#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ABCA8	10351	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	66883567	66883567	+	Silent	SNP	G	G	C			TCGA-CJ-4923-01A-01D-1429-08	TCGA-CJ-4923-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19171a1a-6483-4bf3-b0b4-8cd441303c55	f394a92b-22c4-43d1-991b-b32a270d1cba	g.chr17:66883567G>C	ENST00000269080.2	-	23	3242	c.3105C>G	c.(3103-3105)tcC>tcG	p.S1035S	ABCA8_ENST00000586539.1_Silent_p.S1075S|ABCA8_ENST00000430352.2_Silent_p.S1075S	NM_007168.2	NP_009099.1	O94911	ABCA8_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 8	1035					transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)	p.S1035S(1)		breast(3)|central_nervous_system(2)|endometrium(9)|kidney(5)|large_intestine(19)|liver(1)|lung(30)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|urinary_tract(4)	83	Breast(10;4.56e-13)					AGAAGTACAGGGAAACATCCA	0.418																																																	1	Substitution - coding silent(1)	kidney(1)											115.0	133.0	127.0					17																	66883567		2203	4300	6503	SO:0001819	synonymous_variant	10351			AB020629	CCDS11680.1, CCDS74138.1, CCDS74139.1	17q24	2012-03-14			ENSG00000141338	ENSG00000141338		"""ATP binding cassette transporters / subfamily A"""	38	protein-coding gene	gene with protein product		612505					Standard	XM_005256938		Approved	KIAA0822	uc002jhp.3	O94911		ENST00000269080.2:c.3105C>G	17.37:g.66883567G>C		Somatic		WXS	Illumina HiSeq	Phase_I	A1L3U3|C9JQE6|Q86WW0	Silent	SNP	ENST00000269080.2	37	CCDS11680.1																																																																																				0.418	ABCA8-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000450172.1		NM_007168	
ACTR6	64431	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	100601498	100601498	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-4923-01A-01D-1429-08	TCGA-CJ-4923-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19171a1a-6483-4bf3-b0b4-8cd441303c55	f394a92b-22c4-43d1-991b-b32a270d1cba	g.chr12:100601498A>G	ENST00000188312.2	+	4	1078	c.313A>G	c.(313-315)Att>Gtt	p.I105V	ACTR6_ENST00000551617.1_Missense_Mutation_p.I23V|ACTR6_ENST00000546902.1_Missense_Mutation_p.I23V|ACTR6_ENST00000552376.1_Missense_Mutation_p.I105V	NM_022496.4	NP_071941.1	Q9GZN1	ARP6_HUMAN	ARP6 actin-related protein 6 homolog (yeast)	105						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)		p.I105V(1)		autonomic_ganglia(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|ovary(2)|skin(1)	14						CTTCACTTCAATTCAAGAATC	0.264																																																	1	Substitution - Missense(1)	kidney(1)											49.0	53.0	52.0					12																	100601498		2197	4285	6482	SO:0001583	missense	64431			AF212251	CCDS9074.1	12q23.1	2012-07-09			ENSG00000075089	ENSG00000075089			24025	protein-coding gene	gene with protein product						11368909	Standard	NM_022496		Approved	ARP6, FLJ13433	uc001thb.2	Q9GZN1	OTTHUMG00000170245	ENST00000188312.2:c.313A>G	12.37:g.100601498A>G	ENSP00000188312:p.Ile105Val	Somatic		WXS	Illumina HiSeq	Phase_I	B3KW37|B4DLG9|Q53GH2|Q9BY39|Q9H8H6	Missense_Mutation	SNP	ENST00000188312.2	37	CCDS9074.1	.	.	.	.	.	.	.	.	.	.	A	16.26	3.073872	0.55646	.	.	ENSG00000075089	ENST00000551652;ENST00000188312;ENST00000546902;ENST00000552376;ENST00000551617	D;D;D;D;D	0.97138	-4.26;-4.26;-4.26;-4.26;-4.26	5.57	5.57	0.84162	.	0.046201	0.85682	D	0.000000	D	0.94262	0.8157	L	0.51422	1.61	0.80722	D	1	B;P;B;B	0.42556	0.246;0.783;0.374;0.428	B;B;B;B	0.39562	0.268;0.303;0.102;0.164	D	0.93649	0.6971	10	0.05721	T	0.95	.	15.7359	0.77842	1.0:0.0:0.0:0.0	.	105;23;105;105	B4DLG9;F8VSD1;F8W057;Q9GZN1	.;.;.;ARP6_HUMAN	V	117;105;23;105;23	ENSP00000448508:I117V;ENSP00000188312:I105V;ENSP00000448669:I23V;ENSP00000447237:I105V;ENSP00000448356:I23V	ENSP00000188312:I105V	I	+	1	0	ACTR6	99125629	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.166000	0.94766	2.103000	0.63969	0.528000	0.53228	ATT		0.264	ACTR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408159.1		NM_022496	
AKAP17A	8227	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	1712782	1712782	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-4923-01A-01D-1429-08	TCGA-CJ-4923-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19171a1a-6483-4bf3-b0b4-8cd441303c55	f394a92b-22c4-43d1-991b-b32a270d1cba	g.chrX:1712782G>A	ENST00000313871.3	+	2	623	c.427G>A	c.(427-429)Ggg>Agg	p.G143R	AKAP17A_ENST00000381261.3_Missense_Mutation_p.G143R	NM_005088.2	NP_005079.2	Q02040	AK17A_HUMAN	A kinase (PRKA) anchor protein 17A	143					B cell activation (GO:0042113)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|signal transduction (GO:0007165)	nuclear speck (GO:0016607)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein kinase A binding (GO:0051018)	p.G143R(1)		breast(2)|endometrium(5)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)	26						GACCCTGCCGGGGGAGCGGCC	0.667																																																	1	Substitution - Missense(1)	kidney(1)											113.0	128.0	123.0					X																	1712782		2203	4296	6499	SO:0001583	missense	8227			L03426	CCDS14116.1	Xp22.33 and Yp11.32	2010-09-08	2010-09-08	2010-09-08	ENSG00000197976	ENSG00000197976		"""Pseudoautosomal regions / PAR1"", ""A-kinase anchor proteins"""	18783	protein-coding gene	gene with protein product		312095, 465000	"""chromosome X and Y open reading frame 3"", ""splicing factor, arginine/serine-rich 17A"""	CXYorf3, SFRS17A		9736779, 1438229, 19840947	Standard	NR_027383		Approved	XE7, XE7Y, DXYS155E, MGC39904, 721P, CCDC133	uc004cqa.3	Q02040	OTTHUMG00000021063	ENST00000313871.3:c.427G>A	X.37:g.1712782G>A	ENSP00000324827:p.Gly143Arg	Somatic		WXS	Illumina HiSeq	Phase_I	Q02832|Q2TB98|Q5JQ74|Q5JQ76|Q8N6U9	Missense_Mutation	SNP	ENST00000313871.3	37	CCDS14116.1	.	.	.	.	.	.	.	.	.	.	g	10.01	1.233643	0.22626	.	.	ENSG00000197976	ENST00000313871;ENST00000381261	T;T	0.46819	0.86;0.86	1.86	1.86	0.25419	.	0.000000	0.64402	U	0.000001	T	0.65112	0.2660	.	.	.	0.25136	N	0.990537	D;D	0.89917	0.985;1.0	P;D	0.76575	0.779;0.988	T	0.58702	-0.7590	9	0.87932	D	0	-25.2803	12.1799	0.54206	0.0:0.0:1.0:0.0	.	143;143	Q02040-3;Q02040	.;AK17A_HUMAN	R	143	ENSP00000324827:G143R;ENSP00000370660:G143R	ENSP00000324827:G143R	G	+	1	0	AKAP17A	1672782	1.000000	0.71417	0.009000	0.14445	0.475000	0.33008	7.091000	0.76923	0.717000	0.32145	0.100000	0.15512	GGG		0.667	AKAP17A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055609.2		NM_005088	
ARSD	414	hgsc.bcm.edu	37	X	2835964	2835964	+	Silent	SNP	G	G	A	rs73632972	byFrequency	TCGA-CJ-4923-01A-01D-1429-08	TCGA-CJ-4923-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19171a1a-6483-4bf3-b0b4-8cd441303c55	f394a92b-22c4-43d1-991b-b32a270d1cba	g.chrX:2835964G>A	ENST00000381154.1	-	5	819	c.744C>T	c.(742-744)ttC>ttT	p.F248F	ARSD_ENST00000217890.6_5'UTR	NM_001669.3	NP_001660.2	P51689	ARSD_HUMAN	arylsulfatase D	248					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			large_intestine(3)|lung(3)	6		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				GCACAAACCCGAAGGAGGAGT	0.557																																																	0													35.0	38.0	37.0					X																	2835964		2203	4300	6503	SO:0001819	synonymous_variant	414			X83572	CCDS35196.1	Xp22.3	2013-02-14			ENSG00000006756	ENSG00000006756		"""Arylsulfatase family"""	717	protein-coding gene	gene with protein product		300002				7720070	Standard	NM_001669		Approved		uc004cqy.3	P51689	OTTHUMG00000021077	ENST00000381154.1:c.744C>T	X.37:g.2835964G>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q9UHJ8	Silent	SNP	ENST00000381154.1	37	CCDS35196.1																																																																																				0.557	ARSD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055636.1			
BAP1	8314	broad.mit.edu	37	3	52437168	52437168	+	Nonsense_Mutation	SNP	T	T	A			TCGA-CJ-4923-01A-01D-1429-08	TCGA-CJ-4923-11A-01D-1429-08	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	19171a1a-6483-4bf3-b0b4-8cd441303c55	f394a92b-22c4-43d1-991b-b32a270d1cba	g.chr3:52437168T>A	ENST00000460680.1	-	14	2347	c.1876A>T	c.(1876-1878)Aaa>Taa	p.K626*	BAP1_ENST00000296288.5_Nonsense_Mutation_p.K608*	NM_004656.2	NP_004647.1	Q99496	RING2_HUMAN	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)	0					anterior/posterior axis specification (GO:0009948)|gastrulation with mouth forming second (GO:0001702)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K119 monoubiquitination (GO:0036353)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|MLL1 complex (GO:0071339)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|RING-like zinc finger domain binding (GO:0071535)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.K626*(1)		NS(1)|breast(4)|endometrium(3)|eye(42)|kidney(60)|large_intestine(3)|lung(9)|ovary(4)|pleura(39)|prostate(4)|skin(9)|urinary_tract(2)	180				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		GGTGAGTATTTCTCCCCACTC	0.592			"""N, Mis, F, S, O"""		"""uveal melanoma, breast, NSCLC, RCC"""	"""mesothelioma, uveal melanoma"""																															GBM(101;493 1458 7992 21037 25532)			Rec	yes		3	3p21.31-p21.2	8314	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)		E	1	Substitution - Nonsense(1)	kidney(1)											103.0	102.0	102.0					3																	52437168		2203	4300	6503	SO:0001587	stop_gained	8314			AF045581	CCDS2853.1	3p21.31-p21.2	2014-09-17			ENSG00000163930	ENSG00000163930			950	protein-coding gene	gene with protein product		603089				9528852	Standard	NM_004656		Approved	hucep-6, KIAA0272, UCHL2	uc003ddx.4	Q92560	OTTHUMG00000158392	ENST00000460680.1:c.1876A>T	3.37:g.52437168T>A	ENSP00000417132:p.Lys626*	Somatic		WXS	Illumina GAIIx	Phase_I	B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	Nonsense_Mutation	SNP	ENST00000460680.1	37	CCDS2853.1	.	.	.	.	.	.	.	.	.	.	T	21.4	4.146564	0.77888	.	.	ENSG00000163930	ENST00000460680;ENST00000296288;ENST00000478368	.	.	.	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.9642	0.71179	0.0:0.0:0.0:1.0	.	.	.	.	X	626;608;127	.	ENSP00000296288:K608X	K	-	1	0	BAP1	52412208	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.172000	0.71932	2.267000	0.75376	0.533000	0.62120	AAA		0.592	BAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350895.1			
BIRC3	330	broad.mit.edu	37	11	102206699	102206699	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-4923-01A-01D-1429-08	TCGA-CJ-4923-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19171a1a-6483-4bf3-b0b4-8cd441303c55	f394a92b-22c4-43d1-991b-b32a270d1cba	g.chr11:102206699G>A	ENST00000263464.3	+	7	4077	c.1327G>A	c.(1327-1329)Gat>Aat	p.D443N	BIRC3_ENST00000532808.1_Missense_Mutation_p.D443N	NM_001165.4	NP_001156.1	Q13489	BIRC3_HUMAN	baculoviral IAP repeat containing 3	443	CARD. {ECO:0000255|PROSITE- ProRule:PRU00046}.	Breakpoint for translocation to form BIRC3-MALT1.			apoptotic process (GO:0006915)|cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of necroptotic process (GO:0060546)|negative regulation of phosphorylation (GO:0042326)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of protein ubiquitination (GO:0031398)|protein heterooligomerization (GO:0051291)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of cysteine-type endopeptidase activity (GO:2000116)|regulation of inflammatory response (GO:0050727)|regulation of innate immune response (GO:0045088)|regulation of necroptotic process (GO:0060544)|regulation of nucleotide-binding oligomerization domain containing signaling pathway (GO:0070424)|regulation of RIG-I signaling pathway (GO:0039535)|regulation of toll-like receptor signaling pathway (GO:0034121)|spermatogenesis (GO:0007283)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane raft (GO:0045121)|nucleus (GO:0005634)|protein complex (GO:0043234)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.D443N(1)		endometrium(3)|kidney(2)|large_intestine(7)|lung(5)|ovary(3)|skin(1)	21	all_cancers(8;0.00044)|all_epithelial(12;0.00348)|Lung NSC(15;0.227)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0093)	Lung(13;0.109)|LUSC - Lung squamous cell carcinoma(19;0.151)	BRCA - Breast invasive adenocarcinoma(274;0.0146)		TTATAAAGATGATTTATTATT	0.303			T	MALT1	MALT																																			Dom	yes		11	11q22-q23	330	baculoviral IAP repeat-containing 3		L	1	Substitution - Missense(1)	kidney(1)											55.0	61.0	59.0					11																	102206699		2202	4294	6496	SO:0001583	missense	330			L49432	CCDS8315.1	11q22	2011-01-25	2011-01-25			ENSG00000023445		"""Baculoviral IAP repeat containing"", ""RING-type (C3HC4) zinc fingers"""	591	protein-coding gene	gene with protein product	"""apoptosis inhibitor 2"", ""TNFR2-TRAF signaling complex protein"", ""mammalian IAP homolog C"", ""inhibitor of apoptosis protein 1"""	601721	"""baculoviral IAP repeat-containing 3"""	API2		8552191, 8548810	Standard	NM_001165		Approved	cIAP2, hiap-1, MIHC, RNF49, MALT2, c-IAP2	uc001pgx.3	Q13489		ENST00000263464.3:c.1327G>A	11.37:g.102206699G>A	ENSP00000263464:p.Asp443Asn	Somatic		WXS	Illumina GAIIx	Phase_I	Q16628|Q9HC27|Q9UP46	Missense_Mutation	SNP	ENST00000263464.3	37	CCDS8315.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.952743	0.73787	.	.	ENSG00000023445	ENST00000263464;ENST00000532808;ENST00000532609	T;T	0.26810	1.71;1.71	5.27	5.27	0.74061	DEATH-like (1);Caspase Recruitment (2);	0.043138	0.85682	D	0.000000	T	0.55513	0.1925	M	0.83312	2.635	0.80722	D	1	D	0.64830	0.994	D	0.73708	0.981	T	0.53837	-0.8382	10	0.37606	T	0.19	.	19.0985	0.93265	0.0:0.0:1.0:0.0	.	443	Q13489	BIRC3_HUMAN	N	443;443;211	ENSP00000263464:D443N;ENSP00000432907:D443N	ENSP00000263464:D443N	D	+	1	0	BIRC3	101711909	1.000000	0.71417	0.303000	0.25071	0.566000	0.35808	6.670000	0.74467	2.751000	0.94390	0.650000	0.86243	GAT		0.303	BIRC3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394159.1		NM_001165	
