#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ACER1	125981	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	6309756	6309756	+	Missense_Mutation	SNP	T	T	A			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr19:6309756T>A	ENST00000301452.4	-	4	517	c.440A>T	c.(439-441)aAc>aTc	p.N147I		NM_133492.2	NP_597999.1	Q8TDN7	ACER1_HUMAN	alkaline ceramidase 1	147					cell differentiation (GO:0030154)|cellular response to calcium ion (GO:0071277)|ceramide catabolic process (GO:0046514)|epidermis development (GO:0008544)|keratinocyte differentiation (GO:0030216)|regulation of lipid metabolic process (GO:0019216)|response to alkaline pH (GO:0010446)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingosine biosynthetic process (GO:0046512)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	ceramidase activity (GO:0017040)|dihydroceramidase activity (GO:0071633)	p.N147I(1)		NS(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(4)|pancreas(1)	15						GGCAATGCTGTTGAGGGCGTA	0.607																																																	1	Substitution - Missense(1)	kidney(1)											147.0	110.0	123.0					19																	6309756		2203	4300	6503	SO:0001583	missense	125981			AF347024	CCDS12161.1	19p13.3	2013-01-25	2008-12-19	2008-12-19	ENSG00000167769	ENSG00000167769	3.5.1.23	"""Alkaline ceramidase"""	18356	protein-coding gene	gene with protein product		613491	"""N-acylsphingosine amidohydrolase (alkaline ceramidase) 3"""	ASAH3		12783875	Standard	NM_133492		Approved		uc002mel.2	Q8TDN7		ENST00000301452.4:c.440A>T	19.37:g.6309756T>A	ENSP00000301452:p.Asn147Ile	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000301452.4	37	CCDS12161.1	.	.	.	.	.	.	.	.	.	.	T	16.39	3.108581	0.56291	.	.	ENSG00000167769	ENST00000301452	T	0.42513	0.97	4.49	4.49	0.54785	.	0.000000	0.85682	D	0.000000	T	0.57489	0.2057	M	0.63843	1.955	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.54437	-0.8294	10	0.26408	T	0.33	-52.4102	11.7375	0.51773	0.0:0.0:0.0:1.0	.	147	Q8TDN7	ACER1_HUMAN	I	147	ENSP00000301452:N147I	ENSP00000301452:N147I	N	-	2	0	ACER1	6260756	1.000000	0.71417	0.999000	0.59377	0.240000	0.25518	6.914000	0.75764	1.674000	0.50907	0.443000	0.29094	AAC		0.607	ACER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452982.1		NM_133492	
ADAMTS18	170692	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	77353974	77353974	+	Silent	SNP	G	G	A			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr16:77353974G>A	ENST00000282849.5	-	16	2722	c.2304C>T	c.(2302-2304)gtC>gtT	p.V768V		NM_199355.2	NP_955387.1	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 18	768	Spacer.				eye development (GO:0001654)|negative regulation of platelet aggregation (GO:0090331)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.V768V(1)		NS(1)|breast(5)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(26)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(19)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	118						CTGGAATGAGGACCACCGGAT	0.488																																																	1	Substitution - coding silent(1)	kidney(1)											47.0	53.0	51.0					16																	77353974		2198	4300	6498	SO:0001819	synonymous_variant	170692			AJ311903	CCDS10926.1	16q23	2008-07-29	2005-08-19		ENSG00000140873	ENSG00000140873		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17110	protein-coding gene	gene with protein product		607512	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 18"""	ADAMTS21		11867212, 17546048	Standard	NM_199355		Approved		uc002ffc.4	Q8TE60	OTTHUMG00000137619	ENST00000282849.5:c.2304C>T	16.37:g.77353974G>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q6P4R5|Q6ZWJ9	Silent	SNP	ENST00000282849.5	37	CCDS10926.1																																																																																				0.488	ADAMTS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269037.1			
ALMS1P	200420	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	73900989	73900989	+	RNA	SNP	G	G	A			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr2:73900989G>A	ENST00000450720.1	+	0	787					NR_003683.2		Q96L16	ALM1L_HUMAN	Alstrom syndrome 1 pseudogene						endosomal transport (GO:0016197)|regulation of stress fiber assembly (GO:0051492)			p.R102Q(1)									ATTGGGGAGCGGATAAAGCGT	0.463																																																	1	Substitution - Missense(1)	kidney(1)											93.0	78.0	83.0					2																	73900989		692	1591	2283			200420			BC014492		2p13.2	2008-01-31	2008-01-31	2008-01-31	ENSG00000163016	ENSG00000163016			29586	pseudogene	pseudogene			"""Alstrom syndrome 1-like"""	ALMS1L		12477932	Standard	NR_003683		Approved		uc010yrl.2	Q96L16	OTTHUMG00000152773		2.37:g.73900989G>A		Somatic		WXS	Illumina HiSeq	Phase_I		RNA	SNP	ENST00000450720.1	37																																																																																					0.463	ALMS1P-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000339824.1		NR_003683	
APOO	79135	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	23874429	23874429	+	Missense_Mutation	SNP	T	T	A			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chrX:23874429T>A	ENST00000379226.4	-	7	782	c.551A>T	c.(550-552)aAc>aTc	p.N184I	APOO_ENST00000379220.3_Missense_Mutation_p.N165I	NM_024122.4	NP_077027.1	Q9BUR5	APOO_HUMAN	apolipoprotein O	184					lipid transport (GO:0006869)	extracellular space (GO:0005615)|high-density lipoprotein particle (GO:0034364)|integral component of membrane (GO:0016021)|low-density lipoprotein particle (GO:0034362)|mitochondrion (GO:0005739)|very-low-density lipoprotein particle (GO:0034361)		p.N184I(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(5)|prostate(1)	9						CTTTTGAAAGTTCTCCTTCCA	0.333																																																	1	Substitution - Missense(1)	kidney(1)											151.0	154.0	153.0					X																	23874429		2203	4300	6503	SO:0001583	missense	79135			BC016814	CCDS14208.1	Xp22.11	2013-01-24	2007-01-17	2007-01-17	ENSG00000184831	ENSG00000184831		"""Apolipoproteins"""	28727	protein-coding gene	gene with protein product		300753	"""family with sequence similarity 121B"""	FAM121B		12975309, 16956892	Standard	NR_026545		Approved	MGC4825, My025	uc004dax.3	Q9BUR5	OTTHUMG00000021259	ENST00000379226.4:c.551A>T	X.37:g.23874429T>A	ENSP00000368528:p.Asn184Ile	Somatic		WXS	Illumina HiSeq	Phase_I	B2R4K9|Q9H3J9	Missense_Mutation	SNP	ENST00000379226.4	37	CCDS14208.1	.	.	.	.	.	.	.	.	.	.	T	11.44	1.638462	0.29157	.	.	ENSG00000184831	ENST00000379226;ENST00000439528;ENST00000379220	.	.	.	5.92	3.41	0.39046	.	0.262657	0.41938	D	0.000783	T	0.30448	0.0765	L	0.47716	1.5	0.35041	D	0.759766	P	0.42409	0.779	B	0.33690	0.168	T	0.35151	-0.9800	9	0.23302	T	0.38	-4.9766	4.778	0.13189	0.0:0.0968:0.1878:0.7155	.	184	Q9BUR5	APOO_HUMAN	I	184;164;165	.	ENSP00000368522:N165I	N	-	2	0	APOO	23784350	1.000000	0.71417	1.000000	0.80357	0.604000	0.37047	3.852000	0.55934	0.853000	0.35312	-0.448000	0.05591	AAC		0.333	APOO-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056074.1		NM_024122	
BBS12	166379	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	123664977	123664977	+	Missense_Mutation	SNP	A	A	C			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr4:123664977A>C	ENST00000314218.3	+	2	2123	c.1930A>C	c.(1930-1932)Aat>Cat	p.N644H	BBS12_ENST00000542236.1_Missense_Mutation_p.N644H	NM_152618.2	NP_689831.2	Q6ZW61	BBS12_HUMAN	Bardet-Biedl syndrome 12	644					cellular protein metabolic process (GO:0044267)|chaperone-mediated protein complex assembly (GO:0051131)|eating behavior (GO:0042755)|intraciliary transport (GO:0042073)|negative regulation of fat cell differentiation (GO:0045599)|photoreceptor cell maintenance (GO:0045494)	cilium (GO:0005929)	ATP binding (GO:0005524)	p.N644H(1)		cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|prostate(4)	21						TAGTAAACTAAATAGTAGAAT	0.378									Bardet-Biedl syndrome																																								1	Substitution - Missense(1)	kidney(1)											47.0	48.0	48.0					4																	123664977		2203	4300	6503	SO:0001583	missense	166379	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	AK123553	CCDS3728.1	4q27	2014-06-17	2006-12-13	2006-12-13	ENSG00000181004	ENSG00000181004		"""Heat Shock Proteins / Chaperonins"""	26648	protein-coding gene	gene with protein product		610683	"""chromosome 4 open reading frame 24"""	C4orf24		17160889	Standard	NM_001178007		Approved	FLJ35630, FLJ41559	uc003ieu.3	Q6ZW61	OTTHUMG00000133070	ENST00000314218.3:c.1930A>C	4.37:g.123664977A>C	ENSP00000319062:p.Asn644His	Somatic		WXS	Illumina HiSeq	Phase_I	D3DNX5|Q7Z342|Q7Z482|Q8NAB8	Missense_Mutation	SNP	ENST00000314218.3	37	CCDS3728.1	.	.	.	.	.	.	.	.	.	.	A	11.72	1.722447	0.30503	.	.	ENSG00000181004	ENST00000314218;ENST00000542236	T;T	0.69685	-0.42;-0.42	5.63	4.42	0.53409	.	0.505342	0.22238	N	0.062739	T	0.69672	0.3137	L	0.51422	1.61	0.09310	N	1	D	0.56287	0.975	P	0.55011	0.766	T	0.60682	-0.7215	10	0.41790	T	0.15	-38.6383	10.1735	0.42924	0.8508:0.0:0.0:0.1492	.	644	Q6ZW61	BBS12_HUMAN	H	644	ENSP00000319062:N644H;ENSP00000438273:N644H	ENSP00000319062:N644H	N	+	1	0	BBS12	123884427	0.005000	0.15991	0.021000	0.16686	0.534000	0.34807	1.916000	0.39986	0.929000	0.37192	0.533000	0.62120	AAT		0.378	BBS12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256710.1		NM_152618	
BCL2L12	83596	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	50169188	50169188	+	Silent	SNP	G	G	T			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr19:50169188G>T	ENST00000246785.3	+	1	366	c.108G>T	c.(106-108)ccG>ccT	p.P36P	IRF3_ENST00000599144.1_5'Flank|IRF3_ENST00000597198.1_5'Flank|BCL2L12_ENST00000441864.2_Silent_p.P36P|IRF3_ENST00000442265.2_5'Flank|BCL2L12_ENST00000246784.3_Silent_p.P36P|IRF3_ENST00000593922.1_5'Flank|IRF3_ENST00000600911.1_5'Flank|IRF3_ENST00000596822.1_5'Flank|IRF3_ENST00000309877.7_5'Flank|IRF3_ENST00000377139.3_5'Flank|IRF3_ENST00000377135.4_5'Flank|IRF3_ENST00000601291.1_5'Flank|IRF3_ENST00000600022.1_5'Flank|IRF3_ENST00000599223.1_5'Flank|IRF3_ENST00000596765.1_5'Flank|IRF3_ENST00000598808.1_5'Flank	NM_001040668.1|NM_138639.1	NP_001035758.1|NP_619580.1	Q9HB09	B2L12_HUMAN	BCL2-like 12 (proline rich)	36					inhibition of cysteine-type endopeptidase activity involved in apoptotic process (GO:1990001)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	membrane (GO:0016020)|nucleus (GO:0005634)		p.P36P(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|skin(1)	8		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.000681)|GBM - Glioblastoma multiforme(134;0.0214)		CCAGCGTTCCGCCCTTTCTAC	0.602																																																	1	Substitution - coding silent(1)	kidney(1)											31.0	32.0	31.0					19																	50169188		2203	4300	6503	SO:0001819	synonymous_variant	83596			AF289220	CCDS12776.1, CCDS46144.1, CCDS74424.1, CCDS74423.1	19q13.3	2014-03-07				ENSG00000126453			13787	protein-coding gene	gene with protein product		610837					Standard	NM_001040668		Approved		uc002ppa.3	Q9HB09		ENST00000246785.3:c.108G>T	19.37:g.50169188G>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q3SY11|Q3SY13|Q96I96|Q9HB08	Silent	SNP	ENST00000246785.3	37	CCDS12776.1																																																																																				0.602	BCL2L12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465770.1		NM_052842	
BSCL2	26580	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	62472858	62472858	+	Missense_Mutation	SNP	A	A	T			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr11:62472858A>T	ENST00000403550.1	-	2	550	c.127T>A	c.(127-129)Tgg>Agg	p.W43R	BSCL2_ENST00000360796.5_Missense_Mutation_p.W107R|BSCL2_ENST00000278893.7_Missense_Mutation_p.W43R|BSCL2_ENST00000407022.3_Missense_Mutation_p.W43R|BSCL2_ENST00000433053.1_Missense_Mutation_p.W107R|BSCL2_ENST00000405837.1_Missense_Mutation_p.W107R|HNRNPUL2-BSCL2_ENST00000403734.2_3'UTR|BSCL2_ENST00000421906.1_Missense_Mutation_p.W43R|GNG3_ENST00000294117.5_5'Flank|BSCL2_ENST00000537604.1_Intron			Q96G97	BSCL2_HUMAN	Berardinelli-Seip congenital lipodystrophy 2 (seipin)	43					cell death (GO:0008219)|fat cell differentiation (GO:0045444)|lipid catabolic process (GO:0016042)|lipid particle organization (GO:0034389)|lipid storage (GO:0019915)|negative regulation of lipid catabolic process (GO:0050995)	integral component of endoplasmic reticulum membrane (GO:0030176)		p.W43R(1)		endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|prostate(1)|skin(1)	12						ACAGACACCCAGAGCAAAAGG	0.577																																																	1	Substitution - Missense(1)	kidney(1)											60.0	54.0	56.0					11																	62472858		2202	4299	6501	SO:0001583	missense	26580				CCDS8031.1, CCDS44627.1, CCDS55769.1	11q13	2014-09-17	2009-07-30		ENSG00000168000	ENSG00000168000			15832	protein-coding gene	gene with protein product		606158	"""spastic paraplegia 17 (Silver syndrome)"""	GNG3LG, SPG17		11479539, 14981520	Standard	NM_001122955		Approved		uc001nur.4	Q96G97	OTTHUMG00000150624	ENST00000403550.1:c.127T>A	11.37:g.62472858A>T	ENSP00000385561:p.Trp43Arg	Somatic		WXS	Illumina HiSeq	Phase_I	G3XAE4|Q567S1|Q96SV1|Q9BSQ0	Missense_Mutation	SNP	ENST00000403550.1	37	CCDS8031.1	.	.	.	.	.	.	.	.	.	.	A	22.8	4.338938	0.81911	.	.	ENSG00000168000	ENST00000405837;ENST00000433053;ENST00000278893;ENST00000360796;ENST00000403550;ENST00000407022;ENST00000421906;ENST00000448568;ENST00000524862;ENST00000533982;ENST00000532818	D;D;D;D;D;D;D;D;D;D	0.89123	-2.47;-2.47;-2.47;-2.47;-2.47;-2.47;-2.47;-2.47;-2.47;-2.47	5.57	5.57	0.84162	.	0.000000	0.64402	U	0.000002	D	0.94318	0.8174	M	0.84326	2.69	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;1.0;1.0	D;D;D;D	0.97110	0.99;0.998;0.994;1.0	D	0.94297	0.7534	10	0.48119	T	0.1	-10.7462	13.6882	0.62529	1.0:0.0:0.0:0.0	.	43;43;107;43	Q96G97-3;Q53EN3;G3XAE4;Q96G97	.;.;.;BSCL2_HUMAN	R	107;107;43;107;43;43;43;43;107;43;107	ENSP00000385332:W107R;ENSP00000414002:W107R;ENSP00000278893:W43R;ENSP00000354032:W107R;ENSP00000385561:W43R;ENSP00000384080:W43R;ENSP00000413209:W43R;ENSP00000413340:W43R;ENSP00000433888:W107R;ENSP00000434149:W43R	ENSP00000278893:W43R	W	-	1	0	BSCL2	62229434	1.000000	0.71417	1.000000	0.80357	0.849000	0.48306	7.900000	0.87376	2.135000	0.66039	0.379000	0.24179	TGG		0.577	BSCL2-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000319185.1		NM_032667	
C12orf10	60314	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	53700059	53700059	+	Silent	SNP	G	G	A			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr12:53700059G>A	ENST00000267103.5	+	5	772	c.720G>A	c.(718-720)ctG>ctA	p.L240L	AAAS_ENST00000549983.1_5'Flank|C12orf10_ENST00000549488.1_Silent_p.L77L|C12orf10_ENST00000548632.1_Silent_p.L165L	NM_021640.3	NP_067653	Q9HB07	MYG1_HUMAN	chromosome 12 open reading frame 10	240					locomotory exploration behavior (GO:0035641)|pigmentation (GO:0043473)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)		p.L240L(1)		cervix(1)|endometrium(3)|kidney(5)|lung(6)|ovary(2)|prostate(1)|skin(1)|stomach(1)	20						ACAGCTGGCTGCCAGCCCGGG	0.517																																																	1	Substitution - coding silent(1)	kidney(1)											95.0	101.0	99.0					12																	53700059		2203	4300	6503	SO:0001819	synonymous_variant	60314			AF289485	CCDS31810.1	12q13.13	2014-05-29			ENSG00000139637	ENSG00000139637			17590	protein-coding gene	gene with protein product	"""melanocyte related gene"", ""melanocyte proliferating gene 1"""	611366					Standard	NM_021640		Approved	MYG, MYG1, Gamm1	uc001scp.4	Q9HB07	OTTHUMG00000170030	ENST00000267103.5:c.720G>A	12.37:g.53700059G>A		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000267103.5	37	CCDS31810.1																																																																																				0.517	C12orf10-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406906.1		NM_021640	
C16orf62	57020	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	19613023	19613023	+	Silent	SNP	G	G	T			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr16:19613023G>T	ENST00000251143.5	+	9	774	c.762G>T	c.(760-762)gtG>gtT	p.V254V	C16orf62_ENST00000448695.1_Silent_p.V104V|C16orf62_ENST00000543152.1_Silent_p.V3V|C16orf62_ENST00000542263.1_Silent_p.V343V|C16orf62_ENST00000417362.2_Silent_p.V254V|C16orf62_ENST00000538853.1_3'UTR|C16orf62_ENST00000438132.3_Silent_p.V343V			Q7Z3J2	CP062_HUMAN	chromosome 16 open reading frame 62	254						integral component of membrane (GO:0016021)		p.V343V(1)|p.V254V(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(7)|liver(1)|lung(11)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	36						CCATGTGTGTGGATAGCCGCA	0.478											OREG0023661	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					2	Substitution - coding silent(2)	kidney(2)											139.0	109.0	120.0					16																	19613023		2197	4300	6497	SO:0001819	synonymous_variant	57020				CCDS32397.1, CCDS32397.2, CCDS73840.1	16p12.3	2012-05-30			ENSG00000103544	ENSG00000103544			24641	protein-coding gene	gene with protein product						10493829	Standard	NM_020314		Approved	MGC16824	uc002dgn.3	Q7Z3J2	OTTHUMG00000167925	ENST00000251143.5:c.762G>T	16.37:g.19613023G>T		Somatic	734	WXS	Illumina HiSeq	Phase_I	A8K2M1|O43329|Q69YI1|Q6PDA0|Q7L371|Q86W66|Q8WXA5|Q9H0L7|Q9H7C8	Silent	SNP	ENST00000251143.5	37																																																																																					0.478	C16orf62-201	KNOWN	basic|appris_principal	protein_coding	protein_coding			NM_020314	
FAM205A	259308	broad.mit.edu;hgsc.bcm.edu	37	9	34724109	34724109	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr9:34724109A>G	ENST00000378788.3	-	4	3167	c.3128T>C	c.(3127-3129)aTg>aCg	p.M1043T		NM_001141917.1	NP_001135389.1	Q6ZU69	F205A_HUMAN	family with sequence similarity 205, member A	1043						integral component of membrane (GO:0016021)|nucleus (GO:0005634)		p.M1043T(2)		breast(1)|endometrium(2)|kidney(1)	4						TCCTGCTAGCATGGGGACATG	0.582																																																	2	Substitution - Missense(2)	kidney(2)											11.0	10.0	10.0					9																	34724109		692	1586	2278	SO:0001583	missense	0				CCDS55305.1	9p13.3	2014-05-16			ENSG00000205108	ENSG00000205108			41911	protein-coding gene	gene with protein product							Standard	NM_001141917		Approved	C9orf144B	uc011lor.2	Q6ZU69	OTTHUMG00000000448	ENST00000378788.3:c.3128T>C	9.37:g.34724109A>G	ENSP00000417711:p.Met1043Thr	Somatic		WXS	Illumina HiSeq	Phase_I	A8MVW7	Missense_Mutation	SNP	ENST00000378788.3	37	CCDS55305.1	.	.	.	.	.	.	.	.	.	.	A	0.005	-2.154101	0.00325	.	.	ENSG00000205108	ENST00000378788	T	0.20881	2.04	4.05	-2.86	0.05717	.	.	.	.	.	T	0.09113	0.0225	N	0.16903	0.455	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.41574	-0.9501	9	0.02654	T	1	.	8.7723	0.34740	0.5794:0.0:0.4206:0.0	.	1043	Q6ZU69	F205A_HUMAN	T	1043	ENSP00000417711:M1043T	ENSP00000417711:M1043T	M	-	2	0	RP11-195F19.10	34714109	0.000000	0.05858	0.001000	0.08648	0.000000	0.00434	-1.538000	0.02204	-0.736000	0.04831	-0.911000	0.02809	ATG		0.582	FAM205A-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001150.2		NM_001141917	
CCDC108	255101	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	219888914	219888914	+	Missense_Mutation	SNP	C	C	A	rs368984324		TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr2:219888914C>A	ENST00000341552.5	-	15	2501	c.2418G>T	c.(2416-2418)aaG>aaT	p.K806N	CCDC108_ENST00000441968.1_Missense_Mutation_p.K806N|CCDC108_ENST00000453220.1_Missense_Mutation_p.K806N	NM_194302.2	NP_919278.2	Q6ZU64	CC108_HUMAN	coiled-coil domain containing 108	806			K -> M (in dbSNP:rs9653262).			integral component of membrane (GO:0016021)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)	p.K806N(1)		autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(1)|lung(34)|ovary(2)|pancreas(1)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	80		Renal(207;0.0915)		Epithelial(149;1.12e-06)|all cancers(144;0.000196)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AGGTCAGCAGCTTGCAGTCTT	0.642																																																	1	Substitution - Missense(1)	kidney(1)											54.0	59.0	57.0					2																	219888914		2203	4300	6503	SO:0001583	missense	255101			NM_194302, AL833882, AK127189	CCDS2430.2, CCDS2431.2, CCDS63125.1, CCDS63126.1	2q35	2008-02-05			ENSG00000181378	ENSG00000181378			25325	protein-coding gene	gene with protein product		614270				12477932	Standard	NM_194302		Approved	DKFZp434O0527, MGC35338	uc002vjl.2	Q6ZU64	OTTHUMG00000133013	ENST00000341552.5:c.2418G>T	2.37:g.219888914C>A	ENSP00000340776:p.Lys806Asn	Somatic		WXS	Illumina HiSeq	Phase_I	A2BDD8|E9PCR1|E9PG25|E9PG72|Q6ZSR8|Q8N0T4|Q8NDJ3	Missense_Mutation	SNP	ENST00000341552.5	37	CCDS2430.2	.	.	.	.	.	.	.	.	.	.	C	10.31	1.314958	0.23908	.	.	ENSG00000181378	ENST00000341552;ENST00000441968;ENST00000453220	T;T;T	0.42900	0.96;0.96;0.96	5.84	3.95	0.45737	.	0.389549	0.22053	N	0.065290	T	0.14743	0.0356	N	0.03608	-0.345	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.14615	-1.0466	10	0.13853	T	0.58	-14.1307	2.0808	0.03635	0.2744:0.454:0.1172:0.1544	.	806	Q6ZU64	CC108_HUMAN	N	806	ENSP00000340776:K806N;ENSP00000413377:K806N;ENSP00000409117:K806N	ENSP00000340776:K806N	K	-	3	2	CCDC108	219597158	0.007000	0.16637	0.705000	0.30386	0.775000	0.43874	0.138000	0.16016	1.479000	0.48272	0.561000	0.74099	AAG		0.642	CCDC108-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256598.4		NM_194302	
CDK5RAP1	51654	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	20	31958402	31958402	+	Missense_Mutation	SNP	A	A	T			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr20:31958402A>T	ENST00000357886.4	-	12	1490	c.1337T>A	c.(1336-1338)tTt>tAt	p.F446Y	CDK5RAP1_ENST00000339269.5_Missense_Mutation_p.F355Y|CDK5RAP1_ENST00000346416.2_Missense_Mutation_p.F432Y|CDK5RAP1_ENST00000544843.1_Intron|CDK5RAP1_ENST00000473997.1_Missense_Mutation_p.F342Y			Q96SZ6	CK5P1_HUMAN	CDK5 regulatory subunit associated protein 1	446					brain development (GO:0007420)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|regulation of neuron differentiation (GO:0045664)|tRNA modification (GO:0006400)	cytoplasm (GO:0005737)	4 iron, 4 sulfur cluster binding (GO:0051539)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|transferase activity (GO:0016740)	p.F432Y(1)		endometrium(2)|kidney(2)|large_intestine(3)|lung(12)|ovary(3)|skin(3)|urinary_tract(1)	26						CTCACCACAAAAGCCAGCAAT	0.517																																																	1	Substitution - Missense(1)	kidney(1)											242.0	196.0	212.0					20																	31958402		2203	4300	6503	SO:0001583	missense	51654			AF152097	CCDS13219.1, CCDS63255.1	20q11.21	2012-09-20	2002-07-22	2002-07-26	ENSG00000101391	ENSG00000101391			15880	protein-coding gene	gene with protein product		608200	"""chromosome 20 open reading frame 34"""	C20orf34		10721722, 11882646, 15329498	Standard	NM_016408		Approved	CGI-05, HSPC167, C42	uc002wyy.4	Q96SZ6	OTTHUMG00000032256	ENST00000357886.4:c.1337T>A	20.37:g.31958402A>T	ENSP00000350558:p.Phe446Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	A8K7R0|Q5QP46|Q5QP47|Q5QP48|Q675N4|Q675N5|Q9BVG6|Q9BWZ5|Q9H859|Q9NZZ9|Q9Y3F0	Missense_Mutation	SNP	ENST00000357886.4	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	21.6|21.6	4.176789|4.176789	0.78564|0.78564	.|.	.|.	ENSG00000101391|ENSG00000101391	ENST00000427097|ENST00000346416;ENST00000357886;ENST00000339269;ENST00000452723;ENST00000375351	T|T;T;T;T	0.24350|0.25085	1.86|1.82;1.82;1.82;1.82	5.71|5.71	5.71|5.71	0.89125|0.89125	.|Elongator protein 3/MiaB/NifB (1);Radical SAM, alpha/beta horseshoe (1);Radical SAM (1);	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	T|T	0.58736|0.58736	0.2143|0.2143	M|M	0.91663|0.91663	3.23|3.23	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D;D;D	.|0.89917	.|0.987;1.0;1.0;0.998;1.0;1.0;1.0	.|P;D;D;D;D;D;D	.|0.97110	.|0.766;1.0;1.0;0.995;1.0;1.0;1.0	T|T	0.65697|0.65697	-0.6105|-0.6105	8|10	0.87932|0.44086	D|T	0|0.13	-25.6848|-25.6848	13.9344|13.9344	0.64017|0.64017	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|355;446;432;172;432;432;342	.|Q96SZ6-4;Q96SZ6;Q675N5;E9PF14;Q53H36;Q96SZ6-3;Q96SZ6-2	.|.;CK5P1_HUMAN;.;.;.;.;.	I|Y	101|432;446;355;342;172	ENSP00000409474:F101I|ENSP00000217372:F432Y;ENSP00000350558:F446Y;ENSP00000341840:F355Y;ENSP00000408133:F342Y	ENSP00000409474:F101I|ENSP00000341840:F355Y	F|F	-|-	1|2	0|0	CDK5RAP1|CDK5RAP1	31422063|31422063	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	8.659000|8.659000	0.91116|0.91116	2.172000|2.172000	0.68678|0.68678	0.459000|0.459000	0.35465|0.35465	TTT|TTT		0.517	CDK5RAP1-011	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000078697.1		NM_016408	
CFH	3075	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	196684863	196684863	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr1:196684863G>A	ENST00000367429.4	+	11	1900	c.1660G>A	c.(1660-1662)Ggt>Agt	p.G554S		NM_000186.3	NP_000177.2	P08603	CFAH_HUMAN	complement factor H	554	Sushi 9. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)	p.G554S(2)		NS(3)|breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(24)|lung(33)|ovary(1)|prostate(5)|skin(9)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	101						CATAGTGTGTGGTTACAATGG	0.338																																																	2	Substitution - Missense(2)	lung(1)|kidney(1)											241.0	227.0	232.0					1																	196684863		2203	4300	6503	SO:0001583	missense	3075			Y00716	CCDS1385.1	1q32	2014-09-17	2004-08-09	2004-08-12	ENSG00000000971	ENSG00000000971		"""Complement system"""	4883	protein-coding gene	gene with protein product	"""beta-1H"", ""H factor 2 (complement)"", ""age-related maculopathy susceptibility 1"""	134370	"""H factor 1 (complement)"""	HF, HF1, HF2		2889480, 2963625	Standard	NM_000186		Approved	HUS, FHL1, ARMS1, ARMD4	uc001gtj.4	P08603	OTTHUMG00000035607	ENST00000367429.4:c.1660G>A	1.37:g.196684863G>A	ENSP00000356399:p.Gly554Ser	Somatic		WXS	Illumina HiSeq	Phase_I	A5PL14|P78435|Q14570|Q2TAZ5|Q38G77|Q5TFM3|Q8N708|Q9NU86	Missense_Mutation	SNP	ENST00000367429.4	37	CCDS1385.1	.	.	.	.	.	.	.	.	.	.	G	11.72	1.722318	0.30503	.	.	ENSG00000000971	ENST00000367429	T	0.63417	-0.04	5.42	-0.654	0.11443	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	T	0.42944	0.1225	L	0.52266	1.64	0.09310	N	1	P	0.34684	0.463	B	0.28232	0.087	T	0.21348	-1.0248	9	0.16896	T	0.51	.	1.5214	0.02516	0.2023:0.2909:0.3578:0.149	.	554	P08603	CFAH_HUMAN	S	554	ENSP00000356399:G554S	ENSP00000356399:G554S	G	+	1	0	CFH	194951486	0.142000	0.22610	0.000000	0.03702	0.002000	0.02628	0.369000	0.20416	-0.080000	0.12685	0.655000	0.94253	GGT		0.338	CFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086412.2		NM_000186	
