#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ABCA3	21	hgsc.bcm.edu	37	16	2376045	2376045	+	Missense_Mutation	SNP	C	C	G			TCGA-CJ-4874-01A-01D-1373-10	TCGA-CJ-4874-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a625b4ef-cab6-4e63-b48f-dc6b69faaf5d	9bcf5c2a-6391-4368-9726-ff1cf3cee868	g.chr16:2376045C>G	ENST00000301732.5	-	5	985	c.285G>C	c.(283-285)gaG>gaC	p.E95D	ABCA3_ENST00000382381.3_Missense_Mutation_p.E95D|ABCA3_ENST00000567910.1_Missense_Mutation_p.E95D	NM_001089.2	NP_001080.2	Q99758	ABCA3_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 3	95					response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	alveolar lamellar body (GO:0097208)|alveolar lamellar body membrane (GO:0097233)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(7)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(20)|ovary(7)|prostate(5)|skin(6)|upper_aerodigestive_tract(1)	70		Ovarian(90;0.17)			Imatinib(DB00619)	TGCGCACTGTCTCAGTGACGG	0.632																																																	0													63.0	62.0	62.0					16																	2376045		2198	4300	6498	SO:0001583	missense	21			U78735	CCDS10466.1	16p13.3	2012-03-14			ENSG00000167972	ENSG00000167972		"""ATP binding cassette transporters / subfamily A"""	33	protein-coding gene	gene with protein product		601615		ABC3		8706931	Standard	NM_001089		Approved	ABC-C, EST111653, LBM180	uc002cpy.1	Q99758	OTTHUMG00000128845	ENST00000301732.5:c.285G>C	16.37:g.2376045C>G	ENSP00000301732:p.Glu95Asp	Somatic		WXS	SOLID	Phase_I	B2RU09|Q54A95|Q6P5P9|Q92473	Missense_Mutation	SNP	ENST00000301732.5	37	CCDS10466.1	.	.	.	.	.	.	.	.	.	.	C	18.10	3.548826	0.65311	.	.	ENSG00000167972	ENST00000301732;ENST00000382381	D	0.90197	-2.63	5.63	2.46	0.29980	.	0.309220	0.34932	N	0.003565	D	0.87803	0.6269	L	0.58428	1.81	0.26813	N	0.968955	P;B;D;P	0.57899	0.494;0.417;0.981;0.462	P;B;P;P	0.46510	0.493;0.411;0.519;0.491	T	0.79662	-0.1710	10	0.38643	T	0.18	.	7.0601	0.25121	0.3057:0.6142:0.0:0.0801	.	95;157;95;95	A7MBM9;Q4LE27;Q6P5P9;Q99758	.;.;.;ABCA3_HUMAN	D	95;157	ENSP00000301732:E95D	ENSP00000301732:E95D	E	-	3	2	ABCA3	2316046	0.960000	0.32886	0.011000	0.14972	0.014000	0.08584	2.107000	0.41844	0.268000	0.21939	0.655000	0.94253	GAG		0.632	ABCA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250784.2		NM_001089	
ACAN	176	hgsc.bcm.edu	37	15	89398669	89398669	+	Silent	SNP	T	T	A	rs533111868		TCGA-CJ-4874-01A-01D-1373-10	TCGA-CJ-4874-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a625b4ef-cab6-4e63-b48f-dc6b69faaf5d	9bcf5c2a-6391-4368-9726-ff1cf3cee868	g.chr15:89398669T>A	ENST00000561243.1	+	11	2853	c.2853T>A	c.(2851-2853)gtT>gtA	p.V951V	ACAN_ENST00000439576.2_Silent_p.V951V|ACAN_ENST00000352105.7_Silent_p.V951V|ACAN_ENST00000559004.1_Silent_p.V951V			P16112	PGCA_HUMAN	aggrecan	950	29 X 19 AA approximate tandem repeats of E-[IVDG]-[LV]-[EV]-[GTI]-[STA]-[ATV]- [SP]-[GA]-[VIFAD]-[GEDL]-[DE]-[LVI]-[SG]- [GERK]-[LV]-P-S-G.|CS-1.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|extracellular matrix structural constituent (GO:0005201)|hyaluronic acid binding (GO:0005540)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(15)|liver(2)|lung(40)|ovary(2)|prostate(5)|skin(5)|stomach(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	93	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			CCTCTGGAGTTGGGGATCTCA	0.547													T|||	1	0.000199681	0.0008	0.0	5008	,	,		19370	0.0		0.0	False		,,,				2504	0.0																0													75.0	80.0	78.0					15																	89398669		1857	4111	5968	SO:0001819	synonymous_variant	176			M55172	CCDS53970.1, CCDS53971.1	15q26.1	2013-05-07	2007-02-16	2007-02-16	ENSG00000157766	ENSG00000157766		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	319	protein-coding gene	gene with protein product	"""aggrecan proteoglycan"""	155760	"""chondroitin sulfate proteoglycan 1"", ""aggrecan 1"""	MSK16, CSPG1, AGC1		1985970	Standard	NM_013227		Approved	CSPGCP	uc010upo.1	P16112	OTTHUMG00000171989	ENST00000561243.1:c.2853T>A	15.37:g.89398669T>A		Somatic		WXS	SOLID	Phase_I	Q13650|Q9UCD3|Q9UCP4|Q9UCP5|Q9UDE0	Silent	SNP	ENST00000561243.1	37	CCDS53970.1																																																																																				0.547	ACAN-006	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416267.2		NM_001135	
ACCS	84680	hgsc.bcm.edu;ucsc.edu	37	11	44104723	44104723	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CJ-4874-01A-01D-1373-10	TCGA-CJ-4874-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a625b4ef-cab6-4e63-b48f-dc6b69faaf5d	9bcf5c2a-6391-4368-9726-ff1cf3cee868	g.chr11:44104723G>A	ENST00000263776.8	+	13	1550	c.1116G>A	c.(1114-1116)tgG>tgA	p.W372*		NM_001127219.1|NM_032592.3	NP_001120691.1|NP_115981.1	Q96QU6	1A1L1_HUMAN	1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)	372					biosynthetic process (GO:0009058)		catalytic activity (GO:0003824)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)			breast(4)|endometrium(3)|large_intestine(11)|lung(15)|ovary(1)|skin(1)	35						AAACAGACTGGATCAACCAGG	0.512																																					Esophageal Squamous(158;148 1889 8077 23160 41213)												0													134.0	138.0	137.0					11																	44104723		2203	4300	6503	SO:0001587	stop_gained	84680			AY026508	CCDS7907.1	11p11	2008-03-12	2008-01-28		ENSG00000110455	ENSG00000110455			23989	protein-coding gene	gene with protein product		608405				11470512	Standard	NM_032592		Approved	PHACS, ACS	uc009yks.1	Q96QU6	OTTHUMG00000166427	ENST00000263776.8:c.1116G>A	11.37:g.44104723G>A	ENSP00000263776:p.Trp372*	Somatic		WXS	SOLID	Phase_I	B4E219|Q8WUL4|Q96LX5	Nonsense_Mutation	SNP	ENST00000263776.8	37	CCDS7907.1	.	.	.	.	.	.	.	.	.	.	G	41	8.884684	0.98990	.	.	ENSG00000110455	ENST00000263776	.	.	.	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.4645	19.5934	0.95525	0.0:0.0:1.0:0.0	.	.	.	.	X	372	.	ENSP00000263776:W372X	W	+	3	0	ACCS	44061299	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.245000	0.95431	2.724000	0.93272	0.561000	0.74099	TGG		0.512	ACCS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389721.1		NM_032592	
ALG3	10195	hgsc.bcm.edu	37	3	183963025	183963025	+	Missense_Mutation	SNP	A	A	T			TCGA-CJ-4874-01A-01D-1373-10	TCGA-CJ-4874-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a625b4ef-cab6-4e63-b48f-dc6b69faaf5d	9bcf5c2a-6391-4368-9726-ff1cf3cee868	g.chr3:183963025A>T	ENST00000397676.3	-	4	596	c.566T>A	c.(565-567)cTg>cAg	p.L189Q	ALG3_ENST00000445626.2_Missense_Mutation_p.L141Q|ALG3_ENST00000463495.1_5'Flank|ALG3_ENST00000455059.1_Missense_Mutation_p.L149Q|EIF2B5_ENST00000444495.1_Intron|ALG3_ENST00000418734.2_Missense_Mutation_p.L133Q	NM_005787.5	NP_005778.1	Q92685	ALG3_HUMAN	ALG3, alpha-1,3- mannosyltransferase	189					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|mannosylation (GO:0097502)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	alpha-1,3-mannosyltransferase activity (GO:0000033)|dol-P-Man:Man(5)GlcNAc(2)-PP-Dol alpha-1,3-mannosyltransferase activity (GO:0052925)			kidney(1)|large_intestine(1)|lung(6)|upper_aerodigestive_tract(1)	9	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			CTGGGCCAGCAGGAGGTTGAT	0.542																																																	0													34.0	38.0	36.0					3																	183963025		1978	4149	6127	SO:0001583	missense	10195			BC002839	CCDS46967.1, CCDS46968.1	3q27.3	2013-02-26	2013-02-26		ENSG00000214160	ENSG00000214160	2.4.1.258	"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"""	23056	protein-coding gene	gene with protein product	"""carbohydrate deficient glycoprotein syndrome type IV"", ""dol-P-Man:Man(5)GlcNAc(2)-PP-Dol alpha-1,3-mannosyltransferase"", ""dol-P-Man dependent alpha-1,3- mannosyltransferase"""	608750	"""asparagine-linked glycosylation 3 homolog (yeast, alpha-1,3-mannosyltransferase)"", ""asparagine-linked glycosylation 3, alpha-1,3- mannosyltransferase homolog (S. cerevisiae)"""			1058125	Standard	NM_005787		Approved	NOT56L, Not56, CDGS4, D16Ertd36e	uc003fne.2	Q92685	OTTHUMG00000156823	ENST00000397676.3:c.566T>A	3.37:g.183963025A>T	ENSP00000380793:p.Leu189Gln	Somatic		WXS	SOLID	Phase_I	A8JZZ6|Q9BT71	Missense_Mutation	SNP	ENST00000397676.3	37	CCDS46968.1	.	.	.	.	.	.	.	.	.	.	A	22.1	4.237661	0.79800	.	.	ENSG00000214160	ENST00000418734;ENST00000397676;ENST00000445626;ENST00000455059	D;D;D;D	0.86297	-2.1;-2.1;-2.1;-2.1	4.93	4.93	0.64822	.	0.226724	0.37219	U	0.002192	D	0.92286	0.7553	M	0.79614	2.46	0.36236	D	0.852963	D;P;P;P;P	0.63880	0.993;0.937;0.937;0.797;0.888	D;P;P;P;P	0.63381	0.914;0.739;0.837;0.853;0.724	D	0.95288	0.8392	10	0.87932	D	0	-0.7228	13.766	0.62995	1.0:0.0:0.0:0.0	.	81;141;133;149;189	B4DMZ7;A8JZZ6;B4DS50;C9J7S5;Q92685	.;.;.;.;ALG3_HUMAN	Q	133;189;141;149	ENSP00000402976:L133Q;ENSP00000380793:L189Q;ENSP00000402744:L141Q;ENSP00000397613:L149Q	ENSP00000380793:L189Q	L	-	2	0	ALG3	185445719	1.000000	0.71417	0.270000	0.24601	0.937000	0.57800	9.310000	0.96267	1.839000	0.53478	0.379000	0.24179	CTG		0.542	ALG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346033.1		NM_005787	
SKIDA1	387640	hgsc.bcm.edu;ucsc.edu	37	10	21804074	21804074	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-4874-01A-01D-1373-10	TCGA-CJ-4874-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a625b4ef-cab6-4e63-b48f-dc6b69faaf5d	9bcf5c2a-6391-4368-9726-ff1cf3cee868	g.chr10:21804074G>T	ENST00000449193.2	-	4	4930	c.2678C>A	c.(2677-2679)tCt>tAt	p.S893Y	SKIDA1_ENST00000444772.3_Missense_Mutation_p.S814Y	NM_207371.3	NP_997254.3	Q1XH10	SKDA1_HUMAN	SKI/DACH domain containing 1	812						nucleus (GO:0005634)											AGGTATTGCAGAACCGCCCAG	0.403																																																	0													41.0	39.0	39.0					10																	21804074		1827	4088	5915	SO:0001583	missense	0			AK131456	CCDS44363.1	10p12.31	2012-06-13	2012-06-13	2012-06-13	ENSG00000180592	ENSG00000180592			32697	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 140"""	C10orf140			Standard	NM_207371		Approved	FLJ45187	uc021pnx.1	Q1XH10	OTTHUMG00000017797	ENST00000449193.2:c.2678C>A	10.37:g.21804074G>T	ENSP00000410041:p.Ser893Tyr	Somatic		WXS	SOLID	Phase_I	B1ANA5|Q6ZMX4|Q8N3C3	Missense_Mutation	SNP	ENST00000449193.2	37	CCDS44363.1	.	.	.	.	.	.	.	.	.	.	G	13.90	2.375185	0.42105	.	.	ENSG00000180592	ENST00000449193;ENST00000444772	.	.	.	5.64	5.64	0.86602	.	0.214543	0.41938	D	0.000796	T	0.64757	0.2627	L	0.29908	0.895	0.42474	D	0.992835	D	0.64830	0.994	P	0.59221	0.854	T	0.67173	-0.5737	9	0.72032	D	0.01	-0.7813	19.6637	0.95885	0.0:0.0:1.0:0.0	.	893	E9PAX1	.	Y	893;814	.	ENSP00000442432:S814Y	S	-	2	0	C10orf140	21844080	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.818000	0.62657	2.821000	0.97095	0.655000	0.94253	TCT		0.403	SKIDA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286950.2		NM_207371	
SAMD15	161394	hgsc.bcm.edu	37	14	77844692	77844692	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-4874-01A-01D-1373-10	TCGA-CJ-4874-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a625b4ef-cab6-4e63-b48f-dc6b69faaf5d	9bcf5c2a-6391-4368-9726-ff1cf3cee868	g.chr14:77844692G>A	ENST00000216471.4	+	1	1217	c.931G>A	c.(931-933)Gac>Aac	p.D311N	TMED8_ENST00000216468.7_5'Flank|SAMD15_ENST00000533095.2_Intron	NM_001010860.1	NP_001010860.1	Q9P1V8	SAM15_HUMAN	sterile alpha motif domain containing 15	311										breast(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|pancreas(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						GACTAAACCAGACTTTCCAGA	0.458																																																	0													82.0	82.0	82.0					14																	77844692		2203	4300	6503	SO:0001583	missense	0			AK093282	CCDS32126.1	14q24.3	2013-01-10	2010-10-20	2010-10-20	ENSG00000100583	ENSG00000100583		"""Sterile alpha motif (SAM) domain containing"""	18631	protein-coding gene	gene with protein product			"""family with sequence similarity 15, member A"", ""chromosome 14 open reading frame 174"""	FAM15A, C14orf174			Standard	XM_006720069		Approved	FLJ35963	uc001xtq.1	Q9P1V8		ENST00000216471.4:c.931G>A	14.37:g.77844692G>A	ENSP00000216471:p.Asp311Asn	Somatic		WXS	SOLID	Phase_I	Q2M3P3	Missense_Mutation	SNP	ENST00000216471.4	37	CCDS32126.1	.	.	.	.	.	.	.	.	.	.	G	13.47	2.247225	0.39697	.	.	ENSG00000100583	ENST00000216471	T	0.29142	1.58	4.77	1.94	0.25998	.	1.090860	0.07300	N	0.873900	T	0.20577	0.0495	N	0.22421	0.69	0.09310	N	1	B	0.27625	0.183	B	0.24394	0.053	T	0.29058	-1.0024	10	0.30854	T	0.27	3.7533	8.0697	0.30682	0.269:0.0:0.731:0.0	.	311	Q9P1V8	SAM15_HUMAN	N	311	ENSP00000216471:D311N	ENSP00000216471:D311N	D	+	1	0	SAMD15	76914445	0.041000	0.20044	0.002000	0.10522	0.023000	0.10783	1.638000	0.37165	0.108000	0.17862	0.555000	0.69702	GAC		0.458	SAMD15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394587.2		NM_001010860	
C2orf16	84226	hgsc.bcm.edu;ucsc.edu	37	2	27799674	27799674	+	Missense_Mutation	SNP	T	T	G			TCGA-CJ-4874-01A-01D-1373-10	TCGA-CJ-4874-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a625b4ef-cab6-4e63-b48f-dc6b69faaf5d	9bcf5c2a-6391-4368-9726-ff1cf3cee868	g.chr2:27799674T>G	ENST00000408964.2	+	1	286	c.235T>G	c.(235-237)Tta>Gta	p.L79V		NM_032266.3	NP_115642.3	Q68DN1	CB016_HUMAN	chromosome 2 open reading frame 16	79						extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(33)|urinary_tract(1)	47	Acute lymphoblastic leukemia(172;0.155)					ACATGTGAAATTATCTTCAGT	0.393																																																	0													85.0	79.0	81.0					2																	27799674		1880	4114	5994	SO:0001583	missense	84226			AL136898	CCDS42666.1	2p23.3	2013-09-20			ENSG00000221843	ENSG00000221843			25275	protein-coding gene	gene with protein product	"""P-S-E-R-S-H-H-S repeats containing"""						Standard	NM_032266		Approved	DKFZp434G118	uc002rkz.4	Q68DN1	OTTHUMG00000159099	ENST00000408964.2:c.235T>G	2.37:g.27799674T>G	ENSP00000386190:p.Leu79Val	Somatic		WXS	SOLID	Phase_I	B9EIQ4|Q53S01|Q8ND64|Q9H088	Missense_Mutation	SNP	ENST00000408964.2	37	CCDS42666.1	.	.	.	.	.	.	.	.	.	.	T	13.46	2.242524	0.39598	.	.	ENSG00000221843	ENST00000408964	T	0.07567	3.18	3.39	2.23	0.28157	.	.	.	.	.	T	0.09862	0.0242	L	0.27053	0.805	0.09310	N	1	D	0.60160	0.987	P	0.54026	0.74	T	0.23261	-1.0193	9	0.46703	T	0.11	.	5.2404	0.15469	0.0:0.1345:0.0:0.8655	.	79	Q68DN1	CB016_HUMAN	V	79	ENSP00000386190:L79V	ENSP00000386190:L79V	L	+	1	2	C2orf16	27653178	0.004000	0.15560	0.003000	0.11579	0.003000	0.03518	1.261000	0.32980	0.677000	0.31305	0.460000	0.39030	TTA		0.393	C2orf16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353292.1		NM_032266	
CCDC171	203238	hgsc.bcm.edu;ucsc.edu	37	9	15971713	15971713	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-4874-01A-01D-1373-10	TCGA-CJ-4874-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a625b4ef-cab6-4e63-b48f-dc6b69faaf5d	9bcf5c2a-6391-4368-9726-ff1cf3cee868	g.chr9:15971713C>T	ENST00000380701.3	+	26	4188	c.3860C>T	c.(3859-3861)aCt>aTt	p.T1287I	CCDC171_ENST00000486641.2_Intron	NM_173550.2	NP_775821.2	Q6TFL3	CC171_HUMAN	coiled-coil domain containing 171	1287																	GAACTTGATACTACTTACACT	0.423																																																	0													196.0	186.0	189.0					9																	15971713		2203	4300	6503	SO:0001583	missense	0			AY422473	CCDS6481.1	9p22.2	2012-03-26	2012-03-26	2012-03-26	ENSG00000164989	ENSG00000164989			29828	protein-coding gene	gene with protein product	"""myosin tail domain containing protein"""		"""chromosome 9 open reading frame 93"""	C9orf93		14702039	Standard	NM_173550		Approved	FLJ39267, FLJ46740, Em:AL513423.1, bA778P13.1, bA536D16.1	uc003zmd.3	Q6TFL3	OTTHUMG00000019584	ENST00000380701.3:c.3860C>T	9.37:g.15971713C>T	ENSP00000370077:p.Thr1287Ile	Somatic		WXS	SOLID	Phase_I	B7ZM22|Q5SU58|Q6P1W1|Q6ZR13|Q8N1Z4|Q8N8L3|Q8TBR2	Missense_Mutation	SNP	ENST00000380701.3	37	CCDS6481.1	.	.	.	.	.	.	.	.	.	.	C	15.27	2.782411	0.49891	.	.	ENSG00000164989	ENST00000380701	T	0.16324	2.35	4.77	4.77	0.60923	.	0.109437	0.39834	N	0.001258	T	0.23171	0.0560	N	0.19112	0.55	0.80722	D	1	D;D	0.57571	0.98;0.98	P;P	0.57152	0.814;0.714	T	0.03086	-1.1074	10	0.72032	D	0.01	-11.3061	16.1492	0.81602	0.0:1.0:0.0:0.0	.	1295;1287	B7ZM22;Q6TFL3	.;CI093_HUMAN	I	1287	ENSP00000370077:T1287I	ENSP00000370077:T1287I	T	+	2	0	C9orf93	15961713	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.043000	0.49823	2.463000	0.83235	0.655000	0.94253	ACT		0.423	CCDC171-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051768.4		NM_173550	
CACNA1H	8912	hgsc.bcm.edu;ucsc.edu	37	16	1248701	1248701	+	Missense_Mutation	SNP	T	T	C			TCGA-CJ-4874-01A-01D-1373-10	TCGA-CJ-4874-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a625b4ef-cab6-4e63-b48f-dc6b69faaf5d	9bcf5c2a-6391-4368-9726-ff1cf3cee868	g.chr16:1248701T>C	ENST00000348261.5	+	6	978	c.730T>C	c.(730-732)Ttc>Ctc	p.F244L	CACNA1H_ENST00000358590.4_Missense_Mutation_p.F244L|CACNA1H_ENST00000565831.1_Missense_Mutation_p.F244L	NM_021098.2	NP_066921.2	O95180	CAC1H_HUMAN	calcium channel, voltage-dependent, T type, alpha 1H subunit	244					aldosterone biosynthetic process (GO:0032342)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|myoblast fusion (GO:0007520)|positive regulation of acrosome reaction (GO:2000344)|regulation of heart contraction (GO:0008016)|regulation of membrane potential (GO:0042391)|transport (GO:0006810)	caveola (GO:0005901)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)			breast(4)|endometrium(5)|kidney(2)|lung(23)	34		Hepatocellular(780;0.00369)			Amiodarone(DB01118)|Bepridil(DB01244)|Cinnarizine(DB00568)|Felodipine(DB01023)|Flunarizine(DB04841)|Isradipine(DB00270)|Nifedipine(DB01115)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Zonisamide(DB00909)	CTTCTTCATTTTCGGCATCGT	0.632																																																	0													138.0	152.0	147.0					16																	1248701		2178	4268	6446	SO:0001583	missense	8912			AL031703	CCDS45375.1, CCDS45376.1	16p13.3	2012-03-07	2007-02-16					"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1395	protein-coding gene	gene with protein product		607904				9670923, 16382099	Standard	NM_021098		Approved	Cav3.2	uc002cks.3	O95180		ENST00000348261.5:c.730T>C	16.37:g.1248701T>C	ENSP00000334198:p.Phe244Leu	Somatic		WXS	SOLID	Phase_I	B5ME00|F8WFD1|O95802|Q8WWI6|Q96QI6|Q96RZ9|Q9NYY4|Q9NYY5	Missense_Mutation	SNP	ENST00000348261.5	37	CCDS45375.1	.	.	.	.	.	.	.	.	.	.	T	29.0	4.965693	0.92855	.	.	ENSG00000196557	ENST00000348261;ENST00000358590	D;D	0.99158	-5.5;-5.5	3.65	3.65	0.41850	Ion transport (1);	0.120124	0.56097	D	0.000024	D	0.99324	0.9763	M	0.92880	3.355	0.37009	D	0.895633	D;D	0.71674	0.998;0.997	D;D	0.80764	0.987;0.994	D	0.99895	1.1146	10	0.87932	D	0	.	11.271	0.49138	0.0:0.0:0.0:1.0	.	244;244	O95180-2;O95180	.;CAC1H_HUMAN	L	244	ENSP00000334198:F244L;ENSP00000351401:F244L	ENSP00000334198:F244L	F	+	1	0	CACNA1H	1188702	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	7.050000	0.76620	1.540000	0.49301	0.444000	0.29173	TTC		0.632	CACNA1H-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000421601.1		NM_001005407	
