#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NormalRefReads_WU	i_NormalVAF_WU	i_NormalVarReads_WU	i_ORegAnno_bin	i_RNARefReads_WU	i_RNAVAF_WU	i_RNAVarReads_WU	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TumorRefReads_WU	i_TumorVAF_WU	i_TumorVarReads_WU	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	G	G	A			TCGA-AB-2820-03B-01W-0728-08	TCGA-AB-2820-11B-01W-0728-08	G	G	G	A	G	G	Verified	Invalid:failed_liftOver	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	19900d81-576b-44c1-975d-a874c0b19b15	2f7227c5-2077-405c-ac7c-6589765d1f0b	g.chrUnknown:0G>A								None (None upstream) : None (None downstream)																								0.0																																						dbGAP											0			MT																																								8103	SO:0001628	intergenic_variant	0																															Unknown.37:g.0G>A		Somatic	1765	1.34	24		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	8103	1705	27.24	644		Missense_Mutation	SNP	PatternScan_COX2,HMMPfam_COX2,superfamily_Cupredoxins,HMMPfam_COX2_TM,superfamily_Cytochrome^^_^^c^^_^^oxidase^^_^^subunit^^_^^II-like^^_^^transmembrane^^_^^region	p.D173N		37	c.517		MT																																																																																			-	PatternScan_COX2,HMMPfam_COX2,superfamily_Cupredoxins	0	0					MT-CO2			G			8103	+1	no_errors	ENST00000361739	ensembl	human	known	54_36p	missense	SNP	NULL	A
SDCBPP3	100131656	genome.wustl.edu	37	X	40750752	40750752	+	IGR	SNP	G	G	A			TCGA-AB-2820-03B-01W-0728-08	TCGA-AB-2820-11B-01W-0728-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	19900d81-576b-44c1-975d-a874c0b19b15	2f7227c5-2077-405c-ac7c-6589765d1f0b	g.chrX:40750752G>A								MED14-AS1 (152802 upstream) : USP9X (194135 downstream)																							CAATTACTTTGTCTACCTTCA	0.453																																						dbGAP											0			X																																								40635696	SO:0001628	intergenic_variant	0																															X.37:g.40750752G>A		Somatic	59	4.84	3		1	0.00	0	WXS	Illumina HiSeq	Phase_IV	40635696	40	65.57	80		RNA	SNP	-	NULL		37	NULL		X																																																																																			-	-	0	0.453					LOC100131656			G			40635696	-1	pseudogene	XR_037406.1	genbank	human	model	54_36p	rna	SNP	1.000	A
LRIF1	55791	genome.wustl.edu	37	1	111492550	111492550	+	Missense_Mutation	SNP	C	C	G			TCGA-AB-2820-03B-01W-0728-08	TCGA-AB-2820-11B-01W-0728-08	C	C	C	G	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	19900d81-576b-44c1-975d-a874c0b19b15	2f7227c5-2077-405c-ac7c-6589765d1f0b	g.chr1:111492550C>G	ENST00000369763.4	-	3	2182	c.1792G>C	c.