#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ABCG8	64241	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	44073354	44073354	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr2:44073354A>G	ENST00000272286.2	+	3	316	c.226A>G	c.(226-228)Aca>Gca	p.T76A		NM_022437.2	NP_071882.1	Q9H221	ABCG8_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 8	76	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|excretion (GO:0007588)|intestinal cholesterol absorption (GO:0030299)|negative regulation of intestinal cholesterol absorption (GO:0045796)|negative regulation of intestinal phytosterol absorption (GO:0010949)|phospholipid transport (GO:0015914)|response to drug (GO:0042493)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|protein heterodimerization activity (GO:0046982)|sterol transporter activity (GO:0015248)	p.T76A(1)		NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(21)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	45		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)			Ezetimibe(DB00973)	GATGCCCTGGACATCTCCCAG	0.537																																																	1	Substitution - Missense(1)	kidney(1)											65.0	64.0	64.0					2																	44073354		2203	4300	6503	SO:0001583	missense	64241			AF320294	CCDS1815.1	2p21	2012-03-14	2008-07-31		ENSG00000143921	ENSG00000143921		"""ATP binding cassette transporters / subfamily G"""	13887	protein-coding gene	gene with protein product	"""gallbladder disease 4"", ""sterolin 2"""	605460	"""ATP-binding cassette, sub-family G (WHITE), member 8 (sterolin 2)"""			11099417, 17626266	Standard	NM_022437		Approved	GBD4	uc002rtq.3	Q9H221	OTTHUMG00000128756	ENST00000272286.2:c.226A>G	2.37:g.44073354A>G	ENSP00000272286:p.Thr76Ala	Somatic		WXS	Illumina HiSeq	Phase_I	Q53QN8	Missense_Mutation	SNP	ENST00000272286.2	37	CCDS1815.1	.	.	.	.	.	.	.	.	.	.	A	0.451	-0.893887	0.02491	.	.	ENSG00000143921	ENST00000272286	D	0.87650	-2.28	5.69	-3.18	0.05186	ABC transporter-like (1);	1.501700	0.03375	N	0.199515	T	0.66742	0.2820	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.60332	-0.7284	10	0.07644	T	0.81	.	0.4146	0.00447	0.3224:0.2144:0.2522:0.211	.	76;76	Q9H221-2;Q9H221	.;ABCG8_HUMAN	A	76	ENSP00000272286:T76A	ENSP00000272286:T76A	T	+	1	0	ABCG8	43926858	0.009000	0.17119	0.022000	0.16811	0.155000	0.21991	0.127000	0.15790	-0.429000	0.07329	0.528000	0.53228	ACA		0.537	ABCG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250671.1		NM_022437	
ACSBG2	81616	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	6182803	6182803	+	Silent	SNP	C	C	T			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr19:6182803C>T	ENST00000586696.1	+	9	1224	c.948C>T	c.(946-948)gtC>gtT	p.V316V	ACSBG2_ENST00000252669.5_Silent_p.V316V|ACSBG2_ENST00000588304.1_Silent_p.V266V|ACSBG2_ENST00000591403.1_Silent_p.V316V|ACSBG2_ENST00000588485.1_Silent_p.V129V|ACSBG2_ENST00000591741.1_3'UTR			Q5FVE4	ACBG2_HUMAN	acyl-CoA synthetase bubblegum family member 2	316					cell differentiation (GO:0030154)|fatty acid metabolic process (GO:0006631)|long-chain fatty acid metabolic process (GO:0001676)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)	acyl-CoA hydrolase activity (GO:0047617)|ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)	p.V316V(1)		breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(12)|lung(3)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						AACCTACTGTCTTCATTGGAG	0.483																																																	1	Substitution - coding silent(1)	kidney(1)											79.0	70.0	73.0					19																	6182803		2203	4300	6503	SO:0001819	synonymous_variant	81616				CCDS12159.1, CCDS74269.1	19p13.3	2012-10-02			ENSG00000130377	ENSG00000130377		"""Acyl-CoA synthetase family"""	24174	protein-coding gene	gene with protein product	"""bubblegum related protein"""	614363				11230166	Standard	XM_005259653		Approved	BGR, PRTD-NY3, DKFZp434K1635	uc002meh.1	Q5FVE4	OTTHUMG00000180754	ENST00000586696.1:c.948C>T	19.37:g.6182803C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B3KSF2|Q6UWJ3|Q7Z5A0|Q8WW03|Q96M36|Q9BYZ3|Q9H0C4	Silent	SNP	ENST00000586696.1	37	CCDS12159.1																																																																																				0.483	ACSBG2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452898.1		NM_030924	
ACTL9	284382	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	8807932	8807932	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr19:8807932G>A	ENST00000324436.3	-	1	1240	c.1120C>T	c.(1120-1122)Ccc>Tcc	p.P374S		NM_178525.3	NP_848620.3	Q8TC94	ACTL9_HUMAN	actin-like 9	374						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.P374S(1)		NS(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(15)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(1)	36						TTCCTGGTGGGCTGGGCAGCC	0.682																																																	1	Substitution - Missense(1)	kidney(1)											27.0	31.0	29.0					19																	8807932		2203	4300	6503	SO:0001583	missense	284382				CCDS12207.1	19p13.2	2014-08-08			ENSG00000181786	ENSG00000181786			28494	protein-coding gene	gene with protein product							Standard	NM_178525		Approved	MGC33407	uc002mkl.2	Q8TC94	OTTHUMG00000182194	ENST00000324436.3:c.1120C>T	19.37:g.8807932G>A	ENSP00000316674:p.Pro374Ser	Somatic		WXS	Illumina HiSeq	Phase_I	A8K893|Q6X960	Missense_Mutation	SNP	ENST00000324436.3	37	CCDS12207.1	.	.	.	.	.	.	.	.	.	.	g	16.02	3.004445	0.54254	.	.	ENSG00000181786	ENST00000324436	T	0.08807	3.05	4.51	2.24	0.28232	.	0.557431	0.14814	U	0.296900	T	0.14056	0.0340	M	0.66378	2.025	0.34900	D	0.746414	B	0.34181	0.44	B	0.40782	0.34	T	0.13150	-1.0520	10	0.87932	D	0	.	9.9001	0.41342	0.0:0.1518:0.6908:0.1574	.	374	Q8TC94	ACTL9_HUMAN	S	374	ENSP00000316674:P374S	ENSP00000316674:P374S	P	-	1	0	ACTL9	8668932	1.000000	0.71417	0.205000	0.23548	0.577000	0.36160	3.929000	0.56514	0.569000	0.29329	0.457000	0.33378	CCC		0.682	ACTL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459953.1		NM_178525	
AIFM1	9131	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	129289191	129289191	+	Intron	SNP	G	G	A			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chrX:129289191G>A	ENST00000287295.3	-	2	480				AIFM1_ENST00000535724.1_Intron|AIFM1_ENST00000346424.2_Intron|AIFM1_ENST00000319908.3_Silent_p.G59G	NM_001130847.3|NM_004208.3	NP_001124319.1|NP_004199.1	O95831	AIFM1_HUMAN	apoptosis-inducing factor, mitochondrion-associated, 1						activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|cell redox homeostasis (GO:0045454)|chromosome condensation (GO:0030261)|DNA catabolic process (GO:0006308)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|mitochondrial respiratory chain complex I assembly (GO:0032981)|neuron apoptotic process (GO:0051402)|neuron differentiation (GO:0030182)|positive regulation of apoptotic process (GO:0043065)|regulation of apoptotic DNA fragmentation (GO:1902510)	cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|electron carrier activity (GO:0009055)|FAD binding (GO:0071949)|NAD(P)H oxidase activity (GO:0016174)|oxidoreductase activity, acting on NAD(P)H (GO:0016651)	p.G59G(1)		central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(4)|liver(2)|lung(8)|ovary(4)|prostate(2)|urinary_tract(1)	30					Flavin adenine dinucleotide(DB03147)	CTAGGTTGCTGCCATCTTTCC	0.438																																																	1	Substitution - coding silent(1)	kidney(1)											160.0	148.0	152.0					X																	129289191		2203	4300	6503	SO:0001627	intron_variant	9131			AF100928	CCDS14618.1, CCDS14619.1, CCDS48167.1	Xq26.1	2014-01-30	2006-11-16	2006-11-16	ENSG00000156709	ENSG00000156709			8768	protein-coding gene	gene with protein product		300169	"""programmed cell death 8 (apoptosis-inducing factor)"", ""neuropathy, axonal, motor-sensory with deafness and mental retardation (Cowchock syndrome)"""	PDCD8, NAMSD		9989411, 23217327	Standard	NM_004208		Approved	AIF, CMTX4	uc004evg.3	O95831	OTTHUMG00000022392	ENST00000287295.3:c.249+1243C>T	X.37:g.129289191G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A4QPB4|B1ALN1|B2RB08|D3DTE9|Q1L6K4|Q1L6K6|Q2QKE4|Q5JUZ7|Q6I9X6|Q9Y3I3|Q9Y3I4	Silent	SNP	ENST00000287295.3	37	CCDS14618.1																																																																																				0.438	AIFM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058247.2			
APBB2	323	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	41015685	41015685	+	Silent	SNP	G	G	A			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr4:41015685G>A	ENST00000295974.8	-	6	1379	c.750C>T	c.(748-750)atC>atT	p.I250I	APBB2_ENST00000506352.1_Silent_p.I250I|APBB2_ENST00000508593.1_Silent_p.I250I|APBB2_ENST00000513140.1_Silent_p.I250I	NM_001166050.1|NM_004307.1	NP_001159522.1|NP_004298.1	Q92870	APBB2_HUMAN	amyloid beta (A4) precursor protein-binding, family B, member 2	250					axon guidance (GO:0007411)|cell cycle arrest (GO:0007050)|extracellular matrix organization (GO:0030198)|intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|membrane (GO:0016020)|nucleus (GO:0005634)|synapse (GO:0045202)	beta-amyloid binding (GO:0001540)|transcription factor binding (GO:0008134)	p.I250I(1)		central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(5)|lung(16)|ovary(3)|skin(2)|urinary_tract(1)	34						CCAGGTTCTGGATCCGGTGCA	0.587																																					Ovarian(3;20 75 16686 49997)												1	Substitution - coding silent(1)	kidney(1)											287.0	284.0	285.0					4																	41015685		2067	4208	6275	SO:0001819	synonymous_variant	323			U62325	CCDS43224.1, CCDS54760.1, CCDS54761.1, CCDS54762.1	4p13	2011-10-10	2008-07-31		ENSG00000163697	ENSG00000163697			582	protein-coding gene	gene with protein product	"""Fe65-like"""	602710				8955346, 9585438	Standard	NM_173075		Approved	FE65L, FE65L1, MGC35575	uc003gvn.3	Q92870	OTTHUMG00000160416	ENST00000295974.8:c.750C>T	4.37:g.41015685G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B4DSL4|E9PG87|Q8IUI6	Silent	SNP	ENST00000295974.8	37	CCDS54761.1	.	.	.	.	.	.	.	.	.	.	G	1.481	-0.557098	0.03967	.	.	ENSG00000163697	ENST00000513611	.	.	.	6.04	3.38	0.38709	.	.	.	.	.	T	0.57460	0.2055	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.54497	-0.8285	4	.	.	.	-28.7821	8.7964	0.34883	0.2811:0.0:0.7189:0.0	.	.	.	.	S	240	.	.	P	-	1	0	APBB2	40710442	1.000000	0.71417	1.000000	0.80357	0.110000	0.19582	3.113000	0.50376	1.578000	0.49821	-0.253000	0.11424	CCA		0.587	APBB2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000360523.3		NM_173075	
ATP5B	506	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	57036241	57036241	+	Splice_Site	SNP	C	C	A			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr12:57036241C>A	ENST00000262030.3	-	7	1125		c.e7+1		ATP5B_ENST00000552919.1_Splice_Site|SNORD59A_ENST00000384304.1_RNA|ATP5B_ENST00000550162.1_Splice_Site	NM_001686.3	NP_001677.2	P06576	ATPB_HUMAN	ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide						angiogenesis (GO:0001525)|ATP biosynthetic process (GO:0006754)|ATP catabolic process (GO:0006200)|ATP hydrolysis coupled proton transport (GO:0015991)|cellular metabolic process (GO:0044237)|generation of precursor metabolites and energy (GO:0006091)|lipid metabolic process (GO:0006629)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|osteoblast differentiation (GO:0001649)|proton transport (GO:0015992)|regulation of intracellular pH (GO:0051453)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial nucleoid (GO:0042645)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|mitochondrial proton-transporting ATP synthase, catalytic core (GO:0005754)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|MHC class I protein binding (GO:0042288)|proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)|transmembrane transporter activity (GO:0022857)|transporter activity (GO:0005215)	p.?(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						ATTTTTCTTACCTGTACAGAG	0.478																																																	1	Unknown(1)	kidney(1)											76.0	80.0	79.0					12																	57036241		2203	4300	6503	SO:0001630	splice_region_variant	506			M27132	CCDS8924.1	12p13.3	2012-10-12			ENSG00000110955	ENSG00000110955	3.6.3.14	"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	830	protein-coding gene	gene with protein product		102910		ATPSB		2687158	Standard	NM_001686		Approved		uc001slr.3	P06576	OTTHUMG00000170291	ENST00000262030.3:c.1074+1G>T	12.37:g.57036241C>A		Somatic		WXS	Illumina HiSeq	Phase_I	A8K4X0|Q14283	Splice_Site	SNP	ENST00000262030.3	37	CCDS8924.1	.	.	.	.	.	.	.	.	.	.	C	24.2	4.500329	0.85176	.	.	ENSG00000110955	ENST00000262030;ENST00000552919;ENST00000551020;ENST00000552959;ENST00000551570	.	.	.	6.17	6.17	0.99709	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.6509	0.95805	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ATP5B	55322508	1.000000	0.71417	1.000000	0.80357	0.899000	0.52679	7.601000	0.82783	2.941000	0.99782	0.655000	0.94253	.		0.478	ATP5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408380.1		NM_001686	Intron
ATP8B3	148229	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	1811645	1811645	+	Missense_Mutation	SNP	A	A	T			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr19:1811645A>T	ENST00000310127.6	-	2	329	c.91T>A	c.(91-93)Tca>Aca	p.S31T	ATP8B3_ENST00000525591.1_5'UTR|ATP8B3_ENST00000526092.2_5'UTR|ATP8B3_ENST00000539485.1_Missense_Mutation_p.S31T	NM_138813.3	NP_620168.1	O60423	AT8B3_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 3	31					binding of sperm to zona pellucida (GO:0007339)	acrosomal vesicle (GO:0001669)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.S31T(1)		central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(9)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	23		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GTCACGTCTGAGTCACCCGTG	0.662																																																	1	Substitution - Missense(1)	kidney(1)											41.0	47.0	45.0					19																	1811645		2062	4193	6255	SO:0001583	missense	148229			AA827939	CCDS45901.1, CCDS54196.1	19p13.3	2010-04-28	2010-04-28		ENSG00000130270	ENSG00000130270		"""ATPases / P-type"""	13535	protein-coding gene	gene with protein product	"""aminophospholipid translocase ATP8B3"", ""potential phospholipid-transporting ATPase IK"""	605866	"""ATPase, Class I, type 8B, member 3"", ""ATPase, class I, type 8B, member 3"""			11015572	Standard	NM_138813		Approved	ATPIK	uc002ltw.4	O60423	OTTHUMG00000166189	ENST00000310127.6:c.91T>A	19.37:g.1811645A>T	ENSP00000311336:p.Ser31Thr	Somatic		WXS	Illumina HiSeq	Phase_I	Q7Z485|Q8IVB8|Q8N4Y8|Q96M22	Missense_Mutation	SNP	ENST00000310127.6	37	CCDS45901.1	.	.	.	.	.	.	.	.	.	.	a	12.73	2.024307	0.35701	.	.	ENSG00000130270	ENST00000310127;ENST00000539485	T;T	0.75367	-0.93;-0.93	2.42	1.37	0.22104	.	.	.	.	.	T	0.60170	0.2248	N	0.08118	0	0.09310	N	1	D	0.55385	0.971	P	0.54629	0.757	T	0.50039	-0.8874	9	0.23302	T	0.38	.	4.4984	0.11851	0.8358:0.0:0.1642:0.0	.	31	O60423	AT8B3_HUMAN	T	31	ENSP00000311336:S31T;ENSP00000443574:S31T	ENSP00000311336:S31T	S	-	1	0	ATP8B3	1762645	0.107000	0.21998	0.004000	0.12327	0.115000	0.19883	0.582000	0.23834	0.343000	0.23821	0.459000	0.35465	TCA		0.662	ATP8B3-002	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000388279.1		NM_138813	
ATRX	546	broad.mit.edu;hgsc.bcm.edu	37	X	76952169	76952169	+	Missense_Mutation	SNP	T	T	A			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chrX:76952169T>A	ENST00000373344.5	-	5	480	c.266A>T	c.(265-267)tAt>tTt	p.Y89F	ATRX_ENST00000395603.3_Missense_Mutation_p.Y89F|ATRX_ENST00000373341.1_Missense_Mutation_p.Y50F|ATRX_ENST00000480283.1_5'UTR	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	89					ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.Y89F(2)|p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						TGATTCTACATACTTTGTTAC	0.308			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																																	Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	3	Substitution - Missense(2)|Unknown(1)	kidney(2)|bone(1)											100.0	90.0	94.0					X																	76952169		2202	4292	6494	SO:0001583	missense	546			U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.266A>T	X.37:g.76952169T>A	ENSP00000362441:p.Tyr89Phe	Somatic		WXS	Illumina HiSeq	Phase_I	D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Missense_Mutation	SNP	ENST00000373344.5	37	CCDS14434.1	.	.	.	.	.	.	.	.	.	.	T	21.2	4.116505	0.77323	.	.	ENSG00000085224	ENST00000373344;ENST00000395603;ENST00000400862;ENST00000400861;ENST00000373341	D;D;D	0.96265	-3.96;-3.96;-3.96	5.13	5.13	0.70059	.	0.084915	0.48767	D	0.000177	D	0.97570	0.9204	M	0.68317	2.08	0.37235	D	0.905875	D;D;D;D	0.89917	0.998;1.0;0.998;0.998	D;D;D;D	0.87578	0.978;0.998;0.987;0.978	D	0.99940	1.1396	10	0.87932	D	0	-10.8107	14.2411	0.65956	0.0:0.0:0.0:1.0	.	89;89;89;89	A4LAA3;P46100-6;P46100-4;P46100	.;.;.;ATRX_HUMAN	F	89;89;84;50;50	ENSP00000362441:Y89F;ENSP00000378967:Y89F;ENSP00000362438:Y50F	ENSP00000362438:Y50F	Y	-	2	0	ATRX	76838825	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	5.789000	0.69029	1.810000	0.52873	0.345000	0.21793	TAT		0.308	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058860.2		NM_000489	
AVL9	23080	hgsc.bcm.edu;ucsc.edu	37	7	32584314	32584314	+	Frame_Shift_Del	DEL	T	T	-			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr7:32584314delT	ENST00000318709.4	+	3	444	c.223delT	c.(223-225)tttfs	p.F76fs	AVL9_ENST00000409301.1_Frame_Shift_Del_p.F76fs|AVL9_ENST00000404479.1_Frame_Shift_Del_p.F76fs	NM_015060.1	NP_055875.1	Q8NBF6	AVL9_HUMAN	AVL9 homolog (S. cerevisiase)	76					cell migration (GO:0016477)	integral component of membrane (GO:0016021)|recycling endosome (GO:0055037)				endometrium(3)|kidney(1)|large_intestine(3)|lung(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	18						AGATACTGTGTTTTTTCACTT	0.333																																																	0													95.0	91.0	93.0					7																	32584314		2203	4300	6503	SO:0001589	frameshift_variant	23080			D87682	CCDS34613.1	7p14.3	2013-05-01	2008-10-03	2008-10-03	ENSG00000105778	ENSG00000105778			28994	protein-coding gene	gene with protein product		612927	"""KIAA0241"""	KIAA0241		17229886, 22595670	Standard	XM_005249668		Approved		uc003tcv.1	Q8NBF6	OTTHUMG00000152929	ENST00000318709.4:c.223delT	7.37:g.32584314delT	ENSP00000315568:p.Phe76fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q92573	Frame_Shift_Del	DEL	ENST00000318709.4	37	CCDS34613.1																																																																																				0.333	AVL9-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328643.1		NM_015060	
B3GAT3	26229	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	62384532	62384532	+	Missense_Mutation	SNP	G	G	A	rs559186924		TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr11:62384532G>A	ENST00000265471.5	-	3	772	c.545C>T	c.(544-546)cCa>cTa	p.P182L	B3GAT3_ENST00000534026.1_Missense_Mutation_p.P182L|B3GAT3_ENST00000531383.1_Missense_Mutation_p.P182L	NM_012200.3	NP_036332.2	O94766	B3GA3_HUMAN	beta-1,3-glucuronyltransferase 3	182					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|chondroitin sulfate proteoglycan biosynthetic process (GO:0050650)|dermatan sulfate proteoglycan biosynthetic process (GO:0050651)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|protein glycosylation (GO:0006486)|small molecule metabolic process (GO:0044281)	cis-Golgi network (GO:0005801)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase activity (GO:0015018)|glucuronosyltransferase activity (GO:0015020)|metal ion binding (GO:0046872)	p.P182L(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(2)|prostate(2)|urinary_tract(1)	12						CCCTGGTGGTGGTGGGTCCTT	0.637																																																	1	Substitution - Missense(1)	kidney(1)											96.0	99.0	98.0					11																	62384532		2202	4299	6501	SO:0001583	missense	26229			AB009598	CCDS8025.1	11q12	2014-07-08	2014-07-08		ENSG00000149541	ENSG00000149541	2.4.1.135	"""Beta-1,3-glucuronyltransferases"""	923	protein-coding gene	gene with protein product	"""glucuronosyltransferase I"", ""galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase 3"""	606374	"""beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I)"""			9506957	Standard	NM_012200		Approved	GlcAT-I	uc001ntw.3	O94766	OTTHUMG00000167685	ENST00000265471.5:c.545C>T	11.37:g.62384532G>A	ENSP00000265471:p.Pro182Leu	Somatic		WXS	Illumina HiSeq	Phase_I	B7ZAB3|Q96I06|Q9UEP0	Missense_Mutation	SNP	ENST00000265471.5	37	CCDS8025.1	.	.	.	.	.	.	.	.	.	.	g	11.93	1.784532	0.31593	.	.	ENSG00000149541	ENST00000265471;ENST00000531383;ENST00000534026;ENST00000534715	T;T;T;T	0.76316	-1.01;-1.01;-1.01;-1.01	5.52	5.52	0.82312	.	0.262480	0.37530	N	0.002051	T	0.80433	0.4622	L	0.36672	1.1	0.44995	D	0.998012	D;B;D	0.65815	0.995;0.007;0.988	P;B;P	0.62089	0.898;0.021;0.736	T	0.76623	-0.2891	10	0.25106	T	0.35	.	15.0124	0.71560	0.0:0.0:1.0:0.0	.	182;188;182	B7ZAB3;Q5U676;O94766	.;.;B3GA3_HUMAN	L	182;182;182;205	ENSP00000265471:P182L;ENSP00000431359:P182L;ENSP00000432474:P182L;ENSP00000432854:P205L	ENSP00000265471:P182L	P	-	2	0	B3GAT3	62141108	1.000000	0.71417	0.795000	0.32087	0.986000	0.74619	3.794000	0.55492	2.611000	0.88343	0.550000	0.68814	CCA		0.637	B3GAT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395588.1		NM_012200	
BAZ1A	11177	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	35264070	35264070	+	Silent	SNP	C	C	A			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr14:35264070C>A	ENST00000382422.2	-	10	1575	c.1248G>T	c.(1246-1248)gtG>gtT	p.V416V	BAZ1A_ENST00000360310.1_Silent_p.V416V|BAZ1A_ENST00000358716.4_Silent_p.V416V			Q9NRL2	BAZ1A_HUMAN	bromodomain adjacent to zinc finger domain, 1A	416					chromatin remodeling (GO:0006338)|DNA-dependent DNA replication (GO:0006261)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	ACF complex (GO:0016590)|CHRAC (GO:0008623)|nuclear chromosome (GO:0000228)	zinc ion binding (GO:0008270)	p.V416V(1)		breast(2)|central_nervous_system(2)|cervix(2)|endometrium(6)|kidney(2)|large_intestine(7)|lung(19)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	48	Breast(36;0.0388)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;7.23e-05)|Lung(238;0.00019)|Epithelial(34;0.0793)|all cancers(34;0.175)	GBM - Glioblastoma multiforme(112;0.0659)		GTCTAGTTTTCACTGGTGTTG	0.363																																																	1	Substitution - coding silent(1)	kidney(1)											79.0	73.0	75.0					14																	35264070		2203	4300	6503	SO:0001819	synonymous_variant	11177			AB032252	CCDS9651.1, CCDS41943.1	14q13.2	2013-01-28			ENSG00000198604	ENSG00000198604		"""Zinc fingers, PHD-type"""	960	protein-coding gene	gene with protein product		605680				10662543	Standard	NM_013448		Approved	hACF1, ACF1, WALp1, WCRF180	uc001wsk.3	Q9NRL2	OTTHUMG00000140216	ENST00000382422.2:c.1248G>T	14.37:g.35264070C>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q9NZ15|Q9P065|Q9UIG1|Q9Y3V3	Silent	SNP	ENST00000382422.2	37	CCDS9651.1																																																																																				0.363	BAZ1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276646.1			