CFTR	1080	broad.mit.edu;hgsc.bcm.edu	37	7	117180383	117180383	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr7:117180383G>A	ENST00000003084.6	+	8	1231	c.1099G>A	c.(1099-1101)Gca>Aca	p.A367T	CFTR_ENST00000454343.1_Missense_Mutation_p.A367T	NM_000492.3	NP_000483.3	P13569	CFTR_HUMAN	cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)	367					cellular response to cAMP (GO:0071320)|cellular response to hormone stimulus (GO:0032870)|chloride transmembrane transport (GO:1902476)|cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intracellular pH elevation (GO:0051454)|iodide transport (GO:0015705)|lung development (GO:0030324)|membrane hyperpolarization (GO:0060081)|positive regulation of vasodilation (GO:0045909)|positive regulation of voltage-gated chloride channel activity (GO:1902943)|respiratory gaseous exchange (GO:0007585)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to peptide hormone (GO:0043434)|sperm capacitation (GO:0048240)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vasodilation (GO:0042311)|water transport (GO:0006833)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|chloride channel complex (GO:0034707)|cytoplasmic vesicle membrane (GO:0030659)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-binding and phosphorylation-dependent chloride channel activity (GO:0005224)|bicarbonate transmembrane transporter activity (GO:0015106)|channel-conductance-controlling ATPase activity (GO:0005260)|chloride channel activity (GO:0005254)|chloride channel inhibitor activity (GO:0019869)|chloride transmembrane transporter activity (GO:0015108)|enzyme binding (GO:0019899)|PDZ domain binding (GO:0030165)	p.A367T(1)		NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(15)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(9)	69	Lung NSC(10;0.00148)|all_lung(10;0.00171)		STAD - Stomach adenocarcinoma(10;0.000534)		Bumetanide(DB00887)|Crofelemer(DB04941)|Glyburide(DB01016)|Ibuprofen(DB01050)|Ivacaftor(DB08820)	CTCTCTTGGAGCAATAAACAA	0.378									Cystic Fibrosis																																								1	Substitution - Missense(1)	kidney(1)											88.0	86.0	86.0					7																	117180383		2203	4300	6503	SO:0001583	missense	1080	Familial Cancer Database	CF	M28668	CCDS5773.1	7q31-q32	2014-09-17	2006-09-18		ENSG00000001626	ENSG00000001626		"""Ion channels / Chloride channels : Cystic fibrosis transmembrane conductance regulators"", ""ATP binding cassette transporters / subfamily C"""	1884	protein-coding gene	gene with protein product	"""ATP-binding cassette sub-family C, member 7"""	602421	"""cystic fibrosis transmembrane conductance regulator, ATP-binding cassette (sub-family C, member 7)"""	CF, ABCC7		2772657	Standard	XM_006715842		Approved	MRP7, ABC35, TNR-CFTR, dJ760C5.1, CFTR/MRP	uc003vjd.3	P13569	OTTHUMG00000023076	ENST00000003084.6:c.1099G>A	7.37:g.117180383G>A	ENSP00000003084:p.Ala367Thr	Somatic		WXS	Illumina HiSeq	Phase_I	Q20BG8|Q20BH2|Q2I0A1|Q2I102	Missense_Mutation	SNP	ENST00000003084.6	37	CCDS5773.1	.	.	.	.	.	.	.	.	.	.	G	15.84	2.952558	0.53293	.	.	ENSG00000001626	ENST00000003084;ENST00000454343;ENST00000426809	D;D;D	0.93019	-3.09;-2.9;-3.15	5.26	4.36	0.52297	ABC transporter, transmembrane domain, type 1 (1);	0.268801	0.38381	N	0.001707	D	0.91730	0.7385	M	0.73372	2.23	0.28894	N	0.893656	P	0.42203	0.773	B	0.38327	0.271	D	0.87882	0.2678	10	0.51188	T	0.08	-4.9595	13.2836	0.60230	0.0781:0.0:0.9219:0.0	.	367	P13569	CFTR_HUMAN	T	367;367;337	ENSP00000003084:A367T;ENSP00000403677:A367T;ENSP00000389119:A337T	ENSP00000003084:A367T	A	+	1	0	CFTR	116967619	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.651000	0.67951	1.306000	0.44926	0.563000	0.77884	GCA		0.378	CFTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059397.3		NM_000492	
CNNM4	26504	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	97427956	97427956	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr2:97427956G>A	ENST00000377075.2	+	1	1318	c.1220G>A	c.(1219-1221)cGc>cAc	p.R407H		NM_020184.3	NP_064569.3	Q6P4Q7	CNNM4_HUMAN	cyclin and CBS domain divalent metal cation transport mediator 4	407	CBS 1. {ECO:0000255|PROSITE- ProRule:PRU00703}.				biomineral tissue development (GO:0031214)|ion transport (GO:0006811)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)	p.R407H(1)		breast(2)|endometrium(4)|kidney(1)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)	20						GGCTATACTCGCATCCCGGTG	0.517																																																	1	Substitution - Missense(1)	kidney(1)											129.0	120.0	123.0					2																	97427956		2203	4300	6503	SO:0001583	missense	26504			AB046812	CCDS2024.2	2q11.2	2014-08-08	2014-08-07		ENSG00000158158	ENSG00000158158			105	protein-coding gene	gene with protein product		607805	"""cyclin M4"""	ACDP4		21393841, 24194943	Standard	XM_005263914		Approved	KIAA1592	uc002swx.3	Q6P4Q7	OTTHUMG00000130532	ENST00000377075.2:c.1220G>A	2.37:g.97427956G>A	ENSP00000366275:p.Arg407His	Somatic		WXS	Illumina HiSeq	Phase_I	B7Z1U0|C7SQM3|C7SQM4|C7SQM5|Q53RE5|Q9H9G3|Q9HCI0|Q9NRN1	Missense_Mutation	SNP	ENST00000377075.2	37	CCDS2024.2	.	.	.	.	.	.	.	.	.	.	G	17.33	3.361899	0.61403	.	.	ENSG00000158158	ENST00000377075	T	0.77750	-1.12	5.05	5.05	0.67936	Cystathionine beta-synthase, core (1);	0.000000	0.85682	D	0.000000	D	0.92270	0.7548	H	0.99705	4.715	0.80722	D	1	D	0.65815	0.995	P	0.55112	0.769	D	0.95906	0.8919	10	0.87932	D	0	-14.9422	17.2051	0.86915	0.0:0.0:1.0:0.0	.	407	Q6P4Q7	CNNM4_HUMAN	H	407	ENSP00000366275:R407H	ENSP00000366275:R407H	R	+	2	0	CNNM4	96791683	1.000000	0.71417	0.995000	0.50966	0.156000	0.22039	9.807000	0.99171	2.354000	0.79902	0.655000	0.94253	CGC		0.517	CNNM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252954.1		NM_020184	
COL5A3	50509	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	10084433	10084433	+	Splice_Site	SNP	T	T	A			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr19:10084433T>A	ENST00000264828.3	-	49	3696	c.3611A>T	c.(3610-3612)aAg>aTg	p.K1204M		NM_015719.3	NP_056534.2	P25940	CO5A3_HUMAN	collagen, type V, alpha 3	1204	Triple-helical region.				axon guidance (GO:0007411)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)	p.K1204M(1)		NS(2)|breast(3)|central_nervous_system(2)|endometrium(11)|kidney(23)|large_intestine(12)|liver(2)|lung(35)|ovary(8)|prostate(5)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	116			Epithelial(33;7.11e-05)			CTCACTCACCTTCTCACCCAC	0.607																																																	1	Substitution - Missense(1)	kidney(1)											90.0	96.0	94.0					19																	10084433		2202	4300	6502	SO:0001630	splice_region_variant	50509			AF177941	CCDS12222.1	19p13.2	2013-01-16			ENSG00000080573	ENSG00000080573		"""Collagens"""	14864	protein-coding gene	gene with protein product		120216				10722718	Standard	NM_015719		Approved		uc002mmq.1	P25940	OTTHUMG00000150019	ENST00000264828.3:c.3612+1A>T	19.37:g.10084433T>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q9NZQ6	Missense_Mutation	SNP	ENST00000264828.3	37	CCDS12222.1	.	.	.	.	.	.	.	.	.	.	T	19.45	3.830183	0.71258	.	.	ENSG00000080573	ENST00000264828	D	0.94330	-3.4	4.48	4.48	0.54585	.	0.000000	0.85682	D	0.000000	D	0.96169	0.8751	M	0.80508	2.5	0.51767	D	0.99993	D	0.76494	0.999	D	0.81914	0.995	D	0.96300	0.9220	10	0.66056	D	0.02	.	11.7622	0.51910	0.0:0.0:0.0:1.0	.	1204	P25940	CO5A3_HUMAN	M	1204	ENSP00000264828:K1204M	ENSP00000264828:K1204M	K	-	2	0	COL5A3	9945433	1.000000	0.71417	1.000000	0.80357	0.711000	0.40976	3.951000	0.56684	1.865000	0.54081	0.402000	0.26972	AAG		0.607	COL5A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315788.1		NM_015719	Missense_Mutation
COX17	10063	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	119393997	119393997	+	Nonstop_Mutation	SNP	C	C	A			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr3:119393997C>A	ENST00000261070.2	-	2	283	c.191G>T	c.(190-192)tGa>tTa	p.*64L	COX17_ENST00000484810.1_Nonstop_Mutation_p.*99L|COX17_ENST00000497116.1_Nonstop_Mutation_p.*64L	NM_005694.1	NP_005685.1	Q14061	COX17_HUMAN	COX17 cytochrome c oxidase copper chaperone	0					brain development (GO:0007420)|copper ion transport (GO:0006825)|generation of precursor metabolites and energy (GO:0006091)|heart development (GO:0007507)	cytoplasm (GO:0005737)|mitochondrial intermembrane space (GO:0005758)	copper chaperone activity (GO:0016531)|copper ion binding (GO:0005507)	p.*64L(1)		central_nervous_system(1)|kidney(1)|large_intestine(1)	3				GBM - Glioblastoma multiforme(114;0.227)		CTTACCATTTCATATTTTAAA	0.368																																																	1	Nonstop extension(1)	kidney(1)											117.0	113.0	114.0					3																	119393997		2203	4300	6503	SO:0001578	stop_lost	10063			L77701	CCDS2993.1	3q13.33	2013-05-23	2013-05-23		ENSG00000138495	ENSG00000138495		"""Mitochondrial respiratory chain complex assembly factors"""	2264	protein-coding gene	gene with protein product		604813	"""COX17 (yeast) homolog, cytochrome c oxidase assembly protein"", ""COX17 homolog, cytochrome c oxidase assembly protein (yeast)"", ""COX17 homolog, cytochrome c oxidase assembly protein (S. cerevisiae)"", ""COX17 cytochrome c oxidase assembly homolog (S. cerevisiae)"", ""cytochrome c oxidase assembly homolog 17 (yeast)"""			9050918, 21816817	Standard	NM_005694		Approved		uc003ecz.1	Q14061	OTTHUMG00000159433	ENST00000261070.2:c.191G>T	3.37:g.119393997C>A		Somatic		WXS	Illumina HiSeq	Phase_I	B2R5D2|D3DN84|Q3MHD6	Missense_Mutation	SNP	ENST00000261070.2	37	CCDS2993.1	.	.	.	.	.	.	.	.	.	.	C	11.50	1.657966	0.29425	.	.	ENSG00000138495	ENST00000261070;ENST00000484810;ENST00000497116	.	.	.	5.65	4.74	0.60224	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	0.999998	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.4969	0.44783	0.0:0.9046:0.0:0.0954	.	.	.	.	L	64;99;64	.	.	X	-	2	2	COX17	120876687	1.000000	0.71417	1.000000	0.80357	0.681000	0.39784	0.880000	0.28159	1.543000	0.49345	0.655000	0.94253	TGA		0.368	COX17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355297.2		NM_005694	
COL6A5	256076	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	130174477	130174477	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr3:130174477C>A	ENST00000432398.2	+	37	7251	c.6757C>A	c.(6757-6759)Caa>Aaa	p.Q2253K	COL6A5_ENST00000265379.6_Missense_Mutation_p.Q2253K	NM_153264.5	NP_694996.5	A8TX70	CO6A5_HUMAN	collagen, type VI, alpha 5	2253	Nonhelical region.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)		p.Q292K(1)|p.Q2253K(1)		endometrium(6)|kidney(4)|large_intestine(8)|lung(19)|pancreas(2)|prostate(3)|stomach(1)|urinary_tract(1)	44						TGAAAAAGATCAAAAATCTGC	0.333																																																	2	Substitution - Missense(2)	kidney(2)											49.0	48.0	49.0					3																	130174477		1804	4064	5868	SO:0001583	missense	256076			AK093199		3q21.3	2013-01-16	2010-05-24	2010-05-24	ENSG00000172752	ENSG00000172752		"""Collagens"""	26674	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 4"""	611916	"""collagen, type XXIX, alpha 1"""	COL29A1		17850181	Standard	NM_153264		Approved	FLJ35880, VWA4	uc010htk.2	A8TX70	OTTHUMG00000159712	ENST00000432398.2:c.6757C>A	3.37:g.130174477C>A	ENSP00000390895:p.Gln2253Lys	Somatic		WXS	Illumina HiSeq	Phase_I	A9J6L2|A9J6L4|A9J6L6|A9J6L7|A9J6M0|A9J6M1|A9J6M2|B5MEA7|Q6ZW26|Q8NA36	Missense_Mutation	SNP	ENST00000432398.2	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	3.821|3.821	-0.037685|-0.037685	0.07497|0.07497	.|.	.|.	ENSG00000172752|ENSG00000172752	ENST00000432398;ENST00000265379;ENST00000373157;ENST00000512482|ENST00000512836	D;D;T;T|.	0.88818|.	-2.34;-2.43;-0.87;-0.75|.	4.26|4.26	0.026|0.026	0.14148|0.14148	.|.	2.119150|.	0.02670|.	N|.	0.108475|.	T|.	0.21841|.	0.0526|.	N|N	0.17474|0.17474	0.49|0.49	0.09310|0.09310	N|N	1|1	B;B|.	0.02656|.	0.0;0.0|.	B;B|.	0.04013|.	0.0;0.001|.	T|.	0.30031|.	-0.9992|.	10|.	0.02654|.	T|.	1|.	.|.	8.2937|8.2937	0.31973|0.31973	0.3027:0.5542:0.1431:0.0|0.3027:0.5542:0.1431:0.0	.|.	2253;2253|.	A8TX70;A8TX70-2|.	CO6A5_HUMAN;.|.	K|X	2253;2253;196;88|504	ENSP00000390895:Q2253K;ENSP00000265379:Q2253K;ENSP00000362250:Q196K;ENSP00000424968:Q88K|.	ENSP00000265379:Q2253K|.	Q|S	+|+	1|2	0|0	COL6A5|COL6A5	131657167|131657167	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.000000|0.000000	0.00434|0.00434	-0.464000|-0.464000	0.06688|0.06688	0.170000|0.170000	0.19704|0.19704	-0.846000|-0.846000	0.03041|0.03041	CAA|TCA		0.333	COL6A5-202	KNOWN	basic|appris_principal	protein_coding	protein_coding			NM_153264	
CTNNA1	1495	broad.mit.edu;ucsc.edu	37	5	138261073	138261073	+	Silent	SNP	A	A	C			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr5:138261073A>C	ENST00000302763.7	+	13	1966	c.1876A>C	c.(1876-1878)Agg>Cgg	p.R626R	CTNNA1_ENST00000518825.1_Silent_p.R626R|CTNNA1_ENST00000540387.1_Silent_p.R256R|CTNNA1_ENST00000355078.5_Silent_p.R523R	NM_001903.2	NP_001894.2	P35221	CTNA1_HUMAN	catenin (cadherin-associated protein), alpha 1, 102kDa	626					adherens junction organization (GO:0034332)|aging (GO:0007568)|apical junction assembly (GO:0043297)|axon regeneration (GO:0031103)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular protein localization (GO:0034613)|cellular response to indole-3-methanol (GO:0071681)|epithelial cell-cell adhesion (GO:0090136)|establishment or maintenance of cell polarity (GO:0007163)|gap junction assembly (GO:0016264)|male gonad development (GO:0008584)|muscle cell differentiation (GO:0042692)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell motility (GO:2000146)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of integrin-mediated signaling pathway (GO:2001045)|negative regulation of neuroblast proliferation (GO:0007406)|odontogenesis of dentin-containing tooth (GO:0042475)|ovarian follicle development (GO:0001541)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of smoothened signaling pathway (GO:0045880)|protein heterooligomerization (GO:0051291)|response to estrogen (GO:0043627)	acrosomal vesicle (GO:0001669)|actin cytoskeleton (GO:0015629)|catenin complex (GO:0016342)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|intercalated disc (GO:0014704)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|zonula adherens (GO:0005915)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|gamma-catenin binding (GO:0045295)|poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)|vinculin binding (GO:0017166)	p.R626R(1)		NS(1)|breast(7)|cervix(2)|endometrium(4)|kidney(6)|large_intestine(16)|lung(9)|oesophagus(2)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	52			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			CCGGGACATCAGGAAAGCAGT	0.488																																																	1	Substitution - coding silent(1)	kidney(1)											102.0	93.0	96.0					5																	138261073		2203	4300	6503	SO:0001819	synonymous_variant	1495			D13866	CCDS34243.1, CCDS75315.1	5q31.2	2008-02-05	2002-08-29			ENSG00000044115			2509	protein-coding gene	gene with protein product		116805	"""catenin (cadherin-associated protein), alpha 1 (102kD)"""			1924379	Standard	XM_005271898		Approved	CAP102	uc003ldh.3	P35221		ENST00000302763.7:c.1876A>C	5.37:g.138261073A>C		Somatic		WXS	Illumina GAIIx	Phase_I	Q12795|Q8N1C0	Silent	SNP	ENST00000302763.7	37	CCDS34243.1																																																																																				0.488	CTNNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373868.1		NM_001903	
DENND4A	10260	broad.mit.edu;ucsc.edu	37	15	66023980	66023980	+	Splice_Site	SNP	C	C	T			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr15:66023980C>T	ENST00000431932.2	-	9	1374	c.1166G>A	c.(1165-1167)aGt>aAt	p.S389N	DENND4A_ENST00000443035.3_Splice_Site_p.S389N	NM_005848.3	NP_005839.3	Q7Z401	MYCPP_HUMAN	DENN/MADD domain containing 4A	389	DENN. {ECO:0000255|PROSITE- ProRule:PRU00304}.				positive regulation of Rab GTPase activity (GO:0032851)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.S389N(2)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(11)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	51						TTTTACTTGCCTTAGTGGAAG	0.294																																																	2	Substitution - Missense(2)	kidney(2)											45.0	43.0	43.0					15																	66023980		1795	4050	5845	SO:0001630	splice_region_variant	10260			AF534403	CCDS45285.1, CCDS53949.1	15q22.31	2012-10-03	2006-01-27	2006-01-27				"""DENN/MADD domain containing"""	24321	protein-coding gene	gene with protein product		600382	"""c-myc promoter binding protein"""	MYCPBP		8056341, 12906859	Standard	NM_005848		Approved	IRLB	uc002api.3	Q7Z401		ENST00000431932.2:c.1166+1G>A	15.37:g.66023980C>T		Somatic		WXS	Illumina GAIIx	Phase_I	E7EPL3|Q14655|Q86T77|Q8IVX2|Q8NB93	Missense_Mutation	SNP	ENST00000431932.2	37	CCDS45285.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.113509	0.77210	.	.	ENSG00000174485	ENST00000443035;ENST00000431932	T;T	0.11821	2.74;2.74	5.94	5.94	0.96194	DENN (3);	0.000000	0.85682	U	0.000000	T	0.42988	0.1227	M	0.80982	2.52	0.80722	D	1	P;D;D	0.69078	0.93;0.965;0.997	D;P;D	0.81914	0.919;0.87;0.995	T	0.12967	-1.0527	9	.	.	.	.	19.9544	0.97215	0.0:1.0:0.0:0.0	.	389;389;389	B7Z5Y3;E7EPL3;Q7Z401	.;.;MYCPP_HUMAN	N	389	ENSP00000391167:S389N;ENSP00000396830:S389N	.	S	-	2	0	DENND4A	63811034	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.403000	0.79983	2.807000	0.96579	0.591000	0.81541	AGT		0.294	DENND4A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419611.1		NM_005848	Missense_Mutation
DMRTA1	63951	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	22451073	22451073	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr9:22451073G>T	ENST00000325870.2	+	2	903	c.678G>T	c.(676-678)gaG>gaT	p.E226D		NM_022160.2	NP_071443.2	Q5VZB9	DMRTA_HUMAN	DMRT-like family A1	226					male mating behavior (GO:0060179)|ovarian follicle development (GO:0001541)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E226D(1)		breast(1)|kidney(1)|large_intestine(3)|lung(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	15		all_cancers(5;4.09e-243)|Acute lymphoblastic leukemia(3;8.25e-150)|all_hematologic(3;4.25e-147)|Esophageal squamous(3;2.32e-09)|Renal(3;1.71e-07)|Breast(3;2.07e-06)|Hepatocellular(5;0.00563)		GBM - Glioblastoma multiforme(1;5.12e-278)|Lung(24;8.2e-52)|LUSC - Lung squamous cell carcinoma(38;1.46e-37)|OV - Ovarian serous cystadenocarcinoma(39;0.0517)		AACAAAAAGAGAGTAAATGTG	0.393																																																	1	Substitution - Missense(1)	kidney(1)											66.0	66.0	66.0					9																	22451073		2203	4300	6503	SO:0001583	missense	63951			AJ290954	CCDS6514.1	9p21.3	2008-05-15			ENSG00000176399	ENSG00000176399			13826	protein-coding gene	gene with protein product		614803					Standard	NM_022160		Approved		uc003zpp.1	Q5VZB9	OTTHUMG00000019693	ENST00000325870.2:c.678G>T	9.37:g.22451073G>T	ENSP00000319651:p.Glu226Asp	Somatic		WXS	Illumina HiSeq	Phase_I	A1L481|Q8N8Y9|Q9H4B9	Missense_Mutation	SNP	ENST00000325870.2	37	CCDS6514.1	.	.	.	.	.	.	.	.	.	.	G	7.954	0.745539	0.15710	.	.	ENSG00000176399	ENST00000325870	T	0.31247	1.5	5.74	0.127	0.14727	.	1.603800	0.03045	N	0.153799	T	0.25306	0.0615	L	0.60455	1.87	0.09310	N	1	P	0.34462	0.454	B	0.27262	0.078	T	0.12066	-1.0562	10	0.16420	T	0.52	-0.9624	4.4845	0.11783	0.3535:0.0:0.5025:0.144	.	226	Q5VZB9	DMRTA_HUMAN	D	226	ENSP00000319651:E226D	ENSP00000319651:E226D	E	+	3	2	DMRTA1	22441073	0.000000	0.05858	0.545000	0.28153	0.989000	0.77384	0.010000	0.13242	0.096000	0.17463	0.563000	0.77884	GAG		0.393	DMRTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051935.2			
DNAH2	146754	broad.mit.edu;hgsc.bcm.edu	37	17	7722587	7722587	+	Missense_Mutation	SNP	T	T	A			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr17:7722587T>A	ENST00000572933.1	+	72	12336	c.10876T>A	c.(10876-10878)Tgc>Agc	p.C3626S	DNAH2_ENST00000389173.2_Missense_Mutation_p.C3626S			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	3626					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.C3626S(1)		NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				TGATATGGGCTGCATCGACCC	0.567																																																	1	Substitution - Missense(1)	kidney(1)											112.0	91.0	98.0					17																	7722587		2203	4300	6503	SO:0001583	missense	146754			U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.10876T>A	17.37:g.7722587T>A	ENSP00000458355:p.Cys3626Ser	Somatic		WXS	Illumina HiSeq	Phase_I	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Missense_Mutation	SNP	ENST00000572933.1	37	CCDS32551.1	.	.	.	.	.	.	.	.	.	.	T	3.607	-0.080352	0.07141	.	.	ENSG00000183914	ENST00000360606;ENST00000389173	D	0.85556	-2.0	4.02	2.0	0.26442	.	0.443962	0.23010	N	0.052966	T	0.48187	0.1486	N	0.00300	-1.685	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.34279	-0.9835	10	0.09084	T	0.74	.	3.2601	0.06845	0.3147:0.4661:0.0:0.2192	.	3587;3626	Q9P225-2;Q9P225	.;DYH2_HUMAN	S	3587;3626	ENSP00000373825:C3626S	ENSP00000353818:C3587S	C	+	1	0	DNAH2	7663312	0.839000	0.29477	0.999000	0.59377	0.993000	0.82548	0.288000	0.18939	0.444000	0.26612	-0.366000	0.07423	TGC		0.567	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440241.1		NM_020877	
ERMN	57471	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	158182140	158182140	+	Silent	SNP	C	C	T			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr2:158182140C>T	ENST00000410096.1	-	1	306	c.15G>A	c.(13-15)ccG>ccA	p.P5P	ERMN_ENST00000409925.1_Silent_p.P5P|ERMN_ENST00000397283.2_Silent_p.P18P|ERMN_ENST00000535935.1_5'Flank|ERMN_ENST00000409216.1_Silent_p.P5P|ERMN_ENST00000420719.2_Silent_p.P5P	NM_020711.1	NP_065762.1	Q8TAM6	ERMIN_HUMAN	ermin, ERM-like protein	5					actin filament organization (GO:0007015)|morphogenesis of a branching structure (GO:0001763)|regulation of cell projection organization (GO:0031344)|regulation of cell shape (GO:0008360)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|internode region of axon (GO:0033269)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|paranode region of axon (GO:0033270)		p.P18P(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)	12						TAAATGTAGCCGGAACATCTG	0.453																																																	1	Substitution - coding silent(1)	kidney(1)											179.0	163.0	168.0					2																	158182140		1906	4116	6022	SO:0001819	synonymous_variant	57471			AB033015	CCDS42764.1, CCDS46431.1	2q24	2008-02-05	2008-01-15	2008-01-15	ENSG00000136541	ENSG00000136541			29208	protein-coding gene	gene with protein product	"""juxtanodin"", ""ermin"""	610072	"""KIAA1189"""	KIAA1189		16051705, 16421295	Standard	NM_020711		Approved	JN, ERMIN	uc002tzi.3	Q8TAM6	OTTHUMG00000153843	ENST00000410096.1:c.15G>A	2.37:g.158182140C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B4DKA6|Q9ULN1	Silent	SNP	ENST00000410096.1	37	CCDS46431.1																																																																																				0.453	ERMN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332659.1		NM_001009959	
ESF1	51575	broad.mit.edu;ucsc.edu	37	20	13750637	13750637	+	Silent	SNP	A	A	G			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr20:13750637A>G	ENST00000202816.1	-	7	1541	c.1434T>C	c.(1432-1434)gaT>gaC	p.D478D		NM_001276380.1|NM_016649.3	NP_001263309.1|NP_057733.2	Q9H501	ESF1_HUMAN	ESF1, nucleolar pre-rRNA processing protein, homolog (S. cerevisiae)	478					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular space (GO:0005615)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.D478D(1)		endometrium(3)|kidney(5)|large_intestine(8)|lung(11)|ovary(2)|skin(1)|stomach(1)	31						CCTTAGGCTCATCATCAAAAG	0.313																																																	1	Substitution - coding silent(1)	kidney(1)											68.0	69.0	68.0					20																	13750637		2203	4296	6499	SO:0001819	synonymous_variant	51575				CCDS13117.1	20p12.1	2007-02-12	2006-11-13	2006-11-13	ENSG00000089048	ENSG00000089048			15898	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 6"""	C20orf6			Standard	NM_016649		Approved	bA526K24.1	uc002wok.2	Q9H501	OTTHUMG00000031906	ENST00000202816.1:c.1434T>C	20.37:g.13750637A>G		Somatic		WXS	Illumina GAIIx	Phase_I	Q86X92|Q9H9Q5|Q9HA35|Q9NX93|Q9P1S6	Silent	SNP	ENST00000202816.1	37	CCDS13117.1																																																																																				0.313	ESF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078049.1		NM_016649	
