#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
AOC1	26	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	150558149	150558149	+	Missense_Mutation	SNP	C	C	G			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr7:150558149C>G	ENST00000493429.1	+	7	2692	c.2108C>G	c.(2107-2109)cCa>cGa	p.P703R	AOC1_ENST00000416793.2_Missense_Mutation_p.P722R|AOC1_ENST00000360937.4_Missense_Mutation_p.P703R|AOC1_ENST00000480582.1_3'UTR|AOC1_ENST00000467291.1_Missense_Mutation_p.P703R			P19801	AOC1_HUMAN	amine oxidase, copper containing 1	703					amine metabolic process (GO:0009308)|cellular response to azide (GO:0097185)|cellular response to copper ion (GO:0071280)|cellular response to copper ion starvation (GO:0035874)|cellular response to heparin (GO:0071504)|cellular response to histamine (GO:0071420)|oxidation-reduction process (GO:0055114)|response to antibiotic (GO:0046677)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	calcium ion binding (GO:0005509)|cation channel activity (GO:0005261)|copper ion binding (GO:0005507)|diamine oxidase activity (GO:0052597)|drug binding (GO:0008144)|heparin binding (GO:0008201)|histamine oxidase activity (GO:0052598)|methylputrescine oxidase activity (GO:0052599)|primary amine oxidase activity (GO:0008131)|propane-1,3-diamine oxidase activity (GO:0052600)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|quinone binding (GO:0048038)|receptor activity (GO:0004872)|sodium channel activity (GO:0005272)|zinc ion binding (GO:0008270)	p.P703R(1)								Amiloride(DB00594)	AACTTCTTCCCAGAGGACCCC	0.622																																																	1	Substitution - Missense(1)	kidney(1)											62.0	73.0	69.0					7																	150558149		2047	4187	6234	SO:0001583	missense	26			AK092514	CCDS43679.1, CCDS64797.1	7q36.1	2013-06-19	2013-06-19	2013-06-19	ENSG00000002726	ENSG00000002726	1.4.3.22		80	protein-coding gene	gene with protein product	"""diamine oxidase"""	104610	"""amiloride binding protein 1 (amine oxidase (copper-containing))"""	ABP1		8182053	Standard	NM_001091		Approved	DAO	uc003wia.2	P19801	OTTHUMG00000158306	ENST00000493429.1:c.2108C>G	7.37:g.150558149C>G	ENSP00000418614:p.Pro703Arg	Somatic		WXS	Illumina HiSeq	Phase_I	C9J690|Q16683|Q16684|Q56II4|Q6GU42	Missense_Mutation	SNP	ENST00000493429.1	37	CCDS43679.1	.	.	.	.	.	.	.	.	.	.	C	11.33	1.605770	0.28623	.	.	ENSG00000002726	ENST00000493429;ENST00000467291;ENST00000360937;ENST00000416793;ENST00000437714	T;T;T;T	0.03689	3.84;3.84;3.84;3.84	4.84	1.9	0.25705	Copper amine oxidase, C-terminal (3);	0.731602	0.12782	N	0.439640	T	0.05364	0.0142	L	0.55103	1.725	0.09310	N	1	B;P	0.36647	0.418;0.563	B;B	0.35240	0.133;0.198	T	0.26087	-1.0113	10	0.42905	T	0.14	-25.5945	12.0044	0.53251	0.5984:0.4016:0.0:0.0	.	722;703	C9J690;P19801	.;ABP1_HUMAN	R	703;703;703;722;579	ENSP00000418614:P703R;ENSP00000418328:P703R;ENSP00000354193:P703R;ENSP00000411613:P722R	ENSP00000354193:P703R	P	+	2	0	ABP1	150189082	0.005000	0.15991	0.172000	0.22920	0.943000	0.58893	2.306000	0.43673	0.073000	0.16731	0.305000	0.20034	CCA		0.622	AOC1-009	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350628.1		NM_001091	
ADAMTS12	81792	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	33576548	33576548	+	Missense_Mutation	SNP	G	G	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr5:33576548G>A	ENST00000504830.1	-	19	3918	c.3583C>T	c.(3583-3585)Cca>Tca	p.P1195S	ADAMTS12_ENST00000352040.3_Missense_Mutation_p.P1110S|ADAMTS12_ENST00000504582.1_5'Flank	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	1195	Spacer 2.				cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.P1195S(1)		NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						GGTGCAAGTGGCATTTCTGTA	0.507										HNSCC(64;0.19)																																							1	Substitution - Missense(1)	kidney(1)											201.0	184.0	190.0					5																	33576548		2203	4300	6503	SO:0001583	missense	81792			AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.3583C>T	5.37:g.33576548G>A	ENSP00000422554:p.Pro1195Ser	Somatic		WXS	Illumina HiSeq	Phase_I	A2RRN9|A5D6V6|Q6UWL3	Missense_Mutation	SNP	ENST00000504830.1	37	CCDS34140.1	.	.	.	.	.	.	.	.	.	.	G	12.39	1.923640	0.33908	.	.	ENSG00000151388	ENST00000504830;ENST00000352040	T;T	0.58797	0.33;0.31	5.28	5.28	0.74379	.	0.353660	0.32533	N	0.005969	T	0.49508	0.1561	L	0.36672	1.1	0.47862	D	0.999531	P;P	0.49559	0.925;0.877	P;B	0.47075	0.536;0.335	T	0.33163	-0.9879	10	0.13470	T	0.59	.	11.4596	0.50202	0.0:0.0:0.808:0.192	.	1110;1195	P58397-3;P58397	.;ATS12_HUMAN	S	1195;1110	ENSP00000422554:P1195S;ENSP00000344847:P1110S	ENSP00000344847:P1110S	P	-	1	0	ADAMTS12	33612305	0.987000	0.35691	0.350000	0.25708	0.906000	0.53458	2.502000	0.45398	2.738000	0.93877	0.655000	0.94253	CCA		0.507	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367164.2		NM_030955	
ALS2	57679	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	202598155	202598155	+	Silent	SNP	G	G	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr2:202598155G>A	ENST00000264276.6	-	13	2796	c.2424C>T	c.(2422-2424)ttC>ttT	p.F808F	ALS2_ENST00000457679.2_Silent_p.F120F	NM_020919.3	NP_065970.2	Q96Q42	ALS2_HUMAN	amyotrophic lateral sclerosis 2 (juvenile)	808	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				behavioral fear response (GO:0001662)|cell death (GO:0008219)|endosomal transport (GO:0016197)|endosome organization (GO:0007032)|locomotory behavior (GO:0007626)|neuromuscular junction development (GO:0007528)|neuron projection morphogenesis (GO:0048812)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Rab GTPase activity (GO:0032851)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rac protein signal transduction (GO:0035022)|positive regulation of Ran GTPase activity (GO:0032853)|protein localization (GO:0008104)|receptor recycling (GO:0001881)|regulation of endosome size (GO:0051036)|response to oxidative stress (GO:0006979)|synaptic transmission, glutamatergic (GO:0035249)|vesicle organization (GO:0016050)	centrosome (GO:0005813)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome (GO:0005769)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|ruffle (GO:0001726)|vesicle (GO:0031982)	protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activator activity (GO:0043539)|Rab GTPase binding (GO:0017137)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Ran guanyl-nucleotide exchange factor activity (GO:0005087)	p.F808F(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(22)|ovary(1)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	72						TTTTATTTAGGAAATCACTAG	0.303																																																	1	Substitution - coding silent(1)	kidney(1)											63.0	54.0	57.0					2																	202598155		1795	4066	5861	SO:0001819	synonymous_variant	57679			AB053305	CCDS42800.1, CCDS46492.1	2q33-q35	2014-09-17	2004-06-23		ENSG00000003393	ENSG00000003393		"""Rho guanine nucleotide exchange factors"""	443	protein-coding gene	gene with protein product	"""alsin"""	606352	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 6"""	ALS2CR6		11586298	Standard	NM_020919		Approved		uc002uyo.3	Q96Q42	OTTHUMG00000154507	ENST00000264276.6:c.2424C>T	2.37:g.202598155G>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q53TT1|Q53TV2|Q8N1E0|Q96PC4|Q96Q41|Q9H973|Q9HCK9	Silent	SNP	ENST00000264276.6	37	CCDS42800.1																																																																																				0.303	ALS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335562.3		NM_020919	
ANAPC2	29882	broad.mit.edu;hgsc.bcm.edu	37	9	140075307	140075307	+	Missense_Mutation	SNP	A	A	T			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr9:140075307A>T	ENST00000323927.2	-	8	1547	c.1543T>A	c.(1543-1545)Ttc>Atc	p.F515I		NM_013366.3	NP_037498.1	Q9UJX6	ANC2_HUMAN	anaphase promoting complex subunit 2	515					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of axon extension (GO:0045773)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic plasticity (GO:0031915)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)		p.F515I(1)		breast(2)|endometrium(4)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	15	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.000858)		TCATTGATGAAGAGGTCCTTG	0.637																																																	1	Substitution - Missense(1)	kidney(1)											104.0	89.0	94.0					9																	140075307		2203	4300	6503	SO:0001583	missense	29882			AB037827	CCDS7033.1	9q34.3	2011-06-15			ENSG00000176248	ENSG00000176248		"""Anaphase promoting complex subunits"""	19989	protein-coding gene	gene with protein product		606946				11739784	Standard	NM_013366		Approved	APC2, KIAA1406	uc004clr.1	Q9UJX6	OTTHUMG00000020983	ENST00000323927.2:c.1543T>A	9.37:g.140075307A>T	ENSP00000314004:p.Phe515Ile	Somatic		WXS	Illumina HiSeq	Phase_I	Q5VSG1|Q96DG5|Q96GG4|Q9P2E1	Missense_Mutation	SNP	ENST00000323927.2	37	CCDS7033.1	.	.	.	.	.	.	.	.	.	.	A	35	5.488631	0.96323	.	.	ENSG00000176248	ENST00000323927	D	0.94330	-3.4	5.41	5.41	0.78517	Cullin, N-terminal (1);Cullin homology (3);	0.045624	0.85682	D	0.000000	D	0.96821	0.8962	M	0.87617	2.895	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97303	0.9932	10	0.66056	D	0.02	-24.7114	13.3824	0.60775	1.0:0.0:0.0:0.0	.	515;512	Q9UJX6;Q9UJX6-2	ANC2_HUMAN;.	I	515	ENSP00000314004:F515I	ENSP00000314004:F515I	F	-	1	0	ANAPC2	139195128	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	6.733000	0.74796	2.053000	0.61076	0.459000	0.35465	TTC		0.637	ANAPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055315.1		NM_013366	
ARHGAP21	57584	broad.mit.edu;hgsc.bcm.edu	37	10	24910118	24910118	+	Missense_Mutation	SNP	C	C	T			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr10:24910118C>T	ENST00000396432.2	-	9	1192	c.706G>A	c.(706-708)Gta>Ata	p.V236I	ARHGAP21_ENST00000320481.6_Missense_Mutation_p.V23I	NM_020824.3	NP_065875.3	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 21	235					establishment of Golgi localization (GO:0051683)|Golgi organization (GO:0007030)|maintenance of Golgi location (GO:0051684)|organelle transport along microtubule (GO:0072384)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)	p.V235I(1)		NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(17)|lung(21)|ovary(7)|pancreas(1)|prostate(5)|skin(2)|stomach(2)|urinary_tract(1)	78						TGTGTCAGTACTGGTGTACTG	0.478																																																	1	Substitution - Missense(1)	kidney(1)											93.0	82.0	86.0					10																	24910118		2203	4300	6503	SO:0001583	missense	57584			AF480466	CCDS7144.2	10p12.31	2013-01-10			ENSG00000107863	ENSG00000107863		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	23725	protein-coding gene	gene with protein product		609870				12056806	Standard	NM_020824		Approved	KIAA1424, ARHGAP10	uc001isb.2	Q5T5U3	OTTHUMG00000017825	ENST00000396432.2:c.706G>A	10.37:g.24910118C>T	ENSP00000379709:p.Val236Ile	Somatic		WXS	Illumina HiSeq	Phase_I	Q0VF98|Q7Z3P7|Q8N3A2|Q8NI19|Q8TBV5|Q9P2C3	Missense_Mutation	SNP	ENST00000396432.2	37	CCDS7144.2	.	.	.	.	.	.	.	.	.	.	C	9.946	1.218913	0.22373	.	.	ENSG00000107863	ENST00000396432;ENST00000447364;ENST00000320481;ENST00000376410;ENST00000446003;ENST00000445703	T;T;T;T	0.46451	2.82;2.8;0.88;0.87	5.35	5.35	0.76521	.	0.448964	0.23828	N	0.044165	T	0.40862	0.1134	M	0.63428	1.95	0.27461	N	0.953143	B;B	0.06786	0.001;0.0	B;B	0.08055	0.002;0.003	T	0.44922	-0.9296	10	0.06494	T	0.89	.	19.4376	0.94804	0.0:1.0:0.0:0.0	.	226;235	F8W9U9;Q5T5U3	.;RHG21_HUMAN	I	236;225;23;226;236;71	ENSP00000379709:V236I;ENSP00000365604:V23I;ENSP00000365592:V226I;ENSP00000405018:V236I	ENSP00000365604:V23I	V	-	1	0	ARHGAP21	24950124	0.894000	0.30519	0.892000	0.35008	0.359000	0.29487	2.657000	0.46724	2.686000	0.91538	0.650000	0.86243	GTA		0.478	ARHGAP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047229.4		NM_020824	
BEST1	7439	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	61725623	61725623	+	Silent	SNP	G	G	A	rs281865281		TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr11:61725623G>A	ENST00000378043.4	+	7	1363	c.720G>A	c.(718-720)gtG>gtA	p.V240V	BEST1_ENST00000435278.2_Intron|BEST1_ENST00000449131.2_Silent_p.V180V|BEST1_ENST00000378042.3_Silent_p.V180V|BEST1_ENST00000526988.1_Silent_p.V134V|BEST1_ENST00000534553.1_Intron|BEST1_ENST00000301774.9_Intron	NM_004183.3	NP_004174.1	O76090	BEST1_HUMAN	bestrophin 1	240					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|detection of light stimulus involved in visual perception (GO:0050908)|ion transmembrane transport (GO:0034220)|regulation of calcium ion transport (GO:0051924)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	basolateral plasma membrane (GO:0016323)|chloride channel complex (GO:0034707)|cytosol (GO:0005829)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)	p.V180V(1)|p.V240V(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(9)|prostate(1)|skin(2)|urinary_tract(2)	25						CCCAGGTGGTGACTGTGGCGG	0.587																																																	2	Substitution - coding silent(2)	kidney(2)											133.0	113.0	120.0					11																	61725623		2202	4299	6501	SO:0001819	synonymous_variant	7439			AF057170	CCDS31580.1, CCDS44623.1	11q12	2013-02-14	2006-10-18	2006-10-18	ENSG00000167995	ENSG00000167995		"""Ion channels / Chloride channels : Calcium activated : Bestrophins"""	12703	protein-coding gene	gene with protein product	"""Best disease"""	607854	"""vitelliform macular dystrophy 2"""	VMD2		1302019, 17003041	Standard	NM_004183		Approved	BMD, BEST, RP50	uc001nsr.2	O76090	OTTHUMG00000167469	ENST00000378043.4:c.720G>A	11.37:g.61725623G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A8K0W6|B7Z3J8|B7Z736|O75904|Q53YQ9|Q8IUR9|Q8IZ80	Silent	SNP	ENST00000378043.4	37	CCDS31580.1																																																																																				0.587	BEST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394715.1		NM_004183	
BICD1	636	broad.mit.edu;ucsc.edu	37	12	32491840	32491840	+	Silent	SNP	C	C	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr12:32491840C>A	ENST00000281474.5	+	8	2794	c.2691C>A	c.(2689-2691)ggC>ggA	p.G897G	BICD1_ENST00000548411.1_Intron	NM_001714.2	NP_001705.2	Q96G01	BICD1_HUMAN	bicaudal D homolog 1 (Drosophila)	897					anatomical structure morphogenesis (GO:0009653)|intracellular mRNA localization (GO:0008298)|microtubule anchoring at microtubule organizing center (GO:0072393)|minus-end-directed organelle transport along microtubule (GO:0072385)|negative regulation of phospholipase C activity (GO:1900275)|negative regulation of phospholipase C-activating G-protein coupled receptor signaling pathway (GO:1900737)|positive regulation of receptor-mediated endocytosis (GO:0048260)|protein localization to organelle (GO:0033365)|regulation of proteinase activated receptor activity (GO:1900276)|RNA processing (GO:0006396)|stress granule assembly (GO:0034063)|viral process (GO:0016032)	cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|host cell viral assembly compartment (GO:0072517)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)	cytoskeletal adaptor activity (GO:0008093)|dynactin binding (GO:0034452)|dynein binding (GO:0045502)|proteinase activated receptor binding (GO:0031871)|Rab GTPase binding (GO:0017137)|structural constituent of cytoskeleton (GO:0005200)	p.G897G(1)		NS(1)|breast(2)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46	all_cancers(9;5.13e-11)|all_epithelial(9;2.71e-11)|all_lung(12;6.66e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0213)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		OV - Ovarian serous cystadenocarcinoma(6;0.0201)			TTCTGAAGGGCCCCCCTTCCA	0.502																																																	1	Substitution - coding silent(1)	kidney(1)											73.0	81.0	78.0					12																	32491840		2203	4300	6503	SO:0001819	synonymous_variant	636			U90028	CCDS8726.1, CCDS44859.1	12p11.2-p11.1	2005-01-13	2001-11-28			ENSG00000151746			1049	protein-coding gene	gene with protein product		602204	"""Bicaudal D (Drosophila) homolog 1"""			9367685	Standard	NM_001714		Approved		uc001rku.3	Q96G01	OTTHUMG00000169307	ENST00000281474.5:c.2691C>A	12.37:g.32491840C>A		Somatic		WXS	Illumina GAIIx	Phase_I	A8K2C3|F8W113|O43892|O43893	Silent	SNP	ENST00000281474.5	37	CCDS8726.1																																																																																				0.502	BICD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403380.1		NM_001714	
BLM	641	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	91295052	91295052	+	Missense_Mutation	SNP	G	G	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr15:91295052G>A	ENST00000355112.3	+	4	953	c.835G>A	c.(835-837)Gaa>Aaa	p.E279K	BLM_ENST00000560509.1_Missense_Mutation_p.E279K	NM_000057.2	NP_000048.1	P54132	BLM_HUMAN	Bloom syndrome, RecQ helicase-like	279					alpha-beta T cell differentiation (GO:0046632)|ATP catabolic process (GO:0006200)|cellular response to camptothecin (GO:0072757)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hydroxyurea (GO:0072711)|cellular response to ionizing radiation (GO:0071479)|DNA double-strand break processing (GO:0000729)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA strand renaturation (GO:0000733)|double-strand break repair via homologous recombination (GO:0000724)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of cell division (GO:0051782)|negative regulation of DNA recombination (GO:0045910)|negative regulation of mitotic recombination (GO:0045950)|negative regulation of thymocyte apoptotic process (GO:0070244)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of transcription, DNA-templated (GO:0045893)|protein oligomerization (GO:0051259)|regulation of binding (GO:0051098)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|replication fork processing (GO:0031297)|replication fork protection (GO:0048478)|response to X-ray (GO:0010165)|telomere maintenance (GO:0000723)	cytoplasm (GO:0005737)|lateral element (GO:0000800)|male germ cell nucleus (GO:0001673)|nuclear chromosome (GO:0000228)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleus (GO:0005634)|PML body (GO:0016605)|pronucleus (GO:0045120)|replication fork (GO:0005657)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent helicase activity (GO:0008026)|ATPase activity (GO:0016887)|bubble DNA binding (GO:0000405)|four-way junction helicase activity (GO:0009378)|G-quadruplex DNA binding (GO:0051880)|helicase activity (GO:0004386)|p53 binding (GO:0002039)|single-stranded DNA binding (GO:0003697)	p.E279K(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(11)|liver(4)|lung(9)|ovary(6)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	Lung NSC(78;0.0875)|all_lung(78;0.109)		Lung(145;0.189)			GGAAGAAGCTGAATTACATTC	0.328			"""Mis, N, F"""			"""leukemia, lymphoma, skin squamous cell , other cancers"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Bloom syndrome																														yes	Rec		Bloom Syndrome	15	15q26.1	641	Bloom Syndrome		"""L, E"""	1	Substitution - Missense(1)	kidney(1)											123.0	120.0	121.0					15																	91295052		2197	4297	6494	SO:0001583	missense	641	Familial Cancer Database		U39817	CCDS10363.1, CCDS73782.1	15q26.1	2014-09-17	2009-03-19		ENSG00000197299	ENSG00000197299			1058	protein-coding gene	gene with protein product		604610	"""Bloom syndrome"""			9388193	Standard	NM_000057		Approved	BS, RECQL3, RECQ2	uc002bpr.3	P54132	OTTHUMG00000149834	ENST00000355112.3:c.835G>A	15.37:g.91295052G>A	ENSP00000347232:p.Glu279Lys	Somatic		WXS	Illumina HiSeq	Phase_I	Q52M96	Missense_Mutation	SNP	ENST00000355112.3	37	CCDS10363.1	.	.	.	.	.	.	.	.	.	.	G	23.3	4.398416	0.83120	.	.	ENSG00000197299	ENST00000355112	T	0.50548	0.74	5.81	5.81	0.92471	.	0.424155	0.22734	N	0.056282	T	0.39708	0.1088	L	0.32530	0.975	0.09310	N	1	P;P	0.40970	0.734;0.734	B;B	0.40329	0.326;0.326	T	0.30031	-0.9992	10	0.21014	T	0.42	-33.501	15.5805	0.76432	0.0:0.0:1.0:0.0	.	279;279	B2RAN0;P54132	.;BLM_HUMAN	K	279	ENSP00000347232:E279K	ENSP00000347232:E279K	E	+	1	0	BLM	89096056	0.140000	0.22579	0.010000	0.14722	0.923000	0.55619	1.952000	0.40343	2.738000	0.93877	0.655000	0.94253	GAA		0.328	BLM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313495.1			
BMP2K	55589	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	79808404	79808404	+	Silent	SNP	T	T	C			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr4:79808404T>C	ENST00000335016.5	+	15	2194	c.2028T>C	c.(2026-2028)gaT>gaC	p.D676D	PAQR3_ENST00000295462.3_3'UTR	NM_198892.1	NP_942595.1	Q9NSY1	BMP2K_HUMAN	BMP2 inducible kinase	676					regulation of bone mineralization (GO:0030500)	nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatase regulator activity (GO:0019208)|protein serine/threonine kinase activity (GO:0004674)	p.D676D(1)		NS(1)|breast(1)|endometrium(4)|large_intestine(2)|lung(3)|prostate(1)|urinary_tract(1)	13						CTCCAGAAGATCCTTTTGGTT	0.383																																																	1	Substitution - coding silent(1)	kidney(1)											110.0	105.0	106.0					4																	79808404		1916	4131	6047	SO:0001819	synonymous_variant	55589			AB015331	CCDS34019.1, CCDS47083.1	4q21.21	2008-05-15			ENSG00000138756	ENSG00000138756			18041	protein-coding gene	gene with protein product							Standard	NM_017593		Approved	DKFZp434K0614, BIKe	uc003hlk.3	Q9NSY1	OTTHUMG00000160900	ENST00000335016.5:c.2028T>C	4.37:g.79808404T>C		Somatic		WXS	Illumina HiSeq	Phase_I	O94791|Q4W5H2|Q8IYF2|Q8N2G7|Q8NHG9|Q9NTG8	Silent	SNP	ENST00000335016.5	37	CCDS47083.1	.	.	.	.	.	.	.	.	.	.	T	9.088	1.000919	0.19121	.	.	ENSG00000138756	ENST00000502613	.	.	.	5.79	1.94	0.25998	.	.	.	.	.	T	0.54854	0.1884	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.42949	-0.9421	4	.	.	.	-11.9761	7.0815	0.25234	0.0:0.1327:0.1285:0.7387	.	.	.	.	P	369	.	.	S	+	1	0	BMP2K	80027428	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	0.792000	0.26929	0.110000	0.17919	-0.385000	0.06624	TCC		0.383	BMP2K-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			NM_017593	
BRCA1	672	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	41243622	41243623	+	Missense_Mutation	DNP	TT	TT	AG	rs397509119		TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr17:41243622_41243623TT>AG	ENST00000357654.3	-	10	4043_4044	c.3925_3926AA>CT	c.(3925-3927)AAt>CTt	p.N1309L	BRCA1_ENST00000591849.1_Intron|BRCA1_ENST00000352993.3_Intron|BRCA1_ENST00000471181.2_Missense_Mutation_p.N1309L|BRCA1_ENST00000346315.3_Missense_Mutation_p.N1309L|BRCA1_ENST00000491747.2_Intron|BRCA1_ENST00000591534.1_Intron|BRCA1_ENST00000354071.3_Missense_Mutation_p.N1309L|BRCA1_ENST00000586385.1_Intron|BRCA1_ENST00000309486.4_Missense_Mutation_p.N1013L|BRCA1_ENST00000468300.1_Intron|BRCA1_ENST00000351666.3_Intron|BRCA1_ENST00000493795.1_Missense_Mutation_p.N1262L	NM_007294.3	NP_009225.1	P38398	BRCA1_HUMAN	breast cancer 1, early onset	1309					androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to indole-3-methanol (GO:0071681)|cellular response to tumor necrosis factor (GO:0071356)|chromosome segregation (GO:0007059)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|fatty acid biosynthetic process (GO:0006633)|G2 DNA damage checkpoint (GO:0031572)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of centriole replication (GO:0046600)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of DNA repair (GO:0045739)|positive regulation of gene expression (GO:0010628)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 acetylation (GO:2000617)|positive regulation of histone H4-K16 acetylation (GO:2000620)|positive regulation of histone H4-K20 methylation (GO:0070512)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|postreplication repair (GO:0006301)|protein autoubiquitination (GO:0051865)|protein K6-linked ubiquitination (GO:0085020)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to estrogen (GO:0043627)|response to ionizing radiation (GO:0010212)	BRCA1-A complex (GO:0070531)|BRCA1-BARD1 complex (GO:0031436)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|gamma-tubulin ring complex (GO:0008274)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ribonucleoprotein complex (GO:0030529)|ubiquitin ligase complex (GO:0000151)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|RNA binding (GO:0003723)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.N1309L(1)|p.N1309I(1)|p.N1309H(1)		NS(1)|breast(30)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(28)|ovary(36)|skin(2)|stomach(4)|urinary_tract(2)	120		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		GGTGTTTGTATTTGCAGTCAAG	0.426			"""D, Mis, N, F, S"""		ovarian	"""breast, ovarian"""		Homologous recombination	Hereditary Breast-Ovarian Cancer, BRCA1 type	TCGA Ovarian(2;0.000030)																													yes	Rec	yes	Hereditary breast/ovarian cancer	17	17q21	672	familial breast/ovarian cancer gene 1		E	3	Substitution - Missense(3)	kidney(3)	GRCh37	CD044104	BRCA1	D																																				SO:0001583	missense	672	Familial Cancer Database		U14680	CCDS11453.1, CCDS11454.1, CCDS11455.1, CCDS11456.1, CCDS11459.1, CCDS11455.2, CCDS11456.2, CCDS11459.2, CCDS11454.2	17q21.31	2014-09-17			ENSG00000012048	ENSG00000012048		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1100	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 1"", ""protein phosphatase 1, regulatory subunit 53"""	113705				1676470	Standard	NM_007300		Approved	RNF53, BRCC1, PPP1R53	uc002ict.3	P38398	OTTHUMG00000157426	ENST00000357654.3:c.3925_3926delinsAG	17.37:g.41243622_41243623delinsAG	ENSP00000350283:p.Asn1309Leu	Somatic		WXS	Illumina HiSeq	Phase_I	O15129|Q1RMC1|Q3LRJ0|Q3LRJ6|Q6IN79|Q7KYU9	Missense_Mutation	SNP	ENST00000357654.3	37	CCDS11453.1																																																																																				0.426	BRCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348798.2		NM_007294	
C15orf26	161502	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	81440807	81440807	+	Missense_Mutation	SNP	A	A	T			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr15:81440807A>T	ENST00000286732.4	+	7	922	c.839A>T	c.(838-840)gAt>gTt	p.D280V		NM_173528.2	NP_775799.2	Q6P656	CO026_HUMAN	chromosome 15 open reading frame 26	280								p.D280V(1)		endometrium(1)|kidney(4)|large_intestine(5)|lung(6)|skin(1)	17						TCCATGTTGGATCTGCCCAAA	0.552																																																	1	Substitution - Missense(1)	kidney(1)											88.0	88.0	88.0					15																	81440807		2044	4189	6233	SO:0001583	missense	161502			AK095934	CCDS42068.1	15q25.1	2012-09-10			ENSG00000156206	ENSG00000156206			26782	protein-coding gene	gene with protein product						14702039	Standard	NM_173528		Approved	FLJ38615	uc002bgb.3	Q6P656	OTTHUMG00000172263	ENST00000286732.4:c.839A>T	15.37:g.81440807A>T	ENSP00000286732:p.Asp280Val	Somatic		WXS	Illumina HiSeq	Phase_I	Q8N906	Missense_Mutation	SNP	ENST00000286732.4	37	CCDS42068.1	.	.	.	.	.	.	.	.	.	.	A	14.11	2.438273	0.43326	.	.	ENSG00000156206	ENST00000286732	T	0.53423	0.62	5.33	4.17	0.49024	.	0.314010	0.33057	N	0.005322	T	0.52677	0.1749	M	0.78916	2.43	0.80722	D	1	P	0.47302	0.893	P	0.44990	0.466	T	0.55444	-0.8140	10	0.49607	T	0.09	-3.2774	11.3549	0.49609	0.8476:0.1524:0.0:0.0	.	280	Q6P656	CO026_HUMAN	V	280	ENSP00000286732:D280V	ENSP00000286732:D280V	D	+	2	0	C15orf26	79227862	0.981000	0.34729	0.227000	0.23927	0.065000	0.16274	2.681000	0.46926	0.821000	0.34540	0.533000	0.62120	GAT		0.552	C15orf26-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417587.1		NM_173528	
C19orf44	84167	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	16620643	16620643	+	Frame_Shift_Del	DEL	C	C	-			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr19:16620643delC	ENST00000221671.3	+	5	1639	c.1483delC	c.(1483-1485)ctgfs	p.L495fs	CTD-3222D19.2_ENST00000409035.1_Intron|C19orf44_ENST00000594035.1_Frame_Shift_Del_p.L495fs	NM_032207.2	NP_115583.1	Q9H6X5	CS044_HUMAN	chromosome 19 open reading frame 44	495										endometrium(1)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|stomach(1)|urinary_tract(2)	16						TGACAGAACACTGGACGCTTT	0.493																																																	0													116.0	116.0	116.0					19																	16620643		2203	4300	6503	SO:0001589	frameshift_variant	84167			AK025395	CCDS12345.1, CCDS74306.1	19p13.11	2011-11-24			ENSG00000105072	ENSG00000105072			26141	protein-coding gene	gene with protein product						12477932	Standard	NM_032207		Approved	FLJ21742	uc002neh.1	Q9H6X5		ENST00000221671.3:c.1483delC	19.37:g.16620643delC	ENSP00000221671:p.Leu495fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q8N6Y7	Frame_Shift_Del	DEL	ENST00000221671.3	37	CCDS12345.1																																																																																				0.493	C19orf44-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000461218.1		NM_032207	
KIAA0930	23313	broad.mit.edu;hgsc.bcm.edu	37	22	45601754	45601754	+	Missense_Mutation	SNP	C	C	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr22:45601754C>A	ENST00000336156.5	-	3	321	c.256G>T	c.(256-258)Gac>Tac	p.D86Y	KIAA0930_ENST00000251993.7_Missense_Mutation_p.D91Y|KIAA0930_ENST00000391627.2_Missense_Mutation_p.D52Y|KIAA0930_ENST00000443310.3_Missense_Mutation_p.D68Y	NM_001009880.1	NP_001009880.1	Q6ICG6	K0930_HUMAN	KIAA0930	86								p.D91Y(1)		endometrium(1)|kidney(4)|large_intestine(2)|lung(7)|urinary_tract(1)	15						TTCTTGGAGTCCCGCCGGTAC	0.627																																																	1	Substitution - Missense(1)	kidney(1)											56.0	53.0	54.0					22																	45601754		2203	4300	6503	SO:0001583	missense	0			AK025608	CCDS33665.1, CCDS33666.1	22q13.31	2011-02-23	2011-02-23	2011-02-23	ENSG00000100364	ENSG00000100364			1314	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 9"""	C22orf9		10231032	Standard	NM_015264		Approved	bK268H5.C22.1	uc003bfw.1	Q6ICG6	OTTHUMG00000151263	ENST00000336156.5:c.256G>T	22.37:g.45601754C>A	ENSP00000336720:p.Asp86Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	B0QY17|B0QY19|B3KT48|Q6ZVE5|Q7Z6K9|Q8IZ76|Q9Y2E2	Missense_Mutation	SNP	ENST00000336156.5	37	CCDS33665.1	.	.	.	.	.	.	.	.	.	.	C	28.5	4.926241	0.92319	.	.	ENSG00000100364	ENST00000336156;ENST00000251993;ENST00000391627;ENST00000443310;ENST00000414854;ENST00000424508	.	.	.	4.22	4.22	0.49857	.	0.095122	0.64402	D	0.000001	T	0.77665	0.4164	M	0.65498	2.005	0.80722	D	1	D;D;D;D	0.89917	1.0;0.979;0.978;0.989	D;P;P;P	0.87578	0.998;0.837;0.77;0.883	T	0.81444	-0.0930	9	0.87932	D	0	-19.0778	16.989	0.86348	0.0:1.0:0.0:0.0	.	68;86;91;157	B0AZU2;Q6ICG6;Q6ICG6-2;Q8IUY4	.;K0930_HUMAN;.;.	Y	86;91;52;68;52;68	.	ENSP00000251993:D91Y	D	-	1	0	KIAA0930	43980418	1.000000	0.71417	0.994000	0.49952	0.990000	0.78478	7.212000	0.77941	2.095000	0.63458	0.561000	0.74099	GAC		0.627	KIAA0930-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321975.2		NM_001009880	