BDKRB2	624	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	96703508	96703508	+	Missense_Mutation	SNP	G	G	T	rs532210447		TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr14:96703508G>T	ENST00000306005.3	+	2	260	c.64G>T	c.(64-66)Gcc>Tcc	p.A22S	RP11-404P21.8_ENST00000553811.1_Missense_Mutation_p.A22S|BDKRB2_ENST00000542454.2_5'UTR|BDKRB2_ENST00000554311.1_Missense_Mutation_p.A22S|BDKRB2_ENST00000539359.1_5'UTR	NM_000623.3	NP_000614.1	P30411	BKRB2_HUMAN	bradykinin receptor B2	22					arachidonic acid secretion (GO:0050482)|blood circulation (GO:0008015)|cell surface receptor signaling pathway (GO:0007166)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|metabolic process (GO:0008152)|negative regulation of intrinsic apoptotic signaling pathway in response to osmotic stress by p53 class mediator (GO:1902239)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of vascular permeability (GO:0043114)|regulation of vasoconstriction (GO:0019229)|response to salt stress (GO:0009651)|smooth muscle contraction (GO:0006939)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vasoconstriction (GO:0042310)|vasodilation (GO:0042311)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	bradykinin receptor activity (GO:0004947)|phosphatidylinositol phospholipase C activity (GO:0004435)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|type 1 angiotensin receptor binding (GO:0031702)	p.A22S(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(5)|lung(7)|ovary(3)|skin(1)	24		all_cancers(154;0.0678)|Melanoma(154;0.155)|all_epithelial(191;0.179)		COAD - Colon adenocarcinoma(157;0.226)	Icatibant(DB06196)	GCCCACCACGGCCTCTTTCAG	0.542																																																	1	Substitution - Missense(1)	kidney(1)											147.0	121.0	130.0					14																	96703508		2203	4300	6503	SO:0001583	missense	624			S56772	CCDS9942.1	14q32.1-q32.2	2012-08-08				ENSG00000168398		"""GPCR / Class A : Bradykinin receptors"""	1030	protein-coding gene	gene with protein product		113503				7916737	Standard	NM_000623		Approved	BK-2	uc010avm.1	P30411		ENST00000306005.3:c.64G>T	14.37:g.96703508G>T	ENSP00000307713:p.Ala22Ser	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000306005.3	37	CCDS9942.1	.	.	.	.	.	.	.	.	.	.	G	8.229	0.804270	0.16467	.	.	ENSG00000168398;ENSG00000168398;ENSG00000258691	ENST00000554311;ENST00000306005;ENST00000553811	T;T;T	0.71579	-0.58;-0.58;1.77	3.71	1.86	0.25419	.	1.861990	0.02957	N	0.142566	T	0.49423	0.1556	N	0.08118	0	0.09310	N	1	B	0.31318	0.319	B	0.27170	0.077	T	0.44590	-0.9318	10	0.30854	T	0.27	-2.0302	5.3921	0.16249	0.1123:0.2048:0.6829:0.0	.	22	P30411	BKRB2_HUMAN	S	22	ENSP00000450482:A22S;ENSP00000307713:A22S;ENSP00000450984:A22S	ENSP00000307713:A22S	A	+	1	0	RP11-404P21.8;BDKRB2	95773261	0.008000	0.16893	0.068000	0.19968	0.026000	0.11368	0.611000	0.24268	0.548000	0.28955	-0.830000	0.03078	GCC		0.542	BDKRB2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413294.1			
BRPF3	27154	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	36177669	36177669	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr6:36177669G>A	ENST00000357641.6	+	5	2096	c.1843G>A	c.(1843-1845)Gca>Aca	p.A615T	BRPF3_ENST00000443324.2_Missense_Mutation_p.A615T|BRPF3_ENST00000534694.1_Missense_Mutation_p.A615T|BRPF3_ENST00000543502.1_Missense_Mutation_p.A615T|BRPF3_ENST00000534400.1_Missense_Mutation_p.A615T|BRPF3_ENST00000339717.7_Missense_Mutation_p.A615T	NM_015695.2	NP_056510.2	Q9ULD4	BRPF3_HUMAN	bromodomain and PHD finger containing, 3	615	Bromo. {ECO:0000255|PROSITE- ProRule:PRU00035}.				blood coagulation (GO:0007596)|histone H3 acetylation (GO:0043966)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	cytosol (GO:0005829)|extracellular region (GO:0005576)|MOZ/MORF histone acetyltransferase complex (GO:0070776)	zinc ion binding (GO:0008270)	p.A615T(1)		breast(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(15)|ovary(1)|prostate(1)|skin(4)|urinary_tract(2)	40						ACACATCTTCGCAGAACCAGT	0.507																																																	1	Substitution - Missense(1)	kidney(1)											84.0	72.0	76.0					6																	36177669		2203	4300	6503	SO:0001583	missense	27154			AB033112	CCDS34437.1	6p21.31	2008-02-05			ENSG00000096070	ENSG00000096070			14256	protein-coding gene	gene with protein product						10574462	Standard	NM_015695		Approved	KIAA1286	uc003olv.4	Q9ULD4	OTTHUMG00000014589	ENST00000357641.6:c.1843G>A	6.37:g.36177669G>A	ENSP00000350267:p.Ala615Thr	Somatic		WXS	Illumina HiSeq	Phase_I	A6ND56|A6NJE2|B7ZLN5|E7EX85|Q17RB6|Q5R3K8	Missense_Mutation	SNP	ENST00000357641.6	37	CCDS34437.1	.	.	.	.	.	.	.	.	.	.	G	8.541	0.873173	0.17322	.	.	ENSG00000096070	ENST00000357641;ENST00000339717;ENST00000534694;ENST00000543502;ENST00000443324;ENST00000534400;ENST00000394572	T;T;T;T;T;T	0.30182	1.54;1.54;1.54;1.54;1.54;1.54	5.92	5.04	0.67666	Bromodomain (5);Bromodomain, conserved site (1);	0.098546	0.64402	D	0.000001	T	0.08133	0.0203	L	0.34521	1.04	0.44603	D	0.997578	B;B;B	0.33477	0.009;0.001;0.413	B;B;B	0.19391	0.012;0.004;0.025	T	0.12528	-1.0544	10	0.27785	T	0.31	.	7.6226	0.28193	0.1339:0.0:0.7208:0.1454	.	615;615;615	B7ZLN5;Q17RB6;Q9ULD4	.;.;BRPF3_HUMAN	T	615;615;615;615;615;615;29	ENSP00000350267:A615T;ENSP00000345419:A615T;ENSP00000434501:A615T;ENSP00000445352:A615T;ENSP00000387368:A615T;ENSP00000436504:A615T	ENSP00000345419:A615T	A	+	1	0	BRPF3	36285647	0.998000	0.40836	0.185000	0.23176	0.931000	0.56810	2.762000	0.47597	1.471000	0.48121	-0.274000	0.10170	GCA		0.507	BRPF3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000040335.3		NM_015695	
BZRAP1	9256	hgsc.bcm.edu	37	17	56386383	56386384	+	Frame_Shift_Ins	INS	-	-	T	rs373235874		TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr17:56386383_56386384insT	ENST00000343736.4	-	22	4412_4413	c.4249_4250insA	c.(4249-4251)agcfs	p.S1417fs	BZRAP1_ENST00000355701.3_Frame_Shift_Ins_p.S1417fs|BZRAP1_ENST00000268893.6_Frame_Shift_Ins_p.S1357fs			O95153	RIMB1_HUMAN	benzodiazepine receptor (peripheral) associated protein 1	1417						cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	benzodiazepine receptor binding (GO:0030156)			cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(2)|lung(16)|ovary(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	54	Medulloblastoma(34;0.127)|all_neural(34;0.237)					CCGCCTGCGGCTTGGGGGCTTC	0.653																																																	0																																										SO:0001589	frameshift_variant	9256			AB014512	CCDS11605.1, CCDS45742.1	17q22-q23	2014-01-09	2014-01-09						16831	protein-coding gene	gene with protein product		610764				9734811, 9915832	Standard	NM_004758		Approved	PRAX-1, KIAA0612, RIM-BP1, RIMBP1	uc002ivx.5	O95153		ENST00000343736.4:c.4250dupA	17.37:g.56386385_56386385dupT	ENSP00000345824:p.Ser1417fs	Somatic		WXS	Illumina HiSeq	Phase_I	O75111|Q8N5W3	Frame_Shift_Ins	INS	ENST00000343736.4	37	CCDS11605.1																																																																																				0.653	BZRAP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443980.1		NM_004758	
C20orf24	55969	broad.mit.edu;ucsc.edu	37	20	35238021	35238021	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr20:35238021C>T	ENST00000373852.5	+	3	371	c.236C>T	c.(235-237)gCa>gTa	p.A79V	C20orf24_ENST00000344795.3_Missense_Mutation_p.A79V|C20orf24_ENST00000342422.3_Intron|TGIF2-C20orf24_ENST00000558530.1_Missense_Mutation_p.A105V			Q9BUV8	CT024_HUMAN	chromosome 20 open reading frame 24	79								p.A79V(1)		breast(1)|kidney(1)|lung(2)	4	Breast(12;0.114)	Myeloproliferative disorder(115;0.00878)				CTGATCAATGCAGGAGTCCTG	0.473																																																	1	Substitution - Missense(1)	kidney(1)											274.0	233.0	247.0					20																	35238021		2203	4300	6503	SO:0001583	missense	55969			AF112213	CCDS13279.1, CCDS13280.1, CCDS56190.1	20q11.23	2011-01-25			ENSG00000101084	ENSG00000101084			15870	protein-coding gene	gene with protein product						15178406	Standard	NM_018840		Approved	PNAS-11, RIP5		Q9BUV8	OTTHUMG00000032384	ENST00000373852.5:c.236C>T	20.37:g.35238021C>T	ENSP00000362958:p.Ala79Val	Somatic		WXS	Illumina GAIIx	Phase_I	E1P5U0|O00605|Q5QPG6|Q5QPG7|Q9BT03|Q9BZU7|Q9UI05	Missense_Mutation	SNP	ENST00000373852.5	37	CCDS56190.1	.	.	.	.	.	.	.	.	.	.	C	18.43	3.623287	0.66901	.	.	ENSG00000101084	ENST00000344795;ENST00000373852	.	.	.	5.79	5.79	0.91817	.	.	.	.	.	T	0.78654	0.4317	M	0.77616	2.38	0.80722	D	1	D;D;P	0.89917	0.986;1.0;0.936	P;D;P	0.87578	0.843;0.998;0.692	T	0.73704	-0.3899	8	0.18710	T	0.47	.	17.5355	0.87829	0.0:1.0:0.0:0.0	.	79;79;79	Q9BUV8;Q9BUV8-2;Q9BUV8-3	CT024_HUMAN;.;.	V	79	.	ENSP00000340164:A79V	A	+	2	0	C20orf24	34671435	1.000000	0.71417	1.000000	0.80357	0.024000	0.10985	7.429000	0.80309	2.736000	0.93811	0.655000	0.94253	GCA		0.473	C20orf24-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000079006.1		NM_018840	
SPATA25	128497	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	20	44515557	44515557	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr20:44515557G>A	ENST00000372519.3	-	2	327	c.283C>T	c.(283-285)Cat>Tat	p.H95Y		NM_080608.3	NP_542175.1	Q9BR10	SPT25_HUMAN	spermatogenesis associated 25	95					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)		p.H95Y(1)									TGCCTCACATGCGGGAATTTG	0.637																																																	1	Substitution - Missense(1)	kidney(1)											122.0	123.0	123.0					20																	44515557		2203	4300	6503	SO:0001583	missense	0			AL008726	CCDS13383.1	20q13.12	2011-11-24	2011-11-24	2011-11-24	ENSG00000149634	ENSG00000149634			16158	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 165"""	C20orf165		19240080	Standard	NM_080608		Approved	dJ337O18.8, TSG23	uc002xqf.3	Q9BR10	OTTHUMG00000032628	ENST00000372519.3:c.283C>T	20.37:g.44515557G>A	ENSP00000361597:p.His95Tyr	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000372519.3	37	CCDS13383.1	.	.	.	.	.	.	.	.	.	.	G	0	-2.832830	0.00070	.	.	ENSG00000149634	ENST00000372519	T	0.41758	0.99	4.82	1.8	0.24995	.	1.203530	0.05957	N	0.639872	T	0.25082	0.0609	N	0.14661	0.345	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.22765	-1.0207	10	0.23302	T	0.38	-1.6063	5.8022	0.18420	0.176:0.1596:0.6644:0.0	.	95	Q9BR10	CT165_HUMAN	Y	95	ENSP00000361597:H95Y	ENSP00000361597:H95Y	H	-	1	0	C20orf165	43948964	0.000000	0.05858	0.000000	0.03702	0.037000	0.13140	-0.558000	0.05978	0.235000	0.21160	0.655000	0.94253	CAT		0.637	SPATA25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079541.1			
C2CD3	26005	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	73753116	73753116	+	Silent	SNP	G	G	T			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr11:73753116G>T	ENST00000334126.7	-	29	5869	c.5643C>A	c.(5641-5643)tcC>tcA	p.S1881S	C2CD3_ENST00000313663.7_Silent_p.S1881S			Q4AC94	C2CD3_HUMAN	C2 calcium-dependent domain containing 3	1881					brain development (GO:0007420)|centriole elongation (GO:0061511)|embryonic digit morphogenesis (GO:0042733)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|neural plate axis specification (GO:0021997)|neural tube development (GO:0021915)|nonmotile primary cilium assembly (GO:0035058)|protein localization to centrosome (GO:0071539)|protein processing (GO:0016485)|regulation of proteolysis (GO:0030162)|regulation of smoothened signaling pathway (GO:0008589)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)		p.S1881S(2)		NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(26)|ovary(4)|pancreas(2)|prostate(1)|skin(3)	64	Breast(11;4.16e-06)					AAGTCAGAATGGAGGTTTGGG	0.478																																																	2	Substitution - coding silent(2)	kidney(2)											201.0	171.0	181.0					11																	73753116		2200	4293	6493	SO:0001819	synonymous_variant	26005			BC035599	CCDS31636.1, CCDS66167.1	11q13.4	2014-02-12	2007-10-17		ENSG00000168014	ENSG00000168014			24564	protein-coding gene	gene with protein product		615944					Standard	XM_005273897		Approved	DKFZP586P0123	uc001ouu.2	Q4AC94	OTTHUMG00000168110	ENST00000334126.7:c.5643C>A	11.37:g.73753116G>T		Somatic		WXS	Illumina HiSeq	Phase_I	C9JR55|E2QRD1|Q2NLE1|Q3C1U9|Q6ZU92|Q8IYM4|Q8NB87|Q8NDH7|Q9Y4M2	Silent	SNP	ENST00000334126.7	37		.	.	.	.	.	.	.	.	.	.	G	8.132	0.783305	0.16189	.	.	ENSG00000168014	ENST00000538361	.	.	.	5.82	2.61	0.31194	.	.	.	.	.	T	0.47173	0.1431	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.33523	-0.9865	4	.	.	.	-11.7656	4.3351	0.11081	0.1375:0.1024:0.5322:0.2279	.	.	.	.	N	115	.	.	H	-	1	0	C2CD3	73430764	0.998000	0.40836	0.999000	0.59377	0.979000	0.70002	0.256000	0.18351	0.801000	0.34066	-0.237000	0.12165	CAT		0.478	C2CD3-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding			NM_015531	
TRAPPC11	60684	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	184618916	184618916	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr4:184618916A>G	ENST00000334690.6	+	25	2981	c.2779A>G	c.(2779-2781)Att>Gtt	p.I927V	TRAPPC11_ENST00000357207.4_Missense_Mutation_p.I927V|TRAPPC11_ENST00000512476.1_Missense_Mutation_p.I533V	NM_021942.5	NP_068761.4	Q7Z392	TPC11_HUMAN	trafficking protein particle complex 11	927					vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)		p.I927V(1)									GGCCCTCACTATTGTTTCCAG	0.498																																																	1	Substitution - Missense(1)	kidney(1)											101.0	92.0	95.0					4																	184618916		2203	4300	6503	SO:0001583	missense	0				CCDS34112.1, CCDS47166.1	4q35.1	2011-12-12	2011-12-12	2011-12-12	ENSG00000168538	ENSG00000168538		"""Trafficking protein particle complex"""	25751	protein-coding gene	gene with protein product	"""gryzun homolog (Drosophila)"", ""foie gras homolog (zebrafish)"""	614138	"""chromosome 4 open reading frame 41"""	C4orf41		19942856, 21525244	Standard	NM_021942		Approved	FLJ12716, gry, foigr	uc003ivx.3	Q7Z392	OTTHUMG00000160673	ENST00000334690.6:c.2779A>G	4.37:g.184618916A>G	ENSP00000335371:p.Ile927Val	Somatic		WXS	Illumina HiSeq	Phase_I	A4QPB8|B2RCD6|Q5U5I7|Q6FI73|Q86T25|Q9H0L1|Q9H5K9|Q9H8Q1|Q9H9I7	Missense_Mutation	SNP	ENST00000334690.6	37	CCDS34112.1	.	.	.	.	.	.	.	.	.	.	A	4.374	0.068875	0.08436	.	.	ENSG00000168538	ENST00000334690;ENST00000357207;ENST00000360109;ENST00000512476	.	.	.	5.54	-2.9	0.05648	.	0.267042	0.38436	N	0.001690	T	0.22360	0.0539	L	0.28115	0.83	0.09310	N	1	B;B;B;B	0.18863	0.003;0.001;0.001;0.031	B;B;B;B	0.20184	0.009;0.002;0.005;0.028	T	0.24119	-1.0169	9	0.16896	T	0.51	.	8.7353	0.34525	0.6035:0.0964:0.3002:0.0	.	658;533;927;927	B3KR79;D6RHE5;Q7Z392;Q7Z392-3	.;.;TPC11_HUMAN;.	V	927;927;927;533	.	ENSP00000335371:I927V	I	+	1	0	C4orf41	184855910	0.258000	0.24033	0.000000	0.03702	0.220000	0.24768	0.948000	0.29096	-0.350000	0.08262	-1.139000	0.01908	ATT		0.498	TRAPPC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361654.2		NM_021942	
CD101	9398	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	117568204	117568204	+	Silent	SNP	C	C	T			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr1:117568204C>T	ENST00000256652.4	+	8	2560	c.2502C>T	c.(2500-2502)tgC>tgT	p.C834C	RP11-27K13.3_ENST00000421254.1_RNA|CD101_ENST00000369470.1_Silent_p.C834C|RP11-27K13.3_ENST00000445523.1_RNA	NM_001256106.1|NM_001256109.1|NM_001256111.1|NM_004258.4	NP_001243035.1|NP_001243038.1|NP_001243040.1|NP_004249.2	Q93033	IGSF2_HUMAN	CD101 molecule	834	Ig-like C2-type 7.				cell surface receptor signaling pathway (GO:0007166)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)	p.C834C(1)		NS(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(14)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						CCATCCGCTGCAGCCTGGAGA	0.468																																																	1	Substitution - coding silent(1)	kidney(1)											76.0	78.0	77.0					1																	117568204		2203	4300	6503	SO:0001819	synonymous_variant	9398			Z33642	CCDS891.1	1p13	2013-01-29	2009-10-27	2009-10-27	ENSG00000134256	ENSG00000134256		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5949	protein-coding gene	gene with protein product		604516	"""immunoglobulin superfamily, member 2"""	IGSF2		7722300	Standard	NM_004258		Approved	V7	uc010oxb.2	Q93033	OTTHUMG00000012029	ENST00000256652.4:c.2502C>T	1.37:g.117568204C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q15856	Silent	SNP	ENST00000256652.4	37	CCDS891.1																																																																																				0.468	CD101-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033274.1		NM_004258	
CDC23	8697	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	137542357	137542357	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr5:137542357A>G	ENST00000394886.2	-	3	281	c.251T>C	c.(250-252)aTg>aCg	p.M84T	CDC23_ENST00000505120.1_Missense_Mutation_p.W83R|CDC23_ENST00000394884.3_Missense_Mutation_p.M84T	NM_004661.3	NP_004652.2	Q9UJX2	CDC23_HUMAN	cell division cycle 23	84					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic metaphase plate congression (GO:0007080)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of exit from mitosis (GO:0007096)|regulation of mitotic metaphase/anaphase transition (GO:0030071)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|ubiquitin-dependent protein catabolic process (GO:0006511)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)	ubiquitin-protein transferase activity (GO:0004842)	p.M78T(1)		autonomic_ganglia(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(6)|prostate(2)|skin(1)	23			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			ATAGGCATCCATATCCTGGGC	0.398																																																	1	Substitution - Missense(1)	kidney(1)											78.0	75.0	76.0					5																	137542357		2203	4300	6503	SO:0001583	missense	8697			AF053977	CCDS4200.2	5q31	2013-01-17	2013-01-17		ENSG00000094880	ENSG00000094880		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1724	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 8"""	603462	"""CDC23 (cell division cycle 23, yeast, homolog)"", ""cell division cycle 23 homolog (S. cerevisiae)"""			9790767	Standard	NM_004661		Approved	APC8, ANAPC8, CUT23	uc003lcl.3	Q9UJX2	OTTHUMG00000129198	ENST00000394886.2:c.251T>C	5.37:g.137542357A>G	ENSP00000378350:p.Met84Thr	Somatic		WXS	Illumina HiSeq	Phase_I	A8K6E5|B4E3A2|B7WP05|D3DQB7|O75433|Q53FN2|Q9BS73	Missense_Mutation	SNP	ENST00000394886.2	37	CCDS4200.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	13.84|13.84	2.358226|2.358226	0.41801|0.41801	.|.	.|.	ENSG00000094880|ENSG00000094880	ENST00000394886;ENST00000394884|ENST00000505120	T;T|T	0.39592|0.36520	1.07;1.07|1.25	5.95|5.95	5.95|5.95	0.96441|0.96441	Cdc23 (1);|.	0.172404|.	0.53938|.	D|.	0.000055|.	T|T	0.22627|0.22627	0.0546|0.0546	N|N	0.01576|0.01576	-0.805|-0.805	0.34222|0.34222	D|D	0.675582|0.675582	B;B|.	0.32467|.	0.372;0.001|.	B;B|.	0.27796|.	0.083;0.001|.	T|T	0.50083|0.50083	-0.8869|-0.8869	10|7	0.16420|0.72032	T|D	0.52|0.01	-14.8056|-14.8056	16.4116|16.4116	0.83717|0.83717	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	84;84|.	Q9UJX2-2;Q9UJX2|.	.;CDC23_HUMAN|.	T|R	84|83	ENSP00000378350:M84T;ENSP00000378348:M84T|ENSP00000423704:W83R	ENSP00000378348:M84T|ENSP00000422505:W60R	M|W	-|-	2|1	0|0	CDC23|CDC23	137570256|137570256	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	9.220000|9.220000	0.95180|0.95180	2.276000|2.276000	0.75962|0.75962	0.528000|0.528000	0.53228|0.53228	ATG|TGG		0.398	CDC23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251275.2			
CNTN2	6900	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	205035032	205035032	+	Missense_Mutation	SNP	T	T	A			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr1:205035032T>A	ENST00000331830.4	+	14	2095	c.1811T>A	c.(1810-1812)gTc>gAc	p.V604D		NM_005076.3	NP_005067.1	Q02246	CNTN2_HUMAN	contactin 2 (axonal)	604					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|central nervous system myelination (GO:0022010)|cerebral cortex GABAergic interneuron migration (GO:0021853)|clustering of voltage-gated potassium channels (GO:0045163)|establishment of protein localization to juxtaparanode region of axon (GO:0071206)|learning (GO:0007612)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of adenosine receptor signaling pathway (GO:0060168)|positive regulation of protein processing (GO:0010954)|presynaptic membrane organization (GO:0097090)|receptor internalization (GO:0031623)|regulation of astrocyte differentiation (GO:0048710)|regulation of axon diameter (GO:0031133)|regulation of neuronal synaptic plasticity (GO:0048168)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|juxtaparanode region of axon (GO:0044224)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|synapse (GO:0045202)|voltage-gated potassium channel complex (GO:0008076)	carbohydrate binding (GO:0030246)|identical protein binding (GO:0042802)	p.V604D(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(11)|lung(23)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	54	all_cancers(21;0.144)|Breast(84;0.0437)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			ACAGTCCTGGTCCGAGGTGAG	0.627																																					Melanoma(183;2548 2817 37099 41192)												1	Substitution - Missense(1)	kidney(1)											75.0	69.0	71.0					1																	205035032		2203	4300	6503	SO:0001583	missense	6900			X67734	CCDS1449.1	1q32.1	2013-02-11			ENSG00000184144	ENSG00000184144		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2172	protein-coding gene	gene with protein product		190197		TAX, AXT		8307567, 8586965	Standard	NM_005076		Approved	TAG-1, TAX1	uc001hbr.3	Q02246	OTTHUMG00000037105	ENST00000331830.4:c.1811T>A	1.37:g.205035032T>A	ENSP00000330633:p.Val604Asp	Somatic		WXS	Illumina HiSeq	Phase_I	P78432|Q5T054	Missense_Mutation	SNP	ENST00000331830.4	37	CCDS1449.1	.	.	.	.	.	.	.	.	.	.	T	30	5.057102	0.93846	.	.	ENSG00000184144	ENST00000331830	T	0.61392	0.11	5.75	5.75	0.90469	Immunoglobulin I-set (1);Fibronectin, type III (1);Immunoglobulin-like fold (1);	0.135312	0.33199	N	0.005177	D	0.83852	0.5344	H	0.96996	3.92	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.72075	0.976;0.976	D	0.89415	0.3706	10	0.87932	D	0	.	15.7012	0.77544	0.0:0.0:0.0:1.0	.	604;495	Q02246;Q68DA2	CNTN2_HUMAN;.	D	604	ENSP00000330633:V604D	ENSP00000330633:V604D	V	+	2	0	CNTN2	203301655	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	7.181000	0.77682	2.194000	0.70268	0.482000	0.46254	GTC		0.627	CNTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090080.3		NM_005076	
