#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ABCB5	340273	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	20768032	20768032	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr7:20768032G>A	ENST00000404938.2	+	23	3473	c.2821G>A	c.(2821-2823)Gcc>Acc	p.A941T	ABCB5_ENST00000258738.6_Missense_Mutation_p.A496T	NM_001163941.1	NP_001157413.1	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 5	941	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-dependent (GO:0002485)|antigen processing and presentation of endogenous peptide antigen via MHC class Ib via ER pathway, TAP-dependent (GO:0002489)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|cell differentiation (GO:0030154)|compound eye corneal lens development (GO:0048058)|positive regulation of antigen processing and presentation of peptide antigen via MHC class I (GO:0002591)|regulation of membrane potential (GO:0042391)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|efflux transmembrane transporter activity (GO:0015562)	p.A941T(1)|p.A496T(1)		breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(1)|pancreas(1)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)	77						TCGATTTGGAGCCTATTTAAT	0.443																																																	2	Substitution - Missense(2)	kidney(2)											112.0	110.0	111.0					7																	20768032		2203	4300	6503	SO:0001583	missense	340273			U66692	CCDS5371.1, CCDS55090.1, CCDS55091.1, CCDS55092.1	7p14	2012-03-14			ENSG00000004846	ENSG00000004846		"""ATP binding cassette transporters / subfamily B"""	46	protein-coding gene	gene with protein product	"""P-glycoprotein ABCB5"", ""ATP-binding cassette protein"""	611785				8894702, 12960149	Standard	NM_001163942		Approved	EST422562, ABCB5beta, ABCB5alpha	uc010kuh.3	Q2M3G0	OTTHUMG00000094789	ENST00000404938.2:c.2821G>A	7.37:g.20768032G>A	ENSP00000384881:p.Ala941Thr	Somatic		WXS	Illumina HiSeq	Phase_I	A4D131|A7BKA4|B5MD19|B7WPL1|F8QQP8|F8QQP9|J3KQ04|Q2M3I5|Q5I5Q7|Q5I5Q8|Q6KG50|Q6XFQ5|Q8IXA1	Missense_Mutation	SNP	ENST00000404938.2	37	CCDS55090.1	.	.	.	.	.	.	.	.	.	.	G	15.11	2.736211	0.49045	.	.	ENSG00000004846	ENST00000404938;ENST00000258738	D;D	0.89123	-2.47;-2.47	3.91	2.05	0.26809	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.932149	0.08886	N	0.879289	D	0.90937	0.7151	M	0.80028	2.48	0.31317	N	0.686477	B;B;B	0.23990	0.063;0.095;0.06	B;B;B	0.39771	0.119;0.189;0.309	D	0.87262	0.2280	10	0.62326	D	0.03	.	7.5797	0.27957	0.2282:0.0:0.7718:0.0	.	941;119;496	A7BKA4;A0ASV4;Q2M3G0	.;.;ABCB5_HUMAN	T	941;496	ENSP00000384881:A941T;ENSP00000258738:A496T	ENSP00000258738:A496T	A	+	1	0	ABCB5	20734557	0.997000	0.39634	0.987000	0.45799	0.856000	0.48823	3.583000	0.53928	0.585000	0.29608	-0.150000	0.13652	GCC		0.443	ABCB5-004	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000326736.2		NM_178559	
ADAMTS7	11173	broad.mit.edu	37	15	79051886	79051886	+	Silent	SNP	G	G	A			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr15:79051886G>A	ENST00000388820.4	-	24	5148	c.4938C>T	c.(4936-4938)tgC>tgT	p.C1646C		NM_014272.3	NP_055087.2	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 7	1646	PLAC. {ECO:0000255|PROSITE- ProRule:PRU00233}.				cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of chondrocyte differentiation (GO:0032331)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.C1646C(4)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(23)|ovary(1)|prostate(8)|skin(9)	54						GCAGCGTCTCGCAGAACCCGA	0.701																																																	4	Substitution - coding silent(4)	prostate(2)|lung(1)|kidney(1)											10.0	11.0	11.0					15																	79051886		2150	4223	6373	SO:0001819	synonymous_variant	11173			AF140675	CCDS32303.1	15q25.1	2012-05-16	2005-08-19		ENSG00000136378	ENSG00000136378		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	223	protein-coding gene	gene with protein product	"""COMPase"", ""a disintegrin and metalloprotease with thrombospondin motifs-7 preproprotein"""	605009	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 7"""			10464288	Standard	NM_014272		Approved	ADAM-TS7, DKFZp434H204	uc002bej.4	Q9UKP4	OTTHUMG00000172907	ENST00000388820.4:c.4938C>T	15.37:g.79051886G>A		Somatic		WXS	Illumina GAIIx	Phase_I	Q14F51|Q6P7J9	Silent	SNP	ENST00000388820.4	37	CCDS32303.1																																																																																				0.701	ADAMTS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421331.1		NM_014272	
ALG10B	144245	broad.mit.edu;hgsc.bcm.edu	37	12	38714340	38714340	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr12:38714340G>T	ENST00000308742.4	+	3	1063	c.747G>T	c.(745-747)atG>atT	p.M249I	ALG10B_ENST00000551464.1_Intron|AC117372.1_ENST00000401168.2_RNA	NM_001013620.3	NP_001013642.1	Q5I7T1	AG10B_HUMAN	ALG10B, alpha-1,2-glucosyltransferase	249					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transferase activity, transferring hexosyl groups (GO:0016758)	p.M249I(2)		breast(2)|kidney(3)|large_intestine(7)|lung(8)|ovary(4)|skin(1)	25	Esophageal squamous(101;0.187)	Lung NSC(34;0.204)|all_lung(34;0.235)				ACTTGAGTATGCTTTTCTGTT	0.378																																																	2	Substitution - Missense(2)	ovary(1)|kidney(1)											258.0	255.0	256.0					12																	38714340		2203	4300	6503	SO:0001583	missense	144245			AY845858	CCDS31772.1	12q12	2013-03-04	2013-03-04		ENSG00000175548	ENSG00000175548	2.4.1.256		31088	protein-coding gene	gene with protein product	"""potassium channel regulator 1"", ""dolichyl-P-Glc:Glc(2)Man(9)GlcNAc(2)-PP-dolichol alpha-1,2- glucosyltransferase"""		"""asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog B (yeast)"""				Standard	NM_001013620		Approved	KCR1	uc001rln.4	Q5I7T1	OTTHUMG00000169298	ENST00000308742.4:c.747G>T	12.37:g.38714340G>T	ENSP00000310120:p.Met249Ile	Somatic		WXS	Illumina HiSeq	Phase_I	B2RPF4	Missense_Mutation	SNP	ENST00000308742.4	37	CCDS31772.1	.	.	.	.	.	.	.	.	.	.	N	0.011	-1.712688	0.00712	.	.	ENSG00000175548	ENST00000308742	T	0.54479	0.57	3.23	3.23	0.37069	.	0.484707	0.25402	N	0.030926	T	0.32882	0.0844	N	0.12182	0.205	0.25973	N	0.982473	B	0.02656	0.0	B	0.01281	0.0	T	0.18461	-1.0336	10	0.33141	T	0.24	.	12.7261	0.57173	0.0:0.0:1.0:0.0	.	249	Q5I7T1	AG10B_HUMAN	I	249	ENSP00000310120:M249I	ENSP00000310120:M249I	M	+	3	0	ALG10B	37000607	0.003000	0.15002	0.100000	0.21137	0.020000	0.10135	-0.108000	0.10857	2.103000	0.63969	0.643000	0.83706	ATG		0.378	ALG10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403349.1		NM_001013620	
ALPP	250	broad.mit.edu;hgsc.bcm.edu	37	2	233246013	233246013	+	Silent	SNP	C	C	T			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr2:233246013C>T	ENST00000392027.2	+	10	1514	c.1245C>T	c.(1243-1245)taC>taT	p.Y415Y	AC068134.8_ENST00000439072.1_RNA|AC068134.8_ENST00000441266.1_RNA	NM_001632.3	NP_001623.3	P05187	PPB1_HUMAN	alkaline phosphatase, placental	415					dephosphorylation (GO:0016311)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alkaline phosphatase activity (GO:0004035)|magnesium ion binding (GO:0000287)|zinc ion binding (GO:0008270)	p.Y415Y(2)|p.Y415*(1)		NS(1)|biliary_tract(1)|endometrium(1)|kidney(4)|large_intestine(2)|liver(1)|lung(10)|ovary(2)	22		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;4.45e-22)|Kidney(3;4.42e-11)|KIRC - Kidney renal clear cell carcinoma(3;1.9e-09)|BRCA - Breast invasive adenocarcinoma(100;0.000767)|Lung(119;0.00566)|LUSC - Lung squamous cell carcinoma(224;0.00746)|STAD - Stomach adenocarcinoma(3;0.0181)|GBM - Glioblastoma multiforme(43;0.196)		TCCTCCTATACGGAAACGGTC	0.667																																																	3	Substitution - coding silent(2)|Substitution - Nonsense(1)	kidney(2)|large_intestine(1)											35.0	45.0	42.0					2																	233246013		2202	4296	6498	SO:0001819	synonymous_variant	250			M14169	CCDS2490.1	2q37.1	2010-06-24	2010-06-24		ENSG00000163283	ENSG00000163283	3.1.3.1		439	protein-coding gene	gene with protein product	"""Regan isozyme"""	171800	"""alkaline phosphatase, placental (Regan isozyme)"""			3001717, 3461452	Standard	XM_005246439		Approved		uc002vsq.3	P05187	OTTHUMG00000133255	ENST00000392027.2:c.1245C>T	2.37:g.233246013C>T		Somatic		WXS	Illumina HiSeq	Phase_I	P05188|P06861|Q53S78|Q96DB7	Silent	SNP	ENST00000392027.2	37	CCDS2490.1																																																																																				0.667	ALPP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257032.3		NM_001632	
ANK2	287	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	114267059	114267059	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr4:114267059C>T	ENST00000357077.4	+	35	4305	c.4252C>T	c.(4252-4254)Cgc>Tgc	p.R1418C	ANK2_ENST00000264366.6_Missense_Mutation_p.R1385C|ANK2_ENST00000394537.3_Missense_Mutation_p.R1418C|ANK2_ENST00000509550.1_Missense_Mutation_p.R594C|ANK2_ENST00000506722.1_Missense_Mutation_p.R1409C|ANK2_ENST00000510275.2_Missense_Mutation_p.R70C	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	1418	UPA domain.				atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.R1418C(2)		NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		GTTCAAGGTACGCGATACGAC	0.398																																																	2	Substitution - Missense(2)	large_intestine(1)|kidney(1)											109.0	95.0	100.0					4																	114267059		2203	4300	6503	SO:0001583	missense	287			M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.4252C>T	4.37:g.114267059C>T	ENSP00000349588:p.Arg1418Cys	Somatic		WXS	Illumina HiSeq	Phase_I	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	ENST00000357077.4	37	CCDS3702.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.4|20.4	3.975923|3.975923	0.74360|0.74360	.|.	.|.	ENSG00000145362|ENSG00000145362	ENST00000503423;ENST00000506722;ENST00000431447;ENST00000504454;ENST00000394537;ENST00000357077;ENST00000264366;ENST00000343056;ENST00000509550;ENST00000510275|ENST00000514960;ENST00000504415	T;T;T;T;T;T;T;T|.	0.28069|.	1.63;1.63;1.63;1.63;1.63;1.63;1.63;1.63|.	6.08|6.08	6.08|6.08	0.98989|0.98989	.|.	0.000000|.	0.53938|.	D|.	0.000057|.	D|D	0.82504|0.82504	0.5051|0.5051	M|M	0.81497|0.81497	2.545|2.545	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0;1.0;1.0;1.0|.	D;D;D;D;D;D;D|.	0.97110|.	0.994;0.998;0.992;0.998;1.0;0.999;0.999|.	T|T	0.81326|0.81326	-0.0983|-0.0983	10|5	0.87932|.	D|.	0|.	.|.	20.6721|20.6721	0.99693|0.99693	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	594;1385;464;430;1418;1418;1409|.	E9PCH6;Q01484;F8W694;Q7Z344;Q01484-2;Q01484-4;Q01484-5|.	.;ANK2_HUMAN;.;.;.;.;.|.	C|M	1331;1409;464;1433;1418;1418;1385;1409;594;70|430;70	ENSP00000421011:R1331C;ENSP00000421067:R1409C;ENSP00000424722:R1433C;ENSP00000378044:R1418C;ENSP00000349588:R1418C;ENSP00000264366:R1385C;ENSP00000426944:R594C;ENSP00000421023:R70C|.	ENSP00000264366:R1385C|.	R|T	+|+	1|2	0|0	ANK2|ANK2	114486508|114486508	0.997000|0.997000	0.39634|0.39634	0.995000|0.995000	0.50966|0.50966	0.402000|0.402000	0.30811|0.30811	3.299000|3.299000	0.51826|0.51826	2.894000|2.894000	0.99253|0.99253	0.591000|0.591000	0.81541|0.81541	CGC|ACG		0.398	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2		NM_001148	
APOBEC2	10930	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	41021140	41021140	+	Silent	SNP	G	G	A			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr6:41021140G>A	ENST00000244669.2	+	1	98	c.54G>A	c.(52-54)ggG>ggA	p.G18G		NM_006789.3	NP_006780.1	Q9Y235	ABEC2_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 2	18					cytidine deamination (GO:0009972)|DNA demethylation (GO:0080111)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)		cytidine deaminase activity (GO:0004126)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.G18G(1)		endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|prostate(2)|skin(1)	10	Ovarian(28;0.0418)|Colorectal(47;0.196)					CCCAGAATGGGGAGGATCTGG	0.597																																					Ovarian(118;1320 2185 8096 29684)												1	Substitution - coding silent(1)	kidney(1)											76.0	72.0	73.0					6																	41021140		2203	4300	6503	SO:0001819	synonymous_variant	10930			AF161698	CCDS4848.1	6p21	2008-02-05			ENSG00000124701	ENSG00000124701		"""Apolipoprotein B mRNA editing enzymes"""	605	protein-coding gene	gene with protein product		604797				10403781	Standard	NM_006789		Approved	ARCD1, ARP1	uc003opl.3	Q9Y235	OTTHUMG00000014670	ENST00000244669.2:c.54G>A	6.37:g.41021140G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B2R899|Q53F28|Q5TGU5|Q5TGU6	Silent	SNP	ENST00000244669.2	37	CCDS4848.1																																																																																				0.597	APOBEC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040498.1		NM_006789	
AQR	9716	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	35176806	35176806	+	Missense_Mutation	SNP	T	T	C			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr15:35176806T>C	ENST00000156471.5	-	26	3172	c.2947A>G	c.(2947-2949)Aaa>Gaa	p.K983E		NM_014691.2	NP_055506.1	O60306	AQR_HUMAN	aquarius intron-binding spliceosomal factor	983					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.K983E(1)		breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(10)|lung(18)|ovary(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)	57		Lung NSC(122;8.7e-10)|all_lung(180;1.47e-08)		all cancers(64;4.34e-18)|GBM - Glioblastoma multiforme(113;4.59e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0283)		GATCTTCCTTTAAAAATGGGT	0.368																																																	1	Substitution - Missense(1)	kidney(1)											98.0	94.0	96.0					15																	35176806		1828	4080	5908	SO:0001583	missense	9716			AB011132	CCDS42013.1	15q13	2013-09-12	2013-09-12			ENSG00000021776			29513	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 164"""	610548	"""aquarius homolog (mouse)"""			9626505, 16949364	Standard	NM_014691		Approved	KIAA0560, fSAP164, IBP160	uc001ziv.3	O60306		ENST00000156471.5:c.2947A>G	15.37:g.35176806T>C	ENSP00000156471:p.Lys983Glu	Somatic		WXS	Illumina HiSeq	Phase_I	A0JP17|A5YKK3|Q2YDX9|Q6IRU8|Q6PIC8	Missense_Mutation	SNP	ENST00000156471.5	37	CCDS42013.1	.	.	.	.	.	.	.	.	.	.	T	14.36	2.510809	0.44660	.	.	ENSG00000021776	ENST00000156471;ENST00000543879	D	0.93366	-3.21	5.8	4.62	0.57501	.	0.139477	0.64402	D	0.000006	D	0.89825	0.6827	L	0.48260	1.515	0.36318	D	0.858078	P	0.35575	0.51	B	0.40982	0.345	D	0.87423	0.2383	10	0.05959	T	0.93	-30.6696	12.6746	0.56887	0.0:0.0:0.1376:0.8624	.	983	O60306	AQR_HUMAN	E	983	ENSP00000156471:K983E	ENSP00000156471:K983E	K	-	1	0	AQR	32964098	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.916000	0.63362	2.213000	0.71641	0.528000	0.53228	AAA		0.368	AQR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417526.2		NM_014691	
CTC1	80169	hgsc.bcm.edu;ucsc.edu	37	17	8141944	8141944	+	Frame_Shift_Del	DEL	G	G	-	rs552540195		TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr17:8141944delG	ENST00000315684.8	-	3	208	c.201delC	c.(199-201)ttcfs	p.F67fs	CTC1_ENST00000581671.1_5'UTR	NM_025099.5	NP_079375.3	Q2NKJ3	CTC1_HUMAN	CTS telomere maintenance complex component 1	67					bone marrow development (GO:0048539)|cellular response to DNA damage stimulus (GO:0006974)|hematopoietic stem cell proliferation (GO:0071425)|multicellular organism growth (GO:0035264)|positive regulation of DNA replication (GO:0045740)|positive regulation of fibroblast proliferation (GO:0048146)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|replicative senescence (GO:0090399)|spleen development (GO:0048536)|telomere maintenance (GO:0000723)|telomere maintenance via telomere lengthening (GO:0010833)|thymus development (GO:0048538)	nuclear chromosome, telomeric region (GO:0000784)|nucleus (GO:0005634)|Stn1-Ten1 complex (GO:0070188)	single-stranded DNA binding (GO:0003697)			NS(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(8)|ovary(1)|skin(4)	29						GTACTGAGACGAAGCTGTAGA	0.572																																																	0													65.0	65.0	65.0					17																	8141944		2025	4193	6218	SO:0001589	frameshift_variant	0			AL831955	CCDS42259.1	17p13.1	2011-02-21	2011-02-21	2011-02-21	ENSG00000178971	ENSG00000178971			26169	protein-coding gene	gene with protein product	"""conserved telomere maintenance component 1"", ""alpha accessory factor 132"", ""conserved telomere capping protein 1"""	613129	"""tmp494178"", ""chromosome 17 open reading frame 68"""	C17orf68		19854130, 19854131	Standard	NM_025099		Approved	FLJ22170, AAF132	uc002gkq.4	Q2NKJ3		ENST00000315684.8:c.201delC	17.37:g.8141944delG	ENSP00000313759:p.Phe67fs	Somatic		WXS	Illumina HiSeq	Phase_I	B3KR66|C9JEX5|Q1PCD1|Q2TBE3|Q8N3S6|Q9H6L0	Frame_Shift_Del	DEL	ENST00000315684.8	37	CCDS42259.1																																																																																				0.572	CTC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000442012.1		NM_025099	
C17orf74	201243	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	7330515	7330515	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr17:7330515C>T	ENST00000333870.3	+	3	1279	c.1205C>T	c.(1204-1206)gCc>gTc	p.A402V	C17orf74_ENST00000574034.1_3'UTR|RP11-104H15.7_ENST00000575310.1_RNA	NM_175734.4	NP_783861.3	Q0P670	CQ074_HUMAN	chromosome 17 open reading frame 74	402						integral component of membrane (GO:0016021)		p.A402V(1)		cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	22		Prostate(122;0.157)				ACTACCTCTGCCTCCCTCACG	0.672																																																	1	Substitution - Missense(1)	kidney(1)											66.0	82.0	76.0					17																	7330515		2161	4262	6423	SO:0001583	missense	201243			BC044816	CCDS42255.1	17p13.1	2012-05-30			ENSG00000184560	ENSG00000184560			27315	protein-coding gene	gene with protein product						12477932	Standard	NM_175734		Approved		uc002ggw.3	Q0P670	OTTHUMG00000178190	ENST00000333870.3:c.1205C>T	17.37:g.7330515C>T	ENSP00000328061:p.Ala402Val	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000333870.3	37	CCDS42255.1	.	.	.	.	.	.	.	.	.	.	C	8.912	0.959058	0.18507	.	.	ENSG00000184560	ENST00000333870	T	0.32515	1.45	4.96	3.97	0.46021	.	0.715806	0.12029	N	0.506169	T	0.21307	0.0513	N	0.19112	0.55	0.23346	N	0.997867	B	0.33612	0.419	B	0.35413	0.202	T	0.10823	-1.0613	10	0.66056	D	0.02	-13.704	8.5751	0.33595	0.0:0.895:0.0:0.105	.	402	Q0P670	CQ074_HUMAN	V	402	ENSP00000328061:A402V	ENSP00000328061:A402V	A	+	2	0	C17orf74	7271239	0.101000	0.21875	0.909000	0.35828	0.011000	0.07611	1.304000	0.33482	2.454000	0.82982	0.491000	0.48974	GCC		0.672	C17orf74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440933.2		NM_175734	