BLM	641	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	91292871	91292871	+	Missense_Mutation	SNP	A	A	C			TCGA-CJ-4923-01A-01D-1429-08	TCGA-CJ-4923-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19171a1a-6483-4bf3-b0b4-8cd441303c55	f394a92b-22c4-43d1-991b-b32a270d1cba	g.chr15:91292871A>C	ENST00000355112.3	+	3	491	c.373A>C	c.(373-375)Aca>Cca	p.T125P	BLM_ENST00000560509.1_Missense_Mutation_p.T125P	NM_000057.2	NP_000048.1	P54132	BLM_HUMAN	Bloom syndrome, RecQ helicase-like	125					alpha-beta T cell differentiation (GO:0046632)|ATP catabolic process (GO:0006200)|cellular response to camptothecin (GO:0072757)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hydroxyurea (GO:0072711)|cellular response to ionizing radiation (GO:0071479)|DNA double-strand break processing (GO:0000729)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA strand renaturation (GO:0000733)|double-strand break repair via homologous recombination (GO:0000724)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of cell division (GO:0051782)|negative regulation of DNA recombination (GO:0045910)|negative regulation of mitotic recombination (GO:0045950)|negative regulation of thymocyte apoptotic process (GO:0070244)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of transcription, DNA-templated (GO:0045893)|protein oligomerization (GO:0051259)|regulation of binding (GO:0051098)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|replication fork processing (GO:0031297)|replication fork protection (GO:0048478)|response to X-ray (GO:0010165)|telomere maintenance (GO:0000723)	cytoplasm (GO:0005737)|lateral element (GO:0000800)|male germ cell nucleus (GO:0001673)|nuclear chromosome (GO:0000228)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleus (GO:0005634)|PML body (GO:0016605)|pronucleus (GO:0045120)|replication fork (GO:0005657)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent helicase activity (GO:0008026)|ATPase activity (GO:0016887)|bubble DNA binding (GO:0000405)|four-way junction helicase activity (GO:0009378)|G-quadruplex DNA binding (GO:0051880)|helicase activity (GO:0004386)|p53 binding (GO:0002039)|single-stranded DNA binding (GO:0003697)	p.T125P(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(11)|liver(4)|lung(9)|ovary(6)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	Lung NSC(78;0.0875)|all_lung(78;0.109)		Lung(145;0.189)			TACCCAAAACACACCAACTGT	0.403			"""Mis, N, F"""			"""leukemia, lymphoma, skin squamous cell , other cancers"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Bloom syndrome																														yes	Rec		Bloom Syndrome	15	15q26.1	641	Bloom Syndrome		"""L, E"""	1	Substitution - Missense(1)	kidney(1)											67.0	67.0	67.0					15																	91292871		2198	4298	6496	SO:0001583	missense	641	Familial Cancer Database		U39817	CCDS10363.1, CCDS73782.1	15q26.1	2014-09-17	2009-03-19		ENSG00000197299	ENSG00000197299			1058	protein-coding gene	gene with protein product		604610	"""Bloom syndrome"""			9388193	Standard	NM_000057		Approved	BS, RECQL3, RECQ2	uc002bpr.3	P54132	OTTHUMG00000149834	ENST00000355112.3:c.373A>C	15.37:g.91292871A>C	ENSP00000347232:p.Thr125Pro	Somatic		WXS	Illumina HiSeq	Phase_I	Q52M96	Missense_Mutation	SNP	ENST00000355112.3	37	CCDS10363.1	.	.	.	.	.	.	.	.	.	.	A	13.31	2.197685	0.38806	.	.	ENSG00000197299	ENST00000355112	T	0.44482	0.92	6.02	4.89	0.63831	.	0.551000	0.18395	N	0.142549	T	0.39172	0.1068	L	0.55481	1.735	0.09310	N	1	P;P	0.49961	0.93;0.93	P;P	0.44860	0.462;0.462	T	0.23583	-1.0184	10	0.30854	T	0.27	-0.3649	7.8422	0.29406	0.9009:0.0:0.0991:0.0	.	125;125	B2RAN0;P54132	.;BLM_HUMAN	P	125	ENSP00000347232:T125P	ENSP00000347232:T125P	T	+	1	0	BLM	89093875	0.040000	0.19996	0.014000	0.15608	0.018000	0.09664	2.344000	0.44010	1.093000	0.41377	0.533000	0.62120	ACA		0.403	BLM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313495.1			
NCOR1P1	149934	broad.mit.edu	37	20	26084148	26084148	+	RNA	SNP	T	T	C			TCGA-CJ-4923-01A-01D-1429-08	TCGA-CJ-4923-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19171a1a-6483-4bf3-b0b4-8cd441303c55	f394a92b-22c4-43d1-991b-b32a270d1cba	g.chr20:26084148T>C	ENST00000478176.1	-	0	309					NR_003678.1		Q9H4R4	CT191_HUMAN	nuclear receptor corepressor 1 pseudogene 1									p.I90V(1)									AGTTTAAGGATCTGCTGTTCT	0.318																																																	1	Substitution - Missense(1)	kidney(1)											88.0	68.0	74.0					20																	26084148		692	1590	2282			0			AL391119		20p11.1	2011-09-16	2011-09-16	2011-09-16	ENSG00000240108	ENSG00000240108			16724	pseudogene	pseudogene			"""chromosome 20 open reading frame 191"""	C20orf191			Standard	NR_003678		Approved	bB329D4.2	uc002wvj.5	Q9H4R4	OTTHUMG00000032145		20.37:g.26084148T>C		Somatic		WXS	Illumina GAIIx	Phase_I	A2RUA0	Missense_Mutation	SNP	ENST00000478176.1	37																																																																																					0.318	NCOR1P1-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000078478.2			
ANKRD30BP2	149992	broad.mit.edu	37	21	14439197	14439197	+	IGR	SNP	G	G	C	rs184573568		TCGA-CJ-4923-01A-01D-1429-08	TCGA-CJ-4923-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19171a1a-6483-4bf3-b0b4-8cd441303c55	f394a92b-22c4-43d1-991b-b32a270d1cba	g.chr21:14439197G>C								RNU6-614P (19187 upstream) : AL050302.1 (302733 downstream)																							AAGAAGAAGAGAAGAGAAGAA	0.289																																																	0																																										SO:0001628	intergenic_variant	0																															21.37:g.14439197G>C		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP		37																																																																																				0	0.289									
CHRM2	1129	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	136700123	136700123	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-4923-01A-01D-1429-08	TCGA-CJ-4923-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19171a1a-6483-4bf3-b0b4-8cd441303c55	f394a92b-22c4-43d1-991b-b32a270d1cba	g.chr7:136700123G>A	ENST00000445907.2	+	3	1039	c.511G>A	c.(511-513)Gtg>Atg	p.V171M	CHRM2_ENST00000397608.3_Missense_Mutation_p.V171M|hsa-mir-490_ENST00000593789.1_RNA|hsa-mir-490_ENST00000439694.1_RNA|hsa-mir-490_ENST00000598184.1_RNA|CHRM2_ENST00000402486.3_Missense_Mutation_p.V171M|CHRM2_ENST00000401861.1_Missense_Mutation_p.V171M|hsa-mir-490_ENST00000597642.1_RNA|hsa-mir-490_ENST00000425981.2_RNA|hsa-mir-490_ENST00000586239.1_RNA|hsa-mir-490_ENST00000592183.1_RNA|CHRM2_ENST00000453373.1_Missense_Mutation_p.V171M|CHRM2_ENST00000320658.5_Missense_Mutation_p.V171M	NM_001006627.1|NM_001006629.1	NP_001006628.1|NP_001006630.1	P08172	ACM2_HUMAN	cholinergic receptor, muscarinic 2	171					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|nervous system development (GO:0007399)|phospholipase C-activating G-protein coupled acetylcholine receptor signaling pathway (GO:0007207)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|regulation of heart contraction (GO:0008016)|response to virus (GO:0009615)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	G-protein coupled acetylcholine receptor activity (GO:0016907)	p.V171M(1)		central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(13)|liver(1)|lung(29)|ovary(4)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	68					Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Anisotropine Methylbromide(DB00517)|Aripiprazole(DB01238)|Atropine(DB00572)|Bethanechol(DB01019)|Brompheniramine(DB00835)|Carbachol(DB00411)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Cocaine(DB00907)|Cryptenamine(DB00785)|Cyproheptadine(DB00434)|Darifenacin(DB00496)|Desipramine(DB01151)|Dicyclomine(DB00804)|Dimetindene(DB08801)|Diphenidol(DB01231)|Disopyramide(DB00280)|Doxacurium chloride(DB01135)|Doxepin(DB01142)|Ethopropazine(DB00392)|Fesoterodine(DB06702)|Flavoxate(DB01148)|Gallamine Triethiodide(DB00483)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Methylscopolamine bromide(DB00462)|Metixene(DB00340)|Metocurine(DB01336)|Mivacurium(DB01226)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pancuronium(DB01337)|Paroxetine(DB00715)|Pethidine(DB00454)|Pilocarpine(DB01085)|Pipecuronium(DB01338)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Rocuronium(DB00728)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Tiotropium(DB01409)|Tolterodine(DB01036)|Triflupromazine(DB00508)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Ziprasidone(DB00246)	GGTGAGAACTGTGGAGGATGG	0.483																																																	1	Substitution - Missense(1)	kidney(1)											113.0	107.0	109.0					7																	136700123		2203	4300	6503	SO:0001583	missense	1129				CCDS5843.1	7q35-q36	2014-09-17			ENSG00000181072	ENSG00000181072		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1951	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 2"""	118493					Standard	NM_000739		Approved		uc003vtl.1	P08172	OTTHUMG00000155658	ENST00000445907.2:c.511G>A	7.37:g.136700123G>A	ENSP00000399745:p.Val171Met	Somatic		WXS	Illumina HiSeq	Phase_I	Q4VBK6|Q9P1X9	Missense_Mutation	SNP	ENST00000445907.2	37	CCDS5843.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.030135	0.75504	.	.	ENSG00000181072	ENST00000445907;ENST00000453373;ENST00000320658;ENST00000397608;ENST00000402486;ENST00000401861	T;T;T;T;T;T	0.38560	1.13;1.13;1.13;1.13;1.13;1.13	5.75	5.75	0.90469	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.67767	0.2928	M	0.77406	2.37	0.80722	D	1	D	0.76494	0.999	D	0.73380	0.98	T	0.68857	-0.5298	10	0.59425	D	0.04	-17.8262	19.9598	0.97242	0.0:0.0:1.0:0.0	.	171	P08172	ACM2_HUMAN	M	171	ENSP00000399745:V171M;ENSP00000415386:V171M;ENSP00000319984:V171M;ENSP00000380733:V171M;ENSP00000384937:V171M;ENSP00000384401:V171M	ENSP00000319984:V171M	V	+	1	0	CHRM2	136350663	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.807000	0.99171	2.716000	0.92895	0.655000	0.94253	GTG		0.483	CHRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341010.1			
COBLL1	22837	broad.mit.edu;hgsc.bcm.edu	37	2	165551129	165551129	+	Missense_Mutation	SNP	A	A	C			TCGA-CJ-4923-01A-01D-1429-08	TCGA-CJ-4923-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19171a1a-6483-4bf3-b0b4-8cd441303c55	f394a92b-22c4-43d1-991b-b32a270d1cba	g.chr2:165551129A>C	ENST00000392717.2	-	13	3005	c.3001T>G	c.(3001-3003)Tct>Gct	p.S1001A	COBLL1_ENST00000342193.4_Missense_Mutation_p.S963A|COBLL1_ENST00000194871.6_Missense_Mutation_p.S1030A|COBLL1_ENST00000409184.3_Missense_Mutation_p.S963A|COBLL1_ENST00000375458.2_Missense_Mutation_p.S925A			Q53SF7	COBL1_HUMAN	cordon-bleu WH2 repeat protein-like 1	1001						extracellular vesicular exosome (GO:0070062)		p.S963A(1)		central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(12)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	47						TGTGGAACAGAGTGAGGCATT	0.478																																																	1	Substitution - Missense(1)	kidney(1)											50.0	52.0	51.0					2																	165551129		2203	4300	6503	SO:0001583	missense	22837			AB023194	CCDS2223.2, CCDS63045.1	2q24.3	2012-12-07	2012-12-07		ENSG00000082438	ENSG00000082438			23571	protein-coding gene	gene with protein product		610318	"""COBL-like 1"""				Standard	NM_001278458		Approved	KIAA0977	uc002ucp.3	Q53SF7	OTTHUMG00000074019	ENST00000392717.2:c.3001T>G	2.37:g.165551129A>C	ENSP00000376478:p.Ser1001Ala	Somatic		WXS	Illumina HiSeq	Phase_I	A6NMZ3|Q6IQ33|Q7Z3I6|Q9BRH4|Q9UG88|Q9Y2I3	Missense_Mutation	SNP	ENST00000392717.2	37		.	.	.	.	.	.	.	.	.	.	A	0.004	-2.377489	0.00207	.	.	ENSG00000082438	ENST00000375458;ENST00000342193;ENST00000409184;ENST00000392717;ENST00000194871	.	.	.	5.41	0.128	0.14733	.	1.790450	0.02433	N	0.083814	T	0.33933	0.0880	L	0.50333	1.59	0.09310	N	1	B;B;B	0.22146	0.031;0.065;0.052	B;B;B	0.17433	0.013;0.018;0.016	T	0.08911	-1.0699	9	0.08837	T	0.75	0.0323	5.6518	0.17620	0.4094:0.2436:0.347:0.0	.	1001;1030;963	Q53SF7;B7Z2P5;Q53SF7-2	COBL1_HUMAN;.;.	A	925;963;963;1001;1030	.	ENSP00000194871:S1030A	S	-	1	0	COBLL1	165259375	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-0.142000	0.10311	0.061000	0.16311	0.533000	0.62120	TCT		0.478	COBLL1-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding			NM_014900	
COG8	84342	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	69368915	69368915	+	Missense_Mutation	SNP	T	T	C			TCGA-CJ-4923-01A-01D-1429-08	TCGA-CJ-4923-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19171a1a-6483-4bf3-b0b4-8cd441303c55	f394a92b-22c4-43d1-991b-b32a270d1cba	g.chr16:69368915T>C	ENST00000306875.4	-	3	1036	c.922A>G	c.(922-924)Act>Gct	p.T308A	COG8_ENST00000562081.1_Missense_Mutation_p.T308A|RP11-343C2.12_ENST00000562949.1_5'Flank	NM_032382.4	NP_115758.3	Q96MW5	COG8_HUMAN	component of oligomeric golgi complex 8	308					protein transport (GO:0015031)	Golgi transport complex (GO:0017119)|membrane (GO:0016020)		p.T308A(1)		breast(3)|kidney(1)|large_intestine(2)|ovary(2)|skin(1)	9						TCATTCACAGTGTGCTCACCC	0.577																																																	1	Substitution - Missense(1)	kidney(1)											64.0	54.0	58.0					16																	69368915		2198	4300	6498	SO:0001583	missense	84342			AK025968	CCDS10876.1	16q22.1	2011-05-31			ENSG00000213380	ENSG00000213380		"""Components of oligomeric golgi complex"""	18623	protein-coding gene	gene with protein product		606979				11980916	Standard	NM_032382		Approved	FLJ22315, DOR1	uc002ewy.2	Q96MW5	OTTHUMG00000154277	ENST00000306875.4:c.922A>G	16.37:g.69368915T>C	ENSP00000305459:p.Thr308Ala	Somatic		WXS	Illumina HiSeq	Phase_I	Q0VAK2|Q8WVV6|Q9H6F8	Missense_Mutation	SNP	ENST00000306875.4	37	CCDS10876.1	.	.	.	.	.	.	.	.	.	.	T	5.925	0.354754	0.11239	.	.	ENSG00000213380	ENST00000306875	T	0.41400	1.0	5.93	2.26	0.28386	Cullin repeat-like-containing domain (1);	0.630202	0.18060	N	0.152991	T	0.12305	0.0299	N	0.02539	-0.55	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.14578	0.011;0.007	T	0.24012	-1.0172	10	0.07644	T	0.81	-9.987	1.3285	0.02130	0.335:0.0806:0.2339:0.3505	.	335;308	B4DYU2;Q96MW5	.;COG8_HUMAN	A	308	ENSP00000305459:T308A	ENSP00000305459:T308A	T	-	1	0	COG8	67926416	0.099000	0.21834	0.161000	0.22692	0.892000	0.51952	0.258000	0.18387	1.021000	0.39600	0.460000	0.39030	ACT		0.577	COG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268948.2		NM_032382	
CPAMD8	27151	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	17039855	17039855	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-4923-01A-01D-1429-08	TCGA-CJ-4923-11A-01D-1429-08	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	19171a1a-6483-4bf3-b0b4-8cd441303c55	f394a92b-22c4-43d1-991b-b32a270d1cba	g.chr19:17039855G>T	ENST00000443236.1	-	24	3213	c.3182C>A	c.(3181-3183)aCc>aAc	p.T1061N		NM_015692.2	NP_056507.2	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain containing 8	1014						extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.T1061N(1)		breast(11)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(14)|ovary(7)|pancreas(2)|prostate(4)|skin(5)	82						CATCTTGCTGGTGGAGATCCA	0.582																																																	1	Substitution - Missense(1)	kidney(1)											49.0	51.0	50.0					19																	17039855		1988	4162	6150	SO:0001583	missense	27151			AY101765	CCDS42519.1	19p13.12	2008-02-05			ENSG00000160111	ENSG00000160111			23228	protein-coding gene	gene with protein product		608841				10574462	Standard	NM_015692		Approved	KIAA1283, VIP, K-CAP	uc002nfb.3	Q8IZJ3	OTTHUMG00000133549	ENST00000443236.1:c.3182C>A	19.37:g.17039855G>T	ENSP00000402505:p.Thr1061Asn	Somatic		WXS	Illumina HiSeq	Phase_I	Q8NC09|Q9ULD7	Missense_Mutation	SNP	ENST00000443236.1	37	CCDS42519.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.27|12.27	1.887307|1.887307	0.33348|0.33348	.|.	.|.	ENSG00000160111|ENSG00000160111	ENST00000443236|ENST00000291440	.|.	.|.	.|.	3.51|3.51	2.13|2.13	0.27403|0.27403	.|Farnesoic acid O-methyl transferase (1);	.|1.195030	.|0.06447	.|U	.|0.727106	T|T	0.38825|0.38825	0.1055|0.1055	N|N	0.22421|0.22421	0.69|0.69	0.49798|0.49798	D|D	0.999826|0.999826	.|P	.|0.38677	.|0.642	.|B	.|0.37550	.|0.253	T|T	0.21999|0.21999	-1.0229|-1.0229	5|9	.|0.17369	.|T	.|0.5	.|.	11.0191|11.0191	0.47707|0.47707	0.1834:0.0:0.8166:0.0|0.1834:0.0:0.8166:0.0	.|.	.|1014	.|Q8IZJ3	.|CPMD8_HUMAN	T|N	1072|1061	.|.	.|ENSP00000291440:T1061N	P|T	-|-	1|2	0|0	CPAMD8|CPAMD8	16900855|16900855	0.725000|0.725000	0.28048|0.28048	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	0.849000|0.849000	0.27723|0.27723	1.526000|1.526000	0.49068|0.49068	0.655000|0.655000	0.94253|0.94253	CCA|ACC		0.582	CPAMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257531.2		NM_015692	