CD79A	973	hgsc.bcm.edu	37	19	42384963	42384963	+	Silent	SNP	T	T	C			TCGA-CJ-4874-01A-01D-1373-10	TCGA-CJ-4874-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a625b4ef-cab6-4e63-b48f-dc6b69faaf5d	9bcf5c2a-6391-4368-9726-ff1cf3cee868	g.chr19:42384963T>C	ENST00000221972.3	+	5	782	c.597T>C	c.(595-597)taT>taC	p.Y199Y	ARHGEF1_ENST00000354532.3_5'Flank|ARHGEF1_ENST00000347545.4_5'Flank|CD79A_ENST00000444740.2_Silent_p.Y161Y|ARHGEF1_ENST00000599846.1_5'Flank	NM_001783.3|NM_021601.3	NP_001774.1|NP_067612.1	P11912	CD79A_HUMAN	CD79a molecule, immunoglobulin-associated alpha	199	ITAM. {ECO:0000255|PROSITE- ProRule:PRU00379}.				B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)	B cell receptor complex (GO:0019815)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)	transmembrane signaling receptor activity (GO:0004888)			large_intestine(3)|lung(3)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	11						GCTCCATGTATGAGGACATCT	0.627			"""O, S"""		DLBCL																																			Dom	yes		19	19q13.2	973	"""CD79a molecule, immunoglobulin-associated alpha"""		L	0													34.0	29.0	31.0					19																	42384963		2203	4299	6502	SO:0001819	synonymous_variant	973			M80462	CCDS12589.1, CCDS46088.1	19q13.2	2014-09-17	2006-03-28					"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1698	protein-coding gene	gene with protein product		112205	"""CD79A antigen (immunoglobulin-associated alpha)"""	IGA		1538135	Standard	NM_001783		Approved	MB-1	uc002orv.3	P11912		ENST00000221972.3:c.597T>C	19.37:g.42384963T>C		Somatic		WXS	SOLID	Phase_I	A0N775|Q53FB8	Silent	SNP	ENST00000221972.3	37	CCDS12589.1																																																																																				0.627	CD79A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463058.1			
CENPB	1059	hgsc.bcm.edu	37	20	3765902	3765902	+	Missense_Mutation	SNP	T	T	A			TCGA-CJ-4874-01A-01D-1373-10	TCGA-CJ-4874-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a625b4ef-cab6-4e63-b48f-dc6b69faaf5d	9bcf5c2a-6391-4368-9726-ff1cf3cee868	g.chr20:3765902T>A	ENST00000379751.4	-	1	1435	c.1229A>T	c.(1228-1230)gAg>gTg	p.E410V	CDC25B_ENST00000344256.6_5'Flank|CDC25B_ENST00000379598.5_5'Flank	NM_001810.5	NP_001801.1	P07199	CENPB_HUMAN	centromere protein B, 80kDa	410	Glu-rich (acidic).				regulation of transcription, DNA-templated (GO:0006355)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|nucleus (GO:0005634)	centromeric DNA binding (GO:0019237)|chromatin binding (GO:0003682)|satellite DNA binding (GO:0003696)|sequence-specific DNA binding (GO:0043565)			kidney(1)|large_intestine(2)|lung(4)|skin(1)	8						ttcctcctcctcctcctcttc	0.602																																																	0													59.0	49.0	52.0					20																	3765902		2202	4299	6501	SO:0001583	missense	1059			X05299	CCDS13064.1	20p13	2013-11-05	2002-08-29		ENSG00000125817	ENSG00000125817			1852	protein-coding gene	gene with protein product		117140	"""centromere protein B (80kD)"""			8406460, 11884609	Standard	NM_001810		Approved		uc002wjk.3	P07199	OTTHUMG00000031761	ENST00000379751.4:c.1229A>T	20.37:g.3765902T>A	ENSP00000369075:p.Glu410Val	Somatic		WXS	SOLID	Phase_I	Q96EI4	Missense_Mutation	SNP	ENST00000379751.4	37	CCDS13064.1	.	.	.	.	.	.	.	.	.	.	t	10.12	1.261767	0.23051	.	.	ENSG00000125817	ENST00000379751	T	0.05319	3.46	4.14	4.14	0.48551	.	.	.	.	.	T	0.04543	0.0124	N	0.19112	0.55	0.30679	N	0.75258	D	0.54964	0.969	B	0.41135	0.348	T	0.22730	-1.0208	9	0.25106	T	0.35	-8.0	9.8636	0.41129	0.0:0.0:0.0:1.0	.	410	P07199	CENPB_HUMAN	V	410	ENSP00000369075:E410V	ENSP00000369075:E410V	E	-	2	0	CENPB	3713902	0.915000	0.31059	0.982000	0.44146	0.767000	0.43475	2.500000	0.45381	1.642000	0.50584	0.449000	0.29647	GAG		0.602	CENPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077772.2		NM_001810	
CNTNAP1	8506	hgsc.bcm.edu	37	17	40844515	40844515	+	Splice_Site	SNP	A	A	T			TCGA-CJ-4874-01A-01D-1373-10	TCGA-CJ-4874-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a625b4ef-cab6-4e63-b48f-dc6b69faaf5d	9bcf5c2a-6391-4368-9726-ff1cf3cee868	g.chr17:40844515A>T	ENST00000264638.4	+	17	2747		c.e17-1		CTD-3193K9.3_ENST00000592440.1_RNA	NM_003632.2	NP_003623.1	P78357	CNTP1_HUMAN	contactin associated protein 1						axon cargo transport (GO:0008088)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cytoskeleton organization (GO:0007010)|neuromuscular process controlling balance (GO:0050885)|neuromuscular process controlling posture (GO:0050884)|neuron projection morphogenesis (GO:0048812)|neuronal action potential propagation (GO:0019227)|paranodal junction assembly (GO:0030913)|positive regulation of signal transduction (GO:0009967)|protein localization to paranode region of axon (GO:0002175)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|paranode region of axon (GO:0033270)|voltage-gated potassium channel complex (GO:0008076)	receptor activity (GO:0004872)|SH3 domain binding (GO:0017124)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|breast(4)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(11)|lung(15)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.143)		CACACTGTCCAGCATCCCGGG	0.512																																																	0													115.0	100.0	105.0					17																	40844515		2203	4300	6503	SO:0001630	splice_region_variant	8506			U87223	CCDS11436.1	17q21	2008-07-18				ENSG00000108797			8011	protein-coding gene	gene with protein product	"""neurexin 4"""	602346		NRXN4		9118959	Standard	NM_003632		Approved	p190, Caspr, CNTNAP	uc002iay.3	P78357		ENST00000264638.4:c.2531-1A>T	17.37:g.40844515A>T		Somatic		WXS	SOLID	Phase_I		Splice_Site	SNP	ENST00000264638.4	37	CCDS11436.1	.	.	.	.	.	.	.	.	.	.	A	19.77	3.888444	0.72524	.	.	ENSG00000108797	ENST00000264638	.	.	.	5.31	5.31	0.75309	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.4222	0.75022	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CNTNAP1	38098041	1.000000	0.71417	1.000000	0.80357	0.741000	0.42261	8.315000	0.89983	2.234000	0.73211	0.459000	0.35465	.		0.512	CNTNAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452342.1		NM_003632	Intron
CSMD1	64478	hgsc.bcm.edu	37	8	3265496	3265496	+	Missense_Mutation	SNP	T	T	G			TCGA-CJ-4874-01A-01D-1373-10	TCGA-CJ-4874-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a625b4ef-cab6-4e63-b48f-dc6b69faaf5d	9bcf5c2a-6391-4368-9726-ff1cf3cee868	g.chr8:3265496T>G	ENST00000520002.1	-	15	2554	c.1999A>C	c.(1999-2001)Agt>Cgt	p.S667R	CSMD1_ENST00000539096.1_Missense_Mutation_p.S666R|CSMD1_ENST00000537824.1_Missense_Mutation_p.S666R|CSMD1_ENST00000602723.1_Missense_Mutation_p.S667R|CSMD1_ENST00000400186.3_Missense_Mutation_p.S667R|CSMD1_ENST00000542608.1_Missense_Mutation_p.S666R|CSMD1_ENST00000602557.1_Missense_Mutation_p.S667R			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	667	CUB 4. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		ATATGCCCACTGCTGGCCAGC	0.493																																																	0													77.0	71.0	73.0					8																	3265496		1948	4147	6095	SO:0001583	missense	64478					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.1999A>C	8.37:g.3265496T>G	ENSP00000430733:p.Ser667Arg	Somatic		WXS	SOLID	Phase_I	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	22.0|22.0	4.235471|4.235471	0.79800|0.79800	.|.	.|.	ENSG00000183117|ENSG00000183117	ENST00000335551|ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608;ENST00000539096	.|T;T;T;T;T	.|0.19105	.|2.17;2.17;2.17;2.17;2.17	5.23|5.23	5.23|5.23	0.72850|0.72850	.|CUB (5);	.|0.056177	.|0.64402	.|D	.|0.000001	T|T	0.36468|0.36468	0.0968|0.0968	L|L	0.52759|0.52759	1.655|1.655	0.43073|0.43073	D|D	0.994713|0.994713	.|P;P	.|0.37276	.|0.589;0.562	.|P;P	.|0.52031	.|0.688;0.678	T|T	0.13495|0.13495	-1.0507|-1.0507	5|10	.|0.59425	.|D	.|0.04	.|.	15.1177|15.1177	0.72416|0.72416	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|667;667	.|E5RIG2;Q96PZ7	.|.;CSMD1_HUMAN	P|R	146|667;667;529;666;666;666	.|ENSP00000383047:S667R;ENSP00000430733:S667R;ENSP00000441462:S666R;ENSP00000446243:S666R;ENSP00000441675:S666R	.|ENSP00000320445:S529R	Q|S	-|-	2|1	0|0	CSMD1|CSMD1	3252903|3252903	1.000000|1.000000	0.71417|0.71417	0.981000|0.981000	0.43875|0.43875	0.828000|0.828000	0.46876|0.46876	7.773000|7.773000	0.85462|0.85462	1.973000|1.973000	0.57446|0.57446	0.383000|0.383000	0.25322|0.25322	CAG|AGT		0.493	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2		NM_033225	
CYP2U1	113612	hgsc.bcm.edu	37	4	108868571	108868571	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-4874-01A-01D-1373-10	TCGA-CJ-4874-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a625b4ef-cab6-4e63-b48f-dc6b69faaf5d	9bcf5c2a-6391-4368-9726-ff1cf3cee868	g.chr4:108868571A>G	ENST00000332884.6	+	3	1441	c.1166A>G	c.(1165-1167)aAc>aGc	p.N389S	RP11-286E11.1_ENST00000513071.1_RNA|CYP2U1_ENST00000508453.1_Missense_Mutation_p.N180S	NM_183075.2	NP_898898.1	Q7Z449	CP2U1_HUMAN	cytochrome P450, family 2, subfamily U, polypeptide 1	389					arachidonic acid metabolic process (GO:0019369)|cell death (GO:0008219)|omega-hydroxylase P450 pathway (GO:0097267)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(1)|large_intestine(2)|lung(4)|skin(2)|urinary_tract(1)	10		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000128)		ATTGGCGCCAACCGAGCTCCT	0.493																																																	0													100.0	93.0	95.0					4																	108868571		2203	4300	6503	SO:0001583	missense	113612			BC012027	CCDS34047.1	4q25	2012-11-23			ENSG00000155016	ENSG00000155016		"""Cytochrome P450s"""	20582	protein-coding gene	gene with protein product	"""spastic paraplegia 49"""	610670				14975754, 14660610	Standard	XM_005262717		Approved	SPG49	uc003hyp.3	Q7Z449	OTTHUMG00000161084	ENST00000332884.6:c.1166A>G	4.37:g.108868571A>G	ENSP00000333212:p.Asn389Ser	Somatic		WXS	SOLID	Phase_I	B2RMV7|Q96EQ6	Missense_Mutation	SNP	ENST00000332884.6	37	CCDS34047.1	.	.	.	.	.	.	.	.	.	.	A	6.211	0.407007	0.11754	.	.	ENSG00000155016	ENST00000332884;ENST00000424249;ENST00000508453	T;T	0.79033	-1.23;-1.23	6.08	3.62	0.41486	.	0.500599	0.23461	N	0.047938	T	0.53012	0.1770	N	0.05330	-0.07	0.20975	N	0.999818	B	0.15473	0.013	B	0.19666	0.026	T	0.36792	-0.9733	10	0.06365	T	0.9	.	8.8159	0.34996	0.806:0.1286:0.0653:0.0	.	389	Q7Z449	CP2U1_HUMAN	S	389;346;180	ENSP00000333212:N389S;ENSP00000423667:N180S	ENSP00000333212:N389S	N	+	2	0	CYP2U1	109088020	0.918000	0.31147	0.156000	0.22583	0.889000	0.51656	1.719000	0.38011	0.525000	0.28522	0.482000	0.46254	AAC		0.493	CYP2U1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363691.2		NM_183075	
DFNB31	25861	hgsc.bcm.edu	37	9	117169033	117169033	+	Missense_Mutation	SNP	A	A	G	rs942519	byFrequency	TCGA-CJ-4874-01A-01D-1373-10	TCGA-CJ-4874-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a625b4ef-cab6-4e63-b48f-dc6b69faaf5d	9bcf5c2a-6391-4368-9726-ff1cf3cee868	g.chr9:117169033A>G	ENST00000362057.3	-	9	2006	c.1838T>C	c.(1837-1839)aTg>aCg	p.M613T	DFNB31_ENST00000374059.3_Missense_Mutation_p.M262T|DFNB31_ENST00000265134.6_Missense_Mutation_p.M230T	NM_001173425.1|NM_015404.3	NP_001166896.1|NP_056219	Q9P202	WHRN_HUMAN	deafness, autosomal recessive 31	613	Pro-rich.		M -> T (in dbSNP:rs942519). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.		inner ear receptor stereocilium organization (GO:0060122)|retina homeostasis (GO:0001895)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	actin filament (GO:0005884)|cilium (GO:0005929)|cytoplasm (GO:0005737)|stereocilia ankle link complex (GO:0002142)|stereocilium (GO:0032420)				central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(9)|liver(1)|lung(14)|ovary(5)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						GCAGGAAGGCATGGAGGAAGG	0.672													G|||	2412	0.481629	0.3585	0.5159	5008	,	,		18367	0.503		0.5149	False		,,,				2504	0.5675																0								G	THR/MET,THR/MET,THR/MET	1703,2703	635.7+/-396.4	337,1029,837	55.0	48.0	50.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	689,1838,1838	0.1	0.0	9	dbSNP_86	50	4695,3903	531.4+/-382.0	1252,2191,856	yes	missense,missense,missense	DFNB31	NM_001083885.2,NM_001173425.1,NM_015404.3	81,81,81	1589,3220,1693	GG,GA,AA		45.3943,38.6518,49.2002	benign,benign,benign	230/525,613/907,613/908	117169033	6398,6606	2203	4299	6502	SO:0001583	missense	25861			AK056190	CCDS6806.1, CCDS43870.1	9q32	2013-06-19			ENSG00000095397	ENSG00000095397			16361	protein-coding gene	gene with protein product	"""whirlin"""	607928				12833159, 17171570	Standard	NM_015404		Approved	CIP98, WHRN, USH2D, PDZD7B	uc004biz.4	Q9P202	OTTHUMG00000020539	ENST00000362057.3:c.1838T>C	9.37:g.117169033A>G	ENSP00000354623:p.Met613Thr	Somatic		WXS	SOLID	Phase_I	A5PKU1|A5PKZ9|Q5TAU9|Q5TAV0|Q5TAV1|Q5TAV2|Q96MZ9|Q9H9F4|Q9UFZ3	Missense_Mutation	SNP	ENST00000362057.3	37	CCDS6806.1	1062	0.48626373626373626	180	0.36585365853658536	194	0.5359116022099447	301	0.5262237762237763	387	0.5105540897097626	G	0.006	-2.069501	0.00382	0.386518	0.546057	ENSG00000095397	ENST00000265134;ENST00000374059;ENST00000362057	T;T;T	0.06294	4.22;4.2;3.32	4.57	0.0558	0.14316	.	0.410282	0.22939	N	0.053805	T	0.00012	0.0000	N	0.08118	0	0.58432	P	1.0000000000287557E-6	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.33752	-0.9856	9	0.14656	T	0.56	-1.0976	0.056	0.00013	0.2798:0.192:0.248:0.2803	rs942519;rs60418846;rs942519	613;613;262	B9EGE6;Q9P202;Q9P202-4	.;WHRN_HUMAN;.	T	230;262;613	ENSP00000265134:M230T;ENSP00000363172:M262T;ENSP00000354623:M613T	ENSP00000265134:M230T	M	-	2	0	DFNB31	116208854	0.002000	0.14202	0.000000	0.03702	0.003000	0.03518	1.225000	0.32551	-0.207000	0.10187	-1.383000	0.01170	ATG		0.672	DFNB31-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053776.2		NM_015404	
DNAJB8	165721	hgsc.bcm.edu	37	3	128181552	128181552	+	Silent	SNP	G	G	A			TCGA-CJ-4874-01A-01D-1373-10	TCGA-CJ-4874-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a625b4ef-cab6-4e63-b48f-dc6b69faaf5d	9bcf5c2a-6391-4368-9726-ff1cf3cee868	g.chr3:128181552G>A	ENST00000469083.1	-	2	3094	c.537C>T	c.(535-537)ttC>ttT	p.F179F	DNAJB8_ENST00000319153.3_Silent_p.F179F|DNAJB8-AS1_ENST00000471626.1_RNA			Q8NHS0	DNJB8_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 8	179	Ser-rich.				chaperone-mediated protein folding (GO:0061077)|negative regulation of inclusion body assembly (GO:0090084)	cytosol (GO:0005829)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|protein binding involved in protein folding (GO:0044183)|unfolded protein binding (GO:0051082)			kidney(1)|large_intestine(4)|lung(4)|prostate(1)|skin(1)	11				GBM - Glioblastoma multiforme(114;0.177)		TCACCGACTTGAACCCCGAGC	0.617																																																	0													85.0	82.0	83.0					3																	128181552		2203	4300	6503	SO:0001819	synonymous_variant	165721				CCDS3048.1	3q21.3	2014-01-21			ENSG00000179407	ENSG00000179407		"""Heat shock proteins / DNAJ (HSP40)"""	23699	protein-coding gene	gene with protein product		611337					Standard	NM_153330		Approved	MGC33884, CT156	uc003ekk.2	Q8NHS0	OTTHUMG00000159690	ENST00000469083.1:c.537C>T	3.37:g.128181552G>A		Somatic		WXS	SOLID	Phase_I	B3KWV7	Silent	SNP	ENST00000469083.1	37	CCDS3048.1																																																																																				0.617	DNAJB8-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356933.1		NM_153330	
EBF3	253738	hgsc.bcm.edu	37	10	131671770	131671770	+	Missense_Mutation	SNP	G	G	C			TCGA-CJ-4874-01A-01D-1373-10	TCGA-CJ-4874-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a625b4ef-cab6-4e63-b48f-dc6b69faaf5d	9bcf5c2a-6391-4368-9726-ff1cf3cee868	g.chr10:131671770G>C	ENST00000355311.5	-	8	799	c.727C>G	c.(727-729)Cgg>Ggg	p.R243G	EBF3_ENST00000368648.3_Missense_Mutation_p.R243G			Q9H4W6	COE3_HUMAN	early B-cell factor 3	243					multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R243W(1)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	44		all_cancers(35;1.8e-08)|all_epithelial(44;8.26e-08)|Lung NSC(174;0.0091)|all_lung(145;0.0123)|Breast(234;0.039)|all_neural(114;0.0722)|Colorectal(57;0.0764)		OV - Ovarian serous cystadenocarcinoma(35;0.00513)		CGGCGGGCCCGCCTCCCGTGT	0.498																																																	1	Substitution - Missense(1)	pancreas(1)											58.0	58.0	58.0					10																	131671770		2203	4300	6503	SO:0001583	missense	253738				CCDS31314.1	10q26.3	2007-03-30			ENSG00000108001	ENSG00000108001			19087	protein-coding gene	gene with protein product		607407				12355068	Standard	NM_001005463		Approved	COE3, DKFZp667B0210	uc001lki.2	Q9H4W6	OTTHUMG00000019265	ENST00000355311.5:c.727C>G	10.37:g.131671770G>C	ENSP00000347463:p.Arg243Gly	Somatic		WXS	SOLID	Phase_I	A0AUY1|Q5T6H9|Q9H4W5	Missense_Mutation	SNP	ENST00000355311.5	37		.	.	.	.	.	.	.	.	.	.	G	20.8	4.055325	0.75960	.	.	ENSG00000108001	ENST00000355311;ENST00000368648	T;T	0.60299	0.2;0.38	4.87	3.9	0.45041	.	0.054683	0.64402	D	0.000001	T	0.76140	0.3946	M	0.84683	2.71	0.80722	D	1	D	0.58970	0.984	D	0.66497	0.944	T	0.81008	-0.1127	10	0.87932	D	0	-14.6784	14.2397	0.65950	0.0:0.0:0.8504:0.1496	.	243	Q9H4W6-2	.	G	243	ENSP00000347463:R243G;ENSP00000357637:R243G	ENSP00000347463:R243G	R	-	1	2	EBF3	131561760	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	2.590000	0.46154	2.435000	0.82474	0.655000	0.94253	CGG		0.498	EBF3-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051015.2		NM_001005463	
