#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ALS2CR12	130540	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	202172343	202172343	+	Missense_Mutation	SNP	T	T	C			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr2:202172343T>C	ENST00000286190.5	-	10	824	c.778A>G	c.(778-780)Aaa>Gaa	p.K260E	ALS2CR12_ENST00000448967.1_5'Flank|ALS2CR12_ENST00000392257.3_Missense_Mutation_p.K260E|ALS2CR12_ENST00000439709.1_Missense_Mutation_p.K260E|ALS2CR12_ENST00000405148.2_Missense_Mutation_p.K260E			Q96Q35	AL2SB_HUMAN	amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 12	260					regulation of GTPase activity (GO:0043087)	outer dense fiber (GO:0001520)|sperm fibrous sheath (GO:0035686)|sperm flagellum (GO:0036126)		p.K260E(1)		NS(1)|breast(5)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(2)	21						GTCATCTTTTTTTCTGTGGAA	0.363																																																	1	Substitution - Missense(1)	kidney(1)											120.0	124.0	123.0					2																	202172343		2203	4298	6501	SO:0001583	missense	130540			AB053314	CCDS2346.1, CCDS46488.1	2q33.1	2009-10-06			ENSG00000155749	ENSG00000155749			14439	protein-coding gene	gene with protein product							Standard	XM_006712272		Approved		uc002uya.4	Q96Q35	OTTHUMG00000132824	ENST00000286190.5:c.778A>G	2.37:g.202172343T>C	ENSP00000286190:p.Lys260Glu	Somatic		WXS	Illumina HiSeq	Phase_I	G5E9S3|Q53TT6|Q8N1B6	Missense_Mutation	SNP	ENST00000286190.5	37	CCDS2346.1	.	.	.	.	.	.	.	.	.	.	T	10.85	1.467978	0.26335	.	.	ENSG00000155749	ENST00000286190;ENST00000405148;ENST00000392257;ENST00000439709	T;T;T;T	0.41400	1.0;1.0;1.0;1.0	5.53	-2.71	0.05986	.	1.048030	0.07475	N	0.902821	T	0.25121	0.0610	N	0.22421	0.69	0.09310	N	1	B;B	0.19200	0.034;0.034	B;B	0.18871	0.023;0.023	T	0.24297	-1.0164	10	0.36615	T	0.2	0.3994	5.7161	0.17960	0.2732:0.0:0.2548:0.472	.	260;260	Q96Q35;G5E9S3	AL2SB_HUMAN;.	E	260	ENSP00000286190:K260E;ENSP00000385098:K260E;ENSP00000376086:K260E;ENSP00000412073:K260E	ENSP00000286190:K260E	K	-	1	0	ALS2CR12	201880588	0.001000	0.12720	0.020000	0.16555	0.140000	0.21249	-0.809000	0.04510	-0.456000	0.07043	0.528000	0.53228	AAA		0.363	ALS2CR12-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256286.1		NM_139163	
ASB4	51666	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	95157534	95157534	+	Silent	SNP	C	C	T			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr7:95157534C>T	ENST00000325885.5	+	3	968	c.897C>T	c.(895-897)cgC>cgT	p.R299R	ASB4_ENST00000428113.1_Silent_p.R299R	NM_016116.2	NP_057200.1	Q9Y574	ASB4_HUMAN	ankyrin repeat and SOCS box containing 4	299					intracellular signal transduction (GO:0035556)|positive regulation of vasculogenesis (GO:2001214)|protein autoubiquitination (GO:0051865)	Cul2-RING ubiquitin ligase complex (GO:0031462)|Cul5-RING ubiquitin ligase complex (GO:0031466)	ubiquitin-protein transferase activity (GO:0004842)	p.R299R(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(8)|pancreas(1)|prostate(1)|skin(2)	20	all_cancers(62;2.27e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.218)|all_lung(186;0.246)		STAD - Stomach adenocarcinoma(171;0.0151)			CCTCCGTGCGCCCTGCTGCCC	0.582											OREG0018172	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					1	Substitution - coding silent(1)	kidney(1)											78.0	56.0	64.0					7																	95157534		2203	4300	6503	SO:0001819	synonymous_variant	51666			AF156779	CCDS5641.1, CCDS5642.1	7q21-q22	2013-01-10	2011-01-25		ENSG00000005981	ENSG00000005981		"""Ankyrin repeat domain containing"""	16009	protein-coding gene	gene with protein product		605761	"""ankyrin repeat and SOCS box-containing 4"""				Standard	NM_145872		Approved	ASB-4	uc011kij.2	Q9Y574	OTTHUMG00000153960	ENST00000325885.5:c.897C>T	7.37:g.95157534C>T		Somatic	1310	WXS	Illumina HiSeq	Phase_I	A4D1H6|O14586|Q14D68|Q8TBT2	Silent	SNP	ENST00000325885.5	37	CCDS5641.1																																																																																				0.582	ASB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333225.2		NM_016116	
ATP2B1	490	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	90003742	90003742	+	Missense_Mutation	SNP	A	A	T			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr12:90003742A>T	ENST00000428670.3	-	15	2870	c.2414T>A	c.(2413-2415)cTa>cAa	p.L805Q	ATP2B1_ENST00000393164.2_Missense_Mutation_p.L548Q|ATP2B1_ENST00000359142.3_Missense_Mutation_p.L805Q|ATP2B1_ENST00000261173.2_Missense_Mutation_p.L805Q|ATP2B1_ENST00000348959.3_Missense_Mutation_p.L805Q			P20020	AT2B1_HUMAN	ATPase, Ca++ transporting, plasma membrane 1	805					blood coagulation (GO:0007596)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)	p.L805Q(2)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(13)|lung(15)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	45						TGCTTTCTTTAGTGCTGGGCC	0.363																																																	2	Substitution - Missense(2)	kidney(2)											130.0	117.0	121.0					12																	90003742		2203	4300	6503	SO:0001583	missense	490			J04027	CCDS9035.1, CCDS41817.1	12q21.33	2010-04-20			ENSG00000070961	ENSG00000070961	3.6.3.8	"""ATPases / P-type"""	814	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 1"""	108731				1674727	Standard	NM_001682		Approved	PMCA1	uc001tbh.3	P20020		ENST00000428670.3:c.2414T>A	12.37:g.90003742A>T	ENSP00000392043:p.Leu805Gln	Somatic		WXS	Illumina HiSeq	Phase_I	Q12992|Q12993|Q13819|Q13820|Q13821|Q16504|Q93082	Missense_Mutation	SNP	ENST00000428670.3	37	CCDS9035.1	.	.	.	.	.	.	.	.	.	.	A	27.1	4.796074	0.90453	.	.	ENSG00000070961	ENST00000261173;ENST00000348959;ENST00000359142;ENST00000428670;ENST00000393164	D;D;D;D;D	0.97906	-4.6;-4.6;-4.6;-4.6;-4.6	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	D	0.99441	0.9802	H	0.99825	4.815	0.80722	D	1	P;D;D	0.89917	0.928;1.0;1.0	P;D;D	0.91635	0.541;0.999;0.998	D	0.97892	1.0298	10	0.87932	D	0	-3.9893	16.3786	0.83431	1.0:0.0:0.0:0.0	.	805;805;805	P20020-3;P20020-2;P20020-6	.;.;.	Q	805;805;805;805;548	ENSP00000261173:L805Q;ENSP00000343599:L805Q;ENSP00000352054:L805Q;ENSP00000392043:L805Q;ENSP00000376869:L548Q	ENSP00000261173:L805Q	L	-	2	0	ATP2B1	88527873	0.992000	0.36948	0.836000	0.33094	0.978000	0.69477	9.339000	0.96797	2.323000	0.78572	0.528000	0.53228	CTA		0.363	ATP2B1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406653.1		NM_001682	
ATP6V1D	51382	hgsc.bcm.edu;ucsc.edu	37	14	67819728	67819728	+	Frame_Shift_Del	DEL	T	T	-			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr14:67819728delT	ENST00000216442.7	-	2	621	c.71delA	c.(70-72)aagfs	p.K24fs	ATP6V1D_ENST00000555431.1_Intron|ATP6V1D_ENST00000554236.1_Frame_Shift_Del_p.K24fs|ATP6V1D_ENST00000555474.1_Frame_Shift_Del_p.K24fs	NM_015994.3	NP_057078.1	Q9Y5K8	VATD_HUMAN	ATPase, H+ transporting, lysosomal 34kDa, V1 subunit D	24					cellular iron ion homeostasis (GO:0006879)|cilium assembly (GO:0042384)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|protein localization to cilium (GO:0061512)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|vacuolar proton-transporting V-type ATPase complex (GO:0016471)	ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			lung(3)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	7				all cancers(60;0.000739)|OV - Ovarian serous cystadenocarcinoma(108;0.00597)|BRCA - Breast invasive adenocarcinoma(234;0.00957)		CTGTGCTCCCTTTAAACGAGC	0.378																																																	0													238.0	246.0	244.0					14																	67819728		2203	4300	6503	SO:0001589	frameshift_variant	51382			AF145316	CCDS9780.1	14q23-q24.2	2010-04-21	2002-08-29	2002-05-10	ENSG00000100554	ENSG00000100554		"""ATPases / V-type"""	13527	protein-coding gene	gene with protein product		609398	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump)"""	ATP6M		9442887	Standard	NM_015994		Approved	VATD, VMA8	uc001xjf.3	Q9Y5K8		ENST00000216442.7:c.71delA	14.37:g.67819728delT	ENSP00000216442:p.Lys24fs	Somatic		WXS	Illumina HiSeq	Phase_I	B2RE33|Q9Y688	Frame_Shift_Del	DEL	ENST00000216442.7	37	CCDS9780.1																																																																																				0.378	ATP6V1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412511.1		NM_015994	
ATXN7	6314	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	63981575	63981575	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr3:63981575C>A	ENST00000295900.6	+	12	2627	c.2077C>A	c.(2077-2079)Caa>Aaa	p.Q693K	ATXN7_ENST00000398590.3_Missense_Mutation_p.Q693K|ATXN7_ENST00000538065.1_Missense_Mutation_p.Q693K|ATXN7_ENST00000487717.1_Missense_Mutation_p.Q693K|ATXN7_ENST00000484332.1_Missense_Mutation_p.Q548K	NM_000333.3	NP_000324.1	O15265	ATX7_HUMAN	ataxin 7	693	Ser-rich.				cell death (GO:0008219)|chromatin organization (GO:0006325)|histone deubiquitination (GO:0016578)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of phosphorylation (GO:0042326)|nucleus organization (GO:0006997)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	chromatin binding (GO:0003682)	p.Q693K(2)		NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(7)|lung(12)|prostate(2)|stomach(1)|urinary_tract(3)	35		Prostate(884;0.0181)		BRCA - Breast invasive adenocarcinoma(55;0.000614)|KIRC - Kidney renal clear cell carcinoma(15;0.00294)|Kidney(15;0.00305)		CACTAACTGTCAAAATGCCAG	0.502																																																	2	Substitution - Missense(2)	kidney(2)											68.0	79.0	75.0					3																	63981575		2130	4259	6389	SO:0001583	missense	6314			AJ000517	CCDS43102.1, CCDS46861.1, CCDS46861.2, CCDS54603.1	3p21.1-p12	2014-09-17	2004-08-12	2004-08-12	ENSG00000163635	ENSG00000163635		"""Ataxins"""	10560	protein-coding gene	gene with protein product		607640	"""spinocerebellar ataxia 7 (olivopontocerebellar atrophy with retinal degeneration)"""	SCA7		7647798, 10598805	Standard	NM_000333		Approved	OPCA3, ADCAII	uc021wzy.1	O15265	OTTHUMG00000158763	ENST00000295900.6:c.2077C>A	3.37:g.63981575C>A	ENSP00000295900:p.Gln693Lys	Somatic		WXS	Illumina HiSeq	Phase_I	B4E207|E9PHP9|O75328|O75329|Q9Y6P8	Missense_Mutation	SNP	ENST00000295900.6	37	CCDS43102.1	.	.	.	.	.	.	.	.	.	.	C	10.16	1.274140	0.23221	.	.	ENSG00000163635	ENST00000398590;ENST00000295900;ENST00000487717;ENST00000538065;ENST00000484332	T;T;T;T;T	0.12984	2.63;2.64;2.64;2.63;2.64	4.98	2.8	0.32819	.	0.534882	0.20625	N	0.088692	T	0.04952	0.0133	N	0.08118	0	0.21355	N	0.999716	B;B;B	0.11235	0.0;0.004;0.001	B;B;B	0.11329	0.0;0.006;0.002	T	0.44498	-0.9324	10	0.02654	T	1	-4.4552	7.2027	0.25889	0.4479:0.4279:0.1242:0.0	.	548;693;693	E9PHP9;O15265-2;O15265	.;.;ATX7_HUMAN	K	693;693;693;693;548	ENSP00000381590:Q693K;ENSP00000295900:Q693K;ENSP00000420234:Q693K;ENSP00000439585:Q693K;ENSP00000428277:Q548K	ENSP00000295900:Q693K	Q	+	1	0	ATXN7	63956615	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	2.616000	0.46376	2.325000	0.78763	0.650000	0.86243	CAA		0.502	ATXN7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352070.1		NM_000333	
C10orf53	282966	broad.mit.edu	37	10	50887761	50887761	+	Frame_Shift_Del	DEL	G	G	-			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr10:50887761delG	ENST00000374111.3	+	1	30	c.18delG	c.(16-18)gtgfs	p.V7fs	CHAT_ENST00000455728.2_Intron|C10orf53_ENST00000374113.3_Frame_Shift_Del_p.V7fs|C10orf53_ENST00000374112.3_Frame_Shift_Del_p.V7fs|C10orf53_ENST00000535836.1_Frame_Shift_Del_p.V7fs	NM_001042427.1	NP_001035892.1	Q8N6V4	CJ053_HUMAN	chromosome 10 open reading frame 53	7										endometrium(1)|lung(6)	7		all_neural(218;0.107)				AGAACGCAGTGGTCATCCTGC	0.697																																																	0													23.0	17.0	19.0					10																	50887761		1918	3623	5541	SO:0001589	frameshift_variant	282966			BC028127	CCDS31202.1, CCDS41521.1	10q11.23	2012-05-24			ENSG00000178645	ENSG00000178645			27421	protein-coding gene	gene with protein product						12477932	Standard	NM_182554		Approved	Em:AC069546.1	uc001jid.1	Q8N6V4	OTTHUMG00000018199	ENST00000374111.3:c.18delG	10.37:g.50887761delG	ENSP00000363225:p.Val7fs	Somatic		WXS	Illumina GAIIx	Phase_I	A6NI81|A6NLE0|B9ZVK6	Frame_Shift_Del	DEL	ENST00000374111.3	37	CCDS41521.1																																																																																				0.697	C10orf53-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048005.1		NM_182554	
C11orf42	160298	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	6231300	6231300	+	Missense_Mutation	SNP	G	G	A	rs148934108		TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr11:6231300G>A	ENST00000316375.2	+	2	343	c.293G>A	c.(292-294)cGg>cAg	p.R98Q	FAM160A2_ENST00000529360.1_5'Flank	NM_173525.2	NP_775796.2	Q8N5U0	CK042_HUMAN	chromosome 11 open reading frame 42	98								p.R98Q(1)		endometrium(3)|kidney(3)|large_intestine(1)|lung(4)|ovary(2)|skin(1)|soft_tissue(1)	15		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;1.95e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CACTGCACTCGGGAATACTCA	0.607																																																	1	Substitution - Missense(1)	kidney(1)						G	GLN/ARG	0,4402		0,0,2201	67.0	68.0	68.0		293	4.3	1.0	11	dbSNP_134	68	1,8591	1.2+/-3.3	0,1,4295	no	missense	C11orf42	NM_173525.2	43	0,1,6496	AA,AG,GG		0.0116,0.0,0.0077	benign	98/334	6231300	1,12993	2201	4296	6497	SO:0001583	missense	160298			BC031612	CCDS7759.1	11p15.4	2012-08-09			ENSG00000180878	ENSG00000180878			28541	protein-coding gene	gene with protein product						12477932	Standard	NM_173525		Approved	MGC34805	uc001mcj.3	Q8N5U0	OTTHUMG00000133377	ENST00000316375.2:c.293G>A	11.37:g.6231300G>A	ENSP00000321021:p.Arg98Gln	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000316375.2	37	CCDS7759.1	.	.	.	.	.	.	.	.	.	.	G	9.049	0.991704	0.18966	0.0	1.16E-4	ENSG00000180878	ENST00000316375	T	0.47528	0.84	5.22	4.31	0.51392	.	0.000000	0.50627	D	0.000111	T	0.31263	0.0791	N	0.24115	0.695	0.28666	N	0.905885	B	0.12630	0.006	B	0.12156	0.007	T	0.15378	-1.0439	10	0.26408	T	0.33	-16.1366	9.8198	0.40876	0.0931:0.0:0.9069:0.0	.	98	Q8N5U0	CK042_HUMAN	Q	98	ENSP00000321021:R98Q	ENSP00000321021:R98Q	R	+	2	0	C11orf42	6187876	0.991000	0.36638	1.000000	0.80357	0.975000	0.68041	1.034000	0.30204	1.439000	0.47511	-0.439000	0.05793	CGG		0.607	C11orf42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257227.2		NM_173525	
C11orf42	160298	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	6231320	6231320	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr11:6231320C>T	ENST00000316375.2	+	2	363	c.313C>T	c.(313-315)Cga>Tga	p.R105*	FAM160A2_ENST00000529360.1_5'Flank	NM_173525.2	NP_775796.2	Q8N5U0	CK042_HUMAN	chromosome 11 open reading frame 42	105								p.R105R(1)|p.R105*(1)		endometrium(3)|kidney(3)|large_intestine(1)|lung(4)|ovary(2)|skin(1)|soft_tissue(1)	15		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;1.95e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ACCAAATGGCCGAGCAGAGAG	0.577																																																	2	Substitution - Nonsense(1)|Substitution - coding silent(1)	lung(1)|kidney(1)											80.0	81.0	81.0					11																	6231320		2201	4296	6497	SO:0001587	stop_gained	160298			BC031612	CCDS7759.1	11p15.4	2012-08-09			ENSG00000180878	ENSG00000180878			28541	protein-coding gene	gene with protein product						12477932	Standard	NM_173525		Approved	MGC34805	uc001mcj.3	Q8N5U0	OTTHUMG00000133377	ENST00000316375.2:c.313C>T	11.37:g.6231320C>T	ENSP00000321021:p.Arg105*	Somatic		WXS	Illumina HiSeq	Phase_I		Nonsense_Mutation	SNP	ENST00000316375.2	37	CCDS7759.1	.	.	.	.	.	.	.	.	.	.	C	16.45	3.125554	0.56721	.	.	ENSG00000180878	ENST00000316375	.	.	.	5.22	-0.704	0.11256	.	0.292440	0.24007	N	0.042403	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.0391	3.2699	0.06878	0.4649:0.3098:0.1384:0.087	.	.	.	.	X	105	.	ENSP00000321021:R105X	R	+	1	2	C11orf42	6187896	0.784000	0.28713	0.929000	0.37066	0.936000	0.57629	-0.038000	0.12144	0.041000	0.15688	0.484000	0.47621	CGA		0.577	C11orf42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257227.2		NM_173525	
C11orf42	160298	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	6231744	6231744	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr11:6231744C>T	ENST00000316375.2	+	2	787	c.737C>T	c.(736-738)aCt>aTt	p.T246I	FAM160A2_ENST00000529360.1_5'Flank	NM_173525.2	NP_775796.2	Q8N5U0	CK042_HUMAN	chromosome 11 open reading frame 42	246	Pro-rich.							p.T246I(1)		endometrium(3)|kidney(3)|large_intestine(1)|lung(4)|ovary(2)|skin(1)|soft_tissue(1)	15		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;1.95e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GCTGATACAACTGAAGCTGCT	0.612																																																	1	Substitution - Missense(1)	kidney(1)											48.0	54.0	52.0					11																	6231744		2201	4296	6497	SO:0001583	missense	160298			BC031612	CCDS7759.1	11p15.4	2012-08-09			ENSG00000180878	ENSG00000180878			28541	protein-coding gene	gene with protein product						12477932	Standard	NM_173525		Approved	MGC34805	uc001mcj.3	Q8N5U0	OTTHUMG00000133377	ENST00000316375.2:c.737C>T	11.37:g.6231744C>T	ENSP00000321021:p.Thr246Ile	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000316375.2	37	CCDS7759.1	.	.	.	.	.	.	.	.	.	.	C	0.151	-1.091222	0.01858	.	.	ENSG00000180878	ENST00000316375	T	0.43688	0.94	5.13	0.888	0.19206	.	0.786555	0.11473	N	0.560477	T	0.17577	0.0422	N	0.08118	0	0.09310	N	1	B	0.13594	0.008	B	0.13407	0.009	T	0.25710	-1.0124	10	0.15499	T	0.54	1.6062	3.2956	0.06965	0.1824:0.5158:0.0:0.3018	.	246	Q8N5U0	CK042_HUMAN	I	246	ENSP00000321021:T246I	ENSP00000321021:T246I	T	+	2	0	C11orf42	6188320	0.000000	0.05858	0.002000	0.10522	0.542000	0.35054	0.003000	0.13083	0.332000	0.23536	0.585000	0.79938	ACT		0.612	C11orf42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257227.2		NM_173525	
SWSAP1	126074	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	11486488	11486489	+	Frame_Shift_Del	DEL	TC	TC	-			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	TC	TC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr19:11486488_11486489delTC	ENST00000312423.2	+	2	545_546	c.486_487delTC	c.(484-489)tttcctfs	p.P163fs	CTD-2342J14.6_ENST00000590399.1_RNA	NM_175871.3	NP_787067.2	Q6NVH7	SWAP1_HUMAN	SWIM-type zinc finger 7 associated protein 1	163					ATP catabolic process (GO:0006200)|double-strand break repair via homologous recombination (GO:0000724)|protein stabilization (GO:0050821)	nucleus (GO:0005634)|Shu complex (GO:0097196)	ATPase activity (GO:0016887)|single-stranded DNA binding (GO:0003697)										AGCGGTATTTTCCTGCCCAGTG	0.668																																																	0																																										SO:0001589	frameshift_variant	0			AK092438	CCDS12259.1	19p13.2	2011-11-24	2011-11-24	2011-11-24	ENSG00000173928	ENSG00000173928			26638	protein-coding gene	gene with protein product	"""zinc finger, SWIM-type containing 7 associated protein 1"", ""SWS1-associated protein 1"""	614536	"""chromosome 19 open reading frame 39"""	C19orf39		21965664	Standard	NM_175871		Approved	FLJ35119, ZSWIM7AP1, SWS1AP1	uc002mrg.1	Q6NVH7		ENST00000312423.2:c.486_487delTC	19.37:g.11486488_11486489delTC	ENSP00000310008:p.Pro163fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q8NAM1	Frame_Shift_Del	DEL	ENST00000312423.2	37	CCDS12259.1																																																																																				0.668	SWSAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458789.1		NM_175871	
C1S	716	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	7177889	7177889	+	Silent	SNP	G	G	T			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr12:7177889G>T	ENST00000406697.1	+	15	2629	c.2001G>T	c.(1999-2001)cgG>cgT	p.R667R	C1S_ENST00000328916.3_Silent_p.R667R|C1S_ENST00000360817.5_Silent_p.R667R|C1S_ENST00000402681.3_Silent_p.R500R			P09871	C1S_HUMAN	complement component 1, s subcomponent	667	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|serine-type endopeptidase activity (GO:0004252)	p.R667R(1)		breast(1)|endometrium(5)|kidney(2)|large_intestine(8)|liver(4)|lung(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	33					Abciximab(DB00054)|Adalimumab(DB00051)|Basiliximab(DB00074)|Cetuximab(DB00002)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Muromonab(DB00075)|Rituximab(DB00073)|Trastuzumab(DB00072)	TCTACACACGGGTAAAGAACT	0.537																																					GBM(156;750 1943 12971 24779 31015)												1	Substitution - coding silent(1)	kidney(1)											108.0	116.0	113.0					12																	7177889		2203	4300	6503	SO:0001819	synonymous_variant	716				CCDS31735.1	12p13	2014-09-17			ENSG00000182326	ENSG00000182326	3.4.21.42	"""Complement system"""	1247	protein-coding gene	gene with protein product		120580					Standard	NM_201442		Approved		uc001qsl.3	P09871	OTTHUMG00000150305	ENST00000406697.1:c.2001G>T	12.37:g.7177889G>T		Somatic		WXS	Illumina HiSeq	Phase_I	D3DUT4|Q9UCU7|Q9UCU8|Q9UCU9|Q9UCV0|Q9UCV1|Q9UCV2|Q9UCV3|Q9UCV4|Q9UCV5|Q9UM14	Silent	SNP	ENST00000406697.1	37	CCDS31735.1																																																																																				0.537	C1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317481.1		NM_001734	
C1R	715	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	7242701	7242701	+	Missense_Mutation	SNP	A	A	T			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr12:7242701A>T	ENST00000542285.1	-	3	521	c.372T>A	c.(370-372)aaT>aaA	p.N124K	C1R_ENST00000602298.1_5'Flank			P00736	C1R_HUMAN	complement component 1, r subcomponent	125	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|immune response (GO:0006955)|innate immune response (GO:0045087)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.N139K(1)		endometrium(4)|kidney(1)|large_intestine(4)|lung(6)|pancreas(1)	16					Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	TGATGGTCCCATTCTCCTCGT	0.532																																																	1	Substitution - Missense(1)	kidney(1)											57.0	59.0	58.0					12																	7242701		1956	4138	6094	SO:0001583	missense	715			M14058		12p13.31	2014-05-14			ENSG00000159403	ENSG00000159403	3.4.21.41	"""Complement system"""	1246	protein-coding gene	gene with protein product		613785					Standard	NM_001733		Approved		uc010sfy.2	P00736	OTTHUMG00000168149	ENST00000542285.1:c.372T>A	12.37:g.7242701A>T	ENSP00000438615:p.Asn124Lys	Somatic		WXS	Illumina HiSeq	Phase_I	A6NJQ8|Q68D77|Q8J012	Missense_Mutation	SNP	ENST00000542285.1	37		.	.	.	.	.	.	.	.	.	.	A	20.4	3.982800	0.74474	.	.	ENSG00000159403	ENST00000542220;ENST00000536053;ENST00000535233;ENST00000290575;ENST00000542285;ENST00000540610;ENST00000543835;ENST00000541042;ENST00000540242;ENST00000538050	T;T;T;T;T;T	0.34275	2.41;1.37;1.37;1.37;2.41;1.37	5.43	-4.43	0.03568	CUB (5);	0.144532	0.48286	D	0.000196	T	0.52273	0.1724	.	.	.	0.80722	D	1	D;D;B	0.71674	0.998;0.994;0.27	D;D;B	0.67231	0.939;0.95;0.27	T	0.58086	-0.7698	9	0.62326	D	0.03	.	12.7581	0.57347	0.5187:0.0:0.4813:0.0	.	91;139;125	F5H2D0;B4DPQ0;P00736	.;.;C1R_HUMAN	K	125;139;91;139;124;20;100;20;125;20	ENSP00000438615:N124K;ENSP00000439223:N20K;ENSP00000445285:N100K;ENSP00000441601:N20K;ENSP00000442946:N125K;ENSP00000444009:N20K	ENSP00000290575:N139K	N	-	3	2	C1R	7133842	0.131000	0.22433	0.947000	0.38551	0.977000	0.68977	-0.543000	0.06084	-0.856000	0.04120	0.379000	0.24179	AAT		0.532	C1R-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding			NM_001733	
C4orf48	401115	broad.mit.edu;ucsc.edu	37	4	2045589	2045589	+	Splice_Site	SNP	C	C	T			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr4:2045589C>T	ENST00000409860.1	+	4	375	c.224C>T	c.(223-225)aCg>aTg	p.T75M	C4orf48_ENST00000382878.3_Splice_Site_p.T119M|C4orf48_ENST00000409248.4_Splice_Site_p.T108M	NM_001141936.2	NP_001135408	Q5BLP8	CD048_HUMAN	chromosome 4 open reading frame 48	75						extracellular region (GO:0005576)		p.T119M(1)		kidney(1)|skin(2)	3						GCTTTGCAGACGGAGACCCTA	0.657																																																	1	Substitution - Missense(1)	kidney(1)											50.0	55.0	54.0					4																	2045589		692	1591	2283	SO:0001630	splice_region_variant	401115				CCDS47000.1, CCDS47000.2, CCDS54707.1	4p16.3	2012-09-03			ENSG00000243449	ENSG00000243449			34437	protein-coding gene	gene with protein product		614690				21287218	Standard	NM_001141936		Approved		uc021xkn.1	Q5BLP8	OTTHUMG00000154503	ENST00000409860.1:c.223-1C>T	4.37:g.2045589C>T		Somatic		WXS	Illumina GAIIx	Phase_I	B6ZDN0|B7ZBI7|B7ZBI8	Missense_Mutation	SNP	ENST00000409860.1	37	CCDS47000.2	.	.	.	.	.	.	.	.	.	.	C	17.83	3.484825	0.63962	.	.	ENSG00000243449	ENST00000382878;ENST00000409248;ENST00000409860	.	.	.	3.89	3.89	0.44902	.	0.000000	0.64402	D	0.000001	T	0.77438	0.4130	.	.	.	0.51767	D	0.999935	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	T	0.80564	-0.1326	8	0.87932	D	0	-30.4937	12.0562	0.53536	0.0:1.0:0.0:0.0	.	75;119	Q5BLP8;Q5BLP8-2	CD048_HUMAN;.	M	119;108;75	.	ENSP00000372331:T119M	T	+	2	0	C4orf48	2015387	0.993000	0.37304	0.999000	0.59377	0.505000	0.33919	2.976000	0.49289	2.116000	0.64780	0.561000	0.74099	ACG		0.657	C4orf48-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335537.1		NM_001141936	Missense_Mutation
ADGB	79747	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	146975333	146975333	+	Silent	SNP	C	C	G			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr6:146975333C>G	ENST00000397944.3	+	4	469	c.393C>G	c.(391-393)ctC>ctG	p.L131L	ADGB_ENST00000367493.3_5'UTR	NM_024694.3	NP_078970.3	Q8N7X0	ADGB_HUMAN	androglobin	131	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				oxygen transport (GO:0015671)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)	p.L131L(2)		breast(1)|endometrium(2)|kidney(2)	5						AACATTTACTCTGCAGCGAGG	0.348																																																	2	Substitution - coding silent(2)	kidney(2)											101.0	93.0	96.0					6																	146975333		692	1591	2283	SO:0001819	synonymous_variant	0			AK026774		6q24.2	2012-02-03	2012-02-03	2012-02-03	ENSG00000118492	ENSG00000118492			21212	protein-coding gene	gene with protein product		614630	"""chromosome 6 open reading frame 103"""	C6orf103		22115833	Standard	NM_024694		Approved	FLJ23121, dJ408K24.1	uc010khx.3	Q8N7X0	OTTHUMG00000015758	ENST00000397944.3:c.393C>G	6.37:g.146975333C>G		Somatic		WXS	Illumina HiSeq	Phase_I	Q5T402|Q5T904|Q5T905	Silent	SNP	ENST00000397944.3	37																																																																																					0.348	ADGB-009	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000376350.2		NM_024694	
C7orf50	84310	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	1037413	1037413	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr7:1037413G>T	ENST00000397098.3	-	5	1359	c.433C>A	c.(433-435)Ctg>Atg	p.L145M	C7orf50_ENST00000357429.6_Missense_Mutation_p.L145M|C7orf50_ENST00000397100.2_Missense_Mutation_p.L145M|C7orf50_ENST00000488073.1_5'UTR			Q9BRJ6	CG050_HUMAN	chromosome 7 open reading frame 50	145							poly(A) RNA binding (GO:0044822)	p.L145M(1)		kidney(1)|large_intestine(1)|lung(3)|ovary(1)	6		Ovarian(82;0.0779)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0216)|OV - Ovarian serous cystadenocarcinoma(56;1.3e-15)		AGGTAGGCCAGCAGGGTGGAG	0.672																																																	1	Substitution - Missense(1)	kidney(1)											43.0	53.0	50.0					7																	1037413		2202	4299	6501	SO:0001583	missense	84310			BC006224	CCDS5320.1	7p22.3	2011-11-25			ENSG00000146540	ENSG00000146540			22421	protein-coding gene	gene with protein product							Standard	NM_032350		Approved	MGC11257, YCR016W	uc011jvu.1	Q9BRJ6	OTTHUMG00000151477	ENST00000397098.3:c.433C>A	7.37:g.1037413G>T	ENSP00000380286:p.Leu145Met	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000397098.3	37	CCDS5320.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.59|19.59	3.855342|3.855342	0.71719|0.71719	.|.	.|.	ENSG00000146540|ENSG00000146540	ENST00000412051|ENST00000397100;ENST00000397098;ENST00000357429;ENST00000444428;ENST00000491163	.|.	.|.	.|.	5.61|5.61	5.61|5.61	0.85477|0.85477	.|.	.|0.000000	.|0.64402	.|D	.|0.000011	T|T	0.79221|0.79221	0.4409|0.4409	M|M	0.82132|0.82132	2.575|2.575	0.47698|0.47698	D|D	0.999498|0.999498	.|D	.|0.71674	.|0.998	.|D	.|0.69307	.|0.963	T|T	0.81351|0.81351	-0.0972|-0.0972	5|9	.|0.66056	.|D	.|0.02	-23.1162|-23.1162	15.1362|15.1362	0.72569|0.72569	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|145	.|Q9BRJ6	.|CG050_HUMAN	D|M	129|145;145;145;113;145	.|.	.|ENSP00000350011:L145M	A|L	-|-	2|1	0|2	C7orf50|C7orf50	1003939|1003939	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.922000|0.922000	0.55478|0.55478	3.267000|3.267000	0.51577|0.51577	2.657000|2.657000	0.90304|0.90304	0.655000|0.655000	0.94253|0.94253	GCT|CTG		0.672	C7orf50-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322817.3		NM_032350	