CRY1	1407	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	107393578	107393578	+	Silent	SNP	G	G	A			TCGA-CJ-4923-01A-01D-1429-08	TCGA-CJ-4923-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19171a1a-6483-4bf3-b0b4-8cd441303c55	f394a92b-22c4-43d1-991b-b32a270d1cba	g.chr12:107393578G>A	ENST00000008527.5	-	7	1755	c.888C>T	c.(886-888)ttC>ttT	p.F296F		NM_004075.4	NP_004066.1	Q16526	CRY1_HUMAN	cryptochrome circadian clock 1	296					blue light signaling pathway (GO:0009785)|circadian regulation of gene expression (GO:0032922)|DNA damage induced protein phosphorylation (GO:0006975)|DNA repair (GO:0006281)|entrainment of circadian clock by photoperiod (GO:0043153)|gluconeogenesis (GO:0006094)|glucose homeostasis (GO:0042593)|lipid storage (GO:0019915)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of glucocorticoid secretion (GO:2000850)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein-chromophore linkage (GO:0018298)|regulation of circadian rhythm (GO:0042752)|regulation of DNA damage checkpoint (GO:2000001)|response to glucagon (GO:0033762)|response to insulin (GO:0032868)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	blue light photoreceptor activity (GO:0009882)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|DNA photolyase activity (GO:0003913)|double-stranded DNA binding (GO:0003690)|nuclear hormone receptor binding (GO:0035257)|nucleotide binding (GO:0000166)|phosphatase binding (GO:0019902)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin binding (GO:0043130)	p.F296F(1)		NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(11)|ovary(3)|skin(1)	29						CTGCTGTATAGAAAAATTCAC	0.373																																																	1	Substitution - coding silent(1)	kidney(1)											44.0	47.0	46.0					12																	107393578		2202	4300	6502	SO:0001819	synonymous_variant	1407			BC030519	CCDS9112.1	12q23-q24.1	2014-01-17	2014-01-17		ENSG00000008405	ENSG00000008405			2384	protein-coding gene	gene with protein product		601933	"""cryptochrome 1 (photolyase-like)"""	PHLL1		8921389	Standard	NM_004075		Approved		uc001tmi.4	Q16526	OTTHUMG00000170005	ENST00000008527.5:c.888C>T	12.37:g.107393578G>A		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000008527.5	37	CCDS9112.1																																																																																				0.373	CRY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406827.1		NM_004075	
DCHS2	54798	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	155155839	155155839	+	Missense_Mutation	SNP	T	T	C			TCGA-CJ-4923-01A-01D-1429-08	TCGA-CJ-4923-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19171a1a-6483-4bf3-b0b4-8cd441303c55	f394a92b-22c4-43d1-991b-b32a270d1cba	g.chr4:155155839T>C	ENST00000357232.4	-	25	8599	c.8600A>G	c.(8599-8601)gAa>gGa	p.E2867G		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	2867					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.E2867G(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		AGTCATGCCTTCTGGCAGAGA	0.512																																																	1	Substitution - Missense(1)	kidney(1)											139.0	133.0	135.0					4																	155155839		2203	4300	6503	SO:0001583	missense	54798			BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.8600A>G	4.37:g.155155839T>C	ENSP00000349768:p.Glu2867Gly	Somatic		WXS	Illumina HiSeq	Phase_I	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	ENST00000357232.4	37	CCDS3785.1	.	.	.	.	.	.	.	.	.	.	T	12.68	2.011196	0.35511	.	.	ENSG00000197410	ENST00000357232	T	0.54866	0.55	5.93	3.56	0.40772	.	0.289760	0.30109	N	0.010395	T	0.33702	0.0872	L	0.36672	1.1	0.80722	D	1	P	0.35077	0.483	B	0.27887	0.084	T	0.11542	-1.0583	10	0.26408	T	0.33	.	6.7341	0.23399	0.1165:0.0:0.3304:0.5531	.	2867	Q6V1P9	PCD23_HUMAN	G	2867	ENSP00000349768:E2867G	ENSP00000349768:E2867G	E	-	2	0	DCHS2	155375289	0.995000	0.38212	0.939000	0.37840	0.432000	0.31715	2.314000	0.43743	2.258000	0.74832	0.533000	0.62120	GAA		0.512	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365281.2		NM_001142552	
DNAJC16	23341	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	15893684	15893684	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-4923-01A-01D-1429-08	TCGA-CJ-4923-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19171a1a-6483-4bf3-b0b4-8cd441303c55	f394a92b-22c4-43d1-991b-b32a270d1cba	g.chr1:15893684G>A	ENST00000375847.3	+	14	2033	c.1869G>A	c.(1867-1869)atG>atA	p.M623I	RP4-680D5.8_ENST00000606186.1_RNA|DNAJC16_ENST00000483270.1_3'UTR|DNAJC16_ENST00000375849.1_Missense_Mutation_p.M623I	NM_015291.2	NP_056106.1	Q9Y2G8	DJC16_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 16	623					cell redox homeostasis (GO:0045454)	integral component of membrane (GO:0016021)		p.M623I(1)		central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(7)|urinary_tract(1)	18		Colorectal(325;0.00108)|Renal(390;0.00145)|Breast(348;0.00173)|all_lung(284;0.00459)|Lung NSC(340;0.00499)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;9.18e-07)|COAD - Colon adenocarcinoma(227;4.5e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|STAD - Stomach adenocarcinoma(313;0.00774)|READ - Rectum adenocarcinoma(331;0.0657)		CAGGCCACATGAATGTGGTCC	0.453																																																	1	Substitution - Missense(1)	kidney(1)											172.0	151.0	158.0					1																	15893684		2203	4300	6503	SO:0001583	missense	23341			AB023179	CCDS30606.1, CCDS72710.1	1p36.1	2011-09-02			ENSG00000116138	ENSG00000116138		"""Heat shock proteins / DNAJ (HSP40)"""	29157	protein-coding gene	gene with protein product							Standard	NM_015291		Approved	KIAA0962	uc001aws.3	Q9Y2G8	OTTHUMG00000002358	ENST00000375847.3:c.1869G>A	1.37:g.15893684G>A	ENSP00000365007:p.Met623Ile	Somatic		WXS	Illumina HiSeq	Phase_I	Q68D57|Q86X32|Q8N5P4	Missense_Mutation	SNP	ENST00000375847.3	37	CCDS30606.1	.	.	.	.	.	.	.	.	.	.	G	12.32	1.902365	0.33628	.	.	ENSG00000116138	ENST00000375847;ENST00000375849	T;T	0.70282	-0.44;-0.47	5.67	5.67	0.87782	.	0.070501	0.85682	D	0.000000	T	0.53449	0.1797	N	0.17872	0.535	0.26362	N	0.977022	B	0.10296	0.003	B	0.06405	0.002	T	0.26430	-1.0103	10	0.10636	T	0.68	-36.5115	14.0109	0.64495	0.0:0.1514:0.8486:0.0	.	623	Q9Y2G8	DJC16_HUMAN	I	623	ENSP00000365007:M623I;ENSP00000365009:M623I	ENSP00000365007:M623I	M	+	3	0	DNAJC16	15766271	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.154000	0.42291	2.676000	0.91093	0.655000	0.94253	ATG		0.453	DNAJC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006764.1		NM_015291	
DYNC2H1	79659	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	103349892	103349892	+	Missense_Mutation	SNP	C	C	G			TCGA-CJ-4923-01A-01D-1429-08	TCGA-CJ-4923-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19171a1a-6483-4bf3-b0b4-8cd441303c55	f394a92b-22c4-43d1-991b-b32a270d1cba	g.chr11:103349892C>G	ENST00000375735.2	+	89	12979	c.12835C>G	c.(12835-12837)Cgt>Ggt	p.R4279G	DYNC2H1_ENST00000398093.3_Missense_Mutation_p.R4286G|DYNC2H1_ENST00000334267.7_Missense_Mutation_p.R892G	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	4279					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)	p.R892G(1)|p.R1719G(1)		NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		TGAAAGGGATCGTGTGGTTAC	0.398																																																	2	Substitution - Missense(2)	kidney(2)											119.0	119.0	119.0					11																	103349892		1965	4161	6126	SO:0001583	missense	79659			AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.12835C>G	11.37:g.103349892C>G	ENSP00000364887:p.Arg4279Gly	Somatic		WXS	Illumina HiSeq	Phase_I	O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Missense_Mutation	SNP	ENST00000375735.2	37	CCDS53701.1	.	.	.	.	.	.	.	.	.	.	C	8.425	0.847180	0.17034	.	.	ENSG00000187240	ENST00000375735;ENST00000334267;ENST00000398093;ENST00000533197	T;T;T;T	0.07800	3.16;3.16;3.16;3.16	4.8	2.88	0.33553	Dynein heavy chain (1);	0.227893	0.39274	N	0.001416	T	0.06325	0.0163	N	0.20807	0.61	0.35159	D	0.770466	P;B;B	0.36633	0.562;0.0;0.0	B;B;B	0.39503	0.301;0.006;0.003	T	0.43893	-0.9363	10	0.30078	T	0.28	.	10.0423	0.42166	0.0:0.7825:0.0:0.2175	.	892;4279;4286	Q8NCM8-3;Q8NCM8;Q8NCM8-2	.;DYHC2_HUMAN;.	G	4279;892;4286;196	ENSP00000364887:R4279G;ENSP00000334021:R892G;ENSP00000381167:R4286G;ENSP00000436736:R196G	ENSP00000334021:R892G	R	+	1	0	DYNC2H1	102855102	0.606000	0.26949	0.808000	0.32385	0.435000	0.31806	1.197000	0.32211	0.520000	0.28426	0.460000	0.39030	CGT		0.398	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387196.1		XM_370652	
E2F3	1871	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	20481597	20481597	+	Silent	SNP	C	C	A			TCGA-CJ-4923-01A-01D-1429-08	TCGA-CJ-4923-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19171a1a-6483-4bf3-b0b4-8cd441303c55	f394a92b-22c4-43d1-991b-b32a270d1cba	g.chr6:20481597C>A	ENST00000346618.3	+	3	732	c.666C>A	c.(664-666)acC>acA	p.T222T	E2F3_ENST00000535432.1_Silent_p.T91T	NM_001949.4	NP_001940.1	O00716	E2F3_HUMAN	E2F transcription factor 3	222	Leucine-zipper.				mitotic cell cycle (GO:0000278)|Notch signaling pathway (GO:0007219)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.T222T(1)		central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(3)	7	all_cancers(95;0.154)|all_epithelial(95;0.0585)|Breast(50;0.146)|Ovarian(93;0.148)		OV - Ovarian serous cystadenocarcinoma(7;0.0068)|all cancers(50;0.0148)|Epithelial(50;0.0562)			ATGATATCACCAACGTTCTGG	0.483																																																	1	Substitution - coding silent(1)	kidney(1)											170.0	171.0	170.0					6																	20481597		2203	4300	6503	SO:0001819	synonymous_variant	1871			Y10479	CCDS4545.1, CCDS58999.1	6p22	2008-08-29			ENSG00000112242	ENSG00000112242			3115	protein-coding gene	gene with protein product		600427				8246996	Standard	NM_001949		Approved		uc003nda.2	O00716	OTTHUMG00000016389	ENST00000346618.3:c.666C>A	6.37:g.20481597C>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q15000|Q68DT0|Q9BZ44	Silent	SNP	ENST00000346618.3	37	CCDS4545.1																																																																																				0.483	E2F3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043828.1			
EIF2AK4	440275	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	40308848	40308848	+	Missense_Mutation	SNP	T	T	C			TCGA-CJ-4923-01A-01D-1429-08	TCGA-CJ-4923-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19171a1a-6483-4bf3-b0b4-8cd441303c55	f394a92b-22c4-43d1-991b-b32a270d1cba	g.chr15:40308848T>C	ENST00000263791.5	+	28	3948	c.3905T>C	c.(3904-3906)tTg>tCg	p.L1302S	EIF2AK4_ENST00000382727.2_Missense_Mutation_p.L1274S	NM_001013703.2	NP_001013725.2	Q9P2K8	E2AK4_HUMAN	eukaryotic translation initiation factor 2 alpha kinase 4	1302	Histidyl-tRNA synthetase-like.				cellular response to starvation (GO:0009267)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of translation (GO:0017148)|protein phosphorylation (GO:0006468)|regulation of translational initiation (GO:0006446)|regulation of translational initiation in response to stress (GO:0043558)	cytosolic ribosome (GO:0022626)	ATP binding (GO:0005524)|eukaryotic translation initiation factor 2alpha kinase activity (GO:0004694)|protein serine/threonine kinase activity (GO:0004674)	p.L1302S(1)		NS(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(8)|lung(18)|ovary(1)|prostate(3)|skin(2)|stomach(1)	40		all_cancers(109;1.05e-19)|all_epithelial(112;4.38e-17)|Lung NSC(122;1.09e-12)|all_lung(180;3.56e-11)|Melanoma(134;0.0575)|Ovarian(310;0.0826)|Colorectal(260;0.119)		GBM - Glioblastoma multiforme(113;5.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0616)		GTTGGACTGTTGAAGAAACTC	0.378																																																	1	Substitution - Missense(1)	kidney(1)											113.0	105.0	107.0					15																	40308848		1882	4115	5997	SO:0001583	missense	440275			AB037759	CCDS42016.1	15q13.3	2008-08-18				ENSG00000128829			19687	protein-coding gene	gene with protein product		609280				10504407	Standard	XM_005254392		Approved	GCN2, KIAA1338	uc001zkm.1	Q9P2K8		ENST00000263791.5:c.3905T>C	15.37:g.40308848T>C	ENSP00000263791:p.Leu1302Ser	Somatic		WXS	Illumina HiSeq	Phase_I	C9JEC4|Q69YL7|Q6DC97|Q96GN6|Q9H5K1|Q9NSQ3|Q9NSZ5|Q9UJ56	Missense_Mutation	SNP	ENST00000263791.5	37	CCDS42016.1	.	.	.	.	.	.	.	.	.	.	T	22.7	4.327476	0.81690	.	.	ENSG00000128829	ENST00000263791;ENST00000382727	T;T	0.41400	1.0;1.0	5.52	5.52	0.82312	.	0.075799	0.52532	D	0.000061	T	0.65698	0.2716	M	0.76938	2.355	0.50632	D	0.999881	D	0.76494	0.999	D	0.73708	0.981	T	0.69335	-0.5172	10	0.59425	D	0.04	-7.7525	15.9507	0.79835	0.0:0.0:0.0:1.0	.	1302	Q9P2K8	E2AK4_HUMAN	S	1302;1274	ENSP00000263791:L1302S;ENSP00000372174:L1274S	ENSP00000263791:L1302S	L	+	2	0	EIF2AK4	38096140	1.000000	0.71417	0.996000	0.52242	0.996000	0.88848	7.898000	0.87363	2.221000	0.72209	0.523000	0.50628	TTG		0.378	EIF2AK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418395.1			
EVI2B	2124	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	29632303	29632303	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-4923-01A-01D-1429-08	TCGA-CJ-4923-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19171a1a-6483-4bf3-b0b4-8cd441303c55	f394a92b-22c4-43d1-991b-b32a270d1cba	g.chr17:29632303G>T	ENST00000330927.4	-	2	479	c.325C>A	c.(325-327)Cca>Aca	p.P109T	CTD-2370N5.3_ENST00000578584.1_3'UTR|NF1_ENST00000356175.3_Intron|EVI2B_ENST00000577894.1_Missense_Mutation_p.P109T|EVI2B_ENST00000544462.1_Missense_Mutation_p.P124T|NF1_ENST00000358273.4_Intron	NM_006495.3	NP_006486.3	P34910	EVI2B_HUMAN	ecotropic viral integration site 2B	109						integral component of plasma membrane (GO:0005887)		p.0?(8)|p.?(3)|p.P109T(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|urinary_tract(1)	12		all_cancers(10;6.97e-11)|all_epithelial(10;0.0051)|all_hematologic(16;0.0149)|Breast(31;0.0155)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0257)|all_lung(9;0.0468)|Lung NSC(157;0.094)		UCEC - Uterine corpus endometrioid carcinoma (4;6.64e-05)|all cancers(4;6.88e-13)|Epithelial(4;8.95e-12)|OV - Ovarian serous cystadenocarcinoma(4;1.01e-11)|GBM - Glioblastoma multiforme(4;0.184)		ATTGGTGTTGGTTGTTTGGTG	0.493																																																	12	Whole gene deletion(8)|Unknown(3)|Substitution - Missense(1)	soft_tissue(7)|autonomic_ganglia(2)|lung(1)|kidney(1)|central_nervous_system(1)											568.0	430.0	476.0					17																	29632303		2203	4300	6503	SO:0001583	missense	2124				CCDS11266.1	17q11.2	2011-08-11			ENSG00000185862	ENSG00000185862		"""CD molecules"""	3500	protein-coding gene	gene with protein product		158381				1903357	Standard	NM_006495		Approved	D17S376, EVDB, CD361	uc002hgk.2	P34910	OTTHUMG00000132869	ENST00000330927.4:c.325C>A	17.37:g.29632303G>T	ENSP00000333779:p.Pro109Thr	Somatic		WXS	Illumina HiSeq	Phase_I	B7Z4A7	Missense_Mutation	SNP	ENST00000330927.4	37	CCDS11266.1	.	.	.	.	.	.	.	.	.	.	G	10.20	1.285885	0.23478	.	.	ENSG00000185862	ENST00000330927;ENST00000544462	T;T	0.65364	-0.13;-0.15	5.32	0.79	0.18613	.	0.337408	0.20933	N	0.083067	T	0.43678	0.1258	L	0.38838	1.175	0.25395	N	0.988492	P;P	0.35107	0.484;0.484	B;B	0.33254	0.16;0.16	T	0.28396	-1.0045	10	0.45353	T	0.12	0.0271	3.8777	0.09064	0.0866:0.3053:0.4505:0.1576	.	124;109	B7Z4A7;P34910	.;EVI2B_HUMAN	T	109;124	ENSP00000333779:P109T;ENSP00000439738:P124T	ENSP00000333779:P109T	P	-	1	0	EVI2B	26656429	0.436000	0.25586	0.019000	0.16419	0.031000	0.12232	0.215000	0.17562	-0.046000	0.13446	0.561000	0.74099	CCA		0.493	EVI2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256349.2		NM_006495	
