#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
Unknown	0	broad.mit.edu	37	14	106919168	106919168	+	IGR	DEL	C	C	-	rs139643696	byFrequency	TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr14:106919168delC								IGHV4-39 (41042 upstream) : IGHV3-43 (7019 downstream)																							ACGTTAACCTCCCCCTCACTG	0.557													CCCC|CCCCC|CCCC|insertion	1476	0.294728	0.4289	0.2233	5008	,	,		15151	0.1548		0.2644	False		,,,				2504	0.3395																0																																										SO:0001628	intergenic_variant	8755																															14.37:g.106919168delC		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	DEL		37																																																																																				0	0.557									
Unknown	0	broad.mit.edu	37	14	106919176	106919177	+	IGR	INS	-	-	TG	rs373887691|rs145658629	byFrequency	TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr14:106919176_106919177insTG								IGHV4-39 (41050 upstream) : IGHV3-43 (7010 downstream)																							CTCCCCCTCACTGTCTCTAGTA	0.545														1338	0.267173	0.413	0.1974	5008	,	,		15923	0.122		0.2167	False		,,,				2504	0.3211																0																																										SO:0001628	intergenic_variant	8755																															14.37:g.106919177_106919178dupTG		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	INS		37																																																																																				0	0.545									
ADAR	103	broad.mit.edu;hgsc.bcm.edu	37	1	154569310	154569310	+	Silent	SNP	G	G	A			TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr1:154569310G>A	ENST00000368474.4	-	6	2440	c.2241C>T	c.(2239-2241)gtC>gtT	p.V747V	ADAR_ENST00000368471.3_Silent_p.V452V|ADAR_ENST00000292205.5_Silent_p.V790V	NM_001111.4|NM_015840.3|NM_015841.3	NP_001102|NP_056655.2|NP_056656.2	P55265	DSRAD_HUMAN	adenosine deaminase, RNA-specific	747	DRBM 3. {ECO:0000255|PROSITE- ProRule:PRU00266}.				adenosine to inosine editing (GO:0006382)|base conversion or substitution editing (GO:0016553)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|miRNA loading onto RISC involved in gene silencing by miRNA (GO:0035280)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|negative regulation of viral genome replication (GO:0045071)|positive regulation of viral genome replication (GO:0045070)|pre-miRNA processing (GO:0031054)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|response to interferon-alpha (GO:0035455)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|supraspliceosomal complex (GO:0044530)	DNA binding (GO:0003677)|double-stranded RNA adenosine deaminase activity (GO:0003726)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.V747V(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|lung(20)|ovary(4)|prostate(2)|skin(2)	51	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.0997)		LUSC - Lung squamous cell carcinoma(543;0.185)	Colorectal(1306;0.115)		CGGACTGGTCGACCAACTTGA	0.557																																																	1	Substitution - coding silent(1)	kidney(1)											105.0	88.0	94.0					1																	154569310		2203	4300	6503	SO:0001819	synonymous_variant	103			BC038227	CCDS1071.1, CCDS30879.1	1q21.3	2012-03-22			ENSG00000160710	ENSG00000160710	3.5.4.-		225	protein-coding gene	gene with protein product		146920	"""interferon-induced protein 4"""	IFI4, G1P1		7972084	Standard	NM_001111		Approved	ADAR1	uc001ffh.3	P55265	OTTHUMG00000037261	ENST00000368474.4:c.2241C>T	1.37:g.154569310G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B1AQQ9|B1AQR0|D3DV76|O15223|O43859|O43860|Q9BYM3|Q9BYM4	Silent	SNP	ENST00000368474.4	37	CCDS1071.1																																																																																				0.557	ADAR-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000090691.2		NM_001111	
AHNAK	79026	hgsc.bcm.edu	37	11	62296231	62296231	+	Silent	SNP	G	G	A	rs201187864		TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr11:62296231G>A	ENST00000378024.4	-	5	5932	c.5658C>T	c.(5656-5658)ggC>ggT	p.G1886G	AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000530124.1_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	1886					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				CCACACTGGGGCCTGTTAAAT	0.517																																																	0													146.0	158.0	154.0					11																	62296231		2202	4299	6501	SO:0001819	synonymous_variant	79026			M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.5658C>T	11.37:g.62296231G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A1A586	Silent	SNP	ENST00000378024.4	37	CCDS31584.1																																																																																				0.517	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1		NM_024060	
ANKRD36	375248	broad.mit.edu;hgsc.bcm.edu	37	2	97849372	97849372	+	Silent	SNP	T	T	C			TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr2:97849372T>C	ENST00000461153.2	+	28	2164	c.1920T>C	c.(1918-1920)ggT>ggC	p.G640G	ANKRD36_ENST00000420699.2_Silent_p.G640G			A6QL64	AN36A_HUMAN	ankyrin repeat domain 36	640								p.G640G(2)		endometrium(9)|kidney(5)|liver(1)|lung(3)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	23						GAATAATGGGTGGTGGGAAAT	0.353																																																	2	Substitution - coding silent(2)	kidney(2)											190.0	159.0	168.0					2																	97849372		692	1591	2283	SO:0001819	synonymous_variant	375248			BC046186	CCDS54379.1	2q11.2	2013-09-24			ENSG00000135976	ENSG00000135976		"""Ankyrin repeat domain containing"""	24079	protein-coding gene	gene with protein product						12975309	Standard	NM_001164315		Approved	UNQ2430	uc010yva.2	A6QL64	OTTHUMG00000155256	ENST00000461153.2:c.1920T>C	2.37:g.97849372T>C		Somatic		WXS	Illumina HiSeq	Phase_I	B4E3I8|Q6UX02|Q86X62|Q9HCD1	Silent	SNP	ENST00000461153.2	37	CCDS54379.1																																																																																				0.353	ANKRD36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339154.5			
ALPPL2	251	hgsc.bcm.edu	37	2	233273011	233273011	+	Missense_Mutation	SNP	C	C	G	rs75920311		TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr2:233273011C>G	ENST00000295453.3	+	6	735	c.683C>G	c.(682-684)cCc>cGc	p.P228R		NM_031313.2	NP_112603.2	P10696	PPBN_HUMAN	alkaline phosphatase, placental-like 2	228					dephosphorylation (GO:0016311)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	alkaline phosphatase activity (GO:0004035)|metal ion binding (GO:0046872)			breast(2)|kidney(1)|large_intestine(1)|liver(2)|lung(6)|skin(1)	13		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;4.45e-22)|Kidney(3;4.42e-11)|KIRC - Kidney renal clear cell carcinoma(3;1.9e-09)|BRCA - Breast invasive adenocarcinoma(100;0.000767)|Lung(119;0.00566)|LUSC - Lung squamous cell carcinoma(224;0.00746)|STAD - Stomach adenocarcinoma(3;0.0181)|GBM - Glioblastoma multiforme(43;0.196)	Amifostine(DB01143)	TACATGTTTCCCATGGGGACC	0.612																																																	0													89.0	98.0	95.0					2																	233273011		2199	4295	6494	SO:0001583	missense	251			J04948	CCDS2491.1	2q37	2008-05-20			ENSG00000163286	ENSG00000163286			441	protein-coding gene	gene with protein product		171810					Standard	NM_031313		Approved		uc002vss.4	P10696	OTTHUMG00000133257	ENST00000295453.3:c.683C>G	2.37:g.233273011C>G	ENSP00000295453:p.Pro228Arg	Somatic		WXS	Illumina HiSeq	Phase_I	A8KAF2|Q16727|Q53S81|Q96CM1	Missense_Mutation	SNP	ENST00000295453.3	37	CCDS2491.1	194	0.08882783882783883	45	0.09146341463414634	18	0.049723756906077346	80	0.13986013986013987	51	0.06728232189973615	c	13.23	2.176361	0.38413	.	.	ENSG00000163286	ENST00000295453	D	0.96774	-4.12	3.24	1.12	0.20585	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.053184	0.85682	N	0.000000	T	0.31295	0.0792	H	0.96080	3.765	0.41109	D	0.985721	B	0.25390	0.125	B	0.40677	0.337	T	0.72966	-0.4131	10	0.52906	T	0.07	.	7.2384	0.26082	0.0:0.7275:0.1716:0.1009	.	228	P10696	PPBN_HUMAN	R	228	ENSP00000295453:P228R	ENSP00000295453:P228R	P	+	2	0	ALPPL2	232981255	0.860000	0.29831	0.587000	0.28692	0.582000	0.36321	3.559000	0.53756	0.452000	0.26830	0.205000	0.17691	CCC		0.612	ALPPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257034.2		NM_031313	
AQP7	364	hgsc.bcm.edu	37	9	33386465	33386465	+	Missense_Mutation	SNP	A	A	G	rs74668961		TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr9:33386465A>G	ENST00000537089.1	-	4	385	c.67T>C	c.(67-69)Tat>Cat	p.Y23H	AQP7_ENST00000539936.1_Missense_Mutation_p.Y115H|AQP7_ENST00000541274.1_Missense_Mutation_p.Y23H|AQP7_ENST00000377425.4_Missense_Mutation_p.Y58H			O14520	AQP7_HUMAN	aquaporin 7	115					excretion (GO:0007588)|generation of precursor metabolites and energy (GO:0006091)|glycerol transport (GO:0015793)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	glycerol channel activity (GO:0015254)|water channel activity (GO:0015250)			NS(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(4)|skin(2)|stomach(1)	17			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)		CCCAGCACATAGACCGGAAAC	0.622																																																	0													31.0	30.0	31.0					9																	33386465		2203	4300	6503	SO:0001583	missense	364			AB006190	CCDS6541.1	9p13	2008-02-05			ENSG00000165269	ENSG00000165269		"""Ion channels / Aquaporins"""	640	protein-coding gene	gene with protein product		602974		AQP7L		9252401	Standard	NM_001170		Approved	AQP9, AQPap	uc003zst.3	O14520	OTTHUMG00000019773	ENST00000537089.1:c.67T>C	9.37:g.33386465A>G	ENSP00000441619:p.Tyr23His	Somatic		WXS	Illumina HiSeq	Phase_I	Q08E94|Q5T5L9|Q8NHM3	Missense_Mutation	SNP	ENST00000537089.1	37		.	.	.	.	.	.	.	.	.	.	-	19.28	3.796760	0.70567	.	.	ENSG00000165269	ENST00000537089;ENST00000379507;ENST00000297988;ENST00000377425;ENST00000439678;ENST00000379506;ENST00000539936;ENST00000541274;ENST00000379503	D;D;D;D;D;D;D;D;D	0.92446	-3.04;-3.04;-3.04;-3.04;-3.04;-3.04;-3.04;-3.04;-3.04	4.42	4.42	0.53409	Aquaporin-like (2);	0.054970	0.85682	D	0.000000	D	0.97158	0.9071	H	0.96889	3.9	0.58432	D	0.999999	D;P;P;P;P	0.89917	1.0;0.934;0.729;0.604;0.809	D;P;P;P;P	0.87578	0.998;0.802;0.802;0.616;0.707	D	0.97698	1.0183	10	0.66056	D	0.02	-20.8604	11.9819	0.53125	1.0:0.0:0.0:0.0	.	23;114;115;58;115	B7Z7F6;Q5T5M0;B7Z4U2;Q6P5T0;O14520	.;.;.;.;AQP7_HUMAN	H	23;114;115;58;23;114;115;23;51	ENSP00000441619:Y23H;ENSP00000368821:Y114H;ENSP00000297988:Y115H;ENSP00000396111:Y58H;ENSP00000410138:Y23H;ENSP00000368820:Y114H;ENSP00000439534:Y115H;ENSP00000438860:Y23H;ENSP00000368817:Y51H	ENSP00000297988:Y115H	Y	-	1	0	AQP7	33376465	1.000000	0.71417	0.147000	0.22382	0.585000	0.36419	8.545000	0.90657	2.001000	0.58596	0.524000	0.50904	TAT		0.622	AQP7-202	KNOWN	basic	protein_coding	protein_coding			NM_001170	
AQP7	364	hgsc.bcm.edu	37	9	33386469	33386469	+	Silent	SNP	C	C	T	rs78695486	byFrequency	TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr9:33386469C>T	ENST00000537089.1	-	4	381	c.63G>A	c.(61-63)ccG>ccA	p.P21P	AQP7_ENST00000539936.1_Silent_p.P113P|AQP7_ENST00000541274.1_Silent_p.P21P|AQP7_ENST00000377425.4_Silent_p.P56P			O14520	AQP7_HUMAN	aquaporin 7	113					excretion (GO:0007588)|generation of precursor metabolites and energy (GO:0006091)|glycerol transport (GO:0015793)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	glycerol channel activity (GO:0015254)|water channel activity (GO:0015250)			NS(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(4)|skin(2)|stomach(1)	17			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)		GCACATAGACCGGAAACTTCC	0.627													-|||	2	0.000399361	0.0008	0.0	5008	,	,		16785	0.0		0.001	False		,,,				2504	0.0																0													32.0	31.0	32.0					9																	33386469		2203	4300	6503	SO:0001819	synonymous_variant	364			AB006190	CCDS6541.1	9p13	2008-02-05			ENSG00000165269	ENSG00000165269		"""Ion channels / Aquaporins"""	640	protein-coding gene	gene with protein product		602974		AQP7L		9252401	Standard	NM_001170		Approved	AQP9, AQPap	uc003zst.3	O14520	OTTHUMG00000019773	ENST00000537089.1:c.63G>A	9.37:g.33386469C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q08E94|Q5T5L9|Q8NHM3	Silent	SNP	ENST00000537089.1	37																																																																																					0.627	AQP7-202	KNOWN	basic	protein_coding	protein_coding			NM_001170	
ARHGAP36	158763	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	130218268	130218268	+	Missense_Mutation	SNP	C	C	T			TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chrX:130218268C>T	ENST00000276211.5	+	5	980	c.635C>T	c.(634-636)tCc>tTc	p.S212F	ARHGAP36_ENST00000370922.1_Missense_Mutation_p.S200F|ARHGAP36_ENST00000370921.1_Missense_Mutation_p.S76F	NM_144967.3	NP_659404.2	Q6ZRI8	RHG36_HUMAN	Rho GTPase activating protein 36	212					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)	p.S212F(1)		breast(1)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(16)|lung(31)|ovary(4)|prostate(4)|skin(3)|urinary_tract(2)	71						TCAAAAATTTCCTTTCCAATT	0.498																																																	1	Substitution - Missense(1)	kidney(1)											42.0	41.0	42.0					X																	130218268		2203	4300	6503	SO:0001583	missense	158763				CCDS14628.1, CCDS65320.1	Xq26.1	2011-06-29			ENSG00000147256	ENSG00000147256		"""Rho GTPase activating proteins"""	26388	protein-coding gene	gene with protein product							Standard	NM_144967		Approved	FLJ30058	uc004evz.3	Q6ZRI8	OTTHUMG00000022402	ENST00000276211.5:c.635C>T	X.37:g.130218268C>T	ENSP00000276211:p.Ser212Phe	Somatic		WXS	Illumina HiSeq	Phase_I	B7Z234|B7Z439|Q5JRL9|Q5JRM0|Q5JRM1|Q96NU6	Missense_Mutation	SNP	ENST00000276211.5	37	CCDS14628.1	.	.	.	.	.	.	.	.	.	.	C	15.37	2.812314	0.50527	.	.	ENSG00000147256	ENST00000276211;ENST00000370922;ENST00000423277;ENST00000412432;ENST00000370921	T;T;T;T	0.10960	2.82;2.82;2.83;2.83	4.99	4.99	0.66335	.	0.000000	0.47455	D	0.000238	T	0.14614	0.0353	N	0.08118	0	0.48830	D	0.999712	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.74023	0.982;0.982;0.96	T	0.17961	-1.0352	10	0.52906	T	0.07	.	12.5345	0.56135	0.0:1.0:0.0:0.0	.	181;200;212	Q6ZRI8-2;Q6ZRI8-4;Q6ZRI8	.;.;RHG36_HUMAN	F	212;200;164;181;76	ENSP00000276211:S212F;ENSP00000359960:S200F;ENSP00000408515:S181F;ENSP00000359959:S76F	ENSP00000276211:S212F	S	+	2	0	ARHGAP36	130045949	0.995000	0.38212	0.599000	0.28851	0.102000	0.19082	4.477000	0.60223	2.451000	0.82905	0.529000	0.55759	TCC		0.498	ARHGAP36-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355073.1		NM_144967	
ASXL2	55252	hgsc.bcm.edu;ucsc.edu	37	2	26068366	26068368	+	In_Frame_Del	DEL	CTT	CTT	-			TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	CTT	CTT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr2:26068366_26068368delCTT	ENST00000435504.4	-	2	415_417	c.122_124delAAG	c.(121-126)gaagga>gga	p.E41del	ASXL2_ENST00000336112.4_In_Frame_Del_p.E13del|ASXL2_ENST00000272341.4_5'UTR			Q76L83	ASXL2_HUMAN	additional sex combs like transcriptional regulator 2	41					adult heart development (GO:0007512)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of bone mineralization involved in bone maturation (GO:1900159)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of histone H3-K27 trimethylation (GO:1902466)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(7)|pancreas(1)|prostate(4)|skin(3)|urinary_tract(3)	33	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCTTTTAGTCCTTCTCTCTGGAT	0.256																																																	0																																										SO:0001651	inframe_deletion	55252					2p24.1	2014-06-17	2014-06-17		ENSG00000143970	ENSG00000143970			23805	protein-coding gene	gene with protein product		612991	"""additional sex combs like 2 (Drosophila)"""			12888926	Standard	NM_018263		Approved	ASXH2, FLJ10898, KIAA1685	uc002rgs.2	Q76L83	OTTHUMG00000152176	ENST00000435504.4:c.122_124delAAG	2.37:g.26068366_26068368delCTT	ENSP00000391447:p.Glu41del	Somatic		WXS	Illumina HiSeq	Phase_I	Q53TC9|Q5H9U4|Q76L81|Q86XM1|Q9C0H8|Q9NV67	In_Frame_Del	DEL	ENST00000435504.4	37																																																																																					0.256	ASXL2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000325593.3		NM_018263	
ATP5EP2	432369	broad.mit.edu	37	13	28519646	28519646	+	3'UTR	DEL	A	A	-	rs555129296		TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr13:28519646delA	ENST00000381026.3	+	0	304							Q5VTU8	AT5EL_HUMAN	ATP synthase, H+ transporting, mitochondrial F1 complex, epsilon subunit pseudogene 2						ATP synthesis coupled proton transport (GO:0015986)	mitochondrial proton-transporting ATP synthase complex, catalytic core F(1) (GO:0000275)|mitochondrion (GO:0005739)	proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)			ovary(1)	1						ATTTCATGGGAAAAAAAAATC	0.333																																																	0																																										SO:0001624	3_prime_UTR_variant	432369			EC567419		13q12	2008-10-21			ENSG00000180389	ENSG00000180389			34026	pseudogene	pseudogene							Standard	NR_002162		Approved		uc001uru.3	Q5VTU8	OTTHUMG00000016642	ENST00000381026.3:c.*94A>-	13.37:g.28519646delA		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	DEL	ENST00000381026.3	37																																																																																					0.333	ATP5EP2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000044314.1		NR_002162	
BHMT	635	broad.mit.edu;hgsc.bcm.edu	37	5	78423703	78423703	+	Missense_Mutation	SNP	G	G	A			TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr5:78423703G>A	ENST00000274353.5	+	7	1041	c.934G>A	c.(934-936)Gag>Aag	p.E312K	BHMT_ENST00000524080.1_Missense_Mutation_p.E159K|DMGDH_ENST00000520388.1_Intron	NM_001713.2	NP_001704.2	Q93088	BHMT1_HUMAN	betaine--homocysteine S-methyltransferase	312	Hcy-binding. {ECO:0000255|PROSITE- ProRule:PRU00333}.				amino-acid betaine catabolic process (GO:0006579)|amino-acid betaine metabolic process (GO:0006577)|cellular nitrogen compound metabolic process (GO:0034641)|L-methionine salvage (GO:0071267)|protein methylation (GO:0006479)|regulation of homocysteine metabolic process (GO:0050666)|response to organonitrogen compound (GO:0010243)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	betaine-homocysteine S-methyltransferase activity (GO:0047150)|S-adenosylmethionine-homocysteine S-methyltransferase activity (GO:0008898)|zinc ion binding (GO:0008270)	p.E312K(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)|skin(2)	29		all_lung(232;0.00051)|Lung NSC(167;0.00131)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;1.88e-45)|Epithelial(54;8.07e-41)|all cancers(79;3.51e-36)	L-Methionine(DB00134)	GGCAATTGCAGAGGAGCTGGC	0.537																																																	1	Substitution - Missense(1)	kidney(1)											41.0	43.0	43.0					5																	78423703		2203	4297	6500	SO:0001583	missense	635			BC012616	CCDS4046.1	5q14.1	2012-09-20	2010-04-28		ENSG00000145692	ENSG00000145692	2.1.1.5		1047	protein-coding gene	gene with protein product	"""betaine homocysteine methyltransferase"""	602888				8798461, 9281325	Standard	NM_001713		Approved	BHMT1	uc003kfu.4	Q93088	OTTHUMG00000108157	ENST00000274353.5:c.934G>A	5.37:g.78423703G>A	ENSP00000274353:p.Glu312Lys	Somatic		WXS	Illumina HiSeq	Phase_I	Q9UNI9	Missense_Mutation	SNP	ENST00000274353.5	37	CCDS4046.1	.	.	.	.	.	.	.	.	.	.	G	35	5.477906	0.96291	.	.	ENSG00000145692	ENST00000274353;ENST00000524080	T;T	0.33216	1.42;1.42	5.14	5.14	0.70334	Homocysteine S-methyltransferase (4);	0.000000	0.85682	D	0.000000	T	0.53818	0.1820	L	0.61387	1.9	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.992;0.997	T	0.44952	-0.9294	10	0.30854	T	0.27	-20.2688	18.9602	0.92674	0.0:0.0:1.0:0.0	.	159;312	E5RJH0;Q93088	.;BHMT1_HUMAN	K	312;159	ENSP00000274353:E312K;ENSP00000428240:E159K	ENSP00000274353:E312K	E	+	1	0	BHMT	78459459	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.605000	0.98321	2.547000	0.85894	0.650000	0.86243	GAG		0.537	BHMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226961.1		NM_001713	
BLM	641	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	91292947	91292947	+	Missense_Mutation	SNP	C	C	T			TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr15:91292947C>T	ENST00000355112.3	+	3	567	c.449C>T	c.(448-450)aCc>aTc	p.T150I	BLM_ENST00000560509.1_Missense_Mutation_p.T150I	NM_000057.2	NP_000048.1	P54132	BLM_HUMAN	Bloom syndrome, RecQ helicase-like	150					alpha-beta T cell differentiation (GO:0046632)|ATP catabolic process (GO:0006200)|cellular response to camptothecin (GO:0072757)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hydroxyurea (GO:0072711)|cellular response to ionizing radiation (GO:0071479)|DNA double-strand break processing (GO:0000729)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA strand renaturation (GO:0000733)|double-strand break repair via homologous recombination (GO:0000724)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of cell division (GO:0051782)|negative regulation of DNA recombination (GO:0045910)|negative regulation of mitotic recombination (GO:0045950)|negative regulation of thymocyte apoptotic process (GO:0070244)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of transcription, DNA-templated (GO:0045893)|protein oligomerization (GO:0051259)|regulation of binding (GO:0051098)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|replication fork processing (GO:0031297)|replication fork protection (GO:0048478)|response to X-ray (GO:0010165)|telomere maintenance (GO:0000723)	cytoplasm (GO:0005737)|lateral element (GO:0000800)|male germ cell nucleus (GO:0001673)|nuclear chromosome (GO:0000228)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleus (GO:0005634)|PML body (GO:0016605)|pronucleus (GO:0045120)|replication fork (GO:0005657)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent helicase activity (GO:0008026)|ATPase activity (GO:0016887)|bubble DNA binding (GO:0000405)|four-way junction helicase activity (GO:0009378)|G-quadruplex DNA binding (GO:0051880)|helicase activity (GO:0004386)|p53 binding (GO:0002039)|single-stranded DNA binding (GO:0003697)	p.T150I(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(11)|liver(4)|lung(9)|ovary(6)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	Lung NSC(78;0.0875)|all_lung(78;0.109)		Lung(145;0.189)			TCTTTAAGTACCATCAATGAT	0.378			"""Mis, N, F"""			"""leukemia, lymphoma, skin squamous cell , other cancers"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Bloom syndrome																														yes	Rec		Bloom Syndrome	15	15q26.1	641	Bloom Syndrome		"""L, E"""	1	Substitution - Missense(1)	kidney(1)											70.0	68.0	69.0					15																	91292947		2198	4298	6496	SO:0001583	missense	641	Familial Cancer Database		U39817	CCDS10363.1, CCDS73782.1	15q26.1	2014-09-17	2009-03-19		ENSG00000197299	ENSG00000197299			1058	protein-coding gene	gene with protein product		604610	"""Bloom syndrome"""			9388193	Standard	NM_000057		Approved	BS, RECQL3, RECQ2	uc002bpr.3	P54132	OTTHUMG00000149834	ENST00000355112.3:c.449C>T	15.37:g.91292947C>T	ENSP00000347232:p.Thr150Ile	Somatic		WXS	Illumina HiSeq	Phase_I	Q52M96	Missense_Mutation	SNP	ENST00000355112.3	37	CCDS10363.1	.	.	.	.	.	.	.	.	.	.	C	10.66	1.412641	0.25465	.	.	ENSG00000197299	ENST00000355112	T	0.44482	0.92	5.27	0.719	0.18208	.	0.961955	0.08560	N	0.927613	T	0.33904	0.0879	L	0.51422	1.61	0.09310	N	1	B;B	0.19331	0.02;0.035	B;B	0.19946	0.016;0.027	T	0.38265	-0.9669	10	0.56958	D	0.05	-8.2554	3.6324	0.08137	0.0:0.4847:0.19:0.3253	.	150;150	B2RAN0;P54132	.;BLM_HUMAN	I	150	ENSP00000347232:T150I	ENSP00000347232:T150I	T	+	2	0	BLM	89093951	0.000000	0.05858	0.000000	0.03702	0.035000	0.12851	0.017000	0.13399	0.598000	0.29829	0.650000	0.86243	ACC		0.378	BLM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313495.1			