EML6	400954	hgsc.bcm.edu	37	2	55177823	55177823	+	Missense_Mutation	SNP	T	T	C			TCGA-CJ-4874-01A-01D-1373-10	TCGA-CJ-4874-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a625b4ef-cab6-4e63-b48f-dc6b69faaf5d	9bcf5c2a-6391-4368-9726-ff1cf3cee868	g.chr2:55177823T>C	ENST00000356458.6	+	29	4640	c.4120T>C	c.(4120-4122)Ttc>Ctc	p.F1374L		NM_001039753.2	NP_001034842.2	Q6ZMW3	EMAL6_HUMAN	echinoderm microtubule associated protein like 6	1374						cytoplasm (GO:0005737)|microtubule (GO:0005874)				breast(1)|endometrium(6)	7						CTACAGAGGTTTCGACTGTCG	0.522																																																	0													156.0	124.0	133.0					2																	55177823		692	1591	2283	SO:0001583	missense	400954				CCDS46286.1	2p16.1	2013-01-10			ENSG00000214595	ENSG00000214595		"""WD repeat domain containing"""	35412	protein-coding gene	gene with protein product							Standard	NM_001039753		Approved	FLJ42562	uc002ryb.4	Q6ZMW3	OTTHUMG00000152035	ENST00000356458.6:c.4120T>C	2.37:g.55177823T>C	ENSP00000348842:p.Phe1374Leu	Somatic		WXS	SOLID	Phase_I	A8MUB5|B6ZDG7	Missense_Mutation	SNP	ENST00000356458.6	37	CCDS46286.1	.	.	.	.	.	.	.	.	.	.	T	14.42	2.528631	0.44969	.	.	ENSG00000214595	ENST00000356458	T	0.28255	1.62	5.97	4.8	0.61643	HELP (1);	.	.	.	.	T	0.32010	0.0815	L	0.45581	1.43	0.39723	D	0.971504	B	0.28760	0.221	B	0.42959	0.403	T	0.11767	-1.0574	9	0.10902	T	0.67	.	8.5239	0.33293	0.1298:0.0:0.1362:0.734	.	1374	Q6ZMW3	EMAL6_HUMAN	L	1374	ENSP00000348842:F1374L	ENSP00000348842:F1374L	F	+	1	0	EML6	55031327	1.000000	0.71417	0.071000	0.20095	0.769000	0.43574	3.820000	0.55693	1.059000	0.40554	0.455000	0.32223	TTC		0.522	EML6-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000324997.3		XM_001725002	
EPS8L2	64787	hgsc.bcm.edu;ucsc.edu	37	11	710455	710455	+	Missense_Mutation	SNP	T	T	C			TCGA-CJ-4874-01A-01D-1373-10	TCGA-CJ-4874-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a625b4ef-cab6-4e63-b48f-dc6b69faaf5d	9bcf5c2a-6391-4368-9726-ff1cf3cee868	g.chr11:710455T>C	ENST00000533256.1	+	5	509	c.134T>C	c.(133-135)aTc>aCc	p.I45T	EPS8L2_ENST00000526198.1_Missense_Mutation_p.I45T|EPS8L2_ENST00000530636.1_Missense_Mutation_p.I45T|AP006621.9_ENST00000527021.2_RNA|EPS8L2_ENST00000318562.8_Missense_Mutation_p.I45T			Q9H6S3	ES8L2_HUMAN	EPS8-like 2	45					positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of ruffle assembly (GO:1900029)|regulation of Rho protein signal transduction (GO:0035023)|Rho protein signal transduction (GO:0007266)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)|vesicle (GO:0031982)	actin binding (GO:0003779)			NS(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|pancreas(1)|prostate(2)|soft_tissue(1)|urinary_tract(1)	13		all_cancers(49;1.24e-08)|all_epithelial(84;1.87e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)		all cancers(45;4.37e-27)|Epithelial(43;2.81e-26)|OV - Ovarian serous cystadenocarcinoma(40;1.33e-20)|BRCA - Breast invasive adenocarcinoma(625;4.29e-05)|Lung(200;0.0582)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TCCAACGTCATCATGCACGAG	0.632																																																	0													185.0	146.0	159.0					11																	710455		2203	4300	6503	SO:0001583	missense	64787			AF318331	CCDS31328.1	11p15.5	2008-02-05				ENSG00000177106			21296	protein-coding gene	gene with protein product		614988				12620401	Standard	NM_022772		Approved	FLJ21935, FLJ22171, MGC3088	uc001lqt.3	Q9H6S3		ENST00000533256.1:c.134T>C	11.37:g.710455T>C	ENSP00000435585:p.Ile45Thr	Somatic		WXS	SOLID	Phase_I	B3KSX1|B7ZKL3|Q53GM8|Q8WYW7|Q96K06|Q9H6K9	Missense_Mutation	SNP	ENST00000533256.1	37	CCDS31328.1	.	.	.	.	.	.	.	.	.	.	T	19.32	3.804721	0.70682	.	.	ENSG00000177106	ENST00000524763;ENST00000318562;ENST00000533256;ENST00000534755;ENST00000533500;ENST00000531348;ENST00000530636;ENST00000526198	T;T;T;T;T;T	0.42900	0.98;2.04;2.04;0.96;2.04;2.08	4.07	4.07	0.47477	Pleckstrin homology-type (1);	0.000000	0.85682	D	0.000000	T	0.59932	0.2230	M	0.65975	2.015	0.53688	D	0.99997	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.81914	0.994;0.995;0.994	T	0.61642	-0.7021	10	0.48119	T	0.1	-38.4432	12.4732	0.55799	0.0:0.0:0.0:1.0	.	45;73;45	B7ZKL3;B4DFD2;Q9H6S3	.;.;ES8L2_HUMAN	T	45	ENSP00000435128:I45T;ENSP00000320828:I45T;ENSP00000435585:I45T;ENSP00000432765:I45T;ENSP00000436035:I45T;ENSP00000436230:I45T	ENSP00000320828:I45T	I	+	2	0	EPS8L2	700455	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	6.948000	0.75965	1.858000	0.53909	0.454000	0.30748	ATC		0.632	EPS8L2-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382344.1		NM_022772	
ESYT2	57488	hgsc.bcm.edu;ucsc.edu	37	7	158590762	158590762	+	Silent	SNP	T	T	G			TCGA-CJ-4874-01A-01D-1373-10	TCGA-CJ-4874-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a625b4ef-cab6-4e63-b48f-dc6b69faaf5d	9bcf5c2a-6391-4368-9726-ff1cf3cee868	g.chr7:158590762T>G	ENST00000251527.5	-	3	587	c.522A>C	c.(520-522)gtA>gtC	p.V174V	ESYT2_ENST00000497111.1_5'UTR	NM_020728.2	NP_065779.1	A0FGR8	ESYT2_HUMAN	extended synaptotagmin-like protein 2	202					endocytosis (GO:0006897)|lipid transport (GO:0006869)	extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|integral component of plasma membrane (GO:0005887)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)|membrane (GO:0016020)|organelle membrane contact site (GO:0044232)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|identical protein binding (GO:0042802)|phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|phosphatidylinositol binding (GO:0035091)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(16)|prostate(2)	32						ACATGTGTTTTACAGTCTGGA	0.428																																																	0													58.0	60.0	59.0					7																	158590762		2203	4300	6503	SO:0001819	synonymous_variant	57488			AB033054	CCDS34791.1	7q36.3	2014-07-02	2009-06-23	2009-06-23	ENSG00000117868	ENSG00000117868		"""Synaptotagmins"""	22211	protein-coding gene	gene with protein product			"""family with sequence similarity 62 (C2 domain containing), member B"""	FAM62B		17672888	Standard	NM_020728		Approved	KIAA1228, CHR2SYT	uc003wob.1	A0FGR8	OTTHUMG00000151436	ENST00000251527.5:c.522A>C	7.37:g.158590762T>G		Somatic		WXS	SOLID	Phase_I	A4D229|Q69YJ2|Q6UKI4|Q6ZTU0|Q6ZVU1|Q9BQS0|Q9NW47|Q9ULJ2	Silent	SNP	ENST00000251527.5	37	CCDS34791.1																																																																																				0.428	ESYT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322647.1		NM_020728	
FAM47C	442444	hgsc.bcm.edu	37	X	37027645	37027645	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-4874-01A-01D-1373-10	TCGA-CJ-4874-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a625b4ef-cab6-4e63-b48f-dc6b69faaf5d	9bcf5c2a-6391-4368-9726-ff1cf3cee868	g.chrX:37027645C>T	ENST00000358047.3	+	1	1214	c.1162C>T	c.(1162-1164)Cct>Tct	p.P388S		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	388										breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						GACTCGCGTACCTCCTCTCCG	0.622																																																	0													61.0	61.0	61.0					X																	37027645		2202	4300	6502	SO:0001583	missense	442444			AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.1162C>T	X.37:g.37027645C>T	ENSP00000367913:p.Pro388Ser	Somatic		WXS	SOLID	Phase_I	Q6ZU46	Missense_Mutation	SNP	ENST00000358047.3	37	CCDS35227.1	.	.	.	.	.	.	.	.	.	.	t	0.024	-1.394771	0.01175	.	.	ENSG00000198173	ENST00000358047	T	0.08634	3.07	1.23	-2.47	0.06442	.	.	.	.	.	T	0.02193	0.0068	N	0.01779	-0.725	0.09310	N	1	B	0.20988	0.05	B	0.18263	0.021	T	0.45234	-0.9275	9	0.07813	T	0.8	.	4.4933	0.11824	0.0:0.605:0.0:0.395	.	388	Q5HY64	FA47C_HUMAN	S	388	ENSP00000367913:P388S	ENSP00000367913:P388S	P	+	1	0	FAM47C	36937566	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-3.104000	0.00603	-0.627000	0.05589	-1.121000	0.02013	CCT		0.622	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060508.1		NM_001013736	
FCGBP	8857	hgsc.bcm.edu	37	19	40408822	40408822	+	Silent	SNP	G	G	A	rs139323545	byFrequency	TCGA-CJ-4874-01A-01D-1373-10	TCGA-CJ-4874-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a625b4ef-cab6-4e63-b48f-dc6b69faaf5d	9bcf5c2a-6391-4368-9726-ff1cf3cee868	g.chr19:40408822G>A	ENST00000221347.6	-	8	4024	c.4017C>T	c.(4015-4017)ccC>ccT	p.P1339P		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	1339	VWFD 3. {ECO:0000255|PROSITE- ProRule:PRU00580}.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			CCAGCACCACGGGCAGCTTCA	0.577													G|||	5	0.000998403	0.0008	0.0043	5008	,	,		19319	0.0		0.001	False		,,,				2504	0.0																0								G		1,4405	2.1+/-5.4	0,1,2202	23.0	19.0	20.0		4017	-9.9	0.0	19	dbSNP_134	20	33,8565	21.0+/-64.5	0,33,4266	no	coding-synonymous	FCGBP	NM_003890.2		0,34,6468	AA,AG,GG		0.3838,0.0227,0.2615		1339/5406	40408822	34,12970	2203	4299	6502	SO:0001819	synonymous_variant	8857			D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.4017C>T	19.37:g.40408822G>A		Somatic		WXS	SOLID	Phase_I	O95784	Silent	SNP	ENST00000221347.6	37	CCDS12546.1																																																																																				0.577	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1		NM_003890	
FCRL5	83416	hgsc.bcm.edu	37	1	157494179	157494179	+	Missense_Mutation	SNP	C	C	T	rs571247527		TCGA-CJ-4874-01A-01D-1373-10	TCGA-CJ-4874-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a625b4ef-cab6-4e63-b48f-dc6b69faaf5d	9bcf5c2a-6391-4368-9726-ff1cf3cee868	g.chr1:157494179C>T	ENST00000361835.3	-	10	2286	c.2129G>A	c.(2128-2130)gGg>gAg	p.G710E	FCRL5_ENST00000368190.3_Missense_Mutation_p.G710E|FCRL5_ENST00000461387.1_5'Flank|FCRL5_ENST00000368191.3_Missense_Mutation_p.G625E|FCRL5_ENST00000356953.4_Missense_Mutation_p.G710E	NM_001195388.1|NM_031281.2	NP_001182317.1|NP_112571.2	Q96RD9	FCRL5_HUMAN	Fc receptor-like 5	710	Ig-like C2-type 7.				negative regulation of B cell receptor signaling pathway (GO:0050859)|negative regulation of release of sequestered calcium ion into cytosol (GO:0051280)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)				breast(5)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(45)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	85	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)				GAAGGAGGCCCCTCCTCCAGA	0.547													c|||	1	0.000199681	0.0	0.0	5008	,	,		21019	0.001		0.0	False		,,,				2504	0.0																0													71.0	77.0	75.0					1																	157494179		2203	4300	6503	SO:0001583	missense	83416			AF369794	CCDS1165.1	1q21	2013-01-11			ENSG00000143297	ENSG00000143297		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18508	protein-coding gene	gene with protein product		605877				11027651, 11290337	Standard	NM_031281		Approved	FCRH5, IRTA2, BXMAS1, CD307e	uc009wsm.3	Q96RD9	OTTHUMG00000017481	ENST00000361835.3:c.2129G>A	1.37:g.157494179C>T	ENSP00000354691:p.Gly710Glu	Somatic		WXS	SOLID	Phase_I	A0N0M2|B7WNT9|B7WP94|Q495Q2|Q495Q4|Q5VYK9|Q6UY46	Missense_Mutation	SNP	ENST00000361835.3	37	CCDS1165.1	.	.	.	.	.	.	.	.	.	.	C	9.694	1.152776	0.21371	.	.	ENSG00000143297	ENST00000361835;ENST00000356953;ENST00000368190;ENST00000368191	T;T;T;T	0.02812	4.15;4.15;4.15;4.15	4.69	-0.939	0.10408	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.04634	0.0126	M	0.86740	2.835	0.20703	N	0.999868	D;D;P;D	0.89917	1.0;0.998;0.933;0.975	D;D;D;D	0.81914	0.995;0.972;0.928;0.954	T	0.31475	-0.9942	9	0.20519	T	0.43	.	4.2303	0.10599	0.0:0.3836:0.3271:0.2893	.	625;710;710;710	F5GXJ2;Q96RD9-3;A6NJE8;Q96RD9	.;.;.;FCRL5_HUMAN	E	710;710;710;625	ENSP00000354691:G710E;ENSP00000349434:G710E;ENSP00000357173:G710E;ENSP00000357174:G625E	ENSP00000349434:G710E	G	-	2	0	FCRL5	155760803	0.000000	0.05858	0.035000	0.18076	0.018000	0.09664	0.219000	0.17641	0.027000	0.15297	-0.266000	0.10368	GGG		0.547	FCRL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046263.1		NM_031281	
FREM1	158326	hgsc.bcm.edu;ucsc.edu	37	9	14859188	14859188	+	Silent	SNP	T	T	G			TCGA-CJ-4874-01A-01D-1373-10	TCGA-CJ-4874-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a625b4ef-cab6-4e63-b48f-dc6b69faaf5d	9bcf5c2a-6391-4368-9726-ff1cf3cee868	g.chr9:14859188T>G	ENST00000380880.3	-	4	1407	c.624A>C	c.(622-624)ccA>ccC	p.P208P	FREM1_ENST00000380881.4_Silent_p.P208P|FREM1_ENST00000422223.2_Silent_p.P208P			Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1	208					cell communication (GO:0007154)|cell-matrix adhesion (GO:0007160)|craniofacial suture morphogenesis (GO:0097094)	basement membrane (GO:0005604)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)			breast(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(40)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	100				GBM - Glioblastoma multiforme(50;3.53e-06)		TACGGGACTCTGGGAAAAAAC	0.493																																																	0													42.0	43.0	42.0					9																	14859188		1882	4109	5991	SO:0001819	synonymous_variant	158326			AK058190	CCDS47952.1, CCDS55293.1	9p22.3	2010-06-04	2004-12-15	2004-12-15	ENSG00000164946	ENSG00000164946			23399	protein-coding gene	gene with protein product		608944	"""chromosome 9 open reading frame 154"""	C9orf154		12838346, 15345741	Standard	NM_144966		Approved	FLJ25461, C9orf145, C9orf143, DKFZp686M16108, TILRR	uc003zlm.3	Q5H8C1	OTTHUMG00000019575	ENST00000380880.3:c.624A>C	9.37:g.14859188T>G		Somatic		WXS	SOLID	Phase_I	B7ZBX4|Q5VV00|Q5VV01|Q6MZI4|Q8NEG9|Q96LI3	Silent	SNP	ENST00000380880.3	37	CCDS47952.1																																																																																				0.493	FREM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339474.2		NM_144966	
GNA15	2769	hgsc.bcm.edu	37	19	3162989	3162989	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-4874-01A-01D-1373-10	TCGA-CJ-4874-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a625b4ef-cab6-4e63-b48f-dc6b69faaf5d	9bcf5c2a-6391-4368-9726-ff1cf3cee868	g.chr19:3162989G>T	ENST00000262958.3	+	7	1355	c.1097G>T	c.(1096-1098)cGc>cTc	p.R366L		NM_002068.2	NP_002059.2	P30679	GNA15_HUMAN	guanine nucleotide binding protein (G protein), alpha 15 (Gq class)	366					activation of phospholipase C activity (GO:0007202)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|blood coagulation (GO:0007596)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|phospholipase C-activating G-protein coupled acetylcholine receptor signaling pathway (GO:0007207)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)	heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled receptor binding (GO:0001664)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			large_intestine(5)|lung(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;7.04e-05)|OV - Ovarian serous cystadenocarcinoma(105;5.08e-113)|Epithelial(107;6.19e-111)|all cancers(105;6.19e-103)|BRCA - Breast invasive adenocarcinoma(158;0.00145)|STAD - Stomach adenocarcinoma(1328;0.184)		GTGCTCGCCCGCTACCTGGAC	0.667											OREG0025150	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													80.0	68.0	72.0					19																	3162989		2203	4300	6503	SO:0001583	missense	2769				CCDS12104.1	19p13.3	2008-07-16				ENSG00000060558			4383	protein-coding gene	gene with protein product		139314				1302014	Standard	NM_002068		Approved	GNA16	uc002lxf.2	P30679		ENST00000262958.3:c.1097G>T	19.37:g.3162989G>T	ENSP00000262958:p.Arg366Leu	Somatic	609	WXS	SOLID	Phase_I	E9KL40|E9KL47|O75247|Q53XK2	Missense_Mutation	SNP	ENST00000262958.3	37	CCDS12104.1	.	.	.	.	.	.	.	.	.	.	g	14.87	2.663609	0.47572	.	.	ENSG00000060558	ENST00000262958	D	0.81821	-1.54	3.9	3.9	0.45041	.	0.111669	0.37669	N	0.001982	T	0.60650	0.2285	N	0.13003	0.285	0.39014	D	0.959609	B	0.06786	0.001	B	0.14023	0.01	T	0.55088	-0.8195	10	0.14252	T	0.57	.	7.2896	0.26358	0.1199:0.0:0.8801:0.0	.	366	P30679	GNA15_HUMAN	L	366	ENSP00000262958:R366L	ENSP00000262958:R366L	R	+	2	0	GNA15	3113989	0.799000	0.28903	1.000000	0.80357	0.972000	0.66771	2.783000	0.47766	2.001000	0.58596	0.491000	0.48974	CGC		0.667	GNA15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452320.2		NM_002068	
GPR115	221393	hgsc.bcm.edu;ucsc.edu	37	6	47684543	47684543	+	Splice_Site	SNP	G	G	A			TCGA-CJ-4874-01A-01D-1373-10	TCGA-CJ-4874-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a625b4ef-cab6-4e63-b48f-dc6b69faaf5d	9bcf5c2a-6391-4368-9726-ff1cf3cee868	g.chr6:47684543G>A	ENST00000283303.2	+	7	2192	c.1934G>A	c.(1933-1935)gGt>gAt	p.G645D	GPR115_ENST00000327753.3_Splice_Site_p.G645D|RN7SKP116_ENST00000516902.1_RNA|GPR115_ENST00000371220.1_Splice_Site_p.G702D	NM_153838.3	NP_722580.3	Q8IZF3	GP115_HUMAN	G protein-coupled receptor 115	645					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(24)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	52						TTGCCACAGGGTTTTTTCATC	0.403																																					GBM(22;431 510 9010 26644 32828)												0													98.0	90.0	93.0					6																	47684543		2203	4300	6503	SO:0001630	splice_region_variant	221393			AK095395	CCDS4922.2	6p12.3	2014-08-08			ENSG00000153294	ENSG00000153294		"""-"", ""GPCR / Class B : Orphans"""	19011	protein-coding gene	gene with protein product		614268				12435584	Standard	NM_153838		Approved	FLJ38076, PGR18	uc003oza.1	Q8IZF3	OTTHUMG00000014800	ENST00000283303.2:c.1933-1G>A	6.37:g.47684543G>A		Somatic		WXS	SOLID	Phase_I	B3KTD0|Q2PNZ0|Q5T5B5|Q5T5B6|Q86SN9|Q8IXE6	Missense_Mutation	SNP	ENST00000283303.2	37	CCDS4922.2	.	.	.	.	.	.	.	.	.	.	G	22.9	4.346175	0.82022	.	.	ENSG00000153294	ENST00000371220;ENST00000327753;ENST00000283303	D;D;D	0.84660	-1.88;-1.88;-1.88	5.71	4.85	0.62838	GPCR, family 2-like (1);	0.074856	0.56097	N	0.000022	D	0.92414	0.7592	M	0.92317	3.295	0.52501	D	0.999955	D	0.89917	1.0	D	0.87578	0.998	D	0.93988	0.7264	10	0.87932	D	0	-19.8821	12.2872	0.54798	0.0781:0.0:0.9219:0.0	.	645	Q8IZF3	GP115_HUMAN	D	702;645;645	ENSP00000360264:G702D;ENSP00000328319:G645D;ENSP00000283303:G645D	ENSP00000283303:G645D	G	+	2	0	GPR115	47792502	1.000000	0.71417	0.997000	0.53966	0.986000	0.74619	7.676000	0.84012	1.562000	0.49601	0.655000	0.94253	GGT		0.403	GPR115-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040819.2		NM_153838	Missense_Mutation