DET1	55070	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	89070834	89070834	+	Missense_Mutation	SNP	G	G	A	rs569976232		TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr15:89070834G>A	ENST00000268148.8	-	3	1412	c.1267C>T	c.(1267-1269)Cgc>Tgc	p.R423C	DET1_ENST00000444300.1_Missense_Mutation_p.R434C|DET1_ENST00000564406.1_Missense_Mutation_p.R434C	NM_001144074.1	NP_001137546.1	Q7L5Y6	DET1_HUMAN	de-etiolated homolog 1 (Arabidopsis)	423						nucleus (GO:0005634)		p.R434C(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(10)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	23	Lung NSC(78;0.105)|all_lung(78;0.182)		BRCA - Breast invasive adenocarcinoma(143;0.188)			GCTTACCGGCGCTGGATCTGC	0.443													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19718	0.0		0.0	False		,,,				2504	0.0																1	Substitution - Missense(1)	kidney(1)											69.0	65.0	67.0					15																	89070834		1874	4112	5986	SO:0001583	missense	55070			BC001242	CCDS45343.1, CCDS45344.1	15q25.3	2004-12-13				ENSG00000140543			25477	protein-coding gene	gene with protein product		608727				14739464	Standard	NM_001144074		Approved	FLJ10103	uc002bmq.2	Q7L5Y6		ENST00000268148.8:c.1267C>T	15.37:g.89070834G>A	ENSP00000268148:p.Arg423Cys	Somatic		WXS	Illumina HiSeq	Phase_I	B3KNN6|Q2VPC0|Q9NWD5	Missense_Mutation	SNP	ENST00000268148.8	37	CCDS45344.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.014609	0.75161	.	.	ENSG00000140543	ENST00000444300;ENST00000268148	.	.	.	5.7	5.7	0.88788	.	0.049043	0.85682	D	0.000000	T	0.78953	0.4365	M	0.76574	2.34	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.64506	0.926;0.926	T	0.80725	-0.1254	9	0.87932	D	0	.	18.8293	0.92132	0.0:0.0:1.0:0.0	.	423;434	Q7L5Y6;B3KNN6	DET1_HUMAN;.	C	434;423	.	ENSP00000268148:R423C	R	-	1	0	DET1	86871838	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	7.036000	0.76524	2.683000	0.91414	0.655000	0.94253	CGC		0.443	DET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415442.2		NM_017996	
DPY19L1	23333	broad.mit.edu;ucsc.edu	37	7	35057549	35057549	+	Missense_Mutation	SNP	C	C	G			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr7:35057549C>G	ENST00000310974.4	-	3	281	c.137G>C	c.(136-138)cGt>cCt	p.R46P		NM_015283.1	NP_056098.1	Q2PZI1	D19L1_HUMAN	dpy-19-like 1 (C. elegans)	46						integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity, transferring glycosyl groups (GO:0016757)	p.R46P(1)		endometrium(3)|kidney(5)|large_intestine(8)|lung(8)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)	31						AGAAAAATGACGGTCATTTTC	0.323																																																	1	Substitution - Missense(1)	kidney(1)											79.0	79.0	79.0					7																	35057549		1953	4196	6149	SO:0001583	missense	23333			AB020684	CCDS43567.1	7p14.3-p14.2	2006-04-26			ENSG00000173852	ENSG00000173852			22205	protein-coding gene	gene with protein product		613892					Standard	NM_015283		Approved	KIAA0877	uc003tem.4	Q2PZI1	OTTHUMG00000154888	ENST00000310974.4:c.137G>C	7.37:g.35057549C>G	ENSP00000308695:p.Arg46Pro	Somatic		WXS	Illumina GAIIx	Phase_I	O94954|Q4G151	Missense_Mutation	SNP	ENST00000310974.4	37	CCDS43567.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.165958	0.78339	.	.	ENSG00000173852	ENST00000310974	T	0.57273	0.41	5.17	4.29	0.51040	.	0.000000	0.64402	U	0.000001	T	0.70090	0.3184	M	0.77820	2.39	0.53688	D	0.999976	D	0.71674	0.998	D	0.67382	0.951	T	0.72334	-0.4325	10	0.45353	T	0.12	-10.4194	13.4011	0.60883	0.0:0.9236:0.0:0.0764	.	46	Q2PZI1	D19L1_HUMAN	P	46	ENSP00000308695:R46P	ENSP00000308695:R46P	R	-	2	0	DPY19L1	35024074	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.569000	0.67391	1.336000	0.45506	-0.198000	0.12761	CGT		0.323	DPY19L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337506.1			
FAM83C	128876	hgsc.bcm.edu;ucsc.edu	37	20	33875097	33875099	+	In_Frame_Del	DEL	CTT	CTT	-	rs141444210		TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	CTT	CTT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr20:33875097_33875099delCTT	ENST00000374408.3	-	4	1579_1581	c.1483_1485delAAG	c.(1483-1485)aagdel	p.K495del	EIF6_ENST00000374450.3_5'Flank|FAM83C-AS1_ENST00000429167.1_RNA|EIF6_ENST00000374443.3_5'Flank|EIF6_ENST00000462894.1_5'Flank|EIF6_ENST00000374436.3_5'Flank	NM_178468.5	NP_848563.1	Q9BQN1	FA83C_HUMAN	family with sequence similarity 83, member C	495										central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(19)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(18;0.00252)			CCTTCTTCTCCTTCTCCTCCACT	0.626																																																	0																																										SO:0001651	inframe_deletion	128876			AL121753	CCDS13251.1	20q11.22	2011-04-01	2006-03-23	2006-03-23	ENSG00000125998	ENSG00000125998			16121	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 128"""	C20orf128			Standard	NM_178468		Approved	dJ614O4.7	uc021wck.1	Q9BQN1	OTTHUMG00000032332	ENST00000374408.3:c.1483_1485delAAG	20.37:g.33875097_33875099delCTT	ENSP00000363529:p.Lys495del	Somatic		WXS	Illumina HiSeq	Phase_I	Q14D67|Q5JWN6|Q8N276	In_Frame_Del	DEL	ENST00000374408.3	37	CCDS13251.1																																																																																				0.626	FAM83C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078854.3			
FKBP9P1	360132	broad.mit.edu	37	7	55755510	55755510	+	RNA	SNP	A	A	G			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr7:55755510A>G	ENST00000455909.1	-	0	496				RNU6-389P_ENST00000517048.1_RNA	NR_027340.1|NR_027342.1		Q75LS8	FKB9L_HUMAN							protein folding (GO:0006457)		calcium ion binding (GO:0005509)	p.I17T(1)		endometrium(1)|kidney(1)|lung(3)	5						AGGCGGAATGATCACTGTCCG	0.512																																																	1	Substitution - Missense(1)	kidney(1)											42.0	44.0	43.0					7																	55755510		692	1578	2270			360132																															7.37:g.55755510A>G		Somatic		WXS	Illumina GAIIx	Phase_I	B2R7H1	Missense_Mutation	SNP	ENST00000455909.1	37																																																																																					0.512	FKBP9L-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000251473.2			
FMN2	56776	hgsc.bcm.edu	37	1	240371075	240371075	+	Missense_Mutation	SNP	C	C	T	rs71646825		TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr1:240371075C>T	ENST00000319653.9	+	5	3193	c.2963C>T	c.(2962-2964)cCt>cTt	p.P988L		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	988	FH1.|Pro-rich.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			GGCATACCCCCTCCTCCCCCA	0.711																																																	0													13.0	15.0	15.0					1																	240371075		2181	4262	6443	SO:0001583	missense	56776			AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.2963C>T	1.37:g.240371075C>T	ENSP00000318884:p.Pro988Leu	Somatic		WXS	Illumina HiSeq	Phase_I	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Missense_Mutation	SNP	ENST00000319653.9	37	CCDS31069.2	391	0.17902930402930403	114	0.23170731707317074	55	0.15193370165745856	93	0.16258741258741258	129	0.17018469656992086	C	8.181	0.793768	0.16327	.	.	ENSG00000155816	ENST00000319653	T	0.65549	-0.16	2.73	0.76	0.18442	Actin-binding FH2/DRF autoregulatory (1);Formin Homology 1 (1);	.	.	.	.	T	0.00039	0.0001	M	0.90542	3.125	0.24734	P	0.99307642	B	0.12630	0.006	B	0.12156	0.007	T	0.08700	-1.0709	7	.	.	.	.	5.5141	0.16896	0.0:0.5739:0.1599:0.2661	.	988	Q9NZ56	FMN2_HUMAN	L	988	ENSP00000318884:P988L	.	P	+	2	0	FMN2	238437698	0.082000	0.21442	0.001000	0.08648	0.076000	0.17211	1.602000	0.36783	0.229000	0.21039	0.472000	0.43445	CCT		0.711	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096217.2		XM_371352	
FNIP2	57600	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	159790324	159790324	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr4:159790324G>A	ENST00000264433.6	+	13	2611	c.2536G>A	c.(2536-2538)Gaa>Aaa	p.E846K	FNIP2_ENST00000379346.3_Missense_Mutation_p.E869K	NM_020840.1	NP_065891.1	Q9P278	FNIP2_HUMAN	folliculin interacting protein 2	846	Interaction with PRKAA1.				intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein phosphorylation (GO:0006468)|regulation of protein phosphorylation (GO:0001932)	cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.E846K(1)|p.E172K(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)	9	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.00936)		GAAGGCTGCGGAAGGACCTGT	0.642																																																	2	Substitution - Missense(2)	kidney(2)											54.0	58.0	57.0					4																	159790324		2067	4225	6292	SO:0001583	missense	57600			AB040883	CCDS47155.1	4q32.1	2012-10-31			ENSG00000052795	ENSG00000052795			29280	protein-coding gene	gene with protein product	"""O6-methylguanine-induced apoptosis 1"""	612768				18403135	Standard	NM_020840		Approved	KIAA1450, FNIPL, MAPO1	uc003iqe.4	Q9P278	OTTHUMG00000161983	ENST00000264433.6:c.2536G>A	4.37:g.159790324G>A	ENSP00000264433:p.Glu846Lys	Somatic		WXS	Illumina HiSeq	Phase_I	Q05DC3|Q96I31|Q9H994	Missense_Mutation	SNP	ENST00000264433.6	37	CCDS47155.1	.	.	.	.	.	.	.	.	.	.	G	6.499	0.460349	0.12342	.	.	ENSG00000052795	ENST00000264433;ENST00000379346	T;T	0.21543	2.01;2.0	4.79	1.09	0.20402	.	1.031530	0.07604	N	0.924210	T	0.12050	0.0293	N	0.12182	0.205	0.09310	N	1	B	0.11235	0.004	B	0.11329	0.006	T	0.37502	-0.9703	9	.	.	.	.	9.7097	0.40238	0.3043:0.0:0.6957:0.0	.	846	Q9P278	FNIP2_HUMAN	K	846;869	ENSP00000264433:E846K;ENSP00000368651:E869K	.	E	+	1	0	FNIP2	160009774	0.022000	0.18835	0.000000	0.03702	0.022000	0.10575	1.789000	0.38724	0.311000	0.23014	0.655000	0.94253	GAA		0.642	FNIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366602.1		NM_020840	
GAA	2548	broad.mit.edu;hgsc.bcm.edu	37	17	78090845	78090845	+	Silent	SNP	C	C	T			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr17:78090845C>T	ENST00000302262.3	+	16	2487	c.2268C>T	c.(2266-2268)ctC>ctT	p.L756L	GAA_ENST00000390015.3_Silent_p.L756L	NM_000152.3	NP_000143.2	P10253	LYAG_HUMAN	glucosidase, alpha; acid	756					cardiac muscle contraction (GO:0060048)|diaphragm contraction (GO:0002086)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|heart morphogenesis (GO:0003007)|locomotory behavior (GO:0007626)|lysosome organization (GO:0007040)|maltose metabolic process (GO:0000023)|muscle cell cellular homeostasis (GO:0046716)|neuromuscular process controlling balance (GO:0050885)|neuromuscular process controlling posture (GO:0050884)|regulation of the force of heart contraction (GO:0002026)|sucrose metabolic process (GO:0005985)|tissue development (GO:0009888)|vacuolar sequestering (GO:0043181)	extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|maltose alpha-glucosidase activity (GO:0032450)	p.L756L(1)		autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|lung(6)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	21	all_neural(118;0.117)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.139)		Acarbose(DB00284)|Miglitol(DB00491)	CCCCAGTGCTCCAGGCCGGGA	0.647																																																	1	Substitution - coding silent(1)	kidney(1)											65.0	60.0	61.0					17																	78090845		2203	4300	6503	SO:0001819	synonymous_variant	2548				CCDS32760.1	17q25.2-q25.3	2014-09-17	2008-08-01				3.2.1.20		4065	protein-coding gene	gene with protein product	"""Pompe disease"", ""glycogen storage disease type II"""	606800					Standard	NM_000152		Approved		uc002jxq.3	P10253		ENST00000302262.3:c.2268C>T	17.37:g.78090845C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q09GN4|Q14351|Q16302|Q8IWE7	Silent	SNP	ENST00000302262.3	37	CCDS32760.1																																																																																				0.647	GAA-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437441.1			
GABRB1	2560	hgsc.bcm.edu;ucsc.edu	37	4	47408773	47408774	+	Frame_Shift_Del	DEL	AA	AA	-			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	AA	AA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr4:47408773_47408774delAA	ENST00000295454.3	+	8	1202_1203	c.910_911delAA	c.(910-912)aaafs	p.K304fs	GABRB1_ENST00000538619.1_Frame_Shift_Del_p.K234fs	NM_000812.3	NP_000803.2	P18505	GBRB1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta 1	304	Allosteric effector binding. {ECO:0000250}.				cellular response to histamine (GO:0071420)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|GABA-A receptor complex (GO:1902711)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|ligand-gated ion channel activity (GO:0015276)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44					Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Gamma Hydroxybutyric Acid(DB01440)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lindane(DB00431)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	CCCTTATGTCAAAGCGATTGAT	0.45																																																	0																																										SO:0001589	frameshift_variant	2560				CCDS3474.1	4p12	2012-06-22			ENSG00000163288	ENSG00000163288		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4081	protein-coding gene	gene with protein product	"""GABA(A) receptor, beta 1"""	137190					Standard	NM_000812		Approved		uc003gxh.3	P18505	OTTHUMG00000044269	ENST00000295454.3:c.910_911delAA	4.37:g.47408773_47408774delAA	ENSP00000295454:p.Lys304fs	Somatic		WXS	Illumina HiSeq	Phase_I	B2R6U7|D6REL3|Q16166|Q8TBK3	Frame_Shift_Del	DEL	ENST00000295454.3	37	CCDS3474.1																																																																																				0.450	GABRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216896.1			
GATA2	2624	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	128200752	128200753	+	Frame_Shift_Ins	INS	-	-	T	rs544866789		TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr3:128200752_128200753insT	ENST00000341105.2	-	5	1383_1384	c.1052_1053insA	c.(1051-1053)aatfs	p.N351fs	GATA2_ENST00000489987.1_5'UTR|GATA2_ENST00000487848.1_Frame_Shift_Ins_p.N351fs|GATA2_ENST00000430265.2_Intron	NM_032638.4	NP_116027.2	P23769	GATA2_HUMAN	GATA binding protein 2	351					blood coagulation (GO:0007596)|cell differentiation in hindbrain (GO:0021533)|cell fate determination (GO:0001709)|cell maturation (GO:0048469)|central nervous system neuron development (GO:0021954)|commitment of neuronal cell to specific neuron type in forebrain (GO:0021902)|definitive hemopoiesis (GO:0060216)|embryonic placenta development (GO:0001892)|eosinophil fate commitment (GO:0035854)|GABAergic neuron differentiation (GO:0097154)|homeostasis of number of cells within a tissue (GO:0048873)|inner ear morphogenesis (GO:0042472)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fat cell proliferation (GO:0070345)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phagocytosis (GO:0006909)|pituitary gland development (GO:0021983)|positive regulation of angiogenesis (GO:0045766)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of phagocytosis (GO:0050766)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of forebrain neuron differentiation (GO:2000977)|regulation of histone acetylation (GO:0035065)|semicircular canal development (GO:0060872)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)|urogenital system development (GO:0001655)|ventral spinal cord interneuron differentiation (GO:0021514)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	C2H2 zinc finger domain binding (GO:0070742)|chromatin binding (GO:0003682)|enhancer sequence-specific DNA binding (GO:0001158)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(58)|kidney(2)|large_intestine(3)|lung(9)|prostate(3)|skin(1)|urinary_tract(1)	79				GBM - Glioblastoma multiforme(114;0.173)		TCGTCTGACAATTTGCACAACA	0.639			Mis		AML(CML blast transformation)																																			Dom	yes		3	3q21.3	2624	GATA binding protein 2		L	0																																										SO:0001589	frameshift_variant	2624			AF169253	CCDS3049.1, CCDS46903.1	3q21	2014-09-17	2001-11-28		ENSG00000179348	ENSG00000179348		"""GATA zinc finger domain containing"""	4171	protein-coding gene	gene with protein product		137295	"""GATA-binding protein 2"""			1714909	Standard	NM_032638		Approved	NFE1B	uc003eko.2	P23769	OTTHUMG00000159689	ENST00000341105.2:c.1053dupA	3.37:g.128200755_128200755dupT	ENSP00000345681:p.Asn351fs	Somatic		WXS	Illumina HiSeq	Phase_I	D3DNB3|Q53YE0|Q96BH0|Q96BH8|Q9BUJ6	Frame_Shift_Ins	INS	ENST00000341105.2	37	CCDS3049.1																																																																																				0.639	GATA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356925.1		NM_032638	
GPRIN3	285513	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	90170546	90170546	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr4:90170546G>T	ENST00000609438.1	-	2	1234	c.716C>A	c.(715-717)aCt>aAt	p.T239N	GPRIN3_ENST00000333209.4_Missense_Mutation_p.T239N	NM_198281.2	NP_938022.2	Q6ZVF9	GRIN3_HUMAN	GPRIN family member 3	239								p.T239N(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(5)|prostate(2)|skin(1)	36		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;5.67e-05)		AGATTCTCTAGTTAGAGGTTT	0.552																																																	1	Substitution - Missense(1)	kidney(1)											50.0	55.0	53.0					4																	90170546		2203	4300	6503	SO:0001583	missense	285513			AK124616	CCDS34030.1	4q22.1	2006-08-24				ENSG00000185477			27733	protein-coding gene	gene with protein product		611241				15488195	Standard	NM_198281		Approved	GRIN3, FLJ42625	uc003hsm.1	Q6ZVF9		ENST00000609438.1:c.716C>A	4.37:g.90170546G>T	ENSP00000476603:p.Thr239Asn	Somatic		WXS	Illumina HiSeq	Phase_I	Q8IVE4	Missense_Mutation	SNP	ENST00000609438.1	37	CCDS34030.1	.	.	.	.	.	.	.	.	.	.	G	9.978	1.227470	0.22542	.	.	ENSG00000185477	ENST00000333209	T	0.10860	2.83	4.93	0.83	0.18854	.	0.807286	0.10088	N	0.717539	T	0.05181	0.0138	N	0.14661	0.345	0.09310	N	1	B	0.18968	0.032	B	0.15870	0.014	T	0.41840	-0.9486	10	0.33940	T	0.23	0.635	1.468	0.02410	0.1827:0.1254:0.4522:0.2398	.	239	Q6ZVF9	GRIN3_HUMAN	N	239	ENSP00000328672:T239N	ENSP00000328672:T239N	T	-	2	0	GPRIN3	90389569	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.754000	0.26390	0.311000	0.23014	-0.142000	0.14014	ACT		0.552	GPRIN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363540.2		NM_198281	
HDAC6	10013	hgsc.bcm.edu;ucsc.edu	37	X	48674608	48674608	+	Silent	SNP	C	C	T			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chrX:48674608C>T	ENST00000334136.5	+	18	1732	c.1554C>T	c.(1552-1554)ggC>ggT	p.G518G	HDAC6_ENST00000444343.2_Silent_p.G532G|HDAC6_ENST00000376619.2_Silent_p.G518G			Q9UBN7	HDAC6_HUMAN	histone deacetylase 6	518	Histone deacetylase 2.				aggresome assembly (GO:0070842)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to misfolded protein (GO:0071218)|cellular response to topologically incorrect protein (GO:0035967)|histone deacetylation (GO:0016575)|Hsp90 deacetylation (GO:0070846)|intracellular protein transport (GO:0006886)|lysosome localization (GO:0032418)|macroautophagy (GO:0016236)|misfolded or incompletely synthesized protein catabolic process (GO:0006515)|negative regulation of hydrogen peroxide metabolic process (GO:0010727)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of oxidoreductase activity (GO:0051354)|negative regulation of protein complex disassembly (GO:0043242)|negative regulation of proteolysis (GO:0045861)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine deacetylation (GO:0034983)|polyubiquitinated misfolded protein transport (GO:0070845)|positive regulation of chaperone-mediated protein complex assembly (GO:0090035)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of hydrogen peroxide-mediated programmed cell death (GO:1901300)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of signal transduction (GO:0009967)|protein complex disassembly (GO:0043241)|protein deacetylation (GO:0006476)|protein polyubiquitination (GO:0000209)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of establishment of protein localization (GO:0070201)|regulation of gene expression, epigenetic (GO:0040029)|regulation of microtubule-based movement (GO:0060632)|regulation of receptor activity (GO:0010469)|response to growth factor (GO:0070848)|response to misfolded protein (GO:0051788)|response to organic substance (GO:0010033)|response to toxic substance (GO:0009636)|transcription, DNA-templated (GO:0006351)|tubulin deacetylation (GO:0090042)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	aggresome (GO:0016235)|axon (GO:0030424)|caveola (GO:0005901)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|dendrite (GO:0030425)|histone deacetylase complex (GO:0000118)|inclusion body (GO:0016234)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)	alpha-tubulin binding (GO:0043014)|beta-catenin binding (GO:0008013)|core promoter binding (GO:0001047)|dynein complex binding (GO:0070840)|enzyme binding (GO:0019899)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|Hsp90 protein binding (GO:0051879)|microtubule binding (GO:0008017)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|polyubiquitin binding (GO:0031593)|tau protein binding (GO:0048156)|tubulin deacetylase activity (GO:0042903)|zinc ion binding (GO:0008270)	p.G518G(1)		breast(2)|endometrium(6)|kidney(5)|large_intestine(8)|lung(9)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	40					Vorinostat(DB02546)	AGGAGCTGGGCCTTGCCGGGC	0.652																																					Pancreas(112;205 1675 2305 8976 15959)												1	Substitution - coding silent(1)	kidney(1)											62.0	50.0	54.0					X																	48674608		2203	4300	6503	SO:0001819	synonymous_variant	10013			AF132609	CCDS14306.1	Xp11.23	2014-06-12			ENSG00000094631	ENSG00000094631			14064	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 90"""	300272				10220385, 10048485	Standard	NM_006044		Approved	KIAA0901, JM21, HD6, FLJ16239, PPP1R90	uc004dks.1	Q9UBN7	OTTHUMG00000034496	ENST00000334136.5:c.1554C>T	X.37:g.48674608C>T		Somatic		WXS	Illumina HiSeq	Phase_I	O94975|Q6NT75|Q7L3E5|Q96CY0	Silent	SNP	ENST00000334136.5	37	CCDS14306.1																																																																																				0.652	HDAC6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083394.2		NM_006044	
HHIP	64399	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	145635414	145635414	+	Silent	SNP	T	T	C			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr4:145635414T>C	ENST00000296575.3	+	9	2116	c.1461T>C	c.(1459-1461)agT>agC	p.S487S		NM_022475.2	NP_071920.1	Q96QV1	HHIP_HUMAN	hedgehog interacting protein	487					carbohydrate metabolic process (GO:0005975)|dorsal/ventral pattern formation (GO:0009953)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|negative regulation of signal transduction (GO:0009968)|negative regulation of smoothened signaling pathway (GO:0045879)|neuroblast proliferation (GO:0007405)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|skeletal system morphogenesis (GO:0048705)|smoothened signaling pathway (GO:0007224)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	hedgehog family protein binding (GO:0097108)|oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor (GO:0016901)|quinone binding (GO:0048038)|zinc ion binding (GO:0008270)	p.S487S(1)		central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	33	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.0185)		AGCCATTCAGTAATGGTCCTT	0.383																																																	1	Substitution - coding silent(1)	kidney(1)											127.0	116.0	120.0					4																	145635414		2203	4300	6503	SO:0001819	synonymous_variant	64399			AK024645	CCDS3762.1	4q31.21-q31.3	2008-08-29	2001-11-29		ENSG00000164161	ENSG00000164161			14866	protein-coding gene	gene with protein product		606178	"""hedgehog-interacting protein"""			11435703, 11731473	Standard	NM_022475		Approved	HIP, FLJ20992	uc003ijs.2	Q96QV1	OTTHUMG00000161428	ENST00000296575.3:c.1461T>C	4.37:g.145635414T>C		Somatic		WXS	Illumina HiSeq	Phase_I	Q6PK09|Q8NCI7|Q9BXK3|Q9H1J4|Q9H7E7	Silent	SNP	ENST00000296575.3	37	CCDS3762.1																																																																																				0.383	HHIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364887.2			