C12orf40	283461	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	40076779	40076779	+	Silent	SNP	A	A	T			TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr12:40076779A>T	ENST00000324616.5	+	8	1207	c.1053A>T	c.(1051-1053)acA>acT	p.T351T	C12orf40_ENST00000398716.1_Silent_p.T274T|C12orf40_ENST00000405531.3_Silent_p.T351T	NM_001031748.2	NP_001026918.2	Q86WS4	CL040_HUMAN	chromosome 12 open reading frame 40	351								p.T351T(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(14)|ovary(6)|prostate(1)|skin(2)	38						ACATTTTTACAGTTCCAGAGT	0.323																																																	1	Substitution - coding silent(1)	kidney(1)											59.0	55.0	56.0					12																	40076779		1843	4089	5932	SO:0001819	synonymous_variant	283461			AK097445	CCDS41770.1	12q12	2008-08-04			ENSG00000180116	ENSG00000180116			26846	protein-coding gene	gene with protein product						12477932	Standard	XM_005268806		Approved	FLJ40126	uc001rmc.3	Q86WS4	OTTHUMG00000133567	ENST00000324616.5:c.1053A>T	12.37:g.40076779A>T		Somatic		WXS	Illumina HiSeq	Phase_I	B7WNU1|Q8IXY6|Q8N818|V9HW02	Silent	SNP	ENST00000324616.5	37	CCDS41770.1																																																																																				0.323	C12orf40-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257664.2		NM_173599	
C14orf39	317761	broad.mit.edu;hgsc.bcm.edu	37	14	60932762	60932762	+	Missense_Mutation	SNP	C	C	T			TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr14:60932762C>T	ENST00000321731.3	-	11	1066	c.907G>A	c.(907-909)Gaa>Aaa	p.E303K		NM_174978.2	NP_777638	Q8N1H7	S6OS1_HUMAN	chromosome 14 open reading frame 39	303					multicellular organismal development (GO:0007275)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)			p.E303K(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	30				OV - Ovarian serous cystadenocarcinoma(108;0.0448)		GCAGAACTTTCTTCTTTTATA	0.294																																																	1	Substitution - Missense(1)	kidney(1)											44.0	46.0	45.0					14																	60932762		2201	4295	6496	SO:0001583	missense	317761			AK098187	CCDS9746.1	14q23.1	2012-11-05	2012-11-05	2012-11-05	ENSG00000179008	ENSG00000179008			19849	protein-coding gene	gene with protein product							Standard	NM_174978		Approved	SIX6OS1	uc001xez.4	Q8N1H7	OTTHUMG00000140332	ENST00000321731.3:c.907G>A	14.37:g.60932762C>T	ENSP00000324920:p.Glu303Lys	Somatic		WXS	Illumina HiSeq	Phase_I	Q08AQ4	Missense_Mutation	SNP	ENST00000321731.3	37	CCDS9746.1	.	.	.	.	.	.	.	.	.	.	C	14.93	2.682087	0.47991	.	.	ENSG00000179008	ENST00000321731	T	0.29142	1.58	5.68	3.87	0.44632	.	0.335788	0.25636	N	0.029302	T	0.27205	0.0667	L	0.53249	1.67	0.35988	D	0.836524	B	0.19073	0.033	B	0.19946	0.027	T	0.17048	-1.0382	10	0.30078	T	0.28	-3.4088	8.674	0.34167	0.0:0.8252:0.0:0.1748	.	303	Q8N1H7	S6OS1_HUMAN	K	303	ENSP00000324920:E303K	ENSP00000324920:E303K	E	-	1	0	C14orf39	60002515	0.997000	0.39634	0.976000	0.42696	0.579000	0.36224	1.484000	0.35508	0.753000	0.32945	0.650000	0.86243	GAA		0.294	C14orf39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276948.1		NM_174978	
ZGRF1	55345	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	113468532	113468532	+	Missense_Mutation	SNP	T	T	A			TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr4:113468532T>A	ENST00000505019.1	-	24	5632	c.5507A>T	c.(5506-5508)gAt>gTt	p.D1836V	RP11-402J6.1_ENST00000504009.1_RNA	NM_018392.4	NP_060862.3	Q86YA3	ZGRF1_HUMAN		1836						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)	p.D1836V(1)		breast(1)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(6)|lung(21)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	45		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000676)		CTGTTTGGGATCCCCAACAAG	0.358																																																	1	Substitution - Missense(1)	kidney(1)											87.0	78.0	81.0					4																	113468532		2203	4300	6503	SO:0001583	missense	55345																														ENST00000505019.1:c.5507A>T	4.37:g.113468532T>A	ENSP00000424737:p.Asp1836Val	Somatic		WXS	Illumina HiSeq	Phase_I	B3KQX2|B4DSN6|B4DYU8|E9PDE1|G5EA02|Q6ZU11|Q9NSW3|Q9NUJ4	Missense_Mutation	SNP	ENST00000505019.1	37		.	.	.	.	.	.	.	.	.	.	T	22.8	4.340655	0.81911	.	.	ENSG00000138658	ENST00000505019	D	0.98926	-5.24	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	D	0.99513	0.9826	H	0.97918	4.105	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.994;0.999	D	0.97987	1.0352	10	0.87932	D	0	-37.3326	16.3766	0.83401	0.0:0.0:0.0:1.0	.	1836;294	G5EA02;B3KQX2	.;.	V	1836	ENSP00000424737:D1836V	ENSP00000424737:D1836V	D	-	2	0	C4orf21	113687981	1.000000	0.71417	0.979000	0.43373	0.979000	0.70002	5.203000	0.65174	2.263000	0.75096	0.533000	0.62120	GAT		0.358	C4orf21-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000256413.1			
C5orf60	285679	hgsc.bcm.edu	37	5	179071810	179071812	+	In_Frame_Del	DEL	TCC	TCC	-	rs3987734|rs151013485	byFrequency	TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	TCC	TCC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr5:179071810_179071812delTCC	ENST00000448248.2	-	1	235_237	c.210_212delGGA	c.(208-213)gaggac>gac	p.E70del	C5orf60_ENST00000506142.1_Intron	NM_001142306.1	NP_001135778.1	A6NFR6	CE060_HUMAN	chromosome 5 open reading frame 60	70			Missing. {ECO:0000269|PubMed:15489334}.			integral component of membrane (GO:0016021)				NS(1)|breast(1)|kidney(5)	7						ATTCTCGCTGTCCTCCTCTCTGG	0.522														348	0.0694888	0.0522	0.0461	5008	,	,		23659	0.0417		0.0994	False		,,,				2504	0.1074																0										148,2586		16,116,1235						-0.9	0.0		dbSNP_119	55	363,4813		36,291,2261	no	coding	C5orf60	NM_001142306.1		52,407,3496	A1A1,A1R,RR		7.0131,5.4133,6.4602				511,7399				SO:0001651	inframe_deletion	285679			BC043435	CCDS47353.1	5q35.3	2010-08-19			ENSG00000204661	ENSG00000204661			27753	protein-coding gene	gene with protein product						12477932	Standard	NM_001142306		Approved		uc003mki.3	A6NFR6	OTTHUMG00000163221	ENST00000448248.2:c.210_212delGGA	5.37:g.179071813_179071815delTCC	ENSP00000404583:p.Glu70del	Somatic		WXS	Illumina HiSeq	Phase_I	A1L488|B7ZM52|B7ZM53	In_Frame_Del	DEL	ENST00000448248.2	37	CCDS47353.1																																																																																				0.522	C5orf60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372148.2		NM_001142306	
CA9	768	hgsc.bcm.edu	37	9	35674204	35674204	+	Missense_Mutation	SNP	T	T	C	rs201260414|rs146966274	byFrequency	TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr9:35674204T>C	ENST00000378357.4	+	1	352	c.248T>C	c.(247-249)cTa>cCa	p.L83P	RN7SL22P_ENST00000471800.2_RNA	NM_001216.2	NP_001207.2	Q16790	CAH9_HUMAN	carbonic anhydrase IX	83	Proteoglycan-like (PG).				bicarbonate transport (GO:0015701)|cellular response to hypoxia (GO:0071456)|morphogenesis of an epithelium (GO:0002009)|one-carbon metabolic process (GO:0006730)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|response to drug (GO:0042493)|response to testosterone (GO:0033574)|secretion (GO:0046903)|small molecule metabolic process (GO:0044281)	basolateral plasma membrane (GO:0016323)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)	p.G79_P84delGEEDLP(1)		kidney(1)|large_intestine(3)|lung(5)|ovary(4)|prostate(1)|skin(2)|urinary_tract(1)	17	all_epithelial(49;0.217)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)		Benzthiazide(DB00562)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Zonisamide(DB00909)	GAGGAGGATCTACCTGGAGAG	0.542																																																	1	Deletion - In frame(1)	urinary_tract(1)											57.0	55.0	56.0					9																	35674204		2203	4300	6503	SO:0001583	missense	768			X66839	CCDS6585.1	9p13.3	2012-08-21			ENSG00000107159	ENSG00000107159		"""Carbonic anhydrases"""	1383	protein-coding gene	gene with protein product	"""carbonic dehydratase"", ""RCC-associated protein G250"""	603179				8661007, 9787087	Standard	NM_001216		Approved	MN, CAIX	uc003zxo.4	Q16790	OTTHUMG00000021029	ENST00000378357.4:c.248T>C	9.37:g.35674204T>C	ENSP00000367608:p.Leu83Pro	Somatic		WXS	Illumina HiSeq	Phase_I	Q5T4R1	Missense_Mutation	SNP	ENST00000378357.4	37	CCDS6585.1	43	0.019688644688644688	8	0.016260162601626018	7	0.019337016574585635	21	0.03671328671328671	7	0.009234828496042216	t	2.006	-0.428371	0.04701	.	.	ENSG00000107159	ENST00000378357;ENST00000544074	T	0.63096	-0.02	1.05	1.05	0.20165	.	.	.	.	.	T	0.09468	0.0233	N	0.05124	-0.11	0.33205	D	0.55271	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.17623	-1.0363	9	0.18276	T	0.48	.	5.1402	0.14955	0.0:0.7597:0.0:0.2403	.	83;83	F5H404;Q16790	.;CAH9_HUMAN	P	83	ENSP00000367608:L83P	ENSP00000367608:L83P	L	+	2	0	CA9	35664204	0.006000	0.16342	0.003000	0.11579	0.004000	0.04260	-0.095000	0.11077	-1.660000	0.01486	-1.680000	0.00737	CTA		0.542	CA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055479.1		NM_001216	
CCRN4L	25819	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	139966122	139966122	+	Missense_Mutation	SNP	C	C	G			TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr4:139966122C>G	ENST00000280614.2	+	3	983	c.790C>G	c.(790-792)Cag>Gag	p.Q264E	ELF2_ENST00000515489.1_Intron	NM_012118.2	NP_036250.2	Q9UK39	NOCT_HUMAN	CCR4 carbon catabolite repression 4-like (S. cerevisiae)	264					circadian regulation of gene expression (GO:0032922)|cytoplasmic mRNA processing body assembly (GO:0033962)|deadenylation-dependent decapping of nuclear-transcribed mRNA (GO:0000290)|mRNA processing (GO:0006397)|mRNA stabilization (GO:0048255)|negative regulation of gene expression (GO:0010629)|negative regulation of osteoblast differentiation (GO:0045668)|positive regulation of fat cell differentiation (GO:0045600)|regulation of circadian rhythm (GO:0042752)|regulation of embryonic development (GO:0045995)|regulation of transcription, DNA-templated (GO:0006355)|response to extracellular stimulus (GO:0009991)|response to lipopolysaccharide (GO:0032496)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	metal ion binding (GO:0046872)|mRNA binding (GO:0003729)|poly(A)-specific ribonuclease activity (GO:0004535)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q264E(1)		kidney(2)|large_intestine(3)|lung(3)|ovary(1)	9	all_hematologic(180;0.162)					GAAAACCAACCAGGTGGCCAT	0.498																																					Ovarian(144;566 1842 19130 21379 22209)												1	Substitution - Missense(1)	kidney(1)											84.0	81.0	82.0					4																	139966122		2203	4300	6503	SO:0001583	missense	25819			AF183961	CCDS3743.1	4q31.1	2014-06-18	2001-11-28		ENSG00000151014	ENSG00000151014			14254	protein-coding gene	gene with protein product		608468	"""CCR4-like (carbon catabolite repression 4, S.cerevisiae)"""			10521507	Standard	NM_012118		Approved	CCR4L, Ccr4c	uc003ihl.3	Q9UK39	OTTHUMG00000161271	ENST00000280614.2:c.790C>G	4.37:g.139966122C>G	ENSP00000280614:p.Gln264Glu	Somatic		WXS	Illumina HiSeq	Phase_I	D3DNY5|Q14D51|Q9HD93|Q9HD94|Q9HD95	Missense_Mutation	SNP	ENST00000280614.2	37	CCDS3743.1	.	.	.	.	.	.	.	.	.	.	C	19.57	3.853052	0.71719	.	.	ENSG00000151014	ENST00000280614	T	0.28666	1.6	5.5	5.5	0.81552	Endonuclease/exonuclease/phosphatase (2);	0.000000	0.85682	D	0.000000	T	0.56717	0.2004	M	0.73372	2.23	0.80722	D	1	D	0.67145	0.996	D	0.72075	0.976	T	0.54443	-0.8293	9	.	.	.	-24.7176	19.3911	0.94583	0.0:1.0:0.0:0.0	.	264	Q9UK39	NOCT_HUMAN	E	264	ENSP00000280614:Q264E	.	Q	+	1	0	CCRN4L	140185572	1.000000	0.71417	0.997000	0.53966	0.896000	0.52359	7.706000	0.84615	2.600000	0.87896	0.555000	0.69702	CAG		0.498	CCRN4L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257231.3		NM_012118	
CD97	976	broad.mit.edu;hgsc.bcm.edu	37	19	14507236	14507236	+	Missense_Mutation	SNP	G	G	C			TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr19:14507236G>C	ENST00000242786.5	+	5	509	c.429G>C	c.(427-429)caG>caC	p.Q143H	CD97_ENST00000358600.3_Intron|CD97_ENST00000357355.3_Missense_Mutation_p.Q143H|CD97_ENST00000587728.1_Intron	NM_078481.3	NP_510966.1	P48960	CD97_HUMAN	CD97 molecule	143	EGF-like 3; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular component movement (GO:0006928)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|neuropeptide signaling pathway (GO:0007218)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)	p.Q143H(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30						ATACCTGCCAGTGCCTGCCTG	0.582																																																	1	Substitution - Missense(1)	kidney(1)											122.0	101.0	108.0					19																	14507236		2203	4300	6503	SO:0001583	missense	976				CCDS32929.1, CCDS32930.1, CCDS32931.1	19p13	2014-08-08	2006-03-28			ENSG00000123146		"""CD molecules"", ""-"", ""GPCR / Class B : Orphans"""	1711	protein-coding gene	gene with protein product	"""leukocyte antigen CD97"", ""seven-span transmembrane protein"", ""seven-transmembrane, heterodimeric receptor associated with inflammation"", ""seven transmembrane helix receptor"""	601211	"""CD97 antigen"""			7636245, 8786105	Standard	NM_078481		Approved	TM7LN1	uc002myl.3	P48960		ENST00000242786.5:c.429G>C	19.37:g.14507236G>C	ENSP00000242786:p.Gln143His	Somatic		WXS	Illumina HiSeq	Phase_I	A8K7Z4|B2RBJ9|O00718|O76101|Q8NG72|Q8TBQ7	Missense_Mutation	SNP	ENST00000242786.5	37	CCDS32929.1	.	.	.	.	.	.	.	.	.	.	g	12.15	1.851708	0.32699	.	.	ENSG00000123146	ENST00000242786;ENST00000357355;ENST00000393059	D;D	0.92249	-3.0;-3.0	4.39	-2.35	0.06684	EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	.	.	.	.	D	0.83036	0.5167	N	0.13299	0.325	0.09310	N	1	P;B	0.51791	0.948;0.04	P;B	0.47162	0.54;0.026	T	0.75252	-0.3383	9	0.33141	T	0.24	.	3.9848	0.09511	0.3519:0.3527:0.2954:0.0	.	143;143	P48960-3;P48960	.;CD97_HUMAN	H	143;143;142	ENSP00000242786:Q143H;ENSP00000349918:Q143H	ENSP00000242786:Q143H	Q	+	3	2	CD97	14368236	0.049000	0.20398	0.000000	0.03702	0.012000	0.07955	0.092000	0.15066	-0.161000	0.10983	-0.313000	0.08912	CAG		0.582	CD97-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459821.2		NM_078481	
CEP70	80321	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	138216885	138216885	+	Missense_Mutation	SNP	G	G	A			TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr3:138216885G>A	ENST00000264982.3	-	17	1986	c.1720C>T	c.(1720-1722)Ctt>Ttt	p.L574F	CEP70_ENST00000484888.1_Missense_Mutation_p.L574F|CEP70_ENST00000542237.1_Missense_Mutation_p.L554F|CEP70_ENST00000489254.1_Missense_Mutation_p.L422F	NM_024491.2	NP_077817.2	Q8NHQ1	CEP70_HUMAN	centrosomal protein 70kDa	574					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)		p.L574F(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(6)|skin(3)	24						AAGATTTCAAGTAGATCATTA	0.343																																																	1	Substitution - Missense(1)	kidney(1)											106.0	103.0	104.0					3																	138216885		2203	4300	6503	SO:0001583	missense	80321			AF202146	CCDS3102.1, CCDS75022.1, CCDS75023.1, CCDS75024.1	3q22.3	2014-02-20			ENSG00000114107	ENSG00000114107			29972	protein-coding gene	gene with protein product		614310				14654843	Standard	XM_005247802		Approved	BITE, FLJ13036	uc003esl.3	Q8NHQ1	OTTHUMG00000159891	ENST00000264982.3:c.1720C>T	3.37:g.138216885G>A	ENSP00000264982:p.Leu574Phe	Somatic		WXS	Illumina HiSeq	Phase_I	B7Z5I8|B7Z7E8|D3DNE9|F5GZX8|Q96B31|Q9H2C3|Q9H2Z1|Q9H940	Missense_Mutation	SNP	ENST00000264982.3	37	CCDS3102.1	.	.	.	.	.	.	.	.	.	.	G	19.28	3.796425	0.70567	.	.	ENSG00000114107	ENST00000264982;ENST00000542237;ENST00000489254;ENST00000484888;ENST00000474781;ENST00000459695	T;T;T;T;T;T	0.25579	1.79;1.79;1.79;1.79;1.79;1.79	5.07	5.07	0.68467	.	0.000000	0.64402	D	0.000002	T	0.45175	0.1329	L	0.47190	1.495	0.50171	D	0.999857	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.91635	0.999;0.998;0.998	T	0.35001	-0.9806	10	0.72032	D	0.01	-10.2563	15.9899	0.80197	0.0:0.0:1.0:0.0	.	422;554;574	B7Z2D2;F5GZX8;Q8NHQ1	.;.;CEP70_HUMAN	F	574;554;422;574;556;47	ENSP00000264982:L574F;ENSP00000444128:L554F;ENSP00000417821:L422F;ENSP00000419231:L574F;ENSP00000419833:L556F;ENSP00000418552:L47F	ENSP00000264982:L574F	L	-	1	0	CEP70	139699575	1.000000	0.71417	0.996000	0.52242	0.991000	0.79684	5.563000	0.67352	2.616000	0.88540	0.655000	0.94253	CTT		0.343	CEP70-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000358001.1		NM_024491	
CLASRP	11129	hgsc.bcm.edu	37	19	45571279	45571280	+	Frame_Shift_Ins	INS	-	-	C	rs574020137		TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr19:45571279_45571280insC	ENST00000221455.3	+	15	1772_1773	c.1674_1675insC	c.(1675-1677)cctfs	p.P559fs	CLASRP_ENST00000544944.2_Frame_Shift_Ins_p.P559fs|CLASRP_ENST00000391953.4_Frame_Shift_Ins_p.P497fs	NM_007056.2	NP_008987	Q8N2M8	CLASR_HUMAN	CLK4-associating serine/arginine rich protein	559	Arg-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|pancreas(2)|prostate(1)	16						CCAGGACCGAACCTGCCGCTGG	0.619																																																	0																																										SO:0001589	frameshift_variant	11129			AF042800	CCDS12652.2, CCDS62710.1	19q13.3	2010-09-21	2010-09-21	2010-09-21	ENSG00000104859	ENSG00000104859			17731	protein-coding gene	gene with protein product	"""Clk4 associating SR-related protein"""		"""splicing factor, arginine/serine-rich 16"""	SFRS16		12169693	Standard	NM_007056		Approved	SWAP2, CLASP	uc002pak.3	Q8N2M8	OTTHUMG00000150189	ENST00000221455.3:c.1676dupC	19.37:g.45571281_45571281dupC	ENSP00000221455:p.Pro559fs	Somatic		WXS	Illumina HiSeq	Phase_I	B4DDT8|F8WAG9|O96026|Q6UW71|Q96DX2	Frame_Shift_Ins	INS	ENST00000221455.3	37	CCDS12652.2																																																																																				0.619	CLASRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316749.1		NM_007056	
CYP4B1	1580	hgsc.bcm.edu;ucsc.edu	37	1	47282767	47282767	+	Missense_Mutation	SNP	G	G	A	rs373978131		TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr1:47282767G>A	ENST00000271153.4	+	9	1154	c.1118G>A	c.(1117-1119)aGc>aAc	p.S373N	CYP4B1_ENST00000371923.4_Missense_Mutation_p.S374N|CYP4B1_ENST00000452782.2_Missense_Mutation_p.S211N|CYP4B1_ENST00000371919.4_Missense_Mutation_p.S359N			P13584	CP4B1_HUMAN	cytochrome P450, family 4, subfamily B, polypeptide 1	373					biphenyl metabolic process (GO:0018879)|exogenous drug catabolic process (GO:0042738)|fluorene metabolic process (GO:0018917)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|drug binding (GO:0008144)|fluorene oxygenase activity (GO:0018585)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)			NS(2)|breast(1)|endometrium(2)|kidney(1)|large_intestine(12)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	36	Acute lymphoblastic leukemia(166;0.155)				Midazolam(DB00683)|Phenobarbital(DB01174)|Thiamine(DB00152)	ATCAAGGAGAGCTTCCGCCTC	0.552																																																	0								G	ASN/SER,ASN/SER	0,4406		0,0,2203	161.0	148.0	153.0		1118,1121	1.7	0.9	1		153	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	CYP4B1	NM_000779.3,NM_001099772.1	46,46	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging	373/512,374/513	47282767	1,13005	2203	4300	6503	SO:0001583	missense	1580			BC017758	CCDS542.1, CCDS41328.1	1p33	2013-11-11	2003-01-14		ENSG00000142973	ENSG00000142973		"""Cytochrome P450s"""	2644	protein-coding gene	gene with protein product		124075	"""cytochrome P450, subfamily IVB, polypeptide 1"""				Standard	NM_000779		Approved		uc001cqn.4	P13584	OTTHUMG00000007984	ENST00000271153.4:c.1118G>A	1.37:g.47282767G>A	ENSP00000271153:p.Ser373Asn	Somatic		WXS	Illumina HiSeq	Phase_I	Q1HBI2|Q8TD85|Q8WWF2|Q8WWU9|Q8WWV0	Missense_Mutation	SNP	ENST00000271153.4	37	CCDS542.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.105066	0.77096	0.0	1.16E-4	ENSG00000142973	ENST00000371923;ENST00000271153;ENST00000371919;ENST00000452782;ENST00000468637	T;T;T;T;T	0.70516	-0.49;-0.49;-0.49;-0.49;-0.49	5.82	1.69	0.24217	.	0.361270	0.36409	N	0.002618	D	0.84862	0.5566	M	0.91300	3.195	0.30623	N	0.758289	D;P;P	0.71674	0.998;0.919;0.934	D;P;P	0.70227	0.968;0.851;0.908	D	0.83757	0.0212	10	0.87932	D	0	.	11.5592	0.50766	0.0637:0.3514:0.5849:0.0	.	359;374;373	Q8IZB0;P13584-2;P13584	.;.;CP4B1_HUMAN	N	374;373;359;211;210	ENSP00000360991:S374N;ENSP00000271153:S373N;ENSP00000360987:S359N;ENSP00000400413:S211N;ENSP00000437670:S210N	ENSP00000271153:S373N	S	+	2	0	CYP4B1	47055354	1.000000	0.71417	0.900000	0.35374	0.994000	0.84299	2.691000	0.47010	0.059000	0.16252	0.655000	0.94253	AGC		0.552	CYP4B1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000021911.1		NM_000779	
