#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ALDH1A1	216	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	75555088	75555088	+	Silent	SNP	G	G	A			TCGA-CZ-5452-01A-01D-1501-10	TCGA-CZ-5452-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	96bd68cb-5d8e-4de1-88ca-5f30fbdde036	fdf88258-9b8a-434a-b396-df5242420b20	g.chr9:75555088G>A	ENST00000297785.3	-	2	201	c.147C>T	c.(145-147)ctC>ctT	p.L49L	ALDH1A1_ENST00000376939.1_Silent_p.L49L|ALDH1A1_ENST00000482210.1_5'UTR	NM_000689.4	NP_000680.2	P00352	AL1A1_HUMAN	aldehyde dehydrogenase 1 family, member A1	49					cellular aldehyde metabolic process (GO:0006081)|ethanol oxidation (GO:0006069)|positive regulation of Ras GTPase activity (GO:0032320)|retinol metabolic process (GO:0042572)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	aldehyde dehydrogenase (NAD) activity (GO:0004029)|androgen binding (GO:0005497)|Ras GTPase activator activity (GO:0005099)|retinal dehydrogenase activity (GO:0001758)	p.L49L(1)|p.L63L(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)	17					Tretinoin(DB00755)|Vitamin A(DB00162)	CTACCTGGCAGAGCTCCTCCT	0.408																																																	2	Substitution - coding silent(2)	kidney(2)											123.0	121.0	122.0					9																	75555088		2203	4300	6503	SO:0001819	synonymous_variant	216			K03000	CCDS6644.1	9q21.13	2010-08-05			ENSG00000165092	ENSG00000165092	1.2.1.36, 1.2.1.3	"""Aldehyde dehydrogenases"""	402	protein-coding gene	gene with protein product	"""retinaldehyde dehydrogenase 1"""	100640		PUMB1, ALDH1		1709013	Standard	NM_000689		Approved	RALDH1	uc004ajd.3	P00352	OTTHUMG00000020019	ENST00000297785.3:c.147C>T	9.37:g.75555088G>A		Somatic		WXS	Illumina HiSeq	Phase_I	O00768|Q5SYR1	Silent	SNP	ENST00000297785.3	37	CCDS6644.1																																																																																				0.408	ALDH1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052679.1			
ATP10D	57205	hgsc.bcm.edu	37	4	47560001	47560001	+	Silent	SNP	G	G	A			TCGA-CZ-5452-01A-01D-1501-10	TCGA-CZ-5452-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	96bd68cb-5d8e-4de1-88ca-5f30fbdde036	fdf88258-9b8a-434a-b396-df5242420b20	g.chr4:47560001G>A	ENST00000273859.3	+	12	2414	c.2145G>A	c.(2143-2145)caG>caA	p.Q715Q	AC092597.3_ENST00000508081.1_RNA	NM_020453.3	NP_065186.3	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D	715					cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|endometrium(5)|kidney(5)|large_intestine(14)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	66						TCCCTGGACAGCCATTGGCCT	0.582																																																	0													63.0	57.0	59.0					4																	47560001		2203	4300	6503	SO:0001819	synonymous_variant	57205			AB040920	CCDS3476.1	4p12	2010-04-20	2007-09-19		ENSG00000145246	ENSG00000145246		"""ATPases / P-type"""	13549	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10D"""			12532265	Standard	NM_020453		Approved	ATPVD, KIAA1487	uc003gxk.1	Q9P241	OTTHUMG00000160784	ENST00000273859.3:c.2145G>A	4.37:g.47560001G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A2RRC8|D6REN2|Q8NC70|Q96SR3	Silent	SNP	ENST00000273859.3	37	CCDS3476.1																																																																																				0.582	ATP10D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216900.1		NM_020453	
BTBD9	114781	broad.mit.edu;ucsc.edu	37	6	38160335	38160335	+	Missense_Mutation	SNP	G	G	T			TCGA-CZ-5452-01A-01D-1501-10	TCGA-CZ-5452-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	96bd68cb-5d8e-4de1-88ca-5f30fbdde036	fdf88258-9b8a-434a-b396-df5242420b20	g.chr6:38160335G>T	ENST00000481247.1	-	10	1752	c.1601C>A	c.(1600-1602)tCc>tAc	p.S534Y	BTBD9_ENST00000403056.1_Missense_Mutation_p.S534Y|BTBD9_ENST00000314100.6_Missense_Mutation_p.S466Y|BTBD9_ENST00000419706.2_Missense_Mutation_p.S504Y|BTBD9_ENST00000408958.1_Missense_Mutation_p.S466Y	NM_001099272.1|NM_052893.1	NP_001092742.1|NP_443125.1	Q96Q07	BTBD9_HUMAN	BTB (POZ) domain containing 9	534					adult locomotory behavior (GO:0008344)|cell adhesion (GO:0007155)|circadian sleep/wake cycle, non-REM sleep (GO:0042748)|long-term memory (GO:0007616)|multicellular organismal iron ion homeostasis (GO:0060586)|regulation of synaptic vesicle endocytosis (GO:1900242)|sensory perception of temperature stimulus (GO:0050951)|serotonin metabolic process (GO:0042428)			p.S534Y(1)|p.S466Y(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(3)|prostate(1)	12						ACGGATGAAGGAGGCAGGCTG	0.473																																																	2	Substitution - Missense(2)	kidney(2)											158.0	153.0	155.0					6																	38160335		2029	4204	6233	SO:0001583	missense	114781				CCDS43458.1, CCDS47418.1, CCDS54998.1	6p21	2014-01-28			ENSG00000183826	ENSG00000183826		"""BTB/POZ domain containing"""	21228	protein-coding gene	gene with protein product		611237				11572484	Standard	NM_052893		Approved	KIAA1880, dJ322I12.1	uc010jwx.3	Q96Q07	OTTHUMG00000014634	ENST00000481247.1:c.1601C>A	6.37:g.38160335G>T	ENSP00000418751:p.Ser534Tyr	Somatic		WXS	Illumina GAIIx	Phase_I	Q494V9|Q494W1|Q96M00	Missense_Mutation	SNP	ENST00000481247.1	37	CCDS47418.1	.	.	.	.	.	.	.	.	.	.	G	18.60	3.659606	0.67586	.	.	ENSG00000183826	ENST00000314100;ENST00000481247;ENST00000419706;ENST00000403056;ENST00000408958	T;T;T;T;T	0.76839	-1.05;-1.05;-1.05;-1.05;-1.05	5.15	5.15	0.70609	Coagulation factor 5/8 C-terminal type domain (1);Galactose-binding domain-like (1);	0.000000	0.64402	D	0.000001	T	0.78266	0.4256	L	0.40543	1.245	0.49687	D	0.999811	D;D	0.65815	0.971;0.995	P;D	0.72982	0.903;0.979	T	0.81317	-0.0987	10	0.72032	D	0.01	.	11.9365	0.52876	0.0:0.1755:0.8245:0.0	.	504;534	Q494V9;Q96Q07	.;BTBD9_HUMAN	Y	466;534;504;534;466	ENSP00000323408:S466Y;ENSP00000418751:S534Y;ENSP00000415365:S504Y;ENSP00000386121:S534Y;ENSP00000386211:S466Y	ENSP00000323408:S466Y	S	-	2	0	BTBD9	38268313	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.235000	0.65348	2.387000	0.81309	0.655000	0.94253	TCC		0.473	BTBD9-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040433.2		NM_152733	
C2orf57	165100	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	232458055	232458055	+	Missense_Mutation	SNP	A	A	C			TCGA-CZ-5452-01A-01D-1501-10	TCGA-CZ-5452-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	96bd68cb-5d8e-4de1-88ca-5f30fbdde036	fdf88258-9b8a-434a-b396-df5242420b20	g.chr2:232458055A>C	ENST00000313965.2	+	1	481	c.393A>C	c.(391-393)aaA>aaC	p.K131N		NM_152614.2	NP_689827.2	Q53QW1	CB057_HUMAN	chromosome 2 open reading frame 57	131								p.K131N(1)		endometrium(1)|kidney(2)|large_intestine(1)|lung(7)|ovary(1)|pancreas(1)|prostate(4)|skin(2)	19		Renal(207;0.025)|all_hematologic(139;0.0735)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;1.33e-11)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.014)		TCCTGGGTAAAGACAAGATGT	0.552																																																	1	Substitution - Missense(1)	kidney(1)											128.0	131.0	130.0					2																	232458055		2203	4300	6503	SO:0001583	missense	165100			BC034405	CCDS2487.1	2q37.1	2008-02-05			ENSG00000177673	ENSG00000177673			28563	protein-coding gene	gene with protein product						12477932	Standard	NM_152614		Approved	MGC35154	uc002vrz.3	Q53QW1	OTTHUMG00000133226	ENST00000313965.2:c.393A>C	2.37:g.232458055A>C	ENSP00000315557:p.Lys131Asn	Somatic		WXS	Illumina HiSeq	Phase_I	Q8N4F2	Missense_Mutation	SNP	ENST00000313965.2	37	CCDS2487.1	.	.	.	.	.	.	.	.	.	.	g	10.28	1.307279	0.23821	.	.	ENSG00000177673	ENST00000313965	T	0.18960	2.18	4.57	-0.874	0.10631	.	2.077960	0.02718	N	0.113705	T	0.12008	0.0292	N	0.14661	0.345	0.09310	N	1	B	0.20052	0.041	B	0.16289	0.015	T	0.19549	-1.0302	10	0.27785	T	0.31	.	4.5701	0.12205	0.2843:0.2994:0.4163:0.0	.	131	Q53QW1	CB057_HUMAN	N	131	ENSP00000315557:K131N	ENSP00000315557:K131N	K	+	3	2	C2orf57	232166299	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.298000	0.08265	-0.293000	0.08986	-0.251000	0.11542	AAA		0.552	C2orf57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256962.1		NM_152614	
C3	718	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	6712358	6712358	+	Silent	SNP	G	G	A			TCGA-CZ-5452-01A-01D-1501-10	TCGA-CZ-5452-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	96bd68cb-5d8e-4de1-88ca-5f30fbdde036	fdf88258-9b8a-434a-b396-df5242420b20	g.chr19:6712358G>A	ENST00000245907.6	-	11	1271	c.1179C>T	c.(1177-1179)ggC>ggT	p.G393G		NM_000064.2	NP_000055.2	P01024	CO3_HUMAN	complement component 3	393					complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|fatty acid metabolic process (GO:0006631)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of activation of membrane attack complex (GO:0001970)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic cell clearance (GO:2000427)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|positive regulation of glucose transport (GO:0010828)|positive regulation of lipid storage (GO:0010884)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of type IIa hypersensitivity (GO:0001798)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|regulation of immune response (GO:0050776)|regulation of triglyceride biosynthetic process (GO:0010866)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	C5L2 anaphylatoxin chemotactic receptor binding (GO:0031715)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)	p.G393G(1)		breast(5)|endometrium(7)|kidney(6)|large_intestine(18)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)	72				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)	Intravenous Immunoglobulin(DB00028)	CAGTGTCCTCGCCCTGGACTG	0.617																																																	1	Substitution - coding silent(1)	kidney(1)											148.0	102.0	117.0					19																	6712358		2203	4300	6503	SO:0001819	synonymous_variant	718			J04763	CCDS32883.1	19p13.3-p13.2	2014-09-17			ENSG00000125730	ENSG00000125730	3.4.21.43	"""Complement system"", ""Endogenous ligands"""	1318	protein-coding gene	gene with protein product	"""C3a anaphylatoxin"", ""complement component C3a"", ""complement component C3b"", ""prepro-C3"""	120700					Standard	NM_000064		Approved	CPAMD1, ARMD9, C3a, C3b	uc002mfm.3	P01024	OTTHUMG00000150335	ENST00000245907.6:c.1179C>T	19.37:g.6712358G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A7E236	Silent	SNP	ENST00000245907.6	37	CCDS32883.1																																																																																				0.617	C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317636.2		NM_000064	