COPS7A	50813	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	6837091	6837091	+	Splice_Site	SNP	G	G	C			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr12:6837091G>C	ENST00000543155.1	+	3	644		c.e3-1		COPS7A_ENST00000538410.1_Splice_Site|COPS7A_ENST00000534877.1_Splice_Site|COPS7A_ENST00000534947.1_Splice_Site|COPS7A_ENST00000542150.1_Intron|COPS7A_ENST00000539735.1_Splice_Site|COPS7A_ENST00000229251.3_Splice_Site	NM_001164094.1	NP_001157566.1	Q9UBW8	CSN7A_HUMAN	COP9 signalosome subunit 7A						cullin deneddylation (GO:0010388)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)		p.?(1)		endometrium(2)|kidney(1)|large_intestine(1)|liver(2)|lung(2)|ovary(1)|urinary_tract(1)	10						CATTCTCGCAGCTGGCTGAGA	0.542																																																	1	Unknown(1)	kidney(1)											143.0	113.0	123.0					12																	6837091		2203	4300	6503	SO:0001630	splice_region_variant	50813			AF193844	CCDS8558.1	12p13.31	2013-03-14	2013-03-14		ENSG00000111652	ENSG00000111652			16758	protein-coding gene	gene with protein product			"""COP9 (constitutive photomorphogenic, Arabidopsis, homolog) subunit 7A"", ""COP9 constitutive photomorphogenic homolog subunit 7A (Arabidopsis)"""				Standard	NM_001164093		Approved	CSN7A	uc001qqh.3	Q9UBW8	OTTHUMG00000169182	ENST00000543155.1:c.163-1G>C	12.37:g.6837091G>C		Somatic		WXS	Illumina HiSeq	Phase_I	A8K9A6|Q9NVX3|Q9UJW4	Splice_Site	SNP	ENST00000543155.1	37	CCDS8558.1	.	.	.	.	.	.	.	.	.	.	G	18.17	3.564422	0.65651	.	.	ENSG00000111652	ENST00000543155;ENST00000442593;ENST00000229251;ENST00000539735;ENST00000538410;ENST00000544725;ENST00000534947;ENST00000541866;ENST00000534877;ENST00000538753	.	.	.	5.79	5.79	0.91817	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.148	0.72674	0.0:0.1409:0.8591:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	COPS7A	6707352	1.000000	0.71417	1.000000	0.80357	0.797000	0.45037	5.359000	0.66074	2.735000	0.93741	0.655000	0.94253	.		0.542	COPS7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402740.1			Intron
CEP290	80184	broad.mit.edu	37	12	88483261	88483261	+	Missense_Mutation	SNP	G	G	C			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr12:88483261G>C	ENST00000552810.1	-	31	3920	c.3577C>G	c.(3577-3579)Cag>Gag	p.Q1193E	CEP290_ENST00000309041.7_Missense_Mutation_p.Q1195E|CEP290_ENST00000397838.3_Missense_Mutation_p.Q253E|CEP290_ENST00000547691.2_Missense_Mutation_p.Q253E	NM_025114.3	NP_079390.3	O15078	CE290_HUMAN	centrosomal protein 290kDa	1193					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|G2/M transition of mitotic cell cycle (GO:0000086)|hindbrain development (GO:0030902)|mitotic cell cycle (GO:0000278)|otic vesicle formation (GO:0030916)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephros development (GO:0048793)|protein transport (GO:0015031)|regulation of cAMP metabolic process (GO:0030814)|regulation of establishment of protein localization (GO:0070201)|retina development in camera-type eye (GO:0060041)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|protein complex (GO:0043234)|TCTN-B9D complex (GO:0036038)		p.Q1195E(1)		breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|liver(1)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	73						TCATCAGACTGTGCCTGatat	0.328																																																	1	Substitution - Missense(1)	kidney(1)											21.0	19.0	20.0					12																	88483261		1846	4065	5911	SO:0001583	missense	80184			AB002371	CCDS55858.1	12q21.33	2014-09-17				ENSG00000198707			29021	protein-coding gene	gene with protein product	"""Joubert syndrome 5"", ""nephrocystin-6"", ""cancer/testis antigen 87"", ""POC3 centriolar protein homolog (Chlamydomonas)"", ""Meckel syndrome, type 4"""	610142				15474516, 16682973, 16632484	Standard	NM_025114		Approved	KIAA0373, FLJ13615, 3H11Ag, rd16, NPHP6, JBTS5, SLSN6, LCA10, MKS4, BBS14, CT87, POC3	uc001tar.3	O15078		ENST00000552810.1:c.3577C>G	12.37:g.88483261G>C	ENSP00000448012:p.Gln1193Glu	Somatic		WXS	Illumina GAIIx	Phase_I	Q1PSK5|Q66GS8|Q9H2G6|Q9H6Q7|Q9H8I0	Missense_Mutation	SNP	ENST00000552810.1	37	CCDS55858.1	.	.	.	.	.	.	.	.	.	.	G	12.70	2.017735	0.35606	.	.	ENSG00000198707	ENST00000547691;ENST00000552810;ENST00000309041;ENST00000397838	T;T;T;T	0.64803	0.48;-0.12;-0.12;0.48	5.62	5.62	0.85841	.	0.107337	0.64402	D	0.000004	T	0.47021	0.1423	L	0.28556	0.865	0.40165	D	0.9771	P	0.36712	0.566	B	0.31946	0.138	T	0.51084	-0.8750	10	0.02654	T	1	.	19.6664	0.95894	0.0:0.0:1.0:0.0	.	1193	O15078	CE290_HUMAN	E	253;1193;1195;253	ENSP00000446905:Q253E;ENSP00000448012:Q1193E;ENSP00000308021:Q1195E;ENSP00000380938:Q253E	ENSP00000308021:Q1195E	Q	-	1	0	CEP290	87007392	1.000000	0.71417	1.000000	0.80357	0.693000	0.40251	6.322000	0.72886	2.646000	0.89796	0.585000	0.79938	CAG		0.328	CEP290-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000406344.1		NM_025114	
CRTAC1	55118	broad.mit.edu	37	10	99655168	99655168	+	Silent	SNP	G	G	A			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr10:99655168G>A	ENST00000370597.3	-	11	1675	c.1320C>T	c.(1318-1320)ggC>ggT	p.G440G	CRTAC1_ENST00000370591.2_Silent_p.G440G|CRTAC1_ENST00000298819.4_Silent_p.G440G	NM_018058.6	NP_060528.3	Q9NQ79	CRAC1_HUMAN	cartilage acidic protein 1	440						extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)	p.G440G(1)		autonomic_ganglia(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(7)|lung(6)|ovary(6)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	35		Colorectal(252;0.24)		Epithelial(162;2.18e-10)|all cancers(201;3.27e-09)		TGTTGTTGAAGCCCTGCAGAG	0.637																																																	1	Substitution - coding silent(1)	kidney(1)											49.0	47.0	47.0					10																	99655168		2203	4300	6503	SO:0001819	synonymous_variant	55118			AJ276171	CCDS31266.1, CCDS55723.1	10q22	2007-12-03			ENSG00000095713	ENSG00000095713			14882	protein-coding gene	gene with protein product		606276				11139377	Standard	NM_018058		Approved	FLJ10320, CEP-68, ASPIC1	uc001kou.2	Q9NQ79	OTTHUMG00000018871	ENST00000370597.3:c.1320C>T	10.37:g.99655168G>A		Somatic		WXS	Illumina GAIIx	Phase_I	B1ALN4|Q5T4F8|Q8N4H6|Q8TE52|Q9NQ78|Q9NQ80|Q9NW46	Silent	SNP	ENST00000370597.3	37	CCDS31266.1																																																																																				0.637	CRTAC1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000049754.1		NM_018058	
DIRAS1	148252	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	2717570	2717570	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr19:2717570C>A	ENST00000323469.4	-	2	418	c.235G>T	c.(235-237)Ggc>Tgc	p.G79C	DIRAS1_ENST00000585334.1_Missense_Mutation_p.G79C	NM_145173.3	NP_660156.1	O95057	DIRA1_HUMAN	DIRAS family, GTP-binding RAS-like 1	79					GTP catabolic process (GO:0006184)|small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.G79C(1)		kidney(1)|lung(2)|ovary(2)|prostate(1)	6				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AAGGCGTGGCCCTTGGAGATG	0.622																																																	1	Substitution - Missense(1)	kidney(1)											70.0	59.0	62.0					19																	2717570		2201	4299	6500	SO:0001583	missense	148252			BC030660	CCDS12092.1	19p13.3	2014-05-09				ENSG00000176490			19127	protein-coding gene	gene with protein product		607862				12107278	Standard	NM_145173		Approved	Di-Ras1, GBTS1, RIG	uc002lwf.3	O95057		ENST00000323469.4:c.235G>T	19.37:g.2717570C>A	ENSP00000325836:p.Gly79Cys	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000323469.4	37	CCDS12092.1	.	.	.	.	.	.	.	.	.	.	C	17.73	3.462126	0.63513	.	.	ENSG00000176490	ENST00000323469	T	0.69561	-0.41	4.07	4.07	0.47477	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	T	0.75845	0.3905	L	0.45581	1.43	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.78841	-0.2045	10	0.87932	D	0	.	13.7485	0.62890	0.0:1.0:0.0:0.0	.	79	O95057	DIRA1_HUMAN	C	79	ENSP00000325836:G79C	ENSP00000325836:G79C	G	-	1	0	DIRAS1	2668570	1.000000	0.71417	1.000000	0.80357	0.514000	0.34195	7.539000	0.82063	1.813000	0.52934	0.549000	0.68633	GGC		0.622	DIRAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451350.1			
DNAJB8	165721	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	128181497	128181497	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr3:128181497G>A	ENST00000469083.1	-	2	3149	c.592C>T	c.(592-594)Cgc>Tgc	p.R198C	DNAJB8_ENST00000319153.3_Missense_Mutation_p.R198C|DNAJB8-AS1_ENST00000471626.1_RNA			Q8NHS0	DNJB8_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 8	198					chaperone-mediated protein folding (GO:0061077)|negative regulation of inclusion body assembly (GO:0090084)	cytosol (GO:0005829)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|protein binding involved in protein folding (GO:0044183)|unfolded protein binding (GO:0051082)	p.R198C(1)		kidney(1)|large_intestine(4)|lung(4)|prostate(1)|skin(1)	11				GBM - Glioblastoma multiforme(114;0.177)		TCCACGATGCGCTTGGTGGTG	0.602																																																	1	Substitution - Missense(1)	kidney(1)											154.0	125.0	134.0					3																	128181497		2203	4300	6503	SO:0001583	missense	165721				CCDS3048.1	3q21.3	2014-01-21			ENSG00000179407	ENSG00000179407		"""Heat shock proteins / DNAJ (HSP40)"""	23699	protein-coding gene	gene with protein product		611337					Standard	NM_153330		Approved	MGC33884, CT156	uc003ekk.2	Q8NHS0	OTTHUMG00000159690	ENST00000469083.1:c.592C>T	3.37:g.128181497G>A	ENSP00000417418:p.Arg198Cys	Somatic		WXS	Illumina HiSeq	Phase_I	B3KWV7	Missense_Mutation	SNP	ENST00000469083.1	37	CCDS3048.1	.	.	.	.	.	.	.	.	.	.	G	12.98	2.101449	0.37048	.	.	ENSG00000179407	ENST00000469083;ENST00000319153	T;T	0.49432	0.78;0.78	4.75	1.68	0.24146	.	0.131699	0.47455	D	0.000229	T	0.65709	0.2717	M	0.88640	2.97	0.80722	D	1	D	0.89917	1.0	P	0.57324	0.818	T	0.72181	-0.4368	10	0.87932	D	0	.	11.8136	0.52195	0.0:0.0:0.3542:0.6457	.	198	Q8NHS0	DNJB8_HUMAN	C	198	ENSP00000417418:R198C;ENSP00000316053:R198C	ENSP00000316053:R198C	R	-	1	0	DNAJB8	129664187	1.000000	0.71417	0.996000	0.52242	0.084000	0.17831	4.227000	0.58612	0.399000	0.25367	-0.310000	0.09108	CGC		0.602	DNAJB8-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356933.1		NM_153330	
DPH2	1802	broad.mit.edu	37	1	44436377	44436377	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr1:44436377G>A	ENST00000255108.3	+	2	429	c.257G>A	c.(256-258)gGc>gAc	p.G86D	DPH2_ENST00000412950.2_Missense_Mutation_p.A26T|DPH2_ENST00000396758.2_Missense_Mutation_p.G86D|DPH2_ENST00000529729.1_3'UTR	NM_001384.4	NP_001375.2	Q9BQC3	DPH2_HUMAN	DPH2 homolog (S. cerevisiae)	86					peptidyl-diphthamide biosynthetic process from peptidyl-histidine (GO:0017183)	cytoplasm (GO:0005737)		p.G86D(1)		autonomic_ganglia(1)|kidney(2)|large_intestine(2)|lung(10)|ovary(1)|prostate(2)|skin(1)	19	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0511)				ACAGCCTACGGCAGGTGTGAA	0.562																																																	1	Substitution - Missense(1)	kidney(1)											146.0	144.0	145.0					1																	44436377		2203	4300	6503	SO:0001583	missense	1802			AF053003	CCDS504.1, CCDS41314.1	1p34	2008-02-05	2005-06-03	2005-06-03	ENSG00000132768	ENSG00000132768			3004	protein-coding gene	gene with protein product		603456	"""diptheria toxin resistance protein required for diphthamide biosynthesis-like 2 (S. cerevisiae)"", ""DPH2-like 2 (S. cerevisiae)"""	DPH2L2		9782084, 15485916	Standard	XM_005270559		Approved		uc001ckz.3	Q9BQC3	OTTHUMG00000008295	ENST00000255108.3:c.257G>A	1.37:g.44436377G>A	ENSP00000255108:p.Gly86Asp	Somatic		WXS	Illumina GAIIx	Phase_I	A8MVC9|B2RDE3|B4DNI8|O60623	Missense_Mutation	SNP	ENST00000255108.3	37	CCDS504.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	33|33	5.227836|5.227836	0.95173|0.95173	.|.	.|.	ENSG00000132768|ENSG00000132768	ENST00000412950|ENST00000255108;ENST00000396758	.|T;T	.|0.75589	.|-0.95;-0.95	5.85|5.85	4.94|4.94	0.65067|0.65067	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.88040|0.88040	0.6330|0.6330	M|M	0.88512|0.88512	2.96|2.96	0.30809|0.30809	N|N	0.739023|0.739023	B|D;B	0.11235|0.89917	0.004|1.0;0.103	B|D;B	0.14578|0.85130	0.011|0.997;0.138	D|D	0.88730|0.88730	0.3236|0.3236	8|10	0.12766|0.72032	T|D	0.61|0.01	-22.1567|-22.1567	15.1797|15.1797	0.72945|0.72945	0.0678:0.0:0.9322:0.0|0.0678:0.0:0.9322:0.0	.|.	26|86;86	B4DNI8|A8MVC9;Q9BQC3	.|.;DPH2_HUMAN	T|D	26|86	.|ENSP00000255108:G86D;ENSP00000379981:G86D	ENSP00000413862:A26T|ENSP00000255108:G86D	A|G	+|+	1|2	0|0	DPH2|DPH2	44208964|44208964	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.986000|0.986000	0.74619|0.74619	8.897000|8.897000	0.92532|0.92532	1.481000|1.481000	0.48307|0.48307	-0.142000|-0.142000	0.14014|0.14014	GCA|GGC		0.562	DPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022832.1		NM_001384	
CCSER2	54462	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	86132205	86132205	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr10:86132205G>A	ENST00000224756.8	+	2	1582	c.1397G>A	c.(1396-1398)tGg>tAg	p.W466*	CCSER2_ENST00000359979.4_Nonsense_Mutation_p.W466*|CCSER2_ENST00000372088.2_Nonsense_Mutation_p.W466*	NM_001284243.1|NM_018999.2	NP_001271172.1|NP_061872.2	Q9H7U1	CCSE2_HUMAN	coiled-coil serine-rich protein 2	466					microtubule bundle formation (GO:0001578)	microtubule cytoskeleton (GO:0015630)		p.W466*(1)									ACTGATGAATGGATAGATATA	0.313																																																	1	Substitution - Nonsense(1)	kidney(1)											71.0	80.0	77.0					10																	86132205		2203	4292	6495	SO:0001587	stop_gained	0				CCDS31235.1, CCDS60582.1, CCDS60583.1, CCDS73159.1	10q23.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000107771	ENSG00000107771			29197	protein-coding gene	gene with protein product			"""KIAA1128"", ""family with sequence similarity 190, member B"""	KIAA1128, FAM190B		10574461	Standard	XM_005269905		Approved		uc001kdh.1	Q9H7U1	OTTHUMG00000018641	ENST00000224756.8:c.1397G>A	10.37:g.86132205G>A	ENSP00000224756:p.Trp466*	Somatic		WXS	Illumina HiSeq	Phase_I	B4DFY4|B4DQU9|B7WPE8|D3DWE2|Q8N6E9|Q9H2S0|Q9ULU1	Nonsense_Mutation	SNP	ENST00000224756.8	37	CCDS31235.1	.	.	.	.	.	.	.	.	.	.	G	37	6.003567	0.97189	.	.	ENSG00000107771	ENST00000359979;ENST00000224756;ENST00000372088	.	.	.	5.18	5.18	0.71444	.	0.099916	0.45606	D	0.000359	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.5344	16.189	0.81972	0.0:0.0:1.0:0.0	.	.	.	.	X	466	.	ENSP00000224756:W466X	W	+	2	0	FAM190B	86122185	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.241000	0.78201	2.411000	0.81874	0.655000	0.94253	TGG		0.313	CCSER2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049132.2		NM_018999	
FAT2	2196	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	150948075	150948075	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr5:150948075C>A	ENST00000261800.5	-	1	430	c.418G>T	c.(418-420)Gac>Tac	p.D140Y		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	140	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D140Y(1)		NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TCATTCTGGTCCAGGATGTGG	0.547																																																	1	Substitution - Missense(1)	kidney(1)											114.0	107.0	110.0					5																	150948075		2203	4300	6503	SO:0001583	missense	2196			AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.418G>T	5.37:g.150948075C>A	ENSP00000261800:p.Asp140Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	O75091|Q9NSR7	Missense_Mutation	SNP	ENST00000261800.5	37	CCDS4317.1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.389300	0.82902	.	.	ENSG00000086570	ENST00000261800	T	0.76316	-1.01	5.45	5.45	0.79879	Cadherin (3);Cadherin-like (1);	0.000000	0.64402	D	0.000001	D	0.93334	0.7875	H	0.98276	4.19	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.95737	0.8780	10	0.87932	D	0	.	19.3012	0.94144	0.0:1.0:0.0:0.0	.	140	Q9NYQ8	FAT2_HUMAN	Y	140	ENSP00000261800:D140Y	ENSP00000261800:D140Y	D	-	1	0	FAT2	150928268	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.755000	0.85180	2.553000	0.86117	0.555000	0.69702	GAC		0.547	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252434.1		NM_001447	
FREM1	158326	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	14823201	14823201	+	Missense_Mutation	SNP	C	C	G			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr9:14823201C>G	ENST00000380880.3	-	13	3077	c.2294G>C	c.(2293-2295)tGc>tCc	p.C765S	FREM1_ENST00000380881.4_Missense_Mutation_p.C766S|FREM1_ENST00000422223.2_Missense_Mutation_p.C765S			Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1	765					cell communication (GO:0007154)|cell-matrix adhesion (GO:0007160)|craniofacial suture morphogenesis (GO:0097094)	basement membrane (GO:0005604)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)	p.C766S(1)		breast(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(40)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	100				GBM - Glioblastoma multiforme(50;3.53e-06)		AATGTTAAAGCAGATCCCATG	0.443																																																	1	Substitution - Missense(1)	kidney(1)											135.0	128.0	130.0					9																	14823201		1918	4128	6046	SO:0001583	missense	158326			AK058190	CCDS47952.1, CCDS55293.1	9p22.3	2010-06-04	2004-12-15	2004-12-15	ENSG00000164946	ENSG00000164946			23399	protein-coding gene	gene with protein product		608944	"""chromosome 9 open reading frame 154"""	C9orf154		12838346, 15345741	Standard	NM_144966		Approved	FLJ25461, C9orf145, C9orf143, DKFZp686M16108, TILRR	uc003zlm.3	Q5H8C1	OTTHUMG00000019575	ENST00000380880.3:c.2294G>C	9.37:g.14823201C>G	ENSP00000370262:p.Cys765Ser	Somatic		WXS	Illumina HiSeq	Phase_I	B7ZBX4|Q5VV00|Q5VV01|Q6MZI4|Q8NEG9|Q96LI3	Missense_Mutation	SNP	ENST00000380880.3	37	CCDS47952.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.011711	0.75046	.	.	ENSG00000164946	ENST00000380881;ENST00000422223;ENST00000380880	T;T;T	0.37235	1.21;1.21;1.21	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.39784	0.1091	L	0.58302	1.8	0.80722	D	1	P	0.51449	0.945	P	0.44732	0.459	T	0.19063	-1.0317	10	0.09843	T	0.71	-13.6522	19.7555	0.96287	0.0:1.0:0.0:0.0	.	765	Q5H8C1	FREM1_HUMAN	S	766;765;765	ENSP00000370263:C766S;ENSP00000412940:C765S;ENSP00000370262:C765S	ENSP00000370257:C768S	C	-	2	0	FREM1	14813201	1.000000	0.71417	1.000000	0.80357	0.820000	0.46376	7.445000	0.80570	2.737000	0.93849	0.563000	0.77884	TGC		0.443	FREM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339474.2		NM_144966	
FRMPD2	143162	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	49392912	49392912	+	Frame_Shift_Del	DEL	T	T	-	rs529008159		TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr10:49392912delT	ENST00000374201.3	-	19	2674	c.2372delA	c.(2371-2373)aatfs	p.N791fs	FRMPD2_ENST00000407470.4_Frame_Shift_Del_p.N759fs|FRMPD2_ENST00000305531.3_Frame_Shift_Del_p.N766fs	NM_001018071.3|NM_001042512.2	NP_001018081|NP_001035977.2	Q68DX3	FRPD2_HUMAN	FERM and PDZ domain containing 2	791	PDZ 1. {ECO:0000255|PROSITE- ProRule:PRU00143}.				tight junction assembly (GO:0070830)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)	1-phosphatidylinositol binding (GO:0005545)			NS(2)|autonomic_ganglia(2)|breast(5)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(15)|lung(24)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	66				Kidney(211;0.201)		CTCTCCCTCATTAATGACAAA	0.393																																																	0													77.0	72.0	74.0					10																	49392912		2203	4300	6503	SO:0001589	frameshift_variant	143162			AK123038	CCDS31195.1	10q11	2010-10-13			ENSG00000170324	ENSG00000170324			28572	protein-coding gene	gene with protein product		613323	"""PDZ domain containing 5C"""	PDZD5C, PDZK5C			Standard	NM_001018071		Approved	MGC35285	uc001jdv.3	Q68DX3	OTTHUMG00000018171	ENST00000374201.3:c.2372delA	10.37:g.49392912delT	ENSP00000363317:p.Asn791fs	Somatic		WXS	Illumina HiSeq	Phase_I	B7WNW0|B7ZML5|Q2VY07|Q6GMQ9|Q6ZN38|Q6ZWI2|Q8N5T9	Frame_Shift_Del	DEL	ENST00000374201.3	37	CCDS31195.1																																																																																				0.393	FRMPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047923.3		NM_152428	