DDHD1	80821	hgsc.bcm.edu	37	14	53558606	53558608	+	In_Frame_Del	DEL	CTT	CTT	-			TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	CTT	CTT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr14:53558606_53558608delCTT	ENST00000323669.5	-	4	1183_1185	c.1184_1186delAAG	c.(1183-1188)gaagcc>gcc	p.E395del	DDHD1_ENST00000395606.1_In_Frame_Del_p.E402del|DDHD1_ENST00000357758.3_In_Frame_Del_p.E395del	NM_001160148.1	NP_001153620.1	Q8NEL9	DDHD1_HUMAN	DDHD domain containing 1	395					cell death (GO:0008219)|lipid catabolic process (GO:0016042)	cytoplasm (GO:0005737)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(11)|ovary(3)|prostate(1)	25	Breast(41;0.037)					TCTAATGTGGCTTCTTCTACATA	0.355																																																	0																																										SO:0001651	inframe_deletion	80821			AB051492	CCDS9714.1, CCDS53895.1, CCDS53896.1	14q21	2012-11-23			ENSG00000100523	ENSG00000100523			19714	protein-coding gene	gene with protein product	"""phosphatidic acid-preferring phospholipase A1"""	614603	"""spastic paraplegia 28 (autosomal recessive)"""	SPG28		11214970, 20359546	Standard	NM_030637		Approved	KIAA1705, PA-PLA1	uc001xai.3	Q8NEL9	OTTHUMG00000140305	ENST00000323669.5:c.1184_1186delAAG	14.37:g.53558609_53558611delCTT	ENSP00000327104:p.Glu395del	Somatic		WXS	Illumina HiSeq	Phase_I	G5E9D1|Q8WVH3|Q96LL2|Q9C0F8	In_Frame_Del	DEL	ENST00000323669.5	37	CCDS53895.1																																																																																				0.355	DDHD1-003	KNOWN	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000276901.1			
DDX17	10521	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	22	38889717	38889717	+	Missense_Mutation	SNP	T	T	C			TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr22:38889717T>C	ENST00000396821.3	-	10	1484	c.1385A>G	c.(1384-1386)aAt>aGt	p.N462S	DDX17_ENST00000381633.3_Missense_Mutation_p.N383S|DDX17_ENST00000432525.1_5'UTR	NM_001098504.1|NM_006386.4	NP_001091974|NP_006377.2	Q92841	DDX17_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 17	462	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of skeletal muscle cell differentiation (GO:2001014)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA helicase activity (GO:0003724)|RNA-dependent ATPase activity (GO:0008186)|transcription coactivator activity (GO:0003713)	p.N462S(1)		breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(6)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	25	Melanoma(58;0.0286)					AAACTTACCATTAAGTACCCA	0.373																																					Ovarian(55;1085 1454 6392 21425)												1	Substitution - Missense(1)	kidney(1)											67.0	68.0	68.0					22																	38889717		2203	4300	6503	SO:0001583	missense	10521			U59321	CCDS33646.1, CCDS46706.1	22q13.1	2012-02-23	2012-02-23		ENSG00000100201	ENSG00000100201		"""DEAD-boxes"""	2740	protein-coding gene	gene with protein product		608469	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 17 (72kD)"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 17"""			8871553, 17226766	Standard	NM_006386		Approved	P72	uc003avy.4	Q92841	OTTHUMG00000151136	ENST00000396821.3:c.1385A>G	22.37:g.38889717T>C	ENSP00000380033:p.Asn462Ser	Somatic		WXS	Illumina HiSeq	Phase_I	B1AHM0|Q69YT1|Q6ICD6	Missense_Mutation	SNP	ENST00000396821.3	37	CCDS46706.1	.	.	.	.	.	.	.	.	.	.	T	13.14	2.146975	0.37923	.	.	ENSG00000100201	ENST00000396821;ENST00000381633;ENST00000403230;ENST00000404499	T;T;T	0.74737	-0.87;-0.87;-0.87	5.8	5.8	0.92144	Helicase, C-terminal (3);	0.234146	0.50627	D	0.000111	T	0.55353	0.1915	N	0.12663	0.25	0.80722	D	1	B;B;B	0.22211	0.045;0.066;0.054	B;B;B	0.25405	0.06;0.058;0.035	T	0.53099	-0.8486	10	0.18276	T	0.48	-21.4403	10.4884	0.44735	0.0:0.0719:0.0:0.9281	.	383;464;462	Q92841;Q59F66;Q92841-4	DDX17_HUMAN;.;.	S	462;383;462;464	ENSP00000380033:N462S;ENSP00000371046:N383S;ENSP00000385536:N462S	ENSP00000371046:N383S	N	-	2	0	DDX17	37219663	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	4.501000	0.60393	2.227000	0.72691	0.460000	0.39030	AAT		0.373	DDX17-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321476.2		NM_030881	
DHX29	54505	broad.mit.edu;hgsc.bcm.edu	37	5	54579538	54579538	+	Silent	SNP	T	T	C			TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr5:54579538T>C	ENST00000251636.5	-	11	1606	c.1458A>G	c.(1456-1458)aaA>aaG	p.K486K	RP11-506H20.1_ENST00000506435.1_RNA	NM_019030.2	NP_061903.2	Q7Z478	DHX29_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 29	486						eukaryotic 43S preinitiation complex (GO:0016282)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|translation initiation factor activity (GO:0003743)	p.K486K(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(11)|lung(6)|ovary(4)|prostate(1)|skin(3)|urinary_tract(2)	46		Lung NSC(810;4.08e-05)|Breast(144;0.0544)|Prostate(74;0.183)				GATCACGTGGTTTATTGGTTT	0.383																																																	1	Substitution - coding silent(1)	kidney(1)											165.0	150.0	155.0					5																	54579538		2203	4300	6503	SO:0001819	synonymous_variant	54505			AY036974	CCDS34158.1	5q11.2	2008-02-05	2003-06-13	2003-06-20	ENSG00000067248	ENSG00000067248		"""DEAH-boxes"""	15815	protein-coding gene	gene with protein product		612720	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 29"""	DDX29			Standard	XM_005248544		Approved		uc003jpx.3	Q7Z478	OTTHUMG00000162313	ENST00000251636.5:c.1458A>G	5.37:g.54579538T>C		Somatic		WXS	Illumina HiSeq	Phase_I	O75549|Q63HN0|Q63HN3|Q8IWW2|Q8N3A1|Q9UMH2	Silent	SNP	ENST00000251636.5	37	CCDS34158.1																																																																																				0.383	DHX29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368532.1		NM_019030	
EIF4G3	8672	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	21167484	21167484	+	Missense_Mutation	SNP	C	C	A			TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr1:21167484C>A	ENST00000264211.8	-	24	3952	c.3758G>T	c.(3757-3759)gGc>gTc	p.G1253V	RNU7-200P_ENST00000516105.1_RNA|EIF4G3_ENST00000537738.1_Missense_Mutation_p.G743V|EIF4G3_ENST00000536266.1_Missense_Mutation_p.G857V|EIF4G3_ENST00000374937.3_Missense_Mutation_p.G1259V|EIF4G3_ENST00000400422.1_Missense_Mutation_p.G1253V|EIF4G3_ENST00000602326.1_Missense_Mutation_p.G1259V|EIF4G3_ENST00000374935.3_Missense_Mutation_p.G973V	NM_003760.4	NP_003751.2	O43432	IF4G3_HUMAN	eukaryotic translation initiation factor 4 gamma, 3	1253	MI. {ECO:0000255|PROSITE- ProRule:PRU00698}.				cytokine-mediated signaling pathway (GO:0019221)|positive regulation of meiosis I (GO:0060903)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of translation (GO:0045727)|regulation of translational initiation (GO:0006446)|spermatogenesis (GO:0007283)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)	p.G1253V(1)|p.G1259V(1)		endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(18)|lung(20)|ovary(1)|prostate(4)|skin(3)|stomach(1)|urinary_tract(3)	70		all_lung(284;2.61e-06)|Lung NSC(340;2.81e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00149)|Ovarian(437;0.00338)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|COAD - Colon adenocarcinoma(152;5.42e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000327)|GBM - Glioblastoma multiforme(114;0.000696)|Kidney(64;0.0018)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(64;0.0185)|READ - Rectum adenocarcinoma(331;0.124)|Lung(427;0.191)		ATGTAGTAGGCCCTGGGCATT	0.473																																																	2	Substitution - Missense(2)	kidney(2)											95.0	90.0	92.0					1																	21167484		2203	4300	6503	SO:0001583	missense	8672			AF012072	CCDS214.1, CCDS55580.1, CCDS59192.1, CCDS72723.1	1p36.12	2008-02-05			ENSG00000075151	ENSG00000075151			3298	protein-coding gene	gene with protein product		603929				9418880	Standard	NM_001198801		Approved	eIF4GII	uc001bef.3	O43432	OTTHUMG00000002624	ENST00000264211.8:c.3758G>T	1.37:g.21167484C>A	ENSP00000264211:p.Gly1253Val	Somatic		WXS	Illumina HiSeq	Phase_I	B9EGQ7|Q15597|Q504Z1|Q5SWC3|Q8NEN1	Missense_Mutation	SNP	ENST00000264211.8	37	CCDS214.1	.	.	.	.	.	.	.	.	.	.	C	12.75	2.032015	0.35893	.	.	ENSG00000075151	ENST00000264211;ENST00000400415;ENST00000400422;ENST00000374935;ENST00000537738;ENST00000374937;ENST00000536266;ENST00000435383	T;T;T;T;T;T	0.30714	1.52;1.52;1.52;1.52;1.52;1.52	5.48	0.991	0.19813	Initiation factor eIF-4 gamma, MA3 (3);Armadillo-type fold (1);	0.381500	0.30473	N	0.009542	T	0.14917	0.0360	N	0.02539	-0.55	0.80722	D	1	P;B;B;P;B	0.38335	0.601;0.013;0.026;0.627;0.25	B;B;B;B;B	0.42319	0.383;0.016;0.016;0.306;0.105	T	0.16928	-1.0386	10	0.62326	D	0.03	-0.9816	11.0794	0.48051	0.0:0.6027:0.0:0.3973	.	1448;973;857;1259;1253	Q59GJ0;Q504Z1;F5H564;B9EGQ7;O43432	.;.;.;.;IF4G3_HUMAN	V	1253;1449;1253;973;743;1259;857;19	ENSP00000264211:G1253V;ENSP00000383274:G1253V;ENSP00000364071:G973V;ENSP00000442010:G743V;ENSP00000364073:G1259V;ENSP00000444693:G857V	ENSP00000264211:G1253V	G	-	2	0	EIF4G3	21040071	0.982000	0.34865	0.994000	0.49952	0.772000	0.43724	1.105000	0.31086	0.293000	0.22520	0.313000	0.20887	GGC		0.473	EIF4G3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000007467.3		NM_003760	
FAM193A	8603	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	2733519	2733519	+	Missense_Mutation	SNP	C	C	T			TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr4:2733519C>T	ENST00000324666.5	+	20	4073	c.3722C>T	c.(3721-3723)gCt>gTt	p.A1241V	FAM193A_ENST00000505311.1_3'UTR|FAM193A_ENST00000382839.3_Missense_Mutation_p.A1200V|FAM193A_ENST00000502458.1_Missense_Mutation_p.A1222V	NM_001256666.1	NP_001243595.1	P78312	F193A_HUMAN	family with sequence similarity 193, member A	1241								p.A1200V(1)		NS(2)|breast(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(12)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	40						TTGGATTCTGCTAGACAGACC	0.493																																																	1	Substitution - Missense(1)	kidney(1)											140.0	126.0	131.0					4																	2733519		2203	4300	6503	SO:0001583	missense	8603			AB000459	CCDS33943.1, CCDS58874.1, CCDS58875.1, CCDS58876.1	4p16.3	2009-09-04	2009-09-04	2009-09-04					16822	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 8"""	C4orf8		9734812	Standard	NR_046335		Approved	RES4-22	uc010ick.3	P78312		ENST00000324666.5:c.3722C>T	4.37:g.2733519C>T	ENSP00000324587:p.Ala1241Val	Somatic		WXS	Illumina HiSeq	Phase_I	B7ZM85|B9EGR0|E9PFA1|O43607|P78311|P78313|Q9UEG8	Missense_Mutation	SNP	ENST00000324666.5	37	CCDS58875.1	.	.	.	.	.	.	.	.	.	.	C	29.2	4.987256	0.93106	.	.	ENSG00000125386	ENST00000382839;ENST00000324666;ENST00000502458	T;T;T	0.57107	0.42;0.42;0.42	5.14	5.14	0.70334	.	0.000000	0.85682	D	0.000000	T	0.54240	0.1846	N	0.11201	0.11	0.80722	D	1	B;B;P;P	0.51147	0.02;0.167;0.857;0.942	B;B;P;D	0.64687	0.061;0.061;0.784;0.928	T	0.60311	-0.7288	10	0.42905	T	0.14	-7.5125	17.5935	0.88004	0.0:1.0:0.0:0.0	.	1222;1241;1222;1200	E9PFA1;P78312;B7ZM85;P78312-2	.;F193A_HUMAN;.;.	V	1200;1241;1222	ENSP00000372290:A1200V;ENSP00000324587:A1241V;ENSP00000427505:A1222V	ENSP00000324587:A1241V	A	+	2	0	FAM193A	2703317	1.000000	0.71417	0.375000	0.26029	0.977000	0.68977	7.526000	0.81920	2.408000	0.81797	0.561000	0.74099	GCT		0.493	FAM193A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000360903.1		NM_003704	
FAM193B	54540	broad.mit.edu;hgsc.bcm.edu	37	5	176951610	176951610	+	Silent	SNP	C	C	T			TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr5:176951610C>T	ENST00000514747.1	-	6	1920	c.1872G>A	c.(1870-1872)ctG>ctA	p.L624L	FAM193B_ENST00000508298.1_5'Flank|FAM193B_ENST00000443375.2_Silent_p.L591L|FAM193B_ENST00000329540.5_Silent_p.L250L	NM_001190946.1	NP_001177875.1	Q96PV7	F193B_HUMAN	family with sequence similarity 193, member B	704						cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.L591L(1)|p.L303L(1)		kidney(1)|large_intestine(3)	4						CAGGCTCAGGCAGCTCCTGCT	0.642																																																	2	Substitution - coding silent(2)	kidney(2)											30.0	33.0	32.0					5																	176951610		2013	4174	6187	SO:0001819	synonymous_variant	54540				CCDS54954.1	5q35	2010-02-17			ENSG00000146067	ENSG00000146067			25524	protein-coding gene	gene with protein product		615813				11572484	Standard	NR_024019		Approved	KIAA1931, FLJ10404	uc003mhu.3	Q96PV7	OTTHUMG00000163396	ENST00000514747.1:c.1872G>A	5.37:g.176951610C>T		Somatic		WXS	Illumina HiSeq	Phase_I	E9PET5|Q9NW00	Silent	SNP	ENST00000514747.1	37	CCDS54954.1	.	.	.	.	.	.	.	.	.	.	C	2.655	-0.280977	0.05642	.	.	ENSG00000146067	ENST00000524677	.	.	.	5.75	-5.55	0.02536	.	.	.	.	.	T	0.22513	0.0543	.	.	.	0.31530	N	0.661284	.	.	.	.	.	.	T	0.36065	-0.9763	4	.	.	.	-2.2072	1.7689	0.03008	0.1448:0.3187:0.1653:0.3712	.	.	.	.	T	310	.	.	A	-	1	0	FAM193B	176884216	0.000000	0.05858	0.700000	0.30305	0.505000	0.33919	-2.831000	0.00743	-0.795000	0.04462	-0.367000	0.07326	GCC		0.642	FAM193B-003	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373121.1		NM_019057	
FAM45A	404636	broad.mit.edu;hgsc.bcm.edu	37	10	120871395	120871395	+	Missense_Mutation	SNP	A	A	C	rs371713194		TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr10:120871395A>C	ENST00000361432.2	+	3	313	c.287A>C	c.(286-288)gAt>gCt	p.D96A	FAM45A_ENST00000535029.1_Missense_Mutation_p.D96A|FAM45A_ENST00000544016.1_5'UTR	NM_207009.2	NP_996892.1	Q8TCE6	FA45A_HUMAN	family with sequence similarity 45, member A	96								p.D96A(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|ovary(2)|urinary_tract(1)	14		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0293)		ACCGCCAAAGATTTTAACCCA	0.299																																																	1	Substitution - Missense(1)	kidney(1)											144.0	145.0	145.0					10																	120871395		2203	4298	6501	SO:0001583	missense	404636			AF168713	CCDS7609.1	10q25	2008-09-04			ENSG00000119979	ENSG00000119979			31793	protein-coding gene	gene with protein product							Standard	NM_207009		Approved			Q8TCE6	OTTHUMG00000019143	ENST00000361432.2:c.287A>C	10.37:g.120871395A>C	ENSP00000354688:p.Asp96Ala	Somatic		WXS	Illumina HiSeq	Phase_I	B1AMV6|B4DDC3|D3DRC8|Q9NXW4	Missense_Mutation	SNP	ENST00000361432.2	37	CCDS7609.1	.	.	.	.	.	.	.	.	.	.	A	23.7	4.447852	0.84101	.	.	ENSG00000119979	ENST00000535029;ENST00000546291;ENST00000361432	.	.	.	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	T	0.75831	0.3903	M	0.63843	1.955	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.77004	0.977;0.989;0.977	T	0.78463	-0.2194	9	0.72032	D	0.01	.	13.8633	0.63573	1.0:0.0:0.0:0.0	.	23;88;96	B4DNL9;Q8TCE6-2;Q8TCE6	.;.;FA45A_HUMAN	A	96	.	ENSP00000354688:D96A	D	+	2	0	FAM45A	120861385	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	8.057000	0.89457	2.078000	0.62432	0.460000	0.39030	GAT		0.299	FAM45A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050623.1		NM_207009	
FLAD1	80308	broad.mit.edu;ucsc.edu	37	1	154956241	154956241	+	Nonsense_Mutation	SNP	T	T	A			TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr1:154956241T>A	ENST00000292180.3	+	1	393	c.71T>A	c.(70-72)tTa>tAa	p.L24*	FLAD1_ENST00000315144.10_Intron|FLAD1_ENST00000368431.3_Intron|FLAD1_ENST00000368432.1_Intron|FLAD1_ENST00000368433.1_Nonsense_Mutation_p.L24*|FLAD1_ENST00000487371.1_Intron	NM_025207.4	NP_079483.3	Q8NFF5	FAD1_HUMAN	flavin adenine dinucleotide synthetase 1	24					FAD biosynthetic process (GO:0006747)|Mo-molybdopterin cofactor biosynthetic process (GO:0006777)|riboflavin metabolic process (GO:0006771)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|FMN adenylyltransferase activity (GO:0003919)	p.L24*(1)		endometrium(3)|kidney(4)|large_intestine(2)|lung(7)|ovary(3)|skin(3)	22	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			AGGATCTGGTTAGAGAAGACT	0.522																																																	1	Substitution - Nonsense(1)	kidney(1)											100.0	99.0	99.0					1																	154956241		2203	4300	6503	SO:0001587	stop_gained	80308				CCDS1078.1, CCDS1079.1, CCDS53371.1, CCDS53372.1	1q22	2013-03-05	2013-03-05		ENSG00000160688	ENSG00000160688	2.7.7.2		24671	protein-coding gene	gene with protein product		610595	"""Fad1, flavin adenine dinucleotide synthetase, homolog (yeast)"", ""FAD1 flavin adenine dinucleotide synthetase homolog (S. cerevisiae)"", ""flavin adenine dinucleotide synthetase"""				Standard	NM_001184891		Approved	PP591, FAD1	uc001fgf.2	Q8NFF5	OTTHUMG00000037416	ENST00000292180.3:c.71T>A	1.37:g.154956241T>A	ENSP00000292180:p.Leu24*	Somatic		WXS	Illumina GAIIx	Phase_I	Q8N5J1|Q8N686|Q8WU93|Q8WUJ4|Q96CR8|Q99764|Q9HBN6	Nonsense_Mutation	SNP	ENST00000292180.3	37	CCDS1078.1	.	.	.	.	.	.	.	.	.	.	T	27.2	4.811891	0.90707	.	.	ENSG00000160688	ENST00000368433;ENST00000292180	.	.	.	3.87	-4.8	0.03190	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	0.1991	4.3417	0.11113	0.1265:0.0882:0.5472:0.2382	.	.	.	.	X	24	.	ENSP00000292180:L24X	L	+	2	0	FLAD1	153222865	0.053000	0.20554	0.000000	0.03702	0.168000	0.22595	0.009000	0.13219	-0.988000	0.03489	-0.429000	0.05907	TTA		0.522	FLAD1-001	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000091089.1		NM_025207	
FLJ12825	440101	broad.mit.edu	37	12	54515418	54515418	+	lincRNA	SNP	C	C	T			TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr12:54515418C>T	ENST00000515617.1	+	0	3342				RP11-834C11.5_ENST00000508763.1_RNA	NR_026655.1																						tagtggacaacgggcagtctT	0.507																																																	0																																												440101																															12.37:g.54515418C>T		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP	ENST00000515617.1	37																																																																																					0.507	RP11-834C11.3-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000358961.1			
ANKRD36BP2	645784	broad.mit.edu	37	2	89100619	89100619	+	RNA	SNP	C	C	T	rs75347118		TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr2:89100619C>T	ENST00000393525.3	+	0	1093									ankyrin repeat domain 36B pseudogene 2																		TCAACAGCAACTGGATGATGC	0.373																																																	0																																												0					2q11.2	2010-09-30			ENSG00000230006	ENSG00000230006			33607	pseudogene	pseudogene							Standard	NR_015424		Approved		uc010fhg.4		OTTHUMG00000151690		2.37:g.89100619C>T		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP	ENST00000393525.3	37																																																																																					0.373	ANKRD36BP2-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000323523.1			
FSCN1	6624	broad.mit.edu	37	7	5643128	5643128	+	Splice_Site	SNP	A	A	T			TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr7:5643128A>T	ENST00000382361.3	+	3	1105	c.991A>T	c.(991-993)Aat>Tat	p.N331Y	FSCN1_ENST00000340250.6_Splice_Site_p.N310Y	NM_003088.3	NP_003079.1	Q16658	FSCN1_HUMAN	fascin actin-bundling protein 1	331					actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|cell migration (GO:0016477)|cell motility (GO:0048870)|cell proliferation (GO:0008283)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|invadopodium (GO:0071437)|stress fiber (GO:0001725)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|drug binding (GO:0008144)|poly(A) RNA binding (GO:0044822)	p.N331Y(1)		central_nervous_system(1)|kidney(3)|large_intestine(1)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	9		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)|OV - Ovarian serous cystadenocarcinoma(56;1.21e-13)		ATCCCCCAGGAATGCCAGCTG	0.637																																																	1	Substitution - Missense(1)	kidney(1)											59.0	60.0	60.0					7																	5643128		2203	4300	6503	SO:0001630	splice_region_variant	6624			U03057	CCDS5342.1	7p22	2014-02-03	2014-02-03	2002-09-20	ENSG00000075618	ENSG00000075618		"""Fascins"""	11148	protein-coding gene	gene with protein product	"""Singed, drosophila, homolog-like"", ""actin bundling protein"""	602689	"""singed (Drosophila)-like (sea urchin fascin homolog like)"", ""fascin homolog 1, actin-bundling protein (Strongylocentrotus purpuratus)"""	SNL		8068206, 10783262	Standard	NM_003088		Approved	p55, FLJ38511	uc003sou.3	Q16658	OTTHUMG00000090599	ENST00000382361.3:c.990-1A>T	7.37:g.5643128A>T		Somatic		WXS	Illumina GAIIx	Phase_I	A6NI89|B2RE97|Q96IC5|Q96IH1|Q9BRF1	Missense_Mutation	SNP	ENST00000382361.3	37	CCDS5342.1	.	.	.	.	.	.	.	.	.	.	A	16.23	3.063487	0.55432	.	.	ENSG00000075618	ENST00000340250;ENST00000382361;ENST00000444748;ENST00000447103;ENST00000405801;ENST00000535097	T;T	0.44881	0.91;1.5	4.45	3.28	0.37604	Fascin domain (1);Actin cross-linking (1);	0.229893	0.35349	N	0.003261	T	0.50735	0.1633	M	0.73598	2.24	0.42819	D	0.993983	P;P	0.44195	0.729;0.828	B;P	0.49853	0.338;0.624	T	0.53129	-0.8482	10	0.87932	D	0	-0.2812	8.7032	0.34338	0.9046:0.0:0.0954:0.0	.	310;331	B3KTA3;Q16658	.;FSCN1_HUMAN	Y	310;331;53;53;53;53	ENSP00000339729:N310Y;ENSP00000371798:N331Y	ENSP00000339729:N310Y	N	+	1	0	FSCN1	5609654	1.000000	0.71417	0.989000	0.46669	0.806000	0.45545	2.790000	0.47821	0.661000	0.30985	0.459000	0.35465	AAT		0.637	FSCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207153.3		NM_003088	Missense_Mutation
GALNT7	51809	hgsc.bcm.edu;ucsc.edu	37	4	174090012	174090013	+	Frame_Shift_Ins	INS	-	-	AA			TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr4:174090012_174090013insAA	ENST00000265000.4	+	1	109_110	c.26_27insAA	c.(25-30)ttacgcfs	p.R10fs	RP11-10K16.1_ENST00000500914.2_RNA|RP11-10K16.1_ENST00000510523.1_RNA|GALNT7_ENST00000512285.1_Frame_Shift_Ins_p.R10fs|RP11-10K16.1_ENST00000499322.2_RNA	NM_017423.2	NP_059119.2	Q86SF2	GALT7_HUMAN	polypeptide N-acetylgalactosaminyltransferase 7	10					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			central_nervous_system(1)|kidney(3)|large_intestine(5)|liver(1)|lung(9)	19		Prostate(90;0.0132)|Renal(120;0.0183)|Melanoma(52;0.0749)|all_hematologic(60;0.107)|all_neural(102;0.122)		all cancers(43;1.87e-18)|Epithelial(43;3.44e-17)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-09)|STAD - Stomach adenocarcinoma(60;0.0019)|GBM - Glioblastoma multiforme(59;0.0119)|LUSC - Lung squamous cell carcinoma(193;0.0199)		GGGTTCATCTTACGCAGTTTGC	0.663																																																	0																																										SO:0001589	frameshift_variant	51809			AJ002744	CCDS3815.1	4q31.1	2014-03-13	2014-03-13		ENSG00000109586	ENSG00000109586		"""Glycosyltransferase family 2 domain containing"""	4129	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 7"""	605005	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7 (GalNAc-T7)"""			10544240	Standard	NM_017423		Approved	GALNAC-T7	uc003isz.4	Q86SF2	OTTHUMG00000160817	Exception_encountered	4.37:g.174090012_174090013insAA	ENSP00000265000:p.Arg10fs	Somatic		WXS	Illumina HiSeq	Phase_I	B3KQU3|Q7Z5W7|Q9UJ28	Frame_Shift_Ins	INS	ENST00000265000.4	37	CCDS3815.1																																																																																				0.663	GALNT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362456.2		NM_017423	