GFRA4	64096	broad.mit.edu	37	20	3641432	3641432	+	Frame_Shift_Del	DEL	G	G	-			TCGA-CJ-4923-01A-01D-1429-08	TCGA-CJ-4923-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19171a1a-6483-4bf3-b0b4-8cd441303c55	f394a92b-22c4-43d1-991b-b32a270d1cba	g.chr20:3641432delG	ENST00000319242.3	-	2	550	c.551delC	c.(550-552)ccgfs	p.P184fs	GFRA4_ENST00000290417.2_Frame_Shift_Del_p.R158fs			Q9GZZ7	GFRA4_HUMAN	GDNF family receptor alpha 4	184					negative regulation of ossification (GO:0030279)	anchored component of membrane (GO:0031225)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	glial cell-derived neurotrophic factor receptor activity (GO:0016167)			large_intestine(1)|lung(2)	3						CGCAGGCAGCGGGCGCCCTGG	0.776																																																	0													2.0	2.0	2.0					20																	3641432		1302	2887	4189	SO:0001589	frameshift_variant	64096			AF253318	CCDS13055.1, CCDS13056.1	20p13-p12	2008-07-16			ENSG00000125861	ENSG00000125861			13821	protein-coding gene	gene with protein product	"""persephin receptor"""					10958791, 15225646	Standard	XM_005260793		Approved		uc002win.3	Q9GZZ7	OTTHUMG00000031748	ENST00000319242.3:c.551delC	20.37:g.3641432delG	ENSP00000313423:p.Pro184fs	Somatic		WXS	Illumina GAIIx	Phase_I	Q5JT74|Q9H191|Q9H192	Frame_Shift_Del	DEL	ENST00000319242.3	37	CCDS13056.1																																																																																				0.776	GFRA4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000077744.1		NM_145762	
FAM182B	728882	broad.mit.edu	37	20	25848629	25848629	+	5'UTR	SNP	C	C	T			TCGA-CJ-4923-01A-01D-1429-08	TCGA-CJ-4923-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19171a1a-6483-4bf3-b0b4-8cd441303c55	f394a92b-22c4-43d1-991b-b32a270d1cba	g.chr20:25848629C>T	ENST00000478164.1	-	0	157				FAM182B_ENST00000376404.2_5'UTR			Q5T319	F182B_HUMAN	family with sequence similarity 182, member B											lung(1)	1						gctgggatgccgtgctgcttc	0.667																																																	0																																										SO:0001623	5_prime_UTR_variant	728882					20p11.1	2010-07-14			ENSG00000175170	ENSG00000175170			34503	pseudogene	pseudogene							Standard	NR_027061		Approved			Q5T319	OTTHUMG00000032136	ENST00000478164.1:c.-835G>A	20.37:g.25848629C>T		Somatic		WXS	Illumina GAIIx	Phase_I	Q4G0Q1	RNA	SNP	ENST00000478164.1	37																																																																																					0.667	FAM182B-005	KNOWN	basic	processed_transcript	protein_coding	OTTHUMT00000316665.1		NR_026714	
GPR152	390212	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	67219407	67219407	+	Silent	SNP	G	G	A			TCGA-CJ-4923-01A-01D-1429-08	TCGA-CJ-4923-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19171a1a-6483-4bf3-b0b4-8cd441303c55	f394a92b-22c4-43d1-991b-b32a270d1cba	g.chr11:67219407G>A	ENST00000312457.2	-	1	793	c.789C>T	c.(787-789)ttC>ttT	p.F263F	CABP4_ENST00000438189.2_5'Flank	NM_206997.1	NP_996880.1	Q8TDT2	GP152_HUMAN	G protein-coupled receptor 152	263						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.F263F(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	16			BRCA - Breast invasive adenocarcinoma(15;8.18e-06)			CGTCCCACAGGAAGGCCAGGT	0.632																																					Pancreas(102;800 1581 2723 7382 33622)												1	Substitution - coding silent(1)	kidney(1)											63.0	55.0	58.0					11																	67219407		2200	4295	6495	SO:0001819	synonymous_variant	390212			AY255600	CCDS8165.1	11q13.2	2013-09-20			ENSG00000175514	ENSG00000175514		"""GPCR / Class A : Orphans"""	23622	protein-coding gene	gene with protein product						12679517	Standard	NM_206997		Approved	PGR5	uc001olm.3	Q8TDT2	OTTHUMG00000168032	ENST00000312457.2:c.789C>T	11.37:g.67219407G>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q0VD88|Q86SM0	Silent	SNP	ENST00000312457.2	37	CCDS8165.1																																																																																				0.632	GPR152-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397623.1			
GPR45	11250	broad.mit.edu	37	2	105859013	105859013	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-4923-01A-01D-1429-08	TCGA-CJ-4923-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19171a1a-6483-4bf3-b0b4-8cd441303c55	f394a92b-22c4-43d1-991b-b32a270d1cba	g.chr2:105859013C>T	ENST00000258456.1	+	1	814	c.698C>T	c.(697-699)tCg>tTg	p.S233L		NM_007227.3	NP_009158.3	Q9Y5Y3	GPR45_HUMAN	G protein-coupled receptor 45	233						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.S233L(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(10)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	28						CACAACCAGTCGGACAGCCTG	0.652																																																	1	Substitution - Missense(1)	kidney(1)											76.0	79.0	78.0					2																	105859013		2203	4300	6503	SO:0001583	missense	11250			AF118266	CCDS2066.1	2q11.1-q12	2012-08-21			ENSG00000135973	ENSG00000135973		"""GPCR / Class A : Orphans"""	4503	protein-coding gene	gene with protein product		604838				10036181	Standard	NM_007227		Approved	PSP24, PSP24A	uc002tco.1	Q9Y5Y3	OTTHUMG00000130805	ENST00000258456.1:c.698C>T	2.37:g.105859013C>T	ENSP00000258456:p.Ser233Leu	Somatic		WXS	Illumina GAIIx	Phase_I	Q6NWS4|Q6NXU6	Missense_Mutation	SNP	ENST00000258456.1	37	CCDS2066.1	.	.	.	.	.	.	.	.	.	.	C	19.31	3.802494	0.70682	.	.	ENSG00000135973	ENST00000258456	T	0.41400	1.0	5.1	5.1	0.69264	GPCR, rhodopsin-like superfamily (1);	0.141190	0.46758	D	0.000272	T	0.33904	0.0879	N	0.14661	0.345	0.28533	N	0.912485	P	0.46987	0.888	P	0.44561	0.453	T	0.27123	-1.0083	10	0.52906	T	0.07	-21.0116	18.125	0.89583	0.0:1.0:0.0:0.0	.	233	Q9Y5Y3	GPR45_HUMAN	L	233	ENSP00000258456:S233L	ENSP00000258456:S233L	S	+	2	0	GPR45	105225445	0.423000	0.25482	0.977000	0.42913	0.821000	0.46438	3.862000	0.56009	2.373000	0.80994	0.462000	0.41574	TCG		0.652	GPR45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253348.1		NM_007227	
IGDCC3	9543	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	65624284	65624284	+	Silent	SNP	G	G	A			TCGA-CJ-4923-01A-01D-1429-08	TCGA-CJ-4923-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19171a1a-6483-4bf3-b0b4-8cd441303c55	f394a92b-22c4-43d1-991b-b32a270d1cba	g.chr15:65624284G>A	ENST00000327987.4	-	7	1394	c.1143C>T	c.(1141-1143)aaC>aaT	p.N381N	IGDCC3_ENST00000559231.1_5'UTR	NM_004884.3	NP_004875.2	Q8IVU1	IGDC3_HUMAN	immunoglobulin superfamily, DCC subclass, member 3	381	Ig-like C2-type 4.				neuromuscular process controlling balance (GO:0050885)	integral component of plasma membrane (GO:0005887)		p.N381N(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(9)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						CATACCTGTTGTTATTCTTGA	0.607																																																	1	Substitution - coding silent(1)	kidney(1)											100.0	89.0	93.0					15																	65624284		2201	4299	6500	SO:0001819	synonymous_variant	9543			AF063936	CCDS10205.1	15q22.3-q23	2013-02-11	2009-01-08	2009-01-08	ENSG00000174498	ENSG00000174498		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9700	protein-coding gene	gene with protein product		604184	"""putative neuronal cell adhesion molecule"""	PUNC		9922388	Standard	NM_004884		Approved	HsT18880	uc002aos.2	Q8IVU1	OTTHUMG00000133137	ENST00000327987.4:c.1143C>T	15.37:g.65624284G>A		Somatic		WXS	Illumina HiSeq	Phase_I	O95215	Silent	SNP	ENST00000327987.4	37	CCDS10205.1																																																																																				0.607	IGDCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256826.1		NM_004884	
IGSF9B	22997	broad.mit.edu	37	11	133807380	133807380	+	Silent	SNP	G	G	A	rs540487325		TCGA-CJ-4923-01A-01D-1429-08	TCGA-CJ-4923-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19171a1a-6483-4bf3-b0b4-8cd441303c55	f394a92b-22c4-43d1-991b-b32a270d1cba	g.chr11:133807380G>A	ENST00000321016.8	-	5	800	c.570C>T	c.(568-570)gaC>gaT	p.D190D	IGSF9B_ENST00000533871.2_Silent_p.D190D			Q9UPX0	TUTLB_HUMAN	immunoglobulin superfamily, member 9B	190	Ig-like 2.				homophilic cell adhesion (GO:0007156)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)	dendrite (GO:0030425)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)		p.D190D(1)		breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(18)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	all_hematologic(175;0.127)	all_cancers(12;1.58e-21)|all_epithelial(12;5.17e-16)|all_lung(97;1.6e-05)|Lung NSC(97;3.86e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;7.19e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|all cancers(11;1.23e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00328)|Lung(977;0.221)		TCAGGCTGCCGTCACTCACCT	0.612													G|||	1	0.000199681	0.0	0.0	5008	,	,		17814	0.0		0.0	False		,,,				2504	0.001																1	Substitution - coding silent(1)	kidney(1)											50.0	57.0	55.0					11																	133807380		2187	4263	6450	SO:0001819	synonymous_variant	22997			AK097578	CCDS61010.1	11q25	2013-02-11	2005-10-12	2005-11-20				"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	32326	protein-coding gene	gene with protein product		613773					Standard	NM_001277285		Approved	KIAA1030	uc031qfh.1	Q9UPX0		ENST00000321016.8:c.570C>T	11.37:g.133807380G>A		Somatic		WXS	Illumina GAIIx	Phase_I	G5EA26	Silent	SNP	ENST00000321016.8	37																																																																																					0.612	IGSF9B-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding			XM_290502	
IL16	3603	broad.mit.edu;ucsc.edu	37	15	81591913	81591913	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-4923-01A-01D-1429-08	TCGA-CJ-4923-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19171a1a-6483-4bf3-b0b4-8cd441303c55	f394a92b-22c4-43d1-991b-b32a270d1cba	g.chr15:81591913G>A	ENST00000302987.4	+	13	2246	c.2246G>A	c.(2245-2247)gGg>gAg	p.G749E	IL16_ENST00000560230.1_3'UTR|IL16_ENST00000394660.2_Missense_Mutation_p.G749E|IL16_ENST00000394652.2_Missense_Mutation_p.G48E			Q14005	IL16_HUMAN	interleukin 16	749					immune response (GO:0006955)|induction of positive chemotaxis (GO:0050930)|leukocyte chemotaxis (GO:0030595)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.G703E(1)|p.G749E(1)		NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(12)|lung(20)|ovary(3)|skin(3)|stomach(1)|urinary_tract(1)	57						GAAGAAGAAGGGACACAGGGC	0.512																																																	2	Substitution - Missense(2)	kidney(2)											93.0	96.0	95.0					15																	81591913		2203	4300	6503	SO:0001583	missense	3603			U82972	CCDS10317.1, CCDS42069.1, CCDS53966.1	15q26.3	2011-07-14	2011-07-14		ENSG00000172349	ENSG00000172349		"""Interleukins and interleukin receptors"""	5980	protein-coding gene	gene with protein product	"""prointerleukin 16"", ""lymphocyte chemoattractant factor"""	603035	"""interleukin 16 (lymphocyte chemoattractant factor)"""			9144227	Standard	NM_004513		Approved	LCF, IL-16, prIL-16, HsT19289, FLJ42735, FLJ16806	uc021ssh.1	Q14005	OTTHUMG00000144186	ENST00000302987.4:c.2246G>A	15.37:g.81591913G>A	ENSP00000302935:p.Gly749Glu	Somatic		WXS	Illumina GAIIx	Phase_I	A6NM20|A8MU65|B5TY35|B9EGR6|H3BVH5|Q16435|Q6VVE6|Q6ZMQ7|Q9UP18	Missense_Mutation	SNP	ENST00000302987.4	37	CCDS42069.1	.	.	.	.	.	.	.	.	.	.	G	2.809	-0.247371	0.05867	.	.	ENSG00000172349	ENST00000394660;ENST00000355368;ENST00000302987;ENST00000329842;ENST00000394653;ENST00000394652;ENST00000394656	T;T;T	0.10192	2.9;2.9;3.46	5.06	3.09	0.35607	.	0.680702	0.13007	N	0.421188	T	0.19248	0.0462	L	0.58669	1.825	0.09310	N	1	B;P;B;D;B;B	0.76494	0.136;0.476;0.055;0.999;0.084;0.136	B;B;B;D;B;B	0.66084	0.038;0.122;0.008;0.941;0.006;0.038	T	0.08764	-1.0706	10	0.07175	T	0.84	.	5.9545	0.19265	0.1759:0.0:0.6643:0.1598	.	581;243;286;139;749;749	F8W7Z5;Q6ZTT5;B7Z8M3;B3KY62;Q14005;Q14005-2	.;.;.;.;IL16_HUMAN;.	E	749;581;749;286;139;48;48	ENSP00000378155:G749E;ENSP00000302935:G749E;ENSP00000378147:G48E	ENSP00000302935:G749E	G	+	2	0	IL16	79378968	0.013000	0.17824	0.009000	0.14445	0.003000	0.03518	1.853000	0.39358	1.061000	0.40601	0.655000	0.94253	GGG		0.512	IL16-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000303952.1		NM_172217	
IRS1	3667	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	227662246	227662246	+	Silent	SNP	G	G	C	rs529655323		TCGA-CJ-4923-01A-01D-1429-08	TCGA-CJ-4923-11A-01D-1429-08	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	19171a1a-6483-4bf3-b0b4-8cd441303c55	f394a92b-22c4-43d1-991b-b32a270d1cba	g.chr2:227662246G>C	ENST00000305123.5	-	1	2229	c.1209C>G	c.(1207-1209)acC>acG	p.T403T	RP11-395N3.2_ENST00000607970.1_lincRNA|IRS1_ENST00000498335.1_5'Flank	NM_005544.2	NP_005535.1	P35568	IRS1_HUMAN	insulin receptor substrate 1	403	Ser-rich.				cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipid catabolic process (GO:0016042)|mammary gland development (GO:0030879)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of insulin secretion (GO:0046676)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein kinase B signaling (GO:0043491)|protein localization to nucleus (GO:0034504)|regulation of gene expression (GO:0010468)|response to insulin (GO:0032868)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)	caveola (GO:0005901)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|insulin receptor complex (GO:0005899)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	insulin receptor binding (GO:0005158)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein kinase C binding (GO:0005080)|SH2 domain binding (GO:0042169)|signal transducer activity (GO:0004871)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)	p.T403T(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(5)|kidney(4)|large_intestine(10)|lung(33)|ovary(6)|pancreas(1)|prostate(1)|urinary_tract(2)	69		Renal(207;0.023)|all_lung(227;0.0994)|all_hematologic(139;0.118)|Esophageal squamous(248;0.23)		Epithelial(121;3.03e-11)|all cancers(144;2.42e-08)|Lung(261;0.00712)|LUSC - Lung squamous cell carcinoma(224;0.0137)		GACAATCCGAGGTGGAGCCAT	0.637											OREG0015248	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					1	Substitution - coding silent(1)	kidney(1)											64.0	68.0	67.0					2																	227662246		2203	4300	6503	SO:0001819	synonymous_variant	3667				CCDS2463.1	2q36	2013-01-10			ENSG00000169047	ENSG00000169047		"""Pleckstrin homology (PH) domain containing"""	6125	protein-coding gene	gene with protein product		147545				1648180	Standard	NM_005544		Approved	HIRS-1	uc002voh.4	P35568	OTTHUMG00000133179	ENST00000305123.5:c.1209C>G	2.37:g.227662246G>C		Somatic	2321	WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000305123.5	37	CCDS2463.1																																																																																				0.637	IRS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256886.3		NM_005544	