(1792-1794)Gat>Cat	p.D598H	LRIF1_ENST00000494675.1_Missense_Mutation_p.D62H|RP11-96K19.2_ENST00000440689.1_RNA|LRIF1_ENST00000485275.2_Missense_Mutation_p.D62H	NM_018372.3	NP_060842.3	Q5T3J3	LRIF1_HUMAN	ligand dependent nuclear receptor interacting factor 1	598					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)				endometrium(2)|kidney(2)|large_intestine(7)|lung(12)|ovary(2)|skin(1)|urinary_tract(2)	28						CTAAAGGAATCGAAACCTTCT	0.388																																						dbGAP											0			1											161.0	161.0	161.0					1																	111492550		2203	4300	6503	111294073	SO:0001583	missense	0			AY190122	CCDS30800.1, CCDS41366.1	1p13.3	2011-04-15	2011-04-15	2011-04-15	ENSG00000121931	ENSG00000121931			30299	protein-coding gene	gene with protein product	"""receptor interacting factor 1"""	615354	"""chromosome 1 open reading frame 103"""	C1orf103		17455211	Standard	NM_018372		Approved	RIF1, FLJ11269	uc001eaa.3	Q5T3J3	OTTHUMG00000011913	ENST00000369763.4:c.1792G>C	1.37:g.111492550C>G	ENSP00000358778:p.Asp598His	Somatic	217	0.46	1		23	36.11	13	WXS	Illumina HiSeq	Phase_IV	111294073	354	32.77	175	Q86XS4|Q8N3B6|Q96HT4|Q9NUM5|Q9NV32	Missense_Mutation	SNP	NULL	p.D598H	ENST00000369763.4	37	c.1792	CCDS30800.1	1	.	.	.	.	.	.	.	.	.	.	C	15.66	2.899272	0.52227	.	.	ENSG00000121931	ENST00000369763;ENST00000494675;ENST00000485275	T;T;T	0.32272	1.87;1.46;1.46	5.69	-2.7	0.06004	.	0.850810	0.10495	N	0.667928	T	0.08846	0.0219	L	0.53249	1.67	0.09310	N	1	B;B	0.17667	0.023;0.002	B;B	0.17722	0.019;0.003	T	0.35325	-0.9793	10	0.44086	T	0.13	-0.2125	2.0826	0.03638	0.1258:0.2681:0.3693:0.2368	.	62;598	Q5T3J3-2;Q5T3J3	.;LRIF1_HUMAN	H	598;62;62	ENSP00000358778:D598H;ENSP00000435259:D62H;ENSP00000432290:D62H	ENSP00000358778:D598H	D	-	1	0	LRIF1	111294073	0.017000	0.18338	0.325000	0.25375	0.971000	0.66376	-0.656000	0.05342	0.023000	0.15187	0.563000	0.77884	GAT	-	NULL		0.388	LRIF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C1orf103	protein_coding	OTTHUMT00000032932.2	C	NM_018372		111294073	-1	no_errors	NM_018372.1	genbank	human	validated	54_36p	missense	SNP	0.000	G
IL1RL2	8808	genome.wustl.edu	37	2	102855691	102855691	+	Missense_Mutation	SNP	C	C	T	rs199936712	byFrequency	TCGA-AB-2820-03B-01W-0728-08	TCGA-AB-2820-11B-01W-0728-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	19900d81-576b-44c1-975d-a874c0b19b15	2f7227c5-2077-405c-ac7c-6589765d1f0b	g.chr2:102855691C>T	ENST00000264257.2	+	12	1844	c.1718C>T	c.(1717-1719)aCg>aTg	p.T573M	IL1RL2_ENST00000539491.1_Missense_Mutation_p.T573M|IL1RL2_ENST00000481806.1_3'UTR|IL1RL2_ENST00000441515.2_Missense_Mutation_p.T455M	NM_003854.2	NP_003845.2	Q9HB29	ILRL2_HUMAN	interleukin 1 receptor-like 2	573					cellular defense response (GO:0006968)|cytokine-mediated signaling pathway (GO:0019221)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of T cell differentiation (GO:0045582)|regulation of inflammatory response (GO:0050727)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)	interleukin-1 receptor activity (GO:0004908)|interleukin-1, Type I, activating receptor activity (GO:0004909)			breast(1)|cervix(1)|endometrium(5)|large_intestine(6)|liver(2)|lung(8)|ovary(2)|prostate(1)	26						TGTACTCTCACGACTGGCTAA	0.463													C|||	4	0.000798722	0.0	0.0	5008	,	,		23321	0.001		0.0	False		,,,				2504	0.0031					dbGAP											0			2											145.0	122.0	130.0					