GLP1R	2740	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	39025301	39025301	+	Missense_Mutation	SNP	C	C	T			TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr6:39025301C>T	ENST00000373256.4	+	3	272	c.229C>T	c.(229-231)Cca>Tca	p.P77S		NM_002062.3	NP_002053.3	P43220	GLP1R_HUMAN	glucagon-like peptide 1 receptor	77					activation of adenylate cyclase activity (GO:0007190)|cAMP-mediated signaling (GO:0019933)|energy reserve metabolic process (GO:0006112)|learning or memory (GO:0007611)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of heart contraction (GO:0008016)|regulation of insulin secretion (GO:0050796)|response to stress (GO:0006950)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glucagon receptor activity (GO:0004967)|transmembrane signaling receptor activity (GO:0004888)	p.P77S(1)		breast(5)|endometrium(3)|kidney(1)|large_intestine(8)|lung(9)|pancreas(1)|prostate(1)|skin(1)|stomach(2)	31					Exenatide(DB01276)|Glucagon recombinant(DB00040)|Liraglutide(DB06655)	AGATGGGGAGCCAGGCTCGTT	0.622																																																	1	Substitution - Missense(1)	kidney(1)											131.0	105.0	114.0					6																	39025301		2203	4300	6503	SO:0001583	missense	2740				CCDS4839.1	6p21	2012-08-10			ENSG00000112164	ENSG00000112164		"""GPCR / Class B : Glucagon receptors"""	4324	protein-coding gene	gene with protein product		138032					Standard	NM_002062		Approved		uc003ooj.4	P43220	OTTHUMG00000014638	ENST00000373256.4:c.229C>T	6.37:g.39025301C>T	ENSP00000362353:p.Pro77Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q2M229|Q99669	Missense_Mutation	SNP	ENST00000373256.4	37	CCDS4839.1	.	.	.	.	.	.	.	.	.	.	C	12.88	2.071190	0.36566	.	.	ENSG00000112164	ENST00000373256	T	0.63744	-0.06	5.72	4.84	0.62591	GPCR, family 2, secretin-like, conserved site (1);GPCR, family 2, extracellular hormone receptor domain (3);	0.092187	0.48286	D	0.000200	T	0.67031	0.2850	M	0.64567	1.98	0.20196	N	0.999926	D	0.62365	0.991	D	0.69824	0.966	T	0.64706	-0.6344	10	0.66056	D	0.02	.	14.5087	0.67769	0.0:0.8521:0.1479:0.0	.	77	P43220	GLP1R_HUMAN	S	77	ENSP00000362353:P77S	ENSP00000362353:P77S	P	+	1	0	GLP1R	39133279	0.963000	0.33076	0.049000	0.19019	0.094000	0.18550	3.584000	0.53936	1.399000	0.46721	-0.176000	0.13171	CCA		0.622	GLP1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040443.1			
GPR37L1	9283	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	202092521	202092521	+	Missense_Mutation	SNP	G	G	T			TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr1:202092521G>T	ENST00000367282.5	+	1	536	c.430G>T	c.(430-432)Ggc>Tgc	p.G144C		NM_004767.3	NP_004758.3	O60883	ETBR2_HUMAN	G protein-coupled receptor 37 like 1	144					negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of smoothened signaling pathway (GO:0045879)|positive regulation of cerebellar granule cell precursor proliferation (GO:0021940)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)	p.G144C(1)		central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)	18						GTTTGCGGTGGGCATTGTGGG	0.582																																																	1	Substitution - Missense(1)	kidney(1)											188.0	141.0	157.0					1																	202092521		2203	4300	6503	SO:0001583	missense	9283			AJ310210	CCDS1420.1	1q32	2012-08-21	2006-02-15		ENSG00000170075	ENSG00000170075		"""GPCR / Class A : Orphans"""	14923	protein-coding gene	gene with protein product						9539149	Standard	NM_004767		Approved	ETBR-LP-2	uc001gxj.3	O60883	OTTHUMG00000035924	ENST00000367282.5:c.430G>T	1.37:g.202092521G>T	ENSP00000356251:p.Gly144Cys	Somatic		WXS	Illumina HiSeq	Phase_I	B2R7M9|Q5SXP7|Q86VP7	Missense_Mutation	SNP	ENST00000367282.5	37	CCDS1420.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.115436	0.77323	.	.	ENSG00000170075	ENST00000541334;ENST00000367282	T	0.53423	0.62	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	T	0.69178	0.3082	M	0.69823	2.125	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.72571	-0.4253	10	0.66056	D	0.02	-32.0404	18.1765	0.89764	0.0:0.0:1.0:0.0	.	144	O60883	ETBR2_HUMAN	C	11;144	ENSP00000356251:G144C	ENSP00000356251:G144C	G	+	1	0	GPR37L1	200359144	1.000000	0.71417	1.000000	0.80357	0.641000	0.38312	9.860000	0.99555	2.370000	0.80446	0.462000	0.41574	GGC		0.582	GPR37L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087496.2		NM_004767	
HECW2	57520	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	197194348	197194348	+	Silent	SNP	A	A	T			TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr2:197194348A>T	ENST00000260983.3	-	5	704	c.522T>A	c.(520-522)ggT>ggA	p.G174G	HECW2_ENST00000409111.1_5'UTR	NM_020760.1	NP_065811.1	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2	174	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.G174G(1)		biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(24)|lung(45)|ovary(5)|pancreas(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	113						TTCCTGAAGCACCTCCCTCCA	0.413																																																	1	Substitution - coding silent(1)	kidney(1)											159.0	141.0	147.0					2																	197194348		2203	4300	6503	SO:0001819	synonymous_variant	57520			AL390186	CCDS33354.1	2q32.3	2004-12-13			ENSG00000138411	ENSG00000138411			29853	protein-coding gene	gene with protein product						10718198, 12890487	Standard	NM_020760		Approved	KIAA1301, NEDL2	uc002utm.1	Q9P2P5	OTTHUMG00000154435	ENST00000260983.3:c.522T>A	2.37:g.197194348A>T		Somatic		WXS	Illumina HiSeq	Phase_I	B8ZZB4|Q17RT5|Q68DF8|Q9NPS9	Silent	SNP	ENST00000260983.3	37	CCDS33354.1																																																																																				0.413	HECW2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335199.3		NM_020760	
HIST1H2BM	8342	hgsc.bcm.edu;ucsc.edu	37	6	27782975	27782975	+	Frame_Shift_Del	DEL	G	G	-			TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr6:27782975delG	ENST00000359465.4	+	1	154	c.154delG	c.(154-156)gacfs	p.D52fs	HIST1H2AJ_ENST00000333151.3_5'Flank	NM_003521.2	NP_003512.1	Q99879	H2B1M_HUMAN	histone cluster 1, H2bm	52					chromatin organization (GO:0006325)|nucleosome assembly (GO:0006334)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(2)	12						GGTCCACCCCGACACCGGCAT	0.527																																																	0													190.0	181.0	184.0					6																	27782975		2203	4300	6503	SO:0001589	frameshift_variant	8342			Z83738	CCDS4629.1	6p22.1	2011-01-27	2006-10-11	2003-02-28	ENSG00000196374	ENSG00000273703		"""Histones / Replication-dependent"""	4750	protein-coding gene	gene with protein product		602802	"""H2B histone family, member E"", ""histone 1, H2bm"""	H2BFE		9439656, 12408966	Standard	NM_003521		Approved	H2B/e, dJ160A22.3	uc003njo.3	Q99879	OTTHUMG00000014489	ENST00000359465.4:c.154delG	6.37:g.27782975delG	ENSP00000352442:p.Asp52fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q6NWQ3	Frame_Shift_Del	DEL	ENST00000359465.4	37	CCDS4629.1																																																																																				0.527	HIST1H2BM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040157.1		NM_003521	
HOXD3	3232	broad.mit.edu	37	2	177033982	177033982	+	Missense_Mutation	SNP	A	A	C			TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr2:177033982A>C	ENST00000468418.3	+	3	2230	c.140A>C	c.(139-141)cAc>cCc	p.H47P	HOXD3_ENST00000410016.1_Missense_Mutation_p.H47P|HOXD3_ENST00000249440.3_Missense_Mutation_p.H47P			P31249	HXD3_HUMAN	homeobox D3	47					anterior/posterior pattern specification (GO:0009952)|cartilage development (GO:0051216)|cell-matrix adhesion (GO:0007160)|embryonic skeletal system morphogenesis (GO:0048704)|Notch signaling pathway (GO:0007219)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron differentiation (GO:0045666)|thyroid gland development (GO:0030878)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.H47P(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(11)|prostate(1)|upper_aerodigestive_tract(2)	23			OV - Ovarian serous cystadenocarcinoma(117;0.00569)|Epithelial(96;0.0864)|all cancers(119;0.226)	Colorectal(32;0.247)		AGCACCCCCCACCAGCCCTAC	0.587																																																	1	Substitution - Missense(1)	kidney(1)											93.0	94.0	93.0					2																	177033982		2203	4300	6503	SO:0001583	missense	3232				CCDS2270.1	2q31.1	2011-06-20	2005-12-22		ENSG00000128652	ENSG00000128652		"""Homeoboxes / ANTP class : HOXL subclass"""	5137	protein-coding gene	gene with protein product		142980	"""homeo box D3"""	HOX4A, HOX4, HOX1D		1973146, 1358459	Standard	NM_006898		Approved		uc002ukt.1	P31249	OTTHUMG00000132517	ENST00000468418.3:c.140A>C	2.37:g.177033982A>C	ENSP00000424734:p.His47Pro	Somatic		WXS	Illumina GAIIx	Phase_I	Q99955|Q9BSC5	Missense_Mutation	SNP	ENST00000468418.3	37	CCDS2270.1	.	.	.	.	.	.	.	.	.	.	A	15.84	2.951438	0.53186	.	.	ENSG00000128652	ENST00000432796;ENST00000468418;ENST00000410016;ENST00000249440	D;D;D	0.89617	-2.54;-2.54;-2.54	5.48	5.48	0.80851	.	0.147023	0.64402	D	0.000009	D	0.85044	0.5607	L	0.48642	1.525	0.44492	D	0.997439	B	0.06786	0.001	B	0.04013	0.001	T	0.81178	-0.1051	10	0.46703	T	0.11	.	12.3872	0.55338	0.8596:0.1404:0.0:0.0	.	47	P31249	HXD3_HUMAN	P	47	ENSP00000424734:H47P;ENSP00000386498:H47P;ENSP00000249440:H47P	ENSP00000249440:H47P	H	+	2	0	HOXD3	176742228	1.000000	0.71417	0.998000	0.56505	0.898000	0.52572	8.553000	0.90686	2.199000	0.70637	0.533000	0.62120	CAC		0.587	HOXD3-005	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334246.4			
IGFN1	91156	hgsc.bcm.edu	37	1	201179954	201179954	+	Missense_Mutation	SNP	A	A	C	rs77885442	byFrequency	TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr1:201179954A>C	ENST00000335211.4	+	12	6063	c.5933A>C	c.(5932-5934)gAa>gCa	p.E1978A	IGFN1_ENST00000451870.2_Intron|IGFN1_ENST00000295591.8_5'UTR	NM_001164586.1	NP_001158058.1	Q86VF2	IGFN1_HUMAN	immunoglobulin-like and fibronectin type III domain containing 1	0						nucleus (GO:0005634)|Z disc (GO:0030018)				autonomic_ganglia(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						GGGAGTAAGGAAGGTTTCAGG	0.507													C|||	988	0.197284	0.2073	0.1556	5008	,	,		24957	0.2073		0.2237	False		,,,				2504	0.1759																0																																										SO:0001583	missense	91156			AY245430	CCDS53455.1	1q32.1	2013-02-11			ENSG00000163395	ENSG00000163395		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	24607	protein-coding gene	gene with protein product							Standard	NM_001164586		Approved	DKFZp434B1231, EEF1A2BP1	uc001gwc.3	Q86VF2	OTTHUMG00000035728	ENST00000335211.4:c.5933A>C	1.37:g.201179954A>C	ENSP00000334714:p.Glu1978Ala	Somatic		WXS	Illumina HiSeq	Phase_I	F8WAI1|Q9NT72	Missense_Mutation	SNP	ENST00000335211.4	37	CCDS53455.1	.	.	.	.	.	.	.	.	.	.	C	5.859	0.342733	0.11069	.	.	ENSG00000163395	ENST00000335211	D	0.85702	-2.02	2.37	-4.74	0.03249	.	.	.	.	.	T	0.63616	0.2526	N	0.08118	0	0.09310	N	0.999997	.	.	.	.	.	.	T	0.37174	-0.9717	6	.	.	.	.	6.5042	0.22186	0.4766:0.1542:0.3693:0.0	.	.	.	.	A	1978	ENSP00000334714:E1978A	.	E	+	2	0	IGFN1	199446577	0.987000	0.35691	0.000000	0.03702	0.000000	0.00434	-0.348000	0.07740	-4.273000	0.00060	-3.027000	0.00073	GAA		0.507	IGFN1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			NM_178275	
IGFN1	91156	hgsc.bcm.edu	37	1	201180140	201180140	+	Missense_Mutation	SNP	C	C	T	rs58792551		TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr1:201180140C>T	ENST00000335211.4	+	12	6249	c.6119C>T	c.(6118-6120)gCt>gTt	p.A2040V	IGFN1_ENST00000451870.2_Intron|IGFN1_ENST00000295591.8_5'UTR	NM_001164586.1	NP_001158058.1	Q86VF2	IGFN1_HUMAN	immunoglobulin-like and fibronectin type III domain containing 1	0						nucleus (GO:0005634)|Z disc (GO:0030018)				autonomic_ganglia(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						GATTTGGGGGCTCCTGAGAGA	0.478																																																	0													20.0	17.0	18.0					1																	201180140		692	1591	2283	SO:0001583	missense	91156			AY245430	CCDS53455.1	1q32.1	2013-02-11			ENSG00000163395	ENSG00000163395		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	24607	protein-coding gene	gene with protein product							Standard	NM_001164586		Approved	DKFZp434B1231, EEF1A2BP1	uc001gwc.3	Q86VF2	OTTHUMG00000035728	ENST00000335211.4:c.6119C>T	1.37:g.201180140C>T	ENSP00000334714:p.Ala2040Val	Somatic		WXS	Illumina HiSeq	Phase_I	F8WAI1|Q9NT72	Missense_Mutation	SNP	ENST00000335211.4	37	CCDS53455.1	.	.	.	.	.	.	.	.	.	.	C	4.236	0.042669	0.08196	.	.	ENSG00000163395	ENST00000335211	T	0.44482	0.92	2.85	-5.71	0.02413	.	.	.	.	.	T	0.14787	0.0357	N	0.08118	0	0.09310	N	0.999999	.	.	.	.	.	.	T	0.03957	-1.0989	6	.	.	.	.	1.0914	0.01664	0.2536:0.3503:0.1677:0.2285	.	.	.	.	V	2040	ENSP00000334714:A2040V	.	A	+	2	0	IGFN1	199446763	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.907000	0.01589	-4.359000	0.00054	-3.652000	0.00026	GCT		0.478	IGFN1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			NM_178275	
ITGB1	3688	hgsc.bcm.edu	37	10	33217098	33217098	+	Silent	SNP	G	G	A	rs35057436	byFrequency	TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr10:33217098G>A	ENST00000396033.2	-	5	606	c.471C>T	c.(469-471)gaC>gaT	p.D157D	ITGB1_ENST00000374956.4_Silent_p.D157D|ITGB1_ENST00000484088.1_Intron|ITGB1_ENST00000302278.3_Silent_p.D157D|ITGB1_ENST00000423113.1_Silent_p.D157D	NM_133376.2	NP_596867.1	P05556	ITB1_HUMAN	integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12)	157	VWFA.				axon extension (GO:0048675)|axon guidance (GO:0007411)|B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cardiac muscle cell differentiation (GO:0055007)|cell fate specification (GO:0001708)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell migration involved in sprouting angiogenesis (GO:0002042)|cell-cell adhesion mediated by integrin (GO:0033631)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cellular calcium ion homeostasis (GO:0006874)|cellular defense response (GO:0006968)|cellular response to ionizing radiation (GO:0071479)|cellular response to mechanical stimulus (GO:0071260)|cellular response to vitamin D (GO:0071305)|extracellular matrix organization (GO:0030198)|formation of radial glial scaffolds (GO:0021943)|G1/S transition of mitotic cell cycle (GO:0000082)|germ cell migration (GO:0008354)|heterotypic cell-cell adhesion (GO:0034113)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|maternal process involved in female pregnancy (GO:0060135)|mesodermal cell differentiation (GO:0048333)|negative regulation of anoikis (GO:2000811)|negative regulation of cell projection organization (GO:0031345)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of endocytosis (GO:0045807)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|protein transport within lipid bilayer (GO:0032594)|regulation of cell cycle (GO:0051726)|regulation of collagen catabolic process (GO:0010710)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of immune response (GO:0050776)|response to activity (GO:0014823)|response to drug (GO:0042493)|response to gonadotropin (GO:0034698)|response to transforming growth factor beta (GO:0071559)|sarcomere organization (GO:0045214)|tight junction assembly (GO:0070830)|tissue homeostasis (GO:0001894)|viral process (GO:0016032)	acrosomal vesicle (GO:0001669)|basement membrane (GO:0005604)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integrin alpha1-beta1 complex (GO:0034665)|integrin alpha10-beta1 complex (GO:0034680)|integrin alpha11-beta1 complex (GO:0034681)|integrin alpha2-beta1 complex (GO:0034666)|integrin alpha3-beta1 complex (GO:0034667)|integrin alpha7-beta1 complex (GO:0034677)|integrin alpha8-beta1 complex (GO:0034678)|integrin alpha9-beta1 complex (GO:0034679)|integrin complex (GO:0008305)|intercalated disc (GO:0014704)|invadopodium membrane (GO:0071438)|membrane (GO:0016020)|membrane raft (GO:0045121)|myelin sheath abaxonal region (GO:0035748)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|ruffle (GO:0001726)|ruffle membrane (GO:0032587)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|cell adhesion molecule binding (GO:0050839)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)|peptide binding (GO:0042277)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|virus receptor activity (GO:0001618)			autonomic_ganglia(1)|breast(2)|endometrium(5)|kidney(2)|large_intestine(8)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Ovarian(717;1.34e-05)|Breast(68;0.0634)			Antithymocyte globulin(DB00098)	TCTCCAAATCGTCTTTCATTG	0.393													G|||	30	0.00599042	0.003	0.0115	5008	,	,		18905	0.0		0.008	False		,,,				2504	0.0102																0								G	,,	12,4394	19.1+/-41.9	0,12,2191	148.0	147.0	148.0		471,471,471	-4.6	0.8	10	dbSNP_126	148	99,8501	54.4+/-115.2	0,99,4201	no	coding-synonymous,coding-synonymous,coding-synonymous	ITGB1	NM_002211.3,NM_033668.2,NM_133376.2	,,	0,111,6392	AA,AG,GG		1.1512,0.2724,0.8535	,,	157/799,157/802,157/799	33217098	111,12895	2203	4300	6503	SO:0001819	synonymous_variant	3688			BC020057	CCDS7174.1	10p11.2	2010-10-13			ENSG00000150093	ENSG00000150093		"""CD molecules"", ""Integrins"""	6153	protein-coding gene	gene with protein product		135630		FNRB, MSK12, MDF2		2524991	Standard	NM_033668		Approved	CD29, GPIIA	uc001iwt.4	P05556	OTTHUMG00000017928	ENST00000396033.2:c.471C>T	10.37:g.33217098G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A8K6N2|D3DRX9|D3DRY3|D3DRY4|D3DRY5|P78466|P78467|Q13089|Q13090|Q13091|Q13212|Q14622|Q14647|Q29RW2|Q7Z3V1|Q8WUM6	Silent	SNP	ENST00000396033.2	37	CCDS7174.1																																																																																				0.393	ITGB1-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000047496.1		NM_002211	
ITPR1	3708	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	4669521	4669521	+	Missense_Mutation	SNP	G	G	A			TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr3:4669521G>A	ENST00000443694.2	+	3	238	c.238G>A	c.(238-240)Gcc>Acc	p.A80T	ITPR1_ENST00000544951.1_Missense_Mutation_p.A80T|ITPR1_ENST00000357086.4_Missense_Mutation_p.A80T|ITPR1_ENST00000354582.6_Missense_Mutation_p.A80T|ITPR1_ENST00000456211.2_Missense_Mutation_p.A80T|ITPR1_ENST00000423119.2_Missense_Mutation_p.A80T|ITPR1_ENST00000302640.8_Missense_Mutation_p.A80T			Q14643	ITPR1_HUMAN	inositol 1,4,5-trisphosphate receptor, type 1	80					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of calcium-mediated signaling (GO:0050849)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|post-embryonic development (GO:0009791)|regulation of insulin secretion (GO:0050796)|release of sequestered calcium ion into cytosol (GO:0051209)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|voluntary musculoskeletal movement (GO:0050882)	calcineurin complex (GO:0005955)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|nucleolus (GO:0005730)|platelet dense granule membrane (GO:0031088)|platelet dense tubular network (GO:0031094)|platelet dense tubular network membrane (GO:0031095)|postsynaptic density (GO:0014069)|sarcoplasmic reticulum (GO:0016529)	calcium channel inhibitor activity (GO:0019855)|calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)	p.A80T(3)		NS(1)|autonomic_ganglia(1)|breast(10)|endometrium(15)|kidney(6)|large_intestine(27)|liver(1)|lung(27)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(2)	106				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)	Caffeine(DB00201)	TAAGCCTGGGGCCAACAGCAC	0.522																																																	3	Substitution - Missense(3)	kidney(3)											145.0	144.0	144.0					3																	4669521		2051	4217	6268	SO:0001583	missense	3708			D26070	CCDS46740.1, CCDS46740.2, CCDS54550.1, CCDS54551.1	3p26.1	2014-06-12	2011-04-28			ENSG00000150995		"""Ion channels / Inositol triphosphate receptors"""	6180	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 94"""	147265	"""spinocerebellar ataxia 15"", ""spinocerebellar ataxia 16"", ""spinocerebellar ataxia 29"""	SCA15, SCA16, SCA29		7945203, 7500840, 17590087, 17932120, 22986007	Standard	NM_001099952		Approved	Insp3r1, IP3R1, ACV, PPP1R94	uc003bqc.3	Q14643		ENST00000443694.2:c.238G>A	3.37:g.4669521G>A	ENSP00000401671:p.Ala80Thr	Somatic		WXS	Illumina HiSeq	Phase_I	E7EPX7|E9PDE9|Q14660|Q99897	Missense_Mutation	SNP	ENST00000443694.2	37	CCDS54551.1	.	.	.	.	.	.	.	.	.	.	G	14.12	2.440042	0.43326	.	.	ENSG00000150995	ENST00000356617;ENST00000302640;ENST00000354582;ENST00000423119;ENST00000357086;ENST00000456211;ENST00000544951;ENST00000443694	D;D;D;D;D;D;D	0.98280	-4.84;-4.84;-4.84;-4.84;-4.84;-4.84;-4.84	5.66	5.66	0.87406	Inositol 1,4,5-trisphosphate/ryanodine receptor (1);	0.051558	0.85682	D	0.000000	D	0.95837	0.8645	N	0.17082	0.46	0.35936	D	0.832898	B;B;B;B;B	0.30236	0.274;0.003;0.006;0.263;0.253	B;B;B;B;B	0.38156	0.113;0.026;0.042;0.266;0.113	D	0.95401	0.8490	10	0.17369	T	0.5	.	19.3389	0.94334	0.0:0.0:1.0:0.0	.	80;80;80;80;80	B7ZMI3;E7EPX7;Q14643;E7EVP7;G5E9P1	.;.;ITPR1_HUMAN;.;.	T	80	ENSP00000306253:A80T;ENSP00000346595:A80T;ENSP00000405934:A80T;ENSP00000349597:A80T;ENSP00000397885:A80T;ENSP00000440564:A80T;ENSP00000401671:A80T	ENSP00000306253:A80T	A	+	1	0	ITPR1	4644521	1.000000	0.71417	0.980000	0.43619	0.850000	0.48378	7.930000	0.87610	2.669000	0.90835	0.655000	0.94253	GCC		0.522	ITPR1-004	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337982.3		NM_002222	