EYA4	2070	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	133844277	133844277	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr6:133844277C>T	ENST00000367895.5	+	18	2164	c.1700C>T	c.(1699-1701)gCt>gTt	p.A567V	EYA4_ENST00000525849.1_Missense_Mutation_p.A544V|EYA4_ENST00000431403.2_Missense_Mutation_p.A567V|EYA4_ENST00000452339.2_Missense_Mutation_p.A513V|EYA4_ENST00000355167.3_Missense_Mutation_p.A567V|EYA4_ENST00000531901.1_Missense_Mutation_p.A573V|EYA4_ENST00000355286.6_Missense_Mutation_p.A544V|RP3-323P13.2_ENST00000607033.1_RNA|EYA4_ENST00000430974.2_Missense_Mutation_p.A519V	NM_004100.4	NP_004091.3	O95677	EYA4_HUMAN	EYA transcriptional coactivator and phosphatase 4	567					anatomical structure morphogenesis (GO:0009653)|chromatin modification (GO:0016568)|DNA repair (GO:0006281)|inner ear development (GO:0048839)|middle ear morphogenesis (GO:0042474)|regulation of transcription, DNA-templated (GO:0006355)|sensory perception of sound (GO:0007605)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein tyrosine phosphatase activity (GO:0004725)	p.A567V(2)		breast(1)|central_nervous_system(3)|endometrium(5)|kidney(2)|large_intestine(11)|lung(25)|skin(1)	48	Colorectal(23;0.221)			GBM - Glioblastoma multiforme(68;0.00457)|OV - Ovarian serous cystadenocarcinoma(155;0.0152)		TTAGGAGGTGCTTTCCCCATT	0.388																																					Melanoma(57;398 1237 3528 4702 7415)												2	Substitution - Missense(2)	kidney(2)											126.0	123.0	124.0					6																	133844277		2203	4300	6503	SO:0001583	missense	2070			Y17114	CCDS5165.1, CCDS5166.1, CCDS43506.1, CCDS75521.1, CCDS75523.1	6q23	2014-09-17	2014-06-19		ENSG00000112319	ENSG00000112319		"""Protein tyrosine phosphatases / Asp-based PTPs"""	3522	protein-coding gene	gene with protein product		603550	"""eyes absent (Drosophila) homolog 4"", ""eyes absent homolog 4 (Drosophila)"""	DFNA10, CMD1J		9887327, 11159937	Standard	NM_004100		Approved		uc003qed.4	O95677	OTTHUMG00000015602	ENST00000367895.5:c.1700C>T	6.37:g.133844277C>T	ENSP00000356870:p.Ala567Val	Somatic		WXS	Illumina HiSeq	Phase_I	B7Z7F7|O95464|O95679|Q8IW39|Q9NTR7	Missense_Mutation	SNP	ENST00000367895.5	37	CCDS5165.1	.	.	.	.	.	.	.	.	.	.	C	6.563	0.472167	0.12461	.	.	ENSG00000112319	ENST00000452339;ENST00000430974;ENST00000367895;ENST00000355167;ENST00000355286;ENST00000531901;ENST00000525849;ENST00000431403	D;D;D;D;D;D;D;D	0.97404	-4.37;-2.2;-2.33;-4.37;-2.33;-4.37;-4.37;-4.37	5.86	4.06	0.47325	EYA (1);Haloacid dehalogenase-like hydrolase (1);	0.199134	0.53938	N	0.000057	T	0.74596	0.3737	N	0.00801	-1.175	0.48830	D	0.999711	B;B;B;B;B;B	0.06786	0.0;0.0;0.0;0.001;0.0;0.0	B;B;B;B;B;B	0.08055	0.002;0.002;0.001;0.003;0.002;0.002	T	0.73065	-0.4100	10	0.02654	T	1	-13.3038	9.5646	0.39391	0.0:0.7893:0.0:0.2107	.	573;519;513;544;567;567	F2Z2Y1;E7ESD5;E7EN58;O95677-2;O95677-4;O95677	.;.;.;.;.;EYA4_HUMAN	V	513;519;567;567;544;573;544;567	ENSP00000395916:A513V;ENSP00000388670:A519V;ENSP00000356870:A567V;ENSP00000347294:A567V;ENSP00000347434:A544V;ENSP00000432770:A573V;ENSP00000433219:A544V;ENSP00000404558:A567V	ENSP00000347294:A567V	A	+	2	0	EYA4	133885970	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.959000	0.49153	1.612000	0.50221	0.650000	0.86243	GCT		0.388	EYA4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000042282.2		NM_004100	
FLT1	2321	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	13	28913320	28913320	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr13:28913320C>A	ENST00000282397.4	-	17	2724	c.2473G>T	c.(2473-2475)Gag>Tag	p.E825*	FLT1_ENST00000540678.1_Nonsense_Mutation_p.E43*	NM_002019.4	NP_002010.2	P17948	VGFR1_HUMAN	fms-related tyrosine kinase 1	825					blood vessel morphogenesis (GO:0048514)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic morphogenesis (GO:0048598)|monocyte chemotaxis (GO:0002548)|patterning of blood vessels (GO:0001569)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor receptor-1 signaling pathway (GO:0036323)|vascular endothelial growth factor signaling pathway (GO:0038084)	endosome (GO:0005768)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|placental growth factor-activated receptor activity (GO:0036332)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)|VEGF-A-activated receptor activity (GO:0036326)|VEGF-B-activated receptor activity (GO:0036327)	p.E825*(1)		NS(1)|breast(2)|central_nervous_system(5)|endometrium(8)|kidney(3)|large_intestine(20)|lung(55)|ovary(3)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	115	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	TTAAGTCTCTCCCGGGCAAAC	0.423																																																	1	Substitution - Nonsense(1)	kidney(1)											77.0	75.0	76.0					13																	28913320		2203	4300	6503	SO:0001587	stop_gained	2321			AF063657	CCDS9330.1, CCDS53860.1, CCDS53861.1, CCDS73556.1	13q12	2014-09-17	2012-11-19		ENSG00000102755	ENSG00000102755	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3763	protein-coding gene	gene with protein product	"""vascular endothelial growth factor receptor 1"", ""vascular permeability factor receptor"""	165070	"""fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor)"""	FLT		2158038	Standard	NM_001159920		Approved	VEGFR1	uc001usb.3	P17948	OTTHUMG00000016648	ENST00000282397.4:c.2473G>T	13.37:g.28913320C>A	ENSP00000282397:p.Glu825*	Somatic		WXS	Illumina HiSeq	Phase_I	A3E342|A3E344|A8KA71|B0LPF1|B2BF46|B2BF47|B2BF48|B3FR89|B5A923|F5H5L6|O60722|P16057|Q12954	Nonsense_Mutation	SNP	ENST00000282397.4	37	CCDS9330.1	.	.	.	.	.	.	.	.	.	.	C	40	8.262814	0.98732	.	.	ENSG00000102755	ENST00000282397;ENST00000540678	.	.	.	5.52	5.52	0.82312	.	0.103802	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	.	19.7926	0.96466	0.0:1.0:0.0:0.0	.	.	.	.	X	825;43	.	ENSP00000282397:E825X	E	-	1	0	FLT1	27811320	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.818000	0.86416	2.761000	0.94854	0.655000	0.94253	GAG		0.423	FLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044322.1			
FNDC7	163479	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	109280146	109280146	+	Splice_Site	SNP	G	G	A	rs572093742		TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr1:109280146G>A	ENST00000370017.3	+	11	2447	c.2170G>A	c.(2170-2172)Gtg>Atg	p.V724M	FNDC7_ENST00000271311.2_Splice_Site_p.V725M|RP11-293A10.3_ENST00000437400.2_RNA	NM_001144937.1	NP_001138409.1	Q5VTL7	FNDC7_HUMAN	fibronectin type III domain containing 7	724						extracellular region (GO:0005576)		p.V491M(1)|p.V724M(1)		breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)|ovary(1)|skin(4)|stomach(1)|urinary_tract(1)	20		all_lung(203;0.00439)|Lung NSC(277;0.00683)|all_epithelial(167;0.00728)		Colorectal(144;0.0314)|Lung(183;0.0924)|COAD - Colon adenocarcinoma(174;0.119)|Epithelial(280;0.173)|all cancers(265;0.244)		ACTTGGAATGGGTAAGTCATT	0.299																																																	2	Substitution - Missense(2)	kidney(2)											112.0	119.0	117.0					1																	109280146		2202	4300	6502	SO:0001630	splice_region_variant	163479				CCDS44185.1	1p13.3	2013-02-11			ENSG00000143107	ENSG00000143107		"""Fibronectin type III domain containing"""	26668	protein-coding gene	gene with protein product						12477932	Standard	NM_001144937		Approved	FLJ35838	uc001dvx.3	Q5VTL7	OTTHUMG00000011120	ENST00000370017.3:c.2170+1G>A	1.37:g.109280146G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A1L468|E9PAZ5|Q6PF16|Q8NA51	Missense_Mutation	SNP	ENST00000370017.3	37	CCDS44185.1	.	.	.	.	.	.	.	.	.	.	G	17.45	3.392765	0.62066	.	.	ENSG00000143107	ENST00000370017;ENST00000271311	D;D	0.97959	-4.63;-4.63	5.34	5.34	0.76211	.	0.147571	0.45126	D	0.000384	D	0.94745	0.8304	L	0.47716	1.5	0.58432	D	0.999998	B	0.23058	0.079	B	0.20577	0.03	D	0.92620	0.6107	10	0.72032	D	0.01	-2.228	17.5941	0.88006	0.0:0.0:1.0:0.0	.	724	E9PAZ5	.	M	724;725	ENSP00000359034:V724M;ENSP00000271311:V725M	ENSP00000271311:V725M	V	+	1	0	FNDC7	109081669	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	5.563000	0.67352	2.665000	0.90641	0.655000	0.94253	GTG		0.299	FNDC7-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030589.4		NM_173532	Missense_Mutation
FRAS1	80144	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	79308552	79308552	+	Missense_Mutation	SNP	A	A	T			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr4:79308552A>T	ENST00000325942.6	+	29	4112	c.3672A>T	c.(3670-3672)gaA>gaT	p.E1224D	FRAS1_ENST00000264895.6_Missense_Mutation_p.E1224D	NM_001166133.1	NP_001159605.1	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	1224					cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)	p.E1224D(3)		breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						TGAGAAATGAAGTTCTCCACA	0.468																																																	3	Substitution - Missense(3)	kidney(3)											78.0	76.0	77.0					4																	79308552		1951	4146	6097	SO:0001583	missense	80144			AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000325942.6:c.3672A>T	4.37:g.79308552A>T	ENSP00000326330:p.Glu1224Asp	Somatic		WXS	Illumina HiSeq	Phase_I	A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Missense_Mutation	SNP	ENST00000325942.6	37	CCDS54772.1	.	.	.	.	.	.	.	.	.	.	G	15.53	2.861541	0.51482	.	.	ENSG00000138759	ENST00000325942;ENST00000264895	T;T	0.55588	0.51;0.51	5.6	-2.91	0.05631	.	0.132195	0.50627	D	0.000108	T	0.56156	0.1966	M	0.70595	2.14	0.58432	D	0.999996	D;D	0.62365	0.985;0.991	P;P	0.57204	0.724;0.815	T	0.55198	-0.8178	10	0.34782	T	0.22	.	7.3455	0.26660	0.4662:0.1963:0.3375:0.0	.	1224;1224	E9PHH6;A2RRR8	.;.	D	1224	ENSP00000326330:E1224D;ENSP00000264895:E1224D	ENSP00000264895:E1224D	E	+	3	2	FRAS1	79527576	0.358000	0.24947	0.072000	0.20136	0.406000	0.30931	0.252000	0.18278	-0.566000	0.06054	-0.898000	0.02899	GAA		0.468	FRAS1-001	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000362706.2			
GDAP2	54834	broad.mit.edu;ucsc.edu	37	1	118426150	118426150	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr1:118426150A>G	ENST00000369443.5	-	11	1456	c.1207T>C	c.(1207-1209)Tcc>Ccc	p.S403P	GDAP2_ENST00000464026.1_5'UTR|GDAP2_ENST00000369442.3_Missense_Mutation_p.S403P	NM_017686.3	NP_060156.1	Q9NXN4	GDAP2_HUMAN	ganglioside induced differentiation associated protein 2	403	CRAL-TRIO.				response to retinoic acid (GO:0032526)	lysosomal membrane (GO:0005765)		p.S403P(1)		kidney(2)|large_intestine(3)|lung(9)|ovary(2)	16		all_cancers(81;0.0156)|all_lung(203;5.81e-05)|Lung NSC(69;0.000446)|all_epithelial(167;0.00295)		Lung(183;0.0583)|LUSC - Lung squamous cell carcinoma(189;0.194)		AGGAAGTCGGAGTCCAGGTGA	0.358																																																	1	Substitution - Missense(1)	kidney(1)											100.0	96.0	97.0					1																	118426150		2203	4300	6503	SO:0001583	missense	54834			AK000149	CCDS897.1, CCDS44201.1	1q11	2011-10-20			ENSG00000196505	ENSG00000196505			18010	protein-coding gene	gene with protein product						1021725	Standard	NM_017686		Approved	FLJ20142, dJ776P7.1, MACROD3	uc001ehf.3	Q9NXN4	OTTHUMG00000012199	ENST00000369443.5:c.1207T>C	1.37:g.118426150A>G	ENSP00000358451:p.Ser403Pro	Somatic		WXS	Illumina GAIIx	Phase_I	Q96DZ0	Missense_Mutation	SNP	ENST00000369443.5	37	CCDS897.1	.	.	.	.	.	.	.	.	.	.	A	16.00	2.997507	0.54147	.	.	ENSG00000196505	ENST00000369443;ENST00000369442	T;T	0.63417	-0.04;-0.04	4.73	4.73	0.59995	Cellular retinaldehyde-binding/triple function, C-terminal (3);	0.112014	0.64402	D	0.000006	T	0.52645	0.1747	L	0.38531	1.155	0.46927	D	0.999259	P;D	0.54397	0.911;0.966	P;P	0.52109	0.563;0.69	T	0.59669	-0.7411	10	0.59425	D	0.04	-15.1757	14.2348	0.65919	1.0:0.0:0.0:0.0	.	403;403	Q9NXN4-2;Q9NXN4	.;GDAP2_HUMAN	P	403	ENSP00000358451:S403P;ENSP00000358450:S403P	ENSP00000358450:S403P	S	-	1	0	GDAP2	118227673	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	3.675000	0.54605	1.774000	0.52232	0.397000	0.26171	TCC		0.358	GDAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033732.2		NM_017686	
GKN2	200504	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	69177365	69177365	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr2:69177365C>A	ENST00000328895.4	-	3	205	c.97G>T	c.(97-99)Ggt>Tgt	p.G33C	GKN2_ENST00000481498.1_Missense_Mutation_p.G33C	NM_182536.2	NP_872342.2	Q86XP6	GKN2_HUMAN	gastrokine 2	33						extracellular region (GO:0005576)		p.G33C(1)		autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|urinary_tract(1)	15						ACATTGCCACCATTGTTGCTT	0.343																																																	1	Substitution - Missense(1)	kidney(1)											94.0	88.0	90.0					2																	69177365		2203	4300	6503	SO:0001583	missense	200504			AF494509	CCDS33215.1	2p14	2012-10-10			ENSG00000183607	ENSG00000183607		"""BRICHOS domain containing"""	24588	protein-coding gene	gene with protein product	"""down regulated in gastric cancer GDDR"", ""BRICHOS domain containing 1B"""					15774165, 15924415, 16888721	Standard	NM_182536		Approved	TFIZ1, PRO813, VLTI465, blottin, GDDR, BRICD1B	uc002sfa.3	Q86XP6	OTTHUMG00000152655	ENST00000328895.4:c.97G>T	2.37:g.69177365C>A	ENSP00000329292:p.Gly33Cys	Somatic		WXS	Illumina HiSeq	Phase_I	Q6UWS6	Missense_Mutation	SNP	ENST00000328895.4	37	CCDS33215.1	.	.	.	.	.	.	.	.	.	.	C	13.69	2.313649	0.40996	.	.	ENSG00000183607	ENST00000328895;ENST00000481498	T;T	0.51817	0.72;0.69	5.28	4.38	0.52667	.	0.162193	0.42548	D	0.000695	T	0.64080	0.2566	M	0.72118	2.19	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.78314	0.991;0.972	T	0.55829	-0.8079	10	0.87932	D	0	-3.4231	10.0645	0.42295	0.0:0.9071:0.0:0.0929	.	33;33	E5RHQ8;Q86XP6	.;GKN2_HUMAN	C	33	ENSP00000329292:G33C;ENSP00000428538:G33C	ENSP00000329292:G33C	G	-	1	0	GKN2	69030869	0.014000	0.17966	0.085000	0.20634	0.475000	0.33008	0.990000	0.29642	2.736000	0.93811	0.655000	0.94253	GGT		0.343	GKN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327191.1		NM_182536	
GPT2	84706	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	46958369	46958369	+	Silent	SNP	C	C	T			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr16:46958369C>T	ENST00000340124.4	+	10	1393	c.1281C>T	c.(1279-1281)gtC>gtT	p.V427V	GPT2_ENST00000440783.2_Silent_p.V327V	NM_133443.2	NP_597700.1	Q8TD30	ALAT2_HUMAN	glutamic pyruvate transaminase (alanine aminotransferase) 2	427					2-oxoglutarate metabolic process (GO:0006103)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|L-alanine catabolic process (GO:0042853)|L-alanine metabolic process (GO:0042851)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	L-alanine:2-oxoglutarate aminotransferase activity (GO:0004021)|pyridoxal phosphate binding (GO:0030170)	p.V427V(1)		NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(2)	23		all_cancers(37;0.0276)|all_epithelial(9;0.0498)|all_lung(18;0.0522)			L-Alanine(DB00160)|Phenelzine(DB00780)	TTAACCAAGTCCCAGGAATTC	0.547																																																	1	Substitution - coding silent(1)	kidney(1)											115.0	102.0	107.0					16																	46958369		2203	4300	6503	SO:0001819	synonymous_variant	84706				CCDS10725.1, CCDS45478.1	16q12.1	2008-02-05			ENSG00000166123	ENSG00000166123	2.6.1.2		18062	protein-coding gene	gene with protein product		138210					Standard	NM_133443		Approved	ALT2	uc002eel.3	Q8TD30	OTTHUMG00000132541	ENST00000340124.4:c.1281C>T	16.37:g.46958369C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q8N9E2	Silent	SNP	ENST00000340124.4	37	CCDS10725.1																																																																																				0.547	GPT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255741.2			
GSN	2934	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	124072995	124072995	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr9:124072995G>A	ENST00000373818.4	+	4	607	c.538G>A	c.(538-540)Gta>Ata	p.V180I	GSN_ENST00000373823.3_Missense_Mutation_p.V129I|GSN_ENST00000373807.1_5'Flank|GSN_ENST00000449733.1_Missense_Mutation_p.V129I|GSN_ENST00000341272.2_Missense_Mutation_p.V129I|GSN_ENST00000436847.1_Missense_Mutation_p.V140I|GSN_ENST00000545652.1_Missense_Mutation_p.V137I|GSN_ENST00000412819.1_Missense_Mutation_p.V129I|GSN_ENST00000373808.2_Missense_Mutation_p.V129I|GSN_ENST00000394353.2_Missense_Mutation_p.V140I|GSN_ENST00000485767.1_3'UTR	NM_000177.4|NM_001258029.1	NP_000168.1|NP_001244958.1	P06396	GELS_HUMAN	gelsolin	180					actin filament polymerization (GO:0030041)|actin filament severing (GO:0051014)|aging (GO:0007568)|apoptotic process (GO:0006915)|barbed-end actin filament capping (GO:0051016)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to cadmium ion (GO:0071276)|cilium morphogenesis (GO:0060271)|oligodendrocyte development (GO:0014003)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of cell adhesion (GO:0030155)|response to ethanol (GO:0045471)|response to folic acid (GO:0051593)|tissue regeneration (GO:0042246)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)|ruffle (GO:0001726)	calcium ion binding (GO:0005509)	p.V180I(1)|p.V129I(1)		NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)	21						CAAGCACGTGGTACCCAACGA	0.582																																																	2	Substitution - Missense(2)	kidney(2)											186.0	134.0	151.0					9																	124072995		2203	4300	6503	SO:0001583	missense	2934			X04412	CCDS6828.1, CCDS6829.1, CCDS48011.1, CCDS65118.1, CCDS75890.1, CCDS75891.1	9q33	2010-04-27	2010-04-27		ENSG00000148180	ENSG00000148180			4620	protein-coding gene	gene with protein product	"""amyloidosis, Finnish type"""	137350	"""gelsolin (amyloidosis, Finnish type)"""			1652889	Standard	NM_001127662		Approved	DKFZp313L0718	uc004blf.1	P06396	OTTHUMG00000020584	ENST00000373818.4:c.538G>A	9.37:g.124072995G>A	ENSP00000362924:p.Val180Ile	Somatic		WXS	Illumina HiSeq	Phase_I	A2A418|A8MUD1|A8MYN7|B7Z373|B7Z5V1|F5H1A8|Q5T0I2|Q8WVV7	Missense_Mutation	SNP	ENST00000373818.4	37	CCDS6828.1	.	.	.	.	.	.	.	.	.	.	G	16.52	3.147635	0.57151	.	.	ENSG00000148180	ENST00000373823;ENST00000432226;ENST00000449773;ENST00000436847;ENST00000394353;ENST00000449733;ENST00000412819;ENST00000341272;ENST00000373808;ENST00000394352;ENST00000456109;ENST00000545652;ENST00000373818	T;T;T;T;T;T;T;T;T;T;T	0.64618	-0.11;-0.11;-0.11;-0.11;-0.11;-0.11;-0.11;-0.11;-0.11;-0.11;-0.11	5.33	5.33	0.75918	.	0.104741	0.64402	D	0.000004	T	0.52273	0.1724	L	0.46741	1.465	0.80722	D	1	B;P;B;B	0.42973	0.0;0.796;0.001;0.009	B;B;B;B	0.30401	0.001;0.115;0.001;0.006	T	0.58120	-0.7692	10	0.41790	T	0.15	-3.8469	17.5915	0.87998	0.0:0.0:1.0:0.0	.	153;137;140;180	B7Z9A0;F5H1A8;B7Z373;P06396	.;.;.;GELS_HUMAN	I	129;129;140;140;140;129;129;129;129;113;103;137;180	ENSP00000362929:V129I;ENSP00000404226:V129I;ENSP00000410657:V140I;ENSP00000411293:V140I;ENSP00000377882:V140I;ENSP00000409358:V129I;ENSP00000416586:V129I;ENSP00000340888:V129I;ENSP00000362914:V129I;ENSP00000445823:V137I;ENSP00000362924:V180I	ENSP00000340888:V129I	V	+	1	0	GSN	123112816	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.740000	0.74832	2.492000	0.84095	0.655000	0.94253	GTA		0.582	GSN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000053861.1		NM_000177	
GTF3C2	2976	broad.mit.edu;ucsc.edu	37	2	27565792	27565792	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr2:27565792G>A	ENST00000359541.2	-	3	899	c.470C>T	c.(469-471)tCa>tTa	p.S157L	AC109828.1_ENST00000589232.1_RNA|AC109828.1_ENST00000587586.1_RNA|AC109828.1_ENST00000589853.1_RNA|AC109828.1_ENST00000588707.1_RNA|AC109828.1_ENST00000590383.1_RNA|GTF3C2_ENST00000264720.3_Missense_Mutation_p.S157L			Q8WUA4	TF3C2_HUMAN	general transcription factor IIIC, polypeptide 2, beta 110kDa	157					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	nucleoplasm (GO:0005654)|transcription factor TFIIIC complex (GO:0000127)		p.S157L(1)		central_nervous_system(4)|endometrium(6)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|urinary_tract(2)	38	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TAGGTCTTTTGACAACTTCAG	0.557																																																	1	Substitution - Missense(1)	kidney(1)											83.0	83.0	83.0					2																	27565792		2203	4300	6503	SO:0001583	missense	2976			D13636	CCDS1749.1	2p23.3	2013-01-10	2002-08-29		ENSG00000115207	ENSG00000115207		"""General transcription factors"", ""WD repeat domain containing"""	4665	protein-coding gene	gene with protein product		604883	"""general transcription factor IIIC, polypeptide 2 (beta subunit, 110kD)"""			7729686	Standard	NM_001521		Approved	KIAA0011, TFIIIC110	uc002rjw.2	Q8WUA4	OTTHUMG00000097785	ENST00000359541.2:c.470C>T	2.37:g.27565792G>A	ENSP00000352536:p.Ser157Leu	Somatic		WXS	Illumina GAIIx	Phase_I	D6W557|Q16632|Q9BWI7	Missense_Mutation	SNP	ENST00000359541.2	37	CCDS1749.1	.	.	.	.	.	.	.	.	.	.	G	24.7	4.557321	0.86231	.	.	ENSG00000115207	ENST00000359541;ENST00000264720	T;T	0.75260	-0.92;-0.92	5.31	5.31	0.75309	.	0.214886	0.32719	N	0.005731	T	0.78227	0.4250	N	0.24115	0.695	0.36885	D	0.889582	D;B;D	0.67145	0.996;0.437;0.996	D;B;D	0.77557	0.99;0.081;0.99	T	0.81514	-0.0898	10	0.49607	T	0.09	-7.7538	16.5206	0.84315	0.0:0.0:1.0:0.0	.	157;157;157	Q8WUA4-2;Q8WUA4;Q53QN0	.;TF3C2_HUMAN;.	L	157	ENSP00000352536:S157L;ENSP00000264720:S157L	ENSP00000264720:S157L	S	-	2	0	GTF3C2	27419296	1.000000	0.71417	0.977000	0.42913	0.952000	0.60782	5.631000	0.67812	2.763000	0.94921	0.563000	0.77884	TCA		0.557	GTF3C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215028.2			
HAUS7	55559	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	152721103	152721103	+	Missense_Mutation	SNP	T	T	C			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chrX:152721103T>C	ENST00000370211.4	-	8	900	c.857A>G	c.(856-858)tAc>tGc	p.Y286C	TREX2_ENST00000338525.2_5'UTR|HAUS7_ENST00000484394.1_5'UTR|TREX2_ENST00000330912.2_5'UTR|HAUS7_ENST00000421080.2_Missense_Mutation_p.T108A|TREX2_ENST00000370232.1_5'UTR|TREX2_ENST00000334497.2_5'UTR|HAUS7_ENST00000370212.3_Missense_Mutation_p.Y286C	NM_017518.7	NP_059988.3	Q99871	HAUS7_HUMAN	HAUS augmin-like complex, subunit 7	286					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	thioesterase binding (GO:0031996)	p.Y286C(1)		endometrium(1)|kidney(3)|large_intestine(1)|lung(10)|prostate(1)|skin(3)	19						CTCGTCGTCGTAGACTTGGAG	0.632																																																	1	Substitution - Missense(1)	kidney(1)											97.0	89.0	92.0					X																	152721103		2203	4300	6503	SO:0001583	missense	55559			AF267739	CCDS35438.1	Xq28	2011-10-24	2009-04-20	2009-04-20		ENSG00000213397		"""HAUS augmin-like complex subunits"""	32979	protein-coding gene	gene with protein product	"""UCH37 interacting protein 1"", ""26S proteasome-associated UCH interacting protein 1"""	300540	"""UCHL5 interacting protein"""	UCHL5IP		11163772, 16395595, 19427217	Standard	NM_017518		Approved	UIP1	uc004fho.2	Q99871		ENST00000370211.4:c.857A>G	X.37:g.152721103T>C	ENSP00000359230:p.Tyr286Cys	Somatic		WXS	Illumina HiSeq	Phase_I	B4DUH6|D3DWT9|Q96HS8|Q9NP54|Q9UFH9	Missense_Mutation	SNP	ENST00000370211.4	37	CCDS35438.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	11.89|11.89	1.773971|1.773971	0.31411|0.31411	.|.	.|.	ENSG00000213397|ENSG00000213397	ENST00000435662;ENST00000421080|ENST00000370211;ENST00000370219;ENST00000370212	T|T;T;T	0.21543|0.25912	2.0|1.77;1.77;1.77	4.99|4.99	2.4|2.4	0.29515|0.29515	.|.	.|0.135145	.|0.50627	.|N	.|0.000108	T|T	0.42337|0.42337	0.1198|0.1198	M|M	0.72894|0.72894	2.215|2.215	0.19300|0.19300	N|N	0.999977|0.999977	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.87578	.|0.998;0.996	T|T	0.17592|0.17592	-1.0364|-1.0364	7|10	0.06891|0.87932	T|D	0.86|0	-9.7153|-9.7153	3.9663|3.9663	0.09433|0.09433	0.1868:0.1094:0.0:0.7038|0.1868:0.1094:0.0:0.7038	.|.	.|286;286	.|Q99871;Q99871-2	.|HAUS7_HUMAN;.	A|C	70;108|276;286;286	ENSP00000395447:T108A|ENSP00000359230:Y276C;ENSP00000359239:Y286C;ENSP00000359231:Y286C	ENSP00000395447:T108A|ENSP00000359230:Y276C	T|Y	-|-	1|2	0|0	HAUS7|HAUS7	152374297|152374297	0.312000|0.312000	0.24545|0.24545	0.696000|0.696000	0.30242|0.30242	0.043000|0.043000	0.13939|0.13939	0.311000|0.311000	0.19380|0.19380	0.679000|0.679000	0.31345|0.31345	0.242000|0.242000	0.17961|0.17961	ACG|TAC		0.632	HAUS7-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000060963.2		NM_017518	
HECW2	57520	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	197184391	197184391	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr2:197184391G>A	ENST00000260983.3	-	9	1405	c.1223C>T	c.(1222-1224)cCt>cTt	p.P408L	HECW2_ENST00000409111.1_Missense_Mutation_p.P52L	NM_020760.1	NP_065811.1	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2	408					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.P408L(1)		biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(24)|lung(45)|ovary(5)|pancreas(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	113						TCCTCTGGGAGGTGAGGTCCT	0.522																																																	1	Substitution - Missense(1)	kidney(1)											89.0	91.0	90.0					2																	197184391		2203	4300	6503	SO:0001583	missense	57520			AL390186	CCDS33354.1	2q32.3	2004-12-13			ENSG00000138411	ENSG00000138411			29853	protein-coding gene	gene with protein product						10718198, 12890487	Standard	NM_020760		Approved	KIAA1301, NEDL2	uc002utm.1	Q9P2P5	OTTHUMG00000154435	ENST00000260983.3:c.1223C>T	2.37:g.197184391G>A	ENSP00000260983:p.Pro408Leu	Somatic		WXS	Illumina HiSeq	Phase_I	B8ZZB4|Q17RT5|Q68DF8|Q9NPS9	Missense_Mutation	SNP	ENST00000260983.3	37	CCDS33354.1	.	.	.	.	.	.	.	.	.	.	G	14.79	2.642048	0.47153	.	.	ENSG00000138411	ENST00000409111;ENST00000260983	T;T	0.33654	1.4;1.46	5.64	5.64	0.86602	.	0.381500	0.29424	N	0.012195	T	0.26810	0.0656	N	0.19112	0.55	0.52099	D	0.999949	B	0.09022	0.002	B	0.08055	0.003	T	0.04053	-1.0981	10	0.22109	T	0.4	.	18.0636	0.89384	0.0:0.0:1.0:0.0	.	408	Q9P2P5	HECW2_HUMAN	L	52;408	ENSP00000386775:P52L;ENSP00000260983:P408L	ENSP00000260983:P408L	P	-	2	0	HECW2	196892636	1.000000	0.71417	0.980000	0.43619	0.891000	0.51852	5.883000	0.69721	2.937000	0.99478	0.650000	0.86243	CCT		0.522	HECW2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335199.3		NM_020760	
HS3ST5	222537	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	114383925	114383925	+	Missense_Mutation	SNP	C	C	T	rs144143119	byFrequency	TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr6:114383925C>T	ENST00000312719.5	-	4	1273	c.85G>A	c.(85-87)Gcc>Acc	p.A29T	RP3-399L15.3_ENST00000523087.1_RNA|RP3-399L15.3_ENST00000519104.1_RNA|RP3-399L15.3_ENST00000519270.1_RNA|HS3ST5_ENST00000411826.1_Missense_Mutation_p.A29T			Q8IZT8	HS3S5_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 5	29					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process, enzymatic modification (GO:0015015)|negative regulation of coagulation (GO:0050819)|protein sulfation (GO:0006477)|regulation of viral entry into host cell (GO:0046596)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity (GO:0008467)	p.A29T(1)		breast(4)|endometrium(2)|kidney(1)|large_intestine(7)|lung(17)|ovary(1)|pancreas(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)	41		all_cancers(87;0.0587)|Colorectal(196;0.0676)|all_epithelial(87;0.154)		OV - Ovarian serous cystadenocarcinoma(136;0.00937)|all cancers(137;0.0117)|Epithelial(106;0.0274)|GBM - Glioblastoma multiforme(226;0.143)		CCAACTCTGGCGACTAGATAC	0.483																																																	1	Substitution - Missense(1)	kidney(1)						C	THR/ALA	4,4402	8.1+/-20.4	0,4,2199	151.0	149.0	150.0		85	6.1	1.0	6	dbSNP_134	150	1,8599	1.2+/-3.3	0,1,4299	yes	missense	HS3ST5	NM_153612.3	58	0,5,6498	TT,TC,CC		0.0116,0.0908,0.0384	possibly-damaging	29/347	114383925	5,13001	2203	4300	6503	SO:0001583	missense	222537			AF503292	CCDS34517.1	6q21	2011-11-16			ENSG00000249853	ENSG00000249853		"""Sulfotransferases, membrane-bound"""	19419	protein-coding gene	gene with protein product		609407				12138164	Standard	NM_153612		Approved	3-OST-5	uc003pwg.4	Q8IZT8	OTTHUMG00000015412	ENST00000312719.5:c.85G>A	6.37:g.114383925C>T	ENSP00000427888:p.Ala29Thr	Somatic		WXS	Illumina HiSeq	Phase_I	A8K1J2|Q52LI2|Q8N285	Missense_Mutation	SNP	ENST00000312719.5	37	CCDS34517.1	.	.	.	.	.	.	.	.	.	.	C	35	5.555349	0.96514	9.08E-4	1.16E-4	ENSG00000249853	ENST00000312719;ENST00000411826	T;T	0.50277	0.75;0.75	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.47838	0.1467	N	0.19112	0.55	0.80722	D	1	D	0.67145	0.996	D	0.68621	0.959	T	0.41502	-0.9505	10	0.38643	T	0.18	.	20.6593	0.99626	0.0:1.0:0.0:0.0	.	29	Q8IZT8	HS3S5_HUMAN	T	29	ENSP00000427888:A29T;ENSP00000440332:A29T	ENSP00000427888:A29T	A	-	1	0	HS3ST5	114490618	1.000000	0.71417	0.998000	0.56505	0.992000	0.81027	7.022000	0.76431	2.885000	0.99019	0.655000	0.94253	GCC		0.483	HS3ST5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041911.2		NM_153612	