GTF3C1	2975	hgsc.bcm.edu;ucsc.edu	37	16	27504602	27504602	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-4874-01A-01D-1373-10	TCGA-CJ-4874-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a625b4ef-cab6-4e63-b48f-dc6b69faaf5d	9bcf5c2a-6391-4368-9726-ff1cf3cee868	g.chr16:27504602C>T	ENST00000356183.4	-	17	2809	c.2794G>A	c.(2794-2796)Gaa>Aaa	p.E932K	GTF3C1_ENST00000561623.1_Missense_Mutation_p.E932K	NM_001520.3	NP_001511.2	Q12789	TF3C1_HUMAN	general transcription factor IIIC, polypeptide 1, alpha 220kDa	932					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|rRNA transcription (GO:0009303)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription (GO:0009304)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|liver(3)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	80						TTCAGAAATTCCTCCAGGTTG	0.552																																																	0													112.0	101.0	105.0					16																	27504602		2197	4300	6497	SO:0001583	missense	2975			U06485	CCDS32414.1, CCDS66988.1	16p12	2010-03-23	2002-08-29			ENSG00000077235		"""General transcription factors"""	4664	protein-coding gene	gene with protein product		603246	"""general transcription factor IIIC, polypeptide 1 (alpha subunit, 220kD )"""			8164661, 8127861	Standard	NM_001520		Approved	TFIIIC220	uc002dov.2	Q12789		ENST00000356183.4:c.2794G>A	16.37:g.27504602C>T	ENSP00000348510:p.Glu932Lys	Somatic		WXS	SOLID	Phase_I	B2RP21|Q12838|Q6DKN9|Q9Y4W9	Missense_Mutation	SNP	ENST00000356183.4	37	CCDS32414.1	.	.	.	.	.	.	.	.	.	.	C	16.35	3.097790	0.56075	.	.	ENSG00000077235	ENST00000356183;ENST00000388971	T	0.24723	1.84	5.38	5.38	0.77491	.	0.386003	0.29218	N	0.012782	T	0.30603	0.0770	L	0.59436	1.845	0.31948	N	0.610106	P;P	0.48911	0.917;0.804	B;B	0.41946	0.285;0.371	T	0.35724	-0.9777	10	0.34782	T	0.22	-14.1759	18.7489	0.91806	0.0:1.0:0.0:0.0	.	932;932	Q12789;Q12789-3	TF3C1_HUMAN;.	K	932;930	ENSP00000348510:E932K	ENSP00000348510:E932K	E	-	1	0	GTF3C1	27412103	1.000000	0.71417	0.978000	0.43139	0.233000	0.25261	5.389000	0.66255	2.507000	0.84556	0.655000	0.94253	GAA		0.552	GTF3C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433856.1		NM_001520	
HLA-DRB5	3127	hgsc.bcm.edu	37	6	32497901	32497901	+	Splice_Site	SNP	C	C	T	rs79192142		TCGA-CJ-4874-01A-01D-1373-10	TCGA-CJ-4874-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a625b4ef-cab6-4e63-b48f-dc6b69faaf5d	9bcf5c2a-6391-4368-9726-ff1cf3cee868	g.chr6:32497901C>T	ENST00000374975.3	-	1	163		c.e1+1			NM_002125.3	NP_002116.2			major histocompatibility complex, class II, DR beta 5											NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|pancreas(1)|prostate(1)|stomach(2)	10						TGTGCACTTACGTCGGGTGTC	0.522																																																	0													99.0	102.0	101.0					6																	32497901		2203	4300	6503	SO:0001630	splice_region_variant	3127				CCDS4751.1	6p21.3	2013-01-11			ENSG00000198502	ENSG00000198502		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4953	protein-coding gene	gene with protein product		604776					Standard	NM_002125		Approved		uc003obj.3	Q30154	OTTHUMG00000031027	ENST00000374975.3:c.100+1G>A	6.37:g.32497901C>T		Somatic		WXS	SOLID	Phase_I		Splice_Site	SNP	ENST00000374975.3	37	CCDS4751.1	.	.	.	.	.	.	.	.	.	.	.	5.610	0.297256	0.10622	.	.	ENSG00000198502	ENST00000374975	.	.	.	4.54	1.39	0.22231	.	.	.	.	.	.	.	.	.	.	.	0.37152	P	0.09780999999999995	.	.	.	.	.	.	.	.	.	.	.	.	.	.	3.7318	0.08496	0.0:0.537:0.1955:0.2675	.	.	.	.	.	-1	.	.	.	-	.	.	HLA-DRB5	32605879	0.727000	0.28069	0.044000	0.18714	0.009000	0.06853	0.943000	0.29030	0.065000	0.16485	-0.334000	0.08254	.		0.522	HLA-DRB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076022.2		NM_002125	Intron
HP1BP3	50809	hgsc.bcm.edu	37	1	21100040	21100040	+	Silent	SNP	G	G	T			TCGA-CJ-4874-01A-01D-1373-10	TCGA-CJ-4874-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a625b4ef-cab6-4e63-b48f-dc6b69faaf5d	9bcf5c2a-6391-4368-9726-ff1cf3cee868	g.chr1:21100040G>T	ENST00000312239.5	-	5	553	c.414C>A	c.(412-414)acC>acA	p.T138T	HP1BP3_ENST00000375003.2_5'UTR|HP1BP3_ENST00000487117.1_5'Flank	NM_016287.3	NP_057371.2	Q5SSJ5	HP1B3_HUMAN	heterochromatin protein 1, binding protein 3	138					nucleosome assembly (GO:0006334)	nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(5)|prostate(2)|skin(2)|urinary_tract(1)	16		all_lung(284;6.55e-06)|Lung NSC(340;6.59e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(152;1.26e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00015)|GBM - Glioblastoma multiforme(114;0.000521)|Kidney(64;0.000529)|STAD - Stomach adenocarcinoma(196;0.00311)|KIRC - Kidney renal clear cell carcinoma(64;0.00687)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.201)		TGGCAGAAAGGGTAGCCCAGG	0.423																																																	0													107.0	106.0	107.0					1																	21100040		2203	4300	6503	SO:0001819	synonymous_variant	50809			BC053327	CCDS30621.1	1p36.12	2008-02-05			ENSG00000127483	ENSG00000127483			24973	protein-coding gene	gene with protein product						12477932	Standard	NM_016287		Approved	HP1-BP74	uc001bdw.1	Q5SSJ5	OTTHUMG00000002622	ENST00000312239.5:c.414C>A	1.37:g.21100040G>T		Somatic		WXS	SOLID	Phase_I	A6NI71|A8K5D7|B3KMZ8|B4E210|Q05BI0|Q5SSJ6|Q5SWC6|Q6PIM9|Q8NDF0|Q9UHY0	Silent	SNP	ENST00000312239.5	37	CCDS30621.1																																																																																				0.423	HP1BP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007457.2		NM_016287	
HRAS	3265	hgsc.bcm.edu;ucsc.edu	37	11	533545	533545	+	Missense_Mutation	SNP	G	G	C	rs397517139		TCGA-CJ-4874-01A-01D-1373-10	TCGA-CJ-4874-11A-01D-1373-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	a625b4ef-cab6-4e63-b48f-dc6b69faaf5d	9bcf5c2a-6391-4368-9726-ff1cf3cee868	g.chr11:533545G>C	ENST00000451590.1	-	4	545	c.358C>G	c.(358-360)Ctg>Gtg	p.L120V	HRAS_ENST00000468682.2_5'Flank|HRAS_ENST00000397594.1_Missense_Mutation_p.L120V|HRAS_ENST00000417302.1_Missense_Mutation_p.L120V|HRAS_ENST00000311189.7_Missense_Mutation_p.L120V|HRAS_ENST00000397596.2_Missense_Mutation_p.L120V	NM_001130442.1|NM_005343.2	NP_001123914.1|NP_005334.1	P01112	RASH_HUMAN	Harvey rat sarcoma viral oncogene homolog	120					actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cellular senescence (GO:0090398)|chemotaxis (GO:0006935)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|intrinsic apoptotic signaling pathway (GO:0097193)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of cell differentiation (GO:0045596)|negative regulation of cell proliferation (GO:0008285)|negative regulation of gene expression (GO:0010629)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Rho GTPase activity (GO:0034259)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JNK cascade (GO:0046330)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of miRNA metabolic process (GO:2000630)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rac protein signal transduction (GO:0035022)|positive regulation of ruffle assembly (GO:1900029)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of wound healing (GO:0090303)|protein heterooligomerization (GO:0051291)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|protein C-terminus binding (GO:0008022)			adrenal_gland(1)|bone(3)|breast(7)|cervix(23)|endometrium(4)|haematopoietic_and_lymphoid_tissue(12)|kidney(1)|large_intestine(2)|liver(1)|lung(16)|oesophagus(2)|penis(2)|pituitary(10)|prostate(31)|salivary_gland(24)|skin(184)|soft_tissue(38)|stomach(14)|testis(5)|thymus(1)|thyroid(173)|upper_aerodigestive_tract(122)|urinary_tract(225)	901		all_cancers(49;4.37e-09)|all_epithelial(84;2.09e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;7.63e-28)|Epithelial(43;7.29e-27)|OV - Ovarian serous cystadenocarcinoma(40;7.15e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CGTGCAGCCAGGTCACACTTG	0.627		6	Mis		"""infrequent sarcomas, rare other types"""	"""rhadomyosarcoma, ganglioneuroblastoma, bladder"""			Costello syndrome	HNSCC(11;0.0054)																													yes	Dom	yes	Costello syndrome	11	11p15.5	3265	v-Ha-ras Harvey rat sarcoma viral oncogene homolog		"""E, L, M"""	0													195.0	173.0	181.0					11																	533545		2203	4300	6503	SO:0001583	missense	3265	Familial Cancer Database	incl.: Facio-Cutaneous-Skeletal syndrome	AJ437024	CCDS7698.1, CCDS7699.1	11p15.5	2014-09-17	2013-07-08		ENSG00000174775	ENSG00000174775			5173	protein-coding gene	gene with protein product		190020	"""v-Ha-ras Harvey rat sarcoma viral oncogene homolog"""	HRAS1			Standard	NM_176795		Approved		uc010qvx.2	P01112	OTTHUMG00000131919	ENST00000451590.1:c.358C>G	11.37:g.533545G>C	ENSP00000407586:p.Leu120Val	Somatic		WXS	SOLID	Phase_I	B5BUA0|Q14080|Q6FHV9|Q9BR65|Q9UCE2	Missense_Mutation	SNP	ENST00000451590.1	37	CCDS7698.1	.	.	.	.	.	.	.	.	.	.	G	16.72	3.202117	0.58234	.	.	ENSG00000174775	ENST00000397594;ENST00000397596;ENST00000451590;ENST00000417302;ENST00000311189	T;T;T;T;T	0.76316	-1.01;-1.01;-1.01;-1.01;-1.01	4.08	3.16	0.36331	Small GTP-binding protein domain (1);	0.000000	0.64402	D	0.000001	T	0.81498	0.4835	M	0.92507	3.315	0.80722	D	1	B;B	0.32731	0.382;0.032	B;B	0.33254	0.16;0.111	T	0.82329	-0.0511	10	0.87932	D	0	.	10.9578	0.47368	0.0936:0.0:0.9064:0.0	.	120;120	P01112-2;P01112	.;RASH_HUMAN	V	120	ENSP00000380722:L120V;ENSP00000380723:L120V;ENSP00000407586:L120V;ENSP00000388246:L120V;ENSP00000309845:L120V	ENSP00000309845:L120V	L	-	1	2	HRAS	523545	1.000000	0.71417	0.996000	0.52242	0.997000	0.91878	7.829000	0.86735	0.842000	0.35045	0.561000	0.74099	CTG		0.627	HRAS-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259403.2		NM_176795	
KIAA2026	158358	hgsc.bcm.edu	37	9	5968932	5968932	+	Silent	SNP	A	A	G			TCGA-CJ-4874-01A-01D-1373-10	TCGA-CJ-4874-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a625b4ef-cab6-4e63-b48f-dc6b69faaf5d	9bcf5c2a-6391-4368-9726-ff1cf3cee868	g.chr9:5968932A>G	ENST00000399933.3	-	3	1298	c.1299T>C	c.(1297-1299)ctT>ctC	p.L433L	KIAA2026_ENST00000381461.2_Silent_p.L433L	NM_001017969.2	NP_001017969.2	Q5HYC2	K2026_HUMAN	KIAA2026	433										breast(6)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(1)	46		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)		CAAAGTCACAAAGACCCTTAA	0.368																																																	0													35.0	34.0	34.0					9																	5968932		1846	4097	5943	SO:0001819	synonymous_variant	158358			AB095946		9p24.1	2014-01-10			ENSG00000183354	ENSG00000183354			23378	protein-coding gene	gene with protein product							Standard	NM_001017969		Approved	FLJ20375	uc003zjq.4	Q5HYC2	OTTHUMG00000019507	ENST00000399933.3:c.1299T>C	9.37:g.5968932A>G		Somatic		WXS	SOLID	Phase_I	A8MTP2|B9EGW7|Q4VXA2|Q8IVE5	Silent	SNP	ENST00000399933.3	37																																																																																					0.368	KIAA2026-002	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051652.2		NM_001017969	
IFT74	80173	hgsc.bcm.edu	37	9	26984278	26984278	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-4874-01A-01D-1373-10	TCGA-CJ-4874-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a625b4ef-cab6-4e63-b48f-dc6b69faaf5d	9bcf5c2a-6391-4368-9726-ff1cf3cee868	g.chr9:26984278C>A	ENST00000443698.1	+	5	500	c.329C>A	c.(328-330)aCt>aAt	p.T110N	IFT74_ENST00000433700.1_Missense_Mutation_p.T110N|IFT74_ENST00000429045.2_Missense_Mutation_p.T110N|IFT74_ENST00000380062.5_Missense_Mutation_p.T110N	NM_001099222.1	NP_001092692.1	Q96LB3	IFT74_HUMAN	intraflagellar transport 74	110			T -> A (in dbSNP:rs12004404).		cilium assembly (GO:0042384)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|keratinocyte development (GO:0003334)|negative regulation of epithelial cell proliferation (GO:0050680)|Notch signaling pathway (GO:0007219)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasmic vesicle (GO:0031410)|intraciliary transport particle B (GO:0030992)|motile cilium (GO:0031514)|nucleus (GO:0005634)	beta-tubulin binding (GO:0048487)|chromatin binding (GO:0003682)			endometrium(1)|large_intestine(1)|lung(2)|prostate(1)|skin(1)	6		all_neural(11;2.36e-10)		Lung(218;1.4e-05)|LUSC - Lung squamous cell carcinoma(38;0.000114)		GAACTTACAACTGAAGTTAAT	0.269																																																	0													30.0	32.0	32.0					9																	26984278		1771	4004	5775	SO:0001583	missense	80173			AK023707	CCDS43793.1, CCDS47955.1	9p21.1	2014-07-03	2014-07-03	2005-11-02	ENSG00000096872	ENSG00000096872		"""Intraflagellar transport homologs"""	21424	protein-coding gene	gene with protein product	"""capillary morphogenesis protein 1"""	608040	"""coiled-coil domain containing 2"", ""intraflagellar transport 74 homolog (Chlamydomonas)"""	CCDC2		11683410	Standard	NM_001099223		Approved	CMG1, CMG-1, FLJ22621	uc003zqg.4	Q96LB3	OTTHUMG00000021028	ENST00000443698.1:c.329C>A	9.37:g.26984278C>A	ENSP00000404122:p.Thr110Asn	Somatic		WXS	SOLID	Phase_I	Q3B789|Q5VY34|Q6PGQ8|Q9H643|Q9H8G7	Missense_Mutation	SNP	ENST00000443698.1	37	CCDS43793.1	.	.	.	.	.	.	.	.	.	.	C	11.30	1.596977	0.28445	.	.	ENSG00000096872	ENST00000519968;ENST00000433700;ENST00000517444;ENST00000443698;ENST00000380062;ENST00000544022;ENST00000429045;ENST00000517866	T;T;T;T;T;T;T	0.56103	0.99;2.76;1.95;2.76;2.76;0.48;1.1	5.82	2.84	0.33178	.	0.439257	0.27012	N	0.021364	T	0.28830	0.0715	N	0.14661	0.345	0.27057	N	0.963642	B;B	0.17038	0.005;0.02	B;B	0.15052	0.007;0.012	T	0.12630	-1.0540	10	0.19590	T	0.45	-2.2617	5.934	0.19154	0.1315:0.6544:0.0:0.2141	.	110;110	Q96LB3;Q96LB3-2	IFT74_HUMAN;.	N	110;110;110;110;110;110;110;72	ENSP00000430004:T110N;ENSP00000389224:T110N;ENSP00000430096:T110N;ENSP00000404122:T110N;ENSP00000369402:T110N;ENSP00000393907:T110N;ENSP00000430742:T72N	ENSP00000369402:T110N	T	+	2	0	IFT74	26974278	1.000000	0.71417	0.994000	0.49952	0.796000	0.44982	2.421000	0.44688	0.729000	0.32403	0.585000	0.79938	ACT		0.269	IFT74-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055476.2		NM_025103	
KLHDC2	23588	hgsc.bcm.edu;ucsc.edu	37	14	50249623	50249623	+	Silent	SNP	T	T	G			TCGA-CJ-4874-01A-01D-1373-10	TCGA-CJ-4874-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a625b4ef-cab6-4e63-b48f-dc6b69faaf5d	9bcf5c2a-6391-4368-9726-ff1cf3cee868	g.chr14:50249623T>G	ENST00000298307.5	+	13	2034	c.1173T>G	c.(1171-1173)ctT>ctG	p.L391L	NEMF_ENST00000556925.1_5'Flank|KLHDC2_ENST00000557247.1_3'UTR|KLHDC2_ENST00000554589.1_3'UTR	NM_014315.2	NP_055130.1	Q9Y2U9	KLDC2_HUMAN	kelch domain containing 2	391						nucleus (GO:0005634)				endometrium(3)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16	all_epithelial(31;0.000959)|Breast(41;0.0117)					AACACTTACTTCACAGTGTTA	0.388																																																	0													99.0	84.0	89.0					14																	50249623		2203	4300	6503	SO:0001819	synonymous_variant	23588			AK001771	CCDS9693.1	14q21.3	2003-01-15			ENSG00000165516	ENSG00000165516			20231	protein-coding gene	gene with protein product		611280				11384994	Standard	NM_014315		Approved	HCLP-1, LCP	uc001wwx.3	Q9Y2U9	OTTHUMG00000140288	ENST00000298307.5:c.1173T>G	14.37:g.50249623T>G		Somatic		WXS	SOLID	Phase_I	B3KPF9|Q6IAF0|Q86TY9	Silent	SNP	ENST00000298307.5	37	CCDS9693.1																																																																																				0.388	KLHDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276869.1			
KRT79	338785	hgsc.bcm.edu	37	12	53218102	53218103	+	Frame_Shift_Del	DEL	CA	CA	-			TCGA-CJ-4874-01A-01D-1373-10	TCGA-CJ-4874-11A-01D-1373-10	CA	CA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a625b4ef-cab6-4e63-b48f-dc6b69faaf5d	9bcf5c2a-6391-4368-9726-ff1cf3cee868	g.chr12:53218102_53218103delCA	ENST00000330553.5	-	5	933_934	c.899_900delTG	c.(898-900)gtgfs	p.V300fs		NM_175834.2	NP_787028.1	Q5XKE5	K2C79_HUMAN	keratin 79	300	Linker 12.|Rod.					extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	enzyme binding (GO:0019899)|structural molecule activity (GO:0005198)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						CCATGGACAGCACCACATTGGT	0.604																																																	0																																										SO:0001589	frameshift_variant	338785			AJ564105	CCDS8839.1	12q13.13	2014-02-12	2007-07-03		ENSG00000185640	ENSG00000185640		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28930	protein-coding gene	gene with protein product	"""keratin 6-like"""	611160				11683385	Standard	NM_175834		Approved	K6L, KRT6L	uc001sbb.3	Q5XKE5	OTTHUMG00000169878	ENST00000330553.5:c.899_900delTG	12.37:g.53218102_53218103delCA	ENSP00000328358:p.Val300fs	Somatic		WXS	SOLID	Phase_I	Q6P465|Q7Z793	Frame_Shift_Del	DEL	ENST00000330553.5	37	CCDS8839.1																																																																																				0.604	KRT79-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406376.1		NM_175834	