IARS	3376	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	95021264	95021264	+	Missense_Mutation	SNP	A	A	T			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr9:95021264A>T	ENST00000375643.3	-	19	2154	c.1888T>A	c.(1888-1890)Tcc>Acc	p.S630T	IARS_ENST00000443024.2_Missense_Mutation_p.S630T|IARS_ENST00000375629.3_5'UTR|IARS_ENST00000447699.2_Missense_Mutation_p.S520T	NM_013417.2	NP_038203.2	P41252	SYIC_HUMAN	isoleucyl-tRNA synthetase	630					gene expression (GO:0010467)|isoleucyl-tRNA aminoacylation (GO:0006428)|osteoblast differentiation (GO:0001649)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|isoleucine-tRNA ligase activity (GO:0004822)	p.S630T(1)		breast(3)|endometrium(2)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	35					L-Isoleucine(DB00167)	ACCACAGGGGAGTTAATCAGA	0.423																																																	1	Substitution - Missense(1)	kidney(1)											63.0	60.0	61.0					9																	95021264		2203	4300	6503	SO:0001583	missense	3376			AB209234	CCDS6694.1	9q21	2011-07-01	2007-02-26		ENSG00000196305	ENSG00000196305	6.1.1.5	"""Aminoacyl tRNA synthetases / Class I"""	5330	protein-coding gene	gene with protein product	"""isoleucine tRNA ligase 1, cytoplasmic"""	600709				8812440	Standard	NM_002161		Approved	ILRS, IARS1	uc004aru.4	P41252	OTTHUMG00000020219	ENST00000375643.3:c.1888T>A	9.37:g.95021264A>T	ENSP00000364794:p.Ser630Thr	Somatic		WXS	Illumina HiSeq	Phase_I	A8KAE9|Q5TCD0|Q7Z3T4|Q9H588	Missense_Mutation	SNP	ENST00000375643.3	37	CCDS6694.1	.	.	.	.	.	.	.	.	.	.	A	28.7	4.945663	0.92593	.	.	ENSG00000196305	ENST00000375643;ENST00000443024;ENST00000447699;ENST00000375660	T;T;T	0.36520	1.25;1.25;1.25	5.45	5.45	0.79879	Rossmann-like alpha/beta/alpha sandwich fold (1);Aminoacyl-tRNA synthetase, class Ia (1);	0.000000	0.85682	D	0.000000	T	0.62901	0.2466	M	0.81341	2.54	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.68557	-0.5377	10	0.87932	D	0	-15.2477	15.1695	0.72858	1.0:0.0:0.0:0.0	.	630;475	P41252;Q6P0M4	SYIC_HUMAN;.	T	630;630;520;630	ENSP00000364794:S630T;ENSP00000406448:S630T;ENSP00000415020:S520T	ENSP00000364794:S630T	S	-	1	0	IARS	94061085	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.106000	0.77039	2.072000	0.62099	0.459000	0.35465	TCC		0.423	IARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053059.2		NM_002161	
INADL	10207	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	62237112	62237112	+	Silent	SNP	A	A	G			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr1:62237112A>G	ENST00000371158.2	+	6	648	c.534A>G	c.(532-534)agA>agG	p.R178R	INADL_ENST00000316485.6_Silent_p.R178R	NM_176877.2	NP_795352	Q8NI35	INADL_HUMAN	InaD-like (Drosophila)	178	PDZ 1. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|intracellular signal transduction (GO:0035556)|tight junction assembly (GO:0070830)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)		p.R178R(1)		breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(8)|liver(1)|lung(51)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)	103						GGGATCAAAGATTAAAGGAAA	0.308																																																	1	Substitution - coding silent(1)	kidney(1)											76.0	71.0	72.0					1																	62237112		2203	4300	6503	SO:0001819	synonymous_variant	10207			AB044807	CCDS617.2	1p31	2008-02-05			ENSG00000132849	ENSG00000132849			28881	protein-coding gene	gene with protein product		603199				9280290, 11374908	Standard	NM_176877		Approved	Cipp, PATJ	uc001dab.3	Q8NI35	OTTHUMG00000008560	ENST00000371158.2:c.534A>G	1.37:g.62237112A>G		Somatic		WXS	Illumina HiSeq	Phase_I	O15249|O43742|O60833|Q5VUA5|Q5VUA6|Q5VUA7|Q5VUA8|Q5VUA9|Q5VUB0|Q8WU78|Q9H3N9	Silent	SNP	ENST00000371158.2	37	CCDS617.2																																																																																				0.308	INADL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023639.2		NM_170605	
IL23R	149233	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	67705899	67705899	+	Missense_Mutation	SNP	C	C	G			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr1:67705899C>G	ENST00000347310.5	+	9	1254	c.1083C>G	c.(1081-1083)atC>atG	p.I361M	AL109843.1_ENST00000408806.1_RNA|IL23R_ENST00000395227.1_Missense_Mutation_p.I106M|IL23R_ENST00000371002.1_Intron|IL23R_ENST00000473881.1_Intron	NM_144701.2	NP_653302.2	Q5VWK5	IL23R_HUMAN	interleukin 23 receptor	361					defense response to Gram-negative bacterium (GO:0050829)|inflammatory response (GO:0006954)|interleukin-23-mediated signaling pathway (GO:0038155)|negative regulation of interleukin-10 production (GO:0032693)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of activation of JAK2 kinase activity (GO:0010535)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of granulocyte macrophage colony-stimulating factor production (GO:0032725)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of memory T cell differentiation (GO:0043382)|positive regulation of natural killer cell proliferation (GO:0032819)|positive regulation of NK T cell activation (GO:0051135)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of T-helper 17 cell lineage commitment (GO:2000330)|positive regulation of T-helper 17 type immune response (GO:2000318)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat4 protein (GO:0042520)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|regulation of tyrosine phosphorylation of Stat1 protein (GO:0042510)|response to interferon-gamma (GO:0034341)|response to lipopolysaccharide (GO:0032496)	interleukin-23 receptor complex (GO:0072536)|receptor complex (GO:0043235)		p.I361M(1)		breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|liver(2)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	21						TGGGAATGATCGTCTTTGCTG	0.328																																																	1	Substitution - Missense(1)	kidney(1)											231.0	209.0	216.0					1																	67705899		2203	4299	6502	SO:0001583	missense	149233			AF461422	CCDS637.1	1p31.2	2008-02-05			ENSG00000162594	ENSG00000162594			19100	protein-coding gene	gene with protein product		607562				12023369	Standard	NM_144701		Approved	IL-23R	uc001ddo.3	Q5VWK5	OTTHUMG00000009092	ENST00000347310.5:c.1083C>G	1.37:g.67705899C>G	ENSP00000321345:p.Ile361Met	Somatic		WXS	Illumina HiSeq	Phase_I	C9JGX4|Q4VGP1|Q4VGP2|Q4VGP3|Q4VGP4|Q4VGP5|Q4VGP6|Q5VWK7|Q8IW84|Q8NFQ9|Q96AS1	Missense_Mutation	SNP	ENST00000347310.5	37	CCDS637.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.43|14.43	2.532432|2.532432	0.45073|0.45073	.|.	.|.	ENSG00000162594|ENSG00000162594	ENST00000347310;ENST00000431791;ENST00000441823;ENST00000395227|ENST00000425614	T;T|.	0.34072|.	1.38;1.44|.	5.01|5.01	5.01|5.01	0.66863|0.66863	.|.	0.496991|.	0.18688|.	N|.	0.133946|.	T|T	0.27489|0.27489	0.0675|0.0675	N|N	0.22421|0.22421	0.69|0.69	0.33144|0.33144	D|D	0.544716|0.544716	P;P;P;D;P;P;D;D;P|.	0.54397|.	0.924;0.924;0.924;0.958;0.772;0.794;0.966;0.958;0.873|.	B;B;B;B;B;B;P;P;B|.	0.50192|.	0.443;0.443;0.443;0.443;0.368;0.363;0.634;0.54;0.363|.	T|T	0.10291|0.10291	-1.0636|-1.0636	10|5	0.66056|.	D|.	0.02|.	-25.5107|-25.5107	14.0103|14.0103	0.64493|0.64493	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	107;185;185;119;190;215;268;106;361|.	Q5VWK5-2;B6HY71;B6HY89;E9PHX4;E9PG12;B6HY79;B6VNT7;Q5VWK5-6;Q5VWK5|.	.;.;.;.;.;.;.;.;IL23R_HUMAN|.	M|W	361;190;119;106|123	ENSP00000321345:I361M;ENSP00000378652:I106M|.	ENSP00000321345:I361M|.	I|S	+|+	3|2	3|0	IL23R|IL23R	67478487|67478487	0.759000|0.759000	0.28416|0.28416	0.966000|0.966000	0.40874|0.40874	0.256000|0.256000	0.26092|0.26092	0.693000|0.693000	0.25497|0.25497	2.764000|2.764000	0.94973|0.94973	0.655000|0.655000	0.94253|0.94253	ATC|TCG		0.328	IL23R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025199.2		NM_144701	
FAM188B	84182	broad.mit.edu;hgsc.bcm.edu	37	7	30931623	30931623	+	3'UTR	SNP	G	G	A	rs201582796		TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr7:30931623G>A	ENST00000265299.6	+	0	2354				AQP1_ENST00000509504.1_Intron|AQP1_ENST00000434909.2_Intron|INMT-FAM188B_ENST00000458257.1_3'UTR	NM_032222.2	NP_115598.2	Q4G0A6	F188B_HUMAN	family with sequence similarity 188, member B											endometrium(1)|large_intestine(5)|lung(19)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						TCCTGTGACCGTTGGATGTGG	0.562																																																	0													169.0	174.0	173.0					7																	30931623		2050	4193	6243	SO:0001624	3_prime_UTR_variant	100526825			AK026027	CCDS43565.1	7p14.3	2010-08-17	2009-07-14	2009-07-14	ENSG00000106125	ENSG00000106125			21916	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 67"""	C7orf67			Standard	NM_032222		Approved	FLJ22374	uc003tbt.3	Q4G0A6	OTTHUMG00000152800	ENST00000265299.6:c.*3G>A	7.37:g.30931623G>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q71AZ7|Q9H6D2	RNA	SNP	ENST00000265299.6	37	CCDS43565.1																																																																																				0.562	FAM188B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327962.1		NM_032222	
INTS6	26512	broad.mit.edu;hgsc.bcm.edu	37	13	51969612	51969612	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr13:51969612A>G	ENST00000311234.4	-	5	909	c.437T>C	c.(436-438)tTa>tCa	p.L146S	INTS6_ENST00000425000.1_5'UTR|INTS6_ENST00000497989.1_5'UTR|INTS6_ENST00000420668.2_Intron|INTS6_ENST00000398119.2_Missense_Mutation_p.L133S|INTS6_ENST00000463928.1_Missense_Mutation_p.L146S	NM_012141.2	NP_036273.1	Q9UL03	INT6_HUMAN	integrator complex subunit 6	146	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				signal transduction (GO:0007165)|snRNA processing (GO:0016180)	actin cytoskeleton (GO:0015629)|integrator complex (GO:0032039)|nucleus (GO:0005634)	transmembrane signaling receptor activity (GO:0004888)	p.L146S(1)		NS(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(10)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31		Breast(56;0.000286)|Lung NSC(96;0.00145)|Prostate(109;0.00403)|Hepatocellular(98;0.065)|Myeloproliferative disorder(33;0.163)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;7.7e-08)		ATTAAGAGGTAAATGAAGCTG	0.398																																																	1	Substitution - Missense(1)	kidney(1)											52.0	47.0	49.0					13																	51969612		2203	4300	6503	SO:0001583	missense	26512			AF097645	CCDS9428.1, CCDS41890.1, CCDS45048.1	13q14.3	2010-08-20	2006-03-15	2006-03-15	ENSG00000102786	ENSG00000102786		"""DEAD-boxes"""	14879	protein-coding gene	gene with protein product		604331	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 26"""	DDX26		10467397, 16239144	Standard	XM_005266340		Approved	DICE1, HDB, Notchl2, DBI-1, DDX26A, INT6	uc001vfk.3	Q9UL03	OTTHUMG00000016945	ENST00000311234.4:c.437T>C	13.37:g.51969612A>G	ENSP00000310260:p.Leu146Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q0P664|Q6PJP4|Q9UFK0|Q9Y5M9	Missense_Mutation	SNP	ENST00000311234.4	37	CCDS9428.1	.	.	.	.	.	.	.	.	.	.	A	25.0	4.594379	0.86953	.	.	ENSG00000102786	ENST00000311234;ENST00000398119;ENST00000491189	.	.	.	5.92	5.92	0.95590	von Willebrand factor, type A (2);	0.000000	0.85682	D	0.000000	D	0.85371	0.5681	M	0.91920	3.255	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.88609	0.3155	9	0.87932	D	0	-8.527	15.5442	0.76081	1.0:0.0:0.0:0.0	.	146	Q9UL03	INT6_HUMAN	S	146;133;73	.	ENSP00000310260:L146S	L	-	2	0	INTS6	50867613	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.339000	0.96797	2.266000	0.75297	0.533000	0.62120	TTA		0.398	INTS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045023.1		NM_012141	
KHK	3795	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	27317803	27317803	+	Intron	SNP	G	G	A	rs200086908		TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr2:27317803G>A	ENST00000260599.6	+	3	857				KHK_ENST00000260598.5_Splice_Site|KHK_ENST00000490823.1_Intron	NM_000221.2	NP_000212.1	P50053	KHK_HUMAN	ketohexokinase (fructokinase)						carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose catabolic process (GO:0006001)|regulation of glycogen metabolic process (GO:0070873)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ketohexokinase activity (GO:0004454)	p.?(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(2)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	16	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCCATGACACGTAAGGCCCCC	0.607													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17742	0.0		0.0	False		,,,				2504	0.0																1	Unknown(1)	kidney(1)											76.0	69.0	71.0					2																	27317803		2203	4300	6503	SO:0001627	intron_variant	3795				CCDS1734.1, CCDS1735.1	2p23.3-p23.2	2008-02-05			ENSG00000138030	ENSG00000138030	2.7.1.3		6315	protein-coding gene	gene with protein product		614058				7833921	Standard	NM_000221		Approved		uc002rim.2	P50053	OTTHUMG00000097077	ENST00000260599.6:c.344+324G>A	2.37:g.27317803G>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q6IBK2|Q99532|Q9BRJ3|Q9UMN1	Splice_Site	SNP	ENST00000260599.6	37	CCDS1734.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.135130	0.77662	.	.	ENSG00000138030	ENST00000260598;ENST00000429697	.	.	.	5.2	5.2	0.72013	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.5908	0.68362	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	KHK	27171307	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	8.327000	0.90012	2.605000	0.88082	0.561000	0.74099	.		0.607	KHK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214196.1			
KIAA0586	9786	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	58932590	58932590	+	Missense_Mutation	SNP	C	C	G			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr14:58932590C>G	ENST00000556134.1	+	16	2326	c.2052C>G	c.(2050-2052)ttC>ttG	p.F684L	KIAA0586_ENST00000423743.3_Missense_Mutation_p.F655L|KIAA0586_ENST00000261244.5_Missense_Mutation_p.F623L|KIAA0586_ENST00000538571.2_3'UTR|KIAA0586_ENST00000354386.6_Missense_Mutation_p.F752L	NM_001244190.1|NM_001244193.1	NP_001231119.1|NP_001231122.1	Q9BVV6	TALD3_HUMAN	KIAA0586	684					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|regulation of establishment of protein localization (GO:0070201)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)		p.F752L(1)|p.F623L(1)		endometrium(4)|kidney(6)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						AGACTGACTTCTATGCAACAA	0.343																																																	2	Substitution - Missense(2)	kidney(2)											113.0	105.0	108.0					14																	58932590		1863	4103	5966	SO:0001583	missense	9786			AB011158	CCDS45115.1, CCDS58320.1, CCDS58321.1, CCDS58322.1, CCDS73639.1	14q23.1	2012-12-06			ENSG00000100578	ENSG00000100578			19960	protein-coding gene	gene with protein product		610178				16702409	Standard	NM_014749		Approved	Talpid3	uc010trr.2	Q9BVV6	OTTHUMG00000171141	ENST00000556134.1:c.2052C>G	14.37:g.58932590C>G	ENSP00000452351:p.Phe684Leu	Somatic		WXS	Illumina HiSeq	Phase_I	B4DZB6|E7EWM8|J3KQH9|O60328|Q6NYC6|Q6UV20	Missense_Mutation	SNP	ENST00000556134.1	37	CCDS58321.1	.	.	.	.	.	.	.	.	.	.	C	12.93	2.084692	0.36758	.	.	ENSG00000100578	ENST00000354386;ENST00000556134;ENST00000423743;ENST00000261244;ENST00000546216	T;T;T;T	0.40756	1.02;1.02;1.02;1.02	5.21	-3.8	0.04307	.	0.379771	0.25430	N	0.030729	T	0.15609	0.0376	N	0.24115	0.695	0.09310	N	1	B;B;B;B;B;B	0.30605	0.0;0.0;0.287;0.085;0.0;0.0	B;B;B;B;B;B	0.26864	0.003;0.002;0.074;0.035;0.003;0.003	T	0.19418	-1.0306	10	0.12103	T	0.63	.	0.9502	0.01374	0.1658:0.2052:0.2711:0.3579	.	559;559;752;623;684;655	F5GWA3;B7Z7W7;E7EWM8;E9PGW8;Q9BVV6;Q6UV20	.;.;.;.;K0586_HUMAN;.	L	752;684;655;623;559	ENSP00000346359:F752L;ENSP00000452351:F684L;ENSP00000399427:F655L;ENSP00000261244:F623L	ENSP00000261244:F623L	F	+	3	2	KIAA0586	58002343	0.000000	0.05858	0.618000	0.29105	0.348000	0.29142	-0.067000	0.11579	-0.241000	0.09681	-0.302000	0.09304	TTC		0.343	KIAA0586-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000411887.1		NM_014749	
KLF11	8462	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	10186515	10186515	+	Missense_Mutation	SNP	T	T	C			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr2:10186515T>C	ENST00000305883.1	+	2	443	c.281T>C	c.(280-282)cTa>cCa	p.L94P	KLF11_ENST00000540845.1_Missense_Mutation_p.L77P|KLF11_ENST00000535335.1_Missense_Mutation_p.L77P	NM_003597.4	NP_003588.1	O14901	KLF11_HUMAN	Kruppel-like factor 11	94					apoptotic process (GO:0006915)|cellular response to peptide (GO:1901653)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of apoptotic process (GO:0043065)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.L94P(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.133)|OV - Ovarian serous cystadenocarcinoma(76;0.228)		ACACCTGAACTACCAAAAGAC	0.502																																					Melanoma(56;431 1507 23687 50789)												1	Substitution - Missense(1)	kidney(1)											97.0	89.0	92.0					2																	10186515		2203	4300	6503	SO:0001583	missense	8462			AF028008	CCDS1668.1, CCDS54333.1	2p25	2013-01-08	2004-11-29	2004-12-01	ENSG00000172059	ENSG00000172059		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	11811	protein-coding gene	gene with protein product		603301	"""TGFB inducible early growth response 2"""	TIEG2		9748269, 11087666	Standard	NM_001177716		Approved	Tieg3, MODY7	uc002raf.1	O14901	OTTHUMG00000119004	ENST00000305883.1:c.281T>C	2.37:g.10186515T>C	ENSP00000307023:p.Leu94Pro	Somatic		WXS	Illumina HiSeq	Phase_I	B4DZE7|Q9EPF4	Missense_Mutation	SNP	ENST00000305883.1	37	CCDS1668.1	.	.	.	.	.	.	.	.	.	.	T	17.57	3.423404	0.62733	.	.	ENSG00000172059	ENST00000401510;ENST00000305883;ENST00000448523;ENST00000540845;ENST00000440320;ENST00000535335	T;T;T;T;T;T	0.65178	-0.09;2.52;-0.14;2.51;-0.09;2.51	5.4	4.22	0.49857	.	0.541252	0.19495	N	0.112882	T	0.60818	0.2298	M	0.71581	2.175	0.58432	D	0.999999	B	0.26195	0.144	B	0.21546	0.035	T	0.60172	-0.7315	10	0.72032	D	0.01	.	11.5665	0.50809	0.1341:0.0:0.0:0.8659	.	94	O14901	KLF11_HUMAN	P	77;94;77;77;77;77	ENSP00000386058:L77P;ENSP00000307023:L94P;ENSP00000387866:L77P;ENSP00000444690:L77P;ENSP00000388263:L77P;ENSP00000442722:L77P	ENSP00000307023:L94P	L	+	2	0	KLF11	10103966	0.573000	0.26676	0.997000	0.53966	0.706000	0.40770	2.785000	0.47782	0.845000	0.35118	0.379000	0.24179	CTA		0.502	KLF11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000239202.3		NM_003597	
LACRT	90070	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	55026040	55026040	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr12:55026040C>A	ENST00000257867.4	-	3	291	c.238G>T	c.(238-240)Gaa>Taa	p.E80*	LACRT_ENST00000547511.1_Nonsense_Mutation_p.E80*	NM_033277.1	NP_150593.1	Q9GZZ8	LACRT_HUMAN	lacritin	80					calcineurin-NFAT signaling cascade (GO:0033173)|calcium-mediated signaling (GO:0019722)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of secretion (GO:0051047)|protein localization to Golgi apparatus (GO:0034067)|tear secretion (GO:0070075)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|secretory granule (GO:0030141)	collagen binding (GO:0005518)|fibronectin binding (GO:0001968)|glycoprotein binding (GO:0001948)|growth factor activity (GO:0008083)|laminin-1 binding (GO:0043237)|protein N-terminus binding (GO:0047485)	p.E80*(1)		breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(1)|lung(4)|stomach(1)	10						GGGTTTAGTTCCTGCCTGCTT	0.552																																																	1	Substitution - Nonsense(1)	kidney(1)											123.0	116.0	119.0					12																	55026040		2203	4300	6503	SO:0001587	stop_gained	90070			AF238867	CCDS8883.1	12q13.2	2014-06-13			ENSG00000135413				16430	protein-coding gene	gene with protein product		607360				11419941	Standard	NM_033277		Approved	LACRITIN	uc001sgi.1	Q9GZZ8	OTTHUMG00000169936	ENST00000257867.4:c.238G>T	12.37:g.55026040C>A	ENSP00000257867:p.Glu80*	Somatic		WXS	Illumina HiSeq	Phase_I		Nonsense_Mutation	SNP	ENST00000257867.4	37	CCDS8883.1	.	.	.	.	.	.	.	.	.	.	C	10.36	1.328677	0.24167	.	.	ENSG00000135413	ENST00000546721;ENST00000547511;ENST00000257867	.	.	.	2.73	-5.46	0.02608	.	.	.	.	.	.	.	.	.	.	.	0.58432	A	0.99999	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	1.6025	0.02677	0.1589:0.4425:0.1601:0.2385	.	.	.	.	X	50;80;80	.	ENSP00000257867:E80X	E	-	1	0	LACRT	53312307	0.000000	0.05858	0.000000	0.03702	0.027000	0.11550	-2.673000	0.00842	-1.868000	0.01142	0.462000	0.41574	GAA		0.552	LACRT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406615.1		NM_033277	
LAMC2	3918	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	183177097	183177098	+	Missense_Mutation	DNP	TC	TC	AA			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	T|C	T|C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr1:183177097_183177098TC>AA	ENST00000264144.4	+	2	226_227	c.161_162TC>AA	c.(160-162)cTC>cAA	p.L54Q	LAMC2_ENST00000493293.1_Missense_Mutation_p.L54Q	NM_005562.2	NP_005553.2	Q13753	LAMC2_HUMAN	laminin, gamma 2	54	Laminin EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00460}.				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	cell cortex (GO:0005938)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-2 complex (GO:0005607)|laminin-5 complex (GO:0005610)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	heparin binding (GO:0008201)	p.L54L(1)|p.L54H(1)|p.L54>?(1)		breast(2)|endometrium(6)|kidney(8)|large_intestine(11)|lung(18)|ovary(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55						TTCCGCTGCCTCAACTGCAATG	0.485																																																	3	Substitution - Missense(1)|Complex(1)|Substitution - coding silent(1)	kidney(3)																																								SO:0001583	missense	3918			Z15008	CCDS1352.1, CCDS44285.1	1q25-q31	2013-03-01	2002-08-29		ENSG00000058085	ENSG00000058085		"""Laminins"""	6493	protein-coding gene	gene with protein product		150292	"""laminin, gamma 2 (nicein (100kD), kalinin (105kD), BM600 (100kD), Herlitz junctional epidermolysis bullosa))"""	EBR2, LAMB2T, LAMNB2, EBR2A		1383240	Standard	NM_005562		Approved	nicein-100kDa, kalinin-105kDa, BM600-100kDa	uc001gqa.2	Q13753	OTTHUMG00000035520	Exception_encountered	1.37:g.183177097_183177098delinsAA	ENSP00000264144:p.Leu54Gln	Somatic		WXS	Illumina HiSeq	Phase_I	Q02536|Q02537|Q13752|Q14941|Q14DF7|Q2M1N2|Q5VYE8	Missense_Mutation|Silent	SNP	ENST00000264144.4	37	CCDS1352.1																																																																																				0.485	LAMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086258.1		NM_005562	