KALRN	8997	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	123987876	123987876	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-4923-01A-01D-1429-08	TCGA-CJ-4923-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19171a1a-6483-4bf3-b0b4-8cd441303c55	f394a92b-22c4-43d1-991b-b32a270d1cba	g.chr3:123987876A>G	ENST00000240874.3	+	5	894	c.737A>G	c.(736-738)gAc>gGc	p.D246G	KALRN_ENST00000360013.3_Missense_Mutation_p.D246G|KALRN_ENST00000460856.1_Missense_Mutation_p.D246G	NM_003947.4	NP_003938.1	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase	246					apoptotic signaling pathway (GO:0097190)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|protein phosphorylation (GO:0006468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.D246G(2)		NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(21)|lung(28)|ovary(4)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	83						GAGGAGCTGGACCGGGAGGGG	0.632																																																	2	Substitution - Missense(2)	kidney(2)											20.0	20.0	20.0					3																	123987876		2202	4298	6500	SO:0001583	missense	8997			U94190	CCDS3027.1, CCDS3028.1	3q21.2	2013-02-11	2005-03-11	2005-03-12	ENSG00000160145	ENSG00000160145		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	4814	protein-coding gene	gene with protein product	"""serine/threonine kinase with Dbl and pleckstrin homology domains"""	604605	"""huntingtin-associated protein interacting protein (duo)"""	HAPIP		9285789, 10023074	Standard	NM_001024660		Approved	duo, Hs.8004, TRAD, DUET, Kalirin, ARHGEF24	uc003ehd.3	O60229	OTTHUMG00000125545	ENST00000240874.3:c.737A>G	3.37:g.123987876A>G	ENSP00000240874:p.Asp246Gly	Somatic		WXS	Illumina HiSeq	Phase_I	A8MSI4|C9JQ37|Q6ZN45|Q8TBQ5|Q9NSZ4|Q9Y2A5	Missense_Mutation	SNP	ENST00000240874.3	37	CCDS3027.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	19.17|19.17	3.776316|3.776316	0.70107|0.70107	.|.	.|.	ENSG00000160145|ENSG00000160145	ENST00000460856;ENST00000240874;ENST00000360013|ENST00000354186	T;T;T|.	0.40476|.	1.03;1.03;1.03|.	5.46|5.46	5.46|5.46	0.80206|0.80206	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.78246|0.78246	0.4253|0.4253	M|M	0.83953|0.83953	2.67|2.67	0.80722|0.80722	D|D	1|1	D;D;D|.	0.61080|.	0.974;0.989;0.985|.	P;P;P|.	0.59288|.	0.72;0.828;0.855|.	T|T	0.80430|0.80430	-0.1386|-0.1386	10|5	0.25751|.	T|.	0.34|.	.|.	15.7119|15.7119	0.77635|0.77635	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	246;246;246|.	C9IZQ6;O60229;O60229-2|.	.;KALRN_HUMAN;.|.	G|A	246|224	ENSP00000418611:D246G;ENSP00000240874:D246G;ENSP00000353109:D246G|.	ENSP00000240874:D246G|.	D|T	+|+	2|1	0|0	KALRN|KALRN	125470566|125470566	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.903000|0.903000	0.53119|0.53119	8.968000|8.968000	0.93407|0.93407	2.291000|2.291000	0.77112|0.77112	0.533000|0.533000	0.62120|0.62120	GAC|ACC		0.632	KALRN-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000258843.4		NM_003947	
KHK	3795	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	27320391	27320391	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-4923-01A-01D-1429-08	TCGA-CJ-4923-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19171a1a-6483-4bf3-b0b4-8cd441303c55	f394a92b-22c4-43d1-991b-b32a270d1cba	g.chr2:27320391G>T	ENST00000260599.6	+	5	951	c.438G>T	c.(436-438)caG>caT	p.Q146H	KHK_ENST00000490823.1_3'UTR|KHK_ENST00000260598.5_Missense_Mutation_p.Q146H	NM_000221.2	NP_000212.1	P50053	KHK_HUMAN	ketohexokinase (fructokinase)	146					carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose catabolic process (GO:0006001)|regulation of glycogen metabolic process (GO:0070873)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ketohexokinase activity (GO:0004454)	p.Q146H(2)		endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(2)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	16	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CATCGGAGCAGGTGAAGATGC	0.622																																																	2	Substitution - Missense(2)	kidney(2)											66.0	58.0	61.0					2																	27320391		2203	4300	6503	SO:0001583	missense	3795				CCDS1734.1, CCDS1735.1	2p23.3-p23.2	2008-02-05			ENSG00000138030	ENSG00000138030	2.7.1.3		6315	protein-coding gene	gene with protein product		614058				7833921	Standard	NM_000221		Approved		uc002rim.2	P50053	OTTHUMG00000097077	ENST00000260599.6:c.438G>T	2.37:g.27320391G>T	ENSP00000260599:p.Gln146His	Somatic		WXS	Illumina HiSeq	Phase_I	Q6IBK2|Q99532|Q9BRJ3|Q9UMN1	Missense_Mutation	SNP	ENST00000260599.6	37	CCDS1734.1	.	.	.	.	.	.	.	.	.	.	G	18.75	3.690920	0.68271	.	.	ENSG00000138030	ENST00000260599;ENST00000260598;ENST00000429697	T;T;T	0.77489	-1.1;-1.1;-0.03	5.93	4.15	0.48705	Carbohydrate/purine kinase (1);	0.000000	0.85682	D	0.000000	D	0.86142	0.5862	M	0.75447	2.3	0.54753	D	0.999988	D;D;D;D	0.89917	0.999;1.0;0.999;1.0	D;D;D;D	0.97110	0.975;1.0;0.957;1.0	D	0.86101	0.1556	10	0.66056	D	0.02	-0.0129	10.7427	0.46162	0.1537:0.0:0.8463:0.0	.	146;146;146;146	Q53G56;Q6IBK2;P50053-2;P50053	.;.;.;KHK_HUMAN	H	146;146;191	ENSP00000260599:Q146H;ENSP00000260598:Q146H;ENSP00000404741:Q191H	ENSP00000260598:Q146H	Q	+	3	2	KHK	27173895	1.000000	0.71417	1.000000	0.80357	0.595000	0.36748	5.218000	0.65257	0.866000	0.35629	0.655000	0.94253	CAG		0.622	KHK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214196.1			
Unknown	0	broad.mit.edu	37	5	99715528	99715528	+	IGR	SNP	C	C	T			TCGA-CJ-4923-01A-01D-1429-08	TCGA-CJ-4923-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19171a1a-6483-4bf3-b0b4-8cd441303c55	f394a92b-22c4-43d1-991b-b32a270d1cba	g.chr5:99715528C>T								RNU6-1119P (226045 upstream) : RP11-346J10.1 (21616 downstream)																							AGCGGACAGTCGAAGCCCTTC	0.607																																																	0																																										SO:0001628	intergenic_variant	100133050																															5.37:g.99715528C>T		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP		37																																																																																				0	0.607									
LPIN3	64900	broad.mit.edu;ucsc.edu	37	20	39984632	39984632	+	Silent	SNP	T	T	C			TCGA-CJ-4923-01A-01D-1429-08	TCGA-CJ-4923-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19171a1a-6483-4bf3-b0b4-8cd441303c55	f394a92b-22c4-43d1-991b-b32a270d1cba	g.chr20:39984632T>C	ENST00000373257.3	+	14	1852	c.1761T>C	c.(1759-1761)acT>acC	p.T587T		NM_022896.1	NP_075047.1	Q9BQK8	LPIN3_HUMAN	lipin 3	587					fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	phosphatidate phosphatase activity (GO:0008195)	p.T587T(1)		breast(2)|central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(7)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		Myeloproliferative disorder(115;0.000739)				caccctccactccTACCTACA	0.567																																																	1	Substitution - coding silent(1)	kidney(1)											256.0	193.0	214.0					20																	39984632		2203	4300	6503	SO:0001819	synonymous_variant	64900			AL132654	CCDS33469.1	20q11.2-q12	2006-04-04	2002-05-23		ENSG00000132793	ENSG00000132793			14451	protein-coding gene	gene with protein product		605520	"""lipin 3-like"""	LIPN3L		11138012	Standard	XM_005260515		Approved	SMP2	uc002xjx.3	Q9BQK8	OTTHUMG00000033056	ENST00000373257.3:c.1761T>C	20.37:g.39984632T>C		Somatic		WXS	Illumina GAIIx	Phase_I	B2RTT5|Q5TDB9|Q9NPY8|Q9UJE5	Silent	SNP	ENST00000373257.3	37	CCDS33469.1	.	.	.	.	.	.	.	.	.	.	T	2.440	-0.328776	0.05314	.	.	ENSG00000132793	ENST00000445975	.	.	.	4.4	-3.95	0.04118	.	.	.	.	.	T	0.39911	0.1096	.	.	.	0.48762	D	0.999709	.	.	.	.	.	.	T	0.35375	-0.9791	4	.	.	.	0.0366	3.4707	0.07566	0.0983:0.3759:0.2693:0.2565	.	.	.	.	P	77	.	.	L	+	2	0	LPIN3	39418046	0.000000	0.05858	0.015000	0.15790	0.419000	0.31324	-0.728000	0.04925	-0.620000	0.05641	0.379000	0.24179	CTC		0.567	LPIN3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080393.1		NM_022896	
LTBP3	4054	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	65308037	65308037	+	Missense_Mutation	SNP	T	T	C			TCGA-CJ-4923-01A-01D-1429-08	TCGA-CJ-4923-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19171a1a-6483-4bf3-b0b4-8cd441303c55	f394a92b-22c4-43d1-991b-b32a270d1cba	g.chr11:65308037T>C	ENST00000301873.5	-	22	3294	c.3026A>G	c.(3025-3027)aAg>aGg	p.K1009R	LTBP3_ENST00000530785.1_Missense_Mutation_p.K12R|LTBP3_ENST00000532932.1_Missense_Mutation_p.K439R|LTBP3_ENST00000536982.1_Missense_Mutation_p.K635R|LTBP3_ENST00000529189.1_Missense_Mutation_p.K12R|LTBP3_ENST00000322147.4_Missense_Mutation_p.K1009R	NM_001130144.2	NP_001123616.1	Q9NS15	LTBP3_HUMAN	latent transforming growth factor beta binding protein 3	1009	EGF-like 10; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|extracellular matrix organization (GO:0030198)|lung saccule development (GO:0060430)|negative regulation of bone mineralization (GO:0030502)|negative regulation of chondrocyte differentiation (GO:0032331)|positive regulation of bone resorption (GO:0045780)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of mesenchymal stem cell proliferation (GO:1902462)|transforming growth factor beta activation (GO:0036363)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)	p.K1009R(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|prostate(2)|upper_aerodigestive_tract(3)	23						GTTCACGCACTTGCCCTCCTT	0.642											OREG0021080	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					1	Substitution - Missense(1)	kidney(1)											85.0	72.0	76.0					11																	65308037		2201	4297	6498	SO:0001583	missense	4054			AF135960	CCDS8103.1, CCDS44647.1	11q12	2011-10-20			ENSG00000168056	ENSG00000168056		"""Latent transforming growth factor, beta binding proteins"""	6716	protein-coding gene	gene with protein product		602090		LTBP2		7719025	Standard	NM_001164266		Approved		uc001oej.3	Q9NS15	OTTHUMG00000166575	ENST00000301873.5:c.3026A>G	11.37:g.65308037T>C	ENSP00000301873:p.Lys1009Arg	Somatic	1083	WXS	Illumina HiSeq	Phase_I	O15107|Q96HB9|Q9H7K2|Q9UFN4	Missense_Mutation	SNP	ENST00000301873.5	37	CCDS44647.1	.	.	.	.	.	.	.	.	.	.	T	10.95	1.497059	0.26861	.	.	ENSG00000168056	ENST00000301874;ENST00000322147;ENST00000301873;ENST00000530785;ENST00000529189;ENST00000532932;ENST00000536982;ENST00000532661;ENST00000530866	T;D;D;T;D;T;T;D	0.92348	1.98;-3.02;-2.22;1.62;-3.02;1.98;1.98;-3.02	4.13	4.13	0.48395	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.332208	0.27549	N	0.018869	D	0.84696	0.5529	N	0.03194	-0.395	0.26849	N	0.968206	D;B;B;P;B;B;P	0.57571	0.98;0.115;0.14;0.946;0.226;0.016;0.785	P;B;B;P;B;B;P	0.57204	0.815;0.048;0.115;0.671;0.07;0.038;0.484	T	0.75816	-0.3184	10	0.14252	T	0.57	.	6.9486	0.24532	0.2046:0.0:0.0:0.7954	.	920;635;892;1009;1009;439;635	E9PKW1;F5GWC4;B9EG76;Q9NS15;Q9NS15-2;E9PJR2;B4DQL8	.;.;.;LTBP3_HUMAN;.;.;.	R	12;1009;1009;12;12;439;635;12;920	ENSP00000326647:K1009R;ENSP00000301873:K1009R;ENSP00000434315:K12R;ENSP00000434406:K12R;ENSP00000435530:K439R;ENSP00000441912:K635R;ENSP00000436341:K12R;ENSP00000435276:K920R	ENSP00000301873:K1009R	K	-	2	0	LTBP3	65064613	0.677000	0.27577	1.000000	0.80357	0.994000	0.84299	0.368000	0.20399	1.506000	0.48736	0.374000	0.22700	AAG		0.642	LTBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390538.1		NM_021070	
C7orf55-LUC7L2	100996928	broad.mit.edu;ucsc.edu	37	7	139086943	139086943	+	Nonsense_Mutation	SNP	A	A	T			TCGA-CJ-4923-01A-01D-1429-08	TCGA-CJ-4923-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19171a1a-6483-4bf3-b0b4-8cd441303c55	f394a92b-22c4-43d1-991b-b32a270d1cba	g.chr7:139086943A>T	ENST00000354926.4	+	4	670	c.316A>T	c.(316-318)Aaa>Taa	p.K106*	LUC7L2_ENST00000541515.3_Nonsense_Mutation_p.K172*|C7orf55-LUC7L2_ENST00000541170.3_Nonsense_Mutation_p.K103*|C7orf55-LUC7L2_ENST00000263545.6_Nonsense_Mutation_p.K105*	NM_001270643.1|NM_016019.4	NP_001257572.1|NP_057103.2			C7orf55-LUC7L2 readthrough									p.K106*(1)									AGTGGCCAAGAAAAGATTAGC	0.348																																																	1	Substitution - Nonsense(1)	kidney(1)											90.0	83.0	85.0					7																	139086943		1844	4084	5928	SO:0001587	stop_gained	51631				CCDS59084.1	7q34	2013-02-14			ENSG00000146963	ENSG00000146963			44671	other	readthrough							Standard	NM_001244584		Approved		uc011kqt.3		OTTHUMG00000151717	ENST00000354926.4:c.316A>T	7.37:g.139086943A>T	ENSP00000347005:p.Lys106*	Somatic		WXS	Illumina GAIIx	Phase_I		Nonsense_Mutation	SNP	ENST00000354926.4	37	CCDS43656.1	.	.	.	.	.	.	.	.	.	.	A	38	7.188628	0.98121	.	.	ENSG00000146963	ENST00000448820;ENST00000541170;ENST00000541515;ENST00000545899;ENST00000354926;ENST00000263545	.	.	.	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1.000000	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-25.088	15.9458	0.79792	1.0:0.0:0.0:0.0	.	.	.	.	X	103;103;172;106;106;105	.	ENSP00000263545:K105X	K	+	1	0	LUC7L2	138737483	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	9.307000	0.96226	2.162000	0.67917	0.459000	0.35465	AAA		0.348	C7orf55-LUC7L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323618.2			
MACROD2	140733	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	20	15412069	15412069	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-4923-01A-01D-1429-08	TCGA-CJ-4923-11A-01D-1429-08	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina GAIIx	19171a1a-6483-4bf3-b0b4-8cd441303c55	f394a92b-22c4-43d1-991b-b32a270d1cba	g.chr20:15412069C>A	ENST00000310348.4	+	7	560	c.560C>A	c.(559-561)aCa>aAa	p.T187K	MACROD2_ENST00000402914.1_5'UTR|MACROD2_ENST00000217246.4_Missense_Mutation_p.T187K			A1Z1Q3	MACD2_HUMAN	MACRO domain containing 2	187	Macro. {ECO:0000255|PROSITE- ProRule:PRU00490}.|Substrate binding.				brain development (GO:0007420)|cellular response to DNA damage stimulus (GO:0006974)|protein de-ADP-ribosylation (GO:0051725)|purine nucleoside metabolic process (GO:0042278)	nucleus (GO:0005634)	deacetylase activity (GO:0019213)|hydrolase activity, acting on glycosyl bonds (GO:0016798)	p.T187K(1)		breast(2)|kidney(4)|large_intestine(5)|lung(8)|skin(1)	20		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)				TGCATCTCAACAGGCATTTAT	0.318																																																	1	Substitution - Missense(1)	kidney(1)											309.0	277.0	287.0					20																	15412069		1850	4088	5938	SO:0001583	missense	140733			BC101218	CCDS13120.2, CCDS33443.1	20p12.1	2011-04-28	2007-07-24	2007-07-24	ENSG00000172264	ENSG00000172264			16126	protein-coding gene	gene with protein product		611567	"""chromosome 20 open reading frame 133"""	C20orf133			Standard	NM_080676		Approved	dJ631M13.5	uc002wot.3	A1Z1Q3	OTTHUMG00000031919	ENST00000310348.4:c.560C>A	20.37:g.15412069C>A	ENSP00000309809:p.Thr187Lys	Somatic		WXS	Illumina HiSeq	Phase_I	A6NFF7|B0QZ39|B3KWV0|Q0P6D5|Q495E0|Q5W199|Q6ZN71	Missense_Mutation	SNP	ENST00000310348.4	37	CCDS13120.2	.	.	.	.	.	.	.	.	.	.	C	20.9	4.074354	0.76415	.	.	ENSG00000172264	ENST00000217246;ENST00000310348	T;T	0.32753	1.44;1.44	5.34	5.34	0.76211	Appr-1-p processing (3);	0.000000	0.52532	D	0.000062	T	0.72827	0.3509	H	0.99336	4.52	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.987	D	0.84465	0.0596	10	0.87932	D	0	-10.3118	14.547	0.68038	0.0:1.0:0.0:0.0	.	187;187	A1Z1Q3;A1Z1Q3-2	MACD2_HUMAN;.	K	187	ENSP00000217246:T187K;ENSP00000309809:T187K	ENSP00000217246:T187K	T	+	2	0	MACROD2	15360069	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	3.767000	0.55288	2.479000	0.83701	0.650000	0.86243	ACA		0.318	MACROD2-201	KNOWN	basic|CCDS	protein_coding	protein_coding			NM_080676	
Unknown	0	broad.mit.edu	37	1	16974141	16974141	+	IGR	DEL	G	G	-	rs367807952		TCGA-CJ-4923-01A-01D-1429-08	TCGA-CJ-4923-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19171a1a-6483-4bf3-b0b4-8cd441303c55	f394a92b-22c4-43d1-991b-b32a270d1cba	g.chr1:16974141delG								CROCCP2 (13087 upstream) : RNU1-3 (19138 downstream)																							TGGCTTGGCCGGGGAGGTCAG	0.667																																																	0																																										SO:0001628	intergenic_variant	11209																															1.37:g.16974141delG		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	DEL		37																																																																																				0	0.667									