GAL3ST3	89792	broad.mit.edu;hgsc.bcm.edu	37	11	65810470	65810470	+	Silent	SNP	G	G	A			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr11:65810470G>A	ENST00000312006.4	-	3	1085	c.804C>T	c.(802-804)aaC>aaT	p.N268N	GAL3ST3_ENST00000527878.1_Silent_p.N268N	NM_033036.2	NP_149025.1	Q96A11	G3ST3_HUMAN	galactose-3-O-sulfotransferase 3	268					monosaccharide metabolic process (GO:0005996)|oligosaccharide metabolic process (GO:0009311)|poly-N-acetyllactosamine metabolic process (GO:0030309)|proteoglycan biosynthetic process (GO:0030166)|sulfur compound metabolic process (GO:0006790)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|carbohydrate binding (GO:0030246)|galactose 3-O-sulfotransferase activity (GO:0050694)|galactosylceramide sulfotransferase activity (GO:0001733)|proteoglycan sulfotransferase activity (GO:0050698)	p.N268N(1)		kidney(1)|lung(9)|ovary(2)|skin(2)	14						CGGCGCGCGCGTTGAGCTTGG	0.711																																																	1	Substitution - coding silent(1)	kidney(1)											15.0	15.0	15.0					11																	65810470		2196	4288	6484	SO:0001819	synonymous_variant	89792			AY026481	CCDS8128.1	11q13.1	2014-08-12			ENSG00000175229	ENSG00000175229		"""Sulfotransferases, membrane-bound"""	24144	protein-coding gene	gene with protein product		608234				11323440, 11356829	Standard	NM_033036		Approved	GAL3ST2	uc001ogw.3	Q96A11	OTTHUMG00000166667	ENST00000312006.4:c.804C>T	11.37:g.65810470G>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q14D05	Silent	SNP	ENST00000312006.4	37	CCDS8128.1																																																																																				0.711	GAL3ST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391052.1		NM_033036	
GPR116	221395	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	46849806	46849806	+	Silent	SNP	G	G	A	rs202152357		TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr6:46849806G>A	ENST00000283296.7	-	7	939	c.651C>T	c.(649-651)ggC>ggT	p.G217G	GPR116_ENST00000265417.7_Silent_p.G217G|GPR116_ENST00000362015.4_Silent_p.G217G|GPR116_ENST00000456426.2_Silent_p.G217G	NM_001098518.1	NP_001091988.1	Q8IZF2	GP116_HUMAN	G protein-coupled receptor 116	217	SEA. {ECO:0000255|PROSITE- ProRule:PRU00188}.				energy reserve metabolic process (GO:0006112)|fat cell differentiation (GO:0045444)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|neuropeptide signaling pathway (GO:0007218)|regulation of lipid metabolic process (GO:0019216)|surfactant homeostasis (GO:0043129)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.G217G(1)		breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(21)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	59			Lung(136;0.192)			TCACAGTCACGCCCTTGAAGC	0.388																																					NSCLC(59;410 1274 8751 36715 50546)												1	Substitution - coding silent(1)	kidney(1)						G	,	0,4406		0,0,2203	158.0	168.0	165.0		651,651	-4.5	0.1	6		165	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	GPR116	NM_001098518.1,NM_015234.4	,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,	217/1347,217/1347	46849806	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	221395			AB018301	CCDS4919.1	6p12.3	2014-08-08			ENSG00000069122	ENSG00000069122		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19030	protein-coding gene	gene with protein product						12435584	Standard	NM_001098518		Approved	DKFZp564O1923, KIAA0758	uc003oyo.3	Q8IZF2	OTTHUMG00000014793	ENST00000283296.7:c.651C>T	6.37:g.46849806G>A		Somatic		WXS	Illumina HiSeq	Phase_I	O94858|Q5TF06|Q6RGN2|Q86SP0|Q9Y3Z2	Silent	SNP	ENST00000283296.7	37	CCDS4919.1																																																																																				0.388	GPR116-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040806.2		NM_015234	
GSPT2	23708	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	51487802	51487802	+	Silent	SNP	C	C	T			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chrX:51487802C>T	ENST00000340438.4	+	1	1322	c.1080C>T	c.(1078-1080)atC>atT	p.I360I		NM_018094.4	NP_060564.2	Q8IYD1	ERF3B_HUMAN	G1 to S phase transition 2	360	tr-type G. {ECO:0000255|PROSITE- ProRule:PRU01059}.				cell cycle (GO:0007049)|cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational termination (GO:0006415)	cytosol (GO:0005829)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)	p.I360I(1)		breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	20	Ovarian(276;0.236)					ATTGGAGCATCGAGAGATATG	0.393																																																	1	Substitution - coding silent(1)	kidney(1)											66.0	61.0	63.0					X																	51487802		2203	4300	6503	SO:0001819	synonymous_variant	23708			AI285711	CCDS14336.1	Xp11.22	2008-05-14			ENSG00000189369	ENSG00000189369			4622	protein-coding gene	gene with protein product		300418				10575220	Standard	NM_018094		Approved	eRF3b, FLJ10441	uc004dpl.3	Q8IYD1	OTTHUMG00000021538	ENST00000340438.4:c.1080C>T	X.37:g.51487802C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q9H909|Q9NVY0|Q9NY44	Silent	SNP	ENST00000340438.4	37	CCDS14336.1																																																																																				0.393	GSPT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056587.1			
GUCY2F	2986	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	108708503	108708503	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chrX:108708503G>T	ENST00000218006.2	-	3	1191	c.900C>A	c.(898-900)aaC>aaA	p.N300K		NM_001522.2	NP_001513.2	P51841	GUC2F_HUMAN	guanylate cyclase 2F, retinal	300					intracellular signal transduction (GO:0035556)|phototransduction, visible light (GO:0007603)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|nuclear outer membrane (GO:0005640)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)	p.N300K(1)		breast(3)|central_nervous_system(2)|endometrium(5)|kidney(6)|large_intestine(14)|lung(33)|prostate(3)|skin(1)	67						GCTTTGGGTTGTTCCTTAGGA	0.478																																																	1	Substitution - Missense(1)	kidney(1)											142.0	120.0	128.0					X																	108708503		2203	4300	6503	SO:0001583	missense	2986			L37378	CCDS14545.1	Xq22	2008-08-01			ENSG00000101890	ENSG00000101890			4691	protein-coding gene	gene with protein product	"""guanylate cyclase 2D-like, membrane (retina-specific)"""	300041				8838319, 7777544	Standard	NM_001522		Approved	GUC2DL, GC-F, RetGC-2, ROS-GC2, CYGF	uc004eod.4	P51841	OTTHUMG00000022184	ENST00000218006.2:c.900C>A	X.37:g.108708503G>T	ENSP00000218006:p.Asn300Lys	Somatic		WXS	Illumina HiSeq	Phase_I	Q9UJF1	Missense_Mutation	SNP	ENST00000218006.2	37	CCDS14545.1	.	.	.	.	.	.	.	.	.	.	G	11.85	1.762083	0.31228	.	.	ENSG00000101890	ENST00000218006	D	0.83075	-1.68	3.94	-0.17	0.13335	Extracellular ligand-binding receptor (1);	0.276779	0.38897	N	0.001523	T	0.70430	0.3223	L	0.46157	1.445	0.36070	D	0.842083	B	0.24186	0.099	B	0.28011	0.085	T	0.55147	-0.8186	10	0.26408	T	0.33	.	1.4628	0.02399	0.2247:0.1726:0.4429:0.1598	.	300	P51841	GUC2F_HUMAN	K	300	ENSP00000218006:N300K	ENSP00000218006:N300K	N	-	3	2	GUCY2F	108595159	0.998000	0.40836	0.129000	0.21949	0.983000	0.72400	0.389000	0.20751	-0.179000	0.10654	-0.253000	0.11424	AAC		0.478	GUCY2F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057884.1		NM_001522	
HEMGN	55363	broad.mit.edu;ucsc.edu	37	9	100693156	100693156	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr9:100693156G>T	ENST00000259456.3	-	4	664	c.521C>A	c.(520-522)cCt>cAt	p.P174H		NM_018437.3|NM_197978.2	NP_060907.2|NP_932095.1	Q9BXL5	HEMGN_HUMAN	hemogen	174					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)	nucleus (GO:0005634)		p.P174H(1)		NS(1)|kidney(2)|large_intestine(5)|lung(15)|ovary(1)|skin(2)|urinary_tract(1)	27		Acute lymphoblastic leukemia(62;0.0559)				GTACATTTTAGGAGAGAGGTC	0.373																																																	1	Substitution - Missense(1)	kidney(1)											222.0	223.0	222.0					9																	100693156		2203	4300	6503	SO:0001583	missense	55363			AF228713	CCDS6731.1	9q22.33	2014-01-21			ENSG00000136929	ENSG00000136929			17509	protein-coding gene	gene with protein product		610715					Standard	NM_018437		Approved	EDAG, CT155, NDR	uc004axy.4	Q9BXL5	OTTHUMG00000020336	ENST00000259456.3:c.521C>A	9.37:g.100693156G>T	ENSP00000259456:p.Pro174His	Somatic		WXS	Illumina GAIIx	Phase_I	Q6XAR3|Q86XY5|Q9NPC0	Missense_Mutation	SNP	ENST00000259456.3	37	CCDS6731.1	.	.	.	.	.	.	.	.	.	.	G	15.35	2.807559	0.50421	.	.	ENSG00000136929	ENST00000375112;ENST00000259456	.	.	.	5.37	5.37	0.77165	.	0.129530	0.52532	D	0.000071	T	0.73265	0.3565	M	0.66939	2.045	0.36385	D	0.86213	D	0.89917	1.0	D	0.71870	0.975	T	0.79531	-0.1765	9	0.72032	D	0.01	-6.2927	15.05	0.71862	0.0:0.0:1.0:0.0	.	174	Q9BXL5	HEMGN_HUMAN	H	174	.	ENSP00000259456:P174H	P	-	2	0	HEMGN	99732977	0.999000	0.42202	0.602000	0.28890	0.077000	0.17291	3.610000	0.54125	2.718000	0.92993	0.586000	0.80456	CCT		0.373	HEMGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053344.2		NM_197978	
HERC1	8925	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	63948032	63948032	+	Silent	SNP	G	G	A			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr15:63948032G>A	ENST00000443617.2	-	50	10080	c.9993C>T	c.(9991-9993)aaC>aaT	p.N3331N		NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	3331					cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.N3331N(2)		NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						TTACAACAAAGTTTGGGGAGG	0.428																																																	2	Substitution - coding silent(2)	kidney(2)											61.0	55.0	57.0					15																	63948032		1849	4096	5945	SO:0001819	synonymous_variant	8925			U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.9993C>T	15.37:g.63948032G>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q8IW65	Silent	SNP	ENST00000443617.2	37	CCDS45277.1																																																																																				0.428	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418523.1		NM_003922	
HPS1	3257	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	100177390	100177390	+	Silent	SNP	G	G	A			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr10:100177390G>A	ENST00000325103.6	-	20	2267	c.2034C>T	c.(2032-2034)gaC>gaT	p.D678D	HPS1_ENST00000467246.1_5'UTR|HPS1_ENST00000361490.4_Silent_p.D678D|PYROXD2_ENST00000370575.4_5'Flank	NM_000195.3	NP_000186.2	Q92902	HPS1_HUMAN	Hermansky-Pudlak syndrome 1	678					blood coagulation (GO:0007596)|eye pigmentation (GO:0048069)|lysosome organization (GO:0007040)|melanocyte differentiation (GO:0030318)|positive regulation of natural killer cell activation (GO:0032816)|retina development in camera-type eye (GO:0060041)|secretion of lysosomal enzymes (GO:0033299)|visual perception (GO:0007601)	BLOC-3 complex (GO:0031085)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	protein dimerization activity (GO:0046983)	p.D678D(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(9)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	23		Colorectal(252;0.234)		Epithelial(162;3.87e-12)|all cancers(201;5.63e-10)		GCACCAGCAGGTCAGTGGGGA	0.667									Hermansky-Pudlak syndrome																																								1	Substitution - coding silent(1)	kidney(1)											50.0	47.0	48.0					10																	100177390		2203	4300	6503	SO:0001819	synonymous_variant	3257	Familial Cancer Database	HPS, HPS1-8	U79136	CCDS7475.1, CCDS7476.1	10q23.1-q23.3	2014-06-18		2002-05-01	ENSG00000107521	ENSG00000107521			5163	protein-coding gene	gene with protein product		604982	"""Hermansky-Pudlak syndrome"""	HPS		8541858, 7573033	Standard	NM_182639		Approved		uc021pwv.1	Q92902	OTTHUMG00000018876	ENST00000325103.6:c.2034C>T	10.37:g.100177390G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A8MRT2|O15402|O15502|Q5TAA3|Q8WXE5	Silent	SNP	ENST00000325103.6	37	CCDS7475.1																																																																																				0.667	HPS1-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049776.1		NM_000195, NM_182637, NM_182638, NM_182639	
HUWE1	10075	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	53675215	53675215	+	Silent	SNP	A	A	C			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chrX:53675215A>C	ENST00000342160.3	-	4	541	c.84T>G	c.(82-84)gtT>gtG	p.V28V	HUWE1_ENST00000218328.8_Silent_p.V28V|HUWE1_ENST00000262854.6_Silent_p.V28V			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	28					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)	p.V28V(2)		NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						CATCATTACAAACTTTGAGTT	0.398																																																	2	Substitution - coding silent(2)	kidney(2)											125.0	98.0	107.0					X																	53675215		2203	4300	6503	SO:0001819	synonymous_variant	10075			AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.84T>G	X.37:g.53675215A>C		Somatic		WXS	Illumina HiSeq	Phase_I	O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Silent	SNP	ENST00000342160.3	37	CCDS35301.1																																																																																				0.398	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056766.1		XM_497119	
ICA1	3382	broad.mit.edu;ucsc.edu	37	7	8178473	8178473	+	Missense_Mutation	SNP	C	C	G	rs143861719	byFrequency	TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr7:8178473C>G	ENST00000402384.3	-	12	1323	c.1057G>C	c.(1057-1059)Ggt>Cgt	p.G353R	ICA1_ENST00000422063.2_Missense_Mutation_p.G382R|ICA1_ENST00000265577.7_Missense_Mutation_p.G352R|ICA1_ENST00000406470.2_Missense_Mutation_p.G353R|ICA1_ENST00000401396.1_Missense_Mutation_p.G341R|ICA1_ENST00000396675.3_Missense_Mutation_p.G353R			Q05084	ICA69_HUMAN	islet cell autoantigen 1, 69kDa	353					neurotransmitter transport (GO:0006836)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|secretory granule membrane (GO:0030667)|synaptic vesicle membrane (GO:0030672)		p.G353R(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(8)|urinary_tract(1)	23		Ovarian(82;0.0612)		UCEC - Uterine corpus endometrioid carcinoma (126;0.246)		ATCTTACCACCTTCCTCAGAT	0.289																																																	1	Substitution - Missense(1)	kidney(1)						C	ARG/GLY,ARG/GLY,ARG/GLY	1,4401	2.1+/-5.4	0,1,2200	84.0	96.0	92.0		1057,1057,1057	2.8	1.0	7	dbSNP_134	92	10,8584	7.7+/-29.5	0,10,4287	yes	missense,missense,missense	ICA1	NM_001136020.1,NM_004968.2,NM_022307.2	125,125,125	0,11,6487	GG,GC,CC		0.1164,0.0227,0.0846	possibly-damaging,possibly-damaging,possibly-damaging	353/484,353/484,353/484	8178473	11,12985	2201	4297	6498	SO:0001583	missense	3382				CCDS34602.1, CCDS64595.1	7p22	2006-12-13	2002-08-29		ENSG00000003147	ENSG00000003147			5343	protein-coding gene	gene with protein product		147625	"""islet cell autoantigen 1 (69kD)"""			7918678, 8777998	Standard	NM_001276478		Approved	ICAp69	uc003srm.3	Q05084	OTTHUMG00000152008	ENST00000402384.3:c.1057G>C	7.37:g.8178473C>G	ENSP00000385570:p.Gly353Arg	Somatic		WXS	Illumina GAIIx	Phase_I	A8K7U1|B3FTQ2|P78506|Q13824|Q96HG3	Missense_Mutation	SNP	ENST00000402384.3	37	CCDS34602.1	.	.	.	.	.	.	.	.	.	.	C	8.070	0.770065	0.15983	2.27E-4	0.001164	ENSG00000003147	ENST00000402384;ENST00000406470;ENST00000265577;ENST00000396675;ENST00000401396;ENST00000422063	.	.	.	4.65	2.85	0.33270	Islet cell autoantigen Ica1, C-terminal (1);	0.735454	0.13439	N	0.387857	T	0.22627	0.0546	N	0.22421	0.69	0.26223	N	0.97913	B;P;P;B	0.34864	0.029;0.473;0.473;0.395	B;B;B;B	0.38106	0.055;0.265;0.265;0.229	T	0.13953	-1.0490	9	0.17369	T	0.5	.	5.8911	0.18913	0.0:0.7301:0.0:0.2699	.	382;352;353;341	B3FTQ2;Q96HG3;Q05084;E9PDL4	.;.;ICA69_HUMAN;.	R	353;353;352;353;341;382	.	ENSP00000265577:G352R	G	-	1	0	ICA1	8144998	1.000000	0.71417	1.000000	0.80357	0.758000	0.43043	1.412000	0.34714	1.343000	0.45638	-0.119000	0.15052	GGT		0.289	ICA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000324793.1		NM_004968	
INTS6	26512	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	13	51948840	51948840	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr13:51948840G>A	ENST00000311234.4	-	14	2294	c.1822C>T	c.(1822-1824)Cag>Tag	p.Q608*	INTS6_ENST00000398119.2_Nonsense_Mutation_p.Q595*|INTS6_ENST00000490542.1_Nonsense_Mutation_p.Q292*|INTS6_ENST00000463928.1_Intron|INTS6_ENST00000497989.1_Nonsense_Mutation_p.Q430*|INTS6_ENST00000425000.1_Nonsense_Mutation_p.Q176*	NM_012141.2	NP_036273.1	Q9UL03	INT6_HUMAN	integrator complex subunit 6	608					signal transduction (GO:0007165)|snRNA processing (GO:0016180)	actin cytoskeleton (GO:0015629)|integrator complex (GO:0032039)|nucleus (GO:0005634)	transmembrane signaling receptor activity (GO:0004888)	p.Q608*(1)		NS(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(10)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31		Breast(56;0.000286)|Lung NSC(96;0.00145)|Prostate(109;0.00403)|Hepatocellular(98;0.065)|Myeloproliferative disorder(33;0.163)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;7.7e-08)		CTTCGTGGCTGATCAGGATCA	0.398																																																	1	Substitution - Nonsense(1)	kidney(1)											123.0	103.0	110.0					13																	51948840		2203	4300	6503	SO:0001587	stop_gained	26512			AF097645	CCDS9428.1, CCDS41890.1, CCDS45048.1	13q14.3	2010-08-20	2006-03-15	2006-03-15	ENSG00000102786	ENSG00000102786		"""DEAD-boxes"""	14879	protein-coding gene	gene with protein product		604331	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 26"""	DDX26		10467397, 16239144	Standard	XM_005266340		Approved	DICE1, HDB, Notchl2, DBI-1, DDX26A, INT6	uc001vfk.3	Q9UL03	OTTHUMG00000016945	ENST00000311234.4:c.1822C>T	13.37:g.51948840G>A	ENSP00000310260:p.Gln608*	Somatic		WXS	Illumina HiSeq	Phase_I	Q0P664|Q6PJP4|Q9UFK0|Q9Y5M9	Nonsense_Mutation	SNP	ENST00000311234.4	37	CCDS9428.1	.	.	.	.	.	.	.	.	.	.	G	51	17.389210	0.99885	.	.	ENSG00000102786	ENST00000311234;ENST00000398119;ENST00000497989;ENST00000425000;ENST00000490542	.	.	.	5.04	5.04	0.67666	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.13108	T	0.6	-7.1073	17.7319	0.88380	0.0:0.0:1.0:0.0	.	.	.	.	X	608;595;430;176;292	.	ENSP00000310260:Q608X	Q	-	1	0	INTS6	50846841	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	9.734000	0.98822	2.503000	0.84419	0.467000	0.42956	CAG		0.398	INTS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045023.1		NM_012141	