CCDC144A	9720	broad.mit.edu	37	17	16596346	16596346	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr17:16596346C>T	ENST00000360524.8	+	2	474	c.398C>T	c.(397-399)cCt>cTt	p.P133L	CCDC144A_ENST00000436374.1_3'UTR|CCDC144A_ENST00000399273.1_Missense_Mutation_p.P133L|CCDC144A_ENST00000340621.5_Missense_Mutation_p.P133L|RNU6-405P_ENST00000516637.1_RNA|CCDC144A_ENST00000443444.2_Missense_Mutation_p.P133L|CCDC144A_ENST00000456009.1_Missense_Mutation_p.P133L|RP11-219A15.1_ENST00000448331.3_Missense_Mutation_p.P133L	NM_014695.1	NP_055510.1	A2RUR9	C144A_HUMAN	coiled-coil domain containing 144A	133								p.P133L(1)									GAAAGTCTTCCTCAAAATAAC	0.303																																																	1	Substitution - Missense(1)	kidney(1)											1.0	1.0	1.0					17																	16596346		377	888	1265	SO:0001583	missense	9720			BC133019	CCDS45621.1	17p11.2	2008-10-23			ENSG00000170160	ENSG00000170160			29072	protein-coding gene	gene with protein product						9628581, 11997339	Standard	NM_014695		Approved	KIAA0565, FLJ43983	uc002gqk.1	A2RUR9	OTTHUMG00000059178	ENST00000360524.8:c.398C>T	17.37:g.16596346C>T	ENSP00000353717:p.Pro133Leu	Somatic		WXS	Illumina GAIIx	Phase_I	O60311|Q6ZU57	Missense_Mutation	SNP	ENST00000360524.8	37	CCDS45621.1	.	.	.	.	.	.	.	.	.	.	.	10.23	1.292022	0.23564	.	.	ENSG00000170160	ENST00000420937;ENST00000340621;ENST00000399273;ENST00000436374;ENST00000399264;ENST00000443444;ENST00000448331;ENST00000360524;ENST00000456009;ENST00000360495	T;T;T;T;T;T;T	0.41400	1.0;1.0;1.0;1.0;1.0;1.0;1.0	1.67	0.657	0.17850	.	.	.	.	.	T	0.40645	0.1125	N	0.22421	0.69	0.09310	N	1	D	0.64830	0.994	P	0.62885	0.908	T	0.18587	-1.0332	9	0.62326	D	0.03	.	3.7876	0.08707	0.0:0.7571:0.0:0.2429	.	133	A2RUR9	C144A_HUMAN	L	133	ENSP00000344740:P133L;ENSP00000382215:P133L;ENSP00000439262:P133L;ENSP00000440655:P133L;ENSP00000353717:P133L;ENSP00000394201:P133L;ENSP00000353685:P133L	ENSP00000344740:P133L	P	+	2	0	CCDC144A	16537071	0.000000	0.05858	0.002000	0.10522	0.015000	0.08874	0.172000	0.16704	0.263000	0.21812	0.423000	0.28283	CCT		0.303	CCDC144A-013	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000444093.1			
CD40LG	959	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	135730560	135730560	+	Silent	SNP	C	C	T			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chrX:135730560C>T	ENST00000370629.2	+	1	209	c.153C>T	c.(151-153)gaC>gaT	p.D51D	CD40LG_ENST00000370628.2_Silent_p.D51D	NM_000074.2	NP_000065.1	P29965	CD40L_HUMAN	CD40 ligand	51					B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|immunoglobulin secretion (GO:0048305)|inflammatory response (GO:0006954)|isotype switching (GO:0045190)|leukocyte cell-cell adhesion (GO:0007159)|negative regulation of apoptotic process (GO:0043066)|platelet activation (GO:0030168)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of interleukin-12 production (GO:0032735)|regulation of immune response (GO:0050776)|regulation of immunoglobulin secretion (GO:0051023)	external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	CD40 receptor binding (GO:0005174)	p.D51D(1)		endometrium(1)|kidney(1)|large_intestine(8)|lung(14)|skin(1)|stomach(1)	26	Acute lymphoblastic leukemia(192;0.000127)					GAAGGTTGGACAAGGTAAGAT	0.358									Immune Deficiency with Hyper-IgM																																								1	Substitution - coding silent(1)	kidney(1)											133.0	125.0	128.0					X																	135730560		2203	4300	6503	SO:0001819	synonymous_variant	959	Familial Cancer Database	Hypogammaglobulinemia with Hyper-IgM, HIGM type I-V, XLHIGM	X67878	CCDS14659.1	Xq26	2014-09-17	2008-08-01	2005-01-14	ENSG00000102245	ENSG00000102245		"""Tumor necrosis factor (ligand) superfamily"", ""CD molecules"", ""Endogenous ligands"""	11935	protein-coding gene	gene with protein product	"""CD40 antigen ligand"", ""tumor necrosis factor (ligand) superfamily member 5"", ""T-B cell-activating molecule"", ""TNF-related activation protein"", ""hyper-IgM syndrome"""	300386	"""tumor necrosis factor (ligand) superfamily, member 5 (hyper-IgM syndrome)"""	HIGM1, IMD3, TNFSF5		1427881, 7678782	Standard	NM_000074		Approved	CD40L, TRAP, gp39, hCD40L, CD154	uc004faa.3	P29965	OTTHUMG00000022512	ENST00000370629.2:c.153C>T	X.37:g.135730560C>T		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000370629.2	37	CCDS14659.1																																																																																				0.358	CD40LG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058501.1		NM_000074	
CHPT1	56994	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	102120124	102120124	+	Missense_Mutation	SNP	T	T	A			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr12:102120124T>A	ENST00000229266.3	+	8	1353	c.1118T>A	c.(1117-1119)aTt>aAt	p.I373N	CHPT1_ENST00000549872.1_Missense_Mutation_p.I373N	NM_020244.2	NP_064629.2	Q8WUD6	CHPT1_HUMAN	choline phosphotransferase 1	373					CDP-choline pathway (GO:0006657)|glycerophospholipid biosynthetic process (GO:0046474)|lipid metabolic process (GO:0006629)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|platelet activating factor biosynthetic process (GO:0006663)|regulation of cell growth (GO:0001558)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	diacylglycerol binding (GO:0019992)|diacylglycerol cholinephosphotransferase activity (GO:0004142)|metal ion binding (GO:0046872)	p.I373N(1)		kidney(2)|large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	10						TGCCTGCAAATTTCAAGACAC	0.333																																																	1	Substitution - Missense(1)	kidney(1)											150.0	147.0	148.0					12																	102120124		2203	4300	6503	SO:0001583	missense	56994				CCDS9086.1	12q	2010-07-08				ENSG00000111666	2.7.8.2		17852	protein-coding gene	gene with protein product	"""phosphatidylcholine synthesizing enzyme"""					10893425	Standard	NM_020244		Approved	CPT1	uc001tin.3	Q8WUD6		ENST00000229266.3:c.1118T>A	12.37:g.102120124T>A	ENSP00000229266:p.Ile373Asn	Somatic		WXS	Illumina HiSeq	Phase_I	B3KQM2|Q7Z7H0|Q7Z7H1|Q7Z7H2|Q8IWQ4|Q8IWQ5|Q8WYI4|Q9NRQ6|Q9NRQ7|Q9Y6M6	Missense_Mutation	SNP	ENST00000229266.3	37	CCDS9086.1	.	.	.	.	.	.	.	.	.	.	T	17.50	3.405414	0.62288	.	.	ENSG00000111666	ENST00000229266;ENST00000549872;ENST00000543999	T;T	0.54071	0.59;0.62	5.88	5.88	0.94601	.	0.047789	0.85682	D	0.000000	T	0.76870	0.4048	M	0.87456	2.885	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.81339	-0.0977	10	0.87932	D	0	-11.0096	16.2792	0.82664	0.0:0.0:0.0:1.0	.	373;373	F8W1B3;Q8WUD6	.;CHPT1_HUMAN	N	373;373;206	ENSP00000229266:I373N;ENSP00000448766:I373N	ENSP00000229266:I373N	I	+	2	0	CHPT1	100644255	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.649000	0.74364	2.243000	0.73865	0.533000	0.62120	ATT		0.333	CHPT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000409173.1		NM_020244	
CNGB1	1258	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	57991272	57991272	+	Missense_Mutation	SNP	A	A	T			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr16:57991272A>T	ENST00000251102.8	-	12	907	c.847T>A	c.(847-849)Tcc>Acc	p.S283T	CNGB1_ENST00000311183.4_Missense_Mutation_p.S283T|CNGB1_ENST00000564448.1_Missense_Mutation_p.S277T	NM_001297.4	NP_001288.3	Q14028	CNGB1_HUMAN	cyclic nucleotide gated channel beta 1	283					cation transport (GO:0006812)|cytosolic calcium ion homeostasis (GO:0051480)|detection of light stimulus involved in visual perception (GO:0050908)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|protein heterotetramerization (GO:0051290)|regulation of membrane potential (GO:0042391)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina homeostasis (GO:0001895)|rhodopsin mediated signaling pathway (GO:0016056)|sensory perception of smell (GO:0007608)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|intracellular cyclic nucleotide activated cation channel complex (GO:0017071)|plasma membrane (GO:0005886)|terminal bouton (GO:0043195)|transmembrane transporter complex (GO:1902495)	cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|ligand-gated ion channel activity (GO:0015276)|voltage-gated potassium channel activity (GO:0005249)	p.S283T(1)		breast(7)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(11)|liver(1)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	54						ATCCCAGGGGAGTCAGGCTCC	0.517																																					Colon(156;1293 1853 16336 28962 38659)												1	Substitution - Missense(1)	kidney(1)											85.0	93.0	90.0					16																	57991272		2020	4189	6209	SO:0001583	missense	1258			AF042498	CCDS42169.1, CCDS45495.1, CCDS67042.1	16q13	2013-02-14			ENSG00000070729	ENSG00000070729		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2151	protein-coding gene	gene with protein product	"""glutamic acid-rich protein"""	600724		CNCG2, CNCG3L		8766832, 7590744, 16382102	Standard	NM_001297		Approved	RCNC2, RCNCb, GARP, GAR1, CNGB1B, RP45	uc002emt.2	Q14028	OTTHUMG00000154810	ENST00000251102.8:c.847T>A	16.37:g.57991272A>T	ENSP00000251102:p.Ser283Thr	Somatic		WXS	Illumina HiSeq	Phase_I	H3BN09|O43636|Q13059|Q14029|Q9UMG2	Missense_Mutation	SNP	ENST00000251102.8	37	CCDS42169.1	.	.	.	.	.	.	.	.	.	.	A	15.47	2.841762	0.51057	.	.	ENSG00000070729	ENST00000251102;ENST00000311183	D;T	0.96967	-4.19;0.76	3.17	2.05	0.26809	.	0.966309	0.08382	N	0.954422	D	0.92273	0.7549	L	0.38175	1.15	0.09310	N	1	P;B	0.42518	0.782;0.231	B;B	0.40375	0.327;0.037	D	0.84223	0.0462	10	0.21540	T	0.41	.	6.4589	0.21946	0.7486:0.2514:0.0:0.0	.	283;283	Q14028-3;Q14028	.;CNGB1_HUMAN	T	283	ENSP00000251102:S283T;ENSP00000311670:S283T	ENSP00000251102:S283T	S	-	1	0	CNGB1	56548773	0.000000	0.05858	0.007000	0.13788	0.321000	0.28281	-0.583000	0.05807	0.592000	0.29728	0.459000	0.35465	TCC		0.517	CNGB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337167.2		NM_001297	
COL27A1	85301	hgsc.bcm.edu;ucsc.edu	37	9	117053135	117053135	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr9:117053135G>T	ENST00000356083.3	+	48	4805	c.4414G>T	c.(4414-4416)Ggg>Tgg	p.G1472W		NM_032888.2	NP_116277.2	Q8IZC6	CORA1_HUMAN	collagen, type XXVII, alpha 1	1472	Collagen-like 14.|Pro-rich.|Triple-helical region.				extracellular matrix organization (GO:0030198)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|fibrillar collagen trimer (GO:0005583)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(30)|ovary(4)|prostate(6)|skin(3)|soft_tissue(1)|stomach(1)|urinary_tract(3)	80						GGGCCCTGCTGGGAAGAGAGG	0.582											OREG0019416	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													38.0	37.0	37.0					9																	117053135		2088	4096	6184	SO:0001583	missense	85301			AB058773	CCDS6802.1	9q33.1	2013-01-16			ENSG00000196739	ENSG00000196739		"""Collagens"""	22986	protein-coding gene	gene with protein product		608461				12766169	Standard	NM_032888		Approved	KIAA1870, MGC11337, FLJ11895	uc011lxl.2	Q8IZC6	OTTHUMG00000020537	ENST00000356083.3:c.4414G>T	9.37:g.117053135G>T	ENSP00000348385:p.Gly1472Trp	Somatic	1478	WXS	Illumina HiSeq	Phase_I	Q66K43|Q96JF7	Missense_Mutation	SNP	ENST00000356083.3	37	CCDS6802.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.444743	0.83993	.	.	ENSG00000196739	ENST00000356083;ENST00000357257	D	0.99637	-6.29	5.69	5.69	0.88448	.	.	.	.	.	D	0.99806	0.9916	H	0.98133	4.155	0.54753	D	0.99998	D	0.76494	0.999	D	0.75020	0.985	D	0.97004	0.9731	9	0.87932	D	0	.	17.3069	0.87197	0.0:0.0:1.0:0.0	.	1472	Q8IZC6	CORA1_HUMAN	W	1472	ENSP00000348385:G1472W	ENSP00000348385:G1472W	G	+	1	0	COL27A1	116092956	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.097000	0.76967	2.682000	0.91365	0.585000	0.79938	GGG		0.582	COL27A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053763.1		NM_032888	
CRIPAK	285464	hgsc.bcm.edu	37	4	1388622	1388623	+	Frame_Shift_Ins	INS	-	-	CA	rs79704405|rs540461234|rs558358960	byFrequency	TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr4:1388622_1388623insCA	ENST00000324803.4	+	1	3283_3284	c.323_324insCA	c.(322-327)ctcacgfs	p.LT108fs		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	108					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.L108H(1)		NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			GCCCGCCTGCTCACGTGCCCAT	0.668														506	0.101038	0.0567	0.1427	5008	,	,		19207	0.0169		0.1759	False		,,,				2504	0.1411																1	Substitution - Missense(1)	pancreas(1)																																								SO:0001589	frameshift_variant	285464			AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.324_325dupCA	4.37:g.1388623_1388624dupCA	ENSP00000323978:p.Leu108fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q8NB03	Frame_Shift_Ins	INS	ENST00000324803.4	37	CCDS3349.1																																																																																				0.668	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2		NM_175918	
CTNNA3	29119	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	68940123	68940123	+	Silent	SNP	G	G	A	rs146754105	byFrequency	TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr10:68940123G>A	ENST00000433211.2	-	7	1173	c.999C>T	c.(997-999)aaC>aaT	p.N333N	CTNNA3_ENST00000373744.4_Silent_p.N333N|CTNNA3_ENST00000545309.1_Silent_p.N333N	NM_013266.2	NP_037398.2			catenin (cadherin-associated protein), alpha 3									p.N333N(2)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(1)|lung(50)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|stomach(1)|urinary_tract(1)	95						GGCGAATGGCGTTGCATTCTG	0.517													G|||	3	0.000599042	0.0	0.0014	5008	,	,		17885	0.002		0.0	False		,,,				2504	0.0																2	Substitution - coding silent(2)	kidney(2)						G	,	0,4406		0,0,2203	137.0	118.0	124.0		999,999	-11.4	0.2	10	dbSNP_134	124	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	CTNNA3	NM_001127384.1,NM_013266.2	,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,	333/896,333/896	68940123	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	29119			AF091606	CCDS7269.1	10q21	2006-11-24			ENSG00000183230	ENSG00000183230			2511	protein-coding gene	gene with protein product		607667				12596047, 11590244	Standard	XM_005269717		Approved	VR22, MGC26194	uc001jmw.2	Q9UI47	OTTHUMG00000018334	ENST00000433211.2:c.999C>T	10.37:g.68940123G>A		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000433211.2	37	CCDS7269.1																																																																																				0.517	CTNNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048282.2		NM_013266	
CXorf30	645090	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	36324941	36324941	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chrX:36324941G>A	ENST00000378657.4	+	9	1123	c.475G>A	c.(475-477)Gca>Aca	p.A159T		NM_001098843.4	NP_001092313.2	A6PW82	CX030_HUMAN	chromosome X open reading frame 30	159								p.A159T(1)		breast(1)|lung(2)|stomach(1)	4						TTATCCTTCTGCACTTGGAAG	0.368																																																	1	Substitution - Missense(1)	kidney(1)											237.0	158.0	182.0					X																	36324941		692	1591	2283	SO:0001583	missense	645090				CCDS55396.1	Xp21.1	2014-08-07			ENSG00000205081	ENSG00000205081			27298	protein-coding gene	gene with protein product							Standard	NM_001098843		Approved		uc011mkc.3	A6PW82	OTTHUMG00000021353	ENST00000378657.4:c.475G>A	X.37:g.36324941G>A	ENSP00000367926:p.Ala159Thr	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000378657.4	37	CCDS55396.1	.	.	.	.	.	.	.	.	.	.	G	12.68	2.009647	0.35415	.	.	ENSG00000205081	ENST00000378653;ENST00000378657	T;T	0.23348	1.92;1.91	5.19	4.29	0.51040	.	.	.	.	.	T	0.21062	0.0507	L	0.29908	0.895	0.09310	N	1	P	0.46512	0.879	P	0.45639	0.488	T	0.06075	-1.0847	9	0.24483	T	0.36	.	7.9896	0.30233	0.205:0.0:0.795:0.0	.	159	A6PW82	CX030_HUMAN	T	444;159	ENSP00000367922:A444T;ENSP00000367926:A159T	ENSP00000367922:A444T	A	+	1	0	CXorf30	36234862	0.982000	0.34865	0.020000	0.16555	0.009000	0.06853	2.581000	0.46077	0.997000	0.38969	-0.380000	0.06706	GCA		0.368	CXorf30-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			NP_001092313	
DCUN1D1	54165	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	182683307	182683336	+	Splice_Site	DEL	TCACAAGCAAGCACTCACCTTTGTATCTAT	TCACAAGCAAGCACTCACCTTTGTATCTAT	-	rs371845694		TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	TCACAAGCAAGCACTCACCTTTGTATCTAT	TCACAAGCAAGCACTCACCTTTGTATCTAT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr3:182683307_182683336delTCACAAGCAAGCACTCACCTTTGTATCTAT	ENST00000292782.4	-	2	362_374	c.209_221delATAGATACAAAGGTGAGTGCTTGCTTGTGA	c.(208-222)aatagatacaaaggt>at	p.NRYKG70del	DCUN1D1_ENST00000469954.1_Splice_Site_p.NRYKG55del	NM_020640.2	NP_065691.2	Q96GG9	DCNL1_HUMAN	DCN1, defective in cullin neddylation 1, domain containing 1	70	DCUN1. {ECO:0000255|PROSITE- ProRule:PRU00574}.					ubiquitin ligase complex (GO:0000151)				endometrium(2)|large_intestine(4)|lung(8)|ovary(1)	15	all_cancers(143;9.04e-15)|Ovarian(172;0.0355)		all cancers(12;2.54e-44)|Epithelial(37;4.71e-38)|LUSC - Lung squamous cell carcinoma(7;5.04e-25)|Lung(8;5.03e-23)|OV - Ovarian serous cystadenocarcinoma(80;7.41e-21)			TTACTTAAAGTCACAAGCAAGCACTCACCTTTGTATCTATTGTACAGCTG	0.343																																																	0																																										SO:0001630	splice_region_variant	54165			AF292100, AK056335	CCDS3240.1	3q26.3	2013-06-10	2013-06-10		ENSG00000043093	ENSG00000043093			18184	protein-coding gene	gene with protein product	"""squamous cell carcinoma related oncogene"""	605905	"""DCN1, defective in cullin neddylation 1, domain containing 1 (S. cerevisiae)"""			10777668, 15988528	Standard	NM_020640		Approved	RP42, SCRO, DCUN1L1, Tes3, SCCRO	uc003fld.1	Q96GG9	OTTHUMG00000158314	ENST00000292782.4:c.220+1ATAGATACAAAGGTGAGTGCTTGCTTGTGA>-	3.37:g.182683307_182683336delTCACAAGCAAGCACTCACCTTTGTATCTAT		Somatic		WXS	Illumina HiSeq	Phase_I	B2RB37|Q7L3G9|Q8TEX7|Q9H6M1|Q9HCT3	Frame_Shift_Del	DEL	ENST00000292782.4	37	CCDS3240.1																																																																																				0.343	DCUN1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350658.1		NM_020640	In_Frame_Del
DHX37	57647	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	125435351	125435351	+	Splice_Site	SNP	C	C	T			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr12:125435351C>T	ENST00000308736.2	-	22	2967		c.e22-1		DHX37_ENST00000544745.1_Splice_Site	NM_032656.3	NP_116045.2	Q8IY37	DHX37_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 37								ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)	p.?(1)		breast(5)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(11)|liver(1)|lung(27)|ovary(1)|prostate(2)|skin(3)	65	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;8.05e-05)|Epithelial(86;0.000486)|all cancers(50;0.00653)		GGAGAGGGGTCTGCAGAGAAT	0.552																																																	1	Unknown(1)	kidney(1)											82.0	97.0	92.0					12																	125435351		2203	4300	6503	SO:0001630	splice_region_variant	57647			AB040950	CCDS9261.1	12q24.31	2004-03-25	2003-06-13	2003-06-20		ENSG00000150990		"""DEAH-boxes"""	17210	protein-coding gene	gene with protein product			"""DEAD/DEAH box helicase DDX37"""	DDX37		10819331	Standard	NM_032656		Approved	KIAA1517, MGC4322, MGC2695	uc001ugy.3	Q8IY37		ENST00000308736.2:c.2869-1G>A	12.37:g.125435351C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q9BUI7|Q9P211	Splice_Site	SNP	ENST00000308736.2	37	CCDS9261.1	.	.	.	.	.	.	.	.	.	.	C	16.95	3.263138	0.59431	.	.	ENSG00000150990	ENST00000308736;ENST00000544745	.	.	.	5.26	5.26	0.73747	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.8723	0.92320	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DHX37	124001304	1.000000	0.71417	0.996000	0.52242	0.473000	0.32948	7.448000	0.80631	2.467000	0.83353	0.561000	0.74099	.		0.552	DHX37-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			NM_032656	Intron
DNAH17	8632	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	76450661	76450661	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr17:76450661C>T	ENST00000585328.1	-	64	10406	c.10282G>A	c.(10282-10284)Ggc>Agc	p.G3428S	DNAH17_ENST00000389840.5_Missense_Mutation_p.G3419S|DNAH17_ENST00000586052.1_5'UTR	NM_173628.3	NP_775899.3	Q9UFH2	DYH17_HUMAN	dynein, axonemal, heavy chain 17	3419	AAA 5. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.G3428S(1)		NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			TCGGTGTTGCCCAGGATGGTG	0.602																																																	1	Substitution - Missense(1)	kidney(1)											111.0	84.0	93.0					17																	76450661		2203	4300	6503	SO:0001583	missense	8632			AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775		"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1		9545504	Standard	NM_173628		Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.10282G>A	17.37:g.76450661C>T	ENSP00000465516:p.Gly3428Ser	Somatic		WXS	Illumina HiSeq	Phase_I	O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	Missense_Mutation	SNP	ENST00000585328.1	37		.	.	.	.	.	.	.	.	.	.	C	12.01	1.808321	0.31961	.	.	ENSG00000187775	ENST00000300671;ENST00000389840	T	0.55930	0.49	5.11	2.84	0.33178	.	0.084736	0.52532	D	0.000076	T	0.10594	0.0259	N	0.00028	-2.63	0.23716	N	0.997033	B	0.02656	0.0	B	0.01281	0.0	T	0.36625	-0.9740	10	0.22109	T	0.4	.	6.6654	0.23037	0.5908:0.1408:0.0:0.2683	.	3428	E7EUM8	.	S	3428;3419	ENSP00000374490:G3419S	ENSP00000300671:G3428S	G	-	1	0	DNAH17	73962256	0.991000	0.36638	0.997000	0.53966	0.947000	0.59692	2.479000	0.45197	0.251000	0.21505	-0.272000	0.10252	GGC		0.602	DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000318962.2		NM_173628	
DNAH6	1768	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	84880607	84880607	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr2:84880607G>A	ENST00000237449.6	+	33	5251	c.5243G>A	c.(5242-5244)gGt>gAt	p.G1748D	DNAH6_ENST00000389394.3_Missense_Mutation_p.G1748D|DNAH6_ENST00000398278.2_Missense_Mutation_p.G1748D			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	1748	AAA 2. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.G1748D(1)		NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						GTAAGGCATGGTGTTATGTTA	0.393																																																	1	Substitution - Missense(1)	kidney(1)											73.0	66.0	68.0					2																	84880607		692	1591	2283	SO:0001583	missense	1768			U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.5243G>A	2.37:g.84880607G>A	ENSP00000237449:p.Gly1748Asp	Somatic		WXS	Illumina HiSeq	Phase_I	A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Missense_Mutation	SNP	ENST00000237449.6	37	CCDS46348.1	.	.	.	.	.	.	.	.	.	.	G	20.0	3.930547	0.73327	.	.	ENSG00000115423	ENST00000389394;ENST00000398278;ENST00000237449	T;T;T	0.43294	0.95;0.95;0.95	5.14	5.14	0.70334	ATPase, AAA+ type, core (1);ATPase, dynein-related, AAA domain (1);	.	.	.	.	T	0.78323	0.4265	H	0.98133	4.155	0.44539	D	0.997494	D	0.89917	1.0	D	0.97110	1.0	D	0.87073	0.2161	9	0.87932	D	0	.	17.3824	0.87408	0.0:0.0:1.0:0.0	.	1748	Q9C0G6	DYH6_HUMAN	D	1748	ENSP00000374045:G1748D;ENSP00000381326:G1748D;ENSP00000237449:G1748D	ENSP00000237449:G1748D	G	+	2	0	DNAH6	84734118	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	5.541000	0.67212	2.404000	0.81709	0.544000	0.68410	GGT		0.393	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328537.2		NM_001370	
DOCK5	80005	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	25189787	25189787	+	Missense_Mutation	SNP	A	A	T	rs185726789	byFrequency	TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr8:25189787A>T	ENST00000276440.7	+	19	1968	c.1924A>T	c.(1924-1926)Aat>Tat	p.N642Y		NM_024940.6	NP_079216.4	Q9H7D0	DOCK5_HUMAN	dedicator of cytokinesis 5	642					positive regulation of GTPase activity (GO:0043547)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)	p.N642Y(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(9)|large_intestine(13)|lung(20)|ovary(3)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)		AGGCTTGTTAAATTGGCGTTC	0.373																																					Pancreas(145;34 1887 3271 10937 30165)												1	Substitution - Missense(1)	kidney(1)											137.0	123.0	127.0					8																	25189787		2203	4300	6503	SO:0001583	missense	80005				CCDS6047.1	8p21.2	2009-04-17			ENSG00000147459	ENSG00000147459			23476	protein-coding gene	gene with protein product						12432077	Standard	NM_024940		Approved	FLJ21034	uc003xeg.3	Q9H7D0	OTTHUMG00000131991	ENST00000276440.7:c.1924A>T	8.37:g.25189787A>T	ENSP00000276440:p.Asn642Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	B2RNY0|Q5XKD5|Q6AI11|Q6PJS6|Q6ZTS6	Missense_Mutation	SNP	ENST00000276440.7	37	CCDS6047.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	29.0|29.0	4.966548|4.966548	0.92855|0.92855	.|.	.|.	ENSG00000147459|ENSG00000147459	ENST00000444569|ENST00000276440	.|T	.|0.24350	.|1.86	5.82|5.82	5.82|5.82	0.92795|0.92795	.|.	.|0.101061	.|0.64402	.|D	.|0.000003	T|T	0.50188|0.50188	0.1601|0.1601	M|M	0.74647|0.74647	2.275|2.275	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.54601	.|0.967;0.967;0.967	.|P;P;P	.|0.62184	.|0.866;0.809;0.899	T|T	0.52983|0.52983	-0.8502|-0.8502	5|10	.|0.72032	.|D	.|0.01	.|.	16.1848|16.1848	0.81942|0.81942	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|632;417;642	.|D3DSS6;Q68DL4;Q9H7D0	.|.;.;DOCK5_HUMAN	I|Y	413|642	.|ENSP00000276440:N642Y	.|ENSP00000276440:N642Y	K|N	+|+	2|1	0|0	DOCK5|DOCK5	25245704|25245704	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.987000|0.987000	0.75469|0.75469	8.621000|8.621000	0.90949|0.90949	2.232000|2.232000	0.73038|0.73038	0.528000|0.528000	0.53228|0.53228	AAA|AAT		0.373	DOCK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254955.2		NM_024940	
DPP10	57628	broad.mit.edu;hgsc.bcm.edu	37	2	116510751	116510751	+	Splice_Site	SNP	G	G	T			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr2:116510751G>T	ENST00000410059.1	+	11	1432	c.952G>T	c.(952-954)Gaa>Taa	p.E318*	DPP10_ENST00000310323.8_Splice_Site_p.E311*|DPP10_ENST00000409163.1_Splice_Site_p.E268*|DPP10_ENST00000393147.2_Splice_Site_p.E322*	NM_001178037.1|NM_020868.3	NP_001171508.1|NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl-peptidase 10 (non-functional)	318						integral component of membrane (GO:0016021)|membrane (GO:0016020)	serine-type peptidase activity (GO:0008236)	p.E311*(1)|p.E318*(1)		breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(24)|liver(2)|lung(48)|ovary(6)|prostate(1)|skin(5)|soft_tissue(1)	101						CCAAACTAGAGAATACTATAT	0.343																																																	2	Substitution - Nonsense(2)	kidney(2)											78.0	71.0	73.0					2																	116510751		2203	4300	6503	SO:0001630	splice_region_variant	57628			AY172661	CCDS33278.1, CCDS46400.1, CCDS54388.1, CCDS54389.1	2q14.1	2010-05-04	2010-05-04		ENSG00000175497	ENSG00000175497			20823	protein-coding gene	gene with protein product		608209	"""dipeptidylpeptidase 10"", ""dipeptidyl-peptidase 10"""			10819331, 12662155	Standard	NM_020868		Approved	DPRP3	uc002tle.3	Q8N608	OTTHUMG00000153294	ENST00000410059.1:c.951-1G>T	2.37:g.116510751G>T		Somatic		WXS	Illumina HiSeq	Phase_I	A8K1Q2|J3KPP2|J3KQ46|Q0GLB8|Q53QT3|Q53S86|Q53SL8|Q53SS4|Q6TTV4|Q86YR9|Q9P236	Nonsense_Mutation	SNP	ENST00000410059.1	37	CCDS46400.1	.	.	.	.	.	.	.	.	.	.	G	40	8.112810	0.98659	.	.	ENSG00000175497	ENST00000410059;ENST00000409163;ENST00000393147;ENST00000310323;ENST00000476155	.	.	.	5.1	5.1	0.69264	.	0.055007	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-27.4537	17.6852	0.88255	0.0:0.0:1.0:0.0	.	.	.	.	X	318;268;322;311;268	.	ENSP00000309066:E311X	E	+	1	0	DPP10	116227221	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	9.236000	0.95360	2.660000	0.90430	0.650000	0.86243	GAA		0.343	DPP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330580.4		NM_020868	Nonsense_Mutation
DPP9	91039	broad.mit.edu;ucsc.edu	37	19	4719861	4719861	+	Splice_Site	SNP	A	A	T			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr19:4719861A>T	ENST00000598800.1	-	3	277		c.e3+1		DPP9_ENST00000262960.9_Splice_Site|DPP9_ENST00000597849.1_Splice_Site			Q86TI2	DPP9_HUMAN	dipeptidyl-peptidase 9							cytoplasm (GO:0005737)|membrane (GO:0016020)	aminopeptidase activity (GO:0004177)|identical protein binding (GO:0042802)|serine-type peptidase activity (GO:0008236)	p.?(1)		cervix(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00884)		GGCCAACCTCACCTTCTCCAA	0.592																																																	1	Unknown(1)	kidney(1)											99.0	100.0	100.0					19																	4719861		692	1591	2283	SO:0001630	splice_region_variant	91039			AF452102	CCDS45928.1	19p13.3	2014-06-11	2006-01-12		ENSG00000142002	ENSG00000142002			18648	protein-coding gene	gene with protein product		608258	"""dipeptidylpeptidase 9"""				Standard	NM_139159		Approved		uc002mba.3	Q86TI2	OTTHUMG00000182040	ENST00000598800.1:c.228+1T>A	19.37:g.4719861A>T		Somatic		WXS	Illumina GAIIx	Phase_I	O75273|O75868|Q1ZZB8|Q6AI37|Q6UAL0|Q6ZMT2|Q6ZNJ5|Q8N2J7|Q8N3F5|Q8WXD8|Q96NT8|Q9BVR3	Splice_Site	SNP	ENST00000598800.1	37		.	.	.	.	.	.	.	.	.	.	A	13.97	2.396339	0.42512	.	.	ENSG00000142002	ENST00000357909;ENST00000381797;ENST00000262960	.	.	.	3.29	3.29	0.37713	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.529	0.39182	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DPP9	4670861	1.000000	0.71417	0.959000	0.39883	0.585000	0.36419	5.466000	0.66731	1.374000	0.46228	0.459000	0.35465	.		0.592	DPP9-026	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000459343.2			Intron