FAM208A	23272	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	56667432	56667432	+	Missense_Mutation	SNP	G	G	T			TCGA-CZ-5452-01A-01D-1501-10	TCGA-CZ-5452-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	96bd68cb-5d8e-4de1-88ca-5f30fbdde036	fdf88258-9b8a-434a-b396-df5242420b20	g.chr3:56667432G>T	ENST00000493960.2	-	18	3397	c.3387C>A	c.(3385-3387)aaC>aaA	p.N1129K	FAM208A_ENST00000431842.2_Missense_Mutation_p.N692K|FAM208A_ENST00000355628.5_Missense_Mutation_p.N1068K	NM_001112736.1	NP_001106207.1	Q9UK61	F208A_HUMAN	family with sequence similarity 208, member A	1129				N -> S (in Ref. 1; AAD55098). {ECO:0000305}.			poly(A) RNA binding (GO:0044822)	p.N1068K(1)|p.S692R(1)		NS(1)|breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(11)|prostate(3)|skin(1)	32						GATGTTTATTGTTGAAGTCAC	0.438																																																	2	Substitution - Missense(2)	kidney(2)											139.0	134.0	136.0					3																	56667432		2203	4300	6503	SO:0001583	missense	0			AF180425	CCDS2877.1, CCDS46853.1	3p14.3	2011-09-14	2011-09-14	2011-09-14	ENSG00000163946	ENSG00000163946			30314	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 63"""	C3orf63		10470851, 11149944	Standard	NM_015224		Approved	se89-1, RAP140, KIAA1105	uc003die.4	Q9UK61	OTTHUMG00000158827	ENST00000493960.2:c.3387C>A	3.37:g.56667432G>T	ENSP00000417509:p.Asn1129Lys	Somatic		WXS	Illumina HiSeq	Phase_I	A1L3A4|B5ME28|Q9H2F7|Q9UPP7	Missense_Mutation	SNP	ENST00000493960.2	37	CCDS46853.1	.	.	.	.	.	.	.	.	.	.	G	3.716	-0.058532	0.07317	.	.	ENSG00000163946	ENST00000431842;ENST00000493960;ENST00000355628	T;T;T	0.11169	2.8;3.01;3.01	5.57	3.71	0.42584	.	0.832537	0.11229	N	0.585805	T	0.12518	0.0304	L	0.48642	1.525	0.09310	N	1	B;B;B;B	0.29037	0.052;0.082;0.231;0.126	B;B;B;B	0.32980	0.075;0.036;0.156;0.08	T	0.26155	-1.0111	10	0.46703	T	0.11	-0.0461	8.9081	0.35537	0.0686:0.0:0.6679:0.2634	.	1129;1068;692;1129	Q9UK61-3;Q9UK61-4;Q9UK61-2;Q9UK61	.;.;.;F208A_HUMAN	K	692;1129;1068	ENSP00000399410:N692K;ENSP00000417509:N1129K;ENSP00000347845:N1068K	ENSP00000347845:N1068K	N	-	3	2	C3orf63	56642472	0.297000	0.24408	0.118000	0.21660	0.481000	0.33189	2.113000	0.41902	0.756000	0.33013	0.650000	0.86243	AAC		0.438	FAM208A-004	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352352.2		NM_015224	
CEP170	9859	broad.mit.edu	37	1	243362432	243362432	+	Missense_Mutation	SNP	C	C	A			TCGA-CZ-5452-01A-01D-1501-10	TCGA-CZ-5452-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	96bd68cb-5d8e-4de1-88ca-5f30fbdde036	fdf88258-9b8a-434a-b396-df5242420b20	g.chr1:243362432C>A	ENST00000366542.1	-	7	612	c.561G>T	c.(559-561)gaG>gaT	p.E187D	CEP170_ENST00000366543.1_Missense_Mutation_p.E187D|CEP170_ENST00000366544.1_Missense_Mutation_p.E187D	NM_014812.2	NP_055627.2	Q5SW79	CE170_HUMAN	centrosomal protein 170kDa	187						centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nuclear membrane (GO:0031965)		p.E187D(1)		NS(1)|breast(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(14)|ovary(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	62	all_neural(11;0.101)	all_cancers(173;0.003)	all cancers(7;5.81e-06)|GBM - Glioblastoma multiforme(7;0.000443)|OV - Ovarian serous cystadenocarcinoma(106;0.0101)			TTTCATCCACCTCATCATCCC	0.423																																																	1	Substitution - Missense(1)	kidney(1)											65.0	58.0	60.0					1																	243362432		1833	4083	5916	SO:0001583	missense	9859			AB022657	CCDS44337.1, CCDS44338.1, CCDS44339.1	1q44	2014-02-20	2006-01-12	2006-01-12	ENSG00000143702	ENSG00000143702			28920	protein-coding gene	gene with protein product	"""KARP 1 binding protein"", ""XRCC5 binding protein"""	613023	"""KIAA0470"""	KIAA0470		15616186	Standard	NM_014812		Approved	KAB, FAM68A	uc021plo.1	Q5SW79	OTTHUMG00000039862	ENST00000366542.1:c.561G>T	1.37:g.243362432C>A	ENSP00000355500:p.Glu187Asp	Somatic		WXS	Illumina GAIIx	Phase_I	O75058|Q5SW77|Q5SW78|Q7LGA9|Q86W31|Q9UQ08|Q9UQ09	Missense_Mutation	SNP	ENST00000366542.1	37	CCDS44339.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	3.554|3.554	-0.091125|-0.091125	0.07053|0.07053	.|.	.|.	ENSG00000143702|ENSG00000143702	ENST00000366542;ENST00000366544;ENST00000366543;ENST00000424081|ENST00000336415	T;T;T|.	0.12879|.	2.64;2.64;2.64|.	5.05|5.05	-1.27|-1.27	0.09347|0.09347	.|.	0.112679|.	0.64402|.	D|.	0.000014|.	T|T	0.19485|0.19485	0.0468|0.0468	N|N	0.02876|0.02876	-0.465|-0.465	0.80722|0.80722	D|D	1|1	B;B;B|.	0.26041|.	0.08;0.14;0.004|.	B;B;B|.	0.39562|.	0.192;0.303;0.009|.	T|T	0.07252|0.07252	-1.0782|-1.0782	10|5	0.02654|.	T|.	1|.	-13.3433|-13.3433	7.2043|7.2043	0.25899|0.25899	0.0:0.3879:0.1182:0.4939|0.0:0.3879:0.1182:0.4939	.|.	187;187;187|.	Q5SW79-3;Q5SW79-2;Q5SW79|.	.;.;CE170_HUMAN|.	D|M	187;187;187;85|89	ENSP00000355500:E187D;ENSP00000355502:E187D;ENSP00000355501:E187D|.	ENSP00000355500:E187D|.	E|R	-|-	3|2	2|0	CEP170|CEP170	241429055|241429055	0.266000|0.266000	0.24112|0.24112	0.771000|0.771000	0.31576|0.31576	0.967000|0.967000	0.64934|0.64934	-0.433000|-0.433000	0.06948|0.06948	-0.040000|-0.040000	0.13580|0.13580	0.455000|0.455000	0.32223|0.32223	GAG|AGG		0.423	CEP170-003	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096178.2		NM_014812	
DRD5	1816	broad.mit.edu	37	4	9783962	9783962	+	Silent	SNP	G	G	T			TCGA-CZ-5452-01A-01D-1501-10	TCGA-CZ-5452-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	96bd68cb-5d8e-4de1-88ca-5f30fbdde036	fdf88258-9b8a-434a-b396-df5242420b20	g.chr4:9783962G>T	ENST00000304374.2	+	1	705	c.309G>T	c.(307-309)gtG>gtT	p.V103V		NM_000798.4	NP_000789.1	P21918	DRD5_HUMAN	dopamine receptor D5	103					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|associative learning (GO:0008306)|cellular calcium ion homeostasis (GO:0006874)|cellular response to catecholamine stimulus (GO:0071870)|long term synaptic depression (GO:0060292)|negative regulation of blood pressure (GO:0045776)|negative regulation of NAD(P)H oxidase activity (GO:0033861)|norepinephrine-epinephrine vasoconstriction involved in regulation of systemic arterial blood pressure (GO:0001994)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|reactive oxygen species metabolic process (GO:0072593)|regulation of female receptivity (GO:0045924)|regulation of systemic arterial blood pressure by vasopressin (GO:0001992)|response to amphetamine (GO:0001975)|response to cocaine (GO:0042220)|sensitization (GO:0046960)|synaptic transmission (GO:0007268)|synaptic transmission, dopaminergic (GO:0001963)|transmission of nerve impulse (GO:0019226)|wound healing (GO:0042060)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity (GO:0004952)|dopamine neurotransmitter receptor activity, coupled via Gs (GO:0001588)	p.V103V(1)		NS(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(22)|prostate(7)|skin(3)|stomach(2)|urinary_tract(1)	57					Apomorphine(DB00714)|Aripiprazole(DB01238)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Cinnarizine(DB00568)|Dopamine(DB00988)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Imipramine(DB00458)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Methotrimeprazine(DB01403)|Mianserin(DB06148)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Pergolide(DB01186)|Pramipexole(DB00413)|Quetiapine(DB01224)|Ropinirole(DB00268)|Rotigotine(DB05271)|Trimipramine(DB00726)|Ziprasidone(DB00246)	TCGCCGAGGTGGCCGGTTACT	0.612																																																	1	Substitution - coding silent(1)	kidney(1)											51.0	49.0	49.0					4																	9783962		2203	4300	6503	SO:0001819	synonymous_variant	1816			X58454	CCDS3405.1	4p16.1	2012-08-08			ENSG00000169676	ENSG00000169676		"""GPCR / Class A : Dopamine receptors"""	3026	protein-coding gene	gene with protein product		126453		DRD1L2		1774076	Standard	NM_000798		Approved	DRD1B	uc003gmb.4	P21918	OTTHUMG00000128489	ENST00000304374.2:c.309G>T	4.37:g.9783962G>T		Somatic		WXS	Illumina GAIIx	Phase_I	B2R9S3|Q8NEQ8	Silent	SNP	ENST00000304374.2	37	CCDS3405.1																																																																																				0.612	DRD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250293.1			
FAM71B	153745	broad.mit.edu;ucsc.edu	37	5	156592756	156592756	+	Silent	SNP	G	G	A			TCGA-CZ-5452-01A-01D-1501-10	TCGA-CZ-5452-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	96bd68cb-5d8e-4de1-88ca-5f30fbdde036	fdf88258-9b8a-434a-b396-df5242420b20	g.chr5:156592756G>A	ENST00000302938.4	-	1	519	c.424C>T	c.(424-426)Ctg>Ttg	p.L142L		NM_130899.2	NP_570969.2	Q8TC56	FA71B_HUMAN	family with sequence similarity 71, member B	142						nucleus (GO:0005634)		p.L142L(1)		NS(3)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(32)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	68	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GCGAGTTTCAGGCGCAGCTGC	0.493																																																	1	Substitution - coding silent(1)	kidney(1)											87.0	92.0	91.0					5																	156592756		2203	4300	6503	SO:0001819	synonymous_variant	153745				CCDS4335.1	5q33.3	2005-08-09			ENSG00000170613	ENSG00000170613			28397	protein-coding gene	gene with protein product						12477932	Standard	NM_130899		Approved	MGC26988	uc003lwn.3	Q8TC56	OTTHUMG00000130246	ENST00000302938.4:c.424C>T	5.37:g.156592756G>A		Somatic		WXS	Illumina GAIIx	Phase_I	Q1EDD9|Q8TC64|Q96LY8	Silent	SNP	ENST00000302938.4	37	CCDS4335.1																																																																																				0.493	FAM71B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252570.2		NM_130899	