ITPRIPL1	150771	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	96992895	96992895	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr2:96992895G>T	ENST00000439118.2	+	3	777	c.526G>T	c.(526-528)Gtc>Ttc	p.V176F	ITPRIPL1_ENST00000361124.4_Missense_Mutation_p.V184F|ITPRIPL1_ENST00000542887.1_Missense_Mutation_p.V168F|ITPRIPL1_ENST00000536814.1_Missense_Mutation_p.V168F	NM_001008949.2	NP_001008949.1	Q6GPH6	IPIL1_HUMAN	inositol 1,4,5-trisphosphate receptor interacting protein-like 1	176						integral component of membrane (GO:0016021)|membrane (GO:0016020)		p.V184F(1)		breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(7)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						CAAACACTATGTCCAAAATGC	0.552																																																	1	Substitution - Missense(1)	kidney(1)											112.0	109.0	110.0					2																	96992895		2203	4300	6503	SO:0001583	missense	150771				CCDS33250.1, CCDS46360.1, CCDS54378.1	2q11.2	2011-04-28	2011-04-28	2008-08-11	ENSG00000198885	ENSG00000198885			29371	protein-coding gene	gene with protein product			"""KIAA1754-like"", ""inositol 1,4,5-triphosphate receptor interacting protein-like 1"""	KIAA1754L		12477932	Standard	NM_178495		Approved		uc010yul.2	Q6GPH6	OTTHUMG00000155230	ENST00000439118.2:c.526G>T	2.37:g.96992895G>T	ENSP00000389308:p.Val176Phe	Somatic		WXS	Illumina HiSeq	Phase_I	F5H1L8|Q8NE61	Missense_Mutation	SNP	ENST00000439118.2	37	CCDS46360.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	7.172|7.172	0.587775|0.587775	0.13812|0.13812	.|.	.|.	ENSG00000198885|ENSG00000198885	ENST00000420728|ENST00000420176;ENST00000536814;ENST00000439118;ENST00000361124;ENST00000542887	.|T;T;T;T	.|0.20881	.|2.05;2.05;2.04;2.05	5.08|5.08	-2.39|-2.39	0.06602|0.06602	.|.	.|0.415651	.|0.17503	.|N	.|0.171918	T|T	0.08492|0.08492	0.0211|0.0211	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	0.999993|0.999993	.|B;B	.|0.31859	.|0.343;0.232	.|B;B	.|0.29942	.|0.109;0.051	T|T	0.23904|0.23904	-1.0175|-1.0175	5|10	.|0.46703	.|T	.|0.11	-0.0573|-0.0573	7.8614|7.8614	0.29511|0.29511	0.4971:0.1173:0.3856:0.0|0.4971:0.1173:0.3856:0.0	.|.	.|184;176	.|Q6GPH6-2;Q6GPH6	.|.;IPIL1_HUMAN	I|F	207|168;168;176;184;168	.|ENSP00000439566:V168F;ENSP00000389308:V176F;ENSP00000355121:V184F;ENSP00000438212:V168F	.|ENSP00000355121:V184F	M|V	+|+	3|1	0|0	ITPRIPL1|ITPRIPL1	96356622|96356622	0.326000|0.326000	0.24669|0.24669	0.026000|0.026000	0.17262|0.17262	0.796000|0.796000	0.44982|0.44982	0.661000|0.661000	0.25023|0.25023	-0.312000|-0.312000	0.08741|0.08741	-0.793000|-0.793000	0.03317|0.03317	ATG|GTC		0.552	ITPRIPL1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000338896.1		NM_178495	
JMJD1C	221037	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	64957276	64957276	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr10:64957276C>T	ENST00000399262.2	-	13	5757	c.5539G>A	c.(5539-5541)Gat>Aat	p.D1847N	JMJD1C_ENST00000542921.1_Missense_Mutation_p.D1665N|JMJD1C_ENST00000399251.1_3'UTR|JMJD1C_ENST00000402544.1_Missense_Mutation_p.D1628N	NM_032776.1	NP_116165.1	Q15652	JHD2C_HUMAN	jumonji domain containing 1C	1847					blood coagulation (GO:0007596)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleoplasm (GO:0005654)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)|thyroid hormone receptor binding (GO:0046966)	p.D1847N(1)|p.D1628N(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(9)|lung(27)|ovary(6)|prostate(4)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	77	Prostate(12;0.0119)|all_hematologic(501;0.191)					TCACATGCATCACACATCTCC	0.403																																																	2	Substitution - Missense(2)	kidney(2)											131.0	121.0	124.0					10																	64957276		1931	4162	6093	SO:0001583	missense	221037			L40411	CCDS41532.1, CCDS60538.1	10q22.1	2011-05-25	2004-03-31	2004-04-01	ENSG00000171988	ENSG00000171988			12313	protein-coding gene	gene with protein product		604503	"""thyroid hormone receptor interactor 8"""	TRIP8		7776974	Standard	XM_005269624		Approved	DKFZp761F0118, KIAA1380, FLJ14374	uc001jmn.3	Q15652	OTTHUMG00000018311	ENST00000399262.2:c.5539G>A	10.37:g.64957276C>T	ENSP00000382204:p.Asp1847Asn	Somatic		WXS	Illumina HiSeq	Phase_I	A0T124|Q5SQZ8|Q5SQZ9|Q5SR00|Q7Z3E7|Q8N3U0|Q96KB9|Q9P2G7	Missense_Mutation	SNP	ENST00000399262.2	37	CCDS41532.1	.	.	.	.	.	.	.	.	.	.	C	36	5.690573	0.96793	.	.	ENSG00000171988	ENST00000399262;ENST00000402544;ENST00000542921	D;T;T	0.88896	-2.44;-0.97;-0.66	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	D	0.95159	0.8431	M	0.82823	2.61	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.998;0.998;1.0	D	0.95006	0.8147	10	0.72032	D	0.01	-21.3799	20.1041	0.97884	0.0:1.0:0.0:0.0	.	1388;1847;1665	A6PW35;Q15652;A0T124	.;JHD2C_HUMAN;.	N	1847;1628;1665	ENSP00000382204:D1847N;ENSP00000384990:D1628N;ENSP00000444682:D1665N	ENSP00000382204:D1847N	D	-	1	0	JMJD1C	64627282	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.750000	0.85110	2.826000	0.97356	0.655000	0.94253	GAT		0.403	JMJD1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048249.2		NM_004241	
KBTBD2	25948	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	32909021	32909021	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr7:32909021A>G	ENST00000304056.4	-	4	2507	c.1808T>C	c.(1807-1809)tTt>tCt	p.F603S	AVL9_ENST00000404479.1_Intron|KBTBD2_ENST00000485611.1_5'Flank	NM_015483.2	NP_056298.2	Q8IY47	KBTB2_HUMAN	kelch repeat and BTB (POZ) domain containing 2	603								p.F603S(1)		endometrium(3)|kidney(3)|large_intestine(3)|lung(7)|urinary_tract(1)	17			GBM - Glioblastoma multiforme(11;0.0499)			ATCCGTTGAAAAAAGATAAGT	0.483																																																	1	Substitution - Missense(1)	kidney(1)											108.0	103.0	104.0					7																	32909021		2203	4300	6503	SO:0001583	missense	25948			AB040922	CCDS34614.1	7p14.3	2013-01-08	2003-12-12	2003-12-12	ENSG00000170852	ENSG00000170852		"""BTB/POZ domain containing"""	21751	protein-coding gene	gene with protein product			"""BTB and kelch domain containing 1"""	BKLHD1		10819331	Standard	NM_015483		Approved	DKFZP566C134	uc003tdb.2	Q8IY47	OTTHUMG00000152984	ENST00000304056.4:c.1808T>C	7.37:g.32909021A>G	ENSP00000302586:p.Phe603Ser	Somatic		WXS	Illumina HiSeq	Phase_I	A8K9T7|Q86Y62|Q9P239|Q9UFM7|Q9Y382	Missense_Mutation	SNP	ENST00000304056.4	37	CCDS34614.1	.	.	.	.	.	.	.	.	.	.	A	15.76	2.928313	0.52759	.	.	ENSG00000170852	ENST00000304056	T	0.68624	-0.34	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	T	0.53318	0.1789	N	0.24115	0.695	0.54753	D	0.999983	P	0.34724	0.465	B	0.30646	0.118	T	0.59994	-0.7349	10	0.87932	D	0	.	15.4431	0.75204	1.0:0.0:0.0:0.0	.	603	Q8IY47	KBTB2_HUMAN	S	603	ENSP00000302586:F603S	ENSP00000302586:F603S	F	-	2	0	KBTBD2	32875546	1.000000	0.71417	0.997000	0.53966	0.937000	0.57800	9.339000	0.96797	2.064000	0.61679	0.482000	0.46254	TTT		0.483	KBTBD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328890.1		XM_291224	
KDM5B	10765	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	202743819	202743819	+	Missense_Mutation	SNP	C	C	G			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr1:202743819C>G	ENST00000367265.3	-	3	1491	c.327G>C	c.(325-327)aaG>aaC	p.K109N	KDM5B_ENST00000367264.2_Missense_Mutation_p.K109N	NM_006618.3	NP_006609.3	Q9UGL1	KDM5B_HUMAN	lysine (K)-specific demethylase 5B	109	ARID. {ECO:0000255|PROSITE- ProRule:PRU00355}.				histone H3-K4 demethylation (GO:0034720)|histone H3-K4 demethylation, trimethyl-H3-K4-specific (GO:0034721)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-dimethyl-K4 specific) (GO:0034648)|histone demethylase activity (H3-trimethyl-K4 specific) (GO:0034647)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.K109N(1)		breast(2)|ovary(2)|skin(1)|urinary_tract(1)	6						ACTCCCAGTACTTTGCAATCT	0.358																																																	1	Substitution - Missense(1)	kidney(1)											86.0	87.0	86.0					1																	202743819		2203	4300	6503	SO:0001583	missense	10765			AJ243706	CCDS30974.1	1q32.1	2014-06-12	2009-04-06	2009-04-06	ENSG00000117139	ENSG00000117139		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	18039	protein-coding gene	gene with protein product	"""cancer/testis antigen 31"", ""protein phosphatase 1, regulatory subunit 98"""	605393	"""Jumonji, AT rich interactive domain 1B (RBP2-like)"", ""jumonji, AT rich interactive domain 1B"""	JARID1B		11483573, 11478881	Standard	NM_006618		Approved	RBBP2H1A, PLU-1, CT31, PPP1R98	uc001gyf.3	Q9UGL1	OTTHUMG00000041401	ENST00000367265.3:c.327G>C	1.37:g.202743819C>G	ENSP00000356234:p.Lys109Asn	Somatic		WXS	Illumina HiSeq	Phase_I	O95811|Q15752|Q9Y3Q5	Missense_Mutation	SNP	ENST00000367265.3	37	CCDS30974.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.079852	0.76528	.	.	ENSG00000117139	ENST00000367265;ENST00000367264	T;T	0.64803	-0.12;-0.12	5.36	3.46	0.39613	ARID/BRIGHT DNA-binding domain (5);	0.000000	0.85682	D	0.000000	T	0.76011	0.3928	M	0.77103	2.36	0.58432	D	0.999998	D;D	0.89917	1.0;0.962	D;D	0.87578	0.998;0.943	T	0.77958	-0.2392	10	0.87932	D	0	-27.6879	9.6274	0.39759	0.0:0.7983:0.0:0.2017	.	109;109	Q9UGL1-2;Q9UGL1	.;KDM5B_HUMAN	N	109	ENSP00000356234:K109N;ENSP00000356233:K109N	ENSP00000356233:K109N	K	-	3	2	KDM5B	201010442	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	1.992000	0.40737	2.504000	0.84457	0.557000	0.71058	AAG		0.358	KDM5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000099184.2		NM_006618	
GPALPP1	55425	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	13	45578485	45578485	+	Missense_Mutation	SNP	A	A	C			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr13:45578485A>C	ENST00000379151.4	+	2	237	c.134A>C	c.(133-135)gAt>gCt	p.D45A	RP11-321C24.1_ENST00000437748.2_lincRNA|GPALPP1_ENST00000357537.3_5'Flank|GPALPP1_ENST00000361121.2_Missense_Mutation_p.D45A|RN7SL49P_ENST00000581392.1_RNA	NM_018559.2	NP_061029.2	Q8IXQ4	GPAM1_HUMAN	GPALPP motifs containing 1	45	Poly-Ser.							p.D45A(1)									AGTAGTTCAGATTCATCAGAC	0.408																																																	1	Substitution - Missense(1)	kidney(1)											113.0	110.0	111.0					13																	45578485		2203	4300	6503	SO:0001583	missense	55425			AB051491	CCDS9394.1	13q14.12	2013-08-13	2013-08-12	2013-08-12	ENSG00000133114	ENSG00000133114			20298	protein-coding gene	gene with protein product			"""KIAA1704"""	KIAA1704		11214970	Standard	NM_018559		Approved	bA245H20.2, AD029, LSR7	uc001uzq.3	Q8IXQ4	OTTHUMG00000016841	ENST00000379151.4:c.134A>C	13.37:g.45578485A>C	ENSP00000368447:p.Asp45Ala	Somatic		WXS	Illumina HiSeq	Phase_I	A8K8X8|Q05BX8|Q05D87|Q5T3Z3|Q5T3Z5|Q9C0F9|Q9H2R0|Q9P0W6	Missense_Mutation	SNP	ENST00000379151.4	37	CCDS9394.1	.	.	.	.	.	.	.	.	.	.	A	13.39	2.221607	0.39300	.	.	ENSG00000133114	ENST00000379151;ENST00000361121	.	.	.	5.61	4.44	0.53790	.	0.732918	0.13551	N	0.379483	T	0.43144	0.1234	L	0.52573	1.65	0.31686	N	0.642495	B	0.13145	0.007	B	0.17979	0.02	T	0.44997	-0.9291	9	0.09843	T	0.71	1.7153	8.9445	0.35751	0.9157:0.0:0.0843:0.0	.	45	Q8IXQ4	K1704_HUMAN	A	45	.	ENSP00000355211:D45A	D	+	2	0	KIAA1704	44476485	0.996000	0.38824	0.703000	0.30354	0.833000	0.47200	3.357000	0.52277	0.967000	0.38186	0.477000	0.44152	GAT		0.408	GPALPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044749.2		NM_018559	
KRT24	192666	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	38859817	38859817	+	Silent	SNP	G	G	A			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr17:38859817G>A	ENST00000264651.2	-	1	185	c.129C>T	c.(127-129)ttC>ttT	p.F43F		NM_019016.2	NP_061889.2	Q2M2I5	K1C24_HUMAN	keratin 24	43	Gly-rich.|Head.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)	structural molecule activity (GO:0005198)	p.F43F(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Breast(137;0.00526)				CTCCTCCTCGGAAGCCCTGGG	0.652																																					GBM(61;380 1051 14702 23642 31441)												1	Substitution - coding silent(1)	kidney(1)											37.0	42.0	40.0					17																	38859817		2203	4300	6503	SO:0001819	synonymous_variant	192666				CCDS11372.1	17q21.2	2013-06-25			ENSG00000167916	ENSG00000167916		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	18527	protein-coding gene	gene with protein product		607742				16831889	Standard	NM_019016		Approved	FLJ20261, MGC138169, MGC138173	uc002hvd.3	Q2M2I5	OTTHUMG00000133372	ENST00000264651.2:c.129C>T	17.37:g.38859817G>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q9NXG7	Silent	SNP	ENST00000264651.2	37	CCDS11372.1																																																																																				0.652	KRT24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257217.1		NM_019016	
KRTAP13-4	284827	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	21	31802847	31802847	+	Missense_Mutation	SNP	T	T	G			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr21:31802847T>G	ENST00000334068.2	+	1	276	c.254T>G	c.(253-255)cTa>cGa	p.L85R		NM_181600.1	NP_853631.1	Q3LI77	KR134_HUMAN	keratin associated protein 13-4	85	4 X 10 AA approximate repeats.					intermediate filament (GO:0005882)		p.L85R(1)		NS(1)|breast(1)|kidney(1)|large_intestine(2)|lung(9)|skin(1)	15						TCTGGATCTCTAGGCTTTCGG	0.577																																					NSCLC(196;2401 3038 18004 35753)												1	Substitution - Missense(1)	kidney(1)											83.0	73.0	77.0					21																	31802847		2203	4300	6503	SO:0001583	missense	284827			AP001708	CCDS13592.1	21q22.1	2006-03-13			ENSG00000186971	ENSG00000186971		"""Keratin associated proteins"""	18926	protein-coding gene	gene with protein product						12359730	Standard	NM_181600		Approved	KAP13.4	uc011acw.2	Q3LI77	OTTHUMG00000057770	ENST00000334068.2:c.254T>G	21.37:g.31802847T>G	ENSP00000334834:p.Leu85Arg	Somatic		WXS	Illumina HiSeq	Phase_I	A2RRL3	Missense_Mutation	SNP	ENST00000334068.2	37	CCDS13592.1	.	.	.	.	.	.	.	.	.	.	-	14.57	2.573753	0.45902	.	.	ENSG00000186971	ENST00000334068	T	0.03717	3.83	4.91	2.51	0.30379	.	1.647800	0.04183	N	0.326869	T	0.08980	0.0222	M	0.78344	2.41	0.09310	N	1	P	0.39157	0.662	B	0.42112	0.376	T	0.31779	-0.9931	10	0.49607	T	0.09	.	4.3345	0.11080	0.0:0.1025:0.2063:0.6913	.	85	Q3LI77	KR134_HUMAN	R	85	ENSP00000334834:L85R	ENSP00000334834:L85R	L	+	2	0	KRTAP13-4	30724718	0.001000	0.12720	0.123000	0.21794	0.060000	0.15804	0.640000	0.24705	0.921000	0.36994	0.524000	0.50904	CTA		0.577	KRTAP13-4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128222.1			
LIAS	11019	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	39472863	39472863	+	Silent	SNP	T	T	C			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr4:39472863T>C	ENST00000513731.1	+	5	553	c.501T>C	c.(499-501)cgT>cgC	p.R167R	LIAS_ENST00000381846.1_Silent_p.R254R|LIAS_ENST00000261434.3_Silent_p.R297R|LIAS_ENST00000340169.2_Silent_p.R297R					lipoic acid synthetase									p.R297R(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(2)|ovary(2)	12						CAGCACTTCGTGAGGCAGATG	0.333																																																	1	Substitution - coding silent(1)	kidney(1)											123.0	114.0	117.0					4																	39472863		2203	4300	6503	SO:0001819	synonymous_variant	11019			AJ224162	CCDS3453.1, CCDS3454.1, CCDS63950.1	4p14	2008-02-05			ENSG00000121897	ENSG00000121897			16429	protein-coding gene	gene with protein product		607031				11124703	Standard	NM_006859		Approved	LAS	uc003guf.3	O43766	OTTHUMG00000099369	ENST00000513731.1:c.501T>C	4.37:g.39472863T>C		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000513731.1	37																																																																																					0.333	LIAS-006	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000361037.1		NM_194451	
Unknown	0	broad.mit.edu	37	5	99715528	99715528	+	IGR	SNP	C	C	T			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr5:99715528C>T								RNU6-1119P (226045 upstream) : RP11-346J10.1 (21616 downstream)																							AGCGGACAGTCGAAGCCCTTC	0.607																																																	0																																										SO:0001628	intergenic_variant	100133050																															5.37:g.99715528C>T		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP		37																																																																																				0	0.607									
Unknown	0	broad.mit.edu	37	13	19414102	19414102	+	IGR	SNP	C	C	T			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr13:19414102C>T								LINC00418 (120233 upstream) : RP11-38M15.11 (19864 downstream)																							GAATTTTTACCAAAGATTGAT	0.274																																																	0																																										SO:0001628	intergenic_variant	0																															13.37:g.19414102C>T		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP		37																																																																																				0	0.274									
LRRC37BP1	147172	broad.mit.edu	37	17	28961189	28961189	+	RNA	DEL	A	A	-			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr17:28961189delA	ENST00000417404.1	+	0	1447									leucine rich repeat containing 37B pseudogene 1																		CCACAAACTGAAAACCAACGT	0.323																																																	0																																												0			BC118647		17q11.2	2012-10-05	2010-08-16	2010-08-16	ENSG00000250462	ENSG00000250462			25390	pseudogene	pseudogene			"""leucine rich repeat containing 37, member B2"""	LRRC37B2			Standard	NR_015341		Approved	DKFZp667M2411	uc010csj.3		OTTHUMG00000132795		17.37:g.28961189delA		Somatic		WXS	Illumina GAIIx	Phase_I		Frame_Shift_Del	DEL	ENST00000417404.1	37																																																																																					0.323	LRRC37BP1-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000256203.1		NR_015341	
MAP3K5	4217	hgsc.bcm.edu;ucsc.edu	37	6	137015318	137015319	+	Frame_Shift_Ins	INS	-	-	A			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr6:137015318_137015319insA	ENST00000359015.4	-	7	1572_1573	c.1212_1213insT	c.(1210-1215)tctaatfs	p.N405fs		NM_005923.3	NP_005914.1	Q99683	M3K5_HUMAN	mitogen-activated protein kinase kinase kinase 5	405					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of JUN kinase activity (GO:0007257)|activation of MAPKK activity (GO:0000186)|apoptotic signaling pathway (GO:0097190)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to reactive nitrogen species (GO:1902170)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|JNK cascade (GO:0007254)|MAPK cascade (GO:0000165)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of neuron death (GO:1901216)|programmed necrotic cell death (GO:0097300)|protein phosphorylation (GO:0006468)|response to ischemia (GO:0002931)|viral process (GO:0016032)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|protein kinase complex (GO:1902911)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein phosphatase binding (GO:0019903)			NS(1)|breast(1)|cervix(1)|endometrium(8)|kidney(6)|large_intestine(6)|lung(24)|ovary(2)|prostate(1)|skin(4)|urinary_tract(4)	58	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00137)|OV - Ovarian serous cystadenocarcinoma(155;0.00569)		TCCGTGAAATTAGAGTCCAAAA	0.361																																																	0																																										SO:0001589	frameshift_variant	4217			U67156	CCDS5179.1	6q22.33	2011-06-09			ENSG00000197442	ENSG00000197442		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6857	protein-coding gene	gene with protein product	"""apoptosis signal regulating kinase 1"""	602448		MEKK5		9465908	Standard	NM_005923		Approved	MAPKKK5, ASK1	uc003qhc.3	Q99683	OTTHUMG00000015647	ENST00000359015.4:c.1213dupT	6.37:g.137015319_137015319dupA	ENSP00000351908:p.Asn405fs	Somatic		WXS	Illumina HiSeq	Phase_I	A6NIA0|B4DGB2|Q5THN3|Q99461	Frame_Shift_Del	INS	ENST00000359015.4	37	CCDS5179.1																																																																																				0.361	MAP3K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042383.1			
