#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NormalRefReads_WU	i_NormalVAF_WU	i_NormalVarReads_WU	i_ORegAnno_bin	i_RNARefReads_WU	i_RNAVAF_WU	i_RNAVarReads_WU	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TumorRefReads_WU	i_TumorVAF_WU	i_TumorVarReads_WU	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
PCNPP4	100874220	genome.wustl.edu	37	X	74757519	74757519	+	IGR	SNP	T	T	G			TCGA-AB-2807-03D-01W-0755-09	TCGA-AB-2807-11D-01W-0755-09	T	T	T	G	T	T	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	3d15bdda-bbb7-4e3d-bdd6-7546d2905e95	b5c93c1e-585d-4cf8-a2b8-bd1b9eb4994c	g.chrX:74757519T>G								ZDHHC15 (14182 upstream) : MAGEE2 (245303 downstream)																							TTCCAATATTTTTAATCCTCA	0.358																																						dbGAP											0			X																																								74674244	SO:0001628	intergenic_variant	0																															X.37:g.74757519T>G		Somatic	424	0.47	2		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	74674244	293	36.17	166		Missense_Mutation	SNP	NULL	p.K122N		37	c.366		X																																																																																			-	NULL	0	0.358					LOC100128989			T			74674244	-1	no_start_codon	XM_001716779.1	genbank	human	model	54_36p	missense	SNP	0.999	G
NXF3	56000	genome.wustl.edu	37	X	102335541	102335541	+	Splice_Site	SNP	C	C	T			TCGA-AB-2807-03D-01W-0755-09	TCGA-AB-2807-11D-01W-0755-09	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	3d15bdda-bbb7-4e3d-bdd6-7546d2905e95	b5c93c1e-585d-4cf8-a2b8-bd1b9eb4994c	g.chrX:102335541C>T	ENST00000395065.3	-	10	992		c.e10-1		NXF3_ENST00000425644.1_Splice_Site	NM_022052.1	NP_071335.1	Q9H4D5	NXF3_HUMAN	nuclear RNA export factor 3						mRNA export from nucleus (GO:0006406)|poly(A)+ mRNA export from nucleus (GO:0016973)	cytoplasm (GO:0005737)|nuclear RNA export factor complex (GO:0042272)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)			NS(1)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(2)|lung(15)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26						CAGGATGGAGCTGCCGAAAAT	0.473																																						dbGAP											0			X											118.0	98.0	105.0					X																	102335541		2203	4300	6503	102222197	SO:0001630	splice_region_variant	0			AJ277527	CCDS14503.1	Xq22	2008-02-05			ENSG00000147206	ENSG00000147206			8073	protein-coding gene	gene with protein product		300316				11073998	Standard	NM_022052		Approved		uc004eju.3	Q9H4D5	OTTHUMG00000022088	ENST00000395065.3:c.891-1G>A	X.37:g.102335541C>T		Somatic	340	0.00	0		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	102222197	107	39.55	70	B4DYS7|Q5H9I1|Q9H1A9	Splice_Site	SNP	-	e10-1	ENST00000395065.3	37	c.891-1	CCDS14503.1	X	.	.	.	.	.	.	.	.	.	.	C	9.746	1.166238	0.21621	.	.	ENSG00000147206	ENST00000395065;ENST00000427570	.	.	.	3.54	3.54	0.40534	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.239	0.54532	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NXF3	102222197	0.998000	0.40836	0.022000	0.16811	0.025000	0.11179	3.939000	0.56591	2.034000	0.60081	0.600000	0.82982	.	-	-		0.473	NXF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NXF3	protein_coding	OTTHUMT00000057684.1	C	NM_022052	Intron	102222197	-1	no_errors	NM_022052.1	genbank	human	reviewed	54_36p	splice_site	SNP	0.376	T
CTTNBP2NL	55917	genome.wustl.edu	37	1	112997103	112997103	+	Silent	SNP	G	G	A			TCGA-AB-2807-03D-01W-0755-09	TCGA-AB-2807-11D-01W-0755-09	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	3d15bdda-bbb7-4e3d-bdd6-7546d2905e95	b5c93c1e-585d-4cf8-a2b8-bd1b9eb4994c	g.chr1:112997103G>A	ENST00000271277.6	+	5	588	c.363G>A	c.(361-363)cgG>cgA	p.R121R		NM_018704.2	NP_061174.1	Q9P2B4	CT2NL_HUMAN	CTTNBP2 N-terminal like	121					negative regulation of transmembrane transport (GO:0034763)|negative regulation of transporter activity (GO:0032410)|protein dephosphorylation (GO:0006470)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	protein phosphatase 2A binding (GO:0051721)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	29		all_cancers(81;0.00064)|all_epithelial(167;0.000415)|all_lung(203;0.00045)|Lung NSC(69;0.000705)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		AAAGGCAGCGGCATGCACAGG	0.388																																						dbGAP											0			1											121.0	114.0	117.0					1																	112997103		2203	4300	6503	112798626	SO:0001819	synonymous_variant	0			AB037854	CCDS845.1	1p13.2	2008-02-05			ENSG00000143079	ENSG00000143079			25330	protein-coding gene	gene with protein product		615100				10718198	Standard	NM_018704		Approved	DKFZp547A023	uc001ebx.3	Q9P2B4	OTTHUMG00000011154	ENST00000271277.6:c.363G>A	1.37:g.112997103G>A		Somatic	360	2.44	9		2	33.33	1	WXS	Illumina HiSeq	Phase_IV	112798626	91	44.85	74	B3KMS5|Q96B40	Silent	SNP	HMMPfam_CortBP2	p.R121	ENST00000271277.6	37	c.363	CCDS845.1	1																																																																																			-	HMMPfam_CortBP2		0.388	CTTNBP2NL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTTNBP2NL	protein_coding	OTTHUMT00000030686.1	G	NM_018704		112798626	+1	no_errors	NM_018704.2	genbank	human	validated	54_36p	silent	SNP	1.000	A
TBC1D8	11138	genome.wustl.edu	37	2	101643864	101643864	+	Missense_Mutation	SNP	T	T	G			TCGA-AB-2807-03D-01W-0755-09	TCGA-AB-2807-11D-01W-0755-09	T	T	T	G	T	T	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	3d15bdda-bbb7-4e3d-bdd6-7546d2905e95	b5c93c1e-585d-4cf8-a2b8-bd1b9eb4994c	g.chr2:101643864T>G	ENST00000376840.4	-	15	2455	c.2456A>C	c.(2455-2457)gAg>gCg	p.E819A	TBC1D8_ENST00000409318.1_Missense_Mutation_p.E834A			O95759	TBCD8_HUMAN	TBC1 domain family, member 8 (with GRAM domain)	819					blood circulation (GO:0008015)|positive regulation of cell proliferation (GO:0008284)	membrane (GO:0016020)	calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			breast(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(2)|lung(12)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	32						GTCGTAGAGCTCCTCTAGGTC	0.562																																						dbGAP											0			2											77.0	78.0	78.0					2																	101643864		1916	4120	6036	101010296	SO:0001583	missense	0			AB024057	CCDS46375.1	2q12.1	2011-11-30			ENSG00000204634	ENSG00000204634			17791	protein-coding gene	gene with protein product	"""BUB2-like protein 1"", ""vascular Rab-GAP/TBC-containing protein"""					10373574	Standard	NM_001102426		Approved	HBLP1, VRP, AD3	uc010fiv.3	O95759	OTTHUMG00000153040	ENST00000376840.4:c.2456A>C	2.37:g.101643864T>G	ENSP00000366036:p.Glu819Ala	Somatic	205	1.44	3		13	50.00	13	WXS	Illumina HiSeq	Phase_IV	101010296	103	48.50	97	A6NDL4|A8K9W1|B9A6K4|Q53SQ4|Q9UQ32	Missense_Mutation	SNP	HMMPfam_TBC,HMMSmart_SM00164,superfamily_Ypt/Rab-GAP domain of gyp1p,HMMPfam_GRAM,HMMSmart_SM00568,superfamily_EF-hand	p.E819A	ENST00000376840.4	37	c.2456	CCDS46375.1	2	.	.	.	.	.	.	.	.	.	.	T	13.92	2.381207	0.42207	.	.	ENSG00000204634	ENST00000376840;ENST00000409318	T;T	0.54479	0.57;0.57	5.18	5.18	0.71444	EF-hand-like domain (1);	0.093330	0.46442	D	0.000296	T	0.47967	0.1474	L	0.58101	1.795	0.37771	D	0.926677	B	0.21452	0.056	B	0.23419	0.046	T	0.48293	-0.9048	10	0.13470	T	0.59	-21.4485	13.8994	0.63794	0.0:0.0:0.0:1.0	.	819	O95759	TBCD8_HUMAN	A	819;834	ENSP00000366036:E819A;ENSP00000386856:E834A	ENSP00000366036:E819A	E	-	2	0	TBC1D8	101010296	1.000000	0.71417	0.983000	0.44433	0.891000	0.51852	5.087000	0.64480	2.066000	0.61787	0.533000	0.62120	GAG	-	superfamily_EF-hand		0.562	TBC1D8-011	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D8	protein_coding	OTTHUMT00000376092.1	T	NM_007063		101010296	-1	no_errors	NM_001102426.1	genbank	human	validated	54_36p	missense	SNP	1.000	G
CCDC150	284992	genome.wustl.edu	37	2	197594112	197594112	+	Splice_Site	SNP	G	G	A			TCGA-AB-2807-03D-01W-0755-09	TCGA-AB-2807-11D-01W-0755-09	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	3d15bdda-bbb7-4e3d-bdd6-7546d2905e95	b5c93c1e-585d-4cf8-a2b8-bd1b9eb4994c	g.chr2:197594112G>A	ENST00000389175.4	+	23	2886		c.e23+1		CCDC150_ENST00000487663.1_3'UTR|CCDC150_ENST00000272831.7_Splice_Site|CCDC150_ENST00000409270.1_Splice_Site	NM_001080539.1	NP_001074008.1	Q8NCX0	CC150_HUMAN	coiled-coil domain containing 150											breast(3)|endometrium(6)|kidney(1)|large_intestine(6)|lung(14)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	33						AAGGATGAAGGTTGTATGGGA	0.418																																						dbGAP											0			2											106.0	103.0	104.0					2																	197594112		1882	4103	5985	197302357	SO:0001630	splice_region_variant	0				CCDS46478.1	2q33.1	2008-04-10			ENSG00000144395	ENSG00000144395			26834	protein-coding gene	gene with protein product							Standard	NM_001080539		Approved	FLJ39660	uc002utp.1	Q8NCX0	OTTHUMG00000154475	ENST00000389175.4:c.2751+1G>A	2.37:g.197594112G>A		Somatic	345	0.86	3		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	197302357	284	42.51	210	Q6P5U6|Q6P663|Q8N8V5	Splice_Site	SNP	-	e23+1	ENST00000389175.4	37	c.2751+1	CCDS46478.1	2	.	.	.	.	.	.	.	.	.	.	G	14.37	2.516663	0.44763	.	.	ENSG00000144395	ENST00000272831;ENST00000389175;ENST00000409270	.	.	.	5.67	5.67	0.87782	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.6874	0.85312	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CCDC150	197302357	1.000000	0.71417	0.999000	0.59377	0.367000	0.29736	5.581000	0.67471	2.697000	0.92050	0.655000	0.94253	.	-	-		0.418	CCDC150-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	CCDC150	protein_coding	OTTHUMT00000335377.2	G	NM_001080539	Intron	197302357	+1	no_errors	NM_001080539.1	genbank	human	provisional	54_36p	splice_site	SNP	0.997	A
UNC80	285175	genome.wustl.edu	37	2	210783294	210783294	+	Silent	SNP	G	G	A	rs376345036		TCGA-AB-2807-03D-01W-0755-09	TCGA-AB-2807-11D-01W-0755-09	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	3d15bdda-bbb7-4e3d-bdd6-7546d2905e95	b5c93c1e-585d-4cf8-a2b8-bd1b9eb4994c	g.chr2:210783294G>A	ENST00000439458.1	+	32	5132	c.5052G>A	c.(5050-5052)ccG>ccA	p.P1684P	UNC80_ENST00000272845.6_Silent_p.P1679P	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)	1684					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						TTCCCTCGCCGGTGCTTGGAA	0.498																																						dbGAP											0			2						G	,	1,1383		0,1,691	67.0	57.0	60.0		5052,5037	-2.1	0.7	2		60	0,3182		0,0,1591	no	coding-synonymous,coding-synonymous	UNC80	NM_032504.1,NM_182587.3	,	0,1,2282	AA,AG,GG		0.0,0.0723,0.0219	,	1684/3259,1679/3235	210783294	1,4565	692	1591	2283	210491539	SO:0001819	synonymous_variant	0			AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.5052G>A	2.37:g.210783294G>A		Somatic	243	0.00	0		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	210491539	227	51.08	237	B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Silent	SNP	NULL	p.P859	ENST00000439458.1	37	c.2577	CCDS46504.1	2																																																																																			-	NULL		0.498	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	uc002vdl.1	protein_coding		G	NM_182587		210491539	+1	no_start_codon	ENST00000272845	ensembl	human	known	54_36p	silent	SNP	0.915	A