IL16	3603	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	81552201	81552201	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr15:81552201G>T	ENST00000302987.4	+	2	401	c.401G>T	c.(400-402)aGg>aTg	p.R134M	IL16_ENST00000394660.2_Missense_Mutation_p.R134M			Q14005	IL16_HUMAN	interleukin 16	134					immune response (GO:0006955)|induction of positive chemotaxis (GO:0050930)|leukocyte chemotaxis (GO:0030595)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.R134M(2)		NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(12)|lung(20)|ovary(3)|skin(3)|stomach(1)|urinary_tract(1)	57						TGCCACCAAAGGGCACGCAGC	0.483																																																	2	Substitution - Missense(2)	kidney(2)											70.0	70.0	70.0					15																	81552201		1946	4142	6088	SO:0001583	missense	3603			U82972	CCDS10317.1, CCDS42069.1, CCDS53966.1	15q26.3	2011-07-14	2011-07-14		ENSG00000172349	ENSG00000172349		"""Interleukins and interleukin receptors"""	5980	protein-coding gene	gene with protein product	"""prointerleukin 16"", ""lymphocyte chemoattractant factor"""	603035	"""interleukin 16 (lymphocyte chemoattractant factor)"""			9144227	Standard	NM_004513		Approved	LCF, IL-16, prIL-16, HsT19289, FLJ42735, FLJ16806	uc021ssh.1	Q14005	OTTHUMG00000144186	ENST00000302987.4:c.401G>T	15.37:g.81552201G>T	ENSP00000302935:p.Arg134Met	Somatic		WXS	Illumina HiSeq	Phase_I	A6NM20|A8MU65|B5TY35|B9EGR6|H3BVH5|Q16435|Q6VVE6|Q6ZMQ7|Q9UP18	Missense_Mutation	SNP	ENST00000302987.4	37	CCDS42069.1	.	.	.	.	.	.	.	.	.	.	G	19.29	3.798444	0.70567	.	.	ENSG00000172349	ENST00000394655;ENST00000394660;ENST00000302987	T;T	0.16457	2.34;2.35	4.52	4.52	0.55395	.	0.000000	0.43747	D	0.000530	T	0.39886	0.1095	M	0.70595	2.14	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.70935	0.936;0.971	T	0.28839	-1.0031	10	0.72032	D	0.01	.	14.2776	0.66191	0.0:0.0:1.0:0.0	.	134;134	Q14005;Q14005-2	IL16_HUMAN;.	M	134	ENSP00000378155:R134M;ENSP00000302935:R134M	ENSP00000302935:R134M	R	+	2	0	IL16	79339256	1.000000	0.71417	0.998000	0.56505	0.934000	0.57294	4.808000	0.62583	2.339000	0.79563	0.563000	0.77884	AGG		0.483	IL16-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000303952.1		NM_172217	
ITIH5	80760	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	7682816	7682816	+	Missense_Mutation	SNP	A	A	C			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr10:7682816A>C	ENST00000256861.6	-	4	380	c.302T>G	c.(301-303)cTt>cGt	p.L101R	ITIH5_ENST00000397145.2_Missense_Mutation_p.L101R|ITIH5_ENST00000397146.2_Missense_Mutation_p.L101R|ITIH5_ENST00000446830.2_5'UTR|ITIH5_ENST00000434980.1_5'Flank	NM_030569.6	NP_085046.5	Q86UX2	ITIH5_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 5	101	VIT. {ECO:0000255|PROSITE- ProRule:PRU00801}.				hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.L101R(2)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|kidney(6)|large_intestine(21)|lung(25)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(3)	75						GTCTCCAATAAGCCTGAAATA	0.388																																																	2	Substitution - Missense(2)	kidney(2)											176.0	170.0	172.0					10																	7682816		2202	4300	6502	SO:0001583	missense	80760					10p14	2011-10-26	2011-10-26		ENSG00000123243	ENSG00000123243			21449	protein-coding gene	gene with protein product		609783	"""inter-alpha (globulin) inhibitor H5"""			14744536	Standard	NM_001001851		Approved	MGC10848	uc021pmv.1	Q86UX2	OTTHUMG00000017635	ENST00000256861.6:c.302T>G	10.37:g.7682816A>C	ENSP00000256861:p.Leu101Arg	Somatic		WXS	Illumina HiSeq	Phase_I	Q5T664|Q5T665|Q5T666|Q6AI60|Q6UXB7|Q8TF48|Q8WYV2|Q96K70	Missense_Mutation	SNP	ENST00000256861.6	37		.	.	.	.	.	.	.	.	.	.	A	17.72	3.459598	0.63401	.	.	ENSG00000123243	ENST00000256861;ENST00000397146;ENST00000397145	T;T;T	0.23950	1.88;1.88;1.88	5.71	5.71	0.89125	Vault protein inter-alpha-trypsin (2);	0.497691	0.19151	N	0.121459	T	0.42291	0.1196	.	.	.	0.30567	N	0.763936	P;D	0.60575	0.785;0.988	B;P	0.58454	0.257;0.839	T	0.49925	-0.8887	9	0.59425	D	0.04	-9.051	11.1468	0.48434	0.8463:0.1537:0.0:0.0	.	101;101	G5E9D8;Q86UX2	.;ITIH5_HUMAN	R	101	ENSP00000256861:L101R;ENSP00000380333:L101R;ENSP00000380332:L101R	ENSP00000256861:L101R	L	-	2	0	ITIH5	7722822	1.000000	0.71417	0.956000	0.39512	0.969000	0.65631	4.157000	0.58144	2.162000	0.67917	0.460000	0.39030	CTT		0.388	ITIH5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000046688.1		NM_030569	
KCNA4	3739	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	30034211	30034211	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr11:30034211C>A	ENST00000328224.6	-	2	1248	c.15G>T	c.(13-15)atG>atT	p.M5I	KCNA4_ENST00000526518.1_5'Flank	NM_002233.3	NP_002224.1	P22459	KCNA4_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 4	5					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	potassium ion binding (GO:0030955)|voltage-gated potassium channel activity (GO:0005249)	p.M5I(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(17)|lung(39)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	78					Dalfampridine(DB06637)	CCGCACTCACCATTGCAACCT	0.537																																																	1	Substitution - Missense(1)	kidney(1)											64.0	63.0	63.0					11																	30034211		1940	4137	6077	SO:0001583	missense	3739			M55514	CCDS41629.1	11p14	2012-07-05	2002-07-10			ENSG00000182255		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6222	protein-coding gene	gene with protein product		176266	"""potassium voltage-gated channel, shaker-related subfamily, member 4-like"""	KCNA4L		2263489, 16382104	Standard	NM_002233		Approved	Kv1.4, HK1, HPCN2	uc001msk.3	P22459		ENST00000328224.6:c.15G>T	11.37:g.30034211C>A	ENSP00000328511:p.Met5Ile	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000328224.6	37	CCDS41629.1	.	.	.	.	.	.	.	.	.	.	C	14.73	2.623159	0.46840	.	.	ENSG00000182255	ENST00000328224	D	0.97352	-4.35	5.35	5.35	0.76521	Potassium channel, voltage dependent, Kv1.4, tandem inactivation (2);	107.514000	0.00710	U	0.000828	D	0.97732	0.9256	N	0.24115	0.695	0.80722	D	1	P	0.49559	0.925	D	0.65140	0.932	D	0.88648	0.3180	10	0.72032	D	0.01	.	19.0919	0.93229	0.0:1.0:0.0:0.0	.	5	P22459	KCNA4_HUMAN	I	5	ENSP00000328511:M5I	ENSP00000328511:M5I	M	-	3	0	KCNA4	29990787	1.000000	0.71417	1.000000	0.80357	0.458000	0.32498	7.378000	0.79679	2.503000	0.84419	0.655000	0.94253	ATG		0.537	KCNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388074.2		NM_002233	
KCNAB1	7881	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	156175241	156175241	+	Splice_Site	SNP	G	G	T			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr3:156175241G>T	ENST00000490337.1	+	4	421		c.e4-1		KCNAB1_ENST00000389634.5_Splice_Site|KCNAB1_ENST00000302490.8_Splice_Site|KCNAB1_ENST00000471742.1_Splice_Site|KCNAB1_ENST00000389636.5_Splice_Site|KCNAB1_ENST00000497291.1_Splice_Site	NM_172160.2	NP_751892.1	Q14722	KCAB1_HUMAN	potassium voltage-gated channel, shaker-related subfamily, beta member 1						learning or memory (GO:0007611)|potassium ion transport (GO:0006813)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel regulator activity (GO:0015459)|voltage-gated potassium channel activity (GO:0005249)	p.?(3)		breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	28			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			TCCCCTTGCAGGTTGCTGAAC	0.473																																																	3	Unknown(3)	kidney(3)											192.0	170.0	177.0					3																	156175241		2203	4300	6503	SO:0001630	splice_region_variant	7881			U33428	CCDS3174.1, CCDS3175.1, CCDS33882.1	3q26.1	2006-11-29			ENSG00000169282	ENSG00000169282		"""Potassium channels"", ""Aldo-keto reductases"""	6228	protein-coding gene	gene with protein product		601141				8838324, 7499366	Standard	NM_172160		Approved	AKR6A3, KCNA1B, hKvBeta3, Kvb1.3, hKvb3	uc003far.2	Q14722	OTTHUMG00000158552	ENST00000490337.1:c.358-1G>T	3.37:g.156175241G>T		Somatic		WXS	Illumina HiSeq	Phase_I	A8K9H8|A8KAD4|B3KPZ4|Q13031|Q13302|Q16547|Q6PI60|Q99869	Splice_Site	SNP	ENST00000490337.1	37	CCDS3174.1	.	.	.	.	.	.	.	.	.	.	G	18.01	3.527517	0.64860	.	.	ENSG00000169282	ENST00000472028;ENST00000490337;ENST00000389636;ENST00000471742;ENST00000475456;ENST00000302490;ENST00000389634	.	.	.	5.48	5.48	0.80851	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.8543	0.70323	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	KCNAB1	157657935	1.000000	0.71417	1.000000	0.80357	0.886000	0.51366	7.919000	0.87513	2.554000	0.86153	0.655000	0.94253	.		0.473	KCNAB1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351411.1		NM_003471	Intron
KIAA1429	25962	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	95531232	95531232	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr8:95531232A>G	ENST00000297591.5	-	9	2569	c.2494T>C	c.(2494-2496)Tat>Cat	p.Y832H	KIAA1429_ENST00000421249.2_Missense_Mutation_p.Y832H|KIAA1429_ENST00000437199.1_Missense_Mutation_p.Y832H	NM_015496.4	NP_056311.2	Q69YN4	VIR_HUMAN	KIAA1429	832					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.Y832H(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(16)|lung(28)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	66	Breast(36;3.29e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00185)			TCTTTGGAATAGTACTCCATT	0.328																																																	1	Substitution - Missense(1)	kidney(1)											49.0	56.0	54.0					8																	95531232		2199	4299	6498	SO:0001583	missense	25962			AB037850	CCDS34923.1, CCDS47894.1	8q22.1	2008-11-25			ENSG00000164944	ENSG00000164944			24500	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 121"""					10718198	Standard	NM_015496		Approved	DKFZP434I116, fSAP121	uc003ygo.2	Q69YN4	OTTHUMG00000164426	ENST00000297591.5:c.2494T>C	8.37:g.95531232A>G	ENSP00000297591:p.Tyr832His	Somatic		WXS	Illumina HiSeq	Phase_I	Q2M1N0|Q6AHX9|Q6NT78|Q7Z6C7|Q8IXH4|Q9BTH4|Q9H9C9|Q9NWR3|Q9P2B8|Q9UFW1	Missense_Mutation	SNP	ENST00000297591.5	37	CCDS34923.1	.	.	.	.	.	.	.	.	.	.	A	11.03	1.519950	0.27211	.	.	ENSG00000164944	ENST00000297591;ENST00000437199;ENST00000421249	T;T;T	0.67171	-0.25;-0.25;-0.25	5.02	5.02	0.67125	.	0.142312	0.53938	D	0.000057	T	0.47875	0.1469	N	0.12182	0.205	0.41873	D	0.990283	B;B	0.16396	0.004;0.017	B;B	0.15052	0.007;0.012	T	0.42447	-0.9451	10	0.18276	T	0.48	-15.2528	15.0446	0.71816	1.0:0.0:0.0:0.0	.	832;832	Q69YN4-4;Q69YN4	.;VIR_HUMAN	H	832	ENSP00000297591:Y832H;ENSP00000395600:Y832H;ENSP00000398390:Y832H	ENSP00000297591:Y832H	Y	-	1	0	KIAA1429	95600408	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	5.606000	0.67641	2.009000	0.58944	0.455000	0.32223	TAT		0.328	KIAA1429-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378720.2		NM_015496	
KIAA1429	25962	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	95538745	95538745	+	Missense_Mutation	SNP	T	T	G			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr8:95538745T>G	ENST00000297591.5	-	8	1802	c.1727A>C	c.(1726-1728)aAg>aCg	p.K576T	KIAA1429_ENST00000421249.2_Missense_Mutation_p.K576T|KIAA1429_ENST00000437199.1_Missense_Mutation_p.K576T	NM_015496.4	NP_056311.2	Q69YN4	VIR_HUMAN	KIAA1429	576					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.K576T(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(16)|lung(28)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	66	Breast(36;3.29e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00185)			AGATGAAGTCTTCTCTGCTAA	0.418																																																	1	Substitution - Missense(1)	kidney(1)											146.0	142.0	143.0					8																	95538745		2203	4300	6503	SO:0001583	missense	25962			AB037850	CCDS34923.1, CCDS47894.1	8q22.1	2008-11-25			ENSG00000164944	ENSG00000164944			24500	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 121"""					10718198	Standard	NM_015496		Approved	DKFZP434I116, fSAP121	uc003ygo.2	Q69YN4	OTTHUMG00000164426	ENST00000297591.5:c.1727A>C	8.37:g.95538745T>G	ENSP00000297591:p.Lys576Thr	Somatic		WXS	Illumina HiSeq	Phase_I	Q2M1N0|Q6AHX9|Q6NT78|Q7Z6C7|Q8IXH4|Q9BTH4|Q9H9C9|Q9NWR3|Q9P2B8|Q9UFW1	Missense_Mutation	SNP	ENST00000297591.5	37	CCDS34923.1	.	.	.	.	.	.	.	.	.	.	T	8.782	0.928595	0.18131	.	.	ENSG00000164944	ENST00000297591;ENST00000437199;ENST00000421249	T;T;T	0.47177	0.85;0.85;0.85	5.76	4.41	0.53225	.	0.229492	0.39020	N	0.001495	T	0.24890	0.0604	N	0.08118	0	0.30872	N	0.73236	B;B	0.18741	0.03;0.013	B;B	0.21917	0.037;0.022	T	0.15407	-1.0438	10	0.21540	T	0.41	-15.4918	8.4338	0.32775	0.0:0.2:0.0:0.8	.	576;576	Q69YN4-4;Q69YN4	.;VIR_HUMAN	T	576	ENSP00000297591:K576T;ENSP00000395600:K576T;ENSP00000398390:K576T	ENSP00000297591:K576T	K	-	2	0	KIAA1429	95607921	0.982000	0.34865	1.000000	0.80357	0.964000	0.63967	0.434000	0.21494	2.192000	0.70111	0.460000	0.39030	AAG		0.418	KIAA1429-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378720.2		NM_015496	
KLRC2	3822	broad.mit.edu;hgsc.bcm.edu	37	12	10584769	10584770	+	Frame_Shift_Ins	INS	-	-	AA			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr12:10584769_10584770insAA	ENST00000381902.2	-	5	525_526	c.519_520insTT	c.(517-522)attggtfs	p.G174fs	KLRC2_ENST00000381901.1_Frame_Shift_Ins_p.G174fs|NKG2-E_ENST00000539033.1_Intron|KLRC2_ENST00000536833.2_Frame_Shift_Ins_p.G115fs	NM_002260.3	NP_002251.2	P26717	NKG2C_HUMAN	killer cell lectin-like receptor subfamily C, member 2	174	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cellular defense response (GO:0006968)|innate immune response (GO:0045087)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)	p.G174R(1)		kidney(2)|large_intestine(1)|lung(6)|ovary(1)|skin(1)	11						CGAAACACACCAATCCATGAGG	0.287																																																	1	Substitution - Missense(1)	kidney(1)																																								SO:0001589	frameshift_variant	3822			X54869	CCDS31745.1	12p13	2009-12-03				ENSG00000205809		"""Killer cell lectin-like receptors"", ""CD molecules"""	6375	protein-coding gene	gene with protein product		602891				9598306	Standard	NM_002260		Approved	NKG2-C, CD159c		P26717		ENST00000381902.2:c.518_519dupTT	12.37:g.10584770_10584771dupAA	ENSP00000371327:p.Gly174fs	Somatic		WXS	Illumina HiSeq	Phase_I	O43802|Q52M74|Q9NR42	Frame_Shift_Ins	INS	ENST00000381902.2	37	CCDS31745.1																																																																																				0.287	KLRC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400111.1		NM_002260	
LEPREL4	10609	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	39967279	39967279	+	Missense_Mutation	SNP	A	A	T			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr17:39967279A>T	ENST00000355468.3	-	4	1089	c.623T>A	c.(622-624)tTc>tAc	p.F208Y	LEPREL4_ENST00000393928.1_Missense_Mutation_p.F208Y|FKBP10_ENST00000321562.4_5'Flank			Q92791	SC65_HUMAN	leprecan-like 4	208					synaptonemal complex assembly (GO:0007130)	condensed nuclear chromosome (GO:0000794)|nucleolus (GO:0005730)|synaptonemal complex (GO:0000795)		p.F208Y(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|urinary_tract(1)	8						AGCCCGGAGGAACACGGCCTG	0.647																																																	1	Substitution - Missense(1)	kidney(1)											42.0	43.0	43.0					17																	39967279		2203	4300	6503	SO:0001583	missense	10609			BC001047	CCDS11408.1	17q12	2013-05-03	2002-08-29		ENSG00000141696	ENSG00000141696			16946	protein-coding gene	gene with protein product			"""nucleolar autoantigen (55kD)"", ""rat synaptonemal complex protein"""			8862517	Standard	NM_006455		Approved	SC65, NO55	uc002hxt.3	Q92791	OTTHUMG00000133501	ENST00000355468.3:c.623T>A	17.37:g.39967279A>T	ENSP00000347649:p.Phe208Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	Q53GI6|Q9H4F6	Missense_Mutation	SNP	ENST00000355468.3	37	CCDS11408.1	.	.	.	.	.	.	.	.	.	.	A	27.6	4.842743	0.91197	.	.	ENSG00000141696	ENST00000355468;ENST00000393928;ENST00000545545	T;T	0.59083	0.29;0.29	5.68	5.68	0.88126	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	T	0.65471	0.2694	L	0.41492	1.28	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.997	T	0.59595	-0.7425	10	0.11485	T	0.65	-21.877	14.7617	0.69610	1.0:0.0:0.0:0.0	.	197;208	B4DVZ5;Q92791	.;SC65_HUMAN	Y	208;208;197	ENSP00000347649:F208Y;ENSP00000377505:F208Y	ENSP00000347649:F208Y	F	-	2	0	LEPREL4	37220805	1.000000	0.71417	1.000000	0.80357	0.758000	0.43043	9.059000	0.93902	2.158000	0.67659	0.533000	0.62120	TTC		0.647	LEPREL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257439.2			
LRRC7	57554	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	70518807	70518807	+	Silent	SNP	T	T	C			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr1:70518807T>C	ENST00000035383.5	+	21	4125	c.4095T>C	c.(4093-4095)ccT>ccC	p.P1365P	LRRC7_ENST00000415775.2_Silent_p.P649P|LRRC7_ENST00000310961.5_Silent_p.P1323P	NM_020794.2	NP_065845.1	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	1365						cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)		p.P1365P(1)		breast(11)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(3)|lung(81)|ovary(9)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	162						GGGATGTACCTCCGGACACCA	0.398																																																	1	Substitution - coding silent(1)	kidney(1)											85.0	82.0	83.0					1																	70518807		2203	4300	6503	SO:0001819	synonymous_variant	57554				CCDS645.1	1p31.1	2008-02-05			ENSG00000033122	ENSG00000033122			18531	protein-coding gene	gene with protein product		614453				12525888	Standard	NM_020794		Approved	KIAA1365, densin-180	uc001dep.3	Q96NW7	OTTHUMG00000059194	ENST00000035383.5:c.4095T>C	1.37:g.70518807T>C		Somatic		WXS	Illumina HiSeq	Phase_I	Q5VXC2|Q5VXC3|Q68D07|Q86VE8|Q8WX20|Q9P2I2	Silent	SNP	ENST00000035383.5	37	CCDS645.1																																																																																				0.398	LRRC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131261.1		NM_020794	
LYST	1130	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	235969775	235969775	+	Silent	SNP	C	C	T			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr1:235969775C>T	ENST00000389794.3	-	6	2835	c.2661G>A	c.(2659-2661)aaG>aaA	p.K887K	LYST_ENST00000536965.1_Silent_p.K887K|LYST_ENST00000389793.2_Silent_p.K887K			Q99698	LYST_HUMAN	lysosomal trafficking regulator	887					blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)		p.K887K(1)		NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			GGTTAACAGTCTTCCGTCTCT	0.413																																																	1	Substitution - coding silent(1)	kidney(1)											99.0	101.0	101.0					1																	235969775		2203	4300	6503	SO:0001819	synonymous_variant	1130			U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.2661G>A	1.37:g.235969775C>T		Somatic		WXS	Illumina HiSeq	Phase_I	O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Silent	SNP	ENST00000389794.3	37	CCDS31062.1																																																																																				0.413	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097533.5			
MAGEA11	4110	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	148797543	148797543	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chrX:148797543C>A	ENST00000355220.5	+	5	499	c.397C>A	c.(397-399)Ctg>Atg	p.L133M	MAGEA11_ENST00000333104.4_Missense_Mutation_p.L104M	NM_005366.4	NP_005357.2	P43364	MAGAB_HUMAN	melanoma antigen family A, 11	133						cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.L133M(1)|p.G298G(1)		cervix(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(2)|skin(1)	9	Acute lymphoblastic leukemia(192;6.56e-05)|Colorectal(9;0.0662)					AGAAGAAGACCTGGGCCTGGT	0.572																																																	2	Substitution - Missense(1)|Substitution - coding silent(1)	kidney(2)											46.0	47.0	47.0					X																	148797543		2203	4300	6503	SO:0001583	missense	4110				CCDS48180.1	Xq28	2009-03-13			ENSG00000185247	ENSG00000185247			6798	protein-coding gene	gene with protein product	"""MAGE-11 antigen"", ""melanoma-associated antigen 11"", ""cancer/testis antigen family 1, member 11"""	300344		MAGE11		8575766	Standard	NM_001011544		Approved	MAGE-11, MAGEA-11, MGC10511, CT1.11	uc004fdq.3	P43364	OTTHUMG00000022633	ENST00000355220.5:c.397C>A	X.37:g.148797543C>A	ENSP00000347358:p.Leu133Met	Somatic		WXS	Illumina HiSeq	Phase_I	Q5ETU4|Q6ZRZ5	Missense_Mutation	SNP	ENST00000355220.5	37	CCDS48180.1	.	.	.	.	.	.	.	.	.	.	N	7.326	0.617861	0.14129	.	.	ENSG00000185247	ENST00000412632;ENST00000333104;ENST00000355220	T;T;T	0.04502	3.61;3.61;3.61	0.871	-0.251	0.13003	Melanoma associated antigen, MAGE, N-terminal (1);	.	.	.	.	T	0.14270	0.0345	M	0.84683	2.71	0.09310	N	1	P;P	0.42993	0.465;0.797	P;P	0.52343	0.57;0.696	T	0.07635	-1.0762	8	0.62326	D	0.03	.	.	.	.	.	104;133	G5E962;P43364	.;MAGAB_HUMAN	M	104;104;133	ENSP00000391496:L104M;ENSP00000328177:L104M;ENSP00000347358:L133M	ENSP00000328177:L104M	L	+	1	2	MAGEA11	148576862	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.356000	0.20181	-0.147000	0.11254	0.429000	0.28392	CTG		0.572	MAGEA11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058725.4		NM_005366	
MAP3K5	4217	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	136923035	136923035	+	Missense_Mutation	SNP	G	G	C			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr6:136923035G>C	ENST00000359015.4	-	20	3122	c.2762C>G	c.(2761-2763)cCa>cGa	p.P921R	MAP3K5_ENST00000355845.4_Missense_Mutation_p.P168R	NM_005923.3	NP_005914.1	Q99683	M3K5_HUMAN	mitogen-activated protein kinase kinase kinase 5	921	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of JUN kinase activity (GO:0007257)|activation of MAPKK activity (GO:0000186)|apoptotic signaling pathway (GO:0097190)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to reactive nitrogen species (GO:1902170)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|JNK cascade (GO:0007254)|MAPK cascade (GO:0000165)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of neuron death (GO:1901216)|programmed necrotic cell death (GO:0097300)|protein phosphorylation (GO:0006468)|response to ischemia (GO:0002931)|viral process (GO:0016032)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|protein kinase complex (GO:1902911)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein phosphatase binding (GO:0019903)	p.P921R(1)		NS(1)|breast(1)|cervix(1)|endometrium(8)|kidney(6)|large_intestine(6)|lung(24)|ovary(2)|prostate(1)|skin(4)|urinary_tract(4)	58	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00137)|OV - Ovarian serous cystadenocarcinoma(155;0.00569)		GTCAGGATCTGGTTCAAAACA	0.398																																																	1	Substitution - Missense(1)	kidney(1)											123.0	106.0	112.0					6																	136923035		2203	4300	6503	SO:0001583	missense	4217			U67156	CCDS5179.1	6q22.33	2011-06-09			ENSG00000197442	ENSG00000197442		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6857	protein-coding gene	gene with protein product	"""apoptosis signal regulating kinase 1"""	602448		MEKK5		9465908	Standard	NM_005923		Approved	MAPKKK5, ASK1	uc003qhc.3	Q99683	OTTHUMG00000015647	ENST00000359015.4:c.2762C>G	6.37:g.136923035G>C	ENSP00000351908:p.Pro921Arg	Somatic		WXS	Illumina HiSeq	Phase_I	A6NIA0|B4DGB2|Q5THN3|Q99461	Missense_Mutation	SNP	ENST00000359015.4	37	CCDS5179.1	.	.	.	.	.	.	.	.	.	.	G	18.67	3.673567	0.67928	.	.	ENSG00000197442	ENST00000359015;ENST00000355845;ENST00000367768	T;T	0.24151	1.87;1.87	5.35	5.35	0.76521	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.049944	0.85682	N	0.000000	T	0.13841	0.0335	N	0.01576	-0.805	0.80722	D	1	P;D	0.89917	0.824;1.0	P;D	0.97110	0.533;1.0	T	0.38542	-0.9656	10	0.10902	T	0.67	.	19.4125	0.94681	0.0:0.0:1.0:0.0	.	1001;921	Q59GL6;Q99683	.;M3K5_HUMAN	R	921;168;1001	ENSP00000351908:P921R;ENSP00000348104:P168R	ENSP00000348104:P168R	P	-	2	0	MAP3K5	136964728	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.420000	0.97426	2.654000	0.90174	0.557000	0.71058	CCA		0.398	MAP3K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042383.1			
MCOLN1	57192	hgsc.bcm.edu;ucsc.edu	37	19	7589957	7589957	+	Frame_Shift_Del	DEL	T	T	-	rs536694726		TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr19:7589957delT	ENST00000264079.6	+	2	267	c.142delT	c.(142-144)tttfs	p.F49fs		NM_020533.2	NP_065394.1	Q9GZU1	MCLN1_HUMAN	mucolipin 1	49					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular iron ion homeostasis (GO:0006879)|ion transmembrane transport (GO:0034220)|release of sequestered calcium ion into cytosol (GO:0051209)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	cation channel activity (GO:0005261)|NAADP-sensitive calcium-release channel activity (GO:0072345)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						TCTCAAATACTTTTTCATGAG	0.612																																																	0													42.0	42.0	42.0					19																	7589957		2203	4300	6503	SO:0001589	frameshift_variant	57192			AF249319	CCDS12180.1	19p13.2	2011-12-16				ENSG00000090674		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	13356	protein-coding gene	gene with protein product		605248				16382100	Standard	NM_020533		Approved	TRPML1, ML4, MLIV, MST080, MSTP080, TRPM-L1	uc002mgo.3	Q9GZU1		ENST00000264079.6:c.142delT	19.37:g.7589957delT	ENSP00000264079:p.Phe49fs	Somatic		WXS	Illumina HiSeq	Phase_I	D6W647|Q7Z4F7|Q9H292|Q9H4B3|Q9H4B5	Frame_Shift_Del	DEL	ENST00000264079.6	37	CCDS12180.1																																																																																				0.612	MCOLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458974.2		NM_020533	