KMT2E	55904	hgsc.bcm.edu;ucsc.edu	37	7	104748211	104748211	+	Frame_Shift_Del	DEL	G	G	-			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr7:104748211delG	ENST00000311117.3	+	22	3852	c.3307delG	c.(3307-3309)gagfs	p.E1103fs	KMT2E_ENST00000334877.4_Frame_Shift_Del_p.E1103fs|KMT2E_ENST00000257745.4_Frame_Shift_Del_p.E1103fs|KMT2E_ENST00000334914.7_Frame_Shift_Del_p.E158fs|SRPK2_ENST00000493638.1_5'Flank|CTB-152G17.6_ENST00000607968.1_RNA	NM_182931.2	NP_891847.1	Q8IZD2	KMT2E_HUMAN	lysine (K)-specific methyltransferase 2E	1103					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|DNA methylation (GO:0006306)|erythrocyte differentiation (GO:0030218)|histone H3-K4 methylation (GO:0051568)|neutrophil activation (GO:0042119)|neutrophil mediated immunity (GO:0002446)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of transcription, DNA-templated (GO:0045893)|retinoic acid receptor signaling pathway (GO:0048384)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|MLL5-L complex (GO:0070688)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)	p.E1103Q(1)									CCGAATAAGTGAGTCAAAGTG	0.488																																																	1	Substitution - Missense(1)	NS(1)											93.0	90.0	91.0					7																	104748211		2203	4300	6503	SO:0001589	frameshift_variant	55904			AF067804	CCDS34723.1	7q22.1	2013-05-09	2013-05-09	2013-05-09	ENSG00000005483	ENSG00000005483		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	18541	protein-coding gene	gene with protein product		608444	"""myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila)"""	MLL5		9218106, 7672722	Standard	XM_005250493		Approved	HDCMC04P		Q8IZD2	OTTHUMG00000157403	ENST00000311117.3:c.3307delG	7.37:g.104748211delG	ENSP00000312379:p.Glu1103fs	Somatic		WXS	Illumina HiSeq	Phase_I	B6ZDE4|B6ZDM3|M4K8J3|Q6P5Y2|Q6PKG4|Q6T316|Q86TI3|Q86W12|Q86WG0|Q86WL2|Q8IV78|Q8IWR5|Q8NFF8|Q9NWE7	Frame_Shift_Del	DEL	ENST00000311117.3	37	CCDS34723.1																																																																																				0.488	KMT2E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348697.1			
KMT2E	55904	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	104752966	104752966	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr7:104752966A>G	ENST00000311117.3	+	27	5308	c.4763A>G	c.(4762-4764)cAa>cGa	p.Q1588R	KMT2E_ENST00000334877.4_Missense_Mutation_p.Q1546R|KMT2E_ENST00000257745.4_Missense_Mutation_p.Q1588R|SRPK2_ENST00000493638.1_Intron	NM_182931.2	NP_891847.1	Q8IZD2	KMT2E_HUMAN	lysine (K)-specific methyltransferase 2E	1588	Pro-rich. {ECO:0000255}.				cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|DNA methylation (GO:0006306)|erythrocyte differentiation (GO:0030218)|histone H3-K4 methylation (GO:0051568)|neutrophil activation (GO:0042119)|neutrophil mediated immunity (GO:0002446)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of transcription, DNA-templated (GO:0045893)|retinoic acid receptor signaling pathway (GO:0048384)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|MLL5-L complex (GO:0070688)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)	p.Q1588R(1)									GGACCAAATCAAGCACTTCCT	0.448																																																	1	Substitution - Missense(1)	kidney(1)											137.0	128.0	131.0					7																	104752966		2203	4300	6503	SO:0001583	missense	55904			AF067804	CCDS34723.1	7q22.1	2013-05-09	2013-05-09	2013-05-09	ENSG00000005483	ENSG00000005483		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	18541	protein-coding gene	gene with protein product		608444	"""myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila)"""	MLL5		9218106, 7672722	Standard	XM_005250493		Approved	HDCMC04P		Q8IZD2	OTTHUMG00000157403	ENST00000311117.3:c.4763A>G	7.37:g.104752966A>G	ENSP00000312379:p.Gln1588Arg	Somatic		WXS	Illumina HiSeq	Phase_I	B6ZDE4|B6ZDM3|M4K8J3|Q6P5Y2|Q6PKG4|Q6T316|Q86TI3|Q86W12|Q86WG0|Q86WL2|Q8IV78|Q8IWR5|Q8NFF8|Q9NWE7	Missense_Mutation	SNP	ENST00000311117.3	37	CCDS34723.1	.	.	.	.	.	.	.	.	.	.	A	9.860	1.196049	0.22037	.	.	ENSG00000005483	ENST00000311117;ENST00000334877;ENST00000351043;ENST00000257745	D;D;D	0.93307	-3.2;-3.17;-3.2	3.34	2.1	0.27182	.	0.168583	0.28082	N	0.016670	D	0.91476	0.7309	N	0.24115	0.695	0.80722	D	1	D;D	0.61697	0.99;0.967	P;P	0.62382	0.782;0.901	D	0.87681	0.2547	10	0.33940	T	0.23	.	9.4369	0.38643	0.8202:0.1798:0.0:0.0	.	1508;1588	F8W6H1;Q8IZD2	.;MLL5_HUMAN	R	1588;1546;1508;1588	ENSP00000312379:Q1588R;ENSP00000335599:Q1546R;ENSP00000257745:Q1588R	ENSP00000257745:Q1588R	Q	+	2	0	MLL5	104540202	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	1.958000	0.40402	0.277000	0.22141	0.254000	0.18369	CAA		0.448	KMT2E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348697.1			
NBEA	26960	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	13	35747666	35747668	+	In_Frame_Del	DEL	TCT	TCT	-			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	TCT	TCT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr13:35747666_35747668delTCT	ENST00000400445.3	+	27	5023_5025	c.4489_4491delTCT	c.(4489-4491)tctdel	p.S1498del	NBEA_ENST00000540320.1_In_Frame_Del_p.S1498del|NBEA_ENST00000379939.2_In_Frame_Del_p.S1495del|NBEA_ENST00000310336.4_In_Frame_Del_p.S1498del	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	1498					protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)				NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		GGGAAATAAATCTTCCCATGGAA	0.35																																																	0																																										SO:0001651	inframe_deletion	26960			AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.4489_4491delTCT	13.37:g.35747666_35747668delTCT	ENSP00000383295:p.Ser1498del	Somatic		WXS	Illumina HiSeq	Phase_I	B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	In_Frame_Del	DEL	ENST00000400445.3	37	CCDS45026.1																																																																																				0.350	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			NM_015678	
NEDD4	4734	broad.mit.edu;ucsc.edu	37	15	56140568	56140568	+	Splice_Site	DEL	A	A	-			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr15:56140568delA	ENST00000508342.1	-	13	3099		c.e13+1		NEDD4_ENST00000435532.3_Splice_Site|NEDD4_ENST00000506154.1_Splice_Site|NEDD4_ENST00000338963.2_Splice_Site	NM_001284338.1	NP_001271267.1	P46934	NEDD4_HUMAN	neural precursor cell expressed, developmentally down-regulated 4, E3 ubiquitin protein ligase						adaptive immune response (GO:0002250)|blood vessel morphogenesis (GO:0048514)|cellular response to UV (GO:0034644)|cytokine-mediated signaling pathway (GO:0019221)|development involved in symbiotic interaction (GO:0044111)|endocardial cushion development (GO:0003197)|glucocorticoid receptor signaling pathway (GO:0042921)|lysosomal transport (GO:0007041)|negative regulation of sodium ion transport (GO:0010766)|negative regulation of transcription from RNA polymerase II promoter in response to UV-induced DNA damage (GO:0010768)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|neuromuscular junction development (GO:0007528)|neuron projection development (GO:0031175)|outflow tract morphogenesis (GO:0003151)|positive regulation of nucleocytoplasmic transport (GO:0046824)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein catabolic process (GO:0045732)|progesterone receptor signaling pathway (GO:0050847)|protein K63-linked ubiquitination (GO:0070534)|protein monoubiquitination (GO:0006513)|protein targeting to lysosome (GO:0006622)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|receptor catabolic process (GO:0032801)|receptor internalization (GO:0031623)|regulation of dendrite morphogenesis (GO:0048814)|regulation of ion transmembrane transport (GO:0034765)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|regulation of synapse organization (GO:0050807)|response to calcium ion (GO:0051592)|T cell activation (GO:0042110)|transmission of virus (GO:0019089)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	apicolateral plasma membrane (GO:0016327)|cell cortex (GO:0005938)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	beta-2 adrenergic receptor binding (GO:0031698)|ligase activity (GO:0016874)|phosphoserine binding (GO:0050815)|phosphothreonine binding (GO:0050816)|proline-rich region binding (GO:0070064)|protein domain specific binding (GO:0019904)|RNA polymerase binding (GO:0070063)|sodium channel inhibitor activity (GO:0019871)|ubiquitin binding (GO:0043130)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(15)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	43				all cancers(107;0.0299)|GBM - Glioblastoma multiforme(80;0.113)		AGAGAGACTTACTGGTCCAGT	0.453																																																	0													223.0	190.0	201.0					15																	56140568		2193	4292	6485	SO:0001630	splice_region_variant	4734			D42055	CCDS10156.1, CCDS45265.1, CCDS61643.1, CCDS61644.1	15q	2012-02-23	2012-02-23		ENSG00000069869	ENSG00000069869			7727	protein-coding gene	gene with protein product	"""receptor-potentiating factor 1"""	602278	"""neural precursor cell expressed, developmentally down-regulated 4"""			9073511, 8649367	Standard	XR_243101		Approved	KIAA0093, MGC176705, NEDD4-1, RPF1	uc002adi.3	P46934	OTTHUMG00000132015	ENST00000508342.1:c.2799+1T>-	15.37:g.56140568delA		Somatic		WXS	Illumina GAIIx	Phase_I	A1KY35|A6ND72|A7MD29|B4E2R7|B7ZM59|B7ZM60|B9EGN5|D6RF89	Splice_Site	DEL	ENST00000508342.1	37																																																																																					0.453	NEDD4-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000359817.1		NM_198400	Intron
NOS3	4846	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	150693640	150693640	+	Splice_Site	SNP	G	G	T			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr7:150693640G>T	ENST00000484524.1	+	3	419	c.419G>T	c.(418-420)aGg>aTg	p.R140M	NOS3_ENST00000297494.3_Splice_Site_p.R140M|NOS3_ENST00000467517.1_Splice_Site_p.R140M|NOS3_ENST00000461406.1_Intron	NM_001160111.1	NP_001153583.1	P60323	NANO3_HUMAN	nitric oxide synthase 3 (endothelial cell)	0					germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic signaling pathway (GO:2001234)|oogenesis (GO:0048477)|regulation of cell cycle (GO:0051726)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.R140M(1)		NS(3)|breast(3)|central_nervous_system(5)|endometrium(1)|kidney(4)|large_intestine(6)|liver(2)|lung(11)|ovary(3)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	50	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TCCATTAAGAGGTGACAGCTT	0.642																																																	1	Substitution - Missense(1)	kidney(1)											26.0	27.0	27.0					7																	150693640		2187	4279	6466	SO:0001630	splice_region_variant	4846				CCDS5912.1, CCDS55182.1, CCDS55183.1	7q36	2007-02-15			ENSG00000164867	ENSG00000164867	1.14.13.39		7876	protein-coding gene	gene with protein product	"""endothelial nitric oxide synthase"""	163729				1379542	Standard	NM_000603		Approved	ECNOS, eNOS	uc003wif.3	P29474	OTTHUMG00000158343	ENST00000484524.1:c.419+1G>T	7.37:g.150693640G>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q495E5	Missense_Mutation	SNP	ENST00000484524.1	37	CCDS55182.1	.	.	.	.	.	.	.	.	.	.	G	18.08	3.544106	0.65198	.	.	ENSG00000164867	ENST00000297494;ENST00000484524;ENST00000467517	T;T;T	0.24908	1.83;1.83;1.83	4.98	4.98	0.66077	Nitric oxide synthase, oxygenase domain (3);	0.091468	0.44688	D	0.000435	T	0.39937	0.1097	M	0.77313	2.365	0.58432	D	0.999998	B;B;B;B	0.34103	0.081;0.081;0.437;0.256	B;B;B;B	0.41619	0.087;0.087;0.361;0.272	T	0.39961	-0.9588	10	0.59425	D	0.04	-9.1718	15.8176	0.78615	0.0:0.0:1.0:0.0	.	140;140;140;140	A0S0A6;E9PFR2;A0S0A8;P29474	.;.;.;NOS3_HUMAN	M	140	ENSP00000297494:R140M;ENSP00000420215:R140M;ENSP00000420551:R140M	ENSP00000297494:R140M	R	+	2	0	NOS3	150324573	1.000000	0.71417	1.000000	0.80357	0.571000	0.35966	7.740000	0.84986	2.312000	0.78011	0.543000	0.68304	AGG		0.642	NOS3-004	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000351550.1		NM_000603	Missense_Mutation
NOX5	79400	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	69328249	69328249	+	Silent	SNP	C	C	T			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr15:69328249C>T	ENST00000388866.3	+	7	1202	c.1161C>T	c.(1159-1161)tcC>tcT	p.S387S	NOX5_ENST00000455873.3_Silent_p.S352S|NOX5_ENST00000448182.3_Silent_p.S341S|RP11-809H16.4_ENST00000559495.1_RNA|NOX5_ENST00000260364.5_Silent_p.S369S|NOX5_ENST00000530406.2_Silent_p.S359S	NM_001184779.1|NM_024505.3	NP_001171708.1|NP_078781.3	Q96PH1	NOX5_HUMAN	NADPH oxidase, EF-hand calcium binding domain 5	387	Ferric oxidoreductase.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|cytokine secretion (GO:0050663)|cytokinesis (GO:0000910)|endothelial cell proliferation (GO:0001935)|oxidation-reduction process (GO:0055114)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|proton transport (GO:0015992)|regulation of fusion of sperm to egg plasma membrane (GO:0043012)|regulation of proton transport (GO:0010155)|superoxide anion generation (GO:0042554)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|flavin adenine dinucleotide binding (GO:0050660)|heme binding (GO:0020037)|hydrogen ion channel activity (GO:0015252)|NADP binding (GO:0050661)|superoxide-generating NADPH oxidase activity (GO:0016175)	p.S369S(1)		breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(2)|lung(18)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35						GCTCCAGTTCCTGCATCCGCA	0.597																																																	1	Substitution - coding silent(1)	kidney(1)											102.0	83.0	90.0					15																	69328249		2200	4298	6498	SO:0001819	synonymous_variant	79400			AF317889	CCDS32276.1, CCDS32276.2, CCDS53953.1, CCDS53954.1	15q22.31	2013-01-10			ENSG00000255346	ENSG00000255346		"""EF-hand domain containing"""	14874	protein-coding gene	gene with protein product		606572				11483596	Standard	NM_001184779		Approved	NOX5A, NOX5B	uc002ars.2	Q96PH1	OTTHUMG00000133320	ENST00000388866.3:c.1161C>T	15.37:g.69328249C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B2RBJ4|Q08AN2|Q08AN3|Q8TEQ1|Q8TER4|Q96PH2|Q96PJ8|Q96PJ9|Q9H6E0|Q9HAM8	Silent	SNP	ENST00000388866.3	37	CCDS32276.2																																																																																				0.597	NOX5-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257124.2		NM_024505	
NTN5	126147	broad.mit.edu;hgsc.bcm.edu	37	19	49173943	49173943	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr19:49173943G>A	ENST00000270235.4	-	2	396	c.301C>T	c.(301-303)Ccc>Tcc	p.P101S	SEC1P_ENST00000430145.2_RNA	NM_145807.1	NP_665806.1	Q8WTR8	NET5_HUMAN	netrin 5	101						extracellular region (GO:0005576)		p.P101S(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|pancreas(1)|prostate(1)	10						AGCCTCCAGGGACCCCCTGAG	0.677																																																	1	Substitution - Missense(1)	kidney(1)											10.0	13.0	12.0					19																	49173943		2183	4282	6465	SO:0001583	missense	126147				CCDS33068.1	19q13.33	2013-03-01			ENSG00000142233	ENSG00000142233		"""Netrins"""	25208	protein-coding gene	gene with protein product	"""Netrin-5"""					12477932	Standard	NM_145807		Approved		uc002pkb.3	Q8WTR8		ENST00000270235.4:c.301C>T	19.37:g.49173943G>A	ENSP00000270235:p.Pro101Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q8N4X9|Q8WU63	Missense_Mutation	SNP	ENST00000270235.4	37	CCDS33068.1	.	.	.	.	.	.	.	.	.	.	G	12.32	1.901428	0.33535	.	.	ENSG00000142233	ENST00000270235	T	0.23147	1.92	4.94	1.38	0.22167	.	0.351548	0.28809	N	0.014065	T	0.25717	0.0626	N	0.22421	0.69	0.23555	N	0.997423	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.994	T	0.17018	-1.0383	10	0.08179	T	0.78	.	6.4014	0.21640	0.1765:0.1515:0.672:0.0	.	101;101	Q8WTR8-2;Q8WTR8	.;NET5_HUMAN	S	101	ENSP00000270235:P101S	ENSP00000270235:P101S	P	-	1	0	NTN5	53865755	1.000000	0.71417	0.618000	0.29105	0.925000	0.55904	3.108000	0.50337	0.616000	0.30141	0.455000	0.32223	CCC		0.677	NTN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466176.1		NM_145807	
OR3A4P	390756	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	3213905	3213905	+	RNA	SNP	C	C	T			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr17:3213905C>T	ENST00000573491.1	-	0	359																		p.L101F(1)									TAAGGCCTGCCTCTCCGAGCT	0.557																																																	1	Substitution - Missense(1)	kidney(1)											105.0	104.0	105.0					17																	3213905		2203	4300	6503			0																															17.37:g.3213905C>T		Somatic		WXS	Illumina HiSeq	Phase_I		RNA	SNP	ENST00000573491.1	37																																																																																					0.557	RP11-64J4.2-001	KNOWN	basic	sense_overlapping	sense_overlapping	OTTHUMT00000438371.1			
PACS1	55690	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	65983684	65983684	+	Missense_Mutation	SNP	C	C	G			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr11:65983684C>G	ENST00000320580.4	+	5	788	c.755C>G	c.(754-756)tCc>tGc	p.S252C		NM_018026.3	NP_060496.2	Q6VY07	PACS1_HUMAN	phosphofurin acidic cluster sorting protein 1	252					protein targeting to Golgi (GO:0000042)|protein targeting to plasma membrane (GO:0072661)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	COPI-coated vesicle (GO:0030137)|cytosol (GO:0005829)	ion channel binding (GO:0044325)	p.S252C(1)	RBM14/PACS1(2)	breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(8)|ovary(6)|skin(2)|urinary_tract(1)	37						AAGATCTACTCCCTGTCCAGC	0.512																																																	1	Substitution - Missense(1)	kidney(1)											104.0	85.0	91.0					11																	65983684		2201	4295	6496	SO:0001583	missense	55690			AB033001	CCDS8129.1	11q13.1-q13.2	2008-02-05			ENSG00000175115	ENSG00000175115			30032	protein-coding gene	gene with protein product		607492				12855553, 14608369	Standard	NM_018026		Approved	FLJ10209, KIAA1175	uc001oha.2	Q6VY07	OTTHUMG00000166889	ENST00000320580.4:c.755C>G	11.37:g.65983684C>G	ENSP00000316454:p.Ser252Cys	Somatic		WXS	Illumina HiSeq	Phase_I	Q6PJY6|Q6PKB6|Q7Z590|Q7Z5W4|Q8N8K6|Q96MW0|Q9NW92|Q9ULP5	Missense_Mutation	SNP	ENST00000320580.4	37	CCDS8129.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.277420	0.80580	.	.	ENSG00000175115	ENST00000320580;ENST00000527380	T	0.28255	1.62	5.41	5.41	0.78517	.	0.099925	0.64402	D	0.000001	T	0.54498	0.1862	M	0.64404	1.975	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.87578	0.994;0.998	T	0.49844	-0.8896	10	0.49607	T	0.09	-24.6263	18.1384	0.89630	0.0:1.0:0.0:0.0	.	252;252	Q6VY07;Q6VY07-2	PACS1_HUMAN;.	C	252;154	ENSP00000316454:S252C	ENSP00000316454:S252C	S	+	2	0	PACS1	65740260	1.000000	0.71417	0.993000	0.49108	0.801000	0.45260	7.392000	0.79840	2.826000	0.97356	0.561000	0.74099	TCC		0.512	PACS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391690.2		NM_018026	