CCDC173	129881	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	170505718	170505718	+	Missense_Mutation	SNP	C	C	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr2:170505718C>A	ENST00000447353.1	-	8	1396	c.1291G>T	c.(1291-1293)Gtt>Ttt	p.V431F		NM_001085447.1	NP_001078916.1	Q0VFZ6	CC173_HUMAN	coiled-coil domain containing 173	431								p.V425F(1)									GCATCTTGAACCTCTTGATGT	0.333																																																	1	Substitution - Missense(1)	kidney(1)											153.0	129.0	137.0					2																	170505718		1817	4091	5908	SO:0001583	missense	0			BC015980, BC117445	CCDS46445.1	2q31.1	2012-08-07	2012-08-07	2012-08-07	ENSG00000154479	ENSG00000154479			25064	protein-coding gene	gene with protein product	"""hypothetical LOC129881"""		"""chromosome 2 open reading frame 77"""	C2orf77		12477932	Standard	NM_001085447		Approved	LOC129881	uc002ufe.2	Q0VFZ6	OTTHUMG00000154116	ENST00000447353.1:c.1291G>T	2.37:g.170505718C>A	ENSP00000391504:p.Val431Phe	Somatic		WXS	Illumina HiSeq	Phase_I	Q6PJF6	Missense_Mutation	SNP	ENST00000447353.1	37	CCDS46445.1	.	.	.	.	.	.	.	.	.	.	C	13.24	2.178268	0.38511	.	.	ENSG00000154479	ENST00000447353	T	0.08896	3.04	5.14	-4.19	0.03835	.	.	.	.	.	T	0.08447	0.0210	L	0.56769	1.78	0.19300	N	0.999976	P	0.34462	0.454	B	0.41860	0.368	T	0.36456	-0.9747	9	0.16420	T	0.52	.	2.2454	0.04030	0.1046:0.2753:0.2056:0.4145	.	431	Q0VFZ6	CB077_HUMAN	F	431	ENSP00000391504:V431F	ENSP00000391504:V431F	V	-	1	0	C2orf77	170213964	0.000000	0.05858	0.005000	0.12908	0.630000	0.37929	-2.250000	0.01187	-1.091000	0.03065	0.467000	0.42956	GTT		0.333	CCDC173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333954.2		NM_001085447	
EFCAB12	90288	broad.mit.edu;hgsc.bcm.edu	37	3	129127513	129127513	+	Silent	SNP	C	C	T			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr3:129127513C>T	ENST00000505956.1	-	6	1386	c.1224G>A	c.(1222-1224)ccG>ccA	p.P408P	EFCAB12_ENST00000326085.3_Silent_p.P408P	NM_207307.1	NP_997190.1	Q6NXP0	EFC12_HUMAN	EF-hand calcium binding domain 12	408							calcium ion binding (GO:0005509)	p.P408P(1)									CCTCTGTCAGCGGGAGGCCAT	0.587																																																	1	Substitution - coding silent(1)	kidney(1)											34.0	33.0	33.0					3																	129127513		1994	4169	6163	SO:0001819	synonymous_variant	0			AK096099	CCDS54638.1	3q21.3	2013-01-10	2012-07-20	2012-07-20	ENSG00000172771	ENSG00000172771		"""EF-hand domain containing"""	28061	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 25"""	C3orf25			Standard	NM_207307		Approved		uc003emg.3	Q6NXP0	OTTHUMG00000159464	ENST00000505956.1:c.1224G>A	3.37:g.129127513C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q69YX4	Silent	SNP	ENST00000505956.1	37	CCDS54638.1																																																																																				0.587	EFCAB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355530.1		NM_207307	
CACHD1	57685	hgsc.bcm.edu;ucsc.edu	37	1	65098290	65098290	+	Frame_Shift_Del	DEL	A	A	-			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr1:65098290delA	ENST00000371073.2	+	6	653	c.653delA	c.(652-654)tacfs	p.Y218fs	CACHD1_ENST00000290039.5_Frame_Shift_Del_p.Y167fs|CACHD1_ENST00000495994.1_Intron			Q5VU97	CAHD1_HUMAN	cache domain containing 1	218					calcium ion transport (GO:0006816)	integral component of membrane (GO:0016021)				breast(4)|endometrium(3)|kidney(3)|large_intestine(20)|lung(14)|ovary(2)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55						AGACCCATCTACGTCTCTACA	0.527																																																	0													99.0	101.0	100.0					1																	65098290		2016	4172	6188	SO:0001589	frameshift_variant	57685			AB046793	CCDS628.2	1p31.3	2008-02-05	2005-10-11	2005-10-11	ENSG00000158966	ENSG00000158966			29314	protein-coding gene	gene with protein product			"""von Willebrand factor type A and cache domain containing 1"""	VWCD1		10997877	Standard	NM_020925		Approved	KIAA1573	uc001dbo.1	Q5VU97	OTTHUMG00000009030	ENST00000371073.2:c.653delA	1.37:g.65098290delA	ENSP00000360113:p.Tyr218fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q49AE9|Q658T4|Q7Z3P2|Q9H7W4|Q9H9W3|Q9HCJ9	Frame_Shift_Del	DEL	ENST00000371073.2	37																																																																																					0.527	CACHD1-201	KNOWN	basic	protein_coding	protein_coding			NM_020925	
CCAR1	55749	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	70507264	70507264	+	Missense_Mutation	SNP	C	C	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr10:70507264C>A	ENST00000265872.6	+	8	886	c.767C>A	c.(766-768)tCt>tAt	p.S256Y	CCAR1_ENST00000543719.1_Missense_Mutation_p.S241Y|CCAR1_ENST00000535016.1_Missense_Mutation_p.S241Y	NM_001282959.1|NM_001282960.1|NM_018237.2	NP_001269888.1|NP_001269889.1|NP_060707.2	Q8IX12	CCAR1_HUMAN	cell division cycle and apoptosis regulator 1	256					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|poly(A) RNA binding (GO:0044822)	p.S256Y(1)		NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|lung(13)|ovary(7)|skin(3)	56						TCAGCAGCTTCTATTACACCA	0.463																																																	1	Substitution - Missense(1)	kidney(1)											144.0	139.0	141.0					10																	70507264		2203	4300	6503	SO:0001583	missense	55749			AY249140	CCDS7282.1, CCDS60547.1	10q22.1	2004-02-19			ENSG00000060339	ENSG00000060339			24236	protein-coding gene	gene with protein product		612569				12816952	Standard	NM_018237		Approved	FLJ10590, CARP-1, CARP1	uc001joo.3	Q8IX12	OTTHUMG00000018361	ENST00000265872.6:c.767C>A	10.37:g.70507264C>A	ENSP00000265872:p.Ser256Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	A0JLT7|A1L4P7|A8K9D4|B4DNP8|B4DRK8|Q32NE3|Q5EBM3|Q5VUP6|Q6PIZ0|Q6X935|Q9H8N4|Q9NVA7|Q9NVQ0|Q9NWM6	Missense_Mutation	SNP	ENST00000265872.6	37	CCDS7282.1	.	.	.	.	.	.	.	.	.	.	C	17.13	3.311975	0.60414	.	.	ENSG00000060339	ENST00000265872;ENST00000535016;ENST00000543719;ENST00000539539;ENST00000543225;ENST00000536012;ENST00000540807	T;T;T;T;T;T	0.32272	1.46;1.79;1.79;1.8;1.84;1.81	5.06	5.06	0.68205	.	0.114058	0.64402	D	0.000008	T	0.29321	0.0730	L	0.36672	1.1	0.52099	D	0.999943	B;B;B	0.14438	0.001;0.01;0.002	B;B;B	0.08055	0.002;0.002;0.003	T	0.06445	-1.0826	10	0.62326	D	0.03	-11.7294	18.781	0.91932	0.0:1.0:0.0:0.0	.	241;256;230	Q8IX12-2;Q8IX12;F5H2E6	.;CCAR1_HUMAN;.	Y	256;241;241;241;230;61;61	ENSP00000265872:S256Y;ENSP00000441820:S241Y;ENSP00000445254:S241Y;ENSP00000439252:S241Y;ENSP00000438610:S230Y;ENSP00000439642:S61Y	ENSP00000265872:S256Y	S	+	2	0	CCAR1	70177270	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.347000	0.65998	2.526000	0.85167	0.655000	0.94253	TCT		0.463	CCAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048356.2		NM_018237	
CCDC62	84660	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	123282648	123282648	+	Missense_Mutation	SNP	A	A	C			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr12:123282648A>C	ENST00000253079.6	+	8	1222	c.878A>C	c.(877-879)cAg>cCg	p.Q293P	CCDC62_ENST00000392441.4_Missense_Mutation_p.Q293P|CCDC62_ENST00000392440.2_Missense_Mutation_p.Q54P|CCDC62_ENST00000537566.1_Missense_Mutation_p.Q54P	NM_201435.4	NP_958843.2	Q6P9F0	CCD62_HUMAN	coiled-coil domain containing 62	293					cellular response to estradiol stimulus (GO:0071392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)	p.Q293P(2)		breast(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|skin(1)|urinary_tract(1)	20	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.51e-06)|Epithelial(86;2.65e-05)|BRCA - Breast invasive adenocarcinoma(302;0.206)		GTAAAACAACAGAGTGATCTG	0.343																																																	2	Substitution - Missense(2)	kidney(2)											58.0	56.0	57.0					12																	123282648		2203	4300	6503	SO:0001583	missense	84660				CCDS9238.1	12q24.31	2009-08-18			ENSG00000130783	ENSG00000130783			30723	protein-coding gene	gene with protein product	"""cancer/testis antigen 109"""	613481				18563714, 19126643	Standard	NM_201435		Approved	TSP-NY, FLJ40344, CT109, ERAP75	uc001udc.3	Q6P9F0	OTTHUMG00000168764	ENST00000253079.6:c.878A>C	12.37:g.123282648A>C	ENSP00000253079:p.Gln293Pro	Somatic		WXS	Illumina HiSeq	Phase_I	A8K8V1|B3KUP3|Q6ZVF2|Q86VJ0|Q9BYZ5	Missense_Mutation	SNP	ENST00000253079.6	37	CCDS9238.1	.	.	.	.	.	.	.	.	.	.	A	18.76	3.692843	0.68271	.	.	ENSG00000130783	ENST00000253079;ENST00000392441;ENST00000537566;ENST00000392440	T;T;T;T	0.57907	0.88;0.87;0.37;0.37	5.46	5.46	0.80206	.	0.274193	0.26237	N	0.025537	T	0.69886	0.3161	M	0.73962	2.25	0.45515	D	0.998473	P;P;D	0.71674	0.912;0.937;0.998	P;P;D	0.69142	0.603;0.504;0.962	T	0.73566	-0.3942	10	0.72032	D	0.01	-6.8816	11.9299	0.52841	1.0:0.0:0.0:0.0	.	293;54;293	Q6P9F0-2;Q6P9F0-3;Q6P9F0	.;.;CCD62_HUMAN	P	293;293;54;54	ENSP00000253079:Q293P;ENSP00000376236:Q293P;ENSP00000445045:Q54P;ENSP00000376235:Q54P	ENSP00000253079:Q293P	Q	+	2	0	CCDC62	121848601	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	4.959000	0.63666	2.073000	0.62155	0.467000	0.42956	CAG		0.343	CCDC62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400930.1		NM_032573	
CCNF	899	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	2481270	2481270	+	Silent	SNP	C	C	T			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr16:2481270C>T	ENST00000397066.4	+	2	244	c.156C>T	c.(154-156)atC>atT	p.I52I		NM_001761.2	NP_001752.2	P41002	CCNF_HUMAN	cyclin F	52	F-box. {ECO:0000255|PROSITE- ProRule:PRU00080}.				mitotic nuclear division (GO:0007067)|negative regulation of centrosome duplication (GO:0010826)|placenta development (GO:0001890)|protein ubiquitination (GO:0016567)|re-entry into mitotic cell cycle (GO:0000320)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	centriole (GO:0005814)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)		p.I52I(2)		breast(3)|central_nervous_system(1)|kidney(4)|large_intestine(2)|lung(5)|prostate(4)|skin(1)	20		Ovarian(90;0.17)				TAGAGGACATCCTGGCCGTCC	0.478																																																	2	Substitution - coding silent(2)	kidney(2)											96.0	91.0	92.0					16																	2481270		2198	4300	6498	SO:0001819	synonymous_variant	899			Z36714	CCDS10467.1	16p13.3	2008-02-05			ENSG00000162063	ENSG00000162063		"""F-boxes /  ""other"""""	1591	protein-coding gene	gene with protein product		600227				7896286	Standard	NM_001761		Approved	FBX1, FBXO1	uc002cqd.1	P41002	OTTHUMG00000128858	ENST00000397066.4:c.156C>T	16.37:g.2481270C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B2R8H3|Q96EG9	Silent	SNP	ENST00000397066.4	37	CCDS10467.1	.	.	.	.	.	.	.	.	.	.	C	3.819	-0.038057	0.07497	.	.	ENSG00000162063	ENST00000293968	.	.	.	4.96	4.01	0.46588	.	.	.	.	.	T	0.70185	0.3195	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.71411	-0.4601	5	0.49607	T	0.09	-32.4808	12.3604	0.55199	0.0:0.917:0.0:0.083	.	.	.	.	F	3	.	ENSP00000293968:S3F	S	+	2	0	CCNF	2421271	1.000000	0.71417	1.000000	0.80357	0.595000	0.36748	1.662000	0.37418	1.228000	0.43614	0.655000	0.94253	TCC		0.478	CCNF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250801.1		NM_001761	
CELSR2	1952	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	109793167	109793167	+	Missense_Mutation	SNP	C	C	T			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr1:109793167C>T	ENST00000271332.3	+	1	527	c.466C>T	c.(466-468)Ctc>Ttc	p.L156F		NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	156					cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.L156F(1)		NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		GGCCCCCGGGCTCAGGGCAGG	0.637																																					NSCLC(158;1285 2011 34800 34852 42084)												1	Substitution - Missense(1)	kidney(1)											37.0	49.0	45.0					1																	109793167		2203	4300	6503	SO:0001583	missense	1952			D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.466C>T	1.37:g.109793167C>T	ENSP00000271332:p.Leu156Phe	Somatic		WXS	Illumina HiSeq	Phase_I	Q5T2Y7|Q92566	Missense_Mutation	SNP	ENST00000271332.3	37	CCDS796.1	.	.	.	.	.	.	.	.	.	.	N	1.554	-0.538453	0.04082	.	.	ENSG00000143126	ENST00000271332	T	0.68331	-0.32	5.52	2.39	0.29439	.	.	.	.	.	T	0.15132	0.0365	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.24799	-1.0150	9	0.09843	T	0.71	.	2.428	0.04464	0.1556:0.5239:0.1508:0.1697	.	156	Q9HCU4	CELR2_HUMAN	F	156	ENSP00000271332:L156F	ENSP00000271332:L156F	L	+	1	0	CELSR2	109594690	0.000000	0.05858	0.011000	0.14972	0.054000	0.15201	0.114000	0.15520	0.678000	0.31325	-0.320000	0.08662	CTC		0.637	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033200.1		NM_001408	
CKAP2L	150468	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	113514506	113514506	+	Missense_Mutation	SNP	T	T	C			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr2:113514506T>C	ENST00000302450.6	-	4	520	c.442A>G	c.(442-444)Aaa>Gaa	p.K148E	CKAP2L_ENST00000481732.1_5'UTR|CKAP2L_ENST00000541405.1_5'UTR	NM_152515.3	NP_689728.3	Q8IYA6	CKP2L_HUMAN	cytoskeleton associated protein 2-like	148						centrosome (GO:0005813)|cytoplasm (GO:0005737)		p.K148E(1)		breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	28						TTTGTAGTTTTCAATTGCTCT	0.358																																																	1	Substitution - Missense(1)	kidney(1)											82.0	87.0	85.0					2																	113514506		2203	4300	6503	SO:0001583	missense	150468			AL832036	CCDS2100.1	2q13	2008-02-05			ENSG00000169607	ENSG00000169607			26877	protein-coding gene	gene with protein product						12477932	Standard	NM_152515		Approved	FLJ40629	uc002tie.2	Q8IYA6	OTTHUMG00000131313	ENST00000302450.6:c.442A>G	2.37:g.113514506T>C	ENSP00000305204:p.Lys148Glu	Somatic		WXS	Illumina HiSeq	Phase_I	A8K915|B4DZE3|B7ZAC6|F5H0M5|Q53QF8|Q53RS8|Q8N1J8	Missense_Mutation	SNP	ENST00000302450.6	37	CCDS2100.1	.	.	.	.	.	.	.	.	.	.	T	15.33	2.801715	0.50315	.	.	ENSG00000169607	ENST00000302450	T	0.07908	3.15	5.15	2.73	0.32206	.	0.171809	0.37623	N	0.002006	T	0.10252	0.0251	M	0.72118	2.19	0.20196	N	0.999927	B	0.19935	0.04	B	0.23018	0.043	T	0.21895	-1.0232	10	0.38643	T	0.18	-15.268	6.5507	0.22431	0.0:0.2145:0.0:0.7855	.	148	Q8IYA6	CKP2L_HUMAN	E	148	ENSP00000305204:K148E	ENSP00000305204:K148E	K	-	1	0	CKAP2L	113230977	0.004000	0.15560	0.009000	0.14445	0.022000	0.10575	0.534000	0.23098	0.472000	0.27344	0.477000	0.44152	AAA		0.358	CKAP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254082.2		NM_152515	
CPD	1362	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	28750570	28750570	+	Silent	SNP	G	G	C			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr17:28750570G>C	ENST00000225719.4	+	6	1780	c.1704G>C	c.(1702-1704)gtG>gtC	p.V568V	CPD_ENST00000543464.2_Silent_p.V321V	NM_001304.4	NP_001295.2	O75976	CBPD_HUMAN	carboxypeptidase D	568	Carboxypeptidase-like 2.					extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	metallocarboxypeptidase activity (GO:0004181)|serine-type carboxypeptidase activity (GO:0004185)|zinc ion binding (GO:0008270)	p.V568V(1)		central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(13)|skin(5)|stomach(1)|urinary_tract(1)	36						GAAATGAAGTGGTTGGAAGAG	0.358																																																	1	Substitution - coding silent(1)	kidney(1)											136.0	130.0	132.0					17																	28750570		2203	4300	6503	SO:0001819	synonymous_variant	1362			U65090	CCDS11257.1, CCDS56025.1	17q11.2	2012-02-10			ENSG00000108582	ENSG00000108582	3.4.17.22		2301	protein-coding gene	gene with protein product	"""metallocarboxypeptidase D"""	603102				9628828, 9355738	Standard	NM_001304		Approved	GP180	uc002hfb.2	O75976	OTTHUMG00000132797	ENST00000225719.4:c.1704G>C	17.37:g.28750570G>C		Somatic		WXS	Illumina HiSeq	Phase_I	B7Z7T9|B7ZAU4|F5GZH6|O15377|Q86SH9|Q86XE6	Silent	SNP	ENST00000225719.4	37	CCDS11257.1																																																																																				0.358	CPD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256214.3		NM_001304	
CR1	1378	hgsc.bcm.edu;ucsc.edu	37	1	207753683	207753683	+	Frame_Shift_Del	DEL	G	G	-			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr1:207753683delG	ENST00000367049.4	+	30	5035	c.5035delG	c.(5035-5037)ggcfs	p.G1679fs	CR1_ENST00000400960.2_Frame_Shift_Del_p.G1229fs|CR1_ENST00000367051.1_Frame_Shift_Del_p.G1229fs|RP11-78B10.2_ENST00000596003.1_RNA|CR1_ENST00000367052.1_Frame_Shift_Del_p.G1229fs|CR1_ENST00000367053.1_Frame_Shift_Del_p.G1229fs|RP11-78B10.2_ENST00000597497.1_RNA	NM_000651.4	NP_000642.3	P17927	CR1_HUMAN	complement component (3b/4b) receptor 1 (Knops blood group)	1229	Sushi 26. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation, classical pathway (GO:0006958)|complement receptor mediated signaling pathway (GO:0002430)|innate immune response (GO:0045087)|negative regulation of complement activation, alternative pathway (GO:0045957)|negative regulation of complement activation, classical pathway (GO:0045959)|negative regulation of serine-type endopeptidase activity (GO:1900004)|positive regulation of serine-type endopeptidase activity (GO:1900005)|regulation of complement activation (GO:0030449)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	complement component C3b binding (GO:0001851)|complement component C3b receptor activity (GO:0004877)|complement component C4b binding (GO:0001855)|complement component C4b receptor activity (GO:0001861)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(9)|kidney(11)|large_intestine(13)|lung(33)|ovary(3)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						CTGTGAGCCTGGCTATGACCT	0.587																																																	0													120.0	124.0	122.0					1																	207753683		1977	4172	6149	SO:0001589	frameshift_variant	1378			Y00816	CCDS44308.1, CCDS44309.1	1q32	2014-07-19	2006-01-12		ENSG00000203710	ENSG00000203710		"""CD molecules"", ""Blood group antigens"", ""Complement system"""	2334	protein-coding gene	gene with protein product		120620	"""complement component (3b/4b) receptor 1, including Knops blood group system"""			1708809	Standard	XM_005273064		Approved	CD35, KN	uc001hfx.3	P17927	OTTHUMG00000036311	ENST00000367049.4:c.5035delG	1.37:g.207753683delG	ENSP00000356016:p.Gly1679fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q16744|Q16745|Q5SR43|Q5SR45|Q9UQV2	Frame_Shift_Del	DEL	ENST00000367049.4	37	CCDS44308.1																																																																																				0.587	CR1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382527.1		NM_000573	
CXCL10	3627	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	76943924	76943924	+	Silent	SNP	A	A	G			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr4:76943924A>G	ENST00000306602.1	-	2	173	c.108T>C	c.(106-108)agT>agC	p.S36S	ART3_ENST00000341029.5_Intron	NM_001565.3	NP_001556.2	P02778	CXL10_HUMAN	chemokine (C-X-C motif) ligand 10	36					blood circulation (GO:0008015)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular response to heat (GO:0034605)|cellular response to lipopolysaccharide (GO:0071222)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|defense response to virus (GO:0051607)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|muscle organ development (GO:0007517)|negative regulation of angiogenesis (GO:0016525)|positive regulation of cAMP metabolic process (GO:0030816)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of cell proliferation (GO:0008284)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of T cell migration (GO:2000406)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein secretion (GO:0009306)|regulation of cell proliferation (GO:0042127)|regulation of protein kinase activity (GO:0045859)|response to auditory stimulus (GO:0010996)|response to cold (GO:0009409)|response to gamma radiation (GO:0010332)|response to vitamin D (GO:0033280)|signal transduction (GO:0007165)|T cell chemotaxis (GO:0010818)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	cAMP-dependent protein kinase regulator activity (GO:0008603)|chemokine activity (GO:0008009)|CXCR3 chemokine receptor binding (GO:0048248)|heparin binding (GO:0008201)|receptor binding (GO:0005102)	p.S36S(1)		kidney(1)|large_intestine(1)|lung(1)	3			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			CAGGTTGATTACTAATGCTGA	0.408																																																	1	Substitution - coding silent(1)	kidney(1)											137.0	125.0	129.0					4																	76943924		1915	4124	6039	SO:0001819	synonymous_variant	3627			X02530	CCDS43240.1	4q21	2013-02-25	2002-08-22	2002-08-23		ENSG00000169245		"""Endogenous ligands"""	10637	protein-coding gene	gene with protein product		147310	"""small inducible cytokine subfamily B (Cys-X-Cys), member 10"""	INP10, SCYB10		2437586, 3925348	Standard	NM_001565		Approved	IFI10, IP-10, crg-2, mob-1, C7, gIP-10	uc003hjl.4	P02778		ENST00000306602.1:c.108T>C	4.37:g.76943924A>G		Somatic		WXS	Illumina HiSeq	Phase_I	Q96QJ5	Silent	SNP	ENST00000306602.1	37	CCDS43240.1																																																																																				0.408	CXCL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362817.1			
DCTN1	1639	broad.mit.edu;hgsc.bcm.edu	37	2	74598753	74598753	+	Missense_Mutation	SNP	G	G	T			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr2:74598753G>T	ENST00000361874.3	-	8	873	c.556C>A	c.(556-558)Ccg>Acg	p.P186T	DCTN1_ENST00000394003.3_Missense_Mutation_p.P179T|DCTN1_ENST00000409868.1_Missense_Mutation_p.P169T|DCTN1_ENST00000409567.3_Missense_Mutation_p.P166T|DCTN1_ENST00000407639.2_Missense_Mutation_p.P52T|DCTN1_ENST00000409240.1_Missense_Mutation_p.P149T|DCTN1_ENST00000409438.1_Missense_Mutation_p.P52T	NM_004082.4	NP_004073.2	Q14203	DCTN1_HUMAN	dynactin 1	186	Ser-rich.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|G2/M transition of mitotic cell cycle (GO:0000086)|melanosome transport (GO:0032402)|microtubule-based transport (GO:0010970)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|nervous system development (GO:0007399)	cell leading edge (GO:0031252)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|dynein complex (GO:0030286)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|spindle pole (GO:0000922)	motor activity (GO:0003774)	p.P186T(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(20)|ovary(4)|prostate(1)|skin(3)	45						GTCTGAGCCGGGGTGCTGGGC	0.687																																																	1	Substitution - Missense(1)	kidney(1)											20.0	22.0	21.0					2																	74598753		2201	4296	6497	SO:0001583	missense	1639				CCDS1939.1, CCDS46341.1, CCDS46342.1, CCDS54368.1, CCDS54369.1	2p13	2014-09-17	2010-06-24		ENSG00000204843	ENSG00000204843			2711	protein-coding gene	gene with protein product	"""p150 glued homolog (Drosophila)"""	601143	"""dynactin 1 (p150, Glued (Drosophila) homolog)"""			1828535	Standard	NM_001190836		Approved		uc002skx.3	Q14203	OTTHUMG00000129963	ENST00000361874.3:c.556C>A	2.37:g.74598753G>T	ENSP00000354791:p.Pro186Thr	Somatic		WXS	Illumina HiSeq	Phase_I	A8MY36|B4DM45|E9PFS5|E9PGE1|G5E9H4|O95296|Q6IQ37|Q9BRM9|Q9UIU1|Q9UIU2	Missense_Mutation	SNP	ENST00000361874.3	37	CCDS1939.1	.	.	.	.	.	.	.	.	.	.	G	33	5.223832	0.95139	.	.	ENSG00000204843	ENST00000361874;ENST00000394003;ENST00000393999;ENST00000407639;ENST00000409438;ENST00000409240;ENST00000409868;ENST00000409567	T;T;T;T;T;T;T	0.79454	-0.87;-1.14;-0.93;-0.93;-1.27;-1.08;-1.06	5.39	5.39	0.77823	.	0.000000	0.42964	D	0.000631	T	0.80696	0.4672	N	0.24115	0.695	0.80722	D	1	P;B;D;P;D;D	0.89917	0.717;0.083;1.0;0.544;1.0;1.0	B;B;D;B;D;D	0.87578	0.211;0.02;0.992;0.175;0.998;0.996	T	0.76820	-0.2818	10	0.23302	T	0.38	-4.6103	18.0832	0.89449	0.0:0.0:1.0:0.0	.	166;149;186;179;52;52	E9PGE1;E9PFS5;Q14203;A8MY36;Q14203-2;G5E9H4	.;.;DCTN1_HUMAN;.;.;.	T	186;179;169;52;52;149;169;166	ENSP00000354791:P186T;ENSP00000377571:P179T;ENSP00000384844:P52T;ENSP00000387270:P52T;ENSP00000386406:P149T;ENSP00000387327:P169T;ENSP00000386843:P166T	ENSP00000354791:P186T	P	-	1	0	DCTN1	74452261	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.928000	0.92853	2.795000	0.96236	0.655000	0.94253	CCG		0.687	DCTN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252227.3		NM_004082	
DDX46	9879	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	134131704	134131704	+	Missense_Mutation	SNP	C	C	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr5:134131704C>A	ENST00000354283.4	+	15	1953	c.1818C>A	c.(1816-1818)ttC>ttA	p.F606L	DDX46_ENST00000452510.2_Missense_Mutation_p.F606L			Q7L014	DDX46_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 46	606	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)	p.F606L(1)		NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			AAAAGAAATTCTTGAAGTTAC	0.338																																					Colon(13;391 453 4901 21675 24897)												1	Substitution - Missense(1)	kidney(1)											113.0	106.0	108.0					5																	134131704		2203	4300	6503	SO:0001583	missense	9879				CCDS34240.1, CCDS75306.1	5q31.1	2010-01-25			ENSG00000145833	ENSG00000145833		"""DEAD-boxes"""	18681	protein-coding gene	gene with protein product							Standard	XM_005272142		Approved	KIAA0801, FLJ25329, PRPF5, Prp5	uc003kzw.3	Q7L014	OTTHUMG00000163072	ENST00000354283.4:c.1818C>A	5.37:g.134131704C>A	ENSP00000346236:p.Phe606Leu	Somatic		WXS	Illumina HiSeq	Phase_I	O94894|Q96EI0|Q9Y658	Missense_Mutation	SNP	ENST00000354283.4	37	CCDS34240.1	.	.	.	.	.	.	.	.	.	.	C	14.77	2.634745	0.47049	.	.	ENSG00000145833	ENST00000452510;ENST00000354283	D;D	0.91068	-2.78;-2.78	4.92	2.11	0.27256	Helicase, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.82508	0.5052	N	0.11106	0.095	0.80722	D	1	B	0.27853	0.191	B	0.38020	0.263	T	0.76873	-0.2798	10	0.49607	T	0.09	-9.0449	9.8519	0.41061	0.0:0.642:0.0:0.358	.	606	Q7L014	DDX46_HUMAN	L	606	ENSP00000416534:F606L;ENSP00000346236:F606L	ENSP00000346236:F606L	F	+	3	2	DDX46	134159603	0.997000	0.39634	1.000000	0.80357	0.988000	0.76386	0.748000	0.26305	0.601000	0.29879	-0.424000	0.05967	TTC		0.338	DDX46-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371584.1		NM_014829	
DNAH7	56171	broad.mit.edu	37	2	196720578	196720578	+	Missense_Mutation	SNP	G	G	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr2:196720578G>A	ENST00000312428.6	-	45	8652	c.8552C>T	c.(8551-8553)aCa>aTa	p.T2851I		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	2851	Stalk. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)	p.T2851I(1)		NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						TAATTCAAGTGTGTCTTGAAG	0.428																																																	1	Substitution - Missense(1)	kidney(1)											256.0	243.0	247.0					2																	196720578		1845	4095	5940	SO:0001583	missense	56171			AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.8552C>T	2.37:g.196720578G>A	ENSP00000311273:p.Thr2851Ile	Somatic		WXS	Illumina GAIIx	Phase_I	B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Missense_Mutation	SNP	ENST00000312428.6	37	CCDS42794.1	.	.	.	.	.	.	.	.	.	.	G	7.997	0.754469	0.15778	.	.	ENSG00000118997	ENST00000312428	T	0.74421	-0.84	5.31	3.48	0.39840	Dynein heavy chain, coiled coil stalk (1);	0.107280	0.64402	D	0.000008	T	0.67896	0.2942	L	0.56340	1.77	0.80722	D	1	B	0.09022	0.002	B	0.19666	0.026	T	0.62548	-0.6831	10	0.40728	T	0.16	.	10.1863	0.43000	0.0:0.1335:0.5895:0.277	.	2851	Q8WXX0	DYH7_HUMAN	I	2851	ENSP00000311273:T2851I	ENSP00000311273:T2851I	T	-	2	0	DNAH7	196428823	1.000000	0.71417	0.819000	0.32651	0.290000	0.27261	4.373000	0.59537	0.777000	0.33496	-0.312000	0.09012	ACA		0.428	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335202.3		NM_018897	
DOCK2	1794	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	169174444	169174444	+	Missense_Mutation	SNP	G	G	T			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr5:169174444G>T	ENST00000256935.8	+	23	2392	c.2312G>T	c.(2311-2313)aGa>aTa	p.R771I	DOCK2_ENST00000520908.1_Missense_Mutation_p.R263I|DOCK2_ENST00000540750.1_5'UTR	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	771					actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)	p.R771I(1)		NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GAATCCATGAGACGGCTCTTT	0.358																																																	1	Substitution - Missense(1)	kidney(1)											92.0	88.0	90.0					5																	169174444		2203	4300	6503	SO:0001583	missense	1794			BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.2312G>T	5.37:g.169174444G>T	ENSP00000256935:p.Arg771Ile	Somatic		WXS	Illumina HiSeq	Phase_I	Q2M3I0|Q96AK7	Missense_Mutation	SNP	ENST00000256935.8	37	CCDS4371.1	.	.	.	.	.	.	.	.	.	.	G	16.00	2.997192	0.54147	.	.	ENSG00000134516	ENST00000256935;ENST00000343291;ENST00000520908	T;T	0.53423	0.62;0.62	5.57	5.57	0.84162	.	0.166784	0.64402	D	0.000012	T	0.60209	0.2251	L	0.59436	1.845	0.80722	D	1	P;D	0.60575	0.456;0.988	B;P	0.54664	0.074;0.758	T	0.60707	-0.7210	10	0.52906	T	0.07	.	18.3118	0.90203	0.0:0.0:1.0:0.0	.	263;771	E7ERW7;Q92608	.;DOCK2_HUMAN	I	771;152;263	ENSP00000256935:R771I;ENSP00000429283:R263I	ENSP00000256935:R771I	R	+	2	0	DOCK2	169107022	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.119000	0.71590	2.623000	0.88846	0.561000	0.74099	AGA		0.358	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252828.2		NM_004946	
DYX1C1	161582	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	55722880	55722880	+	Missense_Mutation	SNP	T	T	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr15:55722880T>A	ENST00000321149.3	-	10	1618	c.1251A>T	c.(1249-1251)gaA>gaT	p.E417D	DYX1C1-CCPG1_ENST00000565113.1_RNA|DYX1C1_ENST00000457155.2_3'UTR|DYX1C1_ENST00000448430.2_Intron|DYX1C1_ENST00000380679.1_Intron|DYX1C1_ENST00000348518.3_3'UTR	NM_130810.3	NP_570722.2	Q8WXU2	DYXC1_HUMAN	dyslexia susceptibility 1 candidate 1	417					cilium movement (GO:0003341)|determination of left/right symmetry (GO:0007368)|inner dynein arm assembly (GO:0036159)|neuron migration (GO:0001764)|outer dynein arm assembly (GO:0036158)|regulation of intracellular estrogen receptor signaling pathway (GO:0033146)|regulation of proteasomal protein catabolic process (GO:0061136)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	estrogen receptor binding (GO:0030331)	p.E417D(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	18				all cancers(107;0.0118)|GBM - Glioblastoma multiforme(80;0.171)		AAGATTTTAGTTCTGTTCCTT	0.333																																																	1	Substitution - Missense(1)	kidney(1)											104.0	105.0	105.0					15																	55722880		2192	4288	6480	SO:0001583	missense	161582				CCDS10154.1, CCDS32243.1, CCDS32244.1	15q21.3	2014-09-11			ENSG00000256061	ENSG00000256061		"""Tetratricopeptide (TTC) repeat domain containing"""	21493	protein-coding gene	gene with protein product		608706				12954984	Standard	NM_130810		Approved	EKN1, FLJ37882, CILD25	uc002adc.3	Q8WXU2	OTTHUMG00000132008	ENST00000321149.3:c.1251A>T	15.37:g.55722880T>A	ENSP00000323275:p.Glu417Asp	Somatic		WXS	Illumina HiSeq	Phase_I	Q6P5Y9|Q8N1S6	Missense_Mutation	SNP	ENST00000321149.3	37	CCDS10154.1	.	.	.	.	.	.	.	.	.	.	T	11.47	1.647583	0.29246	.	.	ENSG00000256061	ENST00000321149	T	0.06142	3.34	5.6	5.6	0.85130	.	0.670270	0.13414	U	0.389654	T	0.05731	0.0150	L	0.44542	1.39	0.80722	D	1	B	0.16396	0.017	B	0.11329	0.006	T	0.33650	-0.9860	10	0.13853	T	0.58	.	4.8403	0.13487	0.1658:0.0891:0.0:0.745	.	417	Q8WXU2	DYXC1_HUMAN	D	417	ENSP00000323275:E417D	ENSP00000323275:E417D	E	-	3	2	DYX1C1	53510172	0.086000	0.21541	0.987000	0.45799	0.993000	0.82548	0.958000	0.29227	2.141000	0.66446	0.456000	0.33151	GAA		0.333	DYX1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254976.1		NM_130810	