TENM3	55714	genome.wustl.edu	37	4	183664410	183664410	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2807-03D-01W-0755-09	TCGA-AB-2807-11D-01W-0755-09	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	3d15bdda-bbb7-4e3d-bdd6-7546d2905e95	b5c93c1e-585d-4cf8-a2b8-bd1b9eb4994c	g.chr4:183664410G>A	ENST00000511685.1	+	19	3590	c.3467G>A	c.(3466-3468)cGc>cAc	p.R1156H	TENM3_ENST00000502950.1_3'UTR|TENM3_ENST00000406950.2_Missense_Mutation_p.R1156H			Q9P273	TEN3_HUMAN	teneurin transmembrane protein 3	1156					camera-type eye morphogenesis (GO:0048593)|homophilic cell adhesion (GO:0007156)|positive regulation of neuron projection development (GO:0010976)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										GGGCGAAGGCGCAGCATTTCC	0.527																																						dbGAP											0			4											78.0	81.0	80.0					4																	183664410		2050	4201	6251	183901404	SO:0001583	missense	0			AF195420	CCDS47165.1	4q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000218336	ENSG00000218336			29944	protein-coding gene	gene with protein product		610083	"""odz, odd Oz/ten-m homolog 3 (Drosophila)"""	ODZ3		10331952, 10625539	Standard	NM_001080477		Approved	Ten-M3, KIAA1455	uc003ivd.1	Q9P273	OTTHUMG00000160682	ENST00000511685.1:c.3467G>A	4.37:g.183664410G>A	ENSP00000424226:p.Arg1156His	Somatic	166	0.00	0		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	183901404	126	48.57	119	Q5XUL9|Q96SY2|Q9NV77|Q9NVW1|Q9NZJ2	Missense_Mutation	SNP	HMMPfam_NHL,HMMSmart_EGF,HMMPfam_RHS_repeat,superfamily_CarboxypepD_reg,superfamily_ConA_like_lec_gl,HMMPfam_Ten_N,PatternScan_EGF_1,PatternScan_EGF_2,HMMPfam_EGF_2,superfamily_SSF101898,superfamily_SSF57196,superfamily_SSF63829	p.R1156H	ENST00000511685.1	37	c.3467	CCDS47165.1	4	.	.	.	.	.	.	.	.	.	.	G	35	5.467382	0.96257	.	.	ENSG00000218336	ENST00000511685;ENST00000406950	D;D	0.90900	-2.75;-2.75	5.45	5.45	0.79879	.	.	.	.	.	D	0.96454	0.8843	M	0.91920	3.255	0.80722	D	1	D	0.76494	0.999	D	0.73380	0.98	D	0.96776	0.9572	9	0.87932	D	0	.	19.4688	0.94954	0.0:0.0:1.0:0.0	.	1156	Q9P273	TEN3_HUMAN	H	1156	ENSP00000424226:R1156H;ENSP00000385276:R1156H	ENSP00000385276:R1156H	R	+	2	0	ODZ3	183901404	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	9.636000	0.98440	2.838000	0.97847	0.561000	0.74099	CGC	-	superfamily_ConA_like_lec_gl		0.527	TENM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ODZ3	protein_coding	OTTHUMT00000361734.1	G			183901404	+1	no_errors	NM_001080477.1	genbank	human	provisional	54_36p	missense	SNP	1.000	A
ZNF311	282890	genome.wustl.edu	37	6	28963746	28963746	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2807-03D-01W-0755-09	TCGA-AB-2807-11D-01W-0755-09	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	3d15bdda-bbb7-4e3d-bdd6-7546d2905e95	b5c93c1e-585d-4cf8-a2b8-bd1b9eb4994c	g.chr6:28963746G>A	ENST00000377179.3	-	7	1545	c.1033C>T	c.(1033-1035)Cgt>Tgt	p.R345C	ZNF311_ENST00000483450.1_5'UTR	NM_001010877.2	NP_001010877.2	Q5JNZ3	ZN311_HUMAN	zinc finger protein 311	345					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(11)|skin(3)|upper_aerodigestive_tract(2)	28						ATACAGAGACGGTTCCTGGTC	0.502																																						dbGAP											0			6											91.0	61.0	71.0					6																	28963746		1511	2709	4220	29071725	SO:0001583	missense	0			AL833166	CCDS34357.1	6p21.33	2013-01-08			ENSG00000197935	ENSG00000197935		"""Zinc fingers, C2H2-type"", ""-"""	13847	protein-coding gene	gene with protein product							Standard	XM_006715067		Approved		uc003nlu.2	Q5JNZ3	OTTHUMG00000031292	ENST00000377179.3:c.1033C>T	6.37:g.28963746G>A	ENSP00000366384:p.Arg345Cys	Somatic	575	0.52	3		2	66.67	4	WXS	Illumina HiSeq	Phase_IV	29071725	179	50.55	183	A2BFK5|B0S7Y4|Q92971	Missense_Mutation	SNP	HMMPfam_KRAB,HMMSmart_SM00349,superfamily_KRAB domain (Kruppel-associated box Pfam 01352),HMMPfam_zf-C2H2,PatternScan_ZINC_FINGER_C2H2_1,HMMSmart_SM00355,superfamily_C2H2 and C2HC zinc fingers	p.R345C	ENST00000377179.3	37	c.1033	CCDS34357.1	6	.	.	.	.	.	.	.	.	.	.	G	0.027	-1.362697	0.01235	.	.	ENSG00000197935	ENST00000377179;ENST00000535083	T	0.08193	3.12	2.8	-1.19	0.09585	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02012	0.0063	L	0.39147	1.195	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.43491	-0.9388	9	0.35671	T	0.21	-0.8317	7.997	0.30273	0.4618:0.0:0.5382:0.0	.	345	Q5JNZ3	ZN311_HUMAN	C	345;253	ENSP00000366384:R345C	ENSP00000366384:R345C	R	-	1	0	ZNF311	29071725	0.000000	0.05858	0.001000	0.08648	0.009000	0.06853	-4.125000	0.00290	-0.670000	0.05282	-1.626000	0.00786	CGT	-	HMMPfam_zf-C2H2,PatternScan_ZINC_FINGER_C2H2_1,HMMSmart_SM00355,superfamily_C2H2 and C2HC zinc fingers		0.502	ZNF311-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF311	protein_coding	OTTHUMT00000076631.3	G	XM_212581		29071725	-1	no_errors	NM_001010877.2	genbank	human	provisional	54_36p	missense	SNP	0.000	A
AKAP12	9590	genome.wustl.edu	37	6	151673742	151673742	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2807-03D-01W-0755-09	TCGA-AB-2807-11D-01W-0755-09	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	3d15bdda-bbb7-4e3d-bdd6-7546d2905e95	b5c93c1e-585d-4cf8-a2b8-bd1b9eb4994c	g.chr6:151673742G>A	ENST00000253332.1	+	3	4405	c.4216G>A	c.(4216-4218)Gta>Ata	p.V1406I	AKAP12_ENST00000402676.2_Missense_Mutation_p.V1406I|AKAP12_ENST00000354675.6_Missense_Mutation_p.V1308I|AKAP12_ENST00000359755.5_Missense_Mutation_p.V1301I			Q02952	AKA12_HUMAN	A kinase (PRKA) anchor protein 12	1406					G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of protein kinase A signaling (GO:0010739)|protein targeting (GO:0006605)|regulation of protein kinase C signaling (GO:0090036)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	adenylate cyclase binding (GO:0008179)|protein kinase A binding (GO:0051018)			breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	68		Ovarian(120;0.125)	BRCA - Breast invasive adenocarcinoma(37;0.175)	OV - Ovarian serous cystadenocarcinoma(155;2.98e-11)		AGAGGAGGCAGTATGCACCAA	0.502																																					Melanoma(141;1616 1805 10049 24534 51979)	dbGAP											0			6											71.0	72.0	72.0					6																	151673742		2203	4300	6503	151715435	SO:0001583	missense	0			U81607	CCDS5229.1, CCDS5230.1	6q24-q25	2011-07-01	2008-08-29		ENSG00000131016	ENSG00000131016		"""A-kinase anchor proteins"""	370	protein-coding gene	gene with protein product	"""gravin"", ""Src-Suppressed C Kinase Substrate"""	604698	"""A kinase (PRKA) anchor protein (gravin) 12"""			9000000	Standard	NM_144497		Approved	AKAP250, SSeCKS	uc011eep.2	Q02952	OTTHUMG00000015833	ENST00000253332.1:c.4216G>A	6.37:g.151673742G>A	ENSP00000253332:p.Val1406Ile	Somatic	223	0.45	1		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	151715435	233	46.80	205	O00310|O00498|Q4LE68|Q5SZ80|Q5TGN1|Q68D82|Q99970	Missense_Mutation	SNP	HMMPfam_WSK,HMMPfam_RII_binding_1	p.V1406I	ENST00000253332.1	37	c.4216	CCDS5229.1	6	.	.	.	.	.	.	.	.	.	.	G	11.16	1.556339	0.27827	.	.	ENSG00000131016	ENST00000402676;ENST00000253332;ENST00000354675;ENST00000359755	T;T;T;T	0.07908	3.15;3.15;3.16;3.16	4.75	3.83	0.44106	.	1.874550	0.03646	N	0.240300	T	0.02047	0.0064	N	0.19112	0.55	0.09310	N	1	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.08055	0.003;0.003;0.001	T	0.39251	-0.9623	10	0.35671	T	0.21	.	7.0774	0.25211	0.2195:0.0:0.7805:0.0	.	1301;1308;1406	Q02952-3;Q02952-2;Q02952	.;.;AKA12_HUMAN	I	1406;1406;1308;1301	ENSP00000384537:V1406I;ENSP00000253332:V1406I;ENSP00000346702:V1308I;ENSP00000352794:V1301I	ENSP00000253332:V1406I	V	+	1	0	AKAP12	151715435	0.001000	0.12720	0.001000	0.08648	0.010000	0.07245	0.191000	0.17076	1.040000	0.40099	-0.355000	0.07637	GTA	-	NULL		0.502	AKAP12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AKAP12	protein_coding	OTTHUMT00000042712.1	G			151715435	+1	no_errors	NM_005100.3	genbank	human	reviewed	54_36p	missense	SNP	0.000	A
LPA	4018	genome.wustl.edu	37	6	160998167	160998167	+	Splice_Site	SNP	C	C	T	rs200099994	byFrequency	TCGA-AB-2807-03D-01W-0755-09	TCGA-AB-2807-11D-01W-0755-09	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	3d15bdda-bbb7-4e3d-bdd6-7546d2905e95	b5c93c1e-585d-4cf8-a2b8-bd1b9eb4994c	g.chr6:160998167C>T	ENST00000316300.5	-	28	4676		c.e28+1		LPA_ENST00000447678.1_Splice_Site			P08519	APOA_HUMAN	lipoprotein, Lp(a)						blood circulation (GO:0008015)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|negative regulation of endopeptidase activity (GO:0010951)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|plasma lipoprotein particle (GO:0034358)	apolipoprotein binding (GO:0034185)|endopeptidase inhibitor activity (GO:0004866)|fibronectin binding (GO:0001968)|heparin binding (GO:0008201)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|lung(54)|ovary(4)|pancreas(1)|prostate(2)|skin(10)|stomach(1)|urinary_tract(1)	107		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	CAAATACATACGCATTTGGGT	0.433													C|||	2	0.000399361	0.0	0.0	5008	,	,		16726	0.002		0.0	False		,,,				2504	0.0					dbGAP											0			6						C		2,4260		0,2,2129	164.0	170.0	168.0			2.5	1.0	6		168	1,8565		0,1,4282	yes	splice-5	LPA	NM_005577.2		0,3,6411	TT,TC,CC		0.0117,0.0469,0.0234			160998167	3,12825	2131	4283	6414	160918157	SO:0001630	splice_region_variant	0			X06290	CCDS43523.1	6q25-q26	2012-10-02			ENSG00000198670	ENSG00000198670			6667	protein-coding gene	gene with protein product		152200		LP		3670400	Standard	NM_005577		Approved		uc003qtl.3	P08519	OTTHUMG00000015956	ENST00000316300.5:c.4631+1G>A	6.37:g.160998167C>T		Somatic	154	0.00	0		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	160918157	325	40.04	217	Q5VTD7|Q9UD88	Splice_Site	SNP	-	e28+1	ENST00000316300.5	37	c.4631+1	CCDS43523.1	6	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	8.233	0.805036	0.16467	4.69E-4	1.17E-4	ENSG00000198670	ENST00000316300;ENST00000447678	.	.	.	2.55	2.55	0.30701	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.5946	0.33707	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	LPA	160918157	1.000000	0.71417	0.991000	0.47740	0.146000	0.21551	3.469000	0.53093	1.410000	0.46936	0.430000	0.28490	.	-	-		0.433	LPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPA	protein_coding	OTTHUMT00000042957.1	C	NM_005577	Intron	160918157	-1	no_errors	NM_005577.2	genbank	human	validated	54_36p	splice_site	SNP	1.000	T