EGF	1950	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	110862256	110862256	+	Missense_Mutation	SNP	A	A	T			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr4:110862256A>T	ENST00000265171.5	+	2	727	c.282A>T	c.(280-282)gaA>gaT	p.E94D	EGF_ENST00000503392.1_Missense_Mutation_p.E94D|EGF_ENST00000509793.1_Missense_Mutation_p.E94D|EGF_ENST00000502723.1_3'UTR	NM_001178130.1|NM_001963.4	NP_001171601.1|NP_001954.2	P01133	EGF_HUMAN	epidermal growth factor	94					activation of MAPKK activity (GO:0000186)|activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|branching morphogenesis of an epithelial tube (GO:0048754)|DNA replication (GO:0006260)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERK1 and ERK2 cascade (GO:0070371)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|mammary gland alveolus development (GO:0060749)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of secretion (GO:0051048)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cerebellar granule cell precursor proliferation (GO:0021940)|positive regulation of DNA binding (GO:0043388)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of hyaluronan biosynthetic process (GO:1900127)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of calcium ion import (GO:0090279)|regulation of protein localization to cell surface (GO:2000008)|signal transduction (GO:0007165)|STAT protein import into nucleus (GO:0007262)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	calcium ion binding (GO:0005509)|epidermal growth factor receptor binding (GO:0005154)|growth factor activity (GO:0008083)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)	p.E94D(1)		breast(1)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Hepatocellular(203;0.0893)		OV - Ovarian serous cystadenocarcinoma(123;9.87e-06)	Sucralfate(DB00364)	TGGATTTAGAAAGACAACTTT	0.378																																																	1	Substitution - Missense(1)	kidney(1)											67.0	70.0	69.0					4																	110862256		2203	4300	6503	SO:0001583	missense	1950			X04571	CCDS3689.1, CCDS54794.1, CCDS54795.1	4q25	2012-10-02	2010-05-11		ENSG00000138798	ENSG00000138798			3229	protein-coding gene	gene with protein product		131530	"""epidermal growth factor (beta-urogastrone)"""				Standard	NM_001963		Approved		uc003hzy.4	P01133	OTTHUMG00000132044	ENST00000265171.5:c.282A>T	4.37:g.110862256A>T	ENSP00000265171:p.Glu94Asp	Somatic		WXS	Illumina HiSeq	Phase_I	B4DRK7|E7EVD2|E9PBF0|Q52LZ6	Missense_Mutation	SNP	ENST00000265171.5	37	CCDS3689.1	.	.	.	.	.	.	.	.	.	.	A	17.33	3.362168	0.61403	.	.	ENSG00000138798	ENST00000509793;ENST00000265171;ENST00000503392	T;T;T	0.35605	1.3;1.3;1.3	5.37	2.89	0.33648	Six-bladed beta-propeller, TolB-like (1);	0.325783	0.37304	N	0.002158	T	0.42787	0.1218	M	0.75447	2.3	0.29785	N	0.833662	P;P;P	0.52061	0.917;0.95;0.917	B;P;B	0.49999	0.424;0.628;0.424	T	0.41179	-0.9523	10	0.34782	T	0.22	.	7.1196	0.25437	0.6487:0.2797:0.0717:0.0	.	94;94;94	E7EVD2;P01133-2;P01133	.;.;EGF_HUMAN	D	94	ENSP00000424316:E94D;ENSP00000265171:E94D;ENSP00000421384:E94D	ENSP00000265171:E94D	E	+	3	2	EGF	111081705	1.000000	0.71417	0.987000	0.45799	0.977000	0.68977	1.282000	0.33226	0.337000	0.23665	-0.256000	0.11100	GAA		0.378	EGF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255065.1			
EIF3L	51386	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	22	38270461	38270461	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr22:38270461G>A	ENST00000412331.2	+	9	1418	c.836G>A	c.(835-837)cGc>cAc	p.R279H	EIF3L_ENST00000381683.6_Missense_Mutation_p.R231H|EIF3L_ENST00000406934.1_Missense_Mutation_p.R181H	NM_016091.3	NP_057175.1			eukaryotic translation initiation factor 3, subunit L									p.R279H(1)		kidney(2)|large_intestine(3)|lung(4)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						GGGCTTCTCCGCCTGCACTCC	0.547																																																	1	Substitution - Missense(1)	kidney(1)											142.0	112.0	122.0					22																	38270461		2203	4300	6503	SO:0001583	missense	51386			AF083243	CCDS13960.1, CCDS56230.1	22q	2012-12-20	2009-01-07	2009-01-07	ENSG00000100129	ENSG00000100129			18138	protein-coding gene	gene with protein product			"""eukaryotic translation initiation factor 3, subunit 6 interacting protein"", ""eukaryotic translation initiation factor 3, subunit E interacting protein"""	EIF3S6IP, EIF3EIP		11042152, 11590142	Standard	NM_016091		Approved	HSPC021, HSPC025, EIF3S11	uc003auf.3	Q9Y262	OTTHUMG00000150671	ENST00000412331.2:c.836G>A	22.37:g.38270461G>A	ENSP00000416892:p.Arg279His	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000412331.2	37	CCDS13960.1	.	.	.	.	.	.	.	.	.	.	G	27.5	4.834672	0.91036	.	.	ENSG00000100129	ENST00000412331;ENST00000425539;ENST00000381683;ENST00000262832;ENST00000406934	T;T;T	0.58652	0.32;0.32;0.32	4.96	4.96	0.65561	Tetratricopeptide-like helical (1);	0.156481	0.56097	D	0.000023	T	0.81158	0.4764	M	0.89785	3.06	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.982;0.982;0.996;0.998	D	0.84854	0.0815	10	0.59425	D	0.04	-6.0165	18.6585	0.91463	0.0:0.0:1.0:0.0	.	231;181;279;322	B4DYB2;B0QY90;Q9Y262;B0QY89	.;.;EIF3L_HUMAN;.	H	279;322;231;246;181	ENSP00000416892:R279H;ENSP00000371099:R231H;ENSP00000384634:R181H	ENSP00000262832:R246H	R	+	2	0	EIF3L	36600407	1.000000	0.71417	1.000000	0.80357	0.779000	0.44077	9.823000	0.99369	2.485000	0.83878	0.543000	0.68304	CGC		0.547	EIF3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319551.2		NM_016091	
ERBB4	2066	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	212426720	212426721	+	Missense_Mutation	DNP	TA	TA	AT			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	T|A	T|A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr2:212426720_212426721TA>AT	ENST00000342788.4	-	20	2704_2705	c.2394_2395TA>AT	c.(2392-2397)ctTAtg>ctATtg	p.M799L	ERBB4_ENST00000402597.1_Missense_Mutation_p.M789L|ERBB4_ENST00000436443.1_Missense_Mutation_p.M799L	NM_005235.2	NP_005226.1	Q15303	ERBB4_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4	799	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cardiac muscle tissue regeneration (GO:0061026)|cell fate commitment (GO:0045165)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system morphogenesis (GO:0021551)|embryonic pattern specification (GO:0009880)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory bulb interneuron differentiation (GO:0021889)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell migration (GO:0030334)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transcription regulatory region DNA binding (GO:0044212)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.L798L(1)|p.M799L(1)		NS(1)|breast(7)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(31)|lung(71)|pancreas(1)|prostate(3)|skin(39)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	179		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	Afatinib(DB08916)	CCATGGGGCATAAGTTGAGTAA	0.5										TSP Lung(8;0.080)																																							2	Substitution - Missense(1)|Substitution - coding silent(1)	kidney(2)																																								SO:0001583	missense	2066			L07868	CCDS2394.1, CCDS42811.1	2q33.3-q34	2013-10-11	2013-07-09		ENSG00000178568	ENSG00000178568			3432	protein-coding gene	gene with protein product		600543	"""v-erb-a avian erythroblastic leukemia viral oncogene homolog-like 4"""			7700649, 17018285	Standard	NM_001042599		Approved	ALS19	uc002veg.1	Q15303	OTTHUMG00000133012	ENST00000342788.4:c.2394_2395delinsAT	2.37:g.212426720_212426721delinsAT	ENSP00000342235:p.Met799Leu	Somatic		WXS	Illumina HiSeq	Phase_I	B7ZLD7|B7ZLE2|B7ZLE3|Q2M1W1|Q59EW4	Missense_Mutation|Silent	SNP	ENST00000342788.4	37	CCDS2394.1																																																																																				0.500	ERBB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256597.1		NM_001042599	
ERCC6	2074	broad.mit.edu;hgsc.bcm.edu	37	10	50732744	50732744	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr10:50732744C>A	ENST00000355832.5	-	5	810	c.732G>T	c.(730-732)caG>caT	p.Q244H	PGBD3_ENST00000374127.3_5'Flank|ERCC6-PGBD3_ENST00000447839.2_Missense_Mutation_p.Q244H|ERCC6-PGBD3_ENST00000515869.1_Missense_Mutation_p.Q244H|PGBD3_ENST00000603152.1_Missense_Mutation_p.Q244H	NM_000124.2	NP_000115.1	Q03468	ERCC6_HUMAN	excision repair cross-complementation group 6	244					activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|photoreceptor cell maintenance (GO:0045494)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of protein tyrosine kinase activity (GO:0061098)|pyrimidine dimer repair (GO:0006290)|regulation of DNA-templated transcription, elongation (GO:0032784)|response to gamma radiation (GO:0010332)|response to oxidative stress (GO:0006979)|response to superoxide (GO:0000303)|response to toxic substance (GO:0009636)|response to UV (GO:0009411)|response to UV-B (GO:0010224)|response to X-ray (GO:0010165)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase II promoter (GO:0006366)|transcription-coupled nucleotide-excision repair (GO:0006283)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|protein N-terminus binding (GO:0047485)|protein tyrosine kinase activator activity (GO:0030296)	p.Q244H(1)		breast(5)|central_nervous_system(1)|endometrium(6)|kidney(5)|large_intestine(15)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64						AAGGTGTCATCTGGCCAGTGC	0.502								Direct reversal of damage;Nucleotide excision repair (NER)																																									1	Substitution - Missense(1)	kidney(1)											82.0	84.0	83.0					10																	50732744		2203	4300	6503	SO:0001583	missense	2074			L04791	CCDS7229.1	10q11	2014-09-17	2014-03-07		ENSG00000225830	ENSG00000225830			3438	protein-coding gene	gene with protein product	"""Cockayne syndrome B protein"""	609413	"""excision repair cross-complementing rodent repair deficiency, complementation group 6"""	CKN2		1339317, 19179336	Standard	NM_000124		Approved	CSB, RAD26, ARMD5	uc001jhs.5	Q03468	OTTHUMG00000018195	ENST00000355832.5:c.732G>T	10.37:g.50732744C>A	ENSP00000348089:p.Gln244His	Somatic		WXS	Illumina HiSeq	Phase_I	D3DX94|Q5W0L9	Missense_Mutation	SNP	ENST00000355832.5	37	CCDS7229.1	.	.	.	.	.	.	.	.	.	.	C	19.81	3.895807	0.72639	.	.	ENSG00000225830;ENSG00000258838;ENSG00000258838	ENST00000355832;ENST00000515869;ENST00000447839	D;T;T	0.84589	-1.87;3.07;3.07	6.03	6.03	0.97812	.	.	.	.	.	D	0.84138	0.5406	L	0.58669	1.825	0.80722	D	1	P;B	0.42692	0.787;0.229	B;B	0.39217	0.294;0.132	D	0.84795	0.0781	9	0.51188	T	0.08	-26.6447	18.7472	0.91797	0.0:1.0:0.0:0.0	.	244;244	E7EV46;Q03468	.;ERCC6_HUMAN	H	244	ENSP00000348089:Q244H;ENSP00000423550:Q244H;ENSP00000387966:Q244H	ENSP00000348089:Q244H	Q	-	3	2	ERCC6;RP11-123B3.6	50402750	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.396000	0.44468	2.854000	0.98071	0.655000	0.94253	CAG		0.502	ERCC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047990.1		NM_000124	
FAM129B	64855	broad.mit.edu;hgsc.bcm.edu	37	9	130287413	130287413	+	Silent	SNP	G	G	A	rs370542607		TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr9:130287413G>A	ENST00000373312.3	-	4	558	c.345C>T	c.(343-345)gcC>gcT	p.A115A	FAM129B_ENST00000468379.1_5'UTR|FAM129B_ENST00000373314.3_Silent_p.A102A	NM_022833.2	NP_073744.2	Q96TA1	NIBL1_HUMAN	family with sequence similarity 129, member B	115	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				negative regulation of apoptotic process (GO:0043066)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.A115A(1)		breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|liver(1)|lung(7)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	25						TGTTGATGACGGCTCGTGGTG	0.587																																																	1	Substitution - coding silent(1)	kidney(1)						G	,	0,4406		0,0,2203	102.0	92.0	95.0		306,345	-1.0	0.1	9		95	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	FAM129B	NM_001035534.1,NM_022833.2	,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,	102/734,115/747	130287413	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	64855			AF151783	CCDS35144.1, CCDS35145.1	9q34.13	2010-02-01	2006-11-23	2006-11-23	ENSG00000136830	ENSG00000136830			25282	protein-coding gene	gene with protein product		614045	"""chromosome 9 open reading frame 88"""	C9orf88		14702039, 19362540	Standard	XM_005252135		Approved	DKFZP434H0820, FLJ13518, FLJ22151, FLJ22298, bA356B19.6, MINERVA	uc004brh.3	Q96TA1	OTTHUMG00000020705	ENST00000373312.3:c.345C>T	9.37:g.130287413G>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q4LE55|Q5VVW6|Q5VVW7|Q9BUS2|Q9NT35	Silent	SNP	ENST00000373312.3	37	CCDS35145.1																																																																																				0.587	FAM129B-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054196.1		NM_022833	
FAM83B	222584	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	54806759	54806759	+	Missense_Mutation	SNP	G	G	A	rs146473058		TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr6:54806759G>A	ENST00000306858.7	+	5	3106	c.2990G>A	c.(2989-2991)cGa>cAa	p.R997Q	RP3-523K23.2_ENST00000562834.1_RNA	NM_001010872.1	NP_001010872.1	Q5T0W9	FA83B_HUMAN	family with sequence similarity 83, member B	997								p.R997Q(1)		autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(28)|ovary(6)|prostate(6)|skin(6)|upper_aerodigestive_tract(1)	71	Lung NSC(77;0.0178)|Renal(3;0.122)					AACAAGTTTCGAGGATTTATG	0.338																																																	1	Substitution - Missense(1)	kidney(1)						G	GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	48.0	47.0	48.0		2990	5.8	1.0	6	dbSNP_134	48	0,8600		0,0,4300	no	missense	FAM83B	NM_001010872.1	43	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	997/1012	54806759	1,13005	2203	4300	6503	SO:0001583	missense	222584			AK055204	CCDS34479.1	6p12.1	2014-03-13	2006-03-23	2006-03-23	ENSG00000168143	ENSG00000168143			21357	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 143"""	C6orf143		22886302	Standard	NM_001010872		Approved	FLJ30642	uc003pck.4	Q5T0W9	OTTHUMG00000014899	ENST00000306858.7:c.2990G>A	6.37:g.54806759G>A	ENSP00000304078:p.Arg997Gln	Somatic		WXS	Illumina HiSeq	Phase_I	Q2M1P3|Q96DQ2	Missense_Mutation	SNP	ENST00000306858.7	37	CCDS34479.1	.	.	.	.	.	.	.	.	.	.	G	29.8	5.032739	0.93575	2.27E-4	0.0	ENSG00000168143	ENST00000306858	T	0.47177	0.85	5.76	5.76	0.90799	.	0.099520	0.44483	D	0.000459	T	0.57169	0.2035	M	0.67953	2.075	0.43287	D	0.995267	D	0.76494	0.999	P	0.56751	0.805	T	0.56189	-0.8020	10	0.49607	T	0.09	-17.359	19.9813	0.97326	0.0:0.0:1.0:0.0	.	997	Q5T0W9	FA83B_HUMAN	Q	997	ENSP00000304078:R997Q	ENSP00000304078:R997Q	R	+	2	0	FAM83B	54914718	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.516000	0.73755	2.726000	0.93360	0.655000	0.94253	CGA		0.338	FAM83B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040994.1		XM_294139	
FBXO4	26272	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	41927219	41927219	+	Silent	SNP	G	G	A			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr5:41927219G>A	ENST00000281623.3	+	2	350	c.294G>A	c.(292-294)ctG>ctA	p.L98L	FBXO4_ENST00000509134.1_Silent_p.L98L|FBXO4_ENST00000296812.2_Silent_p.L98L	NM_012176.2	NP_036308.1	Q9UKT5	FBX4_HUMAN	F-box protein 4	98	F-box. {ECO:0000255|PROSITE- ProRule:PRU00080}.				positive regulation of protein ubiquitination (GO:0031398)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|telomere maintenance (GO:0000723)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	protein homodimerization activity (GO:0042803)|ubiquitin-protein transferase activity (GO:0004842)	p.L98L(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(6)|liver(1)|lung(11)|prostate(1)|stomach(1)|urinary_tract(2)	27		Lung NSC(810;4.15e-05)|Breast(839;0.00093)|Ovarian(839;0.00965)|Myeloproliferative disorder(839;0.0255)|all_neural(839;0.0604)				ATCCAATTCTGTGGAGATACT	0.368																																																	1	Substitution - coding silent(1)	kidney(1)											182.0	180.0	181.0					5																	41927219		2203	4300	6503	SO:0001819	synonymous_variant	26272			AF129534	CCDS3938.1, CCDS3939.1, CCDS75238.1	5p12	2008-02-05	2004-06-15		ENSG00000151876	ENSG00000151876		"""F-boxes /  ""other"""""	13583	protein-coding gene	gene with protein product		609090	"""F-box only protein 4"""			10531035, 10531037	Standard	NM_033484		Approved	FBX4	uc003jmq.3	Q9UKT5	OTTHUMG00000094799	ENST00000281623.3:c.294G>A	5.37:g.41927219G>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q68CU8|Q86VT8|Q9UK98	Silent	SNP	ENST00000281623.3	37	CCDS3938.1																																																																																				0.368	FBXO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211614.1			
TNNI3K	51086	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	75009648	75009648	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr1:75009648C>A	ENST00000326637.3	+	25	2541	c.2490C>A	c.(2488-2490)agC>agA	p.S830R	TNNI3K_ENST00000465473.1_3'UTR|FPGT-TNNI3K_ENST00000557284.2_Missense_Mutation_p.S944R|TNNI3K_ENST00000370891.2_Missense_Mutation_p.S931R	NM_015978.2	NP_057062.1			TNNI3 interacting kinase									p.S830R(1)		cervix(1)|endometrium(3)|kidney(5)|large_intestine(21)|lung(31)|ovary(4)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)	76						ATAGTAGCAGCTTTGAGGACA	0.458																																																	1	Substitution - Missense(1)	kidney(1)											123.0	105.0	111.0					1																	75009648		2203	4300	6503	SO:0001583	missense	100526835			AF116826	CCDS664.1, CCDS44161.1	1p31.1	2014-09-17				ENSG00000116783			19661	protein-coding gene	gene with protein product		613932				12721663	Standard	NM_015978		Approved	CARK		Q59H18	OTTHUMG00000171318	ENST00000326637.3:c.2490C>A	1.37:g.75009648C>A	ENSP00000322251:p.Ser830Arg	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000326637.3	37	CCDS664.1	.	.	.	.	.	.	.	.	.	.	C	13.85	2.360959	0.41801	.	.	ENSG00000259030;ENSG00000116783;ENSG00000116783	ENST00000557284;ENST00000370891;ENST00000326637	T;T;T	0.75821	-0.97;-0.97;-0.94	5.32	4.26	0.50523	.	0.160659	0.53938	D	0.000057	T	0.46112	0.1376	L	0.29908	0.895	0.42164	D	0.991614	B;B	0.23058	0.079;0.0	B;B	0.15870	0.014;0.001	T	0.52381	-0.8583	10	0.54805	T	0.06	.	10.0367	0.42133	0.0:0.8888:0.0:0.1112	.	830;931	Q59H18;Q59H18-1	TNI3K_HUMAN;.	R	931;931;830	ENSP00000450895:S931R;ENSP00000359928:S931R;ENSP00000322251:S830R	ENSP00000322251:S830R	S	+	3	2	RP11-653A5.2;AC093158.1	74782236	1.000000	0.71417	1.000000	0.80357	0.720000	0.41350	1.771000	0.38542	1.286000	0.44565	0.561000	0.74099	AGC		0.458	TNNI3K-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026432.1		NM_015978	
FMO5	2330	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	146672930	146672930	+	Silent	SNP	G	G	A			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr1:146672930G>A	ENST00000254090.4	-	7	1375	c.987C>T	c.(985-987)gcC>gcT	p.A329A	RP11-337C18.10_ENST00000606856.1_RNA|RP11-337C18.8_ENST00000606757.1_RNA|RP11-337C18.8_ENST00000607149.1_RNA|FMO5_ENST00000369272.3_Intron|FMO5_ENST00000441068.2_Silent_p.A329A	NM_001461.2	NP_001452.2	P49326	FMO5_HUMAN	flavin containing monooxygenase 5	329						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)	p.A329A(2)		breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(9)|ovary(3)|upper_aerodigestive_tract(1)	25	all_hematologic(923;0.0487)					TATAGCCTGTGGCAAAGATAA	0.438																																																	2	Substitution - coding silent(2)	kidney(2)											100.0	94.0	96.0					1																	146672930		2203	4300	6503	SO:0001819	synonymous_variant	2330			Z47553	CCDS926.1, CCDS44209.1, CCDS44210.1	1q21.1	2011-08-04			ENSG00000131781	ENSG00000131781			3773	protein-coding gene	gene with protein product		603957				8786146, 9119381	Standard	NM_001461		Approved		uc001epi.2	P49326	OTTHUMG00000014607	ENST00000254090.4:c.987C>T	1.37:g.146672930G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B2RBG1|C9JJD1|Q8IV22	Silent	SNP	ENST00000254090.4	37	CCDS926.1																																																																																				0.438	FMO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040373.2		NM_001461	
FMN2	56776	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	240492737	240492737	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr1:240492737G>A	ENST00000319653.9	+	10	4636	c.4406G>A	c.(4405-4407)cGc>cAc	p.R1469H	FMN2_ENST00000545751.1_Missense_Mutation_p.R65H	NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	1469	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)	p.R1612H(1)		NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			TCAATTCGTCGCAAACTGGAA	0.408																																																	1	Substitution - Missense(1)	kidney(1)											137.0	130.0	133.0					1																	240492737		2203	4300	6503	SO:0001583	missense	56776			AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.4406G>A	1.37:g.240492737G>A	ENSP00000318884:p.Arg1469His	Somatic		WXS	Illumina HiSeq	Phase_I	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Missense_Mutation	SNP	ENST00000319653.9	37	CCDS31069.2	.	.	.	.	.	.	.	.	.	.	G	23.8	4.453475	0.84209	.	.	ENSG00000155816	ENST00000319653;ENST00000545751;ENST00000537355	T;T	0.19394	2.15;2.15	5.65	5.65	0.86999	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.000000	0.64402	D	0.000011	T	0.49081	0.1536	M	0.72624	2.21	0.80722	D	1	P;D;D;D	0.89917	0.95;0.999;1.0;0.995	P;D;D;P	0.77004	0.595;0.924;0.989;0.883	T	0.46693	-0.9173	10	0.72032	D	0.01	.	19.7243	0.96157	0.0:0.0:1.0:0.0	.	65;115;98;1469	B4DP05;F5H2C1;B4DN09;Q9NZ56	.;.;.;FMN2_HUMAN	H	1469;65;96	ENSP00000318884:R1469H;ENSP00000437918:R65H	ENSP00000318884:R1469H	R	+	2	0	FMN2	238559360	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.658000	0.68003	2.647000	0.89833	0.655000	0.94253	CGC		0.408	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096217.2		XM_371352	
FRK	2444	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	116288847	116288847	+	Missense_Mutation	SNP	T	T	A			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr6:116288847T>A	ENST00000606080.1	-	4	1112	c.666A>T	c.(664-666)aaA>aaT	p.K222N	FRK_ENST00000538210.1_Missense_Mutation_p.K80N	NM_002031.2	NP_002022.1	P42685	FRK_HUMAN	fyn-related Src family tyrosine kinase	222					cell differentiation (GO:0030154)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)	p.K222N(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|ovary(3)|pancreas(1)|skin(1)|urinary_tract(1)	27		all_cancers(87;0.00559)|all_epithelial(87;0.00738)|Colorectal(196;0.0465)		all cancers(137;0.0128)|OV - Ovarian serous cystadenocarcinoma(136;0.0209)|GBM - Glioblastoma multiforme(226;0.0459)|Epithelial(106;0.0625)	Regorafenib(DB08896)	GGTCCACGGTTTTATACGACA	0.383																																																	1	Substitution - Missense(1)	kidney(1)											96.0	88.0	91.0					6																	116288847		2203	4300	6503	SO:0001583	missense	2444			U00803	CCDS5103.1	6q21-q22.3	2014-06-25	2014-06-25		ENSG00000111816	ENSG00000111816	2.7.10.1	"""SH2 domain containing"""	3955	protein-coding gene	gene with protein product		606573	"""PTK5 protein tyrosine kinase 5"", ""fyn-related kinase"""	PTK5		7510261	Standard	NM_002031		Approved	RAK, GTK	uc003pwi.1	P42685	OTTHUMG00000015424	ENST00000606080.1:c.666A>T	6.37:g.116288847T>A	ENSP00000476145:p.Lys222Asn	Somatic		WXS	Illumina HiSeq	Phase_I	B4DY49|Q13128|Q9NTR5	Missense_Mutation	SNP	ENST00000606080.1	37	CCDS5103.1	.	.	.	.	.	.	.	.	.	.	T	9.284	1.048838	0.19827	.	.	ENSG00000111816	ENST00000368626;ENST00000538210	T;T	0.34472	1.36;1.36	5.37	-0.286	0.12862	Protein kinase-like domain (1);	0.339890	0.28241	N	0.016065	T	0.04815	0.0130	N	0.12471	0.22	0.42244	D	0.991947	B	0.10296	0.003	B	0.06405	0.002	T	0.23368	-1.0190	10	0.16420	T	0.52	.	1.7662	0.03002	0.1317:0.317:0.1354:0.4158	.	222	P42685	FRK_HUMAN	N	222;80	ENSP00000357615:K222N;ENSP00000443075:K80N	ENSP00000357615:K222N	K	-	3	2	FRK	116395540	1.000000	0.71417	0.931000	0.37212	0.331000	0.28603	0.828000	0.27435	0.083000	0.17047	0.477000	0.44152	AAA		0.383	FRK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041924.2		NM_002031	
GP1BA	2811	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	4836600	4836600	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr17:4836600G>A	ENST00000329125.5	+	2	776	c.701G>A	c.(700-702)cGc>cAc	p.R234H		NM_000173.5	NP_000164.5	P07359	GP1BA_HUMAN	glycoprotein Ib (platelet), alpha polypeptide	234	LRRCT.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell morphogenesis (GO:0000902)|cell surface receptor signaling pathway (GO:0007166)|fibrinolysis (GO:0042730)|platelet activation (GO:0030168)|regulation of blood coagulation (GO:0030193)|thrombin receptor signaling pathway (GO:0070493)	anchored component of external side of plasma membrane (GO:0031362)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	thrombin receptor activity (GO:0015057)	p.R234H(1)		central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(5)|stomach(1)|urinary_tract(1)	20						TATTTTCGTCGCTGGCTGCAG	0.493																																																	1	Substitution - Missense(1)	kidney(1)											89.0	82.0	84.0					17																	4836600		2020	4195	6215	SO:0001583	missense	2811				CCDS54068.1	17p13.2	2014-09-17			ENSG00000185245	ENSG00000185245		"""CD molecules"""	4439	protein-coding gene	gene with protein product		606672		GP1B		3353370	Standard	NM_000173		Approved	CD42b	uc021tnz.1	P07359	OTTHUMG00000177946	ENST00000329125.5:c.701G>A	17.37:g.4836600G>A	ENSP00000329380:p.Arg234His	Somatic		WXS	Illumina HiSeq	Phase_I	E7ES66|Q14441|Q16469|Q8N1F3|Q8NG39|Q9HDC7|Q9UEK1|Q9UQS4	Missense_Mutation	SNP	ENST00000329125.5	37	CCDS54068.1	.	.	.	.	.	.	.	.	.	.	G	8.333	0.826886	0.16749	.	.	ENSG00000185245	ENST00000329125;ENST00000438881	T	0.53423	0.62	4.81	-9.0	0.00747	.	0.956133	0.08523	N	0.933196	T	0.30448	0.0765	L	0.49455	1.56	0.09310	N	1	P	0.39094	0.659	B	0.17722	0.019	T	0.07271	-1.0781	10	0.35671	T	0.21	-0.3438	14.5899	0.68356	0.167:0.1014:0.7315:0.0	.	234	A5CKE2	.	H	234	ENSP00000329380:R234H	ENSP00000329380:R234H	R	+	2	0	GP1BA	4777380	0.000000	0.05858	0.001000	0.08648	0.537000	0.34900	-2.237000	0.01200	-2.001000	0.00964	0.313000	0.20887	CGC		0.493	GP1BA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439889.1			
GAS7	8522	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	9873005	9873005	+	Missense_Mutation	SNP	C	C	T	rs545830122		TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr17:9873005C>T	ENST00000432992.2	-	4	620	c.460G>A	c.(460-462)Ggt>Agt	p.G154S	GAS7_ENST00000579158.1_Missense_Mutation_p.G90S|GAS7_ENST00000396115.2_Missense_Mutation_p.G90S|GAS7_ENST00000437099.2_Missense_Mutation_p.G90S|GAS7_ENST00000585266.1_Missense_Mutation_p.G94S|GAS7_ENST00000578655.1_Intron|GAS7_ENST00000542249.1_Missense_Mutation_p.G90S|GAS7_ENST00000540214.1_Missense_Mutation_p.G90S|GAS7_ENST00000323816.4_Missense_Mutation_p.G94S	NM_201433.1	NP_958839.1	O60861	GAS7_HUMAN	growth arrest-specific 7	154					actin filament bundle assembly (GO:0051017)|actin filament polymerization (GO:0030041)|cell cycle arrest (GO:0007050)|neuron projection morphogenesis (GO:0048812)|regulation of cell shape (GO:0008360)|regulation of transcription, DNA-templated (GO:0006355)	actin filament (GO:0005884)|cytoplasm (GO:0005737)|ruffle (GO:0001726)	sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G154S(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(7)|lung(18)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	39						TGGGAATCACCGGTGGATTTT	0.562			T	MLL	AML*								C|||	1	0.000199681	0.0	0.0	5008	,	,		19756	0.001		0.0	False		,,,				2504	0.0							Dom	yes		17	17p	8522	growth arrest-specific 7		L	1	Substitution - Missense(1)	kidney(1)											147.0	121.0	130.0					17																	9873005		2203	4300	6503	SO:0001583	missense	8522			AB007854	CCDS11152.1, CCDS42263.1, CCDS45611.1, CCDS58518.1	17p13.1	2004-02-18							4169	protein-coding gene	gene with protein product		603127				9736752	Standard	NM_001130831		Approved	KIAA0394, MGC1348	uc002gmg.1	O60861		ENST00000432992.2:c.460G>A	17.37:g.9873005C>T	ENSP00000407552:p.Gly154Ser	Somatic		WXS	Illumina HiSeq	Phase_I	A8KAC2|B2RCK9|O43144|Q53Y77|Q7Z571	Missense_Mutation	SNP	ENST00000432992.2	37	CCDS11152.1	.	.	.	.	.	.	.	.	.	.	C	12.46	1.946137	0.34377	.	.	ENSG00000007237	ENST00000323816;ENST00000396115;ENST00000437099;ENST00000540214;ENST00000537970	T;T	0.44482	2.19;0.92	4.76	4.76	0.60689	.	0.529823	0.19253	N	0.118872	T	0.27697	0.0681	N	0.19112	0.55	0.80722	D	1	B;B;B	0.19583	0.037;0.037;0.037	B;B;B	0.10450	0.005;0.005;0.005	T	0.05699	-1.0869	9	.	.	.	-10.3362	13.4409	0.61112	0.0:1.0:0.0:0.0	.	106;94;154	B7Z2L1;A8KAC2;O60861	.;.;GAS7_HUMAN	S	154;94;93;90;94	ENSP00000379421:G94S;ENSP00000446214:G90S	.	G	-	1	0	GAS7	9813730	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.594000	0.46189	2.645000	0.89757	0.591000	0.81541	GGT		0.562	GAS7-017	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439883.1		NM_003644, NM_201432, NM_201433	
GPR160	26996	broad.mit.edu;hgsc.bcm.edu	37	3	169802072	169802072	+	Silent	SNP	T	T	C			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr3:169802072T>C	ENST00000355897.5	+	4	920	c.312T>C	c.(310-312)acT>acC	p.T104T		NM_014373.2	NP_055188.1	Q9UJ42	GP160_HUMAN	G protein-coupled receptor 160	104						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)	p.T104T(1)		breast(1)|cervix(1)|kidney(1)|large_intestine(3)|lung(2)	8	all_cancers(22;3.26e-22)|all_epithelial(15;5.71e-27)|all_lung(20;8.41e-17)|Lung NSC(18;3.49e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0655)			TTTCCTTTACTTATGGCTTTT	0.294																																																	1	Substitution - coding silent(1)	kidney(1)											58.0	61.0	60.0					3																	169802072		2203	4296	6499	SO:0001819	synonymous_variant	26996			AB083583	CCDS3211.1	3q26.2-q27	2012-08-21			ENSG00000173890	ENSG00000173890		"""GPCR / Class A : Orphans"""	23693	protein-coding gene	gene with protein product						12044878	Standard	NM_014373		Approved	GPCR150, GPCR1	uc003fgi.3	Q9UJ42	OTTHUMG00000158776	ENST00000355897.5:c.312T>C	3.37:g.169802072T>C		Somatic		WXS	Illumina HiSeq	Phase_I	D3DNQ2	Silent	SNP	ENST00000355897.5	37	CCDS3211.1																																																																																				0.294	GPR160-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352167.1		NM_014373	