FAM71B	153745	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	156592758	156592758	+	Missense_Mutation	SNP	C	C	T			TCGA-CZ-5452-01A-01D-1501-10	TCGA-CZ-5452-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	96bd68cb-5d8e-4de1-88ca-5f30fbdde036	fdf88258-9b8a-434a-b396-df5242420b20	g.chr5:156592758C>T	ENST00000302938.4	-	1	517	c.422G>A	c.(421-423)cGc>cAc	p.R141H		NM_130899.2	NP_570969.2	Q8TC56	FA71B_HUMAN	family with sequence similarity 71, member B	141						nucleus (GO:0005634)		p.R141H(1)		NS(3)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(32)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	68	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GAGTTTCAGGCGCAGCTGCTG	0.498																																																	1	Substitution - Missense(1)	kidney(1)											86.0	91.0	89.0					5																	156592758		2203	4300	6503	SO:0001583	missense	153745				CCDS4335.1	5q33.3	2005-08-09			ENSG00000170613	ENSG00000170613			28397	protein-coding gene	gene with protein product						12477932	Standard	NM_130899		Approved	MGC26988	uc003lwn.3	Q8TC56	OTTHUMG00000130246	ENST00000302938.4:c.422G>A	5.37:g.156592758C>T	ENSP00000305596:p.Arg141His	Somatic		WXS	Illumina HiSeq	Phase_I	Q1EDD9|Q8TC64|Q96LY8	Missense_Mutation	SNP	ENST00000302938.4	37	CCDS4335.1	.	.	.	.	.	.	.	.	.	.	C	14.58	2.576376	0.45902	.	.	ENSG00000170613	ENST00000302938	T	0.18502	2.21	4.56	3.68	0.42216	.	0.391929	0.21891	N	0.067584	T	0.34483	0.0899	M	0.62154	1.92	0.36227	D	0.852382	D	0.62365	0.991	D	0.65323	0.934	T	0.41822	-0.9487	10	0.56958	D	0.05	-14.3951	11.2991	0.49295	0.0:0.8151:0.1848:0.0	.	141	Q8TC56	FA71B_HUMAN	H	141	ENSP00000305596:R141H	ENSP00000305596:R141H	R	-	2	0	FAM71B	156525336	0.999000	0.42202	0.987000	0.45799	0.103000	0.19146	1.688000	0.37690	1.216000	0.43427	0.655000	0.94253	CGC		0.498	FAM71B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252570.2		NM_130899	
GPATCH8	23131	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	42476146	42476146	+	Missense_Mutation	SNP	C	C	A			TCGA-CZ-5452-01A-01D-1501-10	TCGA-CZ-5452-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	96bd68cb-5d8e-4de1-88ca-5f30fbdde036	fdf88258-9b8a-434a-b396-df5242420b20	g.chr17:42476146C>A	ENST00000591680.1	-	8	3329	c.3299G>T	c.(3298-3300)aGg>aTg	p.R1100M	GPATCH8_ENST00000434000.1_Missense_Mutation_p.R1022M	NM_001002909.2	NP_001002909.1	Q9UKJ3	GPTC8_HUMAN	G patch domain containing 8	1100							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.R1100M(1)		breast(4)|endometrium(7)|kidney(6)|large_intestine(4)|liver(2)|lung(21)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	50		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.206)		CTCCACTTTCCTTGACTGGAT	0.532																																																	1	Substitution - Missense(1)	kidney(1)											146.0	117.0	126.0					17																	42476146		2203	4300	6503	SO:0001583	missense	23131			AB011125	CCDS32666.1	17q21.31	2013-01-28	2006-08-22	2006-12-13	ENSG00000186566	ENSG00000186566		"""G patch domain containing"""	29066	protein-coding gene	gene with protein product		614396	"""KIAA0553"""	KIAA0553, GPATC8		9628581	Standard	NM_001002909		Approved		uc002igw.2	Q9UKJ3	OTTHUMG00000181818	ENST00000591680.1:c.3299G>T	17.37:g.42476146C>A	ENSP00000467556:p.Arg1100Met	Somatic		WXS	Illumina HiSeq	Phase_I	B9EGP9|O60300|Q8TB99	Missense_Mutation	SNP	ENST00000591680.1	37	CCDS32666.1	.	.	.	.	.	.	.	.	.	.	C	9.458	1.092450	0.20471	.	.	ENSG00000186566	ENST00000335500;ENST00000434000	T	0.14893	2.47	4.99	1.9	0.25705	.	0.105760	0.64402	D	0.000008	T	0.14270	0.0345	L	0.29908	0.895	0.42436	D	0.992699	D	0.56287	0.975	P	0.44990	0.466	T	0.02661	-1.1127	10	0.72032	D	0.01	-14.3784	10.59	0.45304	0.0:0.7875:0.0:0.2125	.	1100	Q9UKJ3	GPTC8_HUMAN	M	1100;1022	ENSP00000395016:R1022M	ENSP00000335486:R1100M	R	-	2	0	GPATCH8	39831672	1.000000	0.71417	0.991000	0.47740	0.194000	0.23727	1.347000	0.33975	0.291000	0.22468	-0.143000	0.13931	AGG		0.532	GPATCH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457797.1		NM_001002909	
HEPHL1	341208	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	93836116	93836116	+	Missense_Mutation	SNP	G	G	T			TCGA-CZ-5452-01A-01D-1501-10	TCGA-CZ-5452-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	96bd68cb-5d8e-4de1-88ca-5f30fbdde036	fdf88258-9b8a-434a-b396-df5242420b20	g.chr11:93836116G>T	ENST00000315765.9	+	15	2620	c.2612G>T	c.(2611-2613)aGa>aTa	p.R871I		NM_001098672.1	NP_001092142.1	Q6MZM0	HPHL1_HUMAN	hephaestin-like 1	871	Plastocyanin-like 5.				copper ion transport (GO:0006825)|oxidation-reduction process (GO:0055114)	integral component of membrane (GO:0016021)	copper ion binding (GO:0005507)|ferroxidase activity (GO:0004322)	p.R875I(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(25)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	61		Acute lymphoblastic leukemia(157;2.34e-05)|all_hematologic(158;0.00824)				ATCCCTAAAAGATCCGGTCCA	0.343																																																	1	Substitution - Missense(1)	kidney(1)											75.0	71.0	72.0					11																	93836116		1800	4058	5858	SO:0001583	missense	341208			BX641008	CCDS44710.1	11q21	2008-02-05			ENSG00000181333	ENSG00000181333			30477	protein-coding gene	gene with protein product							Standard	NM_001098672		Approved	DKFZp686F22190	uc001pep.2	Q6MZM0	OTTHUMG00000167751	ENST00000315765.9:c.2612G>T	11.37:g.93836116G>T	ENSP00000313699:p.Arg871Ile	Somatic		WXS	Illumina HiSeq	Phase_I	Q3C1W7	Missense_Mutation	SNP	ENST00000315765.9	37	CCDS44710.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.032585	0.75504	.	.	ENSG00000181333	ENST00000315765	D	0.98747	-5.11	5.16	5.16	0.70880	Cupredoxin (2);Multicopper oxidase, type 3 (1);	0.044111	0.85682	D	0.000000	D	0.99387	0.9784	M	0.93507	3.425	0.58432	D	0.999992	D	0.89917	1.0	D	0.83275	0.996	D	0.98686	1.0694	10	0.72032	D	0.01	-16.2966	18.6682	0.91499	0.0:0.0:1.0:0.0	.	871	Q6MZM0	HPHL1_HUMAN	I	871	ENSP00000313699:R871I	ENSP00000313699:R871I	R	+	2	0	HEPHL1	93475764	1.000000	0.71417	0.999000	0.59377	0.778000	0.44026	8.588000	0.90813	2.401000	0.81631	0.650000	0.86243	AGA		0.343	HEPHL1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396103.2		XM_291947	
IQGAP1	8826	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	91020913	91020913	+	Missense_Mutation	SNP	A	A	C			TCGA-CZ-5452-01A-01D-1501-10	TCGA-CZ-5452-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	96bd68cb-5d8e-4de1-88ca-5f30fbdde036	fdf88258-9b8a-434a-b396-df5242420b20	g.chr15:91020913A>C	ENST00000268182.5	+	26	3245	c.3121A>C	c.(3121-3123)Att>Ctt	p.I1041L	IQGAP1_ENST00000560738.1_Missense_Mutation_p.I469L	NM_003870.3	NP_003861.1	P46940	IQGA1_HUMAN	IQ motif containing GTPase activating protein 1	1041	C1.|Ras-GAP. {ECO:0000255|PROSITE- ProRule:PRU00167}.				cellular response to calcium ion (GO:0071277)|cellular response to epidermal growth factor stimulus (GO:0071364)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerular visceral epithelial cell development (GO:0072015)|negative regulation of catalytic activity (GO:0043086)|negative regulation of dephosphorylation (GO:0035305)|neuron projection extension (GO:1990138)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|regulation of cytokine production (GO:0001817)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	actin filament (GO:0005884)|axon (GO:0030424)|cell junction (GO:0030054)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|lateral plasma membrane (GO:0016328)|microtubule (GO:0005874)|midbody (GO:0030496)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|protein serine/threonine kinase activator activity (GO:0043539)|Ras GTPase activator activity (GO:0005099)	p.I1041L(1)		breast(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|liver(1)|lung(18)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	59	Melanoma(11;0.00551)|Lung NSC(78;0.0237)|all_lung(78;0.0488)		BRCA - Breast invasive adenocarcinoma(143;0.0745)|KIRC - Kidney renal clear cell carcinoma(17;0.138)|Kidney(142;0.194)			GGTAGATCAGATTCAAGAGAT	0.413																																																	1	Substitution - Missense(1)	kidney(1)											76.0	80.0	79.0					15																	91020913		2198	4298	6496	SO:0001583	missense	8826			D29640	CCDS10362.1	15q26.1	2008-07-18			ENSG00000140575	ENSG00000140575			6110	protein-coding gene	gene with protein product	"""RasGAP-like with IQ motifs"""	603379				8051149, 8670801	Standard	XM_005254984		Approved	p195, KIAA0051, SAR1, HUMORFA01	uc002bpl.1	P46940	OTTHUMG00000149832	ENST00000268182.5:c.3121A>C	15.37:g.91020913A>C	ENSP00000268182:p.Ile1041Leu	Somatic		WXS	Illumina HiSeq	Phase_I	A7MBM3	Missense_Mutation	SNP	ENST00000268182.5	37	CCDS10362.1	.	.	.	.	.	.	.	.	.	.	A	14.97	2.694017	0.48202	.	.	ENSG00000140575	ENST00000268182	T	0.78246	-1.16	5.86	4.73	0.59995	Rho GTPase activation protein (1);Ras GTPase-activating protein (4);	0.107330	0.64402	D	0.000006	T	0.62295	0.2416	L	0.28740	0.885	0.80722	D	1	B	0.02656	0.0	B	0.17979	0.02	T	0.53739	-0.8396	10	0.02654	T	1	-13.1644	11.2293	0.48903	0.9285:0.0:0.0715:0.0	.	1041	P46940	IQGA1_HUMAN	L	1041	ENSP00000268182:I1041L	ENSP00000268182:I1041L	I	+	1	0	IQGAP1	88821917	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.499000	0.53310	1.040000	0.40099	0.533000	0.62120	ATT		0.413	IQGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313493.1		NM_003870	
IVL	3713	hgsc.bcm.edu	37	1	152882772	152882801	+	In_Frame_Del	DEL	GAGCAGCAGGAGGGACAGCTGAAGCACCCG	GAGCAGCAGGAGGGACAGCTGAAGCACCCG	-	rs267598044|rs61731348|rs12035307|rs541736259|rs11205135|rs11205136	byFrequency	TCGA-CZ-5452-01A-01D-1501-10	TCGA-CZ-5452-11A-01D-1501-10	GAGCAGCAGGAGGGACAGCTGAAGCACCCG	GAGCAGCAGGAGGGACAGCTGAAGCACCCG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	96bd68cb-5d8e-4de1-88ca-5f30fbdde036	fdf88258-9b8a-434a-b396-df5242420b20	g.chr1:152882772_152882801delGAGCAGCAGGAGGGACAGCTGAAGCACCCG	ENST00000368764.3	+	2	563_592	c.499_528delGAGCAGCAGGAGGGACAGCTGAAGCACCCG	c.(499-528)gagcagcaggagggacagctgaagcacccgdel	p.EQQEGQLKHP167del	IVL_ENST00000392667.2_In_Frame_Del_p.EQQEGQLKHP21del			P07476	INVO_HUMAN	involucrin	167	39 X 10 AA approximate tandem repeats of [LP]-[EKG]-[LHVYQEK]-[PLSQE]-[EQDV]- [QHEKRGA]-Q-[EMVQLP]-[GKLE]-[QHVNLD].				isopeptide cross-linking via N6-(L-isoglutamyl)-L-lysine (GO:0018153)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|response to UV-B (GO:0010224)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)	p.G171V(2)|p.P176P(1)		breast(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	29	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			gaagcacctagagcagcaggagggacagctgaagcacccggagcagcagg	0.617																																																	3	Substitution - Missense(2)|Substitution - coding silent(1)	lung(2)|ovary(1)								22,4244		0,22,2111						-4.0	0.0			32	161,8093		2,157,3968	no	coding	IVL	NM_005547.2		2,179,6079	A1A1,A1R,RR		1.9506,0.5157,1.4617				183,12337				SO:0001651	inframe_deletion	3713			BC046391	CCDS1030.1	1q21	2008-02-05			ENSG00000163207	ENSG00000163207			6187	protein-coding gene	gene with protein product		147360				2873896	Standard	NM_005547		Approved		uc001fau.3	P07476	OTTHUMG00000012451	ENST00000368764.3:c.499_528delGAGCAGCAGGAGGGACAGCTGAAGCACCCG	1.37:g.152882772_152882801delGAGCAGCAGGAGGGACAGCTGAAGCACCCG	ENSP00000357753:p.Glu167_Pro176del	Somatic		WXS	Illumina HiSeq	Phase_I	Q5T7P4	In_Frame_Del	DEL	ENST00000368764.3	37	CCDS1030.1																																																																																				0.617	IVL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034664.1		NM_005547	