LMOD1	25802	broad.mit.edu	37	1	201869657	201869657	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr1:201869657G>A	ENST00000367288.4	-	2	730	c.484C>T	c.(484-486)Cgg>Tgg	p.R162W	RP11-307B6.3_ENST00000414927.1_RNA|RP11-307B6.3_ENST00000458139.1_RNA	NM_012134.2	NP_036266.2	P29536	LMOD1_HUMAN	leiomodin 1 (smooth muscle)	162					muscle contraction (GO:0006936)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)		p.R162W(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|liver(1)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26						GCCCTGACCCGGCCCTTGTCA	0.547																																																	1	Substitution - Missense(1)	kidney(1)											69.0	72.0	71.0					1																	201869657		2029	4169	6198	SO:0001583	missense	25802			X54162	CCDS53457.1	1q32.1	2008-05-22			ENSG00000163431	ENSG00000163431			6647	protein-coding gene	gene with protein product		602715					Standard	NM_012134		Approved	64kD, D1, 1D	uc021phl.1	P29536	OTTHUMG00000035802	ENST00000367288.4:c.484C>T	1.37:g.201869657G>A	ENSP00000356257:p.Arg162Trp	Somatic		WXS	Illumina GAIIx	Phase_I	B1APV6|C4AMB1|Q68EN2	Missense_Mutation	SNP	ENST00000367288.4	37	CCDS53457.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.096503	0.76870	.	.	ENSG00000163431	ENST00000367288;ENST00000400965;ENST00000412469	T	0.14144	2.53	5.77	2.46	0.29980	.	0.000000	0.36893	N	0.002345	T	0.28797	0.0714	M	0.67953	2.075	0.33876	D	0.635491	D;D	0.76494	0.999;0.999	P;P	0.60886	0.88;0.549	T	0.45731	-0.9241	10	0.72032	D	0.01	-36.2117	11.1399	0.48396	0.0:0.0:0.3997:0.6003	.	111;162	B4E3S9;P29536	.;LMOD1_HUMAN	W	162;162;111	ENSP00000356257:R162W	ENSP00000356257:R162W	R	-	1	2	LMOD1	200136280	0.967000	0.33354	1.000000	0.80357	0.993000	0.82548	0.384000	0.20668	0.702000	0.31825	0.655000	0.94253	CGG		0.547	LMOD1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087085.2			
Unknown	0	broad.mit.edu	37	13	19412668	19412668	+	IGR	SNP	C	C	T			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr13:19412668C>T								LINC00418 (118799 upstream) : RP11-38M15.11 (21298 downstream)																							TTCAACAGTTCAGAATTGAGC	0.348																																																	0																																										SO:0001628	intergenic_variant	0																															13.37:g.19412668C>T		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP		37																																																																																				0	0.348									
MMP2	4313	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	55519326	55519326	+	Silent	SNP	G	G	A			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr16:55519326G>A	ENST00000219070.4	+	4	1154	c.645G>A	c.(643-645)ttG>ttA	p.L215L	MMP2_ENST00000437642.2_Silent_p.L165L|MMP2_ENST00000543485.1_Silent_p.L139L|MMP2_ENST00000570308.1_Silent_p.L139L	NM_004530.4	NP_004521.1	P08253	MMP2_HUMAN	matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase)	215	Collagenase-like 1.				angiogenesis (GO:0001525)|blood vessel maturation (GO:0001955)|bone trabecula formation (GO:0060346)|cellular protein metabolic process (GO:0044267)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|intramembranous ossification (GO:0001957)|positive regulation of innate immune response (GO:0045089)|proteolysis (GO:0006508)|response to hypoxia (GO:0001666)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)|sarcomere (GO:0030017)	metalloendopeptidase activity (GO:0004222)|serine-type endopeptidase activity (GO:0004252)|zinc ion binding (GO:0008270)	p.L215L(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(12)|liver(2)|lung(23)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	58		Renal(780;0.00183)|Breast(268;0.00354)|Hepatocellular(780;0.00826)|all_neural(199;0.0189)		UCEC - Uterine corpus endometrioid carcinoma (183;0.0185)|all cancers(182;7.16e-45)|Epithelial(162;5.26e-37)|GBM - Glioblastoma multiforme(240;9e-08)|Kidney(780;0.00227)|BRCA - Breast invasive adenocarcinoma(181;0.00786)	Captopril(DB01197)|Marimastat(DB00786)	TATGGACCTTGGGAGAAGGCC	0.587																																																	1	Substitution - coding silent(1)	kidney(1)											90.0	80.0	84.0					16																	55519326		2198	4300	6498	SO:0001819	synonymous_variant	4313				CCDS10752.1, CCDS45487.1	16q13-q21	2008-02-05	2005-08-08		ENSG00000087245	ENSG00000087245	3.4.24.24		7166	protein-coding gene	gene with protein product		120360	"""matrix metalloproteinase 2 (gelatinase A, 72kD gelatinase, 72kD type IV collagenase)"", ""matrix metalloproteinase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase)"""	CLG4, CLG4A			Standard	NM_004530		Approved	TBE-1	uc002ehz.4	P08253	OTTHUMG00000133202	ENST00000219070.4:c.645G>A	16.37:g.55519326G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B2R6U1|B4DWH3|E9PE45|Q9UCJ8	Silent	SNP	ENST00000219070.4	37	CCDS10752.1																																																																																				0.587	MMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256913.3			
MORC3	23515	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	21	37736413	37736413	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr21:37736413G>A	ENST00000400485.1	+	14	1551	c.1475G>A	c.(1474-1476)cGg>cAg	p.R492Q	AP000692.9_ENST00000397184.2_RNA|MORC3_ENST00000487909.1_3'UTR	NM_015358.2	NP_056173.1	Q14149	MORC3_HUMAN	MORC family CW-type zinc finger 3	492					cell aging (GO:0007569)|maintenance of protein location in nucleus (GO:0051457)|negative regulation of fibroblast proliferation (GO:0048147)|peptidyl-serine phosphorylation (GO:0018105)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)	PML body (GO:0016605)	zinc ion binding (GO:0008270)	p.R492Q(1)		breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(9)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	35						CTGTTGTTTCGGCCAACTGCT	0.383																																																	1	Substitution - Missense(1)	kidney(1)											129.0	117.0	120.0					21																	37736413		1861	4096	5957	SO:0001583	missense	23515			AK025327	CCDS42924.1	21q22.13	2005-06-15	2005-06-15	2005-06-15	ENSG00000159256	ENSG00000159256			23572	protein-coding gene	gene with protein product		610078	"""zinc finger, CW-type with coiled-coil domain 3"", ""zinc finger, CW type with coiled-coil domain 3"""	ZCWCC3		14607086	Standard	NM_015358		Approved	ZCW5, NXP2, KIAA0136	uc002yvi.3	Q14149	OTTHUMG00000086620	ENST00000400485.1:c.1475G>A	21.37:g.37736413G>A	ENSP00000383333:p.Arg492Gln	Somatic		WXS	Illumina HiSeq	Phase_I	A8KA92|Q9UEZ2	Missense_Mutation	SNP	ENST00000400485.1	37	CCDS42924.1	.	.	.	.	.	.	.	.	.	.	G	5.361	0.251920	0.10185	.	.	ENSG00000159256	ENST00000400485	T	0.13420	2.59	5.38	1.19	0.21007	.	0.831221	0.10244	N	0.698016	T	0.04634	0.0126	N	0.03115	-0.41	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.44081	-0.9351	10	0.18710	T	0.47	-0.6205	2.3788	0.04348	0.172:0.2945:0.3986:0.135	.	492	Q14149	MORC3_HUMAN	Q	492	ENSP00000383333:R492Q	ENSP00000383333:R492Q	R	+	2	0	MORC3	36658283	0.001000	0.12720	0.002000	0.10522	0.764000	0.43329	0.461000	0.21940	0.311000	0.23014	0.561000	0.74099	CGG		0.383	MORC3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000194640.1		NM_015358	
MTOR	2475	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	11210198	11210198	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr1:11210198C>T	ENST00000361445.4	-	31	4631	c.4555G>A	c.(4555-4557)Gct>Act	p.A1519T	MTOR-AS1_ENST00000420480.1_RNA|RNU6-537P_ENST00000517277.1_RNA|MTOR-AS1_ENST00000445982.1_RNA	NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)	1519	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.				cell growth (GO:0016049)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell development (GO:0007281)|growth (GO:0040007)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of macroautophagy (GO:0016242)|negative regulation of NFAT protein import into nucleus (GO:0051534)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of carbohydrate utilization (GO:0043610)|regulation of fatty acid beta-oxidation (GO:0031998)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of response to food (GO:0032095)|response to amino acid (GO:0043200)|response to nutrient (GO:0007584)|response to stress (GO:0006950)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|phosphatidylinositol 3-kinase complex (GO:0005942)|PML body (GO:0016605)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	ATP binding (GO:0005524)|drug binding (GO:0008144)|kinase activity (GO:0016301)|phosphoprotein binding (GO:0051219)|protein serine/threonine kinase activity (GO:0004674)|ribosome binding (GO:0043022)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)	p.A1519T(1)		breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)	CCCCATGCAGCTGCAGCAGCC	0.542																																																	1	Substitution - Missense(1)	kidney(1)											77.0	69.0	72.0					1																	11210198		2203	4300	6503	SO:0001583	missense	2475			L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793			3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1		8008069, 8660990	Standard	NM_004958		Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.4555G>A	1.37:g.11210198C>T	ENSP00000354558:p.Ala1519Thr	Somatic		WXS	Illumina HiSeq	Phase_I	Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	Missense_Mutation	SNP	ENST00000361445.4	37	CCDS127.1	.	.	.	.	.	.	.	.	.	.	C	34	5.346891	0.95807	.	.	ENSG00000198793	ENST00000361445;ENST00000539766	T	0.74947	-0.89	5.16	5.16	0.70880	PIK-related kinase (1);PIK-related kinase, FAT (1);Armadillo-like helical (1);	0.000000	0.85682	D	0.000000	D	0.90957	0.7157	H	0.95950	3.745	0.80722	D	1	D	0.69078	0.997	D	0.77004	0.989	D	0.93678	0.6996	10	0.87932	D	0	-23.8113	19.0171	0.92899	0.0:1.0:0.0:0.0	.	1519	P42345	MTOR_HUMAN	T	1519	ENSP00000354558:A1519T	ENSP00000354558:A1519T	A	-	1	0	MTOR	11132785	1.000000	0.71417	0.992000	0.48379	0.993000	0.82548	7.379000	0.79691	2.561000	0.86390	0.655000	0.94253	GCT		0.542	MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005558.1		NM_004958	
MUC16	94025	hgsc.bcm.edu;ucsc.edu	37	19	9075200	9075200	+	Missense_Mutation	SNP	A	A	T			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr19:9075200A>T	ENST00000397910.4	-	3	12449	c.12246T>A	c.(12244-12246)ttT>ttA	p.F4082L		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	4084	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.F4082L(2)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TCATGGCAGGAAAGTTAGACA	0.488																																																	2	Substitution - Missense(2)	kidney(2)											105.0	101.0	102.0					19																	9075200		1992	4159	6151	SO:0001583	missense	94025			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.12246T>A	19.37:g.9075200A>T	ENSP00000381008:p.Phe4082Leu	Somatic		WXS	Illumina HiSeq	Phase_I	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	a	6.746	0.506509	0.12883	.	.	ENSG00000181143	ENST00000397910	T	0.02446	4.29	2.09	-1.4	0.08968	.	.	.	.	.	T	0.02494	0.0076	L	0.34521	1.04	.	.	.	B	0.16603	0.018	B	0.15870	0.014	T	0.36212	-0.9757	8	0.87932	D	0	.	5.0909	0.14708	0.5045:0.0:0.4955:0.0	.	4082	B5ME49	.	L	4082	ENSP00000381008:F4082L	ENSP00000381008:F4082L	F	-	3	2	MUC16	8936200	0.000000	0.05858	0.000000	0.03702	0.041000	0.13682	-1.175000	0.03102	-0.277000	0.09193	-0.765000	0.03448	TTT		0.488	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1		NM_024690	
NBEAL1	65065	broad.mit.edu;ucsc.edu	37	2	204045216	204045217	+	Frame_Shift_Del	DEL	GT	GT	-			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	GT	GT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr2:204045216_204045217delGT	ENST00000449802.1	+	42	6822_6823	c.6489_6490delGT	c.(6487-6492)gagtttfs	p.EF2163fs		NM_001114132.1	NP_001107604.1	Q6ZS30	NBEL1_HUMAN	neurobeachin-like 1	2163	BEACH. {ECO:0000255|PROSITE- ProRule:PRU00026}.									NS(1)|breast(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|liver(1)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37						ATTTCCCAGAGTTTTTGGAAAA	0.356																																																	0																																										SO:0001589	frameshift_variant	65065			AY172970	CCDS46495.1	2q33	2013-01-10			ENSG00000144426	ENSG00000144426		"""WD repeat domain containing"""	20681	protein-coding gene	gene with protein product		609816	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 17"", ""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 16"""	ALS2CR17, ALS2CR16		15193433	Standard	NM_001114132		Approved	MGC164581	uc002uzt.3	Q6ZS30	OTTHUMG00000154129	ENST00000449802.1:c.6489_6490delGT	2.37:g.204045216_204045217delGT	ENSP00000399903:p.Glu2163fs	Somatic		WXS	Illumina GAIIx	Phase_I	A6NHD5|Q6Y876|Q6ZP36|Q6ZQY5|Q8N8R4|Q96Q30|Q96Q31	Frame_Shift_Del	DEL	ENST00000449802.1	37	CCDS46495.1																																																																																				0.356	NBEAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333982.4			
NEBL	10529	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	21124510	21124510	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr10:21124510C>A	ENST00000377122.4	-	14	1777	c.1381G>T	c.(1381-1383)Gga>Tga	p.G461*	NEBL_ENST00000417816.2_Intron|NEBL_ENST00000377159.4_Intron	NM_006393.2	NP_006384.1	O76041	NEBL_HUMAN	nebulette	461					cardiac muscle thin filament assembly (GO:0071691)	extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|cytoskeletal protein binding (GO:0008092)|filamin binding (GO:0031005)|structural constituent of muscle (GO:0008307)|tropomyosin binding (GO:0005523)	p.G461*(2)		NS(2)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(8)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						GCTTGCATTCCTTTCCCTTTA	0.448																																																	2	Substitution - Nonsense(2)	large_intestine(1)|kidney(1)											259.0	236.0	244.0					10																	21124510		2203	4300	6503	SO:0001587	stop_gained	10529			Y16241	CCDS7133.1, CCDS7134.1	10p12	2014-09-17			ENSG00000078114	ENSG00000078114			16932	protein-coding gene	gene with protein product		605491				9733644, 10470015	Standard	NM_213569		Approved		uc001iqi.3	O76041	OTTHUMG00000017788	ENST00000377122.4:c.1381G>T	10.37:g.21124510C>A	ENSP00000366326:p.Gly461*	Somatic		WXS	Illumina HiSeq	Phase_I	B0YJ45|Q2TBD0|Q70I54|Q9UIC4	Nonsense_Mutation	SNP	ENST00000377122.4	37	CCDS7134.1	.	.	.	.	.	.	.	.	.	.	C	42	9.599904	0.99216	.	.	ENSG00000078114	ENST00000377122	.	.	.	5.08	5.08	0.68730	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.38643	T	0.18	.	18.0946	0.89485	0.0:1.0:0.0:0.0	.	.	.	.	X	461	.	ENSP00000366326:G461X	G	-	1	0	NEBL	21164516	1.000000	0.71417	0.997000	0.53966	0.848000	0.48234	5.828000	0.69307	2.380000	0.81148	0.505000	0.49811	GGA		0.448	NEBL-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000047113.1		NM_006393	
NEDD9	4739	broad.mit.edu;ucsc.edu	37	6	11213548	11213548	+	Missense_Mutation	SNP	A	A	G	rs111447705		TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr6:11213548A>G	ENST00000379446.5	-	2	591	c.425T>C	c.(424-426)aTt>aCt	p.I142T	NEDD9_ENST00000379433.5_Missense_Mutation_p.I142T|NEDD9_ENST00000504387.1_Missense_Mutation_p.I142T|RP3-510L9.1_ENST00000500636.2_RNA	NM_001271033.1|NM_006403.3	NP_001257962.1|NP_006394.1	Q14511	CASL_HUMAN	neural precursor cell expressed, developmentally down-regulated 9	142	Interacts strongly with spindle- regulatory protein D1M1.				actin filament bundle assembly (GO:0051017)|cell adhesion (GO:0007155)|cytoskeleton organization (GO:0007010)|integrin-mediated signaling pathway (GO:0007229)|mitotic nuclear division (GO:0007067)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|spindle (GO:0005819)|spindle pole (GO:0000922)		p.I142T(3)		endometrium(3)|kidney(2)|large_intestine(8)|liver(1)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	Breast(50;0.0768)|Ovarian(93;0.152)	all_hematologic(90;0.135)	Epithelial(50;0.0647)|all cancers(50;0.179)			GGTTCCCCCAATGCTTCTCTG	0.458																																																	3	Substitution - Missense(3)	kidney(3)						A	THR/ILE,THR/ILE,THR/ILE	0,4406		0,0,2203	95.0	91.0	92.0		425,425,425	-0.7	0.2	6	dbSNP_132	92	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	NEDD9	NM_001142393.1,NM_006403.3,NM_182966.3	89,89,89	0,1,6502	GG,GA,AA		0.0116,0.0,0.0077	benign,benign,benign	142/835,142/835,142/175	11213548	1,13005	2203	4300	6503	SO:0001583	missense	4739			L43821	CCDS4520.1, CCDS34340.1, CCDS47373.1, CCDS75400.1	6p25-p24	2011-04-13			ENSG00000111859	ENSG00000111859		"""Cas scaffolding proteins"""	7733	protein-coding gene	gene with protein product	"""Cas scaffolding protein family member 2"", ""Cas-like"""	602265					Standard	NM_182966		Approved	HEF1, CAS-L, CASS2	uc003mzv.2	Q14511	OTTHUMG00000014255	ENST00000379446.5:c.425T>C	6.37:g.11213548A>G	ENSP00000368759:p.Ile142Thr	Somatic		WXS	Illumina GAIIx	Phase_I	A8K9G7|A8MSJ9|G5E9Y9|Q5T9R4|Q5XKI0	Missense_Mutation	SNP	ENST00000379446.5	37	CCDS4520.1	.	.	.	.	.	.	.	.	.	.	A	7.651	0.682873	0.14907	0.0	1.16E-4	ENSG00000111859	ENST00000379446;ENST00000504387;ENST00000379433	T;T;T	0.63096	1.08;1.19;-0.02	5.75	-0.682	0.11339	.	1.194830	0.05766	N	0.605757	T	0.29882	0.0747	L	0.47716	1.5	0.19575	N	0.999967	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.06405	0.001;0.002;0.001	T	0.23404	-1.0189	10	0.17832	T	0.49	-0.5798	9.9801	0.41809	0.6724:0.0:0.3276:0.0	.	142;142;142	G5E9Y9;Q5XKI0;Q14511	.;.;CASL_HUMAN	T	142	ENSP00000368759:I142T;ENSP00000422871:I142T;ENSP00000368745:I142T	ENSP00000368745:I142T	I	-	2	0	NEDD9	11321534	0.003000	0.15002	0.171000	0.22900	0.861000	0.49209	0.523000	0.22925	-0.337000	0.08426	0.533000	0.62120	ATT		0.458	NEDD9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039853.2		NM_006403	
NR4A3	8013	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	102590586	102590586	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr9:102590586G>T	ENST00000395097.2	+	3	991	c.262G>T	c.(262-264)Gag>Tag	p.E88*	NR4A3_ENST00000338488.4_Nonsense_Mutation_p.E88*|NR4A3_ENST00000330847.1_Nonsense_Mutation_p.E99*	NM_006981.3|NM_173200.2	NP_008912.2|NP_775292.1	Q92570	NR4A3_HUMAN	nuclear receptor subfamily 4, group A, member 3	88					gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|thyroid hormone receptor activity (GO:0004887)|zinc ion binding (GO:0008270)	p.E88*(1)|p.E99*(1)	TCF12/NR4A3(2)|TAF15/NR4A3(33)|EWSR1/NR4A3(146)|TFG/NR4A3(2)				Acute lymphoblastic leukemia(62;0.0559)|all_hematologic(171;0.189)				CAAAGTGGAGGAGGGGCGGGC	0.602			T	EWSR1	extraskeletal myxoid chondrosarcoma																																			Dom	yes		9	9q22	8013	"""nuclear receptor subfamily 4, group A, member 3 (NOR1)"""		M	2	Substitution - Nonsense(2)	kidney(2)											56.0	51.0	53.0					9																	102590586		2203	4300	6503	SO:0001587	stop_gained	8013			U12767	CCDS6742.1, CCDS6743.1, CCDS6744.1	9q22	2013-01-16			ENSG00000119508	ENSG00000119508		"""Nuclear hormone receptors"""	7982	protein-coding gene	gene with protein product		600542				8614405	Standard	NM_006981		Approved	CSMF, CHN, NOR1, MINOR	uc004baf.1	Q92570	OTTHUMG00000021030	ENST00000395097.2:c.262G>T	9.37:g.102590586G>T	ENSP00000378531:p.Glu88*	Somatic		WXS	Illumina HiSeq	Phase_I	A2A3I7|Q12935|Q14979|Q16420|Q4VXA8|Q4VXA9|Q9UEK2|Q9UEK3	Nonsense_Mutation	SNP	ENST00000395097.2	37	CCDS6743.1	.	.	.	.	.	.	.	.	.	.	G	36	5.627173	0.96671	.	.	ENSG00000119508	ENST00000395097;ENST00000338488;ENST00000330847	.	.	.	5.36	5.36	0.76844	.	2.511850	0.01142	N	0.006233	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	.	19.4622	0.94921	0.0:0.0:1.0:0.0	.	.	.	.	X	88;88;99	.	ENSP00000333122:E99X	E	+	1	0	NR4A3	101630407	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.900000	0.87376	2.662000	0.90505	0.557000	0.71058	GAG		0.602	NR4A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055482.1			
NYX	60506	broad.mit.edu	37	X	41333572	41333572	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chrX:41333572G>A	ENST00000342595.2	+	2	1322	c.866G>A	c.(865-867)aGc>aAc	p.S289N	NYX_ENST00000378220.1_Missense_Mutation_p.S289N	NM_022567.2	NP_072089.1	Q9GZU5	NYX_HUMAN	nyctalopin	289					response to stimulus (GO:0050896)|visual perception (GO:0007601)	intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)		p.S289N(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(11)|upper_aerodigestive_tract(1)	17						GACCGCAACAGCATCGCCTTC	0.692																																																	1	Substitution - Missense(1)	kidney(1)											35.0	34.0	34.0					X																	41333572		2201	4298	6499	SO:0001583	missense	60506			AF254868	CCDS14256.1	Xp11.4	2014-01-28			ENSG00000188937	ENSG00000188937			8082	protein-coding gene	gene with protein product		300278		CSNB1, CSNB4		11062471, 11062472	Standard	NM_022567		Approved	CLRP, CSNB1A	uc004dfh.2	Q9GZU5	OTTHUMG00000021370	ENST00000342595.2:c.866G>A	X.37:g.41333572G>A	ENSP00000340328:p.Ser289Asn	Somatic		WXS	Illumina GAIIx	Phase_I	D3DWC0|Q2M1S4|Q5H983|Q9H4J0	Missense_Mutation	SNP	ENST00000342595.2	37	CCDS14256.1	.	.	.	.	.	.	.	.	.	.	G	14.86	2.660591	0.47572	.	.	ENSG00000188937	ENST00000342595;ENST00000378220	T;T	0.57752	0.38;0.38	5.19	3.4	0.38934	.	0.173078	0.49916	D	0.000131	T	0.32882	0.0844	N	0.17474	0.49	0.29479	N	0.856524	B	0.30563	0.285	B	0.30251	0.113	T	0.20472	-1.0274	10	0.21540	T	0.41	.	10.2694	0.43475	0.1648:0.0:0.8352:0.0	.	289	Q9GZU5	NYX_HUMAN	N	289	ENSP00000340328:S289N;ENSP00000367465:S289N	ENSP00000340328:S289N	S	+	2	0	NYX	41218516	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.342000	0.59341	0.960000	0.38005	0.600000	0.82982	AGC		0.692	NYX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056256.1		NM_022567	
TENM4	26011	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	78369131	78369131	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr11:78369131A>G	ENST00000278550.7	-	34	8744	c.8282T>C	c.(8281-8283)aTg>aCg	p.M2761T		NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	2761					cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)	p.M2761T(2)									GCTCTGTCTCATGAAGTGGAT	0.542																																																	2	Substitution - Missense(2)	kidney(2)											243.0	252.0	249.0					11																	78369131		2107	4230	6337	SO:0001583	missense	0			AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.8282T>C	11.37:g.78369131A>G	ENSP00000278550:p.Met2761Thr	Somatic		WXS	Illumina HiSeq	Phase_I	A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Missense_Mutation	SNP	ENST00000278550.7	37	CCDS44688.1	.	.	.	.	.	.	.	.	.	.	A	14.15	2.450914	0.43531	.	.	ENSG00000149256	ENST00000278550	D	0.88975	-2.45	5.52	5.52	0.82312	.	0.042876	0.85682	D	0.000000	T	0.81678	0.4873	L	0.29908	0.895	0.58432	D	0.999991	B	0.33379	0.41	B	0.26614	0.071	T	0.79699	-0.1694	9	.	.	.	.	15.8062	0.78513	1.0:0.0:0.0:0.0	.	2761	Q6N022	TEN4_HUMAN	T	2761	ENSP00000278550:M2761T	.	M	-	2	0	ODZ4	78046779	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.087000	0.94110	2.317000	0.78254	0.460000	0.39030	ATG		0.542	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391406.2			