MECOM	2122	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	168833688	168833688	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr3:168833688C>A	ENST00000464456.1	-	7	2608	c.1408G>T	c.(1408-1410)Gtg>Ttg	p.V470L	MECOM_ENST00000494292.1_Missense_Mutation_p.V658L|MECOM_ENST00000433243.2_Missense_Mutation_p.V471L|MECOM_ENST00000460814.1_Missense_Mutation_p.V470L|MECOM_ENST00000392736.3_Missense_Mutation_p.V470L|MECOM_ENST00000472280.1_Missense_Mutation_p.V471L|MECOM_ENST00000264674.3_Missense_Mutation_p.V535L|MECOM_ENST00000468789.1_Missense_Mutation_p.V470L	NM_001164000.1	NP_001157472.1	Q13465	MDS1_HUMAN	MDS1 and EVI1 complex locus	0					regulation of transcription, DNA-templated (GO:0006355)		sequence-specific DNA binding transcription factor activity (GO:0003700)	p.V470L(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(13)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(12)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	85						GAATCATTCACAGCTCCTGAC	0.398																																																	1	Substitution - Missense(1)	kidney(1)											302.0	271.0	282.0					3																	168833688		2203	4300	6503	SO:0001583	missense	2122			S82592, AF164154	CCDS3205.1, CCDS54669.1, CCDS54670.1	3q26.2	2013-01-08	2009-08-07	2009-08-07	ENSG00000085276	ENSG00000085276		"""Zinc fingers, C2H2-type"""	3498	protein-coding gene	gene with protein product		165215	"""myelodysplasia syndrome 1"", ""ecotropic viral integration site 1"""	MDS1, EVI1		2115646, 8171026, 8643684	Standard	NM_001105077		Approved	MDS1-EVI1, PRDM3	uc011bpj.1	Q03112	OTTHUMG00000158596	ENST00000464456.1:c.1408G>T	3.37:g.168833688C>A	ENSP00000419770:p.Val470Leu	Somatic		WXS	Illumina HiSeq	Phase_I	Q13466|Q6FH90	Missense_Mutation	SNP	ENST00000464456.1	37	CCDS54669.1	.	.	.	.	.	.	.	.	.	.	C	18.21	3.574312	0.65878	.	.	ENSG00000085276	ENST00000264674;ENST00000392736;ENST00000464456;ENST00000472280;ENST00000494292;ENST00000468789;ENST00000460814;ENST00000433243	T;T;T;T;T;T;T;T	0.05717	3.45;3.44;3.4;3.54;3.4;3.44;3.4;3.54	5.83	5.83	0.93111	.	0.000000	0.64402	D	0.000009	T	0.22704	0.0548	L	0.51422	1.61	0.80722	D	1	D;D;D;D;D	0.67145	0.996;0.996;0.994;0.996;0.994	D;D;D;D;D	0.77557	0.99;0.99;0.978;0.99;0.978	T	0.00027	-1.2308	10	0.66056	D	0.02	-13.4055	20.1162	0.97934	0.0:1.0:0.0:0.0	.	658;471;658;535;470	Q03112-3;Q03112-6;E7EQ57;Q03112-4;Q03112	.;.;.;.;EVI1_HUMAN	L	535;470;470;471;658;470;470;471	ENSP00000264674:V535L;ENSP00000376493:V470L;ENSP00000419770:V470L;ENSP00000420048:V471L;ENSP00000417899:V658L;ENSP00000419995:V470L;ENSP00000420466:V470L;ENSP00000394302:V471L	ENSP00000264674:V535L	V	-	1	0	MECOM	170316382	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.071000	0.71229	2.756000	0.94617	0.655000	0.94253	GTG		0.398	MECOM-020	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000351519.1		NM_005241, NM_004991	
MED13L	23389	broad.mit.edu;ucsc.edu	37	12	116429263	116429263	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr12:116429263C>A	ENST00000281928.3	-	17	3702	c.3496G>T	c.(3496-3498)Gcg>Tcg	p.A1166S		NM_015335.4	NP_056150.1	Q71F56	MD13L_HUMAN	mediator complex subunit 13-like	1166						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)	p.A1166S(1)		NS(2)|breast(1)|endometrium(9)|kidney(3)|large_intestine(18)|lung(34)|ovary(4)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	85	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0407)		TTCATAATCGCACTAAACCCA	0.473																																																	1	Substitution - Missense(1)	kidney(1)											79.0	73.0	75.0					12																	116429263		2203	4300	6503	SO:0001583	missense	23389			AB028948	CCDS9177.1	12q24.22	2010-07-29	2007-07-30	2007-07-30	ENSG00000123066	ENSG00000123066			22962	protein-coding gene	gene with protein product		608771	"""thyroid hormone receptor associated protein 2"""	THRAP2			Standard	NM_015335		Approved	KIAA1025, TRAP240L	uc001tvw.3	Q71F56	OTTHUMG00000169404	ENST00000281928.3:c.3496G>T	12.37:g.116429263C>A	ENSP00000281928:p.Ala1166Ser	Somatic		WXS	Illumina GAIIx	Phase_I	A1L469|Q68DN4|Q9H8C0|Q9NSY9|Q9UFD8|Q9UPX5	Missense_Mutation	SNP	ENST00000281928.3	37	CCDS9177.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.098697	0.76870	.	.	ENSG00000123066	ENST00000281928	D	0.85339	-1.97	5.35	5.35	0.76521	.	0.048809	0.85682	D	0.000000	D	0.90923	0.7147	L	0.56340	1.77	0.80722	D	1	D	0.76494	0.999	D	0.76071	0.987	D	0.90950	0.4804	10	0.62326	D	0.03	.	19.2467	0.93905	0.0:1.0:0.0:0.0	.	1166	Q71F56	MD13L_HUMAN	S	1166	ENSP00000281928:A1166S	ENSP00000281928:A1166S	A	-	1	0	MED13L	114913646	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.320000	0.79064	2.784000	0.95788	0.585000	0.79938	GCG		0.473	MED13L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403879.3			
MUC4	4585	hgsc.bcm.edu	37	3	195506271	195506318	+	In_Frame_Del	DEL	ACCTGTGGATAATGAGGAAGCATTGGTGACAGGAAGAGGGGTGGTGTC	ACCTGTGGATAATGAGGAAGCATTGGTGACAGGAAGAGGGGTGGTGTC	-	rs199896027|rs201839412|rs192584273|rs62282465|rs199596856|rs62282466|rs77023345|rs551098007|rs563580319|rs201564403|rs201191776|rs200161977|rs377584277|rs202208985|rs200602926|rs201679145	byFrequency	TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	ACCTGTGGATAATGAGGAAGCATTGGTGACAGGAAGAGGGGTGGTGTC	ACCTGTGGATAATGAGGAAGCATTGGTGACAGGAAGAGGGGTGGTGTC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr3:195506271_195506318delACCTGTGGATAATGAGGAAGCATTGGTGACAGGAAGAGGGGTGGTGTC	ENST00000463781.3	-	2	12592_12639	c.12133_12180delGACACCACCCCTCTTCCTGTCACCAATGCTTCCTCATTATCCACAGGT	c.(12133-12180)gacaccacccctcttcctgtcaccaatgcttcctcattatccacaggtdel	p.DTTPLPVTNASSLSTG4045del	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_In_Frame_Del_p.DTTPLPVTNASSLSTG4045del	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.P4050T(3)|p.T4046A(2)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GGGTGGCGTGACCTGTGGATAATGAGGAAGCATTGGTGACAGGAAGAGGGGTGGTGTCACCTGTGGAT	0.589																																																	5	Substitution - Missense(5)	kidney(3)|haematopoietic_and_lymphoid_tissue(2)							,,	213,2197		69,75,1061					,,		0.0			23	808,3672		295,218,1727	no	intron,coding,intron	MUC4	NM_138297.4,NM_018406.6,NM_004532.5	,,	364,293,2788	A1A1,A1R,RR		18.0357,8.8382,14.8186	,,	,,		1021,5869				SO:0001651	inframe_deletion	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12133_12180delGACACCACCCCTCTTCCTGTCACCAATGCTTCCTCATTATCCACAGGT	3.37:g.195506271_195506318delACCTGTGGATAATGAGGAAGCATTGGTGACAGGAAGAGGGGTGGTGTC	ENSP00000417498:p.Asp4045_Gly4060del	Somatic		WXS	Illumina HiSeq	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	In_Frame_Del	DEL	ENST00000463781.3	37	CCDS54700.1																																																																																				0.589	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6		NM_018406	
NAT8	9027	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	73868603	73868603	+	Silent	SNP	G	G	A			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr2:73868603G>A	ENST00000272425.3	-	2	302	c.153C>T	c.(151-153)ctC>ctT	p.L51L		NM_003960.3|NM_016347.2	NP_003951.3|NP_057431.2			N-acetyltransferase 8 (GCN5-related, putative)									p.L51L(1)		breast(1)|endometrium(2)|kidney(2)|lung(2)|ovary(1)|prostate(1)	9						GGAGTAGGGCGAGGGGCCCCC	0.612																																																	1	Substitution - coding silent(1)	kidney(1)											75.0	89.0	84.0					2																	73868603		2203	4300	6503	SO:0001819	synonymous_variant	9027			AB013094	CCDS1926.1	2p13.2	2012-03-20	2008-09-24		ENSG00000144035	ENSG00000144035			18069	protein-coding gene	gene with protein product		606716	"""N-acetyltransferase 8"""			11397015, 9852678, 19011241	Standard	NM_003960		Approved	Hcml1, TSC501, GLA, ATase2	uc002sji.1	Q9UHE5	OTTHUMG00000129818	ENST00000272425.3:c.153C>T	2.37:g.73868603G>A		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000272425.3	37	CCDS1926.1																																																																																				0.612	NAT8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327854.1		NM_003960	
NLRP13	126204	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	56443398	56443398	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr19:56443398G>T	ENST00000342929.3	-	1	279	c.280C>A	c.(280-282)Ctg>Atg	p.L94M	NLRP13_ENST00000588751.1_Missense_Mutation_p.L94M	NM_176810.2	NP_789780.2	Q86W25	NAL13_HUMAN	NLR family, pyrin domain containing 13	94	DAPIN. {ECO:0000255|PROSITE- ProRule:PRU00061}.						ATP binding (GO:0005524)	p.L94M(1)		NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(58)|ovary(4)|pancreas(2)|prostate(2)|skin(13)|stomach(2)|urinary_tract(1)	109		Colorectal(82;3.48e-05)|Ovarian(87;0.0481)|Renal(1328;0.218)		GBM - Glioblastoma multiforme(193;0.0642)		AGTGAGGTCAGATTCATTGTC	0.512																																																	1	Substitution - Missense(1)	kidney(1)											62.0	56.0	58.0					19																	56443398		2203	4300	6503	SO:0001583	missense	126204			AY154468	CCDS33119.1	19q13.43	2008-02-05	2006-12-08	2006-12-08	ENSG00000173572	ENSG00000173572		"""Nucleotide-binding domain and leucine rich repeat containing"""	22937	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 13"""	609660	"""NACHT, leucine rich repeat and PYD containing 13"""	NALP13		12563287	Standard	NM_176810		Approved	NOD14, PAN13, CLR19.7	uc010ygg.2	Q86W25	OTTHUMG00000167839	ENST00000342929.3:c.280C>A	19.37:g.56443398G>T	ENSP00000343891:p.Leu94Met	Somatic		WXS	Illumina HiSeq	Phase_I	Q7RTR5	Missense_Mutation	SNP	ENST00000342929.3	37	CCDS33119.1	.	.	.	.	.	.	.	.	.	.	G	12.42	1.933167	0.34096	.	.	ENSG00000173572	ENST00000342929	T	0.51817	0.69	1.97	1.97	0.26223	Pyrin (2);DEATH-like (2);	.	.	.	.	T	0.59088	0.2168	L	0.60455	1.87	0.09310	N	1	D	0.65815	0.995	D	0.71184	0.972	T	0.40327	-0.9569	9	0.51188	T	0.08	.	7.4755	0.27374	0.0:0.0:1.0:0.0	.	94	Q86W25	NAL13_HUMAN	M	94	ENSP00000343891:L94M	ENSP00000343891:L94M	L	-	1	2	NLRP13	61135210	0.028000	0.19301	0.018000	0.16275	0.077000	0.17291	1.729000	0.38115	1.422000	0.47177	0.591000	0.81541	CTG		0.512	NLRP13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396560.1		NM_176810	
NRP2	8828	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	206580920	206580920	+	Silent	SNP	T	T	C			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr2:206580920T>C	ENST00000357785.5	+	3	286	c.255T>C	c.(253-255)taT>taC	p.Y85Y	NRP2_ENST00000417189.1_Silent_p.Y85Y|NRP2_ENST00000355117.4_Silent_p.Y85Y|NRP2_ENST00000357118.4_Silent_p.Y85Y|NRP2_ENST00000540178.1_Silent_p.Y85Y|NRP2_ENST00000540841.1_Silent_p.Y85Y|NRP2_ENST00000412873.2_Silent_p.Y85Y|NRP2_ENST00000272849.3_Silent_p.Y85Y|NRP2_ENST00000360409.3_Silent_p.Y85Y			Q99435	NELL2_HUMAN	neuropilin 2	0	Laminin G-like.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)	p.Y85Y(2)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(14)|lung(19)|ovary(1)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	52						CACCCAGGTATGACTTTATCG	0.532																																																	2	Substitution - coding silent(2)	kidney(2)											155.0	146.0	149.0					2																	206580920		2203	4300	6503	SO:0001819	synonymous_variant	8828			AF016098	CCDS2364.1, CCDS2365.1, CCDS46496.1, CCDS46497.1, CCDS46498.1, CCDS46499.1	2q33.3	2008-05-23			ENSG00000118257	ENSG00000118257			8005	protein-coding gene	gene with protein product		602070				9529250, 9331348	Standard	NM_003872		Approved	VEGF165R2	uc002vaw.3	O60462	OTTHUMG00000132893	ENST00000357785.5:c.255T>C	2.37:g.206580920T>C		Somatic		WXS	Illumina HiSeq	Phase_I	B7Z2U7|B7Z5Q4|B7Z9J5|B7Z9U3|Q96JS2	Silent	SNP	ENST00000357785.5	37	CCDS46496.1																																																																																				0.532	NRP2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000336467.1			
OGDH	4967	broad.mit.edu;ucsc.edu	37	7	44664056	44664056	+	Silent	SNP	G	G	T			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr7:44664056G>T	ENST00000222673.5	+	2	156	c.114G>T	c.(112-114)cgG>cgT	p.R38R	OGDH_ENST00000543843.1_5'Flank|OGDH_ENST00000444676.1_Silent_p.R38R|OGDH_ENST00000443864.2_Silent_p.R38R|OGDH_ENST00000439616.2_Silent_p.R38R|OGDH_ENST00000447398.1_Silent_p.R38R|OGDH_ENST00000449767.1_Silent_p.R38R	NM_002541.3	NP_002532.2	Q02218	ODO1_HUMAN	oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide)	38					2-oxoglutarate metabolic process (GO:0006103)|cellular metabolic process (GO:0044237)|cellular nitrogen compound metabolic process (GO:0034641)|cerebellar cortex development (GO:0021695)|generation of precursor metabolites and energy (GO:0006091)|glycolytic process (GO:0006096)|hippocampus development (GO:0021766)|lysine catabolic process (GO:0006554)|NADH metabolic process (GO:0006734)|olfactory bulb mitral cell layer development (GO:0061034)|pyramidal neuron development (GO:0021860)|small molecule metabolic process (GO:0044281)|striatum development (GO:0021756)|succinyl-CoA metabolic process (GO:0006104)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)|thalamus development (GO:0021794)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrion (GO:0005739)|oxoglutarate dehydrogenase complex (GO:0045252)	metal ion binding (GO:0046872)|oxoglutarate dehydrogenase (NAD+) activity (GO:0034602)|oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)	p.R38R(2)		breast(2)|endometrium(5)|kidney(2)|large_intestine(6)|lung(13)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	36					Valproic Acid(DB00313)	AACAGATTCGGTGCTATTCTG	0.488																																																	2	Substitution - coding silent(2)	kidney(2)											215.0	192.0	200.0					7																	44664056		2203	4300	6503	SO:0001819	synonymous_variant	4967			D10523	CCDS34627.1, CCDS47580.1, CCDS55107.1	7p13-p11.2	2010-11-23			ENSG00000105953	ENSG00000105953	1.2.4.2		8124	protein-coding gene	gene with protein product		613022				8020988, 1542694	Standard	NM_002541		Approved	E1k	uc003tln.3	Q02218	OTTHUMG00000155304	ENST00000222673.5:c.114G>T	7.37:g.44664056G>T		Somatic		WXS	Illumina GAIIx	Phase_I	B4E2U9|D3DVL0|E9PBM1|Q96DD3|Q9UDX0	Silent	SNP	ENST00000222673.5	37	CCDS34627.1																																																																																				0.488	OGDH-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000339391.1			
OR4C3	256144	broad.mit.edu;hgsc.bcm.edu	37	11	48346714	48346714	+	Missense_Mutation	SNP	C	C	G			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr11:48346714C>G	ENST00000319856.4	+	1	243	c.222C>G	c.(220-222)atC>atG	p.I74M		NM_001004702.1	NP_001004702.1	Q8NH37	OR4C3_HUMAN	olfactory receptor, family 4, subfamily C, member 3	47						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.I74M(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(18)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	32						TGGTCACTATCACCTCCAGCC	0.463																																																	1	Substitution - Missense(1)	kidney(1)											156.0	130.0	139.0					11																	48346714		2201	4298	6499	SO:0001583	missense	256144			AB065567	CCDS31489.1	11p11.2	2012-08-09				ENSG00000176547		"""GPCR / Class A : Olfactory receptors"""	14697	protein-coding gene	gene with protein product							Standard	NM_001004702		Approved		uc010rhv.2	Q8NH37	OTTHUMG00000166579	ENST00000319856.4:c.222C>G	11.37:g.48346714C>G	ENSP00000321419:p.Ile74Met	Somatic		WXS	Illumina HiSeq	Phase_I	B2RNF2|Q6IFB3	Missense_Mutation	SNP	ENST00000319856.4	37	CCDS31489.1	.	.	.	.	.	.	.	.	.	.	C	16.39	3.110730	0.56398	.	.	ENSG00000176547	ENST00000319856	T	0.08458	3.09	5.88	-6.81	0.01704	GPCR, rhodopsin-like superfamily (1);	0.845488	0.10052	N	0.722117	T	0.17066	0.0410	H	0.95294	3.65	0.09310	N	1	P	0.39903	0.694	B	0.38985	0.287	T	0.10177	-1.0641	10	0.72032	D	0.01	.	9.7845	0.40668	0.0975:0.3029:0.0:0.5996	.	47	Q8NH37	OR4C3_HUMAN	M	74	ENSP00000321419:I74M	ENSP00000321419:I74M	I	+	3	3	OR4C3	48303290	0.000000	0.05858	0.000000	0.03702	0.886000	0.51366	-1.911000	0.01583	-0.903000	0.03881	0.549000	0.68633	ATC		0.463	OR4C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390557.1		NM_001004702	
OR8J3	81168	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	55904652	55904652	+	Missense_Mutation	SNP	A	A	C			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr11:55904652A>C	ENST00000301529.1	-	1	542	c.543T>G	c.(541-543)atT>atG	p.I181M		NM_001004064.1	NP_001004064.1	Q8NGG0	OR8J3_HUMAN	olfactory receptor, family 8, subfamily J, member 3	181						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.I181M(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(1)|lung(38)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	59	Esophageal squamous(21;0.00693)					ACAGAGGTGCAATATCACAGT	0.333																																																	1	Substitution - Missense(1)	kidney(1)											103.0	102.0	103.0					11																	55904652		2201	4296	6497	SO:0001583	missense	81168				CCDS31520.1	11q12.2	2012-08-09			ENSG00000167822	ENSG00000167822		"""GPCR / Class A : Olfactory receptors"""	15312	protein-coding gene	gene with protein product							Standard	NM_001004064		Approved		uc010riz.2	Q8NGG0	OTTHUMG00000166834	ENST00000301529.1:c.543T>G	11.37:g.55904652A>C	ENSP00000301529:p.Ile181Met	Somatic		WXS	Illumina HiSeq	Phase_I	Q6IFB6|Q96RC2	Missense_Mutation	SNP	ENST00000301529.1	37	CCDS31520.1	.	.	.	.	.	.	.	.	.	.	A	11.29	1.594015	0.28445	.	.	ENSG00000167822	ENST00000301529	T	0.38887	1.11	3.26	-0.823	0.10815	GPCR, rhodopsin-like superfamily (1);	0.717508	0.13352	N	0.394321	T	0.33933	0.0880	N	0.26042	0.785	0.09310	N	1	B	0.29909	0.261	P	0.46419	0.516	T	0.45101	-0.9284	10	0.39692	T	0.17	.	1.2263	0.01934	0.2353:0.1887:0.3911:0.1848	.	181	Q8NGG0	OR8J3_HUMAN	M	181	ENSP00000301529:I181M	ENSP00000301529:I181M	I	-	3	3	OR8J3	55661228	0.000000	0.05858	0.005000	0.12908	0.783000	0.44284	-0.271000	0.08572	0.292000	0.22492	0.240000	0.17902	ATT		0.333	OR8J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391542.1		NM_001004064	
OR10S1	219873	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	123847986	123847986	+	Missense_Mutation	SNP	A	A	T			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr11:123847986A>T	ENST00000531945.1	-	1	502	c.413T>A	c.(412-414)cTg>cAg	p.L138Q		NM_001004474.1	NP_001004474.1	Q8NGN2	O10S1_HUMAN	olfactory receptor, family 10, subfamily S, member 1	138						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L138Q(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(16)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	36		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		ACAGATAGCCAGATAGCGGTC	0.542																																																	1	Substitution - Missense(1)	kidney(1)											100.0	84.0	89.0					11																	123847986		2202	4299	6501	SO:0001583	missense	219873			BK004509	CCDS31701.1	11q24.1	2012-08-09			ENSG00000196248	ENSG00000196248		"""GPCR / Class A : Olfactory receptors"""	14807	protein-coding gene	gene with protein product							Standard	NM_001004474		Approved		uc001pzm.1	Q8NGN2	OTTHUMG00000165963	ENST00000531945.1:c.413T>A	11.37:g.123847986A>T	ENSP00000431914:p.Leu138Gln	Somatic		WXS	Illumina HiSeq	Phase_I	B9EH43|Q6IEV3|Q96R78	Missense_Mutation	SNP	ENST00000531945.1	37	CCDS31701.1	.	.	.	.	.	.	.	.	.	.	A	20.9	4.064408	0.76187	.	.	ENSG00000196248	ENST00000531945	T	0.00397	7.57	4.74	4.74	0.60224	GPCR, rhodopsin-like superfamily (1);	0.000000	0.32753	U	0.005681	T	0.01029	0.0034	M	0.83312	2.635	0.37434	D	0.91414	D	0.89917	1.0	D	0.71184	0.972	T	0.64571	-0.6376	10	0.87932	D	0	-3.8351	14.1974	0.65679	1.0:0.0:0.0:0.0	.	138	Q8NGN2	O10S1_HUMAN	Q	138	ENSP00000431914:L138Q	ENSP00000431914:L138Q	L	-	2	0	OR10S1	123353196	0.319000	0.24607	1.000000	0.80357	0.905000	0.53344	4.806000	0.62569	2.019000	0.59389	0.467000	0.42956	CTG		0.542	OR10S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387265.2		NM_001004474	
PAGE3	139793	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	55286975	55286975	+	Missense_Mutation	SNP	G	G	C			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chrX:55286975G>C	ENST00000374951.1	-	4	619	c.311C>G	c.(310-312)cCa>cGa	p.P104R	PAGE3_ENST00000519203.1_Missense_Mutation_p.P104R			Q5JUK9	PAGE3_HUMAN	P antigen family, member 3 (prostate associated)	104								p.P104R(1)		endometrium(1)|kidney(1)|lung(1)	3						ACCTGCTTCTGGTATTTTAAC	0.368																																																	1	Substitution - Missense(1)	kidney(1)											51.0	45.0	47.0					X																	55286975		2203	4299	6502	SO:0001583	missense	139793					Xp11	2009-06-17	2005-01-26	2005-01-27	ENSG00000204279	ENSG00000204279			4110	protein-coding gene	gene with protein product		300739	"""G antigen, family D, 1"""	GAGED1		9724777	Standard	NR_033460		Approved	PAGE-3, CT16.6	uc022bxs.2	Q5JUK9	OTTHUMG00000021654	ENST00000374951.1:c.311C>G	X.37:g.55286975G>C	ENSP00000364089:p.Pro104Arg	Somatic		WXS	Illumina HiSeq	Phase_I	A5D6Y1	RNA	SNP	ENST00000374951.1	37		.	.	.	.	.	.	.	.	.	.	.	11.28	1.592622	0.28357	.	.	ENSG00000204279	ENST00000374951;ENST00000519203	T;T	0.15372	2.43;2.43	1.01	1.01	0.19927	.	.	.	.	.	T	0.31979	0.0814	.	.	.	0.09310	N	1	D	0.76494	0.999	D	0.76575	0.988	T	0.06499	-1.0823	8	0.54805	T	0.06	.	5.0813	0.14659	0.0:0.0:1.0:0.0	.	104	Q5JUK9	GGED1_HUMAN	R	104	ENSP00000364089:P104R;ENSP00000429571:P104R	ENSP00000364089:P104R	P	-	2	0	PAGE3	55303700	0.436000	0.25586	0.169000	0.22859	0.481000	0.33189	1.364000	0.34171	0.796000	0.33947	0.284000	0.19432	CCA		0.368	PAGE3-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000056867.2		XM_060054	
PCDHB3	56132	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	140481311	140481311	+	Missense_Mutation	SNP	T	T	G			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr5:140481311T>G	ENST00000231130.2	+	1	1078	c.1078T>G	c.(1078-1080)Tcg>Gcg	p.S360A	AC005754.7_ENST00000607216.1_RNA	NM_018937.2	NP_061760.1	Q9Y5E6	PCDB3_HUMAN	protocadherin beta 3	360	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.S360A(1)		NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	72			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TCCTGAGAACTCGGGAGAGAC	0.478																																																	1	Substitution - Missense(1)	kidney(1)											88.0	84.0	85.0					5																	140481311		2203	4300	6503	SO:0001583	missense	56132			AF152496	CCDS4245.1	5q31	2010-01-26			ENSG00000113205	ENSG00000113205		"""Cadherins / Protocadherins : Clustered"""	8688	other	protocadherin		606329				10380929	Standard	NM_018937		Approved	PCDH-BETA3	uc003lio.3	Q9Y5E6	OTTHUMG00000129622	ENST00000231130.2:c.1078T>G	5.37:g.140481311T>G	ENSP00000231130:p.Ser360Ala	Somatic		WXS	Illumina HiSeq	Phase_I	B2R8P2	Missense_Mutation	SNP	ENST00000231130.2	37	CCDS4245.1	.	.	.	.	.	.	.	.	.	.	T	4.376	0.069355	0.08436	.	.	ENSG00000113205	ENST00000231130	T	0.46819	0.86	4.93	4.93	0.64822	Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.26919	0.0659	N	0.11870	0.19	0.22213	N	0.999285	B	0.12013	0.005	B	0.15870	0.014	T	0.15838	-1.0423	9	0.16420	T	0.52	.	7.8183	0.29274	0.0:0.1275:0.0:0.8725	.	360	Q9Y5E6	PCDB3_HUMAN	A	360	ENSP00000231130:S360A	ENSP00000231130:S360A	S	+	1	0	PCDHB3	140461495	0.000000	0.05858	0.975000	0.42487	0.686000	0.39977	-0.512000	0.06313	1.975000	0.57531	0.533000	0.62120	TCG		0.478	PCDHB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251817.2		NM_018937	
PCNT	5116	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	21	47850087	47850087	+	Silent	SNP	G	G	A			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr21:47850087G>A	ENST00000359568.5	+	36	7961	c.7854G>A	c.(7852-7854)caG>caA	p.Q2618Q	PCNT_ENST00000480896.1_3'UTR	NM_006031.5	NP_006022.3	O95613	PCNT_HUMAN	pericentrin	2618					brain morphogenesis (GO:0048854)|cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of intracellular protein transport (GO:0090316)|spindle organization (GO:0007051)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|microtubule (GO:0005874)|motile cilium (GO:0031514)|pericentriolar material (GO:0000242)		p.Q2618Q(1)		NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(15)|liver(2)|lung(41)|ovary(5)|pancreas(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	104	Breast(49;0.112)					AGAGCAGGCAGAAGAGCGAAC	0.617																																																	1	Substitution - coding silent(1)	kidney(1)											83.0	80.0	81.0					21																	47850087		2203	4300	6503	SO:0001819	synonymous_variant	5116			AB007862	CCDS33592.1	21q22.3	2014-02-20	2008-01-30	2005-11-03	ENSG00000160299	ENSG00000160299			16068	protein-coding gene	gene with protein product	"""kendrin"", ""Seckel syndrome 4"""	605925	"""pericentrin 2 (kendrin)"""	PCNT2		8812505, 9455477	Standard	NM_006031		Approved	KEN, KIAA0402, PCN, PCNTB, SCKL4	uc002zji.4	O95613	OTTHUMG00000090665	ENST00000359568.5:c.7854G>A	21.37:g.47850087G>A		Somatic		WXS	Illumina HiSeq	Phase_I	O43152|Q7Z7C9	Silent	SNP	ENST00000359568.5	37	CCDS33592.1																																																																																				0.617	PCNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207336.1		NM_006031	