LILRB4	11006	hgsc.bcm.edu	37	19	55176302	55176302	+	Splice_Site	SNP	T	T	A			TCGA-CJ-4874-01A-01D-1373-10	TCGA-CJ-4874-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a625b4ef-cab6-4e63-b48f-dc6b69faaf5d	9bcf5c2a-6391-4368-9726-ff1cf3cee868	g.chr19:55176302T>A	ENST00000391736.1	+	7	1021		c.e7+2		LILRB4_ENST00000430952.2_Splice_Site|LILRB4_ENST00000391734.3_Splice_Site|LILRB4_ENST00000391733.3_Splice_Site|LILRB4_ENST00000270452.2_Splice_Site	NM_001278426.2|NM_001278428.2|NM_001278429.2|NM_001278430.2	NP_001265355.1|NP_001265357.1|NP_001265358.1|NP_001265359.1	Q8NHJ6	LIRB4_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 4						immune system process (GO:0002376)|negative regulation of osteoclast differentiation (GO:0045671)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|receptor activity (GO:0004872)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(20)|ovary(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)	39				GBM - Glioblastoma multiforme(193;0.035)		CAACAGCTGGTGAGTCTCAGA	0.572																																																	0													64.0	57.0	59.0					19																	55176302		2203	4300	6503	SO:0001630	splice_region_variant	11006			U82979	CCDS12902.1, CCDS42618.1	19q13.4	2013-01-11				ENSG00000186818		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6608	protein-coding gene	gene with protein product		604821				9151699, 9079806	Standard	XM_005277050		Approved	LIR-5, ILT3, HM18, LIR5, CD85k	uc002qgp.3	Q8NHJ6		ENST00000391736.1:c.706+2T>A	19.37:g.55176302T>A		Somatic		WXS	SOLID	Phase_I	A8MVL8|O15468|O75021|Q6FGQ9|Q8N1C7|Q8NHL5	Splice_Site	SNP	ENST00000391736.1	37	CCDS12902.1	.	.	.	.	.	.	.	.	.	.	.	9.479	1.097532	0.20552	.	.	ENSG00000186818	ENST00000391736;ENST00000270452;ENST00000430952;ENST00000391734;ENST00000391733;ENST00000434286	.	.	.	2.43	1.35	0.21983	.	.	.	.	.	.	.	.	.	.	.	0.21675	N	0.999594	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.3823	0.16197	0.0:0.0:0.2965:0.7035	.	.	.	.	.	-1	.	.	.	+	.	.	LILRB4	59868114	0.000000	0.05858	0.057000	0.19452	0.352000	0.29268	0.001000	0.13038	0.318000	0.23185	0.491000	0.48974	.		0.572	LILRB4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000141127.3			Intron
MAGEB2	4113	hgsc.bcm.edu	37	X	30236765	30236765	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-4874-01A-01D-1373-10	TCGA-CJ-4874-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a625b4ef-cab6-4e63-b48f-dc6b69faaf5d	9bcf5c2a-6391-4368-9726-ff1cf3cee868	g.chrX:30236765G>T	ENST00000378988.4	+	2	169	c.68G>T	c.(67-69)cGg>cTg	p.R23L		NM_002364.4	NP_002355.2	O15479	MAGB2_HUMAN	melanoma antigen family B, 2	23										breast(1)|large_intestine(3)|lung(17)|ovary(1)|skin(1)	23						GATGAGACCCGGGGTCTCAAT	0.567																																																	0													37.0	35.0	36.0					X																	30236765		2202	4300	6502	SO:0001583	missense	4113			AF015766	CCDS14219.1	Xp21.3	2009-03-17			ENSG00000099399	ENSG00000099399			6809	protein-coding gene	gene with protein product	"""DSS/AHC critical interval MAGE superfamily 6"", ""melanoma-associated antigen B2"", ""cancer/testis antigen family 3, member 2"""	300098				9441743	Standard	NM_002364		Approved	DAM6, MAGE-XP-2, MGC26438, CT3.2	uc004dbz.3	O15479	OTTHUMG00000021319	ENST00000378988.4:c.68G>T	X.37:g.30236765G>T	ENSP00000368273:p.Arg23Leu	Somatic		WXS	SOLID	Phase_I	O75860	Missense_Mutation	SNP	ENST00000378988.4	37	CCDS14219.1	.	.	.	.	.	.	.	.	.	.	A	10.87	1.472561	0.26423	.	.	ENSG00000099399	ENST00000378988	T	0.04234	3.67	3.43	0.959	0.19624	Melanoma associated antigen, MAGE, N-terminal (1);	0.653207	0.14428	N	0.320189	T	0.02193	0.0068	N	0.04203	-0.255	0.09310	N	1	B	0.20164	0.042	B	0.24701	0.055	T	0.44937	-0.9295	10	0.40728	T	0.16	.	3.0051	0.06026	0.5076:0.2281:0.2643:0.0	.	23	O15479	MAGB2_HUMAN	L	23	ENSP00000368273:R23L	ENSP00000368273:R23L	R	+	2	0	MAGEB2	30146686	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.065000	0.11617	-0.166000	0.10890	-1.641000	0.00772	CGG		0.567	MAGEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056157.1		NM_002364	
MED13	9969	hgsc.bcm.edu	37	17	60140649	60140649	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-4874-01A-01D-1373-10	TCGA-CJ-4874-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a625b4ef-cab6-4e63-b48f-dc6b69faaf5d	9bcf5c2a-6391-4368-9726-ff1cf3cee868	g.chr17:60140649C>T	ENST00000397786.2	-	2	156	c.80G>A	c.(79-81)gGa>gAa	p.G27E		NM_005121.2	NP_005112.2	Q9UHV7	MED13_HUMAN	mediator complex subunit 13	27					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(4)|central_nervous_system(1)|endometrium(10)|kidney(24)|large_intestine(15)|liver(1)|lung(20)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						CCACTTAATTCCTGTCAAGTC	0.378																																																	0													94.0	93.0	93.0					17																	60140649		1852	4086	5938	SO:0001583	missense	9969			AB011165	CCDS42366.1	17q22-q23	2007-07-30	2007-07-30	2007-07-30		ENSG00000108510			22474	protein-coding gene	gene with protein product		603808	"""thyroid hormone receptor associated protein 1"""	THRAP1		1019863	Standard	NM_005121		Approved	KIAA0593, TRAP240	uc002izo.3	Q9UHV7		ENST00000397786.2:c.80G>A	17.37:g.60140649C>T	ENSP00000380888:p.Gly27Glu	Somatic		WXS	SOLID	Phase_I	B2RU05|O60334	Missense_Mutation	SNP	ENST00000397786.2	37	CCDS42366.1	.	.	.	.	.	.	.	.	.	.	C	29.4	5.003804	0.93287	.	.	ENSG00000108510	ENST00000397786;ENST00000262436	D	0.81821	-1.54	5.67	5.67	0.87782	Mediator complex, subunit Med13, N-terminal, metazoa/fungi (1);	0.000000	0.85682	D	0.000000	D	0.91264	0.7246	M	0.85945	2.785	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92008	0.5616	10	0.87932	D	0	-13.2485	19.7607	0.96316	0.0:1.0:0.0:0.0	.	27	Q9UHV7	MED13_HUMAN	E	27	ENSP00000380888:G27E	ENSP00000262436:G27E	G	-	2	0	MED13	57495431	1.000000	0.71417	0.999000	0.59377	0.926000	0.56050	7.818000	0.86416	2.658000	0.90341	0.655000	0.94253	GGA		0.378	MED13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445461.1		NM_005121	
NDFIP1	80762	hgsc.bcm.edu;ucsc.edu	37	5	141520137	141520137	+	Missense_Mutation	SNP	T	T	G			TCGA-CJ-4874-01A-01D-1373-10	TCGA-CJ-4874-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a625b4ef-cab6-4e63-b48f-dc6b69faaf5d	9bcf5c2a-6391-4368-9726-ff1cf3cee868	g.chr5:141520137T>G	ENST00000253814.4	+	6	975	c.505T>G	c.(505-507)Tat>Gat	p.Y169D		NM_030571.3	NP_085048.1	Q9BT67	NFIP1_HUMAN	Nedd4 family interacting protein 1	169					cellular iron ion homeostasis (GO:0006879)|negative regulation of gene expression (GO:0010629)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-4 production (GO:0032713)|negative regulation of isotype switching to IgE isotypes (GO:0048294)|negative regulation of protein transport (GO:0051224)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transporter activity (GO:0032410)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein ubiquitination (GO:0031398)|regulation of isotype switching to IgG isotypes (GO:0048302)|regulation of lymphocyte differentiation (GO:0045619)|regulation of myeloid leukocyte differentiation (GO:0002761)|signal transduction (GO:0007165)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	cell cortex (GO:0005938)|endosome (GO:0005768)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)	signal transducer activity (GO:0004871)			large_intestine(3)|lung(1)|ovary(1)	5		all_hematologic(541;0.0999)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTTTTCCACCTATTTCCCTGG	0.338																																																	0													240.0	229.0	233.0					5																	141520137		2203	4300	6503	SO:0001583	missense	80762			BC004317	CCDS4273.1	5q31.3	2008-02-05			ENSG00000131507	ENSG00000131507			17592	protein-coding gene	gene with protein product		612050				11042109, 11748237	Standard	NM_030571		Approved	N4WBP5, MGC10924	uc003lmi.4	Q9BT67	OTTHUMG00000129659	ENST00000253814.4:c.505T>G	5.37:g.141520137T>G	ENSP00000253814:p.Tyr169Asp	Somatic		WXS	SOLID	Phase_I	B2RDB8|D3DQF0|Q658T8|Q8N2E3|Q8N2F9	Missense_Mutation	SNP	ENST00000253814.4	37	CCDS4273.1	.	.	.	.	.	.	.	.	.	.	T	13.56	2.274118	0.40194	.	.	ENSG00000131507	ENST00000253814	.	.	.	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	T	0.66036	0.2749	L	0.35414	1.06	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.63625	-0.6595	9	0.30854	T	0.27	-13.1119	15.5661	0.76294	0.0:0.0:0.0:1.0	.	169	Q9BT67	NFIP1_HUMAN	D	169	.	ENSP00000253814:Y169D	Y	+	1	0	NDFIP1	141500321	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.691000	0.84191	2.095000	0.63458	0.459000	0.35465	TAT		0.338	NDFIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251859.2		NM_030571	
OGT	8473	hgsc.bcm.edu;ucsc.edu	37	X	70756092	70756092	+	Silent	SNP	A	A	G			TCGA-CJ-4874-01A-01D-1373-10	TCGA-CJ-4874-11A-01D-1373-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	a625b4ef-cab6-4e63-b48f-dc6b69faaf5d	9bcf5c2a-6391-4368-9726-ff1cf3cee868	g.chrX:70756092A>G	ENST00000373719.3	+	2	319	c.102A>G	c.(100-102)gcA>gcG	p.A34A	OGT_ENST00000373701.3_Silent_p.A24A|OGT_ENST00000498566.1_3'UTR	NM_181672.2|NM_181673.2	NP_858058.1|NP_858059.1	O15294	OGT1_HUMAN	O-linked N-acetylglucosamine (GlcNAc) transferase	34					apoptotic process (GO:0006915)|cellular response to retinoic acid (GO:0071300)|chromatin organization (GO:0006325)|circadian regulation of gene expression (GO:0032922)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|negative regulation of protein ubiquitination (GO:0031397)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of catalytic activity (GO:0043085)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of histone H3-K27 methylation (GO:0061087)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of proteolysis (GO:0045862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glycolytic process (GO:0006110)|regulation of insulin receptor signaling pathway (GO:0046626)|regulation of Rac protein signal transduction (GO:0035020)|response to insulin (GO:0032868)|response to nutrient (GO:0007584)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone acetyltransferase complex (GO:0000123)|microtubule organizing center (GO:0005815)|mitochondrion (GO:0005739)|MLL5-L complex (GO:0070688)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	acetylglucosaminyltransferase activity (GO:0008375)|enzyme activator activity (GO:0008047)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein N-acetylglucosaminyltransferase activity (GO:0016262)|protein O-GlcNAc transferase activity (GO:0097363)			breast(6)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(5)|liver(3)|lung(9)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Renal(35;0.156)					AATATCAGGCAGGAGATTTTG	0.458																																																	0													103.0	87.0	92.0					X																	70756092		2203	4300	6503	SO:0001819	synonymous_variant	8473			U77413	CCDS14414.1, CCDS35502.1	Xq13	2013-07-24	2012-05-04		ENSG00000147162	ENSG00000147162	2.4.1.255	"""Tetratricopeptide (TTC) repeat domain containing"""	8127	protein-coding gene	gene with protein product	"""UDP-N-acetylglucosamine:polypeptide-N-acetylglucosaminyl transferase"""	300255	"""O-linked N-acetylglucosamine (GlcNAc) transferase (UDP-N-acetylglucosamine:polypeptide-N-acetylglucosaminyl transferase)"""			9083068	Standard	NM_181672		Approved	O-GLCNAC, HRNT1, MGC22921, FLJ23071	uc004eaa.2	O15294	OTTHUMG00000033316	ENST00000373719.3:c.102A>G	X.37:g.70756092A>G		Somatic		WXS	SOLID	Phase_I	Q7Z3K0|Q8WWM8|Q96CC1|Q9UG57	Silent	SNP	ENST00000373719.3	37	CCDS14414.1																																																																																				0.458	OGT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000081829.3		NM_003605, NM_181672	
PABPC1	26986	hgsc.bcm.edu	37	8	101721709	101721709	+	Missense_Mutation	SNP	T	T	A	rs146200489	byFrequency	TCGA-CJ-4874-01A-01D-1373-10	TCGA-CJ-4874-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a625b4ef-cab6-4e63-b48f-dc6b69faaf5d	9bcf5c2a-6391-4368-9726-ff1cf3cee868	g.chr8:101721709T>A	ENST00000318607.5	-	8	2351	c.1223A>T	c.(1222-1224)tAc>tTc	p.Y408F	PABPC1_ENST00000522387.1_Missense_Mutation_p.Y376F|AP001205.1_ENST00000579868.1_RNA|PABPC1_ENST00000519596.1_5'UTR|PABPC1_ENST00000519004.1_Missense_Mutation_p.Y363F	NM_002568.3	NP_002559.2	P11940	PABP1_HUMAN	poly(A) binding protein, cytoplasmic 1	408					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|mRNA stabilization (GO:0048255)|negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|translation activator activity (GO:0008494)			breast(2)|endometrium(4)|kidney(15)|large_intestine(4)|lung(13)|prostate(1)|skin(1)	40	all_cancers(14;6.8e-05)|all_epithelial(15;3.16e-07)|Lung NSC(17;0.000453)|all_lung(17;0.00125)		Epithelial(11;6.37e-11)|all cancers(13;1.11e-08)|OV - Ovarian serous cystadenocarcinoma(57;3.91e-05)|STAD - Stomach adenocarcinoma(118;0.206)			TGCCATGAAGTAACCTGAAGG	0.493																																																	0													103.0	93.0	96.0					8																	101721709		2203	4300	6503	SO:0001583	missense	26986			Y00345	CCDS6289.1	8q22.2-q23	2013-02-12	2004-04-20		ENSG00000070756	ENSG00000070756		"""RNA binding motif (RRM) containing"""	8554	protein-coding gene	gene with protein product		604679	"""poly(A)-binding protein, cytoplasmic 2"""	PAB1, PABPC2		2885805	Standard	XM_005250861		Approved	PABP1, PABPL1	uc003yjs.1	P11940	OTTHUMG00000164779	ENST00000318607.5:c.1223A>T	8.37:g.101721709T>A	ENSP00000313007:p.Tyr408Phe	Somatic		WXS	SOLID	Phase_I	Q15097|Q93004	Missense_Mutation	SNP	ENST00000318607.5	37	CCDS6289.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	T|T|T	17.26|17.26|17.26	3.344254|3.344254|3.344254	0.61073|0.61073|0.61073	.|.|.	.|.|.	ENSG00000070756|ENSG00000070756|ENSG00000070756	ENST00000519596|ENST00000517403;ENST00000519100|ENST00000318607;ENST00000347137;ENST00000519004;ENST00000522387	.|.|T;T;T	.|.|0.29917	.|.|1.64;1.55;2.61	5.37|5.37|5.37	5.37|5.37|5.37	0.77165|0.77165|0.77165	.|.|.	.|.|0.000000	.|.|0.64402	.|.|D	.|.|0.000016	T|T|T	0.31796|0.31796|0.31796	0.0808|0.0808|0.0808	L|L|L	0.54908|0.54908|0.54908	1.71|1.71|1.71	0.53688|0.53688|0.53688	D|D|D	0.999979|0.999979|0.999979	.|.|B;B;B	.|.|0.09022	.|.|0.0;0.002;0.002	.|.|B;B;B	.|.|0.10450	.|.|0.005;0.003;0.005	T|T|T	0.05257|0.05257|0.05257	-1.0896|-1.0896|-1.0896	5|5|10	.|.|0.33141	.|.|T	.|.|0.24	.|.|.	15.6695|15.6695|15.6695	0.77262|0.77262|0.77262	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.|.	.|.|376;408;408	.|.|E7ERJ7;B3KT93;P11940	.|.|.;.;PABP1_HUMAN	F|S|F	240|61;277|408;408;363;376	.|.|ENSP00000313007:Y408F;ENSP00000429594:Y363F;ENSP00000429395:Y376F	.|.|ENSP00000313007:Y408F	L|T|Y	-|-|-	3|1|2	2|0|0	PABPC1|PABPC1|PABPC1	101790885|101790885|101790885	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.998000|0.998000|0.998000	0.95712|0.95712|0.95712	8.010000|8.010000|8.010000	0.88615|0.88615|0.88615	2.163000|2.163000|2.163000	0.67991|0.67991|0.67991	0.533000|0.533000|0.533000	0.62120|0.62120|0.62120	TTA|ACT|TAC		0.493	PABPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380217.1		NM_002568	
PCDH20	64881	hgsc.bcm.edu	37	13	61987429	61987429	+	Missense_Mutation	SNP	C	C	G			TCGA-CJ-4874-01A-01D-1373-10	TCGA-CJ-4874-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a625b4ef-cab6-4e63-b48f-dc6b69faaf5d	9bcf5c2a-6391-4368-9726-ff1cf3cee868	g.chr13:61987429C>G	ENST00000409186.1	-	5	2908	c.803G>C	c.(802-804)cGc>cCc	p.R268P	PCDH20_ENST00000409204.4_Missense_Mutation_p.R268P			Q8N6Y1	PCD20_HUMAN	protocadherin 20	268	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(14)|liver(1)|lung(23)|ovary(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	58		Breast(118;0.195)|Prostate(109;0.229)		GBM - Glioblastoma multiforme(99;0.000118)		GTAGGGGGTGCGCTCCCCATT	0.522																																																	0													96.0	82.0	87.0					13																	61987429		2203	4300	6503	SO:0001583	missense	64881			AF169693	CCDS9442.2	13q21	2010-01-26			ENSG00000197991	ENSG00000197991		"""Cadherins / Protocadherins : Non-clustered"""	14257	protein-coding gene	gene with protein product		614449					Standard	NM_022843		Approved	PCDH13, FLJ22218	uc001vid.4	Q8N6Y1	OTTHUMG00000017012	ENST00000409186.1:c.803G>C	13.37:g.61987429C>G	ENSP00000386653:p.Arg268Pro	Somatic		WXS	SOLID	Phase_I	A8K1K9|B1AQU2|Q8NDN4|Q9NRT9	Missense_Mutation	SNP	ENST00000409186.1	37	CCDS9442.2	.	.	.	.	.	.	.	.	.	.	C	15.41	2.826026	0.50739	.	.	ENSG00000197991	ENST00000409204;ENST00000409186;ENST00000358674	T;T	0.68181	-0.31;-0.31	5.91	5.91	0.95273	.	0.000000	0.64402	D	0.000003	T	0.59101	0.2169	N	0.25789	0.76	0.44728	D	0.997725	B	0.26445	0.149	B	0.26416	0.069	T	0.54642	-0.8263	10	0.48119	T	0.1	.	20.2963	0.98556	0.0:1.0:0.0:0.0	.	268	A8K1K9	.	P	268;268;14	ENSP00000387250:R268P;ENSP00000386653:R268P	ENSP00000351500:R14P	R	-	2	0	PCDH20	60885430	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.326000	0.59241	2.813000	0.96785	0.655000	0.94253	CGC		0.522	PCDH20-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333054.2		NM_022843	
PGC	5225	hgsc.bcm.edu;ucsc.edu	37	6	41711090	41711090	+	Silent	SNP	G	G	T			TCGA-CJ-4874-01A-01D-1373-10	TCGA-CJ-4874-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a625b4ef-cab6-4e63-b48f-dc6b69faaf5d	9bcf5c2a-6391-4368-9726-ff1cf3cee868	g.chr6:41711090G>T	ENST00000373025.3	-	4	428	c.366C>A	c.(364-366)acC>acA	p.T122T	PGC_ENST00000425343.2_Silent_p.T122T	NM_002630.3	NP_002621.1	P20142	PEPC_HUMAN	progastricsin (pepsinogen C)	122					digestion (GO:0007586)|proteolysis (GO:0006508)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	aspartic-type endopeptidase activity (GO:0004190)			endometrium(3)|kidney(1)|large_intestine(5)|lung(6)|skin(1)	16	Ovarian(28;0.0355)|Colorectal(47;0.121)		Epithelial(12;0.000132)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00507)			TGGTGGAGTAGGTGGACGACT	0.637																																																	0													164.0	153.0	157.0					6																	41711090		2203	4300	6503	SO:0001819	synonymous_variant	5225				CCDS4859.1, CCDS55000.1	6p21.1	2012-10-02			ENSG00000096088	ENSG00000096088	3.4.23.3		8890	protein-coding gene	gene with protein product		169740					Standard	NM_002630		Approved		uc003ora.2	P20142	OTTHUMG00000014683	ENST00000373025.3:c.366C>A	6.37:g.41711090G>T		Somatic		WXS	SOLID	Phase_I	B4DVZ3|Q5T3D7|Q5T3D8	Silent	SNP	ENST00000373025.3	37	CCDS4859.1																																																																																				0.637	PGC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040521.2			