OPN4	94233	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	88418429	88418429	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr10:88418429C>A	ENST00000241891.5	+	4	780	c.613C>A	c.(613-615)Ccc>Acc	p.P205T	OPN4_ENST00000372071.2_Missense_Mutation_p.P216T	NM_033282.3	NP_150598.1	Q9UHM6	OPN4_HUMAN	opsin 4	205					phototransduction (GO:0007602)|protein-chromophore linkage (GO:0018298)|regulation of circadian rhythm (GO:0042752)|rhodopsin mediated signaling pathway (GO:0016056)|rhythmic process (GO:0048511)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	11-cis retinal binding (GO:0005502)|G-protein coupled photoreceptor activity (GO:0008020)	p.P216T(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|liver(2)|lung(5)|ovary(3)	18						GAGTCTGCCACCCTTCTTCGG	0.622																																																	1	Substitution - Missense(1)	kidney(1)											52.0	49.0	50.0					10																	88418429		2203	4300	6503	SO:0001583	missense	94233			AF147788	CCDS7376.1, CCDS31237.1	10q22	2012-08-08	2008-04-16		ENSG00000122375	ENSG00000122375		"""GPCR / Class A : Opsin receptors"""	14449	protein-coding gene	gene with protein product	"""melanopsin"""	606665	"""opsin 4 (melanopsin)"""			10632589	Standard	NM_001030015		Approved	MOP, melanopsin	uc001kdp.3	Q9UHM6	OTTHUMG00000018654	ENST00000241891.5:c.613C>A	10.37:g.88418429C>A	ENSP00000241891:p.Pro205Thr	Somatic		WXS	Illumina HiSeq	Phase_I	B7ZLB3|Q14D01|Q2PP22|Q8NGQ9	Missense_Mutation	SNP	ENST00000241891.5	37	CCDS7376.1	.	.	.	.	.	.	.	.	.	.	C	26.2	4.711362	0.89112	.	.	ENSG00000122375	ENST00000372071;ENST00000241891;ENST00000443292	T;T;T	0.39787	1.06;1.06;1.06	5.22	5.22	0.72569	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.78923	0.4360	H	0.97896	4.1	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	D	0.87441	0.2395	10	0.87932	D	0	.	18.7781	0.91920	0.0:1.0:0.0:0.0	.	216;205;216	C9JWU6;Q9UHM6;Q9UHM6-2	.;OPN4_HUMAN;.	T	216;205;216	ENSP00000361141:P216T;ENSP00000241891:P205T;ENSP00000393132:P216T	ENSP00000241891:P205T	P	+	1	0	OPN4	88408409	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.800000	0.85949	2.434000	0.82447	0.561000	0.74099	CCC		0.622	OPN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049158.2		NM_033282	
OR7G3	390883	hgsc.bcm.edu	37	19	9236698	9236699	+	Frame_Shift_Ins	INS	-	-	ATGGT	rs111867493|rs3029651|rs111279560|rs138680298	byFrequency	TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr19:9236698_9236699insATGGT	ENST00000305444.2	-	1	927_928	c.928_929insACCAT	c.(928-930)tctfs	p.S310fs		NM_001001958.1	NP_001001958.1	Q8NG95	OR7G3_HUMAN	olfactory receptor, family 7, subfamily G, member 3	310						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|endometrium(1)|large_intestine(3)|liver(1)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	15						TCAATGGAAAGATGGTATCCTA	0.446														2122	0.423722	0.711	0.245	5008	,	,		19331	0.3651		0.3141	False		,,,				2504	0.3354																0										2730,1532		902,926,303						-1.2	0.0		dbSNP_132	66	2459,5795		353,1753,2021	no	frameshift	OR7G3	NM_001001958.1		1255,2679,2324	A1A1,A1R,RR		29.7916,35.9456,41.4589				5189,7327				SO:0001589	frameshift_variant	390883				CCDS32899.1	19p13.2	2013-09-24			ENSG00000170920	ENSG00000170920		"""GPCR / Class A : Olfactory receptors"""	8467	protein-coding gene	gene with protein product							Standard	NM_001001958		Approved	OST085	uc010xkl.2	Q8NG95	OTTHUMG00000165520	ENST00000305444.2:c.924_928dupACCAT	19.37:g.9236699_9236703dupATGGT	ENSP00000302867:p.Ser310fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q6IFJ6|Q96R99	Frame_Shift_Ins	INS	ENST00000305444.2	37	CCDS32899.1																																																																																				0.446	OR7G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384611.1			
PAPOLA	10914	broad.mit.edu;ucsc.edu	37	14	97022676	97022676	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr14:97022676A>G	ENST00000216277.8	+	19	2150	c.1930A>G	c.(1930-1932)Act>Gct	p.T644A	PAPOLA_ENST00000392990.2_Missense_Mutation_p.T644A	NM_032632.4	NP_116021.2	P51003	PAPOA_HUMAN	poly(A) polymerase alpha	644					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA splicing, via spliceosome (GO:0000398)|RNA polyadenylation (GO:0043631)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|polynucleotide adenylyltransferase activity (GO:0004652)|RNA binding (GO:0003723)	p.T644A(1)		breast(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(6)|skin(1)|urinary_tract(1)	21		all_cancers(154;0.0555)|all_epithelial(191;0.149)|Melanoma(154;0.155)		COAD - Colon adenocarcinoma(157;0.213)		AAAAATACCTACTCCTATAGT	0.398																																					NSCLC(19;254 734 11908 35501 39234)												1	Substitution - Missense(1)	kidney(1)											111.0	107.0	108.0					14																	97022676		2203	4300	6503	SO:0001583	missense	10914			X76770	CCDS9946.1, CCDS58334.1, CCDS58335.1	14q32.1-q32.2	2008-02-08				ENSG00000090060	2.7.7.19		14981	protein-coding gene	gene with protein product		605553				8302877, 10429366	Standard	NM_032632		Approved	PAP	uc001yfq.3	P51003		ENST00000216277.8:c.1930A>G	14.37:g.97022676A>G	ENSP00000216277:p.Thr644Ala	Somatic		WXS	Illumina GAIIx	Phase_I	Q86SX4|Q86TV0|Q8IYF5|Q9BVU2	Missense_Mutation	SNP	ENST00000216277.8	37	CCDS9946.1	.	.	.	.	.	.	.	.	.	.	A	5.105	0.205008	0.09704	.	.	ENSG00000090060	ENST00000216277;ENST00000546064;ENST00000392990;ENST00000555626	.	.	.	6.1	4.96	0.65561	.	0.329606	0.32624	N	0.005851	T	0.35828	0.0945	L	0.29908	0.895	0.22081	N	0.999373	B;B;B	0.10296	0.003;0.0;0.0	B;B;B	0.06405	0.002;0.0;0.0	T	0.19582	-1.0301	9	0.35671	T	0.21	.	12.1744	0.54178	0.9338:0.0:0.0662:0.0	.	660;660;644	F5H5I8;B4DYF4;P51003	.;.;PAPOA_HUMAN	A	644;660;644;394	.	ENSP00000216277:T644A	T	+	1	0	PAPOLA	96092429	1.000000	0.71417	0.231000	0.23993	0.859000	0.49053	6.414000	0.73318	1.135000	0.42183	-0.256000	0.11100	ACT		0.398	PAPOLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413411.2			
PAX4	5078	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	127252031	127252031	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr7:127252031G>T	ENST00000341640.2	-	7	920	c.715C>A	c.(715-717)Cca>Aca	p.P239T	PAX4_ENST00000463946.1_Missense_Mutation_p.P237T|PAX4_ENST00000378740.2_Missense_Mutation_p.P239T|PAX4_ENST00000338516.3_Intron	NM_006193.2	NP_006184.2	O43316	PAX4_HUMAN	paired box 4	247					cell differentiation (GO:0030154)|circadian rhythm (GO:0007623)|endocrine pancreas development (GO:0031018)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|positive regulation of cell differentiation (GO:0045597)|response to cAMP (GO:0051591)|response to drug (GO:0042493)|retina development in camera-type eye (GO:0060041)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)	p.P239T(1)		cervix(1)|kidney(2)|large_intestine(6)|lung(20)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	35						GCAACCCTTGGTACAGTCAGC	0.557																																					Ovarian(113;737 1605 7858 27720 34092)												1	Substitution - Missense(1)	kidney(1)											65.0	59.0	61.0					7																	127252031		2203	4300	6503	SO:0001583	missense	5078				CCDS5797.1	7q32.1	2011-06-20	2007-07-12		ENSG00000106331	ENSG00000106331		"""Paired boxes"", ""Homeoboxes / PRD class"""	8618	protein-coding gene	gene with protein product		167413	"""paired box gene 4"""				Standard	NM_006193		Approved	MODY9	uc010lld.1	O43316	OTTHUMG00000157562	ENST00000341640.2:c.715C>A	7.37:g.127252031G>T	ENSP00000339906:p.Pro239Thr	Somatic		WXS	Illumina HiSeq	Phase_I	O95161|Q6B0H0	Missense_Mutation	SNP	ENST00000341640.2	37	CCDS5797.1	.	.	.	.	.	.	.	.	.	.	G	10.78	1.447401	0.25987	.	.	ENSG00000106331	ENST00000341640;ENST00000378740;ENST00000463946	D;D	0.94376	-3.41;-3.28	5.27	-1.23	0.09465	.	2.240520	0.02303	N	0.071367	D	0.90549	0.7038	L	0.54323	1.7	0.09310	N	1	B;B;B;B	0.22541	0.013;0.002;0.001;0.071	B;B;B;B	0.23852	0.015;0.002;0.001;0.049	T	0.76405	-0.2971	10	0.45353	T	0.12	.	5.5348	0.17005	0.2565:0.4321:0.3114:0.0	.	239;237;247;237	O43316-4;Q1W386;O43316;G3V4Q1	.;.;PAX4_HUMAN;.	T	239;247;237	ENSP00000339906:P239T;ENSP00000451923:P237T	ENSP00000339906:P239T	P	-	1	0	PAX4	127039267	0.000000	0.05858	0.000000	0.03702	0.034000	0.12701	0.035000	0.13797	0.046000	0.15833	-0.123000	0.14984	CCA		0.557	PAX4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000349165.1			
PCDHGB1	56104	broad.mit.edu;ucsc.edu	37	5	140732064	140732064	+	Missense_Mutation	SNP	A	A	C			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr5:140732064A>C	ENST00000523390.1	+	1	2237	c.2237A>C	c.(2236-2238)tAt>tCt	p.Y746S	PCDHGA3_ENST00000253812.6_Intron|PCDHGA4_ENST00000571252.1_5'Flank|PCDHGA2_ENST00000394576.2_Intron|PCDHGA1_ENST00000517417.1_Intron	NM_018922.2|NM_032095.1	NP_061745.1|NP_115266.1	Q9Y5G3	PCDGD_HUMAN	protocadherin gamma subfamily B, 1	746					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.Y746S(1)		central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|prostate(1)	16			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACTTTGCCCTATTCCTACAAT	0.537																																																	1	Substitution - Missense(1)	kidney(1)											98.0	98.0	98.0					5																	140732064		1968	4152	6120	SO:0001583	missense	56104			AF152517	CCDS54923.1, CCDS75330.1	5q31	2010-01-26				ENSG00000254221		"""Cadherins / Protocadherins : Clustered"""	8708	other	protocadherin	"""protocadherin gamma subfamily B, 1, isoform 2"""	606299				10380929	Standard	NM_018922		Approved	PCDH-GAMMA-B1		Q9Y5G3		ENST00000523390.1:c.2237A>C	5.37:g.140732064A>C	ENSP00000429273:p.Tyr746Ser	Somatic		WXS	Illumina GAIIx	Phase_I	Q3SY75|Q9Y5C8	Missense_Mutation	SNP	ENST00000523390.1	37	CCDS54923.1	.	.	.	.	.	.	.	.	.	.	.	12.73	2.025902	0.35701	.	.	ENSG00000254221	ENST00000523390	T	0.52057	0.68	5.25	2.8	0.32819	.	.	.	.	.	T	0.73024	0.3534	H	0.94264	3.515	0.23563	N	0.997402	D;D	0.71674	0.995;0.998	D;D	0.74674	0.984;0.951	T	0.62334	-0.6876	9	0.87932	D	0	.	7.2942	0.26383	0.799:0.0:0.0718:0.1291	.	746;746	Q9Y5G3-2;Q9Y5G3	.;PCDGD_HUMAN	S	746	ENSP00000429273:Y746S	ENSP00000429273:Y746S	Y	+	2	0	PCDHGB1	140712248	0.047000	0.20315	0.597000	0.28824	0.005000	0.04900	1.460000	0.35244	0.372000	0.24591	0.533000	0.62120	TAT		0.537	PCDHGB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374740.1		NM_018922	
PHACTR4	65979	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	28800469	28800469	+	Silent	SNP	C	C	A			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr1:28800469C>A	ENST00000373839.3	+	7	1488	c.1227C>A	c.(1225-1227)ccC>ccA	p.P409P	PHACTR4_ENST00000373836.3_Silent_p.P419P|PHACTR4_ENST00000493669.1_3'UTR	NM_001048183.1	NP_001041648.1	Q8IZ21	PHAR4_HUMAN	phosphatase and actin regulator 4	409	Pro-rich.				actin cytoskeleton organization (GO:0030036)|closure of optic fissure (GO:0061386)|enteric nervous system development (GO:0048484)|negative regulation of integrin-mediated signaling pathway (GO:2001045)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|positive regulation of catalytic activity (GO:0043085)|regulation of cell cycle (GO:0051726)|Rho protein signal transduction (GO:0007266)	cytoplasm (GO:0005737)|lamellipodium (GO:0030027)	actin binding (GO:0003779)|protein phosphatase 1 binding (GO:0008157)|protein phosphatase type 1 activator activity (GO:0071862)	p.P419P(1)		NS(1)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(6)|lung(10)|ovary(3)|skin(1)|urinary_tract(1)	32		Colorectal(325;3.46e-05)|Lung NSC(340;4.37e-05)|all_lung(284;7.01e-05)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)		OV - Ovarian serous cystadenocarcinoma(117;1.35e-21)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00273)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0144)|READ - Rectum adenocarcinoma(331;0.0649)		CCCATATACCCTCTAGGCTGC	0.527																																																	1	Substitution - coding silent(1)	kidney(1)											70.0	71.0	71.0					1																	28800469		1930	4139	6069	SO:0001819	synonymous_variant	65979			AF130081	CCDS41293.1, CCDS41294.1	1p35.2	2014-06-13			ENSG00000204138	ENSG00000204138		"""Phosphatase and actin regulators"""	25793	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 124"""	608726				11483580, 15107502	Standard	NM_023923		Approved	FLJ13171, PPP1R124	uc001bpy.3	Q8IZ21	OTTHUMG00000003541	ENST00000373839.3:c.1227C>A	1.37:g.28800469C>A		Somatic		WXS	Illumina HiSeq	Phase_I	A2APK6|B9ZVW0|D3DPM3|Q68DD4|Q6NUN6|Q8N384|Q9H395|Q9H6X0|Q9H8W6	Silent	SNP	ENST00000373839.3	37	CCDS41293.1																																																																																				0.527	PHACTR4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000009868.4		NM_023923	
PCSK9	255738	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	55509579	55509580	+	Missense_Mutation	DNP	TC	TC	AT			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	T|C	T|C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr1:55509579_55509580TC>AT	ENST00000302118.5	+	2	561_562	c.271_272TC>AT	c.(271-273)TCa>ATa	p.S91I	PCSK9_ENST00000543384.1_Intron|PCSK9_ENST00000452118.2_Missense_Mutation_p.S91I	NM_174936.3	NP_777596.2	Q8NBP7	PCSK9_HUMAN	proprotein convertase subtilisin/kexin type 9	91					apoptotic process (GO:0006915)|cellular response to insulin stimulus (GO:0032869)|cellular response to starvation (GO:0009267)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|kidney development (GO:0001822)|lipoprotein metabolic process (GO:0042157)|liver development (GO:0001889)|low-density lipoprotein particle receptor catabolic process (GO:0032802)|lysosomal transport (GO:0007041)|negative regulation of low-density lipoprotein particle clearance (GO:0010989)|negative regulation of receptor recycling (GO:0001920)|neurogenesis (GO:0022008)|neuron differentiation (GO:0030182)|phospholipid metabolic process (GO:0006644)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of receptor internalization (GO:0002092)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)|regulation of low-density lipoprotein particle receptor catabolic process (GO:0032803)|regulation of neuron apoptotic process (GO:0043523)|regulation of receptor activity (GO:0010469)|triglyceride metabolic process (GO:0006641)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle (GO:0030134)|extracellular space (GO:0005615)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|lysosome (GO:0005764)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	apolipoprotein binding (GO:0034185)|apolipoprotein receptor binding (GO:0034190)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein particle receptor binding (GO:0050750)|poly(A) RNA binding (GO:0044822)|protein self-association (GO:0043621)|serine-type endopeptidase activity (GO:0004252)|sodium channel inhibitor activity (GO:0019871)|very-low-density lipoprotein particle binding (GO:0034189)|very-low-density lipoprotein particle receptor binding (GO:0070326)	p.S91T(2)|p.S91>?(1)|p.S91L(1)		NS(2)|breast(2)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(1)|liver(2)|lung(4)|ovary(3)|prostate(3)|skin(1)|urinary_tract(1)	32						CCTCTCGCAGTCAGAGCGCACT	0.629																																					Pancreas(137;1454 1827 5886 22361 42375)												4	Substitution - Missense(3)|Complex(1)	kidney(3)|lung(1)																																								SO:0001583	missense	255738			AX207686	CCDS603.1	1p34.1-p32	2014-09-17	2003-05-13		ENSG00000169174	ENSG00000169174			20001	protein-coding gene	gene with protein product		607786	"""hypercholesterolemia, autosomal dominant 3"""	HCHOLA3		12552133, 12730697	Standard	NM_174936		Approved	NARC-1, FH3	uc001cyf.2	Q8NBP7	OTTHUMG00000008136	Exception_encountered	1.37:g.55509579_55509580delinsAT	ENSP00000303208:p.Ser91Ile	Somatic		WXS	Illumina HiSeq	Phase_I	A8T640|C0JYY9|Q5PSM5|Q5SZQ2	Missense_Mutation	SNP	ENST00000302118.5	37	CCDS603.1																																																																																				0.629	PCSK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022280.1		NM_174936	
PKD1L1	168507	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	47873983	47873983	+	Splice_Site	SNP	C	C	A			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr7:47873983C>A	ENST00000289672.2	-	40	6178	c.6128G>T	c.(6127-6129)gGt>gTt	p.G2043V		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	2043					detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)	p.G2043V(1)	BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						GGAATTAGGACCTGATTCAAA	0.408																																																	1	Substitution - Missense(1)	kidney(1)											100.0	91.0	94.0					7																	47873983		2203	4300	6503	SO:0001630	splice_region_variant	168507			AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.6128-1G>T	7.37:g.47873983C>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q6UWK1	Missense_Mutation	SNP	ENST00000289672.2	37	CCDS34633.1	.	.	.	.	.	.	.	.	.	.	C	5.544	0.285267	0.10513	.	.	ENSG00000158683	ENST00000289672	T	0.19532	2.14	3.93	-0.263	0.12954	.	367.945000	0.00166	N	0.000000	T	0.19005	0.0456	L	0.54323	1.7	0.30650	N	0.755531	B	0.19331	0.035	B	0.12837	0.008	T	0.14309	-1.0477	10	0.26408	T	0.33	.	1.6496	0.02769	0.1647:0.4758:0.1605:0.199	.	2043	Q8TDX9	PK1L1_HUMAN	V	2043	ENSP00000289672:G2043V	ENSP00000289672:G2043V	G	-	2	0	PKD1L1	47840508	0.020000	0.18652	0.009000	0.14445	0.005000	0.04900	-0.214000	0.09292	-0.182000	0.10602	-0.263000	0.10527	GGT		0.408	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340974.1		NM_138295	Missense_Mutation
PKN2	5586	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	89236095	89236095	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr1:89236095G>T	ENST00000370521.3	+	4	924	c.565G>T	c.(565-567)Gtc>Ttc	p.V189F	PKN2_ENST00000316005.7_Missense_Mutation_p.V189F|PKN2_ENST00000370513.5_Missense_Mutation_p.V189F|PKN2_ENST00000370505.3_Missense_Mutation_p.V32F	NM_006256.2	NP_006247.1	Q16513	PKN2_HUMAN	protein kinase N2	189					apical junction assembly (GO:0043297)|apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell division (GO:0051301)|epithelial cell migration (GO:0010631)|positive regulation of cytokinesis (GO:0032467)|positive regulation of mitotic cell cycle (GO:0045931)|protein phosphorylation (GO:0006468)|regulation of cell motility (GO:2000145)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	apical junction complex (GO:0043296)|centrosome (GO:0005813)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium (GO:0030027)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)	ATP binding (GO:0005524)|histone deacetylase binding (GO:0042826)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)	p.V189F(2)		breast(2)|endometrium(3)|kidney(3)|large_intestine(8)|lung(15)|prostate(1)|skin(1)	33		Lung NSC(277;0.123)		all cancers(265;0.0136)|Epithelial(280;0.0301)		AAAAATAGAAGTCATACGAAT	0.373																																																	2	Substitution - Missense(2)	kidney(2)											123.0	121.0	121.0					1																	89236095		1908	4119	6027	SO:0001583	missense	5586			U33052	CCDS714.1	1p22	2014-04-23	2004-07-01	2004-07-01	ENSG00000065243	ENSG00000065243			9406	protein-coding gene	gene with protein product	"""cardiolipin-activated protein kinase Pak2"""	602549	"""protein kinase C-like 2"""	PRKCL2		7988719, 7851406	Standard	NM_006256		Approved	PRK2, Pak-2, STK7	uc001dmn.3	Q16513	OTTHUMG00000010074	ENST00000370521.3:c.565G>T	1.37:g.89236095G>T	ENSP00000359552:p.Val189Phe	Somatic		WXS	Illumina HiSeq	Phase_I	B4DQ21|B4DTP5|B4DVG1|D3DT24|Q08AF4|Q9H1W4	Missense_Mutation	SNP	ENST00000370521.3	37	CCDS714.1	.	.	.	.	.	.	.	.	.	.	G	13.58	2.280789	0.40294	.	.	ENSG00000065243	ENST00000370521;ENST00000316005;ENST00000370505;ENST00000370513	T;T;T;T	0.29397	1.57;1.57;1.57;1.57	5.35	5.35	0.76521	.	0.000000	0.40469	U	0.001086	T	0.09905	0.0243	N	0.11870	0.19	0.80722	D	1	B;B;B;B	0.19073	0.004;0.002;0.014;0.033	B;B;B;B	0.21151	0.029;0.008;0.033;0.03	T	0.12993	-1.0526	10	0.14252	T	0.57	.	19.4322	0.94775	0.0:0.0:1.0:0.0	.	189;189;189;189	B4DTP5;E7ESL7;Q16513;B1AL79	.;.;PKN2_HUMAN;.	F	189;189;32;189	ENSP00000359552:V189F;ENSP00000317851:V189F;ENSP00000359536:V32F;ENSP00000359544:V189F	ENSP00000317851:V189F	V	+	1	0	PKN2	89008683	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.871000	0.63042	2.649000	0.89929	0.655000	0.94253	GTC		0.373	PKN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027828.3		NM_006256	
PLA2G4D	283748	broad.mit.edu;ucsc.edu	37	15	42379578	42379578	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr15:42379578A>G	ENST00000290472.3	-	3	269	c.175T>C	c.(175-177)Ttt>Ctt	p.F59L		NM_178034.3	NP_828848.3	Q86XP0	PA24D_HUMAN	phospholipase A2, group IVD (cytosolic)	59	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phospholipase A2 activity (GO:0004623)	p.F59L(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(7)|ovary(1)|skin(2)|stomach(1)	27		all_cancers(109;6.37e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.019)|Ovarian(310;0.143)|Colorectal(260;0.245)		OV - Ovarian serous cystadenocarcinoma(18;4.9e-17)|GBM - Glioblastoma multiforme(94;1.02e-06)		TTGGTCTTAAACTTCATTCCA	0.547																																																	1	Substitution - Missense(1)	kidney(1)											235.0	206.0	216.0					15																	42379578		2203	4299	6502	SO:0001583	missense	283748			AB090876	CCDS32203.1	15q14	2008-09-19				ENSG00000159337	3.1.1.4		30038	protein-coding gene	gene with protein product		612864				14709560	Standard	NM_178034		Approved	cPLA2delta	uc001zox.3	Q86XP0		ENST00000290472.3:c.175T>C	15.37:g.42379578A>G	ENSP00000290472:p.Phe59Leu	Somatic		WXS	Illumina GAIIx	Phase_I	Q8N176	Missense_Mutation	SNP	ENST00000290472.3	37	CCDS32203.1	.	.	.	.	.	.	.	.	.	.	A	0.127	-1.117673	0.01785	.	.	ENSG00000159337	ENST00000290472	T	0.68624	-0.34	5.15	1.47	0.22746	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.802027	0.11380	N	0.569882	T	0.37892	0.1020	N	0.12663	0.25	0.09310	N	1	B	0.06786	0.001	B	0.09377	0.004	T	0.29761	-1.0001	10	0.02654	T	1	-1.8898	4.3509	0.11155	0.5679:0.1653:0.2668:0.0	.	59	Q86XP0	PA24D_HUMAN	L	59	ENSP00000290472:F59L	ENSP00000290472:F59L	F	-	1	0	PLA2G4D	40166870	0.005000	0.15991	0.571000	0.28486	0.293000	0.27360	0.127000	0.15790	0.354000	0.24105	0.533000	0.62120	TTT		0.547	PLA2G4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419317.1		NM_178034	
PLEC	5339	broad.mit.edu;hgsc.bcm.edu	37	8	144999885	144999885	+	Silent	SNP	C	C	G			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr8:144999885C>G	ENST00000322810.4	-	31	4792	c.4623G>C	c.(4621-4623)cgG>cgC	p.R1541R	PLEC_ENST00000436759.2_Silent_p.R1431R|PLEC_ENST00000527096.1_Silent_p.R1427R|PLEC_ENST00000345136.3_Silent_p.R1404R|PLEC_ENST00000354589.3_Silent_p.R1404R|PLEC_ENST00000357649.2_Silent_p.R1408R|PLEC_ENST00000354958.2_Silent_p.R1382R|PLEC_ENST00000356346.3_Silent_p.R1390R|PLEC_ENST00000398774.2_Silent_p.R1372R	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	1541	Central fibrous rod domain.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)	p.R1541R(1)|p.R1404R(1)|p.R1431R(1)		NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						CCGCCTCCTCCCGCCGCACCA	0.716																																																	3	Substitution - coding silent(3)	kidney(3)											8.0	10.0	9.0					8																	144999885		1995	4014	6009	SO:0001819	synonymous_variant	5339			U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.4623G>C	8.37:g.144999885C>G		Somatic		WXS	Illumina HiSeq	Phase_I	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	CCDS43772.1																																																																																				0.716	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1		NM_000445	