PDHB	5162	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	58416621	58416621	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr3:58416621G>A	ENST00000302746.6	-	6	394	c.352C>T	c.(352-354)Caa>Taa	p.Q118*	PDHB_ENST00000474765.1_Nonsense_Mutation_p.Q100*|RP11-802O23.3_ENST00000607214.1_RNA|PDHB_ENST00000485460.1_Nonsense_Mutation_p.Q118*	NM_000925.3|NM_001173468.1	NP_000916.2|NP_001166939.1	P11177	ODPB_HUMAN	pyruvate dehydrogenase (lipoamide) beta	118					acetyl-CoA biosynthetic process from pyruvate (GO:0006086)|cellular metabolic process (GO:0044237)|glucose metabolic process (GO:0006006)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)|pyruvate dehydrogenase complex (GO:0045254)	pyruvate dehydrogenase (acetyl-transferring) activity (GO:0004739)|pyruvate dehydrogenase activity (GO:0004738)	p.Q118*(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(1)|ovary(1)	9				BRCA - Breast invasive adenocarcinoma(55;0.000179)|Kidney(10;0.00231)|KIRC - Kidney renal clear cell carcinoma(10;0.00258)|OV - Ovarian serous cystadenocarcinoma(275;0.187)	Pyruvic acid(DB00119)	TCAATGGCTTGCATGGAGAAA	0.458																																																	1	Substitution - Nonsense(1)	kidney(1)											86.0	92.0	90.0					3																	58416621		2203	4300	6503	SO:0001587	stop_gained	5162				CCDS2890.1, CCDS54602.1	3p21.1-p14.2	1995-12-20			ENSG00000168291	ENSG00000168291	1.2.4.1		8808	protein-coding gene	gene with protein product		179060					Standard	NR_033384		Approved		uc003dkf.4	P11177	OTTHUMG00000159157	ENST00000302746.6:c.352C>T	3.37:g.58416621G>A	ENSP00000307241:p.Gln118*	Somatic		WXS	Illumina HiSeq	Phase_I	B2R7L0|B4DDD7|Q6FH45|Q9BQ27|Q9UFK3	Nonsense_Mutation	SNP	ENST00000302746.6	37	CCDS2890.1	.	.	.	.	.	.	.	.	.	.	G	32	5.112871	0.94339	.	.	ENSG00000168291	ENST00000302746;ENST00000383714;ENST00000485460;ENST00000474765	.	.	.	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-6.2485	19.8946	0.96949	0.0:0.0:1.0:0.0	.	.	.	.	X	118;100;118;100	.	ENSP00000307241:Q118X	Q	-	1	0	PDHB	58391661	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.222000	0.95196	2.937000	0.99478	0.650000	0.86243	CAA		0.458	PDHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353558.1			
PHF20	51230	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	20	34459576	34459576	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr20:34459576G>T	ENST00000374012.3	+	9	1236	c.1107G>T	c.(1105-1107)caG>caT	p.Q369H	PHF20_ENST00000481202.1_3'UTR|PHF20_ENST00000439301.1_3'UTR			Q9BVI0	PHF20_HUMAN	PHD finger protein 20	369					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|MLL1 complex (GO:0071339)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.Q369H(1)		breast(5)|endometrium(1)|kidney(7)|large_intestine(6)|lung(11)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39	Breast(12;0.00631)|all_lung(11;0.0145)					TTCTAGGTCAGTTGAAGTCTG	0.453																																																	1	Substitution - Missense(1)	kidney(1)											80.0	83.0	82.0					20																	34459576		2203	4300	6503	SO:0001583	missense	51230			AL109965	CCDS13268.1	20q11.22-q11.23	2013-01-28	2004-12-01	2004-12-01	ENSG00000025293	ENSG00000025293		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	16098	protein-coding gene	gene with protein product	"""tudor domain containing 20A"""	610335	"""chromosome 20 open reading frame 104"""	C20orf104			Standard	NM_016436		Approved	dJ1121G12.1, TDRD20A	uc002xek.1	Q9BVI0	OTTHUMG00000032367	ENST00000374012.3:c.1107G>T	20.37:g.34459576G>T	ENSP00000363124:p.Gln369His	Somatic		WXS	Illumina HiSeq	Phase_I	A7E235|B2RB56|E1P5S3|Q566Q2|Q5JWY9|Q66K49|Q9BWV4|Q9BXA3|Q9BZW3|Q9H421|Q9H4J6|Q9NZ22	Missense_Mutation	SNP	ENST00000374012.3	37	CCDS13268.1	.	.	.	.	.	.	.	.	.	.	G	12.59	1.984809	0.35036	.	.	ENSG00000025293	ENST00000374012;ENST00000339089;ENST00000374000	T;T;T	0.50001	1.38;0.76;0.76	5.61	0.0789	0.14413	.	0.594765	0.19499	N	0.112799	T	0.47377	0.1442	L	0.47716	1.5	0.80722	D	1	D;D	0.62365	0.978;0.991	P;P	0.57548	0.641;0.823	T	0.41858	-0.9485	10	0.52906	T	0.07	.	3.7668	0.08626	0.2406:0.0:0.4709:0.2885	.	369;369	Q9BVI0;Q66K49	PHF20_HUMAN;.	H	369	ENSP00000363124:Q369H;ENSP00000341900:Q369H;ENSP00000363112:Q369H	ENSP00000341900:Q369H	Q	+	3	2	PHF20	33922990	0.995000	0.38212	0.934000	0.37439	0.082000	0.17680	-0.008000	0.12788	-0.188000	0.10499	-0.998000	0.02512	CAG		0.453	PHF20-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078949.2		NM_016436	
RAB1A	5861	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	65316108	65316108	+	Missense_Mutation	SNP	T	T	C			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr2:65316108T>C	ENST00000409784.3	-	5	575	c.385A>G	c.(385-387)Acc>Gcc	p.T129A	RAB1A_ENST00000409751.1_Missense_Mutation_p.T97A|RAB1A_ENST00000409892.1_Missense_Mutation_p.T65A|RAB1A_ENST00000398529.3_Intron|RAB1A_ENST00000494188.1_Intron|RAB1A_ENST00000356214.7_Missense_Mutation_p.T97A|RAB1A_ENST00000260638.8_Intron	NM_004161.4	NP_004152.1	P62820	RAB1A_HUMAN	RAB1A, member RAS oncogene family	129					autophagic vacuole assembly (GO:0000045)|autophagy (GO:0006914)|cargo loading into COPII-coated vesicle (GO:0090110)|cell migration (GO:0016477)|defense response to bacterium (GO:0042742)|endocytosis (GO:0006897)|ER to Golgi vesicle-mediated transport (GO:0006888)|Golgi organization (GO:0007030)|growth hormone secretion (GO:0030252)|GTP catabolic process (GO:0006184)|interleukin-8 secretion (GO:0072606)|melanosome transport (GO:0032402)|mitotic cell cycle (GO:0000278)|positive regulation of glycoprotein metabolic process (GO:1903020)|small GTPase mediated signal transduction (GO:0007264)|substrate adhesion-dependent cell spreading (GO:0034446)|vesicle transport along microtubule (GO:0047496)|vesicle-mediated transport (GO:0016192)|virion assembly (GO:0019068)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|melanosome (GO:0042470)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.T129A(1)		endometrium(1)|kidney(1)|lung(3)|prostate(1)	6						TTCTTTGTGGTCAGATCACAT	0.358																																																	1	Substitution - Missense(1)	kidney(1)											86.0	75.0	78.0					2																	65316108		1877	4105	5982	SO:0001583	missense	5861			M28209	CCDS46305.1, CCDS46306.1	2p14	2008-02-05		2002-03-17	ENSG00000138069	ENSG00000138069		"""RAB, member RAS oncogene"""	9758	protein-coding gene	gene with protein product	"""Rab GTPase YPT1 homolog (yeast)"""	179508		RAB1		2501306	Standard	NM_004161		Approved	YPT1	uc002sdm.3	P62820	OTTHUMG00000152725	ENST00000409784.3:c.385A>G	2.37:g.65316108T>C	ENSP00000387286:p.Thr129Ala	Somatic		WXS	Illumina HiSeq	Phase_I	P11476|Q6FIE7|Q96N61|Q9Y3T2	Missense_Mutation	SNP	ENST00000409784.3	37	CCDS46306.1	.	.	.	.	.	.	.	.	.	.	T	17.63	3.436263	0.62955	.	.	ENSG00000138069	ENST00000409784;ENST00000409892;ENST00000409751;ENST00000356214	T;T;T;T	0.75938	-0.98;-0.98;-0.98;-0.98	5.6	5.6	0.85130	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	T	0.58538	0.2129	N	0.12502	0.225	0.80722	D	1	B;B;B	0.11235	0.0;0.004;0.0	B;B;B	0.12837	0.002;0.008;0.0	T	0.54098	-0.8344	10	0.23891	T	0.37	.	15.7904	0.78357	0.0:0.0:0.0:1.0	.	97;65;129	B7Z8M7;P62820-2;P62820	.;.;RAB1A_HUMAN	A	129;65;97;97	ENSP00000387286:T129A;ENSP00000386451:T65A;ENSP00000386672:T97A;ENSP00000348546:T97A	ENSP00000348546:T97A	T	-	1	0	RAB1A	65169612	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.036000	0.88901	2.110000	0.64415	0.455000	0.32223	ACC		0.358	RAB1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327572.1		NM_004161	
RAB11FIP5	26056	broad.mit.edu	37	2	73315745	73315745	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr2:73315745G>A	ENST00000258098.6	-	3	1241	c.1001C>T	c.(1000-1002)tCt>tTt	p.S334F	RAB11FIP5_ENST00000493523.2_5'UTR	NM_015470.2	NP_056285.1	Q9BXF6	RFIP5_HUMAN	RAB11 family interacting protein 5 (class I)	334					cellular response to acidic pH (GO:0071468)|insulin secretion involved in cellular response to glucose stimulus (GO:0035773)|protein transport (GO:0015031)|regulated secretory pathway (GO:0045055)|regulation of protein localization to cell surface (GO:2000008)	early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|microtubule organizing center (GO:0005815)|mitochondrial outer membrane (GO:0005741)|recycling endosome (GO:0055037)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)	p.S334F(1)		biliary_tract(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(9)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	23						ACAGAGCGAAGAGCGGGAGGC	0.627																																																	1	Substitution - Missense(1)	kidney(1)											20.0	23.0	22.0					2																	73315745		2203	4298	6501	SO:0001583	missense	26056			AF334812	CCDS1923.1	2p13	2008-02-05			ENSG00000135631	ENSG00000135631			24845	protein-coding gene	gene with protein product		605536				10048485, 11163216	Standard	NM_015470		Approved	GAF1, KIAA0857, RIP11, pp75	uc002sis.4	Q9BXF6	OTTHUMG00000129779	ENST00000258098.6:c.1001C>T	2.37:g.73315745G>A	ENSP00000258098:p.Ser334Phe	Somatic		WXS	Illumina GAIIx	Phase_I	O94939|Q9P0M1	Missense_Mutation	SNP	ENST00000258098.6	37	CCDS1923.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.991695	0.74703	.	.	ENSG00000135631	ENST00000258098	T	0.66638	-0.22	4.19	4.19	0.49359	.	0.341233	0.28187	N	0.016263	T	0.80523	0.4639	M	0.72118	2.19	0.58432	D	0.999999	D;D	0.89917	0.998;1.0	D;D	0.87578	0.995;0.998	T	0.83344	-0.0006	10	0.87932	D	0	-12.8058	15.6183	0.76784	0.0:0.0:1.0:0.0	.	334;334	Q9BXF6;Q2Z1P3	RFIP5_HUMAN;.	F	334	ENSP00000258098:S334F	ENSP00000258098:S334F	S	-	2	0	RAB11FIP5	73169253	1.000000	0.71417	0.948000	0.38648	0.939000	0.58152	6.198000	0.72106	2.335000	0.79485	0.462000	0.41574	TCT		0.627	RAB11FIP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251995.1		NM_015470	
RARB	5915	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	25636158	25636158	+	Missense_Mutation	SNP	T	T	C			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr3:25636158T>C	ENST00000404969.1	+	7	1160	c.1160T>C	c.(1159-1161)aTc>aCc	p.I387T	RARB_ENST00000437042.2_Missense_Mutation_p.I268T|RARB_ENST00000330688.4_Missense_Mutation_p.I380T|RARB_ENST00000458646.1_Missense_Mutation_p.I268T|RARB_ENST00000462272.1_3'UTR			P10826	RARB_HUMAN	retinoic acid receptor, beta	387	Ligand-binding.				embryonic digestive tract development (GO:0048566)|embryonic eye morphogenesis (GO:0048048)|embryonic hindlimb morphogenesis (GO:0035116)|gene expression (GO:0010467)|glandular epithelial cell development (GO:0002068)|growth plate cartilage development (GO:0003417)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of myelination (GO:0031641)|retinal pigment epithelium development (GO:0003406)|signal transduction (GO:0007165)|striatum development (GO:0021756)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ureteric bud development (GO:0001657)|ventricular cardiac muscle cell differentiation (GO:0055012)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|drug binding (GO:0008144)|retinoic acid receptor activity (GO:0003708)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)	p.I387T(1)|p.I380T(1)		breast(3)|kidney(1)|large_intestine(10)|lung(11)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	28					Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Tamibarotene(DB04942)|Tazarotene(DB00799)	CTCCGTAGCATCAGTGCTAAA	0.413																																																	2	Substitution - Missense(2)	kidney(2)											118.0	111.0	114.0					3																	25636158		2203	4300	6503	SO:0001583	missense	5915			Y00291	CCDS2642.1, CCDS46775.1	3p24	2013-01-16			ENSG00000077092	ENSG00000077092		"""Nuclear hormone receptors"""	9865	protein-coding gene	gene with protein product		180220					Standard	NM_016152		Approved	HAP, NR1B2, RRB2	uc003cdh.3	P10826	OTTHUMG00000130480	ENST00000404969.1:c.1160T>C	3.37:g.25636158T>C	ENSP00000385865:p.Ile387Thr	Somatic		WXS	Illumina HiSeq	Phase_I	P12891|Q00989|Q15298|Q9UN48	Missense_Mutation	SNP	ENST00000404969.1	37		.	.	.	.	.	.	.	.	.	.	T	23.4	4.409932	0.83340	.	.	ENSG00000077092	ENST00000383772;ENST00000404969;ENST00000538226;ENST00000437042;ENST00000330688;ENST00000458646	T;T;T;T;T	0.41065	1.01;1.01;1.01;1.01;1.01	5.4	5.4	0.78164	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.000000	0.85682	D	0.000000	T	0.60843	0.2300	L	0.60957	1.885	0.58432	D	0.999999	D;D	0.71674	0.998;0.998	D;D	0.85130	0.995;0.997	T	0.64002	-0.6509	10	0.87932	D	0	.	14.3014	0.66355	0.0:0.0:0.0:1.0	.	387;380	P10826;F1D8S6	RARB_HUMAN;.	T	387;387;387;268;380;268	ENSP00000373282:I387T;ENSP00000385865:I387T;ENSP00000398840:I268T;ENSP00000332296:I380T;ENSP00000391391:I268T	ENSP00000332296:I380T	I	+	2	0	RARB	25611162	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.977000	0.88081	2.186000	0.69663	0.533000	0.62120	ATC		0.413	RARB-201	KNOWN	basic	protein_coding	protein_coding			NM_000965, NM_016152	
RNF121	55298	broad.mit.edu;ucsc.edu	37	11	71707272	71707272	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr11:71707272C>A	ENST00000361756.3	+	9	1256	c.895C>A	c.(895-897)Ctg>Atg	p.L299M	IL18BP_ENST00000497194.2_5'Flank|IL18BP_ENST00000531053.1_5'Flank|IL18BP_ENST00000404792.1_5'Flank|IL18BP_ENST00000393703.4_5'Flank|RNF121_ENST00000533380.1_Missense_Mutation_p.L139M|IL18BP_ENST00000337131.5_5'Flank|IL18BP_ENST00000393705.4_5'Flank|RNF121_ENST00000545854.1_Missense_Mutation_p.L218M|RNF121_ENST00000530137.1_Missense_Mutation_p.L267M|RNF121_ENST00000393713.3_3'UTR	NM_018320.4	NP_060790.2	Q9H920	RN121_HUMAN	ring finger protein 121	299						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)	p.L299M(1)		endometrium(3)|kidney(2)|large_intestine(1)|lung(6)|urinary_tract(1)	13						GTATGGGCAACTGCTGGACTG	0.527																																																	1	Substitution - Missense(1)	kidney(1)											151.0	117.0	129.0					11																	71707272		2200	4293	6493	SO:0001583	missense	55298			AK001961	CCDS8203.1, CCDS73343.1	11q13.3	2008-02-05			ENSG00000137522	ENSG00000137522		"""RING-type (C3HC4) zinc fingers"""	21070	protein-coding gene	gene with protein product							Standard	NM_018320		Approved	FLJ11099	uc001ora.3	Q9H920	OTTHUMG00000157023	ENST00000361756.3:c.895C>A	11.37:g.71707272C>A	ENSP00000354571:p.Leu299Met	Somatic		WXS	Illumina GAIIx	Phase_I	B3KSW8|Q6IA57|Q6P449|Q96DB4	Missense_Mutation	SNP	ENST00000361756.3	37	CCDS8203.1	.	.	.	.	.	.	.	.	.	.	C	34	5.375127	0.95923	.	.	ENSG00000137522	ENST00000361756;ENST00000533380;ENST00000545854;ENST00000530137	T;T;T;T	0.24538	1.85;1.85;1.85;1.85	6.04	6.04	0.98038	.	0.000000	0.85682	D	0.000000	T	0.50497	0.1619	M	0.76838	2.35	0.80722	D	1	P;D	0.64830	0.798;0.994	P;P	0.58780	0.539;0.845	T	0.43015	-0.9417	10	0.48119	T	0.1	-4.4704	19.3663	0.94464	0.0:1.0:0.0:0.0	.	267;299	G3V148;Q9H920	.;RN121_HUMAN	M	299;139;218;267	ENSP00000354571:L299M;ENSP00000433574:L139M;ENSP00000443799:L218M;ENSP00000431286:L267M	ENSP00000354571:L299M	L	+	1	2	RNF121	71384920	1.000000	0.71417	0.995000	0.50966	0.987000	0.75469	7.196000	0.77805	2.873000	0.98535	0.563000	0.77884	CTG		0.527	RNF121-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347132.1		NM_018320	
RNF128	79589	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	105970595	105970595	+	Frame_Shift_Del	DEL	C	C	-			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chrX:105970595delC	ENST00000255499.2	+	1	702	c.452delC	c.(451-453)accfs	p.T151fs	RNF128_ENST00000324342.3_Intron	NM_194463.1	NP_919445.1	Q8TEB7	RN128_HUMAN	ring finger protein 128, E3 ubiquitin protein ligase	151	PA.				negative regulation of cytokine biosynthetic process (GO:0042036)	cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(6)|ovary(1)	11						TTCCCCGGGACCCGCAATGAG	0.577																																																	0													51.0	49.0	49.0					X																	105970595		2203	4300	6503	SO:0001589	frameshift_variant	79589			AK027169	CCDS14520.1, CCDS14521.1	Xq22.3	2013-01-09	2012-02-23		ENSG00000133135	ENSG00000133135		"""RING-type (C3HC4) zinc fingers"""	21153	protein-coding gene	gene with protein product		300439	"""ring finger protein 128"""				Standard	NM_024539		Approved	FLJ23516, GRAIL	uc004eml.3	Q8TEB7	OTTHUMG00000022151	ENST00000255499.2:c.452delC	X.37:g.105970595delC	ENSP00000255499:p.Thr151fs	Somatic		WXS	Illumina HiSeq	Phase_I	A0PJI4|Q6PH80|Q6ZTJ8|Q96RF3|Q9H5E4	Frame_Shift_Del	DEL	ENST00000255499.2	37	CCDS14521.1																																																																																				0.577	RNF128-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057804.1		NM_024539	
RNF43	54894	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	56435542	56435542	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr17:56435542G>A	ENST00000584437.1	-	8	3550	c.1595C>T	c.(1594-1596)tCc>tTc	p.S532F	RNF43_ENST00000577625.1_Missense_Mutation_p.S405F|RNF43_ENST00000581868.1_Missense_Mutation_p.S405F|RNF43_ENST00000500597.2_Missense_Mutation_p.S491F|RNF43_ENST00000583753.1_Missense_Mutation_p.S491F|RNF43_ENST00000577716.1_Missense_Mutation_p.S532F|RNF43_ENST00000407977.2_Missense_Mutation_p.S532F|BZRAP1-AS1_ENST00000583841.1_RNA			Q68DV7	RNF43_HUMAN	ring finger protein 43	532					negative regulation of Wnt signaling pathway (GO:0030178)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|stem cell proliferation (GO:0072089)|Wnt receptor catabolic process (GO:0038018)|Wnt signaling pathway (GO:0016055)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	frizzled binding (GO:0005109)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.S532F(1)		NS(1)|biliary_tract(5)|breast(1)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(14)|lung(9)|ovary(2)|pancreas(10)|prostate(1)|skin(4)	60	Medulloblastoma(34;0.127)|all_neural(34;0.237)					CGAGTCCAAGGAACGAGGCCG	0.592																																																	1	Substitution - Missense(1)	kidney(1)											73.0	72.0	72.0					17																	56435542		2203	4300	6503	SO:0001583	missense	54894				CCDS11607.1	17q23.2	2013-01-09						"""RING-type (C3HC4) zinc fingers"""	18505	protein-coding gene	gene with protein product		612482					Standard	NM_017763		Approved	FLJ20315, DKFZp781H0392, URCC	uc002iwh.4	Q68DV7		ENST00000584437.1:c.1595C>T	17.37:g.56435542G>A	ENSP00000463069:p.Ser532Phe	Somatic		WXS	Illumina HiSeq	Phase_I	A8K4R2|B7Z443|B7Z5D5|B7Z5J5|Q65ZA4|Q6AI04|Q9NXD0	Missense_Mutation	SNP	ENST00000584437.1	37	CCDS11607.1	.	.	.	.	.	.	.	.	.	.	G	19.49	3.837754	0.71373	.	.	ENSG00000108375	ENST00000407977;ENST00000500597	T;T	0.12465	2.78;2.68	5.12	5.12	0.69794	.	0.000000	0.64402	D	0.000001	T	0.27967	0.0689	L	0.36672	1.1	0.45087	D	0.998106	D;D;D	0.76494	0.998;0.999;0.999	D;D;D	0.80764	0.991;0.994;0.986	T	0.01001	-1.1485	10	0.56958	D	0.05	-5.0974	15.2636	0.73643	0.0:0.0:1.0:0.0	.	491;532;532	Q68DV7-2;Q68DV7-4;Q68DV7	.;.;RNF43_HUMAN	F	532;491	ENSP00000385328:S532F;ENSP00000441969:S491F	ENSP00000385328:S532F	S	-	2	0	RNF43	53790541	1.000000	0.71417	1.000000	0.80357	0.736000	0.42039	9.008000	0.93601	2.388000	0.81334	0.174000	0.16983	TCC		0.592	RNF43-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444713.1		NM_017763	
SATB2	23314	broad.mit.edu;ucsc.edu	37	2	200245089	200245089	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr2:200245089G>A	ENST00000417098.1	-	5	1411	c.595C>T	c.(595-597)Cag>Tag	p.Q199*	SATB2_ENST00000484124.1_5'UTR|SATB2_ENST00000260926.5_Nonsense_Mutation_p.Q199*|SATB2_ENST00000443023.1_Nonsense_Mutation_p.Q140*|SATB2_ENST00000457245.1_Nonsense_Mutation_p.Q199*|SATB2_ENST00000428695.1_Intron	NM_001172509.1	NP_001165980.1	Q9UPW6	SATB2_HUMAN	SATB homeobox 2	199					cartilage development (GO:0051216)|cellular response to organic substance (GO:0071310)|chromatin remodeling (GO:0006338)|embryonic pattern specification (GO:0009880)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|osteoblast development (GO:0002076)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)	p.Q199*(1)		breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(40)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						ATACTGACCTGGGAGAGAGGG	0.507																																					Colon(30;262 767 11040 24421 36230)												1	Substitution - Nonsense(1)	kidney(1)											149.0	130.0	137.0					2																	200245089		2203	4300	6503	SO:0001587	stop_gained	23314			AB028957	CCDS2327.1	2q33.1	2011-06-20	2007-02-15		ENSG00000119042	ENSG00000119042		"""Homeoboxes / CUT class"""	21637	protein-coding gene	gene with protein product		608148	"""SATB family member 2"""				Standard	NM_015265		Approved	KIAA1034, FLJ21474	uc002uva.2	Q9UPW6	OTTHUMG00000132767	ENST00000417098.1:c.595C>T	2.37:g.200245089G>A	ENSP00000401112:p.Gln199*	Somatic		WXS	Illumina GAIIx	Phase_I	A8K5Z8|Q3ZB87|Q4V763	Nonsense_Mutation	SNP	ENST00000417098.1	37	CCDS2327.1	.	.	.	.	.	.	.	.	.	.	G	40	8.488578	0.98834	.	.	ENSG00000119042	ENST00000417098;ENST00000443023;ENST00000260926;ENST00000457245	.	.	.	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-20.1497	19.7691	0.96356	0.0:0.0:1.0:0.0	.	.	.	.	X	199;140;199;199	.	ENSP00000260926:Q199X	Q	-	1	0	SATB2	199953334	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	9.869000	0.99810	2.689000	0.91719	0.462000	0.41574	CAG		0.507	SATB2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256140.1		NM_015265	
SCYL2	55681	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	100732421	100732421	+	Missense_Mutation	SNP	T	T	C			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr12:100732421T>C	ENST00000360820.2	+	18	2698	c.2261T>C	c.(2260-2262)aTt>aCt	p.I754T		NM_017988.4	NP_060458.3	Q6P3W7	SCYL2_HUMAN	SCY1-like 2 (S. cerevisiae)	754	Necessary for interaction with AP2 complex and clathrin, interaction with clathrin is necessary for its targeting to the TGN and endosomal membranes.				endosome to lysosome transport (GO:0008333)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of clathrin-mediated endocytosis (GO:2000370)|positive regulation of receptor internalization (GO:0002092)|receptor internalization involved in canonical Wnt signaling pathway (GO:2000286)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|receptor binding (GO:0005102)	p.I758T(1)		central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(4)|lung(15)|ovary(2)|skin(1)	41						TCCATGGGCATTGGTATGATG	0.403																																																	1	Substitution - Missense(1)	kidney(1)											109.0	100.0	103.0					12																	100732421		2203	4300	6503	SO:0001583	missense	55681			AB037781	CCDS9076.1	12q23.1	2005-01-20				ENSG00000136021			19286	protein-coding gene	gene with protein product						10718198	Standard	NM_017988		Approved	KIAA1360	uc001thn.3	Q6P3W7	OTTHUMG00000170319	ENST00000360820.2:c.2261T>C	12.37:g.100732421T>C	ENSP00000354061:p.Ile754Thr	Somatic		WXS	Illumina HiSeq	Phase_I	A8KAB5|Q96EF4|Q96ST4|Q9H7V5|Q9NVH3|Q9P2I7	Missense_Mutation	SNP	ENST00000360820.2	37	CCDS9076.1	.	.	.	.	.	.	.	.	.	.	T	5.098	0.203668	0.09704	.	.	ENSG00000136021	ENST00000360820	T	0.28069	1.63	5.53	4.37	0.52481	.	0.935625	0.09027	N	0.859380	T	0.17323	0.0416	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.32052	-0.9921	10	0.10636	T	0.68	.	8.1377	0.31064	0.1341:0.0:0.1404:0.7255	.	754	Q6P3W7	SCYL2_HUMAN	T	754	ENSP00000354061:I754T	ENSP00000354061:I754T	I	+	2	0	SCYL2	99256552	0.995000	0.38212	0.631000	0.29282	0.895000	0.52256	3.175000	0.50855	1.008000	0.39264	0.477000	0.44152	ATT		0.403	SCYL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408493.2		NM_017988	
SEMA4D	10507	broad.mit.edu	37	9	91994191	91994191	+	Silent	SNP	A	A	G			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr9:91994191A>G	ENST00000450295.1	-	16	2793	c.2017T>C	c.(2017-2019)Ttg>Ctg	p.L673L	SEMA4D_ENST00000356444.2_Silent_p.L673L|SEMA4D_ENST00000339861.4_Intron|SEMA4D_ENST00000420987.1_Intron|SEMA4D_ENST00000343780.4_Intron|SEMA4D_ENST00000455551.2_Intron|SEMA4D_ENST00000422704.2_Silent_p.L673L|SEMA4D_ENST00000438547.2_Silent_p.L673L			Q92854	SEM4D_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4D	673					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|immune response (GO:0006955)|leukocyte aggregation (GO:0070486)|negative regulation of alkaline phosphatase activity (GO:0010693)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell adhesion (GO:0007162)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|ossification involved in bone maturation (GO:0043931)|positive regulation of cell migration (GO:0030335)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell projection organization (GO:0031344)|regulation of cell shape (GO:0008360)|regulation of dendrite morphogenesis (GO:0048814)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in bone trabecula morphogenesis (GO:1900220)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|receptor binding (GO:0005102)|semaphorin receptor binding (GO:0030215)|transmembrane signaling receptor activity (GO:0004888)	p.L673L(1)		NS(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(8)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	34						GATGCCACCAACACTTTGGTG	0.622																																																	1	Substitution - coding silent(1)	kidney(1)											85.0	91.0	89.0					9																	91994191		2203	4300	6503	SO:0001819	synonymous_variant	10507			U60800	CCDS6685.1, CCDS47991.1	9q22-q31	2013-01-11			ENSG00000187764	ENSG00000187764		"""Semaphorins"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10732	protein-coding gene	gene with protein product	"""M-sema G"""	601866	"""chromosome 9 open reading frame 164"""	SEMAJ, C9orf164		8876214, 8969198	Standard	NM_006378		Approved	CD100, coll-4, FLJ39737	uc004aqo.1	Q92854	OTTHUMG00000020185	ENST00000450295.1:c.2017T>C	9.37:g.91994191A>G		Somatic		WXS	Illumina GAIIx	Phase_I	B2RPM6|Q7Z5S4|Q8N8B0	Silent	SNP	ENST00000450295.1	37	CCDS6685.1																																																																																				0.622	SEMA4D-018	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342411.1		NM_006378	