PHKA1	5255	hgsc.bcm.edu;ucsc.edu	37	X	71802268	71802268	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-4874-01A-01D-1373-10	TCGA-CJ-4874-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a625b4ef-cab6-4e63-b48f-dc6b69faaf5d	9bcf5c2a-6391-4368-9726-ff1cf3cee868	g.chrX:71802268C>T	ENST00000373542.4	-	31	3637	c.3478G>A	c.(3478-3480)Gac>Aac	p.D1160N	PHKA1_ENST00000541944.1_Missense_Mutation_p.D1088N|PHKA1_ENST00000339490.3_Missense_Mutation_p.D1147N|PHKA1_ENST00000373539.3_Missense_Mutation_p.D1177N|PHKA1_ENST00000373545.3_Missense_Mutation_p.D1118N	NM_002637.3	NP_002628.2	P46020	KPB1_HUMAN	phosphorylase kinase, alpha 1 (muscle)	1160					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(2)|lung(18)|ovary(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	52	Renal(35;0.156)					AGGAACAAGTCATTGGCAATA	0.423																																																	0													106.0	78.0	87.0					X																	71802268		2203	4300	6503	SO:0001583	missense	5255				CCDS14421.1, CCDS48137.1, CCDS55453.1	Xq12-q13	2009-07-10			ENSG00000067177	ENSG00000067177	2.7.11.19		8925	protein-coding gene	gene with protein product		311870		PHKA			Standard	NM_002637		Approved		uc004eax.4	P46020	OTTHUMG00000022696	ENST00000373542.4:c.3478G>A	X.37:g.71802268C>T	ENSP00000362643:p.Asp1160Asn	Somatic		WXS	SOLID	Phase_I	B7ZL05|B7ZL07|Q2M3D7	Missense_Mutation	SNP	ENST00000373542.4	37	CCDS14421.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.018379	0.75275	.	.	ENSG00000067177	ENST00000373545;ENST00000373542;ENST00000541944;ENST00000339490;ENST00000373539	D;D;D;D;D	0.91124	-2.77;-2.79;-2.76;-2.75;-2.76	5.33	5.33	0.75918	.	0.196895	0.52532	D	0.000067	D	0.89856	0.6836	L	0.55990	1.75	0.58432	D	0.999996	P;B;B;P	0.49358	0.732;0.14;0.118;0.923	B;B;B;P	0.48524	0.29;0.097;0.062;0.58	D	0.87394	0.2365	10	0.14656	T	0.56	-11.8996	15.4029	0.74855	0.0:1.0:0.0:0.0	.	1088;1118;1147;1160	B7ZL07;A6NIT2;P46020-2;P46020	.;.;.;KPB1_HUMAN	N	1118;1160;1088;1147;1177	ENSP00000362646:D1118N;ENSP00000362643:D1160N;ENSP00000441251:D1088N;ENSP00000342469:D1147N;ENSP00000362640:D1177N	ENSP00000342469:D1147N	D	-	1	0	PHKA1	71718993	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.734000	0.84928	2.230000	0.72887	0.538000	0.68166	GAC		0.423	PHKA1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058896.1			
PIK3C2G	5288	hgsc.bcm.edu	37	12	18446881	18446881	+	Silent	SNP	C	C	T	rs7301521	byFrequency	TCGA-CJ-4874-01A-01D-1373-10	TCGA-CJ-4874-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a625b4ef-cab6-4e63-b48f-dc6b69faaf5d	9bcf5c2a-6391-4368-9726-ff1cf3cee868	g.chr12:18446881C>T	ENST00000266497.5	+	4	1004	c.966C>T	c.(964-966)tgC>tgT	p.C322C	RERGL_ENST00000541632.1_Intron|PIK3C2G_ENST00000538779.1_Silent_p.C322C|PIK3C2G_ENST00000433979.1_Silent_p.C322C|PIK3C2G_ENST00000535651.1_Silent_p.C322C|PIK3C2G_ENST00000536967.1_3'UTR			O75747	P3C2G_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 gamma	322	PI3K-RBD. {ECO:0000255|PROSITE- ProRule:PRU00879}.				chemotaxis (GO:0006935)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol phosphate kinase activity (GO:0016307)			breast(5)|central_nervous_system(6)|endometrium(2)|kidney(4)|large_intestine(8)|lung(31)|ovary(2)|prostate(1)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	66		Hepatocellular(102;0.194)				TGCATTTTTGCACAAATGACC	0.284													C|||	135	0.0269569	0.0038	0.072	5008	,	,		15993	0.0		0.0676	False		,,,				2504	0.0123																0								C		54,3556		0,54,1751	67.0	61.0	63.0		966	-1.2	0.1	12	dbSNP_116	63	708,7418		34,640,3389	no	coding-synonymous	PIK3C2G	NM_004570.4		34,694,5140	TT,TC,CC		8.7128,1.4958,6.4928		322/1446	18446881	762,10974	1805	4063	5868	SO:0001819	synonymous_variant	5288			AJ000008	CCDS44839.1, CCDS73452.1	12p12	2012-07-13	2012-07-13		ENSG00000139144	ENSG00000139144	2.7.1.154		8973	protein-coding gene	gene with protein product		609001	"""phosphoinositide-3-kinase, class 2, gamma polypeptide"""			9878262	Standard	XM_005253393		Approved		uc001rdt.3	O75747	OTTHUMG00000168841	ENST00000266497.5:c.966C>T	12.37:g.18446881C>T		Somatic		WXS	SOLID	Phase_I	A1L3U0	Silent	SNP	ENST00000266497.5	37	CCDS44839.1																																																																																				0.284	PIK3C2G-002	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401316.1		NM_004570	
PLCG2	5336	hgsc.bcm.edu	37	16	81934322	81934322	+	Silent	SNP	C	C	G			TCGA-CJ-4874-01A-01D-1373-10	TCGA-CJ-4874-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a625b4ef-cab6-4e63-b48f-dc6b69faaf5d	9bcf5c2a-6391-4368-9726-ff1cf3cee868	g.chr16:81934322C>G	ENST00000359376.3	+	14	1513	c.1299C>G	c.(1297-1299)ccC>ccG	p.P433P		NM_002661.3	NP_002652.2	P16885	PLCG2_HUMAN	phospholipase C, gamma 2 (phosphatidylinositol-specific)	433	PI-PLC X-box. {ECO:0000255|PROSITE- ProRule:PRU00270}.				B cell differentiation (GO:0030183)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid catabolic process (GO:0009395)|platelet activation (GO:0030168)|release of sequestered calcium ion into cytosol (GO:0051209)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			NS(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(18)|lung(21)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	58						TGACGAAGCCCACGGAGGCCA	0.612																																																	0													44.0	50.0	48.0					16																	81934322		2137	4254	6391	SO:0001819	synonymous_variant	5336				CCDS42204.1	16q24.1	2014-09-17				ENSG00000197943	3.1.4.11	"""SH2 domain containing"""	9066	protein-coding gene	gene with protein product		600220				7835906	Standard	XR_248240		Approved		uc002fgt.3	P16885		ENST00000359376.3:c.1299C>G	16.37:g.81934322C>G		Somatic		WXS	SOLID	Phase_I	D3DUL3|Q3ZTS2|Q59H45|Q969T5	Silent	SNP	ENST00000359376.3	37	CCDS42204.1																																																																																				0.612	PLCG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432429.1			
PRODH2	58510	hgsc.bcm.edu	37	19	36290976	36290976	+	Silent	SNP	C	C	T			TCGA-CJ-4874-01A-01D-1373-10	TCGA-CJ-4874-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a625b4ef-cab6-4e63-b48f-dc6b69faaf5d	9bcf5c2a-6391-4368-9726-ff1cf3cee868	g.chr19:36290976C>T	ENST00000301175.3	-	11	1592	c.1575G>A	c.(1573-1575)cgG>cgA	p.R525R	AC002398.5_ENST00000433059.1_lincRNA	NM_021232.1	NP_067055.1	Q9UF12	PROD2_HUMAN	proline dehydrogenase (oxidase) 2	525			R -> Q (in dbSNP:rs3761097).		proline catabolic process to glutamate (GO:0010133)	mitochondrial inner membrane (GO:0005743)	proline dehydrogenase activity (GO:0004657)			haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(9)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	21	all_lung(56;2.87e-07)|Lung NSC(56;4.32e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GCAGCAGCCGCCGCCACAGTT	0.612																																																	0													30.0	24.0	26.0					19																	36290976		2203	4300	6503	SO:0001819	synonymous_variant	58510			U80018	CCDS12478.1	19q13.1	2014-07-11				ENSG00000250799			17325	protein-coding gene	gene with protein product							Standard	NM_021232		Approved	HSPOX1	uc002obx.1	Q9UF12		ENST00000301175.3:c.1575G>A	19.37:g.36290976C>T		Somatic		WXS	SOLID	Phase_I		Silent	SNP	ENST00000301175.3	37	CCDS12478.1																																																																																				0.612	PRODH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452552.2		NM_021232	
RC3H2	54542	hgsc.bcm.edu	37	9	125621286	125621286	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-4874-01A-01D-1373-10	TCGA-CJ-4874-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a625b4ef-cab6-4e63-b48f-dc6b69faaf5d	9bcf5c2a-6391-4368-9726-ff1cf3cee868	g.chr9:125621286G>T	ENST00000373670.1	-	11	2545	c.1945C>A	c.(1945-1947)Cct>Act	p.P649T	RC3H2_ENST00000357244.2_Missense_Mutation_p.P649T|RC3H2_ENST00000423239.2_Missense_Mutation_p.P649T			Q9HBD1	RC3H2_HUMAN	ring finger and CCCH-type domains 2	649	Pro-rich.				B cell homeostasis (GO:0001782)|limb development (GO:0060173)|lung alveolus development (GO:0048286)|lymph node development (GO:0048535)|multicellular organism growth (GO:0035264)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|post-embryonic development (GO:0009791)|posttranscriptional regulation of gene expression (GO:0010608)|protein polyubiquitination (GO:0000209)|spleen development (GO:0048536)|T cell homeostasis (GO:0043029)|T cell proliferation (GO:0042098)|T follicular helper cell differentiation (GO:0061470)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(6)|large_intestine(4)|liver(1)|lung(11)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	33						ATGGAAGCAGGTGGGAGGGAG	0.532																																																	0													79.0	86.0	84.0					9																	125621286		2072	4206	6278	SO:0001583	missense	54542			AK000308	CCDS43874.1, CCDS48014.1	9q34	2013-01-18	2010-09-15	2007-02-06	ENSG00000056586	ENSG00000056586		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, CCCH-type domain containing"""	21461	protein-coding gene	gene with protein product		615231	"""membrane associated DNA binding protein"", ""ring finger and CCCH-type zinc finger domains 2"""	MNAB		10938276	Standard	NM_001100588		Approved	FLJ20301, FLJ20713, RNF164	uc010mwc.1	Q9HBD1	OTTHUMG00000020632	ENST00000373670.1:c.1945C>A	9.37:g.125621286G>T	ENSP00000362774:p.Pro649Thr	Somatic		WXS	SOLID	Phase_I	Q4VXB1|Q5JPD7|Q86ST6|Q8N3D6|Q96F27|Q9H5J2|Q9HBD2|Q9NWN9|Q9NXE1	Missense_Mutation	SNP	ENST00000373670.1	37	CCDS43874.1	.	.	.	.	.	.	.	.	.	.	G	18.91	3.722740	0.68959	.	.	ENSG00000056586	ENST00000373670;ENST00000357244;ENST00000373663;ENST00000423239	T;T;T	0.50548	0.74;0.74;0.78	5.84	5.84	0.93424	.	0.052293	0.85682	D	0.000000	T	0.53530	0.1802	N	0.14661	0.345	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.83275	0.981;0.996	T	0.56214	-0.8016	10	0.45353	T	0.12	.	17.2865	0.87143	0.0:0.0:1.0:0.0	.	649;649	Q9HBD1;Q9HBD1-4	RC3H2_HUMAN;.	T	649;649;520;649	ENSP00000362774:P649T;ENSP00000349783:P649T;ENSP00000411767:P649T	ENSP00000349783:P649T	P	-	1	0	RC3H2	124661107	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.219000	0.72231	2.751000	0.94390	0.655000	0.94253	CCT		0.532	RC3H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053966.1		NM_018835	
RIPK3	11035	hgsc.bcm.edu	37	14	24808388	24808388	+	Silent	SNP	A	A	G	rs3181247	byFrequency	TCGA-CJ-4874-01A-01D-1373-10	TCGA-CJ-4874-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a625b4ef-cab6-4e63-b48f-dc6b69faaf5d	9bcf5c2a-6391-4368-9726-ff1cf3cee868	g.chr14:24808388A>G	ENST00000216274.5	-	3	522	c.304T>C	c.(304-306)Ttg>Ctg	p.L102L	RIPK3_ENST00000554338.1_5'Flank|RP11-934B9.3_ENST00000555591.1_5'Flank	NM_006871.3	NP_006862.2	Q9Y572	RIPK3_HUMAN	receptor-interacting serine-threonine kinase 3	102	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of protein kinase activity (GO:0032147)|amyloid fibril formation (GO:1990000)|apoptotic signaling pathway (GO:0097190)|cellular protein modification process (GO:0006464)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|lymph node development (GO:0048535)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|necroptotic process (GO:0070266)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of ligase activity (GO:0051351)|positive regulation of necroptotic process (GO:0060545)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of phosphatase activity (GO:0010922)|positive regulation of protein deacetylation (GO:0090312)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of type I interferon production (GO:0032481)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of activated T cell proliferation (GO:0046006)|regulation of activation-induced cell death of T cells (GO:0070235)|regulation of adaptive immune response (GO:0002819)|regulation of CD8-positive, alpha-beta cytotoxic T cell extravasation (GO:2000452)|regulation of interferon-gamma production (GO:0032649)|regulation of T cell mediated cytotoxicity (GO:0001914)|signal transduction (GO:0007165)|spleen development (GO:0048536)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|thymus development (GO:0048538)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|ripoptosome (GO:0097342)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|NF-kappaB-inducing kinase activity (GO:0004704)|protein complex binding (GO:0032403)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription coactivator activity (GO:0003713)	p.L102L(1)		NS(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(4)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23				GBM - Glioblastoma multiforme(265;0.0181)		AGCCCCGACAAGGAGCCGTTC	0.572													G|||	320	0.0638978	0.1286	0.0418	5008	,	,		17983	0.001		0.0596	False		,,,				2504	0.0613				Pancreas(58;918 1191 4668 13304 15331)												1	Substitution - coding silent(1)	prostate(1)						G		524,3882	773.8+/-414.0	21,482,1700	72.0	66.0	68.0		304	3.8	1.0	14	dbSNP_105	68	416,8184	799.0+/-407.4	19,378,3903	no	coding-synonymous	RIPK3	NM_006871.3		40,860,5603	GG,GA,AA		4.8372,11.8929,7.2274		102/519	24808388	940,12066	2203	4300	6503	SO:0001819	synonymous_variant	11035			AF156884	CCDS9628.1	14q12	2006-05-15			ENSG00000129465	ENSG00000129465			10021	protein-coding gene	gene with protein product		605817				10339433, 10358032	Standard	NM_006871		Approved	RIP3	uc001wpb.3	Q9Y572	OTTHUMG00000029349	ENST00000216274.5:c.304T>C	14.37:g.24808388A>G		Somatic		WXS	SOLID	Phase_I	B4DJL9|C4AM87|Q5J795|Q5J796|Q6P5Y1	Silent	SNP	ENST00000216274.5	37	CCDS9628.1																																																																																				0.572	RIPK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073203.4		NM_006871	
RMND5B	64777	hgsc.bcm.edu	37	5	177574747	177574747	+	Silent	SNP	C	C	T			TCGA-CJ-4874-01A-01D-1373-10	TCGA-CJ-4874-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a625b4ef-cab6-4e63-b48f-dc6b69faaf5d	9bcf5c2a-6391-4368-9726-ff1cf3cee868	g.chr5:177574747C>T	ENST00000515098.1	+	11	1332	c.981C>T	c.(979-981)ggC>ggT	p.G327G	RMND5B_ENST00000313386.4_Silent_p.G327G|RMND5B_ENST00000542098.1_Silent_p.G314G			Q96G75	RMD5B_HUMAN	required for meiotic nuclear division 5 homolog B (S. cerevisiae)	327										endometrium(3)|large_intestine(5)|lung(6)|ovary(1)|skin(2)	17	all_cancers(89;0.00294)|Renal(175;0.000269)|Lung NSC(126;0.00858)|all_lung(126;0.0139)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TTGAACTAGGCATGAAGTGCT	0.562																																																	0													156.0	140.0	146.0					5																	177574747		2203	4300	6503	SO:0001819	synonymous_variant	64777			BC009911	CCDS4431.1, CCDS75382.1	5q35.3	2012-07-20			ENSG00000145916	ENSG00000145916			26181	protein-coding gene	gene with protein product	"""GID complex subunit 2 homolog B"""					12975309	Standard	NM_022762		Approved	FLJ22318, GID2, GID2B	uc003mim.3	Q96G75	OTTHUMG00000130897	ENST00000515098.1:c.981C>T	5.37:g.177574747C>T		Somatic		WXS	SOLID	Phase_I	Q1HE27|Q6UVY7|Q9H6F6	Silent	SNP	ENST00000515098.1	37	CCDS4431.1																																																																																				0.562	RMND5B-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373542.1		NM_022762	
SCN1A	6323	hgsc.bcm.edu;ucsc.edu	37	2	166847875	166847875	+	Silent	SNP	T	T	C			TCGA-CJ-4874-01A-01D-1373-10	TCGA-CJ-4874-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a625b4ef-cab6-4e63-b48f-dc6b69faaf5d	9bcf5c2a-6391-4368-9726-ff1cf3cee868	g.chr2:166847875T>C	ENST00000303395.4	-	26	5909	c.5910A>G	c.(5908-5910)acA>acG	p.T1970T	SCN1A_ENST00000409050.1_Silent_p.T1942T|SCN1A_ENST00000375405.3_Silent_p.T1959T|AC010127.3_ENST00000595647.1_RNA|AC010127.3_ENST00000597623.1_RNA|SCN1A_ENST00000423058.2_Silent_p.T1970T			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit	1970					adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)			NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CAGTTTTTTCTGTAATAGAGT	0.373																																																	0													90.0	85.0	87.0					2																	166847875		2203	4300	6503	SO:0001819	synonymous_variant	6323			AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.5910A>G	2.37:g.166847875T>C		Somatic		WXS	SOLID	Phase_I	E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Silent	SNP	ENST00000303395.4	37	CCDS54413.1																																																																																				0.373	SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102661.1		NM_006920	
SERAC1	84947	hgsc.bcm.edu	37	6	158565392	158565392	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-4874-01A-01D-1373-10	TCGA-CJ-4874-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a625b4ef-cab6-4e63-b48f-dc6b69faaf5d	9bcf5c2a-6391-4368-9726-ff1cf3cee868	g.chr6:158565392C>T	ENST00000367104.3	-	7	679	c.548G>A	c.(547-549)cGa>cAa	p.R183Q	SERAC1_ENST00000367102.2_Missense_Mutation_p.R183Q|SERAC1_ENST00000367101.1_Missense_Mutation_p.R183Q	NM_032861.3	NP_116250.3	Q96JX3	SRAC1_HUMAN	serine active site containing 1	183					extracellular matrix organization (GO:0030198)|GPI anchor metabolic process (GO:0006505)|intracellular protein transport (GO:0006886)|phospholipid biosynthetic process (GO:0008654)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	hydrolase activity, acting on ester bonds (GO:0016788)			endometrium(1)|kidney(2)|large_intestine(6)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	15		Breast(66;0.00519)|Ovarian(120;0.123)|Prostate(117;0.178)		OV - Ovarian serous cystadenocarcinoma(65;1.37e-18)|BRCA - Breast invasive adenocarcinoma(81;3.19e-05)		CTCTTCGCTTCGTGCCAAACC	0.338																																																	0													85.0	87.0	87.0					6																	158565392		2203	4300	6503	SO:0001583	missense	84947			BC001705	CCDS5255.1	6q25.3	2003-05-12			ENSG00000122335	ENSG00000122335			21061	protein-coding gene	gene with protein product		614725					Standard	NM_032861		Approved	FLJ14917	uc003qrc.2	Q96JX3	OTTHUMG00000015905	ENST00000367104.3:c.548G>A	6.37:g.158565392C>T	ENSP00000356071:p.Arg183Gln	Somatic		WXS	SOLID	Phase_I	Q49AT1|Q5VTX3|Q6PKF3	Missense_Mutation	SNP	ENST00000367104.3	37	CCDS5255.1	.	.	.	.	.	.	.	.	.	.	C	35	5.574234	0.96553	.	.	ENSG00000122335	ENST00000367102;ENST00000367104;ENST00000367101	T;T;T	0.71698	-0.59;-0.59;-0.59	5.8	5.8	0.92144	Armadillo-like helical (1);	0.000000	0.85682	D	0.000000	D	0.83059	0.5172	M	0.78801	2.425	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.84215	0.0458	10	0.87932	D	0	-13.0151	18.8408	0.92183	0.0:1.0:0.0:0.0	.	183	Q96JX3	SRAC1_HUMAN	Q	183	ENSP00000356069:R183Q;ENSP00000356071:R183Q;ENSP00000356068:R183Q	ENSP00000356068:R183Q	R	-	2	0	SERAC1	158485380	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.288000	0.72679	2.758000	0.94735	0.563000	0.77884	CGA		0.338	SERAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042862.1		NM_032861	