POM121L12	285877	genome.wustl.edu	37	7	53103840	53103840	+	Missense_Mutation	SNP	G	G	A	rs565383229	byFrequency	TCGA-AB-2807-03D-01W-0755-09	TCGA-AB-2807-11D-01W-0755-09	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	3d15bdda-bbb7-4e3d-bdd6-7546d2905e95	b5c93c1e-585d-4cf8-a2b8-bd1b9eb4994c	g.chr7:53103840G>A	ENST00000408890.4	+	1	492	c.476G>A	c.(475-477)cGc>cAc	p.R159H		NM_182595.3	NP_872401.3	Q8N7R1	P1L12_HUMAN	POM121 transmembrane nucleoporin-like 12	159								p.R159H(1)		endometrium(5)|kidney(1)|large_intestine(5)|lung(44)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	61						CAGAGAgcccgccccgcaggc	0.726													G|||	2	0.000399361	0.0	0.0	5008	,	,		10797	0.0		0.0	False		,,,				2504	0.002					dbGAP											1	Substitution - Missense(1)	lung(1)	7											13.0	16.0	15.0					7																	53103840		1848	4065	5913	53071334	SO:0001583	missense	0				CCDS43584.1	7p12.1	2012-03-13	2012-03-13		ENSG00000221900	ENSG00000221900			25369	protein-coding gene	gene with protein product			"""POM121 membrane glycoprotein-like 12"""				Standard	NM_182595		Approved	DKFZp564N2472	uc003tpz.3	Q8N7R1	OTTHUMG00000155995	ENST00000408890.4:c.476G>A	7.37:g.53103840G>A	ENSP00000386133:p.Arg159His	Somatic	12	0.00	0		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	53071334	16	30.43	7	Q8NDI9	Missense_Mutation	SNP	NULL	p.R159H	ENST00000408890.4	37	c.476	CCDS43584.1	7	.	.	.	.	.	.	.	.	.	.	G	12.74	2.029590	0.35797	.	.	ENSG00000221900	ENST00000408890	T	0.23552	1.9	2.08	-4.17	0.03857	.	.	.	.	.	T	0.12902	0.0313	N	0.08118	0	0.09310	N	1	D	0.69078	0.997	P	0.48304	0.573	T	0.10776	-1.0615	9	0.40728	T	0.16	.	4.4869	0.11794	0.2735:0.3869:0.3396:0.0	.	159	Q8N7R1	P1L12_HUMAN	H	159	ENSP00000386133:R159H	ENSP00000386133:R159H	R	+	2	0	POM121L12	53071334	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.533000	0.02215	-1.234000	0.02548	0.555000	0.69702	CGC	-	NULL		0.726	POM121L12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DKFZp564N2472	protein_coding	OTTHUMT00000342656.1	G	NM_182595		53071334	+1	no_errors	NM_182595.2	genbank	human	validated	54_36p	missense	SNP	0.001	A
PCLO	27445	genome.wustl.edu	37	7	82538317	82538317	+	Missense_Mutation	SNP	C	C	T			TCGA-AB-2807-03D-01W-0755-09	TCGA-AB-2807-11D-01W-0755-09	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	3d15bdda-bbb7-4e3d-bdd6-7546d2905e95	b5c93c1e-585d-4cf8-a2b8-bd1b9eb4994c	g.chr7:82538317C>T	ENST00000333891.9	-	8	13650	c.13313G>A	c.(13312-13314)cGt>cAt	p.R4438H	PCLO_ENST00000423517.2_Missense_Mutation_p.R4438H	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						TTCCTCACGACGCAGATGATA	0.453																																						dbGAP											0			7											90.0	80.0	83.0					7																	82538317		1937	4142	6079	82376253	SO:0001583	missense	0			AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.13313G>A	7.37:g.82538317C>T	ENSP00000334319:p.Arg4438His	Somatic	97	2.02	2		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	82376253	182	40.13	122		Missense_Mutation	SNP	HMMPfam_C2,HMMSmart_SM00239,HMMPfam_PDZ,HMMSmart_SM00228,superfamily_PDZ domain-like,HMMPfam_zf-piccolo,superfamily_C2 domain (Calcium/lipid-binding domain CaLB),superfamily_FYVE/PHD zinc finger	p.R4438H	ENST00000333891.9	37	c.13313	CCDS47630.1	7	.	.	.	.	.	.	.	.	.	.	C	15.69	2.907159	0.52333	.	.	ENSG00000186472	ENST00000333891;ENST00000423517	T;T	0.19105	2.17;2.17	5.39	5.39	0.77823	.	.	.	.	.	T	0.46870	0.1415	M	0.61703	1.905	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.76575	0.988;0.988	T	0.40515	-0.9559	9	0.87932	D	0	.	19.5274	0.95212	0.0:1.0:0.0:0.0	.	4438;4438	Q9Y6V0-5;Q9Y6V0-6	.;.	H	4438	ENSP00000334319:R4438H;ENSP00000388393:R4438H	ENSP00000334319:R4438H	R	-	2	0	PCLO	82376253	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.890000	0.69774	2.699000	0.92147	0.591000	0.81541	CGT	-	NULL		0.453	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PCLO	protein_coding	OTTHUMT00000337368.5	C	NM_014510		82376253	-1	no_errors	NM_033026.2	genbank	human	validated	54_36p	missense	SNP	1.000	T
FLNC	2318	genome.wustl.edu	37	7	128480714	128480714	+	Silent	SNP	C	C	T	rs376975967		TCGA-AB-2807-03D-01W-0755-09	TCGA-AB-2807-11D-01W-0755-09	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	3d15bdda-bbb7-4e3d-bdd6-7546d2905e95	b5c93c1e-585d-4cf8-a2b8-bd1b9eb4994c	g.chr7:128480714C>T	ENST00000325888.8	+	10	1923	c.1662C>T	c.(1660-1662)taC>taT	p.Y554Y	FLNC_ENST00000346177.6_Silent_p.Y554Y	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	554					cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)			biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						GGGGCGGCTACGCCATCCCTC	0.642													C|||	1	0.000199681	0.0	0.0	5008	,	,		18512	0.001		0.0	False		,,,				2504	0.0					dbGAP											0			7											147.0	165.0	159.0					7																	128480714		2141	4238	6379	128267950	SO:0001819	synonymous_variant	0			AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.1662C>T	7.37:g.128480714C>T		Somatic	1521	3.73	59		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	128267950	97	47.57	88	B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Silent	SNP	HMMSmart_SM00557,PatternScan_ACTININ_1,PatternScan_ACTININ_2,HMMPfam_CH,HMMSmart_SM00033,superfamily_E set domains,superfamily_Calponin-homology domain CH-domain,HMMPfam_Filamin	p.Y554	ENST00000325888.8	37	c.1662	CCDS43644.1	7																																																																																			-	HMMSmart_SM00557,superfamily_E set domains,HMMPfam_Filamin		0.642	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FLNC	protein_coding	OTTHUMT00000059948.3	C			128267950	+1	no_errors	NM_001458.1	genbank	human	reviewed	54_36p	silent	SNP	0.972	T
GPR124	25960	genome.wustl.edu	37	8	37697763	37697763	+	Missense_Mutation	SNP	C	C	T			TCGA-AB-2807-03D-01W-0755-09	TCGA-AB-2807-11D-01W-0755-09	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	3d15bdda-bbb7-4e3d-bdd6-7546d2905e95	b5c93c1e-585d-4cf8-a2b8-bd1b9eb4994c	g.chr8:37697763C>T	ENST00000412232.2	+	17	2649	c.2636C>T	c.(2635-2637)cCt>cTt	p.P879L	GPR124_ENST00000315215.7_Missense_Mutation_p.P662L	NM_032777.9	NP_116166.9	Q96PE1	GP124_HUMAN	G protein-coupled receptor 124	879					central nervous system development (GO:0007417)|endothelial cell migration (GO:0043542)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|neuropeptide signaling pathway (GO:0007218)|positive regulation of endothelial cell migration (GO:0010595)|regulation of angiogenesis (GO:0045765)|regulation of chemotaxis (GO:0050920)|regulation of establishment of blood-brain barrier (GO:0090210)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(16)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	37			BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)			CCCGCTCTGCCTACTCCCAGT	0.597																																						dbGAP											0			8											69.0	60.0	63.0					8																	37697763		2203	4300	6503	37816921	SO:0001583	missense	0			AB040964	CCDS6097.2	8p11.22	2014-08-08			ENSG00000020181	ENSG00000020181		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17849	protein-coding gene	gene with protein product	"""tumor endothelial marker 5"""	606823				11559528, 12565841	Standard	NM_032777		Approved	TEM5, DKFZp434C211, DKFZp434J0911, KIAA1531, FLJ14390	uc003xkj.3	Q96PE1	OTTHUMG00000156182	ENST00000412232.2:c.2636C>T	8.37:g.37697763C>T	ENSP00000406367:p.Pro879Leu	Somatic	185	0.00	0		3	25.00	1	WXS	Illumina HiSeq	Phase_IV	37816921	96	26.72	35	A6H8W3|D3DSW4|Q8N3R1|Q8TEM3|Q96KB2|Q9P1Z7|Q9UFY4	Missense_Mutation	SNP	HMMPfam_GPS,HMMSmart_SM00082,HMMPfam_LRR_1,HMMPfam_HRM,HMMSmart_SM00369,HMMSmart_SM00409,PatternScan_G_PROTEIN_RECEP_F2_2,superfamily_Hormone receptor domain (HRM Pfam 02793),superfamily_L domain-like	p.P872L	ENST00000412232.2	37	c.2615	CCDS6097.2	8	.	.	.	.	.	.	.	.	.	.	C	18.19	3.569507	0.65765	.	.	ENSG00000020181	ENST00000416514;ENST00000315215;ENST00000412232	T;T	0.43294	0.95;0.95	3.91	3.91	0.45181	GPCR, family 2-like (1);	0.060680	0.64402	N	0.000002	T	0.62109	0.2401	M	0.65975	2.015	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.98;0.999	T	0.63844	-0.6545	10	0.41790	T	0.15	-14.9293	16.5234	0.84322	0.0:1.0:0.0:0.0	.	662;879	Q96PE1-2;Q96PE1	.;GP124_HUMAN	L	872;662;879	ENSP00000323508:P662L;ENSP00000406367:P879L	ENSP00000323508:P662L	P	+	2	0	GPR124	37816921	1.000000	0.71417	0.078000	0.20375	0.028000	0.11728	7.506000	0.81665	2.188000	0.69820	0.650000	0.86243	CCT	-	NULL		0.597	GPR124-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR124	protein_coding	OTTHUMT00000343331.2	C			37816921	+1	no_errors	NM_032777.7	genbank	human	validated	54_36p	missense	SNP	0.875	T