EAF2	55840	hgsc.bcm.edu;ucsc.edu	37	3	121554180	121554181	+	Frame_Shift_Del	DEL	TC	TC	-			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	TC	TC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr3:121554180_121554181delTC	ENST00000273668.2	+	1	119_120	c.48_49delTC	c.(46-51)gttctcfs	p.L17fs	IQCB1_ENST00000310864.6_5'Flank|IQCB1_ENST00000349820.6_5'Flank|EAF2_ENST00000465664.1_3'UTR|EAF2_ENST00000451944.2_Frame_Shift_Del_p.L17fs	NM_018456.4	NP_060926.2	Q96CJ1	EAF2_HUMAN	ELL associated factor 2	17	Necessary for interaction with ELL.				apoptotic process (GO:0006915)|negative regulation of cell growth (GO:0030308)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	ELL-EAF complex (GO:0032783)|transcription elongation factor complex (GO:0008023)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			endometrium(1)|kidney(2)|large_intestine(1)|lung(4)|prostate(1)	9				GBM - Glioblastoma multiforme(114;0.0972)		GCGAGCGGGTTCTCAAGTTAGG	0.584																																					Esophageal Squamous(194;1942 2097 24663 29345 31866)												0																																										SO:0001589	frameshift_variant	55840			AF517829	CCDS3006.1	3q21.1	2007-08-01			ENSG00000145088	ENSG00000145088			23115	protein-coding gene	gene with protein product		607659				12446457, 12907652	Standard	NM_018456		Approved	BM040, TRAITS, U19	uc003een.3	Q96CJ1	OTTHUMG00000159424	ENST00000273668.2:c.48_49delTC	3.37:g.121554182_121554183delTC	ENSP00000273668:p.Leu17fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q9NZ82	Frame_Shift_Del	DEL	ENST00000273668.2	37	CCDS3006.1																																																																																				0.584	EAF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355247.1		NM_018456	
EAF2	55840	hgsc.bcm.edu	37	3	121554183	121554183	+	Silent	SNP	C	C	T			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr3:121554183C>T	ENST00000273668.2	+	1	122	c.51C>T	c.(49-51)ctC>ctT	p.L17L	IQCB1_ENST00000310864.6_5'Flank|IQCB1_ENST00000349820.6_5'Flank|EAF2_ENST00000465664.1_3'UTR|EAF2_ENST00000451944.2_Silent_p.L17L	NM_018456.4	NP_060926.2	Q96CJ1	EAF2_HUMAN	ELL associated factor 2	17	Necessary for interaction with ELL.				apoptotic process (GO:0006915)|negative regulation of cell growth (GO:0030308)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	ELL-EAF complex (GO:0032783)|transcription elongation factor complex (GO:0008023)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			endometrium(1)|kidney(2)|large_intestine(1)|lung(4)|prostate(1)	9				GBM - Glioblastoma multiforme(114;0.0972)		AGCGGGTTCTCAAGTTAGGGG	0.582																																					Esophageal Squamous(194;1942 2097 24663 29345 31866)												0													63.0	60.0	61.0					3																	121554183		2203	4300	6503	SO:0001819	synonymous_variant	55840			AF517829	CCDS3006.1	3q21.1	2007-08-01			ENSG00000145088	ENSG00000145088			23115	protein-coding gene	gene with protein product		607659				12446457, 12907652	Standard	NM_018456		Approved	BM040, TRAITS, U19	uc003een.3	Q96CJ1	OTTHUMG00000159424	ENST00000273668.2:c.51C>T	3.37:g.121554183C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q9NZ82	Silent	SNP	ENST00000273668.2	37	CCDS3006.1																																																																																				0.582	EAF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355247.1		NM_018456	
EGF	1950	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	110897230	110897230	+	Frame_Shift_Del	DEL	T	T	-			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr4:110897230delT	ENST00000265171.5	+	13	2337	c.1892delT	c.(1891-1893)cttfs	p.L631fs	EGF_ENST00000503392.1_Frame_Shift_Del_p.L631fs|EGF_ENST00000509793.1_Frame_Shift_Del_p.L589fs	NM_001178130.1|NM_001963.4	NP_001171601.1|NP_001954.2	P01133	EGF_HUMAN	epidermal growth factor	631					activation of MAPKK activity (GO:0000186)|activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|branching morphogenesis of an epithelial tube (GO:0048754)|DNA replication (GO:0006260)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERK1 and ERK2 cascade (GO:0070371)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|mammary gland alveolus development (GO:0060749)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of secretion (GO:0051048)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cerebellar granule cell precursor proliferation (GO:0021940)|positive regulation of DNA binding (GO:0043388)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of hyaluronan biosynthetic process (GO:1900127)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of calcium ion import (GO:0090279)|regulation of protein localization to cell surface (GO:2000008)|signal transduction (GO:0007165)|STAT protein import into nucleus (GO:0007262)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	calcium ion binding (GO:0005509)|epidermal growth factor receptor binding (GO:0005154)|growth factor activity (GO:0008083)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			breast(1)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Hepatocellular(203;0.0893)		OV - Ovarian serous cystadenocarcinoma(123;9.87e-06)	Sucralfate(DB00364)	CTCCAAGGCCTTGGCCGTCTG	0.428																																																	0													180.0	189.0	186.0					4																	110897230		2203	4300	6503	SO:0001589	frameshift_variant	1950			X04571	CCDS3689.1, CCDS54794.1, CCDS54795.1	4q25	2012-10-02	2010-05-11		ENSG00000138798	ENSG00000138798			3229	protein-coding gene	gene with protein product		131530	"""epidermal growth factor (beta-urogastrone)"""				Standard	NM_001963		Approved		uc003hzy.4	P01133	OTTHUMG00000132044	ENST00000265171.5:c.1892delT	4.37:g.110897230delT	ENSP00000265171:p.Leu631fs	Somatic		WXS	Illumina HiSeq	Phase_I	B4DRK7|E7EVD2|E9PBF0|Q52LZ6	Frame_Shift_Del	DEL	ENST00000265171.5	37	CCDS3689.1																																																																																				0.428	EGF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255065.1			
EIF4G3	8672	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	21186921	21186921	+	Missense_Mutation	SNP	T	T	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr1:21186921T>A	ENST00000264211.8	-	18	3227	c.3033A>T	c.(3031-3033)caA>caT	p.Q1011H	EIF4G3_ENST00000602326.1_Missense_Mutation_p.Q1017H|EIF4G3_ENST00000374937.3_Missense_Mutation_p.Q1017H|EIF4G3_ENST00000400422.1_Missense_Mutation_p.Q1011H|EIF4G3_ENST00000374935.3_Missense_Mutation_p.Q731H|EIF4G3_ENST00000536266.1_Missense_Mutation_p.Q615H|EIF4G3_ENST00000537738.1_Missense_Mutation_p.Q501H	NM_003760.4	NP_003751.2	O43432	IF4G3_HUMAN	eukaryotic translation initiation factor 4 gamma, 3	1011	eIF3/EIF4A-binding. {ECO:0000250}.				cytokine-mediated signaling pathway (GO:0019221)|positive regulation of meiosis I (GO:0060903)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of translation (GO:0045727)|regulation of translational initiation (GO:0006446)|spermatogenesis (GO:0007283)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)	p.Q1017H(1)|p.Q1011H(1)		endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(18)|lung(20)|ovary(1)|prostate(4)|skin(3)|stomach(1)|urinary_tract(3)	70		all_lung(284;2.61e-06)|Lung NSC(340;2.81e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00149)|Ovarian(437;0.00338)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|COAD - Colon adenocarcinoma(152;5.42e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000327)|GBM - Glioblastoma multiforme(114;0.000696)|Kidney(64;0.0018)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(64;0.0185)|READ - Rectum adenocarcinoma(331;0.124)|Lung(427;0.191)		GGACCTTCCTTTGCTCTTCTT	0.423																																																	2	Substitution - Missense(2)	kidney(2)											243.0	225.0	231.0					1																	21186921		2203	4300	6503	SO:0001583	missense	8672			AF012072	CCDS214.1, CCDS55580.1, CCDS59192.1, CCDS72723.1	1p36.12	2008-02-05			ENSG00000075151	ENSG00000075151			3298	protein-coding gene	gene with protein product		603929				9418880	Standard	NM_001198801		Approved	eIF4GII	uc001bef.3	O43432	OTTHUMG00000002624	ENST00000264211.8:c.3033A>T	1.37:g.21186921T>A	ENSP00000264211:p.Gln1011His	Somatic		WXS	Illumina HiSeq	Phase_I	B9EGQ7|Q15597|Q504Z1|Q5SWC3|Q8NEN1	Missense_Mutation	SNP	ENST00000264211.8	37	CCDS214.1	.	.	.	.	.	.	.	.	.	.	T	13.79	2.342977	0.41498	.	.	ENSG00000075151	ENST00000264211;ENST00000400415;ENST00000400422;ENST00000374935;ENST00000537738;ENST00000374937;ENST00000536266	T;T;T;T;T;T	0.08546	3.6;3.6;3.44;3.08;3.6;3.3	5.51	-1.38	0.09027	.	0.000000	0.85682	D	0.000000	T	0.11495	0.0280	N	0.16307	0.4	0.80722	D	1	D;B;B;D;D	0.76494	0.999;0.093;0.285;0.998;0.989	D;B;B;D;P	0.85130	0.997;0.042;0.091;0.993;0.897	T	0.01290	-1.1394	10	0.17832	T	0.49	-11.6486	13.3598	0.60648	0.0:0.6349:0.0:0.3651	.	1206;731;615;1017;1011	Q59GJ0;Q504Z1;F5H564;B9EGQ7;O43432	.;.;.;.;IF4G3_HUMAN	H	1011;1207;1011;731;501;1017;615	ENSP00000264211:Q1011H;ENSP00000383274:Q1011H;ENSP00000364071:Q731H;ENSP00000442010:Q501H;ENSP00000364073:Q1017H;ENSP00000444693:Q615H	ENSP00000264211:Q1011H	Q	-	3	2	EIF4G3	21059508	0.965000	0.33210	0.984000	0.44739	0.983000	0.72400	0.160000	0.16462	-0.507000	0.06549	0.528000	0.53228	CAA		0.423	EIF4G3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000007467.3		NM_003760	
EMILIN1	11117	broad.mit.edu;hgsc.bcm.edu	37	2	27305278	27305278	+	Missense_Mutation	SNP	C	C	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr2:27305278C>A	ENST00000380320.4	+	4	1338	c.839C>A	c.(838-840)gCc>gAc	p.A280D		NM_007046.3	NP_008977	Q9Y6C2	EMIL1_HUMAN	elastin microfibril interfacer 1	280					cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix constituent conferring elasticity (GO:0030023)	p.A280D(1)		breast(1)|central_nervous_system(1)|kidney(5)|large_intestine(1)|lung(14)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	26	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ccagccccagcctcagccccT	0.701																																																	1	Substitution - Missense(1)	kidney(1)											8.0	10.0	9.0					2																	27305278		2123	4182	6305	SO:0001583	missense	11117			AF088916	CCDS1733.1	2p23.3-p23.2	2008-02-05			ENSG00000138080	ENSG00000138080		"""EMI domain containing"""	19880	protein-coding gene	gene with protein product		130660					Standard	NM_007046		Approved	DKFZp586M121, gp115	uc002rii.4	Q9Y6C2	OTTHUMG00000097069	ENST00000380320.4:c.839C>A	2.37:g.27305278C>A	ENSP00000369677:p.Ala280Asp	Somatic		WXS	Illumina HiSeq	Phase_I	A5PL03|H0Y7A0|Q53SY9|Q96G58|Q96IH6|Q9UG76	Missense_Mutation	SNP	ENST00000380320.4	37	CCDS1733.1	.	.	.	.	.	.	.	.	.	.	C	0.614	-0.823980	0.02755	.	.	ENSG00000138080	ENST00000380320	T	0.17054	2.3	5.11	1.5	0.22942	.	0.955627	0.08687	N	0.908469	T	0.07683	0.0193	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.42783	-0.9431	10	0.10902	T	0.67	-0.1483	2.4349	0.04480	0.264:0.4752:0.1384:0.1223	.	280	Q9Y6C2	EMIL1_HUMAN	D	280	ENSP00000369677:A280D	ENSP00000369677:A280D	A	+	2	0	EMILIN1	27158782	0.024000	0.19004	0.165000	0.22776	0.008000	0.06430	0.653000	0.24902	0.417000	0.25871	0.462000	0.41574	GCC		0.701	EMILIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214185.1		NM_007046	
FAT3	120114	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	92534186	92534186	+	Silent	SNP	G	G	T			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr11:92534186G>T	ENST00000298047.6	+	9	8024	c.8007G>T	c.(8005-8007)ctG>ctT	p.L2669L	FAT3_ENST00000525166.1_Silent_p.L2519L|FAT3_ENST00000409404.2_Silent_p.L2669L			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	2669	Cadherin 24. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.L2669L(2)		NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				TTAACCAGCTGAAAAATACAG	0.478										TCGA Ovarian(4;0.039)																																							2	Substitution - coding silent(2)	kidney(2)											41.0	39.0	40.0					11																	92534186		1883	4114	5997	SO:0001819	synonymous_variant	120114			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.8007G>T	11.37:g.92534186G>T		Somatic		WXS	Illumina HiSeq	Phase_I	B5MDB0|Q96AU6	Silent	SNP	ENST00000298047.6	37																																																																																					0.478	FAT3-201	KNOWN	basic	protein_coding	protein_coding			NM_001008781	
FAT3	120114	broad.mit.edu	37	11	92616488	92616488	+	Missense_Mutation	SNP	T	T	C			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr11:92616488T>C	ENST00000298047.6	+	23	12883	c.12866T>C	c.(12865-12867)cTc>cCc	p.L4289P	FAT3_ENST00000525166.1_Missense_Mutation_p.L4139P|FAT3_ENST00000533797.1_Missense_Mutation_p.L624P|FAT3_ENST00000489716.1_3'UTR|FAT3_ENST00000409404.2_Missense_Mutation_p.L4289P			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	4289					homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.L4289P(2)|p.L864P(1)		NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				GCCCCCAACCTCCCCGCCGTG	0.652										TCGA Ovarian(4;0.039)																																							3	Substitution - Missense(3)	kidney(3)											23.0	29.0	27.0					11																	92616488		2069	4174	6243	SO:0001583	missense	120114			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.12866T>C	11.37:g.92616488T>C	ENSP00000298047:p.Leu4289Pro	Somatic		WXS	Illumina GAIIx	Phase_I	B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	37		.	.	.	.	.	.	.	.	.	.	T	14.29	2.491396	0.44249	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166;ENST00000533797	T;T;T;D	0.92446	-1.14;-1.25;-1.15;-3.04	5.64	4.52	0.55395	.	.	.	.	.	D	0.86973	0.6062	L	0.37466	1.105	0.80722	D	1	B;B	0.16166	0.015;0.016	B;B	0.18561	0.022;0.013	T	0.82810	-0.0273	9	0.34782	T	0.22	.	11.0241	0.47734	0.0:0.0725:0.0:0.9275	.	4289;4289	Q8TDW7-3;Q8TDW7	.;FAT3_HUMAN	P	4289;4289;4139;624	ENSP00000298047:L4289P;ENSP00000387040:L4289P;ENSP00000432586:L4139P;ENSP00000436399:L624P	ENSP00000298047:L4289P	L	+	2	0	FAT3	92256136	1.000000	0.71417	0.928000	0.36995	0.912000	0.54170	6.109000	0.71528	2.149000	0.67028	0.533000	0.62120	CTC		0.652	FAT3-201	KNOWN	basic	protein_coding	protein_coding			NM_001008781	
FOXB1	27023	broad.mit.edu;hgsc.bcm.edu	37	15	60297463	60297463	+	Missense_Mutation	SNP	A	A	T			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr15:60297463A>T	ENST00000396057.4	+	2	780	c.301A>T	c.(301-303)Agc>Tgc	p.S101C	FOXB1_ENST00000560857.1_Intron	NM_012182.2	NP_036314.2	Q99853	FOXB1_HUMAN	forkhead box B1	101					axon target recognition (GO:0007412)|cell migration in diencephalon (GO:0061381)|epithelial cell differentiation involved in mammary gland alveolus development (GO:0061030)|floor plate development (GO:0033504)|hypothalamus cell migration (GO:0021855)|inferior colliculus development (GO:0061379)|lactation (GO:0007595)|mammary gland lobule development (GO:0061377)|mammillary body development (GO:0021767)|mammillothalamic axonal tract development (GO:0061374)|midbrain development (GO:0030901)|negative regulation of neuron apoptotic process (GO:0043524)|somitogenesis (GO:0001756)|spinal cord development (GO:0021510)|telencephalon cell migration (GO:0022029)|thalamus development (GO:0021794)|transcription, DNA-templated (GO:0006351)|urogenital system development (GO:0001655)|visual learning (GO:0008542)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S101C(2)		central_nervous_system(1)|kidney(1)|lung(3)|ovary(1)	6						CGAGAACGGCAGCTTCCTGCG	0.667																																																	2	Substitution - Missense(2)	kidney(2)											32.0	35.0	34.0					15																	60297463		2203	4298	6501	SO:0001583	missense	27023			AF055080	CCDS32255.1	15q22.2	2014-09-09			ENSG00000171956	ENSG00000171956		"""Forkhead boxes"""	3799	protein-coding gene	gene with protein product							Standard	NM_012182		Approved	HFKH-5, FKH5	uc002agj.1	Q99853	OTTHUMG00000172011	ENST00000396057.4:c.301A>T	15.37:g.60297463A>T	ENSP00000379369:p.Ser101Cys	Somatic		WXS	Illumina HiSeq	Phase_I	O60652|O75917|Q14CL2	Missense_Mutation	SNP	ENST00000396057.4	37	CCDS32255.1	.	.	.	.	.	.	.	.	.	.	A	17.17	3.320796	0.60634	.	.	ENSG00000171956	ENST00000396057	D	0.95690	-3.78	3.72	3.72	0.42706	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (3);	0.000000	0.85682	U	0.000000	D	0.94964	0.8371	N	0.25380	0.74	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93882	0.7172	10	0.39692	T	0.17	.	11.3903	0.49811	1.0:0.0:0.0:0.0	.	101	Q99853	FOXB1_HUMAN	C	101	ENSP00000379369:S101C	ENSP00000379369:S101C	S	+	1	0	FOXB1	58084755	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.035000	0.70940	1.529000	0.49120	0.528000	0.53228	AGC		0.667	FOXB1-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416378.1			
FZD10	11211	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	130648663	130648663	+	Missense_Mutation	SNP	C	C	A	rs145130520		TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr12:130648663C>A	ENST00000229030.4	+	1	1660	c.1176C>A	c.(1174-1176)aaC>aaA	p.N392K	FZD10-AS1_ENST00000505807.2_RNA|FZD10_ENST00000539839.1_Missense_Mutation_p.R360S			Q9ULW2	FZD10_HUMAN	frizzled class receptor 10	392					brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cellular response to retinoic acid (GO:0071300)|gonad development (GO:0008406)|negative regulation of Rho GTPase activity (GO:0034259)|neuron differentiation (GO:0030182)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of actin cytoskeleton organization (GO:0032956)|vasculature development (GO:0001944)	cell projection (GO:0042995)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)	p.N392K(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(14)|pancreas(1)|prostate(3)|urinary_tract(1)	35	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.3e-06)|Epithelial(86;1.66e-05)|all cancers(50;5.18e-05)		TGGACGTCAACGCGCTCACCG	0.662																																																	1	Substitution - Missense(1)	kidney(1)											119.0	107.0	111.0					12																	130648663		2203	4300	6503	SO:0001583	missense	11211			AB027464	CCDS9267.1	12q24.33	2014-01-29	2014-01-29			ENSG00000111432		"""GPCR / Class F : Frizzled receptors"", ""CD molecules"""	4039	protein-coding gene	gene with protein product		606147	"""frizzled (Drosophila) homolog 10"", ""frizzled homolog 10 (Drosophila)"", ""frizzled 10, seven transmembrane spanning receptor"", ""frizzled family receptor 10"""			10448064	Standard	NM_007197		Approved	CD350	uc001uii.3	Q9ULW2		ENST00000229030.4:c.1176C>A	12.37:g.130648663C>A	ENSP00000229030:p.Asn392Lys	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000229030.4	37	CCDS9267.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.077|8.077	0.771518|0.771518	0.16051|0.16051	.|.	.|.	ENSG00000111432|ENSG00000111432	ENST00000229030|ENST00000539839	T|.	0.81330|.	-1.48|.	5.21|5.21	-0.892|-0.892	0.10570|0.10570	GPCR, family 2-like (1);|.	0.269386|.	0.33534|.	U|.	0.004805|.	T|T	0.34019|0.34019	0.0883|0.0883	N|N	0.17674|0.17674	0.51|0.51	0.32903|0.32903	D|D	0.513439|0.513439	B|.	0.10296|.	0.003|.	B|.	0.16289|.	0.015|.	T|T	0.48031|0.48031	-0.9070|-0.9070	10|6	0.46703|0.87932	T|D	0.11|0	.|.	6.7516|6.7516	0.23489|0.23489	0.0:0.4426:0.2172:0.3402|0.0:0.4426:0.2172:0.3402	.|.	392|.	Q9ULW2|.	FZD10_HUMAN|.	K|S	392|360	ENSP00000229030:N392K|.	ENSP00000229030:N392K|ENSP00000438460:R360S	N|R	+|+	3|1	2|0	FZD10|FZD10	129214616|129214616	0.045000|0.045000	0.20229|0.20229	0.024000|0.024000	0.17045|0.17045	0.982000|0.982000	0.71751|0.71751	-0.641000|-0.641000	0.05434|0.05434	-0.065000|-0.065000	0.13021|0.13021	0.561000|0.561000	0.74099|0.74099	AAC|CGC		0.662	FZD10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				
GLI2	2736	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	121748151	121748151	+	Missense_Mutation	SNP	C	C	G			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr2:121748151C>G	ENST00000452319.1	+	14	4721	c.4661C>G	c.(4660-4662)cCc>cGc	p.P1554R	GLI2_ENST00000314490.11_Intron|GLI2_ENST00000361492.4_Missense_Mutation_p.P1554R					GLI family zinc finger 2									p.P1554R(1)		NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|lung(24)|ovary(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(3;0.0496)	Prostate(154;0.0623)				TTGACCCTGCCCTCCATCCCC	0.617																																																	1	Substitution - Missense(1)	kidney(1)											102.0	116.0	111.0					2																	121748151		2203	4300	6503	SO:0001583	missense	2736				CCDS33283.1	2q14	2013-01-25	2009-03-05		ENSG00000074047	ENSG00000074047		"""Zinc fingers, C2H2-type"""	4318	protein-coding gene	gene with protein product	"""tax-responsive element-2 holding protein"", ""tax helper protein 1"", ""tax helper protein 2"""	165230	"""GLI-Kruppel family member GLI2"", ""glioma-associated oncogene family zinc finger 2"""			2850480, 9557682	Standard	NM_005270		Approved	THP2, HPE9, THP1	uc010flp.3	P10070	OTTHUMG00000153741	ENST00000452319.1:c.4661C>G	2.37:g.121748151C>G	ENSP00000390436:p.Pro1554Arg	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000452319.1	37	CCDS33283.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.185014	0.78677	.	.	ENSG00000074047	ENST00000452319;ENST00000361492	T;T	0.15834	2.39;2.39	4.98	4.98	0.66077	.	0.185612	0.47852	D	0.000202	T	0.45196	0.1330	M	0.79258	2.445	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.72075	0.916;0.976	T	0.47459	-0.9116	10	0.87932	D	0	.	18.4555	0.90718	0.0:1.0:0.0:0.0	.	1554;1209	P10070;P10070-2	GLI2_HUMAN;.	R	1554	ENSP00000390436:P1554R;ENSP00000354586:P1554R	ENSP00000354586:P1554R	P	+	2	0	GLI2	121464621	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	7.651000	0.83577	2.581000	0.87130	0.555000	0.69702	CCC		0.617	GLI2-009	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332293.3		NM_005270	
FZD5	7855	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	208632143	208632143	+	Missense_Mutation	SNP	C	C	G			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr2:208632143C>G	ENST00000295417.3	-	2	1874	c.1321G>C	c.(1321-1323)Gac>Cac	p.D441H		NM_003468.3	NP_003459.2	Q13467	FZD5_HUMAN	frizzled class receptor 5	441					angiogenesis (GO:0001525)|anterior/posterior axis specification, embryo (GO:0008595)|apoptotic process (GO:0006915)|apoptotic process involved in morphogenesis (GO:0060561)|axonogenesis (GO:0007409)|brain development (GO:0007420)|branching involved in labyrinthine layer morphogenesis (GO:0060670)|canonical Wnt signaling pathway (GO:0060070)|cell maturation (GO:0048469)|cellular response to molecule of bacterial origin (GO:0071219)|chorionic trophoblast cell differentiation (GO:0060718)|embryonic axis specification (GO:0000578)|embryonic camera-type eye development (GO:0031076)|gonad development (GO:0008406)|labyrinthine layer blood vessel development (GO:0060716)|negative regulation of cell proliferation (GO:0008285)|neuron differentiation (GO:0030182)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic camera-type eye development (GO:0031077)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of chorionic trophoblast cell proliferation (GO:1901382)|regulation of tight junction assembly (GO:2000810)|Spemann organizer formation (GO:0060061)|syncytiotrophoblast cell differentiation involved in labyrinthine layer development (GO:0060715)|T cell differentiation in thymus (GO:0033077)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)	cell projection (GO:0042995)|cell surface (GO:0009986)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|protein kinase binding (GO:0019901)|ubiquitin protein ligase binding (GO:0031625)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)	p.D441H(1)		NS(1)|kidney(1)|lung(1)|ovary(2)|prostate(1)|skin(1)	7				LUSC - Lung squamous cell carcinoma(261;0.0703)|Epithelial(149;0.13)|Lung(261;0.134)		TCCAGCTTGTCCGTCTTGGTG	0.622																																																	1	Substitution - Missense(1)	kidney(1)											56.0	52.0	54.0					2																	208632143		2200	4299	6499	SO:0001583	missense	7855			U43318	CCDS33366.1	2q33.3	2014-01-29	2014-01-29		ENSG00000163251	ENSG00000163251		"""GPCR / Class F : Frizzled receptors"""	4043	protein-coding gene	gene with protein product		601723	"""frizzled (Drosophila) homolog 5"", ""chromosome 2 open reading frame 31"", ""frizzled homolog 5 (Drosophila)"", ""frizzled 5, seven transmembrane spanning receptor"", ""frizzled family receptor 5"""	C2orf31		8626800, 11408929	Standard	NM_003468		Approved	HFZ5, DKFZP434E2135	uc002vcj.3	Q13467	OTTHUMG00000154790	ENST00000295417.3:c.1321G>C	2.37:g.208632143C>G	ENSP00000354607:p.Asp441His	Somatic		WXS	Illumina HiSeq	Phase_I	A8K2X1|B2RCZ1|Q53R22	Missense_Mutation	SNP	ENST00000295417.3	37	CCDS33366.1	.	.	.	.	.	.	.	.	.	.	C	16.48	3.136376	0.56936	.	.	ENSG00000163251	ENST00000295417	D	0.83163	-1.69	5.3	5.3	0.74995	GPCR, family 2-like (1);	0.000000	0.85682	D	0.000000	D	0.84129	0.5404	L	0.60904	1.88	0.80722	D	1	B	0.24675	0.109	B	0.34418	0.182	T	0.82208	-0.0571	10	0.59425	D	0.04	.	18.9536	0.92649	0.0:1.0:0.0:0.0	.	441	Q13467	FZD5_HUMAN	H	441	ENSP00000354607:D441H	ENSP00000354607:D441H	D	-	1	0	FZD5	208340388	0.999000	0.42202	0.999000	0.59377	0.984000	0.73092	4.082000	0.57635	2.468000	0.83385	0.561000	0.74099	GAC		0.622	FZD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337060.1		NM_003468	
GNA13	10672	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	63049764	63049764	+	Missense_Mutation	SNP	C	C	G			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr17:63049764C>G	ENST00000439174.2	-	2	611	c.366G>C	c.(364-366)atG>atC	p.M122I	GNA13_ENST00000541118.1_Missense_Mutation_p.M27I|RP11-583F2.5_ENST00000581796.1_RNA	NM_006572.4	NP_006563.2	Q14344	GNA13_HUMAN	guanine nucleotide binding protein (G protein), alpha 13	122					activation of phospholipase D activity (GO:0031584)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cellular component movement (GO:0006928)|in utero embryonic development (GO:0001701)|patterning of blood vessels (GO:0001569)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of cell migration (GO:0030334)|regulation of cell shape (GO:0008360)|Rho protein signal transduction (GO:0007266)|signal transduction (GO:0007165)	brush border membrane (GO:0031526)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|heterotrimeric G-protein complex (GO:0005834)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	D5 dopamine receptor binding (GO:0031752)|G-protein beta/gamma-subunit complex binding (GO:0031683)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)|type 1 angiotensin receptor binding (GO:0031702)	p.M122I(1)		breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(14)|kidney(2)|large_intestine(4)|lung(6)|urinary_tract(1)	34						CAAACGACATCATCTTATCTC	0.453																																																	1	Substitution - Missense(1)	kidney(1)											150.0	146.0	147.0					17																	63049764		2203	4300	6503	SO:0001583	missense	10672			L22075	CCDS11661.1, CCDS62302.1	17q24.1	2014-09-04			ENSG00000120063	ENSG00000120063			4381	protein-coding gene	gene with protein product		604406				7791744	Standard	NM_006572		Approved	G13, MGC46138	uc002jfc.3	Q14344	OTTHUMG00000179316	ENST00000439174.2:c.366G>C	17.37:g.63049764C>G	ENSP00000400717:p.Met122Ile	Somatic		WXS	Illumina HiSeq	Phase_I	B2R977|B7Z7R0|F5H1G8|Q8TD70	Missense_Mutation	SNP	ENST00000439174.2	37	CCDS11661.1	.	.	.	.	.	.	.	.	.	.	C	9.886	1.202890	0.22121	.	.	ENSG00000120063	ENST00000439174;ENST00000541118;ENST00000239138	D;D	0.86627	-2.15;-2.15	5.42	4.39	0.52855	G protein alpha subunit, helical insertion (2);	0.130936	0.64402	D	0.000001	T	0.71005	0.3289	N	0.02865	-0.47	0.45979	D	0.998791	B	0.10296	0.003	B	0.11329	0.006	T	0.66428	-0.5926	10	0.18710	T	0.47	.	14.9624	0.71166	0.1432:0.8568:0.0:0.0	.	122	Q14344	GNA13_HUMAN	I	122;27;97	ENSP00000400717:M122I;ENSP00000439647:M27I	ENSP00000239138:M97I	M	-	3	0	GNA13	60480226	1.000000	0.71417	1.000000	0.80357	0.716000	0.41182	5.687000	0.68219	2.542000	0.85734	0.655000	0.94253	ATG		0.453	GNA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445720.1		NM_006572	
GNPTAB	79158	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	102179968	102179968	+	Silent	SNP	T	T	C			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr12:102179968T>C	ENST00000299314.7	-	5	655	c.393A>G	c.(391-393)acA>acG	p.T131T	GNPTAB_ENST00000549940.1_Silent_p.T131T	NM_024312.4	NP_077288.2	Q3T906	GNPTA_HUMAN	N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits	131					carbohydrate phosphorylation (GO:0046835)|cell differentiation (GO:0030154)|lysosome organization (GO:0007040)|protein secretion (GO:0009306)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|UDP-N-acetylglucosamine-lysosomal-enzyme N-acetylglucosaminephosphotransferase activity (GO:0003976)	p.T131T(1)		NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(8)|lung(8)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	37						TAATGCAGTGTGTTAGCAAAC	0.433																																																	1	Substitution - coding silent(1)	kidney(1)											90.0	86.0	87.0					12																	102179968		2203	4300	6503	SO:0001819	synonymous_variant	79158			AY687932	CCDS9088.1	12q23.3	2013-01-10				ENSG00000111670		"""EF-hand domain containing"""	29670	protein-coding gene	gene with protein product		607840		GNPTA		10574462, 16116615	Standard	NM_024312		Approved	KIAA1208, MGC4170	uc001tit.3	Q3T906	OTTHUMG00000170444	ENST00000299314.7:c.393A>G	12.37:g.102179968T>C		Somatic		WXS	Illumina HiSeq	Phase_I	A2RRQ9|Q3ZQK2|Q6IPW5|Q86TQ2|Q96N13|Q9ULL2	Silent	SNP	ENST00000299314.7	37	CCDS9088.1																																																																																				0.433	GNPTAB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409182.1			
GPC5	2262	broad.mit.edu	37	13	92051340	92051340	+	Missense_Mutation	SNP	C	C	T	rs183780526	byFrequency	TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr13:92051340C>T	ENST00000377067.3	+	1	412	c.40C>T	c.(40-42)Ctc>Ttc	p.L14F		NM_004466.4	NP_004457.1	P78333	GPC5_HUMAN	glypican 5	14					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)		p.L14F(1)		NS(1)|breast(4)|endometrium(6)|kidney(4)|large_intestine(7)|lung(34)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)				TCGCTGCCTCCTCCTTCTGGC	0.682													C|||	2	0.000399361	0.0	0.0	5008	,	,		13027	0.002		0.0	False		,,,				2504	0.0																1	Substitution - Missense(1)	kidney(1)											29.0	27.0	28.0					13																	92051340		2194	4290	6484	SO:0001583	missense	2262			AF001462	CCDS9468.1	13q32	2011-08-01			ENSG00000179399	ENSG00000179399		"""Proteoglycans / Cell Surface : Glypicans"""	4453	protein-coding gene	gene with protein product	"""glypican proteoglycan 5"""	602446				9070915, 20304703, 19556317, 15057823	Standard	NM_004466		Approved		uc010tif.2	P78333	OTTHUMG00000017200	ENST00000377067.3:c.40C>T	13.37:g.92051340C>T	ENSP00000366267:p.Leu14Phe	Somatic		WXS	Illumina GAIIx	Phase_I	B2R726|O60436|Q9BX27	Missense_Mutation	SNP	ENST00000377067.3	37	CCDS9468.1	2	9.157509157509158E-4	0	0.0	0	0.0	2	0.0034965034965034965	0	0.0	C	11.58	1.681410	0.29872	.	.	ENSG00000179399	ENST00000377067	T	0.54279	0.58	4.0	4.0	0.46444	.	0.543822	0.16607	N	0.207093	T	0.51193	0.1660	M	0.61703	1.905	0.28424	N	0.917601	B	0.17465	0.022	B	0.22386	0.039	T	0.53732	-0.8397	10	0.66056	D	0.02	.	12.3126	0.54938	0.0:1.0:0.0:0.0	.	14	P78333	GPC5_HUMAN	F	14	ENSP00000366267:L14F	ENSP00000366267:L14F	L	+	1	0	GPC5	90849341	0.980000	0.34600	0.934000	0.37439	0.328000	0.28507	0.878000	0.28126	2.143000	0.66587	0.471000	0.43371	CTC		0.682	GPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045454.1		NM_004466	