PPIE	10450	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	40209514	40209514	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr1:40209514G>T	ENST00000324379.5	+	6	321	c.302G>T	c.(301-303)tGg>tTg	p.W101L	PPIE_ENST00000372830.1_Missense_Mutation_p.W101L|PPIE_ENST00000470213.1_Missense_Mutation_p.W101L|PPIE_ENST00000356511.2_Missense_Mutation_p.W101L|PPIE_ENST00000480169.1_3'UTR	NM_006112.3	NP_006103.1	Q9UNP9	PPIE_HUMAN	peptidylprolyl isomerase E (cyclophilin E)	101					mRNA splicing, via spliceosome (GO:0000398)|positive regulation of viral genome replication (GO:0045070)|protein folding (GO:0006457)|regulation of transcription, DNA-templated (GO:0006355)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	cyclosporin A binding (GO:0016018)|nucleotide binding (GO:0000166)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.W101L(2)		kidney(3)|large_intestine(2)|lung(2)|prostate(1)|urinary_tract(1)	9	all_cancers(7;1.63e-13)|all_lung(5;2.27e-16)|all_epithelial(6;1.35e-15)|Lung NSC(20;1.49e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.87e-18)|Epithelial(16;2.7e-17)|all cancers(16;5.5e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			GATGATGACTGGTTGAAGAAG	0.443																																																	2	Substitution - Missense(2)	kidney(2)											102.0	105.0	104.0					1																	40209514		2203	4300	6503	SO:0001583	missense	10450			AF042385	CCDS442.1, CCDS443.1, CCDS53299.1	1p32	2013-02-12			ENSG00000084072	ENSG00000084072		"""RNA binding motif (RRM) containing"""	9258	protein-coding gene	gene with protein product	"""peptidyl-prolyl cis-trans isomerase E"", ""cyclophilin 33"", ""cyclophilin E"", ""PPIase E"", ""rotamase E"", ""peptidylprolyl isomerase E, isoform 1"""	602435				9747881	Standard	NM_203456		Approved	CyP-33, MGC3736, MGC111222	uc001cdw.3	Q9UNP9	OTTHUMG00000009248	ENST00000324379.5:c.302G>T	1.37:g.40209514G>T	ENSP00000312769:p.Trp101Leu	Somatic		WXS	Illumina HiSeq	Phase_I	B2R971|O43634|O43635|Q32Q72|Q3S611|Q5TGA0|Q5TGA2|Q5TGA3|Q9UIZ5	Missense_Mutation	SNP	ENST00000324379.5	37	CCDS443.1	.	.	.	.	.	.	.	.	.	.	G	28.4	4.915318	0.92178	.	.	ENSG00000084072	ENST00000470018;ENST00000324379;ENST00000356511;ENST00000497370;ENST00000470213;ENST00000372835;ENST00000372830	T;T;T;T;T;T	0.73469	3.03;3.02;1.47;3.5;-0.75;3.0	4.78	4.78	0.61160	.	0.000000	0.85682	D	0.000000	D	0.88669	0.6499	M	0.89534	3.04	0.80722	D	1	D;D;D;D	0.89917	0.998;0.998;1.0;0.998	P;D;D;P	0.87578	0.896;0.948;0.998;0.835	D	0.90365	0.4376	10	0.54805	T	0.06	-14.3597	17.5827	0.87973	0.0:0.0:1.0:0.0	.	35;101;101;101	B4E3F2;Q5TGA3;Q9UNP9-2;Q9UNP9	.;.;.;PPIE_HUMAN	L	35;101;101;35;101;50;101	ENSP00000312769:W101L;ENSP00000348904:W101L;ENSP00000433475:W35L;ENSP00000431714:W101L;ENSP00000361925:W50L;ENSP00000361918:W101L	ENSP00000312769:W101L	W	+	2	0	PPIE	39982101	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.899000	0.92544	2.501000	0.84356	0.561000	0.74099	TGG		0.443	PPIE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025642.2		NM_006112	
PPIP5K2	23262	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	102502993	102502993	+	Missense_Mutation	SNP	C	C	G			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr5:102502993C>G	ENST00000358359.3	+	18	2540	c.2031C>G	c.(2029-2031)atC>atG	p.I677M	PPIP5K2_ENST00000321521.9_Missense_Mutation_p.I677M|PPIP5K2_ENST00000513500.1_3'UTR|PPIP5K2_ENST00000414217.1_Missense_Mutation_p.I677M	NM_001276277.1	NP_001263206.1	O43314	VIP2_HUMAN	diphosphoinositol pentakisphosphate kinase 2	677					inositol metabolic process (GO:0006020)|inositol phosphate metabolic process (GO:0043647)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	acid phosphatase activity (GO:0003993)|ATP binding (GO:0005524)|diphosphoinositol-pentakisphosphate kinase activity (GO:0033857)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol-1,3,4,5,6-pentakisphosphate kinase activity (GO:0000827)	p.I677M(1)		NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						CTTCTCAAATCAGACATCGAA	0.289																																																	1	Substitution - Missense(1)	kidney(1)											75.0	81.0	79.0					5																	102502993		2202	4293	6495	SO:0001583	missense	23262			AB007893	CCDS34207.1, CCDS64212.1, CCDS75283.1	5q21.1	2014-05-06	2010-01-26	2010-01-26	ENSG00000145725	ENSG00000145725	2.7.4.24		29035	protein-coding gene	gene with protein product		611648	"""histidine acid phosphatase domain containing 1"""	HISPPD1		9455477, 17690096, 18981179	Standard	NM_001276277		Approved	KIAA0433, VIP2	uc003koe.4	O43314	OTTHUMG00000181461	ENST00000358359.3:c.2031C>G	5.37:g.102502993C>G	ENSP00000351126:p.Ile677Met	Somatic		WXS	Illumina HiSeq	Phase_I	A1NI53|A6NGS8|Q8TB50	Missense_Mutation	SNP	ENST00000358359.3	37		.	.	.	.	.	.	.	.	.	.	C	15.89	2.965458	0.53507	.	.	ENSG00000145725	ENST00000321521;ENST00000358359;ENST00000451606;ENST00000414217	T;T;T	0.35048	1.33;1.33;1.33	5.43	2.53	0.30540	.	0.000000	0.85682	D	0.000000	T	0.44456	0.1294	L	0.33245	0.995	0.47441	D	0.999423	B;D	0.67145	0.318;0.996	B;D	0.72982	0.321;0.979	T	0.29274	-1.0017	10	0.87932	D	0	.	9.4302	0.38606	0.0:0.6465:0.0:0.3535	.	677;677	O43314-2;O43314	.;VIP2_HUMAN	M	677	ENSP00000313070:I677M;ENSP00000351126:I677M;ENSP00000416016:I677M	ENSP00000313070:I677M	I	+	3	3	PPIP5K2	102530892	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	0.792000	0.26929	0.199000	0.20427	0.460000	0.39030	ATC		0.289	PPIP5K2-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000370487.1		NM_015216	
PROCR	10544	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	20	33763988	33763988	+	Missense_Mutation	SNP	T	T	A			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr20:33763988T>A	ENST00000216968.4	+	3	422	c.340T>A	c.(340-342)Tgc>Agc	p.C114S	EDEM2_ENST00000540582.1_Intron	NM_006404.3	NP_006395.2	Q9UNN8	EPCR_HUMAN	protein C receptor, endothelial	114					antigen processing and presentation (GO:0019882)|blood coagulation (GO:0007596)|immune response (GO:0006955)|negative regulation of coagulation (GO:0050819)	cell surface (GO:0009986)|centrosome (GO:0005813)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)	p.C114S(1)		breast(1)|kidney(2)|large_intestine(1)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	10			BRCA - Breast invasive adenocarcinoma(18;0.0152)		Drotrecogin alfa(DB00055)	GACCATCCGCTGCTTCCTGGG	0.597																																																	1	Substitution - Missense(1)	kidney(1)											78.0	83.0	82.0					20																	33763988		2203	4300	6503	SO:0001583	missense	10544			L35545	CCDS13248.1	20q11.2	2010-05-04	2010-05-04		ENSG00000101000	ENSG00000101000		"""CD molecules"""	9452	protein-coding gene	gene with protein product		600646				7929370, 10518938	Standard	NM_006404		Approved	EPCR, CCD41, CD201	uc002xbt.3	Q9UNN8	OTTHUMG00000032323	ENST00000216968.4:c.340T>A	20.37:g.33763988T>A	ENSP00000216968:p.Cys114Ser	Somatic		WXS	Illumina HiSeq	Phase_I	B2RC04|Q14218|Q6IB56|Q96CB3|Q9ULX1	Missense_Mutation	SNP	ENST00000216968.4	37	CCDS13248.1	.	.	.	.	.	.	.	.	.	.	T	21.7	4.186295	0.78789	.	.	ENSG00000101000	ENST00000374477;ENST00000216968	D	0.82167	-1.58	5.6	4.43	0.53597	MHC class I, alpha chain, alpha1/alpha2 (1);MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	0.163418	0.44688	D	0.000428	D	0.89501	0.6733	M	0.80982	2.52	0.46823	D	0.999219	D	0.89917	1.0	D	0.85130	0.997	D	0.88282	0.2937	10	0.35671	T	0.21	.	9.7446	0.40440	0.1547:0.0:0.0:0.8453	.	114	Q9UNN8	EPCR_HUMAN	S	114	ENSP00000216968:C114S	ENSP00000216968:C114S	C	+	1	0	PROCR	33227649	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.414000	0.44627	2.139000	0.66308	0.448000	0.29417	TGC		0.597	PROCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078843.3			
RABAC1	10567	broad.mit.edu;ucsc.edu	37	19	42462491	42462491	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr19:42462491C>T	ENST00000222008.6	-	3	411	c.314G>A	c.(313-315)gGc>gAc	p.G105D	RABAC1_ENST00000601891.1_Missense_Mutation_p.G105D|RABAC1_ENST00000601078.1_Missense_Mutation_p.G11D	NM_006423.2	NP_006414.2	Q9UI14	PRAF1_HUMAN	Rab acceptor 1 (prenylated)	105						cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|synapse (GO:0045202)	identical protein binding (GO:0042802)	p.G105D(1)		central_nervous_system(1)|kidney(1)|prostate(1)	3						GTAACAGGCGCCGAAAAAGAC	0.582																																																	1	Substitution - Missense(1)	kidney(1)											71.0	64.0	66.0					19																	42462491		2203	4297	6500	SO:0001583	missense	10567			AJ133534	CCDS12593.1	19q13.2	2012-09-20			ENSG00000105404	ENSG00000105404			9794	protein-coding gene	gene with protein product	"""PRA1 domain family 1"", ""prenylated Rab acceptor 1"""	604925				10329441, 10751420	Standard	NM_006423		Approved	PRA1, PRAF1, YIP3	uc002osf.3	Q9UI14		ENST00000222008.6:c.314G>A	19.37:g.42462491C>T	ENSP00000222008:p.Gly105Asp	Somatic		WXS	Illumina GAIIx	Phase_I	Q7Z4Y2|Q9Y3R1	Missense_Mutation	SNP	ENST00000222008.6	37	CCDS12593.1	.	.	.	.	.	.	.	.	.	.	C	29.6	5.021472	0.93462	.	.	ENSG00000105404	ENST00000222008	T	0.46063	0.88	4.65	4.65	0.58169	.	0.000000	0.85682	D	0.000000	T	0.66906	0.2837	M	0.83118	2.625	0.80722	D	1	D	0.76494	0.999	D	0.76071	0.987	T	0.72950	-0.4136	10	0.72032	D	0.01	-9.4411	15.3911	0.74744	0.0:1.0:0.0:0.0	.	105	Q9UI14	PRAF1_HUMAN	D	105	ENSP00000222008:G105D	ENSP00000222008:G105D	G	-	2	0	RABAC1	47154331	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.211000	0.72182	2.309000	0.77851	0.655000	0.94253	GGC		0.582	RABAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463388.1		NM_006423	
RASGRF2	5924	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	80508333	80508333	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr5:80508333G>A	ENST00000265080.4	+	23	3372	c.3305G>A	c.(3304-3306)aGa>aAa	p.R1102K	CKMT2-AS1_ENST00000503483.2_RNA|CKMT2-AS1_ENST00000511495.1_RNA	NM_006909.2	NP_008840.1	O14827	RGRF2_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 2	1102	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.|Responsible of the affinity for farnesylated versus geranylgeranylated Ras. {ECO:0000250}.				apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.R1102K(1)		biliary_tract(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(28)|ovary(5)|prostate(3)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	75		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)		OV - Ovarian serous cystadenocarcinoma(54;4.22e-42)|Epithelial(54;4.04e-35)|all cancers(79;2.52e-29)		GCCTTAAACAGAAGTGCCATC	0.582																																																	1	Substitution - Missense(1)	kidney(1)											49.0	46.0	47.0					5																	80508333		2203	4300	6503	SO:0001583	missense	5924			AF023130	CCDS4052.1	5q13	2013-01-10			ENSG00000113319	ENSG00000113319		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9876	protein-coding gene	gene with protein product		606614					Standard	NM_006909		Approved	GRF2, Ras-GRF2	uc003kha.2	O14827	OTTHUMG00000119015	ENST00000265080.4:c.3305G>A	5.37:g.80508333G>A	ENSP00000265080:p.Arg1102Lys	Somatic		WXS	Illumina HiSeq	Phase_I	B9EG89|Q9UK56	Missense_Mutation	SNP	ENST00000265080.4	37	CCDS4052.1	.	.	.	.	.	.	.	.	.	.	G	35	5.456851	0.96223	.	.	ENSG00000113319	ENST00000265080	T	0.29142	1.58	5.74	5.74	0.90152	Guanine-nucleotide dissociation stimulator CDC25 (4);Ras guanine nucleotide exchange factor, domain (1);	0.000000	0.85682	D	0.000000	T	0.32466	0.0830	N	0.20881	0.62	0.58432	D	0.999998	P	0.35944	0.529	B	0.43155	0.41	T	0.09640	-1.0665	10	0.59425	D	0.04	.	19.5211	0.95185	0.0:0.0:1.0:0.0	.	1102	O14827	RGRF2_HUMAN	K	1102	ENSP00000265080:R1102K	ENSP00000265080:R1102K	R	+	2	0	RASGRF2	80544089	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.864000	0.99589	2.707000	0.92482	0.655000	0.94253	AGA		0.582	RASGRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239215.2		NM_006909	
RBM7	10179	broad.mit.edu;hgsc.bcm.edu	37	11	114272549	114272549	+	Missense_Mutation	SNP	T	T	C			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr11:114272549T>C	ENST00000540163.1	+	2	868	c.226T>C	c.(226-228)Tat>Cat	p.Y76H	RBM7_ENST00000544582.1_Missense_Mutation_p.Y76H|RBM7_ENST00000545678.1_Intron|RBM7_ENST00000541475.1_Missense_Mutation_p.Y76H|C11orf71_ENST00000325636.4_5'Flank|RP11-212D19.4_ENST00000544347.1_Silent_p.F72F|RBM7_ENST00000375490.5_Missense_Mutation_p.Y76H			Q9Y580	RBM7_HUMAN	RNA binding motif protein 7	76	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				meiotic nuclear division (GO:0007126)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.Y76H(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	17		all_cancers(61;5.06e-12)|all_epithelial(67;5.3e-06)|all_hematologic(158;7.68e-05)|Acute lymphoblastic leukemia(157;0.000966)|Melanoma(852;0.00153)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)|Breast(348;0.0818)|Prostate(24;0.104)		BRCA - Breast invasive adenocarcinoma(274;2.56e-06)|Epithelial(105;4.17e-05)|all cancers(92;0.000348)		AATCAAACTTTATGGAAGGCC	0.343																																																	1	Substitution - Missense(1)	kidney(1)											82.0	84.0	83.0					11																	114272549		2201	4296	6497	SO:0001583	missense	10179			AF156098	CCDS8370.1, CCDS66233.1, CCDS73395.1	11q23.1-q23.2	2013-02-12			ENSG00000076053	ENSG00000076053		"""RNA binding motif (RRM) containing"""	9904	protein-coding gene	gene with protein product		612413				12477932	Standard	NM_001286045		Approved		uc001pov.3	Q9Y580		ENST00000540163.1:c.226T>C	11.37:g.114272549T>C	ENSP00000439918:p.Tyr76His	Somatic		WXS	Illumina HiSeq	Phase_I	B2R6K8|Q9NUT4	Missense_Mutation	SNP	ENST00000540163.1	37	CCDS8370.1	.	.	.	.	.	.	.	.	.	.	T	15.45	2.837943	0.50951	.	.	ENSG00000076053	ENST00000540163;ENST00000375490;ENST00000541475;ENST00000544582	T;T;T;T	0.15834	2.39;2.39;2.39;2.39	5.76	5.76	0.90799	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.254979	0.45867	D	0.000325	T	0.11836	0.0288	N	0.11756	0.17	0.80722	D	1	B;B	0.13145	0.003;0.007	B;B	0.20577	0.03;0.02	T	0.12167	-1.0558	10	0.37606	T	0.19	-16.1596	14.9156	0.70795	0.0:0.0:0.0:1.0	.	76;76	Q6IRX3;Q9Y580	.;RBM7_HUMAN	H	76	ENSP00000439918:Y76H;ENSP00000364639:Y76H;ENSP00000440949:Y76H;ENSP00000440923:Y76H	ENSP00000364639:Y76H	Y	+	1	0	RBM7	113777759	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	5.696000	0.68287	2.186000	0.69663	0.533000	0.62120	TAT		0.343	RBM7-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399010.1		NM_016090	
S100A7A	338324	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	153391770	153391770	+	Silent	SNP	T	T	C	rs368536104		TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr1:153391770T>C	ENST00000368729.4	+	3	348	c.291T>C	c.(289-291)tcT>tcC	p.S97S	S100A7A_ENST00000329256.2_Silent_p.S97S|S100A7A_ENST00000368728.2_Silent_p.S97S	NM_176823.3	NP_789793.1	Q86SG5	S1A7A_HUMAN	S100 calcium binding protein A7A	97						cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|protein self-association (GO:0043621)	p.S97S(1)		cervix(1)|endometrium(3)|kidney(1)|lung(3)|prostate(1)|skin(2)|stomach(1)	12	all_lung(78;2.81e-33)|Lung NSC(65;9.54e-32)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.171)			CGCCCTGTTCTGGGGGAAGCC	0.527																																																	1	Substitution - coding silent(1)	kidney(1)						T		0,4406		0,0,2203	46.0	46.0	46.0		291	-1.9	0.0	1		46	1,8599		0,1,4299	no	coding-synonymous	S100A7A	NM_176823.3		0,1,6502	CC,CT,TT		0.0116,0.0,0.0077		97/102	153391770	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	338324			AY189118	CCDS30872.1	1q22	2013-01-10	2006-09-11	2006-09-11	ENSG00000184330	ENSG00000184330		"""S100 calcium binding proteins"", ""EF-hand domain containing"""	21657	protein-coding gene	gene with protein product			"""S100 calcium binding protein A15"", ""S100 calcium binding protein A7-like 1"""	S100A15, S100A7L1		11230159	Standard	NM_176823		Approved	S100A7f	uc001fbt.1	Q86SG5	OTTHUMG00000013122	ENST00000368729.4:c.291T>C	1.37:g.153391770T>C		Somatic		WXS	Illumina HiSeq	Phase_I	D3DV38|Q5SY69	Silent	SNP	ENST00000368729.4	37	CCDS30872.1																																																																																				0.527	S100A7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036786.2		NM_176823	
SCARB2	950	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	77084506	77084506	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr4:77084506G>A	ENST00000264896.2	-	11	1619	c.1270C>T	c.(1270-1272)Cga>Tga	p.R424*	SCARB2_ENST00000452464.2_Nonsense_Mutation_p.R281*	NM_005506.3	NP_005497.1	Q14108	SCRB2_HUMAN	scavenger receptor class B, member 2	424					cell adhesion (GO:0007155)|protein targeting to lysosome (GO:0006622)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	enzyme binding (GO:0019899)|receptor activity (GO:0004872)	p.R424*(1)		breast(1)|endometrium(4)|kidney(4)|large_intestine(7)|lung(3)|prostate(2)|skin(1)	22			Lung(101;0.196)			GACTTCAGTCGACTCGCCGTC	0.403																																																	1	Substitution - Nonsense(1)	kidney(1)											224.0	194.0	204.0					4																	77084506		2203	4300	6503	SO:0001587	stop_gained	950			D12676	CCDS3577.1, CCDS56335.1	4q21.1	2014-07-11	2002-09-06	2002-09-06	ENSG00000138760	ENSG00000138760			1665	protein-coding gene	gene with protein product		602257	"""CD36 antigen (collagen type I receptor, thrombospondin receptor)-like 2 (lysosomal integral membrane protein II)"""	CD36L2		1374238	Standard	NM_005506		Approved	HLGP85, LIMPII, SR-BII, LIMP-2	uc003hju.2	Q14108	OTTHUMG00000130099	ENST00000264896.2:c.1270C>T	4.37:g.77084506G>A	ENSP00000264896:p.Arg424*	Somatic		WXS	Illumina HiSeq	Phase_I	B4DKD8|E7EM68|Q53Y63	Nonsense_Mutation	SNP	ENST00000264896.2	37	CCDS3577.1	.	.	.	.	.	.	.	.	.	.	G	36	5.764607	0.96906	.	.	ENSG00000138760	ENST00000264896;ENST00000452464	.	.	.	5.87	4.95	0.65309	.	0.206931	0.49916	D	0.000132	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.12103	T	0.63	.	10.7923	0.46440	0.0:0.0:0.7251:0.2749	.	.	.	.	X	424;281	.	ENSP00000264896:R424X	R	-	1	2	SCARB2	77303530	0.370000	0.25047	0.243000	0.24186	0.273000	0.26683	3.552000	0.53705	2.780000	0.95670	0.655000	0.94253	CGA		0.403	SCARB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252403.1		NM_005506	
SH3GLB1	51100	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	87200796	87200796	+	Missense_Mutation	SNP	A	A	T			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr1:87200796A>T	ENST00000370558.4	+	7	1019	c.695A>T	c.(694-696)gAa>gTa	p.E232V	SH3GLB1_ENST00000535010.1_Missense_Mutation_p.E132V|SH3GLB1_ENST00000482504.1_Missense_Mutation_p.E253V	NM_001206651.1|NM_001206653.1|NM_016009.4	NP_001193580.1|NP_001193582.1|NP_057093.1	Q9Y371	SHLB1_HUMAN	SH3-domain GRB2-like endophilin B1	232	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.				'de novo' posttranslational protein folding (GO:0051084)|apoptotic process (GO:0006915)|phosphatidic acid biosynthetic process (GO:0006654)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|protein oligomerization (GO:0051259)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|mitochondrial outer membrane (GO:0005741)|protein complex (GO:0043234)	fatty acid binding (GO:0005504)|identical protein binding (GO:0042802)|lysophosphatidic acid acyltransferase activity (GO:0042171)|protein homodimerization activity (GO:0042803)	p.E253V(1)|p.E232V(1)		endometrium(2)|kidney(1)|large_intestine(4)|lung(3)|stomach(1)	11		Lung NSC(277;0.209)		all cancers(265;0.0136)|Epithelial(280;0.0414)		GACTTTGTAGAAGCCCAGATG	0.403																																																	2	Substitution - Missense(2)	kidney(2)											138.0	129.0	132.0					1																	87200796		2203	4300	6503	SO:0001583	missense	51100			AF263293	CCDS710.1, CCDS55612.1, CCDS55613.1, CCDS72819.1	1p22.3	2012-04-17	2001-12-04		ENSG00000097033	ENSG00000097033		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	10833	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 70"""	609287	"""SH3-domain, GRB2-like, endophilin B1"""			11161816, 11259440	Standard	NM_016009		Approved	CGI-61, KIAA0491, Bif-1, PPP1R70	uc001dly.3	Q9Y371	OTTHUMG00000010257	ENST00000370558.4:c.695A>T	1.37:g.87200796A>T	ENSP00000473267:p.Glu232Val	Somatic		WXS	Illumina HiSeq	Phase_I	B4E182|Q5H8U5|Q9H3Z0|Q9NR47|Q9NYA9	Missense_Mutation	SNP	ENST00000370558.4	37	CCDS710.1	.	.	.	.	.	.	.	.	.	.	A	32	5.128459	0.94473	.	.	ENSG00000097033	ENST00000212369;ENST00000535010;ENST00000482504	T;T	0.35605	1.3;1.3	5.53	5.53	0.82687	BAR (3);IRSp53/MIM homology domain (IMD) (1);	0.000000	0.85682	D	0.000000	T	0.56790	0.2009	M	0.86343	2.81	0.80722	D	1	D;D;D	0.63880	0.993;0.991;0.958	D;P;P	0.64410	0.925;0.886;0.833	T	0.66760	-0.5842	10	0.87932	D	0	-5.4135	15.6728	0.77292	1.0:0.0:0.0:0.0	.	132;253;232	B4E182;Q9Y371-2;Q9Y371	.;.;SHLB1_HUMAN	V	232;132;253	ENSP00000441355:E132V;ENSP00000418744:E253V	ENSP00000212369:E232V	E	+	2	0	SH3GLB1	86973384	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.336000	0.96533	2.095000	0.63458	0.533000	0.62120	GAA		0.403	SH3GLB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028287.2		NM_016009	
SLC22A4	6583	broad.mit.edu	37	5	131630693	131630693	+	Silent	SNP	C	C	T			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr5:131630693C>T	ENST00000200652.3	+	1	558	c.384C>T	c.(382-384)gtC>gtT	p.V128V	P4HA2_ENST00000471826.1_Intron	NM_003059.2	NP_003050.2	Q9H015	S22A4_HUMAN	solute carrier family 22 (organic cation/zwitterion transporter), member 4	128					body fluid secretion (GO:0007589)|carnitine metabolic process (GO:0009437)|carnitine transmembrane transport (GO:1902603)|carnitine transport (GO:0015879)|cation transmembrane transport (GO:0098655)|organic cation transport (GO:0015695)|quaternary ammonium group transport (GO:0015697)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|triglyceride metabolic process (GO:0006641)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|carnitine transmembrane transporter activity (GO:0015226)|cation:cation antiporter activity (GO:0015491)|nucleotide binding (GO:0000166)|PDZ domain binding (GO:0030165)|quaternary ammonium group transmembrane transporter activity (GO:0015651)|secondary active organic cation transmembrane transporter activity (GO:0008513)|symporter activity (GO:0015293)	p.V128V(1)		endometrium(1)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|urinary_tract(1)	16		all_cancers(142;0.0752)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		Amiloride(DB00594)|Aminohippurate(DB00345)|Benzylpenicillin(DB01053)|Choline(DB00122)|Cimetidine(DB00501)|Clonidine(DB00575)|Desipramine(DB01151)|Guanidine(DB00536)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|L-Arginine(DB00125)|L-Carnitine(DB00583)|L-Lysine(DB00123)|Levofloxacin(DB01137)|Mepyramine(DB06691)|Nicotine(DB00184)|Ofloxacin(DB01165)|Procainamide(DB01035)|Quinidine(DB00908)|Quinine(DB00468)|Spermine(DB00127)|Testosterone(DB00624)|Tiotropium(DB01409)|Verapamil(DB00661)	TGTCCACCGTCGTGACCGAGG	0.701																																																	1	Substitution - coding silent(1)	kidney(1)											15.0	19.0	18.0					5																	131630693		2187	4269	6456	SO:0001819	synonymous_variant	6583			AB007448	CCDS4153.1	5q23.3	2013-07-18	2013-07-18		ENSG00000197208	ENSG00000197208		"""Solute carriers"""	10968	protein-coding gene	gene with protein product		604190	"""solute carrier family 22 (organic cation/ergothioneine transporter), member 4"""			9426230, 15795384	Standard	NM_003059		Approved	OCTN1, MGC34546	uc003kwq.3	Q9H015	OTTHUMG00000059648	ENST00000200652.3:c.384C>T	5.37:g.131630693C>T		Somatic		WXS	Illumina GAIIx	Phase_I	O14546	Silent	SNP	ENST00000200652.3	37	CCDS4153.1																																																																																				0.701	SLC22A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132661.1		NM_003059	