LONRF1	91694	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	12586770	12586770	+	Missense_Mutation	SNP	A	A	C			TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr8:12586770A>C	ENST00000398246.3	-	9	1829	c.1760T>G	c.(1759-1761)tTt>tGt	p.F587C	MIR3926-2_ENST00000578598.1_RNA|LONRF1_ENST00000525024.1_Missense_Mutation_p.F13C|LONRF1_ENST00000533751.1_Missense_Mutation_p.F230C	NM_152271.3	NP_689484.3	Q17RB8	LONF1_HUMAN	LON peptidase N-terminal domain and ring finger 1	587	Lon.						ATP-dependent peptidase activity (GO:0004176)|zinc ion binding (GO:0008270)	p.F587C(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(4)|ovary(1)|upper_aerodigestive_tract(2)	19				READ - Rectum adenocarcinoma(644;0.236)		TCTTGGCTCAAATACATGGAG	0.388																																																	1	Substitution - Missense(1)	kidney(1)											91.0	86.0	88.0					8																	12586770		1903	4118	6021	SO:0001583	missense	91694			AK074329	CCDS5987.2	8p23.1	2013-01-09			ENSG00000154359	ENSG00000154359		"""RING-type (C3HC4) zinc fingers"""	26302	protein-coding gene	gene with protein product						18253036	Standard	XM_005273685		Approved	FLJ23749, RNF191	uc003wwd.1	Q17RB8	OTTHUMG00000165475	ENST00000398246.3:c.1760T>G	8.37:g.12586770A>C	ENSP00000381298:p.Phe587Cys	Somatic		WXS	Illumina HiSeq	Phase_I	B4DM29|B4DU84|Q8TEA0|Q9BSV1	Missense_Mutation	SNP	ENST00000398246.3	37	CCDS5987.2	.	.	.	.	.	.	.	.	.	.	A	22.0	4.226230	0.79576	.	.	ENSG00000154359	ENST00000398246;ENST00000525024;ENST00000533751;ENST00000524526	T;T;T;T	0.47869	0.83;0.83;0.83;0.83	5.05	5.05	0.67936	Peptidase S16, lon N-terminal (1);PUA-like domain (1);	0.000000	0.85682	D	0.000000	T	0.75657	0.3879	M	0.93375	3.41	0.80722	D	1	D;D	0.61080	0.987;0.989	D;D	0.72625	0.962;0.978	T	0.81395	-0.0952	10	0.48119	T	0.1	-20.4606	15.5017	0.75703	1.0:0.0:0.0:0.0	.	576;587	Q17RB8-2;Q17RB8	.;LONF1_HUMAN	C	587;13;230;190	ENSP00000381298:F587C;ENSP00000436770:F13C;ENSP00000432130:F230C;ENSP00000433327:F190C	ENSP00000381298:F587C	F	-	2	0	LONRF1	12631141	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.287000	0.95975	2.210000	0.71456	0.460000	0.39030	TTT		0.388	LONRF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251693.2		NM_152271	
MAGEC1	9947	hgsc.bcm.edu;ucsc.edu	37	X	140993716	140993716	+	Missense_Mutation	SNP	G	G	C	rs78700965	byFrequency	TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chrX:140993716G>C	ENST00000285879.4	+	4	812	c.526G>C	c.(526-528)Gtg>Ctg	p.V176L	MAGEC1_ENST00000406005.2_Intron	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	176										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					CTCCACTTTAGTGAGTATTTT	0.507										HNSCC(15;0.026)			-|||	494	0.130861	0.1256	0.1037	3775	,	,		13963	0.0655		0.0895	False		,,,				2504	0.1022																0													78.0	88.0	85.0					X																	140993716		2203	4297	6500	SO:0001583	missense	9947			AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.526G>C	X.37:g.140993716G>C	ENSP00000285879:p.Val176Leu	Somatic		WXS	Illumina HiSeq	Phase_I	A0PK03|O75451|Q8TCV4	Missense_Mutation	SNP	ENST00000285879.4	37	CCDS35417.1	.	.	.	.	.	.	.	.	.	.	-	0.790	-0.759232	0.03019	.	.	ENSG00000155495	ENST00000285879	T	0.02737	4.18	.	.	.	.	.	.	.	.	T	0.01061	0.0035	N	0.08118	0	0.26371	N	0.976892	B	0.09022	0.002	B	0.01281	0.0	T	0.44726	-0.9309	8	0.02654	T	1	.	2.1954	0.03909	0.3318:0.3336:0.3346:0.0	.	176	O60732	MAGC1_HUMAN	L	176	ENSP00000285879:V176L	ENSP00000285879:V176L	V	+	1	0	MAGEC1	140821382	0.000000	0.05858	0.014000	0.15608	0.014000	0.08584	-4.994000	0.00162	-2.175000	0.00771	-2.144000	0.00337	GTG		0.507	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058604.1		NM_005462	
MAS1L	116511	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	29454618	29454618	+	Silent	SNP	T	T	A	rs376444510		TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr6:29454618T>A	ENST00000377127.3	-	1	1120	c.1062A>T	c.(1060-1062)ccA>ccT	p.P354P		NM_052967.1	NP_443199.1	P35410	MAS1L_HUMAN	MAS1 proto-oncogene like, G protein-coupled receptor	354					G-protein coupled receptor signaling pathway (GO:0007186)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.P354P(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(7)|pancreas(1)|prostate(2)|skin(2)	28						GTTGCTCCATTGGGTCGATGC	0.507																																					NSCLC(153;755 1987 3859 11251 32945)												1	Substitution - coding silent(1)	kidney(1)											178.0	172.0	174.0					6																	29454618		2203	4300	6503	SO:0001819	synonymous_variant	116511			S78653	CCDS4661.1	6p22.1	2014-06-26	2014-06-26		ENSG00000204687	ENSG00000204687		"""GPCR / Class A : Orphans"""	13961	protein-coding gene	gene with protein product		607235	"""MAS1 oncogene-like"""				Standard	NM_052967		Approved	MAS-L, MRG, dJ994E9.2	uc011dlq.2	P35410	OTTHUMG00000031089	ENST00000377127.3:c.1062A>T	6.37:g.29454618T>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q5SUN5	Silent	SNP	ENST00000377127.3	37	CCDS4661.1																																																																																				0.507	MAS1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076126.2		NM_052967	
MED26	9441	broad.mit.edu;ucsc.edu	37	19	16687395	16687395	+	Missense_Mutation	SNP	T	T	G			TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr19:16687395T>G	ENST00000263390.3	-	3	1508	c.1246A>C	c.(1246-1248)Aag>Cag	p.K416Q	CTC-429P9.4_ENST00000593962.1_5'Flank|CTD-3222D19.2_ENST00000409035.1_Intron	NM_004831.3	NP_004822.2	O95402	MED26_HUMAN	mediator complex subunit 26	416					gene expression (GO:0010467)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|RNA polymerase II transcription cofactor activity (GO:0001104)|transcription coactivator activity (GO:0003713)	p.K416Q(1)		endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)|skin(1)	8						CGGACAGGCTTGACGCCCGCC	0.572																																																	1	Substitution - Missense(1)	kidney(1)											68.0	61.0	63.0					19																	16687395		2203	4300	6503	SO:0001583	missense	9441			AF104253	CCDS12347.1	19p13.11	2008-02-05	2007-07-30	2007-07-30		ENSG00000105085			2376	protein-coding gene	gene with protein product		605043	"""cofactor required for Sp1 transcriptional activation, subunit 7, 70kDa"""	CRSP7		9989412	Standard	NM_004831		Approved	CRSP70	uc002nen.1	O95402		ENST00000263390.3:c.1246A>C	19.37:g.16687395T>G	ENSP00000263390:p.Lys416Gln	Somatic		WXS	Illumina GAIIx	Phase_I	A1A4S3|Q0VGB6	Missense_Mutation	SNP	ENST00000263390.3	37	CCDS12347.1	.	.	.	.	.	.	.	.	.	.	T	16.76	3.211245	0.58343	.	.	ENSG00000105085	ENST00000263390	T	0.44482	0.92	5.19	5.19	0.71726	.	0.000000	0.85682	D	0.000000	T	0.55146	0.1902	M	0.68952	2.095	0.54753	D	0.999981	P	0.52577	0.954	P	0.54856	0.762	T	0.55976	-0.8055	10	0.41790	T	0.15	-21.8299	14.2736	0.66166	0.0:0.0:0.0:1.0	.	416	O95402	MED26_HUMAN	Q	416	ENSP00000263390:K416Q	ENSP00000263390:K416Q	K	-	1	0	MED26	16548395	1.000000	0.71417	0.899000	0.35326	0.934000	0.57294	5.764000	0.68826	1.980000	0.57719	0.472000	0.43445	AAG		0.572	MED26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461178.1		NM_004831	
Unknown	0	broad.mit.edu	37	1	16974256	16974256	+	IGR	SNP	G	G	C	rs560643608	byFrequency	TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr1:16974256G>C								CROCCP2 (13202 upstream) : RNU1-3 (19023 downstream)																							GCTCGGGGCCGGACCTATCTC	0.652													.|||	2706	0.540335	0.5159	0.5115	5008	,	,		32477	0.6736		0.5	False		,,,				2504	0.498																0																																										SO:0001628	intergenic_variant	11209																															1.37:g.16974256G>C		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP		37																																																																																				0	0.652									
Unknown	0	broad.mit.edu	37	1	16975495	16975495	+	IGR	SNP	T	T	C	rs199672680	byFrequency	TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr1:16975495T>C								CROCCP2 (14441 upstream) : RNU1-3 (17784 downstream)																							CTTGCGGAATTGGTGAGGCAC	0.612													.|||	2809	0.560903	0.4584	0.6268	5008	,	,		29458	0.7004		0.5159	False		,,,				2504	0.5552																0																																										SO:0001628	intergenic_variant	11209																															1.37:g.16975495T>C		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP		37																																																																																				0	0.612									
MUC4	4585	broad.mit.edu	37	3	195506099	195506099	+	Missense_Mutation	SNP	T	T	C	rs199748333	byFrequency	TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr3:195506099T>C	ENST00000463781.3	-	2	12811	c.12352A>G	c.(12352-12354)Act>Gct	p.T4118A	MUC4_ENST00000475231.1_Missense_Mutation_p.T4118A|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.T4118A(2)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GCAGAGGAAGTGTCGGTGACA	0.587																																																	2	Substitution - Missense(2)	kidney(1)|endometrium(1)											12.0	9.0	9.0					3																	195506099		521	1359	1880	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12352A>G	3.37:g.195506099T>C	ENSP00000417498:p.Thr4118Ala	Somatic		WXS	Illumina GAIIx	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	N	0.306	-0.971024	0.02232	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.34275	1.37;1.41	0.423	-0.846	0.10734	.	.	.	.	.	T	0.16642	0.0400	N	0.14661	0.345	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.17745	-1.0359	8	.	.	.	.	2.941	0.05830	0.3528:0.4303:0.0:0.217	.	3990	E7ESK3	.	A	4118	ENSP00000417498:T4118A;ENSP00000420243:T4118A	.	T	-	1	0	MUC4	196990878	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.357000	0.07651	-4.447000	0.00048	-4.198000	0.00009	ACT		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6		NM_018406	
MUC4	4585	broad.mit.edu	37	3	195518112	195518113	+	In_Frame_Ins	INS	-	-	GTCTCCTGCGTAACA	rs66727693|rs372078184|rs71180965|rs75263205|rs142781032	byFrequency	TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr3:195518112_195518113insGTCTCCTGCGTAACA	ENST00000463781.3	-	2	797_798	c.338_339insTGTTACGCAGGAGAC	c.(337-339)aca>acTGTTACGCAGGAGACa	p.113_113T>TVTQET	MUC4_ENST00000475231.1_In_Frame_Ins_p.113_113T>TVTQET|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	113					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CTGGAGGAGCTGTCTCCATCAC	0.465														3649	0.728634	0.6611	0.6758	5008	,	,		25131	0.8095		0.8221	False		,,,				2504	0.6779																0									,,	2524,1282		875,774,254					,,	-0.7	0.0		dbSNP_130	152	6249,1679		2505,1239,220	no	intron,coding,intron	MUC4	NM_138297.4,NM_018406.6,NM_004532.5	,,	3380,2013,474	A1A1,A1R,RR		21.1781,33.6837,25.2344	,,	,,		8773,2961				SO:0001652	inframe_insertion	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.338_339insTGTTACGCAGGAGAC	3.37:g.195518112_195518113insGTCTCCTGCGTAACA	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	In_Frame_Ins	INS	ENST00000463781.3	37	CCDS54700.1																																																																																				0.465	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6		NM_018406	
MUC4	4585	hgsc.bcm.edu	37	3	195512302	195512302	+	Missense_Mutation	SNP	G	G	A	rs201164821	byFrequency	TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr3:195512302G>A	ENST00000463781.3	-	2	6608	c.6149C>T	c.(6148-6150)cCt>cTt	p.P2050L	MUC4_ENST00000475231.1_Missense_Mutation_p.P2050L|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GCTGGTGACAGGAAGAGGGGT	0.572																																																	0													23.0	21.0	22.0					3																	195512302		687	1578	2265	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.6149C>T	3.37:g.195512302G>A	ENSP00000417498:p.Pro2050Leu	Somatic		WXS	Illumina HiSeq	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	G	2.749	-0.260440	0.05791	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.29397	1.58;1.57	.	.	.	.	.	.	.	.	T	0.14399	0.0348	N	0.19112	0.55	0.09310	N	1	B	0.15141	0.012	B	0.04013	0.001	T	0.27365	-1.0076	6	.	.	.	.	.	.	.	.	2050	E7ESK3	.	L	2050	ENSP00000417498:P2050L;ENSP00000420243:P2050L	.	P	-	2	0	MUC4	196996697	0.014000	0.17966	0.001000	0.08648	0.017000	0.09413	1.130000	0.31393	-0.833000	0.04245	0.064000	0.15345	CCT		0.572	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6		NM_018406	
MUC6	4588	hgsc.bcm.edu	37	11	1018095	1018095	+	Missense_Mutation	SNP	G	G	A			TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr11:1018095G>A	ENST00000421673.2	-	31	4756	c.4706C>T	c.(4705-4707)cCa>cTa	p.P1569L		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1569	Pro-rich.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GGGTGGTGGTGGCCTGCTGCT	0.572																																																	0													255.0	266.0	262.0					11																	1018095		2185	4271	6456	SO:0001583	missense	4588			U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.4706C>T	11.37:g.1018095G>A	ENSP00000406861:p.Pro1569Leu	Somatic		WXS	Illumina HiSeq	Phase_I	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	A	6.720	0.501560	0.12822	.	.	ENSG00000184956	ENST00000421673	T	0.22336	1.96	1.87	-0.481	0.12082	.	.	.	.	.	T	0.20333	0.0489	M	0.64404	1.975	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.26916	-1.0089	9	0.30078	T	0.28	.	9.6087	0.39650	0.15:0.0:0.85:0.0	.	1569	Q6W4X9	MUC6_HUMAN	L	1569	ENSP00000406861:P1569L	ENSP00000406861:P1569L	P	-	2	0	MUC6	1008095	0.942000	0.31987	0.000000	0.03702	0.000000	0.00434	-0.493000	0.06459	-0.390000	0.07774	-3.285000	0.00047	CCA		0.572	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2		XM_290540	
MUC6	4588	hgsc.bcm.edu	37	11	1018555	1018555	+	Missense_Mutation	SNP	C	C	T	rs562090596		TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr11:1018555C>T	ENST00000421673.2	-	31	4296	c.4246G>A	c.(4246-4248)Gtc>Atc	p.V1416I		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1416	Pro-rich.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GTGGAAGGGACGGGACTCCCC	0.577													c|||	1	0.000199681	0.0	0.0	5008	,	,		12873	0.0		0.001	False		,,,				2504	0.0																0													110.0	118.0	116.0					11																	1018555		2026	4152	6178	SO:0001583	missense	4588			U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.4246G>A	11.37:g.1018555C>T	ENSP00000406861:p.Val1416Ile	Somatic		WXS	Illumina HiSeq	Phase_I	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	c	0.117	-1.131216	0.01756	.	.	ENSG00000184956	ENST00000421673	T	0.20069	2.1	1.7	-3.39	0.04868	.	.	.	.	.	T	0.12944	0.0314	L	0.50333	1.59	0.09310	N	1	B	0.12630	0.006	B	0.01281	0.0	T	0.37731	-0.9693	9	0.16420	T	0.52	.	0.9755	0.01425	0.4878:0.1432:0.1637:0.2053	.	1416	Q6W4X9	MUC6_HUMAN	I	1416	ENSP00000406861:V1416I	ENSP00000406861:V1416I	V	-	1	0	MUC6	1008555	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-5.649000	0.00107	-2.728000	0.00385	-0.703000	0.03666	GTC		0.577	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2		XM_290540	
MYO16	23026	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	13	109535457	109535457	+	Silent	SNP	T	T	C			TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr13:109535457T>C	ENST00000357550.2	+	12	1451	c.1410T>C	c.(1408-1410)ccT>ccC	p.P470P	MYO16_ENST00000251041.5_Silent_p.P470P|MYO16_ENST00000356711.2_Silent_p.P470P	NM_001198950.1	NP_001185879.1			myosin XVI									p.P470P(1)		NS(3)|breast(4)|central_nervous_system(2)|endometrium(10)|kidney(8)|large_intestine(27)|lung(51)|ovary(9)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	121	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			CCTCGCTGCCTCCTCACCTCT	0.562																																																	1	Substitution - coding silent(1)	kidney(1)											171.0	145.0	154.0					13																	109535457		2203	4300	6503	SO:0001819	synonymous_variant	23026				CCDS32008.1, CCDS73598.1	13q33.3	2014-06-12			ENSG00000041515	ENSG00000041515		"""Myosins / Myosin superfamily : Class XVI"", ""Ankyrin repeat domain containing"""	29822	protein-coding gene	gene with protein product	"""neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 3"", ""protein phosphatase 1, regulatory subunit 107"""	615479				11588169, 17029291, 21946561	Standard	NM_001198950		Approved	MYR8, KIAA0865, Myo16b, NYAP3, PPP1R107	uc001vqt.1	Q9Y6X6	OTTHUMG00000017333	ENST00000357550.2:c.1410T>C	13.37:g.109535457T>C		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000357550.2	37	CCDS32008.1																																																																																				0.562	MYO16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045746.1		NM_015011	
NBPF1	55672	broad.mit.edu	37	1	16918653	16918653	+	Splice_Site	SNP	C	C	T			TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr1:16918653C>T	ENST00000430580.2	-	6	853		c.e6+1			NM_017940.3	NP_060410.2	Q3BBV0	NBPF1_HUMAN	neuroblastoma breakpoint family, member 1							cytoplasm (GO:0005737)									UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		TCTTAACTTACTGTTGTGAAA	0.418																																																	0																																										SO:0001630	splice_region_variant	55672			AB051480		1p36.13	2013-01-30			ENSG00000219481	ENSG00000219481		"""neuroblastoma breakpoint family"""	26088	protein-coding gene	gene with protein product		610501				11214970, 16079250	Standard	NM_017940		Approved	FLJ20719, KIAA1693	uc001ayw.4	Q3BBV0	OTTHUMG00000002487	ENST00000430580.2:c.34+1G>A	1.37:g.16918653C>T		Somatic		WXS	Illumina GAIIx	Phase_I	Q8N4E8|Q9C0H0	Splice_Site	SNP	ENST00000430580.2	37																																																																																					0.418	NBPF1-005	NOVEL	upstream_uORF|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000106436.3		NM_017940	Intron
NOP56	10528	broad.mit.edu;hgsc.bcm.edu	37	20	2637491	2637491	+	Missense_Mutation	SNP	G	G	A			TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr20:2637491G>A	ENST00000329276.5	+	10	1747	c.1231G>A	c.(1231-1233)Gga>Aga	p.G411R	SNORA51_ENST00000606420.1_RNA|SNORD86_ENST00000391196.1_RNA|NOP56_ENST00000492135.1_3'UTR|SNORD56_ENST00000413522.1_RNA|SNORD57_ENST00000448188.1_RNA|IDH3B_ENST00000488299.1_5'Flank|SNORD110_ENST00000408189.1_RNA	NM_006392.3	NP_006383.2	O00567	NOP56_HUMAN	NOP56 ribonucleoprotein	411					cell death (GO:0008219)|rRNA processing (GO:0006364)	box C/D snoRNP complex (GO:0031428)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|pre-snoRNP complex (GO:0070761)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|snoRNA binding (GO:0030515)	p.G411R(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	25						CTATGAGACTGGAGAGATACC	0.512																																																	1	Substitution - Missense(1)	kidney(1)											165.0	137.0	147.0					20																	2637491		2203	4300	6503	SO:0001583	missense	10528			Y12065	CCDS13030.1	20p13	2012-12-10	2012-12-10	2009-01-13	ENSG00000101361	ENSG00000101361			15911	protein-coding gene	gene with protein product	"""spinocerebellar ataxia 36"""	614154	"""nucleolar protein 5A (56kD with KKE/D repeat)"", ""nucleolar protein 5A (56kDa with KKE/D repeat)"", ""NOP56 ribonucleoprotein homolog (yeast)"""	NOL5A		9372940, 21683323	Standard	NR_027700		Approved	SCA36	uc002wgh.3	O00567	OTTHUMG00000031703	ENST00000329276.5:c.1231G>A	20.37:g.2637491G>A	ENSP00000370589:p.Gly411Arg	Somatic		WXS	Illumina HiSeq	Phase_I	Q2M3T6|Q9NQ05	Missense_Mutation	SNP	ENST00000329276.5	37	CCDS13030.1	.	.	.	.	.	.	.	.	.	.	G	24.3	4.512494	0.85389	.	.	ENSG00000101361	ENST00000329276;ENST00000381169	T	0.47177	0.85	5.75	5.75	0.90469	.	0.099000	0.64402	D	0.000002	T	0.80105	0.4562	H	0.96576	3.845	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.996;1.0	D	0.86390	0.1735	10	0.87932	D	0	-8.5813	17.4537	0.87600	0.0:0.0:1.0:0.0	.	158;411	E9PDI8;O00567	.;NOP56_HUMAN	R	411;158	ENSP00000370589:G411R	ENSP00000370589:G411R	G	+	1	0	NOP56	2585491	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	9.477000	0.97925	2.716000	0.92895	0.655000	0.94253	GGA		0.512	NOP56-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077631.2		NM_006392	
OR2T12	127064	broad.mit.edu;hgsc.bcm.edu	37	1	248458390	248458390	+	Missense_Mutation	SNP	A	A	G			TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr1:248458390A>G	ENST00000317996.1	-	1	490	c.491T>C	c.(490-492)tTc>tCc	p.F164S		NM_001004692.1	NP_001004692.1	Q8NG77	O2T12_HUMAN	olfactory receptor, family 2, subfamily T, member 12	164						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.F164S(1)		endometrium(4)|kidney(3)|large_intestine(3)|lung(25)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	43	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0201)			GCAATATGGGAAGCTCAGGGT	0.587																																																	1	Substitution - Missense(1)	kidney(1)											82.0	82.0	82.0					1																	248458390		2199	4298	6497	SO:0001583	missense	127064			BK004485	CCDS31110.1	1q44	2012-08-09			ENSG00000177201	ENSG00000177201		"""GPCR / Class A : Olfactory receptors"""	19592	protein-coding gene	gene with protein product							Standard	NM_001004692		Approved		uc010pzj.2	Q8NG77	OTTHUMG00000040457	ENST00000317996.1:c.491T>C	1.37:g.248458390A>G	ENSP00000324583:p.Phe164Ser	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000317996.1	37	CCDS31110.1	.	.	.	.	.	.	.	.	.	.	a	13.38	2.219850	0.39201	.	.	ENSG00000177201	ENST00000317996	T	0.00202	8.56	1.55	1.55	0.23275	GPCR, rhodopsin-like superfamily (1);	0.000000	0.36591	U	0.002513	T	0.00412	0.0013	M	0.71581	2.175	0.09310	N	1	D	0.71674	0.998	D	0.74674	0.984	T	0.43426	-0.9392	10	0.87932	D	0	.	8.3975	0.32566	1.0:0.0:0.0:0.0	.	164	Q8NG77	O2T12_HUMAN	S	164	ENSP00000324583:F164S	ENSP00000324583:F164S	F	-	2	0	OR2T12	246525013	0.000000	0.05858	0.082000	0.20525	0.090000	0.18270	0.450000	0.21762	0.540000	0.28808	0.147000	0.16070	TTC		0.587	OR2T12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097353.1		NM_001004692	
OR2T4	127074	hgsc.bcm.edu	37	1	248525328	248525329	+	Frame_Shift_Ins	INS	-	-	TA	rs370409078|rs61248663	byFrequency	TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr1:248525328_248525329insTA	ENST00000366475.1	+	1	446_447	c.446_447insTA	c.(445-450)accatgfs	p.M150fs		NM_001004696.1	NP_001004696.1	Q8NH00	OR2T4_HUMAN	olfactory receptor, family 2, subfamily T, member 4	150						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.M150fs*20(1)		central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|liver(2)|lung(47)	56	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CTTCTAGCCACCATGGCCTATG	0.525														1358	0.271166	0.2284	0.2637	5008	,	,		20870	0.381		0.1779	False		,,,				2504	0.317																1	Insertion - Frameshift(1)	liver(1)																																								SO:0001589	frameshift_variant	127074			BK004464	CCDS31113.1	1q44	2012-08-09			ENSG00000196944	ENSG00000196944		"""GPCR / Class A : Olfactory receptors"""	15016	protein-coding gene	gene with protein product							Standard	NM_001004696		Approved	OR2T4Q	uc001ieh.1	Q8NH00	OTTHUMG00000040453	Exception_encountered	1.37:g.248525328_248525329insTA	ENSP00000355431:p.Met150fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q6IEZ8	Frame_Shift_Ins	INS	ENST00000366475.1	37	CCDS31113.1																																																																																				0.525	OR2T4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097349.2		NM_001004696	