AP5Z1	9907	broad.mit.edu;ucsc.edu	37	7	4830337	4830337	+	Missense_Mutation	SNP	T	T	C			TCGA-CZ-5452-01A-01D-1501-10	TCGA-CZ-5452-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	96bd68cb-5d8e-4de1-88ca-5f30fbdde036	fdf88258-9b8a-434a-b396-df5242420b20	g.chr7:4830337T>C	ENST00000348624.4	+	16	2066	c.1972T>C	c.(1972-1974)Tac>Cac	p.Y658H	MIR4656_ENST00000579503.1_RNA|AP5Z1_ENST00000490487.1_Intron	NM_014855.2	NP_055670.1	O43299	AP5Z1_HUMAN	adaptor-related protein complex 5, zeta 1 subunit	658					cell death (GO:0008219)|double-strand break repair via homologous recombination (GO:0000724)|endosomal transport (GO:0016197)|protein transport (GO:0015031)	AP-5 adaptor complex (GO:0044599)|AP-type membrane coat adaptor complex (GO:0030119)|cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.Y1369H(1)|p.Y502H(1)									GTCGGTGACCTACGATCGGAG	0.657																																																	2	Substitution - Missense(2)	kidney(2)											43.0	51.0	48.0					7																	4830337		2016	4156	6172	SO:0001583	missense	0			AB007875	CCDS47528.1	7p22.1	2012-03-20	2012-03-20	2012-03-20	ENSG00000242802	ENSG00000242802			22197	protein-coding gene	gene with protein product		613653	"""KIAA0415"""	KIAA0415		20613862, 22022230	Standard	NM_014855		Approved	SPG48, zeta	uc003sne.3	O43299	OTTHUMG00000151754	ENST00000348624.4:c.1972T>C	7.37:g.4830337T>C	ENSP00000297562:p.Tyr658His	Somatic		WXS	Illumina GAIIx	Phase_I	Q8N3X2|Q96H80	Missense_Mutation	SNP	ENST00000348624.4	37	CCDS47528.1	.	.	.	.	.	.	.	.	.	.	T	8.632	0.893957	0.17613	.	.	ENSG00000242802	ENST00000348624	T	0.64991	-0.13	5.3	4.15	0.48705	Armadillo-like helical (1);	.	.	.	.	T	0.57021	0.2025	M	0.66939	2.045	0.28588	N	0.909807	B;B	0.21821	0.011;0.061	B;B	0.16289	0.003;0.015	T	0.50224	-0.8853	9	0.26408	T	0.33	.	9.1721	0.37089	0.0:0.1535:0.0:0.8465	.	1369;658	A4D1Z4;O43299	.;K0415_HUMAN	H	658	ENSP00000297562:Y658H	ENSP00000297562:Y658H	Y	+	1	0	KIAA0415	4796863	0.318000	0.24598	0.001000	0.08648	0.057000	0.15508	2.523000	0.45580	0.970000	0.38263	0.448000	0.29417	TAC		0.657	AP5Z1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323771.1			
KITLG	4254	hgsc.bcm.edu;ucsc.edu	37	12	88939566	88939566	+	Frame_Shift_Del	DEL	T	T	-			TCGA-CZ-5452-01A-01D-1501-10	TCGA-CZ-5452-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	96bd68cb-5d8e-4de1-88ca-5f30fbdde036	fdf88258-9b8a-434a-b396-df5242420b20	g.chr12:88939566delT	ENST00000228280.5	-	2	274	c.92delA	c.(91-93)aatfs	p.N31fs	KITLG_ENST00000347404.5_Frame_Shift_Del_p.N31fs|KITLG_ENST00000357116.4_Intron	NM_000899.4	NP_000890.1	P21583	SCF_HUMAN	KIT ligand	31					cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|male gonad development (GO:0008584)|negative regulation of mast cell apoptotic process (GO:0033026)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of DNA replication (GO:0045740)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of mast cell proliferation (GO:0070668)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of myeloid leukocyte differentiation (GO:0002763)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of Ras protein signal transduction (GO:0046579)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	stem cell factor receptor binding (GO:0005173)			kidney(2)|large_intestine(3)|lung(1)|ovary(1)|prostate(1)|stomach(1)	9						AGTCACACGATTCCTGCAGAT	0.383									Testicular Cancer, Familial Clustering of																																								0													92.0	84.0	87.0					12																	88939566		2203	4300	6503	SO:0001589	frameshift_variant	4254	Familial Cancer Database		M59964	CCDS31867.1, CCDS31868.1	12q22	2010-11-23			ENSG00000049130	ENSG00000049130			6343	protein-coding gene	gene with protein product	"""mast cell growth factor"", ""stem cell factor"", ""steel factor"", ""familial progressive hyperpigmentation 2"""	184745		MGF		2208279, 1707188, 19375057	Standard	NM_003994		Approved	SCF, SF, Kitl, KL-1, FPH2	uc001tav.3	P21583	OTTHUMG00000169888	ENST00000228280.5:c.92delA	12.37:g.88939566delT	ENSP00000228280:p.Asn31fs	Somatic		WXS	Illumina HiSeq	Phase_I	A0AV09|A8K2Q4|B7ZLM4|Q16487|Q68DZ2|Q7M4N8|Q9UQK7	Frame_Shift_Del	DEL	ENST00000228280.5	37	CCDS31868.1																																																																																				0.383	KITLG-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406424.2		NM_003994	
LAMA2	3908	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	129371227	129371227	+	Missense_Mutation	SNP	C	C	A	rs530988751	byFrequency	TCGA-CZ-5452-01A-01D-1501-10	TCGA-CZ-5452-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	96bd68cb-5d8e-4de1-88ca-5f30fbdde036	fdf88258-9b8a-434a-b396-df5242420b20	g.chr6:129371227C>A	ENST00000421865.2	+	2	326	c.277C>A	c.(277-279)Cca>Aca	p.P93T		NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2	93	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)	p.P93T(1)		NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		CAGCAGCAATCCAAACCGTAT	0.438													C|||	2	0.000399361	0.0	0.0	5008	,	,		16485	0.002		0.0	False		,,,				2504	0.0																1	Substitution - Missense(1)	kidney(1)											148.0	124.0	132.0					6																	129371227		2203	4300	6503	SO:0001583	missense	3908			Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.277C>A	6.37:g.129371227C>A	ENSP00000400365:p.Pro93Thr	Somatic		WXS	Illumina HiSeq	Phase_I	Q14736|Q5VUM2|Q93022	Missense_Mutation	SNP	ENST00000421865.2	37	CCDS5138.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.024427	0.75390	.	.	ENSG00000196569	ENST00000358023;ENST00000354729;ENST00000421865	T	0.74632	-0.86	5.44	4.52	0.55395	Laminin, N-terminal (3);	0.321128	0.28510	N	0.015095	T	0.73931	0.3650	M	0.78456	2.415	0.39807	D	0.972656	P;P	0.40578	0.722;0.722	B;B	0.43413	0.419;0.419	T	0.80294	-0.1443	10	0.72032	D	0.01	.	17.7953	0.88568	0.0:0.8677:0.1323:0.0	.	93;93	A6NF00;P24043	.;LAMA2_HUMAN	T	93	ENSP00000400365:P93T	ENSP00000346769:P93T	P	+	1	0	LAMA2	129412920	0.029000	0.19370	0.999000	0.59377	0.913000	0.54294	1.409000	0.34680	2.552000	0.86080	0.561000	0.74099	CCA		0.438	LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042180.1			
LIPE	3991	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	42912472	42912472	+	Missense_Mutation	SNP	G	G	C			TCGA-CZ-5452-01A-01D-1501-10	TCGA-CZ-5452-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	96bd68cb-5d8e-4de1-88ca-5f30fbdde036	fdf88258-9b8a-434a-b396-df5242420b20	g.chr19:42912472G>C	ENST00000244289.4	-	3	1698	c.1422C>G	c.(1420-1422)ttC>ttG	p.F474L	LIPE_ENST00000602000.1_5'UTR|LIPE-AS1_ENST00000593491.2_RNA|LIPE-AS1_ENST00000594624.2_RNA|LIPE-AS1_ENST00000599276.1_RNA|LIPE-AS1_ENST00000597203.1_RNA	NM_005357.2	NP_005348.2	Q05469	LIPS_HUMAN	lipase, hormone-sensitive	474					cholesterol metabolic process (GO:0008203)|diacylglycerol catabolic process (GO:0046340)|lipid catabolic process (GO:0016042)|long-chain fatty acid catabolic process (GO:0042758)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)	cytosol (GO:0005829)|lipid particle (GO:0005811)|plasma membrane (GO:0005886)	hormone-sensitive lipase activity (GO:0033878)|triglyceride lipase activity (GO:0004806)	p.F474L(1)		breast(2)|endometrium(4)|kidney(7)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	32		Prostate(69;0.00682)				TGGCAGGCGTGAACTGTGGAG	0.617																																																	1	Substitution - Missense(1)	kidney(1)											121.0	111.0	115.0					19																	42912472		2203	4300	6503	SO:0001583	missense	3991			L11706	CCDS12607.1	19q13.1-q13.2	2014-03-14			ENSG00000079435	ENSG00000079435	3.1.1.3		6621	protein-coding gene	gene with protein product		151750				8506334	Standard	NM_005357		Approved	HSL	uc002otr.3	Q05469	OTTHUMG00000182814	ENST00000244289.4:c.1422C>G	19.37:g.42912472G>C	ENSP00000244289:p.Phe474Leu	Somatic		WXS	Illumina HiSeq	Phase_I	Q3LRT2|Q6NSL7	Missense_Mutation	SNP	ENST00000244289.4	37	CCDS12607.1	.	.	.	.	.	.	.	.	.	.	G	14.86	2.660955	0.47572	.	.	ENSG00000079435	ENST00000244289	T	0.41065	1.01	4.32	3.19	0.36642	Hormone-sensitive lipase, N-terminal (1);	0.074428	0.52532	D	0.000065	T	0.51856	0.1699	M	0.74647	2.275	0.48452	D	0.999651	P;P	0.52463	0.93;0.953	P;P	0.55391	0.625;0.775	T	0.53704	-0.8401	10	0.52906	T	0.07	-17.7996	6.6642	0.23031	0.0984:0.0:0.7212:0.1805	.	474;474	A8K8W7;Q05469	.;LIPS_HUMAN	L	474	ENSP00000244289:F474L	ENSP00000244289:F474L	F	-	3	2	LIPE	47604312	1.000000	0.71417	1.000000	0.80357	0.289000	0.27227	1.830000	0.39131	2.145000	0.66743	0.561000	0.74099	TTC		0.617	LIPE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463861.1		NM_005357	
Unknown	0	broad.mit.edu	37	1	149280301	149280302	+	IGR	INS	-	-	A	rs145241142|rs145896171|rs587754269		TCGA-CZ-5452-01A-01D-1501-10	TCGA-CZ-5452-11A-01D-1501-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	96bd68cb-5d8e-4de1-88ca-5f30fbdde036	fdf88258-9b8a-434a-b396-df5242420b20	g.chr1:149280301_149280302insA								RP11-403I13.4 (14791 upstream) : RP11-403I13.7 (4342 downstream)																							CCAATTTAGTGAAAAAAAACTG	0.411																																																	0																																										SO:0001628	intergenic_variant	388692																															1.37:g.149280309_149280309dupA		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	INS		37																																																																																				0	0.411									