SMEK2	57223	hgsc.bcm.edu	37	2	55804449	55804449	+	Splice_Site	SNP	A	A	T			TCGA-CJ-4874-01A-01D-1373-10	TCGA-CJ-4874-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a625b4ef-cab6-4e63-b48f-dc6b69faaf5d	9bcf5c2a-6391-4368-9726-ff1cf3cee868	g.chr2:55804449A>T	ENST00000345102.5	-	11	1908		c.e11+1		SMEK2_ENST00000407823.3_Splice_Site|SMEK2_ENST00000272313.5_Splice_Site	NM_001122964.1	NP_001116436	Q5MIZ7	P4R3B_HUMAN	SMEK homolog 2, suppressor of mek1 (Dictyostelium)						positive regulation of gluconeogenesis (GO:0045722)|protein dephosphorylation (GO:0006470)|regulation of lipid metabolic process (GO:0019216)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|protein phosphatase 4 complex (GO:0030289)				kidney(1)|large_intestine(4)|liver(1)|lung(7)|ovary(1)|prostate(1)|skin(1)	16			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			ATTCATACTTACCGGGACAAA	0.244																																																	0													40.0	41.0	41.0					2																	55804449		2190	4270	6460	SO:0001630	splice_region_variant	57223			AB037808	CCDS1855.1, CCDS46289.1, CCDS62913.1	2p16.1	2008-09-15			ENSG00000138041				29267	protein-coding gene	gene with protein product		610352				16085932, 18614045	Standard	NM_001122964		Approved	PSY2, FLFL2, KIAA1387, FLJ31474	uc002rzc.3	Q5MIZ7	OTTHUMG00000129336	ENST00000345102.5:c.1606+1T>A	2.37:g.55804449A>T		Somatic		WXS	SOLID	Phase_I	Q6P9B0|Q86XB8|Q9BQJ0|Q9BRK2|Q9H913|Q9P2G0	Splice_Site	SNP	ENST00000345102.5	37	CCDS46289.1	.	.	.	.	.	.	.	.	.	.	A	14.31	2.496242	0.44352	.	.	ENSG00000138041	ENST00000272313;ENST00000407823;ENST00000345102	.	.	.	5.54	5.54	0.83059	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.845	0.70254	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SMEK2	55657953	1.000000	0.71417	1.000000	0.80357	0.316000	0.28119	6.359000	0.73060	2.096000	0.63516	0.533000	0.62120	.		0.244	SMEK2-002	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251483.1		NM_020463	Intron
SUN1	23353	hgsc.bcm.edu	37	7	897496	897496	+	Missense_Mutation	SNP	G	G	A	rs59910530	byFrequency	TCGA-CJ-4874-01A-01D-1373-10	TCGA-CJ-4874-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a625b4ef-cab6-4e63-b48f-dc6b69faaf5d	9bcf5c2a-6391-4368-9726-ff1cf3cee868	g.chr7:897496G>A	ENST00000405266.1	+	14	1561	c.1537G>A	c.(1537-1539)Gag>Aag	p.E513K	SUN1_ENST00000456758.2_Missense_Mutation_p.E665K|SUN1_ENST00000413514.2_Missense_Mutation_p.E274K|SUN1_ENST00000452783.2_Missense_Mutation_p.E373K|SUN1_ENST00000389574.3_Missense_Mutation_p.E393K|SUN1_ENST00000401592.1_Missense_Mutation_p.E476K|SUN1_ENST00000425407.2_Missense_Mutation_p.E393K			O94901	SUN1_HUMAN	Sad1 and UNC84 domain containing 1	503					cytoskeletal anchoring at nuclear membrane (GO:0090286)|nuclear envelope organization (GO:0006998)|nuclear matrix anchoring at nuclear membrane (GO:0090292)	acrosomal membrane (GO:0002080)|integral component of nuclear inner membrane (GO:0005639)|nuclear envelope (GO:0005635)|SUN-KASH complex (GO:0034993)				NS(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(17)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						GCCCACAGTCGAGCACCTCCA	0.562													G|||	843	0.168331	0.0772	0.2406	5008	,	,		15787	0.1359		0.1849	False		,,,				2504	0.2566																0								G	LYS/GLU,LYS/GLU,LYS/GLU	354,3828		19,316,1756	162.0	176.0	171.0		1426,1117,1177	-10.3	0.0	7	dbSNP_129	171	1365,7061		105,1155,2953	yes	missense,missense,missense	SUN1	NM_001130965.2,NM_001171944.1,NM_025154.5	56,56,56	124,1471,4709	AA,AG,GG		16.1999,8.4648,13.6342	benign,benign,benign	476/786,373/683,393/703	897496	1719,10889	2091	4213	6304	SO:0001583	missense	23353			AF202724	CCDS43533.1, CCDS47525.1, CCDS55078.1, CCDS55079.1, CCDS55080.1	7p22.3	2010-01-27	2010-01-27	2010-01-27	ENSG00000164828	ENSG00000164828			18587	protein-coding gene	gene with protein product	"""Sad1 unc-84 domain protein 1"""	607723	"""unc-84 homolog A (C. elegans)"""	UNC84A		11593002	Standard	NM_001130965		Approved	KIAA0810, FLJ12407	uc021zym.1	O94901	OTTHUMG00000151426	ENST00000405266.1:c.1537G>A	7.37:g.897496G>A	ENSP00000384116:p.Glu513Lys	Somatic		WXS	SOLID	Phase_I	A5PL20|B3KMV7|B4DZF7|B7WNY4|B7WP53|E9PDU4|E9PF23|F8WD13|Q96CZ7|Q9HA14|Q9UH98	Missense_Mutation	SNP	ENST00000405266.1	37		359|359	0.16437728937728938|0.16437728937728938	49|49	0.09959349593495935|0.09959349593495935	86|86	0.23756906077348067|0.23756906077348067	89|89	0.1555944055944056|0.1555944055944056	135|135	0.17810026385224276|0.17810026385224276	G|G	8.800|8.800	0.932697|0.932697	0.18131|0.18131	0.084648|0.084648	0.161999|0.161999	ENSG00000164828|ENSG00000164828	ENST00000456758;ENST00000389574;ENST00000452783;ENST00000405266;ENST00000401592;ENST00000297445;ENST00000425407;ENST00000429178;ENST00000413514|ENST00000433212	T;T;T;T;T;T;T;T|.	0.22336|.	2.31;2.31;2.32;2.31;2.31;2.31;1.99;1.96|.	5.15|5.15	-10.3|-10.3	0.00346|0.00346	.|.	1.071220|.	0.06979|.	N|.	0.819504|.	T|T	0.00012|0.00012	0.0000|0.0000	N|N	0.08118|0.08118	0|0	0.80722|0.80722	P|P	0.0|0.0	B;B;B;B;B;B|.	0.17268|.	0.002;0.002;0.003;0.021;0.003;0.005|.	B;B;B;B;B;B|.	0.09377|.	0.002;0.002;0.003;0.004;0.002;0.004|.	T|T	0.22243|0.22243	-1.0222|-1.0222	9|4	0.06236|.	T|.	0.91|.	-4.5311|-4.5311	9.0345|9.0345	0.36280|0.36280	0.2149:0.5051:0.28:0.0|0.2149:0.5051:0.28:0.0	rs59910530;rs61743533|rs59910530;rs61743533	274;373;476;665;503;393|.	E7EP45;E9PDU4;E9PF23;A4D2Q0;O94901;O94901-5|.	.;.;.;.;SUN1_HUMAN;.|.	K|Q	665;393;373;513;476;503;393;401;274|324	ENSP00000388743:E665K;ENSP00000374225:E393K;ENSP00000413439:E373K;ENSP00000384116:E513K;ENSP00000384015:E476K;ENSP00000392309:E393K;ENSP00000409909:E401K;ENSP00000389313:E274K|.	ENSP00000297445:E503K|.	E|R	+|+	1|2	0|0	SUN1|SUN1	864022|864022	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.002000|0.002000	0.02628|0.02628	-0.212000|-0.212000	0.09319|0.09319	-2.067000|-2.067000	0.00885|0.00885	-0.302000|-0.302000	0.09304|0.09304	GAG|CGA		0.562	SUN1-001	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000322566.1		NM_025154	
TAF7L	54457	hgsc.bcm.edu;ucsc.edu	37	X	100547952	100547952	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-4874-01A-01D-1373-10	TCGA-CJ-4874-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a625b4ef-cab6-4e63-b48f-dc6b69faaf5d	9bcf5c2a-6391-4368-9726-ff1cf3cee868	g.chrX:100547952G>T	ENST00000372907.3	-	1	93	c.82C>A	c.(82-84)Caa>Aaa	p.Q28K	TAF7L_ENST00000356784.1_5'Flank|TAF7L_ENST00000372905.2_5'UTR	NM_024885.3	NP_079161.3	Q5H9L4	TAF7L_HUMAN	TAF7-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 50kDa	28					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|transcription factor TFIID complex (GO:0005669)				NS(1)|breast(4)|kidney(4)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	29						GGTTCTTGTTGGCTAGTTACT	0.532																																					Ovarian(104;431 1530 3210 15406 18594)												0													234.0	233.0	233.0					X																	100547952		2203	4300	6503	SO:0001583	missense	54457			AF285595	CCDS35347.1, CCDS55466.1	Xq22.1	2009-03-25	2002-08-29	2001-12-07	ENSG00000102387	ENSG00000102387			11548	protein-coding gene	gene with protein product	"""cancer/testis antigen 40"""	300314	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, Q"""	TAF2Q		11279525	Standard	NM_024885		Approved	CT40	uc004ehb.3	Q5H9L4	OTTHUMG00000022021	ENST00000372907.3:c.82C>A	X.37:g.100547952G>T	ENSP00000361998:p.Gln28Lys	Somatic		WXS	SOLID	Phase_I	Q5H9L6|Q86XI4|Q9BXU5|Q9H5R0	Missense_Mutation	SNP	ENST00000372907.3	37	CCDS35347.1	.	.	.	.	.	.	.	.	.	.	G	6.457	0.452410	0.12283	.	.	ENSG00000102387	ENST00000372907	T	0.13420	2.59	3.67	-7.34	0.01427	.	4.241640	0.00678	N	0.000678	T	0.06234	0.0161	N	0.19112	0.55	0.09310	N	0.999999	B	0.10296	0.003	B	0.01281	0.0	T	0.37502	-0.9703	10	0.02654	T	1	18.4255	4.9815	0.14168	0.1457:0.1161:0.6217:0.1164	.	28	Q5H9L4	TAF7L_HUMAN	K	28	ENSP00000361998:Q28K	ENSP00000361998:Q28K	Q	-	1	0	TAF7L	100434608	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.577000	0.05847	-2.462000	0.00535	-0.956000	0.02647	CAA		0.532	TAF7L-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057526.2			
TMEM169	92691	hgsc.bcm.edu;ucsc.edu	37	2	216965089	216965089	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-4874-01A-01D-1373-10	TCGA-CJ-4874-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a625b4ef-cab6-4e63-b48f-dc6b69faaf5d	9bcf5c2a-6391-4368-9726-ff1cf3cee868	g.chr2:216965089G>A	ENST00000295658.4	+	3	925	c.718G>A	c.(718-720)Gca>Aca	p.A240T	TMEM169_ENST00000454545.1_Missense_Mutation_p.A240T|TMEM169_ENST00000437356.2_Missense_Mutation_p.A240T|TMEM169_ENST00000406027.2_Missense_Mutation_p.A240T	NM_001142311.1|NM_001142312.1|NM_138390.3	NP_001135783.1|NP_001135784.1|NP_612399.1	Q96HH4	TM169_HUMAN	transmembrane protein 169	240						integral component of membrane (GO:0016021)				breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(2)	13		Renal(323;0.0651)		Epithelial(149;6.44e-06)|all cancers(144;0.000398)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GTCCTGGGAAGCATGGTGGCA	0.582																																																	0													181.0	150.0	160.0					2																	216965089		2203	4300	6503	SO:0001583	missense	92691			AK091582	CCDS2401.1	2q35	2008-02-05			ENSG00000163449	ENSG00000163449			25130	protein-coding gene	gene with protein product						12477932	Standard	NM_001142310		Approved	FLJ34263	uc002vfv.4	Q96HH4	OTTHUMG00000133053	ENST00000295658.4:c.718G>A	2.37:g.216965089G>A	ENSP00000295658:p.Ala240Thr	Somatic		WXS	SOLID	Phase_I	B2R8W6	Missense_Mutation	SNP	ENST00000295658.4	37	CCDS2401.1	.	.	.	.	.	.	.	.	.	.	G	15.24	2.773896	0.49786	.	.	ENSG00000163449	ENST00000454545;ENST00000437356;ENST00000295658;ENST00000406027	.	.	.	4.93	4.03	0.46877	.	0.102556	0.64402	D	0.000003	T	0.42787	0.1218	L	0.50333	1.59	0.31744	N	0.63542	B	0.20052	0.041	B	0.14578	0.011	T	0.42832	-0.9428	8	.	.	.	-15.7215	9.5136	0.39091	0.0785:0.0:0.7804:0.1411	.	240	Q96HH4	TM169_HUMAN	T	240	.	.	A	+	1	0	TMEM169	216673334	1.000000	0.71417	0.991000	0.47740	0.988000	0.76386	4.526000	0.60566	2.550000	0.86006	0.655000	0.94253	GCA		0.582	TMEM169-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256666.2		NM_138390	
TMEM47	83604	hgsc.bcm.edu	37	X	34657472	34657472	+	Missense_Mutation	SNP	C	C	T	rs112608415		TCGA-CJ-4874-01A-01D-1373-10	TCGA-CJ-4874-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a625b4ef-cab6-4e63-b48f-dc6b69faaf5d	9bcf5c2a-6391-4368-9726-ff1cf3cee868	g.chrX:34657472C>T	ENST00000275954.3	-	2	517	c.259G>A	c.(259-261)Ggc>Agc	p.G87S		NM_031442.3	NP_113630.1	Q9BQJ4	TMM47_HUMAN	transmembrane protein 47	87						cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.G87C(1)		breast(1)|kidney(1)|large_intestine(1)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	9						GCAGCGCCGCCCAGGAGTAAA	0.438																																																	1	Substitution - Missense(1)	lung(1)											62.0	55.0	57.0					X																	34657472		2202	4300	6502	SO:0001583	missense	83604			AK090917	CCDS14235.1	Xp11.4	2008-02-05	2005-03-21	2005-03-21	ENSG00000147027	ENSG00000147027			18515	protein-coding gene	gene with protein product		300698	"""transmembrane 4 superfamily member 10"""	TM4SF10		11472633	Standard	NM_031442		Approved	BCMP1, DKFZP761J17121, DKFZp564E153	uc004ddh.3	Q9BQJ4	OTTHUMG00000021343	ENST00000275954.3:c.259G>A	X.37:g.34657472C>T	ENSP00000275954:p.Gly87Ser	Somatic		WXS	SOLID	Phase_I	Q5JR44	Missense_Mutation	SNP	ENST00000275954.3	37	CCDS14235.1	.	.	.	.	.	.	.	.	.	.	C	19.58	3.854639	0.71719	.	.	ENSG00000147027	ENST00000275954	T	0.67865	-0.29	5.98	5.98	0.97165	.	0.045963	0.85682	D	0.000000	T	0.57301	0.2044	N	0.22421	0.69	0.80722	D	1	B	0.21606	0.058	B	0.24848	0.056	T	0.52041	-0.8628	10	0.40728	T	0.16	-22.0154	18.1776	0.89766	0.0:1.0:0.0:0.0	.	87	Q9BQJ4	TMM47_HUMAN	S	87	ENSP00000275954:G87S	ENSP00000275954:G87S	G	-	1	0	TMEM47	34567393	1.000000	0.71417	0.998000	0.56505	0.961000	0.63080	7.487000	0.81328	2.516000	0.84829	0.538000	0.68166	GGC		0.438	TMEM47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056209.1		NM_031442	
TMEM63A	9725	hgsc.bcm.edu	37	1	226037701	226037701	+	Silent	SNP	C	C	T			TCGA-CJ-4874-01A-01D-1373-10	TCGA-CJ-4874-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a625b4ef-cab6-4e63-b48f-dc6b69faaf5d	9bcf5c2a-6391-4368-9726-ff1cf3cee868	g.chr1:226037701C>T	ENST00000366835.3	-	21	2253	c.1983G>A	c.(1981-1983)aaG>aaA	p.K661K		NM_014698.2	NP_055513.2	O94886	CSCL1_HUMAN	transmembrane protein 63A	661					ion transport (GO:0006811)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	nucleotide binding (GO:0000166)			breast(2)|endometrium(3)|large_intestine(5)|lung(6)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	24	Breast(184;0.197)					AGTGGATCCCCTTCTCCAGCT	0.597																																																	0													125.0	112.0	117.0					1																	226037701		2203	4300	6503	SO:0001819	synonymous_variant	9725				CCDS31042.1	1q42.12	2008-02-05	2005-07-25	2005-07-25	ENSG00000196187	ENSG00000196187			29118	protein-coding gene	gene with protein product			"""KIAA0792"""	KIAA0792		9872452, 9455484	Standard	NM_014698		Approved		uc001hpm.2	O94886	OTTHUMG00000037442	ENST00000366835.3:c.1983G>A	1.37:g.226037701C>T		Somatic		WXS	SOLID	Phase_I	Q53GI7|Q5TE96|Q8N2U2	Silent	SNP	ENST00000366835.3	37	CCDS31042.1																																																																																				0.597	TMEM63A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091154.2		NM_014698	
TRIP10	9322	hgsc.bcm.edu;ucsc.edu	37	19	6744588	6744588	+	Silent	SNP	C	C	T			TCGA-CJ-4874-01A-01D-1373-10	TCGA-CJ-4874-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a625b4ef-cab6-4e63-b48f-dc6b69faaf5d	9bcf5c2a-6391-4368-9726-ff1cf3cee868	g.chr19:6744588C>T	ENST00000313244.9	+	8	701	c.666C>T	c.(664-666)cgC>cgT	p.R222R	TRIP10_ENST00000596758.1_Silent_p.R222R|TRIP10_ENST00000600428.1_Silent_p.R114R|TRIP10_ENST00000313285.8_Silent_p.R222R			Q15642	CIP4_HUMAN	thyroid hormone receptor interactor 10	222	F-BAR domain.				actin cytoskeleton organization (GO:0030036)|cell communication (GO:0007154)|endocytosis (GO:0006897)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)			NS(1)|breast(1)|endometrium(1)|large_intestine(1)|liver(2)|lung(7)|ovary(1)|prostate(1)|urinary_tract(1)	16						TGGATGAACGCAGGGCCACCC	0.582																																																	0													108.0	118.0	114.0					19																	6744588		2203	4300	6503	SO:0001819	synonymous_variant	9322			AB072596	CCDS12172.1, CCDS74271.1, CCDS74272.1	19p13.3	2008-02-05			ENSG00000125733	ENSG00000125733			12304	protein-coding gene	gene with protein product	"""Cdc42-interacting protein"""	604504	"""salt tolerator"""	STOT		7776974, 9210375, 11294612	Standard	XM_005259683		Approved	STP, HSTP, CIP4	uc002mfr.3	Q15642	OTTHUMG00000150255	ENST00000313244.9:c.666C>T	19.37:g.6744588C>T		Somatic		WXS	SOLID	Phase_I	B2R8A6|B7WP22|D6W645|O15184|Q53G22|Q5TZN1|Q6FI24|Q8NFL1|Q8TCY1|Q8TDX3|Q96RJ1	Silent	SNP	ENST00000313244.9	37																																																																																					0.582	TRIP10-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000317129.2			
TRO	7216	hgsc.bcm.edu	37	X	54957276	54957276	+	Silent	SNP	T	T	A			TCGA-CJ-4874-01A-01D-1373-10	TCGA-CJ-4874-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a625b4ef-cab6-4e63-b48f-dc6b69faaf5d	9bcf5c2a-6391-4368-9726-ff1cf3cee868	g.chrX:54957276T>A	ENST00000173898.7	+	12	4231	c.4119T>A	c.(4117-4119)acT>acA	p.T1373T	TRO_ENST00000375022.4_Intron|TRO_ENST00000399736.1_Intron|TRO_ENST00000375041.2_Silent_p.T976T|TRO_ENST00000420798.2_Silent_p.T904T|TRO_ENST00000319167.8_Intron	NM_001039705.2	NP_001034794.1	Q12816	TROP_HUMAN	trophinin	1373	62 X 10 AA approximate tandem repeats.				embryo implantation (GO:0007566)|homophilic cell adhesion (GO:0007156)|negative regulation of cell growth (GO:0030308)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(19)|ovary(2)|skin(2)|urinary_tract(1)	37						GACCAAGCACTGGTGTTGGCT	0.592																																																	0													82.0	84.0	83.0					X																	54957276		2056	4174	6230	SO:0001819	synonymous_variant	7216			U04811	CCDS43958.1, CCDS43959.1, CCDS59527.1, CCDS59528.1, CCDS59529.1	Xp11.22-p11.21	2008-02-05			ENSG00000067445	ENSG00000067445			12326	protein-coding gene	gene with protein product		300132				9533028, 11454705	Standard	NM_001039705		Approved	MAGE-D3, KIAA1114, MAGED3	uc004dtq.4	Q12816	OTTHUMG00000021640	ENST00000173898.7:c.4119T>A	X.37:g.54957276T>A		Somatic		WXS	SOLID	Phase_I	B1AKE9|B1AKF1|F5GY27|Q96SX2|Q9NU89|Q9UPN8	Silent	SNP	ENST00000173898.7	37	CCDS43959.1																																																																																				0.592	TRO-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056837.3		NM_016157	