HIC1	3090	broad.mit.edu;ucsc.edu	37	17	1961130	1961130	+	Frame_Shift_Del	DEL	G	G	-			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr17:1961130delG	ENST00000322941.3	+	2	1203	c.1203delG	c.(1201-1203)gagfs	p.E402fs	HIC1_ENST00000399849.3_Frame_Shift_Del_p.E383fs|SMG6_ENST00000573166.1_5'Flank	NM_001098202.1	NP_001091672.1	Q14526	HIC1_HUMAN	hypermethylated in cancer 1	402					intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(1)|lung(1)|prostate(1)	3				READ - Rectum adenocarcinoma(1115;0.236)		GCAGCAGCGAGGAGACCGGTA	0.761																																																	0													7.0	11.0	9.0					17																	1961130		2080	4197	6277	SO:0001589	frameshift_variant	3090				CCDS42229.1, CCDS42230.1	17p13.3	2013-01-09				ENSG00000177374		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	4909	protein-coding gene	gene with protein product		603825					Standard	NM_006497		Approved	ZBTB29, ZNF901	uc010cjy.3	Q14526		ENST00000322941.3:c.1203delG	17.37:g.1961130delG	ENSP00000314080:p.Glu402fs	Somatic		WXS	Illumina GAIIx	Phase_I	D3DTI4	Frame_Shift_Del	DEL	ENST00000322941.3	37	CCDS42229.1																																																																																				0.761	HIC1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438878.1		NM_006497	
HR	55806	broad.mit.edu;hgsc.bcm.edu	37	8	21986313	21986313	+	Missense_Mutation	SNP	G	G	T			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr8:21986313G>T	ENST00000381418.4	-	2	1851	c.371C>A	c.(370-372)cCt>cAt	p.P124H	HR_ENST00000312841.8_Missense_Mutation_p.P124H|HR_ENST00000518377.1_5'Flank	NM_005144.4	NP_005135.2	O43593	HAIR_HUMAN	hair growth associated	124					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nuclear body (GO:0016604)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.P124H(1)		central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	27		Breast(100;0.000162)|Acute lymphoblastic leukemia(644;0.0775)|Prostate(55;0.116)		KIRC - Kidney renal clear cell carcinoma(542;1.19e-05)|BRCA - Breast invasive adenocarcinoma(99;3.56e-05)|Colorectal(74;0.00191)|COAD - Colon adenocarcinoma(73;0.0615)|READ - Rectum adenocarcinoma(644;0.1)		ACTATGCTCAGGCATCAGGGG	0.637																																																	1	Substitution - Missense(1)	kidney(1)											34.0	31.0	32.0					8																	21986313		2202	4299	6501	SO:0001583	missense	55806			AF039196	CCDS6022.1, CCDS6023.1	8p12	2012-12-07	2012-12-07		ENSG00000168453	ENSG00000168453			5172	protein-coding gene	gene with protein product		602302	"""hairless (mouse) homolog"", ""hairless homolog (mouse)"""	ALUNC		10051399, 9463324	Standard	NM_018411		Approved	AU	uc003xas.3	O43593	OTTHUMG00000097089	ENST00000381418.4:c.371C>A	8.37:g.21986313G>T	ENSP00000370826:p.Pro124His	Somatic		WXS	Illumina HiSeq	Phase_I	Q6GS30|Q96H33|Q9NPE1	Missense_Mutation	SNP	ENST00000381418.4	37	CCDS6022.1	.	.	.	.	.	.	.	.	.	.	G	18.26	3.585458	0.66105	.	.	ENSG00000168453	ENST00000381418;ENST00000312841	T;T	0.77877	-1.11;-1.13	4.82	3.94	0.45596	.	0.000000	0.43747	D	0.000522	T	0.80088	0.4559	L	0.34521	1.04	0.32431	N	0.548049	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.998	T	0.82491	-0.0431	10	0.87932	D	0	-10.9725	8.7874	0.34830	0.1014:0.0:0.8986:0.0	.	124;124;124	A6NCE3;O43593-2;O43593	.;.;HAIR_HUMAN	H	124	ENSP00000370826:P124H;ENSP00000326765:P124H	ENSP00000326765:P124H	P	-	2	0	HR	22042258	1.000000	0.71417	1.000000	0.80357	0.830000	0.47004	5.122000	0.64697	1.252000	0.44001	0.561000	0.74099	CCT		0.637	HR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214213.1			
HVCN1	84329	hgsc.bcm.edu;ucsc.edu	37	12	111089051	111089052	+	Frame_Shift_Ins	INS	-	-	T			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr12:111089051_111089052insT	ENST00000356742.5	-	5	1366_1367	c.613_614insA	c.(613-615)cggfs	p.R205fs	HVCN1_ENST00000439744.2_Frame_Shift_Ins_p.R185fs|HVCN1_ENST00000548312.1_Frame_Shift_Ins_p.R205fs|HVCN1_ENST00000242607.8_Frame_Shift_Ins_p.R205fs			Q96D96	HVCN1_HUMAN	hydrogen voltage-gated channel 1	205					cellular response to pH (GO:0071467)|cellular response to zinc ion (GO:0071294)|multicellular organism reproduction (GO:0032504)|proton transport (GO:0015992)|response to pH (GO:0009268)|response to zinc ion (GO:0010043)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	voltage-gated cation channel activity (GO:0022843)|voltage-gated proton channel activity (GO:0030171)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(6)|prostate(1)|skin(1)	19						CCGCCACAGCCGGAGCAGAATC	0.604																																																	0																																										SO:0001589	frameshift_variant	84329			BC007277	CCDS31900.1, CCDS58278.1	12q24.11	2011-12-09	2006-03-24	2006-03-24	ENSG00000122986	ENSG00000122986		"""Voltage-gated ion channels / Hydrogen voltage-gated channel"""	28240	protein-coding gene	gene with protein product	"""voltage sensor domain-only protein"""	611227				20961760, 16556803, 18356202, 22020278	Standard	NM_032369		Approved	MGC15619, Hv1, VSOP	uc001trs.2	Q96D96		ENST00000356742.5:c.613_614insA	12.37:g.111089051_111089052insT	ENSP00000349181:p.Arg205fs	Somatic		WXS	Illumina HiSeq	Phase_I	A8MQ37|B4DEB3|F8WCH5|Q6UW11|Q96IS5	Frame_Shift_Ins	INS	ENST00000356742.5	37	CCDS31900.1																																																																																				0.604	HVCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404653.1		NM_032369	
HVCN1	84329	hgsc.bcm.edu	37	12	111089052	111089052	+	Silent	SNP	G	G	T			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr12:111089052G>T	ENST00000356742.5	-	5	1366	c.613C>A	c.(613-615)Cgg>Agg	p.R205R	HVCN1_ENST00000439744.2_Silent_p.R185R|HVCN1_ENST00000548312.1_Silent_p.R205R|HVCN1_ENST00000242607.8_Silent_p.R205R			Q96D96	HVCN1_HUMAN	hydrogen voltage-gated channel 1	205					cellular response to pH (GO:0071467)|cellular response to zinc ion (GO:0071294)|multicellular organism reproduction (GO:0032504)|proton transport (GO:0015992)|response to pH (GO:0009268)|response to zinc ion (GO:0010043)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	voltage-gated cation channel activity (GO:0022843)|voltage-gated proton channel activity (GO:0030171)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(6)|prostate(1)|skin(1)	19						CGCCACAGCCGGAGCAGAATC	0.602																																																	0													73.0	62.0	65.0					12																	111089052		2203	4300	6503	SO:0001819	synonymous_variant	84329			BC007277	CCDS31900.1, CCDS58278.1	12q24.11	2011-12-09	2006-03-24	2006-03-24	ENSG00000122986	ENSG00000122986		"""Voltage-gated ion channels / Hydrogen voltage-gated channel"""	28240	protein-coding gene	gene with protein product	"""voltage sensor domain-only protein"""	611227				20961760, 16556803, 18356202, 22020278	Standard	NM_032369		Approved	MGC15619, Hv1, VSOP	uc001trs.2	Q96D96		ENST00000356742.5:c.613C>A	12.37:g.111089052G>T		Somatic		WXS	Illumina HiSeq	Phase_I	A8MQ37|B4DEB3|F8WCH5|Q6UW11|Q96IS5	Silent	SNP	ENST00000356742.5	37	CCDS31900.1																																																																																				0.602	HVCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404653.1		NM_032369	
IL2RA	3559	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	6067797	6067797	+	Splice_Site	SNP	C	C	G			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr10:6067797C>G	ENST00000379959.3	-	2	429	c.256G>C	c.(256-258)Gcc>Ccc	p.A86P	IL2RA_ENST00000379954.1_Splice_Site_p.A86P|IL2RA_ENST00000256876.6_Splice_Site_p.A86P|RP11-536K7.5_ENST00000440436.1_RNA	NM_000417.2	NP_000408.1	P01589	IL2RA_HUMAN	interleukin 2 receptor, alpha	86					activation-induced cell death of T cells (GO:0006924)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-2-mediated signaling pathway (GO:0038110)|negative regulation of defense response to virus (GO:0050687)|negative regulation of immune response (GO:0050777)|negative regulation of inflammatory response (GO:0050728)|negative regulation of T cell proliferation (GO:0042130)|Notch signaling pathway (GO:0007219)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of T cell differentiation (GO:0045582)|regulation of T cell homeostatic proliferation (GO:0046013)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|interleukin-2 receptor activity (GO:0004911)	p.A86P(1)		endometrium(1)|kidney(3)|large_intestine(3)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	17					Aldesleukin(DB00041)|Basiliximab(DB00074)|Daclizumab(DB00111)|Denileukin diftitox(DB00004)	GGACACTTACCAGAGCTTGTG	0.478																																																	1	Substitution - Missense(1)	kidney(1)											103.0	98.0	100.0					10																	6067797		2203	4300	6503	SO:0001630	splice_region_variant	3559			X01057	CCDS7076.1	10p15-p14	2014-09-17			ENSG00000134460	ENSG00000134460		"""Interleukins and interleukin receptors"", ""CD molecules"""	6008	protein-coding gene	gene with protein product		147730	"""insulin-dependent diabetes mellitus 10"""	IL2R, IDDM10		3925551, 17676041	Standard	NM_000417		Approved	CD25	uc001iiz.2	P01589	OTTHUMG00000017616	ENST00000379959.3:c.256+1G>C	10.37:g.6067797C>G		Somatic		WXS	Illumina HiSeq	Phase_I	Q5W007	Missense_Mutation	SNP	ENST00000379959.3	37	CCDS7076.1	.	.	.	.	.	.	.	.	.	.	C	10.12	1.263632	0.23136	.	.	ENSG00000134460	ENST00000379959;ENST00000397240;ENST00000379954;ENST00000256876	T;T;T	0.50277	1.44;0.75;1.44	4.61	-1.18	0.09617	.	1.196580	0.06023	N	0.651590	T	0.18841	0.0452	N	0.01874	-0.695	0.09310	N	0.999992	P;P;P	0.47841	0.896;0.901;0.877	B;B;B	0.39299	0.145;0.277;0.296	T	0.09185	-1.0686	9	.	.	.	-16.6536	6.6798	0.23113	0.3492:0.4959:0.0:0.1549	.	86;72;86	Q5W005;E9PF94;P01589	.;.;IL2RA_HUMAN	P	86;72;86;86	ENSP00000369293:A86P;ENSP00000369287:A86P;ENSP00000256876:A86P	.	A	-	1	0	IL2RA	6107803	0.099000	0.21834	0.182000	0.23118	0.006000	0.05464	0.138000	0.16016	0.023000	0.15187	-1.378000	0.01179	GCC		0.478	IL2RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046627.1		NM_000417	Missense_Mutation
IPO9	55705	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	201843415	201843415	+	Silent	SNP	G	G	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr1:201843415G>A	ENST00000361565.4	+	21	2817	c.2748G>A	c.(2746-2748)aaG>aaA	p.K916K		NM_018085.4	NP_060555.2	Q96P70	IPO9_HUMAN	importin 9	916				K -> R (in Ref. 4; BAC11173). {ECO:0000305}.	protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	histone binding (GO:0042393)|protein transporter activity (GO:0008565)	p.K916K(1)		cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	38						TGCTGGTCAAGATCCTAAAGC	0.522																																																	1	Substitution - coding silent(1)	kidney(1)											139.0	132.0	134.0					1																	201843415		2203	4300	6503	SO:0001819	synonymous_variant	55705			AF410465	CCDS1415.1	1q31.3	2008-02-05			ENSG00000198700	ENSG00000198700		"""Importins"""	19425	protein-coding gene	gene with protein product						11823430, 10574461	Standard	NM_018085		Approved	Imp9, FLJ10402	uc001gwz.3	Q96P70	OTTHUMG00000035805	ENST00000361565.4:c.2748G>A	1.37:g.201843415G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B1ASV5|Q8N1Y1|Q8N3I2|Q8NCG9|Q96SU6|Q9NW01|Q9P0A8|Q9ULM8	Silent	SNP	ENST00000361565.4	37	CCDS1415.1																																																																																				0.522	IPO9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087088.1		NM_018085	
IQSEC3	440073	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	280284	280284	+	Missense_Mutation	SNP	G	G	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr12:280284G>A	ENST00000538872.1	+	13	3189	c.3071G>A	c.(3070-3072)aGg>aAg	p.R1024K	IQSEC3_ENST00000537151.1_3'UTR|IQSEC3_ENST00000382841.2_Missense_Mutation_p.R721K|IQSEC3_ENST00000326261.4_Missense_Mutation_p.R1024K|RP11-598F7.6_ENST00000537295.1_lincRNA			Q9UPP2	IQEC3_HUMAN	IQ motif and Sec7 domain 3	1024					actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|inhibitory synapse (GO:0060077)|postsynaptic membrane (GO:0045211)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)	p.R721K(1)|p.R1024K(1)		central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(18)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	all_cancers(10;0.016)|all_lung(10;0.0222)|all_epithelial(11;0.0262)|Lung NSC(10;0.031)		OV - Ovarian serous cystadenocarcinoma(31;0.00456)	LUAD - Lung adenocarcinoma(1;0.172)|Lung(1;0.179)		AAAGCCAAAAGGGAAGCCGCG	0.617																																																	2	Substitution - Missense(2)	kidney(2)											94.0	98.0	96.0					12																	280284		2203	4300	6503	SO:0001583	missense	440073			AB029033	CCDS31725.1, CCDS53728.1	12p13.33	2014-03-18			ENSG00000120645	ENSG00000120645			29193	protein-coding gene	gene with protein product		612118				10470851	Standard	NM_001170738		Approved	KIAA1110, MGC30156	uc001qhw.2	Q9UPP2	OTTHUMG00000167975	ENST00000538872.1:c.3071G>A	12.37:g.280284G>A	ENSP00000437554:p.Arg1024Lys	Somatic		WXS	Illumina HiSeq	Phase_I	A6NIF2|A6NKV9|Q8TB43	Missense_Mutation	SNP	ENST00000538872.1	37	CCDS53728.1	.	.	.	.	.	.	.	.	.	.	G	10.77	1.443470	0.25987	.	.	ENSG00000120645	ENST00000538872;ENST00000326261;ENST00000382841	T;T;T	0.08896	5.85;5.85;3.04	4.05	4.05	0.47172	.	1.346210	0.04310	N	0.348766	T	0.03915	0.0110	N	0.04043	-0.29	0.31540	N	0.660079	B;B	0.13594	0.008;0.0	B;B	0.06405	0.002;0.002	T	0.35968	-0.9767	10	0.06365	T	0.9	.	5.76	0.18195	0.1803:0.0:0.8197:0.0	.	1024;721	Q9UPP2;Q9UPP2-2	IQEC3_HUMAN;.	K	1024;1024;721	ENSP00000437554:R1024K;ENSP00000315662:R1024K;ENSP00000372292:R721K	ENSP00000315662:R1024K	R	+	2	0	IQSEC3	150545	1.000000	0.71417	0.849000	0.33467	0.446000	0.32137	3.044000	0.49830	2.084000	0.62774	0.561000	0.74099	AGG		0.617	IQSEC3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397382.3		XM_495902	
CTIF	9811	broad.mit.edu	37	18	46284644	46284644	+	Silent	SNP	A	A	C			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr18:46284644A>C	ENST00000256413.3	+	8	1234	c.939A>C	c.(937-939)ccA>ccC	p.P313P	CTIF_ENST00000382998.4_Silent_p.P313P	NM_014772.2	NP_055587.1	O43310	CTIF_HUMAN	CBP80/20-dependent translation initiation factor	313					nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of translational initiation (GO:0006446)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)	p.P313P(1)|p.P265P(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(14)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	31						GGCTGCCCCCACAGCAGTCAG	0.632																																																	2	Substitution - coding silent(2)	kidney(2)											49.0	61.0	57.0					18																	46284644		2203	4300	6503	SO:0001819	synonymous_variant	0			AB007887	CCDS11935.1, CCDS45864.1	18q21.1	2011-01-20	2011-01-20	2011-01-20	ENSG00000134030	ENSG00000134030			23925	protein-coding gene	gene with protein product		613178	"""KIAA0427"""	KIAA0427		9455477, 19648179	Standard	NM_014772		Approved		uc002ldd.3	O43310	OTTHUMG00000132656	ENST00000256413.3:c.939A>C	18.37:g.46284644A>C		Somatic		WXS	Illumina GAIIx	Phase_I	B3KTR8|Q8IVD5	Silent	SNP	ENST00000256413.3	37	CCDS11935.1																																																																																				0.632	CTIF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255907.1		NM_014772	
CEMIP	57214	broad.mit.edu	37	15	81166242	81166242	+	Missense_Mutation	SNP	G	G	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr15:81166242G>A	ENST00000394685.3	+	3	441	c.22G>A	c.(22-24)Gac>Aac	p.D8N	KIAA1199_ENST00000220244.3_Missense_Mutation_p.D8N|KIAA1199_ENST00000356249.5_Missense_Mutation_p.D8N			Q8WUJ3	CEMIP_HUMAN		8					hyaluronan catabolic process (GO:0030214)|positive regulation of cell migration (GO:0030335)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein kinase C activity (GO:1900020)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|sensory perception of sound (GO:0007605)	clathrin-coated vesicle membrane (GO:0030665)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	clathrin heavy chain binding (GO:0032050)|ER retention sequence binding (GO:0046923)|hyaluronic acid binding (GO:0005540)|hyalurononglucosaminidase activity (GO:0004415)	p.D8N(1)		breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(14)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	49						TGGGAGGCAGGACTTCCTCTT	0.577																																																	1	Substitution - Missense(1)	kidney(1)											70.0	54.0	60.0					15																	81166242		2202	4298	6500	SO:0001583	missense	57214																														ENST00000394685.3:c.22G>A	15.37:g.81166242G>A	ENSP00000378177:p.Asp8Asn	Somatic		WXS	Illumina GAIIx	Phase_I	Q6L9J5|Q9H1K5|Q9NPN9|Q9ULM1	Missense_Mutation	SNP	ENST00000394685.3	37	CCDS10315.1	.	.	.	.	.	.	.	.	.	.	G	1.188	-0.636233	0.03557	.	.	ENSG00000103888	ENST00000220244;ENST00000394685;ENST00000356249;ENST00000394683	T;T;T	0.65549	-0.16;-0.16;-0.16	4.92	-2.97	0.05530	.	6.948940	0.00166	N	0.000000	T	0.43853	0.1266	L	0.27053	0.805	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.13602	-1.0503	10	0.12766	T	0.61	-8.0685	5.165	0.15081	0.3585:0.2796:0.3619:0.0	.	8	Q8WUJ3	K1199_HUMAN	N	8	ENSP00000220244:D8N;ENSP00000378177:D8N;ENSP00000348583:D8N	ENSP00000220244:D8N	D	+	1	0	KIAA1199	78953297	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-1.356000	0.02609	-0.329000	0.08527	-0.165000	0.13383	GAC		0.577	KIAA1199-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000291389.1			
KIAA1462	57608	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	30315665	30315665	+	Missense_Mutation	SNP	G	G	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr10:30315665G>A	ENST00000375377.1	-	3	3513	c.3412C>T	c.(3412-3414)Ccc>Tcc	p.P1138S		NM_020848.2	NP_065899.1	Q9P266	JCAD_HUMAN	KIAA1462	1138					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)		p.P1138S(1)		breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|lung(23)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	75						GACACCCTGGGGACATCTGCC	0.627																																																	1	Substitution - Missense(1)	kidney(1)											57.0	59.0	59.0					10																	30315665		1966	4157	6123	SO:0001583	missense	57608			AB040895	CCDS41500.1	10p12.1	2013-04-23			ENSG00000165757	ENSG00000165757			29283	protein-coding gene	gene with protein product	"""junctional protein associated with coronary artery disease"""	614398				10819331, 21884682	Standard	NM_020848		Approved	JCAD	uc001iux.3	Q9P266	OTTHUMG00000017885	ENST00000375377.1:c.3412C>T	10.37:g.30315665G>A	ENSP00000364526:p.Pro1138Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q5HYA7|Q5T992|Q86WZ9|Q9BYJ2	Missense_Mutation	SNP	ENST00000375377.1	37	CCDS41500.1	.	.	.	.	.	.	.	.	.	.	G	11.41	1.629416	0.28978	.	.	ENSG00000165757	ENST00000375377	T	0.11930	2.73	4.91	0.496	0.16896	.	0.667481	0.14343	N	0.325592	T	0.06600	0.0169	L	0.28740	0.885	0.09310	N	1	B	0.33318	0.408	B	0.27170	0.077	T	0.30297	-0.9983	10	0.25751	T	0.34	-9.6449	1.5764	0.02625	0.1696:0.1178:0.3005:0.4121	.	1138	Q9P266	K1462_HUMAN	S	1138	ENSP00000364526:P1138S	ENSP00000364526:P1138S	P	-	1	0	KIAA1462	30355671	0.000000	0.05858	0.004000	0.12327	0.054000	0.15201	-0.520000	0.06252	0.191000	0.20236	0.462000	0.41574	CCC		0.627	KIAA1462-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047409.1		NM_020848	
KIAA2022	340533	broad.mit.edu;hgsc.bcm.edu	37	X	73962314	73962314	+	Missense_Mutation	SNP	T	T	C			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chrX:73962314T>C	ENST00000055682.6	-	3	2689	c.2078A>G	c.(2077-2079)gAc>gGc	p.D693G		NM_001008537.2	NP_001008537.1	Q5QGS0	K2022_HUMAN	KIAA2022	693					base-excision repair, gap-filling (GO:0006287)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|nervous system development (GO:0007399)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)	delta DNA polymerase complex (GO:0043625)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|DNA-directed DNA polymerase activity (GO:0003887)	p.D693G(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(23)|liver(1)|lung(41)|ovary(7)|pancreas(2)|prostate(4)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	109						GCCTGTGATGTCATTTAAATG	0.438																																																	1	Substitution - Missense(1)	kidney(1)											85.0	73.0	77.0					X																	73962314		2203	4300	6503	SO:0001583	missense	340533				CCDS35337.1	Xq13.3	2014-02-19			ENSG00000050030	ENSG00000050030			29433	protein-coding gene	gene with protein product	"""XLMR-related protein, neurite extension"""	300524				15466006, 23615299	Standard	NM_001008537		Approved	XPN, MRX98	uc004eby.3	Q5QGS0	OTTHUMG00000021860	ENST00000055682.6:c.2078A>G	X.37:g.73962314T>C	ENSP00000055682:p.Asp693Gly	Somatic		WXS	Illumina HiSeq	Phase_I	A7YY87|Q5JUX9|Q8IVE9	Missense_Mutation	SNP	ENST00000055682.6	37	CCDS35337.1	.	.	.	.	.	.	.	.	.	.	T	1.206	-0.631076	0.03584	.	.	ENSG00000050030	ENST00000373468;ENST00000055682	T;T	0.34072	1.38;1.38	5.52	1.93	0.25924	.	0.833235	0.10591	N	0.656767	T	0.16642	0.0400	N	0.12182	0.205	0.27545	N	0.950678	B	0.06786	0.001	B	0.08055	0.003	T	0.32640	-0.9899	10	0.13470	T	0.59	-0.9801	3.9298	0.09279	0.1481:0.2439:0.0:0.6081	.	693	Q5QGS0	K2022_HUMAN	G	693	ENSP00000362567:D693G;ENSP00000055682:D693G	ENSP00000055682:D693G	D	-	2	0	KIAA2022	73879039	1.000000	0.71417	0.335000	0.25508	0.455000	0.32408	2.024000	0.41049	0.265000	0.21872	0.486000	0.48141	GAC		0.438	KIAA2022-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057270.2		NM_001008537	
KIF13A	63971	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	17794626	17794626	+	Splice_Site	SNP	C	C	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr6:17794626C>A	ENST00000259711.6	-	25	3181	c.3076G>T	c.(3076-3078)Ggt>Tgt	p.G1026C	KIF13A_ENST00000378816.5_Splice_Site_p.G1026C|KIF13A_ENST00000378826.2_Splice_Site_p.G1026C|KIF13A_ENST00000378814.5_Splice_Site_p.G1026C|KIF13A_ENST00000378843.2_Splice_Site_p.G1026C	NM_022113.5	NP_071396.4	Q9H1H9	KI13A_HUMAN	kinesin family member 13A	1026					ATP catabolic process (GO:0006200)|cargo loading into vesicle (GO:0035459)|cytokinesis (GO:0000910)|endosome to lysosome transport (GO:0008333)|Golgi to plasma membrane protein transport (GO:0043001)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end-directed vesicle transport along microtubule (GO:0072383)	centrosome (GO:0005813)|endosome membrane (GO:0010008)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|midbody (GO:0030496)|trans-Golgi network membrane (GO:0032588)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.G1026C(2)		breast(3)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(16)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	64	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)			CGGGAATGACCCTGAAGAGGG	0.463																																																	2	Substitution - Missense(2)	kidney(2)											92.0	86.0	88.0					6																	17794626		1888	4126	6014	SO:0001630	splice_region_variant	63971			AJ291578	CCDS47380.1, CCDS47381.1, CCDS54967.1, CCDS54968.1, CCDS58998.1	6p23	2008-10-21			ENSG00000137177	ENSG00000137177		"""Kinesins"""	14566	protein-coding gene	gene with protein product		605433				11106728	Standard	NM_022113		Approved	bA500C11.2	uc003ncg.4	Q9H1H9	OTTHUMG00000014313	ENST00000259711.6:c.3076-1G>T	6.37:g.17794626C>A		Somatic		WXS	Illumina HiSeq	Phase_I	A0JP21|A0JP22|F2Z382|Q5THQ2|Q5THQ3|Q9H193|Q9H194|Q9H1H8	Missense_Mutation	SNP	ENST00000259711.6	37	CCDS47381.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	28.6|28.6	4.936896|4.936896	0.92458|0.92458	.|.	.|.	ENSG00000137177|ENSG00000137177	ENST00000378814;ENST00000502297;ENST00000259711;ENST00000378826;ENST00000378843;ENST00000378816|ENST00000358380	D;T;D;D;D;D|.	0.93426|.	-3.22;-1.06;-2.1;-2.02;-3.21;-2.02|.	5.65|5.65	5.65|5.65	0.86999|0.86999	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.74596|0.74596	0.3737|0.3737	M|M	0.77616|0.77616	2.38|2.38	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0|.	D;D;D;D|.	0.97110|.	0.999;1.0;1.0;1.0|.	T|T	0.72940|0.72940	-0.4139|-0.4139	10|5	0.87932|.	D|.	0|.	.|.	20.0965|20.0965	0.97849|0.97849	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1026;1026;1026;1026|.	Q9H1H9-4;Q9H1H9-2;Q9H1H9;Q9H1H9-3|.	.;.;KI13A_HUMAN;.|.	C|S	1026;43;1026;1026;1026;1026|419	ENSP00000368091:G1026C;ENSP00000425616:G43C;ENSP00000259711:G1026C;ENSP00000368103:G1026C;ENSP00000368120:G1026C;ENSP00000368093:G1026C|.	ENSP00000259711:G1026C|.	G|R	-|-	1|3	0|2	KIF13A|KIF13A	17902605|17902605	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.934000|0.934000	0.57294|0.57294	7.424000|7.424000	0.80242|0.80242	2.824000|2.824000	0.97209|0.97209	0.655000|0.655000	0.94253|0.94253	GGT|AGG		0.463	KIF13A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039954.4			Missense_Mutation
KPNA4	3840	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	160227602	160227602	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr3:160227602C>A	ENST00000334256.4	-	14	1500	c.1195G>T	c.(1195-1197)Gga>Tga	p.G399*		NM_002268.4	NP_002259.1	O00629	IMA3_HUMAN	karyopherin alpha 4 (importin alpha 3)	399					cytokine-mediated signaling pathway (GO:0019221)|NLS-bearing protein import into nucleus (GO:0006607)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)	protein transporter activity (GO:0008565)	p.G399*(1)		breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(10)|prostate(2)	22			Lung(72;0.00149)|LUSC - Lung squamous cell carcinoma(72;0.00216)			TCTTTCCTTCCACTAATTGTT	0.308																																																	1	Substitution - Nonsense(1)	kidney(1)											134.0	136.0	135.0					3																	160227602		2203	4300	6503	SO:0001587	stop_gained	3840			AB002533	CCDS3191.1	3q25.33	2013-02-14			ENSG00000186432	ENSG00000186432		"""Importins"", ""Armadillo repeat containing"""	6397	protein-coding gene	gene with protein product		602970				9168958, 9395085	Standard	NM_002268		Approved	QIP1, SRP3, IPOA3, MGC12217, MGC26703	uc003fdn.3	O00629	OTTHUMG00000159033	ENST00000334256.4:c.1195G>T	3.37:g.160227602C>A	ENSP00000334373:p.Gly399*	Somatic		WXS	Illumina HiSeq	Phase_I	A8K4S6|D3DNM2|O00190	Nonsense_Mutation	SNP	ENST00000334256.4	37	CCDS3191.1	.	.	.	.	.	.	.	.	.	.	C	40	8.163642	0.98686	.	.	ENSG00000186432	ENST00000334256	.	.	.	5.0	5.0	0.66597	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-3.8231	17.6453	0.88147	0.0:1.0:0.0:0.0	.	.	.	.	X	399	.	ENSP00000334373:G399X	G	-	1	0	KPNA4	161710296	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.582000	0.82546	2.496000	0.84212	0.305000	0.20034	GGA		0.308	KPNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352960.1		NM_002268	
KRTAP4-9	100132386	broad.mit.edu	37	17	39261882	39261882	+	Missense_Mutation	SNP	G	G	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr17:39261882G>A	ENST00000391415.1	+	1	299	c.242G>A	c.(241-243)cGc>cAc	p.R81H		NM_001146041.1	NP_001139513.1	Q9BYQ8	KRA49_HUMAN	keratin associated protein 4-9	81	29 X 5 AA repeats of C-C-[RQVHIEK]- [SPTR]-[VSTQCRNP].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)		p.R81H(1)		central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|urinary_tract(3)	14						ACCTGCTACCGCCCCAGCTGT	0.657																																																	1	Substitution - Missense(1)	kidney(1)																																								SO:0001583	missense	100132386			AJ406941	CCDS54124.1	17q21.2	2013-06-25			ENSG00000212722	ENSG00000212722		"""Keratin associated proteins"""	18910	protein-coding gene	gene with protein product							Standard	NM_001146041		Approved	KAP4.9	uc010wfp.2	Q9BYQ8	OTTHUMG00000133584	ENST00000391415.1:c.242G>A	17.37:g.39261882G>A	ENSP00000375234:p.Arg81His	Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000391415.1	37	CCDS54124.1	.	.	.	.	.	.	.	.	.	.	.	16.94	3.260264	0.59321	.	.	ENSG00000212722	ENST00000391415;ENST00000333994	T	0.29655	1.56	2.48	1.32	0.21799	.	0.218239	0.19032	U	0.124525	T	0.49558	0.1564	M	0.77616	2.38	0.22500	N	0.99905	D	0.89917	1.0	D	0.72075	0.976	T	0.16571	-1.0398	10	0.54805	T	0.06	.	7.9592	0.30062	0.0:0.0:0.7576:0.2424	.	81	Q9BYQ8	KRA49_HUMAN	H	81	ENSP00000375234:R81H	ENSP00000334461:R81H	R	+	2	0	KRTAP4-9	36515408	0.000000	0.05858	0.049000	0.19019	0.807000	0.45602	0.131000	0.15870	1.375000	0.46248	0.462000	0.41574	CGC		0.657	KRTAP4-9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257688.1		NM_001146041	
NBPF14	25832	broad.mit.edu	37	1	148017563	148017563	+	Silent	SNP	A	A	G			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr1:148017563A>G	ENST00000369219.1	-	6	736	c.720T>C	c.(718-720)tcT>tcC	p.S240S				Q5TI25	NBPFE_HUMAN	neuroblastoma breakpoint family, member 14	240	NBPF 2. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)		p.S240S(1)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(23)|ovary(2)|pancreas(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(1)	42	all_hematologic(923;0.032)					TGCTGCTGTAAGACTTGTACG	0.478																																																	1	Substitution - coding silent(1)	kidney(1)											40.0	41.0	41.0					1																	148017563		1500	2697	4197	SO:0001819	synonymous_variant	0			AK092351		1q21.1	2013-01-17			ENSG00000122497			"""neuroblastoma breakpoint family"""	25232	protein-coding gene	gene with protein product		614003				8619474, 9110174, 16079250	Standard	NM_015383		Approved	DJ328E19.C1.1	uc021owp.2	Q5TI25	OTTHUMG00000013900	ENST00000369219.1:c.720T>C	1.37:g.148017563A>G		Somatic		WXS	Illumina GAIIx	Phase_I	Q5TI23|Q8IX76|Q9UJI9	Silent	SNP	ENST00000369219.1	37		.	.	.	.	.	.	.	.	.	.	a	1.069	-0.670594	0.03403	.	.	ENSG00000122497	ENST00000310701;ENST00000444640;ENST00000431121;ENST00000436356;ENST00000448574;ENST00000458135;ENST00000392972;ENST00000426874	.	.	.	.	.	.	.	.	.	.	.	T	0.14313	0.0346	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.27536	-1.0071	2	.	.	.	.	.	.	.	.	.	.	.	P	246;251;251;251;251;251;251;251	.	.	L	-	2	0	NBPF14	146484187	0.054000	0.20591	0.004000	0.12327	0.004000	0.04260	0.794000	0.26958	0.356000	0.24157	0.351000	0.21866	CTT		0.478	NBPF14-201	KNOWN	basic|appris_principal	protein_coding	protein_coding			NM_015383	
LRP1	4035	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	57591375	57591375	+	Missense_Mutation	SNP	G	G	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr12:57591375G>A	ENST00000243077.3	+	58	9676	c.9210G>A	c.(9208-9210)atG>atA	p.M3070I		NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	3070					aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)	p.M3070I(1)		NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	GAGAGCAGATGATCTACTGGA	0.587																																																	1	Substitution - Missense(1)	kidney(1)											130.0	111.0	118.0					12																	57591375		2203	4300	6503	SO:0001583	missense	4035			X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.9210G>A	12.37:g.57591375G>A	ENSP00000243077:p.Met3070Ile	Somatic		WXS	Illumina HiSeq	Phase_I	Q2PP12|Q86SW0|Q8IVG8	Missense_Mutation	SNP	ENST00000243077.3	37	CCDS8932.1	.	.	.	.	.	.	.	.	.	.	G	13.66	2.304522	0.40795	.	.	ENSG00000123384	ENST00000243077	D	0.85171	-1.95	4.53	4.53	0.55603	Six-bladed beta-propeller, TolB-like (1);Growth factor, receptor (1);	0.000000	0.85682	D	0.000000	D	0.89839	0.6831	L	0.59436	1.845	0.80722	D	1	D	0.54964	0.969	D	0.70227	0.968	D	0.87548	0.2463	10	0.25106	T	0.35	.	16.1915	0.81992	0.0:0.0:1.0:0.0	.	3070	Q07954	LRP1_HUMAN	I	3070	ENSP00000243077:M3070I	ENSP00000243077:M3070I	M	+	3	0	LRP1	55877642	1.000000	0.71417	1.000000	0.80357	0.544000	0.35116	4.572000	0.60886	2.347000	0.79759	0.511000	0.50034	ATG		0.587	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412772.2		NM_002332	