2																	102855691		2203	4300	6503	102222123	SO:0001583	missense	0			U49065	CCDS2056.1	2q12	2013-01-14			ENSG00000115598	ENSG00000115598		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5999	protein-coding gene	gene with protein product		604512				8898719, 10191101, 11466363	Standard	NM_003854		Approved	IL1R-rp2, IL1RRP2	uc002tbs.3	Q9HB29	OTTHUMG00000130776	ENST00000264257.2:c.1718C>T	2.37:g.102855691C>T	ENSP00000264257:p.Thr573Met	Somatic	126	1.56	2		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	102222123	98	33.56	50	A4FU63|Q13525|Q45H74|Q53TU8|Q587I8	Missense_Mutation	SNP	HMMPfam_TIR,HMMSmart_TIR,superfamily_TIR,HMMSmart_IG,HMMPfam_ig,superfamily_SSF48726	p.T573M	ENST00000264257.2	37	c.1718	CCDS2056.1	2	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	0.708	-0.788143	0.02884	.	.	ENSG00000115598	ENST00000264257;ENST00000441515;ENST00000539491	T;T;T	0.03831	4.11;3.79;4.11	2.43	-4.86	0.03132	.	.	.	.	.	T	0.02571	0.0078	N	0.14661	0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.39643	-0.9604	9	0.49607	T	0.09	.	4.5779	0.12243	0.2668:0.3826:0.0:0.3506	.	455;573	A4FU63;Q9HB29	.;ILRL2_HUMAN	M	573;455;573	ENSP00000264257:T573M;ENSP00000413348:T455M;ENSP00000442184:T573M	ENSP00000264257:T573M	T	+	2	0	IL1RL2	102222123	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.333000	0.07894	-2.822000	0.00343	-2.890000	0.00095	ACG	-	NULL		0.463	IL1RL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL1RL2	protein_coding	OTTHUMT00000253290.1	C	NM_003854		102222123	+1	no_errors	NM_003854.2	genbank	human	reviewed	54_36p	missense	SNP	0.000	T
MFN1	55669	genome.wustl.edu	37	3	179080206	179080206	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2820-03B-01W-0728-08	TCGA-AB-2820-11B-01W-0728-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	19900d81-576b-44c1-975d-a874c0b19b15	2f7227c5-2077-405c-ac7c-6589765d1f0b	g.chr3:179080206G>A	ENST00000471841.1	+	5	598	c.472G>A	c.(472-474)Gta>Ata	p.V158I	MFN1_ENST00000263969.5_Missense_Mutation_p.V158I|MFN1_ENST00000280653.7_Missense_Mutation_p.V158I	NM_033540.2	NP_284941	Q8IWA4	MFN1_HUMAN	mitofusin 1	158	Dynamin-type G.				mitochondrial fusion (GO:0008053)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(14)|ovary(3)|prostate(1)|urinary_tract(1)	31	all_cancers(143;1.67e-16)|Ovarian(172;0.0172)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;5.78e-26)|GBM - Glioblastoma multiforme(14;0.00225)|BRCA - Breast invasive adenocarcinoma(182;0.0923)			TGGCTGTCTTGTACGTGTGTT	0.408																																						dbGAP											0			3											115.0	111.0	113.0					3																	179080206		2203	4300	6503	180562900	SO:0001583	missense	0			AF054986	CCDS3228.1	3q26.32	2006-12-13			ENSG00000171109	ENSG00000171109			18262	protein-coding gene	gene with protein product		608506				8358434, 11181170	Standard	NM_033540		Approved	FLJ20693	uc003fjs.3	Q8IWA4	OTTHUMG00000157385	ENST00000471841.1:c.472G>A	3.37:g.179080206G>A	ENSP00000420617:p.Val158Ile	Somatic	123	1.60	2		14	50.00	15	WXS	Illumina HiSeq	Phase_IV	180562900	105	40.66	74	B2RAR1|D3DNR6|O15323|O60639|Q9BZB5|Q9NWQ2	Missense_Mutation	SNP	HMMPfam_Dynamin_N,HMMPfam_Fzo_mitofusin,superfamily_P-loop containing nucleoside triphosphate hydrolases	p.V158I	ENST00000471841.1	37	c.472	CCDS3228.1	3	.	