LYST	1130	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	235971939	235971939	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CZ-5452-01A-01D-1501-10	TCGA-CZ-5452-11A-01D-1501-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	96bd68cb-5d8e-4de1-88ca-5f30fbdde036	fdf88258-9b8a-434a-b396-df5242420b20	g.chr1:235971939G>A	ENST00000389794.3	-	5	2353	c.2179C>T	c.(2179-2181)Cag>Tag	p.Q727*	LYST_ENST00000536965.1_Nonsense_Mutation_p.Q727*|LYST_ENST00000389793.2_Nonsense_Mutation_p.Q727*			Q99698	LYST_HUMAN	lysosomal trafficking regulator	727					blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)		p.Q727*(1)		NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			AATTTCCACTGAACAACTATA	0.328																																																	1	Substitution - Nonsense(1)	kidney(1)											46.0	50.0	49.0					1																	235971939		2203	4300	6503	SO:0001587	stop_gained	1130			U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.2179C>T	1.37:g.235971939G>A	ENSP00000374444:p.Gln727*	Somatic		WXS	Illumina HiSeq	Phase_I	O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Nonsense_Mutation	SNP	ENST00000389794.3	37	CCDS31062.1	.	.	.	.	.	.	.	.	.	.	G	42	9.468019	0.99180	.	.	ENSG00000143669	ENST00000389794;ENST00000389793;ENST00000536965	.	.	.	5.8	5.8	0.92144	.	0.162102	0.56097	D	0.000023	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.18276	T	0.48	.	20.0706	0.97721	0.0:0.0:1.0:0.0	.	.	.	.	X	727	.	ENSP00000374443:Q727X	Q	-	1	0	LYST	234038562	1.000000	0.71417	0.980000	0.43619	0.886000	0.51366	9.476000	0.97823	2.744000	0.94065	0.655000	0.94253	CAG		0.328	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097533.5			
MOCS2	4338	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	52404436	52404436	+	Missense_Mutation	SNP	G	G	A	rs372782831		TCGA-CZ-5452-01A-01D-1501-10	TCGA-CZ-5452-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	96bd68cb-5d8e-4de1-88ca-5f30fbdde036	fdf88258-9b8a-434a-b396-df5242420b20	g.chr5:52404436G>A	ENST00000361377.4	-	2	97	c.56C>T	c.(55-57)aCa>aTa	p.T19I	MOCS2_ENST00000584946.1_Missense_Mutation_p.T19I|MOCS2_ENST00000527216.1_Missense_Mutation_p.T14I|MOCS2_ENST00000582677.1_Missense_Mutation_p.T19I|CTD-2366F13.1_ENST00000502171.2_RNA|MOCS2_ENST00000510818.2_Missense_Mutation_p.T19I|MOCS2_ENST00000508922.1_Missense_Mutation_p.T19I|MOCS2_ENST00000396954.3_5'UTR|CTD-2366F13.1_ENST00000499459.2_RNA|CTD-2366F13.1_ENST00000512301.1_RNA|MOCS2_ENST00000450852.3_Missense_Mutation_p.T19I					molybdenum cofactor synthesis 2									p.T19I(1)		endometrium(1)|lung(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	5		Lung NSC(810;3.08e-05)|Breast(144;0.0848)				ACGAACTCCTGTTATTTCAGC	0.363																																																	1	Substitution - Missense(1)	kidney(1)											100.0	90.0	93.0					5																	52404436		1843	4102	5945	SO:0001583	missense	4338			AF117815	CCDS3958.1, CCDS47205.1	5q11	2008-02-05			ENSG00000164172	ENSG00000164172			7193	protein-coding gene	gene with protein product		603708				10053004, 9889283	Standard	NM_004531		Approved	MOCO1	uc003joz.3	O96007	OTTHUMG00000096981	ENST00000361377.4:c.56C>T	5.37:g.52404436G>A	ENSP00000355160:p.Thr19Ile	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000361377.4	37	CCDS47205.1	.	.	.	.	.	.	.	.	.	.	G	16.78	3.217859	0.58560	.	.	ENSG00000164172	ENST00000361377;ENST00000510818;ENST00000450852;ENST00000508922	T;T;T;T	0.65732	-0.17;-0.17;-0.17;-0.17	5.86	4.99	0.66335	Molybdopterin synthase/thiamin biosynthesis sulphur carrier, beta-grasp (1);Beta-grasp fold, ferredoxin-type (1);	.	.	.	.	T	0.49150	0.1540	.	.	.	0.22531	N	0.999019	B	0.22851	0.076	B	0.26864	0.074	T	0.29822	-0.9999	8	0.15952	T	0.53	.	14.538	0.67973	0.0709:0.0:0.9291:0.0	.	19	O96033	MOC2A_HUMAN	I	19	ENSP00000355160:T19I;ENSP00000424267:T19I;ENSP00000411022:T19I;ENSP00000426274:T19I	ENSP00000355160:T19I	T	-	2	0	MOCS2	52440193	0.998000	0.40836	0.264000	0.24511	0.989000	0.77384	4.820000	0.62671	1.474000	0.48178	0.655000	0.94253	ACA		0.363	MOCS2-004	KNOWN	alternative_3_UTR|NMD_exception|basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000367796.3		NM_183418	
NLRP8	126205	broad.mit.edu;ucsc.edu	37	19	56467043	56467043	+	Missense_Mutation	SNP	G	G	T	rs372284254		TCGA-CZ-5452-01A-01D-1501-10	TCGA-CZ-5452-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	96bd68cb-5d8e-4de1-88ca-5f30fbdde036	fdf88258-9b8a-434a-b396-df5242420b20	g.chr19:56467043G>T	ENST00000291971.3	+	3	1690	c.1619G>T	c.(1618-1620)cGc>cTc	p.R540L	NLRP8_ENST00000590542.1_Missense_Mutation_p.R540L	NM_176811.2	NP_789781.2	Q86W28	NALP8_HUMAN	NLR family, pyrin domain containing 8	540					neuron death (GO:0070997)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)	p.R540L(1)		breast(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|ovary(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)	35		Colorectal(82;0.000147)|Ovarian(87;0.17)		GBM - Glioblastoma multiforme(193;0.0695)		AATATCCAGCGCCTGATAGCG	0.463																																																	1	Substitution - Missense(1)	kidney(1)											104.0	101.0	102.0					19																	56467043		2203	4300	6503	SO:0001583	missense	126205			AY154463	CCDS12937.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179709		"""Nucleotide-binding domain and leucine rich repeat containing"""	22940	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 8"""	609659	"""NACHT, leucine rich repeat and PYD containing 8"""	NALP8		12563287	Standard	NM_176811		Approved	NOD16, PAN4, CLR19.2	uc002qmh.3	Q86W28		ENST00000291971.3:c.1619G>T	19.37:g.56467043G>T	ENSP00000291971:p.Arg540Leu	Somatic		WXS	Illumina GAIIx	Phase_I	Q7RTR4	Missense_Mutation	SNP	ENST00000291971.3	37	CCDS12937.1	.	.	.	.	.	.	.	.	.	.	G	0.065	-1.214990	0.01542	.	.	ENSG00000179709	ENST00000291971	D	0.87809	-2.3	2.04	-1.42	0.08913	.	.	.	.	.	T	0.73489	0.3593	N	0.21282	0.65	0.09310	N	1	B;B	0.23377	0.084;0.001	B;B	0.19391	0.025;0.003	T	0.56836	-0.7913	9	0.24483	T	0.36	.	5.0065	0.14291	0.5224:0.0:0.4776:0.0	.	540;540	Q86W28-2;Q86W28	.;NALP8_HUMAN	L	540	ENSP00000291971:R540L	ENSP00000291971:R540L	R	+	2	0	NLRP8	61158855	0.000000	0.05858	0.000000	0.03702	0.028000	0.11728	-0.459000	0.06728	-0.281000	0.09141	-0.346000	0.07831	CGC		0.463	NLRP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457462.1		NM_176811	
NT5C1B	93034	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	18765441	18765441	+	Silent	SNP	C	C	T			TCGA-CZ-5452-01A-01D-1501-10	TCGA-CZ-5452-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	96bd68cb-5d8e-4de1-88ca-5f30fbdde036	fdf88258-9b8a-434a-b396-df5242420b20	g.chr2:18765441C>T	ENST00000359846.2	-	6	1061	c.984G>A	c.(982-984)gaG>gaA	p.E328E	NT5C1B-RDH14_ENST00000532967.1_Silent_p.E328E|NT5C1B_ENST00000600945.1_Silent_p.E328E|NT5C1B_ENST00000460052.1_5'Flank|NT5C1B_ENST00000304081.4_Silent_p.E268E|RNU6-1215P_ENST00000384441.1_RNA	NM_001002006.2|NM_001199086.1|NM_001199087.1|NM_001199088.1	NP_001002006.1|NP_001186015.1|NP_001186016.1|NP_001186017.1	Q96P26	5NT1B_HUMAN	5'-nucleotidase, cytosolic IB	328					nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)	5'-nucleotidase activity (GO:0008253)|magnesium ion binding (GO:0000287)|nucleotide binding (GO:0000166)	p.E328E(1)		endometrium(2)|kidney(2)|large_intestine(10)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	29	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.177)	Ovarian(717;0.208)				GACCCTCTTGCTCGTAGATTT	0.552																																																	1	Substitution - coding silent(1)	kidney(1)											166.0	159.0	161.0					2																	18765441		2203	4300	6503	SO:0001819	synonymous_variant	93034			AF356185	CCDS33149.1, CCDS33150.1	2p24.2	2010-08-13			ENSG00000185013	ENSG00000185013	3.1.3.5		17818	protein-coding gene	gene with protein product		610526				11690631	Standard	NM_033253		Approved	AIRP, CN-IB		Q96P26	OTTHUMG00000151765	ENST00000359846.2:c.984G>A	2.37:g.18765441C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B5MCR0|B7ZVX7|Q53RX2|Q8N9W3|Q8NA26|Q96DU5|Q96KE6|Q96M25|Q96SA3	Silent	SNP	ENST00000359846.2	37	CCDS33150.1																																																																																				0.552	NT5C1B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000323822.1			
OTC	5009	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	38262963	38262963	+	Silent	SNP	C	C	T			TCGA-CZ-5452-01A-01D-1501-10	TCGA-CZ-5452-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	96bd68cb-5d8e-4de1-88ca-5f30fbdde036	fdf88258-9b8a-434a-b396-df5242420b20	g.chrX:38262963C>T	ENST00000039007.4	+	6	785	c.633C>T	c.(631-633)ttC>ttT	p.F211F	TM4SF2_ENST00000465127.1_Intron	NM_000531.5	NP_000522.3	P00480	OTC_HUMAN	ornithine carbamoyltransferase	211					ammonia homeostasis (GO:0097272)|arginine biosynthetic process (GO:0006526)|cellular nitrogen compound metabolic process (GO:0034641)|citrulline biosynthetic process (GO:0019240)|liver development (GO:0001889)|midgut development (GO:0007494)|ornithine catabolic process (GO:0006593)|protein homotrimerization (GO:0070207)|response to biotin (GO:0070781)|response to drug (GO:0042493)|response to insulin (GO:0032868)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|urea cycle (GO:0000050)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	amino acid binding (GO:0016597)|ornithine carbamoyltransferase activity (GO:0004585)|phosphate ion binding (GO:0042301)|phospholipid binding (GO:0005543)	p.F211F(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	22					L-Citrulline(DB00155)|L-Ornithine(DB00129)	CAGCGAAATTCGGAATGCACC	0.468																																																	1	Substitution - coding silent(1)	kidney(1)											106.0	85.0	92.0					X																	38262963		2202	4300	6502	SO:0001819	synonymous_variant	5009			K02100	CCDS14247.1	Xp21.1	2014-06-28			ENSG00000036473	ENSG00000036473	2.1.3.3		8512	protein-coding gene	gene with protein product		300461					Standard	NM_000531		Approved		uc004def.4	P00480	OTTHUMG00000022727	ENST00000039007.4:c.633C>T	X.37:g.38262963C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A8K9P2|D3DWB0|Q3KNR1|Q6B0I1|Q9NYJ5	Silent	SNP	ENST00000039007.4	37	CCDS14247.1																																																																																				0.468	OTC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059006.2			