LRP2	4036	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	170081963	170081963	+	Splice_Site	SNP	C	C	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr2:170081963C>A	ENST00000263816.3	-	33	5680	c.5395G>T	c.(5395-5397)Ggt>Tgt	p.G1799C		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	1799					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.G1799C(1)		biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	TGAATTTCACCCTGGAAAGAA	0.473																																																	1	Substitution - Missense(1)	kidney(1)											86.0	85.0	86.0					2																	170081963		2203	4300	6503	SO:0001630	splice_region_variant	4036				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.5395-1G>T	2.37:g.170081963C>A		Somatic		WXS	Illumina HiSeq	Phase_I	O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	37	CCDS2232.1	.	.	.	.	.	.	.	.	.	.	C	28.4	4.915740	0.92178	.	.	ENSG00000081479	ENST00000263816	D	0.93763	-3.28	5.48	5.48	0.80851	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.85682	D	0.000000	D	0.96062	0.8717	M	0.62266	1.93	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94828	0.7993	10	0.33940	T	0.23	.	19.3435	0.94355	0.0:1.0:0.0:0.0	.	1799	P98164	LRP2_HUMAN	C	1799	ENSP00000263816:G1799C	ENSP00000263816:G1799C	G	-	1	0	LRP2	169790209	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.818000	0.86416	2.569000	0.86673	0.591000	0.81541	GGT		0.473	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2		NM_004525	Missense_Mutation
MACROD2	140733	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	20	16021897	16021897	+	Missense_Mutation	SNP	A	A	T			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr20:16021897A>T	ENST00000310348.4	+	16	1205	c.1205A>T	c.(1204-1206)gAc>gTc	p.D402V	MACROD2_ENST00000217246.4_Missense_Mutation_p.D402V|MACROD2_ENST00000378058.3_Missense_Mutation_p.D167V|MACROD2_ENST00000402914.1_Missense_Mutation_p.D167V|MACROD2_ENST00000407045.3_Missense_Mutation_p.D53V			A1Z1Q3	MACD2_HUMAN	MACRO domain containing 2	402					brain development (GO:0007420)|cellular response to DNA damage stimulus (GO:0006974)|protein de-ADP-ribosylation (GO:0051725)|purine nucleoside metabolic process (GO:0042278)	nucleus (GO:0005634)	deacetylase activity (GO:0019213)|hydrolase activity, acting on glycosyl bonds (GO:0016798)	p.D402V(1)|p.D167V(1)		breast(2)|kidney(4)|large_intestine(5)|lung(8)|skin(1)	20		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)				GGCTCCAGTGACCTAGAAAAT	0.443																																																	2	Substitution - Missense(2)	kidney(2)											79.0	79.0	79.0					20																	16021897		2203	4299	6502	SO:0001583	missense	140733			BC101218	CCDS13120.2, CCDS33443.1	20p12.1	2011-04-28	2007-07-24	2007-07-24	ENSG00000172264	ENSG00000172264			16126	protein-coding gene	gene with protein product		611567	"""chromosome 20 open reading frame 133"""	C20orf133			Standard	NM_080676		Approved	dJ631M13.5	uc002wot.3	A1Z1Q3	OTTHUMG00000031919	ENST00000310348.4:c.1205A>T	20.37:g.16021897A>T	ENSP00000309809:p.Asp402Val	Somatic		WXS	Illumina HiSeq	Phase_I	A6NFF7|B0QZ39|B3KWV0|Q0P6D5|Q495E0|Q5W199|Q6ZN71	Missense_Mutation	SNP	ENST00000310348.4	37	CCDS13120.2	.	.	.	.	.	.	.	.	.	.	A	7.097	0.573316	0.13623	.	.	ENSG00000172264	ENST00000217246;ENST00000310348;ENST00000402914;ENST00000378058;ENST00000407045	T;T;T;T	0.55588	2.27;2.09;0.51;0.51	5.37	4.25	0.50352	.	0.259107	0.27720	N	0.018138	T	0.47691	0.1459	N	0.14661	0.345	0.09310	N	0.999999	D;P;P	0.63046	0.992;0.622;0.739	P;B;B	0.57244	0.816;0.11;0.221	T	0.37454	-0.9705	10	0.87932	D	0	-6.0719	9.5653	0.39394	0.9138:0.0:0.0862:0.0	.	53;402;402	A1Z1Q3-6;A1Z1Q3;A1Z1Q3-2	.;MACD2_HUMAN;.	V	402;402;167;167;53	ENSP00000217246:D402V;ENSP00000309809:D402V;ENSP00000385290:D167V;ENSP00000367297:D167V	ENSP00000217246:D402V	D	+	2	0	MACROD2	15969897	0.628000	0.27138	0.089000	0.20774	0.112000	0.19704	3.381000	0.52455	2.164000	0.68074	0.533000	0.62120	GAC		0.443	MACROD2-201	KNOWN	basic|CCDS	protein_coding	protein_coding			NM_080676	
METTL14	57721	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	119626961	119626961	+	Missense_Mutation	SNP	A	A	T			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr4:119626961A>T	ENST00000388822.5	+	10	1218	c.1051A>T	c.(1051-1053)Agt>Tgt	p.S351C	METTL14_ENST00000506780.1_Missense_Mutation_p.S313C			Q9HCE5	MET14_HUMAN	methyltransferase like 14	351					mRNA destabilization (GO:0061157)|mRNA methylation (GO:0080009)|stem cell maintenance (GO:0019827)	MIS complex (GO:0036396)|nucleus (GO:0005634)	mRNA (2'-O-methyladenosine-N6-)-methyltransferase activity (GO:0016422)|RNA binding (GO:0003723)	p.S351C(1)		endometrium(3)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)|stomach(1)	16						TGGAAGAGATAGTACAATTCG	0.343																																																	1	Substitution - Missense(1)	kidney(1)											69.0	71.0	70.0					4																	119626961		2203	4300	6503	SO:0001583	missense	57721			AB046847	CCDS34053.1	4q26	2009-02-24			ENSG00000145388	ENSG00000145388			29330	protein-coding gene	gene with protein product						10997877	Standard	NM_020961		Approved	KIAA1627	uc003icf.3	Q9HCE5	OTTHUMG00000161167	ENST00000388822.5:c.1051A>T	4.37:g.119626961A>T	ENSP00000373474:p.Ser351Cys	Somatic		WXS	Illumina HiSeq	Phase_I	A6NIG1|Q969V2	Missense_Mutation	SNP	ENST00000388822.5	37	CCDS34053.1	.	.	.	.	.	.	.	.	.	.	A	19.42	3.823248	0.71143	.	.	ENSG00000145388	ENST00000388822;ENST00000506780	T;T	0.42900	0.96;0.96	5.82	5.82	0.92795	.	0.087165	0.85682	D	0.000000	T	0.65709	0.2717	M	0.77313	2.365	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.72982	0.979;0.979	T	0.67484	-0.5659	10	0.48119	T	0.1	.	16.1758	0.81851	1.0:0.0:0.0:0.0	.	313;351	D6RBL4;Q9HCE5	.;MTL14_HUMAN	C	351;313	ENSP00000373474:S351C;ENSP00000424111:S313C	ENSP00000373474:S351C	S	+	1	0	METTL14	119846409	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.448000	0.73469	2.225000	0.72522	0.477000	0.44152	AGT		0.343	METTL14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364034.3		NM_020961	
MKL1	57591	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	22	40831553	40831553	+	Missense_Mutation	SNP	T	T	C			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr22:40831553T>C	ENST00000355630.3	-	5	603	c.13A>G	c.(13-15)Aaa>Gaa	p.K5E	MKL1_ENST00000396617.3_Missense_Mutation_p.K5E|MKL1_ENST00000407029.1_Missense_Mutation_p.K5E|MKL1_ENST00000402042.1_Missense_Mutation_p.K5E|MKL1_ENST00000402630.1_Missense_Mutation_p.K5E	NM_020831.3	NP_065882.1	Q969V6	MKL1_HUMAN	megakaryoblastic leukemia (translocation) 1	5	Mediates interaction with SCAI and ACTB. {ECO:0000250}.				negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription via serum response element binding (GO:0010735)|smooth muscle cell differentiation (GO:0051145)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	actin binding (GO:0003779)|actin monomer binding (GO:0003785)|leucine zipper domain binding (GO:0043522)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription regulatory region sequence-specific DNA binding (GO:0000976)	p.K5E(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(13)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	30						GCTGGACTTTTCAAAGCTGTT	0.458			T	RBM15	acute megakaryocytic leukemia																																			Dom	yes		22	22q13	57591	megakaryoblastic leukemia (translocation) 1		L	1	Substitution - Missense(1)	kidney(1)											99.0	95.0	97.0					22																	40831553		2203	4300	6503	SO:0001583	missense	57591			AB037859	CCDS14003.1, CCDS74865.1, CCDS74866.1	22q13	2008-06-12			ENSG00000196588	ENSG00000196588			14334	protein-coding gene	gene with protein product	"""megakaryocytic acute leukemia"", ""myocardin-related transcription factor A"", ""basic, SAP and coiled-coil domain"""	606078				11431691, 12019265, 14970199	Standard	XM_005261692		Approved	KIAA1438, MAL, MRTF-A, BSAC	uc003ayw.1	Q969V6	OTTHUMG00000151146	ENST00000355630.3:c.13A>G	22.37:g.40831553T>C	ENSP00000347847:p.Lys5Glu	Somatic		WXS	Illumina HiSeq	Phase_I	Q8TCL1|Q96SC5|Q96SC6|Q9P2B0	Missense_Mutation	SNP	ENST00000355630.3	37	CCDS14003.1	.	.	.	.	.	.	.	.	.	.	T	34	5.410982	0.96072	.	.	ENSG00000196588	ENST00000355630;ENST00000396617;ENST00000402042;ENST00000407029;ENST00000402630;ENST00000422851	D;D;D;D;D;D	0.99854	-7.19;-7.19;-7.19;-7.19;-7.19;-7.19	5.18	5.18	0.71444	.	0.000000	0.85682	D	0.000000	D	0.99834	0.9925	M	0.81942	2.565	0.80722	D	1	D;D;D	0.76494	0.999;0.997;0.997	D;D;D	0.80764	0.994;0.98;0.98	D	0.96451	0.9334	10	0.87932	D	0	-6.389	15.335	0.74244	0.0:0.0:0.0:1.0	.	5;5;5	B0QY83;E7ER32;Q969V6	.;.;MKL1_HUMAN	E	5;5;5;5;5;32	ENSP00000347847:K5E;ENSP00000379861:K5E;ENSP00000385584:K5E;ENSP00000385835:K5E;ENSP00000385076:K5E;ENSP00000398478:K32E	ENSP00000347847:K5E	K	-	1	0	MKL1	39161499	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.825000	0.86693	2.097000	0.63578	0.454000	0.30748	AAA		0.458	MKL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321522.1		NM_020831	
MOB2	81532	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	1492592	1492592	+	Nonsense_Mutation	SNP	G	G	T	rs559675327		TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr11:1492592G>T	ENST00000329957.6	-	4	612	c.423C>A	c.(421-423)taC>taA	p.Y141*	MOB2_ENST00000526462.1_5'UTR	NM_001172223.1	NP_001165694.1	Q70IA6	MOB2_HUMAN	MOB kinase activator 2	110					actin cytoskeleton organization (GO:0030036)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein phosphorylation (GO:0001934)	cytoplasm (GO:0005737)|neuron projection terminus (GO:0044306)|nucleolus (GO:0005730)|nucleus (GO:0005634)	metal ion binding (GO:0046872)	p.Y141*(2)		breast(1)|kidney(2)|lung(1)	4						CGAAGTCAACGTACTGTGGGG	0.592																																																	2	Substitution - Nonsense(2)	kidney(2)											112.0	128.0	122.0					11																	1492592		2169	4247	6416	SO:0001587	stop_gained	81532				CCDS53591.1	11p15.5	2011-09-28			ENSG00000182208	ENSG00000182208		"""MOB kinase activators"""	24904	protein-coding gene	gene with protein product	"""MOB2 Mps One Binder homolog (yeast)"""	611969				11223154, 15067004	Standard	NM_053005		Approved	HCCA2	uc010qwz.2	Q70IA6	OTTHUMG00000165545	ENST00000329957.6:c.423C>A	11.37:g.1492592G>T	ENSP00000328694:p.Tyr141*	Somatic		WXS	Illumina HiSeq	Phase_I	B4DKP3|Q96M67	Nonsense_Mutation	SNP	ENST00000329957.6	37	CCDS53591.1	.	.	.	.	.	.	.	.	.	.	G	27.3	4.818415	0.90790	.	.	ENSG00000182208	ENST00000329957	.	.	.	4.34	1.14	0.20703	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-37.8779	9.088	0.36592	0.3524:0.0:0.6476:0.0	.	.	.	.	X	141	.	ENSP00000328694:Y141X	Y	-	3	2	AC091196.1	1449168	0.736000	0.28164	1.000000	0.80357	0.803000	0.45373	-0.206000	0.09398	0.453000	0.26858	0.462000	0.41574	TAC		0.592	MOB2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000384770.1		NM_053005	
MTBP	27085	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	121500410	121500410	+	Missense_Mutation	SNP	G	G	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr8:121500410G>A	ENST00000305949.1	+	12	1222	c.1177G>A	c.(1177-1179)Gaa>Aaa	p.E393K		NM_022045.4	NP_071328.2	Q96DY7	MTBP_HUMAN	MDM2 binding protein	393					cell cycle arrest (GO:0007050)|mitotic spindle checkpoint (GO:0071174)|negative regulation of cell proliferation (GO:0008285)|protein localization to kinetochore (GO:0034501)|traversing start control point of mitotic cell cycle (GO:0007089)	chromatin (GO:0000785)|kinetochore (GO:0000776)		p.E393K(1)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	30	Lung NSC(37;5.68e-08)|Ovarian(258;0.00769)|all_neural(195;0.0804)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00503)			TCCAGATGTTGAAGTGAAAGG	0.343																																																	1	Substitution - Missense(1)	kidney(1)											109.0	101.0	104.0					8																	121500410		2203	4300	6503	SO:0001583	missense	27085				CCDS6333.1	8q24.1-q24.2	2014-03-03	2014-03-03		ENSG00000172167	ENSG00000172167			7417	protein-coding gene	gene with protein product		605927	"""MDM2 (mouse double minute 2)-binding protein, 104kD"", ""Mdm2, transformed 3T3 cell double minute 2, p53 binding protein (mouse) binding protein, 104kDa"""			10906133, 11060448	Standard	NM_022045		Approved		uc003ypc.2	Q96DY7	OTTHUMG00000165040	ENST00000305949.1:c.1177G>A	8.37:g.121500410G>A	ENSP00000303398:p.Glu393Lys	Somatic		WXS	Illumina HiSeq	Phase_I	B4DUR5|Q9HA89	Missense_Mutation	SNP	ENST00000305949.1	37	CCDS6333.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.211786	0.79240	.	.	ENSG00000172167	ENST00000305949	.	.	.	6.17	6.17	0.99709	.	0.215910	0.47093	D	0.000257	T	0.71484	0.3345	M	0.66939	2.045	0.50039	D	0.999849	P	0.49559	0.925	P	0.49752	0.621	T	0.67628	-0.5622	9	0.36615	T	0.2	-10.736	20.8794	0.99867	0.0:0.0:1.0:0.0	.	393	Q96DY7	MTBP_HUMAN	K	393	.	ENSP00000303398:E393K	E	+	1	0	MTBP	121569591	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.475000	0.81041	2.941000	0.99782	0.655000	0.94253	GAA		0.343	MTBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381530.1		NM_022045	
MTMR11	10903	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	149901785	149901785	+	Silent	SNP	G	G	C			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr1:149901785G>C	ENST00000439741.2	-	16	1921	c.1671C>G	c.(1669-1671)ccC>ccG	p.P557P	MTMR11_ENST00000361405.6_3'UTR|MTMR11_ENST00000406732.3_3'UTR|MTMR11_ENST00000369140.3_Silent_p.P485P|SF3B4_ENST00000271628.8_5'Flank|MTMR11_ENST00000492824.1_5'UTR	NM_001145862.1	NP_001139334.1	A4FU01	MTMRB_HUMAN	myotubularin related protein 11	557	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.						phosphatase activity (GO:0016791)	p.P485P(1)|p.P557P(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(13)|prostate(2)|stomach(1)|urinary_tract(4)	34	Breast(34;0.0009)|Ovarian(49;0.0377)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)			CAGAACTGGGGGGTCCAGGAA	0.522																																																	2	Substitution - coding silent(2)	kidney(2)											43.0	47.0	46.0					1																	149901785		2203	4300	6503	SO:0001819	synonymous_variant	10903			AK097000	CCDS72901.1, CCDS72902.1	1q12-q21	2011-06-09			ENSG00000014914	ENSG00000014914		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	24307	protein-coding gene	gene with protein product	"""cisplatin resistance associated"""					12495846	Standard	NM_181873		Approved	CRA	uc001etl.4	A4FU01	OTTHUMG00000012207	ENST00000439741.2:c.1671C>G	1.37:g.149901785G>C		Somatic		WXS	Illumina HiSeq	Phase_I	B3KUE4|B4DJI6|B4DQF5|B4E3Q6|Q3ZCP7|Q5SZ62|Q6P2Q8|Q99752|Q99753	Silent	SNP	ENST00000439741.2	37	CCDS53360.1																																																																																				0.522	MTMR11-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			NM_181873	
MVP	9961	broad.mit.edu;ucsc.edu	37	16	29858549	29858549	+	Missense_Mutation	SNP	G	G	A	rs3815823	byFrequency	TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr16:29858549G>A	ENST00000357402.5	+	14	2435	c.2297G>A	c.(2296-2298)cGa>cAa	p.R766Q	MVP_ENST00000395353.1_Missense_Mutation_p.R766Q	NM_005115.4|NM_017458.3	NP_005106.2|NP_059447.2	Q14764	MVP_HUMAN	major vault protein	766					cell proliferation (GO:0008283)|ERBB signaling pathway (GO:0038127)|mRNA transport (GO:0051028)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of protein tyrosine kinase activity (GO:0061099)|negative regulation of signaling (GO:0023057)|protein activation cascade (GO:0072376)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear pore (GO:0005643)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ribonucleoprotein complex (GO:0030529)	protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)	p.R766Q(1)		central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(7)|ovary(2)|skin(3)|soft_tissue(1)|stomach(1)	27						CAGAAGGTCCGAGAGCTGGAA	0.542																																																	1	Substitution - Missense(1)	kidney(1)											63.0	70.0	68.0					16																	29858549		2196	4300	6496	SO:0001583	missense	9961			X79882	CCDS10656.1	16p11.2	2012-04-25			ENSG00000013364	ENSG00000013364			7531	protein-coding gene	gene with protein product	"""lung resistance-related protein"""	605088				7585126	Standard	NM_005115		Approved	LRP, VAULT1	uc002dui.3	Q14764	OTTHUMG00000048227	ENST00000357402.5:c.2297G>A	16.37:g.29858549G>A	ENSP00000349977:p.Arg766Gln	Somatic		WXS	Illumina GAIIx	Phase_I	Q96BG4|Q9BPW6|Q9BQT1|Q9UBD1	Missense_Mutation	SNP	ENST00000357402.5	37	CCDS10656.1	.	.	.	.	.	.	.	.	.	.	G	13.28	2.189641	0.38707	.	.	ENSG00000013364	ENST00000357402;ENST00000395353	T;T	0.29917	1.55;1.55	6.06	1.93	0.25924	.	0.055256	0.64402	D	0.000001	T	0.14960	0.0361	L	0.31157	0.91	0.80722	D	1	P	0.49635	0.926	B	0.34452	0.183	T	0.09292	-1.0681	10	0.23891	T	0.37	-7.1796	7.6358	0.28266	0.0982:0.0:0.649:0.2528	rs3815823;rs3815823	766	Q14764	MVP_HUMAN	Q	766	ENSP00000349977:R766Q;ENSP00000378760:R766Q	ENSP00000349977:R766Q	R	+	2	0	MVP	29766050	1.000000	0.71417	0.065000	0.19835	0.041000	0.13682	3.644000	0.54381	0.144000	0.18951	-0.169000	0.13324	CGA		0.542	MVP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109711.3		NM_005115	
MYCL	4610	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	40363241	40363241	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr1:40363241G>A	ENST00000372816.2	-	2	1345	c.898C>T	c.(898-900)Cga>Tga	p.R300*	RP1-118J21.5_ENST00000418255.1_RNA|MYCL_ENST00000397332.2_Nonsense_Mutation_p.R330*			P12524	MYCL_HUMAN	v-myc avian myelocytomatosis viral oncogene lung carcinoma derived homolog	300	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.					nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R330*(1)									GCCAAGAATCGCGAACGCAGG	0.567																																																	1	Substitution - Nonsense(1)	kidney(1)											76.0	76.0	76.0					1																	40363241		2203	4300	6503	SO:0001587	stop_gained	4610				CCDS30682.1, CCDS44117.1, CCDS44117.2, CCDS53300.1	1p34.3	2013-07-09	2013-07-09	2013-07-09	ENSG00000116990	ENSG00000116990		"""Basic helix-loop-helix proteins"""	7555	protein-coding gene	gene with protein product	"""l-myc protein"", ""myc-related gene from lung cancer"", ""oncogene lmyc"""	164850	"""v-myc avian myelocytomatosis viral oncogene homolog 1, lung carcinoma derived"""	MYCL1		8978772	Standard	NM_001033082		Approved	LMYC, bHLHe38	uc001cer.2	P12524	OTTHUMG00000009243	ENST00000372816.2:c.898C>T	1.37:g.40363241G>A	ENSP00000361903:p.Arg300*	Somatic		WXS	Illumina HiSeq	Phase_I	A2A2C9|B4DJH2|Q14897|Q5QPL0|Q5QPL1|Q9NUE9	Nonsense_Mutation	SNP	ENST00000372816.2	37	CCDS30682.1	.	.	.	.	.	.	.	.	.	.	G	39	7.826870	0.98510	.	.	ENSG00000116990	ENST00000397332;ENST00000372816	.	.	.	5.75	3.76	0.43208	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.2172	14.2989	0.66334	0.0:0.0:0.6875:0.3125	.	.	.	.	X	330;300	.	ENSP00000361903:R300X	R	-	1	2	MYCL1	40135828	0.993000	0.37304	0.626000	0.29213	0.963000	0.63663	2.115000	0.41921	0.635000	0.30488	0.655000	0.94253	CGA		0.567	MYCL-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000277004.1		NM_001033082	
MYF6	4618	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	81101549	81101549	+	Silent	SNP	G	G	T			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr12:81101549G>T	ENST00000228641.3	+	1	273	c.51G>T	c.(49-51)ggG>ggT	p.G17G		NM_002469.2	NP_002460.1	P23409	MYF6_HUMAN	myogenic factor 6 (herculin)	17					muscle cell differentiation (GO:0042692)|muscle cell fate commitment (GO:0042693)|muscle tissue morphogenesis (GO:0060415)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal muscle cell differentiation (GO:0035914)|skeletal muscle tissue development (GO:0007519)|skeletal muscle tissue regeneration (GO:0043403)|somitogenesis (GO:0001756)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G17G(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(12)|skin(1)	26						ACTTGGATGGGGAAAATGTTA	0.502																																																	1	Substitution - coding silent(1)	kidney(1)											100.0	106.0	104.0					12																	81101549		2203	4300	6503	SO:0001819	synonymous_variant	4618				CCDS9019.1	12q21	2013-05-21				ENSG00000111046		"""Basic helix-loop-helix proteins"""	7566	protein-coding gene	gene with protein product	"""muscle-specific regulatory factor 4"""	159991				8978788	Standard	NM_002469		Approved	MRF4, bHLHc4	uc001szf.2	P23409		ENST00000228641.3:c.51G>T	12.37:g.81101549G>T		Somatic		WXS	Illumina HiSeq	Phase_I	B2R898|Q53X80|Q6FHI9	Silent	SNP	ENST00000228641.3	37	CCDS9019.1																																																																																				0.502	MYF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407756.1		NM_002469	
MYF6	4618	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	81101620	81101620	+	Nonsense_Mutation	SNP	T	T	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr12:81101620T>A	ENST00000228641.3	+	1	344	c.122T>A	c.(121-123)tTg>tAg	p.L41*		NM_002469.2	NP_002460.1	P23409	MYF6_HUMAN	myogenic factor 6 (herculin)	41					muscle cell differentiation (GO:0042692)|muscle cell fate commitment (GO:0042693)|muscle tissue morphogenesis (GO:0060415)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal muscle cell differentiation (GO:0035914)|skeletal muscle tissue development (GO:0007519)|skeletal muscle tissue regeneration (GO:0043403)|somitogenesis (GO:0001756)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L41*(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(12)|skin(1)	26						GATGGTACCTTGTCCCCCTGC	0.592																																																	1	Substitution - Nonsense(1)	kidney(1)											75.0	78.0	77.0					12																	81101620		2203	4300	6503	SO:0001587	stop_gained	4618				CCDS9019.1	12q21	2013-05-21				ENSG00000111046		"""Basic helix-loop-helix proteins"""	7566	protein-coding gene	gene with protein product	"""muscle-specific regulatory factor 4"""	159991				8978788	Standard	NM_002469		Approved	MRF4, bHLHc4	uc001szf.2	P23409		ENST00000228641.3:c.122T>A	12.37:g.81101620T>A	ENSP00000228641:p.Leu41*	Somatic		WXS	Illumina HiSeq	Phase_I	B2R898|Q53X80|Q6FHI9	Nonsense_Mutation	SNP	ENST00000228641.3	37	CCDS9019.1	.	.	.	.	.	.	.	.	.	.	T	37	6.557917	0.97663	.	.	ENSG00000111046	ENST00000228641	.	.	.	5.62	5.62	0.85841	.	0.000000	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.8173	0.78612	0.0:0.0:0.0:1.0	.	.	.	.	X	41	.	ENSP00000228641:L41X	L	+	2	0	MYF6	79625751	1.000000	0.71417	0.993000	0.49108	0.974000	0.67602	7.303000	0.78871	2.151000	0.67156	0.533000	0.62120	TTG		0.592	MYF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407756.1		NM_002469	
MYH7B	57644	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	20	33585398	33585398	+	Missense_Mutation	SNP	G	G	C			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr20:33585398G>C	ENST00000262873.7	+	30	3920	c.3828G>C	c.(3826-3828)gaG>gaC	p.E1276D		NM_020884.3	NP_065935.2	A7E2Y1	MYH7B_HUMAN	myosin, heavy chain 7B, cardiac muscle, beta	1234						membrane (GO:0016020)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.E1276D(1)		NS(2)|breast(5)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(19)|ovary(5)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	54			BRCA - Breast invasive adenocarcinoma(18;0.00691)			TGCGCATGGAGGTGGACGACC	0.652																																																	1	Substitution - Missense(1)	kidney(1)											67.0	72.0	70.0					20																	33585398		2203	4299	6502	SO:0001583	missense	57644			AB040945	CCDS42869.1	20q11	2011-09-27	2006-09-29		ENSG00000078814	ENSG00000078814		"""Myosins / Myosin superfamily : Class II"""	15906	protein-coding gene	gene with protein product		609928	"""myosin, heavy polypeptide 7B, cardiac muscle, beta"""			11919279, 15014174	Standard	XM_006723839		Approved	KIAA1512, dJ756N5.1, MYH14, MHC14	uc002xbi.2	A7E2Y1	OTTHUMG00000032320	ENST00000262873.7:c.3828G>C	20.37:g.33585398G>C	ENSP00000262873:p.Glu1276Asp	Somatic		WXS	Illumina HiSeq	Phase_I	Q5JVW7|Q6NT44|Q6NT57|Q6WG75|Q96I57|Q9NWE2|Q9P216	Missense_Mutation	SNP	ENST00000262873.7	37	CCDS42869.1	.	.	.	.	.	.	.	.	.	.	G	19.91	3.915413	0.73098	.	.	ENSG00000078814	ENST00000262873	D	0.82433	-1.61	4.73	2.8	0.32819	Myosin tail (1);	0.000000	0.38381	N	0.001715	D	0.89715	0.6795	M	0.85710	2.77	0.41441	D	0.987927	D	0.76494	0.999	D	0.80764	0.994	D	0.88200	0.2883	10	0.59425	D	0.04	.	7.5425	0.27746	0.3284:0.0:0.6716:0.0	.	1234	A7E2Y1	MYH7B_HUMAN	D	1276	ENSP00000262873:E1276D	ENSP00000262873:E1276D	E	+	3	2	MYH7B	33049059	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	1.947000	0.40293	0.613000	0.30089	0.563000	0.77884	GAG		0.652	MYH7B-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000078833.2		NM_020884	
KAT6A	7994	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	41792289	41792289	+	Missense_Mutation	SNP	T	T	G			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr8:41792289T>G	ENST00000396930.3	-	18	3992	c.3449A>C	c.(3448-3450)aAg>aCg	p.K1150T	KAT6A_ENST00000265713.2_Missense_Mutation_p.K1150T|KAT6A_ENST00000406337.1_Missense_Mutation_p.K1150T	NM_001099412.1	NP_001092882.1	Q92794	KAT6A_HUMAN	K(lysine) acetyltransferase 6A	1150	Poly-Lys.				aorta morphogenesis (GO:0035909)|cellular senescence (GO:0090398)|chromatin organization (GO:0006325)|DNA packaging (GO:0006323)|embryonic hemopoiesis (GO:0035162)|face morphogenesis (GO:0060325)|heart morphogenesis (GO:0003007)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|myeloid cell differentiation (GO:0030099)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|protein acetylation (GO:0006473)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|PML body (GO:0016605)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.K1150T(1)									GGGCCATCCCTTTTTCTTTTT	0.433																																																	1	Substitution - Missense(1)	kidney(1)											176.0	188.0	184.0					8																	41792289		2203	4300	6503	SO:0001583	missense	0			U47742	CCDS6124.1	8p11	2013-01-28	2011-07-21	2011-07-21	ENSG00000083168	ENSG00000083168		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	13013	protein-coding gene	gene with protein product	"""Monocytic leukemia zinc finger protein"""	601408	"""runt-related transcription factor binding protein 2"", ""MYST histone acetyltransferase (monocytic leukemia) 3"""	ZNF220, RUNXBP2, MYST3		8849440, 8782817	Standard	NM_001099412		Approved	MOZ, ZC2HC6A	uc003xon.4	Q92794	OTTHUMG00000150453	ENST00000396930.3:c.3449A>C	8.37:g.41792289T>G	ENSP00000380136:p.Lys1150Thr	Somatic		WXS	Illumina HiSeq	Phase_I	Q76L81	Missense_Mutation	SNP	ENST00000396930.3	37	CCDS6124.1	.	.	.	.	.	.	.	.	.	.	T	14.69	2.610218	0.46527	.	.	ENSG00000083168	ENST00000265713;ENST00000406337;ENST00000396930	T;T;T	0.65549	-0.16;-0.16;-0.16	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.77003	0.4067	L	0.61218	1.895	0.53688	D	0.999979	D	0.76494	0.999	D	0.80764	0.994	T	0.78698	-0.2103	10	0.62326	D	0.03	-35.1012	16.17	0.81801	0.0:0.0:0.0:1.0	.	1150	Q92794	KAT6A_HUMAN	T	1150	ENSP00000265713:K1150T;ENSP00000385888:K1150T;ENSP00000380136:K1150T	ENSP00000265713:K1150T	K	-	2	0	KAT6A	41911446	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.456000	0.80751	2.279000	0.76181	0.533000	0.62120	AAG		0.433	KAT6A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318163.1		NM_006766	
NF1	4763	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	29664584	29664584	+	Missense_Mutation	SNP	T	T	C			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr17:29664584T>C	ENST00000358273.4	+	43	7009	c.6626T>C	c.(6625-6627)tTg>tCg	p.L2209S	NF1_ENST00000356175.3_Missense_Mutation_p.L2188S|NF1_ENST00000417592.2_5'Flank|NF1_ENST00000444181.2_5'Flank	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	2209					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(3)|p.L2209S(2)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		ACAGAAGCTTTGTTGGAGATC	0.358			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																													yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	13	Whole gene deletion(8)|Unknown(3)|Substitution - Missense(2)	soft_tissue(7)|kidney(2)|autonomic_ganglia(2)|lung(1)|central_nervous_system(1)											99.0	98.0	99.0					17																	29664584		2203	4300	6503	SO:0001583	missense	4763	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.6626T>C	17.37:g.29664584T>C	ENSP00000351015:p.Leu2209Ser	Somatic		WXS	Illumina HiSeq	Phase_I	O00662|Q14284|Q14930|Q14931|Q9UMK3	Missense_Mutation	SNP	ENST00000358273.4	37	CCDS42292.1	.	.	.	.	.	.	.	.	.	.	T	18.81	3.702232	0.68501	.	.	ENSG00000196712	ENST00000358273;ENST00000356175;ENST00000456735	T;T;T	0.31769	1.48;1.48;1.48	5.45	5.45	0.79879	Armadillo-type fold (2);	0.000000	0.64402	D	0.000001	T	0.55625	0.1932	M	0.72894	2.215	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.78314	0.991;0.979	T	0.59878	-0.7371	10	0.87932	D	0	.	15.8101	0.78552	0.0:0.0:0.0:1.0	.	2188;2209	P21359-2;P21359	.;NF1_HUMAN	S	2209;2188;1854	ENSP00000351015:L2209S;ENSP00000348498:L2188S;ENSP00000389907:L1854S	ENSP00000348498:L2188S	L	+	2	0	NF1	26688710	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.518000	0.81795	2.178000	0.69098	0.533000	0.62120	TTG		0.358	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256351.2		NM_000267	