MFSD2A	84879	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	40430907	40430907	+	Silent	SNP	C	C	T	rs115805986	byFrequency	TCGA-CJ-4923-01A-01D-1429-08	TCGA-CJ-4923-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19171a1a-6483-4bf3-b0b4-8cd441303c55	f394a92b-22c4-43d1-991b-b32a270d1cba	g.chr1:40430907C>T	ENST00000372809.5	+	4	560	c.417C>T	c.(415-417)gcC>gcT	p.A139A	MFSD2A_ENST00000480630.1_3'UTR|MFSD2A_ENST00000372811.5_Silent_p.A126A|MFSD2A_ENST00000420632.2_5'UTR	NM_001136493.1	NP_001129965.1	Q8NA29	NLS1_HUMAN	major facilitator superfamily domain containing 2A	139					establishment of blood-brain barrier (GO:0060856)|fatty acid transport (GO:0015908)|lipid transport across blood brain barrier (GO:1990379)|transcytosis (GO:0045056)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phospholipid transporter activity (GO:0005548)|symporter activity (GO:0015293)	p.A126A(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	24						CGCCCCTGGCCGTCATTGCCT	0.587													C|||	107	0.0213658	0.0	0.0	5008	,	,		21083	0.0139		0.0	False		,,,				2504	0.0951																1	Substitution - coding silent(1)	kidney(1)						C	,	0,4406		0,0,2203	160.0	136.0	144.0		417,378	2.5	0.9	1	dbSNP_132	144	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous,coding-synonymous	MFSD2A	NM_001136493.1,NM_032793.3	,	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	,	139/544,126/531	40430907	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	84879			AK093223	CCDS446.1, CCDS44118.1, CCDS72762.1	1p34.2	2009-09-08	2009-09-08	2009-09-08	ENSG00000168389	ENSG00000168389			25897	protein-coding gene	gene with protein product		614397	"""major facilitator superfamily domain containing 2"""	MFSD2		18694395	Standard	XM_005271285		Approved	FLJ14490	uc001cev.3	Q8NA29	OTTHUMG00000009293	ENST00000372809.5:c.417C>T	1.37:g.40430907C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A8K675|Q6UWU5|Q96F59|Q9BRC8	Silent	SNP	ENST00000372809.5	37	CCDS44118.1																																																																																				0.587	MFSD2A-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000025756.1		NM_032793	
NDUFS8	4728	broad.mit.edu;ucsc.edu	37	11	67799656	67799656	+	Missense_Mutation	SNP	T	T	A			TCGA-CJ-4923-01A-01D-1429-08	TCGA-CJ-4923-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19171a1a-6483-4bf3-b0b4-8cd441303c55	f394a92b-22c4-43d1-991b-b32a270d1cba	g.chr11:67799656T>A	ENST00000313468.5	+	2	145	c.38T>A	c.(37-39)cTg>cAg	p.L13Q	NDUFS8_ENST00000528492.1_Intron|RP5-901A4.1_ENST00000532296.1_RNA|MIR4691_ENST00000583764.1_RNA	NM_002496.3	NP_002487.1	O00217	NDUS8_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 8, 23kDa (NADH-coenzyme Q reductase)	13					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|mitochondrial respiratory chain complex I assembly (GO:0032981)|respiratory electron transport chain (GO:0022904)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)	4 iron, 4 sulfur cluster binding (GO:0051539)|metal ion binding (GO:0046872)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)	p.L13Q(1)		endometrium(1)|kidney(1)|lung(5)|skin(1)	8						CTGCGGGCCCTGGCCCAGGCT	0.602																																					Colon(116;1205 2770 20054)												1	Substitution - Missense(1)	kidney(1)											100.0	96.0	97.0					11																	67799656		2200	4294	6494	SO:0001583	missense	4728			U65579	CCDS8176.1	11q13.2	2011-07-04	2002-08-29		ENSG00000110717	ENSG00000110717	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7715	protein-coding gene	gene with protein product	"""complex I 23kDa subunit"", ""NADH dehydrogenase [ubiquinone] iron-sulfur protein 8, mitochondrial"""	602141	"""NADH dehydrogenase (ubiquinone) Fe-S protein 8 (23kD) (NADH-coenzyme Q reductase)"""			9666055, 9116042	Standard	NM_002496		Approved	TYKY, CI-23k	uc001onc.3	O00217	OTTHUMG00000167331	ENST00000313468.5:c.38T>A	11.37:g.67799656T>A	ENSP00000315774:p.Leu13Gln	Somatic		WXS	Illumina GAIIx	Phase_I	B2RB86|Q0VDA8	Missense_Mutation	SNP	ENST00000313468.5	37	CCDS8176.1	.	.	.	.	.	.	.	.	.	.	T	11.75	1.731638	0.30684	.	.	ENSG00000110717	ENST00000313468;ENST00000453471;ENST00000526339;ENST00000525628	D;D;D;D	0.93307	-3.2;-3.2;-3.2;-3.2	4.56	3.4	0.38934	.	0.176376	0.37857	N	0.001915	D	0.94149	0.8123	L	0.58101	1.795	0.80722	D	1	D;D;P	0.76494	0.999;0.984;0.952	D;P;P	0.74023	0.982;0.694;0.601	D	0.91586	0.5283	10	0.25751	T	0.34	.	8.0011	0.30297	0.0:0.0972:0.0:0.9028	.	13;13;13	B4DYI3;E9PPW7;O00217	.;.;NDUS8_HUMAN	Q	13	ENSP00000315774:L13Q;ENSP00000403972:L13Q;ENSP00000436287:L13Q;ENSP00000432968:L13Q	ENSP00000315774:L13Q	L	+	2	0	NDUFS8	67556232	1.000000	0.71417	1.000000	0.80357	0.857000	0.48899	2.507000	0.45442	1.910000	0.55303	0.533000	0.62120	CTG		0.602	NDUFS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394193.1		NM_002496	
NOVA2	4858	hgsc.bcm.edu	37	19	46443739	46443739	+	Silent	SNP	T	T	G	rs28742045	byFrequency	TCGA-CJ-4923-01A-01D-1429-08	TCGA-CJ-4923-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19171a1a-6483-4bf3-b0b4-8cd441303c55	f394a92b-22c4-43d1-991b-b32a270d1cba	g.chr19:46443739T>G	ENST00000263257.5	-	4	1055	c.861A>C	c.(859-861)gcA>gcC	p.A287A		NM_002516.2	NP_002507.1	Q9UNW9	NOVA2_HUMAN	neuro-oncological ventral antigen 2	287	Ala-rich.				regulation of RNA metabolic process (GO:0051252)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(3)|large_intestine(5)|lung(13)	21		all_neural(266;0.113)|Ovarian(192;0.127)		OV - Ovarian serous cystadenocarcinoma(262;0.00245)|GBM - Glioblastoma multiforme(486;0.0782)|Epithelial(262;0.179)		AGCCGTAACTTGCCAGCGTGT	0.731													G|||	3681	0.735024	0.8003	0.5764	5008	,	,		4953	0.7937		0.7018	False		,,,				2504	0.7331																0								G		3429,863		1382,665,99	15.0	11.0	12.0		861	3.3	1.0	19	dbSNP_125	12	5840,2630		2044,1752,439	no	coding-synonymous	NOVA2	NM_002516.2		3426,2417,538	GG,GT,TT		31.0508,20.1072,27.3703		287/493	46443739	9269,3493	2146	4235	6381	SO:0001819	synonymous_variant	4858			U70477	CCDS12679.1	19q13.3	2008-07-17				ENSG00000104967			7887	protein-coding gene	gene with protein product	"""neuro-oncological ventral antigen 3"""	601991		NOVA3		9344654, 10368286	Standard	NM_002516		Approved	ANOVA	uc002pdv.2	Q9UNW9		ENST00000263257.5:c.861A>C	19.37:g.46443739T>G		Somatic		WXS	Illumina HiSeq	Phase_I	O43267|Q9UEA1	Silent	SNP	ENST00000263257.5	37	CCDS12679.1																																																																																				0.731	NOVA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437210.2		NM_002516	
NRXN1	9378	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	50724674	50724674	+	Missense_Mutation	SNP	C	C	G			TCGA-CJ-4923-01A-01D-1429-08	TCGA-CJ-4923-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19171a1a-6483-4bf3-b0b4-8cd441303c55	f394a92b-22c4-43d1-991b-b32a270d1cba	g.chr2:50724674C>G	ENST00000406316.2	-	14	4152	c.2676G>C	c.(2674-2676)gaG>gaC	p.E892D	NRXN1_ENST00000405472.3_Missense_Mutation_p.E884D|NRXN1_ENST00000401710.1_5'Flank|NRXN1_ENST00000404971.1_Missense_Mutation_p.E932D|NRXN1_ENST00000402717.3_Missense_Mutation_p.E884D|NRXN1_ENST00000406859.3_Missense_Mutation_p.E892D|NRXN1_ENST00000401669.2_Missense_Mutation_p.E892D|NRXN1_ENST00000331040.5_5'UTR	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	892					adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)	p.E933D(1)|p.E892D(1)|p.E932D(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			TGGCATTAAGCTCACAGTAAT	0.443																																																	3	Substitution - Missense(3)	kidney(3)											126.0	116.0	119.0					2																	50724674		1997	4167	6164	SO:0001583	missense	9378			AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.2676G>C	2.37:g.50724674C>G	ENSP00000384311:p.Glu892Asp	Somatic		WXS	Illumina HiSeq	Phase_I	A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Missense_Mutation	SNP	ENST00000406316.2	37	CCDS54360.1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.248198	0.80024	.	.	ENSG00000179915	ENST00000404971;ENST00000406316;ENST00000405472;ENST00000401669;ENST00000536085;ENST00000402717;ENST00000406859	T;T;T;T;T;T	0.78924	-1.22;-1.22;-1.22;-1.22;-1.22;-1.22	5.58	4.7	0.59300	.	0.000000	0.85682	D	0.000000	T	0.80265	0.4591	M	0.77616	2.38	0.37190	D	0.903906	P;P;B	0.44690	0.748;0.841;0.38	P;B;B	0.48704	0.587;0.401;0.109	T	0.80562	-0.1327	10	0.22706	T	0.39	.	9.9704	0.41749	0.0:0.846:0.0:0.154	.	932;892;884	Q9ULB1-3;F8WB18;A7E294	.;.;.	D	932;892;884;892;933;884;892	ENSP00000385142:E932D;ENSP00000384311:E892D;ENSP00000434015:E884D;ENSP00000385017:E892D;ENSP00000385434:E884D;ENSP00000385681:E892D	ENSP00000385017:E892D	E	-	3	2	NRXN1	50578178	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.641000	0.37197	1.568000	0.49683	0.655000	0.94253	GAG		0.443	NRXN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325291.2			
OR4B1	119765	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	48238947	48238947	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-4923-01A-01D-1429-08	TCGA-CJ-4923-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19171a1a-6483-4bf3-b0b4-8cd441303c55	f394a92b-22c4-43d1-991b-b32a270d1cba	g.chr11:48238947A>G	ENST00000309562.2	+	1	604	c.586A>G	c.(586-588)Att>Gtt	p.I196V		NM_001005470.1	NP_001005470.1	Q8NGF8	OR4B1_HUMAN	olfactory receptor, family 4, subfamily B, member 1	196						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.I196V(1)		breast(1)|kidney(1)|large_intestine(3)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	28						GGAGGGGGTTATTGTGTTGGC	0.463																																																	1	Substitution - Missense(1)	kidney(1)											187.0	157.0	168.0					11																	48238947		2201	4298	6499	SO:0001583	missense	119765			AB065848	CCDS31485.1	11p11.2	2012-08-09			ENSG00000175619	ENSG00000175619		"""GPCR / Class A : Olfactory receptors"""	8290	protein-coding gene	gene with protein product							Standard	NM_001005470		Approved	OST208	uc010rhs.2	Q8NGF8	OTTHUMG00000166576	ENST00000309562.2:c.586A>G	11.37:g.48238947A>G	ENSP00000311605:p.Ile196Val	Somatic		WXS	Illumina HiSeq	Phase_I	Q6IF75|Q96R64	Missense_Mutation	SNP	ENST00000309562.2	37	CCDS31485.1	.	.	.	.	.	.	.	.	.	.	A	0.839	-0.742448	0.03088	.	.	ENSG00000175619	ENST00000309562	T	0.36520	1.25	5.54	-3.01	0.05463	GPCR, rhodopsin-like superfamily (1);	0.808617	0.10917	N	0.619857	T	0.10852	0.0265	N	0.02111	-0.68	0.09310	N	1	B	0.06786	0.001	B	0.17979	0.02	T	0.18209	-1.0344	10	0.38643	T	0.18	.	1.6735	0.02817	0.3394:0.2452:0.296:0.1194	.	196	Q8NGF8	OR4B1_HUMAN	V	196	ENSP00000311605:I196V	ENSP00000311605:I196V	I	+	1	0	OR4B1	48195523	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.780000	0.04654	-0.495000	0.06659	-0.478000	0.04885	ATT		0.463	OR4B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390554.1		NM_001005470	
PBRM1	55193	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	52582140	52582140	+	Missense_Mutation	SNP	C	C	G			TCGA-CJ-4923-01A-01D-1429-08	TCGA-CJ-4923-11A-01D-1429-08	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	19171a1a-6483-4bf3-b0b4-8cd441303c55	f394a92b-22c4-43d1-991b-b32a270d1cba	g.chr3:52582140C>G	ENST00000296302.7	-	30	5010	c.5009G>C	c.(5008-5010)cGa>cCa	p.R1670P	PBRM1_ENST00000409767.1_Missense_Mutation_p.R1578P|PBRM1_ENST00000356770.4_Missense_Mutation_p.R1583P|SMIM4_ENST00000476842.1_Intron|PBRM1_ENST00000409114.3_Missense_Mutation_p.R1633P|PBRM1_ENST00000337303.4_Missense_Mutation_p.R1563P|PBRM1_ENST00000409057.1_Missense_Mutation_p.R1615P|PBRM1_ENST00000410007.1_Missense_Mutation_p.R1590P|PBRM1_ENST00000394830.3_Missense_Mutation_p.R1563P			Q86U86	PB1_HUMAN	polybromo 1	1670					chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.R1670P(1)|p.R1563P(1)|p.R1583P(1)		breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		CATCAAATCTCGAAGGCGCCA	0.483			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																			Rec	yes		3	3p21	55193	polybromo 1		E	3	Substitution - Missense(3)	kidney(3)											140.0	134.0	136.0					3																	52582140		2203	4300	6503	SO:0001583	missense	55193			BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.5009G>C	3.37:g.52582140C>G	ENSP00000296302:p.Arg1670Pro	Somatic		WXS	Illumina HiSeq	Phase_I	A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Missense_Mutation	SNP	ENST00000296302.7	37		.	.	.	.	.	.	.	.	.	.	C	17.62	3.435295	0.62955	.	.	ENSG00000163939	ENST00000356770;ENST00000394830;ENST00000296302;ENST00000337303;ENST00000409057;ENST00000410007;ENST00000409114;ENST00000409767	T;T;T;T;T;T;T;T	0.64438	-0.08;-0.1;-0.02;0.04;-0.1;-0.08;0.5;0.04	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	T	0.81692	0.4876	M	0.80332	2.49	0.58432	D	0.999995	D;D;D;D;D;D;D;D	0.89917	0.999;0.999;0.999;0.999;1.0;0.998;0.999;0.999	D;D;D;D;D;D;D;D	0.87578	0.995;0.997;0.997;0.997;0.998;0.992;0.997;0.997	T	0.83127	-0.0115	10	0.87932	D	0	-8.966	19.9915	0.97366	0.0:1.0:0.0:0.0	.	1590;1563;1615;1633;1578;1670;1583;1563	Q86U86-9;Q86U86-4;Q86U86-2;Q86U86-8;Q86U86-7;Q86U86;Q86U86-3;Q86U86-5	.;.;.;.;.;PB1_HUMAN;.;.	P	1583;1563;1670;1563;1615;1590;1633;1578	ENSP00000349213:R1583P;ENSP00000378307:R1563P;ENSP00000296302:R1670P;ENSP00000338302:R1563P;ENSP00000386593:R1615P;ENSP00000386529:R1590P;ENSP00000386643:R1633P;ENSP00000386601:R1578P	ENSP00000296302:R1670P	R	-	2	0	PBRM1	52557180	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.731000	0.84895	2.723000	0.93209	0.655000	0.94253	CGA		0.483	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000327232.1		NM_018165	
PCDH1	5097	broad.mit.edu;ucsc.edu	37	5	141233715	141233715	+	Silent	SNP	G	G	A			TCGA-CJ-4923-01A-01D-1429-08	TCGA-CJ-4923-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19171a1a-6483-4bf3-b0b4-8cd441303c55	f394a92b-22c4-43d1-991b-b32a270d1cba	g.chr5:141233715G>A	ENST00000287008.3	-	5	3753	c.3606C>T	c.(3604-3606)tgC>tgT	p.C1202C	PCDH1_ENST00000503492.1_3'UTR	NM_032420.2	NP_115796.2	Q08174	PCDH1_HUMAN	protocadherin 1	0					cell-cell signaling (GO:0007267)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.C1202C(1)		breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(4)|lung(20)|ovary(5)|skin(3)|upper_aerodigestive_tract(1)	51		Lung NSC(810;0.027)|all_lung(500;0.0321)|all_hematologic(541;0.0433)|Prostate(461;0.0453)|Breast(839;0.128)|Lung SC(612;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;1.06e-05)		CCGAGTCCTTGCAGGAATCAT	0.662																																					Ovarian(132;1609 1739 4190 14731 45037)												1	Substitution - coding silent(1)	kidney(1)											36.0	40.0	38.0					5																	141233715		2203	4300	6503	SO:0001819	synonymous_variant	5097			AK075233	CCDS4267.1, CCDS43375.1	5q31.3	2010-01-26	2007-02-12		ENSG00000156453	ENSG00000156453		"""Cadherins / Protocadherins : Non-clustered"""	8655	protein-coding gene	gene with protein product		603626	"""protocadherin 1 (cadherin-like 1)"""			8508762	Standard	NM_032420		Approved	pc42	uc003llp.3	Q08174	OTTHUMG00000129661	ENST00000287008.3:c.3606C>T	5.37:g.141233715G>A		Somatic		WXS	Illumina GAIIx	Phase_I	Q8IUP2	Silent	SNP	ENST00000287008.3	37	CCDS4267.1																																																																																				0.662	PCDH1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320587.2		NM_032420	