TSHZ1	10194	hgsc.bcm.edu;ucsc.edu	37	18	72998919	72998919	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-4874-01A-01D-1373-10	TCGA-CJ-4874-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a625b4ef-cab6-4e63-b48f-dc6b69faaf5d	9bcf5c2a-6391-4368-9726-ff1cf3cee868	g.chr18:72998919G>T	ENST00000580243.1	+	2	1905	c.1557G>T	c.(1555-1557)gaG>gaT	p.E519D	TSHZ1_ENST00000322038.5_Missense_Mutation_p.E474D			Q6ZSZ6	TSH1_HUMAN	teashirt zinc finger homeobox 1	519					anterior/posterior pattern specification (GO:0009952)|middle ear morphogenesis (GO:0042474)|regulation of transcription, DNA-templated (GO:0006355)|soft palate development (GO:0060023)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(11)|liver(1)|lung(14)|ovary(1)|skin(6)|upper_aerodigestive_tract(2)	42		Esophageal squamous(42;0.129)|Prostate(75;0.142)|Melanoma(33;0.211)		Colorectal(1;0.000501)|READ - Rectum adenocarcinoma(2;0.00226)|BRCA - Breast invasive adenocarcinoma(31;0.246)		TCAAGGAGGAGAGTGAGGACA	0.597																																																	0													120.0	124.0	123.0					18																	72998919		2203	4300	6503	SO:0001583	missense	10194			AF039698	CCDS12009.1	18q22.3	2013-11-20	2007-07-16	2006-03-14	ENSG00000179981	ENSG00000179981		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	10669	protein-coding gene	gene with protein product		614427	"""serologically defined colon cancer antigen 33"", ""teashirt zinc finger 1"", ""teashirt family zinc finger 1"""	SDCCAG33		17586487	Standard	NM_005786		Approved	NY-CO-33, TSH1	uc002lly.4	Q6ZSZ6	OTTHUMG00000132859	ENST00000580243.1:c.1557G>T	18.37:g.72998919G>T	ENSP00000464391:p.Glu519Asp	Somatic		WXS	SOLID	Phase_I	O60534|Q4LE29|Q53EU4	Missense_Mutation	SNP	ENST00000580243.1	37		.	.	.	.	.	.	.	.	.	.	G	10.97	1.500239	0.26861	.	.	ENSG00000179981	ENST00000322038	T	0.32988	1.43	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	T	0.41143	0.1146	M	0.80183	2.485	0.32640	N	0.520762	P	0.51351	0.944	P	0.46796	0.527	T	0.52741	-0.8535	10	0.14656	T	0.56	-37.1277	12.8704	0.57962	0.0745:0.0:0.9255:0.0	.	519	Q6ZSZ6	TSH1_HUMAN	D	474	ENSP00000323584:E474D	ENSP00000323584:E474D	E	+	3	2	TSHZ1	71127907	1.000000	0.71417	0.516000	0.27786	0.937000	0.57800	2.850000	0.48294	0.083000	0.17047	0.459000	0.35465	GAG		0.597	TSHZ1-005	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000444913.1		NM_005786	
TSHZ2	128553	hgsc.bcm.edu	37	20	51870958	51870958	+	Nonsense_Mutation	SNP	A	A	T			TCGA-CJ-4874-01A-01D-1373-10	TCGA-CJ-4874-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a625b4ef-cab6-4e63-b48f-dc6b69faaf5d	9bcf5c2a-6391-4368-9726-ff1cf3cee868	g.chr20:51870958A>T	ENST00000371497.5	+	2	1848	c.961A>T	c.(961-963)Aag>Tag	p.K321*	TSHZ2_ENST00000603338.2_Nonsense_Mutation_p.K318*|TSHZ2_ENST00000329613.6_Nonsense_Mutation_p.K318*|RP4-678D15.1_ENST00000606932.1_RNA	NM_001193421.1|NM_173485.5	NP_001180350.1|NP_775756.3	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	321					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(16)|lung(38)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	84			STAD - Stomach adenocarcinoma(23;0.1)			CACCCCGGCTAAGAAACGCGT	0.448																																																	0													74.0	81.0	79.0					20																	51870958		2203	4300	6503	SO:0001587	stop_gained	128553			AF230201	CCDS33490.1, CCDS54474.1	20q13.2	2013-11-20	2007-07-16	2006-03-14	ENSG00000182463	ENSG00000182463		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	13010	protein-coding gene	gene with protein product		614118	"""chromosome 20 open reading frame 17"", ""zinc finger protein 218"", ""teashirt family zinc finger 2"""	C20orf17, ZNF218		9671742	Standard	NM_173485		Approved	ZABC2, OVC10-2, TSH2	uc021wex.1	Q9NRE2	OTTHUMG00000033058	ENST00000371497.5:c.961A>T	20.37:g.51870958A>T	ENSP00000360552:p.Lys321*	Somatic		WXS	SOLID	Phase_I	B7Z7W1|J3KNQ0|Q4VXM4|Q6N003|Q8N260	Nonsense_Mutation	SNP	ENST00000371497.5	37	CCDS33490.1	.	.	.	.	.	.	.	.	.	.	A	44	11.088252	0.99514	.	.	ENSG00000182463	ENST00000371497;ENST00000329613	.	.	.	5.8	5.8	0.92144	.	0.045464	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.5457	16.1354	0.81481	1.0:0.0:0.0:0.0	.	.	.	.	X	321;318	.	ENSP00000333114:K318X	K	+	1	0	TSHZ2	51304365	1.000000	0.71417	0.901000	0.35422	0.651000	0.38670	8.956000	0.93066	2.206000	0.71126	0.523000	0.50628	AAG		0.448	TSHZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080398.6		NM_173485	
VIT	5212	hgsc.bcm.edu	37	2	37035867	37035867	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-4874-01A-01D-1373-10	TCGA-CJ-4874-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a625b4ef-cab6-4e63-b48f-dc6b69faaf5d	9bcf5c2a-6391-4368-9726-ff1cf3cee868	g.chr2:37035867C>T	ENST00000389975.3	+	14	1899	c.1597C>T	c.(1597-1599)Cgc>Tgc	p.R533C	VIT_ENST00000497382.1_Missense_Mutation_p.R202C|VIT_ENST00000379241.3_Missense_Mutation_p.R511C|VIT_ENST00000379242.3_Missense_Mutation_p.R548C|VIT_ENST00000401530.1_Missense_Mutation_p.R512C|VIT_ENST00000404084.1_Missense_Mutation_p.R485C	NM_001177969.1|NM_001177970.1	NP_001171440.1|NP_001171441.1	Q6UXI7	VITRN_HUMAN	vitrin	533	VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	interstitial matrix (GO:0005614)	glycosaminoglycan binding (GO:0005539)	p.R548S(1)		autonomic_ganglia(1)|breast(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	57		all_hematologic(82;0.248)				CACGGACACGCGCATCGGGGC	0.587																																																	1	Substitution - Missense(1)	lung(1)											81.0	78.0	79.0					2																	37035867		2203	4300	6503	SO:0001583	missense	5212			AF063833	CCDS33180.1, CCDS54347.1, CCDS54348.1, CCDS54349.1, CCDS54350.1	2p22.2	2008-05-15			ENSG00000205221	ENSG00000205221			12697	protein-coding gene	gene with protein product							Standard	NM_001177969		Approved		uc002rpl.3	Q6UXI7	OTTHUMG00000152149	ENST00000389975.3:c.1597C>T	2.37:g.37035867C>T	ENSP00000374625:p.Arg533Cys	Somatic		WXS	SOLID	Phase_I	A1A526|A6NKI9|A8K7Y4|E9PF47|Q6P7T3|Q96DM8|Q96DT1|Q9UDN0	Missense_Mutation	SNP	ENST00000389975.3	37	CCDS54347.1	.	.	.	.	.	.	.	.	.	.	C	15.66	2.897948	0.52227	.	.	ENSG00000205221	ENST00000379242;ENST00000389975;ENST00000497382;ENST00000404084;ENST00000379241;ENST00000401530	D;D;D;D;D;D	0.87029	-2.2;-2.2;-2.2;-2.2;-2.2;-2.2	5.27	4.39	0.52855	von Willebrand factor, type A (3);	0.000000	0.85682	D	0.000000	D	0.95017	0.8387	H	0.96916	3.905	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;1.0;0.999	D	0.94779	0.7952	10	0.87932	D	0	-15.256	8.8491	0.35188	0.1481:0.7767:0.0:0.0752	.	512;511;533;548	E9PF47;Q6UXI7-2;Q6UXI7;Q6UXI7-4	.;.;VITRN_HUMAN;.	C	548;533;202;485;511;512	ENSP00000368544:R548C;ENSP00000374625:R533C;ENSP00000417874:R202C;ENSP00000384154:R485C;ENSP00000368543:R511C;ENSP00000385658:R512C	ENSP00000368543:R511C	R	+	1	0	VIT	36889371	0.998000	0.40836	0.060000	0.19600	0.449000	0.32228	3.857000	0.55972	1.225000	0.43566	0.557000	0.71058	CGC		0.587	VIT-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding				
XYLT1	64131	hgsc.bcm.edu;ucsc.edu	37	16	17221643	17221643	+	Silent	SNP	C	C	T			TCGA-CJ-4874-01A-01D-1373-10	TCGA-CJ-4874-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a625b4ef-cab6-4e63-b48f-dc6b69faaf5d	9bcf5c2a-6391-4368-9726-ff1cf3cee868	g.chr16:17221643C>T	ENST00000261381.6	-	10	2187	c.2103G>A	c.(2101-2103)aaG>aaA	p.K701K		NM_022166.3	NP_071449.1	Q86Y38	XYLT1_HUMAN	xylosyltransferase I	701					cellular response to heat (GO:0034605)|chondroitin sulfate biosynthetic process (GO:0030206)|glycosaminoglycan biosynthetic process (GO:0006024)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|protein xylosyltransferase activity (GO:0030158)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						TAGCATGATGCTTGATCAGAA	0.512																																																	0													163.0	157.0	159.0					16																	17221643		2197	4300	6497	SO:0001819	synonymous_variant	64131			AJ277441	CCDS10569.1	16p12	2013-02-25			ENSG00000103489	ENSG00000103489	2.4.2.26	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	15516	protein-coding gene	gene with protein product	"""protein xylosyltransferase 1"""	608124				11099377	Standard	NM_022166		Approved	XT-I, PXYLT1	uc002dfa.3	Q86Y38	OTTHUMG00000129975	ENST00000261381.6:c.2103G>A	16.37:g.17221643C>T		Somatic		WXS	SOLID	Phase_I	Q9H1B6	Silent	SNP	ENST00000261381.6	37	CCDS10569.1																																																																																				0.512	XYLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252241.2		NM_022166	
ZBTB38	253461	hgsc.bcm.edu	37	3	141162128	141162128	+	Missense_Mutation	SNP	C	C	G	rs62282002	byFrequency	TCGA-CJ-4874-01A-01D-1373-10	TCGA-CJ-4874-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a625b4ef-cab6-4e63-b48f-dc6b69faaf5d	9bcf5c2a-6391-4368-9726-ff1cf3cee868	g.chr3:141162128C>G	ENST00000514251.1	+	4	1177	c.898C>G	c.(898-900)Cca>Gca	p.P300A	ZBTB38_ENST00000441582.2_Missense_Mutation_p.P300A|ZBTB38_ENST00000321464.5_Missense_Mutation_p.P301A					zinc finger and BTB domain containing 38											breast(3)|cervix(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|lung(14)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	41						AAGTCCACAACCAGCTGCTGT	0.443													C|||	557	0.111222	0.0053	0.2046	5008	,	,		21560	0.2192		0.0915	False		,,,				2504	0.0971																0								C	ALA/PRO	74,3726		1,72,1827	87.0	84.0	85.0		898	5.3	1.0	3	dbSNP_129	85	730,7500		23,684,3408	yes	missense	ZBTB38	NM_001080412.2	27	24,756,5235	GG,GC,CC		8.87,1.9474,6.6833	possibly-damaging	300/1196	141162128	804,11226	1900	4115	6015	SO:0001583	missense	253461			BC015444	CCDS43157.1	3q23	2014-06-13			ENSG00000177311	ENSG00000177311		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	26636	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 171"""	612218				12477932	Standard	NM_001080412		Approved	FLJ35036, CIBZ, ZNF921, PPP1R171	uc003etw.3	Q8NAP3	OTTHUMG00000160128	ENST00000514251.1:c.898C>G	3.37:g.141162128C>G	ENSP00000426387:p.Pro300Ala	Somatic		WXS	SOLID	Phase_I		Missense_Mutation	SNP	ENST00000514251.1	37	CCDS43157.1	282	0.12912087912087913	6	0.012195121951219513	64	0.17679558011049723	146	0.25524475524475526	66	0.0870712401055409	C	1.183	-0.637454	0.03557	0.019474	0.0887	ENSG00000177311	ENST00000509883;ENST00000514251;ENST00000441582;ENST00000321464	T;T;T;T	0.08720	3.39;3.06;3.06;3.06	5.28	5.28	0.74379	.	0.624337	0.16082	N	0.230452	T	0.00012	0.0000	N	0.24115	0.695	0.80722	P	0.0	B	0.24483	0.104	B	0.25140	0.058	T	0.47522	-0.9111	8	.	.	.	-11.0258	7.1963	0.25855	0.0:0.7913:0.0:0.2087	rs62282002	300	Q8NAP3	ZBT38_HUMAN	A	300;300;300;301	ENSP00000424254:P300A;ENSP00000426387:P300A;ENSP00000406955:P300A;ENSP00000372635:P301A	.	P	+	1	0	ZBTB38	142644818	0.570000	0.26651	0.959000	0.39883	0.750000	0.42670	1.548000	0.36201	2.611000	0.88343	0.591000	0.81541	CCA		0.443	ZBTB38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359329.2			
ZNF442	79973	hgsc.bcm.edu	37	19	12460568	12460568	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-4874-01A-01D-1373-10	TCGA-CJ-4874-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a625b4ef-cab6-4e63-b48f-dc6b69faaf5d	9bcf5c2a-6391-4368-9726-ff1cf3cee868	g.chr19:12460568A>G	ENST00000242804.4	-	6	2413	c.1831T>C	c.(1831-1833)Tct>Cct	p.S611P	CTD-3105H18.13_ENST00000563695.2_lincRNA|ZNF442_ENST00000438182.1_Missense_Mutation_p.S542P	NM_030824.2	NP_110451.1	Q9H7R0	ZN442_HUMAN	zinc finger protein 442	611					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(8)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	31						GAACTGAGAGAACTCAGTGCC	0.388																																																	0													102.0	91.0	95.0					19																	12460568		2203	4300	6503	SO:0001583	missense	79973			AK024418	CCDS12271.1	19p13.13	2013-01-08			ENSG00000198342	ENSG00000198342		"""Zinc fingers, C2H2-type"", ""-"""	20877	protein-coding gene	gene with protein product							Standard	NM_030824		Approved	FLJ14356	uc002mtr.1	Q9H7R0	OTTHUMG00000156411	ENST00000242804.4:c.1831T>C	19.37:g.12460568A>G	ENSP00000242804:p.Ser611Pro	Somatic		WXS	SOLID	Phase_I	B4DJ48	Missense_Mutation	SNP	ENST00000242804.4	37	CCDS12271.1	.	.	.	.	.	.	.	.	.	.	A	10.21	1.286257	0.23478	.	.	ENSG00000198342	ENST00000242804;ENST00000438182	T;T	0.61274	0.12;0.12	0.792	0.792	0.18625	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.69151	0.3079	M	0.78223	2.4	0.09310	N	1	D	0.76494	0.999	D	0.68483	0.958	T	0.54807	-0.8238	9	0.36615	T	0.2	.	5.8456	0.18663	1.0:0.0:0.0:0.0	.	611	Q9H7R0	ZN442_HUMAN	P	611;542	ENSP00000242804:S611P;ENSP00000388634:S542P	ENSP00000242804:S611P	S	-	1	0	ZNF442	12321568	0.006000	0.16342	0.000000	0.03702	0.275000	0.26752	0.922000	0.28734	0.613000	0.30089	0.254000	0.18369	TCT		0.388	ZNF442-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344109.1		NM_030824	
ZNF112	7771	hgsc.bcm.edu	37	19	44832764	44832764	+	Missense_Mutation	SNP	G	G	C			TCGA-CJ-4874-01A-01D-1373-10	TCGA-CJ-4874-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a625b4ef-cab6-4e63-b48f-dc6b69faaf5d	9bcf5c2a-6391-4368-9726-ff1cf3cee868	g.chr19:44832764G>C	ENST00000337401.4	-	5	1652	c.1564C>G	c.(1564-1566)Cag>Gag	p.Q522E	ZNF112_ENST00000354340.4_Missense_Mutation_p.Q516E|ZNF112_ENST00000536500.1_Missense_Mutation_p.Q539E	NM_001083335.1	NP_001076804.1	Q9UJU3	ZN112_HUMAN	zinc finger protein 112	522					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										TATGGCTTCTGTCCAGTGTGG	0.408																																																	0													118.0	116.0	117.0					19																	44832764		2203	4300	6503	SO:0001583	missense	7771			AF198358		19q13.2	2014-02-06	2012-11-27		ENSG00000062370	ENSG00000062370		"""Zinc fingers, C2H2-type"""	12892	protein-coding gene	gene with protein product		603994	"""zinc finger protein 112 homolog (mouse)"", ""zinc finger protein 228"""	ZFP112, ZNF228			Standard	NM_013380		Approved			Q9UJU3	OTTHUMG00000182357	ENST00000337401.4:c.1564C>G	19.37:g.44832764G>C	ENSP00000337081:p.Gln522Glu	Somatic		WXS	SOLID	Phase_I	A4FU53|Q9HCA7	Missense_Mutation	SNP	ENST00000337401.4	37	CCDS54276.1	.	.	.	.	.	.	.	.	.	.	G	0.507	-0.868153	0.02590	.	.	ENSG00000062370	ENST00000337401;ENST00000412927;ENST00000354340;ENST00000536500;ENST00000253426	T;T;T	0.11712	2.75;2.75;2.75	5.1	2.96	0.34315	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.244826	0.21003	N	0.081824	T	0.01558	0.0050	N	0.00063	-2.32	0.29128	N	0.879834	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.40384	-0.9566	10	0.02654	T	1	-4.5268	8.4372	0.32795	0.0:0.6686:0.2313:0.1001	.	521;539;522	B4DYT4;F5GWS7;Q9UJU3	.;.;ZF112_HUMAN	E	522;522;516;539;521	ENSP00000337081:Q522E;ENSP00000346305:Q516E;ENSP00000441990:Q539E	ENSP00000253426:Q521E	Q	-	1	0	ZNF285	49524604	0.995000	0.38212	0.968000	0.41197	0.877000	0.50540	3.171000	0.50824	0.667000	0.31107	0.655000	0.94253	CAG		0.408	ZNF112-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460744.1		NM_013380	
ZNF791	163049	hgsc.bcm.edu;ucsc.edu	37	19	12739410	12739410	+	Missense_Mutation	SNP	A	A	G	rs148416734		TCGA-CJ-4874-01A-01D-1373-10	TCGA-CJ-4874-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a625b4ef-cab6-4e63-b48f-dc6b69faaf5d	9bcf5c2a-6391-4368-9726-ff1cf3cee868	g.chr19:12739410A>G	ENST00000343325.4	+	4	1229	c.1067A>G	c.(1066-1068)tAt>tGt	p.Y356C	ZNF791_ENST00000446165.1_3'UTR|ZNF791_ENST00000458122.3_Missense_Mutation_p.Y324C|ZNF791_ENST00000540038.1_Missense_Mutation_p.Y247C|AC010422.1_ENST00000408416.1_RNA|ZNF490_ENST00000465656.1_Intron	NM_153358.2	NP_699189.2	Q3KP31	ZN791_HUMAN	zinc finger protein 791	356					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(5)|lung(6)|ovary(2)|prostate(3)	19						GAGAAACCCTATAAGTGTAAA	0.413																																																	0								A	CYS/TYR	1,4405	2.1+/-5.4	0,1,2202	56.0	60.0	59.0		1067	1.8	0.6	19	dbSNP_134	59	0,8600		0,0,4300	no	missense	ZNF791	NM_153358.2	194	0,1,6502	GG,GA,AA		0.0,0.0227,0.0077	probably-damaging	356/577	12739410	1,13005	2203	4300	6503	SO:0001583	missense	163049			AK074877	CCDS12273.1	19p13.2-p13.13	2013-01-08			ENSG00000173875	ENSG00000173875		"""Zinc fingers, C2H2-type"", ""-"""	26895	protein-coding gene	gene with protein product							Standard	NM_153358		Approved	FLJ90396	uc002mua.2	Q3KP31	OTTHUMG00000156426	ENST00000343325.4:c.1067A>G	19.37:g.12739410A>G	ENSP00000342974:p.Tyr356Cys	Somatic		WXS	SOLID	Phase_I	B7Z586|Q8NC99	Missense_Mutation	SNP	ENST00000343325.4	37	CCDS12273.1	.	.	.	.	.	.	.	.	.	.	A	8.038	0.763213	0.15914	2.27E-4	0.0	ENSG00000173875	ENST00000343325;ENST00000393303;ENST00000458122;ENST00000540038	T;T;T	0.25414	1.8;1.8;1.8	1.83	1.83	0.25207	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.46927	0.1418	M	0.81239	2.535	0.09310	N	0.999992	D	0.89917	1.0	D	0.83275	0.996	T	0.20042	-1.0287	9	0.87932	D	0	.	4.7437	0.13028	0.6707:0.3293:0.0:0.0	.	356	Q3KP31	ZN791_HUMAN	C	356;338;324;247	ENSP00000342974:Y356C;ENSP00000441761:Y324C;ENSP00000441038:Y247C	ENSP00000342974:Y356C	Y	+	2	0	ZNF791	12600410	0.005000	0.15991	0.650000	0.29550	0.337000	0.28794	0.899000	0.28417	0.834000	0.34852	0.402000	0.26972	TAT		0.413	ZNF791-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344140.1		NM_153358	
ZNF530	348327	hgsc.bcm.edu	37	19	58118342	58118342	+	Silent	SNP	A	A	T			TCGA-CJ-4874-01A-01D-1373-10	TCGA-CJ-4874-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a625b4ef-cab6-4e63-b48f-dc6b69faaf5d	9bcf5c2a-6391-4368-9726-ff1cf3cee868	g.chr19:58118342A>T	ENST00000332854.6	+	3	1669	c.1449A>T	c.(1447-1449)acA>acT	p.T483T	ZNF530_ENST00000597864.1_Intron	NM_020880.3	NP_065931.3	Q6P9A1	ZN530_HUMAN	zinc finger protein 530	483					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(6)|skin(1)	20		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0443)|Breast(46;0.0848)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		GACACCAGACAGTTCACACTG	0.413																																																	0													73.0	68.0	70.0					19																	58118342		2203	4300	6503	SO:0001819	synonymous_variant	348327			AK096831	CCDS12955.1	19q13.43	2013-01-08				ENSG00000183647		"""Zinc fingers, C2H2-type"", ""-"""	29297	protein-coding gene	gene with protein product						10819331	Standard	NM_020880		Approved	KIAA1508	uc002qpk.2	Q6P9A1		ENST00000332854.6:c.1449A>T	19.37:g.58118342A>T		Somatic		WXS	SOLID	Phase_I	O43340|Q9P220	Silent	SNP	ENST00000332854.6	37	CCDS12955.1																																																																																				0.413	ZNF530-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466797.1		NM_020880	