.	.	.	.	.	.	.	.	.	G	23.3	4.396771	0.83120	.	.	ENSG00000171109	ENST00000471841;ENST00000280653;ENST00000539169;ENST00000263969;ENST00000489329;ENST00000474903	D;D;D;D;D	0.99129	-3.54;-3.54;-3.54;-5.46;-4.16	5.54	5.54	0.83059	Dynamin, GTPase domain (1);	0.055721	0.64402	N	0.000001	D	0.98448	0.9483	N	0.17901	0.54	0.80722	D	1	D;B;B	0.67145	0.996;0.118;0.166	D;B;B	0.77557	0.99;0.083;0.09	D	0.98766	1.0726	10	0.32370	T	0.25	-14.4966	19.8254	0.96616	0.0:0.0:1.0:0.0	.	158;186;158	Q8IWA4-3;Q4AEJ4;Q8IWA4	.;.;MFN1_HUMAN	I	158;158;158;158;11;21	ENSP00000420617:V158I;ENSP00000280653:V158I;ENSP00000263969:V158I;ENSP00000420148:V11I;ENSP00000419926:V21I	ENSP00000263969:V158I	V	+	1	0	MFN1	180562900	1.000000	0.71417	0.985000	0.45067	0.996000	0.88848	9.358000	0.97109	2.754000	0.94517	0.655000	0.94253	GTA	-	HMMPfam_Dynamin_N,superfamily_P-loop containing nucleoside triphosphate hydrolases		0.408	MFN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MFN1	protein_coding	OTTHUMT00000348654.2	G	NM_017927		180562900	+1	no_errors	NM_033540.2	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
ZNF595	152687	genome.wustl.edu	37	4	54736	54736	+	Intron	SNP	G	G	A			TCGA-AB-2820-03B-01W-0728-08	TCGA-AB-2820-11B-01W-0728-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	19900d81-576b-44c1-975d-a874c0b19b15	2f7227c5-2077-405c-ac7c-6589765d1f0b	g.chr4:54736G>A	ENST00000509152.2	+	1	188				ZNF595_ENST00000526473.2_Intron|ZNF595_ENST00000339368.6_Intron			Q8IYB9	ZN595_HUMAN	zinc finger protein 595						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(5)|kidney(1)|large_intestine(1)|lung(11)|prostate(2)	20		all_cancers(4;0.0738)|all_epithelial(65;0.139)		Lung(54;0.0654)|Epithelial(2;0.0921)|all cancers(2;0.146)|LUSC - Lung squamous cell carcinoma(95;0.173)		TGTACCTGTGGCACAAACCAG	0.547																																						dbGAP											0			4																																								44736	SO:0001627	intron_variant	0			BX537887	CCDS75075.1, CCDS75076.1, CCDS75077.1	4p16.3	2013-01-08				ENSG00000272602		"""Zinc fingers, C2H2-type"", ""-"""	27196	protein-coding gene	gene with protein product						12477932	Standard	NM_182524		Approved	FLJ31740		Q8IYB9		ENST00000509152.2:c.3+1351G>A	4.37:g.54736G>A		Somatic	313	10.80	38		7	0.00	0	WXS	Illumina HiSeq	Phase_IV	44736	577	14.01	95		RNA	SNP	-	NULL	ENST00000509152.2	37	NULL		4																																																																																			-	-		0.547	ZNF595-004	PUTATIVE	basic|appris_candidate|exp_conf	protein_coding	CEP170L	protein_coding	OTTHUMT00000357817.2	G	NM_182524		44736	+1	pseudogene	XR_042173.2	genbank	human	model	54_36p	rna	SNP	0.002	A