PLEKHG2	64857	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	39913384	39913384	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr19:39913384G>A	ENST00000409794.3	+	18	2540	c.1690G>A	c.(1690-1692)Gac>Aac	p.D564N	PLEKHG2_ENST00000378550.1_Intron|PLEKHG2_ENST00000458508.2_Missense_Mutation_p.D505N|PLEKHG2_ENST00000409797.2_Intron|PLEKHG2_ENST00000425673.1_Missense_Mutation_p.D535N	NM_022835.2	NP_073746.2	Q9H7P9	PKHG2_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 2	564					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.D522N(1)|p.D564N(1)|p.D505N(1)		breast(3)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(2)|liver(1)|lung(13)|pancreas(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	40	all_cancers(60;3.08e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;6.57e-07)|Ovarian(47;0.0569)		Epithelial(26;2.92e-26)|all cancers(26;2.01e-23)|Lung(45;0.000499)|LUSC - Lung squamous cell carcinoma(53;0.000657)			GTCCACCCATGACATTCCCAA	0.582																																																	3	Substitution - Missense(3)	kidney(3)											75.0	59.0	65.0					19																	39913384		2203	4300	6503	SO:0001583	missense	64857			AK024429	CCDS33022.2	19q13.2	2013-01-11			ENSG00000090924	ENSG00000090924		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	29515	protein-coding gene	gene with protein product		611893				11839748, 18045877	Standard	NM_022835		Approved	CLG, FLJ00018, ARHGEF42	uc010xuz.2	Q9H7P9	OTTHUMG00000152570	ENST00000409794.3:c.1690G>A	19.37:g.39913384G>A	ENSP00000386733:p.Asp564Asn	Somatic		WXS	Illumina HiSeq	Phase_I	B8ZZK6|C9J0Y4|Q6DHV6|Q96BU2|Q96D18|Q9H699	Missense_Mutation	SNP	ENST00000409794.3	37	CCDS33022.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.03|14.03	2.412726|2.412726	0.42817|0.42817	.|.	.|.	ENSG00000090924|ENSG00000090924	ENST00000409794;ENST00000425673;ENST00000458508|ENST00000205135	T;T;T|.	0.74315|.	-0.68;-0.74;-0.83|.	5.13|5.13	4.09|4.09	0.47781|0.47781	.|.	0.291643|.	0.24771|.	N|.	0.035735|.	T|T	0.36166|0.36166	0.0957|0.0957	L|L	0.34521|0.34521	1.04|1.04	0.28365|0.28365	N|N	0.920287|0.920287	D;D;D|.	0.89917|.	1.0;0.993;1.0|.	D;D;D|.	0.87578|.	0.998;0.984;0.994|.	T|T	0.22138|0.22138	-1.0225|-1.0225	10|5	0.66056|.	D|.	0.02|.	.|.	9.8313|9.8313	0.40944|0.40944	0.0961:0.0:0.9039:0.0|0.0961:0.0:0.9039:0.0	.|.	535;564;505|.	Q9H7P9-3;Q9H7P9;E7ESZ3|.	.;PKHG2_HUMAN;.|.	N|I	564;535;505|431	ENSP00000386733:D564N;ENSP00000392906:D535N;ENSP00000408857:D505N|.	ENSP00000386733:D564N|.	D|M	+|+	1|3	0|0	PLEKHG2|PLEKHG2	44605224|44605224	0.616000|0.616000	0.27035|0.27035	0.008000|0.008000	0.14137|0.14137	0.075000|0.075000	0.17131|0.17131	1.960000|1.960000	0.40422|0.40422	1.278000|1.278000	0.44430|0.44430	0.591000|0.591000	0.81541|0.81541	GAC|ATG		0.582	PLEKHG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326802.1		NM_022835	
POLQ	10721	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	121207746	121207746	+	Silent	SNP	T	T	A			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr3:121207746T>A	ENST00000264233.5	-	16	4160	c.4032A>T	c.(4030-4032)gcA>gcT	p.A1344A		NM_199420.3	NP_955452.3	O75417	DPOLQ_HUMAN	polymerase (DNA directed), theta	1344					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|single-stranded DNA-dependent ATPase activity (GO:0043142)	p.A1479A(1)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(55)|ovary(5)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	120				GBM - Glioblastoma multiforme(114;0.0915)		TGGTGTCCTTTGCTCCTAGTT	0.413								DNA polymerases (catalytic subunits)																													Pancreas(152;907 1925 26081 31236 36904)												1	Substitution - coding silent(1)	kidney(1)											211.0	185.0	194.0					3																	121207746		2203	4300	6503	SO:0001819	synonymous_variant	10721			AF052573	CCDS33833.1	3q13.3	2012-05-18			ENSG00000051341	ENSG00000051341	2.7.7.7	"""DNA polymerases"""	9186	protein-coding gene	gene with protein product		604419				10395804	Standard	NM_199420		Approved	POLH	uc003eee.4	O75417	OTTHUMG00000159396	ENST00000264233.5:c.4032A>T	3.37:g.121207746T>A		Somatic		WXS	Illumina HiSeq	Phase_I	O95160|Q6VMB5	Silent	SNP	ENST00000264233.5	37	CCDS33833.1																																																																																				0.413	POLQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355097.1		NM_199420	
PRAM1	84106	broad.mit.edu;ucsc.edu	37	19	8564274	8564274	+	Missense_Mutation	SNP	G	G	C			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr19:8564274G>C	ENST00000423345.4	-	2	938	c.418C>G	c.(418-420)Cca>Gca	p.P140A	PRAM1_ENST00000255612.3_Missense_Mutation_p.P140A			Q96QH2	PRAM_HUMAN	PML-RARA regulated adaptor molecule 1	188	8 X 12 AA repeats of K-P-P-[PQ]-P-[EQ]- [VAF]-T-D-L-P-K.|Pro-rich.				integrin-mediated signaling pathway (GO:0007229)|regulation of neutrophil degranulation (GO:0043313)		lipid binding (GO:0008289)	p.P140A(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(5)|prostate(1)|skin(1)	19						GGCTTCCTTGGAAACGGAGTG	0.662																																																	1	Substitution - Missense(1)	kidney(1)											29.0	33.0	32.0					19																	8564274		1814	3874	5688	SO:0001583	missense	84106			BC028012	CCDS45954.1, CCDS45954.2	19p13.2	2009-01-21				ENSG00000133246			30091	protein-coding gene	gene with protein product		606466				11301322, 15572693	Standard	NM_032152		Approved	PML-RAR	uc002mkd.3	Q96QH2		ENST00000423345.4:c.418C>G	19.37:g.8564274G>C	ENSP00000408342:p.Pro140Ala	Somatic		WXS	Illumina GAIIx	Phase_I	Q8N6W7	Missense_Mutation	SNP	ENST00000423345.4	37	CCDS45954.2	.	.	.	.	.	.	.	.	.	.	G	9.202	1.028609	0.19512	.	.	ENSG00000133246	ENST00000255612;ENST00000423345	T;T	0.17691	2.26;2.26	3.97	0.224	0.15297	.	0.000000	0.41712	D	0.000836	T	0.11410	0.0278	N	0.19112	0.55	0.09310	N	1	B;B	0.24043	0.069;0.096	B;B	0.27887	0.084;0.043	T	0.25779	-1.0122	10	0.48119	T	0.1	.	12.7654	0.57388	0.0:0.4809:0.5191:0.0	.	140;188	Q96QH2-2;Q96QH2	.;PRAM_HUMAN	A	140	ENSP00000255612:P140A;ENSP00000408342:P140A	ENSP00000255612:P140A	P	-	1	0	PRAM1	8470274	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	0.500000	0.22562	0.043000	0.15746	-0.226000	0.12346	CCA		0.662	PRAM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397040.3		NM_032152	
PPP5C	5536	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	46890487	46890487	+	Missense_Mutation	SNP	G	G	C			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr19:46890487G>C	ENST00000012443.4	+	8	1145	c.1042G>C	c.(1042-1044)Gtg>Ctg	p.V348L	PPP5C_ENST00000391919.1_Missense_Mutation_p.V220L	NM_006247.3	NP_006238.1	P53041	PPP5_HUMAN	protein phosphatase 5, catalytic subunit	348	Catalytic.				cell death (GO:0008219)|DNA repair (GO:0006281)|mitotic nuclear division (GO:0007067)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein dephosphorylation (GO:0006470)|protein heterooligomerization (GO:0051291)|response to morphine (GO:0043278)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)|metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|RNA binding (GO:0003723)|signal transducer activity (GO:0004871)	p.V348L(1)		endometrium(4)|kidney(1)|large_intestine(5)|liver(2)|lung(4)|ovary(1)|pancreas(1)	18		Ovarian(192;0.0731)|all_neural(266;0.196)		OV - Ovarian serous cystadenocarcinoma(262;0.000196)|all cancers(93;0.00192)|GBM - Glioblastoma multiforme(486;0.0499)|Epithelial(262;0.0504)		CAACGGCAAAGTGCTGGTGAG	0.617																																																	1	Substitution - Missense(1)	kidney(1)											101.0	74.0	83.0					19																	46890487		2203	4300	6503	SO:0001583	missense	5536				CCDS12684.1	19q13.3	2013-01-10			ENSG00000011485	ENSG00000011485	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	9322	protein-coding gene	gene with protein product		600658		PPP5		8666404	Standard	NM_006247		Approved	PP5	uc002pem.3	P53041	OTTHUMG00000134287	ENST00000012443.4:c.1042G>C	19.37:g.46890487G>C	ENSP00000012443:p.Val348Leu	Somatic		WXS	Illumina HiSeq	Phase_I	Q16722|Q53XV2	Missense_Mutation	SNP	ENST00000012443.4	37	CCDS12684.1	.	.	.	.	.	.	.	.	.	.	G	32	5.173234	0.94807	.	.	ENSG00000011485	ENST00000012443;ENST00000451918;ENST00000391919	D;D	0.85484	-1.99;-1.99	4.85	4.85	0.62838	Serine/threonine-specific protein phosphatase/bis(5-nucleosyl)-tetraphosphatase (2);Metallophosphoesterase domain (1);	0.000000	0.85682	D	0.000000	D	0.91686	0.7372	M	0.86502	2.82	0.80722	D	1	D;P;D	0.59767	0.986;0.899;0.957	P;P;P	0.58210	0.835;0.548;0.769	D	0.92958	0.6386	10	0.59425	D	0.04	-20.7828	15.4887	0.75587	0.0:0.0:1.0:0.0	.	206;348;348	B7Z1I1;B2R6R6;P53041	.;.;PPP5_HUMAN	L	348;335;220	ENSP00000012443:V348L;ENSP00000375786:V220L	ENSP00000012443:V348L	V	+	1	0	PPP5C	51582327	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	9.278000	0.95766	2.230000	0.72887	0.655000	0.94253	GTG		0.617	PPP5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258969.2		NM_006247	
PUM2	23369	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	20511383	20511383	+	Missense_Mutation	SNP	A	A	T			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr2:20511383A>T	ENST00000361078.2	-	4	412	c.390T>A	c.(388-390)gaT>gaA	p.D130E	PUM2_ENST00000420234.1_Intron|PUM2_ENST00000536417.1_Missense_Mutation_p.D74E|PUM2_ENST00000319801.5_Missense_Mutation_p.D130E|PUM2_ENST00000403432.1_Missense_Mutation_p.D130E|PUM2_ENST00000338086.5_Missense_Mutation_p.D130E			Q8TB72	PUM2_HUMAN	pumilio RNA-binding family member 2	130	Interaction with SNAPIN.				regulation of translation (GO:0006417)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nuclear membrane (GO:0031965)|perinuclear region of cytoplasm (GO:0048471)	poly(A) RNA binding (GO:0044822)	p.D130E(1)		breast(2)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(7)|lung(13)|ovary(2)|prostate(4)|urinary_tract(3)	42	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGCCTTTTTGATCTCCTTTCT	0.383																																																	1	Substitution - Missense(1)	kidney(1)											143.0	129.0	134.0					2																	20511383		2203	4300	6503	SO:0001583	missense	23369			AF315591	CCDS1698.1, CCDS74486.1, CCDS74487.1	2p22-p21	2013-09-02	2013-09-02		ENSG00000055917	ENSG00000055917			14958	protein-coding gene	gene with protein product		607205	"""pumilio (Drosphila) homolog 2"", ""pumilio homolog 2 (Drosophila)"""			9039502, 12459267, 12511597	Standard	XM_005262607		Approved	PUMH2, KIAA0235	uc002rds.1	Q8TB72	OTTHUMG00000122098	ENST00000361078.2:c.390T>A	2.37:g.20511383A>T	ENSP00000354370:p.Asp130Glu	Somatic		WXS	Illumina HiSeq	Phase_I	B3KSL0|B4E2B6|D6W527|O00234|Q53TV7|Q8WY43|Q9HAN2	Missense_Mutation	SNP	ENST00000361078.2	37		.	.	.	.	.	.	.	.	.	.	A	3.998	-0.003081	0.07773	.	.	ENSG00000055917	ENST00000338086;ENST00000361078;ENST00000319801;ENST00000440577;ENST00000403432;ENST00000536417;ENST00000442400	T;T;T;T;T;T	0.18810	2.21;2.47;2.5;2.25;2.21;2.19	5.98	5.98	0.97165	.	0.127557	0.64402	D	0.000001	T	0.08268	0.0206	N	0.03115	-0.41	0.40456	D	0.98019	B;B;B	0.06786	0.0;0.001;0.001	B;B;B	0.08055	0.002;0.003;0.001	T	0.34254	-0.9836	10	0.17369	T	0.5	-8.6164	6.7193	0.23321	0.7929:0.0:0.0708:0.1363	.	74;130;130	B4E2B6;B7ZL34;Q8TB72-3	.;.;.	E	130;130;130;21;130;74;130	ENSP00000338173:D130E;ENSP00000354370:D130E;ENSP00000326746:D130E;ENSP00000409905:D21E;ENSP00000385992:D130E;ENSP00000440093:D74E	ENSP00000326746:D130E	D	-	3	2	PUM2	20374864	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.969000	0.40510	2.289000	0.77006	0.533000	0.62120	GAT		0.383	PUM2-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding			NM_015317	
PREPL	9581	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	44556213	44556213	+	Silent	SNP	A	A	C			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr2:44556213A>C	ENST00000409936.1	-	10	1829	c.1392T>G	c.(1390-1392)acT>acG	p.T464T	PREPL_ENST00000410081.1_Silent_p.T464T|PREPL_ENST00000378511.3_Silent_p.T402T|PREPL_ENST00000409411.1_Silent_p.T375T|PREPL_ENST00000260648.6_Silent_p.T464T|PREPL_ENST00000409957.1_Silent_p.T375T|PREPL_ENST00000409272.1_Silent_p.T464T|PREPL_ENST00000378520.3_Silent_p.T398T|PREPL_ENST00000541738.1_Silent_p.T375T	NM_001171606.1	NP_001165077.1	Q4J6C6	PPCEL_HUMAN	prolyl endopeptidase-like	464						cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)	serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)	p.T464T(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(19)|ovary(1)|prostate(1)|skin(2)	33		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				CCTCAGAGTCAGTTTTGTGGA	0.378																																																	1	Substitution - coding silent(1)	kidney(1)											86.0	86.0	86.0					2																	44556213		2203	4300	6503	SO:0001819	synonymous_variant	9581			AB007896	CCDS33190.1, CCDS42675.1, CCDS42676.1, CCDS54353.1	2p22.1	2008-02-05			ENSG00000138078	ENSG00000138078			30228	protein-coding gene	gene with protein product		609557				11524703	Standard	NM_006036		Approved	KIAA0436	uc002ruk.2	Q4J6C6	OTTHUMG00000152791	ENST00000409936.1:c.1392T>G	2.37:g.44556213A>C		Somatic		WXS	Illumina HiSeq	Phase_I	A7E2X6|D6W5A3|O43163|Q4J6C3|Q4J6C4|Q4ZG39|Q6ZMW7|Q96DW7	Silent	SNP	ENST00000409936.1	37	CCDS33190.1																																																																																				0.378	PREPL-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327900.1		NM_006036	
RAI2	10742	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	17819213	17819213	+	Silent	SNP	C	C	T	rs565435195		TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chrX:17819213C>T	ENST00000545871.1	-	3	1378	c.918G>A	c.(916-918)acG>acA	p.T306T	RAI2_ENST00000360011.1_Silent_p.T306T|RAI2_ENST00000451717.1_Silent_p.T306T|RAI2_ENST00000331511.1_Silent_p.T306T|RAI2_ENST00000415486.3_Silent_p.T256T	NM_001172739.1|NM_001172743.1	NP_001166210|NP_001166214	Q9Y5P3	RAI2_HUMAN	retinoic acid induced 2	306					embryo development (GO:0009790)			p.T306T(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|prostate(1)	22	Hepatocellular(33;0.183)					TCTTAATGACCGTGTGGCGGC	0.542													c|||	5	0.0013245	0.0	0.0	3775	,	,		13714	0.0		0.0	False		,,,				2504	0.0051																1	Substitution - coding silent(1)	kidney(1)											108.0	111.0	110.0					X																	17819213		2203	4300	6503	SO:0001819	synonymous_variant	10742			Z93242	CCDS14183.1, CCDS55374.1	Xp22	2008-02-05			ENSG00000131831	ENSG00000131831			9835	protein-coding gene	gene with protein product		300217				10049581, 10394933	Standard	NR_033348		Approved		uc010nfa.3	Q9Y5P3	OTTHUMG00000021209	ENST00000545871.1:c.918G>A	X.37:g.17819213C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B1B1K2|B4DQM9|E7EMN4|Q8N6X7	Silent	SNP	ENST00000545871.1	37	CCDS14183.1																																																																																				0.542	RAI2-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055937.1		NM_021785	
RBMX	27316	hgsc.bcm.edu	37	X	135961597	135961597	+	5'UTR	SNP	T	T	C			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chrX:135961597T>C	ENST00000320676.7	-	0	144				RBMX_ENST00000562646.1_5'UTR|RBMX_ENST00000565438.1_Intron|RBMX_ENST00000570135.1_5'UTR|RBMX_ENST00000431446.3_5'UTR|SNORD61_ENST00000384252.1_RNA	NM_002139.3	NP_002130.2	P38159	RBMX_HUMAN	RNA binding motif protein, X-linked						cellular response to interleukin-1 (GO:0071347)|gene expression (GO:0010467)|membrane protein ectodomain proteolysis (GO:0006509)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|osteoblast differentiation (GO:0001649)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homooligomerization (GO:0051260)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|supraspliceosomal complex (GO:0044530)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|large_intestine(2)|lung(12)|ovary(2)|pancreas(1)|prostate(2)|urinary_tract(1)	33	Acute lymphoblastic leukemia(192;0.000127)					GTTTTTTTTTTTTTGGGCCGG	0.383																																																	0													51.0	51.0	51.0					X																	135961597		2202	4296	6498	SO:0001623	5_prime_UTR_variant	27316				CCDS14661.1, CCDS55510.1	Xq26	2013-05-23	2003-09-12		ENSG00000147274	ENSG00000147274		"""RNA binding motif (RRM) containing"""	9910	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein G"""	300199	"""RNA binding motif protein, X chromosome"""			10391206, 10391207	Standard	NM_002139		Approved	RNMX, hnRNP-G, HNRNPG	uc004fae.2	P38159	OTTHUMG00000022517	ENST00000320676.7:c.-11A>G	X.37:g.135961597T>C		Somatic		WXS	Illumina HiSeq	Phase_I	B4E3U4|D3DWH0|E9PG86|Q5JQ67|Q8N8Y7|Q969R3	RNA	SNP	ENST00000320676.7	37	CCDS14661.1																																																																																				0.383	RBMX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058507.1		NM_002139	
ROBO3	64221	broad.mit.edu	37	11	124750448	124750453	+	In_Frame_Del	DEL	CGGAGT	CGGAGT	-	rs55725290|rs56085444|rs71859853	byFrequency	TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	CGGAGT	CGGAGT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr11:124750448_124750453delCGGAGT	ENST00000397801.1	+	27	4285_4290	c.4093_4098delCGGAGT	c.(4093-4098)cggagtdel	p.RS1367del	ROBO3_ENST00000543966.1_In_Frame_Del_p.RS130del|ROBO3_ENST00000538940.1_In_Frame_Del_p.RS1345del|ROBO3_ENST00000525482.1_3'UTR	NM_022370.3	NP_071765.2	Q96MS0	ROBO3_HUMAN	roundabout, axon guidance receptor, homolog 3 (Drosophila)	1367					axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|neuron migration (GO:0001764)	axon (GO:0030424)|integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	35	all_hematologic(175;0.215)	Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|Breast(109;0.0481)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0296)		TGgccggagccggagtcggagtcaga	0.66														2107	0.420727	0.6664	0.2392	5008	,	,		17575	0.378		0.2883	False		,,,				2504	0.3978																0										2069,1609		709,651,479						2.4	1.0		dbSNP_130	17	1833,5925		332,1169,2378	no	coding	ROBO3	NM_022370.3		1041,1820,2857	A1A1,A1R,RR		23.6272,43.7466,34.1203				3902,7534				SO:0001651	inframe_deletion	64221			AK024697	CCDS44755.1	11q24	2013-02-11	2001-11-28		ENSG00000154134	ENSG00000154134		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13433	protein-coding gene	gene with protein product		608630	"""roundabout (axon guidance receptor, Drosophila) homolog 3"", ""horizontal gaze palsy with progressive scoliosis"""	HGPPS		15105459	Standard	NM_022370		Approved	RBIG1, FLJ21044, HGPS	uc001qbc.3	Q96MS0	OTTHUMG00000165934	ENST00000397801.1:c.4093_4098delCGGAGT	11.37:g.124750454_124750459delCGGAGT	ENSP00000380903:p.Arg1367_Ser1368del	Somatic		WXS	Illumina GAIIx	Phase_I		In_Frame_Del	DEL	ENST00000397801.1	37	CCDS44755.1																																																																																				0.660	ROBO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387091.1		XM_370663	