PCDHGA5	56110	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	140745027	140745027	+	Missense_Mutation	SNP	G	G	A			TCGA-CZ-5452-01A-01D-1501-10	TCGA-CZ-5452-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	96bd68cb-5d8e-4de1-88ca-5f30fbdde036	fdf88258-9b8a-434a-b396-df5242420b20	g.chr5:140745027G>A	ENST00000518069.1	+	1	1130	c.1130G>A	c.(1129-1131)gGa>gAa	p.G377E	PCDHGA3_ENST00000253812.6_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB2_ENST00000522605.1_Intron	NM_018918.2|NM_032054.1	NP_061741.1|NP_114443.1	Q9Y5G8	PCDG5_HUMAN	protocadherin gamma subfamily A, 5	377	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G377E(1)		endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(5)|upper_aerodigestive_tract(3)	18			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGTGATTCTGGAGAAAATGGT	0.443																																																	1	Substitution - Missense(1)	kidney(1)											99.0	98.0	98.0					5																	140745027		1998	4174	6172	SO:0001583	missense	56110			AF152512	CCDS54925.1, CCDS75333.1	5q31	2010-01-26				ENSG00000253485		"""Cadherins / Protocadherins : Clustered"""	8703	other	protocadherin	"""cadherin ME3"""	606292				10380929	Standard	NM_018918		Approved	CDH-GAMMA-A5, ME3, PCDH-GAMMA-A5		Q9Y5G8		ENST00000518069.1:c.1130G>A	5.37:g.140745027G>A	ENSP00000429834:p.Gly377Glu	Somatic		WXS	Illumina HiSeq	Phase_I	Q2M3F5|Q9Y5D2	Missense_Mutation	SNP	ENST00000518069.1	37	CCDS54925.1	.	.	.	.	.	.	.	.	.	.	.	13.15	2.150105	0.37923	.	.	ENSG00000253485	ENST00000518069	T	0.49720	0.77	5.52	4.64	0.57946	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.61924	0.2386	M	0.81341	2.54	0.28499	N	0.914111	P;P	0.49961	0.914;0.93	P;P	0.50825	0.519;0.651	T	0.60959	-0.7159	9	0.36615	T	0.2	.	16.242	0.82418	0.0:0.1332:0.8668:0.0	.	377;377	Q9Y5G8-2;Q9Y5G8	.;PCDG5_HUMAN	E	377	ENSP00000429834:G377E	ENSP00000429834:G377E	G	+	2	0	PCDHGA5	140725211	0.999000	0.42202	1.000000	0.80357	0.683000	0.39861	2.831000	0.48144	1.427000	0.47276	0.563000	0.77884	GGA		0.443	PCDHGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374742.1		NM_018918	
PI15	51050	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	75756222	75756222	+	Missense_Mutation	SNP	G	G	T			TCGA-CZ-5452-01A-01D-1501-10	TCGA-CZ-5452-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	96bd68cb-5d8e-4de1-88ca-5f30fbdde036	fdf88258-9b8a-434a-b396-df5242420b20	g.chr8:75756222G>T	ENST00000260113.2	+	3	459	c.280G>T	c.(280-282)Gat>Tat	p.D94Y	PI15_ENST00000523773.1_Missense_Mutation_p.D94Y|RP11-758M4.4_ENST00000523860.1_RNA|RP11-758M4.4_ENST00000518128.1_RNA|RP11-758M4.4_ENST00000522914.1_RNA	NM_015886.3	NP_056970.1	O43692	PI15_HUMAN	peptidase inhibitor 15	94	SCP.					extracellular vesicular exosome (GO:0070062)	peptidase inhibitor activity (GO:0030414)	p.D94Y(1)		breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|pancreas(1)|skin(1)	30	Breast(64;0.137)		BRCA - Breast invasive adenocarcinoma(89;0.104)|Epithelial(68;0.118)			ACAGGTTTGGGATGAAAATCT	0.393																																																	1	Substitution - Missense(1)	kidney(1)											100.0	101.0	101.0					8																	75756222		2203	4300	6503	SO:0001583	missense	51050			D45027	CCDS6218.1	8q13.3	2005-08-17	2005-08-17		ENSG00000137558	ENSG00000137558			8946	protein-coding gene	gene with protein product		607076	"""protease inhibitor 15"""			8882727, 9473672	Standard	XM_005251255		Approved	P25TI	uc003yal.3	O43692	OTTHUMG00000164528	ENST00000260113.2:c.280G>T	8.37:g.75756222G>T	ENSP00000260113:p.Asp94Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	Q68CY1	Missense_Mutation	SNP	ENST00000260113.2	37	CCDS6218.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.505334	0.85282	.	.	ENSG00000137558	ENST00000260113;ENST00000523773	T;T	0.18338	2.22;2.22	5.06	5.06	0.68205	CAP domain (3);	0.048766	0.85682	D	0.000000	T	0.51210	0.1661	M	0.90759	3.145	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.58295	-0.7661	10	0.52906	T	0.07	.	18.9924	0.92798	0.0:0.0:1.0:0.0	.	94	O43692	PI15_HUMAN	Y	94	ENSP00000260113:D94Y;ENSP00000428567:D94Y	ENSP00000260113:D94Y	D	+	1	0	PI15	75918777	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	8.962000	0.93254	2.783000	0.95769	0.655000	0.94253	GAT		0.393	PI15-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379115.1		NM_015886	
PRKCI	5584	broad.mit.edu	37	3	169940502	169940503	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-CZ-5452-01A-01D-1501-10	TCGA-CZ-5452-11A-01D-1501-10	AG	AG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	96bd68cb-5d8e-4de1-88ca-5f30fbdde036	fdf88258-9b8a-434a-b396-df5242420b20	g.chr3:169940502_169940503delAG	ENST00000295797.4	+	1	350_351	c.45_46delAG	c.(43-48)gcaggcfs	p.G18fs		NM_002740.5	NP_002731.4	P41743	KPCI_HUMAN	protein kinase C, iota	18	Regulatory domain.|Required for interaction with RAB2.				actin filament organization (GO:0007015)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell-cell junction organization (GO:0045216)|cellular response to insulin stimulus (GO:0032869)|cytoskeleton organization (GO:0007010)|establishment of apical/basal cell polarity (GO:0035089)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|eye photoreceptor cell development (GO:0042462)|Golgi vesicle budding (GO:0048194)|intracellular signal transduction (GO:0035556)|membrane organization (GO:0061024)|negative regulation of apoptotic process (GO:0043066)|negative regulation of glial cell apoptotic process (GO:0034351)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of glucose import (GO:0046326)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein phosphorylation (GO:0006468)|protein targeting to membrane (GO:0006612)|response to interleukin-1 (GO:0070555)|secretion (GO:0046903)|tight junction assembly (GO:0070830)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|Schmidt-Lanterman incisure (GO:0043220)	ATP binding (GO:0005524)|phospholipid binding (GO:0005543)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)			breast(2)|endometrium(5)|kidney(1)|large_intestine(4)|lung(16)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	36	all_cancers(22;6.45e-23)|all_epithelial(15;8.52e-28)|all_lung(20;6.31e-17)|Lung NSC(18;2.61e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.197)		Tamoxifen(DB00675)	ACACGGTCGCAGGCGGCGGCAG	0.728																																																	0																																										SO:0001589	frameshift_variant	5584				CCDS3212.2	3q26.3	2008-07-18			ENSG00000163558	ENSG00000163558	2.7.11.13		9404	protein-coding gene	gene with protein product		600539		DXS1179E		7607695, 11978974	Standard	NM_002740		Approved	PKCI	uc003fgs.2	P41743	OTTHUMG00000150214	ENST00000295797.4:c.45_46delAG	3.37:g.169940502_169940503delAG	ENSP00000295797:p.Gly18fs	Somatic		WXS	Illumina GAIIx	Phase_I	D3DNQ4|Q8WW06	Frame_Shift_Del	DEL	ENST00000295797.4	37	CCDS3212.2																																																																																				0.728	PRKCI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316866.3		NM_002740	
PSG3	5671	broad.mit.edu	37	19	43234081	43234081	+	Missense_Mutation	SNP	G	G	C			TCGA-CZ-5452-01A-01D-1501-10	TCGA-CZ-5452-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	96bd68cb-5d8e-4de1-88ca-5f30fbdde036	fdf88258-9b8a-434a-b396-df5242420b20	g.chr19:43234081G>C	ENST00000327495.5	-	4	1021	c.837C>G	c.(835-837)agC>agG	p.S279R	PSG3_ENST00000595140.1_Missense_Mutation_p.S279R	NM_021016.3	NP_066296.2	Q16557	PSG3_HUMAN	pregnancy specific beta-1-glycoprotein 3	279	Ig-like C2-type 2.				defense response (GO:0006952)|female pregnancy (GO:0007565)	extracellular region (GO:0005576)		p.S279R(1)		central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	36		Prostate(69;0.00682)				TGACCGGGAGGCTCTGACCAT	0.463																																																	1	Substitution - Missense(1)	kidney(1)											84.0	93.0	90.0					19																	43234081		1510	2701	4211	SO:0001583	missense	5671				CCDS12611.1	19q13.2	2013-01-29			ENSG00000221826	ENSG00000221826		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9520	protein-coding gene	gene with protein product		176392				2341148	Standard	NM_021016		Approved		uc002oue.3	Q16557	OTTHUMG00000151120	ENST00000327495.5:c.837C>G	19.37:g.43234081G>C	ENSP00000332215:p.Ser279Arg	Somatic		WXS	Illumina GAIIx	Phase_I	Q08265|Q9BRW2|Q9UPL4|Q9UQ77	Missense_Mutation	SNP	ENST00000327495.5	37	CCDS12611.1	.	.	.	.	.	.	.	.	.	.	g	0.003	-2.409765	0.00193	.	.	ENSG00000221826	ENST00000327495	T	0.12255	2.7	0.545	-1.09	0.09904	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.14527	0.0351	M	0.69248	2.105	0.09310	N	1	B;B	0.21071	0.051;0.032	B;B	0.32724	0.12;0.151	T	0.44436	-0.9328	8	0.19590	T	0.45	.	.	.	.	.	257;279	Q08266;Q16557	.;PSG3_HUMAN	R	279	ENSP00000332215:S279R	ENSP00000332215:S279R	S	-	3	2	PSG3	47925921	0.037000	0.19845	0.022000	0.16811	0.008000	0.06430	0.194000	0.17135	-0.412000	0.07519	-0.751000	0.03497	AGC		0.463	PSG3-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321423.2		NM_021016	
PTOV1	53635	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	50358311	50358311	+	Missense_Mutation	SNP	T	T	A			TCGA-CZ-5452-01A-01D-1501-10	TCGA-CZ-5452-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	96bd68cb-5d8e-4de1-88ca-5f30fbdde036	fdf88258-9b8a-434a-b396-df5242420b20	g.chr19:50358311T>A	ENST00000601675.1	+	5	639	c.535T>A	c.(535-537)Tgc>Agc	p.C179S	PTOV1_ENST00000598325.1_3'UTR|PTOV1_ENST00000600603.1_Missense_Mutation_p.C147S|AC018766.5_ENST00000593654.1_RNA|AC018766.6_ENST00000601211.1_RNA|PTOV1_ENST00000221557.9_Missense_Mutation_p.C147S|PTOV1_ENST00000391842.1_Missense_Mutation_p.C179S|PTOV1_ENST00000599732.1_Missense_Mutation_p.C179S|MIR4749_ENST00000578197.1_RNA|PTOV1_ENST00000601638.1_Missense_Mutation_p.C147S			Q86YD1	PTOV1_HUMAN	prostate tumor overexpressed 1	179					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.C179S(1)		endometrium(5)|kidney(3)|large_intestine(2)|lung(5)|ovary(1)	16		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.107)|Ovarian(192;0.231)		GBM - Glioblastoma multiforme(134;0.0116)|OV - Ovarian serous cystadenocarcinoma(262;0.0132)		CAAGGGGCTCTGCCGCATCAT	0.632																																																	1	Substitution - Missense(1)	kidney(1)											38.0	32.0	34.0					19																	50358311		2202	4300	6502	SO:0001583	missense	53635			AF238381	CCDS12782.1	19q13.33	2014-08-28	2008-09-12		ENSG00000104960	ENSG00000104960			9632	protein-coding gene	gene with protein product		610195				12598323, 15713644	Standard	XM_005258998		Approved		uc002pqf.1	Q86YD1	OTTHUMG00000183162	ENST00000601675.1:c.535T>A	19.37:g.50358311T>A	ENSP00000472816:p.Cys179Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q6UXX7|Q96BU3|Q9HBN4|Q9NYL1	Missense_Mutation	SNP	ENST00000601675.1	37	CCDS12782.1	.	.	.	.	.	.	.	.	.	.	T	14.33	2.503807	0.44558	.	.	ENSG00000104960	ENST00000221557;ENST00000391842	.	.	.	3.53	3.53	0.40419	Mediator complex, subunit Med25, PTOV activation and synapsin 2 (1);	0.240219	0.32258	N	0.006353	T	0.40743	0.1129	N	0.22421	0.69	0.38243	D	0.941378	B;P;B	0.48503	0.137;0.911;0.009	B;P;B	0.45343	0.18;0.477;0.078	T	0.37454	-0.9705	9	0.30078	T	0.28	-30.7162	12.01	0.53282	0.0:0.0:0.0:1.0	.	147;179;147	B4DG17;Q86YD1;Q86YD1-2	.;PTOV1_HUMAN;.	S	147;179	.	ENSP00000221557:C147S	C	+	1	0	PTOV1	55050123	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	5.065000	0.64344	1.847000	0.53656	0.460000	0.39030	TGC		0.632	PTOV1-007	KNOWN	alternative_3_UTR|NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465347.1		NM_017432	