OR4A5	81318	hgsc.bcm.edu;ucsc.edu	37	11	51411740	51411740	+	Missense_Mutation	SNP	A	A	G	rs35083184	byFrequency	TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr11:51411740A>G	ENST00000319760.6	-	1	708	c.656T>C	c.(655-657)cTa>cCa	p.L219P		NM_001005272.3	NP_001005272.3	Q8NH83	OR4A5_HUMAN	olfactory receptor, family 4, subfamily A, member 5	219			L -> Q (in dbSNP:rs35083184).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(28)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	49		all_lung(304;0.236)				AAGGGAGCTTAGGATGACTCC	0.438																																																	0													60.0	60.0	60.0					11																	51411740		2201	4295	6496	SO:0001583	missense	81318			AB065506	CCDS73289.1	11p11.12	2012-08-09			ENSG00000221840	ENSG00000221840		"""GPCR / Class A : Olfactory receptors"""	15162	protein-coding gene	gene with protein product							Standard	NM_001005272		Approved		uc001nhi.2	Q8NH83	OTTHUMG00000166764	ENST00000319760.6:c.656T>C	11.37:g.51411740A>G	ENSP00000367664:p.Leu219Pro	Somatic		WXS	Illumina HiSeq	Phase_I	Q6IF84	Missense_Mutation	SNP	ENST00000319760.6	37	CCDS31497.1	.	.	.	.	.	.	.	.	.	.	.	7.324	0.617595	0.14129	.	.	ENSG00000221840	ENST00000319760	T	0.00249	8.44	1.93	0.659	0.17861	GPCR, rhodopsin-like superfamily (1);	0.204155	0.24258	N	0.040117	T	0.00580	0.0019	M	0.92317	3.295	0.20074	N	0.999934	D	0.67145	0.996	D	0.76071	0.987	T	0.40421	-0.9564	10	0.87932	D	0	.	6.1148	0.20120	0.7386:0.2614:0.0:0.0	.	219	Q8NH83	OR4A5_HUMAN	P	219	ENSP00000367664:L219P	ENSP00000367664:L219P	L	-	2	0	OR4A5	51268316	0.004000	0.15560	0.262000	0.24481	0.026000	0.11368	1.313000	0.33585	0.166000	0.19597	0.136000	0.15936	CTA		0.438	OR4A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391399.1		NM_001005272	
OR5AU1	390445	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	21624096	21624096	+	Missense_Mutation	SNP	C	C	T			TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr14:21624096C>T	ENST00000304418.3	-	1	126	c.89G>A	c.(88-90)aGc>aAc	p.S30N		NM_001004731.1	NP_001004731.1	Q8NGC0	O5AU1_HUMAN	olfactory receptor, family 5, subfamily AU, member 1	30						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S30N(1)		central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(12)|pancreas(1)	21	all_cancers(95;0.00238)		Epithelial(56;6.88e-07)|all cancers(55;6.02e-06)	GBM - Glioblastoma multiforme(265;0.0192)		ACACCTGGGGCTCTGACTGGG	0.478																																																	1	Substitution - Missense(1)	kidney(1)											141.0	135.0	137.0					14																	21624096		2203	4300	6503	SO:0001583	missense	390445			AL157687	CCDS32042.1	14q11.2	2013-09-23			ENSG00000169327	ENSG00000169327		"""GPCR / Class A : Olfactory receptors"""	15362	protein-coding gene	gene with protein product							Standard	NM_001004731		Approved		uc010tlp.2	Q8NGC0	OTTHUMG00000170753	ENST00000304418.3:c.89G>A	14.37:g.21624096C>T	ENSP00000302057:p.Ser30Asn	Somatic		WXS	Illumina HiSeq	Phase_I	B2RP78|Q6IEU2|Q96R10	Missense_Mutation	SNP	ENST00000304418.3	37	CCDS32042.1	.	.	.	.	.	.	.	.	.	.	C	11.63	1.696677	0.30142	.	.	ENSG00000169327	ENST00000304418	T	0.00949	5.51	3.38	1.53	0.23141	.	.	.	.	.	T	0.00695	0.0023	N	0.08118	0	0.09310	N	1	B	0.10296	0.003	B	0.09377	0.004	T	0.47947	-0.9077	9	0.59425	D	0.04	.	7.7332	0.28799	0.0:0.7803:0.0:0.2196	.	30	Q8NGC0	O5AU1_HUMAN	N	30	ENSP00000302057:S30N	ENSP00000302057:S30N	S	-	2	0	OR5AU1	20693936	0.000000	0.05858	0.001000	0.08648	0.271000	0.26615	0.026000	0.13599	0.420000	0.25954	0.491000	0.48974	AGC		0.478	OR5AU1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410213.1			
OR5H6	79295	hgsc.bcm.edu;ucsc.edu	37	3	97983488	97983496	+	In_Frame_Del	DEL	TGTAACCAC	TGTAACCAC	-	rs145155372|rs149984587|rs369030566|rs398062605|rs74203917|rs372483864	byFrequency	TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	TGTAACCAC	TGTAACCAC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr3:97983488_97983496delTGTAACCAC	ENST00000383696.2	+	1	401_409	c.360_368delTGTAACCAC	c.(358-369)cttgtaaccact>ctt	p.VTT124del	RP11-325B23.2_ENST00000508616.1_lincRNA	NM_001005479.1	NP_001005479.1	Q8NGV6	OR5H6_HUMAN	olfactory receptor, family 5, subfamily H, member 6 (gene/pseudogene)	124						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(2)|endometrium(1)|large_intestine(4)|lung(20)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	34						TTTTTTCCCTTGTAACCACTGTAACCACA	0.383														1588	0.317093	0.2141	0.3372	5008	,	,		24385	0.1319		0.5616	False		,,,				2504	0.3814																0										1036,3228		131,774,1227						2.2	0.0		dbSNP_134	100	4355,3849		1213,1929,960	no	coding	OR5H6	NM_001005479.1		1344,2703,2187	A1A1,A1R,RR		46.9161,24.2964,43.2387				5391,7077				SO:0001651	inframe_deletion	79295			BK004374	CCDS33800.1	3q12.1	2013-10-10	2013-10-10		ENSG00000230301	ENSG00000230301		"""GPCR / Class A : Olfactory receptors"""	14767	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily H, member 6"""				Standard	NM_001005479		Approved		uc003dsi.1	Q8NGV6	OTTHUMG00000160078	ENST00000383696.2:c.360_368delTGTAACCAC	3.37:g.97983497_97983505delTGTAACCAC	ENSP00000373196:p.Val124_Thr126del	Somatic		WXS	Illumina HiSeq	Phase_I	Q6IF88	In_Frame_Del	DEL	ENST00000383696.2	37	CCDS33800.1																																																																																				0.383	OR5H6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359111.2			
PCMTD1	115294	hgsc.bcm.edu	37	8	52733055	52733055	+	Silent	SNP	C	C	T	rs117334240		TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr8:52733055C>T	ENST00000360540.5	-	7	1336	c.930G>A	c.(928-930)gaG>gaA	p.E310E	PCMTD1_ENST00000544451.1_Silent_p.E234E|PCMTD1_ENST00000522514.1_Silent_p.E310E|PCMTD1_ENST00000519559.1_5'UTR	NM_052937.2	NP_443169.2	Q96MG8	PCMD1_HUMAN	protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1	310						cytoplasm (GO:0005737)	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity (GO:0004719)			NS(2)|endometrium(1)|kidney(3)|large_intestine(3)|lung(17)|prostate(2)|skin(8)|soft_tissue(1)	37		Lung NSC(129;0.0795)|all_lung(136;0.144)				ctttgttatcctcttccattt	0.393																																																	0													100.0	84.0	89.0					8																	52733055		2203	4300	6503	SO:0001819	synonymous_variant	115294				CCDS6148.1, CCDS69480.1	8q11.23	2010-08-05			ENSG00000168300	ENSG00000168300			30483	protein-coding gene	gene with protein product							Standard	XM_005251146		Approved	FLJ10883	uc003xqx.4	Q96MG8	OTTHUMG00000164246	ENST00000360540.5:c.930G>A	8.37:g.52733055C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q96FK9	Silent	SNP	ENST00000360540.5	37	CCDS6148.1																																																																																				0.393	PCMTD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377909.2		NM_052937	
PDZD8	118987	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	119044693	119044693	+	Silent	SNP	T	T	C			TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr10:119044693T>C	ENST00000334464.5	-	5	1790	c.1551A>G	c.(1549-1551)tcA>tcG	p.S517S	PDZD8_ENST00000482496.1_5'UTR	NM_173791.3	NP_776152.1	Q8NEN9	PDZD8_HUMAN	PDZ domain containing 8	517					cytoskeleton organization (GO:0007010)|intracellular signal transduction (GO:0035556)|regulation of cell morphogenesis (GO:0022604)|viral process (GO:0016032)	membrane (GO:0016020)	metal ion binding (GO:0046872)	p.S517S(1)		kidney(3)|large_intestine(8)|lung(24)|upper_aerodigestive_tract(3)	38		Colorectal(252;0.19)		all cancers(201;0.0121)		TATGACTTAATGATTGTGCCT	0.398																																																	1	Substitution - coding silent(1)	kidney(1)											271.0	261.0	264.0					10																	119044693		2203	4300	6503	SO:0001819	synonymous_variant	118987			AL122051	CCDS7600.1	10q26.12	2006-01-24		2006-01-24	ENSG00000165650	ENSG00000165650			26974	protein-coding gene	gene with protein product		614235		PDZK8		12477932	Standard	NM_173791		Approved	bA129M16.2, FLJ34427	uc001lde.1	Q8NEN9	OTTHUMG00000019122	ENST00000334464.5:c.1551A>G	10.37:g.119044693T>C		Somatic		WXS	Illumina HiSeq	Phase_I	Q86WE0|Q86WE5|Q9UFF1	Silent	SNP	ENST00000334464.5	37	CCDS7600.1																																																																																				0.398	PDZD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050565.1		NM_173791	
PRDM10	56980	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	129794821	129794821	+	Missense_Mutation	SNP	A	A	G			TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr11:129794821A>G	ENST00000360871.3	-	12	2065	c.1834T>C	c.(1834-1836)Ttc>Ctc	p.F612L	PRDM10_ENST00000423662.2_Missense_Mutation_p.F530L|PRDM10_ENST00000526082.1_Missense_Mutation_p.F530L|PRDM10_ENST00000528746.1_Missense_Mutation_p.F586L|PRDM10_ENST00000358825.5_Missense_Mutation_p.F616L|PRDM10_ENST00000304538.6_Missense_Mutation_p.F526L	NM_199437.1	NP_955469.1	Q9NQV6	PRD10_HUMAN	PR domain containing 10	616					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)	p.F612L(1)		breast(2)|endometrium(6)|kidney(3)|large_intestine(14)|lung(15)|pancreas(2)|skin(1)|stomach(3)|urinary_tract(2)	48	all_hematologic(175;0.0537)	Breast(109;0.000496)|Lung NSC(97;0.000693)|all_lung(97;0.00151)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0174)|Lung(977;0.176)|LUSC - Lung squamous cell carcinoma(976;0.185)		GGGCAGGTGAAGTAGCCATCA	0.418																																																	1	Substitution - Missense(1)	kidney(1)											107.0	109.0	109.0					11																	129794821		2201	4297	6498	SO:0001583	missense	56980			AF275817	CCDS8484.1, CCDS8485.1, CCDS44771.1, CCDS44772.1	11q24.3	2013-01-08			ENSG00000170325	ENSG00000170325		"""Zinc fingers, C2H2-type"""	13995	protein-coding gene	gene with protein product	"""PRDM zinc finger transcription factor"", ""PR-domain family member 7"", ""tristanin"""					12175877	Standard	NM_020228		Approved	KIAA1231, PFM7, MGC131802	uc001qfm.3	Q9NQV6	OTTHUMG00000165762	ENST00000360871.3:c.1834T>C	11.37:g.129794821A>G	ENSP00000354118:p.Phe612Leu	Somatic		WXS	Illumina HiSeq	Phase_I	B7ZL71|G3XAE5|J3KP23|Q17R90|Q2KHR4|Q863Z2|Q9NXI4|Q9ULI9	Missense_Mutation	SNP	ENST00000360871.3	37	CCDS8484.1	.	.	.	.	.	.	.	.	.	.	A	31	5.076262	0.94000	.	.	ENSG00000170325	ENST00000358825;ENST00000304538;ENST00000360871;ENST00000423662;ENST00000528746;ENST00000526082;ENST00000533431	T;T;T;T;T;T;T	0.17691	2.26;2.26;2.26;2.26;2.26;2.26;2.26	5.71	5.71	0.89125	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.050083	0.85682	D	0.000000	T	0.34919	0.0914	L	0.52206	1.635	0.58432	D	0.999999	P;P;P;P;D;P	0.69078	0.953;0.942;0.953;0.942;0.997;0.942	P;P;P;P;P;P	0.62813	0.672;0.543;0.672;0.543;0.907;0.543	T	0.04115	-1.0976	10	0.72032	D	0.01	-27.2871	15.9869	0.80160	1.0:0.0:0.0:0.0	.	526;612;616;530;526;530	B7ZL72;G3XAE5;Q9NQV6;Q9NQV6-5;Q9NQV6-2;Q9NQV6-1	.;.;PRD10_HUMAN;.;.;.	L	616;526;612;530;586;530;329	ENSP00000351686:F616L;ENSP00000302669:F526L;ENSP00000354118:F612L;ENSP00000398431:F530L;ENSP00000431262:F586L;ENSP00000432237:F530L;ENSP00000435940:F329L	ENSP00000302669:F526L	F	-	1	0	PRDM10	129300031	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.711000	0.91396	2.171000	0.68590	0.533000	0.62120	TTC		0.418	PRDM10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386076.1		NM_199437	
PRIM2	5558	broad.mit.edu	37	6	57512788	57512789	+	3'UTR	INS	-	-	TA	rs376103961|rs386701662|rs79832250		TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr6:57512788_57512789insTA	ENST00000389488.2	+	0	1703_1704				PRIM2_ENST00000607273.1_3'UTR			P49643	PRI2_HUMAN	primase, DNA, polypeptide 2 (58kDa)						DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	nucleoplasm (GO:0005654)|primosome complex (GO:1990077)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA primase activity (GO:0003896)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(34)|prostate(6)|stomach(4)|upper_aerodigestive_tract(1)	59				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		tgcactctgttgtgtaattgtg	0.436																																																	0																																										SO:0001624	3_prime_UTR_variant	5558				CCDS75476.1, CCDS75477.1	6p12-p11.1	2013-01-31	2007-06-19	2007-06-19	ENSG00000146143	ENSG00000146143			9370	protein-coding gene	gene with protein product		176636	"""primase, polypeptide 2A (58kD)"", ""primase, polypeptide 2A, 58kDa"""	PRIM2A		8530050, 20675616	Standard	NM_001282487		Approved		uc003pdx.3	P49643	OTTHUMG00000016190	ENST00000389488.2:c.*1701->TA	6.37:g.57512788_57512789insTA		Somatic		WXS	Illumina GAIIx	Phase_I	Q53FJ8|Q6P1Q7|Q8WVL2|Q9H413	Splice_Site	INS	ENST00000389488.2	37																																																																																					0.436	PRIM2-001	KNOWN	sequence_error|basic	processed_transcript	protein_coding	OTTHUMT00000043468.3		NM_000947	
PRIM2	5558	broad.mit.edu	37	6	57512794	57512796	+	3'UTR	DEL	ATT	ATT	-	rs368894562|rs78697028		TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	ATT	ATT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr6:57512794_57512796delATT	ENST00000389488.2	+	0	1709_1711				PRIM2_ENST00000607273.1_3'UTR			P49643	PRI2_HUMAN	primase, DNA, polypeptide 2 (58kDa)						DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	nucleoplasm (GO:0005654)|primosome complex (GO:1990077)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA primase activity (GO:0003896)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(34)|prostate(6)|stomach(4)|upper_aerodigestive_tract(1)	59				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		ctgttgtgtaattgtgacacaat	0.443																																																	0																																										SO:0001624	3_prime_UTR_variant	5558				CCDS75476.1, CCDS75477.1	6p12-p11.1	2013-01-31	2007-06-19	2007-06-19	ENSG00000146143	ENSG00000146143			9370	protein-coding gene	gene with protein product		176636	"""primase, polypeptide 2A (58kD)"", ""primase, polypeptide 2A, 58kDa"""	PRIM2A		8530050, 20675616	Standard	NM_001282487		Approved		uc003pdx.3	P49643	OTTHUMG00000016190	ENST00000389488.2:c.*1708ATT>-	6.37:g.57512794_57512796delATT		Somatic		WXS	Illumina GAIIx	Phase_I	Q53FJ8|Q6P1Q7|Q8WVL2|Q9H413	Splice_Site	DEL	ENST00000389488.2	37																																																																																					0.443	PRIM2-001	KNOWN	sequence_error|basic	processed_transcript	protein_coding	OTTHUMT00000043468.3		NM_000947	
PRR21	643905	hgsc.bcm.edu	37	2	240982052	240982052	+	Silent	SNP	C	C	G	rs77588089		TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr2:240982052C>G	ENST00000408934.1	-	1	347	c.348G>C	c.(346-348)tcG>tcC	p.S116S		NM_001080835.1	NP_001074304.1	Q8WXC7	PRR21_HUMAN	proline rich 21	116	Pro-rich.							p.S116S(2)		NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(7)|ovary(2)|prostate(5)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)	29						GAGGCATGGACGAAGGGCCGT	0.627																																																	2	Substitution - coding silent(2)	upper_aerodigestive_tract(2)											5.0	6.0	6.0					2																	240982052		1363	2884	4247	SO:0001819	synonymous_variant	643905			AF453950	CCDS33417.1	2q37.3	2009-04-20			ENSG00000221961	ENSG00000221961			33866	protein-coding gene	gene with protein product							Standard	NM_001080835		Approved		uc010zod.2	Q8WXC7	OTTHUMG00000159174	ENST00000408934.1:c.348G>C	2.37:g.240982052C>G		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000408934.1	37	CCDS33417.1																																																																																				0.627	PRR21-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			NM_001080835	
QSER1	79832	broad.mit.edu	37	11	33005748	33005748	+	Frame_Shift_Del	DEL	C	C	-			TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr11:33005748delC	ENST00000527788.1	+	15	4870	c.4514delC	c.(4513-4515)accfs	p.T1505fs				Q2KHR3	QSER1_HUMAN	glutamine and serine rich 1	0										breast(5)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(4)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	48	Breast(20;0.158)					GTTAGCAGCACCAGAAGATCA	0.343																																																	0																																										SO:0001589	frameshift_variant	79832			AL834141	CCDS41631.1	11p13	2014-02-12			ENSG00000060749	ENSG00000060749			26154	protein-coding gene	gene with protein product							Standard	XM_006718323		Approved	FLJ21924	uc001mty.3	Q2KHR3		ENST00000527788.1:c.4514delC	11.37:g.33005748delC	ENSP00000432766:p.Thr1505fs	Somatic		WXS	Illumina GAIIx	Phase_I	Q6ZU30|Q6ZUR5	Frame_Shift_Del	DEL	ENST00000527788.1	37																																																																																					0.343	QSER1-002	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000388449.2		NM_024774	
RBM20	282996	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	112572492	112572492	+	Silent	SNP	C	C	T			TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr10:112572492C>T	ENST00000369519.3	+	9	2395	c.2337C>T	c.(2335-2337)ccC>ccT	p.P779P		NM_001134363.1	NP_001127835.1	Q5T481	RBM20_HUMAN	RNA binding motif protein 20	779					heart development (GO:0007507)|mRNA processing (GO:0006397)|positive regulation of RNA splicing (GO:0033120)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.P779P(1)		autonomic_ganglia(1)|endometrium(4)|kidney(3)|large_intestine(1)|ovary(1)|skin(2)	12						AGGATGCCCCCGGGAGGTCCA	0.592																																																	1	Substitution - coding silent(1)	kidney(1)											42.0	45.0	44.0					10																	112572492		692	1591	2283	SO:0001819	synonymous_variant	282996			BX648563	CCDS44477.1	10q25.3	2014-09-17			ENSG00000203867	ENSG00000203867		"""RNA binding motif (RRM) containing"""	27424	protein-coding gene	gene with protein product		613171					Standard	NM_001134363		Approved		uc001kzf.2	Q5T481	OTTHUMG00000019043	ENST00000369519.3:c.2337C>T	10.37:g.112572492C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A6NIP5|B5A868|Q5JVI1	Silent	SNP	ENST00000369519.3	37	CCDS44477.1																																																																																				0.592	RBM20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050339.2		NM_001134363	
RETNLB	84666	hgsc.bcm.edu;ucsc.edu	37	3	108475993	108475994	+	Frame_Shift_Ins	INS	-	-	GGGGATTA	rs5851607|rs368497660	byFrequency	TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr3:108475993_108475994insGGGGATTA	ENST00000295755.6	-	1	237_238	c.39_40insTAATCCCC	c.(37-42)ccccttfs	p.L14fs	RETNLB_ENST00000482939.1_5'Flank	NM_032579.2	NP_115968.1	Q9BQ08	RETNB_HUMAN	resistin like beta	14					cell proliferation (GO:0008283)	extracellular region (GO:0005576)				endometrium(1)|kidney(3)|lung(10)|prostate(1)|skin(1)	16						AGCTGGAGAAGGGGGATTAGGA	0.51														459	0.0916534	0.0893	0.1239	5008	,	,		19161	0.0		0.1909	False		,,,				2504	0.0644																0										420,3846		19,382,1732						2.2	0.4		dbSNP_114	65	1534,6720		140,1254,2733	no	frameshift	RETNLB	NM_032579.2		159,1636,4465	A1A1,A1R,RR		18.5849,9.8453,15.607				1954,10566				SO:0001589	frameshift_variant	84666			AF290873	CCDS2953.1	3q13.1	2008-02-05			ENSG00000163515	ENSG00000163515			20388	protein-coding gene	gene with protein product		605645				10921885, 12574343	Standard	NM_032579		Approved	HXCP2, FIZZ2, RELMb	uc003dxh.2	Q9BQ08	OTTHUMG00000159393	ENST00000295755.6:c.32_39dupTAATCCCC	3.37:g.108475994_108476001dupGGGGATTA	ENSP00000295755:p.Leu14fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q14D27	Frame_Shift_Del	INS	ENST00000295755.6	37	CCDS2953.1																																																																																				0.510	RETNLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355093.1			
RIMS3	9783	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	41092246	41092246	+	Silent	SNP	G	G	T			TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr1:41092246G>T	ENST00000372684.3	-	8	1339	c.870C>A	c.(868-870)ctC>ctA	p.L290L	RIMS3_ENST00000372683.1_Silent_p.L290L	NM_014747.2	NP_055562.2	Q9UJD0	RIMS3_HUMAN	regulating synaptic membrane exocytosis 3	290					calcium ion-dependent exocytosis (GO:0017156)|neurotransmitter transport (GO:0006836)|regulation of membrane potential (GO:0042391)	cell junction (GO:0030054)|presynaptic active zone (GO:0048786)		p.L290L(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	23	Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.47e-17)			GGCGCCTGGTGAGGGATCCGA	0.632																																																	1	Substitution - coding silent(1)	kidney(1)											60.0	56.0	58.0					1																	41092246		2203	4300	6503	SO:0001819	synonymous_variant	9783			BC003103	CCDS30687.1	1p34.2	2013-09-19			ENSG00000117016	ENSG00000117016			21292	protein-coding gene	gene with protein product		611600				12620390, 10748113	Standard	NM_014747		Approved	RIM3, NIM3	uc001cfu.1	Q9UJD0	OTTHUMG00000007453	ENST00000372684.3:c.870C>A	1.37:g.41092246G>T		Somatic		WXS	Illumina HiSeq	Phase_I	D3DPV8|Q92511|X5D7U7	Silent	SNP	ENST00000372684.3	37	CCDS30687.1																																																																																				0.632	RIMS3-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019585.1		NM_014747	
RIOK1	83732	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	7395314	7395314	+	Missense_Mutation	SNP	C	C	T			TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr6:7395314C>T	ENST00000379834.2	+	3	812	c.305C>T	c.(304-306)tCa>tTa	p.S102L		NM_031480.2|NM_153005.1	NP_113668.2|NP_694550.1	Q9BRS2	RIOK1_HUMAN	RIO kinase 1	102							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.S95L(1)		cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	19	Ovarian(93;0.0418)					GACAGCAGTTCAGCCAAAATG	0.393																																																	1	Substitution - Missense(1)	kidney(1)											58.0	54.0	55.0					6																	7395314		2203	4300	6503	SO:0001583	missense	83732			BC006104	CCDS4500.1	6p24.3	2012-12-10	2012-12-10		ENSG00000124784	ENSG00000124784			18656	protein-coding gene	gene with protein product			"""RIO kinase 1 (yeast)"""				Standard	NM_031480		Approved	AD034, FLJ30006, bA288G3.1, RRP10	uc003mxn.3	Q9BRS2	OTTHUMG00000014207	ENST00000379834.2:c.305C>T	6.37:g.7395314C>T	ENSP00000369162:p.Ser102Leu	Somatic		WXS	Illumina HiSeq	Phase_I	B2RB28|Q8NDC8|Q96NV9	Missense_Mutation	SNP	ENST00000379834.2	37	CCDS4500.1	.	.	.	.	.	.	.	.	.	.	C	12.58	1.981421	0.34942	.	.	ENSG00000124784	ENST00000379834	T	0.05925	3.37	5.55	4.68	0.58851	.	0.534882	0.19993	N	0.101518	T	0.03783	0.0107	M	0.76838	2.35	0.27296	N	0.957704	B	0.10296	0.003	B	0.06405	0.002	T	0.31081	-0.9956	10	0.26408	T	0.33	-0.2772	11.9661	0.53035	0.0:0.9198:0.0:0.0802	.	102	Q9BRS2	RIOK1_HUMAN	L	102	ENSP00000369162:S102L	ENSP00000369162:S102L	S	+	2	0	RIOK1	7340313	0.916000	0.31088	0.227000	0.23927	0.719000	0.41307	3.232000	0.51302	1.349000	0.45751	0.591000	0.81541	TCA		0.393	RIOK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039780.2		NM_031480	