HEXA	3073	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	72640389	72640389	+	Splice_Site	SNP	G	G	A	rs552505619		TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr15:72640389G>A	ENST00000268097.5	-	9	1576	c.1073C>T	c.(1072-1074)aCg>aTg	p.T358M	RP11-106M3.2_ENST00000379915.4_RNA|HEXA_ENST00000566304.1_Splice_Site_p.T369M|HEXA_ENST00000567159.1_Splice_Site_p.T358M|RP11-106M3.3_ENST00000570175.1_RNA|HEXA_ENST00000457859.2_Splice_Site_p.T166M|HEXA_ENST00000429918.2_Splice_Site_p.T185M	NM_000520.4	NP_000511.2	P06865	HEXA_HUMAN	hexosaminidase A (alpha polypeptide)	358					carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|glycosphingolipid metabolic process (GO:0006687)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)	beta-N-acetylhexosaminidase activity (GO:0004563)|protein heterodimerization activity (GO:0046982)	p.T358M(1)		breast(2)|cervix(1)|endometrium(3)|kidney(3)|lung(7)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	24						CCTTCCTCACGTCTGGATGTA	0.577													G|||	1	0.000199681	0.0	0.0	5008	,	,		12614	0.0		0.0	False		,,,				2504	0.001																1	Substitution - Missense(1)	kidney(1)											64.0	62.0	63.0					15																	72640389		2199	4297	6496	SO:0001630	splice_region_variant	3073			M13520	CCDS10243.1	15q24.1	2012-10-02			ENSG00000213614	ENSG00000213614	3.2.1.52		4878	protein-coding gene	gene with protein product	"""Tay Sachs disease"", ""GM2 gangliosidosis"""	606869				2952641, 3013851	Standard	NM_000520		Approved		uc002aun.4	P06865	OTTHUMG00000133445	ENST00000268097.5:c.1073+1C>T	15.37:g.72640389G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B4DKE7|E7ENH7|Q53HS8|Q6AI32	Missense_Mutation	SNP	ENST00000268097.5	37	CCDS10243.1	.	.	.	.	.	.	.	.	.	.	G	15.20	2.762731	0.49574	.	.	ENSG00000213614	ENST00000268097;ENST00000457859;ENST00000429918	D;D;D	0.97620	-3.78;-4.46;-3.78	5.55	-3.71	0.04424	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);Glycoside hydrolase, family 20, catalytic core (1);	0.471231	0.23622	N	0.046240	D	0.90573	0.7045	L	0.38175	1.15	0.34479	D	0.70362	B;B;B;B;B	0.22480	0.039;0.032;0.039;0.018;0.07	B;B;B;B;B	0.26094	0.002;0.066;0.002;0.011;0.011	T	0.77960	-0.2391	9	.	.	.	-1.3951	0.8207	0.01111	0.1932:0.2193:0.1748:0.4127	.	185;369;185;238;358	E9PGL4;B4DVA7;B4DVL8;Q9BVJ8;P06865	.;.;.;.;HEXA_HUMAN	M	358;166;185	ENSP00000268097:T358M;ENSP00000398026:T166M;ENSP00000416187:T185M	.	T	-	2	0	HEXA	70427443	0.829000	0.29322	0.993000	0.49108	0.943000	0.58893	-0.112000	0.10791	-0.294000	0.08973	0.655000	0.94253	ACG		0.577	HEXA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257317.2		NM_000520	Missense_Mutation
HSPA9	3313	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	137895767	137895767	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr5:137895767A>G	ENST00000297185.3	-	11	1321	c.1196T>C	c.(1195-1197)gTa>gCa	p.V399A	SNORD63_ENST00000411005.1_RNA|SNORD63_ENST00000384262.1_RNA|HSPA9_ENST00000501917.2_Intron	NM_004134.6	NP_004125.3	P38646	GRP75_HUMAN	heat shock 70kDa protein 9 (mortalin)	399					cellular protein metabolic process (GO:0044267)|negative regulation of apoptotic process (GO:0043066)|protein export from nucleus (GO:0006611)|protein folding (GO:0006457)|protein targeting to mitochondrion (GO:0006626)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)	p.V399A(1)		breast(2)|endometrium(1)|kidney(4)|large_intestine(8)|lung(12)|upper_aerodigestive_tract(1)	28			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			AAGATCCTGTACAGTCTGCTG	0.537																																																	1	Substitution - Missense(1)	kidney(1)											34.0	33.0	33.0					5																	137895767		2203	4300	6503	SO:0001583	missense	3313			L11066	CCDS4208.1	5q31.1	2011-09-02	2006-10-31	2006-10-31	ENSG00000113013	ENSG00000113013		"""Heat shock proteins / HSP70"""	5244	protein-coding gene	gene with protein product		600548	"""heat shock 70kDa protein 9B (mortalin-2)"""	HSPA9B		7684501	Standard	NM_004134		Approved	GRP75, PBP74, mot-2, mthsp75	uc003ldf.3	P38646	OTTHUMG00000129206	ENST00000297185.3:c.1196T>C	5.37:g.137895767A>G	ENSP00000297185:p.Val399Ala	Somatic		WXS	Illumina HiSeq	Phase_I	B2RCM1|P30036|P31932|Q1HB43|Q53H23|Q6GU03|Q9BWB7|Q9UC56	Missense_Mutation	SNP	ENST00000297185.3	37	CCDS4208.1	.	.	.	.	.	.	.	.	.	.	A	16.62	3.173044	0.57584	.	.	ENSG00000113013	ENST00000297185;ENST00000541333;ENST00000540484	T	0.01446	4.88	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	T	0.16938	0.0407	H	0.95151	3.63	0.80722	D	1	P;P	0.49358	0.785;0.923	D;D	0.68039	0.913;0.955	T	0.01643	-1.1305	10	0.87932	D	0	-13.7568	15.5293	0.75942	1.0:0.0:0.0:0.0	.	330;399	B7Z1V7;P38646	.;GRP75_HUMAN	A	399;352;385	ENSP00000297185:V399A	ENSP00000297185:V399A	V	-	2	0	HSPA9	137923666	1.000000	0.71417	0.979000	0.43373	0.002000	0.02628	9.221000	0.95188	2.220000	0.72140	0.533000	0.62120	GTA		0.537	HSPA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251285.1		NM_004134	
IQCE	23288	broad.mit.edu;hgsc.bcm.edu	37	7	2629606	2629606	+	Silent	SNP	C	C	G	rs200293391	byFrequency	TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr7:2629606C>G	ENST00000402050.2	+	14	1294	c.1110C>G	c.(1108-1110)gcC>gcG	p.A370A	IQCE_ENST00000325979.7_Silent_p.A305A|IQCE_ENST00000404984.1_Silent_p.A319A|IQCE_ENST00000438376.2_Silent_p.A354A	NM_001100390.1|NM_152558.3	NP_001093860.1|NP_689771.3	Q6IPM2	IQCE_HUMAN	IQ motif containing E	370						mitochondrion (GO:0005739)		p.A370A(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;1.23e-13)		ACCCGCCAGCCTGCCTTGCAT	0.567																																																	1	Substitution - coding silent(1)	kidney(1)											50.0	60.0	57.0					7																	2629606		2098	4231	6329	SO:0001819	synonymous_variant	23288			AL136792	CCDS43542.1, CCDS47527.1, CCDS47527.2, CCDS75559.1, CCDS75560.1	7p22.3	2006-04-12			ENSG00000106012	ENSG00000106012			29171	protein-coding gene	gene with protein product						10470851	Standard	XR_242067		Approved	KIAA1023	uc003smo.4	Q6IPM2	OTTHUMG00000152047	ENST00000402050.2:c.1110C>G	7.37:g.2629606C>G		Somatic		WXS	Illumina HiSeq	Phase_I	Q4G0P7|Q6P7T4|Q9H0H7|Q9UPX7	Silent	SNP	ENST00000402050.2	37	CCDS43542.1																																																																																				0.567	IQCE-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325063.2		NM_152558	
ISPD	729920	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	16445697	16445697	+	Missense_Mutation	SNP	T	T	C			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr7:16445697T>C	ENST00000407010.2	-	2	522	c.523A>G	c.(523-525)Aag>Gag	p.K175E	ISPD_ENST00000399310.3_Missense_Mutation_p.K175E	NM_001101426.3	NP_001094896.1	A4D126	ISPD_HUMAN	isoprenoid synthase domain containing	175					axon guidance (GO:0007411)|isoprenoid biosynthetic process (GO:0008299)|protein O-linked mannosylation (GO:0035269)		nucleotidyltransferase activity (GO:0016779)	p.K175E(2)		endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)	9						CCGTGTTCCTTAGCAGCTGTG	0.393										Multiple Myeloma(15;0.18)																																							2	Substitution - Missense(2)	kidney(2)											73.0	67.0	69.0					7																	16445697		1892	4115	6007	SO:0001583	missense	729920			AK124805		7p21.2	2010-03-19			ENSG00000214960	ENSG00000214960			37276	protein-coding gene	gene with protein product	"""notch1-induced protein"", ""4-diphosphocytidyl-2C-methyl-D-erythritol synthase homolog (Arabidopsis)"""	614631				11181995	Standard	NM_001101417		Approved	hCG_1745121, IspD, Nip	uc010ktx.2	A4D126	OTTHUMG00000152447	ENST00000407010.2:c.523A>G	7.37:g.16445697T>C	ENSP00000385478:p.Lys175Glu	Somatic		WXS	Illumina HiSeq	Phase_I	A8MU35|H9KVB2	Missense_Mutation	SNP	ENST00000407010.2	37		.	.	.	.	.	.	.	.	.	.	T	14.37	2.514626	0.44763	.	.	ENSG00000214960	ENST00000407010;ENST00000399310	D;D	0.84516	-1.86;-1.86	5.88	3.44	0.39384	4-diphosphocytidyl-2C-methyl-D-erythritol synthase (1);	0.131090	0.49305	U	0.000157	T	0.73265	0.3565	N	0.17800	0.525	0.49051	D	0.999745	B	0.17852	0.024	B	0.22152	0.038	T	0.62324	-0.6878	10	0.32370	T	0.25	-11.5792	9.008	0.36124	0.0:0.0654:0.1263:0.8083	.	175	A4D126	ISPD_HUMAN	E	175	ENSP00000385478:K175E;ENSP00000382249:K175E	ENSP00000382249:K175E	K	-	1	0	ISPD	16412222	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	4.851000	0.62896	0.440000	0.26502	0.533000	0.62120	AAG		0.393	ISPD-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000326252.4		NM_001101426	
KCNAB2	8514	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	6157369	6157369	+	Frame_Shift_Del	DEL	G	G	-			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr1:6157369delG	ENST00000164247.1	+	15	1530	c.966delG	c.(964-966)ctgfs	p.L322fs	KCNAB2_ENST00000458166.2_Frame_Shift_Del_p.L255fs|KCNAB2_ENST00000602612.1_Frame_Shift_Del_p.L322fs|KCNAB2_ENST00000378092.1_Frame_Shift_Del_p.L308fs|KCNAB2_ENST00000378111.1_Intron|KCNAB2_ENST00000378087.3_Intron|KCNAB2_ENST00000352527.1_Frame_Shift_Del_p.L308fs|KCNAB2_ENST00000378097.1_Frame_Shift_Del_p.L322fs|KCNAB2_ENST00000341524.1_Frame_Shift_Del_p.L322fs|KCNAB2_ENST00000378083.3_Frame_Shift_Del_p.L370fs	NM_001199860.1	NP_001186789.1	Q13303	KCAB2_HUMAN	potassium voltage-gated channel, shaker-related subfamily, beta member 2	322					hematopoietic progenitor cell differentiation (GO:0002244)|protein heterooligomerization (GO:0051291)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|plasma membrane (GO:0005886)	potassium channel regulator activity (GO:0015459)|voltage-gated potassium channel activity (GO:0005249)			large_intestine(1)|lung(4)|skin(3)	8	Ovarian(185;0.0634)	all_cancers(23;5.85e-39)|all_epithelial(116;4.88e-22)|all_lung(118;4.21e-08)|Lung NSC(185;9.77e-07)|all_hematologic(16;2.78e-06)|all_neural(13;3.18e-06)|Acute lymphoblastic leukemia(12;0.000272)|Breast(487;0.000496)|Renal(390;0.0007)|Colorectal(325;0.00106)|Glioma(11;0.00203)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0393)|Medulloblastoma(700;0.211)		Epithelial(90;6.9e-37)|GBM - Glioblastoma multiforme(13;8.8e-31)|OV - Ovarian serous cystadenocarcinoma(86;1.45e-19)|Colorectal(212;2.46e-07)|COAD - Colon adenocarcinoma(227;2.07e-05)|Kidney(185;7.88e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00131)|BRCA - Breast invasive adenocarcinoma(365;0.00133)|STAD - Stomach adenocarcinoma(132;0.00391)|READ - Rectum adenocarcinoma(331;0.0649)		CCGTGCTCCTGGGGGCCTCCA	0.652																																																	0													57.0	47.0	51.0					1																	6157369		2120	4164	6284	SO:0001589	frameshift_variant	8514			U33429	CCDS55.1, CCDS56.1, CCDS55570.1, CCDS55571.1	1p36.3	2008-02-05			ENSG00000069424	ENSG00000069424		"""Potassium channels"", ""Aldo-keto reductases"""	6229	protein-coding gene	gene with protein product		601142				8838324	Standard	NM_003636		Approved	AKR6A5, KCNA2B, HKvbeta2.1, HKvbeta2.2	uc001aly.2	Q13303	OTTHUMG00000000795	ENST00000164247.1:c.966delG	1.37:g.6157369delG	ENSP00000164247:p.Leu322fs	Somatic		WXS	Illumina HiSeq	Phase_I	A0AVM9|A8K1A4|B0AZR7|O43659|Q5TG82|Q5TG83|Q6ZNE4|Q99411	Frame_Shift_Del	DEL	ENST00000164247.1	37	CCDS55.1																																																																																				0.652	KCNAB2-006	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000002114.3		NM_172130	
KAZN	23254	broad.mit.edu;hgsc.bcm.edu	37	1	15428039	15428039	+	Splice_Site	SNP	C	C	T			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr1:15428039C>T	ENST00000376030.2	+	11	1842	c.1548C>T	c.(1546-1548)agC>agT	p.S516S		NM_201628.2	NP_963922.2	Q674X7	KAZRN_HUMAN	kazrin, periplakin interacting protein	516					keratinization (GO:0031424)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|desmosome (GO:0030057)|nucleus (GO:0005634)		p.S516S(1)		central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(6)|ovary(1)|prostate(2)	25						TCCTCCCCAGCCTGTCCAAAG	0.587																																																	1	Substitution - coding silent(1)	kidney(1)											19.0	19.0	19.0					1																	15428039		2138	4108	6246	SO:0001630	splice_region_variant	0			AY505119	CCDS30604.1, CCDS41267.1, CCDS152.2, CCDS41268.1	1p36.21	2014-02-12	2011-01-31		ENSG00000189337	ENSG00000189337		"""Sterile alpha motif (SAM) domain containing"""	29173	protein-coding gene	gene with protein product						15337775, 18840647	Standard	NM_015209		Approved	KIAA1026, KAZRIN, FLJ43806	uc001avm.4	Q674X7	OTTHUMG00000002042	ENST00000376030.2:c.1548-1C>T	1.37:g.15428039C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B0QYQ0|B1AK78|Q5TGF1|Q674X4|Q674X6|Q6ZUD1|Q8IYN7|Q8N409|Q9UIL2|Q9UPX4	Silent	SNP	ENST00000376030.2	37	CCDS152.2																																																																																				0.587	KAZN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005690.2		NM_001017999	Silent
KCTD20	222658	broad.mit.edu;ucsc.edu	37	6	36442785	36442785	+	Missense_Mutation	SNP	G	G	A	rs576744140		TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr6:36442785G>A	ENST00000373731.2	+	3	771	c.380G>A	c.(379-381)cGt>cAt	p.R127H	KCTD20_ENST00000474988.1_Intron|KCTD20_ENST00000536244.1_Intron|KCTD20_ENST00000449081.2_Intron|KCTD20_ENST00000544295.1_Intron	NM_173562.3	NP_775833.2	Q7Z5Y7	KCD20_HUMAN	potassium channel tetramerization domain containing 20	127	BTB.				protein homooligomerization (GO:0051260)			p.R127H(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|skin(1)	15						GATGGCACACGTTTTGTTGTG	0.408													G|||	1	0.000199681	0.0	0.0014	5008	,	,		18145	0.0		0.0	False		,,,				2504	0.0																1	Substitution - Missense(1)	kidney(1)											129.0	124.0	126.0					6																	36442785		2203	4300	6503	SO:0001583	missense	222658			BC023525	CCDS4821.1, CCDS69096.1, CCDS69097.1	6p21.31	2013-06-20	2013-06-20	2006-06-26	ENSG00000112078	ENSG00000112078			21052	protein-coding gene	gene with protein product		615932	"""chromosome 6 open reading frame 69"", ""potassium channel tetramerisation domain containing 20"""	C6orf69			Standard	NM_001286580		Approved	dJ108K11.3, MGC14254	uc003ome.3	Q7Z5Y7	OTTHUMG00000014597	ENST00000373731.2:c.380G>A	6.37:g.36442785G>A	ENSP00000362836:p.Arg127His	Somatic		WXS	Illumina GAIIx	Phase_I	B4DZD3|B4E2Q3|F5H3T3|Q5W105|Q69YQ7|Q8IZ55	Missense_Mutation	SNP	ENST00000373731.2	37	CCDS4821.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.161161	0.78226	.	.	ENSG00000112078	ENST00000373731	D	0.82619	-1.63	5.26	5.26	0.73747	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.076450	0.53938	D	0.000049	T	0.80649	0.4663	M	0.71871	2.18	0.80722	D	1	P	0.50819	0.939	B	0.42555	0.391	D	0.84453	0.0589	10	0.72032	D	0.01	-17.2199	19.0748	0.93156	0.0:0.0:1.0:0.0	.	127	Q7Z5Y7	KCD20_HUMAN	H	127	ENSP00000362836:R127H	ENSP00000362836:R127H	R	+	2	0	KCTD20	36550763	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.781000	0.85668	2.733000	0.93635	0.655000	0.94253	CGT		0.408	KCTD20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040345.2		NM_173562	
KIF1C	10749	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	4923903	4923903	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr17:4923903G>A	ENST00000320785.5	+	20	2224	c.1867G>A	c.(1867-1869)Gac>Aac	p.D623N	KIF1C_ENST00000573815.1_3'UTR|AC109333.10_ENST00000438266.1_RNA	NM_006612.5	NP_006603.2	O43896	KIF1C_HUMAN	kinesin family member 1C	623					ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)|poly(A) RNA binding (GO:0044822)	p.D623N(1)		NS(2)|breast(4)|endometrium(4)|kidney(2)|large_intestine(8)|lung(6)|skin(1)|urinary_tract(3)	30						TGAGCCAGTCGACTGGAACTT	0.617																																					Melanoma(96;1023 1447 10250 19259 33730)												1	Substitution - Missense(1)	kidney(1)											50.0	51.0	51.0					17																	4923903		2203	4300	6503	SO:0001583	missense	10749			U91329	CCDS11065.1	17p13.2	2014-03-03			ENSG00000129250	ENSG00000129250		"""Kinesins"""	6317	protein-coding gene	gene with protein product		603060	"""spastic ataxia 2 (autosomal recessive)"""	SAX2		9685376, 24319291, 24482476	Standard	NM_006612		Approved	SPAX2, SPG58	uc002gan.2	O43896	OTTHUMG00000099451	ENST00000320785.5:c.1867G>A	17.37:g.4923903G>A	ENSP00000320821:p.Asp623Asn	Somatic		WXS	Illumina HiSeq	Phase_I	D3DTL6|O75186|Q5U618	Missense_Mutation	SNP	ENST00000320785.5	37	CCDS11065.1	.	.	.	.	.	.	.	.	.	.	G	28.7	4.946724	0.92593	.	.	ENSG00000129250	ENST00000320785	T	0.78595	-1.19	5.68	5.68	0.88126	.	.	.	.	.	D	0.89842	0.6832	M	0.88310	2.945	0.80722	D	1	D	0.76494	0.999	D	0.75020	0.985	D	0.91098	0.4912	9	0.66056	D	0.02	.	17.2981	0.87174	0.0:0.0:1.0:0.0	.	623	O43896	KIF1C_HUMAN	N	623	ENSP00000320821:D623N	ENSP00000320821:D623N	D	+	1	0	KIF1C	4864627	1.000000	0.71417	0.961000	0.40146	0.749000	0.42624	9.771000	0.98977	2.683000	0.91414	0.655000	0.94253	GAC		0.617	KIF1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216916.1			
KRTAP7-1	337878	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	21	32202006	32202006	+	RNA	SNP	G	G	C			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr21:32202006G>C	ENST00000452750.1	-	0	72							Q8IUC3	KRA71_HUMAN	keratin associated protein 7-1 (gene/pseudogene)							intermediate filament (GO:0005882)											CACAGCAGAAGTAACGAGTCA	0.488																																																	0													52.0	52.0	52.0					21																	32202006		692	1591	2283			337878			AJ457063	CCDS74780.1	21q22.1	2014-04-10	2010-03-12		ENSG00000184586	ENSG00000274749		"""Keratin associated proteins"""	18934	protein-coding gene	gene with protein product			"""keratin associated protein 7-1"""			12359730	Standard	NM_181606		Approved	KAP7.1	uc011adj.2	Q8IUC3	OTTHUMG00000188305		21.37:g.32202006G>C		Somatic		WXS	Illumina HiSeq	Phase_I	Q3LI56	Nonsense_Mutation	SNP	ENST00000452750.1	37																																																																																					0.488	KRTAP7-1-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000128248.3		NM_181606	
Unknown	0	broad.mit.edu	37	1	149280301	149280302	+	IGR	INS	-	-	A	rs145241142|rs145896171|rs587754269		TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr1:149280301_149280302insA								RP11-403I13.4 (14791 upstream) : RP11-403I13.7 (4342 downstream)																							CCAATTTAGTGAAAAAAAACTG	0.411																																																	0																																										SO:0001628	intergenic_variant	388692																															1.37:g.149280309_149280309dupA		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	INS		37																																																																																				0	0.411									
SMG1P5	595101	broad.mit.edu	37	16	30278845	30278845	+	IGR	DEL	A	A	-			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr16:30278845delA								RP11-347C12.1 (21723 upstream) : snoU13 (11723 downstream)																							TTTCTCTTACAAAAAAAAAAA	0.313																																																	0																																										SO:0001628	intergenic_variant	440354																															16.37:g.30278845delA		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	DEL		37																																																																																				0	0.313									
LPHN2	23266	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	82456186	82456186	+	Missense_Mutation	SNP	A	A	C			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr1:82456186A>C	ENST00000370728.1	+	25	4382	c.3737A>C	c.(3736-3738)cAa>cCa	p.Q1246P	LPHN2_ENST00000335786.5_Missense_Mutation_p.Q1203P|LPHN2_ENST00000394879.1_Missense_Mutation_p.Q1248P|LPHN2_ENST00000370717.2_Missense_Mutation_p.Q1261P|LPHN2_ENST00000370715.1_3'UTR|LPHN2_ENST00000370730.1_Missense_Mutation_p.Q1203P|LPHN2_ENST00000271029.4_Missense_Mutation_p.Q1218P|LPHN2_ENST00000370725.1_Missense_Mutation_p.Q1261P|LPHN2_ENST00000469377.2_3'UTR|LPHN2_ENST00000370723.1_Missense_Mutation_p.Q1248P|LPHN2_ENST00000319517.6_Missense_Mutation_p.Q1190P|LPHN2_ENST00000370727.1_Missense_Mutation_p.Q1218P|LPHN2_ENST00000370713.1_3'UTR|LPHN2_ENST00000359929.3_Missense_Mutation_p.Q1190P|LPHN2_ENST00000370721.1_Missense_Mutation_p.Q1171P			O95490	LPHN2_HUMAN	latrophilin 2	1246					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)|latrotoxin receptor activity (GO:0016524)	p.Q1190P(1)|p.Q1261P(1)		NS(3)|breast(6)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(37)|ovary(3)|pancreas(1)|prostate(3)|skin(22)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	119				all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)		GACAGCGTGCAAGTTGTGGAC	0.433																																																	2	Substitution - Missense(2)	kidney(2)											128.0	119.0	122.0					1																	82456186		2203	4300	6503	SO:0001583	missense	23266			AJ131581	CCDS689.1, CCDS72811.1	1p31.1	2014-08-08	2003-03-17	2003-05-02	ENSG00000117114	ENSG00000117114		"""-"", ""GPCR / Class B : Orphans"""	18582	protein-coding gene	gene with protein product		607018	"""latrophilin 1"""	LPHH1		10760572	Standard	XR_248786		Approved	KIAA0786, LEC1	uc001diu.3	O95490	OTTHUMG00000009844	ENST00000370728.1:c.3737A>C	1.37:g.82456186A>C	ENSP00000359763:p.Gln1246Pro	Somatic		WXS	Illumina HiSeq	Phase_I	A5XEI2|B1ALT8|B1ALT9|B1ALU0|B1ALU2|B1ALU4|B1ALU5|B1ALU6|O94882|Q5VX76|Q9UKY5|Q9UKY6	Missense_Mutation	SNP	ENST00000370728.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	3.601|3.601	-0.081525|-0.081525	0.07141|0.07141	.|.	.|.	ENSG00000117114|ENSG00000117114	ENST00000449420|ENST00000370721;ENST00000370728;ENST00000370730;ENST00000370727;ENST00000370725;ENST00000370723;ENST00000359929;ENST00000319517;ENST00000370717;ENST00000394879;ENST00000271029;ENST00000335786	.|T;T;T;T;T;T;T;T;T;T;T;T	.|0.71222	.|-0.51;-0.54;-0.55;-0.49;-0.48;-0.43;-0.51;-0.51;-0.48;-0.43;-0.49;-0.55	5.53|5.53	5.53|5.53	0.82687|0.82687	.|.	.|0.133666	.|0.50627	.|D	.|0.000113	T|T	0.58061|0.58061	0.2096|0.2096	L|L	0.47716|0.47716	1.5|1.5	0.80722|0.80722	D|D	1|1	.|B;B	.|0.30104	.|0.002;0.268	.|B;B	.|0.38378	.|0.007;0.272	T|T	0.60042|0.60042	-0.7340|-0.7340	5|10	.|0.32370	.|T	.|0.25	.|.	15.669|15.669	0.77258|0.77258	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|1190;170	.|O95490-2;B3KVU1	.|.;.	Q|P	1138|1171;1246;1203;1218;1261;1248;1190;1190;1261;1248;1218;1203	.|ENSP00000359756:Q1171P;ENSP00000359763:Q1246P;ENSP00000359765:Q1203P;ENSP00000359762:Q1218P;ENSP00000359760:Q1261P;ENSP00000359758:Q1248P;ENSP00000353006:Q1190P;ENSP00000322270:Q1190P;ENSP00000359752:Q1261P;ENSP00000378344:Q1248P;ENSP00000271029:Q1218P;ENSP00000337306:Q1203P	.|ENSP00000271029:Q1218P	K|Q	+|+	1|2	0|0	LPHN2|LPHN2	82228774|82228774	1.000000|1.000000	0.71417|0.71417	0.983000|0.983000	0.44433|0.44433	0.159000|0.159000	0.22180|0.22180	7.175000|7.175000	0.77632|0.77632	2.092000|2.092000	0.63282|0.63282	0.460000|0.460000	0.39030|0.39030	AAG|CAA		0.433	LPHN2-007	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000027188.1		NM_012302	
MAB21L2	10586	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	151504561	151504561	+	Missense_Mutation	SNP	A	A	T			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr4:151504561A>T	ENST00000317605.4	+	1	1485	c.380A>T	c.(379-381)aAg>aTg	p.K127M	LRBA_ENST00000510413.1_Intron|LRBA_ENST00000507224.1_Intron|LRBA_ENST00000503716.1_5'Flank|RP11-1336O20.2_ENST00000507934.1_RNA|LRBA_ENST00000357115.3_Intron|LRBA_ENST00000535741.1_Intron	NM_006439.4	NP_006430.1	Q9Y586	MB212_HUMAN	mab-21-like 2 (C. elegans)	127					camera-type eye development (GO:0043010)|embryonic body morphogenesis (GO:0010172)|eye development (GO:0001654)|nervous system development (GO:0007399)|positive regulation of cell proliferation (GO:0008284)	nucleus (GO:0005634)		p.K127M(1)		breast(2)|endometrium(6)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|skin(2)	21	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.159)		TCAGCGCGTAAGATCCGCTCG	0.617																																																	1	Substitution - Missense(1)	kidney(1)											103.0	100.0	101.0					4																	151504561		2203	4300	6503	SO:0001583	missense	10586			AF155219	CCDS3774.1	4q31.3	2013-10-22	2001-11-28		ENSG00000181541	ENSG00000181541			6758	protein-coding gene	gene with protein product		604357	"""mab-21 (C. elegans)-like 2"""				Standard	NM_006439		Approved		uc003ilw.3	Q9Y586	OTTHUMG00000161442	ENST00000317605.4:c.380A>T	4.37:g.151504561A>T	ENSP00000324701:p.Lys127Met	Somatic		WXS	Illumina HiSeq	Phase_I	B3KP37|Q9HBA7	Missense_Mutation	SNP	ENST00000317605.4	37	CCDS3774.1	.	.	.	.	.	.	.	.	.	.	A	20.7	4.027913	0.75390	.	.	ENSG00000181541	ENST00000317605	T	0.11712	2.75	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.40094	0.1103	M	0.86953	2.85	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.43718	-0.9374	10	0.87932	D	0	-19.6246	16.0916	0.81094	1.0:0.0:0.0:0.0	.	127	Q9Y586	MB212_HUMAN	M	127	ENSP00000324701:K127M	ENSP00000324701:K127M	K	+	2	0	MAB21L2	151724011	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.339000	0.96797	2.186000	0.69663	0.533000	0.62120	AAG		0.617	MAB21L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364937.1		NM_006439	
MAPKAPK2	9261	hgsc.bcm.edu	37	1	206903392	206903393	+	Frame_Shift_Ins	INS	-	-	C	rs139297717|rs571837891	byFrequency	TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr1:206903392_206903393insC	ENST00000367103.3	+	5	833_834	c.640_641insC	c.(640-642)accfs	p.T214fs	MAPKAPK2_ENST00000294981.4_Frame_Shift_Ins_p.T214fs	NM_004759.4|NM_032960.3	NP_004750.1|NP_116584.2	P49137	MAPK2_HUMAN	mitogen-activated protein kinase-activated protein kinase 2	214	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				3'-UTR-mediated mRNA stabilization (GO:0070935)|activation of MAPK activity (GO:0000187)|arachidonic acid metabolic process (GO:0019369)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|G2 DNA damage checkpoint (GO:0031572)|gene expression (GO:0010467)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|leukotriene metabolic process (GO:0006691)|macropinocytosis (GO:0044351)|MAPK cascade (GO:0000165)|mRNA metabolic process (GO:0016071)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|regulation of interleukin-6 production (GO:0032675)|regulation of tumor necrosis factor production (GO:0032680)|response to cytokine (GO:0034097)|response to lipopolysaccharide (GO:0032496)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	19	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.211)			TGCCAAGGAAACCACCAGCCAC	0.48																																																	0																																										SO:0001589	frameshift_variant	9261			U12779	CCDS1466.1, CCDS31001.1	1q32	2008-02-05			ENSG00000162889	ENSG00000162889			6887	protein-coding gene	gene with protein product		602006				8179591, 8280084	Standard	NM_004759		Approved		uc001hem.2	P49137	OTTHUMG00000036342	ENST00000367103.3:c.642dupC	1.37:g.206903394_206903394dupC	ENSP00000356070:p.Thr214fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q5SY30|Q5SY41|Q8IYD6	Frame_Shift_Ins	INS	ENST00000367103.3	37	CCDS31001.1																																																																																				0.480	MAPKAPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088465.1		NM_004759	
MAST4	375449	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	66459741	66459741	+	Silent	SNP	G	G	A			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr5:66459741G>A	ENST00000403625.2	+	29	5029	c.4734G>A	c.(4732-4734)ccG>ccA	p.P1578P	MAST4_ENST00000403666.1_Silent_p.P1389P|MAST4_ENST00000261569.7_Silent_p.P1384P|MAST4_ENST00000404260.3_Silent_p.P1581P|MAST4_ENST00000405643.1_Silent_p.P1399P	NM_001164664.1	NP_001158136.1	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase family member 4	1581						cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)	p.P1581P(2)		breast(2)|central_nervous_system(1)|kidney(2)|lung(6)|ovary(2)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		AAGTCTATCCGAAGGCTGTGG	0.502																																																	2	Substitution - coding silent(2)	kidney(1)|central_nervous_system(1)											34.0	37.0	36.0					5																	66459741		1940	4138	6078	SO:0001819	synonymous_variant	375449			AY830839	CCDS47224.1, CCDS47225.1, CCDS54861.1, CCDS75254.1	5q12.3	2007-06-20			ENSG00000069020	ENSG00000069020			19037	protein-coding gene	gene with protein product						9205841	Standard	NM_198828		Approved	KIAA0303	uc021xzk.1	O15021	OTTHUMG00000152471	ENST00000403625.2:c.4734G>A	5.37:g.66459741G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A6NL49|B5ME48|Q05EE6|Q6ZN07|Q8N4X4|Q96LY3	Silent	SNP	ENST00000403625.2	37	CCDS54861.1	.	.	.	.	.	.	.	.	.	.	G	5.529	0.282491	0.10458	.	.	ENSG00000069020	ENST00000443808	.	.	.	5.23	-8.45	0.00946	.	.	.	.	.	T	0.28764	0.0713	.	.	.	0.22511	N	0.999032	.	.	.	.	.	.	T	0.35051	-0.9804	4	.	.	.	-6.8335	10.969	0.47428	0.2857:0.2548:0.4595:0.0	.	.	.	.	K	635	.	.	E	+	1	0	MAST4	66495497	0.000000	0.05858	0.002000	0.10522	0.081000	0.17604	-1.355000	0.02612	-1.668000	0.01471	-0.137000	0.14449	GAA		0.502	MAST4-001	NOVEL	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326324.2			