PNPLA6	10908	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	7615512	7615512	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-4923-01A-01D-1429-08	TCGA-CJ-4923-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19171a1a-6483-4bf3-b0b4-8cd441303c55	f394a92b-22c4-43d1-991b-b32a270d1cba	g.chr19:7615512G>A	ENST00000221249.6	+	19	2370	c.1939G>A	c.(1939-1941)Gac>Aac	p.D647N	PNPLA6_ENST00000594864.1_3'UTR|PNPLA6_ENST00000450331.3_Missense_Mutation_p.D647N|PNPLA6_ENST00000600737.1_Missense_Mutation_p.D686N|PNPLA6_ENST00000545201.2_Missense_Mutation_p.D621N|PNPLA6_ENST00000414982.3_Missense_Mutation_p.D695N	NM_006702.4	NP_006693.3	Q8IY17	PLPL6_HUMAN	patatin-like phospholipase domain containing 6	686					angiogenesis (GO:0001525)|cell death (GO:0008219)|lipid catabolic process (GO:0016042)|organ morphogenesis (GO:0009887)|phosphatidylcholine metabolic process (GO:0046470)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	lysophospholipase activity (GO:0004622)	p.D647N(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(14)|ovary(3)|stomach(1)|upper_aerodigestive_tract(1)	35						CGGCCGCGGCGACCTCATCGG	0.642																																																	1	Substitution - Missense(1)	kidney(1)											48.0	40.0	43.0					19																	7615512		2203	4300	6503	SO:0001583	missense	10908			AJ004832	CCDS32891.1, CCDS54206.1, CCDS54207.1, CCDS59343.1	19p13.2	2013-09-11						"""Patatin-like phospholipase domain containing"""	16268	protein-coding gene	gene with protein product	"""neuropathy target esterase"""	603197				9576844, 16799181, 19029121	Standard	NM_006702		Approved	NTE, sws, iPLA2delta, SPG39	uc010xjq.2	Q8IY17		ENST00000221249.6:c.1939G>A	19.37:g.7615512G>A	ENSP00000221249:p.Asp647Asn	Somatic		WXS	Illumina HiSeq	Phase_I	A6NGQ0|B4DFB9|B7Z7T2|F5H5K9|J3KQS3|O60859|Q86W58|Q9UG58	Missense_Mutation	SNP	ENST00000221249.6	37	CCDS32891.1	.	.	.	.	.	.	.	.	.	.	G	36	5.646156	0.96704	.	.	ENSG00000032444	ENST00000221249;ENST00000545201;ENST00000414982;ENST00000450331	T;T;T;T	0.50277	0.75;0.75;0.75;0.75	5.09	5.09	0.68999	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (3);	0.000000	0.85682	D	0.000000	T	0.69602	0.3129	M	0.81497	2.545	0.80722	D	1	D;D;D;D	0.69078	0.994;0.992;0.992;0.997	D;D;D;D	0.69307	0.946;0.91;0.939;0.963	T	0.74850	-0.3524	10	0.87932	D	0	.	16.002	0.80301	0.0:0.0:1.0:0.0	.	686;621;686;647	Q8IY17;F5H5K9;Q8IY17-3;Q8IY17-2	PLPL6_HUMAN;.;.;.	N	647;621;695;647	ENSP00000221249:D647N;ENSP00000443323:D621N;ENSP00000407509:D695N;ENSP00000394348:D647N	ENSP00000221249:D647N	D	+	1	0	PNPLA6	7521512	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	9.646000	0.98474	2.362000	0.80069	0.591000	0.81541	GAC		0.642	PNPLA6-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459275.1		NM_006702	
PRPF8	10594	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	1579248	1579248	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-4923-01A-01D-1429-08	TCGA-CJ-4923-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19171a1a-6483-4bf3-b0b4-8cd441303c55	f394a92b-22c4-43d1-991b-b32a270d1cba	g.chr17:1579248G>A	ENST00000572621.1	-	17	2918	c.2653C>T	c.(2653-2655)Ctc>Ttc	p.L885F	PRPF8_ENST00000304992.6_Missense_Mutation_p.L885F			Q6P2Q9	PRP8_HUMAN	pre-mRNA processing factor 8	885	Reverse transcriptase homology domain.				gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|U5 snRNP (GO:0005682)	poly(A) RNA binding (GO:0044822)|U5 snRNA binding (GO:0030623)|U6 snRNA binding (GO:0017070)	p.L885F(1)		NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(13)|lung(24)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	77				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)		TGTGTGAGGAGGTGACGCTTG	0.532																																																	1	Substitution - Missense(1)	kidney(1)											71.0	68.0	69.0					17																	1579248		2203	4300	6503	SO:0001583	missense	10594			AB007510	CCDS11010.1	17p13.3	2013-07-16	2013-06-10		ENSG00000174231	ENSG00000174231			17340	protein-coding gene	gene with protein product		607300	"""PRP8 pre-mRNA processing factor 8 homolog (yeast)"", ""PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae)"""	RP13		11468273, 10411133	Standard	NM_006445		Approved	PRPC8, Prp8, hPrp8, SNRNP220	uc002fte.3	Q6P2Q9	OTTHUMG00000090553	ENST00000572621.1:c.2653C>T	17.37:g.1579248G>A	ENSP00000460348:p.Leu885Phe	Somatic		WXS	Illumina HiSeq	Phase_I	O14547|O75965	Missense_Mutation	SNP	ENST00000572621.1	37	CCDS11010.1	.	.	.	.	.	.	.	.	.	.	G	19.10	3.761943	0.69763	.	.	ENSG00000174231	ENST00000304992	D	0.86694	-2.16	6.01	3.71	0.42584	.	0.000000	0.85682	D	0.000000	D	0.91801	0.7406	M	0.89840	3.065	0.58432	D	0.999998	D	0.55385	0.971	P	0.54924	0.764	D	0.92135	0.5715	10	0.56958	D	0.05	-11.4303	9.9151	0.41430	0.2761:0.0:0.7239:0.0	.	885	Q6P2Q9	PRP8_HUMAN	F	885	ENSP00000304350:L885F	ENSP00000304350:L885F	L	-	1	0	PRPF8	1525998	1.000000	0.71417	0.999000	0.59377	0.951000	0.60555	4.942000	0.63547	1.558000	0.49541	0.650000	0.86243	CTC		0.532	PRPF8-002	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438412.2			
PYDC2	152138	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	191179038	191179038	+	Silent	SNP	G	G	A			TCGA-CJ-4923-01A-01D-1429-08	TCGA-CJ-4923-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19171a1a-6483-4bf3-b0b4-8cd441303c55	f394a92b-22c4-43d1-991b-b32a270d1cba	g.chr3:191179038G>A	ENST00000518817.1	+	1	87	c.87G>A	c.(85-87)ctG>ctA	p.L29L		NM_001083308.1	NP_001076777.1	Q56P42	PYDC2_HUMAN	pyrin domain containing 2	29	DAPIN. {ECO:0000255|PROSITE- ProRule:PRU00061}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.L29L(1)		breast(1)|kidney(2)|large_intestine(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	10						TCAAGTCTCTGATCAGAACAA	0.517																																																	1	Substitution - coding silent(1)	kidney(1)											76.0	84.0	81.0					3																	191179038		2202	4300	6502	SO:0001819	synonymous_variant	152138					3q28	2008-07-29				ENSG00000253548			33512	protein-coding gene	gene with protein product		615701				17178784	Standard	NM_001083308		Approved	POP2	uc011bso.2	Q56P42		ENST00000518817.1:c.87G>A	3.37:g.191179038G>A		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000518817.1	37																																																																																					0.517	PYDC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000343231.2		NM_001083308	
RPSAP58	388524	broad.mit.edu	37	19	24010099	24010099	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-4923-01A-01D-1429-08	TCGA-CJ-4923-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19171a1a-6483-4bf3-b0b4-8cd441303c55	f394a92b-22c4-43d1-991b-b32a270d1cba	g.chr19:24010099A>G	ENST00000496398.1	+	4	559	c.136A>G	c.(136-138)Atc>Gtc	p.I46V	RP11-255H23.2_ENST00000471224.1_RNA|RPSAP58_ENST00000354585.4_Missense_Mutation_p.I46V|RP11-255H23.4_ENST00000599944.1_lincRNA					ribosomal protein SA pseudogene 58									p.I46V(2)		endometrium(1)|kidney(5)|lung(2)|prostate(1)|urinary_tract(1)	10						AAGTGATGGCATCTATATCAT	0.453																																																	2	Substitution - Missense(2)	kidney(2)																																								SO:0001583	missense	388524					19p12	2010-06-16			ENSG00000205246	ENSG00000205246			36809	pseudogene	pseudogene						19123937	Standard	NR_003662		Approved		uc002nrn.3		OTTHUMG00000158122	ENST00000496398.1:c.136A>G	19.37:g.24010099A>G	ENSP00000417240:p.Ile46Val	Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000496398.1	37		.	.	.	.	.	.	.	.	.	.	.	4.856	0.159130	0.09236	.	.	ENSG00000205246	ENST00000486528;ENST00000496398;ENST00000354585	T;T;T	0.24151	1.87;1.87;1.87	2.75	2.75	0.32379	.	0.081810	0.48286	U	0.000182	T	0.11452	0.0279	.	.	.	0.26884	N	0.967484	B	0.02656	0.0	B	0.06405	0.002	T	0.28776	-1.0033	9	0.09590	T	0.72	.	9.0538	0.36392	1.0:0.0:0.0:0.0	.	46	A6NE09	.	V	46	ENSP00000420173:I46V;ENSP00000417240:I46V;ENSP00000346598:I46V	ENSP00000346598:I46V	I	+	1	0	RPSAP58	23801939	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.475000	0.35409	1.303000	0.44873	0.510000	0.49958	ATC		0.453	RPSAP58-001	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000350238.1		NR_003662	
RUNDC3B	154661	broad.mit.edu;hgsc.bcm.edu	37	7	87436831	87436831	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-4923-01A-01D-1429-08	TCGA-CJ-4923-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19171a1a-6483-4bf3-b0b4-8cd441303c55	f394a92b-22c4-43d1-991b-b32a270d1cba	g.chr7:87436831A>G	ENST00000338056.3	+	10	1562	c.1151A>G	c.(1150-1152)tAt>tGt	p.Y384C	RUNDC3B_ENST00000394654.3_Missense_Mutation_p.Y367C|RUNDC3B_ENST00000493037.1_Intron	NM_001134405.1|NM_138290.2	NP_001127877.1|NP_612147.1	Q96NL0	RUN3B_HUMAN	RUN domain containing 3B	384								p.Y384C(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(2)	26	Esophageal squamous(14;0.00164)					AAACAGTGGTATGAGTAAGTG	0.383																																																	1	Substitution - Missense(1)	kidney(1)											110.0	98.0	102.0					7																	87436831		2203	4300	6503	SO:0001583	missense	154661				CCDS5609.1, CCDS47635.1, CCDS47636.1	7q21.12	2009-01-14			ENSG00000105784	ENSG00000105784			30286	protein-coding gene	gene with protein product						12645870	Standard	NM_138290		Approved	RPIP9, RPIB9	uc003ujb.3	Q96NL0	OTTHUMG00000131035	ENST00000338056.3:c.1151A>G	7.37:g.87436831A>G	ENSP00000337732:p.Tyr384Cys	Somatic		WXS	Illumina HiSeq	Phase_I	B4DFD0|E9PBR4|Q8IWW5|Q8NB55|Q8TBG7	Missense_Mutation	SNP	ENST00000338056.3	37	CCDS5609.1	.	.	.	.	.	.	.	.	.	.	A	14.40	2.524574	0.44969	.	.	ENSG00000105784	ENST00000338056;ENST00000394654	T;T	0.13901	2.55;2.55	6.17	6.17	0.99709	.	0.238619	0.41097	D	0.000948	T	0.08537	0.0212	N	0.08118	0	0.46241	D	0.99894	P;P	0.39831	0.69;0.69	B;B	0.35971	0.215;0.215	T	0.34502	-0.9826	10	0.37606	T	0.19	-9.4114	16.8222	0.85835	1.0:0.0:0.0:0.0	.	367;384	E9PBR4;Q96NL0	.;RUN3B_HUMAN	C	384;367	ENSP00000337732:Y384C;ENSP00000378149:Y367C	ENSP00000337732:Y384C	Y	+	2	0	RUNDC3B	87274767	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.121000	0.77160	2.371000	0.80710	0.533000	0.62120	TAT		0.383	RUNDC3B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000253679.1		NM_138290	
SELENBP1	8991	broad.mit.edu;ucsc.edu	37	1	151339307	151339307	+	Silent	SNP	C	C	T	rs146898667	byFrequency	TCGA-CJ-4923-01A-01D-1429-08	TCGA-CJ-4923-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19171a1a-6483-4bf3-b0b4-8cd441303c55	f394a92b-22c4-43d1-991b-b32a270d1cba	g.chr1:151339307C>T	ENST00000368868.5	-	6	646	c.555G>A	c.(553-555)ccG>ccA	p.P185P	SELENBP1_ENST00000435071.1_Silent_p.P121P|SELENBP1_ENST00000447402.3_Silent_p.P123P|SELENBP1_ENST00000426705.2_Silent_p.P227P|SELENBP1_ENST00000473693.1_5'Flank	NM_003944.3	NP_003935.2	Q13228	SBP1_HUMAN	selenium binding protein 1	185					protein transport (GO:0015031)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	selenium binding (GO:0008430)	p.P185P(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(11)|prostate(1)|urinary_tract(1)	20	Lung SC(34;0.00471)|Ovarian(49;0.00871)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			CATAGCCCAACGGTGCAGCAC	0.577													C|||	3	0.000599042	0.0015	0.0	5008	,	,		18092	0.0		0.001	False		,,,				2504	0.0																1	Substitution - coding silent(1)	kidney(1)											235.0	193.0	207.0					1																	151339307		2203	4300	6503	SO:0001819	synonymous_variant	8991			U29091	CCDS995.1, CCDS58027.1, CCDS60266.1	1q21.3	2014-05-19			ENSG00000143416	ENSG00000143416			10719	protein-coding gene	gene with protein product		604188				9027582	Standard	NM_003944		Approved	hSP56, hSBP, LPSB	uc010pcy.3	Q13228	OTTHUMG00000012498	ENST00000368868.5:c.555G>A	1.37:g.151339307C>T		Somatic		WXS	Illumina GAIIx	Phase_I	A6NML9|A6PVW9|B2RDR3|B4DKP6|B4E1F3|Q49AQ8|Q96GX7	Silent	SNP	ENST00000368868.5	37	CCDS995.1	2	9.157509157509158E-4	1	0.0020325203252032522	0	0.0	0	0.0	1	0.0013192612137203166	C	0.081	-1.184018	0.01620	.	.	ENSG00000143416	ENST00000424475	.	.	.	5.32	-10.6	0.00265	.	.	.	.	.	T	0.26738	0.0654	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.63010	-0.6732	4	.	.	.	-0.6142	9.151	0.36962	0.0672:0.3002:0.5268:0.1058	.	.	.	.	H	146	.	.	R	-	2	0	SELENBP1	149605931	0.000000	0.05858	0.001000	0.08648	0.112000	0.19704	-9.080000	0.00014	-4.422000	0.00050	-1.434000	0.01081	CGT		0.577	SELENBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034904.4			
STK17B	9262	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	197002269	197002269	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CJ-4923-01A-01D-1429-08	TCGA-CJ-4923-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19171a1a-6483-4bf3-b0b4-8cd441303c55	f394a92b-22c4-43d1-991b-b32a270d1cba	g.chr2:197002269C>A	ENST00000263955.4	-	8	1307	c.1021G>T	c.(1021-1023)Gag>Tag	p.E341*	STK17B_ENST00000409228.1_Nonsense_Mutation_p.E341*	NM_004226.3	NP_004217.1	O94768	ST17B_HUMAN	serine/threonine kinase 17b	341					apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|positive regulation of fibroblast apoptotic process (GO:2000271)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.E341*(1)		breast(1)|cervix(1)|kidney(2)|large_intestine(1)|lung(10)	15			OV - Ovarian serous cystadenocarcinoma(117;0.141)			GGGATATTCTCTTTGTCTTCT	0.418																																																	1	Substitution - Nonsense(1)	kidney(1)											141.0	147.0	145.0					2																	197002269		2203	4300	6503	SO:0001587	stop_gained	9262			AB011421	CCDS2315.1	2q33.1	2008-02-05	2007-02-12		ENSG00000081320	ENSG00000081320			11396	protein-coding gene	gene with protein product	"""death-associated protein kinase-related 2"""	604727	"""serine/threonine kinase 17b (apoptosis-inducing)"""			9786912	Standard	NM_004226		Approved	DRAK2	uc002utk.3	O94768	OTTHUMG00000132735	ENST00000263955.4:c.1021G>T	2.37:g.197002269C>A	ENSP00000263955:p.Glu341*	Somatic		WXS	Illumina HiSeq	Phase_I		Nonsense_Mutation	SNP	ENST00000263955.4	37	CCDS2315.1	.	.	.	.	.	.	.	.	.	.	C	34	5.378061	0.95945	.	.	ENSG00000081320	ENST00000263955;ENST00000409228	.	.	.	4.98	4.98	0.66077	.	0.000000	0.50627	D	0.000115	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.25106	T	0.35	.	16.6188	0.84924	0.0:1.0:0.0:0.0	.	.	.	.	X	341	.	ENSP00000263955:E341X	E	-	1	0	STK17B	196710514	1.000000	0.71417	1.000000	0.80357	0.652000	0.38707	4.867000	0.63013	2.600000	0.87896	0.650000	0.86243	GAG		0.418	STK17B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256092.2			
SYNJ2	8871	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	158497795	158497795	+	Silent	SNP	A	A	G			TCGA-CJ-4923-01A-01D-1429-08	TCGA-CJ-4923-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19171a1a-6483-4bf3-b0b4-8cd441303c55	f394a92b-22c4-43d1-991b-b32a270d1cba	g.chr6:158497795A>G	ENST00000355585.4	+	17	2505	c.2430A>G	c.(2428-2430)aaA>aaG	p.K810K	SYNJ2_ENST00000367121.3_Silent_p.K810K|SYNJ2_ENST00000367122.2_Silent_p.K810K|SYNJ2_ENST00000367112.1_5'Flank	NM_001178088.1|NM_003898.3	NP_001171559.1|NP_003889.1	O15056	SYNJ2_HUMAN	synaptojanin 2	810					phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|membrane (GO:0016020)	nucleotide binding (GO:0000166)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|RNA binding (GO:0003723)	p.K810K(1)		biliary_tract(1)|endometrium(9)|kidney(3)|large_intestine(11)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	46				OV - Ovarian serous cystadenocarcinoma(65;4.42e-18)|BRCA - Breast invasive adenocarcinoma(81;4.23e-05)		GGAGGAAGAAACATCCCTTTG	0.572																																																	1	Substitution - coding silent(1)	kidney(1)											46.0	44.0	45.0					6																	158497795		2203	4300	6503	SO:0001819	synonymous_variant	8871			AB002346	CCDS5254.1	6q25.3	2008-05-15			ENSG00000078269	ENSG00000078269			11504	protein-coding gene	gene with protein product		609410					Standard	NM_003898		Approved	INPP5H	uc003qqx.2	O15056	OTTHUMG00000015904	ENST00000355585.4:c.2430A>G	6.37:g.158497795A>G		Somatic		WXS	Illumina HiSeq	Phase_I	Q5TA13|Q5TA16|Q5TA19|Q86XK0|Q8IZA8|Q9H226	Silent	SNP	ENST00000355585.4	37	CCDS5254.1																																																																																				0.572	SYNJ2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042858.2			