NKX2-2	4821	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	20	21492858	21492858	+	Missense_Mutation	SNP	C	C	G			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr20:21492858C>G	ENST00000377142.4	-	2	881	c.525G>C	c.(523-525)tgG>tgC	p.W175C	NKX2-2-AS1_ENST00000549659.1_RNA	NM_002509.3	NP_002500.1	O95096	NKX22_HUMAN	NK2 homeobox 2	175					astrocyte differentiation (GO:0048708)|brain development (GO:0007420)|digestive tract development (GO:0048565)|endocrine pancreas development (GO:0031018)|negative regulation of neuron differentiation (GO:0045665)|neuron fate specification (GO:0048665)|oligodendrocyte development (GO:0014003)|optic nerve development (GO:0021554)|pancreatic A cell fate commitment (GO:0003326)|pancreatic PP cell fate commitment (GO:0003329)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to glucose (GO:0009749)|response to progesterone (GO:0032570)|smoothened signaling pathway (GO:0007224)|spinal cord motor neuron differentiation (GO:0021522)|spinal cord oligodendrocyte cell fate specification (GO:0021530)|transcription, DNA-templated (GO:0006351)|type B pancreatic cell development (GO:0003323)|type B pancreatic cell fate commitment (GO:0003327)|ventral spinal cord interneuron fate determination (GO:0060580)	nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|core promoter proximal region DNA binding (GO:0001159)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)	p.W175C(1)		endometrium(2)|kidney(2)|large_intestine(2)|lung(10)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	21						GGTTCTGGAACCAGATCTTGA	0.692																																																	1	Substitution - Missense(1)	kidney(1)											42.0	44.0	43.0					20																	21492858		2202	4300	6502	SO:0001583	missense	4821			AF019415	CCDS13145.1	20p11.22	2012-03-09	2007-07-09	2002-10-04	ENSG00000125820	ENSG00000125820		"""Homeoboxes / ANTP class : NKL subclass"""	7835	protein-coding gene	gene with protein product		604612	"""NK-2 (Drosophila) homolog B"", ""NK2 transcription factor related, locus 2 (Drosophila)"""	NKX2B		9703340, 1346742	Standard	NM_002509		Approved	NKX2.2	uc002wsi.3	O95096	OTTHUMG00000170524	ENST00000377142.4:c.525G>C	20.37:g.21492858C>G	ENSP00000366347:p.Trp175Cys	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000377142.4	37	CCDS13145.1	.	.	.	.	.	.	.	.	.	.	C	19.53	3.845485	0.71603	.	.	ENSG00000125820	ENST00000377142	D	0.99822	-6.94	5.25	5.25	0.73442	Homeobox, eukaryotic (2);Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.99912	0.9958	H	0.99726	4.73	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96127	0.9089	10	0.87932	D	0	.	14.1628	0.65457	0.0:0.9252:0.0:0.0748	.	175	O95096	NKX22_HUMAN	C	175	ENSP00000366347:W175C	ENSP00000366347:W175C	W	-	3	0	NKX2-2	21440858	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.808000	0.86044	2.442000	0.82660	0.462000	0.41574	TGG		0.692	NKX2-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078278.9			
PABPC3	5042	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	13	25670549	25670549	+	Silent	SNP	C	C	G			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr13:25670549C>G	ENST00000281589.3	+	1	250	c.213C>G	c.(211-213)acC>acG	p.T71T		NM_030979.2	NP_112241.2	Q9H361	PABP3_HUMAN	poly(A) binding protein, cytoplasmic 3	71	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA metabolic process (GO:0016071)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)	p.T71T(1)		breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|pancreas(1)|skin(3)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)		CTCTGGACACCATGAATTTTG	0.493																																																	1	Substitution - coding silent(1)	kidney(1)											80.0	72.0	75.0					13																	25670549		2203	4300	6503	SO:0001819	synonymous_variant	5042			AF132026	CCDS9311.1	13q12-q13	2013-02-12	2001-11-28		ENSG00000151846	ENSG00000151846		"""RNA binding motif (RRM) containing"""	8556	protein-coding gene	gene with protein product	"""testis PABP"""	604680	"""poly(A)-binding protein, cytoplasmic 3"""	PABPL3		8432538, 10543404	Standard	NM_030979		Approved	PABP3, tPABP	uc001upy.3	Q9H361	OTTHUMG00000016601	ENST00000281589.3:c.213C>G	13.37:g.25670549C>G		Somatic		WXS	Illumina HiSeq	Phase_I	Q8NHV0|Q9H086	Silent	SNP	ENST00000281589.3	37	CCDS9311.1																																																																																				0.493	PABPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044220.2		NM_030979	
PBRM1	55193	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	52649438	52649438	+	Missense_Mutation	SNP	A	A	T			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr3:52649438A>T	ENST00000296302.7	-	15	1854	c.1853T>A	c.(1852-1854)cTc>cAc	p.L618H	PBRM1_ENST00000356770.4_Missense_Mutation_p.L586H|PBRM1_ENST00000409114.3_Missense_Mutation_p.L633H|PBRM1_ENST00000409057.1_Missense_Mutation_p.L618H|PBRM1_ENST00000337303.4_Missense_Mutation_p.L618H|PBRM1_ENST00000394830.3_Missense_Mutation_p.L618H|PBRM1_ENST00000409767.1_Missense_Mutation_p.L633H|PBRM1_ENST00000410007.1_Missense_Mutation_p.L618H			Q86U86	PB1_HUMAN	polybromo 1	618					chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.L618H(2)|p.L586H(1)		breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		TTTCTCCTTGAGTAACTTCTC	0.373			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																			Rec	yes		3	3p21	55193	polybromo 1		E	3	Substitution - Missense(3)	kidney(3)											114.0	103.0	107.0					3																	52649438		2203	4300	6503	SO:0001583	missense	55193			BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.1853T>A	3.37:g.52649438A>T	ENSP00000296302:p.Leu618His	Somatic		WXS	Illumina HiSeq	Phase_I	A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Missense_Mutation	SNP	ENST00000296302.7	37		.	.	.	.	.	.	.	.	.	.	A	23.8	4.459501	0.84317	.	.	ENSG00000163939	ENST00000356770;ENST00000394830;ENST00000296302;ENST00000337303;ENST00000409057;ENST00000410007;ENST00000409114;ENST00000409767;ENST00000423351;ENST00000446103	T;T;T;T;T;T;T;T;T;T	0.20200	2.09;2.09;2.09;2.09;2.09;2.09;2.09;2.09;2.09;2.09	5.69	5.69	0.88448	Bromodomain (3);	0.061216	0.64402	D	0.000004	T	0.37210	0.0995	L	0.32530	0.975	0.58432	D	0.999992	D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D	0.87578	0.998;0.998;0.996;0.998;0.996;0.998;0.998;0.998;0.996	T	0.15578	-1.0432	10	0.87932	D	0	0.8528	15.944	0.79779	1.0:0.0:0.0:0.0	.	618;618;618;618;633;633;618;586;618	Q86U86-9;Q86U86-6;Q86U86-4;Q86U86-2;Q86U86-8;Q86U86-7;Q86U86;Q86U86-3;Q86U86-5	.;.;.;.;.;.;PB1_HUMAN;.;.	H	586;618;618;618;618;618;633;633;618;577	ENSP00000349213:L586H;ENSP00000378307:L618H;ENSP00000296302:L618H;ENSP00000338302:L618H;ENSP00000386593:L618H;ENSP00000386529:L618H;ENSP00000386643:L633H;ENSP00000386601:L633H;ENSP00000387775:L618H;ENSP00000397662:L577H	ENSP00000296302:L618H	L	-	2	0	PBRM1	52624478	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	9.339000	0.96797	2.170000	0.68504	0.379000	0.24179	CTC		0.373	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000327232.1		NM_018165	
PCDHB8	56128	broad.mit.edu;hgsc.bcm.edu	37	5	140559547	140559547	+	Silent	SNP	G	G	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr5:140559547G>A	ENST00000239444.2	+	1	2177	c.1932G>A	c.(1930-1932)ctG>ctA	p.L644L	PCDHB16_ENST00000361016.2_5'Flank	NM_019120.3	NP_061993.2	Q9UN66	PCDB8_HUMAN	protocadherin beta 8	644	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.L644L(1)		NS(2)|breast(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(14)|liver(1)|lung(38)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGGTGGTGCTGGTCAAGGACA	0.701																																																	1	Substitution - coding silent(1)	kidney(1)											19.0	22.0	21.0					5																	140559547		2141	4200	6341	SO:0001819	synonymous_variant	56128			AF152501	CCDS4250.1	5q31	2010-01-26			ENSG00000120322	ENSG00000120322		"""Cadherins / Protocadherins : Clustered"""	8693	other	protocadherin		606334				10380929	Standard	NM_019120		Approved	PCDH-BETA8, PCDH3I	uc011dai.2	Q9UN66	OTTHUMG00000129621	ENST00000239444.2:c.1932G>A	5.37:g.140559547G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B9EGV1	Silent	SNP	ENST00000239444.2	37	CCDS4250.1																																																																																				0.701	PCDHB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251816.2		NM_019120	
PCIF1	63935	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	20	44575022	44575022	+	Splice_Site	DEL	G	G	-			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr20:44575022delG	ENST00000372409.3	+	14	1976	c.1612delG	c.(1612-1614)ggg>gg	p.G538fs	PCIF1_ENST00000479348.1_3'UTR	NM_022104.3	NP_071387.1	Q9H4Z3	PCIF1_HUMAN	PDX1 C-terminal inhibiting factor 1	538					negative regulation of phosphatase activity (GO:0010923)	intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	20						TGGCTCCCGCGGGTGAGGGCC	0.642																																																	0													85.0	84.0	84.0					20																	44575022		2203	4300	6503	SO:0001630	splice_region_variant	63935			AB050014	CCDS13388.1	20q13.12	2014-06-13	2008-04-29	2008-04-29	ENSG00000100982	ENSG00000100982			16200	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 121"""		"""chromosome 20 open reading frame 67"""	C20orf67		12565871, 15121856	Standard	NM_022104		Approved	bA465L10.1, PPP1R121	uc002xqs.3	Q9H4Z3	OTTHUMG00000032635	ENST00000372409.3:c.1613+1G>-	20.37:g.44575022delG		Somatic		WXS	Illumina HiSeq	Phase_I	E1P5P1|Q54AB9|Q9NT85	Frame_Shift_Del	DEL	ENST00000372409.3	37	CCDS13388.1																																																																																				0.642	PCIF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079550.1		NM_022104	Frame_Shift_Del
PCSK6	5046	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	101938736	101938737	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	TT	TT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr15:101938736_101938737delTT	ENST00000348070.1	-	8	864_865	c.865_866delAA	c.(865-867)aagfs	p.K289fs	PCSK6_ENST00000398181.2_Frame_Shift_Del_p.K289fs|PCSK6_ENST00000331826.7_Frame_Shift_Del_p.K124fs|PCSK6_ENST00000344273.2_Frame_Shift_Del_p.K289fs|PCSK6_ENST00000561177.1_5'UTR|PCSK6_ENST00000358417.3_Frame_Shift_Del_p.K289fs	NM_002570.3|NM_138320.1	NP_002561.1|NP_612193.1	P29122	PCSK6_HUMAN	proprotein convertase subtilisin/kexin type 6	290	Peptidase S8.				determination of left/right symmetry (GO:0007368)|glycoprotein metabolic process (GO:0009100)|nerve growth factor processing (GO:0032455)|nerve growth factor production (GO:0032902)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptide hormone processing (GO:0016486)|protein processing (GO:0016485)|regulation of BMP signaling pathway (GO:0030510)|secretion by cell (GO:0032940)|zygotic determination of anterior/posterior axis, embryo (GO:0007354)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|heparin binding (GO:0008201)|nerve growth factor binding (GO:0048406)|serine-type endopeptidase activity (GO:0004252)	p.K289T(2)		breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(17)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	Lung NSC(78;0.00102)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000803)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			GCCCAGCGACTTTGCCTCGACC	0.649																																																	2	Substitution - Missense(2)	large_intestine(2)																																								SO:0001589	frameshift_variant	5046				CCDS73789.1, CCDS73790.1, CCDS73791.1, CCDS73792.1, CCDS73793.1	15q26	2008-07-18	2004-06-14	2004-06-16		ENSG00000140479			8569	protein-coding gene	gene with protein product	"""subtilisin-like protease"", ""subtilisin-like proprotein convertase 4"", ""subtilisin/kexin-like protease PACE4"""	167405	"""paired basic amino acid cleaving system 4"""	PACE4		1741956	Standard	NM_002570		Approved	SPC4	uc002bwy.3	P29122		ENST00000348070.1:c.865_866delAA	15.37:g.101938736_101938737delTT	ENSP00000305056:p.Lys289fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q15099|Q15100|Q9UEG7|Q9UEJ1|Q9UEJ2|Q9UEJ7|Q9UEJ8|Q9UEJ9|Q9Y4G9|Q9Y4H0|Q9Y4H1	Frame_Shift_Del	DEL	ENST00000348070.1	37																																																																																					0.649	PCSK6-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding			NM_002570	
PIGB	9488	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	55621962	55621962	+	Missense_Mutation	SNP	G	G	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr15:55621962G>A	ENST00000164305.5	+	5	854	c.563G>A	c.(562-564)tGt>tAt	p.C188Y	PIGB_ENST00000539642.1_5'UTR	NM_004855.4	NP_004846.4	Q92521	PIGB_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class B	188					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|mannosylation (GO:0097502)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	mannosyltransferase activity (GO:0000030)	p.C188Y(1)		endometrium(3)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)	11				all cancers(107;0.0255)		TGGTATTGCTGTACCAGAACC	0.353																																																	1	Substitution - Missense(1)	kidney(1)											196.0	188.0	190.0					15																	55621962		1823	4076	5899	SO:0001583	missense	9488			D42138	CCDS61641.1	15q21.3	2013-02-26	2006-06-28		ENSG00000069943	ENSG00000069943		"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"", ""Phosphatidylinositol glycan anchor biosynthesis"""	8959	protein-coding gene	gene with protein product	"""GPI mannosyltransferase 3"", ""dol-P-Man dependent GPI mannosyltransferase"""	604122	"""phosphatidylinositol glycan, class B"""			8861954	Standard	NM_004855		Approved		uc002act.3	Q92521	OTTHUMG00000172654	ENST00000164305.5:c.563G>A	15.37:g.55621962G>A	ENSP00000164305:p.Cys188Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	Q53FF9|Q8WVN7	Missense_Mutation	SNP	ENST00000164305.5	37		.	.	.	.	.	.	.	.	.	.	G	19.26	3.793854	0.70452	.	.	ENSG00000069943	ENST00000164305	T	0.62941	-0.01	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	T	0.68860	0.3047	L	0.53249	1.67	0.80722	D	1	D	0.58268	0.982	P	0.60236	0.871	T	0.62609	-0.6818	10	0.02654	T	1	-22.4431	17.1412	0.86754	0.0:0.0:1.0:0.0	.	188	Q92521	PIGB_HUMAN	Y	188	ENSP00000164305:C188Y	ENSP00000164305:C188Y	C	+	2	0	PIGB	53409254	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.937000	0.75898	2.832000	0.97577	0.655000	0.94253	TGT		0.353	PIGB-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000419687.1		NM_004855	
PIGT	51604	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	20	44050027	44050027	+	Silent	SNP	C	C	T	rs141166012		TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr20:44050027C>T	ENST00000279036.6	+	9	1118	c.1038C>T	c.(1036-1038)gcC>gcT	p.A346A	PIGT_ENST00000535404.1_Silent_p.A191A|PIGT_ENST00000543458.2_Silent_p.A290A|PIGT_ENST00000341555.5_Silent_p.A152A|PIGT_ENST00000545755.1_Silent_p.A84A|PIGT_ENST00000279035.9_Silent_p.A244A|PIGT_ENST00000372689.5_Intron	NM_015937.5	NP_057021.2	Q969N2	PIGT_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class T	346					attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|neuron apoptotic process (GO:0051402)|neuron differentiation (GO:0030182)|post-translational protein modification (GO:0043687)	cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum membrane (GO:0005789)|GPI-anchor transamidase complex (GO:0042765)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)	GPI-anchor transamidase activity (GO:0003923)	p.A346A(2)		breast(1)|endometrium(2)|kidney(5)|large_intestine(4)|lung(7)|pancreas(1)|skin(1)|stomach(1)	22		Myeloproliferative disorder(115;0.0122)				ACACAGAGGCCCCCCCAGTGC	0.577																																																	2	Substitution - coding silent(2)	kidney(2)											31.0	32.0	32.0					20																	44050027		2203	4300	6503	SO:0001819	synonymous_variant	51604				CCDS13353.1, CCDS54464.1, CCDS54465.1, CCDS54466.1	20q12-q13.12	2013-02-26	2006-06-28		ENSG00000124155	ENSG00000124155		"""Phosphatidylinositol glycan anchor biosynthesis"""	14938	protein-coding gene	gene with protein product	"""GPI transamidase subunit"""	610272	"""phosphatidylinositol glycan, class T"""			15713669	Standard	NM_015937		Approved		uc002xoh.3	Q969N2	OTTHUMG00000032574	ENST00000279036.6:c.1038C>T	20.37:g.44050027C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B2RND5|B7Z3N1|B7Z7I8|E1P622|G8JLF5|Q2NL69|Q7Z3N7|Q9BQY7|Q9BQY8|Q9UJG6|Q9Y2Z5	Silent	SNP	ENST00000279036.6	37	CCDS13353.1																																																																																				0.577	PIGT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079434.2		NM_015937	
PIK3R6	146850	broad.mit.edu	37	17	8738616	8738616	+	Missense_Mutation	SNP	C	C	A	rs369528341		TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr17:8738616C>A	ENST00000311434.9	-	8	858	c.619G>T	c.(619-621)Gca>Tca	p.A207S	PIK3R6_ENST00000434064.2_5'UTR	NM_001010855.2	NP_001010855.1	Q5UE93	PI3R6_HUMAN	phosphoinositide-3-kinase, regulatory subunit 6	207					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|G-protein coupled receptor signaling pathway (GO:0007186)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of MAP kinase activity (GO:0043406)|regulation of phosphatidylinositol 3-kinase activity (GO:0043551)|small molecule metabolic process (GO:0044281)	1-phosphatidylinositol-4-phosphate 3-kinase, class IB complex (GO:0005944)|cytosol (GO:0005829)|membrane (GO:0016020)	1-phosphatidylinositol-3-kinase regulator activity (GO:0046935)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)	p.A288S(1)									AGAGCGCCTGCGTGACAGGCC	0.667																																																	1	Substitution - Missense(1)	kidney(1)											14.0	17.0	16.0					17																	8738616		2039	4173	6212	SO:0001583	missense	146850			AK091819	CCDS73985.1	17p13.1	2013-01-31	2008-02-04	2008-02-04	ENSG00000174083	ENSG00000276231			27101	protein-coding gene	gene with protein product		611462	"""chromosome 17 open reading frame 38"""	C17orf38		16476736	Standard	NM_001010855		Approved	FLJ34500, HsT41028, p87PIKAP	uc002glq.1	Q5UE93	OTTHUMG00000132861	ENST00000311434.9:c.619G>T	17.37:g.8738616C>A	ENSP00000475670:p.Ala207Ser	Somatic		WXS	Illumina GAIIx	Phase_I	Q658R3	Missense_Mutation	SNP	ENST00000311434.9	37																																																																																					0.667	PIK3R6-201	KNOWN	basic|appris_principal	protein_coding	protein_coding			NM_001010855	
PLD4	122618	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	105396381	105396381	+	Missense_Mutation	SNP	T	T	C			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr14:105396381T>C	ENST00000392593.4	+	6	824	c.656T>C	c.(655-657)gTt>gCt	p.V219A	PLD4_ENST00000553861.1_5'Flank|PLD4_ENST00000540372.1_Missense_Mutation_p.V226A	NM_138790.2	NP_620145.2	Q96BZ4	PLD4_HUMAN	phospholipase D family, member 4	219	PLD phosphodiesterase 1. {ECO:0000255|PROSITE-ProRule:PRU00153}.				glycerophospholipid biosynthetic process (GO:0046474)|hematopoietic progenitor cell differentiation (GO:0002244)|inositol phosphate metabolic process (GO:0043647)|lipid catabolic process (GO:0016042)|phagocytosis (GO:0006909)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|phagocytic vesicle (GO:0045335)|trans-Golgi network membrane (GO:0032588)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase D activity (GO:0004630)	p.V202A(1)|p.V219A(1)		central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	13		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.00067)|OV - Ovarian serous cystadenocarcinoma(23;0.00976)|Epithelial(46;0.0201)|GBM - Glioblastoma multiforme(11;0.116)			AAATTCTGGGTTGTGGATGGA	0.587																																																	2	Substitution - Missense(2)	kidney(2)											85.0	90.0	88.0					14																	105396381		2070	4211	6281	SO:0001583	missense	122618				CCDS9995.2	14q32.33	2014-01-28	2005-05-20	2005-05-20	ENSG00000166428	ENSG00000166428			23792	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 175"""	C14orf175			Standard	XM_006720024		Approved		uc001ypu.1	Q96BZ4	OTTHUMG00000144167	ENST00000392593.4:c.656T>C	14.37:g.105396381T>C	ENSP00000376372:p.Val219Ala	Somatic		WXS	Illumina HiSeq	Phase_I	Q6UWD2	Missense_Mutation	SNP	ENST00000392593.4	37	CCDS9995.2	.	.	.	.	.	.	.	.	.	.	T	17.56	3.420166	0.62622	.	.	ENSG00000166428	ENST00000540372;ENST00000392593;ENST00000557573	T;T;T	0.25250	2.29;2.29;1.81	3.87	3.87	0.44632	Phospholipase D/Transphosphatidylase (3);	0.150752	0.44097	D	0.000487	T	0.34077	0.0885	M	0.74881	2.28	0.80722	D	1	P;B	0.36959	0.575;0.44	B;B	0.40901	0.343;0.186	T	0.30268	-0.9984	10	0.59425	D	0.04	-1.4464	12.6315	0.56659	0.0:0.0:0.0:1.0	.	226;219	F5H2B5;Q96BZ4	.;PLD4_HUMAN	A	226;219;217	ENSP00000438677:V226A;ENSP00000376372:V219A;ENSP00000451278:V217A	ENSP00000376372:V219A	V	+	2	0	PLD4	104467426	1.000000	0.71417	0.940000	0.37924	0.868000	0.49771	5.943000	0.70211	1.517000	0.48917	0.459000	0.35465	GTT		0.587	PLD4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000291348.2		NM_138790	
PRDM4	11108	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	108145796	108145797	+	Frame_Shift_Ins	INS	-	-	C			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr12:108145796_108145797insC	ENST00000228437.5	-	5	980_981	c.521_522insG	c.(520-522)ggtfs	p.G174fs	PRDM4_ENST00000547268.1_5'Flank|RP11-864J10.4_ENST00000546714.1_RNA	NM_012406.3	NP_036538.3	Q9UKN5	PRDM4_HUMAN	PR domain containing 4	174					cell proliferation (GO:0008283)|negative regulation of cell cycle (GO:0045786)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|methyltransferase activity (GO:0008168)|zinc ion binding (GO:0008270)			biliary_tract(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|prostate(2)|skin(2)|urinary_tract(1)	20						GACTTTGGGCACCATGTGTGTT	0.47																																																	0																																										SO:0001589	frameshift_variant	11108			AF144757	CCDS9115.1	12q23-q24.1	2013-01-08				ENSG00000110851		"""Zinc fingers, C2H2-type"""	9348	protein-coding gene	gene with protein product		605780				10552934	Standard	NM_012406		Approved	PFM1	uc001tmp.3	Q9UKN5	OTTHUMG00000169914	ENST00000228437.5:c.522dupG	12.37:g.108145798_108145798dupC	ENSP00000228437:p.Gly174fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q9UFA6	Frame_Shift_Ins	INS	ENST00000228437.5	37	CCDS9115.1																																																																																				0.470	PRDM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406546.1		NM_012406	
PRKD1	5587	broad.mit.edu;hgsc.bcm.edu	37	14	30132919	30132919	+	Missense_Mutation	SNP	C	C	T			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr14:30132919C>T	ENST00000331968.5	-	4	911	c.682G>A	c.(682-684)Gat>Aat	p.D228N	PRKD1_ENST00000415220.2_Missense_Mutation_p.D228N	NM_002742.2	NP_002733.2	Q15139	KPCD1_HUMAN	protein kinase D1	228					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|cellular response to oxidative stress (GO:0034599)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|Golgi organization (GO:0007030)|Golgi vesicle transport (GO:0048193)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|negative regulation of cell death (GO:0060548)|negative regulation of endocytosis (GO:0045806)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein autophosphorylation (GO:0046777)|regulation of integrin-mediated signaling pathway (GO:2001044)|regulation of keratinocyte proliferation (GO:0010837)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)	p.D228N(2)		NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|lung(32)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	78	Hepatocellular(127;0.0604)		LUAD - Lung adenocarcinoma(48;0.00527)|Lung(238;0.0252)	GBM - Glioblastoma multiforme(265;0.00888)		AGGGGCTCATCAGGGGCACTT	0.527																																																	2	Substitution - Missense(2)	kidney(2)											158.0	152.0	154.0					14																	30132919		2203	4300	6503	SO:0001583	missense	5587				CCDS9637.1	14q11	2013-01-10	2004-10-28	2004-10-30	ENSG00000184304	ENSG00000184304	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	9407	protein-coding gene	gene with protein product		605435	"""protein kinase C, mu"""	PRKCM		8119958, 10965134	Standard	NM_002742		Approved	PKCM, PKD, PKC-mu	uc001wqh.3	Q15139	OTTHUMG00000140203	ENST00000331968.5:c.682G>A	14.37:g.30132919C>T	ENSP00000333568:p.Asp228Asn	Somatic		WXS	Illumina HiSeq	Phase_I	A6NL64|B2RAF6	Missense_Mutation	SNP	ENST00000331968.5	37	CCDS9637.1	.	.	.	.	.	.	.	.	.	.	C	19.15	3.771098	0.69992	.	.	ENSG00000184304	ENST00000331968;ENST00000415220	T;T	0.66460	-0.19;-0.21	5.93	5.93	0.95920	.	0.052975	0.64402	D	0.000001	T	0.68007	0.2954	L	0.56769	1.78	0.80722	D	1	P	0.41420	0.749	B	0.40741	0.339	T	0.66677	-0.5863	10	0.38643	T	0.18	-16.9773	20.3368	0.98748	0.0:1.0:0.0:0.0	.	228	Q15139	KPCD1_HUMAN	N	228	ENSP00000333568:D228N;ENSP00000390535:D228N	ENSP00000333568:D228N	D	-	1	0	PRKD1	29202670	1.000000	0.71417	0.943000	0.38184	0.989000	0.77384	5.562000	0.67346	2.805000	0.96524	0.655000	0.94253	GAT		0.527	PRKD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000276611.2		NM_002742	
PROL1	58503	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	71275489	71275489	+	Silent	SNP	C	C	T			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr4:71275489C>T	ENST00000399575.2	+	3	618	c.444C>T	c.(442-444)acC>acT	p.T148T	PROL1_ENST00000514338.1_3'UTR	NM_021225.4	NP_067048.4	Q99935	PROL1_HUMAN	proline rich, lacrimal 1	148	Thr-rich.				negative regulation of endopeptidase activity (GO:0010951)|regulation of sensory perception of pain (GO:0051930)|retina homeostasis (GO:0001895)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	endopeptidase inhibitor activity (GO:0004866)|peptidase inhibitor activity (GO:0030414)	p.T148T(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)|skin(3)	15		all_hematologic(202;0.196)				ACATCACCACCGCAGATACAA	0.448																																																	1	Substitution - coding silent(1)	kidney(1)											189.0	211.0	204.0					4																	71275489		1975	4164	6139	SO:0001819	synonymous_variant	58503			S83198	CCDS43235.1	4q13.3	2011-10-28	2005-02-07		ENSG00000171199	ENSG00000171199			17279	protein-coding gene	gene with protein product		608936	"""proline rich 1"""			8670737	Standard	NM_021225		Approved	BPLP, PRL1, opiorphin	uc003hfi.3	Q99935	OTTHUMG00000160845	ENST00000399575.2:c.444C>T	4.37:g.71275489C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A8MZ07|P85047	Silent	SNP	ENST00000399575.2	37	CCDS43235.1																																																																																				0.448	PROL1-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000362639.1		NM_021225	
PTDSS1	9791	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	97342498	97342498	+	Missense_Mutation	SNP	C	C	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr8:97342498C>A	ENST00000517309.1	+	11	1557	c.1231C>A	c.(1231-1233)Cac>Aac	p.H411N	PTDSS1_ENST00000455950.2_Missense_Mutation_p.H265N|PTDSS1_ENST00000522072.1_Missense_Mutation_p.H208N	NM_014754.1	NP_055569.1	P48651	PTSS1_HUMAN	phosphatidylserine synthase 1	411					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylserine biosynthetic process (GO:0006659)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity (GO:0016740)	p.H411N(1)		endometrium(2)|kidney(2)|large_intestine(8)|lung(14)|ovary(1)|prostate(1)|stomach(1)	29	Breast(36;6.18e-05)				Phosphatidylserine(DB00144)	ACACTATGGTCACCGAGAAAA	0.453																																																	1	Substitution - Missense(1)	kidney(1)											118.0	104.0	109.0					8																	97342498		2203	4300	6503	SO:0001583	missense	9791			D14694	CCDS6271.1	8q22	2008-05-02			ENSG00000156471	ENSG00000156471			9587	protein-coding gene	gene with protein product		612792					Standard	NM_014754		Approved	KIAA0024, PSSA, PSS1	uc003yht.1	P48651	OTTHUMG00000164687	ENST00000517309.1:c.1231C>A	8.37:g.97342498C>A	ENSP00000430548:p.His411Asn	Somatic		WXS	Illumina HiSeq	Phase_I	E5RFC5|Q9BUQ5	Missense_Mutation	SNP	ENST00000517309.1	37	CCDS6271.1	.	.	.	.	.	.	.	.	.	.	C	13.93	2.385294	0.42308	.	.	ENSG00000156471	ENST00000517309;ENST00000455950;ENST00000522072	T;T;T	0.42900	1.02;1.01;0.96	5.6	5.6	0.85130	.	0.213391	0.50627	D	0.000112	T	0.27559	0.0677	N	0.14661	0.345	0.40799	D	0.983329	B	0.02656	0.0	B	0.04013	0.001	T	0.09997	-1.0649	10	0.16420	T	0.52	-15.3401	16.5306	0.84357	0.0:1.0:0.0:0.0	.	411	P48651	PTSS1_HUMAN	N	411;265;208	ENSP00000430548:H411N;ENSP00000401248:H265N;ENSP00000430928:H208N	ENSP00000401248:H265N	H	+	1	0	PTDSS1	97411674	0.999000	0.42202	0.996000	0.52242	0.647000	0.38526	3.219000	0.51200	2.631000	0.89168	0.561000	0.74099	CAC		0.453	PTDSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379743.2			
PTPN18	26469	broad.mit.edu	37	2	131129929	131129934	+	In_Frame_Del	DEL	GACGGG	GACGGG	-	rs112040677	byFrequency	TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	GACGGG	GACGGG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr2:131129929_131129934delGACGGG	ENST00000175756.5	+	13	1214_1219	c.1113_1118delGACGGG	c.(1111-1119)cagacgggg>cag	p.TG378del	PTPN18_ENST00000347849.3_In_Frame_Del_p.TG271del	NM_014369.3	NP_055184.2	Q99952	PTN18_HUMAN	protein tyrosine phosphatase, non-receptor type 18 (brain-derived)	378				Missing (in Ref. 1; CAA56105). {ECO:0000305}.	peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)	p.T378_G379delTG(1)		endometrium(1)|kidney(3)|large_intestine(2)|lung(5)|ovary(3)|prostate(1)	15	Colorectal(110;0.1)					gtgggacgcagacggggacggggacg	0.777														1724	0.344249	0.6324	0.2349	5008	,	,		12983	0.3214		0.2008	False		,,,				2504	0.2035																1	Deletion - In frame(1)	prostate(1)							,	1068,966		446,176,395					,	-3.8	0.0		dbSNP_132	3	951,4205		280,391,1907	no	coding,coding	PTPN18	NM_014369.3,NM_001142370.1	,	726,567,2302	A1A1,A1R,RR		18.4445,47.4926,28.0807	,	,		2019,5171				SO:0001651	inframe_deletion	26469			X79568	CCDS2161.1, CCDS46410.1	2q21	2011-06-09			ENSG00000072135	ENSG00000072135		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9649	protein-coding gene	gene with protein product		606587				8950995	Standard	NM_014369		Approved	BDP1	uc002trc.3	Q99952	OTTHUMG00000131630	ENST00000175756.5:c.1113_1118delGACGGG	2.37:g.131129935_131129940delGACGGG	ENSP00000175756:p.Thr378_Gly379del	Somatic		WXS	Illumina GAIIx	Phase_I	B4E1E6|Q53P42	In_Frame_Del	DEL	ENST00000175756.5	37	CCDS2161.1																																																																																				0.777	PTPN18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254523.2			
RAD51AP2	729475	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	17697415	17697415	+	Silent	SNP	T	T	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr2:17697415T>A	ENST00000399080.2	-	1	2291	c.2268A>T	c.(2266-2268)gtA>gtT	p.V756V		NM_001099218.2	NP_001092688.1	Q09MP3	R51A2_HUMAN	RAD51 associated protein 2	756								p.V756V(1)		endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(10)|liver(1)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	49	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					TGTGCATATTTACTTCATAAA	0.323																																																	1	Substitution - coding silent(1)	kidney(1)											98.0	90.0	93.0					2																	17697415		1820	4078	5898	SO:0001819	synonymous_variant	729475			AK310498	CCDS42656.1	2p24.2	2009-01-13			ENSG00000214842	ENSG00000214842			34417	protein-coding gene	gene with protein product						16990250	Standard	NM_001099218		Approved	FLJ17540	uc002rcl.1	Q09MP3	OTTHUMG00000151761	ENST00000399080.2:c.2268A>T	2.37:g.17697415T>A		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000399080.2	37	CCDS42656.1																																																																																				0.323	RAD51AP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323801.3		NM_001099218	