P2RY2	5029	genome.wustl.edu	37	11	72946279	72946279	+	Missense_Mutation	SNP	T	T	C	rs74472890	byFrequency	TCGA-AB-2807-03D-01W-0755-09	TCGA-AB-2807-11D-01W-0755-09	T	T	T	C	T	T	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	3d15bdda-bbb7-4e3d-bdd6-7546d2905e95	b5c93c1e-585d-4cf8-a2b8-bd1b9eb4994c	g.chr11:72946279T>C	ENST00000311131.2	+	3	1542	c.1075T>C	c.(1075-1077)Tct>Cct	p.S359P	P2RY2_ENST00000393597.2_Missense_Mutation_p.S359P|P2RY2_ENST00000393596.2_Missense_Mutation_p.S359P	NM_002564.2|NM_176072.1	NP_002555|NP_788086	P41231	P2RY2_HUMAN	purinergic receptor P2Y, G-protein coupled, 2	359				S -> F (in Ref. 1; AAC04923). {ECO:0000305}.	cellular ion homeostasis (GO:0006873)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of mucus secretion (GO:0070257)|regulation of vasodilation (GO:0042312)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|receptor activity (GO:0004872)			endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|prostate(1)|skin(2)|urinary_tract(2)	25					Suramin(DB04786)	CAGTGAGGACTCTAGGCGGAC	0.597													T|||	107	0.0213658	0.0023	0.0231	5008	,	,		19669	0.002		0.0467	False		,,,				2504	0.0399					dbGAP											0			11						T	PRO/SER,PRO/SER,PRO/SER	50,4304		0,50,2127	89.0	93.0	92.0		1075,1075,1075	-0.2	0.2	11	dbSNP_131	92	376,8144		8,360,3892	yes	missense,missense,missense	P2RY2	NM_002564.2,NM_176071.1,NM_176072.1	74,74,74	8,410,6019	CC,CT,TT		4.4131,1.1484,3.309	benign,benign,benign	359/378,359/378,359/378	72946279	426,12448	2177	4260	6437	72623927	SO:0001583	missense	0			U07225	CCDS8219.1	11q13.5-q14.1	2012-08-08				ENSG00000175591		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	8541	protein-coding gene	gene with protein product		600041				8159738, 9286708	Standard	NM_002564		Approved	P2U	uc001otj.4	P41231		ENST00000311131.2:c.1075T>C	11.37:g.72946279T>C	ENSP00000310305:p.Ser359Pro	Somatic	1258	3.67	48		5	0.00	0	WXS	Illumina HiSeq	Phase_IV	72623927	84	50.59	86	B2R9W3|Q96EM8	Missense_Mutation	SNP	HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1,superfamily_Family A G protein-coupled receptor-like	p.S359P	ENST00000311131.2	37	c.1075	CCDS8219.1	11	40	0.018315018315018316	1	0.0020325203252032522	7	0.019337016574585635	1	0.0017482517482517483	31	0.040897097625329816	T	12.54	1.967865	0.34754	0.011484	0.044131	ENSG00000175591	ENST00000393597;ENST00000311131;ENST00000393596	T;T;T	0.73789	-0.78;-0.78;-0.78	3.87	-0.188	0.13264	.	1.570370	0.04200	N	0.329931	T	0.21962	0.0529	N	0.08118	0	0.20975	N	0.999818	P	0.36733	0.567	B	0.33568	0.166	T	0.37056	-0.9722	10	0.45353	T	0.12	.	7.1556	0.25635	0.5501:0.0:0.0:0.4499	.	359	P41231	P2RY2_HUMAN	P	359	ENSP00000377222:S359P;ENSP00000310305:S359P;ENSP00000377221:S359P	ENSP00000310305:S359P	S	+	1	0	P2RY2	72623927	0.008000	0.16893	0.241000	0.24154	0.534000	0.34807	0.514000	0.22786	-0.040000	0.13580	0.459000	0.35465	TCT	-	NULL		0.597	P2RY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	P2RY2	protein_coding	OTTHUMT00000397336.1	T	NM_176072		72623927	+1	no_errors	NM_002564.2	genbank	human	reviewed	54_36p	missense	SNP	0.000	C
KRT5	3852	genome.wustl.edu	37	12	52910546	52910546	+	Silent	SNP	G	G	T			TCGA-AB-2807-03D-01W-0755-09	TCGA-AB-2807-11D-01W-0755-09	G	G	G	T	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	3d15bdda-bbb7-4e3d-bdd6-7546d2905e95	b5c93c1e-585d-4cf8-a2b8-bd1b9eb4994c	g.chr12:52910546G>T	ENST00000252242.4	-	7	1704	c.1314C>A	c.(1312-1314)gcC>gcA	p.A438A		NM_000424.3	NP_000415.2	P13647	K2C5_HUMAN	keratin 5	438	Coil 2.|Rod.		A -> D (in WC-EBS). {ECO:0000269|PubMed:12655565}.		cell junction assembly (GO:0034329)|epidermis development (GO:0008544)|hemidesmosome assembly (GO:0031581)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)			endometrium(5)|kidney(1)|large_intestine(8)|lung(15)|prostate(4)|skin(2)	35				BRCA - Breast invasive adenocarcinoma(357;0.189)		CCTTCTGCAGGGCCTCCTCCA	0.632																																						dbGAP											0			12											97.0	87.0	90.0					12																	52910546		2203	4300	6503	51196813	SO:0001819	synonymous_variant	0				CCDS8830.1	12q13.13	2013-01-16	2008-08-01		ENSG00000186081	ENSG00000186081		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6442	protein-coding gene	gene with protein product		148040	"""epidermolysis bullosa simplex 2 Dowling-Meara/Kobner/Weber-Cockayne types"", ""keratin 5 (epidermolysis bullosa simplex, Dowling-Meara/Kobner/Weber-Cockayne types)"""	EBS2		1713141, 16831889	Standard	NM_000424		Approved	KRT5A	uc001san.3	P13647	OTTHUMG00000169657	ENST00000252242.4:c.1314C>A	12.37:g.52910546G>T		Somatic	216	3.14	7		0	100.00	2	WXS	Illumina HiSeq	Phase_IV	51196813	118	48.70	112	Q6PI71|Q6UBJ0|Q8TA91	Missense_Mutation	SNP	NULL	p.G548C	ENST00000252242.4	37	c.1642	CCDS8830.1	12	.	.	.	.	.	.	.	.	.	.	G	10.92	1.487338	0.26686	.	.	ENSG00000186081	ENST00000548409	.	.	.	5.93	3.09	0.35607	.	.	.	.	.	T	0.55705	0.1937	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.46707	-0.9172	4	.	.	.	.	7.3447	0.26656	0.2475:0.1167:0.6358:0.0	.	.	.	.	T	146	.	.	P	-	1	0	KRT5	51196813	0.156000	0.22821	0.991000	0.47740	0.976000	0.68499	-0.471000	0.06631	0.389000	0.25086	0.655000	0.94253	CCT	-	NULL		0.632	KRT5-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	LOC100129218	protein_coding	OTTHUMT00000405312.1	G			51196813	+1	no_errors	XM_001718439.1	genbank	human	model	54_36p	missense	SNP	1.000	T
GCN1L1	10985	genome.wustl.edu	37	12	120572142	120572142	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2807-03D-01W-0755-09	TCGA-AB-2807-11D-01W-0755-09	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	3d15bdda-bbb7-4e3d-bdd6-7546d2905e95	b5c93c1e-585d-4cf8-a2b8-bd1b9eb4994c	g.chr12:120572142G>A	ENST00000300648.6	-	53	7282	c.7270C>T	c.(7270-7272)Cgg>Tgg	p.R2424W		NM_006836.1	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis 1-like 1 (yeast)	2424					regulation of translation (GO:0006417)|translation (GO:0006412)	cytoplasm (GO:0005737)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)			NS(2)|breast(2)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(13)|liver(1)|lung(36)|ovary(4)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	94	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					ATGTTTTTCCGGATGACGGCA	0.592																																						dbGAP											0			12											119.0	121.0	120.0					12																	120572142		2122	4230	6352	119056525	SO:0001583	missense	0			U77700	CCDS41847.1	12q24.2	2008-07-03	2001-11-28						4199	protein-coding gene	gene with protein product		605614	"""GCN1 (general control of amino-acid synthesis 1, yeast)-like 1"""			9234705	Standard	NM_006836		Approved	KIAA0219, GCN1, GCN1L	uc001txo.3	Q92616	OTTHUMG00000169338	ENST00000300648.6:c.7270C>T	12.37:g.120572142G>A	ENSP00000300648:p.Arg2424Trp	Somatic	118	0.84	1		39	46.58	34	WXS	Illumina HiSeq	Phase_IV	119056525	83	47.47	75	A8KAY1|O95001|O95651|Q6P2S3|Q86X65|Q8N5I5|Q8WU80|Q99736|Q9UE60	Missense_Mutation	SNP	HMMPfam_HEAT,superfamily_ARM repeat	p.R2424W	ENST00000300648.6	37	c.7270	CCDS41847.1	12	.	.	.	.	.	.	.	.	.	.	G	19.76	3.887564	0.72410	.	.	ENSG00000089154	ENST00000300648	T	0.64803	-0.12	5.5	3.56	0.40772	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.73071	0.3540	M	0.89095	3.005	0.80722	D	1	D	0.64830	0.994	P	0.48815	0.591	T	0.81129	-0.1073	10	0.87932	D	0	-25.4064	14.1936	0.65654	0.0:0.0:0.5127:0.4873	.	2424	Q92616	GCN1L_HUMAN	W	2424	ENSP00000300648:R2424W	ENSP00000300648:R2424W	R	-	1	2	GCN1L1	119056525	1.000000	0.71417	0.997000	0.53966	0.874000	0.50279	3.123000	0.50453	1.288000	0.44600	0.511000	0.50034	CGG	-	HMMPfam_HEAT,superfamily_ARM repeat		0.592	GCN1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCN1L1	protein_coding	OTTHUMT00000403592.1	G			119056525	-1	no_errors	NM_006836.1	genbank	human	validated	54_36p	missense	SNP	1.000	A
DCLK1	9201	genome.wustl.edu	37	13	36445426	36445426	+	Missense_Mutation	SNP	C	C	T	rs56185003		TCGA-AB-2807-03D-01W-0755-09	TCGA-AB-2807-11D-01W-0755-09	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	3d15bdda-bbb7-4e3d-bdd6-7546d2905e95	b5c93c1e-585d-4cf8-a2b8-bd1b9eb4994c	g.chr13:36445426C>T	ENST00000360631.3	-	5	1086	c.875G>A	c.(874-876)cGc>cAc	p.R292H	DCLK1_ENST00000379892.4_Missense_Mutation_p.R292H|DCLK1_ENST00000255448.4_Missense_Mutation_p.R292H			O15075	DCLK1_HUMAN	doublecortin-like kinase 1	292	Pro/Ser-rich.		R -> H (in dbSNP:rs56185003). {ECO:0000269|PubMed:17344846}.		axon extension (GO:0048675)|central nervous system development (GO:0007417)|central nervous system projection neuron axonogenesis (GO:0021952)|dendrite morphogenesis (GO:0048813)|endosomal transport (GO:0016197)|forebrain development (GO:0030900)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|protein phosphorylation (GO:0006468)|response to virus (GO:0009615)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein activity (GO:0005057)			breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(18)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(6)|urinary_tract(1)	64		Breast(139;0.0147)|Lung SC(185;0.0685)|Prostate(109;0.122)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.72e-06)|Epithelial(112;4.24e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00159)|OV - Ovarian serous cystadenocarcinoma(117;0.0158)|GBM - Glioblastoma multiforme(144;0.0638)		GGTGCTCCTGCGGGATGATGA	0.507																																						dbGAP											0			13											247.0	237.0	240.0					13																	36445426		2203	4300	6503	35343426	SO:0001583	missense	0			AB002367	CCDS9354.1, CCDS55895.1, CCDS73561.1	13q13.3	2008-02-05	2007-04-02	2007-04-02	ENSG00000133083	ENSG00000133083			2700	protein-coding gene	gene with protein product		604742	"""doublecortin and CaM kinase-like 1"""	DCAMKL1		9747029, 10036192	Standard	NM_004734		Approved	KIAA0369, DCLK, DCDC3A	uc001uvf.3	O15075	OTTHUMG00000016729	ENST00000360631.3:c.875G>A	13.37:g.36445426C>T	ENSP00000353846:p.Arg292His	Somatic	368	1.34	5		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	35343426	251	49.60	248	B7Z3E9|Q5VZY8|Q5VZZ0|Q5VZZ1	Missense_Mutation	SNP	HMMSmart_S_TKc,HMMPfam_DCX,HMMSmart_DCX,PatternScan_PROTEIN_KINASE_ST,superfamily_Kinase_like,PatternScan_PROTEIN_KINASE_ATP,HMMPfam_Pkinase,superfamily_SSF89837	p.R292H	ENST00000360631.3	37	c.875		13	.	.	.	.	.	.	.	.	.	.	C	24.3	4.519467	0.85495	.	.	ENSG00000133083	ENST00000255448;ENST00000360631;ENST00000539451;ENST00000379892	T;T;T	0.69175	-0.38;-0.37;1.76	5.28	5.28	0.74379	.	0.265538	0.37261	N	0.002163	T	0.67221	0.2870	L	0.42245	1.32	0.54753	D	0.99998	D	0.57571	0.98	P	0.47206	0.541	T	0.70241	-0.4926	10	0.54805	T	0.06	.	19.2736	0.94021	0.0:1.0:0.0:0.0	rs56185003	292	O15075-2	.	H	292	ENSP00000255448:R292H;ENSP00000353846:R292H;ENSP00000369222:R292H	ENSP00000255448:R292H	R	-	2	0	DCLK1	35343426	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	5.461000	0.66699	2.617000	0.88574	0.655000	0.94253	CGC	-	NULL		0.507	DCLK1-010	KNOWN	basic	protein_coding	DCLK1	protein_coding	OTTHUMT00000044487.1	C	NM_004734		35343426	-1	no_errors	NM_004734.3	genbank	human	validated	54_36p	missense	SNP	1.000	T