RP1L1	94137	hgsc.bcm.edu	37	8	10466019	10466019	+	Silent	SNP	A	A	T	rs199959237|rs535482422|rs199577777	byFrequency	TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr8:10466019A>T	ENST00000382483.3	-	4	5812	c.5589T>A	c.(5587-5589)gcT>gcA	p.A1863A		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	1943					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		CCTCCCCTTCAGCCTCCTGGG	0.627																																																	0													157.0	156.0	156.0					8																	10466019		1904	4108	6012	SO:0001819	synonymous_variant	94137			AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.5589T>A	8.37:g.10466019A>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Silent	SNP	ENST00000382483.3	37	CCDS43708.1																																																																																				0.627	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1			
RTKN2	219790	hgsc.bcm.edu;ucsc.edu	37	10	63976913	63976918	+	In_Frame_Del	DEL	AGCTTC	AGCTTC	-	rs115357868|rs201442319|rs149331212|rs59044276|rs76810894	byFrequency	TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	AGCTTC	AGCTTC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr10:63976913_63976918delAGCTTC	ENST00000373789.3	-	9	1075_1080	c.979_984delGAAGCT	c.(979-984)gaagctdel	p.EA327del	RTKN2_ENST00000395265.1_In_Frame_Del_p.EA327del|RTKN2_ENST00000315289.2_In_Frame_Del_p.EA108del	NM_145307.2	NP_660350.2	Q8IZC4	RTKN2_HUMAN	rhotekin 2	327	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				hemopoiesis (GO:0030097)|positive regulation of cell proliferation (GO:0008284)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(3)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	Prostate(12;0.0297)|all_hematologic(501;0.215)					GTTCCACTTTAGCTTCAATTTCCTCT	0.354														704	0.140575	0.295	0.1066	5008	,	,		17288	0.005		0.16	False		,,,				2504	0.0757																0										1087,3173		162,763,1205						6.0	1.0		dbSNP_129	131	1232,7022		103,1026,2998	no	coding	RTKN2	NM_145307.2		265,1789,4203	A1A1,A1R,RR		14.9261,25.5164,18.5312				2319,10195				SO:0001651	inframe_deletion	219790			BC025765	CCDS7263.1, CCDS73140.1	10q21.3	2013-01-10	2007-12-14	2007-12-14	ENSG00000182010	ENSG00000182010		"""Pleckstrin homology (PH) domain containing"""	19364	protein-coding gene	gene with protein product			"""pleckstrin homology domain containing, family K member 1"""	PLEKHK1		15504364	Standard	NM_001282941		Approved	Em:AC024597.2, bA531F24.1, FLJ39352	uc001jlw.3	Q8IZC4	OTTHUMG00000018299	ENST00000373789.3:c.979_984delGAAGCT	10.37:g.63976913_63976918delAGCTTC	ENSP00000362894:p.Glu327_Ala328del	Somatic		WXS	Illumina HiSeq	Phase_I	Q3ZCR1|Q68DZ6|Q8N8K1|Q8TAV2	In_Frame_Del	DEL	ENST00000373789.3	37	CCDS7263.1																																																																																				0.354	RTKN2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000091618.1		NM_145307	
SCGN	10590	broad.mit.edu;hgsc.bcm.edu	37	6	25670266	25670266	+	Missense_Mutation	SNP	A	A	C			TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr6:25670266A>C	ENST00000377961.2	+	6	601	c.433A>C	c.(433-435)Att>Ctt	p.I145L	SCGN_ENST00000334979.6_3'UTR	NM_006998.3	NP_008929.2	O76038	SEGN_HUMAN	secretagogin, EF-hand calcium binding protein	145						cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)	p.I145L(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	24						CAAAAAGGCCATTTCTGAGGC	0.463																																																	1	Substitution - Missense(1)	kidney(1)											152.0	156.0	155.0					6																	25670266		2203	4300	6503	SO:0001583	missense	10590			BC000336	CCDS4561.1	6p22.3-p22.1	2013-01-10			ENSG00000079689	ENSG00000079689		"""EF-hand domain containing"""	16941	protein-coding gene	gene with protein product	"""calbindin-like"""	609202				10811645	Standard	NM_006998		Approved	SECRET, DJ501N12.8, SEGN, CALBL	uc003nfb.3	O76038	OTTHUMG00000014409	ENST00000377961.2:c.433A>C	6.37:g.25670266A>C	ENSP00000367197:p.Ile145Leu	Somatic		WXS	Illumina HiSeq	Phase_I	A8K0B2|Q5VV44|Q96QV7|Q9UJF6	Missense_Mutation	SNP	ENST00000377961.2	37	CCDS4561.1	.	.	.	.	.	.	.	.	.	.	A	14.10	2.435246	0.43224	.	.	ENSG00000079689	ENST00000377961	T	0.06371	3.31	5.6	-2.61	0.06171	EF-hand-like domain (1);	0.405182	0.30126	N	0.010354	T	0.01661	0.0053	L	0.33485	1.01	0.23043	N	0.998383	B	0.26602	0.154	B	0.27262	0.078	T	0.37686	-0.9695	10	0.51188	T	0.08	.	11.1085	0.48218	0.5858:0.0:0.4142:0.0	.	145	O76038	SEGN_HUMAN	L	145	ENSP00000367197:I145L	ENSP00000367197:I145L	I	+	1	0	SCGN	25778245	0.015000	0.18098	0.000000	0.03702	0.984000	0.73092	0.252000	0.18278	-0.739000	0.04809	0.460000	0.39030	ATT		0.463	SCGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040067.1			
SETX	23064	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	135173490	135173490	+	Silent	SNP	G	G	A			TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr9:135173490G>A	ENST00000224140.5	-	13	5940	c.5758C>T	c.(5758-5760)Ctg>Ttg	p.L1920L	SETX_ENST00000393220.1_Silent_p.L1920L|SETX_ENST00000372169.2_Silent_p.L1920L	NM_015046.5	NP_055861.3	Q7Z333	SETX_HUMAN	senataxin	1920					cell death (GO:0008219)|circadian rhythm (GO:0007623)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|RNA processing (GO:0006396)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)	p.L1920L(1)		breast(7)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(1)|lung(36)|ovary(2)|prostate(2)|skin(1)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	97		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)		GTTGTAGTCAGTAAATCTTTT	0.368																																																	1	Substitution - coding silent(1)	kidney(1)											111.0	107.0	108.0					9																	135173490		2203	4300	6503	SO:0001819	synonymous_variant	23064			AB014525	CCDS6947.1	9q34	2014-09-17	2005-11-29	2005-11-29	ENSG00000107290	ENSG00000107290			445	protein-coding gene	gene with protein product		608465	"""amyotrophic lateral sclerosis 4"", ""spinocerebellar ataxia, recessive, non-Friedreich type 1"""	ALS4, SCAR1		9497266, 11022012	Standard	NM_015046		Approved	KIAA0625, AOA2	uc004cbk.3	Q7Z333	OTTHUMG00000020834	ENST00000224140.5:c.5758C>T	9.37:g.135173490G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A2A396|B2RPB2|B5ME16|C9JQ10|O75120|Q3KQX4|Q5JUJ1|Q68DW5|Q6AZD7|Q7Z3J6|Q8WX33|Q9H9D1|Q9NVP9	Silent	SNP	ENST00000224140.5	37	CCDS6947.1																																																																																				0.368	SETX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054774.3		NM_015046	
SLC39A12	221074	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	18276482	18276482	+	Missense_Mutation	SNP	C	C	A			TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr10:18276482C>A	ENST00000377369.2	+	7	1444	c.1171C>A	c.(1171-1173)Cat>Aat	p.H391N	SLC39A12_ENST00000377374.4_Missense_Mutation_p.H391N|SLC39A12_ENST00000539911.1_Missense_Mutation_p.H257N|SLC39A12_ENST00000377371.3_Missense_Mutation_p.H391N	NM_001145195.1|NM_001282733.1|NM_001282734.1	NP_001138667.1|NP_001269662.1|NP_001269663.1	Q504Y0	S39AC_HUMAN	solute carrier family 39 (zinc transporter), member 12	391					regulation of microtubule polymerization (GO:0031113)|regulation of neuron projection development (GO:0010975)|signal transduction (GO:0007165)|zinc ion transmembrane import (GO:0071578)	integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	zinc ion transmembrane transporter activity (GO:0005385)	p.H391N(1)		NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|kidney(3)|large_intestine(5)|lung(38)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	60						GGTCCTTTTCCATAGCTGTGA	0.547																																																	1	Substitution - Missense(1)	kidney(1)											158.0	127.0	138.0					10																	18276482		2203	4300	6503	SO:0001583	missense	221074				CCDS7124.1, CCDS44362.1, CCDS60493.1, CCDS60494.1	10p12.33	2013-05-22			ENSG00000148482	ENSG00000148482		"""Solute carriers"""	20860	protein-coding gene	gene with protein product		608734	"""solute carrier family 39 (metal ion transporter), member 12"""			12659941	Standard	NM_152725		Approved	FLJ30499	uc001ipo.2	Q504Y0	OTTHUMG00000017759	ENST00000377369.2:c.1171C>A	10.37:g.18276482C>A	ENSP00000366586:p.His391Asn	Somatic		WXS	Illumina HiSeq	Phase_I	B7ZL35|C9JJL4|Q49AN8|Q4G0L3|Q5VWV8|Q5VWV9|Q6NZY5|Q96NN4	Missense_Mutation	SNP	ENST00000377369.2	37	CCDS44362.1	.	.	.	.	.	.	.	.	.	.	C	12.25	1.880124	0.33162	.	.	ENSG00000148482	ENST00000377369;ENST00000377374;ENST00000377371;ENST00000539911;ENST00000425219	T;T;T;T	0.46063	0.88;0.88;0.88;0.88	5.84	3.81	0.43845	.	0.502768	0.23608	N	0.046369	T	0.13329	0.0323	N	0.00510	-1.415	0.32743	N	0.507383	B;B;B	0.06786	0.001;0.0;0.001	B;B;B	0.08055	0.003;0.001;0.003	T	0.11108	-1.0601	10	0.15952	T	0.53	-3.9863	12.4521	0.55682	0.5836:0.4164:0.0:0.0	.	391;391;391	Q504Y0-4;Q504Y0;Q504Y0-3	.;S39AC_HUMAN;.	N	391;391;391;257;311	ENSP00000366586:H391N;ENSP00000366591:H391N;ENSP00000366588:H391N;ENSP00000440445:H257N	ENSP00000366586:H391N	H	+	1	0	SLC39A12	18316488	1.000000	0.71417	0.935000	0.37517	0.978000	0.69477	2.623000	0.46435	1.441000	0.47550	0.655000	0.94253	CAT		0.547	SLC39A12-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			NM_152725	
TMTC1	83857	broad.mit.edu;hgsc.bcm.edu	37	12	29709847	29709847	+	Missense_Mutation	SNP	G	G	T			TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr12:29709847G>T	ENST00000539277.1	-	10	1677	c.1619C>A	c.(1618-1620)gCt>gAt	p.A540D	TMTC1_ENST00000552618.1_Missense_Mutation_p.A564D|TMTC1_ENST00000319685.8_5'UTR|TMTC1_ENST00000381224.2_Missense_Mutation_p.A494D|TMTC1_ENST00000256062.5_Missense_Mutation_p.A432D|TMTC1_ENST00000551659.1_Missense_Mutation_p.A602D	NM_001193451.1	NP_001180380.1	Q8IUR5	TMTC1_HUMAN	transmembrane and tetratricopeptide repeat containing 1	540						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)		p.A432D(1)|p.A432V(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(17)|lung(45)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	75	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)					GAGCTGGAGAGCCCTCTGATA	0.498																																																	2	Substitution - Missense(2)	large_intestine(1)|kidney(1)											227.0	189.0	202.0					12																	29709847		2203	4300	6503	SO:0001583	missense	83857				CCDS8718.1, CCDS53772.1	12p11.22	2014-06-09	2006-01-06			ENSG00000133687		"""Tetratricopeptide (TTC) repeat domain containing"""	24099	protein-coding gene	gene with protein product		615855				24764305	Standard	NM_001193451		Approved	ARG99, OLF, FLJ31400, FLJ41625	uc021qwi.1	Q8IUR5	OTTHUMG00000169324	ENST00000539277.1:c.1619C>A	12.37:g.29709847G>T	ENSP00000442046:p.Ala540Asp	Somatic		WXS	Illumina HiSeq	Phase_I	D0EP37|F5H8B5|Q6PIU4|Q6ZSM5|Q96N52|Q9BXM2	Missense_Mutation	SNP	ENST00000539277.1	37	CCDS53772.1	.	.	.	.	.	.	.	.	.	.	G	29.5	5.015135	0.93404	.	.	ENSG00000133687	ENST00000540901;ENST00000256062;ENST00000551659;ENST00000552618;ENST00000539277;ENST00000381224	T;T;T;T;T	0.74632	-0.82;-0.82;-0.86;-0.82;-0.82	5.48	5.48	0.80851	Tetratricopeptide-like helical (1);PIK-related kinase, FAT (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	D	0.90528	0.7032	H	0.95260	3.645	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.81914	0.992;0.995;0.989	D	0.93097	0.6505	9	.	.	.	-13.9388	17.9347	0.89009	0.0:0.0:1.0:0.0	.	494;540;602	Q8IUR5-3;Q8IUR5;F8VTQ9	.;TMTC1_HUMAN;.	D	303;432;602;564;540;494	ENSP00000256062:A432D;ENSP00000448112:A602D;ENSP00000449043:A564D;ENSP00000442046:A540D;ENSP00000370622:A494D	.	A	-	2	0	TMTC1	29601114	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	8.945000	0.92985	2.576000	0.86940	0.655000	0.94253	GCT		0.498	TMTC1-002	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000403509.1		NM_031920	
TMTC2	160335	broad.mit.edu;hgsc.bcm.edu	37	12	83290207	83290207	+	Missense_Mutation	SNP	G	G	A			TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr12:83290207G>A	ENST00000321196.3	+	3	1972	c.1265G>A	c.(1264-1266)cGa>cAa	p.R422Q	TMTC2_ENST00000549919.1_Missense_Mutation_p.R416Q|TMTC2_ENST00000548305.1_Missense_Mutation_p.R422Q	NM_152588.1	NP_689801.1	Q8N394	TMTC2_HUMAN	transmembrane and tetratricopeptide repeat containing 2	422					calcium ion homeostasis (GO:0055074)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)		p.R422Q(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(7)|lung(13)|ovary(2)|skin(1)|urinary_tract(1)	39						ATTGCAGAGCGAGTATTATAT	0.413																																																	1	Substitution - Missense(1)	kidney(1)											147.0	144.0	145.0					12																	83290207		2203	4300	6503	SO:0001583	missense	160335			AK074634	CCDS9025.1	12q21.31	2014-06-09			ENSG00000179104	ENSG00000179104		"""Tetratricopeptide (TTC) repeat domain containing"""	25440	protein-coding gene	gene with protein product		615856				24764305	Standard	NM_152588		Approved	DKFZp762A217	uc001szt.3	Q8N394	OTTHUMG00000169736	ENST00000321196.3:c.1265G>A	12.37:g.83290207G>A	ENSP00000322300:p.Arg422Gln	Somatic		WXS	Illumina HiSeq	Phase_I	B2RCU7|Q8N2K8	Missense_Mutation	SNP	ENST00000321196.3	37	CCDS9025.1	.	.	.	.	.	.	.	.	.	.	G	29.9	5.044058	0.93685	.	.	ENSG00000179104	ENST00000321196;ENST00000548305;ENST00000549919;ENST00000546590	T;T;T	0.69306	-0.39;-0.39;-0.39	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	D	0.86230	0.5883	M	0.90309	3.105	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.998;1.0;0.999	D	0.87972	0.2737	10	0.87932	D	0	-8.4529	20.1996	0.98256	0.0:0.0:1.0:0.0	.	422;177;422	Q8N394;F8VRQ2;F8VSH2	TMTC2_HUMAN;.;.	Q	422;422;416;177	ENSP00000322300:R422Q;ENSP00000448292:R422Q;ENSP00000447609:R416Q	ENSP00000322300:R422Q	R	+	2	0	TMTC2	81814338	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.476000	0.97823	2.776000	0.95493	0.650000	0.86243	CGA		0.413	TMTC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405663.1		NM_152588	
STAB2	55576	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	104062492	104062492	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr12:104062492C>A	ENST00000388887.2	+	20	2361	c.2157C>A	c.(2155-2157)tgC>tgA	p.C719*	RP11-341G23.3_ENST00000550175.1_RNA	NM_017564.9	NP_060034.9			stabilin 2									p.C719*(1)		NS(4)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(11)|large_intestine(26)|lung(77)|ovary(10)|pancreas(1)|prostate(5)|skin(14)|stomach(2)	174						CCCGGTACTGCAATGCCACTG	0.612																																																	1	Substitution - Nonsense(1)	kidney(1)											54.0	39.0	44.0					12																	104062492		2080	4026	6106	SO:0001587	stop_gained	55576			AF160476	CCDS31888.1	12q23.3	2007-01-29				ENSG00000136011			18629	protein-coding gene	gene with protein product	"""hyaluronic acid receptor for endocytosis"""	608561				11829752, 12077138	Standard	XR_429107		Approved	DKFZP434E0321, FELL, STAB-2, HARE, FEEL-2	uc001tjw.3	Q8WWQ8	OTTHUMG00000170056	ENST00000388887.2:c.2157C>A	12.37:g.104062492C>A	ENSP00000373539:p.Cys719*	Somatic		WXS	Illumina HiSeq	Phase_I		Nonsense_Mutation	SNP	ENST00000388887.2	37	CCDS31888.1	.	.	.	.	.	.	.	.	.	.	C	38	6.974915	0.97975	.	.	ENSG00000136011	ENST00000388887	.	.	.	5.25	-4.96	0.03038	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.5757	0.68246	0.0:0.6554:0.0:0.3446	.	.	.	.	X	719	.	ENSP00000373539:C719X	C	+	3	2	STAB2	102586622	0.969000	0.33509	0.046000	0.18839	0.585000	0.36419	-0.173000	0.09854	-1.014000	0.03379	-0.484000	0.04775	TGC		0.612	STAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407089.1			
TRIM16	10626	broad.mit.edu	37	17	15554772	15554772	+	Missense_Mutation	SNP	A	A	G			TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr17:15554772A>G	ENST00000578237.1	-	6	1007	c.152T>C	c.(151-153)cTt>cCt	p.L51P	RP11-640I15.1_ENST00000584540.1_RNA|RP11-385D13.1_ENST00000455584.2_Missense_Mutation_p.L51P|TRIM16_ENST00000336708.7_Missense_Mutation_p.L51P|TRIM16_ENST00000581224.1_Intron|TRIM16_ENST00000416464.2_Intron			O95361	TRI16_HUMAN	tripartite motif containing 16	51					histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|positive regulation of transcription, DNA-templated (GO:0045893)|response to growth hormone (GO:0060416)|response to organophosphorus (GO:0046683)|response to retinoic acid (GO:0032526)	cytoplasm (GO:0005737)|PML body (GO:0016605)	DNA binding (GO:0003677)|interleukin-1 binding (GO:0019966)|NACHT domain binding (GO:0032089)|zinc ion binding (GO:0008270)	p.L51P(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(4)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)	19				UCEC - Uterine corpus endometrioid carcinoma (92;0.0839)|Epithelial(1;8.4e-29)|all cancers(1;3.06e-28)|Colorectal(1;1.57e-19)|OV - Ovarian serous cystadenocarcinoma(1;6.1e-17)|COAD - Colon adenocarcinoma(1;3.38e-12)|READ - Rectum adenocarcinoma(2;1.46e-05)|BRCA - Breast invasive adenocarcinoma(8;0.0559)		CTCCCTGCCAAGCTTCTCCGA	0.627																																																	1	Substitution - Missense(1)	kidney(1)											139.0	139.0	139.0					17																	15554772		2203	4300	6503	SO:0001583	missense	10626			AF096870	CCDS11171.1	17p11.2	2011-04-20	2011-01-25		ENSG00000221926	ENSG00000221926		"""Tripartite motif containing / Tripartite motif containing"""	17241	protein-coding gene	gene with protein product	"""estrogen-responsive B box protein"""	609505	"""tripartite motif-containing 16"""			11331580	Standard	NM_006470		Approved	EBBP	uc002gor.1	O95361	OTTHUMG00000059067	ENST00000578237.1:c.152T>C	17.37:g.15554772A>G	ENSP00000463188:p.Leu51Pro	Somatic		WXS	Illumina GAIIx	Phase_I	Q6IAL8|Q7Z6I2|Q96BE8|Q96J43	Missense_Mutation	SNP	ENST00000578237.1	37	CCDS11171.1	.	.	.	.	.	.	.	.	.	.	a	8.498	0.863525	0.17250	.	.	ENSG00000221926	ENST00000336708	T	0.64618	-0.11	5.17	3.12	0.35913	.	0.717192	0.12568	N	0.457580	T	0.47637	0.1456	L	0.31207	0.915	0.09310	N	0.999998	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.34850	-0.9812	10	0.39692	T	0.17	.	8.0201	0.30404	0.0925:0.1616:0.7459:0.0	.	51;65	O95361;Q59EB2	TRI16_HUMAN;.	P	51	ENSP00000338989:L51P	ENSP00000338989:L51P	L	-	2	0	TRIM16	15495497	0.016000	0.18221	0.000000	0.03702	0.004000	0.04260	1.813000	0.38962	0.528000	0.28580	-0.464000	0.05259	CTT		0.627	TRIM16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130700.2		NM_006470	
TTBK2	146057	broad.mit.edu;hgsc.bcm.edu	37	15	43102877	43102877	+	Missense_Mutation	SNP	G	G	A			TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr15:43102877G>A	ENST00000267890.6	-	9	865	c.757C>T	c.(757-759)Cca>Tca	p.P253S	TTBK2_ENST00000567840.1_Missense_Mutation_p.P253S|TTBK2_ENST00000567274.1_Missense_Mutation_p.P218S	NM_173500.3	NP_775771.3	Q6IQ55	TTBK2_HUMAN	tau tubulin kinase 2	253	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell death (GO:0008219)|cilium assembly (GO:0042384)|peptidyl-serine phosphorylation (GO:0018105)|smoothened signaling pathway (GO:0007224)	centriole (GO:0005814)|ciliary basal body (GO:0036064)|ciliary transition zone (GO:0035869)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.P253S(1)		NS(1)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(8)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(2)	43		all_cancers(109;6.11e-16)|all_epithelial(112;5.5e-14)|Lung NSC(122;1.76e-08)|all_lung(180;6.04e-08)|Melanoma(134;0.0179)|Colorectal(260;0.216)		GBM - Glioblastoma multiforme(94;3.23e-07)		CTGAATTCTGGAGGGAGATGT	0.393																																																	1	Substitution - Missense(1)	kidney(1)											122.0	115.0	117.0					15																	43102877		1857	4094	5951	SO:0001583	missense	146057			AB020654	CCDS42029.1	15q15.2	2014-01-21			ENSG00000128881	ENSG00000128881			19141	protein-coding gene	gene with protein product		611695	"""spinocerebellar ataxia 11"""	SCA11		10048485	Standard	NM_173500		Approved	KIAA0847	uc001zqo.2	Q6IQ55	OTTHUMG00000175802	ENST00000267890.6:c.757C>T	15.37:g.43102877G>A	ENSP00000267890:p.Pro253Ser	Somatic		WXS	Illumina HiSeq	Phase_I	O94932|Q6ZN52|Q8IVV1	Missense_Mutation	SNP	ENST00000267890.6	37	CCDS42029.1	.	.	.	.	.	.	.	.	.	.	G	4.329	0.060509	0.08339	.	.	ENSG00000128881	ENST00000267890;ENST00000399479;ENST00000263802	T	0.20200	2.09	5.85	4.86	0.63082	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.193855	0.53938	D	0.000042	T	0.24044	0.0582	N	0.21282	0.65	0.37935	D	0.932122	B;B;B;B	0.27264	0.173;0.001;0.0;0.001	B;B;B;B	0.41917	0.37;0.012;0.004;0.02	T	0.18398	-1.0338	10	0.33141	T	0.24	.	17.6994	0.88290	0.0:0.0:0.869:0.131	.	233;184;253;253	Q8IWY7;Q6IQ55-2;Q6IQ55-3;Q6IQ55	.;.;.;TTBK2_HUMAN	S	253;183;233	ENSP00000267890:P253S	ENSP00000263802:P233S	P	-	1	0	TTBK2	40890169	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.780000	0.47742	2.761000	0.94854	0.655000	0.94253	CCA		0.393	TTBK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000431106.2		NM_173500	
Unknown	0	broad.mit.edu	37	1	148891580	148891580	+	IGR	SNP	A	A	T	rs374678179		TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr1:148891580A>T								RP11-763B22.6 (37863 upstream) : RNA5SP59 (21692 downstream)																							GAATCAGGGAAGACTCAGTTA	0.358																																																	0																																										SO:0001628	intergenic_variant	0																															1.37:g.148891580A>T		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP		37																																																																																				0	0.358									