MSMP	692094	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	35752830	35752830	+	IGR	SNP	T	T	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr9:35752830T>A	ENST00000436428.2	-	0	670				RGP1_ENST00000456972.2_Missense_Mutation_p.Y419N|RGP1_ENST00000378078.4_Missense_Mutation_p.Y379N|GBA2_ENST00000545786.1_5'Flank|MSMP_ENST00000414286.1_5'Flank	NM_001044264.2	NP_001037729.1	Q1L6U9	MSMP_HUMAN	microseminoprotein, prostate associated							cytoplasm (GO:0005737)|extracellular space (GO:0005615)		p.Y419N(1)|p.Y379N(1)		endometrium(2)|kidney(1)|lung(3)|prostate(3)	9						CCTGGCCTCATATGCTGCCCC	0.587																																																	2	Substitution - Missense(2)	kidney(2)											33.0	34.0	34.0					9																	35752830		1988	4144	6132	SO:0001628	intergenic_variant	9827			DQ012170	CCDS43797.1	9p13.3	2012-10-02			ENSG00000215183	ENSG00000215183			29663	protein-coding gene	gene with protein product		612191				17338636	Standard	NM_001044264		Approved	PC-3, PSMP	uc003zyb.2	Q1L6U9	OTTHUMG00000019882		9.37:g.35752830T>A		Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000436428.2	37	CCDS43797.1	.	.	.	.	.	.	.	.	.	.	T	12.93	2.084127	0.36758	.	.	ENSG00000107185	ENST00000456972;ENST00000378078	.	.	.	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.54631	0.1870	L	0.50919	1.6	0.80722	D	1	B;B	0.20550	0.046;0.046	B;B	0.17098	0.017;0.017	T	0.52102	-0.8620	9	0.09084	T	0.74	-3.2517	15.5577	0.76213	0.0:0.0:0.0:1.0	.	379;379	Q92546;A8K0K1	RGP1_HUMAN;.	N	419;379	.	ENSP00000367318:Y379N	Y	+	1	0	RGP1	35742830	1.000000	0.71417	0.951000	0.38953	0.958000	0.62258	6.340000	0.72973	2.263000	0.75096	0.533000	0.62120	TAT		0.587	MSMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052384.2		NM_001044264	
RIC8B	55188	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	107209026	107209026	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr12:107209026G>T	ENST00000392839.2	+	3	791	c.685G>T	c.(685-687)Gag>Tag	p.E229*	RIC8B_ENST00000549643.1_Intron|RIC8B_ENST00000392837.4_Nonsense_Mutation_p.E229*|RIC8B_ENST00000355478.2_Nonsense_Mutation_p.E189*	NM_018157.2	NP_060627.2	Q9NVN3	RIC8B_HUMAN	RIC8 guanine nucleotide exchange factor B	229					regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	G-protein alpha-subunit binding (GO:0001965)|guanyl-nucleotide exchange factor activity (GO:0005085)	p.E229*(1)		kidney(2)|large_intestine(5)|lung(10)|ovary(1)|urinary_tract(1)	19						CTGTGCCATTGAGGCCCTCAA	0.463																																																	1	Substitution - Nonsense(1)	kidney(1)											129.0	121.0	124.0					12																	107209026		2203	4300	6503	SO:0001587	stop_gained	55188			AK128102	CCDS9109.2	12q23.3	2013-08-05	2013-08-05		ENSG00000111785	ENSG00000111785			25555	protein-coding gene	gene with protein product		609147	"""resistance to inhibitors of cholinesterase 8 homolog B (C. elegans)"""				Standard	XM_005268998		Approved	FLJ10620, hSyn, RIC8	uc001tlx.3	Q9NVN3	OTTHUMG00000144188	ENST00000392839.2:c.685G>T	12.37:g.107209026G>T	ENSP00000376583:p.Glu229*	Somatic		WXS	Illumina HiSeq	Phase_I	A2RTZ0|Q4G103|Q6ZRN4|Q86WD3	Nonsense_Mutation	SNP	ENST00000392839.2	37	CCDS9109.2	.	.	.	.	.	.	.	.	.	.	G	37	6.134890	0.97315	.	.	ENSG00000111785	ENST00000392837;ENST00000392839;ENST00000355478	.	.	.	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-6.6137	20.2963	0.98556	0.0:0.0:1.0:0.0	.	.	.	.	X	229;229;189	.	ENSP00000347662:E189X	E	+	1	0	RIC8B	105733156	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.187000	0.94912	2.813000	0.96785	0.655000	0.94253	GAG		0.463	RIC8B-006	KNOWN	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000291398.2		NM_018157	
RPUSD2	27079	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	40865743	40865743	+	Silent	SNP	G	G	T			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr15:40865743G>T	ENST00000315616.7	+	3	959	c.921G>T	c.(919-921)gtG>gtT	p.V307V	RPUSD2_ENST00000559271.1_Silent_p.V246V	NM_152260.1	NP_689473.1	Q8IZ73	RUSD2_HUMAN	RNA pseudouridylate synthase domain containing 2	307					pseudouridine synthesis (GO:0001522)		poly(A) RNA binding (GO:0044822)|pseudouridine synthase activity (GO:0009982)	p.V307V(1)		kidney(4)|lung(4)|skin(3)	11		all_cancers(109;2.74e-14)|all_epithelial(112;1.64e-11)|Lung NSC(122;6.69e-09)|all_lung(180;1.22e-07)|Melanoma(134;0.091)|Colorectal(260;0.175)|Ovarian(310;0.243)		GBM - Glioblastoma multiforme(113;3.1e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0786)		AGGAGTACGTGTGCCGGGTGG	0.512																																																	1	Substitution - coding silent(1)	kidney(1)											65.0	65.0	65.0					15																	40865743		2203	4300	6503	SO:0001819	synonymous_variant	27079			AK055971	CCDS10061.1, CCDS66737.1	15q13.3	2013-02-11	2005-01-31	2005-02-07	ENSG00000166133	ENSG00000166133		"""RNA pseudouridylate synthase domain containing"""	24180	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 19"""	C15orf19		12477932	Standard	NM_001286407		Approved	C18B11, FLJ31409	uc001zmd.1	Q8IZ73	OTTHUMG00000130031	ENST00000315616.7:c.921G>T	15.37:g.40865743G>T		Somatic		WXS	Illumina HiSeq	Phase_I	B4DDD1|Q7L989|Q92939|Q96IA7|Q96N50	Silent	SNP	ENST00000315616.7	37	CCDS10061.1																																																																																				0.512	RPUSD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252308.2		NM_152260	
SEMA3C	10512	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	80433459	80433459	+	Missense_Mutation	SNP	G	G	A	rs373225376		TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr7:80433459G>A	ENST00000265361.3	-	8	1325	c.764C>T	c.(763-765)aCg>aTg	p.T255M	SEMA3C_ENST00000544525.1_Missense_Mutation_p.T273M|SEMA3C_ENST00000419255.2_Missense_Mutation_p.T255M|SEMA3C_ENST00000536800.1_Missense_Mutation_p.T107M	NM_006379.3	NP_006370.1	Q99985	SEM3C_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C	255	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|blood vessel remodeling (GO:0001974)|cardiac right ventricle morphogenesis (GO:0003215)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|immune response (GO:0006955)|limb bud formation (GO:0060174)|neural crest cell migration (GO:0001755)|neural tube development (GO:0021915)|outflow tract morphogenesis (GO:0003151)|post-embryonic development (GO:0009791)|pulmonary myocardium development (GO:0003350)|response to drug (GO:0042493)|somitogenesis (GO:0001756)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	receptor activity (GO:0004872)	p.T255M(1)		NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	34						AATCTGTTTCGTGCTCCTGTT	0.368																																																	1	Substitution - Missense(1)	kidney(1)						G	MET/THR	1,4405	2.1+/-5.4	0,1,2202	173.0	161.0	165.0		764	4.7	0.9	7		165	0,8600		0,0,4300	no	missense	SEMA3C	NM_006379.3	81	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	255/752	80433459	1,13005	2203	4300	6503	SO:0001583	missense	10512			AB000220	CCDS5596.1	7q21-q31	2013-01-11			ENSG00000075223	ENSG00000075223		"""Semaphorins"", ""Immunoglobulin superfamily / I-set domain containing"""	10725	protein-coding gene	gene with protein product		602645		SEMAE		7748561, 9168980	Standard	NM_006379		Approved	SemE	uc003uhj.3	Q99985	OTTHUMG00000023447	ENST00000265361.3:c.764C>T	7.37:g.80433459G>A	ENSP00000265361:p.Thr255Met	Somatic		WXS	Illumina HiSeq	Phase_I	B4DRL8	Missense_Mutation	SNP	ENST00000265361.3	37	CCDS5596.1	.	.	.	.	.	.	.	.	.	.	G	13.57	2.276246	0.40294	2.27E-4	0.0	ENSG00000075223	ENST00000265361;ENST00000419255;ENST00000544525;ENST00000536800	T;T;T;T	0.23348	1.91;1.91;1.91;1.91	5.62	4.72	0.59763	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.134142	0.64402	D	0.000002	T	0.46889	0.1416	L	0.55743	1.74	0.58432	D	0.999993	D;D;D	0.89917	0.998;0.999;1.0	P;D;D	0.72625	0.879;0.962;0.978	T	0.47368	-0.9123	10	0.62326	D	0.03	.	16.3716	0.83364	0.0:0.1321:0.8679:0.0	.	107;273;255	B4DRL8;F5H1Z7;Q99985	.;.;SEM3C_HUMAN	M	255;255;273;107	ENSP00000265361:T255M;ENSP00000411193:T255M;ENSP00000445649:T273M;ENSP00000438258:T107M	ENSP00000265361:T255M	T	-	2	0	SEMA3C	80271395	1.000000	0.71417	0.862000	0.33874	0.101000	0.19017	5.620000	0.67736	1.325000	0.45301	0.585000	0.79938	ACG		0.368	SEMA3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253279.1		NM_006379	
SEPT4	5414	hgsc.bcm.edu;ucsc.edu	37	17	56604046	56604064	+	Frame_Shift_Del	DEL	AGAGGAATCATAGGGATCA	AGAGGAATCATAGGGATCA	-	rs565103124		TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	AGAGGAATCATAGGGATCA	AGAGGAATCATAGGGATCA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr17:56604046_56604064delAGAGGAATCATAGGGATCA	ENST00000317268.3	-	2	512_530	c.336_354delTGATCCCTATGATTCCTCT	c.(334-354)cttgatccctatgattcctctfs	p.LDPYDSS112fs	SEPT4_ENST00000412945.3_Frame_Shift_Del_p.LDPYDSS104fs|SEPT4_ENST00000426861.1_Frame_Shift_Del_p.LDPYDSS93fs|SEPT4_ENST00000579371.1_Intron|SEPT4_ENST00000583114.1_5'UTR|SEPT4_ENST00000580844.1_Intron|SEPT4_ENST00000393086.1_Frame_Shift_Del_p.LDPYDSS93fs|SEPT4_ENST00000457347.2_Frame_Shift_Del_p.LDPYDSS127fs|SEPT4_ENST00000317256.6_Frame_Shift_Del_p.LDPYDSS93fs|RP11-112H10.4_ENST00000580769.1_RNA|SEPT4_ENST00000580791.1_5'UTR|RP11-112H10.4_ENST00000578022.1_RNA|SEPT4_ENST00000580809.1_Intron|RP11-112H10.4_ENST00000580589.1_RNA	NM_004574.3	NP_004565.1	O43236	SEPT4_HUMAN	septin 4	112					apoptotic process (GO:0006915)|brain development (GO:0007420)|cell cycle (GO:0007049)|cell division (GO:0051301)|GTP catabolic process (GO:0006184)|positive regulation of apoptotic process (GO:0043065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of protein ubiquitination (GO:0031398)|regulation of apoptotic process (GO:0042981)|sperm capacitation (GO:0048240)|sperm mitochondrion organization (GO:0030382)	cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|sperm annulus (GO:0097227)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural molecule activity (GO:0005198)			NS(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	18	Medulloblastoma(34;0.127)|all_neural(34;0.237)					GCTCTACCTCAGAGGAATCATAGGGATCAAGCTTGCCCC	0.63																																																	0																																										SO:0001589	frameshift_variant	5414			AF073312	CCDS11609.1, CCDS11610.1, CCDS45743.1, CCDS56041.1, CCDS58581.1, CCDS58582.1	17q22	2013-01-21	2005-01-11	2005-01-12	ENSG00000108387	ENSG00000108387		"""Septins"""	9165	protein-coding gene	gene with protein product	"""bradeoin"", ""septin-M"""	603696	"""peanut-like 2 (Drosophila)"""	PNUTL2		9889007	Standard	NM_001198713		Approved	H5, CE5B3, hucep-7, ARTS, hCDCREL-2, MART	uc002iwm.2	O43236		ENST00000317268.3:c.336_354delTGATCCCTATGATTCCTCT	17.37:g.56604046_56604064delAGAGGAATCATAGGGATCA	ENSP00000321674:p.Leu112fs	Somatic		WXS	Illumina HiSeq	Phase_I	B2RD42|B3KSX9|B4DXC6|B4DXV5|Q6IAP3|Q9H315|Q9UM58	Frame_Shift_Del	DEL	ENST00000317268.3	37	CCDS11610.1																																																																																				0.630	SEPT4-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000445420.1		NM_080417	
SETBP1	26040	broad.mit.edu	37	18	42281379	42281380	+	Missense_Mutation	DNP	CC	CC	GG			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr18:42281379_42281380CC>GG	ENST00000282030.5	+	2	364_365	c.68_69CC>GG	c.(67-69)tCC>tGG	p.S23W	SETBP1_ENST00000426838.4_Missense_Mutation_p.S23W	NM_015559.2	NP_056374.2	Q9Y6X0	SETBP_HUMAN	SET binding protein 1	23						nucleus (GO:0005634)	DNA binding (GO:0003677)	p.S23S(3)|p.S23C(2)|p.S23W(1)|p.S23>?(1)		NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(20)|lung(47)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	104				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		CTGCCGGTCTCCTCAGCCAAGC	0.614									Schinzel-Giedion syndrome																																								7	Substitution - Missense(3)|Substitution - coding silent(3)|Complex(1)	kidney(6)|haematopoietic_and_lymphoid_tissue(1)																																								SO:0001583	missense	26040	Familial Cancer Database	SGC, Schinzel-Giedion Midface Retraction syndrome	AB022660	CCDS11923.2, CCDS45859.1	18q21.1	2008-08-01			ENSG00000152217	ENSG00000152217			15573	protein-coding gene	gene with protein product		611060				11231286	Standard	NM_015559		Approved	SEB, KIAA0437	uc010dni.3	Q9Y6X0	OTTHUMG00000132613	Exception_encountered	18.37:g.42281379_42281380delinsGG	ENSP00000282030:p.Ser23Trp	Somatic		WXS	Illumina GAIIx	Phase_I	A6H8W5|Q6P6C3|Q9UEF3	Missense_Mutation|Silent	SNP	ENST00000282030.5	37	CCDS11923.2																																																																																				0.614	SETBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255854.4		NM_001130110	
SHROOM4	57477	broad.mit.edu;hgsc.bcm.edu	37	X	50556986	50556986	+	Silent	SNP	G	G	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chrX:50556986G>A	ENST00000289292.7	-	1	316	c.33C>T	c.(31-33)gtC>gtT	p.V11V	SHROOM4_ENST00000376020.2_Silent_p.V11V			Q9ULL8	SHRM4_HUMAN	shroom family member 4	11	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				actin cytoskeleton organization (GO:0030036)|actin filament organization (GO:0007015)|brain development (GO:0007420)|cognition (GO:0050890)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|myosin II complex (GO:0016460)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)	p.V11V(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(6)|liver(1)|lung(20)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	52	Ovarian(276;0.236)					GCTGCACAGGGACGTACTGGA	0.662																																																	1	Substitution - coding silent(1)	kidney(1)											36.0	35.0	35.0					X																	50556986		2200	4299	6499	SO:0001819	synonymous_variant	57477			AB033028	CCDS35277.1	Xp11.22	2008-02-05			ENSG00000158352	ENSG00000158352			29215	protein-coding gene	gene with protein product		300579				10574462, 16615870	Standard	NR_027121		Approved	KIAA1202	uc004dpe.2	Q9ULL8	OTTHUMG00000021521	ENST00000289292.7:c.33C>T	X.37:g.50556986G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A7E2X9|D6RFW0|Q96LA0	Silent	SNP	ENST00000289292.7	37	CCDS35277.1																																																																																				0.662	SHROOM4-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056564.4		NM_020717	
SLC45A4	57210	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	142228421	142228421	+	Missense_Mutation	SNP	A	A	G			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr8:142228421A>G	ENST00000024061.3	-	4	1472	c.1165T>C	c.(1165-1167)Tac>Cac	p.Y389H	SLC45A4_ENST00000433583.2_Missense_Mutation_p.Y382H|SLC45A4_ENST00000519067.1_Missense_Mutation_p.Y389H|SLC45A4_ENST00000517878.1_Missense_Mutation_p.Y440H	NM_001080431.1	NP_001073900.1	Q5BKX6	S45A4_HUMAN	solute carrier family 45, member 4						transport (GO:0006810)	integral component of membrane (GO:0016021)		p.Y389H(1)		breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(9)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	31	all_cancers(97;1.52e-15)|all_epithelial(106;2.92e-14)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0493)			GCGCGCCGGTAGCGGTAGCAG	0.687																																																	1	Substitution - Missense(1)	kidney(1)											39.0	44.0	42.0					8																	142228421		2202	4297	6499	SO:0001583	missense	57210			AB032952	CCDS34948.1, CCDS69550.1, CCDS75795.1	8q24.3	2013-05-22						"""Solute carriers"""	29196	protein-coding gene	gene with protein product							Standard	NM_001080431		Approved	KIAA1126	uc003ywd.1	Q5BKX6		ENST00000024061.3:c.1165T>C	8.37:g.142228421A>G	ENSP00000024061:p.Tyr389His	Somatic		WXS	Illumina HiSeq	Phase_I	Q6ZRI2|Q9ULU3	Missense_Mutation	SNP	ENST00000024061.3	37	CCDS34948.1	.	.	.	.	.	.	.	.	.	.	A	14.26	2.483683	0.44147	.	.	ENSG00000022567	ENST00000519067;ENST00000517878;ENST00000433583;ENST00000024061	D;D;D;D	0.93189	-3.18;-3.18;-3.18;-3.18	5.47	1.74	0.24563	.	0.456719	0.24139	N	0.041195	D	0.86108	0.5854	L	0.29908	0.895	0.31563	N	0.657295	B;B;B	0.18461	0.009;0.028;0.015	B;B;B	0.16289	0.004;0.015;0.015	T	0.76683	-0.2869	10	0.22706	T	0.39	-19.8838	8.7015	0.34329	0.7692:0.0:0.2308:0.0	.	440;389;389	E7EV90;Q5BKX6-3;Q5BKX6-2	.;.;.	H	389;440;382;389	ENSP00000429059:Y389H;ENSP00000428137:Y440H;ENSP00000400799:Y382H;ENSP00000024061:Y389H	ENSP00000024061:Y389H	Y	-	1	0	SLC45A4	142297603	1.000000	0.71417	0.995000	0.50966	0.980000	0.70556	3.051000	0.49885	0.062000	0.16340	0.459000	0.35465	TAC		0.687	SLC45A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378571.3		XM_050325	
SLC5A12	159963	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	26694953	26694953	+	Missense_Mutation	SNP	T	T	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr11:26694953T>A	ENST00000396005.3	-	14	2012	c.1703A>T	c.(1702-1704)gAg>gTg	p.E568V		NM_178498.3	NP_848593.2	Q1EHB4	SC5AC_HUMAN	solute carrier family 5 (sodium/monocarboxylate cotransporter), member 12	568					sodium ion transport (GO:0006814)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)	p.E568V(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(1)	35						GCTCACCTGCTCTGTCCCACT	0.423																																																	1	Substitution - Missense(1)	kidney(1)											153.0	156.0	155.0					11																	26694953		2066	4227	6293	SO:0001583	missense	159963			BC049207	CCDS7860.2	11p14.2	2013-07-19	2013-07-19		ENSG00000148942	ENSG00000148942		"""Solute carriers"""	28750	protein-coding gene	gene with protein product		612455	"""solute carrier family 5 (sodium/glucose cotransporter), member 12"""			12477932	Standard	NM_178498		Approved	MGC52019, SMCT2	uc001mra.2	Q1EHB4	OTTHUMG00000150706	ENST00000396005.3:c.1703A>T	11.37:g.26694953T>A	ENSP00000379326:p.Glu568Val	Somatic		WXS	Illumina HiSeq	Phase_I	Q86UC7	Missense_Mutation	SNP	ENST00000396005.3	37	CCDS7860.2	.	.	.	.	.	.	.	.	.	.	T	12.64	1.999527	0.35320	.	.	ENSG00000148942	ENST00000396005	D	0.85556	-2.0	5.62	4.37	0.52481	.	1.202440	0.06292	U	0.699335	T	0.79329	0.4427	L	0.36672	1.1	0.80722	D	1	B	0.16603	0.018	B	0.16722	0.016	T	0.66192	-0.5985	10	0.29301	T	0.29	.	7.9833	0.30196	0.2632:0.0:0.0:0.7368	.	568	Q1EHB4	SC5AC_HUMAN	V	568	ENSP00000379326:E568V	ENSP00000379326:E568V	E	-	2	0	SLC5A12	26651529	0.990000	0.36364	0.942000	0.38095	0.661000	0.39034	2.826000	0.48104	2.270000	0.75569	0.477000	0.44152	GAG		0.423	SLC5A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319681.1		NM_178498	
SOX8	30812	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	1034895	1034895	+	Missense_Mutation	SNP	G	G	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr16:1034895G>A	ENST00000293894.3	+	3	965	c.850G>A	c.(850-852)Gag>Aag	p.E284K		NM_014587.3	NP_055402.2	P57073	SOX8_HUMAN	SRY (sex determining region Y)-box 8	284					adipose tissue development (GO:0060612)|astrocyte fate commitment (GO:0060018)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|enteric nervous system development (GO:0048484)|fat cell differentiation (GO:0045444)|in utero embryonic development (GO:0001701)|male gonad development (GO:0008584)|metanephric nephron tubule formation (GO:0072289)|morphogenesis of a branching epithelium (GO:0061138)|negative regulation of apoptotic process (GO:0043066)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell migration (GO:0001755)|oligodendrocyte differentiation (GO:0048709)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of gliogenesis (GO:0014015)|positive regulation of kidney development (GO:0090184)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of hormone levels (GO:0010817)|renal vesicle induction (GO:0072034)|retina development in camera-type eye (GO:0060041)|retinal rod cell differentiation (GO:0060221)|Sertoli cell development (GO:0060009)|signal transduction (GO:0007165)|skeletal muscle cell differentiation (GO:0035914)|spermatogenesis (GO:0007283)|ureter morphogenesis (GO:0072197)	cytoplasm (GO:0005737)|nuclear transcription factor complex (GO:0044798)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.E284K(1)		central_nervous_system(1)|kidney(1)|lung(5)|prostate(2)|skin(1)	10		Hepatocellular(780;0.00308)				CGACGTCCACGAGTTCGACCA	0.701																																																	1	Substitution - Missense(1)	kidney(1)											28.0	27.0	27.0					16																	1034895		2198	4295	6493	SO:0001583	missense	30812			AF164104	CCDS10428.1	16p13.3	2008-05-23			ENSG00000005513	ENSG00000005513		"""SRY (sex determining region Y)-boxes"""	11203	protein-coding gene	gene with protein product		605923				10662550, 10684944	Standard	NM_014587		Approved		uc002ckn.3	P57073	OTTHUMG00000122101	ENST00000293894.3:c.850G>A	16.37:g.1034895G>A	ENSP00000293894:p.Glu284Lys	Somatic		WXS	Illumina HiSeq	Phase_I	Q9NZW2	Missense_Mutation	SNP	ENST00000293894.3	37	CCDS10428.1	.	.	.	.	.	.	.	.	.	.	G	33	5.263121	0.95399	.	.	ENSG00000005513	ENST00000293894	T	0.80824	-1.42	4.47	4.47	0.54385	.	0.000000	0.85682	D	0.000000	D	0.91838	0.7417	M	0.92970	3.365	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.93939	0.7221	10	0.87932	D	0	.	16.342	0.83084	0.0:0.0:1.0:0.0	.	284	P57073	SOX8_HUMAN	K	284	ENSP00000293894:E284K	ENSP00000293894:E284K	E	+	1	0	SOX8	974896	1.000000	0.71417	0.993000	0.49108	0.959000	0.62525	9.297000	0.96120	2.309000	0.77851	0.650000	0.86243	GAG		0.701	SOX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000242867.1			
SPAG7	9552	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	4863167	4863167	+	Silent	SNP	A	A	T	rs540363718		TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr17:4863167A>T	ENST00000206020.3	-	6	529	c.462T>A	c.(460-462)ccT>ccA	p.P154P	SPAG7_ENST00000573366.1_Silent_p.P103P|SPAG7_ENST00000575142.1_Silent_p.P143P	NM_004890.2	NP_004881.2	O75391	SPAG7_HUMAN	sperm associated antigen 7	154						nucleus (GO:0005634)	nucleic acid binding (GO:0003676)	p.P154P(1)		central_nervous_system(1)|endometrium(1)|kidney(2)|lung(3)|ovary(2)|urinary_tract(1)	10						TCACCACCACAGGCCCCTGCT	0.642																																																	1	Substitution - coding silent(1)	kidney(1)											61.0	65.0	64.0					17																	4863167		2126	4234	6360	SO:0001819	synonymous_variant	9552			AF047437	CCDS42240.1	17p13.2	2008-07-18				ENSG00000091640			11216	protein-coding gene	gene with protein product		610056				9653160	Standard	NM_004890		Approved	FSA-1, ACRP, MGC20134	uc002gae.3	O75391		ENST00000206020.3:c.462T>A	17.37:g.4863167A>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q96EU5	Silent	SNP	ENST00000206020.3	37	CCDS42240.1																																																																																				0.642	SPAG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438747.1		NM_004890	
SPTA1	6708	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	158646048	158646048	+	Missense_Mutation	SNP	A	A	C			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr1:158646048A>C	ENST00000368147.4	-	8	1175	c.995T>G	c.(994-996)cTt>cGt	p.L332R		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	332					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.L332R(1)		NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					AGGATGGGAAAGTGTCAGCTT	0.473																																																	1	Substitution - Missense(1)	kidney(1)											217.0	203.0	207.0					1																	158646048		1926	4140	6066	SO:0001583	missense	6708			M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.995T>G	1.37:g.158646048A>C	ENSP00000357129:p.Leu332Arg	Somatic		WXS	Illumina HiSeq	Phase_I	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	37	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	A	4.255	0.046312	0.08243	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.32753	1.44;1.44	5.24	2.87	0.33458	.	1.377560	0.05647	N	0.584494	T	0.08492	0.0211	L	0.38175	1.15	0.09310	N	1	B	0.16603	0.018	B	0.25759	0.063	T	0.36962	-0.9726	10	0.18276	T	0.48	.	4.4158	0.11455	0.4962:0.0:0.0846:0.4192	.	332	P02549	SPTA1_HUMAN	R	332	ENSP00000357130:L332R;ENSP00000357129:L332R	ENSP00000357129:L332R	L	-	2	0	SPTA1	156912672	0.989000	0.36119	0.031000	0.17742	0.449000	0.32228	2.250000	0.43178	0.416000	0.25844	0.533000	0.62120	CTT		0.473	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3		NM_003126	
SRP72	6731	hgsc.bcm.edu	37	4	57333822	57333822	+	Silent	SNP	G	G	T	rs12513091	byFrequency	TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr4:57333822G>T	ENST00000342756.5	+	1	742	c.21G>T	c.(19-21)ggG>ggT	p.G7G	SRP72_ENST00000510663.1_Silent_p.G7G|SRP72_ENST00000504757.1_Silent_p.G7G	NM_006947.3	NP_008878.3	O76094	SRP72_HUMAN	signal recognition particle 72kDa	7					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|response to drug (GO:0042493)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|signal recognition particle, endoplasmic reticulum targeting (GO:0005786)	7S RNA binding (GO:0008312)|poly(A) RNA binding (GO:0044822)|signal recognition particle binding (GO:0005047)			breast(2)|endometrium(4)|kidney(1)|large_intestine(4)|liver(2)|lung(7)|ovary(2)	22	Glioma(25;0.08)|all_neural(26;0.101)					GCGGCAGCGGGGGGGTGTCAG	0.642													G|||	1156	0.230831	0.1036	0.4092	5008	,	,		14542	0.2282		0.2127	False		,,,				2504	0.2975																0								G		515,3883		23,469,1707	15.0	17.0	16.0		21	1.5	1.0	4	dbSNP_120	16	1547,7047		120,1307,2870	no	coding-synonymous	SRP72	NM_006947.3		143,1776,4577	TT,TG,GG		18.0009,11.7099,15.8713		7/672	57333822	2062,10930	2199	4297	6496	SO:0001819	synonymous_variant	6731			AF069765	CCDS3506.1, CCDS58898.1	4q11	2013-01-10	2002-08-29		ENSG00000174780	ENSG00000174780		"""Tetratricopeptide (TTC) repeat domain containing"""	11303	protein-coding gene	gene with protein product		602122	"""signal recognition particle 72kD"""			9224693, 9857079	Standard	NM_006947		Approved		uc003hbv.3	O76094	OTTHUMG00000128843	ENST00000342756.5:c.21G>T	4.37:g.57333822G>T		Somatic		WXS	Illumina HiSeq	Phase_I	G5E9Z8|Q7Z3C0	Silent	SNP	ENST00000342756.5	37	CCDS3506.1																																																																																				0.642	SRP72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250782.7			
SSX5	6758	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	48053635	48053635	+	Missense_Mutation	SNP	G	G	T			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chrX:48053635G>T	ENST00000376923.1	-	3	209	c.210C>A	c.(208-210)ttC>ttA	p.F70L	SSX5_ENST00000311798.1_Missense_Mutation_p.F111L|SSX5_ENST00000347757.1_Missense_Mutation_p.F70L			O60225	SSX5_HUMAN	synovial sarcoma, X breakpoint 5	70	KRAB-related. {ECO:0000255|PROSITE- ProRule:PRU00120}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)	p.F111L(1)		endometrium(3)|kidney(1)|large_intestine(6)|lung(7)|skin(1)	18						TATTACGCATGAAAGGTGGGA	0.478																																																	1	Substitution - Missense(1)	kidney(1)											139.0	124.0	129.0					X																	48053635		2203	4299	6502	SO:0001583	missense	6758			BC016640	CCDS14288.1, CCDS14289.1	Xp11.23	2008-02-05			ENSG00000165583	ENSG00000165583			11339	protein-coding gene	gene with protein product		300327					Standard	NM_021015		Approved		uc004diz.1	O60225	OTTHUMG00000021471	ENST00000376923.1:c.210C>A	X.37:g.48053635G>T	ENSP00000366122:p.Phe70Leu	Somatic		WXS	Illumina HiSeq	Phase_I	Q5JQ59|Q5JQ60|Q96AW3	Missense_Mutation	SNP	ENST00000376923.1	37	CCDS14289.1	.	.	.	.	.	.	.	.	.	.	N	13.75	2.329278	0.41197	.	.	ENSG00000165583	ENST00000311798;ENST00000376923;ENST00000347757	T;T;T	0.00678	5.87;5.87;5.87	1.72	1.72	0.24424	Krueppel-associated box (2);Krueppel-associated box-related (1);	0.129282	0.36268	N	0.002699	T	0.01523	0.0049	L	0.29908	0.895	0.09310	N	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.998;0.999	T	0.54576	-0.8273	10	0.32370	T	0.25	.	6.3099	0.21159	0.0:0.0:1.0:0.0	.	70;111	O60225;O60225-2	SSX5_HUMAN;.	L	111;70;70	ENSP00000312415:F111L;ENSP00000366122:F70L;ENSP00000290558:F70L	ENSP00000312415:F111L	F	-	3	2	SSX5	47938579	1.000000	0.71417	0.228000	0.23943	0.030000	0.12068	3.052000	0.49893	1.147000	0.42369	0.171000	0.16805	TTC		0.478	SSX5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000056466.1		NM_021015	
ST14	6768	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	130064609	130064609	+	Missense_Mutation	SNP	A	A	T			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr11:130064609A>T	ENST00000278742.5	+	9	1508	c.1090A>T	c.(1090-1092)Att>Ttt	p.I364F		NM_021978.3	NP_068813.1	Q9Y5Y6	ST14_HUMAN	suppression of tumorigenicity 14 (colon carcinoma)	364	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.				keratinocyte differentiation (GO:0030216)|proteolysis (GO:0006508)	basolateral plasma membrane (GO:0016323)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.I364F(1)		central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(12)|ovary(3)|pancreas(2)|prostate(1)|skin(3)	32	all_hematologic(175;0.0429)	Lung NSC(97;0.000602)|Breast(109;0.000962)|all_lung(97;0.00126)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0183)|Lung(977;0.228)	Urokinase(DB00013)	CCCACCCAACATTGACTGCAC	0.552																																																	1	Substitution - Missense(1)	kidney(1)											218.0	141.0	167.0					11																	130064609		2201	4297	6498	SO:0001583	missense	6768			AF118224	CCDS8487.1	11q24-q25	2011-08-31	2005-11-19		ENSG00000149418	ENSG00000149418		"""Serine peptidases / Transmembrane"""	11344	protein-coding gene	gene with protein product	"""epithin"", ""matriptase"""	606797		PRSS14		9925927, 10373424	Standard	NM_021978		Approved	SNC19, HAI, MT-SP1, TMPRSS14	uc001qfw.3	Q9Y5Y6	OTTHUMG00000165768	ENST00000278742.5:c.1090A>T	11.37:g.130064609A>T	ENSP00000278742:p.Ile364Phe	Somatic		WXS	Illumina HiSeq	Phase_I	Q9BS01|Q9H3S0|Q9HB36|Q9HCA3	Missense_Mutation	SNP	ENST00000278742.5	37	CCDS8487.1	.	.	.	.	.	.	.	.	.	.	A	13.85	2.360458	0.41801	.	.	ENSG00000149418	ENST00000278742;ENST00000525779	T	0.18174	2.23	4.9	3.77	0.43336	CUB (5);	0.640394	0.12658	N	0.449889	T	0.22781	0.0550	M	0.72894	2.215	0.44129	D	0.996918	B;B	0.15930	0.015;0.012	B;B	0.21917	0.018;0.037	T	0.02161	-1.1203	10	0.62326	D	0.03	.	10.1391	0.42725	0.9193:0.0:0.0807:0.0	.	174;364	B4DYI7;Q9Y5Y6	.;ST14_HUMAN	F	364;266	ENSP00000278742:I364F	ENSP00000278742:I364F	I	+	1	0	ST14	129569819	0.000000	0.05858	0.901000	0.35422	0.553000	0.35397	0.317000	0.19487	0.711000	0.32018	0.418000	0.28097	ATT		0.552	ST14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386119.1			
SYCN	342898	broad.mit.edu;hgsc.bcm.edu	37	19	39694580	39694580	+	Silent	SNP	G	G	T			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr19:39694580G>T	ENST00000318438.6	-	1	326	c.315C>A	c.(313-315)gcC>gcA	p.A105A		NM_001080468.2	NP_001073937.1	Q0VAF6	SYCN_HUMAN	syncollin	105					exocytosis (GO:0006887)	secretory granule membrane (GO:0030667)		p.A105A(1)		endometrium(1)|kidney(1)	2	all_cancers(60;7.32e-07)|all_lung(34;1.58e-07)|Lung NSC(34;1.88e-07)|all_epithelial(25;8.97e-07)|Ovarian(47;0.0454)		Epithelial(26;1.34e-25)|all cancers(26;9.31e-23)|Lung(45;0.000278)|LUSC - Lung squamous cell carcinoma(53;0.000335)			GGTAGGTGCCGGCAGAGAACT	0.672																																																	1	Substitution - coding silent(1)	kidney(1)											17.0	21.0	20.0					19																	39694580		2071	4184	6255	SO:0001819	synonymous_variant	342898			BC039541	CCDS46070.1	19q13.2	2008-02-05	2005-05-26			ENSG00000179751			18442	protein-coding gene	gene with protein product			"""insulin synthesis associated 1"""	INSSA1		11839820	Standard	NM_001080468		Approved	SYL, FLJ27441	uc002okr.2	Q0VAF6		ENST00000318438.6:c.315C>A	19.37:g.39694580G>T		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000318438.6	37	CCDS46070.1																																																																																				0.672	SYCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463830.1			