MICAL1	64780	broad.mit.edu	37	6	109771288	109771288	+	Splice_Site	SNP	G	G	T			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr6:109771288G>T	ENST00000358807.3	-	9	1503	c.1192C>A	c.(1192-1194)Ccc>Acc	p.P398T	MICAL1_ENST00000358577.3_Splice_Site_p.P312T|MICAL1_ENST00000483856.1_5'Flank|MICAL1_ENST00000368952.4_Splice_Site_p.P417T	NM_022765.3	NP_073602.3	Q8TDZ2	MICA1_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 1	398	Monooxygenase domain. {ECO:0000250}.				actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of protein phosphorylation (GO:0001933)|oxidation-reduction process (GO:0055114)|signal transduction (GO:0007165)|sulfur oxidation (GO:0019417)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)	p.P398T(1)		NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|liver(1)|lung(7)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	40		all_cancers(87;0.000189)|Acute lymphoblastic leukemia(125;3.07e-08)|all_hematologic(75;3.33e-06)|all_epithelial(87;0.00686)|Lung SC(18;0.0743)|Colorectal(196;0.101)|all_lung(197;0.149)		Epithelial(106;0.0142)|all cancers(137;0.0197)|OV - Ovarian serous cystadenocarcinoma(136;0.0233)|BRCA - Breast invasive adenocarcinoma(108;0.0574)		GGCCAGAAGGGCTGCAGTGTC	0.617																																																	1	Substitution - Missense(1)	kidney(1)											79.0	82.0	81.0					6																	109771288		2203	4300	6503	SO:0001630	splice_region_variant	64780			AB048948	CCDS5076.1, CCDS55047.1	6q21	2013-03-26	2013-03-26	2005-02-16	ENSG00000135596	ENSG00000135596			20619	protein-coding gene	gene with protein product		607129	"""NEDD9 interacting protein with calponin homology and LIM domains"""	NICAL		11827972	Standard	NM_022765		Approved	MICAL, FLJ11937, DKFZp434B1517, FLJ21739	uc003ptk.3	Q8TDZ2	OTTHUMG00000015350	ENST00000358807.3:c.1192-1C>A	6.37:g.109771288G>T		Somatic		WXS	Illumina GAIIx	Phase_I	B7Z3R5|E1P5F0|Q7Z633|Q8IVS9|Q96G47|Q9H6X6|Q9H7I0|Q9HAA1|Q9UFF7	Missense_Mutation	SNP	ENST00000358807.3	37	CCDS5076.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.391157	0.82902	.	.	ENSG00000135596	ENST00000358807;ENST00000368952;ENST00000358577	T;T;T	0.27890	1.92;1.92;1.64	4.57	4.57	0.56435	Calponin homology domain (1);	0.064917	0.64402	D	0.000007	T	0.52885	0.1762	M	0.85945	2.785	0.53688	D	0.999977	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.91635	0.99;0.973;0.999	T	0.60177	-0.7314	10	0.72032	D	0.01	.	15.2634	0.73643	0.0:0.0:1.0:0.0	.	417;312;398	B7Z3R5;Q8TDZ2-2;Q8TDZ2	.;.;MICA1_HUMAN	T	398;417;312	ENSP00000351664:P398T;ENSP00000357948:P417T;ENSP00000351385:P312T	ENSP00000351385:P312T	P	-	1	0	MICAL1	109877981	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	9.510000	0.98004	2.534000	0.85438	0.650000	0.86243	CCC		0.617	MICAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041759.2		NM_022765	Missense_Mutation
MICALCL	84953	broad.mit.edu;hgsc.bcm.edu	37	11	12316279	12316279	+	Missense_Mutation	SNP	A	A	C			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr11:12316279A>C	ENST00000256186.2	+	3	1592	c.1301A>C	c.(1300-1302)gAa>gCa	p.E434A		NM_032867.2	NP_116256.2	Q6ZW33	MICLK_HUMAN	MICAL C-terminal like	434					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)	mitogen-activated protein kinase binding (GO:0051019)	p.E434A(1)		breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(5)|lung(5)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	30				Epithelial(150;0.00177)		GTGCTGCCTGAAGATAGTGCG	0.552																																																	1	Substitution - Missense(1)	kidney(1)											63.0	67.0	65.0					11																	12316279		1959	4134	6093	SO:0001583	missense	84953			BK000463	CCDS41620.1	11p15.3	2005-11-01			ENSG00000133808	ENSG00000133808			25933	protein-coding gene	gene with protein product		612355				12110185	Standard	NM_032867		Approved	FLJ14966	uc001mkg.1	Q6ZW33	OTTHUMG00000165777	ENST00000256186.2:c.1301A>C	11.37:g.12316279A>C	ENSP00000256186:p.Glu434Ala	Somatic		WXS	Illumina HiSeq	Phase_I	Q7RTP7|Q96JU6	Missense_Mutation	SNP	ENST00000256186.2	37	CCDS41620.1	.	.	.	.	.	.	.	.	.	.	A	1.855	-0.464062	0.04476	.	.	ENSG00000133808	ENST00000256186	T	0.11495	2.77	4.97	-6.59	0.01830	.	1.880630	0.02874	N	0.132027	T	0.05686	0.0149	L	0.29908	0.895	0.09310	N	1	B	0.16802	0.019	B	0.14023	0.01	T	0.34800	-0.9814	10	0.09590	T	0.72	.	1.9774	0.03418	0.1866:0.3914:0.13:0.2921	.	434	Q6ZW33	MICLK_HUMAN	A	434	ENSP00000256186:E434A	ENSP00000256186:E434A	E	+	2	0	MICALCL	12272855	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.095000	0.01350	-1.312000	0.02306	-0.710000	0.03640	GAA		0.552	MICALCL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386164.1		NM_032867	
MKL2	57496	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	14334311	14334311	+	Missense_Mutation	SNP	A	A	T			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr16:14334311A>T	ENST00000341243.5	+	8	1016	c.1016A>T	c.(1015-1017)aAc>aTc	p.N339I	MKL2_ENST00000572567.1_Missense_Mutation_p.N339I|MKL2_ENST00000318282.5_Missense_Mutation_p.N350I|MKL2_ENST00000571589.1_Missense_Mutation_p.N350I|MKL2_ENST00000573051.1_Missense_Mutation_p.N299I|MKL2_ENST00000574045.1_Missense_Mutation_p.N350I			Q9ULH7	MKL2_HUMAN	MKL/myocardin-like 2	339					blood vessel morphogenesis (GO:0048514)|cardiac muscle tissue development (GO:0048738)|embryonic organ development (GO:0048568)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|muscle organ development (GO:0007517)|positive regulation of striated muscle tissue development (GO:0045844)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|smooth muscle cell differentiation (GO:0051145)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)	p.N350I(1)		breast(3)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(6)|liver(2)|lung(7)|ovary(4)|pancreas(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						CAGCACTACAACTACCAGACC	0.532																																																	1	Substitution - Missense(1)	kidney(1)											108.0	100.0	103.0					16																	14334311		2197	4300	6497	SO:0001583	missense	57496			AB033069	CCDS32391.1	16p13.12	2012-11-29			ENSG00000186260	ENSG00000186260			29819	protein-coding gene	gene with protein product		609463				10574462	Standard	NM_014048		Approved	MRTF-B, FLJ31823	uc002dcg.3	Q9ULH7	OTTHUMG00000177379	ENST00000341243.5:c.1016A>T	16.37:g.14334311A>T	ENSP00000345841:p.Asn339Ile	Somatic		WXS	Illumina HiSeq	Phase_I	A6ND53|B4DGT8|Q68CT1|Q6UB16|Q86WW2|Q8N226	Missense_Mutation	SNP	ENST00000341243.5	37		.	.	.	.	.	.	.	.	.	.	A	22.0	4.234065	0.79688	.	.	ENSG00000186260	ENST00000318282;ENST00000389126;ENST00000341243	.	.	.	5.78	2.34	0.29019	.	0.042919	0.85682	D	0.000000	T	0.75606	0.3872	M	0.76838	2.35	0.48975	D	0.999736	D;P;D;D	0.89917	0.973;0.954;0.999;1.0	P;P;D;D	0.87578	0.696;0.684;0.944;0.998	T	0.73216	-0.4053	9	0.56958	D	0.05	-16.4209	9.1368	0.36879	0.7982:0.0:0.2018:0.0	.	299;350;339;350	Q9ULH7-2;B4DGT8;Q9ULH7;Q9ULH7-4	.;.;MKL2_HUMAN;.	I	350;339;339	.	ENSP00000339086:N350I	N	+	2	0	MKL2	14241812	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.103000	0.71492	0.126000	0.18424	0.533000	0.62120	AAC		0.532	MKL2-202	KNOWN	basic	protein_coding	protein_coding			NM_014048	
Unknown	0	broad.mit.edu	37	1	16976585	16976585	+	IGR	SNP	C	C	T	rs1135350		TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr1:16976585C>T								CROCCP2 (15531 upstream) : RNU1-3 (16694 downstream)																							TACGGGGGCCCACTTGCCTGC	0.567																																																	0																																										SO:0001628	intergenic_variant	11209																															1.37:g.16976585C>T		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP		37																																																																																				0	0.567									
MTDH	92140	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	98703400	98703400	+	Silent	SNP	A	A	C			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr8:98703400A>C	ENST00000336273.3	+	6	1360	c.1032A>C	c.(1030-1032)tcA>tcC	p.S344S	MTDH_ENST00000519934.1_Silent_p.S321S	NM_178812.3	NP_848927.2	Q86UE4	LYRIC_HUMAN	metadherin	344					lipopolysaccharide-mediated signaling pathway (GO:0031663)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of angiogenesis (GO:0045766)|positive regulation of autophagy (GO:0010508)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein kinase B signaling (GO:0051897)|tight junction assembly (GO:0070830)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intercellular canaliculus (GO:0046581)|nuclear body (GO:0016604)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|tight junction (GO:0005923)	double-stranded RNA binding (GO:0003725)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|transcription coactivator activity (GO:0003713)	p.S344S(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(5)|liver(1)|lung(8)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	32	Breast(36;2.56e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.178)			GTGACCGTTCAATATTTTCTG	0.338																																																	1	Substitution - coding silent(1)	kidney(1)											112.0	122.0	119.0					8																	98703400		2203	4300	6503	SO:0001819	synonymous_variant	92140			AF411226	CCDS6274.1	8q22.1	2014-07-14			ENSG00000147649	ENSG00000147649			29608	protein-coding gene	gene with protein product	"""astrocyte elevated gene 1"""	610323				15093543	Standard	NM_178812		Approved	LYRIC, 3D3, AEG-1	uc003yhz.3	Q86UE4	OTTHUMG00000164692	ENST00000336273.3:c.1032A>C	8.37:g.98703400A>C		Somatic		WXS	Illumina HiSeq	Phase_I	Q05DH2|Q52QU9|Q6PK07|Q8TCX3	Silent	SNP	ENST00000336273.3	37	CCDS6274.1																																																																																				0.338	MTDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379772.2			
MTMR3	8897	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	22	30418102	30418102	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr22:30418102G>A	ENST00000401950.2	+	18	3652	c.3310G>A	c.(3310-3312)Gag>Aag	p.E1104K	CTA-85E5.10_ENST00000429350.1_RNA|MTMR3_ENST00000351488.3_Intron|MTMR3_ENST00000323630.5_Missense_Mutation_p.E968K|MTMR3_ENST00000406629.1_Intron|MTMR3_ENST00000333027.3_Intron|CTA-85E5.10_ENST00000453743.2_RNA	NM_021090.3	NP_066576.1	Q13615	MTMR3_HUMAN	myotubularin related protein 3	1104					peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|phosphatidylinositol-3,5-bisphosphate 3-phosphatase activity (GO:0052629)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)	p.E1104K(1)		breast(3)|large_intestine(3)|ovary(2)|skin(8)|upper_aerodigestive_tract(1)	17			OV - Ovarian serous cystadenocarcinoma(5;0.00204)|Epithelial(10;0.06)|all cancers(5;0.107)			AGCCAGCTGGGAGCAGGTGGA	0.507																																																	1	Substitution - Missense(1)	kidney(1)											75.0	70.0	71.0					22																	30418102		2203	4300	6503	SO:0001583	missense	8897			U58034	CCDS13870.1, CCDS13871.1, CCDS46682.1	22q12.2	2011-06-09			ENSG00000100330	ENSG00000100330		"""Zinc fingers, FYVE domain containing"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7451	protein-coding gene	gene with protein product		603558				8640223, 9736772	Standard	NM_153050		Approved	KIAA0371, ZFYVE10, FYVE-DSP1	uc003agv.4	Q13615	OTTHUMG00000151278	ENST00000401950.2:c.3310G>A	22.37:g.30418102G>A	ENSP00000384651:p.Glu1104Lys	Somatic		WXS	Illumina HiSeq	Phase_I	A5PL26|A7MD32|Q9NYN5|Q9NYN6|Q9UDX6|Q9UEG3	Missense_Mutation	SNP	ENST00000401950.2	37	CCDS13870.1	.	.	.	.	.	.	.	.	.	.	G	32	5.152628	0.94645	.	.	ENSG00000100330	ENST00000401950;ENST00000323630	D;D	0.94092	-3.16;-3.35	5.32	5.32	0.75619	.	0.130552	0.56097	D	0.000032	D	0.94909	0.8354	L	0.36672	1.1	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	D	0.95274	0.8380	10	0.72032	D	0.01	.	18.1693	0.89740	0.0:0.0:1.0:0.0	.	1104	Q13615	MTMR3_HUMAN	K	1104;968	ENSP00000384651:E1104K;ENSP00000318070:E968K	ENSP00000318070:E968K	E	+	1	0	MTMR3	28748102	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.253000	0.95501	2.767000	0.95098	0.655000	0.94253	GAG		0.507	MTMR3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000322066.1		NM_021090	
MTOR	2475	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	11184573	11184573	+	Missense_Mutation	SNP	G	G	T	rs587777894		TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr1:11184573G>T	ENST00000361445.4	-	47	6720	c.6644C>A	c.(6643-6645)tCt>tAt	p.S2215Y	MTOR_ENST00000376838.1_Missense_Mutation_p.S420Y	NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)	2215	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.		S -> Y (in a colorectal adenocarcinoma sample; somatic mutation). {ECO:0000269|PubMed:17344846}.		cell growth (GO:0016049)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell development (GO:0007281)|growth (GO:0040007)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of macroautophagy (GO:0016242)|negative regulation of NFAT protein import into nucleus (GO:0051534)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of carbohydrate utilization (GO:0043610)|regulation of fatty acid beta-oxidation (GO:0031998)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of response to food (GO:0032095)|response to amino acid (GO:0043200)|response to nutrient (GO:0007584)|response to stress (GO:0006950)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|phosphatidylinositol 3-kinase complex (GO:0005942)|PML body (GO:0016605)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	ATP binding (GO:0005524)|drug binding (GO:0008144)|kinase activity (GO:0016301)|phosphoprotein binding (GO:0051219)|protein serine/threonine kinase activity (GO:0004674)|ribosome binding (GO:0043022)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)	p.S2215Y(4)		breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)	TTTCCGAAGAGATGTTGGGTC	0.438																																																	4	Substitution - Missense(4)	large_intestine(2)|kidney(1)|endometrium(1)											101.0	98.0	99.0					1																	11184573		2203	4300	6503	SO:0001583	missense	2475			L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793			3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1		8008069, 8660990	Standard	NM_004958		Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.6644C>A	1.37:g.11184573G>T	ENSP00000354558:p.Ser2215Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	Missense_Mutation	SNP	ENST00000361445.4	37	CCDS127.1	.	.	.	.	.	.	.	.	.	.	G	28.2	4.903707	0.92035	.	.	ENSG00000198793	ENST00000361445;ENST00000376838	T;T	0.78364	-1.17;-1.17	5.8	5.8	0.92144	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	D	0.88862	0.6552	M	0.86651	2.83	0.80722	D	1	D	0.58970	0.984	P	0.60541	0.876	D	0.90182	0.4243	10	0.87932	D	0	-14.2436	18.2956	0.90145	0.0:0.0:1.0:0.0	.	2215	P42345	MTOR_HUMAN	Y	2215;420	ENSP00000354558:S2215Y;ENSP00000366034:S420Y	ENSP00000354558:S2215Y	S	-	2	0	MTOR	11107160	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	9.362000	0.97126	2.761000	0.94854	0.650000	0.86243	TCT		0.438	MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005558.1		NM_004958	
MUC4	4585	broad.mit.edu	37	3	195506315	195506315	+	Missense_Mutation	SNP	T	T	C	rs62282465	byFrequency	TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr3:195506315T>C	ENST00000463781.3	-	2	12595	c.12136A>G	c.(12136-12138)Acc>Gcc	p.T4046A	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.T4046A	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.T4046A(2)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGAGGGGTGGTGTCACCTGTG	0.587													.|||	561	0.112021	0.0817	0.0951	5008	,	,		10183	0.0595		0.1998	False		,,,				2504	0.1288																2	Substitution - Missense(2)	kidney(2)											32.0	17.0	22.0					3																	195506315		597	1263	1860	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12136A>G	3.37:g.195506315T>C	ENSP00000417498:p.Thr4046Ala	Somatic		WXS	Illumina GAIIx	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	t	5.814	0.334415	0.11013	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.29917	1.55;1.64	0.613	0.613	0.17597	.	0.326178	0.13539	N	0.380396	T	0.12944	0.0314	N	0.19112	0.55	0.09310	N	1	B	0.33494	0.414	B	0.22386	0.039	T	0.15321	-1.0441	9	.	.	.	.	3.4823	0.07607	1.0E-4:0.0:0.427:0.5729	rs62282465	3918	E7ESK3	.	A	4046	ENSP00000417498:T4046A;ENSP00000420243:T4046A	.	T	-	1	0	MUC4	196991094	0.001000	0.12720	0.008000	0.14137	0.095000	0.18619	0.338000	0.19858	0.522000	0.28464	0.055000	0.15244	ACC		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6		NM_018406	
MURC	347273	broad.mit.edu;hgsc.bcm.edu	37	9	103348313	103348313	+	Silent	SNP	A	A	C			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr9:103348313A>C	ENST00000307584.5	+	2	740	c.675A>C	c.(673-675)atA>atC	p.I225I		NM_001018116.1	NP_001018126.1	Q5BKX8	MURC_HUMAN	muscle-related coiled-coil protein	225					cell differentiation (GO:0030154)|muscle organ development (GO:0007517)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	Z disc (GO:0030018)		p.I225I(1)		endometrium(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)	16		Acute lymphoblastic leukemia(62;0.0461)				GAACTAGAATAGTGACCCCGG	0.458																																																	1	Substitution - coding silent(1)	kidney(1)											110.0	119.0	116.0					9																	103348313		2203	4300	6503	SO:0001819	synonymous_variant	347273			BC090888	CCDS35083.1	9q31.1	2014-09-17			ENSG00000170681	ENSG00000170681			33742	protein-coding gene	gene with protein product	"""muscle-restricted coiled-coil protein"""					18508909, 18332105	Standard	NM_001018116		Approved	cavin-4, CAVIN4	uc004bba.3	Q5BKX8	OTTHUMG00000020368	ENST00000307584.5:c.675A>C	9.37:g.103348313A>C		Somatic		WXS	Illumina HiSeq	Phase_I	B1PRL3|B4DT88	Silent	SNP	ENST00000307584.5	37	CCDS35083.1																																																																																				0.458	MURC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053419.2		NM_001018116	
MYO18A	399687	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	27417116	27417116	+	Splice_Site	SNP	G	G	C			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr17:27417116G>C	ENST00000527372.1	-	37	5569	c.5389C>G	c.(5389-5391)Cta>Gta	p.L1797V	MYO18A_ENST00000533112.1_Splice_Site_p.L1760V|MYO18A_ENST00000354329.4_Splice_Site_p.L1797V|TIAF1_ENST00000408971.2_5'UTR|MYO18A_ENST00000531253.1_Splice_Site_p.L1797V|MYO18A_ENST00000529578.1_5'UTR	NM_078471.3	NP_510880.2	Q92614	MY18A_HUMAN	myosin XVIIIA	1797					actomyosin structure organization (GO:0031032)|cell migration (GO:0016477)|DNA metabolic process (GO:0006259)|Golgi organization (GO:0007030)|Golgi vesicle budding (GO:0048194)|negative regulation of apoptotic process (GO:0043066)|positive regulation of protein secretion (GO:0050714)	actomyosin (GO:0042641)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|myosin complex (GO:0016459)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)	p.L1797V(2)		NS(1)|cervix(1)|endometrium(6)|kidney(6)|lung(20)|urinary_tract(2)	36			Epithelial(11;4.97e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000221)|all cancers(11;0.000234)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)			AGGGCTTGTAGCTAGAGGTGG	0.577																																					Esophageal Squamous(182;472 2015 7001 15270 22562)												2	Substitution - Missense(2)	kidney(2)											30.0	31.0	31.0					17																	27417116		1994	4172	6166	SO:0001630	splice_region_variant	399687			D86970	CCDS45641.1, CCDS45642.1	17q11.2	2011-09-27			ENSG00000196535	ENSG00000196535		"""Myosins / Myosin superfamily : Class XVIII"""	31104	protein-coding gene	gene with protein product		610067				12761286	Standard	NM_078471		Approved	KIAA0216, MysPDZ	uc002hdt.1	Q92614	OTTHUMG00000166360	ENST00000527372.1:c.5389-1C>G	17.37:g.27417116G>C		Somatic		WXS	Illumina HiSeq	Phase_I	Q5H9U3|Q5W9F9|Q5W9G1|Q8IXP8	Missense_Mutation	SNP	ENST00000527372.1	37	CCDS45642.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.19|12.19	1.863826|1.863826	0.32884|0.32884	.|.	.|.	ENSG00000196535|ENSG00000196535	ENST00000354329;ENST00000359450;ENST00000533112;ENST00000531253;ENST00000527372;ENST00000529799;ENST00000540575;ENST00000458428;ENST00000546105|ENST00000527859	T;D;T;T|.	0.83506|.	-0.85;-1.73;-0.85;-0.85|.	5.2|5.2	3.11|3.11	0.35812|0.35812	Myosin tail (1);|.	0.078542|.	0.51477|.	D|.	0.000100|.	T|T	0.58623|0.58623	0.2135|0.2135	L|L	0.56769|0.56769	1.78|1.78	0.80722|0.80722	D|D	1|1	B;B;B;B|.	0.33940|.	0.433;0.433;0.433;0.187|.	B;B;B;B|.	0.34301|.	0.179;0.117;0.117;0.072|.	T|T	0.55909|0.55909	-0.8066|-0.8066	10|5	0.10377|.	T|.	0.69|.	.|.	6.5337|6.5337	0.22341|0.22341	0.1521:0.0:0.6936:0.1544|0.1521:0.0:0.6936:0.1544	.|.	1400;1760;1797;1797|.	F8W6Y3;Q92614-3;Q92614-4;Q92614|.	.;.;.;MY18A_HUMAN|.	V|R	1797;1760;1760;1797;1797;693;693;1400;78|59	ENSP00000346291:L1797V;ENSP00000435932:L1760V;ENSP00000434228:L1797V;ENSP00000437073:L1797V|.	ENSP00000346291:L1797V|.	L|S	-|-	1|3	2|2	MYO18A|MYO18A	24441242|24441242	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.933000|0.933000	0.57130|0.57130	2.323000|2.323000	0.43823|0.43823	2.607000|2.607000	0.88179|0.88179	0.655000|0.655000	0.94253|0.94253	CTA|AGC		0.577	MYO18A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389396.1		NM_078471	Missense_Mutation
NASP	4678	hgsc.bcm.edu	37	1	46073373	46073373	+	Missense_Mutation	SNP	G	G	A	rs199792714	byFrequency	TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr1:46073373G>A	ENST00000350030.3	+	6	877	c.790G>A	c.(790-792)Gga>Aga	p.G264R	NASP_ENST00000351223.3_Intron|NASP_ENST00000537798.1_Missense_Mutation_p.G200R|NASP_ENST00000372052.4_Intron|NASP_ENST00000402363.3_Missense_Mutation_p.G266R	NM_002482.3	NP_002473.2	P49321	NASP_HUMAN	nuclear autoantigenic sperm protein (histone-binding)	264	Glu-rich (acidic).				blastocyst development (GO:0001824)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|DNA replication (GO:0006260)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone exchange (GO:0043486)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)	Hsp90 protein binding (GO:0051879)			breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)|prostate(3)|skin(1)	17	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.211)					GGAGAAGCAGGGAGAGGTAAT	0.478																																																	0													44.0	47.0	46.0					1																	46073373		2203	4300	6503	SO:0001583	missense	4678			M97856	CCDS524.1, CCDS525.1, CCDS55597.1	1p34.1	2013-01-10			ENSG00000132780	ENSG00000132780		"""Tetratricopeptide (TTC) repeat domain containing"""	7644	protein-coding gene	gene with protein product		603185				1426632	Standard	NM_002482		Approved	FLB7527, FLJ31599, FLJ35510, MGC19722, MGC20372, MGC2297, DKFZp547F162, PRO1999	uc001coi.2	P49321	OTTHUMG00000007826	ENST00000350030.3:c.790G>A	1.37:g.46073373G>A	ENSP00000255120:p.Gly264Arg	Somatic		WXS	Illumina HiSeq	Phase_I	A8K6H2|B4DQP3|D3DQ07|F5H3J2|Q53GW5|Q5T622|Q5T625|Q96A69|Q9BTW2	Missense_Mutation	SNP	ENST00000350030.3	37	CCDS524.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.306595	0.81247	.	.	ENSG00000132780	ENST00000537798;ENST00000402363;ENST00000341288;ENST00000350030;ENST00000470768	D;D;D;D	0.94650	-3.48;-3.48;-3.48;-3.48	5.37	5.37	0.77165	.	0.623202	0.16964	N	0.192395	D	0.93615	0.7961	L	0.32530	0.975	0.43412	D	0.995555	P;P;D;P;P	0.53619	0.928;0.933;0.961;0.883;0.919	P;P;P;B;B	0.50405	0.565;0.542;0.64;0.231;0.408	D	0.92054	0.5651	9	.	.	.	-3.2525	20.0097	0.97446	0.0:0.0:1.0:0.0	.	200;264;164;264;266	F5H3J2;Q53H03;B4DS57;P49321;P49321-3	.;.;.;NASP_HUMAN;.	R	200;266;164;264;227	ENSP00000438871:G200R;ENSP00000384529:G266R;ENSP00000255120:G264R;ENSP00000436924:G227R	.	G	+	1	0	NASP	45845960	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.877000	0.39598	2.902000	0.99343	0.650000	0.86243	GGA		0.478	NASP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000021533.2		NM_002482	
Unknown	0	broad.mit.edu	37	1	144615246	144615247	+	IGR	INS	-	-	AG	rs371124631|rs200815869	byFrequency	TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr1:144615246_144615247insAG								RP11-640M9.2 (9355 upstream) : NBPF9 (196496 downstream)																							GTAAACCTCAAAGAGATGTTTT	0.47														1285	0.256589	0.0703	0.2709	5008	,	,		13502	0.4583		0.2247	False		,,,				2504	0.3231																0																																										SO:0001628	intergenic_variant	400818																															1.37:g.144615249_144615250dupAG		Somatic		WXS	Illumina GAIIx	Phase_I		Splice_Site	INS		37																																																																																				0	0.470									
NRIP1	8204	hgsc.bcm.edu	37	21	16338707	16338707	+	Missense_Mutation	SNP	T	T	A			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr21:16338707T>A	ENST00000400202.1	-	3	2519	c.1807A>T	c.(1807-1809)Aca>Tca	p.T603S	NRIP1_ENST00000400199.1_Missense_Mutation_p.T603S|NRIP1_ENST00000318948.4_Missense_Mutation_p.T603S|AF127577.10_ENST00000446301.1_RNA			P48552	NRIP1_HUMAN	nuclear receptor interacting protein 1	603	Repression domain 2.				androgen receptor signaling pathway (GO:0030521)|lipid storage (GO:0019915)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|ovarian follicle rupture (GO:0001543)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|estrogen receptor binding (GO:0030331)|glucocorticoid receptor binding (GO:0035259)|nuclear hormone receptor binding (GO:0035257)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			cervix(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|lung(13)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	39				Epithelial(23;1.19e-05)|all cancers(11;4.64e-05)|COAD - Colon adenocarcinoma(22;0.000232)|Colorectal(24;0.0006)|OV - Ovarian serous cystadenocarcinoma(11;0.00418)|Lung(58;0.199)|LUSC - Lung squamous cell carcinoma(23;0.24)		TTGCTTTTTGTAAGGTCCATT	0.428																																																	0													249.0	252.0	251.0					21																	16338707		2203	4300	6503	SO:0001583	missense	8204			X84373	CCDS13568.1	21q11.2	2008-07-31			ENSG00000180530	ENSG00000180530			8001	protein-coding gene	gene with protein product	"""receptor interacting protein 140"", ""nuclear factor RIP140"""	602490				7641693, 9521594	Standard	NM_003489		Approved	RIP140	uc002yjx.2	P48552	OTTHUMG00000074323	ENST00000400202.1:c.1807A>T	21.37:g.16338707T>A	ENSP00000383063:p.Thr603Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q8IWE8	Missense_Mutation	SNP	ENST00000400202.1	37	CCDS13568.1	.	.	.	.	.	.	.	.	.	.	T	5.750	0.322728	0.10900	.	.	ENSG00000180530	ENST00000400199;ENST00000400202;ENST00000318948	T;T;T	0.20200	2.09;2.09;2.09	6.02	4.85	0.62838	.	0.144434	0.46758	D	0.000278	T	0.20007	0.0481	L	0.50333	1.59	0.21878	N	0.999499	B	0.18310	0.027	B	0.17722	0.019	T	0.14783	-1.0460	10	0.30078	T	0.28	-24.6424	11.1104	0.48230	0.2593:0.0:0.0:0.7407	.	603	P48552	NRIP1_HUMAN	S	603	ENSP00000383060:T603S;ENSP00000383063:T603S;ENSP00000327213:T603S	ENSP00000327213:T603S	T	-	1	0	NRIP1	15260578	1.000000	0.71417	0.854000	0.33618	0.714000	0.41099	4.540000	0.60664	1.064000	0.40671	0.533000	0.62120	ACA		0.428	NRIP1-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157926.1		NM_003489	
OR2A12	346525	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	143792898	143792898	+	Missense_Mutation	SNP	G	G	T	rs555296359	byFrequency	TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr7:143792898G>T	ENST00000408949.2	+	1	758	c.698G>T	c.(697-699)cGc>cTc	p.R233L		NM_001004135.1	NP_001004135.1	Q8NGT7	O2A12_HUMAN	olfactory receptor, family 2, subfamily A, member 12	233						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R233L(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(14)|ovary(2)	25	Melanoma(164;0.0783)					GGGGAGGGCCGCAGAAAGGCC	0.592																																																	1	Substitution - Missense(1)	kidney(1)											149.0	144.0	145.0					7																	143792898		1964	4148	6112	SO:0001583	missense	346525				CCDS43670.1	7q35	2013-09-20	2002-11-13	2002-11-13	ENSG00000221858	ENSG00000221858		"""GPCR / Class A : Olfactory receptors"""	15082	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily A, member 12 pseudogene"""	OR2A12P			Standard	NM_001004135		Approved		uc011kty.2	Q8NGT7	OTTHUMG00000157996	ENST00000408949.2:c.698G>T	7.37:g.143792898G>T	ENSP00000386174:p.Arg233Leu	Somatic		WXS	Illumina HiSeq	Phase_I	Q6IF43	Missense_Mutation	SNP	ENST00000408949.2	37	CCDS43670.1	.	.	.	.	.	.	.	.	.	.	G	17.46	3.396317	0.62177	.	.	ENSG00000221858	ENST00000408949	T	0.00330	8.08	4.33	3.45	0.39498	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00724	0.0024	M	0.80746	2.51	0.09310	N	1	D	0.58620	0.983	D	0.64042	0.921	T	0.44205	-0.9343	9	0.87932	D	0	-12.5177	10.0057	0.41955	0.1007:0.0:0.8993:0.0	.	233	Q8NGT7	O2A12_HUMAN	L	233	ENSP00000386174:R233L	ENSP00000386174:R233L	R	+	2	0	OR2A12	143423831	0.002000	0.14202	0.959000	0.39883	0.959000	0.62525	1.072000	0.30678	1.043000	0.40175	0.505000	0.49811	CGC		0.592	OR2A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349969.1			
PBRM1	55193	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	52584643	52584643	+	Frame_Shift_Del	DEL	A	A	-			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr3:52584643delA	ENST00000296302.7	-	29	4692	c.4691delT	c.(4690-4692)ttgfs	p.L1564fs	PBRM1_ENST00000337303.4_Frame_Shift_Del_p.L1457fs|PBRM1_ENST00000356770.4_Frame_Shift_Del_p.L1477fs|PBRM1_ENST00000409057.1_Frame_Shift_Del_p.L1509fs|PBRM1_ENST00000394830.3_Frame_Shift_Del_p.L1457fs|PBRM1_ENST00000409767.1_Frame_Shift_Del_p.L1472fs|PBRM1_ENST00000410007.1_Frame_Shift_Del_p.L1484fs|PBRM1_ENST00000409114.3_Frame_Shift_Del_p.L1527fs|SMIM4_ENST00000476842.1_Intron|RNU6-856P_ENST00000516959.1_RNA			Q86U86	PB1_HUMAN	polybromo 1	1564	Pro-rich.				chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		TGGAGGCCCCAAAACTCCCAC	0.537			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																			Rec	yes		3	3p21	55193	polybromo 1		E	0													67.0	69.0	68.0					3																	52584643		2203	4300	6503	SO:0001589	frameshift_variant	55193			BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.4691delT	3.37:g.52584643delA	ENSP00000296302:p.Leu1564fs	Somatic		WXS	Illumina HiSeq	Phase_I	A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Frame_Shift_Del	DEL	ENST00000296302.7	37																																																																																					0.537	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000327232.1		NM_018165	