TYRO3	7301	genome.wustl.edu	37	15	41854889	41854889	+	Missense_Mutation	SNP	C	C	T			TCGA-AB-2807-03D-01W-0755-09	TCGA-AB-2807-11D-01W-0755-09	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	3d15bdda-bbb7-4e3d-bdd6-7546d2905e95	b5c93c1e-585d-4cf8-a2b8-bd1b9eb4994c	g.chr15:41854889C>T	ENST00000263798.3	+	4	777	c.553C>T	c.(553-555)Ccc>Tcc	p.P185S	TYRO3_ENST00000559066.1_Missense_Mutation_p.P140S	NM_006293.3	NP_006284.2	Q06418	TYRO3_HUMAN	TYRO3 protein tyrosine kinase	185	Ig-like C2-type 2.				apoptotic cell clearance (GO:0043277)|cell adhesion (GO:0007155)|forebrain cell migration (GO:0021885)|natural killer cell differentiation (GO:0001779)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of lymphocyte activation (GO:0051250)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|neuron cellular homeostasis (GO:0070050)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol 3-kinase signaling (GO:0014065)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|protein autophosphorylation (GO:0046777)|protein kinase B signaling (GO:0043491)|secretion by cell (GO:0032940)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(26)|ovary(3)|prostate(1)	43		all_cancers(109;7.33e-15)|all_epithelial(112;2.8e-12)|Lung NSC(122;3.48e-08)|all_lung(180;1.71e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.31e-18)|GBM - Glioblastoma multiforme(113;9.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.117)		GGGACCCGCTCCCTCTCCATC	0.567																																						dbGAP											0			15											40.0	38.0	39.0					15																	41854889		2203	4300	6503	39642181	SO:0001583	missense	0			D50479	CCDS10080.1	15q15.1-q21.1	2013-02-11			ENSG00000092445	ENSG00000092445	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12446	protein-coding gene	gene with protein product		600341		RSE		7851890	Standard	NM_006293		Approved	Dtk, Brt, Tif, Sky	uc001zof.2	Q06418	OTTHUMG00000130341	ENST00000263798.3:c.553C>T	15.37:g.41854889C>T	ENSP00000263798:p.Pro185Ser	Somatic	574	0.00	0		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	39642181	54	50.46	55	O14953|Q86VR3	Missense_Mutation	SNP	HMMPfam_Pkinase_Tyr,HMMSmart_TyrKc,HMMSmart_IGc2,HMMSmart_IG,HMMPfam_fn3,HMMSmart_FN3,PatternScan_PROTEIN_KINASE_TYR,superfamily_FN_III-like,superfamily_Kinase_like,HMMPfam_ig,PatternScan_PROTEIN_KINASE_ATP,superfamily_SSF48726	p.P185S	ENST00000263798.3	37	c.553	CCDS10080.1	15	.	.	.	.	.	.	.	.	.	.	c	6.261	0.416284	0.11870	.	.	ENSG00000092445	ENST00000540218;ENST00000263798	T	0.11385	2.78	4.8	3.87	0.44632	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.416855	0.17770	N	0.162621	T	0.05823	0.0152	N	0.25485	0.75	0.25942	N	0.982869	B	0.11235	0.004	B	0.12156	0.007	T	0.41324	-0.9515	10	0.08837	T	0.75	-8.1142	3.3635	0.07196	0.2527:0.4572:0.2071:0.083	.	185	Q06418	TYRO3_HUMAN	S	117;185	ENSP00000263798:P185S	ENSP00000263798:P185S	P	+	1	0	TYRO3	39642181	0.269000	0.24143	0.967000	0.41034	0.971000	0.66376	1.603000	0.36794	1.207000	0.43291	0.472000	0.43445	CCC	-	HMMSmart_IG,HMMPfam_ig,superfamily_SSF48726		0.567	TYRO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TYRO3	protein_coding	OTTHUMT00000252693.2	C			39642181	+1	no_errors	NM_006293.2	genbank	human	provisional	54_36p	missense	SNP	0.035	T
FAM154B	283726	genome.wustl.edu	37	15	82574495	82574495	+	Missense_Mutation	SNP	C	C	T			TCGA-AB-2807-03D-01W-0755-09	TCGA-AB-2807-11D-01W-0755-09	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	3d15bdda-bbb7-4e3d-bdd6-7546d2905e95	b5c93c1e-585d-4cf8-a2b8-bd1b9eb4994c	g.chr15:82574495C>T	ENST00000339465.5	+	3	358	c.289C>T	c.(289-291)Ctt>Ttt	p.L97F	FAM154B_ENST00000427381.2_Missense_Mutation_p.L82F|FAM154B_ENST00000565501.1_3'UTR	NM_001008226.1	NP_001008227.1	Q658L1	F154B_HUMAN	family with sequence similarity 154, member B	97										autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|skin(2)	19						TAAAAGTGAACTTTATAAGCC	0.338																																						dbGAP											0			15											82.0	86.0	85.0					15																	82574495		2203	4300	6503	80361550	SO:0001583	missense	0			AL833762	CCDS32310.1	15q25.2	2008-02-21				ENSG00000188659			33727	protein-coding gene	gene with protein product							Standard	XM_005254317		Approved	DKFZp666G057	uc002bgv.3	Q658L1		ENST00000339465.5:c.289C>T	15.37:g.82574495C>T	ENSP00000340445:p.Leu97Phe	Somatic	132	0.00	0		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	80361550	119	46.64	104	B4E2M2	Missense_Mutation	SNP	NULL	p.L97F	ENST00000339465.5	37	c.289	CCDS32310.1	15	.	.	.	.	.	.	.	.	.	.	C	2.915	-0.224576	0.06061	.	.	ENSG00000188659	ENST00000339465;ENST00000427381	T;T	0.17691	2.26;2.26	3.57	1.65	0.23941	.	0.395009	0.19496	N	0.112850	T	0.15478	0.0373	L	0.58583	1.82	0.09310	N	1	B;B	0.21147	0.025;0.052	B;B	0.28232	0.043;0.087	T	0.37934	-0.9684	10	0.09843	T	0.71	-6.9549	8.7844	0.34811	0.0:0.7341:0.0:0.2659	.	82;97	B4E2M2;Q658L1	.;F154B_HUMAN	F	97;82	ENSP00000340445:L97F;ENSP00000403743:L82F	ENSP00000340445:L97F	L	+	1	0	FAM154B	80361550	0.001000	0.12720	0.232000	0.24009	0.236000	0.25371	0.163000	0.16520	0.308000	0.22923	0.536000	0.68110	CTT	-	NULL		0.338	FAM154B-001	KNOWN	basic|CCDS	protein_coding	FAM154B	protein_coding	OTTHUMT00000419644.1	C	NM_001008226		80361550	+1	no_errors	NM_001008226.1	genbank	human	predicted	54_36p	missense	SNP	0.864	T
ALPK3	57538	genome.wustl.edu	37	15	85401322	85401322	+	Missense_Mutation	SNP	C	C	T	rs200275512		TCGA-AB-2807-03D-01W-0755-09	TCGA-AB-2807-11D-01W-0755-09	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	3d15bdda-bbb7-4e3d-bdd6-7546d2905e95	b5c93c1e-585d-4cf8-a2b8-bd1b9eb4994c	g.chr15:85401322C>T	ENST00000258888.5	+	6	4126	c.3959C>T	c.(3958-3960)gCg>gTg	p.A1320V		NM_020778.4	NP_065829.3	Q96L96	ALPK3_HUMAN	alpha-kinase 3	1320					heart development (GO:0007507)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(3)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(4)|large_intestine(9)|lung(27)|ovary(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	81			BRCA - Breast invasive adenocarcinoma(143;0.0587)			CTGGGGGAGGCGGGTGGGCAG	0.667																																						dbGAP											0			15							VAL/ALA	0,4290		0,0,2145	8.0	11.0	10.0		3959	-6.3	0.0	15		10	4,8476		0,4,4236	no	missense	ALPK3	NM_020778.4	64	0,4,6381	TT,TC,CC		0.0472,0.0,0.0313	benign	1320/1908	85401322	4,12766	2145	4240	6385	83202326	SO:0001583	missense	0			AY044449	CCDS10333.1	15q25.2	2013-01-29			ENSG00000136383	ENSG00000136383		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17574	protein-coding gene	gene with protein product	"""myocyte induction differentiation originator"", ""muscle alpha-kinase"""					10021370	Standard	NM_020778		Approved	MAK, KIAA1330, Midori	uc002ble.3	Q96L96	OTTHUMG00000148667	ENST00000258888.5:c.3959C>T	15.37:g.85401322C>T	ENSP00000258888:p.Ala1320Val	Somatic	47	2.08	1		1	0.00	0	WXS	Illumina HiSeq	Phase_IV	83202326	56	46.73	50	Q9P2L6	Missense_Mutation	SNP	HMMSmart_SM00408,HMMSmart_SM00409,HMMPfam_Alpha_kinase,HMMSmart_SM00811,superfamily_Protein kinase-like (PK-like),HMMPfam_I-set,superfamily_Immunoglobulin	p.A1320V	ENST00000258888.5	37	c.3959	CCDS10333.1	15	.	.	.	.	.	.	.	.	.	.	C	0.054	-1.242687	0.01481	0.0	4.72E-4	ENSG00000136383	ENST00000258888	T	0.58506	0.33	4.67	-6.34	0.01982	.	1.504030	0.04197	N	0.329285	T	0.28699	0.0711	N	0.04508	-0.205	0.09310	N	1	B	0.15473	0.013	B	0.06405	0.002	T	0.11591	-1.0581	10	0.24483	T	0.36	0.6782	5.9306	0.19136	0.0:0.2218:0.3742:0.404	.	1320	Q96L96	ALPK3_HUMAN	V	1320	ENSP00000258888:A1320V	ENSP00000258888:A1320V	A	+	2	0	ALPK3	83202326	0.000000	0.05858	0.000000	0.03702	0.080000	0.17528	-1.364000	0.02590	-1.145000	0.02858	-0.258000	0.10820	GCG	-	NULL		0.667	ALPK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALPK3	protein_coding	OTTHUMT00000308997.1	C	NM_020778		83202326	+1	no_errors	NM_020778.4	genbank	human	validated	54_36p	missense	SNP	0.000	T
IDH2	3418	genome.wustl.edu	37	15	90631934	90631934	+	Missense_Mutation	SNP	C	C	T	rs121913502		TCGA-AB-2807-03D-01W-0755-09	TCGA-AB-2807-11D-01W-0755-09	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	3d15bdda-bbb7-4e3d-bdd6-7546d2905e95	b5c93c1e-585d-4cf8-a2b8-bd1b9eb4994c	g.chr15:90631934C>T	ENST00000330062.3	-	4	532	c.419G>A	c.(418-420)cGg>cAg	p.R140Q	IDH2_ENST00000559482.1_Intron|IDH2_ENST00000539790.1_Missense_Mutation_p.R10Q|IDH2_ENST00000540499.2_Missense_Mutation_p.R88Q	NM_002168.2	NP_002159.2	P48735	IDHP_HUMAN	isocitrate dehydrogenase 2 (NADP+), mitochondrial	140	Substrate binding. {ECO:0000250}.		R -> G (in D2HGA2). {ECO:0000269|PubMed:20847235}.|R -> Q (in D2HGA2). {ECO:0000269|PubMed:20847235}.		2-oxoglutarate metabolic process (GO:0006103)|carbohydrate metabolic process (GO:0005975)|cellular metabolic process (GO:0044237)|glyoxylate cycle (GO:0006097)|isocitrate metabolic process (GO:0006102)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	isocitrate dehydrogenase (NADP+) activity (GO:0004450)|magnesium ion binding (GO:0000287)|NAD binding (GO:0051287)	p.R140Q(292)|p.R140L(8)		biliary_tract(11)|bone(19)|central_nervous_system(107)|endometrium(1)|haematopoietic_and_lymphoid_tissue(953)|large_intestine(8)|lung(5)|skin(5)	1109	Melanoma(11;0.00551)|Lung NSC(78;0.0196)|all_lung(78;0.04)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.106)			CAGGATGTTCCGGATAGTTCC	0.537			M		GBM																																	dbGAP		Dom	yes		15	15q26.1	3418	"""socitrate dehydrogenase 2 (NADP+), mitochondrial """		M	300	Substitution - Missense(300)	haematopoietic_and_lymphoid_tissue(300)	15											103.0	103.0	103.0					15																	90631934		2200	4298	6498	88432938	SO:0001583	missense	0				CCDS10359.1	15q26.1	2014-09-17			ENSG00000182054	ENSG00000182054	1.1.1.42		5383	protein-coding gene	gene with protein product		147650					Standard	NM_001289910		Approved		uc002box.3	P48735	OTTHUMG00000149815	ENST00000330062.3:c.419G>A	15.37:g.90631934C>T	ENSP00000331897:p.Arg140Gln	Somatic	153	0.65	1		160	45.05	132	WXS	Illumina HiSeq	Phase_IV	88432938	97	45.81	82	B2R6L6|B4DFL2|Q96GT3	Missense_Mutation	SNP	HMMPfam_Iso_dh,PatternScan_IDH_IMDH,superfamily_Isocitrate/Isopropylmalate dehydrogenase-like	p.R140Q	ENST00000330062.3	37	c.419	CCDS10359.1	15	.	.	.	.	.	.	.	.	.	.	C	18.35	3.604397	0.66445	.	.	ENSG00000182054	ENST00000330062;ENST00000539790;ENST00000540499	D;D;D	0.87179	-2.22;-2.22;-2.22	5.67	4.75	0.60458	Isopropylmalate dehydrogenase-like domain (2);	0.000000	0.85682	D	0.000000	D	0.95449	0.8522	H	0.96833	3.89	0.48185	D	0.999601	D	0.89917	1.0	D	0.87578	0.998	D	0.96254	0.9185	10	0.87932	D	0	.	12.4459	0.55651	0.0:0.9189:0.0:0.0811	.	140	P48735	IDHP_HUMAN	Q	140;10;88	ENSP00000331897:R140Q;ENSP00000438457:R10Q;ENSP00000446147:R88Q	ENSP00000331897:R140Q	R	-	2	0	IDH2	88432938	1.000000	0.71417	1.000000	0.80357	0.051000	0.14879	7.797000	0.85911	1.397000	0.46682	-0.258000	0.10820	CGG	-	HMMPfam_Iso_dh,superfamily_Isocitrate/Isopropylmalate dehydrogenase-like		0.537	IDH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IDH2	protein_coding	OTTHUMT00000313426.1	C			88432938	-1	no_errors	NM_002168.2	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