SECISBP2L	9728	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	49320719	49320719	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr15:49320719G>T	ENST00000559471.1	-	5	1088	c.825C>A	c.(823-825)tgC>tgA	p.C275*	SECISBP2L_ENST00000261847.3_Nonsense_Mutation_p.C275*	NM_001193489.1	NP_001180418.1	Q93073	SBP2L_HUMAN	SECIS binding protein 2-like	275							poly(A) RNA binding (GO:0044822)	p.C275*(1)		breast(1)|endometrium(5)|kidney(8)|large_intestine(12)|lung(11)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|urinary_tract(1)	46						GTTTGGGACTGCAGTAACCAC	0.493																																																	1	Substitution - Nonsense(1)	kidney(1)											147.0	121.0	130.0					15																	49320719		2197	4295	6492	SO:0001587	stop_gained	9728			BC033001	CCDS32234.1, CCDS53942.1	15q21.1	2014-02-12				ENSG00000138593			28997	protein-coding gene	gene with protein product		615756					Standard	NM_001193489		Approved	KIAA0256	uc001zxe.2	Q93073		ENST00000559471.1:c.825C>A	15.37:g.49320719G>T	ENSP00000453854:p.Cys275*	Somatic		WXS	Illumina HiSeq	Phase_I	Q8N767	Nonsense_Mutation	SNP	ENST00000559471.1	37	CCDS53942.1	.	.	.	.	.	.	.	.	.	.	G	37	6.388183	0.97529	.	.	ENSG00000138593	ENST00000261847;ENST00000380927	.	.	.	5.78	4.86	0.63082	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05721	T	0.95	.	9.2897	0.37780	0.2293:0.0:0.7707:0.0	.	.	.	.	X	275	.	ENSP00000261847:C275X	C	-	3	2	SECISBP2L	47108011	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.743000	0.38258	1.423000	0.47198	0.655000	0.94253	TGC		0.493	SECISBP2L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417277.1		NM_014701	
SETD3	84193	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	99932086	99932086	+	Silent	SNP	A	A	G			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr14:99932086A>G	ENST00000331768.5	-	2	216	c.57T>C	c.(55-57)acT>acC	p.T19T	SETD3_ENST00000329331.3_Silent_p.T19T|SETD3_ENST00000453938.1_5'UTR|SETD3_ENST00000436070.2_Silent_p.T19T	NM_032233.2	NP_115609.2	Q86TU7	SETD3_HUMAN	SET domain containing 3	19					histone H3-K36 methylation (GO:0010452)|peptidyl-lysine dimethylation (GO:0018027)|peptidyl-lysine monomethylation (GO:0018026)|peptidyl-lysine trimethylation (GO:0018023)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)	p.T19T(2)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(8)|ovary(1)|skin(1)	25		all_cancers(154;0.224)|all_epithelial(191;0.0644)|Melanoma(154;0.0866)				TTGGTGACACAGTTGCTGTAG	0.448																																																	2	Substitution - coding silent(2)	kidney(1)|endometrium(1)											189.0	172.0	178.0					14																	99932086		2203	4300	6503	SO:0001819	synonymous_variant	84193			AK026680	CCDS9951.1, CCDS9952.1	14q32.2	2006-02-15	2006-02-15	2006-02-15	ENSG00000183576	ENSG00000183576			20493	protein-coding gene	gene with protein product		615671	"""chromosome 14 open reading frame 154"""	C14orf154			Standard	NM_032233		Approved	FLJ23027	uc001ygc.3	Q86TU7	OTTHUMG00000028970	ENST00000331768.5:c.57T>C	14.37:g.99932086A>G		Somatic		WXS	Illumina HiSeq	Phase_I	A0PJU3|A5PLP0|B4DZE8|Q0VAQ2|Q659C0|Q86TU8|Q96GY9|Q9H5U5	Silent	SNP	ENST00000331768.5	37	CCDS9951.1																																																																																				0.448	SETD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000072339.3		NM_032233	
SIRPB2	284759	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	20	1460670	1460670	+	Silent	SNP	T	T	C			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr20:1460670T>C	ENST00000359801.3	-	2	162	c.126A>G	c.(124-126)ctA>ctG	p.L42L	SIRPB2_ENST00000444444.2_Silent_p.L42L|SIRPB2_ENST00000537284.1_5'UTR|SIRPB2_ENST00000608747.1_5'UTR	NM_001122962.1	NP_001116434.1	Q9P1W8	SIRPG_HUMAN	signal-regulatory protein beta 2	35	Ig-like V-type.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell activation (GO:0050870)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.L141L(1)|p.L42L(1)		endometrium(2)|kidney(2)|large_intestine(4)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						CCTCGGGCTGTAGCACCTGCC	0.542																																																	2	Substitution - coding silent(2)	kidney(2)											38.0	38.0	38.0					20																	1460670		1568	3582	5150	SO:0001819	synonymous_variant	284759			AL109658	CCDS42849.1, CCDS46570.1	20p13	2013-01-11	2006-02-03	2006-02-03	ENSG00000196209	ENSG00000196209		"""Signal-regulatory proteins"", ""Immunoglobulin superfamily / V-set domain containing"""	16247	protein-coding gene	gene with protein product			"""protein tyrosine phosphatase, non-receptor type 1-like"", ""protein tyrosine phosphatase, non-receptor type substrate 1-like 3"""	PTPN1L, PTPNS1L3		16339511	Standard	NM_001122962		Approved	dJ776F14.2	uc002wfg.2	Q5JXA9	OTTHUMG00000031670	ENST00000359801.3:c.126A>G	20.37:g.1460670T>C		Somatic		WXS	Illumina HiSeq	Phase_I	B1AKP6|Q5D051|Q5JV25|Q5MKL4|Q8WWA5|Q9NQK8	Silent	SNP	ENST00000359801.3	37	CCDS42849.1																																																																																				0.542	SIRPB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077544.1		NM_178459	
SLC36A1	206358	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	150867782	150867782	+	Silent	SNP	C	C	T			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr5:150867782C>T	ENST00000243389.3	+	11	1621	c.1398C>T	c.(1396-1398)ccC>ccT	p.P466P	SLC36A1_ENST00000520701.1_Silent_p.P466P	NM_078483.2	NP_510968.2	Q7Z2H8	S36A1_HUMAN	solute carrier family 36 (proton/amino acid symporter), member 1	466					amino acid transport (GO:0006865)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	glycine transmembrane transporter activity (GO:0015187)|hydrogen ion transmembrane transporter activity (GO:0015078)|L-alanine transmembrane transporter activity (GO:0015180)|L-proline transmembrane transporter activity (GO:0015193)|symporter activity (GO:0015293)	p.P466P(1)		endometrium(5)|kidney(9)|lung(8)|skin(2)|urinary_tract(1)	25		Medulloblastoma(196;0.091)|all_hematologic(541;0.103)|all_neural(839;0.138)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Acamprosate(DB00659)|Glycine(DB00145)|Hydroxyproline(DB08847)|L-Alanine(DB00160)|Spaglumic Acid(DB08835)|Vigabatrin(DB01080)	GCAATGCTCCCATCTTCATCA	0.557																																					Melanoma(151;1534 1860 12947 32979 37872)												1	Substitution - coding silent(1)	kidney(1)											99.0	88.0	92.0					5																	150867782		2203	4300	6503	SO:0001819	synonymous_variant	206358			AK057340	CCDS4316.1	5q33.1	2013-05-22			ENSG00000123643	ENSG00000123643		"""Solute carriers"""	18761	protein-coding gene	gene with protein product		606561				11959859, 11390972	Standard	NM_078483		Approved	LYAAT-1, PAT1, TRAMD3	uc003luc.3	Q7Z2H8	OTTHUMG00000130125	ENST00000243389.3:c.1398C>T	5.37:g.150867782C>T		Somatic		WXS	Illumina HiSeq	Phase_I	C9JI34|Q1LZ56|Q7Z7C0|Q86YK4|Q96M74	Silent	SNP	ENST00000243389.3	37	CCDS4316.1																																																																																				0.557	SLC36A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252433.1		NM_078483	
SMAD3	4088	hgsc.bcm.edu;ucsc.edu	37	15	67477111	67477111	+	Frame_Shift_Del	DEL	G	G	-			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr15:67477111delG	ENST00000327367.4	+	7	1228	c.918delG	c.(916-918)gagfs	p.E306fs	SMAD3_ENST00000540846.2_Frame_Shift_Del_p.E201fs|SMAD3_ENST00000439724.3_Frame_Shift_Del_p.E262fs|SMAD3_ENST00000537194.2_Frame_Shift_Del_p.E111fs	NM_005902.3	NP_005893.1	P84022	SMAD3_HUMAN	SMAD family member 3	306	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.|Sufficient for interaction with XPO4.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097296)|activin receptor signaling pathway (GO:0032924)|cell cycle arrest (GO:0007050)|cell-cell junction organization (GO:0045216)|developmental growth (GO:0048589)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic foregut morphogenesis (GO:0048617)|embryonic pattern specification (GO:0009880)|endoderm development (GO:0007492)|evasion or tolerance of host defenses by virus (GO:0019049)|extrinsic apoptotic signaling pathway (GO:0097191)|gene expression (GO:0010467)|heart looping (GO:0001947)|immune response (GO:0006955)|immune system development (GO:0002520)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|lens fiber cell differentiation (GO:0070306)|liver development (GO:0001889)|mesoderm formation (GO:0001707)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of inflammatory response (GO:0050728)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of osteoblast proliferation (GO:0033689)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of wound healing (GO:0061045)|nodal signaling pathway (GO:0038092)|osteoblast development (GO:0002076)|paraxial mesoderm morphogenesis (GO:0048340)|pericardium development (GO:0060039)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of bone mineralization (GO:0030501)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of gene expression (GO:0010628)|positive regulation of gene expression involved in extracellular matrix organization (GO:1901313)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta3 production (GO:0032916)|primary miRNA processing (GO:0031053)|protein stabilization (GO:0050821)|regulation of binding (GO:0051098)|regulation of epithelial cell proliferation (GO:0050678)|regulation of immune response (GO:0050776)|regulation of striated muscle tissue development (GO:0016202)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein complex assembly (GO:0007183)|somitogenesis (GO:0001756)|T cell activation (GO:0042110)|thyroid gland development (GO:0030878)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transdifferentiation (GO:0060290)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transport (GO:0006810)|ureteric bud development (GO:0001657)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nuclear inner membrane (GO:0005637)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|SMAD protein complex (GO:0071141)|SMAD2-SMAD3 protein complex (GO:0071144)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|bHLH transcription factor binding (GO:0043425)|chromatin DNA binding (GO:0031490)|co-SMAD binding (GO:0070410)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|double-stranded DNA binding (GO:0003690)|enhancer binding (GO:0035326)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor binding (GO:0005160)|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity (GO:0030618)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|large_intestine(11)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31				Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(7;0.125)		TCTTCGCAGAGTGCCTCAGTG	0.567																																																	0													161.0	134.0	143.0					15																	67477111		2201	4299	6500	SO:0001589	frameshift_variant	4088			BC050743	CCDS10222.1, CCDS45288.1, CCDS53950.1, CCDS53951.1	15q21-q22	2006-11-06	2006-11-06	2004-05-26	ENSG00000166949	ENSG00000166949		"""SMADs"""	6769	protein-coding gene	gene with protein product		603109	"""MAD, mothers against decapentaplegic homolog 3 (Drosophila)"", ""SMAD, mothers against DPP homolog 3 (Drosophila)"""	MADH3		8774881, 8673135	Standard	NM_001145102		Approved	JV15-2, HsT17436	uc002aqj.3	P84022	OTTHUMG00000133230	ENST00000327367.4:c.918delG	15.37:g.67477111delG	ENSP00000332973:p.Glu306fs	Somatic		WXS	Illumina HiSeq	Phase_I	A8K4B6|B7Z4Z5|B7Z6M9|B7Z9Q2|F5H383|O09064|O09144|O14510|O35273|Q92940|Q93002|Q9GKR4	Frame_Shift_Del	DEL	ENST00000327367.4	37	CCDS10222.1																																																																																				0.567	SMAD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256967.2		NM_005902	
SP8	221833	broad.mit.edu	37	7	20824941	20824943	+	In_Frame_Del	DEL	GCC	GCC	-	rs372591893	byFrequency	TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	GCC	GCC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr7:20824941_20824943delGCC	ENST00000361443.4	-	3	676_678	c.439_441delGGC	c.(439-441)ggcdel	p.G147del	SP8_ENST00000418710.2_In_Frame_Del_p.G165del	NM_198956.2	NP_945194.1	Q8IXZ3	SP8_HUMAN	Sp8 transcription factor	147					dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|proximal/distal pattern formation (GO:0009954)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G165delG(1)|p.G147delG(1)		NS(1)|central_nervous_system(1)|large_intestine(2)|lung(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	8						GCGCGGAGGAgccgccgccgccg	0.729														461	0.0920527	0.0098	0.1124	5008	,	,		5525	0.002		0.2664	False		,,,				2504	0.1022																2	Deletion - In frame(2)	central_nervous_system(2)							,	50,654		19,12,321					,	0.5	0.3			2	602,1424		217,168,628	no	coding,coding	SP8	NM_198956.2,NM_182700.4	,	236,180,949	A1A1,A1R,RR		29.7137,7.1023,23.8828	,	,		652,2078				SO:0001651	inframe_deletion	221833				CCDS5372.1, CCDS43555.1	7p21.2	2013-01-08			ENSG00000164651	ENSG00000164651		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	19196	protein-coding gene	gene with protein product		608306					Standard	NM_182700		Approved		uc003suz.3	Q8IXZ3	OTTHUMG00000094788	ENST00000361443.4:c.439_441delGGC	7.37:g.20824950_20824952delGCC	ENSP00000354482:p.Gly147del	Somatic		WXS	Illumina GAIIx	Phase_I	Q7Z615|Q7Z616|Q96MJ1	In_Frame_Del	DEL	ENST00000361443.4	37	CCDS5372.1																																																																																				0.729	SP8-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326904.2			
SPTBN2	6712	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	66472813	66472813	+	Missense_Mutation	SNP	C	C	T	rs536915281		TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr11:66472813C>T	ENST00000533211.1	-	15	2265	c.1934G>A	c.(1933-1935)cGt>cAt	p.R645H	SPTBN2_ENST00000309996.2_Missense_Mutation_p.R645H|SPTBN2_ENST00000529997.1_Missense_Mutation_p.R645H			O15020	SPTN2_HUMAN	spectrin, beta, non-erythrocytic 2	645					actin filament capping (GO:0051693)|adult behavior (GO:0030534)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|cell death (GO:0008219)|cerebellar Purkinje cell layer morphogenesis (GO:0021692)|multicellular organism growth (GO:0035264)|synapse assembly (GO:0007416)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|spectrin (GO:0008091)	actin binding (GO:0003779)|phospholipid binding (GO:0005543)|structural constituent of cytoskeleton (GO:0005200)	p.R645H(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(15)|liver(1)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	74						CCAGAGGAAACGCCAGAGCCG	0.701																																																	1	Substitution - Missense(1)	kidney(1)																																								SO:0001583	missense	6712			AB008567, AF026487, AF026488, AF079569	CCDS8150.1	11q13.2	2013-01-10			ENSG00000173898	ENSG00000173898		"""Pleckstrin homology (PH) domain containing"""	11276	protein-coding gene	gene with protein product		604985	"""spinocerebellar ataxia 5"""	SCA5		9826670, 16429157	Standard	NM_006946		Approved		uc001ojd.3	O15020	OTTHUMG00000167262	ENST00000533211.1:c.1934G>A	11.37:g.66472813C>T	ENSP00000432568:p.Arg645His	Somatic		WXS	Illumina HiSeq	Phase_I	O14872|O14873	Missense_Mutation	SNP	ENST00000533211.1	37	CCDS8150.1	.	.	.	.	.	.	.	.	.	.	C	11.98	1.799931	0.31869	.	.	ENSG00000173898	ENST00000533211;ENST00000309996;ENST00000529997	T;T;T	0.53423	0.62;0.62;0.62	4.45	2.59	0.31030	.	0.071765	0.64402	D	0.000018	T	0.40473	0.1118	N	0.22421	0.69	0.31801	N	0.6284	D	0.61080	0.989	P	0.53760	0.734	T	0.48246	-0.9052	10	0.54805	T	0.06	.	6.3502	0.21370	0.0:0.6198:0.0:0.3802	.	645	O15020	SPTN2_HUMAN	H	645	ENSP00000432568:R645H;ENSP00000311489:R645H;ENSP00000433593:R645H	ENSP00000311489:R645H	R	-	2	0	SPTBN2	66229389	0.190000	0.23276	0.989000	0.46669	0.645000	0.38454	0.914000	0.28624	0.515000	0.28320	-0.320000	0.08662	CGT		0.701	SPTBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393892.2		NM_006946	
SYNE1	23345	broad.mit.edu;hgsc.bcm.edu	37	6	152599304	152599304	+	Silent	SNP	G	G	A			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr6:152599304G>A	ENST00000367255.5	-	98	19094	c.18493C>T	c.(18493-18495)Ctg>Ttg	p.L6165L	SYNE1_ENST00000341594.5_Silent_p.L5777L|SYNE1_ENST00000448038.1_Silent_p.L6094L|SYNE1_ENST00000423061.1_Silent_p.L6094L|SYNE1_ENST00000265368.4_Silent_p.L6165L|SYNE1_ENST00000356820.4_Silent_p.L689L	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	6165					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.L6165L(2)|p.L6094L(1)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TTTCCAGCCAGCTGCTCGGCC	0.572										HNSCC(10;0.0054)																																							3	Substitution - coding silent(3)	kidney(3)											114.0	117.0	116.0					6																	152599304		2203	4300	6503	SO:0001819	synonymous_variant	23345			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.18493C>T	6.37:g.152599304G>A		Somatic		WXS	Illumina HiSeq	Phase_I	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Silent	SNP	ENST00000367255.5	37	CCDS5236.2																																																																																				0.572	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2		NM_182961	
TOX2	84969	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	20	42574588	42574588	+	Silent	SNP	G	G	A			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr20:42574588G>A	ENST00000358131.5	+	1	244	c.36G>A	c.(34-36)gcG>gcA	p.A12A	TOX2_ENST00000423191.2_Intron|TOX2_ENST00000341197.4_Intron|TOX2_ENST00000372999.1_Intron	NM_001098798.1	NP_001092268.1	Q96NM4	TOX2_HUMAN	TOX high mobility group box family member 2	12					female gonad development (GO:0008585)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to gonadotropin (GO:0034698)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.A12A(1)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|skin(2)	26		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.00189)			TCGCGGGCGCGTTCTCTCGCT	0.527																																																	1	Substitution - coding silent(1)	kidney(1)											48.0	49.0	49.0					20																	42574588		1981	4154	6135	SO:0001819	synonymous_variant	84969			BC007636	CCDS13324.1, CCDS42875.1, CCDS46603.1	20q13.12	2007-03-20	2007-03-20	2007-03-20					16095	protein-coding gene	gene with protein product	"""granulosa cell HMG box 1"""	611163	"""chromosome 20 open reading frame 100"""	C20orf100		14764631	Standard	NM_001098796		Approved	dJ1108D11.2, GCX-1	uc010ggo.3	Q96NM4		ENST00000358131.5:c.36G>A	20.37:g.42574588G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A8K1J1|E1P5X0|G3XAC7|Q5TE33|Q5TE34|Q5TE35|Q96IC9|Q9BQN5	Silent	SNP	ENST00000358131.5	37	CCDS42875.1																																																																																				0.527	TOX2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000079329.2			
TRIOBP	11078	hgsc.bcm.edu;ucsc.edu	37	22	38134696	38134696	+	Frame_Shift_Del	DEL	C	C	-			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr22:38134696delC	ENST00000406386.3	+	10	5409	c.5154delC	c.(5152-5154)gacfs	p.D1718fs		NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	1718					actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					GAGGCCAAGACCCCCTGACTG	0.542																																																	0													52.0	53.0	52.0					22																	38134696		2032	4190	6222	SO:0001589	frameshift_variant	11078			AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.5154delC	22.37:g.38134696delC	ENSP00000384312:p.Asp1718fs	Somatic		WXS	Illumina HiSeq	Phase_I	B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Frame_Shift_Del	DEL	ENST00000406386.3	37	CCDS43015.1																																																																																				0.542	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319439.2			