SYNE2	23224	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	64457262	64457262	+	Frame_Shift_Del	DEL	T	T	-			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr14:64457262delT	ENST00000344113.4	+	20	2659	c.2447delT	c.(2446-2448)attfs	p.I816fs	SYNE2_ENST00000358025.3_Frame_Shift_Del_p.I816fs|SYNE2_ENST00000357395.3_5'UTR|SYNE2_ENST00000554584.1_Frame_Shift_Del_p.I816fs	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	816					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		CAGGCAAAGATTCAAGAAGCT	0.398																																																	0													102.0	98.0	99.0					14																	64457262		1835	4087	5922	SO:0001589	frameshift_variant	23224			AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.2447delT	14.37:g.64457262delT	ENSP00000341781:p.Ile816fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Frame_Shift_Del	DEL	ENST00000344113.4	37	CCDS41963.1																																																																																				0.398	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2		NM_182914	
DNAJC11	55735	broad.mit.edu;ucsc.edu	37	1	6694078	6694079	+	IGR	DEL	AG	AG	-			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	AG	AG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr1:6694078_6694079delAG	ENST00000377577.5	-	0	3311				THAP3_ENST00000377627.3_Splice_Site|DNAJC11_ENST00000465508.1_5'Flank	NM_018198.3	NP_060668.2	Q9NVH1	DJC11_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 11							extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)				NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(11)|lung(8)|ovary(2)|skin(1)|urinary_tract(1)	32	Ovarian(185;0.0265)|all_lung(157;0.154)	all_cancers(23;1.97e-27)|all_epithelial(116;1.76e-17)|all_lung(118;2.27e-05)|Lung NSC(185;9.97e-05)|Renal(390;0.00188)|Breast(487;0.00289)|Colorectal(325;0.00342)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.156)		Colorectal(212;2.34e-07)|COAD - Colon adenocarcinoma(227;2.05e-05)|Kidney(185;7.67e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000639)|KIRC - Kidney renal clear cell carcinoma(229;0.00128)|STAD - Stomach adenocarcinoma(132;0.00179)|READ - Rectum adenocarcinoma(331;0.0649)		TTTATTTCTCAGGCAATGTTGT	0.401																																																	0																																										SO:0001628	intergenic_variant	90326			AF306695	CCDS87.1	1p36.23	2011-09-02			ENSG00000007923	ENSG00000007923		"""Heat shock proteins / DNAJ (HSP40)"""	25570	protein-coding gene	gene with protein product		614827				12964007	Standard	NM_018198		Approved	FLJ10737	uc001aof.2	Q9NVH1	OTTHUMG00000001443		1.37:g.6694078_6694079delAG		Somatic		WXS	Illumina GAIIx	Phase_I	Q4VWF5|Q5VZN0|Q6PK20|Q6PK70|Q8NDM2|Q96CL7	Splice_Site	DEL	ENST00000377577.5	37	CCDS87.1																																																																																				0.401	DNAJC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004216.3		NM_018198	
TLR8	51311	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	12938126	12938126	+	Missense_Mutation	SNP	T	T	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chrX:12938126T>A	ENST00000218032.6	+	2	1054	c.967T>A	c.(967-969)Tta>Ata	p.L323I	TLR8_ENST00000311912.5_Missense_Mutation_p.L341I	NM_138636.4	NP_619542.1	Q9NR97	TLR8_HUMAN	toll-like receptor 8	323					cellular response to mechanical stimulus (GO:0071260)|defense response to virus (GO:0051607)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|immunoglobulin mediated immune response (GO:0016064)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|regulation of cytokine secretion (GO:0050707)|response to virus (GO:0009615)|toll-like receptor 8 signaling pathway (GO:0034158)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	endolysosome membrane (GO:0036020)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|drug binding (GO:0008144)|receptor activity (GO:0004872)|RNA binding (GO:0003723)|single-stranded RNA binding (GO:0003727)	p.L341I(1)		breast(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	50					Imiquimod(DB00724)	ATTCAACTATTTAGTGGGAGA	0.413																																																	1	Substitution - Missense(1)	kidney(1)											70.0	71.0	71.0					X																	12938126		2200	4295	6495	SO:0001583	missense	51311			AF246971	CCDS14152.1, CCDS14153.1	Xp22	2009-11-23			ENSG00000101916	ENSG00000101916		"""CD molecules"""	15632	protein-coding gene	gene with protein product		300366				11022119	Standard	NM_138636		Approved	CD288	uc004cve.3	Q9NR97	OTTHUMG00000021145	ENST00000218032.6:c.967T>A	X.37:g.12938126T>A	ENSP00000218032:p.Leu323Ile	Somatic		WXS	Illumina HiSeq	Phase_I	B3Y654|D1CS70|D1CS76|Q495P4|Q6UXL6|Q9NYG9	Missense_Mutation	SNP	ENST00000218032.6	37	CCDS14152.1	.	.	.	.	.	.	.	.	.	.	T	15.96	2.985601	0.53934	.	.	ENSG00000101916	ENST00000218032;ENST00000311912	T;T	0.62639	0.01;0.01	5.17	4.0	0.46444	.	0.000000	0.32416	N	0.006138	T	0.71126	0.3303	L	0.53617	1.68	0.43076	D	0.994726	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.73307	-0.4024	10	0.87932	D	0	.	7.8439	0.29414	0.0:0.1663:0.0:0.8337	.	323;341	Q9NR97;D1CS70	TLR8_HUMAN;.	I	323;341	ENSP00000218032:L323I;ENSP00000312082:L341I	ENSP00000218032:L323I	L	+	1	2	TLR8	12848047	0.967000	0.33354	0.754000	0.31244	0.434000	0.31775	1.759000	0.38420	1.832000	0.53329	0.486000	0.48141	TTA		0.413	TLR8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055784.2		NM_016610	
TMTC4	84899	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	13	101277820	101277820	+	Missense_Mutation	SNP	T	T	C			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr13:101277820T>C	ENST00000376234.3	-	14	1937	c.1748A>G	c.(1747-1749)tAc>tGc	p.Y583C	TMTC4_ENST00000342624.5_Missense_Mutation_p.Y602C|TMTC4_ENST00000462211.1_5'UTR|TMTC4_ENST00000328767.5_Missense_Mutation_p.Y472C	NM_001079669.1	NP_001073137.1	Q5T4D3	TMTC4_HUMAN	transmembrane and tetratricopeptide repeat containing 4	583						integral component of membrane (GO:0016021)		p.Y602C(1)		breast(3)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(14)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					ACAGTCTGGGTATTTCCTTCT	0.468																																																	1	Substitution - Missense(1)	kidney(1)											138.0	117.0	124.0					13																	101277820		2203	4300	6503	SO:0001583	missense	84899				CCDS9497.2, CCDS41904.1, CCDS66575.1	13q32.3	2013-01-10	2006-01-06		ENSG00000125247	ENSG00000125247		"""Tetratricopeptide (TTC) repeat domain containing"""	25904	protein-coding gene	gene with protein product							Standard	XM_005254082		Approved	FLJ14624, FLJ22153	uc001vot.3	Q5T4D3	OTTHUMG00000017289	ENST00000376234.3:c.1748A>G	13.37:g.101277820T>C	ENSP00000365408:p.Tyr583Cys	Somatic		WXS	Illumina HiSeq	Phase_I	A6NLI7|B7Z666|Q5T4D4|Q5T4D5|Q5T4D6|Q8WV63|Q96SU8	Missense_Mutation	SNP	ENST00000376234.3	37	CCDS41904.1	.	.	.	.	.	.	.	.	.	.	T	26.4	4.732704	0.89482	.	.	ENSG00000125247	ENST00000376234;ENST00000342624;ENST00000328767	T;T;T	0.57436	0.4;0.4;0.4	5.61	5.61	0.85477	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	T	0.77350	0.4117	M	0.89095	3.005	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.97110	0.998;0.982;1.0;0.986	T	0.82244	-0.0553	10	0.87932	D	0	.	16.1025	0.81194	0.0:0.0:0.0:1.0	.	472;583;583;602	B7Z666;Q5T4D3-2;Q5T4D3;Q5T4D3-3	.;.;TMTC4_HUMAN;.	C	583;602;472	ENSP00000365408:Y583C;ENSP00000343871:Y602C;ENSP00000365409:Y472C	ENSP00000365409:Y472C	Y	-	2	0	TMTC4	100075821	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.997000	0.88414	2.254000	0.74563	0.533000	0.62120	TAC		0.468	TMTC4-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045649.2		NM_032813	
TNRC6A	27327	broad.mit.edu;ucsc.edu	37	16	24816069	24816069	+	Missense_Mutation	SNP	C	C	T			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr16:24816069C>T	ENST00000395799.3	+	13	4010	c.3881C>T	c.(3880-3882)tCc>tTc	p.S1294F	TNRC6A_ENST00000315183.7_Intron|CTD-2515A14.1_ENST00000568895.1_RNA	NM_014494.2	NP_055309.2	Q8NDV7	TNR6A_HUMAN	trinucleotide repeat containing 6A	1294	Sufficient for interaction with AGO1 and AGO4.				cellular response to starvation (GO:0009267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|micro-ribonucleoprotein complex (GO:0035068)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.S1294F(1)		breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|liver(1)|lung(20)|ovary(3)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64				GBM - Glioblastoma multiforme(48;0.0394)		CAGTTTATGTCCAGTCAAAGC	0.468																																																	1	Substitution - Missense(1)	kidney(1)											178.0	165.0	169.0					16																	24816069		2197	4300	6497	SO:0001583	missense	27327			U80739	CCDS10624.2	16p11.2	2009-09-22	2004-12-17	2004-12-17	ENSG00000090905	ENSG00000090905		"""Trinucleotide (CAG) repeat containing"""	11969	protein-coding gene	gene with protein product		610739	"""trinucleotide repeat containing 6"""	TNRC6		9225980	Standard	NM_014494		Approved	CAGH26, KIAA1460, GW182	uc002dmm.3	Q8NDV7	OTTHUMG00000096999	ENST00000395799.3:c.3881C>T	16.37:g.24816069C>T	ENSP00000379144:p.Ser1294Phe	Somatic		WXS	Illumina GAIIx	Phase_I	C9JAR8|O15408|Q658L5|Q6NVB5|Q8NEZ0|Q8TBT8|Q8TCR0|Q9NV59|Q9P268	Missense_Mutation	SNP	ENST00000395799.3	37	CCDS10624.2	.	.	.	.	.	.	.	.	.	.	C	24.6	4.546366	0.86022	.	.	ENSG00000090905	ENST00000395799	T	0.12672	2.66	5.82	5.82	0.92795	.	0.065942	0.64402	D	0.000009	T	0.21509	0.0518	N	0.22421	0.69	0.80722	D	1	D	0.61697	0.99	P	0.54664	0.758	T	0.00647	-1.1628	10	0.72032	D	0.01	-4.6338	20.0989	0.97860	0.0:1.0:0.0:0.0	.	1294	Q8NDV7	TNR6A_HUMAN	F	1294	ENSP00000379144:S1294F	ENSP00000379144:S1294F	S	+	2	0	TNRC6A	24723570	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.056000	0.76662	2.764000	0.94973	0.650000	0.86243	TCC		0.468	TNRC6A-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214081.1		NM_020847	
TTC1	7265	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	159437682	159437682	+	Silent	SNP	T	T	C			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr5:159437682T>C	ENST00000231238.5	+	2	257	c.147T>C	c.(145-147)gaT>gaC	p.D49D	Y_RNA_ENST00000362528.1_RNA|TTC1_ENST00000522793.1_Silent_p.D49D	NM_001282500.1|NM_003314.1	NP_001269429.1|NP_003305.1	Q99614	TTC1_HUMAN	tetratricopeptide repeat domain 1	49					protein folding (GO:0006457)	peroxisomal membrane (GO:0005778)	unfolded protein binding (GO:0051082)	p.D49D(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(2)|lung(1)|prostate(1)|skin(1)	12	Renal(175;0.00196)	all_hematologic(541;0.00014)|Breast(839;0.0101)|all_neural(177;0.0281)|Medulloblastoma(196;0.0425)|Lung NSC(249;0.119)|all_lung(500;0.163)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	Epithelial(171;8.37e-05)|all cancers(165;0.000694)|OV - Ovarian serous cystadenocarcinoma(192;0.0402)		TCAGGGATGATGAGGCCCATC	0.517																																																	1	Substitution - coding silent(1)	kidney(1)											59.0	55.0	57.0					5																	159437682		2203	4300	6503	SO:0001819	synonymous_variant	7265			U46570	CCDS4348.1	5q32-q33.2	2013-01-10			ENSG00000113312	ENSG00000113312		"""Tetratricopeptide (TTC) repeat domain containing"""	12391	protein-coding gene	gene with protein product		601963				8836031	Standard	NM_003314		Approved	TPR1	uc003lxu.3	Q99614	OTTHUMG00000130326	ENST00000231238.5:c.147T>C	5.37:g.159437682T>C		Somatic		WXS	Illumina HiSeq	Phase_I	B2RCT2|D3DQJ8|Q9BVT3	Silent	SNP	ENST00000231238.5	37	CCDS4348.1																																																																																				0.517	TTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252675.3		NM_003314	
TSPAN17	26262	broad.mit.edu;hgsc.bcm.edu	37	5	176084597	176084597	+	Silent	SNP	G	G	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr5:176084597G>A	ENST00000503045.1	+	9	883	c.828G>A	c.(826-828)caG>caA	p.Q276Q	TSPAN17_ENST00000298564.10_3'UTR|TSPAN17_ENST00000508164.1_Silent_p.Q296Q|TSPAN17_ENST00000405525.2_3'UTR|TSPAN17_ENST00000515708.1_3'UTR|TSPAN17_ENST00000310032.8_Silent_p.Q299Q			Q96FV3	TSN17_HUMAN	tetraspanin 17	0					establishment of protein localization to organelle (GO:0072594)|protein ubiquitination (GO:0016567)	integral component of membrane (GO:0016021)|ubiquitin ligase complex (GO:0000151)	enzyme binding (GO:0019899)|ubiquitin-protein transferase activity (GO:0004842)	p.Q296Q(1)		endometrium(4)|kidney(1)|large_intestine(2)|lung(5)|urinary_tract(1)	13	all_cancers(89;0.00141)|Renal(175;0.000269)|Lung NSC(126;0.00814)|all_lung(126;0.0133)	Medulloblastoma(196;0.00498)|all_neural(177;0.0212)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CGGGGCCTCAGcagaactctc	0.552																																																	1	Substitution - coding silent(1)	kidney(1)											25.0	29.0	28.0					5																	176084597		2202	4297	6499	SO:0001819	synonymous_variant	26262			AF174603	CCDS34298.1, CCDS47346.1, CCDS47346.2, CCDS54952.1	5q35.3	2013-02-14	2005-03-21	2005-03-21	ENSG00000048140	ENSG00000048140		"""Tetraspanins"""	13594	protein-coding gene	gene with protein product			"""F-box only protein 23, transmembrane 4 superfamily member 17"""	FBXO23, TM4SF17		10531035, 10531037	Standard	NM_012171		Approved	FBX23	uc003met.3	Q96FV3	OTTHUMG00000163230	ENST00000503045.1:c.828G>A	5.37:g.176084597G>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q6NXF7|Q96S98|Q9UKB9	Silent	SNP	ENST00000503045.1	37																																																																																					0.552	TSPAN17-008	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000372215.1			
TTN	7273	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	179591818	179591818	+	Splice_Site	DEL	T	T	-			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr2:179591818delT	ENST00000591111.1	-	67	19547	c.19323delA	c.(19321-19323)aaa>aa	p.K6441fs	TTN_ENST00000460472.2_Intron|TTN_ENST00000589042.1_Splice_Site_p.K6758fs|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Splice_Site_p.K5514fs|RP11-171I2.1_ENST00000590024.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000342175.6_Intron			Q8WZ42	TITIN_HUMAN	titin	13208					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GATGTCTACCTTTTACTATAA	0.388																																																	0													111.0	109.0	110.0					2																	179591818		1889	4115	6004	SO:0001630	splice_region_variant	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.19324+1A>-	2.37:g.179591818delT		Somatic		WXS	Illumina HiSeq	Phase_I	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Frame_Shift_Del	DEL	ENST00000591111.1	37																																																																																					0.388	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1		NM_133378	Frame_Shift_Del
TTN	7273	hgsc.bcm.edu	37	2	179591821	179591821	+	Silent	SNP	T	T	C			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr2:179591821T>C	ENST00000591111.1	-	67	19544	c.19320A>G	c.(19318-19320)gtA>gtG	p.V6440V	TTN_ENST00000460472.2_Intron|TTN_ENST00000589042.1_Silent_p.V6757V|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Silent_p.V5513V|RP11-171I2.1_ENST00000590024.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000342175.6_Intron			Q8WZ42	TITIN_HUMAN	titin	13207	Ig-like 45.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTCTACCTTTTACTATAACCT	0.393																																																	0													112.0	109.0	110.0					2																	179591821		1888	4117	6005	SO:0001819	synonymous_variant	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.19320A>G	2.37:g.179591821T>C		Somatic		WXS	Illumina HiSeq	Phase_I	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37																																																																																					0.393	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1		NM_133378	
LOC101928663	101928663	broad.mit.edu	37	6	25261582	25261582	+	RNA	DEL	T	T	-			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr6:25261582delT	ENST00000413898.2	-	0	57																											AAAGGTGATATTGCAGACATC	0.408																																																	0																																												0																															6.37:g.25261582delT		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	DEL	ENST00000413898.2	37																																																																																					0.408	RP3-522P13.3-001	KNOWN	basic	antisense	antisense	OTTHUMT00000040041.2			
UPK3A	7380	hgsc.bcm.edu	37	22	45691552	45691553	+	Frame_Shift_Ins	INS	-	-	C			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr22:45691552_45691553insC	ENST00000216211.4	+	6	848_849	c.816_817insC	c.(817-819)ccgfs	p.P273fs	UPK3A_ENST00000396082.2_Frame_Shift_Ins_p.P152fs	NM_006953.3	NP_008884.1	O75631	UPK3A_HUMAN	uroplakin 3A	273			P -> L (found in patients with renal adysplasia; unknown pathological significance; normal targeting to the cell surface; dbSNP:rs121918186). {ECO:0000269|PubMed:15888565}.		cell morphogenesis (GO:0000902)|epithelial cell differentiation (GO:0030855)|kidney development (GO:0001822)|potassium ion homeostasis (GO:0055075)|sodium ion homeostasis (GO:0055078)|urea transport (GO:0015840)|urinary bladder development (GO:0060157)|water transport (GO:0006833)	apical plasma membrane (GO:0016324)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				kidney(1)|large_intestine(1)|lung(2)|skin(1)	5		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)		TGAACCGGGGGCCGCCACTGGA	0.629																																																	0																																										SO:0001589	frameshift_variant	7380			AB010637	CCDS14064.1, CCDS54539.1	22q13.31	2005-11-14	2003-07-29	2003-07-30	ENSG00000100373	ENSG00000100373			12580	protein-coding gene	gene with protein product		611559	"""uroplakin 3"""	UPK3		9818021	Standard	NM_006953		Approved		uc003bfy.3	O75631	OTTHUMG00000151339	ENST00000216211.4:c.818dupC	22.37:g.45691554_45691554dupC	ENSP00000216211:p.Pro273fs	Somatic		WXS	Illumina HiSeq	Phase_I	B0QY25|O60261|Q32N05|Q5TII6	Frame_Shift_Ins	INS	ENST00000216211.4	37	CCDS14064.1																																																																																				0.629	UPK3A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000322276.1		NM_006953	
VHL	7428	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	10183776	10183776	+	Missense_Mutation	SNP	G	G	C			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454;Illumina Miseq			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr3:10183776G>C	ENST00000256474.2	+	1	1085	c.245G>C	c.(244-246)cGc>cCc	p.R82P	snoU13_ENST00000458986.1_RNA|VHL_ENST00000345392.2_Missense_Mutation_p.R82P	NM_000551.3	NP_000542.1	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase	82			Missing (in VHLD).|R -> P (in VHLD; type I).		cell morphogenesis (GO:0000902)|cellular response to hypoxia (GO:0071456)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|transcription factor binding (GO:0008134)|ubiquitin protein ligase activity (GO:0061630)|ubiquitin-protein transferase activity (GO:0004842)	p.R82P(4)|p.P81fs*49(2)|p.S72_V87>L(1)|p.R82fs*75(1)|p.S80fs*73(1)|p.R60fs*35(1)|p.V83fs*48(1)|p.V74fs*77(1)|p.R82L(1)		adrenal_gland(25)|autonomic_ganglia(3)|central_nervous_system(2)|endometrium(6)|kidney(1662)|large_intestine(14)|lung(6)|pancreas(18)|paratesticular_tissues(1)|pleura(1)|skin(1)|soft_tissue(24)|thyroid(3)|upper_aerodigestive_tract(3)	1769				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		CGCAGTCCGCGCGTCGTGCTG	0.716		1	"""D, Mis, N, F, S"""		"""renal, hemangioma, pheochromocytoma"""	"""renal, hemangioma, pheochromocytoma"""			von Hippel-Lindau disease;Pheochromocytoma (Adrenal), Familial;Chuvash Polycythemia																														yes	Rec	yes	von Hippel-Lindau syndrome	3	3p25	7428	von Hippel-Lindau syndrome gene		"""E, M, O"""	13	Deletion - Frameshift(7)|Substitution - Missense(5)|Complex - deletion inframe(1)	kidney(12)|adrenal_gland(1)	GRCh37	CD941806|CM023994	VHL	D|M							12.0	15.0	14.0					3																	10183776		2160	4219	6379	SO:0001583	missense	7428	Familial Cancer Database	VHL; ;Erythrocytosis, Familial type 2	L15409	CCDS2597.1, CCDS2598.1	3p25.3	2014-09-17	2012-02-23		ENSG00000134086	ENSG00000134086			12687	protein-coding gene	gene with protein product		608537	"""von Hippel-Lindau syndrome"", ""von Hippel-Lindau tumor suppressor"""			9671762	Standard	NM_000551		Approved	VHL1	uc003bvc.3	P40337	OTTHUMG00000128668	ENST00000256474.2:c.245G>C	3.37:g.10183776G>C	ENSP00000256474:p.Arg82Pro	Somatic		WXS	Illumina HiSeq	Phase_I	B2RE45|Q13599|Q6PDA9	Missense_Mutation	SNP	ENST00000256474.2	37	CCDS2597.1	.	.	.	.	.	.	.	.	.	.	G	34	5.402333	0.96030	.	.	ENSG00000134086	ENST00000256474;ENST00000345392	D;D	0.99833	-7.03;-7.03	5.43	5.43	0.79202	von Hippel-Lindau disease tumor suppressor,  beta domain (1);von Hippel-Lindau disease tumour suppressor, beta/alpha domain (2);	0.101946	0.64402	D	0.000001	D	0.99799	0.9914	M	0.80183	2.485	0.43787	D	0.996324	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.97000	0.9728	10	0.72032	D	0.01	-8.5138	16.8166	0.85735	0.0:0.0:1.0:0.0	.	82;82	P40337-2;P40337	.;VHL_HUMAN	P	82	ENSP00000256474:R82P;ENSP00000344757:R82P	ENSP00000256474:R82P	R	+	2	0	VHL	10158776	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	5.961000	0.70356	2.558000	0.86282	0.550000	0.68814	CGC		0.716	VHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250559.1		NM_000551	
VPS13C	54832	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	62352506	62352506	+	Missense_Mutation	SNP	T	T	C			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr15:62352506T>C	ENST00000261517.5	-	1	141	c.68A>G	c.(67-69)aAc>aGc	p.N23S	RP11-643M14.1_ENST00000558368.2_RNA|VPS13C_ENST00000395898.3_Missense_Mutation_p.N23S|VPS13C_ENST00000249837.3_Missense_Mutation_p.N23S|VPS13C_ENST00000395896.4_Missense_Mutation_p.N23S|RP11-643M14.1_ENST00000560813.2_RNA	NM_020821.2	NP_065872.1			vacuolar protein sorting 13 homolog C (S. cerevisiae)									p.N23S(2)		NS(3)|breast(4)|endometrium(4)|kidney(9)|large_intestine(26)|lung(46)|ovary(5)|prostate(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						CTGGGACTTGTTCAGGTTCTC	0.682																																																	2	Substitution - Missense(2)	kidney(2)											37.0	36.0	37.0					15																	62352506		2203	4300	6503	SO:0001583	missense	54832			AJ608770	CCDS10180.1, CCDS32257.1, CCDS45272.1, CCDS58367.1	15q21.3	2009-07-09	2006-04-04		ENSG00000129003	ENSG00000129003			23594	protein-coding gene	gene with protein product		608879	"""vacuolar protein sorting 13C (yeast)"""				Standard	NM_018080		Approved	FLJ20136, FLJ10381, KIAA1421	uc002agz.3	Q709C8	OTTHUMG00000132801	ENST00000261517.5:c.68A>G	15.37:g.62352506T>C	ENSP00000261517:p.Asn23Ser	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000261517.5	37	CCDS32257.1	.	.	.	.	.	.	.	.	.	.	T	29.1	4.975288	0.92919	.	.	ENSG00000129003	ENST00000249837;ENST00000261517;ENST00000395896;ENST00000395898	D;D;D;D	0.82619	-1.63;-1.63;-1.63;-1.63	4.8	4.8	0.61643	.	0.125808	0.52532	D	0.000063	T	0.79639	0.4480	N	0.12961	0.28	0.38834	D	0.955916	P;P;P;P	0.43287	0.73;0.765;0.73;0.802	P;P;B;P	0.53146	0.492;0.492;0.391;0.719	D	0.83467	0.0057	10	0.66056	D	0.02	.	12.3297	0.55033	0.0:0.0:0.0:1.0	.	23;23;23;23	Q709C8-4;Q709C8-2;Q709C8-3;Q709C8	.;.;.;VP13C_HUMAN	S	23	ENSP00000249837:N23S;ENSP00000261517:N23S;ENSP00000379233:N23S;ENSP00000379235:N23S	ENSP00000249837:N23S	N	-	2	0	VPS13C	60139798	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	6.330000	0.72925	2.011000	0.59026	0.533000	0.62120	AAC		0.682	VPS13C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000415997.1		NM_017684	
TBC1D31	93594	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	124138304	124138304	+	Missense_Mutation	SNP	T	T	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr8:124138304T>A	ENST00000287380.1	+	12	1669	c.1579T>A	c.(1579-1581)Tgt>Agt	p.C527S	TBC1D31_ENST00000518805.1_Missense_Mutation_p.C160S|TBC1D31_ENST00000309336.3_Missense_Mutation_p.C527S|TBC1D31_ENST00000378080.2_Missense_Mutation_p.C422S|TBC1D31_ENST00000327098.5_Missense_Mutation_p.C527S|TBC1D31_ENST00000521676.1_Missense_Mutation_p.C404S|TBC1D31_ENST00000522420.1_Missense_Mutation_p.C422S	NM_145647.3	NP_663622.2	Q96DN5	TBC31_HUMAN	TBC1 domain family, member 31	527	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.					centrosome (GO:0005813)	Rab GTPase activator activity (GO:0005097)	p.C527S(1)									AGTCAATTGGTGTCAACACTG	0.299																																																	1	Substitution - Missense(1)	kidney(1)											63.0	62.0	63.0					8																	124138304		2203	4297	6500	SO:0001583	missense	93594			AK094612	CCDS6338.1, CCDS47916.1	8q24.13	2013-07-10	2013-07-10	2013-07-10	ENSG00000156787	ENSG00000156787		"""WD repeat domain containing"""	30888	protein-coding gene	gene with protein product			"""WD repeat domain 67"""	WDR67		12477932	Standard	NM_001145088		Approved	MGC21654, Gm85	uc003ypp.2	Q96DN5	OTTHUMG00000165081	ENST00000287380.1:c.1579T>A	8.37:g.124138304T>A	ENSP00000287380:p.Cys527Ser	Somatic		WXS	Illumina HiSeq	Phase_I	B7ZL19|Q2M2J9|Q3MIR6|Q8TBP9	Missense_Mutation	SNP	ENST00000287380.1	37	CCDS6338.1	.	.	.	.	.	.	.	.	.	.	T	18.54	3.645858	0.67358	.	.	ENSG00000156787	ENST00000287380;ENST00000309336;ENST00000327098;ENST00000522420;ENST00000521676;ENST00000378080;ENST00000518805	T;T;T;T;T;T;T	0.32515	1.45;1.45;1.45;1.45;1.45;1.45;1.45	5.43	5.43	0.79202	Rab-GAP/TBC domain (2);	0.047600	0.85682	D	0.000000	T	0.59418	0.2192	M	0.86953	2.85	0.58432	D	0.999996	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.91635	0.993;0.999;0.996	T	0.66268	-0.5966	10	0.72032	D	0.01	-18.2939	11.7926	0.52078	0.1313:0.0:0.0:0.8687	.	527;422;527	B7ZL19;E7ERK7;Q96DN5	.;.;WDR67_HUMAN	S	527;527;527;422;404;422;160	ENSP00000287380:C527S;ENSP00000308358:C527S;ENSP00000312701:C527S;ENSP00000429334:C422S;ENSP00000430628:C404S;ENSP00000367320:C422S;ENSP00000429494:C160S	ENSP00000287380:C527S	C	+	1	0	WDR67	124207485	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.259000	0.72494	2.053000	0.61076	0.482000	0.46254	TGT		0.299	TBC1D31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381721.1		NM_145647	
WNK2	65268	broad.mit.edu	37	9	96070760	96070760	+	Missense_Mutation	SNP	T	T	C			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr9:96070760T>C	ENST00000297954.4	+	28	6521	c.6521T>C	c.(6520-6522)gTg>gCg	p.V2174A	WNK2_ENST00000427277.2_Missense_Mutation_p.V1749A|WNK2_ENST00000395477.2_Missense_Mutation_p.V2137A|WNK2_ENST00000395475.2_3'UTR|WNK2_ENST00000356055.3_3'UTR|WNK2_ENST00000349097.3_Missense_Mutation_p.V1786A	NM_001282394.1	NP_001269323.1	Q9Y3S1	WNK2_HUMAN	WNK lysine deficient protein kinase 2	2174					intracellular signal transduction (GO:0035556)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.V2122A(1)|p.V2174A(1)		breast(2)|central_nervous_system(1)|endometrium(11)|kidney(4)|large_intestine(5)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)	54						AGCAAGACGGTGGGGGCCGCG	0.647																																																	2	Substitution - Missense(2)	kidney(2)											83.0	56.0	65.0					9																	96070760		2200	4296	6496	SO:0001583	missense	65268			AJ242724	CCDS75858.1	9q22.3	2008-02-05	2003-06-23	2005-01-22	ENSG00000165238	ENSG00000165238			14542	protein-coding gene	gene with protein product		606249	"""serologically defined colon cancer antigen 43"""	SDCCAG43, PRKWNK2		9610721, 11571656	Standard	NM_006648		Approved	NY-CO-43, KIAA1760	uc004atj.3	Q9Y3S1	OTTHUMG00000020247	ENST00000297954.4:c.6521T>C	9.37:g.96070760T>C	ENSP00000297954:p.Val2174Ala	Somatic		WXS	Illumina GAIIx	Phase_I	Q5VWF1|Q5VWF2|Q8IY36|Q9C0A3|Q9H3P4	Missense_Mutation	SNP	ENST00000297954.4	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.73|14.73	2.621348|2.621348	0.46736|0.46736	.|.	.|.	ENSG00000165238|ENSG00000165238	ENST00000297954;ENST00000395477;ENST00000349097;ENST00000427277|ENST00000432730;ENST00000448251;ENST00000453718	T;T;T;T|.	0.77229|.	-1.08;-1.04;-0.34;-0.33|.	5.37|5.37	-1.14|-1.14	0.09741|0.09741	.|.	0.162634|.	0.39615|.	N|.	0.001305|.	T|T	0.52075|0.52075	0.1712|0.1712	L|L	0.42245|0.42245	1.32|1.32	0.80722|0.80722	D|D	1|1	B;B;B;B|.	0.28324|.	0.207;0.058;0.037;0.15|.	B;B;B;B|.	0.30943|.	0.122;0.017;0.024;0.027|.	T|T	0.40251|0.40251	-0.9573|-0.9573	10|5	0.49607|.	T|.	0.09|.	.|.	9.8346|9.8346	0.40963|0.40963	0.0:0.3608:0.0:0.6392|0.0:0.3608:0.0:0.6392	.|.	2137;1628;2137;2174|.	Q9Y3S1-2;A6PVR4;F8W9F9;Q9Y3S1|.	.;.;.;WNK2_HUMAN|.	A|R	2174;2137;1786;1749|2133;934;611	ENSP00000297954:V2174A;ENSP00000378860:V2137A;ENSP00000297876:V1786A;ENSP00000411181:V1749A|.	ENSP00000297954:V2174A|.	V|W	+|+	2|1	0|0	WNK2|WNK2	95110581|95110581	0.893000|0.893000	0.30496|0.30496	0.240000|0.240000	0.24138|0.24138	0.994000|0.994000	0.84299|0.84299	1.372000|1.372000	0.34261|0.34261	-0.475000|-0.475000	0.06852|0.06852	0.533000|0.533000	0.62120|0.62120	GTG|TGG		0.647	WNK2-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000317359.1		NM_006648	
ZFP90	146198	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	68598080	68598080	+	Missense_Mutation	SNP	G	G	A			TCGA-CZ-4853-01A-01D-1429-08	TCGA-CZ-4853-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdef62d1-a036-43b4-811b-bf4beab7eca8	32e7b838-5d52-4880-8d59-f19e54cd177f	g.chr16:68598080G>A	ENST00000570495.1	+	5	1682	c.1390G>A	c.(1390-1392)Gac>Aac	p.D464N	ZFP90_ENST00000563169.2_Missense_Mutation_p.D464N|ZFP90_ENST00000398253.2_Missense_Mutation_p.D464N			Q8TF47	ZFP90_HUMAN	ZFP90 zinc finger protein	464					negative regulation of DNA binding (GO:0043392)|positive regulation of transcription, DNA-templated (GO:0045893)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)	p.D464N(1)		breast(2)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	27		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.00233)|Epithelial(162;0.0184)|all cancers(182;0.0946)		TCACATTACAGACTTTACTGA	0.433																																																	1	Substitution - Missense(1)	kidney(1)											125.0	120.0	122.0					16																	68598080		2017	4190	6207	SO:0001583	missense	146198			AK074332	CCDS42183.1	16q22.1	2013-01-08	2012-11-27			ENSG00000184939		"""Zinc fingers, C2H2-type"", ""-"""	23329	protein-coding gene	gene with protein product		609451	"""zinc finger protein 90 homolog (mouse)"""			7576184	Standard	NM_133458		Approved	KIAA1954, NK10, ZNF756	uc002ewc.3	Q8TF47		ENST00000570495.1:c.1390G>A	16.37:g.68598080G>A	ENSP00000460547:p.Asp464Asn	Somatic		WXS	Illumina HiSeq	Phase_I	B2RU00|B3KVE7|Q49AD1|Q96MQ6	Missense_Mutation	SNP	ENST00000570495.1	37	CCDS42183.1	.	.	.	.	.	.	.	.	.	.	G	10.86	1.469747	0.26423	.	.	ENSG00000184939	ENST00000398253	T	0.47177	0.85	5.66	4.68	0.58851	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.22282	0.0537	N	0.02865	-0.47	0.23809	N	0.996787	B	0.32010	0.351	B	0.28465	0.09	T	0.06075	-1.0847	9	0.07990	T	0.79	-11.479	14.5133	0.67802	0.0:0.1477:0.8523:0.0	.	464	Q8TF47	ZFP90_HUMAN	N	464	ENSP00000381304:D464N	ENSP00000381304:D464N	D	+	1	0	ZFP90	67155581	0.000000	0.05858	0.793000	0.32043	0.968000	0.65278	-0.786000	0.04623	1.478000	0.48253	0.655000	0.94253	GAC		0.433	ZFP90-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436217.3		XM_085375	