CAMKK1	84254	genome.wustl.edu	37	17	3785557	3785557	+	Intron	SNP	G	G	A	rs143907936	byFrequency	TCGA-AB-2807-03D-01W-0755-09	TCGA-AB-2807-11D-01W-0755-09	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	3d15bdda-bbb7-4e3d-bdd6-7546d2905e95	b5c93c1e-585d-4cf8-a2b8-bd1b9eb4994c	g.chr17:3785557G>A	ENST00000348335.2	-	7	834				CAMKK1_ENST00000158166.5_Missense_Mutation_p.R265C|CAMKK1_ENST00000381769.2_Intron|CAMKK1_ENST00000381771.2_Missense_Mutation_p.R265C	NM_032294.2	NP_115670.1	Q8N5S9	KKCC1_HUMAN	calcium/calmodulin-dependent protein kinase kinase 1, alpha						synaptic transmission (GO:0007268)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)			NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)	11				LUAD - Lung adenocarcinoma(2;2.11e-05)|Lung(3;0.0176)		CTACCTGAGCGCGCAGCCCAC	0.532																																						dbGAP											0			17						A	,,CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	88.0	83.0	85.0		,,793	-1.2	0.0	17	dbSNP_134	85	4,8596	3.7+/-12.6	0,4,4296	yes	intron,intron,missense	CAMKK1	NM_032294.2,NM_172206.1,NM_172207.2	,,180	0,5,6498	AA,AG,GG		0.0465,0.0227,0.0384	,,	,,265/521	3785557	5,13001	2203	4300	6503	3732306	SO:0001627	intron_variant	0			AL136576	CCDS11038.1, CCDS11039.1	17p13.3	2004-02-18			ENSG00000004660	ENSG00000004660			1469	protein-coding gene	gene with protein product		611411				11230166	Standard	NM_172207		Approved	DKFZp761M0423, CAMKKA, MGC34095	uc002fwt.3	Q8N5S9	OTTHUMG00000090725	ENST00000348335.2:c.685+264C>T	17.37:g.3785557G>A		Somatic	293	1.01	3		4	33.33	2	WXS	Illumina HiSeq	Phase_IV	3732306	74	39.84	49	Q9BQH3	Missense_Mutation	SNP	HMMSmart_S_TKc,PatternScan_PROTEIN_KINASE_ST,superfamily_Kinase_like,PatternScan_PROTEIN_KINASE_ATP,HMMPfam_Pkinase	p.R265C	ENST00000348335.2	37	c.793	CCDS11038.1	17	.	.	.	.	.	.	.	.	.	.	g	4.387	0.071454	0.08436	2.27E-4	4.65E-4	ENSG00000004660	ENST00000381771;ENST00000158166	T;T	0.74106	-0.81;-0.8	2.08	-1.16	0.09678	.	.	.	.	.	T	0.58750	0.2144	L	0.35723	1.085	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.43523	-0.9386	9	0.38643	T	0.18	.	5.0377	0.14443	0.5053:0.0:0.4947:0.0	.	265	F8W9H1	.	C	265	ENSP00000371190:R265C;ENSP00000158166:R265C	ENSP00000158166:R265C	R	-	1	0	CAMKK1	3732306	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.204000	0.03017	-0.272000	0.09259	-0.726000	0.03593	CGC	-	HMMSmart_S_TKc,superfamily_Kinase_like,HMMPfam_Pkinase		0.532	CAMKK1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CAMKK1	protein_coding	OTTHUMT00000207456.1	G	NM_032294, NM_172206, NM_172207		3732306	-1	no_errors	NM_172207.2	genbank	human	reviewed	54_36p	missense	SNP	0.001	A
USP6	9098	genome.wustl.edu	37	17	5064824	5064824	+	Splice_Site	SNP	G	G	A			TCGA-AB-2807-03D-01W-0755-09	TCGA-AB-2807-11D-01W-0755-09	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	3d15bdda-bbb7-4e3d-bdd6-7546d2905e95	b5c93c1e-585d-4cf8-a2b8-bd1b9eb4994c	g.chr17:5064824G>A	ENST00000574788.1	+	32	5060	c.2830G>A	c.(2830-2832)Gat>Aat	p.D944N	USP6_ENST00000250066.6_Splice_Site_p.D944N|USP6_ENST00000332776.4_3'UTR|USP6_ENST00000304328.5_Splice_Site_p.D627N			P35125	UBP6_HUMAN	ubiquitin specific peptidase 6	944	USP.				cellular protein modification process (GO:0006464)|protein deubiquitination (GO:0016579)|regulation of vesicle-mediated transport (GO:0060627)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	calmodulin binding (GO:0005516)|cysteine-type endopeptidase activity (GO:0004197)|nucleic acid binding (GO:0003676)|Rab GTPase activator activity (GO:0005097)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	34						CTGTTTCAGTGATAACTGTAT	0.428			T	"""COL1A1, CDH11, ZNF9, OMD"""	aneurysmal bone cysts																																	dbGAP		Dom	yes		17	17p13	9098	ubiquitin specific peptidase 6 (Tre-2 oncogene)		M	0			17											137.0	126.0	130.0					17																	5064824		2203	4300	6503	5005548	SO:0001630	splice_region_variant	0			X63547	CCDS11069.2	17p13	2014-06-12	2014-06-12		ENSG00000129204	ENSG00000129204	3.4.19.12	"""Ubiquitin-specific peptidases"""	12629	protein-coding gene	gene with protein product	"""ubiquitin carboxyl-terminal hydrolase 6"", ""TBC1D3 and USP32 fusion"", ""Tre-2 oncogene"""	604334	"""ubiquitin specific protease 6 (Tre-2 oncogene)"", ""TRE oncogene, Smith Magenis syndrome chromosome region"", ""ubiquitin specific peptidase 6 (Tre-2 oncogene)"""	HRP1, TRESMCR		12838346, 1349106	Standard	NM_004505		Approved	Tre-2, TRE17, Tre2	uc002gav.1	P35125	OTTHUMG00000099449	ENST00000574788.1:c.2829-1G>A	17.37:g.5064824G>A		Somatic	359	0.28	1		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	5005548	291	42.83	218	Q15634|Q86WP6|Q8IWT4	Missense_Mutation	SNP	HMMPfam_TBC,HMMSmart_SM00164,superfamily_Ypt/Rab-GAP domain of gyp1p,HMMPfam_UCH,PatternScan_UCH_2_1,PatternScan_UCH_2_2,superfamily_Cysteine proteinases	p.D944N	ENST00000574788.1	37	c.2830	CCDS11069.2	17	.	.	.	.	.	.	.	.	.	.	G	14.02	2.410488	0.42715	.	.	ENSG00000129204	ENST00000250066;ENST00000304328	T;T	0.15256	2.81;2.44	2.45	2.45	0.29901	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.091325	0.64402	D	0.000001	T	0.32941	0.0846	L	0.54908	1.71	0.53688	D	0.999973	D;P	0.71674	0.998;0.716	D;B	0.81914	0.995;0.268	T	0.09250	-1.0683	10	0.87932	D	0	.	10.7278	0.46079	0.0:0.0:1.0:0.0	.	627;944	P35125-2;P35125	.;UBP6_HUMAN	N	944;627	ENSP00000250066:D944N;ENSP00000305473:D627N	ENSP00000250066:D944N	D	+	1	0	USP6	5005548	1.000000	0.71417	1.000000	0.80357	0.138000	0.21146	9.474000	0.97718	1.389000	0.46526	0.134000	0.15878	GAT	-	HMMPfam_UCH,superfamily_Cysteine proteinases		0.428	USP6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	USP6	protein_coding	OTTHUMT00000438990.1	G	NM_004505	Missense_Mutation	5005548	+1	no_errors	NM_004505.2	genbank	human	validated	54_36p	missense	SNP	1.000	A
LINC00324	284029	genome.wustl.edu	37	17	8125888	8125888	+	lincRNA	SNP	T	T	C			TCGA-AB-2807-03D-01W-0755-09	TCGA-AB-2807-11D-01W-0755-09	T	T	T	C	T	T	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	3d15bdda-bbb7-4e3d-bdd6-7546d2905e95	b5c93c1e-585d-4cf8-a2b8-bd1b9eb4994c	g.chr17:8125888T>C	ENST00000315707.3	-	0	936				RP11-849F2.8_ENST00000602405.1_lincRNA	NR_026951.1				long intergenic non-protein coding RNA 324																		CGCGTGTCAATCAAAGCGAAA	0.542																																						dbGAP											0			17																																								8066613			0			AK092109		17p13.1	2012-10-12	2011-08-10	2011-08-10	ENSG00000178977	ENSG00000178977		"""Long non-coding RNAs"""	26628	non-coding RNA	RNA, long non-coding			"""chromosome 17 open reading frame 44"", ""non-protein coding RNA 324"""	C17orf44, NCRNA00324			Standard	NR_026951		Approved	FLJ34790, MGC104931	uc002gkp.4		OTTHUMG00000132866		17.37:g.8125888T>C		Somatic	216	0.00	0		1	0.00	0	WXS	Illumina HiSeq	Phase_IV	8066613	160	50.15	162		Missense_Mutation	SNP	NULL	p.I106V	ENST00000315707.3	37	c.316		17																																																																																			-	NULL		0.542	LINC00324-001	KNOWN	basic	lincRNA	C17orf44	lincRNA	OTTHUMT00000256341.1	T			8066613	-1	no_errors	ENST00000315707	ensembl	human	known	54_36p	missense	SNP	0.000	C
KRT20	54474	genome.wustl.edu	37	17	39041199	39041199	+	Missense_Mutation	SNP	C	C	T			TCGA-AB-2807-03D-01W-0755-09	TCGA-AB-2807-11D-01W-0755-09	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	3d15bdda-bbb7-4e3d-bdd6-7546d2905e95	b5c93c1e-585d-4cf8-a2b8-bd1b9eb4994c	g.chr17:39041199C>T	ENST00000167588.3	-	1	280	c.239G>A	c.(238-240)cGt>cAt	p.R80H		NM_019010.2	NP_061883.1	P35900	K1C20_HUMAN	keratin 20	80	Coil 1A.|Rod.				apoptotic process (GO:0006915)|cellular response to stress (GO:0033554)|intermediate filament organization (GO:0045109)|regulation of protein secretion (GO:0050708)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)	structural constituent of cytoskeleton (GO:0005200)			NS(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|skin(1)	14		Breast(137;0.000301)|Ovarian(249;0.15)				GCTCGCTAGACGGTCATTTAG	0.537																																						dbGAP											0			17											98.0	85.0	90.0					17																	39041199		2203	4300	6503	36294725	SO:0001583	missense	0			BC031559	CCDS11379.1	17q21.2	2013-01-16			ENSG00000171431	ENSG00000171431		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	20412	protein-coding gene	gene with protein product		608218				8359595, 12515621, 16831889	Standard	NM_019010		Approved	CK20, K20, MGC35423	uc002hvl.3	P35900	OTTHUMG00000133366	ENST00000167588.3:c.239G>A	17.37:g.39041199C>T	ENSP00000167588:p.Arg80His	Somatic	278	0.36	1		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	36294725	258	13.71	41	B2R6W7	Missense_Mutation	SNP	HMMPfam_Filament,PatternScan_IF	p.R80H	ENST00000167588.3	37	c.239	CCDS11379.1	17	.	.	.	.	.	.	.	.	.	.	C	36	5.656830	0.96724	.	.	ENSG00000171431	ENST00000167588	D	0.94046	-3.34	5.79	5.79	0.91817	Filament (1);	0.198571	0.34828	N	0.003660	D	0.97306	0.9119	M	0.86953	2.85	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.97487	1.0051	10	0.87932	D	0	.	20.0314	0.97540	0.0:1.0:0.0:0.0	.	80	P35900	K1C20_HUMAN	H	80	ENSP00000167588:R80H	ENSP00000167588:R80H	R	-	2	0	KRT20	36294725	1.000000	0.71417	0.982000	0.44146	0.944000	0.59088	7.547000	0.82146	2.737000	0.93849	0.655000	0.94253	CGT	-	HMMPfam_Filament		0.537	KRT20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT20	protein_coding	OTTHUMT00000257202.2	C			36294725	-1	no_errors	NM_019010.1	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
BZRAP1	9256	genome.wustl.edu	37	17	56408625	56408625	+	5'Flank	SNP	T	T	C	rs562696473		TCGA-AB-2807-03D-01W-0755-09	TCGA-AB-2807-11D-01W-0755-09	T	T	T	C	T	T	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	3d15bdda-bbb7-4e3d-bdd6-7546d2905e95	b5c93c1e-585d-4cf8-a2b8-bd1b9eb4994c	g.chr17:56408625T>C	ENST00000268893.6	-	0	0				MIR142_ENST00000579003.1_RNA|BZRAP1-AS1_ENST00000580515.1_RNA|MIR142_ENST00000384835.1_RNA|BZRAP1-AS1_ENST00000580633.1_RNA|BZRAP1_ENST00000355701.3_5'Flank|BZRAP1-AS1_ENST00000579527.1_RNA|BZRAP1-AS1_ENST00000578334.1_RNA	NM_024418.2	NP_077729.1	O95153	RIMB1_HUMAN	benzodiazepine receptor (peripheral) associated protein 1							cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	benzodiazepine receptor binding (GO:0030156)			cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(2)|lung(16)|ovary(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	54	Medulloblastoma(34;0.127)|all_neural(34;0.237)					TAGGAAACACTACACCCTCCA	0.582																																						dbGAP											0			17											109.0	105.0	106.0					17																	56408625		1568	3582	5150	53763624	SO:0001631	upstream_gene_variant	0			AB014512	CCDS11605.1, CCDS45742.1	17q22-q23	2014-01-09	2014-01-09						16831	protein-coding gene	gene with protein product		610764				9734811, 9915832	Standard	NM_004758		Approved	PRAX-1, KIAA0612, RIM-BP1, RIMBP1	uc002ivx.5	O95153			17.37:g.56408625T>C	Exception_encountered	Somatic	291	0.00	0		25	50.98	26	WXS	Illumina HiSeq	Phase_IV	53763624	77	39.37	50	O75111|Q8N5W3	RNA	SNP	-	NULL	ENST00000268893.6	37	NULL	CCDS45742.1	17																																																																																			-	-		0.582	BZRAP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MIRN142	protein_coding	OTTHUMT00000443978.1	T	NM_004758		53763624	-1	no_errors	ENST00000384835	ensembl	human	known	54_36p	rna	SNP	1.000	C