PDILT	204474	hgsc.bcm.edu;ucsc.edu	37	16	20384428	20384428	+	Missense_Mutation	SNP	C	C	T	rs141043720	byFrequency	TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr16:20384428C>T	ENST00000302451.4	-	6	946	c.698G>A	c.(697-699)cGc>cAc	p.R233H		NM_174924.1	NP_777584.1	Q8N807	PDILT_HUMAN	protein disulfide isomerase-like, testis expressed	233					cell migration (GO:0016477)|cell redox homeostasis (GO:0045454)|multicellular organismal development (GO:0007275)|protein folding (GO:0006457)|spermatid development (GO:0007286)	endoplasmic reticulum (GO:0005783)	protein disulfide isomerase activity (GO:0003756)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(33)|prostate(3)|skin(1)|urinary_tract(1)	61						AAGCTTTTGGCGGTTCACAAT	0.358																																																	0													194.0	186.0	189.0					16																	20384428		2203	4300	6503	SO:0001583	missense	204474				CCDS10584.1	16p12.3	2011-11-10	2009-02-23		ENSG00000169340	ENSG00000169340		"""Protein disulfide isomerases"""	27338	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 7"", ""protein disulfide isomerase-like protein of the testis"""					15475357	Standard	NM_174924		Approved	PDIA7	uc002dhc.1	Q8N807	OTTHUMG00000131487	ENST00000302451.4:c.698G>A	16.37:g.20384428C>T	ENSP00000305465:p.Arg233His	Somatic		WXS	Illumina HiSeq	Phase_I	Q8IVQ5	Missense_Mutation	SNP	ENST00000302451.4	37	CCDS10584.1	.	.	.	.	.	.	.	.	.	.	C	10.74	1.435279	0.25813	.	.	ENSG00000169340	ENST00000302451	T	0.31510	1.49	4.82	3.8	0.43715	Thioredoxin-like fold (2);	0.498124	0.22895	N	0.054324	T	0.37785	0.1016	L	0.57536	1.79	0.29313	N	0.8679	D	0.65815	0.995	P	0.51918	0.684	T	0.29058	-1.0024	10	0.59425	D	0.04	.	9.3493	0.38129	0.2293:0.7707:0.0:0.0	.	233	Q8N807	PDILT_HUMAN	H	233	ENSP00000305465:R233H	ENSP00000305465:R233H	R	-	2	0	PDILT	20291929	0.999000	0.42202	0.995000	0.50966	0.139000	0.21198	1.395000	0.34520	2.492000	0.84095	0.563000	0.77884	CGC		0.358	PDILT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254332.1		NM_174924	
PILRA	29992	broad.mit.edu;ucsc.edu	37	7	99987688	99987688	+	Missense_Mutation	SNP	T	T	G			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr7:99987688T>G	ENST00000198536.2	+	3	844	c.632T>G	c.(631-633)aTt>aGt	p.I211S	PILRA_ENST00000350573.2_Intron|PILRA_ENST00000453419.1_Intron|PILRA_ENST00000394000.2_Intron	NM_013439.2	NP_038467.2	Q9UKJ1	PILRA_HUMAN	paired immunoglobin-like type 2 receptor alpha	211					signal transduction (GO:0007165)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.I211S(1)		endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|pancreas(1)|skin(1)|urinary_tract(1)	15	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GGAATCATGATTTTGGGACTG	0.582																																																	1	Substitution - Missense(1)	kidney(1)											130.0	107.0	115.0					7																	99987688		2203	4300	6503	SO:0001583	missense	29992			AF161080	CCDS5691.1, CCDS5692.1, CCDS47660.1	7q22.1	2013-01-11			ENSG00000085514	ENSG00000085514		"""Immunoglobulin superfamily / V-set domain containing"""	20396	protein-coding gene	gene with protein product		605341				10660620	Standard	NM_178272		Approved	FDF03	uc003uuo.1	Q9UKJ1	OTTHUMG00000155248	ENST00000198536.2:c.632T>G	7.37:g.99987688T>G	ENSP00000198536:p.Ile211Ser	Somatic		WXS	Illumina GAIIx	Phase_I	Q8NHI1	Missense_Mutation	SNP	ENST00000198536.2	37	CCDS5691.1	.	.	.	.	.	.	.	.	.	.	T	13.41	2.229280	0.39399	.	.	ENSG00000085514	ENST00000198536	T	0.40756	1.02	3.73	2.58	0.30949	.	0.900349	0.09305	N	0.820422	T	0.39572	0.1083	M	0.63843	1.955	0.09310	N	0.999999	P	0.50943	0.94	B	0.42653	0.394	T	0.27872	-1.0061	9	.	.	.	.	5.6716	0.17725	0.0:0.1233:0.0:0.8767	.	211	Q9UKJ1	PILRA_HUMAN	S	211	ENSP00000198536:I211S	.	I	+	2	0	PILRA	99825624	0.006000	0.16342	0.007000	0.13788	0.034000	0.12701	0.106000	0.15354	0.798000	0.33994	0.533000	0.62120	ATT		0.582	PILRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339016.1		NM_013439	
PLA2G4E	123745	hgsc.bcm.edu	37	15	42302340	42302341	+	Frame_Shift_Ins	INS	-	-	G	rs374407634|rs139522193		TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr15:42302340_42302341insG	ENST00000413860.2	-	1	104_105	c.105_106insC	c.(103-108)cggggtfs	p.G36fs	CTD-2382E5.2_ENST00000552704.1_RNA|PLA2G4E_ENST00000399518.3_Intron			Q3MJ16	PA24E_HUMAN	phospholipase A2, group IVE	46					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|lysosome (GO:0005764)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phospholipase A2 activity (GO:0004623)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)|stomach(1)	16		all_cancers(109;8.09e-13)|all_epithelial(112;2.03e-11)|Lung NSC(122;2.17e-07)|all_lung(180;8.79e-07)|Melanoma(134;0.0273)		OV - Ovarian serous cystadenocarcinoma(18;7.61e-18)|GBM - Glioblastoma multiforme(94;3.07e-06)		GCCCCCCCACCCCGGGCCTGGA	0.599																																																	0																																										SO:0001589	frameshift_variant	123745				CCDS55962.1	15q15.1	2008-09-19			ENSG00000188089	ENSG00000188089	3.1.1.4		24791	protein-coding gene	gene with protein product						15866882	Standard	NM_001206670		Approved	FLJ45651	uc021sjp.1	Q3MJ16	OTTHUMG00000130371	ENST00000413860.2:c.105_106insC	15.37:g.42302340_42302341insG	ENSP00000413897:p.Gly36fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q6ZSC0	Frame_Shift_Ins	INS	ENST00000413860.2	37																																																																																					0.599	PLA2G4E-201	KNOWN	basic	protein_coding	protein_coding			NM_198442	
RAB43	339122	broad.mit.edu;hgsc.bcm.edu	37	3	128813995	128813995	+	Silent	SNP	C	C	A	rs369991706		TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr3:128813995C>A	ENST00000315150.5	-	2	522	c.222G>T	c.(220-222)acG>acT	p.T74T	RAB43_ENST00000476465.1_Silent_p.T74T|RAB43_ENST00000393304.1_Silent_p.T74T|RAB43_ENST00000393307.1_Silent_p.T74T|RAB43_ENST00000393305.1_Silent_p.T74T|ISY1-RAB43_ENST00000418265.1_Missense_Mutation_p.R290L|RAB43_ENST00000393308.1_Silent_p.T74T	NM_001204888.1|NM_198490.2	NP_001191817.1|NP_940892.1	Q86YS6	RAB43_HUMAN	RAB43, member RAS oncogene family	74					Golgi organization (GO:0007030)|GTP catabolic process (GO:0006184)|phagosome maturation (GO:0090382)|protein transport (GO:0015031)|retrograde transport, plasma membrane to Golgi (GO:0035526)|small GTPase mediated signal transduction (GO:0007264)|virion assembly (GO:0019068)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|phagocytic vesicle (GO:0045335)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.T74T(1)		kidney(2)|liver(1)|lung(2)|skin(1)	6						CCTGGCCGGCCGTGTCCCAGA	0.592																																																	1	Substitution - coding silent(1)	kidney(1)						C	,,,,,CYS/GLY,LEU/ARG,	0,4406		0,0,2203	55.0	55.0	55.0		222,222,222,222,222,208,869,222	-9.1	0.7	3		55	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,missense,missense,coding-synonymous	RAB43,ISY1-RAB43	NM_001204883.1,NM_001204884.1,NM_001204885.1,NM_001204886.1,NM_001204887.1,NM_001204888.1,NM_001204890.1,NM_198490.2	,,,,,159,102,	0,1,6502	AA,AC,CC		0.0116,0.0,0.0077	,,,,,,,	74/213,74/213,74/213,74/213,74/156,70/109,290/332,74/213	128813995	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	339122			AY166852	CCDS33850.1, CCDS56275.1	3q21.3	2010-03-30			ENSG00000172780	ENSG00000172780		"""RAB, member RAS oncogene"""	19983	protein-coding gene	gene with protein product						15018353	Standard	NM_198490		Approved	RAB41, RAB11B, ISY1	uc021xdp.1	Q86YS6	OTTHUMG00000137364	ENST00000315150.5:c.222G>T	3.37:g.128813995C>A		Somatic		WXS	Illumina HiSeq	Phase_I	A8K4P9|E9PBQ0	Silent	SNP	ENST00000315150.5	37	CCDS33850.1	.	.	.	.	.	.	.	.	.	.	C	12.54	1.968953	0.34754	0.0	1.16E-4	ENSG00000240682	ENST00000418265	.	.	.	4.55	-9.1	0.00714	.	1.514590	0.04868	N	0.445488	T	0.20007	0.0481	.	.	.	0.26820	N	0.968812	B	0.02656	0.0	B	0.04013	0.001	T	0.14392	-1.0474	8	0.35671	T	0.21	.	3.078	0.06253	0.1796:0.4263:0.1033:0.2908	.	290	Q9ULR0-1	.	L	290	.	ENSP00000411822:R290L	R	-	2	0	ISY1	130296685	0.000000	0.05858	0.746000	0.31095	0.828000	0.46876	-3.083000	0.00612	-0.871000	0.04042	-0.670000	0.03821	CGG		0.592	RAB43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000267849.1		XM_290714	
RBFOX1	54715	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	7645620	7645620	+	Missense_Mutation	SNP	G	G	A	rs372761949		TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr16:7645620G>A	ENST00000550418.1	+	8	1526	c.538G>A	c.(538-540)Gtg>Atg	p.V180M	RBFOX1_ENST00000436368.2_Missense_Mutation_p.V200M|RBFOX1_ENST00000547338.1_Missense_Mutation_p.V180M|RBFOX1_ENST00000535565.2_Intron|RBFOX1_ENST00000552089.1_Missense_Mutation_p.V197M|RBFOX1_ENST00000311745.5_Missense_Mutation_p.V200M|RBFOX1_ENST00000547372.1_Missense_Mutation_p.V223M|RBFOX1_ENST00000422070.4_Missense_Mutation_p.V223M|RBFOX1_ENST00000340209.4_Missense_Mutation_p.V185M|RBFOX1_ENST00000553186.1_Missense_Mutation_p.V180M|RBFOX1_ENST00000355637.4_Missense_Mutation_p.V200M	NM_018723.3	NP_061193.2	Q9NWB1	RFOX1_HUMAN	RNA binding protein, fox-1 homolog (C. elegans) 1	180	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|neuromuscular process controlling balance (GO:0050885)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|RNA transport (GO:0050658)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	nucleotide binding (GO:0000166)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)	p.V200M(6)|p.V180M(1)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(11)|lung(17)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)	55						ACACGGCACCGTGGTAGAGGG	0.448																																					Ovarian(157;934 2567 15163 39509)												7	Substitution - Missense(7)	kidney(3)|ovary(2)|prostate(2)						G	MET/VAL,MET/VAL,MET/VAL,MET/VAL,MET/VAL,MET/VAL	1,4393	2.1+/-5.4	0,1,2196	169.0	151.0	157.0		538,538,538,598,598,598	5.8	1.0	16		157	0,8600		0,0,4300	no	missense,missense,missense,missense,missense,missense	RBFOX1	NM_001142333.1,NM_001142334.1,NM_018723.3,NM_145891.2,NM_145892.2,NM_145893.2	21,21,21,21,21,21	0,1,6496	AA,AG,GG		0.0,0.0228,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	180/371,180/398,180/398,200/419,200/393,200/396	7645620	1,12993	2197	4300	6497	SO:0001583	missense	54715			AF107203	CCDS10531.1, CCDS10532.1, CCDS45405.1, CCDS55983.1, CCDS55984.1	16p13.3	2013-02-12			ENSG00000078328	ENSG00000078328		"""RNA binding motif (RRM) containing"""	18222	protein-coding gene	gene with protein product	"""ataxin 2-binding protein 1"", ""hexaribonucleotide binding protein 1"""	605104				10814712, 16260614	Standard	NM_018723		Approved	A2BP1, FOX-1, HRNBP1	uc002cyy.2	Q9NWB1	OTTHUMG00000129551	ENST00000550418.1:c.538G>A	16.37:g.7645620G>A	ENSP00000450031:p.Val180Met	Somatic		WXS	Illumina HiSeq	Phase_I	Q7Z7I7|Q8TAE3|Q8TAF2|Q8WYB2|Q9NS20	Missense_Mutation	SNP	ENST00000550418.1	37	CCDS55983.1	.	.	.	.	.	.	.	.	.	.	G	12.91	2.079368	0.36662	2.28E-4	0.0	ENSG00000078328	ENST00000547605;ENST00000550418;ENST00000553186;ENST00000547372;ENST00000422070;ENST00000552089;ENST00000551752;ENST00000547338;ENST00000436368;ENST00000311745;ENST00000355637;ENST00000352951;ENST00000340209	T;T;T;T;T;T;T;T;T;T;T;T	0.16196	2.36;2.36;2.36;2.36;2.36;2.36;2.36;2.36;2.36;2.36;2.36;2.36	5.76	5.76	0.90799	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.26666	0.0652	N	0.11673	0.155	0.58432	D	0.99999	B;P;D;P;D;B;B;P	0.89917	0.406;0.805;1.0;0.62;1.0;0.366;0.419;0.871	B;B;D;B;D;B;B;B	0.80764	0.208;0.433;0.923;0.119;0.994;0.074;0.189;0.208	T	0.23547	-1.0185	10	0.51188	T	0.08	-9.9013	19.975	0.97300	0.0:0.0:1.0:0.0	.	200;223;200;200;200;180;180;223	F8WAC5;B7Z1U7;Q9NWB1-2;Q9NWB1-4;Q9NWB1-5;Q9NWB1-3;Q9NWB1;F8VZG9	.;.;.;.;.;.;RFOX1_HUMAN;.	M	179;180;180;223;223;197;180;180;200;200;200;200;185	ENSP00000450402:V179M;ENSP00000450031:V180M;ENSP00000447753:V180M;ENSP00000446842:V223M;ENSP00000391269:V223M;ENSP00000448496:V197M;ENSP00000447281:V180M;ENSP00000447717:V180M;ENSP00000402745:V200M;ENSP00000309117:V200M;ENSP00000347855:V200M;ENSP00000344196:V185M	ENSP00000309117:V200M	V	+	1	0	RBFOX1	7585621	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.653000	0.46691	2.724000	0.93272	0.585000	0.79938	GTG		0.448	RBFOX1-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409492.2		NM_145891	
SBF2	81846	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	9868520	9868520	+	Missense_Mutation	SNP	T	T	G			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr11:9868520T>G	ENST00000256190.8	-	23	3054	c.2917A>C	c.(2917-2919)Aca>Cca	p.T973P	RP11-1H15.2_ENST00000533659.1_RNA	NM_030962.3	NP_112224.1	Q86WG5	MTMRD_HUMAN	SET binding factor 2	973					cell death (GO:0008219)|myelination (GO:0042552)|positive regulation of Rab GTPase activity (GO:0032851)|protein tetramerization (GO:0051262)	membrane (GO:0016020)|vacuolar membrane (GO:0005774)	phosphatase activity (GO:0016791)|phosphatase regulator activity (GO:0019208)|phosphatidylinositol binding (GO:0035091)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.T973P(1)		breast(4)|endometrium(8)|kidney(2)|large_intestine(8)|lung(16)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48				all cancers(16;2.88e-11)|Epithelial(150;3.61e-10)|BRCA - Breast invasive adenocarcinoma(625;0.00887)		GATGCTGATGTGATCTGCAGT	0.393																																																	1	Substitution - Missense(1)	kidney(1)											222.0	196.0	205.0					11																	9868520		2201	4294	6495	SO:0001583	missense	81846			AB051553	CCDS31427.1	11p15.3	2014-09-17	2004-11-12	2004-11-12	ENSG00000133812	ENSG00000133812		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"", ""DENN/MADD domain containing"", ""Pleckstrin homology (PH) domain containing"""	2135	protein-coding gene	gene with protein product	"""myotubularin related 13"""	607697	"""Charcot-Marie-Tooth neuropathy 4B2 (autosomal recessive, with myelin outfolding)"", ""DENN/MADD domain containing 7B"""	CMT4B2		10644431	Standard	NM_030962		Approved	KIAA1766, MTMR13, DENND7B	uc001mib.2	Q86WG5	OTTHUMG00000165890	ENST00000256190.8:c.2917A>C	11.37:g.9868520T>G	ENSP00000256190:p.Thr973Pro	Somatic		WXS	Illumina HiSeq	Phase_I	Q3MJF0|Q68DQ3|Q6P459|Q6PJD1|Q7Z325|Q7Z621|Q86VE2|Q96FE2|Q9C097	Missense_Mutation	SNP	ENST00000256190.8	37	CCDS31427.1	.	.	.	.	.	.	.	.	.	.	T	15.71	2.914813	0.52546	.	.	ENSG00000133812	ENST00000256190	D	0.83075	-1.68	6.03	6.03	0.97812	.	0.165693	0.49916	D	0.000121	T	0.72439	0.3460	N	0.22421	0.69	0.40626	D	0.981817	B	0.34329	0.449	B	0.30782	0.12	T	0.75958	-0.3134	10	0.87932	D	0	.	12.4101	0.55461	0.0:0.0:0.14:0.86	.	973	Q86WG5	MTMRD_HUMAN	P	973	ENSP00000256190:T973P	ENSP00000256190:T973P	T	-	1	0	SBF2	9825096	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.825000	0.48096	2.308000	0.77769	0.533000	0.62120	ACA		0.393	SBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386911.2		NM_030962	
SBNO1	55206	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	123812074	123812074	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr12:123812074A>G	ENST00000602398.1	-	13	1718	c.1591T>C	c.(1591-1593)Tac>Cac	p.Y531H	SBNO1_ENST00000602750.1_Missense_Mutation_p.Y530H|SBNO1_ENST00000267176.4_Missense_Mutation_p.Y530H|SBNO1_ENST00000420886.2_Missense_Mutation_p.Y531H			A3KN83	SBNO1_HUMAN	strawberry notch homolog 1 (Drosophila)	531					regulation of transcription, DNA-templated (GO:0006355)			p.Y530H(1)		NS(2)|breast(6)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(11)|lung(18)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(2)	62	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000701)|Epithelial(86;0.00197)		CGAGCAATGTACATTCCTCTA	0.353																																																	1	Substitution - Missense(1)	kidney(1)											72.0	71.0	71.0					12																	123812074		2203	4300	6503	SO:0001583	missense	55206			AK001563	CCDS9246.1, CCDS53844.1	12q24.31	2006-10-06	2006-10-06			ENSG00000139697			22973	protein-coding gene	gene with protein product		614274	"""sno, strawberry notch homolog 1 (Drosophila)"""				Standard	NM_018183		Approved	MOP3, FLJ10701, FLJ10833, Sno	uc010tap.2	A3KN83		ENST00000602398.1:c.1591T>C	12.37:g.123812074A>G	ENSP00000473665:p.Tyr531His	Somatic		WXS	Illumina HiSeq	Phase_I	Q05C06|Q3ZTS3|Q9H3T8|Q9NVB2	Missense_Mutation	SNP	ENST00000602398.1	37	CCDS53844.1	.	.	.	.	.	.	.	.	.	.	A	26.0	4.699236	0.88830	.	.	ENSG00000139697	ENST00000420886;ENST00000267176;ENST00000442601	T;T	0.51817	0.69;0.69	6.04	6.04	0.98038	.	0.000000	0.85682	D	0.000000	T	0.78780	0.4337	H	0.95539	3.685	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.997	D	0.85310	0.1078	10	0.87932	D	0	-13.1551	16.5763	0.84648	1.0:0.0:0.0:0.0	.	531;530;529	A3KN83;A3KN83-2;A3KN83-3	SBNO1_HUMAN;.;.	H	531;530;530	ENSP00000387361:Y531H;ENSP00000267176:Y530H	ENSP00000267176:Y530H	Y	-	1	0	SBNO1	122378027	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.310000	0.96267	2.317000	0.78254	0.459000	0.35465	TAC		0.353	SBNO1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000467684.1		NM_018183	
SECISBP2L	9728	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	49301479	49301479	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr15:49301479C>A	ENST00000559471.1	-	14	2224	c.1961G>T	c.(1960-1962)aGt>aTt	p.S654I	SECISBP2L_ENST00000261847.3_Missense_Mutation_p.S609I	NM_001193489.1	NP_001180418.1	Q93073	SBP2L_HUMAN	SECIS binding protein 2-like	654							poly(A) RNA binding (GO:0044822)	p.S609I(1)		breast(1)|endometrium(5)|kidney(8)|large_intestine(12)|lung(11)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|urinary_tract(1)	46						TATTCCAGAACTAGCAGGAGA	0.413																																																	1	Substitution - Missense(1)	kidney(1)											187.0	164.0	172.0					15																	49301479		2197	4295	6492	SO:0001583	missense	9728			BC033001	CCDS32234.1, CCDS53942.1	15q21.1	2014-02-12				ENSG00000138593			28997	protein-coding gene	gene with protein product		615756					Standard	NM_001193489		Approved	KIAA0256	uc001zxe.2	Q93073		ENST00000559471.1:c.1961G>T	15.37:g.49301479C>A	ENSP00000453854:p.Ser654Ile	Somatic		WXS	Illumina HiSeq	Phase_I	Q8N767	Missense_Mutation	SNP	ENST00000559471.1	37	CCDS53942.1	.	.	.	.	.	.	.	.	.	.	C	27.0	4.790621	0.90367	.	.	ENSG00000138593	ENST00000261847;ENST00000380927	T	0.74106	-0.81	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	D	0.84875	0.5569	L	0.58669	1.825	0.58432	D	0.999997	D;D	0.89917	0.999;1.0	D;D	0.79108	0.97;0.992	D	0.85194	0.1011	10	0.66056	D	0.02	.	19.7573	0.96299	0.0:1.0:0.0:0.0	.	654;609	Q93073;Q93073-2	SBP2L_HUMAN;.	I	609;654	ENSP00000261847:S609I	ENSP00000261847:S609I	S	-	2	0	SECISBP2L	47088771	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.237000	0.78164	2.757000	0.94681	0.655000	0.94253	AGT		0.413	SECISBP2L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417277.1		NM_014701	
SENP5	205564	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	196650309	196650309	+	Missense_Mutation	SNP	C	C	G			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr3:196650309C>G	ENST00000323460.5	+	7	2158	c.1909C>G	c.(1909-1911)Ctg>Gtg	p.L637V	SENP5_ENST00000419026.1_Missense_Mutation_p.L127V|SENP5_ENST00000445299.2_Intron	NM_152699.4	NP_689912.2	Q96HI0	SENP5_HUMAN	SUMO1/sentrin specific peptidase 5	637	Protease.				cell cycle (GO:0007049)|cell division (GO:0051301)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein sumoylation (GO:0016925)	intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)	p.L637V(1)		NS(1)|breast(2)|endometrium(2)|kidney(3)|large_intestine(9)|lung(14)|skin(1)	32	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;3.14e-24)|all cancers(36;2.1e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.03e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.004)		AAAGAGTCTTCTGTTGATTCC	0.383																																					Ovarian(47;891 1095 11174 13858 51271)												1	Substitution - Missense(1)	kidney(1)											148.0	141.0	143.0					3																	196650309		2203	4300	6503	SO:0001583	missense	205564			BC030705	CCDS3322.1	3q29	2005-08-17	2005-08-17		ENSG00000119231	ENSG00000119231			28407	protein-coding gene	gene with protein product		612845	"""SUMO1/sentrin specific protease 5"""			12477932	Standard	NM_152699		Approved	MGC27076	uc003fwz.4	Q96HI0	OTTHUMG00000155527	ENST00000323460.5:c.1909C>G	3.37:g.196650309C>G	ENSP00000327197:p.Leu637Val	Somatic		WXS	Illumina HiSeq	Phase_I	B4DY82|Q96SA5	Missense_Mutation	SNP	ENST00000323460.5	37	CCDS3322.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.93|15.93	2.979125|2.979125	0.53827|0.53827	.|.	.|.	ENSG00000119231|ENSG00000119231	ENST00000448068|ENST00000323460;ENST00000419026	.|T;T	.|0.30448	.|1.53;1.53	4.66|4.66	3.76|3.76	0.43208|0.43208	.|.	.|0.081294	.|0.50627	.|D	.|0.000120	T|T	0.40196|0.40196	0.1107|0.1107	L|L	0.37466|0.37466	1.105|1.105	0.51767|0.51767	D|D	0.999934|0.999934	.|D	.|0.76494	.|0.999	.|D	.|0.71656	.|0.974	T|T	0.08086|0.08086	-1.0739|-1.0739	5|10	.|0.39692	.|T	.|0.17	-4.2808|-4.2808	10.1294|10.1294	0.42669|0.42669	0.0:0.9008:0.0:0.0992|0.0:0.9008:0.0:0.0992	.|.	.|637	.|Q96HI0	.|SENP5_HUMAN	L|V	7|637;127	.|ENSP00000327197:L637V;ENSP00000396927:L127V	.|ENSP00000327197:L637V	F|L	+|+	3|1	2|2	SENP5|SENP5	198134706|198134706	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.983000|0.983000	0.72400|0.72400	0.840000|0.840000	0.27600|0.27600	2.305000|2.305000	0.77605|0.77605	0.555000|0.555000	0.69702|0.69702	TTC|CTG		0.383	SENP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340524.1		NM_152699	
SEPP1	6414	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	42807034	42807035	+	Frame_Shift_Del	DEL	AA	AA	-			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	AA	AA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr5:42807034_42807035delAA	ENST00000514985.1	-	3	635_636	c.379_380delTT	c.(379-381)ttafs	p.L127fs	SEPP1_ENST00000509276.1_Intron|SEPP1_ENST00000506577.1_Frame_Shift_Del_p.L127fs|SEPP1_ENST00000507920.1_Intron|SEPP1_ENST00000511224.1_Frame_Shift_Del_p.L127fs|CTD-2325A15.5_ENST00000606056.1_RNA	NM_005410.2	NP_005401.3	P49908	SEPP1_HUMAN	selenoprotein P, plasma, 1	127					brain development (GO:0007420)|growth (GO:0040007)|locomotory behavior (GO:0007626)|post-embryonic development (GO:0009791)|response to oxidative stress (GO:0006979)|selenium compound metabolic process (GO:0001887)|sexual reproduction (GO:0019953)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	selenium binding (GO:0008430)			kidney(10)|large_intestine(1)|lung(4)	15						GCTTCCATTTAAAAGAGTCCAG	0.307																																																	0																																										SO:0001589	frameshift_variant	6414			BC040075	CCDS43311.1	5q31	2012-03-01				ENSG00000250722			10751	protein-coding gene	gene with protein product		601484				8421687	Standard	NM_001085486		Approved	SeP	uc011cpu.2	P49908		ENST00000514985.1:c.379_380delTT	5.37:g.42807036_42807037delAA	ENSP00000420939:p.Leu127fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q6PD59|Q6PI43|Q6PI87|Q6PJF9	Frame_Shift_Del	DEL	ENST00000514985.1	37	CCDS43311.1																																																																																				0.307	SEPP1-001	KNOWN	basic|appris_principal|CCDS|seleno	protein_coding	protein_coding	OTTHUMT00000367483.1		NM_005410	
SHD	56961	broad.mit.edu;hgsc.bcm.edu	37	19	4280225	4280225	+	Silent	SNP	G	G	A	rs368273049		TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr19:4280225G>A	ENST00000543264.2	+	1	1628	c.165G>A	c.(163-165)ccG>ccA	p.P55P	SHD_ENST00000599689.1_Silent_p.P55P	NM_020209.3	NP_064594.3	Q96IW2	SHD_HUMAN	Src homology 2 domain containing transforming protein D	55								p.P55P(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|stomach(1)	14				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0337)|STAD - Stomach adenocarcinoma(1328;0.18)		GCTTGGAGCCGGACCCCGCGG	0.652																																																	1	Substitution - coding silent(1)	kidney(1)						G		1,4405		0,1,2202	19.0	24.0	22.0		165	-9.2	0.0	19		22	0,8600		0,0,4300	no	coding-synonymous	SHD	NM_020209.3		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		55/341	4280225	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	56961			BC007206	CCDS12125.1	19p13.3	2013-02-14				ENSG00000105251		"""SH2 domain containing"""	30633	protein-coding gene	gene with protein product		610481				9315092	Standard	NM_020209		Approved		uc002lzw.2	Q96IW2		ENST00000543264.2:c.165G>A	19.37:g.4280225G>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q96NC2	Silent	SNP	ENST00000543264.2	37	CCDS12125.1																																																																																				0.652	SHD-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458082.1		NM_020209	
SLC30A5	64924	broad.mit.edu	37	5	68414420	68414420	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr5:68414420A>G	ENST00000396591.3	+	12	2144	c.1534A>G	c.(1534-1536)Att>Gtt	p.I512V	CTC-498J12.3_ENST00000504129.1_RNA	NM_022902.4	NP_075053.2	Q8TAD4	ZNT5_HUMAN	solute carrier family 30 (zinc transporter), member 5	512					cellular protein metabolic process (GO:0044267)|cellular zinc ion homeostasis (GO:0006882)|cobalt ion transport (GO:0006824)|regulation of proton transport (GO:0010155)|response to zinc ion (GO:0010043)|transmembrane transport (GO:0055085)|zinc ion transmembrane transport (GO:0071577)|zinc ion transport (GO:0006829)	apical plasma membrane (GO:0016324)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|secretory granule (GO:0030141)|secretory granule membrane (GO:0030667)	zinc ion binding (GO:0008270)|zinc ion transmembrane transporter activity (GO:0005385)	p.I512V(1)		breast(3)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		Lung NSC(167;0.000986)|Prostate(74;0.00809)|Colorectal(97;0.0508)|Ovarian(174;0.16)		OV - Ovarian serous cystadenocarcinoma(47;1.24e-56)|Epithelial(20;1.12e-52)|all cancers(19;2.63e-48)|Lung(70;0.0177)		GGCTAGATTGATTGATCCTCC	0.318																																																	1	Substitution - Missense(1)	kidney(1)											140.0	146.0	144.0					5																	68414420		2203	4298	6501	SO:0001583	missense	64924			AF212235	CCDS3996.1, CCDS34173.1, CCDS58955.1	5q13.1	2013-05-22			ENSG00000145740	ENSG00000145740		"""Solute carriers"""	19089	protein-coding gene	gene with protein product		607819				11937503, 11904301	Standard	NM_022902		Approved	ZTL1, ZnT-5, FLJ12496, FLJ12756, ZNT5, MGC5499, ZNTL1	uc003jvh.3	Q8TAD4	OTTHUMG00000131253	ENST00000396591.3:c.1534A>G	5.37:g.68414420A>G	ENSP00000379836:p.Ile512Val	Somatic		WXS	Illumina GAIIx	Phase_I	B7ZM89|Q6UX54|Q7L4M4|Q8TDG3|Q9BVY8|Q9H9H1	Missense_Mutation	SNP	ENST00000396591.3	37	CCDS3996.1	.	.	.	.	.	.	.	.	.	.	A	11.15	1.552828	0.27739	.	.	ENSG00000145740	ENST00000396591;ENST00000438236	T	0.64438	-0.1	6.06	4.89	0.63831	.	0.257624	0.42964	D	0.000636	T	0.42177	0.1191	N	0.17872	0.535	0.80722	D	1	B;B;B	0.14438	0.001;0.01;0.009	B;B;B	0.18263	0.01;0.021;0.021	T	0.25676	-1.0125	10	0.30854	T	0.27	.	5.0565	0.14535	0.6411:0.0:0.0745:0.2844	.	341;341;512	Q9H9X0;Q8TAD4-2;Q8TAD4	.;.;ZNT5_HUMAN	V	512;125	ENSP00000379836:I512V	ENSP00000379836:I512V	I	+	1	0	SLC30A5	68450176	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.528000	0.35985	1.091000	0.41335	0.528000	0.53228	ATT		0.318	SLC30A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254017.2			
SLC37A2	219855	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	124955896	124955896	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr11:124955896C>T	ENST00000403796.2	+	17	1773	c.1472C>T	c.(1471-1473)tCc>tTc	p.S491F	SLC37A2_ENST00000407458.1_Missense_Mutation_p.S491F|SLC37A2_ENST00000525837.1_3'UTR|SLC37A2_ENST00000308074.4_Missense_Mutation_p.S491F|SLC37A2_ENST00000298280.5_3'UTR	NM_001145290.1	NP_001138762.1	Q8TED4	SPX2_HUMAN	solute carrier family 37 (glucose-6-phosphate transporter), member 2	491					carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	transporter activity (GO:0005215)	p.S491F(2)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(1)	27	all_hematologic(175;0.215)	Breast(109;0.012)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.152)|all_lung(97;0.159)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0384)		TGGAAGGTGTCCCTGAGCAGA	0.577																																					Melanoma(11;373 620 21213 26083 47768)												2	Substitution - Missense(2)	kidney(2)											104.0	89.0	94.0					11																	124955896		2201	4299	6500	SO:0001583	missense	219855			AK074100	CCDS31714.1, CCDS44757.1	11q24.2	2013-07-17	2013-07-17		ENSG00000134955	ENSG00000134955		"""Solute carriers"""	20644	protein-coding gene	gene with protein product			"""solute carrier family 37 (glycerol-3-phosphate transporter), member 2"""				Standard	NM_198277		Approved	FLJ00171	uc010sau.2	Q8TED4	OTTHUMG00000165879	ENST00000403796.2:c.1472C>T	11.37:g.124955896C>T	ENSP00000384407:p.Ser491Phe	Somatic		WXS	Illumina HiSeq	Phase_I	A8K2P9|Q6P599|Q7Z7P8|Q8TEM2	Missense_Mutation	SNP	ENST00000403796.2	37	CCDS44757.1	.	.	.	.	.	.	.	.	.	.	C	11.20	1.569955	0.28003	.	.	ENSG00000134955	ENST00000403796;ENST00000407458;ENST00000308074	T;T;T	0.32272	1.47;1.46;1.46	4.9	-0.51	0.11973	.	0.662303	0.15794	N	0.244315	T	0.15392	0.0371	N	0.22421	0.69	0.09310	N	1	B;B;B	0.12013	0.002;0.005;0.003	B;B;B	0.11329	0.004;0.006;0.002	T	0.15037	-1.0451	10	0.52906	T	0.07	-4.3824	2.0187	0.03504	0.2299:0.4237:0.1878:0.1585	.	116;491;491	B7Z480;Q8TED4-2;Q8TED4	.;.;SPX2_HUMAN	F	491	ENSP00000384407:S491F;ENSP00000385126:S491F;ENSP00000311833:S491F	ENSP00000311833:S491F	S	+	2	0	SLC37A2	124461106	0.000000	0.05858	0.006000	0.13384	0.370000	0.29829	-0.325000	0.07976	0.241000	0.21283	0.655000	0.94253	TCC		0.577	SLC37A2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000386837.1		XM_166184	