RALGAPA1	253959	broad.mit.edu;hgsc.bcm.edu	37	14	36143766	36143766	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CZ-5452-01A-01D-1501-10	TCGA-CZ-5452-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	96bd68cb-5d8e-4de1-88ca-5f30fbdde036	fdf88258-9b8a-434a-b396-df5242420b20	g.chr14:36143766G>A	ENST00000389698.3	-	22	3646	c.3256C>T	c.(3256-3258)Caa>Taa	p.Q1086*	RALGAPA1_ENST00000307138.6_Nonsense_Mutation_p.Q1086*|RALGAPA1_ENST00000258840.6_Nonsense_Mutation_p.Q1133*|RALGAPA1_ENST00000382366.3_Nonsense_Mutation_p.Q1099*	NM_014990.1	NP_055805.1	Q6GYQ0	RGPA1_HUMAN	Ral GTPase activating protein, alpha subunit 1 (catalytic)	1086					activation of Ral GTPase activity (GO:0032859)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)	p.Q1086*(2)		breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(7)|large_intestine(14)|lung(21)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						TCAAAAACTTGAGCATGTATT	0.353																																																	2	Substitution - Nonsense(2)	kidney(2)											28.0	29.0	29.0					14																	36143766		2200	4288	6488	SO:0001587	stop_gained	253959			AK126975	CCDS32064.1, CCDS32065.1, CCDS61439.1	14q13.2	2012-01-26	2009-09-09	2009-09-09	ENSG00000174373	ENSG00000174373			17770	protein-coding gene	gene with protein product	"""tuberin-like protein 1"", ""GAP-related interacting protein to E12"""	608884	"""GTPase activating RANGAP domain-like 1"", ""GTPase activating Rap/RanGAP domain-like 1"""	GARNL1		19520869	Standard	NM_014990		Approved	GRIPE, DKFZp667F074, KIAA0884, Tulip1, RalGAPalpha1	uc001wtj.3	Q6GYQ0	OTTHUMG00000170619	ENST00000389698.3:c.3256C>T	14.37:g.36143766G>A	ENSP00000374348:p.Gln1086*	Somatic		WXS	Illumina HiSeq	Phase_I	A6NMA4|B9EK38|C5NU19|O94960|Q6GYP9|Q6ZT23|Q86YF3|Q86YF5|Q8ND69	Nonsense_Mutation	SNP	ENST00000389698.3	37	CCDS32065.1	.	.	.	.	.	.	.	.	.	.	G	45	11.840016	0.99609	.	.	ENSG00000174373	ENST00000389698;ENST00000307138;ENST00000335518;ENST00000258840;ENST00000382366;ENST00000553892	.	.	.	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.18710	T	0.47	-11.7635	19.6332	0.95719	0.0:0.0:1.0:0.0	.	.	.	.	X	1086;1086;1086;1133;1099;1133	.	ENSP00000258840:Q1133X	Q	-	1	0	RALGAPA1	35213517	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.872000	0.87187	2.645000	0.89757	0.591000	0.81541	CAA		0.353	RALGAPA1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409829.1		XM_210022	
RASGRP3	25780	hgsc.bcm.edu;ucsc.edu	37	2	33747059	33747059	+	Frame_Shift_Del	DEL	A	A	-			TCGA-CZ-5452-01A-01D-1501-10	TCGA-CZ-5452-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	96bd68cb-5d8e-4de1-88ca-5f30fbdde036	fdf88258-9b8a-434a-b396-df5242420b20	g.chr2:33747059delA	ENST00000403687.3	+	7	1146	c.406delA	c.(406-408)aaafs	p.K137fs	RASGRP3_ENST00000407811.1_Frame_Shift_Del_p.K137fs|RASGRP3_ENST00000402538.3_Frame_Shift_Del_p.K137fs	NM_001139488.1	NP_001132960.1	Q8IV61	GRP3_HUMAN	RAS guanyl releasing protein 3 (calcium and DAG-regulated)	137					MAPK cascade (GO:0000165)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rap GTPase activity (GO:0032854)|Ras protein signal transduction (GO:0007265)|small GTPase mediated signal transduction (GO:0007264)	guanyl-nucleotide exchange factor complex (GO:0032045)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|diacylglycerol binding (GO:0019992)|guanyl-nucleotide exchange factor activity (GO:0005085)|Rap GTPase activator activity (GO:0046582)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|signal transducer activity (GO:0004871)			large_intestine(3)|lung(3)|ovary(2)|pancreas(1)|stomach(2)	11	all_hematologic(175;0.115)					CACACAGAGGAAAAAAGTATC	0.423																																																	0													131.0	127.0	129.0					2																	33747059		1873	4106	5979	SO:0001589	frameshift_variant	25780			AB020653	CCDS46256.1, CCDS54346.1	2p25.1-p24.1	2013-01-10			ENSG00000152689	ENSG00000152689		"""EF-hand domain containing"""	14545	protein-coding gene	gene with protein product		609531				10048485, 10934204	Standard	NM_170672		Approved	KIAA0846, GRP3	uc002roy.3	Q8IV61	OTTHUMG00000152124	ENST00000403687.3:c.406delA	2.37:g.33747059delA	ENSP00000384192:p.Lys137fs	Somatic		WXS	Illumina HiSeq	Phase_I	D6W583|O94931|Q53SD7	Frame_Shift_Del	DEL	ENST00000403687.3	37	CCDS46256.1																																																																																				0.423	RASGRP3-006	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325462.2		NM_015376	
RBM19	9904	hgsc.bcm.edu;ucsc.edu	37	12	114364876	114364877	+	Frame_Shift_Ins	INS	-	-	T			TCGA-CZ-5452-01A-01D-1501-10	TCGA-CZ-5452-11A-01D-1501-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	96bd68cb-5d8e-4de1-88ca-5f30fbdde036	fdf88258-9b8a-434a-b396-df5242420b20	g.chr12:114364876_114364877insT	ENST00000545145.2	-	17	2304_2305	c.2226_2227insA	c.(2224-2229)acagaafs	p.E743fs	RBM19_ENST00000392561.3_Frame_Shift_Ins_p.E743fs|RBM19_ENST00000261741.5_Frame_Shift_Ins_p.E743fs	NM_001146699.1	NP_001140171.1	Q9Y4C8	RBM19_HUMAN	RNA binding motif protein 19	743	RRM 5. {ECO:0000255|PROSITE- ProRule:PRU00176}.				multicellular organismal development (GO:0007275)|positive regulation of embryonic development (GO:0040019)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|skin(3)|stomach(4)	55	Medulloblastoma(191;0.163)|all_neural(191;0.178)					AGCTTCTCTTCTGTTGTGTCAA	0.49																																																	0																																										SO:0001589	frameshift_variant	9904			AL117547	CCDS9172.1	12q24.21	2013-02-12				ENSG00000122965		"""RNA binding motif (RRM) containing"""	29098	protein-coding gene	gene with protein product						9734811, 11230166	Standard	NM_016196		Approved	DKFZp586F1023, KIAA0682	uc009zwi.2	Q9Y4C8	OTTHUMG00000169646	ENST00000545145.2:c.2227dupA	12.37:g.114364877_114364877dupT	ENSP00000442053:p.Glu743fs	Somatic		WXS	Illumina HiSeq	Phase_I	A8K5X9|Q9BPY6|Q9UFN5	Frame_Shift_Ins	INS	ENST00000545145.2	37	CCDS9172.1																																																																																				0.490	RBM19-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405251.1		NM_016196	
RRBP1	6238	broad.mit.edu;ucsc.edu	37	20	17641024	17641024	+	Silent	SNP	G	G	T			TCGA-CZ-5452-01A-01D-1501-10	TCGA-CZ-5452-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	96bd68cb-5d8e-4de1-88ca-5f30fbdde036	fdf88258-9b8a-434a-b396-df5242420b20	g.chr20:17641024G>T	ENST00000377813.1	-	3	432	c.129C>A	c.(127-129)gcC>gcA	p.A43A	RRBP1_ENST00000455029.2_Intron|RRBP1_ENST00000360807.4_Silent_p.A43A|RRBP1_ENST00000377807.2_Silent_p.A43A|RRBP1_ENST00000246043.4_Silent_p.A43A			Q9P2E9	RRBP1_HUMAN	ribosome binding protein 1	43					osteoblast differentiation (GO:0001649)|protein transport (GO:0015031)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|receptor activity (GO:0004872)	p.A43A(2)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|prostate(6)	28						TGCGCTGGTTGGCTAGGGCTT	0.463																																																	2	Substitution - coding silent(2)	kidney(2)											87.0	74.0	78.0					20																	17641024		2203	4300	6503	SO:0001819	synonymous_variant	6238			AB037819	CCDS13128.1	20p12	2012-12-07	2012-12-07		ENSG00000125844	ENSG00000125844			10448	protein-coding gene	gene with protein product		601418	"""ribosome binding protein 1 (dog 180kD homolog)"", ""ribosome binding protein 1 homolog 180kDa (dog)"""			8812507	Standard	NM_001042576		Approved	ES/130, hES	uc002wpw.1	Q9P2E9	OTTHUMG00000031945	ENST00000377813.1:c.129C>A	20.37:g.17641024G>T		Somatic		WXS	Illumina GAIIx	Phase_I	A2A2S6|A6NCN6|O75300|O75301|Q5W165|Q96SB2|Q9BWP1|Q9H476	Silent	SNP	ENST00000377813.1	37																																																																																					0.463	RRBP1-002	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000078125.1		NM_001042576	
TRIM45	80263	broad.mit.edu	37	1	117661045	117661045	+	Missense_Mutation	SNP	C	C	T			TCGA-CZ-5452-01A-01D-1501-10	TCGA-CZ-5452-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	96bd68cb-5d8e-4de1-88ca-5f30fbdde036	fdf88258-9b8a-434a-b396-df5242420b20	g.chr1:117661045C>T	ENST00000256649.4	-	2	1359	c.833G>A	c.(832-834)cGg>cAg	p.R278Q	TRIM45_ENST00000369461.3_Missense_Mutation_p.R221Q|TRIM45_ENST00000369464.3_Missense_Mutation_p.R278Q	NM_025188.3	NP_079464.2	Q9H8W5	TRI45_HUMAN	tripartite motif containing 45	278					bone development (GO:0060348)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)	p.R278Q(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(9)|prostate(1)	23	Lung SC(450;0.225)	all_cancers(81;0.000979)|all_lung(203;7.65e-05)|all_epithelial(167;0.000134)|Lung NSC(69;0.000389)		Lung(183;0.0537)|Colorectal(144;0.172)|LUSC - Lung squamous cell carcinoma(189;0.187)		CGAGAATGTCCGGACATCAGC	0.572																																																	1	Substitution - Missense(1)	kidney(1)											61.0	65.0	64.0					1																	117661045		2203	4300	6503	SO:0001583	missense	80263				CCDS893.1, CCDS44200.1	1p13.1	2011-04-20	2011-01-25		ENSG00000134253	ENSG00000134253		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19018	protein-coding gene	gene with protein product		609318	"""tripartite motif-containing 45"""			15351693	Standard	NM_025188		Approved	FLJ13181, RNF99	uc001egz.2	Q9H8W5	OTTHUMG00000012119	ENST00000256649.4:c.833G>A	1.37:g.117661045C>T	ENSP00000256649:p.Arg278Gln	Somatic		WXS	Illumina GAIIx	Phase_I	Q53GN0|Q5T2K4|Q5T2K5|Q8IYV6	Missense_Mutation	SNP	ENST00000256649.4	37	CCDS893.1	.	.	.	.	.	.	.	.	.	.	C	6.211	0.407025	0.11754	.	.	ENSG00000134253	ENST00000256649;ENST00000369464;ENST00000369461	D;D;D	0.86097	-2.07;-2.07;-2.07	5.32	0.224	0.15297	.	0.436137	0.25169	N	0.032603	T	0.61937	0.2387	L	0.45581	1.43	0.09310	N	1	B;B	0.27166	0.17;0.106	B;B	0.16722	0.016;0.007	T	0.53049	-0.8493	10	0.30854	T	0.27	-2.6042	11.38	0.49752	0.0:0.6159:0.0:0.3841	.	278;278	Q9H8W5-2;Q9H8W5	.;TRI45_HUMAN	Q	278;278;221	ENSP00000256649:R278Q;ENSP00000358476:R278Q;ENSP00000358473:R221Q	ENSP00000256649:R278Q	R	-	2	0	TRIM45	117462568	0.238000	0.23825	0.000000	0.03702	0.175000	0.22909	0.765000	0.26546	-0.317000	0.08677	-0.797000	0.03246	CGG		0.572	TRIM45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033503.1		NM_025188	