SMARCAL1	50485	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	217342998	217342998	+	Silent	SNP	A	A	G			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr2:217342998A>G	ENST00000357276.4	+	17	2931	c.2601A>G	c.(2599-2601)acA>acG	p.T867T	AC098820.3_ENST00000453157.1_RNA|SMARCAL1_ENST00000358207.5_Silent_p.T867T	NM_014140.3	NP_054859.2	Q9NZC9	SMAL1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a-like 1	867	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA metabolic process (GO:0006259)|DNA strand renaturation (GO:0000733)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|replication fork processing (GO:0031297)	nucleus (GO:0005634)|site of double-strand break (GO:0035861)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)	p.T867T(1)		NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(10)|liver(1)|lung(15)|ovary(3)|prostate(1)|skin(1)	42		Renal(323;0.0458)		Epithelial(149;9.48e-06)|all cancers(144;0.000621)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0111)		CAGAAATGACAGAATCCACTG	0.488									Schimke Immuno-Osseous Dysplasia																																								1	Substitution - coding silent(1)	kidney(1)											100.0	106.0	104.0					2																	217342998		2203	4300	6503	SO:0001819	synonymous_variant	50485	Familial Cancer Database	SIOD	AF210833	CCDS2403.1	2q35	2014-09-17			ENSG00000138375	ENSG00000138375			11102	protein-coding gene	gene with protein product	"""HepA-related protein"", ""ATP-driven annealing helicase"""	606622				10713074, 10857751, 18974355	Standard	NM_014140		Approved	HHARP, HARP	uc002vgd.4	Q9NZC9	OTTHUMG00000133055	ENST00000357276.4:c.2601A>G	2.37:g.217342998A>G		Somatic		WXS	Illumina HiSeq	Phase_I	A6NEH0|Q53R00|Q96AY1|Q9NXQ5|Q9UFH3|Q9UI93	Silent	SNP	ENST00000357276.4	37	CCDS2403.1																																																																																				0.488	SMARCAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256671.2			
SPTBN4	57731	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	41066216	41066216	+	Missense_Mutation	SNP	C	C	G			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr19:41066216C>G	ENST00000352632.3	+	27	5908	c.5822C>G	c.(5821-5823)aCa>aGa	p.T1941R	SPTBN4_ENST00000392023.1_Missense_Mutation_p.T617R|SPTBN4_ENST00000595535.1_Missense_Mutation_p.T1941R|SPTBN4_ENST00000338932.3_Missense_Mutation_p.T1941R|SPTBN4_ENST00000598249.1_Missense_Mutation_p.T1941R|SPTBN4_ENST00000392025.1_Missense_Mutation_p.T684R			Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4	1941					actin filament capping (GO:0051693)|adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cardiac conduction (GO:0061337)|central nervous system projection neuron axonogenesis (GO:0021952)|clustering of voltage-gated sodium channels (GO:0045162)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization to plasma membrane (GO:0090002)|fertilization (GO:0009566)|negative regulation of heart rate (GO:0010459)|positive regulation of multicellular organism growth (GO:0040018)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of sodium ion transport (GO:0002028)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|axon hillock (GO:0043203)|axon initial segment (GO:0043194)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|nuclear matrix (GO:0016363)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|PML body (GO:0016605)|spectrin (GO:0008091)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phosphatase binding (GO:0019902)|phospholipid binding (GO:0005543)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.T1941R(1)|p.T617R(1)		breast(4)|central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	73			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GTCAGCTCCACAGCCGACGCC	0.657																																																	2	Substitution - Missense(2)	kidney(2)											89.0	77.0	81.0					19																	41066216		2203	4300	6503	SO:0001583	missense	57731			AF082075	CCDS12559.1, CCDS42569.1	19q13.13	2013-01-10				ENSG00000160460		"""Pleckstrin homology (PH) domain containing"""	14896	protein-coding gene	gene with protein product		606214				11086001	Standard	NM_020971		Approved	SPTBN3, KIAA1642	uc002onz.3	Q9H254		ENST00000352632.3:c.5822C>G	19.37:g.41066216C>G	ENSP00000263373:p.Thr1941Arg	Somatic		WXS	Illumina HiSeq	Phase_I	E9PGQ5|Q9H1K7|Q9H1K8|Q9H1K9|Q9H253|Q9H3G8|Q9HCD0	Missense_Mutation	SNP	ENST00000352632.3	37	CCDS12559.1	.	.	.	.	.	.	.	.	.	.	C	15.28	2.787764	0.49997	.	.	ENSG00000160460	ENST00000428507;ENST00000352632;ENST00000338932;ENST00000392025;ENST00000392023	T;T;T;T	0.60797	1.33;1.33;1.33;0.16	4.47	4.47	0.54385	.	0.180734	0.37483	U	0.002065	T	0.73321	0.3572	M	0.64997	1.995	0.40000	D	0.975155	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.979;0.999;0.988;0.998	T	0.77778	-0.2460	10	0.87932	D	0	.	16.0659	0.80870	0.0:1.0:0.0:0.0	.	684;617;1941;1941	C9JY79;E9PGQ5;Q9H254;Q71S06	.;.;SPTN4_HUMAN;.	R	1941;1941;1941;684;617	ENSP00000263373:T1941R;ENSP00000340345:T1941R;ENSP00000375879:T684R;ENSP00000375877:T617R	ENSP00000340345:T1941R	T	+	2	0	SPTBN4	45758056	0.560000	0.26570	1.000000	0.80357	0.202000	0.24057	2.581000	0.46077	2.321000	0.78463	0.591000	0.81541	ACA		0.657	SPTBN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462559.2			
TECTB	6975	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	114053509	114053509	+	Missense_Mutation	SNP	C	C	G			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr10:114053509C>G	ENST00000369422.3	+	5	497	c.497C>G	c.(496-498)tCc>tGc	p.S166C		NM_058222.1	NP_478129.1	Q96PL2	TECTB_HUMAN	tectorin beta	166	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.					anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)		p.S166C(1)		kidney(2)|large_intestine(3)|lung(9)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	19		Colorectal(252;0.198)		Epithelial(162;0.0143)|all cancers(201;0.0242)		GCCAAGTTCTCCATCAAGAAA	0.468																																																	1	Substitution - Missense(1)	kidney(1)											147.0	138.0	141.0					10																	114053509		2203	4300	6503	SO:0001583	missense	6975			AF312827	CCDS7571.1	10q25-q26	2005-06-09			ENSG00000119913	ENSG00000119913			11721	protein-coding gene	gene with protein product		602653				9079715	Standard	NM_058222		Approved		uc001kzr.1	Q96PL2	OTTHUMG00000019056	ENST00000369422.3:c.497C>G	10.37:g.114053509C>G	ENSP00000358430:p.Ser166Cys	Somatic		WXS	Illumina HiSeq	Phase_I	Q5VW53	Missense_Mutation	SNP	ENST00000369422.3	37	CCDS7571.1	.	.	.	.	.	.	.	.	.	.	C	18.72	3.684472	0.68157	.	.	ENSG00000119913	ENST00000369422	D	0.84298	-1.83	5.87	5.87	0.94306	Zona pellucida sperm-binding protein (3);	0.193177	0.49916	D	0.000137	D	0.85292	0.5663	L	0.55481	1.735	0.43959	D	0.996635	D	0.56287	0.975	P	0.47786	0.557	D	0.86055	0.1528	10	0.56958	D	0.05	.	14.3622	0.66779	0.0:0.9297:0.0:0.0703	.	166	Q96PL2	TECTB_HUMAN	C	166	ENSP00000358430:S166C	ENSP00000358430:S166C	S	+	2	0	TECTB	114043499	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	3.708000	0.54845	2.780000	0.95670	0.655000	0.94253	TCC		0.468	TECTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050381.1		NM_058222	
TSGA10IP	254187	broad.mit.edu	37	11	65715209	65715209	+	RNA	SNP	C	C	T			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr11:65715209C>T	ENST00000532620.1	+	0	1144				TSGA10IP_ENST00000608857.1_RNA			Q3SY00	T10IP_HUMAN	testis specific, 10 interacting protein									p.R275*(1)		endometrium(2)|kidney(3)|lung(9)	14						CCTCCGAAGGCGACAATGGAG	0.607																																																	1	Substitution - Nonsense(1)	kidney(1)											17.0	20.0	19.0					11																	65715209		2076	4201	6277			254187			AK057442	CCDS66138.1	11q13.1	2014-03-25			ENSG00000175513	ENSG00000175513			26555	protein-coding gene	gene with protein product						14702039	Standard	NM_152762		Approved	FLJ32880, FAM161C	uc001ogk.1	Q3SY00	OTTHUMG00000166753		11.37:g.65715209C>T		Somatic		WXS	Illumina GAIIx	Phase_I	Q3SXZ9|Q3SY01|Q96M26	Nonsense_Mutation	SNP	ENST00000532620.1	37																																																																																					0.607	TSGA10IP-001	KNOWN	basic	processed_transcript	polymorphic_pseudogene	OTTHUMT00000391373.2		NM_152762	
RP11-24M17.5	0	broad.mit.edu	37	15	76074470	76074470	+	RNA	SNP	A	A	G			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr15:76074470A>G	ENST00000395215.3	+	0	649				RN7SL319P_ENST00000480656.2_RNA														p.Q203R(4)									CGGTTACAGCAGACCATAAAG	0.577																																																	4	Substitution - Missense(4)	kidney(3)|endometrium(1)																																										0																															15.37:g.76074470A>G		Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000395215.3	37		.	.	.	.	.	.	.	.	.	.	.	3.199	-0.164202	0.06502	.	.	ENSG00000187812	ENST00000395215	.	.	.	0.789	0.789	0.18607	.	.	.	.	.	T	0.40222	0.1108	.	.	.	.	.	.	D	0.54964	0.969	P	0.57101	0.813	T	0.45101	-0.9284	6	0.19147	T	0.46	.	2.915	0.05750	0.5938:0.0:0.0:0.4062	.	203	B4DZE6	.	R	203	.	ENSP00000378641:Q203R	Q	+	2	0	AC019294.2	73861525	0.996000	0.38824	0.003000	0.11579	0.003000	0.03518	0.808000	0.27154	0.620000	0.30215	0.228000	0.17796	CAG		0.577	RP11-24M17.5-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000420501.1			
VHL	7428	broad.mit.edu;hgsc.bcm.edu	37	3	10183797	10183797	+	Missense_Mutation	SNP	T	T	C	rs5030807		TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr3:10183797T>C	ENST00000256474.2	+	1	1106	c.266T>C	c.(265-267)cTc>cCc	p.L89P	snoU13_ENST00000458986.1_RNA|VHL_ENST00000345392.2_Missense_Mutation_p.L89P	NM_000551.3	NP_000542.1	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase	89			L -> H (in lung cancer).|L -> P (in VHLD; type I; dbSNP:rs5030807). {ECO:0000269|PubMed:8956040}.		cell morphogenesis (GO:0000902)|cellular response to hypoxia (GO:0071456)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|transcription factor binding (GO:0008134)|ubiquitin protein ligase activity (GO:0061630)|ubiquitin-protein transferase activity (GO:0004842)	p.L89H(11)|p.L89P(6)|p.L89R(3)|p.R60fs*35(1)|p.V84_E94>E(1)|p.V84fs*69(1)|p.L89fs*67(1)		adrenal_gland(25)|autonomic_ganglia(3)|central_nervous_system(2)|endometrium(6)|kidney(1662)|large_intestine(14)|lung(6)|pancreas(18)|paratesticular_tissues(1)|pleura(1)|skin(1)|soft_tissue(24)|thyroid(3)|upper_aerodigestive_tract(3)	1769				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		CCCGTATGGCTCAACTTCGAC	0.726	L89H(NCIH28_PLEURA)	1	"""D, Mis, N, F, S"""		"""renal, hemangioma, pheochromocytoma"""	"""renal, hemangioma, pheochromocytoma"""			von Hippel-Lindau disease;Pheochromocytoma (Adrenal), Familial;Chuvash Polycythemia																														yes	Rec	yes	von Hippel-Lindau syndrome	3	3p25	7428	von Hippel-Lindau syndrome gene		"""E, M, O"""	24	Substitution - Missense(20)|Deletion - Frameshift(3)|Complex - deletion inframe(1)	kidney(22)|pancreas(1)|pleura(1)	GRCh37	CM941368	VHL	M	rs5030807						13.0	16.0	15.0					3																	10183797		2106	4156	6262	SO:0001583	missense	7428	Familial Cancer Database	VHL; ;Erythrocytosis, Familial type 2	L15409	CCDS2597.1, CCDS2598.1	3p25.3	2014-09-17	2012-02-23		ENSG00000134086	ENSG00000134086			12687	protein-coding gene	gene with protein product		608537	"""von Hippel-Lindau syndrome"", ""von Hippel-Lindau tumor suppressor"""			9671762	Standard	NM_000551		Approved	VHL1	uc003bvc.3	P40337	OTTHUMG00000128668	ENST00000256474.2:c.266T>C	3.37:g.10183797T>C	ENSP00000256474:p.Leu89Pro	Somatic		WXS	Illumina HiSeq	Phase_I	B2RE45|Q13599|Q6PDA9	Missense_Mutation	SNP	ENST00000256474.2	37	CCDS2597.1	.	.	.	.	.	.	.	.	.	.	T	26.9	4.777209	0.90195	.	.	ENSG00000134086	ENST00000256474;ENST00000345392	D;D	0.99815	-6.9;-6.9	5.06	5.06	0.68205	von Hippel-Lindau disease tumor suppressor,  beta domain (1);von Hippel-Lindau disease tumour suppressor, beta/alpha domain (2);	0.185584	0.46442	D	0.000292	D	0.99563	0.9843	L	0.41492	1.28	0.54753	D	0.999989	D;D	0.76494	0.998;0.999	D;D	0.71656	0.962;0.974	D	0.97591	1.0117	10	0.72032	D	0.01	-8.4916	12.8448	0.57823	0.0:0.0:0.0:1.0	rs5030807	89;89	P40337-2;P40337	.;VHL_HUMAN	P	89	ENSP00000256474:L89P;ENSP00000344757:L89P	ENSP00000256474:L89P	L	+	2	0	VHL	10158797	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	4.914000	0.63348	1.920000	0.55613	0.450000	0.29827	CTC		0.726	VHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250559.1		NM_000551	
YIF1A	10897	hgsc.bcm.edu;ucsc.edu	37	11	66052992	66052996	+	Frame_Shift_Del	DEL	CACCT	CACCT	-			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	CACCT	CACCT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr11:66052992_66052996delCACCT	ENST00000376901.4	-	6	681_685	c.497_501delAGGTG	c.(496-501)gaggtgfs	p.EV166fs	YIF1A_ENST00000471387.2_Frame_Shift_Del_p.EV23fs|YIF1A_ENST00000359461.6_Intron|YIF1A_ENST00000496746.1_5'Flank|YIF1A_ENST00000526497.1_5'UTR	NM_020470.2	NP_065203.2	O95070	YIF1A_HUMAN	Yip1 interacting factor homolog A (S. cerevisiae)	166					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|microtubule organizing center (GO:0005815)				endometrium(1)|large_intestine(1)|lung(3)|prostate(1)|skin(2)|stomach(1)	9						ACAGGCCCAGCACCTCCGGGGAGAA	0.663																																																	0																																										SO:0001589	frameshift_variant	10897			AF004876	CCDS8132.1, CCDS73325.1	11q13	2009-01-05	2005-06-07	2005-06-07	ENSG00000174851	ENSG00000174851			16688	protein-coding gene	gene with protein product		611484	"""Yip1 interacting factor homolog (S. cerevisiae)"""	YIF1		8824393, 10970842, 18718466	Standard	NM_020470		Approved	YIF1P, 54TM, FinGER7	uc001ohk.4	O95070	OTTHUMG00000102079	ENST00000376901.4:c.497_501delAGGTG	11.37:g.66052992_66052996delCACCT	ENSP00000366098:p.Glu166fs	Somatic		WXS	Illumina HiSeq	Phase_I	A6NM00|Q96G83|Q9BVD0	Frame_Shift_Del	DEL	ENST00000376901.4	37	CCDS8132.1																																																																																				0.663	YIF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219903.3		NM_020470	
ZFR	51663	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	32390443	32390443	+	Missense_Mutation	SNP	G	G	C			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr5:32390443G>C	ENST00000265069.8	-	12	2182	c.2080C>G	c.(2080-2082)Cca>Gca	p.P694A		NM_016107.3	NP_057191.2	Q96KR1	ZFR_HUMAN	zinc finger RNA binding protein	694					multicellular organismal development (GO:0007275)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.P694A(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|upper_aerodigestive_tract(2)	32				STAD - Stomach adenocarcinoma(35;0.19)		AATGGGCCTGGAGGACCATGA	0.542																																																	1	Substitution - Missense(1)	kidney(1)											137.0	130.0	132.0					5																	32390443		2203	4300	6503	SO:0001583	missense	51663			AF100742	CCDS34139.1	5p15.2	2014-03-03			ENSG00000056097	ENSG00000056097			17277	protein-coding gene	gene with protein product		615635				11574164, 24482476	Standard	NM_016107		Approved	ZFR1, SPG71	uc003jhr.1	Q96KR1	OTTHUMG00000161979	ENST00000265069.8:c.2080C>G	5.37:g.32390443G>C	ENSP00000265069:p.Pro694Ala	Somatic		WXS	Illumina HiSeq	Phase_I	B2RNR5|Q05C08|Q3B7X5|Q6P5A3|Q86UA0|Q9H6V4|Q9NTI1|Q9Y687	Missense_Mutation	SNP	ENST00000265069.8	37	CCDS34139.1	.	.	.	.	.	.	.	.	.	.	G	18.04	3.535325	0.64972	.	.	ENSG00000056097	ENST00000265069;ENST00000382126	T	0.07021	3.23	5.28	5.28	0.74379	.	0.109289	0.64402	D	0.000006	T	0.30792	0.0776	M	0.78049	2.395	0.80722	D	1	D	0.63880	0.993	D	0.68192	0.956	T	0.01480	-1.1344	10	0.41790	T	0.15	.	18.907	0.92466	0.0:0.0:1.0:0.0	.	694	Q96KR1	ZFR_HUMAN	A	694;672	ENSP00000265069:P694A	ENSP00000265069:P694A	P	-	1	0	ZFR	32426200	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.170000	0.94795	2.463000	0.83235	0.561000	0.74099	CCA		0.542	ZFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366586.1			
ZNF45	7596	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	44418082	44418082	+	Silent	SNP	G	G	A	rs142171881	byFrequency	TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr19:44418082G>A	ENST00000269973.5	-	10	2596	c.1506C>T	c.(1504-1506)tgC>tgT	p.C502C	ZNF45_ENST00000589703.1_Silent_p.C502C|RP11-15A1.2_ENST00000586247.1_RNA	NM_003425.3	NP_003416.1	Q02386	ZNF45_HUMAN	zinc finger protein 45	502					gene expression (GO:0010467)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.C502C(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	17						CACACCTCTCGCATTTATAGG	0.483													G|||	5	0.000998403	0.003	0.0014	5008	,	,		20706	0.0		0.0	False		,,,				2504	0.0																1	Substitution - coding silent(1)	kidney(1)						G		13,4393	21.2+/-45.6	0,13,2190	59.0	57.0	57.0		1506	-0.0	1.0	19	dbSNP_134	57	0,8600		0,0,4300	no	coding-synonymous	ZNF45	NM_003425.3		0,13,6490	AA,AG,GG		0.0,0.2951,0.1		502/683	44418082	13,12993	2203	4300	6503	SO:0001819	synonymous_variant	7596			M67509	CCDS12632.1	19q13.2	2013-01-08	2005-01-11			ENSG00000124459		"""Zinc fingers, C2H2-type"", ""-"""	13111	protein-coding gene	gene with protein product		194554	"""zinc finger protein 45 (a Kruppel-associated box (KRAB) domain polypeptide)"", ""zinc finger protein 13"""	ZNF13		9067431	Standard	NM_003425		Approved		uc002oxw.2	Q02386		ENST00000269973.5:c.1506C>T	19.37:g.44418082G>A		Somatic		WXS	Illumina HiSeq	Phase_I	P17016|P78472|Q9P1U9	Silent	SNP	ENST00000269973.5	37	CCDS12632.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	6.631	0.484853	0.12641	0.002951	0.0	ENSG00000124459	ENST00000328762	.	.	.	3.61	-0.0442	0.13856	.	.	.	.	.	T	0.60741	0.2292	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.59289	-0.7482	5	0.66056	D	0.02	-10.9822	7.9251	0.29870	0.5885:0.0:0.4115:0.0	.	.	.	.	V	502	.	ENSP00000367176:A502V	A	-	2	0	ZNF45	49109922	0.065000	0.20965	0.995000	0.50966	0.974000	0.67602	0.499000	0.22546	-0.136000	0.11475	-0.693000	0.03709	GCG		0.483	ZNF45-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459919.1		NM_003425	
ZPBP2	124626	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	38031594	38031594	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr17:38031594G>A	ENST00000348931.4	+	7	987	c.796G>A	c.(796-798)Gtg>Atg	p.V266M	ZPBP2_ENST00000584588.1_Missense_Mutation_p.V193M|ZPBP2_ENST00000377940.3_Missense_Mutation_p.V244M	NM_199321.2	NP_955353.1	Q6X784	ZPBP2_HUMAN	zona pellucida binding protein 2	266					acrosome assembly (GO:0001675)|binding of sperm to zona pellucida (GO:0007339)	acrosomal vesicle (GO:0001669)|cell body (GO:0044297)|extracellular region (GO:0005576)|nucleus (GO:0005634)|zona pellucida receptor complex (GO:0002199)		p.V266M(1)		kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	15	Colorectal(19;0.000442)		Lung(15;0.00849)|LUSC - Lung squamous cell carcinoma(15;0.171)			AATGCATTTTGTGGACCACAG	0.393																																																	1	Substitution - Missense(1)	kidney(1)											87.0	83.0	85.0					17																	38031594		2203	4300	6503	SO:0001583	missense	124626			BC043152	CCDS11352.1, CCDS11353.2	17q21.1	2013-01-11			ENSG00000186075	ENSG00000186075		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	20678	protein-coding gene	gene with protein product		608499					Standard	XM_005257031		Approved	ZPBPL, MGC41930	uc002hte.3	Q6X784	OTTHUMG00000133022	ENST00000348931.4:c.796G>A	17.37:g.38031594G>A	ENSP00000335384:p.Val266Met	Somatic		WXS	Illumina HiSeq	Phase_I	A8K8L8|Q6X783|Q86XL5	Missense_Mutation	SNP	ENST00000348931.4	37	CCDS11352.1	.	.	.	.	.	.	.	.	.	.	G	10.95	1.495983	0.26774	.	.	ENSG00000186075	ENST00000348931;ENST00000377940	T;T	0.59772	0.24;0.24	5.55	1.31	0.21738	.	0.396545	0.21320	N	0.076498	T	0.51568	0.1682	M	0.66939	2.045	0.32824	D	0.503153	P;P	0.41710	0.577;0.76	B;B	0.38428	0.179;0.273	T	0.63435	-0.6638	10	0.87932	D	0	-4.4988	9.3336	0.38036	0.3475:0.0:0.6525:0.0	.	244;266	Q6X784-2;Q6X784	.;ZPBP2_HUMAN	M	266;244	ENSP00000335384:V266M;ENSP00000367174:V244M	ENSP00000335384:V266M	V	+	1	0	ZPBP2	35285120	0.997000	0.39634	0.999000	0.59377	0.974000	0.67602	0.501000	0.22578	0.307000	0.22880	0.460000	0.39030	GTG		0.393	ZPBP2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256609.2		NM_198844	
ZSCAN1	284312	broad.mit.edu;hgsc.bcm.edu	37	19	58549265	58549265	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b0483455-4cde-408f-b831-17223c03241a	8a6d1d13-52dd-44de-9bba-95cbb12056a0	g.chr19:58549265G>T	ENST00000282326.1	+	3	308	c.61G>T	c.(61-63)Gag>Tag	p.E21*	ZSCAN1_ENST00000391700.1_Nonsense_Mutation_p.E21*|ZSCAN1_ENST00000601162.1_Nonsense_Mutation_p.E21*	NM_182572.3	NP_872378.3	Q8NBB4	ZSCA1_HUMAN	zinc finger and SCAN domain containing 1	21					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|transcription coactivator activity (GO:0003713)	p.E21*(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	48		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0152)		AACCCCGAGTGAGCAGGACGC	0.687																																																	1	Substitution - Nonsense(1)	kidney(1)											9.0	11.0	10.0					19																	58549265		1992	4144	6136	SO:0001587	stop_gained	284312			AK091098	CCDS12969.1	19q13.43	2013-06-13	2004-04-21		ENSG00000152467	ENSG00000152467		"""-"", ""Zinc fingers, C2H2-type"""	23712	protein-coding gene	gene with protein product			"""zinc finger with SCAN domain 1"""			12477932	Standard	NM_182572		Approved	FLJ33779, ZNF915	uc002qrc.1	Q8NBB4	OTTHUMG00000183381	ENST00000282326.1:c.61G>T	19.37:g.58549265G>T	ENSP00000282326:p.Glu21*	Somatic		WXS	Illumina HiSeq	Phase_I	Q3B798|Q6WLH8|Q86WS8	Nonsense_Mutation	SNP	ENST00000282326.1	37	CCDS12969.1	.	.	.	.	.	.	.	.	.	.	G	16.43	3.120717	0.56613	.	.	ENSG00000152467	ENST00000391700;ENST00000282326	.	.	.	1.89	0.798	0.18660	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.27785	T	0.31	.	5.5814	0.17252	0.0:0.0:0.675:0.325	.	.	.	.	X	21	.	ENSP00000282326:E21X	E	+	1	0	ZSCAN1	63241077	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.182000	0.09726	0.145000	0.18977	-0.292000	0.09595	GAG		0.687	ZSCAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466427.1		NM_182572	