SF3B1	23451	broad.mit.edu;ucsc.edu	37	2	198257832	198257832	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr2:198257832G>A	ENST00000335508.6	-	24	3711	c.3620C>T	c.(3619-3621)tCg>tTg	p.S1207L		NM_012433.2	NP_036565.2	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1, 155kDa	1207					anterior/posterior pattern specification (GO:0009952)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)	p.S1207L(1)		NS(35)|breast(10)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(524)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|pancreas(4)|prostate(6)|salivary_gland(1)|skin(4)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	633			OV - Ovarian serous cystadenocarcinoma(117;0.246)			GTGATTCAGCGAATCTTCACA	0.458			Mis		myelodysplastic syndrome																																			Dom	yes		2	2q33.1	23451	"""splicing factor 3b, subunit 1, 155kDa"""		L	1	Substitution - Missense(1)	kidney(1)											121.0	106.0	111.0					2																	198257832		2203	4300	6503	SO:0001583	missense	23451			AF054284	CCDS33356.1, CCDS46479.1	2q33.1	2014-09-17	2002-08-29		ENSG00000115524	ENSG00000115524			10768	protein-coding gene	gene with protein product		605590	"""splicing factor 3b, subunit 1, 155kD"""			9585501	Standard	XM_005246428		Approved	SAP155, SF3b155, PRPF10, Prp10, Hsh155	uc002uue.3	O75533	OTTHUMG00000154447	ENST00000335508.6:c.3620C>T	2.37:g.198257832G>A	ENSP00000335321:p.Ser1207Leu	Somatic		WXS	Illumina GAIIx	Phase_I	E9PCH3	Missense_Mutation	SNP	ENST00000335508.6	37	CCDS33356.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.96|16.96	3.265690|3.265690	0.59540|0.59540	.|.	.|.	ENSG00000115524|ENSG00000115524	ENST00000424674|ENST00000335508	.|T	.|0.62498	.|0.02	5.39|5.39	4.51|4.51	0.55191|0.55191	.|Armadillo-type fold (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.49167|0.49167	0.1541|0.1541	L|L	0.27053|0.27053	0.805|0.805	0.80722|0.80722	D|D	1|1	.|B	.|0.30542	.|0.284	.|B	.|0.26969	.|0.075	T|T	0.51880|0.51880	-0.8649|-0.8649	5|10	.|0.66056	.|D	.|0.02	.|.	13.9274|13.9274	0.63970|0.63970	0.0732:0.0:0.9268:0.0|0.0732:0.0:0.9268:0.0	.|.	.|1207	.|O75533	.|SF3B1_HUMAN	C|L	223|1207	.|ENSP00000335321:S1207L	.|ENSP00000335321:S1207L	R|S	-|-	1|2	0|0	SF3B1|SF3B1	197966077|197966077	1.000000|1.000000	0.71417|0.71417	0.616000|0.616000	0.29078|0.29078	0.962000|0.962000	0.63368|0.63368	9.793000|9.793000	0.99091|0.99091	1.295000|1.295000	0.44724|0.44724	0.491000|0.491000	0.48974|0.48974	CGC|TCG		0.458	SF3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335245.2			
SIN3B	23309	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	16977286	16977286	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr19:16977286G>T	ENST00000248054.5	+	12	1746	c.1725G>T	c.(1723-1725)caG>caT	p.Q575H	SIN3B_ENST00000595541.1_Missense_Mutation_p.Q165H|SIN3B_ENST00000379803.1_Missense_Mutation_p.Q607H					SIN3 transcription regulator family member B									p.Q607H(1)		endometrium(4)|kidney(2)|large_intestine(8)|lung(8)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	26						TTGACCACCAGGCTGTGAACT	0.582																																																	1	Substitution - Missense(1)	kidney(1)											158.0	112.0	127.0					19																	16977286		2203	4300	6503	SO:0001583	missense	23309			AB014600	CCDS32946.1, CCDS74308.1	19p13.12	2013-08-21	2013-08-21						19354	protein-coding gene	gene with protein product		607777	"""SIN3 homolog B, transcription regulator (yeast)"", ""SIN3 transcription regulator homolog B (yeast)"""			9734811	Standard	XM_005259832		Approved	KIAA0700	uc002ney.2	O75182		ENST00000248054.5:c.1725G>T	19.37:g.16977286G>T	ENSP00000248054:p.Gln575His	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000248054.5	37		.	.	.	.	.	.	.	.	.	.	G	18.80	3.701589	0.68501	.	.	ENSG00000127511	ENST00000379803;ENST00000248054	T;T	0.53206	0.68;0.63	4.96	1.69	0.24217	.	0.000000	0.85682	D	0.000000	T	0.72898	0.3518	H	0.95004	3.61	0.80722	D	1	D;D;D	0.89917	0.998;1.0;1.0	D;D;D	0.85130	0.995;0.997;0.984	T	0.75816	-0.3184	10	0.72032	D	0.01	-20.6094	9.4399	0.38661	0.2318:0.0:0.7682:0.0	.	165;575;607	B7Z392;O75182-2;O75182	.;.;SIN3B_HUMAN	H	607;575	ENSP00000369131:Q607H;ENSP00000248054:Q575H	ENSP00000248054:Q575H	Q	+	3	2	SIN3B	16838286	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.590000	0.46154	0.502000	0.28037	0.491000	0.48974	CAG		0.582	SIN3B-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000462846.1		NM_015260	
SLC36A2	153201	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	150701632	150701632	+	Silent	SNP	A	A	G			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr5:150701632A>G	ENST00000335244.4	-	9	1284	c.1155T>C	c.(1153-1155)atT>atC	p.I385I	SLC36A2_ENST00000450886.1_Silent_p.I109I|SLC36A2_ENST00000521967.1_Silent_p.I385I	NM_181776.2	NP_861441.2	Q495M3	S36A2_HUMAN	solute carrier family 36 (proton/amino acid symporter), member 2	385					amino acid transport (GO:0006865)|ion transport (GO:0006811)|proline transmembrane transport (GO:0035524)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glycine transmembrane transporter activity (GO:0015187)|hydrogen:amino acid symporter activity (GO:0005280)|L-alanine transmembrane transporter activity (GO:0015180)|L-proline transmembrane transporter activity (GO:0015193)	p.I385I(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(14)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	33		Medulloblastoma(196;0.109)|all_hematologic(541;0.243)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Cycloserine(DB00260)	TGACGAGGCGAATGGACAGAT	0.542																																																	1	Substitution - coding silent(1)	kidney(1)											133.0	123.0	126.0					5																	150701632		2203	4300	6503	SO:0001819	synonymous_variant	153201			AY162214	CCDS4315.1	5q33.1	2013-05-22			ENSG00000186335	ENSG00000186335		"""Solute carriers"""	18762	protein-coding gene	gene with protein product		608331				11959859	Standard	NM_181776		Approved	PAT2, tramdorin, TRAMD1	uc003lty.3	Q495M3	OTTHUMG00000130129	ENST00000335244.4:c.1155T>C	5.37:g.150701632A>G		Somatic		WXS	Illumina HiSeq	Phase_I	Q495M4|Q495M6|Q6ZWK5|Q7Z6B5	Silent	SNP	ENST00000335244.4	37	CCDS4315.1																																																																																				0.542	SLC36A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252437.1			
SORBS2	8470	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	186548090	186548090	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr4:186548090C>T	ENST00000284776.7	-	12	1327	c.818G>A	c.(817-819)aGt>aAt	p.S273N	SORBS2_ENST00000437304.2_Missense_Mutation_p.S524N|SORBS2_ENST00000393528.3_Missense_Mutation_p.S366N|SORBS2_ENST00000449407.2_Missense_Mutation_p.S344N|SORBS2_ENST00000448662.2_Missense_Mutation_p.S361N|SORBS2_ENST00000418609.1_Missense_Mutation_p.S177N|SORBS2_ENST00000319471.9_Missense_Mutation_p.S431N|SORBS2_ENST00000498125.1_5'UTR|SORBS2_ENST00000431808.1_Missense_Mutation_p.S273N|SORBS2_ENST00000355634.5_Missense_Mutation_p.S373N	NM_021069.4	NP_066547.1	O94875	SRBS2_HUMAN	sorbin and SH3 domain containing 2	273					actin filament organization (GO:0007015)|cell adhesion (GO:0007155)|cell migration (GO:0016477)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	cytoskeletal adaptor activity (GO:0008093)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)	p.S361N(1)|p.S273N(1)|p.S366N(1)|p.S524N(1)		endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(9)|lung(21)|ovary(2)|prostate(2)|skin(4)|urinary_tract(1)	53		all_cancers(14;4.27e-52)|all_epithelial(14;6.58e-39)|all_lung(41;1.42e-13)|Lung NSC(41;3.73e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00692)|Hepatocellular(41;0.00826)|Renal(120;0.00994)|Prostate(90;0.0101)|all_hematologic(60;0.0174)|all_neural(102;0.244)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-09)|BRCA - Breast invasive adenocarcinoma(30;0.000232)|GBM - Glioblastoma multiforme(59;0.000385)|STAD - Stomach adenocarcinoma(60;0.00109)|LUSC - Lung squamous cell carcinoma(40;0.0205)		CCTGCTCGCACTTTGATCTCC	0.552																																					Esophageal Squamous(153;41 2433 9491 36028)												4	Substitution - Missense(4)	kidney(4)											125.0	123.0	124.0					4																	186548090		2203	4300	6503	SO:0001583	missense	8470				CCDS3845.1, CCDS43289.2, CCDS47173.1, CCDS47174.1, CCDS47175.1, CCDS47176.1, CCDS54825.1, CCDS59482.1	4q35.1	2008-02-05			ENSG00000154556	ENSG00000154556			24098	protein-coding gene	gene with protein product	"""Arg/Abl interacting protein"""					9211900, 9872452	Standard	NM_021069		Approved	ARGBP2, KIAA0777	uc003iym.3	O94875	OTTHUMG00000157215	ENST00000284776.7:c.818G>A	4.37:g.186548090C>T	ENSP00000284776:p.Ser273Asn	Somatic		WXS	Illumina HiSeq	Phase_I	A6NEK9|B3KPQ7|B7Z1G5|B7Z3X6|C9JKV9|D3DP62|D3DP63|E9PAS5|E9PAW4|G3XAI0|H7BXR4|J3KNZ5|O60592|O60593|Q96EX0	Missense_Mutation	SNP	ENST00000284776.7	37	CCDS3845.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	1.152|1.152	-0.646316|-0.646316	0.03531|0.03531	.|.	.|.	ENSG00000154556|ENSG00000154556	ENST00000284776;ENST00000448662;ENST00000431808;ENST00000418609;ENST00000437304;ENST00000319471;ENST00000449407;ENST00000355634;ENST00000393528;ENST00000319454;ENST00000451974|ENST00000445625	T;T;T;T;T;T;T;T;T;T;T|.	0.34275|.	1.5;1.58;1.5;1.38;1.37;1.38;1.58;1.5;1.65;1.55;2.67|.	5.16|5.16	0.00452|0.00452	0.14058|0.14058	.|.	0.368951|.	0.35708|.	N|.	0.003036|.	T|T	0.09247|0.09247	0.0228|0.0228	N|N	0.03608|0.03608	-0.345|-0.345	0.09310|0.09310	N|N	1|1	B;B;B;B;B;B;B;B;B;B;B;B;B;B;B|.	0.15141|.	0.0;0.002;0.0;0.0;0.0;0.012;0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.002|.	B;B;B;B;B;B;B;B;B;B;B;B;B;B;B|.	0.14578|.	0.001;0.007;0.0;0.001;0.0;0.011;0.001;0.001;0.001;0.0;0.0;0.0;0.001;0.001;0.007|.	T|T	0.27123|0.27123	-1.0083|-1.0083	10|5	0.11794|.	T|.	0.64|.	-0.9705|-0.9705	0.8027|0.8027	0.01078|0.01078	0.1678:0.2207:0.3325:0.279|0.1678:0.2207:0.3325:0.279	.|.	336;366;361;177;192;249;391;373;273;344;524;361;391;345;366|.	B7Z3D7;G3XAI0;C9JKV9;B7Z3X6;B7Z997;B3KPU4;O94875-4;B3KPQ7;O94875;E9PAS5;E9PAW4;B7Z1G5;O94875-5;O94875-3;O94875-2|.	.;.;.;.;.;.;.;.;SRBS2_HUMAN;.;.;.;.;.;.|.	N|M	273;361;273;177;524;431;344;373;366;391;149|219	ENSP00000284776:S273N;ENSP00000409158:S361N;ENSP00000411764:S273N;ENSP00000397482:S177N;ENSP00000396008:S524N;ENSP00000322182:S431N;ENSP00000397262:S344N;ENSP00000347852:S373N;ENSP00000377162:S366N;ENSP00000321983:S391N;ENSP00000401818:S149N|.	ENSP00000284776:S273N|.	S|V	-|-	2|1	0|0	SORBS2|SORBS2	186785084|186785084	0.180000|0.180000	0.23148|0.23148	0.001000|0.001000	0.08648|0.08648	0.021000|0.021000	0.10359|0.10359	0.819000|0.819000	0.27308|0.27308	0.251000|0.251000	0.21505|0.21505	0.655000|0.655000	0.94253|0.94253	AGT|GTG		0.552	SORBS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347944.3		NM_003603	
SP4	6671	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	21469813	21469813	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr7:21469813A>G	ENST00000222584.3	+	3	1248	c.1030A>G	c.(1030-1032)Act>Gct	p.T344A		NM_003112.3	NP_003103.2	Q02446	SP4_HUMAN	Sp4 transcription factor	344					regulation of heart contraction (GO:0008016)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)	p.T344A(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(11)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	35						CTCAGCAGATACTGGCCAGTA	0.502																																																	1	Substitution - Missense(1)	kidney(1)											109.0	80.0	90.0					7																	21469813		2203	4300	6503	SO:0001583	missense	6671				CCDS5373.1	7p15	2013-01-08			ENSG00000105866	ENSG00000105866		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	11209	protein-coding gene	gene with protein product		600540				1454515	Standard	XM_005249828		Approved	SPR-1, HF1B, MGC130008, MGC130009	uc003sva.3	Q02446	OTTHUMG00000094801	ENST00000222584.3:c.1030A>G	7.37:g.21469813A>G	ENSP00000222584:p.Thr344Ala	Somatic		WXS	Illumina HiSeq	Phase_I	O60402|Q32M52	Missense_Mutation	SNP	ENST00000222584.3	37	CCDS5373.1	.	.	.	.	.	.	.	.	.	.	A	3.225	-0.158626	0.06544	.	.	ENSG00000105866	ENST00000222584	T	0.09723	2.95	4.94	-0.49	0.12049	.	0.361510	0.31797	N	0.007057	T	0.05823	0.0152	N	0.22421	0.69	0.27328	N	0.956843	B	0.19583	0.037	B	0.12837	0.008	T	0.27971	-1.0058	10	0.37606	T	0.19	.	6.1997	0.20569	0.6776:0.0:0.2032:0.1191	.	344	Q02446	SP4_HUMAN	A	344	ENSP00000222584:T344A	ENSP00000222584:T344A	T	+	1	0	SP4	21436338	0.007000	0.16637	0.728000	0.30774	0.584000	0.36387	0.074000	0.14662	0.069000	0.16605	-0.993000	0.02533	ACT		0.502	SP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211617.2		NM_003112	
SPTBN2	6712	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	66483388	66483388	+	Silent	SNP	G	G	A			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr11:66483388G>A	ENST00000533211.1	-	4	553	c.222C>T	c.(220-222)gtC>gtT	p.V74V	SPTBN2_ENST00000309996.2_Silent_p.V74V|RN7SL12P_ENST00000473849.2_RNA|SPTBN2_ENST00000529997.1_Silent_p.V74V			O15020	SPTN2_HUMAN	spectrin, beta, non-erythrocytic 2	74	Actin-binding.|CH 1. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin filament capping (GO:0051693)|adult behavior (GO:0030534)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|cell death (GO:0008219)|cerebellar Purkinje cell layer morphogenesis (GO:0021692)|multicellular organism growth (GO:0035264)|synapse assembly (GO:0007416)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|spectrin (GO:0008091)	actin binding (GO:0003779)|phospholipid binding (GO:0005543)|structural constituent of cytoskeleton (GO:0005200)	p.V74V(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(15)|liver(1)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	74						CCCGGCACGTGACCCGGGCCA	0.592																																																	1	Substitution - coding silent(1)	kidney(1)											97.0	73.0	81.0					11																	66483388		2200	4295	6495	SO:0001819	synonymous_variant	6712			AB008567, AF026487, AF026488, AF079569	CCDS8150.1	11q13.2	2013-01-10			ENSG00000173898	ENSG00000173898		"""Pleckstrin homology (PH) domain containing"""	11276	protein-coding gene	gene with protein product		604985	"""spinocerebellar ataxia 5"""	SCA5		9826670, 16429157	Standard	NM_006946		Approved		uc001ojd.3	O15020	OTTHUMG00000167262	ENST00000533211.1:c.222C>T	11.37:g.66483388G>A		Somatic		WXS	Illumina HiSeq	Phase_I	O14872|O14873	Silent	SNP	ENST00000533211.1	37	CCDS8150.1																																																																																				0.592	SPTBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393892.2		NM_006946	
STK36	27148	broad.mit.edu	37	2	219557312	219557312	+	Missense_Mutation	SNP	C	C	T	rs145717046		TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr2:219557312C>T	ENST00000295709.3	+	16	2201	c.1922C>T	c.(1921-1923)cCg>cTg	p.P641L	STK36_ENST00000392105.3_Missense_Mutation_p.P641L|STK36_ENST00000440309.1_Missense_Mutation_p.P641L|STK36_ENST00000392106.2_Missense_Mutation_p.P641L	NM_015690.4	NP_056505.2			serine/threonine kinase 36									p.P641R(1)|p.P641L(1)		biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(6)|lung(20)|ovary(4)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	52		Renal(207;0.0915)		Epithelial(149;9.65e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.00984)		ACAGGAGCCCCGCAAGTGAGC	0.572																																																	2	Substitution - Missense(2)	lung(1)|kidney(1)						C	LEU/PRO	0,4406		0,0,2203	38.0	40.0	39.0		1922	4.0	1.0	2	dbSNP_134	39	2,8598	2.2+/-6.3	0,2,4298	yes	missense	STK36	NM_015690.4	98	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	possibly-damaging	641/1316	219557312	2,13004	2203	4300	6503	SO:0001583	missense	27148			AB033104	CCDS2421.1, CCDS58750.1	2q35	2010-06-25	2010-06-25		ENSG00000163482	ENSG00000163482			17209	protein-coding gene	gene with protein product	"""fused homolog (Drosophila)"""	607652	"""serine/threonine kinase 36 (fused homolog, Drosophila)"""			10806483	Standard	NM_001243313		Approved	KIAA1278, FU	uc002viu.3	Q9NRP7	OTTHUMG00000133079	ENST00000295709.3:c.1922C>T	2.37:g.219557312C>T	ENSP00000295709:p.Pro641Leu	Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000295709.3	37	CCDS2421.1	.	.	.	.	.	.	.	.	.	.	C	14.21	2.468753	0.43839	0.0	2.33E-4	ENSG00000163482	ENST00000295709;ENST00000392106;ENST00000392105;ENST00000440309	T;T;T;T	0.70631	-0.5;-0.5;0.57;-0.5	4.87	3.99	0.46301	Armadillo-like helical (1);	0.156017	0.30347	N	0.009831	T	0.55689	0.1936	N	0.24115	0.695	0.42002	D	0.990897	B;B	0.16396	0.016;0.017	B;B	0.11329	0.006;0.002	T	0.53837	-0.8382	10	0.46703	T	0.11	-6.8433	11.3442	0.49550	0.0:0.9163:0.0:0.0837	.	641;641	Q9NRP7-2;Q9NRP7	.;STK36_HUMAN	L	641	ENSP00000295709:P641L;ENSP00000375955:P641L;ENSP00000375954:P641L;ENSP00000394095:P641L	ENSP00000295709:P641L	P	+	2	0	STK36	219265556	0.755000	0.28372	0.956000	0.39512	0.704000	0.40688	1.463000	0.35277	1.275000	0.44379	0.561000	0.74099	CCG		0.572	STK36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256723.2			
SVEP1	79987	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	113312161	113312161	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr9:113312161A>G	ENST00000401783.2	-	2	1091	c.755T>C	c.(754-756)tTt>tCt	p.F252S	SVEP1_ENST00000302728.8_Missense_Mutation_p.F252S|SVEP1_ENST00000467821.1_5'UTR|SVEP1_ENST00000374469.1_Missense_Mutation_p.F229S|SVEP1_ENST00000374461.1_Missense_Mutation_p.F229S	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	252	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)	p.F252S(1)		NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						TAAAGCCTCAAATTCTTCAAA	0.458																																																	1	Substitution - Missense(1)	kidney(1)											71.0	67.0	68.0					9																	113312161		1922	4127	6049	SO:0001583	missense	79987			AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.755T>C	9.37:g.113312161A>G	ENSP00000384917:p.Phe252Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Missense_Mutation	SNP	ENST00000401783.2	37	CCDS48004.1	.	.	.	.	.	.	.	.	.	.	A	26.2	4.712590	0.89112	.	.	ENSG00000165124	ENST00000401783;ENST00000374469;ENST00000302728;ENST00000374461	T;T;T;T	0.77877	-1.13;-1.13;-1.13;-1.13	5.38	5.38	0.77491	von Willebrand factor, type A (3);	0.000000	0.85682	D	0.000000	D	0.89743	0.6803	M	0.88906	2.99	0.45777	D	0.998662	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.91635	0.996;0.999;0.997	D	0.91759	0.5418	10	0.87932	D	0	.	15.6841	0.77396	1.0:0.0:0.0:0.0	.	252;252;252	E9PBN8;Q4LDE5;Q4LDE5-2	.;SVEP1_HUMAN;.	S	252;229;252;229	ENSP00000384917:F252S;ENSP00000363593:F229S;ENSP00000304118:F252S;ENSP00000363585:F229S	ENSP00000304118:F252S	F	-	2	0	SVEP1	112351982	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.835000	0.92100	2.162000	0.67917	0.460000	0.39030	TTT		0.458	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				
TAF1	6872	broad.mit.edu;hgsc.bcm.edu	37	X	70603945	70603945	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chrX:70603945A>G	ENST00000373790.4	+	13	2129	c.2078A>G	c.(2077-2079)cAg>cGg	p.Q693R	TAF1_ENST00000449580.1_Missense_Mutation_p.Q693R|TAF1_ENST00000276072.3_Missense_Mutation_p.Q714R|TAF1_ENST00000423759.1_Missense_Mutation_p.Q714R	NM_004606.3|NM_138923.2	NP_004597.2|NP_620278.1	P21675	TAF1_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa	693	Histone acetyltransferase (HAT).				cellular response to DNA damage stimulus (GO:0006974)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|protein autophosphorylation (GO:0046777)|regulation of transcription involved in G2/M transition of mitotic cell cycle (GO:0000117)|RNA polymerase II transcriptional preinitiation complex assembly (GO:0051123)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	ATP binding (GO:0005524)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)|sequence-specific DNA binding (GO:0043565)|TBP-class protein binding (GO:0017025)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)	p.Q693R(1)|p.Q714R(1)		breast(13)|central_nervous_system(6)|cervix(1)|endometrium(25)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(16)|lung(34)|ovary(9)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	124	Renal(35;0.156)	all_lung(315;0.000321)				TTAATGATGCAGGTTGGCATG	0.398																																																	2	Substitution - Missense(2)	kidney(2)											120.0	101.0	107.0					X																	70603945		2203	4299	6502	SO:0001583	missense	6872				CCDS14412.1, CCDS35325.1, CCDS69783.1	Xq13.1	2011-07-01	2002-08-29	2001-12-07	ENSG00000147133	ENSG00000147133		"""Chromatin-modifying enzymes / K-acetyltransferases"""	11535	protein-coding gene	gene with protein product		313650	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, A, 250kD"", ""dystonia 3 (with Parkinsonism)"""	TAF2A, BA2R, CCG1, CCGS, DYT3		3556424, 12928496, 17952504	Standard	XM_005262295		Approved	NSCL2, TAFII250, KAT4, DYT3/TAF1	uc004dzt.4	P21675	OTTHUMG00000022723	ENST00000373790.4:c.2078A>G	X.37:g.70603945A>G	ENSP00000362895:p.Gln693Arg	Somatic		WXS	Illumina HiSeq	Phase_I	A5CVC8|A5CVC9|A5CVD0|A5CVD1|B1Q2X3|Q59FZ3|Q6IUZ1|Q70Q86|Q70Q87|Q70T00|Q70T01|Q70T02|Q70T03	Missense_Mutation	SNP	ENST00000373790.4	37	CCDS35325.1	.	.	.	.	.	.	.	.	.	.	.	24.2	4.500569	0.85176	.	.	ENSG00000147133	ENST00000373790;ENST00000449580;ENST00000423759;ENST00000276072	T;T;T;T	0.14022	2.54;2.54;2.54;2.54	5.88	5.88	0.94601	Transcription initiation factor TFIID subunit 1, domain of unknown function (1);	0.000000	0.85682	D	0.000000	T	0.36608	0.0973	M	0.69248	2.105	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.80764	0.994;0.987	T	0.08973	-1.0696	10	0.66056	D	0.02	.	15.2112	0.73225	1.0:0.0:0.0:0.0	.	693;714	P21675;P21675-2	TAF1_HUMAN;.	R	693;693;714;714	ENSP00000362895:Q693R;ENSP00000389000:Q693R;ENSP00000406549:Q714R;ENSP00000276072:Q714R	ENSP00000276072:Q714R	Q	+	2	0	TAF1	70520670	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.818000	0.91991	1.976000	0.57569	0.486000	0.48141	CAG		0.398	TAF1-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058995.2		NM_004606	
TANC1	85461	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	160080760	160080760	+	Silent	SNP	G	G	A			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr2:160080760G>A	ENST00000263635.6	+	23	3933	c.3696G>A	c.(3694-3696)gaG>gaA	p.E1232E	TANC1_ENST00000454300.1_Silent_p.E1126E	NM_001145909.1|NM_033394.2	NP_001139381.1|NP_203752.2	Q9C0D5	TANC1_HUMAN	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1	1232					dendritic spine maintenance (GO:0097062)|myoblast fusion (GO:0007520)|visual learning (GO:0008542)	axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)		p.E1232E(1)		breast(3)|central_nervous_system(4)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(25)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	77						ACCTGGTGGAGAAGGGAGCCG	0.602																																																	1	Substitution - coding silent(1)	kidney(1)											69.0	77.0	74.0					2																	160080760		2086	4214	6300	SO:0001819	synonymous_variant	85461			AB051515	CCDS42766.1	2q24.2	2013-01-11			ENSG00000115183	ENSG00000115183		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29364	protein-coding gene	gene with protein product	"""rolling pebbles homolog B (Drosophila)"""	611397				15673434	Standard	NM_033394		Approved	KIAA1728, ROLSB	uc002uag.3	Q9C0D5	OTTHUMG00000153945	ENST00000263635.6:c.3696G>A	2.37:g.160080760G>A		Somatic		WXS	Illumina HiSeq	Phase_I	C9JD88|Q49AI8	Silent	SNP	ENST00000263635.6	37	CCDS42766.1																																																																																				0.602	TANC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333135.1			
TM7SF3	51768	broad.mit.edu;ucsc.edu	37	12	27156169	27156169	+	Splice_Site	SNP	C	C	T			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr12:27156169C>T	ENST00000343028.4	-	2	471	c.246G>A	c.(244-246)ccG>ccA	p.P82P	TM7SF3_ENST00000542667.1_Intron	NM_016551.2	NP_057635.1	Q9NS93	TM7S3_HUMAN	transmembrane 7 superfamily member 3	82						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.P82P(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	18	Colorectal(261;0.0847)					TTGCACTTACCGGAGAAAAGG	0.308																																																	1	Substitution - coding silent(1)	kidney(1)											43.0	43.0	43.0					12																	27156169		2202	4300	6502	SO:0001630	splice_region_variant	51768			AB032470	CCDS8710.1	12q11-q12	2012-08-10			ENSG00000064115	ENSG00000064115			23049	protein-coding gene	gene with protein product		605181				10828615	Standard	NM_016551		Approved		uc010sjl.2	Q9NS93	OTTHUMG00000169243	ENST00000343028.4:c.246+1G>A	12.37:g.27156169C>T		Somatic		WXS	Illumina GAIIx	Phase_I	B3KMZ3|Q9NUS4	Silent	SNP	ENST00000343028.4	37	CCDS8710.1																																																																																				0.308	TM7SF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403033.1		NM_016551	Silent
TMEM102	284114	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	7340067	7340067	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr17:7340067G>A	ENST00000323206.1	+	3	1042	c.769G>A	c.(769-771)Gcg>Acg	p.A257T	RP11-104H15.8_ENST00000576615.1_RNA|RP11-104H15.10_ENST00000575331.1_RNA|TMEM102_ENST00000396568.1_Missense_Mutation_p.A257T|FGF11_ENST00000575235.1_5'Flank|RP11-104H15.9_ENST00000570444.1_RNA|RP11-104H15.7_ENST00000575310.1_RNA|FGF11_ENST00000293829.4_5'Flank	NM_178518.2	NP_848613.1	Q8N9M5	TM102_HUMAN	transmembrane protein 102	257					apoptotic process (GO:0006915)|positive regulation of cell adhesion (GO:0045785)|positive regulation of T cell chemotaxis (GO:0010820)|positive regulation of T cell migration (GO:2000406)|regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901028)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to cytokine (GO:0034097)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|protein complex (GO:0043234)		p.A257T(1)		kidney(1)|lung(3)|skin(1)	5		Prostate(122;0.173)				GGCTCGGGAAGCGTGGCCCAC	0.622																																																	1	Substitution - Missense(1)	kidney(1)											77.0	80.0	79.0					17																	7340067		2203	4300	6503	SO:0001583	missense	284114			AK094197	CCDS11104.1	17p13.1	2008-04-21			ENSG00000181284	ENSG00000181284			26722	protein-coding gene	gene with protein product		613936				12477932	Standard	NM_178518		Approved	FLJ36878	uc002ggx.1	Q8N9M5	OTTHUMG00000132901	ENST00000323206.1:c.769G>A	17.37:g.7340067G>A	ENSP00000315387:p.Ala257Thr	Somatic		WXS	Illumina HiSeq	Phase_I	D3DTP8	Missense_Mutation	SNP	ENST00000323206.1	37	CCDS11104.1	.	.	.	.	.	.	.	.	.	.	G	6.615	0.481807	0.12581	.	.	ENSG00000181284	ENST00000323206;ENST00000396568	T;T	0.44881	0.91;0.91	5.23	3.11	0.35812	.	0.544520	0.17105	N	0.186827	T	0.23054	0.0557	L	0.29908	0.895	0.09310	N	1	B	0.31318	0.319	B	0.27608	0.081	T	0.08066	-1.0740	10	0.13470	T	0.59	-11.399	5.3897	0.16237	0.1005:0.0:0.6978:0.2017	.	257	Q8N9M5	TM102_HUMAN	T	257	ENSP00000315387:A257T;ENSP00000379815:A257T	ENSP00000315387:A257T	A	+	1	0	TMEM102	7280791	0.000000	0.05858	0.754000	0.31244	0.346000	0.29079	0.079000	0.14782	2.596000	0.87737	0.561000	0.74099	GCG		0.622	TMEM102-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256405.1		NM_178518	