SMG1P7	100506060	broad.mit.edu	37	16	70268080	70268080	+	RNA	SNP	T	T	C			TCGA-CZ-5452-01A-01D-1501-10	TCGA-CZ-5452-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	96bd68cb-5d8e-4de1-88ca-5f30fbdde036	fdf88258-9b8a-434a-b396-df5242420b20	g.chr16:70268080T>C	ENST00000459379.1	-	0	0																											GTCTTACTGTTGGCTAAAAGG	0.373																																																	0																																												0																															16.37:g.70268080T>C		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP	ENST00000459379.1	37																																																																																					0.373	snoU13.216-201	NOVEL	basic	snoRNA	snoRNA				
WASH6P	653440	broad.mit.edu	37	X	155254706	155254706	+	RNA	SNP	C	C	T			TCGA-CZ-5452-01A-01D-1501-10	TCGA-CZ-5452-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	96bd68cb-5d8e-4de1-88ca-5f30fbdde036	fdf88258-9b8a-434a-b396-df5242420b20	g.chrX:155254706C>T	ENST00000461007.1	+	0	3622				AJ271736.10_ENST00000285718.7_RNA			Q9NQA3	WASH6_HUMAN	WAS protein family homolog 6 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)	p.T415M(2)									GTGAGAGCCACGAGCCAAGGT	0.637													c|||	392	0.0782748	0.0121	0.2233	5008	,	,		28320	0.0615		0.1352	False		,,,				2504	0.0235																2	Substitution - Missense(2)	kidney(2)																																										0			AI042587		Xq28 and Yq12	2014-08-28	2008-01-16	2008-01-16	ENSG00000182484	ENSG00000182484		"""Pseudoautosomal regions / PAR2"", ""WAS protein homologs"""	31685	pseudogene	pseudogene			"""family with sequence similarity 39, member A"", ""chromosomes X and Y open reading frame 1"""	FAM39A, CXYorf1		10655549, 12566406, 18159949	Standard	NG_008380		Approved			Q9NQA3	OTTHUMG00000022677		X.37:g.155254706C>T		Somatic		WXS	Illumina GAIIx	Phase_I	A6NGF1|Q8N305	Missense_Mutation	SNP	ENST00000461007.1	37		.	.	.	.	.	.	.	.	.	.	c	13.63	2.293922	0.40594	.	.	ENSG00000182484	ENST00000359512;ENST00000285718	.	.	.	0.379	0.379	0.16213	.	0.155800	0.56097	N	0.000022	T	0.38983	0.1061	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.28586	-1.0039	6	0.62326	D	0.03	-19.9253	6.473	0.22020	0.0:0.9998:0.0:2.0E-4	.	.	.	.	M	415;384	.	ENSP00000285718:T384M	T	+	2	0	WASH6P	154907900	0.648000	0.27313	0.679000	0.29978	0.260000	0.26232	2.495000	0.45337	0.418000	0.25898	0.171000	0.16805	ACG		0.637	WASH6P-016	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000058840.1		NG_008380	
WDFY4	57705	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	49988080	49988080	+	Silent	SNP	C	C	T			TCGA-CZ-5452-01A-01D-1501-10	TCGA-CZ-5452-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	96bd68cb-5d8e-4de1-88ca-5f30fbdde036	fdf88258-9b8a-434a-b396-df5242420b20	g.chr10:49988080C>T	ENST00000325239.5	+	18	3519	c.3492C>T	c.(3490-3492)caC>caT	p.H1164H	WDFY4_ENST00000413659.2_Intron	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4	1164						integral component of membrane (GO:0016021)		p.H1164H(1)		NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						AGTGGCATCACTTGGCTGTGG	0.537																																																	1	Substitution - coding silent(1)	kidney(1)											186.0	162.0	169.0					10																	49988080		692	1591	2283	SO:0001819	synonymous_variant	57705			AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.3492C>T	10.37:g.49988080C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	Silent	SNP	ENST00000325239.5	37	CCDS44385.1	.	.	.	.	.	.	.	.	.	.	C	8.800	0.932664	0.18131	.	.	ENSG00000128815	ENST00000312002	.	.	.	5.71	2.5	0.30297	.	.	.	.	.	T	0.52386	0.1731	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.43766	-0.9371	4	.	.	.	.	5.1202	0.14856	0.0:0.5591:0.0:0.4409	.	.	.	.	F	255	.	.	L	+	1	0	WDFY4	49658086	0.995000	0.38212	1.000000	0.80357	0.885000	0.51271	0.344000	0.19962	0.777000	0.33496	0.561000	0.74099	CTT		0.537	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			XM_033379	
ZNF160	90338	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	53577475	53577475	+	Silent	SNP	C	C	T			TCGA-CZ-5452-01A-01D-1501-10	TCGA-CZ-5452-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	96bd68cb-5d8e-4de1-88ca-5f30fbdde036	fdf88258-9b8a-434a-b396-df5242420b20	g.chr19:53577475C>T	ENST00000429604.1	-	6	604	c.189G>A	c.(187-189)ggG>ggA	p.G63G	ZNF160_ENST00000418871.1_Silent_p.G63G|ZNF160_ENST00000599056.1_Silent_p.G63G|ZNF160_ENST00000601421.1_Silent_p.G27G|ZNF160_ENST00000599729.1_5'Flank|ZNF160_ENST00000355147.5_Silent_p.G63G	NM_001102603.1|NM_198893.2	NP_001096073.1|NP_942596.1	Q9HCG1	ZN160_HUMAN	zinc finger protein 160	63	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				hemopoiesis (GO:0030097)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G63G(1)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(8)|lung(10)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	35				GBM - Glioblastoma multiforme(134;0.02)		AGGGCTCTTTCCCTTCCTCCA	0.458																																																	1	Substitution - coding silent(1)	kidney(1)											134.0	117.0	123.0					19																	53577475		2203	4300	6503	SO:0001819	synonymous_variant	90338			X78928	CCDS12859.1	19q13.42	2013-01-08				ENSG00000170949		"""Zinc fingers, C2H2-type"", ""-"""	12948	protein-coding gene	gene with protein product		600398				7774943, 7865130	Standard	NM_198893		Approved	HZF5, F11, KR18, HKr18, FLJ00032, KIAA1611	uc002qar.4	Q9HCG1		ENST00000429604.1:c.189G>A	19.37:g.53577475C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q14589|Q504Q8|Q96JC5|Q9BVY9|Q9H7N6	Silent	SNP	ENST00000429604.1	37	CCDS12859.1																																																																																				0.458	ZNF160-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463994.2		NM_033288	
ZNF543	125919	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	57838032	57838032	+	Nonsense_Mutation	SNP	C	C	G			TCGA-CZ-5452-01A-01D-1501-10	TCGA-CZ-5452-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	96bd68cb-5d8e-4de1-88ca-5f30fbdde036	fdf88258-9b8a-434a-b396-df5242420b20	g.chr19:57838032C>G	ENST00000321545.4	+	3	522	c.177C>G	c.(175-177)taC>taG	p.Y59*		NM_213598.3	NP_998763.2	Q08ER8	ZN543_HUMAN	zinc finger protein 543	59	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Y59*(1)		breast(1)|kidney(2)|large_intestine(8)|lung(11)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	28		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		AGCTGATCTACCAGTTGGATC	0.498																																																	1	Substitution - Nonsense(1)	kidney(1)											86.0	79.0	81.0					19																	57838032		2203	4300	6503	SO:0001587	stop_gained	125919			AL834534	CCDS33130.1	19q13.43	2013-01-08				ENSG00000178229		"""Zinc fingers, C2H2-type"", ""-"""	25281	protein-coding gene	gene with protein product							Standard	NM_213598		Approved	DKFZp434H055	uc002qoi.2	Q08ER8		ENST00000321545.4:c.177C>G	19.37:g.57838032C>G	ENSP00000322545:p.Tyr59*	Somatic		WXS	Illumina HiSeq	Phase_I	Q495U9|Q495V0|Q6ZMP4|Q8NCX4	Nonsense_Mutation	SNP	ENST00000321545.4	37	CCDS33130.1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.295372	0.81025	.	.	ENSG00000178229	ENST00000321545	.	.	.	2.4	-0.0443	0.13855	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	3.0345	0.06117	0.0:0.5171:0.287:0.1959	.	.	.	.	X	59	.	ENSP00000322545:Y59X	Y	+	3	2	ZNF543	62529844	0.000000	0.05858	0.001000	0.08648	0.055000	0.15305	0.167000	0.16602	0.052000	0.16007	0.467000	0.42956	TAC		0.498	ZNF543-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465780.1		XM_064865	
BAP1	8314	ucsc.edu	37	3	52438499	52438499	+	Frame_Shift_Del	DEL	T	T	-			TCGA-CZ-5452-01A-01D-1501-10	TCGA-CZ-5452-11A-01D-1501-10	T	T	T	-	T	T	Unknown	Valid	Somatic	Phase_I	WXS	PGM	.		Illumina GAIIx	96bd68cb-5d8e-4de1-88ca-5f30fbdde036	fdf88258-9b8a-434a-b396-df5242420b20	g.chr3:52438499delT	ENST00000460680.1	-	12	1691	c.1220delA	c.(1219-1221)gatfs	p.D408fs	BAP1_ENST00000296288.5_Frame_Shift_Del_p.D390fs	NM_004656.2	NP_004647.1	Q99496	RING2_HUMAN	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)	206					anterior/posterior axis specification (GO:0009948)|gastrulation with mouth forming second (GO:0001702)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K119 monoubiquitination (GO:0036353)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|MLL1 complex (GO:0071339)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|RING-like zinc finger domain binding (GO:0071535)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(3)|eye(42)|kidney(60)|large_intestine(3)|lung(9)|ovary(4)|pleura(39)|prostate(4)|skin(9)|urinary_tract(2)	180				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		CTGCAcgtcatcctcctcgtc	0.562			"""N, Mis, F, S, O"""		"""uveal melanoma, breast, NSCLC, RCC"""	"""mesothelioma, uveal melanoma"""																															GBM(101;493 1458 7992 21037 25532)	.		Rec	yes		3	3p21.31-p21.2	8314	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)		E	0													179.0	133.0	148.0					3																	52438499		2203	4300	6503	SO:0001589	frameshift_variant	8314			AF045581	CCDS2853.1	3p21.31-p21.2	2014-09-17			ENSG00000163930	ENSG00000163930			950	protein-coding gene	gene with protein product		603089				9528852	Standard	NM_004656		Approved	hucep-6, KIAA0272, UCHL2	uc003ddx.4	Q92560	OTTHUMG00000158392	ENST00000460680.1:c.1220delA	3.37:g.52438499delT	ENSP00000417132:p.Asp408fs	Somatic		WXS	Illumina HiSeq	.	B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	Frame_Shift_Del	DEL	ENST00000460680.1	37	CCDS2853.1																																																																																				0.562	BAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350895.1			