TG	7038	hgsc.bcm.edu;ucsc.edu	37	8	133925416	133925416	+	Frame_Shift_Del	DEL	C	C	-			TCGA-CJ-4923-01A-01D-1429-08	TCGA-CJ-4923-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19171a1a-6483-4bf3-b0b4-8cd441303c55	f394a92b-22c4-43d1-991b-b32a270d1cba	g.chr8:133925416delC	ENST00000220616.4	+	20	4324	c.4284delC	c.(4282-4284)gacfs	p.D1428fs	TG_ENST00000377869.1_Frame_Shift_Del_p.D1428fs	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	1428					hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		TCCAAGGGGACCACTTTGGCA	0.562																																																	0													113.0	92.0	99.0					8																	133925416		2203	4300	6503	SO:0001589	frameshift_variant	7038			AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.4284delC	8.37:g.133925416delC	ENSP00000220616:p.Asp1428fs	Somatic		WXS	Illumina HiSeq	Phase_I	O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Frame_Shift_Del	DEL	ENST00000220616.4	37	CCDS34944.1																																																																																				0.562	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379606.1		NM_003235	
TOP3B	8940	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	22	22317229	22317229	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-4923-01A-01D-1429-08	TCGA-CJ-4923-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19171a1a-6483-4bf3-b0b4-8cd441303c55	f394a92b-22c4-43d1-991b-b32a270d1cba	g.chr22:22317229C>T	ENST00000398793.2	-	12	1675	c.1241G>A	c.(1240-1242)aGa>aAa	p.R414K	TOP3B_ENST00000413067.2_Missense_Mutation_p.R143K|TOP3B_ENST00000357179.5_Missense_Mutation_p.R414K	NM_003935.3	NP_003926.1	O95985	TOP3B_HUMAN	topoisomerase (DNA) III beta	414					chromosome segregation (GO:0007059)|DNA topological change (GO:0006265)	condensed chromosome (GO:0000793)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA topoisomerase activity (GO:0003916)|DNA topoisomerase type I activity (GO:0003917)|poly(A) RNA binding (GO:0044822)	p.R414K(2)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(4)|lung(9)|ovary(1)	26	Colorectal(54;0.105)			READ - Rectum adenocarcinoma(21;0.145)		GATGAAGTGTCTGGTGATGTA	0.622																																																	2	Substitution - Missense(2)	kidney(2)											107.0	101.0	103.0					22																	22317229		2203	4300	6503	SO:0001583	missense	8940			AF017146	CCDS13797.1	22q11.22	2011-05-24			ENSG00000100038	ENSG00000100038			11993	protein-coding gene	gene with protein product		603582				9786842, 9074928	Standard	XM_005261811		Approved		uc002zvs.3	O95985	OTTHUMG00000167438	ENST00000398793.2:c.1241G>A	22.37:g.22317229C>T	ENSP00000381773:p.Arg414Lys	Somatic		WXS	Illumina HiSeq	Phase_I	A0M8Q3|Q9BUP5	Missense_Mutation	SNP	ENST00000398793.2	37	CCDS13797.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.2|23.2	4.381534|4.381534	0.82792|0.82792	.|.	.|.	ENSG00000100038|ENSG00000100038	ENST00000457270|ENST00000357179;ENST00000398793;ENST00000413067	.|T;T;T	.|0.22945	.|1.93;1.93;1.93	4.59|4.59	4.59|4.59	0.56863|0.56863	.|DNA topoisomerase, type IA, core domain (1);DNA topoisomerase, type IA, central region, subdomain 3 (1);DNA topoisomerase, type IA, central (1);DNA topoisomerase, type IA, DNA-binding (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.39279|0.39279	0.1072|0.1072	M|M	0.83384|0.83384	2.64|2.64	0.80722|0.80722	D|D	1|1	.|B;B	.|0.21753	.|0.06;0.048	.|B;B	.|0.28916	.|0.096;0.047	T|T	0.45585|0.45585	-0.9251|-0.9251	5|10	.|0.66056	.|D	.|0.02	.|.	17.5949|17.5949	0.88009|0.88009	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|414;414	.|O95985;O95985-2	.|TOP3B_HUMAN;.	N|K	209|414;414;143	.|ENSP00000349705:R414K;ENSP00000381773:R414K;ENSP00000393118:R143K	.|ENSP00000349705:R414K	D|R	-|-	1|2	0|0	TOP3B|TOP3B	20647229|20647229	0.900000|0.900000	0.30661|0.30661	0.932000|0.932000	0.37286|0.37286	0.868000|0.868000	0.49771|0.49771	7.085000|7.085000	0.76875|0.76875	2.368000|2.368000	0.80403|0.80403	0.563000|0.563000	0.77884|0.77884	GAC|AGA		0.622	TOP3B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320251.1		NM_003935	
TUBB8P7	197331	broad.mit.edu	37	16	90161578	90161578	+	RNA	SNP	G	G	A	rs13337896	byFrequency	TCGA-CJ-4923-01A-01D-1429-08	TCGA-CJ-4923-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19171a1a-6483-4bf3-b0b4-8cd441303c55	f394a92b-22c4-43d1-991b-b32a270d1cba	g.chr16:90161578G>A	ENST00000564451.1	+	0	931				TUBB8P7_ENST00000567960.1_RNA					tubulin, beta 8 class VIII pseudogene 7									p.R105H(3)									GCCAAGGGACGCTACACCGAA	0.587													.|||	668	0.133387	0.0386	0.1499	5008	,	,		18807	0.4087		0.0537	False		,,,				2504	0.0481																3	Substitution - Missense(3)	urinary_tract(1)|prostate(1)|kidney(1)																																										0					16q24.3	2013-02-18			ENSG00000261812	ENSG00000261812			42345	pseudogene	pseudogene							Standard	NG_002334		Approved				OTTHUMG00000172847		16.37:g.90161578G>A		Somatic		WXS	Illumina GAIIx	Phase_I		Silent	SNP	ENST00000564451.1	37																																																																																					0.587	TUBB8P7-004	KNOWN	basic	processed_transcript	polymorphic_pseudogene	OTTHUMT00000420856.1		NG_002334	
VPS13B	157680	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	100148945	100148945	+	Missense_Mutation	SNP	A	A	C			TCGA-CJ-4923-01A-01D-1429-08	TCGA-CJ-4923-11A-01D-1429-08	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	19171a1a-6483-4bf3-b0b4-8cd441303c55	f394a92b-22c4-43d1-991b-b32a270d1cba	g.chr8:100148945A>C	ENST00000358544.2	+	12	1727	c.1616A>C	c.(1615-1617)gAt>gCt	p.D539A	VPS13B_ENST00000357162.2_Missense_Mutation_p.D539A|VPS13B_ENST00000395996.1_Missense_Mutation_p.D539A|VPS13B_ENST00000355155.1_Missense_Mutation_p.D539A	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	539					protein transport (GO:0015031)			p.D539A(2)		NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			TTTTATATGGATTACCTGTAT	0.383																																					Colon(161;2205 2542 7338 31318)												2	Substitution - Missense(2)	kidney(2)											257.0	248.0	251.0					8																	100148945		2203	4300	6503	SO:0001583	missense	157680			AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.1616A>C	8.37:g.100148945A>C	ENSP00000351346:p.Asp539Ala	Somatic		WXS	Illumina HiSeq	Phase_I	C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Missense_Mutation	SNP	ENST00000358544.2	37	CCDS6280.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.119350	0.77323	.	.	ENSG00000132549	ENST00000355155;ENST00000357162;ENST00000358544;ENST00000395996	D;T;T;T	0.85955	-2.05;-1.44;-1.44;-1.15	5.1	5.1	0.69264	.	0.000000	0.64402	D	0.000003	D	0.85898	0.5804	N	0.14661	0.345	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.998;0.998;0.996;0.998;1.0	D	0.88746	0.3247	10	0.87932	D	0	.	14.9004	0.70675	1.0:0.0:0.0:0.0	.	539;539;539;539;539	Q7Z7G8-6;Q7Z7G8-2;Q7Z7G8;Q7Z7G8-3;Q7Z7G8-4	.;.;VP13B_HUMAN;.;.	A	539	ENSP00000347281:D539A;ENSP00000349685:D539A;ENSP00000351346:D539A;ENSP00000379318:D539A	ENSP00000347281:D539A	D	+	2	0	VPS13B	100218121	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.701000	0.91331	1.927000	0.55829	0.377000	0.23210	GAT		0.383	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277138.1		NM_184042	
ZFR	51663	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	32404076	32404076	+	Missense_Mutation	SNP	A	A	T			TCGA-CJ-4923-01A-01D-1429-08	TCGA-CJ-4923-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19171a1a-6483-4bf3-b0b4-8cd441303c55	f394a92b-22c4-43d1-991b-b32a270d1cba	g.chr5:32404076A>T	ENST00000265069.8	-	7	1261	c.1159T>A	c.(1159-1161)Tgc>Agc	p.C387S		NM_016107.3	NP_057191.2	Q96KR1	ZFR_HUMAN	zinc finger RNA binding protein	387					multicellular organismal development (GO:0007275)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.C387S(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|upper_aerodigestive_tract(2)	32				STAD - Stomach adenocarcinoma(35;0.19)		GACACATCGCAGAGCTCACAA	0.453																																																	1	Substitution - Missense(1)	kidney(1)											164.0	157.0	159.0					5																	32404076		2203	4300	6503	SO:0001583	missense	51663			AF100742	CCDS34139.1	5p15.2	2014-03-03			ENSG00000056097	ENSG00000056097			17277	protein-coding gene	gene with protein product		615635				11574164, 24482476	Standard	NM_016107		Approved	ZFR1, SPG71	uc003jhr.1	Q96KR1	OTTHUMG00000161979	ENST00000265069.8:c.1159T>A	5.37:g.32404076A>T	ENSP00000265069:p.Cys387Ser	Somatic		WXS	Illumina HiSeq	Phase_I	B2RNR5|Q05C08|Q3B7X5|Q6P5A3|Q86UA0|Q9H6V4|Q9NTI1|Q9Y687	Missense_Mutation	SNP	ENST00000265069.8	37	CCDS34139.1	.	.	.	.	.	.	.	.	.	.	A	18.82	3.705685	0.68615	.	.	ENSG00000056097	ENST00000265069;ENST00000382126	D	0.99964	-9.97	5.82	5.82	0.92795	Zinc finger, C2H2-like (1);Zinc finger, U1-type (1);Zinc finger, C2H2 (1);	0.039510	0.85682	D	0.000000	D	0.99967	0.9988	M	0.77103	2.36	0.80722	D	1	D	0.54772	0.968	D	0.72338	0.977	D	0.93825	0.7122	10	0.87932	D	0	.	14.7574	0.69576	1.0:0.0:0.0:0.0	.	387	Q96KR1	ZFR_HUMAN	S	387;365	ENSP00000265069:C387S	ENSP00000265069:C387S	C	-	1	0	ZFR	32439833	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.339000	0.96797	2.227000	0.72691	0.454000	0.30748	TGC		0.453	ZFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366586.1			
ZNF184	7738	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	27420046	27420046	+	Nonsense_Mutation	SNP	G	G	C			TCGA-CJ-4923-01A-01D-1429-08	TCGA-CJ-4923-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19171a1a-6483-4bf3-b0b4-8cd441303c55	f394a92b-22c4-43d1-991b-b32a270d1cba	g.chr6:27420046G>C	ENST00000211936.6	-	6	1576	c.1292C>G	c.(1291-1293)tCa>tGa	p.S431*	ZNF184_ENST00000377419.1_Nonsense_Mutation_p.S431*	NM_007149.2	NP_009080.2	Q99676	ZN184_HUMAN	zinc finger protein 184	431					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.S431*(1)		breast(1)|cervix(1)|endometrium(4)|kidney(9)|large_intestine(13)|lung(14)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	48						AGTGAGGTTTGAGTGCTGGCT	0.438																																																	1	Substitution - Nonsense(1)	kidney(1)											94.0	93.0	93.0					6																	27420046		2203	4300	6503	SO:0001587	stop_gained	7738			U66561	CCDS4624.1	6p21.3	2013-01-08	2006-06-28		ENSG00000096654	ENSG00000096654		"""Zinc fingers, C2H2-type"", ""-"""	12975	protein-coding gene	gene with protein product		602277	"""zinc finger protein 184 (Kruppel-like)"""				Standard	NM_007149		Approved		uc003nji.3	Q99676	OTTHUMG00000014478	ENST00000211936.6:c.1292C>G	6.37:g.27420046G>C	ENSP00000211936:p.Ser431*	Somatic		WXS	Illumina HiSeq	Phase_I	B2R715|O60792|Q8TBA9	Nonsense_Mutation	SNP	ENST00000211936.6	37	CCDS4624.1	.	.	.	.	.	.	.	.	.	.	G	37	6.585715	0.97684	.	.	ENSG00000096654	ENST00000211936;ENST00000377419;ENST00000341087	.	.	.	5.27	5.27	0.74061	.	0.000000	0.42821	D	0.000660	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	11.9965	0.53206	0.0:0.1741:0.8259:0.0	.	.	.	.	X	431	.	ENSP00000211936:S431X	S	-	2	0	ZNF184	27528025	0.000000	0.05858	0.991000	0.47740	0.995000	0.86356	0.653000	0.24902	2.744000	0.94065	0.655000	0.94253	TCA		0.438	ZNF184-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040146.1		NM_007149	
ZNF772	400720	hgsc.bcm.edu	37	19	57988666	57988667	+	In_Frame_Ins	INS	-	-	GCC	rs77164240|rs528587884|rs34678661|rs193920834	byFrequency	TCGA-CJ-4923-01A-01D-1429-08	TCGA-CJ-4923-11A-01D-1429-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19171a1a-6483-4bf3-b0b4-8cd441303c55	f394a92b-22c4-43d1-991b-b32a270d1cba	g.chr19:57988666_57988667insGCC	ENST00000343280.4	-	1	271_272	c.11_12insGGC	c.(10-12)gct>gcGGCt	p.4_4A>AA	AC004076.9_ENST00000415705.3_5'UTR|ZNF772_ENST00000600175.1_In_Frame_Ins_p.4_4A>AA|ZNF772_ENST00000356584.3_In_Frame_Ins_p.4_4A>AA|AC004076.9_ENST00000596831.1_In_Frame_Ins_p.4_4A>AA|ZNF772_ENST00000427512.2_5'UTR|ZNF772_ENST00000425074.3_In_Frame_Ins_p.4_4A>AA|AC003005.2_ENST00000595422.1_lincRNA|ZNF772_ENST00000601768.1_In_Frame_Ins_p.4_4A>AA	NM_001024596.2	NP_001019767.1	Q68DY9	ZN772_HUMAN	zinc finger protein 772	4					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|large_intestine(4)|lung(3)	9		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)|Lung(386;0.174)		CCATCGGCTCAGCCGCCGCCAT	0.644											OREG0025695	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)		2037	0.406749	0.3124	0.4481	5008	,	,		16965	0.5823		0.2753	False		,,,				2504	0.4591				Melanoma(5;289 436 14293 15924 30817)												0									,	1273,2975		195,883,1046					,	-4.0	0.0		dbSNP_126	62	2294,5946		320,1654,2146	no	coding,coding	ZNF772	NM_001144068.1,NM_001024596.2	,	515,2537,3192	A1A1,A1R,RR		27.8398,29.967,28.5634	,	,		3567,8921				SO:0001652	inframe_insertion	400720			BX647068	CCDS33133.1, CCDS46210.1	19q13.43	2013-01-08				ENSG00000197128		"""Zinc fingers, C2H2-type"", ""-"""	33106	protein-coding gene	gene with protein product							Standard	NM_001024596		Approved	DKFZp686I1569	uc002qot.3	Q68DY9		ENST00000343280.4:c.9_11dupGGC	19.37:g.57988673_57988675dupGCC	ENSP00000341165:p.Ala4dup	Somatic	1027	WXS	Illumina HiSeq	Phase_I	A6NJK9|B4DH56|B4DYS0	In_Frame_Ins	INS	ENST00000343280.4	37	CCDS33133.1																																																																																				0.644	ZNF772-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397447.1		NM_001024596	
ZSWIM4	65249	broad.mit.edu;hgsc.bcm.edu	37	19	13910687	13910687	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-4923-01A-01D-1429-08	TCGA-CJ-4923-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	19171a1a-6483-4bf3-b0b4-8cd441303c55	f394a92b-22c4-43d1-991b-b32a270d1cba	g.chr19:13910687G>A	ENST00000254323.2	+	2	496	c.307G>A	c.(307-309)Ggg>Agg	p.G103R	CTD-3252C9.2_ENST00000591242.1_RNA	NM_023072.2	NP_075560.2	Q9H7M6	ZSWM4_HUMAN	zinc finger, SWIM-type containing 4	103							zinc ion binding (GO:0008270)	p.G103R(1)		central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	27			OV - Ovarian serous cystadenocarcinoma(19;2.94e-23)|Epithelial(5;4.58e-19)			CTTTACCCGCGGGCTGCACCT	0.642																																																	1	Substitution - Missense(1)	kidney(1)											46.0	44.0	45.0					19																	13910687		2203	4299	6502	SO:0001583	missense	65249			AK022283	CCDS32924.1	19p13.13	2012-02-23			ENSG00000132003	ENSG00000132003		"""Zinc fingers, SWIM-type"""	25704	protein-coding gene	gene with protein product							Standard	NM_023072		Approved	FLJ12221	uc002mxh.1	Q9H7M6		ENST00000254323.2:c.307G>A	19.37:g.13910687G>A	ENSP00000254323:p.Gly103Arg	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000254323.2	37	CCDS32924.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.266496	0.80358	.	.	ENSG00000132003	ENST00000254323	T	0.59083	0.29	4.31	4.31	0.51392	.	0.358291	0.22319	N	0.061626	T	0.79736	0.4497	M	0.90542	3.125	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.84507	0.0620	10	0.87932	D	0	-34.9787	14.3012	0.66355	0.0:0.0:1.0:0.0	.	103	Q9H7M6	ZSWM4_HUMAN	R	103	ENSP00000254323:G103R	ENSP00000254323:G103R	G	+	1	0	ZSWIM4	13771687	1.000000	0.71417	0.929000	0.37066	0.613000	0.37349	6.686000	0.74548	1.946000	0.56461	0.484000	0.47621	GGG		0.642	ZSWIM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457457.1		XM_031342	