SLC5A11	115584	broad.mit.edu;hgsc.bcm.edu	37	16	24921753	24921753	+	Missense_Mutation	SNP	G	G	A	rs572775623		TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr16:24921753G>A	ENST00000347898.3	+	15	2399	c.1777G>A	c.(1777-1779)Gtc>Atc	p.V593I	SLC5A11_ENST00000567758.1_Missense_Mutation_p.V558I|SLC5A11_ENST00000568579.1_Missense_Mutation_p.V523I|SLC5A11_ENST00000565769.1_Missense_Mutation_p.V529I|SLC5A11_ENST00000545376.1_Missense_Mutation_p.V523I|SLC5A11_ENST00000569071.1_Missense_Mutation_p.V437I|SLC5A11_ENST00000449109.2_Missense_Mutation_p.V437I|SLC5A11_ENST00000424767.2_Missense_Mutation_p.V558I|SLC5A11_ENST00000539472.1_Missense_Mutation_p.V529I	NM_052944.3	NP_443176.2			solute carrier family 5 (sodium/inositol cotransporter), member 11									p.V593I(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(30)|ovary(2)|prostate(2)|urinary_tract(1)	49				GBM - Glioblastoma multiforme(48;0.0365)		CAGCAGCAGCGTCCAGTTCGA	0.532													G|||	1	0.000199681	0.0008	0.0	5008	,	,		16146	0.0		0.0	False		,,,				2504	0.0																1	Substitution - Missense(1)	kidney(1)											98.0	76.0	83.0					16																	24921753		2197	4300	6497	SO:0001583	missense	115584			AF292385	CCDS10625.1, CCDS58437.1, CCDS58438.1, CCDS58439.1, CCDS58440.1	16p12.1	2013-07-19	2013-07-19		ENSG00000158865	ENSG00000158865		"""Solute carriers"""	23091	protein-coding gene	gene with protein product		610238	"""solute carrier family 5 (sodium/glucose cotransporter), member 11"""			12039040, 12133831	Standard	NM_001258414		Approved	KST1, SMIT2, SGLT6	uc002dmu.4	Q8WWX8	OTTHUMG00000097003	ENST00000347898.3:c.1777G>A	16.37:g.24921753G>A	ENSP00000289932:p.Val593Ile	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000347898.3	37	CCDS10625.1	.	.	.	.	.	.	.	.	.	.	G	0.125	-1.120544	0.01785	.	.	ENSG00000158865	ENST00000347898;ENST00000449109;ENST00000424767;ENST00000545376;ENST00000539472	T;T;T;T;T	0.64260	-0.09;-0.09;-0.09;-0.09;-0.09	0.158	0.158	0.14942	.	2.550580	0.00941	N	0.002832	T	0.30448	0.0765	N	0.02011	-0.69	0.09310	N	1	B;B;B;P	0.39404	0.0;0.001;0.0;0.672	B;B;B;B	0.29524	0.0;0.001;0.0;0.103	T	0.28427	-1.0044	9	0.33141	T	0.24	.	.	.	.	.	523;558;593;437	B7Z329;Q8WWX8-2;Q8WWX8;Q05BF1	.;.;SC5AB_HUMAN;.	I	593;437;558;523;529	ENSP00000289932:V593I;ENSP00000389606:V437I;ENSP00000416782:V558I;ENSP00000441384:V523I;ENSP00000441018:V529I	ENSP00000289932:V593I	V	+	1	0	SLC5A11	24829254	0.000000	0.05858	0.012000	0.15200	0.251000	0.25915	-0.428000	0.06991	0.202000	0.20498	0.205000	0.17691	GTC		0.532	SLC5A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214091.3		NM_052944	
SNW1	22938	hgsc.bcm.edu;ucsc.edu	37	14	78184785	78184797	+	Frame_Shift_Del	DEL	CTCTGGGCCATAT	CTCTGGGCCATAT	-	rs571130787		TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	CTCTGGGCCATAT	CTCTGGGCCATAT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr14:78184785_78184797delCTCTGGGCCATAT	ENST00000261531.7	-	13	1387_1399	c.1325_1337delATATGGCCCAGAG	c.(1324-1338)gatatggcccagagtfs	p.DMAQS442fs	SNW1_ENST00000555761.1_Frame_Shift_Del_p.DMAQS442fs|SNW1_ENST00000554775.1_Frame_Shift_Del_p.DMAQS280fs|SLIRP_ENST00000557623.1_Intron|SLIRP_ENST00000557431.1_Intron	NM_012245.2	NP_036377.1	Q13573	SNW1_HUMAN	SNW domain containing 1	442					cellular response to retinoic acid (GO:0071300)|gene expression (GO:0010467)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of vitamin D receptor signaling pathway (GO:0070564)|regulation of retinoic acid receptor signaling pathway (GO:0048385)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of vitamin D receptor signaling pathway (GO:0070562)|retinoic acid receptor signaling pathway (GO:0048384)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|chromatin (GO:0000785)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	Notch binding (GO:0005112)|nuclear hormone receptor binding (GO:0035257)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)|SMAD binding (GO:0046332)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|vitamin D receptor binding (GO:0042809)	p.D442D(1)		NS(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0291)		CCTATAAATACTCTGGGCCATATCTTTACCACC	0.408																																																	1	Substitution - coding silent(1)	kidney(1)																																								SO:0001589	frameshift_variant	22938			AF045184	CCDS9867.1	14q22.1-q22.3	2005-09-13	2005-09-13	2005-09-13		ENSG00000100603			16696	protein-coding gene	gene with protein product		603055	"""SKI interacting protein"""	SKIIP		8973337, 9632709	Standard	NM_012245		Approved	NCoA-62, SKIP, Prp45, PRPF45, Bx42	uc001xuf.3	Q13573		ENST00000261531.7:c.1325_1337delATATGGCCCAGAG	14.37:g.78184785_78184797delCTCTGGGCCATAT	ENSP00000261531:p.Asp442fs	Somatic		WXS	Illumina HiSeq	Phase_I	A8K8A9|Q13483|Q32N03|Q5D0D6	Frame_Shift_Del	DEL	ENST00000261531.7	37	CCDS9867.1																																																																																				0.408	SNW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413912.1		NM_012245	
SPRY2	10253	broad.mit.edu	37	13	80911818	80911818	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr13:80911818C>T	ENST00000377102.1	-	2	1000	c.23G>A	c.(22-24)gGc>gAc	p.G8D	SPRY2_ENST00000540649.1_Missense_Mutation_p.G8D|SPRY2_ENST00000377104.3_Missense_Mutation_p.G8D			O43597	SPY2_HUMAN	sprouty homolog 2 (Drosophila)	8					bud elongation involved in lung branching (GO:0060449)|cell fate commitment (GO:0045165)|epidermal growth factor receptor signaling pathway (GO:0007173)|establishment of mitotic spindle orientation (GO:0000132)|fibroblast growth factor receptor signaling pathway (GO:0008543)|inner ear morphogenesis (GO:0042472)|lung growth (GO:0060437)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of neurotrophin TRK receptor signaling pathway (GO:0051387)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|negative regulation of Ras GTPase activity (GO:0034261)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|sensory perception of sound (GO:0007605)	cell projection (GO:0042995)|cytosol (GO:0005829)|microtubule (GO:0005874)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein serine/threonine kinase activator activity (GO:0043539)|protein serine/threonine kinase inhibitor activity (GO:0030291)	p.G8D(1)		central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)	12	Medulloblastoma(90;0.18)	Acute lymphoblastic leukemia(28;0.218)|Breast(118;0.244)		GBM - Glioblastoma multiforme(99;0.0318)		CGACCCGTTGCCACTCTGAGC	0.607																																																	1	Substitution - Missense(1)	kidney(1)											38.0	41.0	40.0					13																	80911818		2203	4300	6503	SO:0001583	missense	10253			AF039843	CCDS9463.1	13q31.1	2008-05-14	2001-11-28		ENSG00000136158	ENSG00000136158			11270	protein-coding gene	gene with protein product		602466	"""sprouty (Drosophila) homolog 2"""			9458049	Standard	NM_005842		Approved	hSPRY2	uc001vlj.3	O43597	OTTHUMG00000017140	ENST00000377102.1:c.23G>A	13.37:g.80911818C>T	ENSP00000366306:p.Gly8Asp	Somatic		WXS	Illumina GAIIx	Phase_I	B2R9J9|Q5T6Z7	Missense_Mutation	SNP	ENST00000377102.1	37	CCDS9463.1	.	.	.	.	.	.	.	.	.	.	C	18.31	3.596406	0.66332	.	.	ENSG00000136158	ENST00000377104;ENST00000377102;ENST00000541655;ENST00000540649	T;T;T	0.60040	0.22;0.22;0.22	5.2	5.2	0.72013	.	0.000000	0.85682	D	0.000000	T	0.59689	0.2212	M	0.71581	2.175	0.50171	D	0.999856	B	0.27351	0.176	B	0.19666	0.026	T	0.62110	-0.6923	10	0.62326	D	0.03	-0.8358	18.8229	0.92105	0.0:1.0:0.0:0.0	.	8	O43597	SPY2_HUMAN	D	8	ENSP00000366308:G8D;ENSP00000366306:G8D;ENSP00000439027:G8D	ENSP00000366306:G8D	G	-	2	0	SPRY2	79809819	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	3.538000	0.53597	2.455000	0.83008	0.650000	0.86243	GGC		0.607	SPRY2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045387.1			
SRCAP	10847	broad.mit.edu;hgsc.bcm.edu	37	16	30734026	30734026	+	Silent	SNP	C	C	T			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr16:30734026C>T	ENST00000262518.4	+	23	4234	c.3849C>T	c.(3847-3849)acC>acT	p.T1283T	SRCAP_ENST00000344771.4_Intron|SRCAP_ENST00000395059.2_Intron	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	1283	Pro-rich.				histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)	p.T1283T(1)		NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			CCAGCACCACCCCTGCCCCTA	0.657																																																	1	Substitution - coding silent(1)	kidney(1)											119.0	125.0	123.0					16																	30734026		2070	4188	6258	SO:0001819	synonymous_variant	10847			AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.3849C>T	16.37:g.30734026C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B0JZA6|O15026|Q7Z744|Q9Y5L9	Silent	SNP	ENST00000262518.4	37	CCDS10689.2																																																																																				0.657	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255523.1		NM_006662	
SREBF2	6721	broad.mit.edu	37	22	42276853	42276853	+	Missense_Mutation	SNP	G	G	A	rs377649542	byFrequency	TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr22:42276853G>A	ENST00000361204.4	+	10	2061	c.1895G>A	c.(1894-1896)cGc>cAc	p.R632H		NM_004599.2	NP_004590.2	Q12772	SRBP2_HUMAN	sterol regulatory element binding transcription factor 2	632					cellular lipid metabolic process (GO:0044255)|cellular response to laminar fluid shear stress (GO:0071499)|cholesterol metabolic process (GO:0008203)|lipid metabolic process (GO:0006629)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cholesterol homeostasis (GO:2000188)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|response to low-density lipoprotein particle (GO:0055098)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SREBP-SCAP-Insig complex (GO:0032937)	E-box binding (GO:0070888)|protein C-terminus binding (GO:0008022)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R632H(1)		NS(2)|breast(6)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	38						CAGAAGCTACGCCTGGTGCGC	0.652													G|||	3	0.000599042	0.0	0.0014	5008	,	,		16520	0.002		0.0	False		,,,				2504	0.0																1	Substitution - Missense(1)	kidney(1)											36.0	37.0	36.0					22																	42276853		2203	4300	6503	SO:0001583	missense	6721			U02031	CCDS14023.1	22q13.2	2013-05-21			ENSG00000198911	ENSG00000198911		"""Basic helix-loop-helix proteins"""	11290	protein-coding gene	gene with protein product		600481				7903453	Standard	NM_004599		Approved	SREBP2, bHLHd2	uc003bbi.3	Q12772	OTTHUMG00000151261	ENST00000361204.4:c.1895G>A	22.37:g.42276853G>A	ENSP00000354476:p.Arg632His	Somatic		WXS	Illumina GAIIx	Phase_I	Q05BD5|Q6GTH7|Q86V36|Q9UH04	Missense_Mutation	SNP	ENST00000361204.4	37	CCDS14023.1	.	.	.	.	.	.	.	.	.	.	G	17.11	3.305992	0.60305	.	.	ENSG00000198911	ENST00000361204;ENST00000457567	T	0.07688	3.17	4.95	4.95	0.65309	.	0.297614	0.37623	N	0.002011	T	0.03608	0.0103	N	0.03608	-0.345	0.34191	D	0.672	D	0.58620	0.983	B	0.35312	0.2	T	0.43491	-0.9388	10	0.42905	T	0.14	-20.6961	14.8681	0.70434	0.0:0.1547:0.8453:0.0	.	632	Q12772	SRBP2_HUMAN	H	632	ENSP00000354476:R632H	ENSP00000354476:R632H	R	+	2	0	SREBF2	40606799	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	4.561000	0.60809	2.292000	0.77174	0.478000	0.44815	CGC		0.652	SREBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321956.1		NM_004599	
SRRM4	84530	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	119552153	119552153	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr12:119552153C>T	ENST00000267260.4	+	3	737	c.349C>T	c.(349-351)Cgg>Tgg	p.R117W	RP11-364C11.2_ENST00000537730.1_RNA	NM_194286.3	NP_919262.2	A7MD48	SRRM4_HUMAN	serine/arginine repetitive matrix 4	117	Lys-rich.				cell differentiation (GO:0030154)|mRNA processing (GO:0006397)|nervous system development (GO:0007399)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|sensory perception of sound (GO:0007605)	nucleus (GO:0005634)	mRNA binding (GO:0003729)	p.R117W(2)|p.R214W(1)		breast(2)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(8)|ovary(3)|upper_aerodigestive_tract(1)	24						GAAATCCACTCGGAAGAAGAG	0.473																																																	3	Substitution - Missense(3)	kidney(3)											72.0	69.0	70.0					12																	119552153		1916	4131	6047	SO:0001583	missense	84530			AB058756	CCDS44994.1	12q24.23	2009-09-22	2009-09-21	2009-09-21	ENSG00000139767	ENSG00000139767			29389	protein-coding gene	gene with protein product	"""neural-specific SR-related protein of 100 kDa"""	613103	"""KIAA1853"""	KIAA1853		19737518	Standard	NM_194286		Approved	nSR100	uc001txa.2	A7MD48	OTTHUMG00000168928	ENST00000267260.4:c.349C>T	12.37:g.119552153C>T	ENSP00000267260:p.Arg117Trp	Somatic		WXS	Illumina HiSeq	Phase_I	A8K5P6|B2RZH7|Q7Z5F0|Q96JH4	Missense_Mutation	SNP	ENST00000267260.4	37	CCDS44994.1	.	.	.	.	.	.	.	.	.	.	C	14.27	2.485638	0.44147	.	.	ENSG00000139767	ENST00000267260	T	0.32272	1.46	4.63	2.71	0.32032	.	0.164203	0.40728	N	0.001032	T	0.49184	0.1542	M	0.64404	1.975	0.37717	D	0.924798	D	0.89917	1.0	D	0.91635	0.999	T	0.54708	-0.8253	10	0.66056	D	0.02	-3.1817	10.7947	0.46453	0.3565:0.6435:0.0:0.0	.	117	A7MD48	SRRM4_HUMAN	W	117	ENSP00000267260:R117W	ENSP00000267260:R117W	R	+	1	2	SRRM4	118036536	0.577000	0.26708	0.851000	0.33527	0.993000	0.82548	0.783000	0.26802	0.615000	0.30124	-0.310000	0.09108	CGG		0.473	SRRM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401640.2		NM_194286	
SSPO	23145	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	149480310	149480310	+	RNA	SNP	A	A	C			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr7:149480310A>C	ENST00000378016.2	+	0	2192							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)	p.K66T(1)				Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			GTGGCCGGCAAGGGAAGATGC	0.627																																																	1	Substitution - Missense(1)	kidney(1)											87.0	92.0	90.0					7																	149480310		2146	4247	6393			23145			AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149480310A>C		Somatic		WXS	Illumina HiSeq	Phase_I	Q76B61	Silent	SNP	ENST00000378016.2	37																																																																																					0.627	SSPO-202	KNOWN	basic	processed_transcript	processed_transcript				
SULT1A1	6817	broad.mit.edu	37	16	28620121	28620121	+	Missense_Mutation	SNP	G	G	A	rs200542791	byFrequency	TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr16:28620121G>A	ENST00000395607.1	-	2	329	c.56C>T	c.(55-57)cCg>cTg	p.P19L	SULT1A1_ENST00000569554.1_Missense_Mutation_p.P19L|SULT1A1_ENST00000350842.4_Intron|SULT1A1_ENST00000314752.7_Missense_Mutation_p.P19L|SULT1A1_ENST00000395609.1_Missense_Mutation_p.P19L	NM_177530.2|NM_177534.2	NP_803566.1|NP_803878.1	P50225	ST1A1_HUMAN	sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1	19					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|amine metabolic process (GO:0009308)|catecholamine metabolic process (GO:0006584)|estrogen metabolic process (GO:0008210)|flavonoid metabolic process (GO:0009812)|small molecule metabolic process (GO:0044281)|sulfation (GO:0051923)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	aryl sulfotransferase activity (GO:0004062)|flavonol 3-sulfotransferase activity (GO:0047894)|steroid sulfotransferase activity (GO:0050294)|sulfotransferase activity (GO:0008146)	p.P19L(2)		endometrium(2)|kidney(7)|large_intestine(2)|lung(2)|ovary(1)|stomach(2)	16					Acetaminophen(DB00316)|Tamoxifen(DB00675)	CTTGATGAGCGGGACCCCCTT	0.632																																																	2	Substitution - Missense(2)	kidney(2)											36.0	36.0	36.0					16																	28620121		2197	4293	6490	SO:0001583	missense	6817			U52852	CCDS10637.1, CCDS32420.1	16p12.1	2008-02-05			ENSG00000196502	ENSG00000196502	2.8.2.1	"""Sulfotransferases, cytosolic"""	11453	protein-coding gene	gene with protein product		171150		STP, STP1		8288252, 8912648	Standard	NM_177534		Approved	P-PST	uc002dqj.3	P50225	OTTHUMG00000131765	ENST00000395607.1:c.56C>T	16.37:g.28620121G>A	ENSP00000378971:p.Pro19Leu	Somatic		WXS	Illumina GAIIx	Phase_I	Q2NL71|Q86U58|Q92818|Q9BVU6|Q9UGG7	Missense_Mutation	SNP	ENST00000395607.1	37	CCDS32420.1	.	.	.	.	.	.	.	.	.	.	.	10.83	1.461115	0.26248	.	.	ENSG00000196502	ENST00000314752;ENST00000395609;ENST00000395607	T;T;T	0.01560	4.77;4.77;4.77	2.5	1.49	0.22878	.	0.000000	0.64402	D	0.000001	T	0.02807	0.0084	N	0.24115	0.695	0.47037	D	0.999295	D	0.89917	1.0	D	0.76071	0.987	T	0.57225	-0.7848	10	0.06625	T	0.88	.	7.8438	0.29414	0.1395:0.0:0.8605:0.0	.	19	P50225	ST1A1_HUMAN	L	19	ENSP00000321988:P19L;ENSP00000378972:P19L;ENSP00000378971:P19L	ENSP00000321988:P19L	P	-	2	0	SULT1A1	28527622	0.990000	0.36364	0.082000	0.20525	0.073000	0.16967	2.174000	0.42482	0.605000	0.29947	0.306000	0.20318	CCG		0.632	SULT1A1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254694.2		NM_001055	
SYTL5	94122	broad.mit.edu;hgsc.bcm.edu	37	X	37935825	37935825	+	Frame_Shift_Del	DEL	T	T	-	rs144659697		TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chrX:37935825delT	ENST00000357972.5	+	6	1106	c.560delT	c.(559-561)cttfs	p.L188fs	SYTL5_ENST00000297875.2_Frame_Shift_Del_p.L188fs|SYTL5_ENST00000456733.2_Frame_Shift_Del_p.L188fs|TM4SF2_ENST00000465127.1_Intron			Q8TDW5	SYTL5_HUMAN	synaptotagmin-like 5	188					exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)	membrane (GO:0016020)	metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(9)|lung(23)|prostate(1)|skin(2)|urinary_tract(1)	44						TTCAGATTTCTTCTTAGCAAG	0.313																																																	0													35.0	28.0	31.0					X																	37935825		2201	4299	6500	SO:0001589	frameshift_variant	94122				CCDS14244.1, CCDS55399.1	Xp21.1	2008-02-05			ENSG00000147041	ENSG00000147041			15589	protein-coding gene	gene with protein product	"""exophilin 9"""						Standard	NM_138780		Approved		uc004ddx.3	Q8TDW5	OTTHUMG00000033176	ENST00000357972.5:c.560delT	X.37:g.37935825delT	ENSP00000350657:p.Leu188fs	Somatic		WXS	Illumina HiSeq	Phase_I	A2RRF2	Frame_Shift_Del	DEL	ENST00000357972.5	37	CCDS14244.1																																																																																				0.313	SYTL5-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080883.1		NM_138780	
TCEA3	6920	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	23743879	23743879	+	Silent	SNP	G	G	A	rs377440841		TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr1:23743879G>A	ENST00000450454.2	-	4	349	c.243C>T	c.(241-243)tcC>tcT	p.S81S	TCEA3_ENST00000461794.1_Silent_p.S44S|TCEA3_ENST00000374601.3_Silent_p.S81S	NM_003196.1	NP_003187.1	O75764	TCEA3_HUMAN	transcription elongation factor A (SII), 3	81	TFIIS N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00649}.				regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.S81S(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|urinary_tract(1)	7		Colorectal(325;3.46e-05)|Lung NSC(340;4.16e-05)|all_lung(284;6.68e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.0054)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;1.6e-25)|Colorectal(126;8.32e-08)|COAD - Colon adenocarcinoma(152;4.29e-06)|GBM - Glioblastoma multiforme(114;9e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00112)|KIRC - Kidney renal clear cell carcinoma(1967;0.00424)|STAD - Stomach adenocarcinoma(196;0.0145)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.0963)|LUSC - Lung squamous cell carcinoma(448;0.198)		GGGGTCCAGGGGAGTCTGAAA	0.512																																																	1	Substitution - coding silent(1)	kidney(1)											68.0	68.0	68.0					1																	23743879		1923	4146	6069	SO:0001819	synonymous_variant	6920			AJ223473	CCDS44086.1	1p36.11	2011-01-25			ENSG00000204219	ENSG00000204219			11615	protein-coding gene	gene with protein product		604128				9790746	Standard	NM_003196		Approved	TFIIS.H	uc021oig.1	O75764	OTTHUMG00000003233	ENST00000450454.2:c.243C>T	1.37:g.23743879G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A8K2K7|Q5DR83	Silent	SNP	ENST00000450454.2	37	CCDS44086.1																																																																																				0.512	TCEA3-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008911.2		NM_003196	
TNKS1BP1	85456	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	57076422	57076422	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr11:57076422C>T	ENST00000532437.1	-	5	4074	c.3763G>A	c.(3763-3765)Gtg>Atg	p.V1255M	TNKS1BP1_ENST00000358252.3_Missense_Mutation_p.V1255M|TNKS1BP1_ENST00000530920.1_5'Flank			Q9C0C2	TB182_HUMAN	tankyrase 1 binding protein 1, 182kDa	1255	Acidic.|Gly-rich.				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|RNA metabolic process (GO:0016070)|telomere maintenance via telomerase (GO:0007004)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nuclear telomeric heterochromatin (GO:0005724)|nucleus (GO:0005634)	ankyrin binding (GO:0030506)|enzyme binding (GO:0019899)	p.V1255M(1)		breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(24)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	64		all_epithelial(135;0.21)				GTCTGCCCCACGCCACTCTCT	0.577																																																	1	Substitution - Missense(1)	kidney(1)											150.0	153.0	152.0					11																	57076422		2201	4296	6497	SO:0001583	missense	85456			AB051528	CCDS7951.1	11q12.2	2008-07-21			ENSG00000149115	ENSG00000149115			19081	protein-coding gene	gene with protein product		607104				11854288	Standard	NM_033396		Approved	TAB182, KIAA1741, FLJ45975	uc001njs.3	Q9C0C2	OTTHUMG00000167022	ENST00000532437.1:c.3763G>A	11.37:g.57076422C>T	ENSP00000437271:p.Val1255Met	Somatic		WXS	Illumina HiSeq	Phase_I	A7E2F8|Q6PJ35|Q6ZV74	Missense_Mutation	SNP	ENST00000532437.1	37	CCDS7951.1	.	.	.	.	.	.	.	.	.	.	C	19.65	3.867352	0.72065	.	.	ENSG00000149115	ENST00000358252;ENST00000532437	T;T	0.36340	1.26;1.26	5.2	5.2	0.72013	.	0.135229	0.33572	N	0.004773	T	0.59595	0.2205	M	0.72894	2.215	0.31878	N	0.618827	D	0.89917	1.0	D	0.79108	0.992	T	0.68112	-0.5495	10	0.72032	D	0.01	-19.3694	15.6536	0.77115	0.0:1.0:0.0:0.0	.	1255	Q9C0C2	TB182_HUMAN	M	1255	ENSP00000350990:V1255M;ENSP00000437271:V1255M	ENSP00000350990:V1255M	V	-	1	0	TNKS1BP1	56832998	0.025000	0.19082	0.988000	0.46212	0.847000	0.48162	0.202000	0.17295	2.434000	0.82447	0.462000	0.41574	GTG		0.577	TNKS1BP1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392455.1		NM_033396	
TPR	7175	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	186303510	186303510	+	Missense_Mutation	SNP	G	G	C			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr1:186303510G>C	ENST00000367478.4	-	36	5425	c.5129C>G	c.(5128-5130)aCt>aGt	p.T1710S		NM_003292.2	NP_003283.2	P12270	TPR_HUMAN	translocated promoter region, nuclear basket protein	1710					carbohydrate metabolic process (GO:0005975)|cellular response to heat (GO:0034605)|cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|MAPK import into nucleus (GO:0000189)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic spindle assembly checkpoint (GO:0007094)|mRNA export from nucleus in response to heat stress (GO:0031990)|negative regulation of RNA export from nucleus (GO:0046832)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translational initiation (GO:0045947)|nuclear pore organization (GO:0006999)|positive regulation of heterochromatin assembly (GO:0031453)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein import into nucleus (GO:0042307)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|regulation of mitotic sister chromatid separation (GO:0010965)|regulation of spindle assembly involved in mitosis (GO:1901673)|response to epidermal growth factor (GO:0070849)|RNA export from nucleus (GO:0006405)|RNA import into nucleus (GO:0006404)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|extrinsic component of membrane (GO:0019898)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|dynein complex binding (GO:0070840)|heat shock protein binding (GO:0031072)|mitogen-activated protein kinase binding (GO:0051019)|mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)	p.T1710S(1)|p.T1711S(1)		autonomic_ganglia(1)|breast(5)|central_nervous_system(4)|cervix(2)|endometrium(9)|kidney(12)|large_intestine(23)|liver(1)|lung(45)|ovary(2)|pancreas(1)|prostate(6)|skin(3)|stomach(1)|urinary_tract(8)	123		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		TGGGGTAGTAGTGGGATTTGT	0.433			T	NTRK1	papillary thyroid																																			Dom	yes		1	1q25	7175	translocated promoter region		E	2	Substitution - Missense(2)	kidney(2)											147.0	145.0	146.0					1																	186303510		1906	4116	6022	SO:0001583	missense	7175			U69668	CCDS41446.1	1q25	2012-03-13	2012-03-13		ENSG00000047410	ENSG00000047410			12017	protein-coding gene	gene with protein product		189940	"""translocated promoter region (to activated MET oncogene)"""			1611909, 15229283	Standard	NM_003292		Approved		uc001grv.3	P12270	OTTHUMG00000035580	ENST00000367478.4:c.5129C>G	1.37:g.186303510G>C	ENSP00000356448:p.Thr1710Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q15655|Q5SWY0|Q99968	Missense_Mutation	SNP	ENST00000367478.4	37	CCDS41446.1	.	.	.	.	.	.	.	.	.	.	G	19.48	3.835466	0.71373	.	.	ENSG00000047410	ENST00000367478	T	0.25250	1.81	5.27	5.27	0.74061	.	0.108369	0.64402	D	0.000007	T	0.48978	0.1530	M	0.64997	1.995	0.49687	D	0.999813	D	0.63880	0.993	D	0.66196	0.942	T	0.38845	-0.9642	10	0.46703	T	0.11	.	19.2495	0.93917	0.0:0.0:1.0:0.0	.	1710	P12270	TPR_HUMAN	S	1710	ENSP00000356448:T1710S	ENSP00000356448:T1710S	T	-	2	0	TPR	184570133	1.000000	0.71417	0.643000	0.29450	0.985000	0.73830	6.310000	0.72830	2.609000	0.88269	0.563000	0.77884	ACT		0.433	TPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086353.2		NM_003292	
TRIM22	10346	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	5727831	5727831	+	Missense_Mutation	SNP	T	T	C	rs370736499		TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr11:5727831T>C	ENST00000379965.3	+	5	1035	c.758T>C	c.(757-759)aTt>aCt	p.I253T	TRIM5_ENST00000380027.1_Intron	NM_001199573.1|NM_006074.4	NP_001186502.1|NP_006065.2	Q8IYM9	TRI22_HUMAN	tripartite motif containing 22	253					defense response to virus (GO:0051607)|immune response (GO:0006955)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein trimerization (GO:0070206)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|response to virus (GO:0009615)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.I253T(1)		kidney(3)|large_intestine(8)|lung(9)|prostate(1)|stomach(2)	23		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)		Epithelial(150;7.54e-09)|BRCA - Breast invasive adenocarcinoma(625;0.14)		CAGGATGTGATTGACGTCATG	0.353													T|||	1	0.000199681	0.0	0.0	5008	,	,		15593	0.0		0.001	False		,,,				2504	0.0				GBM(104;491 2336 5222)												1	Substitution - Missense(1)	kidney(1)						T	THR/ILE,THR/ILE	0,3650		0,0,1825	156.0	138.0	144.0		746,758	-7.2	0.0	11		144	1,8155		0,1,4077	no	missense,missense	TRIM22	NM_001199573.1,NM_006074.4	89,89	0,1,5902	CC,CT,TT		0.0123,0.0,0.0085	benign,benign	249/495,253/499	5727831	1,11805	1825	4078	5903	SO:0001583	missense	10346			X82200	CCDS41612.1	11p15	2013-01-09	2011-01-25		ENSG00000132274	ENSG00000132274		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16379	protein-coding gene	gene with protein product		606559	"""tripartite motif-containing 22"""			11331580, 11096452	Standard	NM_006074		Approved	STAF50, GPSTAF50, RNF94	uc001mbr.3	Q8IYM9	OTTHUMG00000066904	ENST00000379965.3:c.758T>C	11.37:g.5727831T>C	ENSP00000369299:p.Ile253Thr	Somatic		WXS	Illumina HiSeq	Phase_I	Q05CQ0|Q15521	Missense_Mutation	SNP	ENST00000379965.3	37	CCDS41612.1	.	.	.	.	.	.	.	.	.	.	T	7.243	0.601726	0.13939	0.0	1.23E-4	ENSG00000132274	ENST00000379965;ENST00000545338;ENST00000454828;ENST00000455293;ENST00000450670	T;T;T	0.30981	3.64;3.64;1.51	3.59	-7.19	0.01500	.	.	.	.	.	T	0.17959	0.0431	L	0.47716	1.5	0.09310	N	1	P;P;B;B	0.36874	0.572;0.454;0.217;0.212	B;B;B;B	0.31946	0.114;0.115;0.138;0.05	T	0.05115	-1.0905	9	0.29301	T	0.29	.	5.8935	0.18927	0.158:0.0:0.1981:0.6439	.	175;221;249;253	F8WAP8;C9JWC5;Q8IYM9-2;Q8IYM9	.;.;.;TRI22_HUMAN	T	253;64;221;175;3	ENSP00000369299:I253T;ENSP00000393250:I221T;ENSP00000406412:I3T	ENSP00000369299:I253T	I	+	2	0	TRIM22	5684407	0.000000	0.05858	0.000000	0.03702	0.516000	0.34256	-1.151000	0.03175	-1.675000	0.01459	0.383000	0.25322	ATT		0.353	TRIM22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143387.2		NM_006074	