TXNDC5	81567	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	7883469	7883469	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr6:7883469G>A	ENST00000379757.4	-	10	1244	c.1207C>T	c.(1207-1209)Cga>Tga	p.R403*	TXNDC5_ENST00000539054.1_Nonsense_Mutation_p.R331*|BLOC1S5-TXNDC5_ENST00000439343.2_3'UTR|TXNDC5_ENST00000473453.1_Nonsense_Mutation_p.R295*	NM_030810.3	NP_110437.2	Q8NBS9	TXND5_HUMAN	thioredoxin domain containing 5 (endoplasmic reticulum)	403	Thioredoxin 3. {ECO:0000255|PROSITE- ProRule:PRU00691}.				apoptotic cell clearance (GO:0043277)|cell redox homeostasis (GO:0045454)|membrane organization (GO:0061024)|negative regulation of apoptotic process (GO:0043066)|post-Golgi vesicle-mediated transport (GO:0006892)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	protein disulfide isomerase activity (GO:0003756)	p.R403R(1)|p.R403*(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(6)|prostate(1)|skin(2)	22	Ovarian(93;0.0398)					TTCCCTCCTCGGAAAAGCAAT	0.453																																					Ovarian(119;1430 1625 3928 26125 34589)												2	Substitution - Nonsense(1)|Substitution - coding silent(1)	kidney(1)|endometrium(1)											133.0	110.0	117.0					6																	7883469		2203	4300	6503	SO:0001587	stop_gained	81567			AK025006	CCDS4505.1, CCDS47369.1	6p24.3	2011-10-19	2009-02-23		ENSG00000239264	ENSG00000239264		"""Protein disulfide isomerases"""	21073	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 15"""		"""thioredoxin domain containing 5"""				Standard	NM_001145549		Approved	MGC3178, FLJ21353, FLJ90810, EndoPDI, Hcc-2, ERp46, PDIA15	uc003mxv.3	Q8NBS9	OTTHUMG00000014216	ENST00000379757.4:c.1207C>T	6.37:g.7883469G>A	ENSP00000369081:p.Arg403*	Somatic		WXS	Illumina HiSeq	Phase_I	B2RDM2|Q5TCQ0|Q8ND33|Q8TCT2|Q9BVH9	Nonsense_Mutation	SNP	ENST00000379757.4	37	CCDS4505.1	.	.	.	.	.	.	.	.	.	.	G	33	5.288356	0.95517	.	.	ENSG00000239264	ENST00000539054;ENST00000379757;ENST00000473453	.	.	.	5.8	5.8	0.92144	.	0.050224	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	20.063	0.97692	0.0:0.0:1.0:0.0	.	.	.	.	X	331;403;295	.	ENSP00000442453:R331X	R	-	1	2	TXNDC5	7828468	1.000000	0.71417	0.999000	0.59377	0.948000	0.59901	6.122000	0.71608	2.735000	0.93741	0.655000	0.94253	CGA		0.453	TXNDC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039792.1		NM_030810	
U2AF2	11338	hgsc.bcm.edu;ucsc.edu	37	19	56185308	56185310	+	In_Frame_Del	DEL	GGA	GGA	-			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	GGA	GGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr19:56185308_56185310delGGA	ENST00000308924.4	+	12	1342_1344	c.1302_1304delGGA	c.(1300-1305)gtggag>gtg	p.E435del	EPN1_ENST00000085079.7_5'Flank|EPN1_ENST00000411543.2_5'Flank|CTD-2537I9.12_ENST00000589456.1_RNA|EPN1_ENST00000270460.6_5'Flank|CTD-2537I9.12_ENST00000585940.1_RNA|U2AF2_ENST00000590551.1_In_Frame_Del_p.E267del|CTD-2537I9.13_ENST00000592252.1_RNA|U2AF2_ENST00000450554.2_In_Frame_Del_p.E431del			P26368	U2AF2_HUMAN	U2 small nuclear RNA auxiliary factor 2	435	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	enzyme binding (GO:0019899)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			biliary_tract(1)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|urinary_tract(2)	21		Colorectal(82;0.00244)|Ovarian(87;0.133)	BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.107)		AGATCTTTGTGGAGTTCACCTCT	0.567																																																	0																																										SO:0001651	inframe_deletion	11338			BC008740	CCDS12933.1, CCDS46197.1	19q13.43	2014-09-17	2006-04-11			ENSG00000063244		"""RNA binding motif (RRM) containing"""	23156	protein-coding gene	gene with protein product	"""U2 small nuclear ribonucleoprotein auxiliary factor (65kD)"", ""splicing factor U2AF 65 kD subunit"", ""U2 snRNP auxiliary factor large subunit"""	191318	"""U2 (RNU2) small nuclear RNA auxiliary factor 2"""			1538748	Standard	XM_006722994		Approved	U2AF65	uc002qlu.3	P26368		ENST00000308924.4:c.1302_1304delGGA	19.37:g.56185308_56185310delGGA	ENSP00000307863:p.Glu435del	Somatic		WXS	Illumina HiSeq	Phase_I	Q96HC5	In_Frame_Del	DEL	ENST00000308924.4	37	CCDS12933.1																																																																																				0.567	U2AF2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453599.1		NM_007279	
Unknown	0	broad.mit.edu	37	10	11715686	11715686	+	IGR	SNP	T	T	C			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr10:11715686T>C								RP11-138I18.1 (61460 upstream) : RP11-138I18.2 (5987 downstream)																							AATATCCCATTCCAAACCTCT	0.473																																																	0																																										SO:0001628	intergenic_variant	0																															10.37:g.11715686T>C		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP		37																																																																																				0	0.473									
MIR570	693155	broad.mit.edu	37	3	195427029	195427029	+	RNA	DEL	T	T	-	rs75160807	byFrequency	TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr3:195427029delT	ENST00000384917.1	+	0	97					NR_030296.1				microRNA 570																		gcaacaggaattttttcaggc	0.423													ttttt|TTTTTT|TTTTT|insertion	1660	0.33147	0.4539	0.3012	5008	,	,		38182	0.4077		0.2197	False		,,,				2504	0.2239																0																																												0					3	2011-09-12		2008-12-18	ENSG00000207650	ENSG00000207650		"""ncRNAs / Micro RNAs"""	32826	non-coding RNA	RNA, micro		614538		MIRN570			Standard	NR_030296		Approved	hsa-mir-570	uc021xjf.1				3.37:g.195427029delT		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	DEL	ENST00000384917.1	37																																																																																					0.423	MIR570-201	KNOWN	basic	miRNA	miRNA			NR_030296	
USP9Y	8287	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	Y	14850172	14850172	+	Nonsense_Mutation	SNP	A	A	T			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chrY:14850172A>T	ENST00000338981.3	+	11	2191	c.1246A>T	c.(1246-1248)Aaa>Taa	p.K416*	USP9Y_ENST00000426564.2_3'UTR	NM_004654.3	NP_004645.2	O00507	USP9Y_HUMAN	ubiquitin specific peptidase 9, Y-linked	416					BMP signaling pathway (GO:0030509)|protein deubiquitination (GO:0016579)|spermatogenesis (GO:0007283)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)	co-SMAD binding (GO:0070410)|cysteine-type peptidase activity (GO:0008234)|ubiquitin-specific protease activity (GO:0004843)	p.K416*(1)		kidney(1)|large_intestine(8)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17						AAAGCTAGAGAAAATTCTTCG	0.328																																																	1	Substitution - Nonsense(1)	kidney(1)																																								SO:0001587	stop_gained	8287			Y13618	CCDS14781.1	Yq11.2	2010-04-09	2009-03-17		ENSG00000114374	ENSG00000114374		"""Ubiquitin-specific peptidases"""	12633	protein-coding gene	gene with protein product	"""fat facets-like homolog (Drosophila)"""	400005	"""ubiquitin specific peptidase 9, Y-linked (fat facets-like, Drosophila)"""			8922996, 9384609, 19246359	Standard	NM_004654		Approved	DFFRY	uc004fst.1	O00507	OTTHUMG00000036469	ENST00000338981.3:c.1246A>T	Y.37:g.14850172A>T	ENSP00000342812:p.Lys416*	Somatic		WXS	Illumina HiSeq	Phase_I	O14601	Nonsense_Mutation	SNP	ENST00000338981.3	37	CCDS14781.1																																																																																				0.328	USP9Y-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088703.2		NM_004654	
VARS	7407	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	31752061	31752061	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr6:31752061G>A	ENST00000375663.3	-	13	2041	c.1601C>T	c.(1600-1602)gCa>gTa	p.A534V	VARS_ENST00000482996.1_5'Flank|VARS_ENST00000444930.2_Missense_Mutation_p.A239V	NM_006295.2	NP_006286.1	P26640	SYVC_HUMAN	valyl-tRNA synthetase	534					gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)|valyl-tRNA aminoacylation (GO:0006438)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|valine-tRNA ligase activity (GO:0004832)	p.A534V(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(18)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	30					L-Valine(DB00161)	CCGAGTTGTTGCCACCACCAC	0.597																																																	1	Substitution - Missense(1)	kidney(1)											211.0	188.0	196.0					6																	31752061		2203	4300	6503	SO:0001583	missense	7407			BC012808	CCDS34412.1	6p21.3	2011-07-01		2005-07-05	ENSG00000204394	ENSG00000204394	6.1.1.9	"""Aminoacyl tRNA synthetases / Class I"""	12651	protein-coding gene	gene with protein product	"""valine tRNA ligase 1, cytoplasmic"""	192150	"""valyl-tRNA synthetase 2"""	VARS2		15779907	Standard	XM_005249362		Approved		uc003nxe.3	P26640	OTTHUMG00000031286	ENST00000375663.3:c.1601C>T	6.37:g.31752061G>A	ENSP00000364815:p.Ala534Val	Somatic		WXS	Illumina HiSeq	Phase_I	B0V1N1|B4DZ61|Q5JQ90|Q96E77|Q9UQM2	Missense_Mutation	SNP	ENST00000375663.3	37	CCDS34412.1	.	.	.	.	.	.	.	.	.	.	G	35	5.418684	0.96092	.	.	ENSG00000204394	ENST00000375663;ENST00000444930	T;T	0.40225	1.04;1.04	5.73	5.73	0.89815	Valyl/Leucyl/Isoleucyl-tRNA synthetase, class Ia, editing domain (2);Aminoacyl-tRNA synthetase, class Ia (1);	0.000000	0.85682	D	0.000000	T	0.79399	0.4439	H	0.99682	4.7	0.58432	D	0.999999	D	0.89917	1.0	D	0.85130	0.997	D	0.88438	0.3040	10	0.87932	D	0	-15.2796	17.3974	0.87450	0.0:0.0:1.0:0.0	.	534	P26640	SYVC_HUMAN	V	534;239	ENSP00000364815:A534V;ENSP00000398317:A239V	ENSP00000364815:A534V	A	-	2	0	VARS	31860040	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	8.862000	0.92283	2.706000	0.92434	0.655000	0.94253	GCA		0.597	VARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076619.2		NM_006295	
VHL	7428	broad.mit.edu;hgsc.bcm.edu	37	3	10191648	10191648	+	Nonstop_Mutation	SNP	G	G	T			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr3:10191648G>T	ENST00000256474.2	+	3	1481	c.641G>T	c.(640-642)tGa>tTa	p.*214L	VHL_ENST00000477538.1_3'UTR|VHL_ENST00000345392.2_Nonstop_Mutation_p.*173L	NM_000551.3	NP_000542.1	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase	0					cell morphogenesis (GO:0000902)|cellular response to hypoxia (GO:0071456)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|transcription factor binding (GO:0008134)|ubiquitin protein ligase activity (GO:0061630)|ubiquitin-protein transferase activity (GO:0004842)	p.*214L(1)|p.D213fs(1)|p.?(1)		adrenal_gland(25)|autonomic_ganglia(3)|central_nervous_system(2)|endometrium(6)|kidney(1662)|large_intestine(14)|lung(6)|pancreas(18)|paratesticular_tissues(1)|pleura(1)|skin(1)|soft_tissue(24)|thyroid(3)|upper_aerodigestive_tract(3)	1769				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		ATGGGAGATTGAAGATTTCTG	0.458		1	"""D, Mis, N, F, S"""		"""renal, hemangioma, pheochromocytoma"""	"""renal, hemangioma, pheochromocytoma"""			von Hippel-Lindau disease;Pheochromocytoma (Adrenal), Familial;Chuvash Polycythemia																														yes	Rec	yes	von Hippel-Lindau syndrome	3	3p25	7428	von Hippel-Lindau syndrome gene		"""E, M, O"""	3	Unknown(1)|Complex - frameshift(1)|Nonstop extension(1)	kidney(3)											53.0	44.0	47.0					3																	10191648		2203	4300	6503	SO:0001578	stop_lost	7428	Familial Cancer Database	VHL; ;Erythrocytosis, Familial type 2	L15409	CCDS2597.1, CCDS2598.1	3p25.3	2014-09-17	2012-02-23		ENSG00000134086	ENSG00000134086			12687	protein-coding gene	gene with protein product		608537	"""von Hippel-Lindau syndrome"", ""von Hippel-Lindau tumor suppressor"""			9671762	Standard	NM_000551		Approved	VHL1	uc003bvc.3	P40337	OTTHUMG00000128668	ENST00000256474.2:c.641G>T	3.37:g.10191648G>T	ENSP00000256474:p.*214Leuext*14	Somatic		WXS	Illumina HiSeq	Phase_I	B2RE45|Q13599|Q6PDA9	Missense_Mutation	SNP	ENST00000256474.2	37	CCDS2597.1	.	.	.	.	.	.	.	.	.	.	G	8.125	0.781823	0.16120	.	.	ENSG00000134086	ENST00000256474;ENST00000345392;ENST00000450183	.	.	.	4.68	2.72	0.32119	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.4204	0.11477	0.1166:0.0:0.6586:0.2248	.	.	.	.	L	214;173;132	.	.	X	+	2	2	VHL	10166648	0.054000	0.20591	0.015000	0.15790	0.007000	0.05969	0.198000	0.17217	1.193000	0.43086	-0.152000	0.13540	TGA		0.458	VHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250559.1		NM_000551	
VPS11	55823	broad.mit.edu;ucsc.edu	37	11	118938631	118938631	+	Missense_Mutation	SNP	C	C	G			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr11:118938631C>G	ENST00000300793.6	+	1	139	c.97C>G	c.(97-99)Cct>Gct	p.P33A	RP11-110I1.13_ENST00000607709.1_RNA|RP11-110I1.14_ENST00000607857.1_lincRNA|VPS11_ENST00000527798.1_3'UTR	NM_021729.4	NP_068375.3	Q9H270	VPS11_HUMAN	vacuolar protein sorting 11 homolog (S. cerevisiae)	33					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	endocytic vesicle (GO:0030139)|endosome (GO:0005768)|HOPS complex (GO:0030897)|lysosomal membrane (GO:0005765)	nucleotide binding (GO:0000166)|zinc ion binding (GO:0008270)	p.P33A(1)		autonomic_ganglia(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)|skin(2)|urinary_tract(2)	29	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.88e-05)		CGGGGCCACACCTGCTTCTGG	0.607																																																	1	Substitution - Missense(1)	kidney(1)											29.0	32.0	31.0					11																	118938631		1967	4152	6119	SO:0001583	missense	55823			AB027508	CCDS73404.1	11q23	2008-02-05	2006-12-19			ENSG00000160695		"""RING-type (C3HC4) zinc fingers"""	14583	protein-coding gene	gene with protein product		608549	"""vacuolar protein sorting 11 (yeast homolog)"""				Standard	NM_021729		Approved	RNF108, PEP5	uc010ryx.2	Q9H270		ENST00000300793.6:c.97C>G	11.37:g.118938631C>G	ENSP00000475301:p.Pro33Ala	Somatic		WXS	Illumina GAIIx	Phase_I	Q8WY89|Q96EP8|Q9H6D9|Q9HCS6	Missense_Mutation	SNP	ENST00000300793.6	37																																																																																					0.607	VPS11-201	KNOWN	basic|appris_principal	protein_coding	protein_coding			NM_021729	
VSIG8	391123	hgsc.bcm.edu;ucsc.edu	37	1	159828569	159828572	+	Frame_Shift_Del	DEL	CTCG	CTCG	-	rs139423041		TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	CTCG	CTCG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr1:159828569_159828572delCTCG	ENST00000368100.1	-	2	315_318	c.180_183delCGAG	c.(178-183)atcgagfs	p.IE60fs	RP11-190A12.7_ENST00000544342.1_3'UTR	NM_001013661.1	NP_001013683.1	Q5VU13	VSIG8_HUMAN	V-set and immunoglobulin domain containing 8	60	Ig-like V-type 1.					integral component of membrane (GO:0016021)|intracellular (GO:0005622)	poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(1)|prostate(1)|upper_aerodigestive_tract(1)	8	all_hematologic(112;0.0597)					CCTGCATCCACTCGATGTCCAGCC	0.583																																																	0																																										SO:0001589	frameshift_variant	391123				CCDS30913.1	1q23.2	2013-01-11			ENSG00000243284	ENSG00000243284		"""Immunoglobulin superfamily / V-set domain containing"""	32063	protein-coding gene	gene with protein product							Standard	NM_001013661		Approved		uc001fuh.3	Q5VU13	OTTHUMG00000168834	ENST00000368100.1:c.180_183delCGAG	1.37:g.159828569_159828572delCTCG	ENSP00000357080:p.Ile60fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q5VU14	Frame_Shift_Del	DEL	ENST00000368100.1	37	CCDS30913.1																																																																																				0.583	VSIG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085978.8		NM_001013661	
YLPM1	56252	hgsc.bcm.edu;ucsc.edu	37	14	75287773	75287773	+	Frame_Shift_Del	DEL	A	A	-			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr14:75287773delA	ENST00000552421.1	+	16	4050	c.3926delA	c.(3925-3927)gatfs	p.D1309fs	YLPM1_ENST00000325680.7_Frame_Shift_Del_p.D2015fs|YLPM1_ENST00000238571.3_Frame_Shift_Del_p.D1780fs|YLPM1_ENST00000546901.1_3'UTR			P49750	YLPM1_HUMAN	YLP motif containing 1	1820					regulation of telomere maintenance (GO:0032204)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(24)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	62			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)		GAGATGGAAGATTTTGATGCA	0.358																																																	0													44.0	49.0	47.0					14																	75287773		1806	4033	5839	SO:0001589	frameshift_variant	56252			AK090435	CCDS45135.1	14q24.3	2014-06-13	2004-07-15	2004-07-15	ENSG00000119596	ENSG00000119596			17798	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 169"""		"""chromosome 14 open reading frame 170"""	C14orf170		7596406	Standard	NM_019589		Approved	ZAP, PPP1R169	uc001xqj.4	P49750	OTTHUMG00000172503	ENST00000552421.1:c.3926delA	14.37:g.75287773delA	ENSP00000447921:p.Asp1309fs	Somatic		WXS	Illumina HiSeq	Phase_I	P49752|Q96I64|Q9P1V7	Frame_Shift_Del	DEL	ENST00000552421.1	37																																																																																					0.358	YLPM1-008	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000404450.1		NM_019589	
ZFAND2B	130617	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	220072990	220072990	+	Silent	SNP	C	C	A			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr2:220072990C>A	ENST00000289528.5	+	5	642	c.447C>A	c.(445-447)atC>atA	p.I149I	ZFAND2B_ENST00000409336.1_Silent_p.I149I|ZFAND2B_ENST00000444522.2_Silent_p.I149I|ZFAND2B_ENST00000409206.1_Silent_p.I149I|ZFAND2B_ENST00000409594.1_Silent_p.I149I|ZFAND2B_ENST00000409097.1_Silent_p.I149I|ZFAND2B_ENST00000409217.1_Silent_p.I149I	NM_001270998.1|NM_001270999.1|NM_138802.2	NP_001257927.1|NP_001257928.1|NP_620157.1	Q8WV99	ZFN2B_HUMAN	zinc finger, AN1-type domain 2B	149						endoplasmic reticulum (GO:0005783)	zinc ion binding (GO:0008270)	p.I149I(1)		endometrium(2)|kidney(4)|lung(4)|upper_aerodigestive_tract(1)	11		Renal(207;0.0915)		Epithelial(149;1.16e-06)|all cancers(144;0.000191)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TTGCTGCCATCTCCAGAGCAC	0.532																																																	1	Substitution - coding silent(1)	kidney(1)											75.0	62.0	66.0					2																	220072990		2203	4300	6503	SO:0001819	synonymous_variant	130617			AK074571	CCDS2435.1, CCDS74656.1	2q35	2010-04-23	2005-08-22		ENSG00000158552	ENSG00000158552		"""Zinc fingers, AN1-type domain containing"""	25206	protein-coding gene	gene with protein product	"""arsenite inducible RNA associated protein-like"""	613474	"""zinc finger, AN1-type 2B"""			18467495	Standard	NM_138802		Approved	AIRAPL	uc002vka.4	Q8WV99	OTTHUMG00000133135	ENST00000289528.5:c.447C>A	2.37:g.220072990C>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q8NB98	Silent	SNP	ENST00000289528.5	37	CCDS2435.1																																																																																				0.532	ZFAND2B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256824.2		NM_138802	
ZMYM1	79830	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	35579833	35579833	+	Missense_Mutation	SNP	A	A	C			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr1:35579833A>C	ENST00000373330.1	+	11	2576	c.2402A>C	c.(2401-2403)aAg>aCg	p.K801T	ZMYM1_ENST00000373329.1_3'UTR|ZMYM1_ENST00000359858.4_Missense_Mutation_p.K801T			Q5SVZ6	ZMYM1_HUMAN	zinc finger, MYM-type 1	801						nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.K801T(1)		NS(1)|breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(5)|lung(8)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				AAAACATGCAAGAAACATATA	0.338																																																	1	Substitution - Missense(1)	kidney(1)											99.0	92.0	94.0					1																	35579833		1871	4104	5975	SO:0001583	missense	79830			AK096206	CCDS41302.1	1p34.3	2008-05-02	2005-09-12		ENSG00000197056	ENSG00000197056		"""Zinc fingers, MYM type"""	26253	protein-coding gene	gene with protein product			"""zinc finger, MYM domain containing 1"""			12477932	Standard	XM_005271216		Approved	FLJ23151, MYM	uc001bym.3	Q5SVZ6	OTTHUMG00000004374	ENST00000373330.1:c.2402A>C	1.37:g.35579833A>C	ENSP00000362427:p.Lys801Thr	Somatic		WXS	Illumina HiSeq	Phase_I	D3DPR7|Q7Z3Q4	Missense_Mutation	SNP	ENST00000373330.1	37	CCDS41302.1	.	.	.	.	.	.	.	.	.	.	A	3.478	-0.106404	0.06924	.	.	ENSG00000197056	ENST00000359858;ENST00000373329;ENST00000373330	T;T;T	0.21361	2.01;2.01;2.01	4.03	2.9	0.33743	Ribonuclease H-like (1);	0.272597	0.26321	N	0.025045	T	0.18002	0.0432	L	0.51422	1.61	0.25900	N	0.983369	P;P	0.46395	0.877;0.734	B;B	0.40636	0.335;0.254	T	0.08554	-1.0716	9	.	.	.	-2.6586	7.9948	0.30261	0.8995:0.0:0.1005:0.0	.	782;801	B4DSJ9;Q5SVZ6	.;ZMYM1_HUMAN	T	801;726;801	ENSP00000352920:K801T;ENSP00000362426:K726T;ENSP00000362427:K801T	.	K	+	2	0	ZMYM1	35352420	0.999000	0.42202	0.932000	0.37286	0.006000	0.05464	1.560000	0.36331	0.896000	0.36366	0.455000	0.32223	AAG		0.338	ZMYM1-001	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012705.1		NM_024772	
ZNF354B	117608	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	178309752	178309752	+	Missense_Mutation	SNP	A	A	T			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr5:178309752A>T	ENST00000322434.3	+	5	525	c.299A>T	c.(298-300)cAg>cTg	p.Q100L	RNU1-39P_ENST00000383897.1_RNA	NM_058230.2	NP_478137.1	Q96LW1	Z354B_HUMAN	zinc finger protein 354B	100					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q100L(1)		breast(2)|kidney(2)|large_intestine(7)|liver(2)|lung(2)|ovary(2)|stomach(3)|urinary_tract(1)	21	all_cancers(89;0.000639)|all_epithelial(37;0.000109)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			ACTCAAACTCAGGATTCATTT	0.358																																																	1	Substitution - Missense(1)	kidney(1)											61.0	62.0	61.0					5																	178309752		2196	4296	6492	SO:0001583	missense	117608			AK057737	CCDS4439.1	5q35.3	2013-01-08			ENSG00000178338	ENSG00000178338		"""Zinc fingers, C2H2-type"", ""-"""	17197	protein-coding gene	gene with protein product							Standard	NM_058230		Approved	KID2, FLJ25008	uc003mjl.3	Q96LW1	OTTHUMG00000130896	ENST00000322434.3:c.299A>T	5.37:g.178309752A>T	ENSP00000327143:p.Gln100Leu	Somatic		WXS	Illumina HiSeq	Phase_I	A8K0V2|Q5U5Z4	Missense_Mutation	SNP	ENST00000322434.3	37	CCDS4439.1	.	.	.	.	.	.	.	.	.	.	A	8.750	0.921124	0.17982	.	.	ENSG00000178338	ENST00000322434;ENST00000520377	T;T	0.06371	3.31;6.09	3.53	3.53	0.40419	.	.	.	.	.	T	0.03651	0.0104	N	0.08118	0	0.09310	N	1	B	0.27498	0.18	B	0.24974	0.057	T	0.40942	-0.9536	9	0.39692	T	0.17	.	8.3805	0.32468	1.0:0.0:0.0:0.0	.	100	Q96LW1	Z354B_HUMAN	L	100	ENSP00000327143:Q100L;ENSP00000429827:Q100L	ENSP00000327143:Q100L	Q	+	2	0	ZNF354B	178242358	0.055000	0.20627	0.924000	0.36721	0.213000	0.24496	2.361000	0.44160	1.474000	0.48178	0.459000	0.35465	CAG		0.358	ZNF354B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253482.1		NM_058230	
ZNF57	126295	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	2917051	2917051	+	Missense_Mutation	SNP	G	G	C			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr19:2917051G>C	ENST00000306908.5	+	4	580	c.432G>C	c.(430-432)aaG>aaC	p.K144N	AC006277.2_ENST00000520090.2_RNA|ZNF57_ENST00000523428.1_Missense_Mutation_p.K112N	NM_173480.2	NP_775751.1	Q68EA5	ZNF57_HUMAN	zinc finger protein 57	144					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.K144N(1)		endometrium(1)|kidney(2)|large_intestine(5)|lung(2)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	18				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|GBM - Glioblastoma multiforme(1328;0.00161)|STAD - Stomach adenocarcinoma(1328;0.18)		AATGCACCAAGTGCAGGACAG	0.448																																					NSCLC(150;910 1964 4303 10464 26498)												1	Substitution - Missense(1)	kidney(1)											117.0	93.0	101.0					19																	2917051		2203	4300	6503	SO:0001583	missense	126295			M88368	CCDS12098.1	19p13.3	2013-01-08			ENSG00000171970	ENSG00000171970		"""Zinc fingers, C2H2-type"", ""-"""	13125	protein-coding gene	gene with protein product			"""zinc finger protein 424"""	ZNF424		1505991	Standard	NM_173480		Approved		uc002lwr.3	Q68EA5	OTTHUMG00000164485	ENST00000306908.5:c.432G>C	19.37:g.2917051G>C	ENSP00000303696:p.Lys144Asn	Somatic		WXS	Illumina HiSeq	Phase_I	Q8N6R9	Missense_Mutation	SNP	ENST00000306908.5	37	CCDS12098.1	.	.	.	.	.	.	.	.	.	.	G	13.39	2.221508	0.39300	.	.	ENSG00000171970	ENST00000306908;ENST00000395204;ENST00000522294;ENST00000523428	T;T;T	0.52526	0.66;2.43;0.66	2.21	-1.25	0.09405	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.34164	0.0888	L	0.28115	0.83	0.09310	N	1	P	0.47191	0.891	P	0.45558	0.485	T	0.23404	-1.0189	9	0.59425	D	0.04	.	5.7456	0.18118	0.6608:0.0:0.3392:0.0	.	144	Q68EA5	ZNF57_HUMAN	N	144;146;112;112	ENSP00000303696:K144N;ENSP00000430905:K112N;ENSP00000430223:K112N	ENSP00000303696:K144N	K	+	3	2	ZNF57	2868051	0.000000	0.05858	0.001000	0.08648	0.178000	0.23041	-0.993000	0.03720	-0.081000	0.12662	0.505000	0.49811	AAG		0.448	ZNF57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378969.1		NM_173480	
ZNF780B	163131	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	40540306	40540306	+	Silent	SNP	G	G	A			TCGA-CJ-5672-01A-11D-1534-10	TCGA-CJ-5672-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61497c42-78f2-43d4-b2ab-2b1e655271a8	495879a9-ed52-43a8-99ea-37ca7008c323	g.chr19:40540306G>A	ENST00000434248.1	-	5	2525	c.2460C>T	c.(2458-2460)atC>atT	p.I820I	ZNF780B_ENST00000221355.6_Silent_p.I672I	NM_001005851.2	NP_001005851.1	Q9Y6R6	Z780B_HUMAN	zinc finger protein 780B	820					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.I820I(2)		endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	23	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					AGTTGCTACTGATGTCTGAAG	0.388																																																	2	Substitution - coding silent(2)	kidney(2)											62.0	67.0	65.0					19																	40540306		2177	4289	6466	SO:0001819	synonymous_variant	163131			AK127063	CCDS46077.1	19q13.2	2013-01-08	2006-08-15	2006-08-15	ENSG00000128000	ENSG00000128000		"""Zinc fingers, C2H2-type"", ""-"""	33109	protein-coding gene	gene with protein product			"""zinc finger protein 779"""	ZNF779			Standard	NM_001005851		Approved		uc002omu.3	Q9Y6R6	OTTHUMG00000155118	ENST00000434248.1:c.2460C>T	19.37:g.40540306G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B9EH00	Silent	SNP	ENST00000434248.1	37	CCDS46077.1																																																																																				0.388	ZNF780B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338466.1		NM_001005851	