TTBK2	146057	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	43109262	43109262	+	Missense_Mutation	SNP	G	G	C	rs563297091		TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr15:43109262G>C	ENST00000267890.6	-	7	679	c.571C>G	c.(571-573)Cgt>Ggt	p.R191G	TTBK2_ENST00000567274.1_Missense_Mutation_p.R156G|TTBK2_ENST00000567840.1_Missense_Mutation_p.R191G	NM_173500.3	NP_775771.3	Q6IQ55	TTBK2_HUMAN	tau tubulin kinase 2	191	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell death (GO:0008219)|cilium assembly (GO:0042384)|peptidyl-serine phosphorylation (GO:0018105)|smoothened signaling pathway (GO:0007224)	centriole (GO:0005814)|ciliary basal body (GO:0036064)|ciliary transition zone (GO:0035869)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.R191G(1)		NS(1)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(8)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(2)	43		all_cancers(109;6.11e-16)|all_epithelial(112;5.5e-14)|Lung NSC(122;1.76e-08)|all_lung(180;6.04e-08)|Melanoma(134;0.0179)|Colorectal(260;0.216)		GBM - Glioblastoma multiforme(94;3.23e-07)		GATGCATAACGAACTGTCCCT	0.403																																																	1	Substitution - Missense(1)	kidney(1)											74.0	69.0	71.0					15																	43109262		1969	4144	6113	SO:0001583	missense	146057			AB020654	CCDS42029.1	15q15.2	2014-01-21			ENSG00000128881	ENSG00000128881			19141	protein-coding gene	gene with protein product		611695	"""spinocerebellar ataxia 11"""	SCA11		10048485	Standard	NM_173500		Approved	KIAA0847	uc001zqo.2	Q6IQ55	OTTHUMG00000175802	ENST00000267890.6:c.571C>G	15.37:g.43109262G>C	ENSP00000267890:p.Arg191Gly	Somatic		WXS	Illumina HiSeq	Phase_I	O94932|Q6ZN52|Q8IVV1	Missense_Mutation	SNP	ENST00000267890.6	37	CCDS42029.1	.	.	.	.	.	.	.	.	.	.	G	29.1	4.973774	0.92919	.	.	ENSG00000128881	ENST00000267890;ENST00000399479;ENST00000263802	T	0.66280	-0.2	6.06	6.06	0.98353	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.78413	0.4279	M	0.70275	2.135	0.80722	D	1	D;D;D;D	0.89917	1.0;0.986;0.97;0.977	D;D;P;D	0.97110	1.0;0.918;0.779;0.934	T	0.79396	-0.1821	10	0.87932	D	0	.	15.3675	0.74535	0.0:0.0:0.8606:0.1394	.	171;122;191;191	Q8IWY7;Q6IQ55-2;Q6IQ55-3;Q6IQ55	.;.;.;TTBK2_HUMAN	G	191;121;171	ENSP00000267890:R191G	ENSP00000263802:R171G	R	-	1	0	TTBK2	40896554	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.568000	0.82369	2.880000	0.98712	0.650000	0.86243	CGT		0.403	TTBK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000431106.2		NM_173500	
ZNF724P	440519	broad.mit.edu	37	19	23406130	23406130	+	Missense_Mutation	SNP	C	C	G			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr19:23406130C>G	ENST00000418100.1	-	4	1034	c.917G>C	c.(916-918)gGa>gCa	p.G306A				A8MTY0	ZN724_HUMAN	zinc finger protein 724, pseudogene	306					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G306A(2)		endometrium(3)|kidney(1)|lung(2)|ovary(2)	8						GGGCTTCTCTCCAGCATGAAT	0.353																																																	2	Substitution - Missense(2)	kidney(2)																																								SO:0001583	missense	0					19p12	2014-02-14	2010-08-03		ENSG00000196081	ENSG00000196081			32460	pseudogene	pseudogene			"""zinc finger protein 724 pseudogene"", ""zinc finger protein 724 (pseudogene)"""				Standard	NR_045525		Approved		uc021uru.1	A8MTY0	OTTHUMG00000183231	ENST00000418100.1:c.917G>C	19.37:g.23406130C>G	ENSP00000413411:p.Gly306Ala	Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000418100.1	37		.	.	.	.	.	.	.	.	.	.	C	13.36	2.214691	0.39102	.	.	ENSG00000196081	ENST00000418100	T	0.26373	1.74	1.07	1.07	0.20283	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.43523	0.1251	.	.	.	0.34674	D	0.724044	D	0.71674	0.998	D	0.66196	0.942	T	0.56565	-0.7958	8	0.72032	D	0.01	.	8.9477	0.35769	0.0:1.0:0.0:0.0	.	306	A8MTY0	ZN724_HUMAN	A	306	ENSP00000413411:G306A	ENSP00000413411:G306A	G	-	2	0	ZNF724P	23197970	0.475000	0.25894	0.178000	0.23040	0.166000	0.22503	1.372000	0.34261	0.475000	0.27415	0.478000	0.44815	GGA		0.353	ZNF724P-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000465743.1			
VPS52	6293	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	33231657	33231657	+	Splice_Site	SNP	C	C	T			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr6:33231657C>T	ENST00000445902.2	-	16	1839		c.e16-1		VPS52_ENST00000478934.1_Splice_Site|VPS52_ENST00000436044.2_Splice_Site|VPS52_ENST00000482399.1_Splice_Site	NM_022553.4	NP_072047.4	Q8N1B4	VPS52_HUMAN	vacuolar protein sorting 52 homolog (S. cerevisiae)						ectodermal cell differentiation (GO:0010668)|embryonic ectodermal digestive tract development (GO:0048611)|protein transport (GO:0015031)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)		p.?(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(8)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)	28						CCACCTCCACCTGAAAAGGCA	0.542																																																	1	Unknown(1)	kidney(1)											61.0	55.0	57.0					6																	33231657		2203	4300	6503	SO:0001630	splice_region_variant	6293			AJ223319	CCDS4770.2	6p21.3	2010-02-17	2006-12-19	2003-09-05	ENSG00000223501	ENSG00000223501			10518	protein-coding gene	gene with protein product		603443	"""SAC2 suppressor of actin mutations 2-like (yeast)"", ""vacuolar protein sorting 52 (yeast)"""	SACM2L		9790748	Standard	NM_022553		Approved	ARE1	uc003odm.1	Q8N1B4	OTTHUMG00000031276	ENST00000445902.2:c.1621-1G>A	6.37:g.33231657C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A2BF38|B0UZZ4|B4DNI9|Q53GR4|Q5JPA0|Q5SQW1|Q8IUN6|Q9NPT5	Splice_Site	SNP	ENST00000445902.2	37	CCDS4770.2	.	.	.	.	.	.	.	.	.	.	C	18.46	3.628042	0.66901	.	.	ENSG00000223501	ENST00000445902;ENST00000418054;ENST00000436044	.	.	.	4.77	4.77	0.60923	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.7008	0.77541	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	VPS52	33339635	1.000000	0.71417	1.000000	0.80357	0.881000	0.50899	6.354000	0.73036	2.647000	0.89833	0.446000	0.29264	.		0.542	VPS52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076598.2		NM_022553	Intron
WDR89	112840	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	64066630	64066630	+	Silent	SNP	G	G	A			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr14:64066630G>A	ENST00000394942.2	-	2	119	c.31C>T	c.(31-33)Ctg>Ttg	p.L11L	CTD-2302E22.2_ENST00000553983.1_lincRNA|WDR89_ENST00000267522.3_Silent_p.L11L	NM_001008726.2|NM_001258272.1|NM_080666.3	NP_001008726.1|NP_001245201.1|NP_542397.1	Q96FK6	WDR89_HUMAN	WD repeat domain 89	11								p.L11L(1)		endometrium(1)|kidney(1)|large_intestine(3)|liver(1)|lung(7)|upper_aerodigestive_tract(1)	14				OV - Ovarian serous cystadenocarcinoma(108;0.00543)|all cancers(60;0.0181)|BRCA - Breast invasive adenocarcinoma(234;0.101)		ACAATGTGCAGATTAGCAAAT	0.348																																																	1	Substitution - coding silent(1)	kidney(1)											63.0	64.0	63.0					14																	64066630		2203	4300	6503	SO:0001819	synonymous_variant	112840			AF115513	CCDS9759.1	14q23.2	2013-01-09		2006-07-07	ENSG00000140006	ENSG00000140006		"""WD repeat domain containing"""	20489	protein-coding gene	gene with protein product				C14orf150			Standard	NM_080666		Approved	MGC9907	uc001xgi.4	Q96FK6	OTTHUMG00000140340	ENST00000394942.2:c.31C>T	14.37:g.64066630G>A		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000394942.2	37	CCDS9759.1																																																																																				0.348	WDR89-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411879.2		NM_080666	
XIAP	331	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	123020288	123020288	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chrX:123020288A>G	ENST00000371199.3	+	2	1075	c.776A>G	c.(775-777)aAt>aGt	p.N259S	XIAP_ENST00000434753.3_Missense_Mutation_p.N259S|XIAP_ENST00000355640.3_Missense_Mutation_p.N259S|XIAP_ENST00000468691.1_Intron	NM_001167.3	NP_001158.2	P98170	XIAP_HUMAN	X-linked inhibitor of apoptosis	259					apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|copper ion homeostasis (GO:0055070)|inhibition of cysteine-type endopeptidase activity involved in apoptotic process (GO:1990001)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of neuron apoptotic process (GO:0043524)|neuron apoptotic process (GO:0051402)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of protein linear polyubiquitination (GO:1902530)|positive regulation of protein ubiquitination (GO:0031398)|protein ubiquitination (GO:0016567)|regulation of BMP signaling pathway (GO:0030510)|regulation of cell proliferation (GO:0042127)|regulation of inflammatory response (GO:0050727)|regulation of innate immune response (GO:0045088)|regulation of nucleotide-binding oligomerization domain containing signaling pathway (GO:0070424)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)	cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.N259S(1)		breast(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(12)|ovary(3)	25						CTTCCAAGAAATCCATCCATG	0.383									X-linked Lymphoproliferative syndrome																																								1	Substitution - Missense(1)	kidney(1)											90.0	88.0	89.0					X																	123020288		2203	4300	6503	SO:0001583	missense	331	Familial Cancer Database	XLP, Duncan syndrome, Familial Fatal Epstein-Barr Infection, incl. XLP2	U45880	CCDS14606.1	Xq25	2014-09-17	2008-03-04	2008-03-04	ENSG00000101966	ENSG00000101966		"""Baculoviral IAP repeat containing"""	592	protein-coding gene	gene with protein product		300079	"""baculoviral IAP repeat-containing 4"""	API3, BIRC4		8552191, 8654366	Standard	NM_001167		Approved	hILP	uc010nqu.3	P98170	OTTHUMG00000022336	ENST00000371199.3:c.776A>G	X.37:g.123020288A>G	ENSP00000360242:p.Asn259Ser	Somatic		WXS	Illumina HiSeq	Phase_I	D3DTF2|Q9NQ14	Missense_Mutation	SNP	ENST00000371199.3	37	CCDS14606.1	.	.	.	.	.	.	.	.	.	.	A	11.21	1.571777	0.28003	.	.	ENSG00000101966	ENST00000434753;ENST00000371199;ENST00000355640	T;T;T	0.03889	3.77;3.77;3.77	5.81	4.65	0.58169	Baculoviral inhibition of apoptosis protein repeat (1);	0.231330	0.37857	N	0.001914	T	0.04407	0.0121	L	0.38531	1.155	0.30914	N	0.728803	B	0.13145	0.007	B	0.04013	0.001	T	0.20371	-1.0277	9	.	.	.	-26.4307	8.1825	0.31319	0.8451:0.0:0.1549:0.0	.	259	P98170	XIAP_HUMAN	S	259	ENSP00000395230:N259S;ENSP00000360242:N259S;ENSP00000347858:N259S	.	N	+	2	0	XIAP	122847969	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.714000	0.37961	0.829000	0.34733	0.413000	0.27773	AAT		0.383	XIAP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058165.5		NM_001167	
ZDHHC1	29800	broad.mit.edu;ucsc.edu	37	16	67429119	67429119	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr16:67429119G>T	ENST00000348579.2	-	10	1357	c.1016C>A	c.(1015-1017)tCt>tAt	p.S339Y	TPPP3_ENST00000290942.5_5'Flank|TPPP3_ENST00000393957.2_5'Flank|TPPP3_ENST00000562206.1_5'Flank|ZDHHC1_ENST00000566075.1_5'UTR	NM_013304.2	NP_037436.1	Q8WTX9	ZDHC1_HUMAN	zinc finger, DHHC-type containing 1	339					protein palmitoylation (GO:0018345)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	DNA binding (GO:0003677)|palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)	p.S339Y(1)		breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(1)|urinary_tract(1)	10		Ovarian(137;0.223)		UCEC - Uterine corpus endometrioid carcinoma (183;0.0178)|all cancers(182;5.71e-53)|Epithelial(162;4.73e-52)|OV - Ovarian serous cystadenocarcinoma(108;1.53e-29)|Kidney(780;4.37e-05)|BRCA - Breast invasive adenocarcinoma(181;5.8e-05)|GBM - Glioblastoma multiforme(240;0.0022)		GGCAGGGCGAGAGTGTCTGGG	0.657																																																	1	Substitution - Missense(1)	kidney(1)											10.0	11.0	11.0					16																	67429119		2182	4273	6455	SO:0001583	missense	29800			U90653	CCDS10836.1	16q22.1	2010-03-25	2003-01-27		ENSG00000159714	ENSG00000159714		"""Zinc fingers, DHHC-type"""	17916	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 1"""	C16orf1		10395086	Standard	NM_013304		Approved	HSU90653, ZNF377	uc010vjm.2	Q8WTX9	OTTHUMG00000137522	ENST00000348579.2:c.1016C>A	16.37:g.67429119G>T	ENSP00000340299:p.Ser339Tyr	Somatic		WXS	Illumina GAIIx	Phase_I	O15461	Missense_Mutation	SNP	ENST00000348579.2	37	CCDS10836.1	.	.	.	.	.	.	.	.	.	.	G	11.71	1.720356	0.30503	.	.	ENSG00000159714	ENST00000348579	T	0.39056	1.1	3.78	0.546	0.17196	.	2.897380	0.02499	U	0.090268	T	0.33673	0.0871	L	0.27053	0.805	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.28839	-1.0031	10	0.44086	T	0.13	.	9.6229	0.39732	0.0:0.2008:0.662:0.1371	.	339	Q8WTX9	ZDHC1_HUMAN	Y	339	ENSP00000340299:S339Y	ENSP00000340299:S339Y	S	-	2	0	ZDHHC1	65986620	0.002000	0.14202	0.002000	0.10522	0.379000	0.30106	1.135000	0.31454	-0.183000	0.10585	-1.104000	0.02111	TCT		0.657	ZDHHC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268845.1		NM_013304	
ZKSCAN2	342357	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	25266607	25266607	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr16:25266607C>A	ENST00000328086.7	-	2	1309	c.506G>T	c.(505-507)cGg>cTg	p.R169L		NM_001012981.4	NP_001012999.3	Q63HK3	ZKSC2_HUMAN	zinc finger with KRAB and SCAN domains 2	169					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.R169L(1)		breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(15)|ovary(3)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)	36				GBM - Glioblastoma multiforme(48;0.0378)		AGGTTCCTCCCGAGACACCGC	0.617																																																	1	Substitution - Missense(1)	kidney(1)											83.0	74.0	77.0					16																	25266607		2197	4300	6497	SO:0001583	missense	342357			AK026852	CCDS32410.1	16p12.1	2013-01-09	2007-02-20	2007-02-20		ENSG00000155592		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	25677	protein-coding gene	gene with protein product			"""zinc finger protein 694"""	ZNF694			Standard	NM_001012981		Approved	FLJ23199, ZSCAN34	uc002dod.4	Q63HK3		ENST00000328086.7:c.506G>T	16.37:g.25266607C>A	ENSP00000331626:p.Arg169Leu	Somatic		WXS	Illumina HiSeq	Phase_I	A1L3B4|Q6ZN77	Missense_Mutation	SNP	ENST00000328086.7	37	CCDS32410.1	.	.	.	.	.	.	.	.	.	.	C	4.154	0.026922	0.08054	.	.	ENSG00000155592	ENST00000328086;ENST00000536768	T	0.14766	2.48	5.3	-10.6	0.00265	.	1.696110	0.02958	N	0.142643	T	0.04497	0.0123	N	0.04508	-0.205	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.23726	-1.0180	10	0.26408	T	0.33	2.1776	2.892	0.05679	0.3591:0.1564:0.0655:0.419	.	169;169	Q63HK3-2;Q63HK3	.;ZKSC2_HUMAN	L	169	ENSP00000331626:R169L	ENSP00000331626:R169L	R	-	2	0	ZKSCAN2	25174108	0.000000	0.05858	0.002000	0.10522	0.284000	0.27059	-2.598000	0.00894	-4.668000	0.00037	-1.184000	0.01707	CGG		0.617	ZKSCAN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435739.1		NM_001012981	
ZFHX3	463	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	72830806	72830806	+	Silent	SNP	A	A	T			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr16:72830806A>T	ENST00000268489.5	-	9	6447	c.5775T>A	c.(5773-5775)ggT>ggA	p.G1925G	ZFHX3_ENST00000397992.5_Silent_p.G1011G	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	1925					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.G1925G(1)		NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				GCTCAGAACCACCCCCTGGTG	0.587																																																	1	Substitution - coding silent(1)	kidney(1)											85.0	87.0	86.0					16																	72830806		2198	4300	6498	SO:0001819	synonymous_variant	463			D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.5775T>A	16.37:g.72830806A>T		Somatic		WXS	Illumina HiSeq	Phase_I	D3DWS8|O15101|Q13719	Silent	SNP	ENST00000268489.5	37	CCDS10908.1																																																																																				0.587	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269008.1		NM_006885	
ZNF583	147949	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	56934784	56934784	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr19:56934784G>A	ENST00000333201.9	+	5	967	c.757G>A	c.(757-759)Gca>Aca	p.A253T	ZNF583_ENST00000585612.1_3'UTR|ZNF583_ENST00000291598.7_Missense_Mutation_p.A253T	NM_001159861.1|NM_152478.2	NP_001153333.1|NP_689691.2	Q96ND8	ZN583_HUMAN	zinc finger protein 583	253					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A253T(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(5)|ovary(2)|prostate(1)|skin(1)	26		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0564)		CAGCCAGAGTGCAAACTTGGC	0.443																																																	1	Substitution - Missense(1)	kidney(1)											53.0	54.0	53.0					19																	56934784		2203	4298	6501	SO:0001583	missense	147949			AK055592	CCDS12943.1	19q13.43	2013-09-20			ENSG00000198440	ENSG00000198440		"""Zinc fingers, C2H2-type"", ""-"""	26427	protein-coding gene	gene with protein product							Standard	NM_152478		Approved	FLJ31030	uc010ygl.1	Q96ND8	OTTHUMG00000168874	ENST00000333201.9:c.757G>A	19.37:g.56934784G>A	ENSP00000388502:p.Ala253Thr	Somatic		WXS	Illumina HiSeq	Phase_I	O14850|Q2NKK3	Missense_Mutation	SNP	ENST00000333201.9	37	CCDS12943.1	.	.	.	.	.	.	.	.	.	.	G	13.95	2.390135	0.42410	.	.	ENSG00000198440	ENST00000291598;ENST00000333201	T;T	0.01043	5.41;5.41	4.43	-5.92	0.02261	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.44285	D	0.000461	T	0.00637	0.0021	N	0.13235	0.315	0.09310	N	1	B	0.32653	0.379	B	0.33042	0.157	T	0.50381	-0.8835	9	.	.	.	.	7.3783	0.26841	0.1892:0.0:0.1547:0.6561	.	253	Q96ND8	ZN583_HUMAN	T	253	ENSP00000291598:A253T;ENSP00000388502:A253T	.	A	+	1	0	ZNF583	61626596	0.000000	0.05858	0.000000	0.03702	0.963000	0.63663	-2.892000	0.00709	-0.649000	0.05430	0.462000	0.41574	GCA		0.443	ZNF583-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401453.1		NM_152478	
ZNF831	128611	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	20	57769082	57769082	+	Missense_Mutation	SNP	G	G	A	rs538061169		TCGA-CJ-4897-01A-03D-1429-08	TCGA-CJ-4897-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1331eec-e2df-4924-918b-7e5134e933c2	d294e13c-9c97-4dcb-a1ac-4b345a27c4de	g.chr20:57769082G>A	ENST00000371030.2	+	1	3008	c.3008G>A	c.(3007-3009)aGc>aAc	p.S1003N		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	1003							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)	p.S1003N(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					GAGGCGGACAGCATCCTGGAG	0.642													.|||	1	0.000199681	0.0	0.0	5008	,	,		15459	0.0		0.0	False		,,,				2504	0.001																1	Substitution - Missense(1)	kidney(1)											36.0	38.0	37.0					20																	57769082		1954	4140	6094	SO:0001583	missense	128611			AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.3008G>A	20.37:g.57769082G>A	ENSP00000360069:p.Ser1003Asn	Somatic		WXS	Illumina HiSeq	Phase_I	Q5TDR4|Q8TCP0	Missense_Mutation	SNP	ENST00000371030.2	37	CCDS42894.1	.	.	.	.	.	.	.	.	.	.	G	13.26	2.183824	0.38609	.	.	ENSG00000124203	ENST00000371030	T	0.06449	3.3	4.42	-0.223	0.13118	.	1.100580	0.06852	N	0.797555	T	0.05181	0.0138	L	0.32530	0.975	0.09310	N	1	B	0.25235	0.121	B	0.17722	0.019	T	0.42982	-0.9419	10	0.46703	T	0.11	-1.8522	4.2105	0.10509	0.2914:0.33:0.3786:0.0	.	1003	Q5JPB2	ZN831_HUMAN	N	1003	ENSP00000360069:S1003N	ENSP00000360069:S1003N	S	+	2	0	ZNF831	57202477	0.001000	0.12720	0.000000	0.03702	0.018000	0.09664	0.877000	0.28106	0.091000	0.17302	0.313000	0.20887	AGC		0.642	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000079916.2		NM_178457	