LAMA1	284217	genome.wustl.edu	37	18	7036046	7036046	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AB-2807-03D-01W-0755-09	TCGA-AB-2807-11D-01W-0755-09	G	G	G	T	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	3d15bdda-bbb7-4e3d-bdd6-7546d2905e95	b5c93c1e-585d-4cf8-a2b8-bd1b9eb4994c	g.chr18:7036046G>T	ENST00000389658.3	-	13	1872	c.1779C>A	c.(1777-1779)taC>taA	p.Y593*		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	593	Laminin IV type A 1. {ECO:0000255|PROSITE-ProRule:PRU00458}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				CCGGAATATCGTAGGACACCG	0.448																																						dbGAP											0			18											171.0	123.0	140.0					18																	7036046		2203	4300	6503	7026046	SO:0001587	stop_gained	0			X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.1779C>A	18.37:g.7036046G>T	ENSP00000374309:p.Tyr593*	Somatic	378	3.57	14		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	7026046	140	44.00	110		Nonsense_Mutation	SNP	HMMPfam_Laminin_B,HMMSmart_SM00282,HMMPfam_Laminin_EGF,HMMSmart_SM00180,PatternScan_EGF_LAM_1,HMMSmart_SM00181,HMMPfam_Laminin_N,HMMSmart_SM00136,superfamily_Galactose-binding domain-like,superfamily_Concanavalin A-like lectins/glucanases,HMMPfam_Laminin_I,HMMPfam_Laminin_II,HMMPfam_Laminin_G_1,HMMPfam_Laminin_G_2,PatternScan_EGF_1,PatternScan_EGF_2,HMMSmart_SM00281,superfamily_EGF/Laminin	p.Y593*	ENST00000389658.3	37	c.1779	CCDS32787.1	18	.	.	.	.	.	.	.	.	.	.	G	38	6.923224	0.97936	.	.	ENSG00000101680	ENST00000389658	.	.	.	5.78	-3.14	0.05250	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.5907	0.68362	0.7665:0.0:0.2335:0.0	.	.	.	.	X	593	.	ENSP00000374309:Y593X	Y	-	3	2	LAMA1	7026046	0.070000	0.21116	0.063000	0.19743	0.765000	0.43378	-0.390000	0.07332	-0.461000	0.06993	-0.136000	0.14681	TAC	-	HMMPfam_Laminin_B,superfamily_Concanavalin A-like lectins/glucanases,HMMSmart_SM00281		0.448	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA1	protein_coding	OTTHUMT00000257369.1	G	NM_005559		7026046	-1	no_errors	NM_005559.2	genbank	human	validated	54_36p	nonsense	SNP	0.990	T
SERPINB5	5268	genome.wustl.edu	37	18	61164540	61164540	+	Intron	SNP	G	G	A			TCGA-AB-2807-03D-01W-0755-09	TCGA-AB-2807-11D-01W-0755-09	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	3d15bdda-bbb7-4e3d-bdd6-7546d2905e95	b5c93c1e-585d-4cf8-a2b8-bd1b9eb4994c	g.chr18:61164540G>A	ENST00000382771.4	+	6	859				SERPINB5_ENST00000464346.1_Intron	NM_002639.4	NP_002630.2	P36952	SPB5_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 5						cellular component movement (GO:0006928)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelium (GO:0002009)|negative regulation of endopeptidase activity (GO:0010951)|prostate gland morphogenesis (GO:0060512)|regulation of epithelial cell proliferation (GO:0050678)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)			kidney(3)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)	12						TCAAGCAGCAGCTCTTCTCCT	0.522																																						dbGAP											0			18																																								59315520	SO:0001627	intron_variant	0			U04313	CCDS32839.1	18q21.33	2014-02-18	2005-08-18		ENSG00000206075	ENSG00000206075		"""Serine (or cysteine) peptidase inhibitors"""	8949	protein-coding gene	gene with protein product	"""protease inhibitor 5 (maspin)"""	154790	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 5"""	PI5		8290962, 7724531, 16720730, 24172014	Standard	NM_002639		Approved	maspin	uc002liz.4	P36952	OTTHUMG00000141307	ENST00000382771.4:c.568-1813G>A	18.37:g.61164540G>A		Somatic	141	2.07	3		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	59315520	155	49.51	153	B2R6Y4|Q6N0B4|Q8WW89	RNA	SNP	-	NULL	ENST00000382771.4	37	NULL	CCDS32839.1	18																																																																																			-	-		0.522	SERPINB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC728205	protein_coding	OTTHUMT00000280629.1	G	NM_002639		59315520	+1	pseudogene	XR_015404.1	genbank	human	model	54_36p	rna	SNP	1.000	A
POLR2E	5434	genome.wustl.edu	37	19	1090936	1090936	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AB-2807-03D-01W-0755-09	TCGA-AB-2807-11D-01W-0755-09	C	C	C	A	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	3d15bdda-bbb7-4e3d-bdd6-7546d2905e95	b5c93c1e-585d-4cf8-a2b8-bd1b9eb4994c	g.chr19:1090936C>A	ENST00000215587.7	-	4	683	c.400G>T	c.(400-402)Gag>Tag	p.E134*	POLR2E_ENST00000585838.1_5'UTR|POLR2E_ENST00000586746.1_Nonsense_Mutation_p.E134*			P19388	RPAB1_HUMAN	polymerase (RNA) II (DNA directed) polypeptide E, 25kDa	134					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of type I interferon production (GO:0032481)|positive regulation of viral transcription (GO:0050434)|RNA splicing (GO:0008380)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	cytosol (GO:0005829)|DNA-directed RNA polymerase I complex (GO:0005736)|DNA-directed RNA polymerase II, core complex (GO:0005665)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(4)|skin(2)	11		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ATGAGCAGCTCCTGCTGCAGA	0.662																																						dbGAP											0			19											63.0	59.0	60.0					19																	1090936		2203	4300	6503	1041936	SO:0001587	stop_gained	0				CCDS12056.1	19p13.3	2013-01-21	2002-08-29			ENSG00000099817		"""RNA polymerase subunits"""	9192	protein-coding gene	gene with protein product	"""DNA directed RNA polymerase II 23 kda polypeptide"""	180664	"""polymerase (RNA) II (DNA directed) polypeptide E (25kD)"""			8034326	Standard	NM_002695		Approved	RPB5, RPABC1, XAP4, hRPB25, hsRPB5	uc002lre.4	P19388		ENST00000215587.7:c.400G>T	19.37:g.1090936C>A	ENSP00000215587:p.Glu134*	Somatic	32	0.00	0		34	17.07	7	WXS	Illumina HiSeq	Phase_IV	1041936	16	38.46	10	B2R6L4|D6W5Y1|O43380|Q6PIH5|Q9BT06	Nonsense_Mutation	SNP	HMMPfam_RNA_pol_Rpb5_C,PatternScan_RNA_POL_H_23KD,superfamily_RNApol_RPB5_like,HMMPfam_RNA_pol_Rpb5_N,superfamily_RNA_pol_Rpb5_N	p.E134*	ENST00000215587.7	37	c.400	CCDS12056.1	19	.	.	.	.	.	.	.	.	.	.	C	36	5.961316	0.97151	.	.	ENSG00000099817	ENST00000215587	.	.	.	3.47	3.47	0.39725	.	0.119091	0.56097	D	0.000034	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-0.5314	14.0569	0.64774	0.0:1.0:0.0:0.0	.	.	.	.	X	134	.	ENSP00000215587:E134X	E	-	1	0	POLR2E	1041936	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	5.607000	0.67648	1.912000	0.55364	0.491000	0.48974	GAG	-	superfamily_RNA_pol_Rpb5_N		0.662	POLR2E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR2E	protein_coding	OTTHUMT00000458044.1	C	NM_002695		1041936	-1	no_errors	NM_002695.3	genbank	human	reviewed	54_36p	nonsense	SNP	1.000	A
CFAP61	26074	genome.wustl.edu	37	20	20079446	20079446	+	Nonsense_Mutation	SNP	C	C	T	rs201899206		TCGA-AB-2807-03D-01W-0755-09	TCGA-AB-2807-11D-01W-0755-09	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	3d15bdda-bbb7-4e3d-bdd6-7546d2905e95	b5c93c1e-585d-4cf8-a2b8-bd1b9eb4994c	g.chr20:20079446C>T	ENST00000245957.5	+	8	923	c.847C>T	c.(847-849)Cga>Tga	p.R283*	C20orf26_ENST00000377309.2_5'UTR|C20orf26_ENST00000451767.2_Nonsense_Mutation_p.R283*|C20orf26_ENST00000377306.1_Nonsense_Mutation_p.R283*|C20orf26_ENST00000389656.3_5'UTR	NM_015585.3	NP_056400.3	Q8NHU2	CT026_HUMAN		283										NS(2)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(42)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	77				READ - Rectum adenocarcinoma(2;0.171)		CCTAAGTGTCCGAAGAAGTCA	0.468													C|||	1	0.000199681	0.0	0.0	5008	,	,		18264	0.001		0.0	False		,,,				2504	0.0					dbGAP											0			20											116.0	93.0	101.0					20																	20079446		2203	4300	6503	20027446	SO:0001587	stop_gained	0																														ENST00000245957.5:c.847C>T	20.37:g.20079446C>T	ENSP00000245957:p.Arg283*	Somatic	914	0.22	2		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	20027446	255	47.31	229	A6NHA1|Q5JXV4|Q5TE18|Q8N5R9|Q96M59|Q9BQL2|Q9H127|Q9H128|Q9NQH4|Q9UFV8|Q9Y4V7	Nonsense_Mutation	SNP	superfamily_Acyl-CoA N-acyltransferases (Nat),superfamily_FAD/NAD(P)-binding domain	p.R283*	ENST00000245957.5	37	c.847	CCDS33447.1	20	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	14.56	2.572038	0.45798	.	.	ENSG00000089101	ENST00000340348;ENST00000343997;ENST00000389655;ENST00000245957;ENST00000377306;ENST00000451767;ENST00000442372;ENST00000377297	.	.	.	4.88	-1.78	0.07957	.	1.324370	0.05429	N	0.545642	.	.	.	.	.	.	0.09310	N	0.999998	.	.	.	.	.	.	.	.	.	.	0.10902	T	0.67	.	16.6415	0.85128	0.1012:0.2098:0.689:0.0	.	.	.	.	X	237;283;283;283;283;283;42;75	.	ENSP00000245957:R283X	R	+	1	2	C20orf26	20027446	0.000000	0.05858	0.000000	0.03702	0.145000	0.21501	-0.256000	0.08757	-0.212000	0.10109	-0.176000	0.13171	CGA	-	NULL		0.468	C20orf26-004	KNOWN	basic|appris_principal|CCDS	protein_coding	C20orf26	protein_coding	OTTHUMT00000078228.3	C			20027446	+1	no_errors	NM_015585.2	genbank	human	predicted	54_36p	nonsense	SNP	0.000	T