Unknown	0	broad.mit.edu	37	1	148891643	148891643	+	IGR	SNP	A	A	G	rs200975583		TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr1:148891643A>G								RP11-763B22.6 (37926 upstream) : RNA5SP59 (21629 downstream)																							CCAAAACTGAAATTGAAGATT	0.423																																																	0																																										SO:0001628	intergenic_variant	0																															1.37:g.148891643A>G		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP		37																																																																																				0	0.423									
KRT16P6	353194	broad.mit.edu	37	17	16723994	16723994	+	RNA	SNP	C	C	T			TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr17:16723994C>T	ENST00000417510.1	-	0	672																											AAGTCATCTGCGGCCAGACGG	0.512																																																	0																																												0																															17.37:g.16723994C>T		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP	ENST00000417510.1	37																																																																																					0.512	AC022596.6-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000131123.1			
USP49	25862	broad.mit.edu	37	6	41773626	41773626	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr6:41773626G>A	ENST00000394253.3	-	3	1425	c.1096C>T	c.(1096-1098)Cga>Tga	p.R366*	USP49_ENST00000373010.1_Nonsense_Mutation_p.R366*|USP49_ENST00000373006.1_Nonsense_Mutation_p.R366*|USP49_ENST00000297229.2_Nonsense_Mutation_p.R366*|USP49_ENST00000373009.3_Nonsense_Mutation_p.R366*			Q70CQ1	UBP49_HUMAN	ubiquitin specific peptidase 49	366	USP.				histone H2B conserved C-terminal lysine deubiquitination (GO:0035616)|mRNA splicing, via spliceosome (GO:0000398)|protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|histone binding (GO:0042393)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.R366*(1)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(7)|ovary(3)|prostate(2)|skin(2)	23	Ovarian(28;0.0919)|Colorectal(47;0.121)		STAD - Stomach adenocarcinoma(11;0.000204)|Epithelial(12;0.000309)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			CACATGACTCGGAAGAGGGTG	0.597																																																	1	Substitution - Nonsense(1)	kidney(1)											66.0	64.0	65.0					6																	41773626		2203	4300	6503	SO:0001587	stop_gained	25862			AJ586139	CCDS4861.1, CCDS69111.1	6p12.1	2008-02-05	2005-08-08		ENSG00000164663	ENSG00000164663		"""Ubiquitin-specific peptidases"""	20078	protein-coding gene	gene with protein product			"""ubiquitin specific protease 49"""			14715245	Standard	NM_018561		Approved	MGC20741	uc003ori.3	Q70CQ1	OTTHUMG00000014688	ENST00000394253.3:c.1096C>T	6.37:g.41773626G>A	ENSP00000377797:p.Arg366*	Somatic		WXS	Illumina GAIIx	Phase_I	Q5T3D9|Q5T3E0|Q96CK4	Nonsense_Mutation	SNP	ENST00000394253.3	37		.	.	.	.	.	.	.	.	.	.	G	35	5.519976	0.96416	.	.	ENSG00000164663	ENST00000394253;ENST00000373010;ENST00000373009;ENST00000373006;ENST00000297229	.	.	.	5.1	5.1	0.69264	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-4.1379	13.4991	0.61442	0.0:0.0:0.8036:0.1964	.	.	.	.	X	366	.	ENSP00000297229:R366X	R	-	1	2	USP49	41881604	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.532000	0.53553	2.521000	0.84997	0.655000	0.94253	CGA		0.597	USP49-007	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000316513.3		NM_018561	
VHL	7428	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	10191492	10191492	+	Missense_Mutation	SNP	G	G	A	rs397516444|rs5030622		TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr3:10191492G>A	ENST00000256474.2	+	3	1325	c.485G>A	c.(484-486)tGc>tAc	p.C162Y	VHL_ENST00000477538.1_3'UTR|VHL_ENST00000345392.2_Missense_Mutation_p.C121Y	NM_000551.3	NP_000542.1	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase	162	Interaction with Elongin BC complex.		C -> F (in VHLD; type I; No effect on interaction with HIF1A nor on HIF1A degradation). {ECO:0000269|PubMed:8956040, ECO:0000269|PubMed:9452032, ECO:0000269|PubMed:9829911}.|C -> R (in VHLD; type I). {ECO:0000269|PubMed:8956040}.|C -> W (in VHLD; type I-II; dbSNP:rs5030622). {ECO:0000269|PubMed:8956040, ECO:0000269|PubMed:9829912}.|C -> Y (in VHLD; type I). {ECO:0000269|PubMed:8956040}.		cell morphogenesis (GO:0000902)|cellular response to hypoxia (GO:0071456)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|transcription factor binding (GO:0008134)|ubiquitin protein ligase activity (GO:0061630)|ubiquitin-protein transferase activity (GO:0004842)	p.C162Y(5)|p.C162F(3)|p.L158fs*6(1)		adrenal_gland(25)|autonomic_ganglia(3)|central_nervous_system(2)|endometrium(6)|kidney(1662)|large_intestine(14)|lung(6)|pancreas(18)|paratesticular_tissues(1)|pleura(1)|skin(1)|soft_tissue(24)|thyroid(3)|upper_aerodigestive_tract(3)	1769				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		AAAGAGCGATGCCTCCAGGTT	0.507		1	"""D, Mis, N, F, S"""		"""renal, hemangioma, pheochromocytoma"""	"""renal, hemangioma, pheochromocytoma"""			von Hippel-Lindau disease;Pheochromocytoma (Adrenal), Familial;Chuvash Polycythemia																														yes	Rec	yes	von Hippel-Lindau syndrome	3	3p25	7428	von Hippel-Lindau syndrome gene		"""E, M, O"""	9	Substitution - Missense(8)|Deletion - Frameshift(1)	kidney(9)	GRCh37	CI011898|CM951291|CM951292	VHL	I|M							94.0	85.0	88.0					3																	10191492		2203	4300	6503	SO:0001583	missense	7428	Familial Cancer Database	VHL; ;Erythrocytosis, Familial type 2	L15409	CCDS2597.1, CCDS2598.1	3p25.3	2014-09-17	2012-02-23		ENSG00000134086	ENSG00000134086			12687	protein-coding gene	gene with protein product		608537	"""von Hippel-Lindau syndrome"", ""von Hippel-Lindau tumor suppressor"""			9671762	Standard	NM_000551		Approved	VHL1	uc003bvc.3	P40337	OTTHUMG00000128668	ENST00000256474.2:c.485G>A	3.37:g.10191492G>A	ENSP00000256474:p.Cys162Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	B2RE45|Q13599|Q6PDA9	Missense_Mutation	SNP	ENST00000256474.2	37	CCDS2597.1	.	.	.	.	.	.	.	.	.	.	G	19.29	3.799771	0.70567	.	.	ENSG00000134086	ENST00000256474;ENST00000345392;ENST00000450183	D;D	0.99832	-7.02;-7.02	4.86	4.86	0.63082	von Hippel-Lindau disease tumour suppressor, beta/alpha domain (2);von Hippel-Lindau disease tumor suppressor, alpha domain (1);	0.108704	0.64402	D	0.000008	D	0.99729	0.9894	M	0.66939	2.045	0.46586	D	0.999112	D;D	0.89917	0.997;1.0	D;D	0.83275	0.982;0.996	D	0.96961	0.9701	10	0.87932	D	0	-7.1517	15.8663	0.79067	0.0:0.0:1.0:0.0	.	121;162	P40337-2;P40337	.;VHL_HUMAN	Y	162;121;80	ENSP00000256474:C162Y;ENSP00000344757:C121Y	ENSP00000256474:C162Y	C	+	2	0	VHL	10166492	1.000000	0.71417	0.998000	0.56505	0.937000	0.57800	4.965000	0.63708	2.676000	0.91093	0.655000	0.94253	TGC		0.507	VHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250559.1		NM_000551	
VSIG10L	147645	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	51845047	51845047	+	Silent	SNP	C	C	G			TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr19:51845047C>G	ENST00000335624.4	-	2	254	c.255G>C	c.(253-255)ctG>ctC	p.L85L	CTD-2616J11.16_ENST00000594311.1_RNA|CTD-2616J11.16_ENST00000601148.1_RNA	NM_001163922.1	NP_001157394.1	Q86VR7	VS10L_HUMAN	V-set and immunoglobulin domain containing 10 like	85	Ser-rich.					integral component of membrane (GO:0016021)		p.L85L(2)		breast(1)|endometrium(2)|kidney(1)	4						TGTTGGAACTCAGGGCCTCAG	0.507																																																	2	Substitution - coding silent(2)	kidney(2)											52.0	54.0	53.0					19																	51845047		692	1591	2283	SO:0001819	synonymous_variant	147645				CCDS54300.1	19q13.41	2013-01-11				ENSG00000186806		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	27111	protein-coding gene	gene with protein product						12477932	Standard	NM_001163922		Approved		uc002pwf.3	Q86VR7		ENST00000335624.4:c.255G>C	19.37:g.51845047C>G		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000335624.4	37	CCDS54300.1																																																																																				0.507	VSIG10L-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464535.1		NM_001163922	
XIRP2	129446	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	168103910	168103910	+	Missense_Mutation	SNP	A	A	T			TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr2:168103910A>T	ENST00000409195.1	+	9	6097	c.6008A>T	c.(6007-6009)aAa>aTa	p.K2003I	XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000295237.9_Missense_Mutation_p.K2003I|XIRP2_ENST00000409273.1_Missense_Mutation_p.K1781I|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000409756.2_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	1828					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)		p.K2003I(1)		NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						ACTATGGGGAAATCTTGCCAT	0.443																																																	1	Substitution - Missense(1)	kidney(1)											50.0	47.0	48.0					2																	168103910		1871	4097	5968	SO:0001583	missense	129446			AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.6008A>T	2.37:g.168103910A>T	ENSP00000386840:p.Lys2003Ile	Somatic		WXS	Illumina HiSeq	Phase_I	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	ENST00000409195.1	37	CCDS42769.1	.	.	.	.	.	.	.	.	.	.	A	10.18	1.280641	0.23392	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273	T;T;T	0.03772	3.81;3.81;3.81	5.31	2.88	0.33553	.	0.777035	0.12620	N	0.453136	T	0.16214	0.0390	M	0.65975	2.015	0.26624	N	0.972609	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.91635	0.933;0.97;0.999	T	0.08576	-1.0715	10	0.56958	D	0.05	-10.3412	6.4355	0.21821	0.782:0.0:0.0779:0.1401	.	1828;1828;1781	A4UGR9;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.	I	2003;2003;1781	ENSP00000386840:K2003I;ENSP00000295237:K2003I;ENSP00000387255:K1781I	ENSP00000295237:K2003I	K	+	2	0	XIRP2	167812156	0.069000	0.21087	0.008000	0.14137	0.262000	0.26303	1.049000	0.30392	0.326000	0.23384	-0.341000	0.08007	AAA		0.443	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1		NM_152381	
YES1	7525	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	18	743325	743325	+	Missense_Mutation	SNP	A	A	C			TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr18:743325A>C	ENST00000584307.1	-	7	985	c.815T>G	c.(814-816)aTc>aGc	p.I272S	YES1_ENST00000314574.4_Missense_Mutation_p.I272S|YES1_ENST00000577961.1_Missense_Mutation_p.I277S			P07947	YES_HUMAN	YES proto-oncogene 1, Src family tyrosine kinase	272					blood coagulation (GO:0007596)|cellular protein modification process (GO:0006464)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|glucose transport (GO:0015758)|innate immune response (GO:0045087)|leukocyte migration (GO:0050900)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|regulation of vascular permeability (GO:0043114)|T cell costimulation (GO:0031295)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)	p.I272S(1)		endometrium(3)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(1)	17					Dasatinib(DB01254)	TTCTCGAGGGATTTCCCAAGC	0.418																																																	1	Substitution - Missense(1)	kidney(1)											114.0	104.0	107.0					18																	743325		2203	4300	6503	SO:0001583	missense	7525			M15990	CCDS11824.1	18p11.31-p11.21	2014-06-26	2014-06-26		ENSG00000176105	ENSG00000176105		"""SH2 domain containing"""	12841	protein-coding gene	gene with protein product		164880	"""v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1"""			2983418	Standard	NM_005433		Approved	Yes, c-yes, HsT441	uc002kky.3	P07947	OTTHUMG00000131472	ENST00000584307.1:c.815T>G	18.37:g.743325A>C	ENSP00000462468:p.Ile272Ser	Somatic		WXS	Illumina HiSeq	Phase_I	A6NLB3|D3DUH1	Missense_Mutation	SNP	ENST00000584307.1	37	CCDS11824.1	.	.	.	.	.	.	.	.	.	.	A	24.9	4.580369	0.86645	.	.	ENSG00000176105	ENST00000359834;ENST00000314574	T	0.27402	1.67	5.69	5.69	0.88448	Protein kinase-like domain (1);SH2 motif (1);	0.000000	0.85682	D	0.000000	T	0.64516	0.2605	H	0.95043	3.615	0.80722	D	1	D	0.65815	0.995	P	0.59221	0.854	T	0.77003	-0.2749	10	0.87932	D	0	.	15.9592	0.79914	1.0:0.0:0.0:0.0	.	272	P07947	YES_HUMAN	S	272	ENSP00000324740:I272S	ENSP00000324740:I272S	I	-	2	0	YES1	733325	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.215000	0.95146	2.175000	0.68902	0.533000	0.62120	ATC		0.418	YES1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440827.2		NM_005433	
ZFYVE26	23503	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	68249593	68249594	+	Missense_Mutation	DNP	AA	AA	TT			TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr14:68249593_68249594AA>TT	ENST00000347230.4	-	21	4413_4414	c.4275_4276TT>AA	c.(4273-4278)gaTTgg>gaAAgg	p.1425_1426DW>ER	ZFYVE26_ENST00000555452.1_Missense_Mutation_p.1425_1426DW>ER	NM_015346.3	NP_056161.2	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	1425					cell death (GO:0008219)|cytokinesis (GO:0000910)|double-strand break repair via homologous recombination (GO:0000724)	centrosome (GO:0005813)|lysosomal membrane (GO:0005765)|midbody (GO:0030496)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)	p.W1426R(1)|p.D1425E(1)		NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(8)|lung(39)|ovary(12)|pancreas(1)|prostate(7)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	94				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		GCCCGGGACCAATCTCTGGCCA	0.545																																																	2	Substitution - Missense(2)	kidney(2)																																								SO:0001583	missense	23503			AB002319	CCDS9788.1	14q23.3	2012-11-23				ENSG00000072121		"""Zinc fingers, FYVE domain containing"""	20761	protein-coding gene	gene with protein product	"""spastizin"", ""FYVE-CENT"""	612012	"""spastic paraplegia 15 (complicated, autosomal recessive)"""	SPG15		9205841, 18394578	Standard	NM_015346		Approved	KIAA0321	uc001xka.2	Q68DK2		ENST00000347230.4:c.4275_4276delinsTT	14.37:g.68249593_68249594delinsTT	ENSP00000251119:p.D1425_W1426delinsER	Somatic		WXS	Illumina HiSeq	Phase_I	B1B5Y3|B4E2U3|O15035|Q68DT9|Q6AW90|Q6ZR50|Q7Z3A4|Q7Z3I1|Q8N4W7	Missense_Mutation	SNP	ENST00000347230.4	37	CCDS9788.1																																																																																				0.545	ZFYVE26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412736.2		NM_015346	
ZMYM2	7750	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	13	20657807	20657807	+	Missense_Mutation	SNP	A	A	G			TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr13:20657807A>G	ENST00000382874.2	+	25	4022	c.3832A>G	c.(3832-3834)Act>Gct	p.T1278A	ZMYM2_ENST00000494061.2_3'UTR|ZMYM2_ENST00000382871.2_Missense_Mutation_p.T1278A|ZMYM2_ENST00000382869.3_Missense_Mutation_p.T1278A	NM_001190964.1	NP_001177893.1	Q9UBW7	ZMYM2_HUMAN	zinc finger, MYM-type 2	1278					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|PML body (GO:0016605)	ubiquitin conjugating enzyme binding (GO:0031624)|zinc ion binding (GO:0008270)	p.T1278A(2)		large_intestine(3)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	10		all_cancers(29;8.65e-21)|all_epithelial(30;1.04e-18)|all_lung(29;6.75e-18)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;0.000148)|Epithelial(112;0.000249)|OV - Ovarian serous cystadenocarcinoma(117;0.00816)|Lung(94;0.0173)|LUSC - Lung squamous cell carcinoma(192;0.0856)		TAAAATTACTACTGGAAAAAG	0.303																																																	2	Substitution - Missense(2)	kidney(2)											52.0	46.0	48.0					13																	20657807		1784	4066	5850	SO:0001583	missense	7750			AF012126	CCDS45016.1	13q11-q12	2013-01-08	2006-07-13	2006-07-13	ENSG00000121741	ENSG00000121741		"""Zinc fingers, MYM type"""	12989	protein-coding gene	gene with protein product		602221	"""zinc finger protein 198"""	ZNF198		9499416, 9425908	Standard	XM_005266517		Approved	RAMP, FIM, MYM	uc001ums.3	Q9UBW7	OTTHUMG00000016507	ENST00000382874.2:c.3832A>G	13.37:g.20657807A>G	ENSP00000372327:p.Thr1278Ala	Somatic		WXS	Illumina HiSeq	Phase_I	A6NDG0|A6NI02|O43212|O43434|O60898|Q5W0Q4|Q5W0T3|Q63HP0|Q8NE39|Q9H0V5|Q9H538|Q9UEU2	Missense_Mutation	SNP	ENST00000382874.2	37	CCDS45016.1	.	.	.	.	.	.	.	.	.	.	A	9.866	1.197616	0.22037	.	.	ENSG00000121741	ENST00000382869;ENST00000456228;ENST00000382874;ENST00000382871;ENST00000382870	T	0.16743	2.32	5.26	4.05	0.47172	.	0.194288	0.44902	D	0.000416	T	0.04861	0.0131	N	0.02011	-0.69	0.80722	D	1	P	0.37061	0.58	B	0.34489	0.184	T	0.36040	-0.9764	10	0.08381	T	0.77	-10.8578	7.4082	0.27004	0.7833:0.1429:0.0738:0.0	.	1278	Q9UBW7	ZMYM2_HUMAN	A	1278;1278;1276;1276;656	ENSP00000372322:T1278A	ENSP00000372322:T1278A	T	+	1	0	ZMYM2	19555807	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.706000	0.37878	0.918000	0.36919	0.477000	0.44152	ACT		0.303	ZMYM2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044051.2		NM_003453	
ZSCAN9	7746	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	28195519	28195519	+	Missense_Mutation	SNP	C	C	G			TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr6:28195519C>G	ENST00000252207.5	+	3	620	c.472C>G	c.(472-474)Cta>Gta	p.L158V	ZSCAN9_ENST00000531981.1_3'UTR|ZSCAN9_ENST00000425468.2_Missense_Mutation_p.L158V|ZSCAN9_ENST00000531979.1_Missense_Mutation_p.L158V|ZSCAN9_ENST00000527436.1_Missense_Mutation_p.L158V	NM_006299.4	NP_006290.1	O15535	ZSC9_HUMAN	zinc finger and SCAN domain containing 9	158					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L158V(1)|p.L158L(1)									GATGGTGCCTCTAGCAGAGCA	0.483																																																	2	Substitution - Missense(1)|Substitution - coding silent(1)	lung(1)|kidney(1)											71.0	65.0	67.0					6																	28195519		2203	4300	6503	SO:0001583	missense	0			U62392	CCDS4646.1, CCDS56407.1	6p21	2013-01-09	2013-01-09	2013-01-09	ENSG00000137185	ENSG00000137185		"""-"", ""Zinc fingers, C2H2-type"""	12984	protein-coding gene	gene with protein product		602246	"""zinc finger protein 193"""	ZNF193			Standard	NM_001199479		Approved	PRD51	uc003nkq.2	O15535	OTTHUMG00000014515	ENST00000252207.5:c.472C>G	6.37:g.28195519C>G	ENSP00000252207:p.Leu158Val	Somatic		WXS	Illumina HiSeq	Phase_I	B4E1W6|E7EVQ2|Q2TTR1	Missense_Mutation	SNP	ENST00000252207.5	37	CCDS4646.1	.	.	.	.	.	.	.	.	.	.	C	11.33	1.606676	0.28623	.	.	ENSG00000137185	ENST00000425468;ENST00000252207;ENST00000531979;ENST00000527436;ENST00000527844	T;T;T;T;T	0.08458	3.09;3.17;3.17;4.18;3.24	2.69	-0.304	0.12788	Transcription regulator SCAN (1);	.	.	.	.	T	0.00998	0.0033	N	0.08118	0	0.09310	N	1	B;B	0.21452	0.056;0.056	B;B	0.16722	0.016;0.016	T	0.48103	-0.9064	9	0.19147	T	0.46	.	5.9025	0.18974	0.2079:0.3856:0.4065:0.0	.	158;158	E7EVQ2;O15535	.;ZN193_HUMAN	V	158	ENSP00000404074:L158V;ENSP00000252207:L158V;ENSP00000433402:L158V;ENSP00000433468:L158V;ENSP00000436166:L158V	ENSP00000252207:L158V	L	+	1	2	ZNF193	28303498	0.000000	0.05858	0.001000	0.08648	0.710000	0.40934	-2.288000	0.01150	-0.101000	0.12219	-0.223000	0.12442	CTA		0.483	ZSCAN9-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000040183.2		NM_006299	
ZNF665	79788	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	53668352	53668352	+	Missense_Mutation	SNP	C	C	T			TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr19:53668352C>T	ENST00000600412.1	-	2	1311	c.1196G>A	c.(1195-1197)gGt>gAt	p.G399D	ZNF665_ENST00000396424.3_Missense_Mutation_p.G464D|CTD-2245F17.2_ENST00000600257.1_RNA			Q9H7R5	ZN665_HUMAN	zinc finger protein 665	399					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G464D(1)|p.G399D(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(10)|lung(16)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	35				GBM - Glioblastoma multiforme(134;0.0196)		GAAGACCTTACCGCAGTCATT	0.433																																																	2	Substitution - Missense(2)	kidney(2)											81.0	84.0	83.0					19																	53668352		2203	4300	6503	SO:0001583	missense	79788				CCDS46169.1	19q13.42	2013-01-08				ENSG00000197497		"""Zinc fingers, C2H2-type"", ""-"""	25885	protein-coding gene	gene with protein product							Standard	NM_024733		Approved	FLJ14345	uc010eqm.1	Q9H7R5		ENST00000600412.1:c.1196G>A	19.37:g.53668352C>T	ENSP00000469154:p.Gly399Asp	Somatic		WXS	Illumina HiSeq	Phase_I	A8K5T8	Missense_Mutation	SNP	ENST00000600412.1	37		.	.	.	.	.	.	.	.	.	.	C	12.80	2.047914	0.36085	.	.	ENSG00000197497	ENST00000396424	T	0.07021	3.23	2.55	-1.27	0.09347	.	.	.	.	.	T	0.11623	0.0283	N	0.17872	0.535	0.09310	N	1	D	0.89917	1.0	D	0.97110	1.0	T	0.24119	-1.0169	9	0.48119	T	0.1	.	4.8271	0.13421	0.0:0.5964:0.1765:0.227	.	464	Q9H7R5-2	.	D	464	ENSP00000379702:G464D	ENSP00000379702:G464D	G	-	2	0	ZNF665	58360164	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.081000	0.14823	-0.341000	0.08376	-0.386000	0.06593	GGT		0.433	ZNF665-002	PUTATIVE	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000464179.1		NM_024733	
ZNF814	730051	broad.mit.edu	37	19	58385546	58385546	+	Missense_Mutation	SNP	G	G	T	rs201682072		TCGA-CW-5588-01A-01D-1534-10	TCGA-CW-5588-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	574bd631-8862-468f-90e9-065aad6d1419	ab8b8c6d-9b42-4c32-b691-9cfd29859bf8	g.chr19:58385546G>T	ENST00000435989.2	-	3	1446	c.1212C>A	c.(1210-1212)gaC>gaA	p.D404E	ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000600634.1_Intron|ZNF814_ENST00000595295.1_Intron|ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000597832.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	404					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D404E(10)		NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						AATGTTTTTTGTCAGTGTGAA	0.393																																																	10	Substitution - Missense(10)	urinary_tract(3)|kidney(3)|prostate(2)|NS(1)|skin(1)											117.0	93.0	100.0					19																	58385546		692	1591	2283	SO:0001583	missense	730051				CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.1212C>A	19.37:g.58385546G>T	ENSP00000410545:p.Asp404Glu	Somatic		WXS	Illumina GAIIx	Phase_I	A6NF35	Missense_Mutation	SNP	ENST00000435989.2	37	CCDS46212.1	.	.	.	.	.	.	.	.	.	.	.	11.12	1.545823	0.27652	.	.	ENSG00000204514	ENST00000435989;ENST00000376205	T	0.14640	2.49	2.33	-4.66	0.03329	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.04363	0.0120	N	0.03177	-0.4	0.09310	N	1	B	0.13145	0.007	B	0.10450	0.005	T	0.33574	-0.9863	9	0.54805	T	0.06	.	1.2175	0.01917	0.3897:0.3041:0.1331:0.1731	.	404	B7Z6K7	ZN814_HUMAN	E	404;266	ENSP00000410545:D404E	ENSP00000365378:D266E	D	-	3	2	ZNF814	63077358	0.000000	0.05858	0.000000	0.03702	0.038000	0.13279	-1.489000	0.02306	-2.531000	0.00491	-1.292000	0.01352	GAC		0.393	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466976.1		XM_001725708	