TSPYL2	64061	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	53115408	53115408	+	Missense_Mutation	SNP	G	G	T	rs375418655		TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chrX:53115408G>T	ENST00000375442.4	+	6	1966	c.1834G>T	c.(1834-1836)Gac>Tac	p.D612Y		NM_022117.3	NP_071400.1	Q9H2G4	TSYL2_HUMAN	TSPY-like 2	612	Asp-rich.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cell cycle (GO:0007049)|cellular protein metabolic process (GO:0044267)|chromatin modification (GO:0016568)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell growth (GO:0030308)|negative regulation of DNA replication (GO:0008156)|nucleosome assembly (GO:0006334)|regulation of protein kinase activity (GO:0045859)|regulation of signal transduction (GO:0009966)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	rDNA binding (GO:0000182)	p.D612Y(1)		central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(8)|upper_aerodigestive_tract(1)	19						AGTTATTGAAGACTTTGACAA	0.468													G|||	2	0.000529801	0.0015	0.0	3775	,	,		17954	0.0		0.0	False		,,,				2504	0.0																1	Substitution - Missense(1)	kidney(1)											154.0	110.0	125.0					X																	53115408		2203	4300	6503	SO:0001583	missense	64061			AF273046	CCDS14350.1	Xp11	2014-06-09			ENSG00000184205	ENSG00000184205			24358	protein-coding gene	gene with protein product		300564				11318608, 11395479	Standard	NM_022117		Approved	SE20-4, HRIHFB2216, CTCL, DENTT, CDA1, CINAP, TSPX	uc004drw.3	Q9H2G4	OTTHUMG00000021597	ENST00000375442.4:c.1834G>T	X.37:g.53115408G>T	ENSP00000364591:p.Asp612Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	O94799|Q96DG7|Q9BZW6	Missense_Mutation	SNP	ENST00000375442.4	37	CCDS14350.1	.	.	.	.	.	.	.	.	.	.	G	13.87	2.365541	0.41902	.	.	ENSG00000184205	ENST00000375442	T	0.22945	1.93	2.76	1.87	0.25490	.	2.138670	0.03568	U	0.228135	T	0.19725	0.0474	N	0.19112	0.55	0.09310	N	1	P;P	0.43701	0.815;0.718	B;B	0.40534	0.332;0.178	T	0.24512	-1.0158	10	0.72032	D	0.01	-13.7803	6.8446	0.23980	0.0:0.2852:0.7148:0.0	.	252;612	Q59GC7;Q9H2G4	.;TSYL2_HUMAN	Y	612	ENSP00000364591:D612Y	ENSP00000364591:D612Y	D	+	1	0	TSPYL2	53132133	0.053000	0.20554	0.006000	0.13384	0.365000	0.29674	0.260000	0.18424	0.563000	0.29222	0.287000	0.19450	GAC		0.468	TSPYL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056718.1		NM_022117	
TSSC1	7260	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	3217939	3217940	+	Nonsense_Mutation	DNP	TC	TC	CA			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	T|C	T|C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr2:3217939_3217940TC>CA	ENST00000382125.4	-	5	688_689	c.496_497GA>TG	c.(496-498)GAa>TGa	p.E166*	TSSC1_ENST00000398659.4_Nonsense_Mutation_p.E193*|TSSC1_ENST00000443925.2_Nonsense_Mutation_p.E166*|TSSC1_ENST00000478754.1_5'UTR	NM_003310.2	NP_003301.1	Q53HC9	TSSC1_HUMAN	tumor suppressing subtransferable candidate 1	166								p.E166G(1)|p.E166*(1)		breast(2)|kidney(2)|large_intestine(3)|lung(9)|prostate(1)|skin(1)	18	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)	all_cancers(51;0.212)		OV - Ovarian serous cystadenocarcinoma(76;0.00877)|Epithelial(75;0.0283)|all cancers(51;0.0464)		GCTCGAGCTTTCCTGTAAATCC	0.446																																					Colon(140;1261 1762 4183 34270 49743)												2	Substitution - Missense(1)|Substitution - Nonsense(1)	kidney(2)																																								SO:0001587	stop_gained	7260			AF019952	CCDS1651.1	2p25.3	2013-01-10			ENSG00000032389	ENSG00000032389		"""WD repeat domain containing"""	12383	protein-coding gene	gene with protein product		608998				9403053, 9925925	Standard	NM_003310		Approved		uc002qxj.2	Q53HC9	OTTHUMG00000090329	ENST00000382125.4:c.496_497delinsCA	2.37:g.3217939_3217940delinsCA	ENSP00000371559:p.Glu166*	Somatic		WXS	Illumina HiSeq	Phase_I	D6W4Y1|O43179|Q53S19|Q53SG2	Missense_Mutation|Nonsense_Mutation	SNP	ENST00000382125.4	37	CCDS1651.1																																																																																				0.446	TSSC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206694.2		NM_003310	
LINC00837	100507605	broad.mit.edu	37	10	29080850	29080851	+	lincRNA	DEL	AA	AA	-	rs1775947|rs144810223	byFrequency	TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	AA	AA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr10:29080850_29080851delAA	ENST00000443246.2	-	0	1256_1257				RP11-478H13.3_ENST00000426922.2_lincRNA	NR_038374.1|NR_038375.1|NR_038376.1				long intergenic non-protein coding RNA 837																		ACACACACACAAAAAAGACAAG	0.54																																																	0																																												0					10p12.1	2012-12-19			ENSG00000235824	ENSG00000235824		"""Long non-coding RNAs"""	27436	non-coding RNA	RNA, long non-coding							Standard	NR_038374		Approved		uc021poo.1		OTTHUMG00000017876		10.37:g.29080854_29080855delAA		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	DEL	ENST00000443246.2	37																																																																																					0.540	LINC00837-001	KNOWN	basic|exp_conf	lincRNA	lincRNA	OTTHUMT00000047376.2		NR_038374	
Unknown	0	broad.mit.edu	37	12	92018	92018	+	IGR	SNP	T	T	C	rs376561453		TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr12:92018T>C								AC215219.1 (18696 upstream) : AC026369.1 (55033 downstream)																							GACTCCACACTCTCCTGGGTT	0.592																																																	0																																										SO:0001628	intergenic_variant	0																															12.37:g.92018T>C		Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP		37																																																																																				0	0.592									
UBBP4	23666	broad.mit.edu	37	17	21731234	21731234	+	Missense_Mutation	SNP	A	A	C			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr17:21731234A>C	ENST00000584755.1	+	2	933	c.536A>C	c.(535-537)aAg>aCg	p.K179T	UBBP4_ENST00000578713.1_Intron|UBBP4_ENST00000583708.1_3'UTR					ubiquitin B pseudogene 4									p.K179T(1)		endometrium(9)|kidney(4)|lung(4)|prostate(3)|urinary_tract(4)	24						GAAAATGTGAAGGCCAAGATC	0.532																																																	1	Substitution - Missense(1)	kidney(1)																																								SO:0001583	missense	0			X07499		17p11.2	2011-08-10				ENSG00000263563			12467	pseudogene	pseudogene						2834222	Standard	NG_002285		Approved		uc002gyy.3			ENST00000584755.1:c.536A>C	17.37:g.21731234A>C	ENSP00000463647:p.Lys179Thr	Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000584755.1	37																																																																																					0.532	UBBP4-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000444585.1			
AC015849.16	0	broad.mit.edu	37	17	34234138	34234138	+	lincRNA	SNP	G	G	A			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr17:34234138G>A	ENST00000587132.1	-	0	3889																											GTCAGTGTCCGTGGTAGGCTC	0.517																																																	0																																												0																															17.37:g.34234138G>A		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP	ENST00000587132.1	37																																																																																					0.517	AC015849.16-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000449325.1			
Unknown	0	broad.mit.edu	37	5	170733147	170733147	+	IGR	DEL	A	A	-			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr5:170733147delA								RANBP17 (6128 upstream) : TLX3 (3140 downstream)																							ccaacaaaataacaaaccttt	0.378																																																	0																																										SO:0001628	intergenic_variant	0																															5.37:g.170733147delA		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	DEL		37																																																																																				0	0.378									
TRY2P	207147	broad.mit.edu	37	7	141969146	141969147	+	RNA	DEL	TT	TT	-	rs369343750|rs10538162	byFrequency	TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	TT	TT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr7:141969146_141969147delTT	ENST00000334288.5	-	0	994_995					NR_036483.1																						TCATACTGTCTTTGTGCACGAG	0.431														1014	0.202476	0.1967	0.2277	5008	,	,		20453	0.0089		0.3469	False		,,,				2504	0.2434																0																																												0																															7.37:g.141969146_141969147delTT		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	DEL	ENST00000334288.5	37																																																																																					0.431	U66059.29-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000351332.2			
USP25	29761	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	21	17205757	17205757	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr21:17205757G>A	ENST00000285679.6	+	17	2453	c.2084G>A	c.(2083-2085)cGa>cAa	p.R695Q	USP25_ENST00000285681.2_Missense_Mutation_p.R695Q|USP25_ENST00000351097.5_Intron|USP25_ENST00000400183.2_Missense_Mutation_p.R695Q	NM_013396.3	NP_037528.3	Q9UHP3	UBP25_HUMAN	ubiquitin specific peptidase 25	695					cellular protein modification process (GO:0006464)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|proteolysis (GO:0006508)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	peptidase activity (GO:0008233)|SUMO binding (GO:0032183)|ubiquitin-specific protease activity (GO:0004843)	p.R695Q(1)		breast(4)|endometrium(6)|kidney(2)|large_intestine(13)|liver(5)|lung(14)|ovary(4)|prostate(1)|skin(1)|urinary_tract(2)	52				Epithelial(23;7.55e-05)|all cancers(11;0.000429)|COAD - Colon adenocarcinoma(22;0.00543)|OV - Ovarian serous cystadenocarcinoma(11;0.00743)|Colorectal(24;0.0116)|Lung(58;0.0853)|LUSC - Lung squamous cell carcinoma(23;0.0889)		GACAACCAACGATTTGAAAAA	0.408																																																	1	Substitution - Missense(1)	kidney(1)											71.0	75.0	74.0					21																	17205757		2203	4300	6503	SO:0001583	missense	29761			AF170562	CCDS33515.1, CCDS63336.1, CCDS63337.1	21q11.2	2011-02-24	2005-08-08		ENSG00000155313	ENSG00000155313		"""Ubiquitin-specific peptidases"""	12624	protein-coding gene	gene with protein product		604736	"""ubiquitin specific protease 25"""			12838346, 10612803	Standard	NM_013396		Approved	USP21	uc002yjy.1	Q9UHP3	OTTHUMG00000074343	ENST00000285679.6:c.2084G>A	21.37:g.17205757G>A	ENSP00000285679:p.Arg695Gln	Somatic		WXS	Illumina HiSeq	Phase_I	C0LSZ0|Q6DHZ9|Q9H9W1	Missense_Mutation	SNP	ENST00000285679.6	37	CCDS33515.1	.	.	.	.	.	.	.	.	.	.	G	15.28	2.788101	0.49997	.	.	ENSG00000155313	ENST00000285681;ENST00000285679;ENST00000400183	T;T;T	0.23754	1.89;1.89;1.9	5.24	4.34	0.51931	.	0.196762	0.44688	D	0.000435	T	0.13457	0.0326	N	0.17631	0.505	0.24410	N	0.994662	B;B;B	0.30455	0.28;0.105;0.003	B;B;B	0.18561	0.022;0.022;0.001	T	0.13683	-1.0500	10	0.24483	T	0.36	.	9.9311	0.41523	0.1527:0.0:0.8473:0.0	.	695;695;695	Q9UHP3-3;Q9UHP3-1;Q9UHP3	.;.;UBP25_HUMAN	Q	695	ENSP00000285681:R695Q;ENSP00000285679:R695Q;ENSP00000383044:R695Q	ENSP00000285679:R695Q	R	+	2	0	USP25	16127628	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	1.814000	0.38972	2.615000	0.88500	0.591000	0.81541	CGA		0.408	USP25-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157964.1			
VHL	7428	hgsc.bcm.edu	37	3	10183797	10183797	+	Missense_Mutation	SNP	T	T	C	rs5030807		TCGA-CJ-5679-01A-11W-1584-10	TCGA-CJ-5679-11A-01W-1585-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de904324-2c23-4a2c-b5bf-56e2e6f616ef	20ed414c-6f1f-4d6a-a731-e28d3d45efc3	g.chr3:10183797T>C	ENST00000256474.2	+	1	1106	c.266T>C	c.(265-267)cTc>cCc	p.L89P	VHL_ENST00000345392.2_Missense_Mutation_p.L89P|snoU13_ENST00000458986.1_RNA	NM_000551.3	NP_000542.1	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase	89			L -> H (in lung cancer).|L -> P (in VHLD; type I; dbSNP:rs5030807). {ECO:0000269|PubMed:8956040}.		cell morphogenesis (GO:0000902)|cellular response to hypoxia (GO:0071456)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|transcription factor binding (GO:0008134)|ubiquitin protein ligase activity (GO:0061630)|ubiquitin-protein transferase activity (GO:0004842)	p.L89H(11)|p.L89P(6)|p.L89R(3)|p.R60fs*35(1)|p.V84_E94>E(1)|p.V84fs*69(1)|p.L89fs*67(1)		adrenal_gland(25)|autonomic_ganglia(3)|central_nervous_system(2)|endometrium(6)|kidney(1662)|large_intestine(14)|lung(6)|pancreas(18)|paratesticular_tissues(1)|pleura(1)|skin(1)|soft_tissue(24)|thyroid(3)|upper_aerodigestive_tract(3)	1769				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		CCCGTATGGCTCAACTTCGAC	0.726	L89H(NCIH28_PLEURA)	1	"""D, Mis, N, F, S"""		"""renal, hemangioma, pheochromocytoma"""	"""renal, hemangioma, pheochromocytoma"""			von Hippel-Lindau disease;Pheochromocytoma (Adrenal), Familial;Chuvash Polycythemia																													.	yes	Rec	yes	von Hippel-Lindau syndrome	3	3p25	7428	von Hippel-Lindau syndrome gene		"""E, M, O"""	24	Substitution - Missense(20)|Deletion - Frameshift(3)|Complex - deletion inframe(1)	kidney(22)|pancreas(1)|pleura(1)	GRCh37	CM941368	VHL	M	rs5030807						13.0	16.0	15.0					3																	10183797		2106	4156	6262	SO:0001583	missense	7428	Familial Cancer Database	VHL; ;Erythrocytosis, Familial type 2	L15409	CCDS2597.1, CCDS2598.1	3p25.3	2014-09-17	2012-02-23		ENSG00000134086	ENSG00000134086			12687	protein-coding gene	gene with protein product		608537	"""von Hippel-Lindau syndrome"", ""von Hippel-Lindau tumor suppressor"""			9671762	Standard	NM_000551		Approved	VHL1	uc003bvc.3	P40337	OTTHUMG00000128668	ENST00000256474.2:c.266T>C	3.37:g.10183797T>C	ENSP00000256474:p.Leu89Pro	Somatic		WXS	Illumina MiSeq	Phase_I	B2RE45|Q13599|Q6PDA9	Missense_Mutation	SNP	ENST00000256474.2	37	CCDS2597.1	.	.	.	.	.	.	.	.	.	.	T	26.9	4.777209	0.90195	.	.	ENSG00000134086	ENST00000256474;ENST00000345392	D;D	0.99815	-6.9;-6.9	5.06	5.06	0.68205	von Hippel-Lindau disease tumor suppressor,  beta domain (1);von Hippel-Lindau disease tumour suppressor, beta/alpha domain (2);	0.185584	0.46442	D	0.000292	D	0.99563	0.9843	L	0.41492	1.28	0.54753	D	0.999989	D;D	0.76494	0.998;0.999	D;D	0.71656	0.962;0.974	D	0.97591	1.0117	10	0.72032	D	0.01	-8.4916	12.8448	0.57823	0.0:0.0:0.0:1.0	rs5030807	89;89	P40337-2;P40337	.;VHL_HUMAN	P	89	ENSP00000256474:L89P;ENSP00000344757:L89P	ENSP00000256474:L89P	L	+	2	0	VHL	10158797	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	4.914000	0.63348	1.920000	0.55613	0.450000	0.29827	CTC		0.726	VHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250559.1		NM_000551	
WDR11	55717	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	122624668	122624668	+	Missense_Mutation	SNP	G	G	C	rs145467317		TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr10:122624668G>C	ENST00000263461.6	+	6	1069	c.823G>C	c.(823-825)Gtg>Ctg	p.V275L		NM_018117.11	NP_060587.8	Q8WWQ0	PHIP_HUMAN	WD repeat domain 11	0					cytoskeleton organization (GO:0007010)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell morphogenesis (GO:0022604)|regulation of growth (GO:0040008)|regulation of protein phosphorylation (GO:0001932)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin receptor binding (GO:0005158)|lysine-acetylated histone binding (GO:0070577)	p.V275L(1)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(9)|prostate(2)|skin(2)|stomach(5)	38						TGACCTTGAGGTGAATCAGAC	0.378																																																	1	Substitution - Missense(1)	kidney(1)											141.0	136.0	138.0					10																	122624668		2203	4300	6503	SO:0001583	missense	55717			AF320223	CCDS7619.1	10q26	2013-01-21	2010-01-06	2010-01-06	ENSG00000120008	ENSG00000120008		"""WD repeat domain containing"""	13831	protein-coding gene	gene with protein product		606417	"""bromodomain and WD repeat domain containing 2"""	BRWD2		10718198, 11536051	Standard	NM_018117		Approved	KIAA1351, FLJ10506, WDR15, HH14, DR11	uc021pzt.1	Q9BZH6	OTTHUMG00000019171	ENST00000263461.6:c.823G>C	10.37:g.122624668G>C	ENSP00000263461:p.Val275Leu	Somatic		WXS	Illumina HiSeq	Phase_I	A7J992|B2RPK4|Q05CQ9|Q5VVH4|Q66I29|Q69YV1|Q8NBZ5|Q96H52|Q96ME2|Q9H261	Missense_Mutation	SNP	ENST00000263461.6	37	CCDS7619.1	.	.	.	.	.	.	.	.	.	.	G	16.33	3.093433	0.56075	.	.	ENSG00000120008	ENST00000263461	D	0.89552	-2.53	5.96	5.96	0.96718	WD40 repeat-like-containing domain (1);	0.052030	0.85682	D	0.000000	T	0.81427	0.4820	N	0.12182	0.205	0.53688	D	0.999976	B	0.14012	0.009	B	0.14578	0.011	T	0.74003	-0.3804	10	0.21540	T	0.41	-21.974	20.422	0.99049	0.0:0.0:1.0:0.0	.	275	Q9BZH6	WDR11_HUMAN	L	275	ENSP00000263461:V275L	ENSP00000263461:V275L	V	+	1	0	WDR11	122614658	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.912000	0.75753	2.832000	0.97577	0.655000	0.94253	GTG		0.378	WDR11-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050707.2			
DAW1	164781	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	228754578	228754578	+	Missense_Mutation	SNP	T	T	A			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr2:228754578T>A	ENST00000309931.2	+	3	203	c.120T>A	c.(118-120)gaT>gaA	p.D40E	DAW1_ENST00000545118.1_Missense_Mutation_p.D25E|DAW1_ENST00000373666.2_Missense_Mutation_p.D40E|SNORA25_ENST00000607153.1_RNA|DAW1_ENST00000472604.1_3'UTR	NM_178821.1	NP_849143.1	Q8N136	DAW1_HUMAN	dynein assembly factor with WDR repeat domains 1	40						cilium (GO:0005929)		p.D40E(1)									TCAGCACTGATGTCAGTGCGT	0.358																																																	1	Substitution - Missense(1)	kidney(1)											72.0	70.0	71.0					2																	228754578		2203	4300	6503	SO:0001583	missense	164781				CCDS2470.1	2q36.3	2013-09-03	2013-02-19	2013-02-19	ENSG00000123977	ENSG00000123977		"""WD repeat domain containing"""	26383	protein-coding gene	gene with protein product	"""outer row dynein assembly 16 homolog (Chlamydomonas)"""		"""WD repeat domain 69"""	WDR69		20568242, 21953912	Standard	NM_178821		Approved	FLJ25955, ODA16	uc002vpn.1	Q8N136	OTTHUMG00000133190	ENST00000309931.2:c.120T>A	2.37:g.228754578T>A	ENSP00000311899:p.Asp40Glu	Somatic		WXS	Illumina HiSeq	Phase_I	Q6ZRY1|Q8N776	Missense_Mutation	SNP	ENST00000309931.2	37	CCDS2470.1	.	.	.	.	.	.	.	.	.	.	T	15.23	2.773009	0.49680	.	.	ENSG00000123977	ENST00000373666;ENST00000309931;ENST00000440997;ENST00000545118	T;T;T;T	0.56444	0.66;0.64;0.46;0.63	5.45	-1.18	0.09617	.	0.684911	0.14135	N	0.339127	T	0.50000	0.1590	M	0.85630	2.765	0.44508	D	0.997459	B	0.15473	0.013	B	0.18561	0.022	T	0.36578	-0.9742	10	0.40728	T	0.16	.	5.1271	0.14890	0.1226:0.2834:0.0:0.5941	.	40	Q8N136	WDR69_HUMAN	E	40;40;25;25	ENSP00000362770:D40E;ENSP00000311899:D40E;ENSP00000394853:D25E;ENSP00000437887:D25E	ENSP00000311899:D40E	D	+	3	2	WDR69	228462822	1.000000	0.71417	0.526000	0.27913	0.760000	0.43138	0.863000	0.27913	-0.356000	0.08187	0.528000	0.53228	GAT		0.358	DAW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331745.1		NM_178821	
WDR78	79819	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	67301400	67301400	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr1:67301400C>T	ENST00000371026.3	-	11	1697	c.1642G>A	c.(1642-1644)Gca>Aca	p.A548T	WDR78_ENST00000431318.1_Missense_Mutation_p.A294T	NM_024763.4	NP_079039.4	Q5VTH9	WDR78_HUMAN	WD repeat domain 78	548					hematopoietic progenitor cell differentiation (GO:0002244)			p.A548T(1)		NS(1)|endometrium(3)|kidney(6)|large_intestine(6)|lung(10)|ovary(3)|skin(3)	32						AGGTTAGGTGCTCCAATTGAA	0.358																																																	1	Substitution - Missense(1)	kidney(1)											101.0	102.0	102.0					1																	67301400		2203	4300	6503	SO:0001583	missense	79819			BX648840	CCDS635.1, CCDS44157.1	1p31.2	2014-02-21	2013-02-19	2013-02-19	ENSG00000152763	ENSG00000152763		"""WD repeat domain containing"""	26252	protein-coding gene	gene with protein product						21953912	Standard	NM_207014		Approved	DIC4, FLJ23129	uc001dcx.3	Q5VTH9	OTTHUMG00000009165	ENST00000371026.3:c.1642G>A	1.37:g.67301400C>T	ENSP00000360065:p.Ala548Thr	Somatic		WXS	Illumina HiSeq	Phase_I	A8K9W5|B5MDT3|H7BY80|Q5VTI0|Q8N5G5|Q9H5R9|Q9UF44	Missense_Mutation	SNP	ENST00000371026.3	37	CCDS635.1	.	.	.	.	.	.	.	.	.	.	C	1.132	-0.652169	0.03480	.	.	ENSG00000152763	ENST00000371026;ENST00000431318;ENST00000464352	T;T;T	0.64991	1.64;-0.13;-0.13	5.47	-10.9	0.00192	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	1.296490	0.04974	N	0.464493	T	0.07548	0.0190	N	0.01505	-0.83	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.08659	-1.0711	10	0.17832	T	0.49	-0.1882	6.891	0.24230	0.5644:0.0664:0.0621:0.3072	.	294;548	Q5VTH9-3;Q5VTH9	.;WDR78_HUMAN	T	548;294;314	ENSP00000360065:A548T;ENSP00000393182:A294T;ENSP00000433682:A314T	ENSP00000360065:A548T	A	-	1	0	WDR78	67073988	0.000000	0.05858	0.000000	0.03702	0.956000	0.61745	-0.879000	0.04188	-3.772000	0.00109	-1.301000	0.01330	GCA		0.358	WDR78-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025404.1		NM_024763	
XIRP2	129446	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	168103812	168103812	+	Missense_Mutation	SNP	G	G	C			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr2:168103812G>C	ENST00000409195.1	+	9	5999	c.5910G>C	c.(5908-5910)caG>caC	p.Q1970H	XIRP2_ENST00000295237.9_Missense_Mutation_p.Q1970H|XIRP2_ENST00000409273.1_Missense_Mutation_p.Q1748H|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000409605.1_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	1795					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)		p.Q1970H(1)		NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						TTGCTGTCCAGAGGAACAAAA	0.453																																																	1	Substitution - Missense(1)	kidney(1)											42.0	41.0	41.0					2																	168103812		1911	4123	6034	SO:0001583	missense	129446			AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.5910G>C	2.37:g.168103812G>C	ENSP00000386840:p.Gln1970His	Somatic		WXS	Illumina HiSeq	Phase_I	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	ENST00000409195.1	37	CCDS42769.1	.	.	.	.	.	.	.	.	.	.	G	0.963	-0.702711	0.03255	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273	T;T;T	0.03212	4.01;4.01;4.01	5.73	0.307	0.15811	.	0.340768	0.30771	N	0.008920	T	0.05044	0.0135	M	0.67953	2.075	0.19300	N	0.99997	B;B;B	0.20671	0.013;0.023;0.047	B;B;B	0.18561	0.003;0.007;0.022	T	0.27905	-1.0060	10	0.56958	D	0.05	-2.0748	8.3951	0.32553	0.2355:0.1955:0.569:0.0	.	1795;1795;1748	A4UGR9;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.	H	1970;1970;1748	ENSP00000386840:Q1970H;ENSP00000295237:Q1970H;ENSP00000387255:Q1748H	ENSP00000295237:Q1970H	Q	+	3	2	XIRP2	167812058	0.981000	0.34729	0.036000	0.18154	0.037000	0.13140	0.147000	0.16202	0.340000	0.23745	0.650000	0.86243	CAG		0.453	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1		NM_152381	
XPNPEP2	7512	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	128886138	128886138	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chrX:128886138C>A	ENST00000371106.3	+	10	1026	c.834C>A	c.(832-834)aaC>aaA	p.N278K		NM_003399.5	NP_003390.4	O43895	XPP2_HUMAN	X-prolyl aminopeptidase (aminopeptidase P) 2, membrane-bound	278						anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)	p.N278K(1)		endometrium(3)|kidney(3)|large_intestine(5)|liver(1)|lung(20)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	37						TGTTTGCAAACAAGAGTCGCT	0.527																																																	1	Substitution - Missense(1)	kidney(1)											98.0	90.0	92.0					X																	128886138		2203	4299	6502	SO:0001583	missense	7512			U90724	CCDS14613.1	Xq25	2008-02-05			ENSG00000122121	ENSG00000122121	3.4.11.9		12823	protein-coding gene	gene with protein product		300145				9375790, 9628831	Standard	NM_003399		Approved		uc004eut.1	O43895	OTTHUMG00000022373	ENST00000371106.3:c.834C>A	X.37:g.128886138C>A	ENSP00000360147:p.Asn278Lys	Somatic		WXS	Illumina HiSeq	Phase_I	A0AV16|O75994	Missense_Mutation	SNP	ENST00000371106.3	37	CCDS14613.1	.	.	.	.	.	.	.	.	.	.	C	15.88	2.964858	0.53507	.	.	ENSG00000122121	ENST00000371106	T	0.73897	-0.79	5.78	3.78	0.43462	.	0.086790	0.85682	D	0.000000	T	0.77370	0.4120	M	0.79805	2.47	0.41776	D	0.989797	D	0.54964	0.969	P	0.51229	0.663	T	0.78257	-0.2274	10	0.72032	D	0.01	-14.3392	4.4638	0.11678	0.0:0.5345:0.0:0.4655	.	278	O43895	XPP2_HUMAN	K	278	ENSP00000360147:N278K	ENSP00000360147:N278K	N	+	3	2	XPNPEP2	128713819	0.534000	0.26362	0.995000	0.50966	0.461000	0.32589	0.299000	0.19138	1.211000	0.43351	0.529000	0.55759	AAC		0.527	XPNPEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058210.1		NM_003399	
ZNF226	7769	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	44680985	44680985	+	Missense_Mutation	SNP	G	G	C			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr19:44680985G>C	ENST00000590089.1	+	7	1937	c.1570G>C	c.(1570-1572)Gtc>Ctc	p.V524L	ZNF226_ENST00000337433.5_Missense_Mutation_p.V524L|ZNF226_ENST00000588883.1_3'UTR|ZNF226_ENST00000454662.2_Missense_Mutation_p.V524L			Q9NYT6	ZN226_HUMAN	zinc finger protein 226	524					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.V524L(1)					Prostate(69;0.0352)|all_neural(266;0.202)				TCATCTAGTGGTCCACACAGG	0.448																																					Pancreas(115;581 1665 13228 19278 50070)												1	Substitution - Missense(1)	kidney(1)											68.0	73.0	71.0					19																	44680985		2194	4298	6492	SO:0001583	missense	7769			AF024707	CCDS46102.1, CCDS46103.1	19q13.31	2013-01-08	2012-09-11	2012-09-11	ENSG00000167380	ENSG00000167380		"""Zinc fingers, C2H2-type"", ""-"""	13019	protein-coding gene	gene with protein product							Standard	NM_001146220		Approved		uc002oyp.3	Q9NYT6		ENST00000590089.1:c.1570G>C	19.37:g.44680985G>C	ENSP00000465121:p.Val524Leu	Somatic		WXS	Illumina HiSeq	Phase_I	Q8WWE6|Q96TE6|Q9NS44	Missense_Mutation	SNP	ENST00000590089.1	37	CCDS46102.1	.	.	.	.	.	.	.	.	.	.	G	14.55	2.569452	0.45798	.	.	ENSG00000167380	ENST00000337433;ENST00000454662	T;T	0.00986	5.47;5.47	3.92	1.75	0.24633	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.636474	0.12006	N	0.508350	T	0.01730	0.0055	N	0.25286	0.73	0.09310	N	1	D	0.71674	0.998	D	0.83275	0.996	T	0.54721	-0.8251	10	0.48119	T	0.1	.	2.2299	0.03994	0.2619:0.0:0.4774:0.2607	.	524	Q9NYT6	ZN226_HUMAN	L	524	ENSP00000336719:V524L;ENSP00000393265:V524L	ENSP00000336719:V524L	V	+	1	0	ZNF226	49372825	0.001000	0.12720	0.665000	0.29768	0.997000	0.91878	0.532000	0.23067	0.978000	0.38470	0.655000	0.94253	GTC		0.448	ZNF226-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460712.1			
ZNF610	162963	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	52869427	52869427	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr19:52869427G>A	ENST00000403906.3	+	6	1252	c.796G>A	c.(796-798)Gac>Aac	p.D266N	ZNF610_ENST00000327920.8_Missense_Mutation_p.D266N|ZNF610_ENST00000601151.1_Missense_Mutation_p.D223N|ZNF610_ENST00000321287.8_Missense_Mutation_p.D266N	NM_001161425.1	NP_001154897.1	Q8N9Z0	ZN610_HUMAN	zinc finger protein 610	266					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.D266N(1)		NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(8)|liver(2)|lung(9)|ovary(2)|stomach(2)|upper_aerodigestive_tract(2)	34				OV - Ovarian serous cystadenocarcinoma(262;0.00396)|GBM - Glioblastoma multiforme(134;0.00434)		TAGTGAATGTGACAAGGTGTT	0.398																																																	1	Substitution - Missense(1)	kidney(1)											55.0	53.0	54.0					19																	52869427		2203	4300	6503	SO:0001583	missense	162963			AK093359	CCDS12851.1, CCDS54309.1	19q13.41	2013-01-08			ENSG00000167554	ENSG00000167554		"""Zinc fingers, C2H2-type"", ""-"""	26687	protein-coding gene	gene with protein product						12477932	Standard	NM_001161425		Approved	FLJ36040	uc002pyx.4	Q8N9Z0		ENST00000403906.3:c.796G>A	19.37:g.52869427G>A	ENSP00000383922:p.Asp266Asn	Somatic		WXS	Illumina HiSeq	Phase_I	A8K4C3|Q86YH8|Q8NDS9	Missense_Mutation	SNP	ENST00000403906.3	37	CCDS12851.1	.	.	.	.	.	.	.	.	.	.	G	17.33	3.362626	0.61403	.	.	ENSG00000167554	ENST00000403906;ENST00000321287;ENST00000327920	T;T	0.07327	3.2;3.2	1.82	1.82	0.25136	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.06050	0.0157	N	0.11698	0.16	0.24222	N	0.995438	P;P	0.42123	0.73;0.771	B;B	0.42282	0.263;0.382	T	0.35624	-0.9781	9	0.72032	D	0.01	.	9.1995	0.37249	0.0:0.0:1.0:0.0	.	223;266	Q8N9Z0-2;Q8N9Z0	.;ZN610_HUMAN	N	266;223;266	ENSP00000383922:D266N;ENSP00000327597:D266N	ENSP00000324441:D223N	D	+	1	0	ZNF610	57561239	0.176000	0.23096	0.045000	0.18777	0.074000	0.17049	0.401000	0.20948	0.983000	0.38602	0.467000	0.42956	GAC		0.398	ZNF610-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462880.1		NM_173530	
ZP2	7783	hgsc.bcm.edu	37	16	21208874	21208875	+	Frame_Shift_Ins	INS	-	-	C			TCGA-CJ-5679-01A-11D-1534-10	TCGA-CJ-5679-11A-01D-1535-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	84120a7c-4be0-4025-a95a-f78bfb58d28f	4c1ae2ec-1dbf-4c5a-88f2-9995df35736e	g.chr16:21208874_21208875insC	ENST00000574002.1	-	20	2646_2647	c.2164_2165insG	c.(2164-2166)gccfs	p.A722fs	ZP2_ENST00000219593.4_Frame_Shift_Ins_p.A722fs|ZP2_ENST00000574091.1_Frame_Shift_Ins_p.A713fs|AF001550.7_ENST00000572747.1_RNA			Q05996	ZP2_HUMAN	zona pellucida glycoprotein 2 (sperm receptor)	722					binding of sperm to zona pellucida (GO:0007339)|intracellular protein transport (GO:0006886)|multicellular organism reproduction (GO:0032504)|prevention of polyspermy (GO:0060468)|signal transduction (GO:0007165)|single fertilization (GO:0007338)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)|secretory granule (GO:0030141)	acrosin binding (GO:0032190)|coreceptor activity (GO:0015026)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(16)|ovary(1)|prostate(1)|stomach(1)	41				GBM - Glioblastoma multiforme(48;0.0573)		ACCTGCAAAGGCAGCCACAGCA	0.46																																																	0																																										SO:0001589	frameshift_variant	7783			M90366	CCDS10596.1, CCDS73843.1	16p12	2014-07-04			ENSG00000103310	ENSG00000103310		"""Zona pellucida glycoproteins"""	13188	protein-coding gene	gene with protein product		182888				8385033	Standard	XM_005255562		Approved	ZPA	uc002dii.2	Q05996	OTTHUMG00000090681	ENST00000574002.1:c.2165dupG	16.37:g.21208875_21208875dupC	ENSP00000460971:p.Ala722fs	Somatic		WXS	Illumina HiSeq	Phase_I	B2R7J2|Q4VAN9|Q4VAP0|Q4VAP1	Frame_Shift_Ins	INS	ENST00000574002.1	37	CCDS10596.1																																																																																				0.460	ZP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207365.2			