OSBP2	23762	genome.wustl.edu	37	22	31266557	31266557	+	Missense_Mutation	SNP	G	G	C	rs370057467		TCGA-AB-2807-03D-01W-0755-09	TCGA-AB-2807-11D-01W-0755-09	G	G	G	C	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	3d15bdda-bbb7-4e3d-bdd6-7546d2905e95	b5c93c1e-585d-4cf8-a2b8-bd1b9eb4994c	g.chr22:31266557G>C	ENST00000332585.6	+	3	1099	c.995G>C	c.(994-996)cGc>cCc	p.R332P	OSBP2_ENST00000382310.3_Missense_Mutation_p.R332P|OSBP2_ENST00000407373.1_Missense_Mutation_p.R159P|OSBP2_ENST00000403222.3_Missense_Mutation_p.R167P|OSBP2_ENST00000437268.2_Missense_Mutation_p.R74P|OSBP2_ENST00000401475.1_5'UTR|OSBP2_ENST00000446658.2_Missense_Mutation_p.R332P	NM_001282739.1|NM_001282740.1|NM_001282741.1|NM_001282742.1|NM_030758.3	NP_001269668.1|NP_001269669.1|NP_001269670.1|NP_001269671.1|NP_110385.1	Q969R2	OSBP2_HUMAN	oxysterol binding protein 2	332					lipid transport (GO:0006869)	membrane (GO:0016020)	cholesterol binding (GO:0015485)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(2)|lung(6)|ovary(1)|skin(3)|urinary_tract(1)	19						GCACTCCAGCGCTCCCTGACA	0.572																																						dbGAP											0			22											59.0	66.0	64.0					22																	31266557		2148	4240	6388	29596557	SO:0001583	missense	0				CCDS43002.1, CCDS63448.1, CCDS63449.1, CCDS63450.1, CCDS63451.1	22q12.2	2013-01-10			ENSG00000184792	ENSG00000184792		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	8504	protein-coding gene	gene with protein product		606729		OSBPL1		10591208, 11278871, 11802775	Standard	NM_001282738		Approved	KIAA1664, ORP-4, ORP4	uc003aiy.1	Q969R2	OTTHUMG00000151153	ENST00000332585.6:c.995G>C	22.37:g.31266557G>C	ENSP00000332576:p.Arg332Pro	Somatic	44	2.22	1		0	100.00	2	WXS	Illumina HiSeq	Phase_IV	29596557	22	46.34	19	B0QYG1|B4DK24|B4DKE4|B4DTR3|F5H2A3|O60396|Q0VF99|Q8NA37|Q9BY96|Q9BZF0	Missense_Mutation	SNP	HMMPfam_Oxysterol_BP,HMMPfam_PH,HMMSmart_SM00233,PatternScan_OSBP,superfamily_PH domain-like	p.R332P	ENST00000332585.6	37	c.995	CCDS43002.1	22	.	.	.	.	.	.	.	.	.	.	G	25.7	4.663047	0.88251	.	.	ENSG00000184792	ENST00000403222;ENST00000407373;ENST00000332585;ENST00000382310;ENST00000446658;ENST00000437268	T;T;T;T;T;T	0.58210	0.54;0.55;1.3;1.14;1.29;0.35	4.51	4.51	0.55191	.	0.000000	0.85682	D	0.000000	T	0.77738	0.4175	M	0.90483	3.12	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;0.999;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.997;0.935;0.993;0.993;1.0;0.999	T	0.83263	-0.0047	10	0.66056	D	0.02	-23.212	17.0329	0.86466	0.0:0.0:1.0:0.0	.	74;332;167;159;332;332	F5H2A3;B4DFA8;B4DKE4;Q6ZN50;Q0VF99;Q969R2	.;.;.;.;.;OSBP2_HUMAN	P	167;159;332;332;332;74	ENSP00000384213:R167P;ENSP00000385237:R159P;ENSP00000332576:R332P;ENSP00000371747:R332P;ENSP00000392080:R332P;ENSP00000389200:R74P	ENSP00000332576:R332P	R	+	2	0	OSBP2	29596557	1.000000	0.71417	1.000000	0.80357	0.736000	0.42039	9.190000	0.94934	2.349000	0.79799	0.563000	0.77884	CGC	-	NULL		0.572	OSBP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OSBP2	protein_coding	OTTHUMT00000321547.2	G	NM_030758		29596557	+1	no_errors	NM_030758.3	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
C22orf42	150297	genome.wustl.edu	37	22	32555094	32555094	+	Missense_Mutation	SNP	C	C	A			TCGA-AB-2807-03D-01W-0755-09	TCGA-AB-2807-11D-01W-0755-09	C	C	C	A	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	3d15bdda-bbb7-4e3d-bdd6-7546d2905e95	b5c93c1e-585d-4cf8-a2b8-bd1b9eb4994c	g.chr22:32555094C>A	ENST00000382097.3	-	1	181	c.109G>T	c.(109-111)Gca>Tca	p.A37S	RP1-90G24.8_ENST00000426354.1_lincRNA	NM_001010859.1	NP_001010859.1	Q6IC83	CV042_HUMAN	chromosome 22 open reading frame 42	37										NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(2)	24						GCTGTGGCTGCCACAGTCTCA	0.582																																						dbGAP											0			22											108.0	94.0	99.0					22																	32555094		2203	4300	6503	30885094	SO:0001583	missense	0			BC040263	CCDS33639.1	22q12.3	2009-03-05			ENSG00000205856	ENSG00000205856			27160	protein-coding gene	gene with protein product						12477932	Standard	XM_005261369		Approved		uc003amd.3	Q6IC83	OTTHUMG00000030380	ENST00000382097.3:c.109G>T	22.37:g.32555094C>A	ENSP00000371529:p.Ala37Ser	Somatic	370	0.27	1		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	30885094	131	51.30	138	A4QPH5	Missense_Mutation	SNP	NULL	p.A37S	ENST00000382097.3	37	c.109	CCDS33639.1	22	.	.	.	.	.	.	.	.	.	.	C	1.787	-0.480494	0.04383	.	.	ENSG00000205856	ENST00000382097	T	0.34667	1.35	0.131	0.131	0.14755	.	.	.	.	.	T	0.15825	0.0381	N	0.08118	0	0.09310	N	1	P	0.45594	0.862	B	0.37943	0.261	T	0.11567	-1.0582	8	0.59425	D	0.04	.	.	.	.	.	37	Q6IC83	CV042_HUMAN	S	37	ENSP00000371529:A37S	ENSP00000371529:A37S	A	-	1	0	C22orf42	30885094	0.002000	0.14202	0.009000	0.14445	0.009000	0.06853	0.199000	0.17237	0.171000	0.19730	0.174000	0.16983	GCA	-	NULL		0.582	C22orf42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C22orf42	protein_coding	OTTHUMT00000075268.2	C	NM_001010859		30885094	-1	no_errors	NM_001010859.1	genbank	human	provisional	54_36p	missense	SNP	0.000	A
ASXL1	171023	genome.wustl.edu	37	20	31022727	31022727	+	Frame_Shift_Del	DEL	G	G	-			TCGA-AB-2807-03D-01W-0755-09	TCGA-AB-2807-11D-01W-0755-09	G	G	G	-	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	3d15bdda-bbb7-4e3d-bdd6-7546d2905e95	b5c93c1e-585d-4cf8-a2b8-bd1b9eb4994c	g.chr20:31022727delG	ENST00000375687.4	+	13	2636	c.2212delG	c.(2212-2214)ggafs	p.G738fs	ASXL1_ENST00000306058.5_Frame_Shift_Del_p.G733fs	NM_015338.5	NP_056153	Q8IXJ9	ASXL1_HUMAN	additional sex combs like transcriptional regulator 1	738					bone development (GO:0060348)|monoubiquitinated histone H2A deubiquitination (GO:0035522)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035359)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to retinoic acid (GO:0032526)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|PR-DUB complex (GO:0035517)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)|retinoic acid receptor binding (GO:0042974)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(655)|kidney(5)|large_intestine(18)|liver(1)|lung(27)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	722						GGCTACAGTTGGACTCACAGA	0.592			"""F, N, Mis"""		"""MDS, CMML"""																																	dbGAP		Rec	yes		20	20q11.1	171023	additional sex combs like 1		L	0			20											53.0	54.0	53.0					20																	31022727		2203	4300	6503	30486388	SO:0001589	frameshift_variant	0			AJ438952	CCDS13201.1	20q11	2014-09-17	2014-06-17		ENSG00000171456	ENSG00000171456			18318	protein-coding gene	gene with protein product		612990	"""additional sex combs like 1 (Drosophila)"""			12657473	Standard	NM_015338		Approved	KIAA0978	uc002wxs.3	Q8IXJ9	OTTHUMG00000032218	ENST00000375687.4:c.2212delG	20.37:g.31022727delG	ENSP00000364839:p.Gly738fs	Somatic	65	5.80	4		28	45.10	23	WXS	Illumina HiSeq	Phase_IV	30486388	61	50.41	62	B2RP59|Q5JWS9|Q8IYY7|Q9H466|Q9NQF8|Q9UFJ0|Q9UFP8|Q9Y2I4	Frame_Shift_Del	DEL	NULL	p.G738fs	ENST00000375687.4	37	c.2212	CCDS13201.1	20																																																																																			-	NULL		0.592	ASXL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ASXL1	protein_coding	OTTHUMT00000078624.2	G	NM_015338		30486388	+1	no_errors	NM_015338.4	genbank	human	reviewed	54_36p	frame_shift_del	DEL	0.000	-
RUNX1	861	genome.wustl.edu	37	21	36252856	36252861	+	In_Frame_Del	DEL	CTTCCA	CTTCCA	-			TCGA-AB-2807-03D-01W-0755-09	TCGA-AB-2807-11D-01W-0755-09	CTTCCA	CTTCCA	CTTCCA	-	CTTCCA	CTTCCA	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	3d15bdda-bbb7-4e3d-bdd6-7546d2905e95	b5c93c1e-585d-4cf8-a2b8-bd1b9eb4994c	g.chr21:36252856_36252861delCTTCCA	ENST00000344691.4	-	2	1997_2002	c.420_425delTGGAAG	c.(418-426)agtggaaga>aga	p.SG140del	RUNX1_ENST00000486278.2_In_Frame_Del_p.SG143del|RUNX1_ENST00000437180.1_In_Frame_Del_p.SG167del|RUNX1_ENST00000358356.5_In_Frame_Del_p.SG140del|RUNX1_ENST00000300305.3_In_Frame_Del_p.SG167del|RUNX1_ENST00000325074.5_In_Frame_Del_p.SG155del|RUNX1_ENST00000399240.1_In_Frame_Del_p.SG140del	NM_001001890.2	NP_001001890.1	Q01196	RUNX1_HUMAN	runt-related transcription factor 1	140	Interaction with DNA.|Runt. {ECO:0000255|PROSITE- ProRule:PRU00399}.				behavioral response to pain (GO:0048266)|cellular response to transforming growth factor beta stimulus (GO:0071560)|central nervous system development (GO:0007417)|definitive hemopoiesis (GO:0060216)|embryonic hemopoiesis (GO:0035162)|hair follicle morphogenesis (GO:0031069)|hematopoietic stem cell proliferation (GO:0071425)|hemopoiesis (GO:0030097)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|myeloid cell differentiation (GO:0030099)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of granulocyte differentiation (GO:0030853)|peripheral nervous system neuron development (GO:0048935)|positive regulation of angiogenesis (GO:0045766)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of progesterone secretion (GO:2000872)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of hair follicle cell proliferation (GO:0071336)|regulation of signal transduction (GO:0009966)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	basement membrane (GO:0005604)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.G168*(1)|p.R169fs*44(1)|p.G168_R169insRSG(1)|p.R169fs*11(1)|p.R169fs*10(1)		breast(5)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(428)|large_intestine(3)|lung(6)|oesophagus(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	452						TAACGTACCTCTTCCACTTCGACCGA	0.427			T	"""RPL22, MDS1, EVI1, CBFA2T3, CBFA2T1, ETV6, LAF4"""	"""AML, preB- ALL, T-ALL"""																																	dbGAP		Dom	yes		21	21q22.3	861	runt-related transcription factor 1  (AML1)		L	5	Insertion - Frameshift(3)|Insertion - In frame(1)|Substitution - Nonsense(1)	haematopoietic_and_lymphoid_tissue(4)|breast(1)	21																																								35174731	SO:0001651	inframe_deletion	0			X79549	CCDS13639.1, CCDS42922.1, CCDS46646.1	21q22.3	2014-09-17	2008-07-29		ENSG00000159216	ENSG00000159216			10471	protein-coding gene	gene with protein product	"""aml1 oncogene"""	151385	"""acute myeloid leukemia 1"""	AML1, CBFA2		1427868, 7835892	Standard	NM_001001890		Approved	PEBP2A2, AMLCR1	uc010gmv.3	Q01196	OTTHUMG00000086299	ENST00000344691.4:c.420_425delTGGAAG	21.37:g.36252856_36252861delCTTCCA	ENSP00000340690:p.Ser140_Gly141del	Somatic	NA	NA	NA		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	35174726	NA	NA	NA	A8MV94|B2RMS4|D3DSG1|O60472|O60473|O76047|O76089|Q13081|Q13755|Q13756|Q13757|Q13758|Q13759|Q15341|Q15343|Q16122|Q16284|Q16285|Q16286|Q16346|Q16347|Q92479	In_Frame_Del	DEL	superfamily_p53-like transcription factors,HMMPfam_Runt,HMMPfam_RunxI	p.SG167in_frame_del	ENST00000344691.4	37	c.506_501	CCDS42922.1	21																																																																																			-	superfamily_p53-like transcription factors,HMMPfam_Runt		0.427	RUNX1-001	KNOWN	basic|CCDS	protein_coding	RUNX1	protein_coding	OTTHUMT00000194230.1	CTTCCA			35174731	-1	no_errors	NM_001754.2	genbank	human	reviewed	54_36p	in_frame_del	DEL	1.000:1.000:1.000:1.000:1.000:0.990	-