GPR125	166647	genome.wustl.edu	37	4	22389827	22389827	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2820-03B-01W-0728-08	TCGA-AB-2820-11B-01W-0728-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	19900d81-576b-44c1-975d-a874c0b19b15	2f7227c5-2077-405c-ac7c-6589765d1f0b	g.chr4:22389827G>A	ENST00000334304.5	-	19	3736	c.3467C>T	c.(3466-3468)gCg>gTg	p.A1156V	GPR125_ENST00000282943.5_5'UTR	NM_145290.3	NP_660333.2	Q8IWK6	GP125_HUMAN	G protein-coupled receptor 125	1156					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(33)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	56		Breast(46;0.198)				TTCTAAAGGCGCCACGTGCAT	0.453																																						dbGAP											0			4											73.0	73.0	73.0					4																	22389827		2203	4300	6503	21998925	SO:0001583	missense	0			AK095866	CCDS33964.1	4p15.31	2014-08-08			ENSG00000152990	ENSG00000152990		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / I-set domain containing"""	13839	protein-coding gene	gene with protein product		612303				12565841	Standard	NM_145290		Approved	FLJ38547, PGR21	uc003gqm.2	Q8IWK6	OTTHUMG00000160926	ENST00000334304.5:c.3467C>T	4.37:g.22389827G>A	ENSP00000334952:p.Ala1156Val	Somatic	92	1.08	1		1	75.00	3	WXS	Illumina HiSeq	Phase_IV	21998925	131	46.00	115	Q6UXK9|Q86SQ5|Q8TC55	Missense_Mutation	SNP	HMMPfam_GPS,HMMSmart_SM00303,HMMPfam_LRRCT,HMMSmart_SM00082,HMMPfam_7tm_2,HMMPfam_LRR_1,HMMSmart_SM00369,HMMSmart_SM00409,superfamily_Hormone receptor domain (HRM Pfam 02793),superfamily_Immunoglobulin,superfamily_L domain-like	p.A1156V	ENST00000334304.5	37	c.3467	CCDS33964.1	4	.	.	.	.	.	.	.	.	.	.	G	17.46	3.394883	0.62066	.	.	ENSG00000152990	ENST00000334304	T	0.55052	0.54	5.64	5.64	0.86602	.	0.050514	0.85682	D	0.000000	T	0.50548	0.1622	M	0.62723	1.935	0.80722	D	1	P;D	0.59357	0.8;0.985	B;B	0.38106	0.209;0.265	T	0.53697	-0.8402	10	0.30078	T	0.28	.	19.7052	0.96069	0.0:0.0:1.0:0.0	.	1013;1156	Q8IWK6-3;Q8IWK6	.;GP125_HUMAN	V	1156	ENSP00000334952:A1156V	ENSP00000334952:A1156V	A	-	2	0	GPR125	21998925	1.000000	0.71417	0.959000	0.39883	0.710000	0.40934	9.225000	0.95219	2.637000	0.89404	0.650000	0.86243	GCG	-	NULL		0.453	GPR125-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR125	protein_coding	OTTHUMT00000362960.3	G			21998925	-1	no_errors	NM_145290.2	genbank	human	validated	54_36p	missense	SNP	0.998	A
GALNTL6	442117	genome.wustl.edu	37	4	172735732	172735732	+	Start_Codon_SNP	SNP	A	A	G			TCGA-AB-2820-03B-01W-0728-08	TCGA-AB-2820-11B-01W-0728-08	A	A	A	G	A	A	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	19900d81-576b-44c1-975d-a874c0b19b15	2f7227c5-2077-405c-ac7c-6589765d1f0b	g.chr4:172735732A>G	ENST00000506823.1	+	2	658	c.1A>G	c.(1-3)Atg>Gtg	p.M1V	GALNTL6_ENST00000511251.1_Start_Codon_SNP_p.M1V	NM_001034845.2	NP_001030017.2	Q49A17	GLTL6_HUMAN	polypeptide N-acetylgalactosaminyltransferase-like 6	1					protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|liver(2)|lung(21)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	45						ACCATTTGCAATGAAGAGGAA	0.428																																						dbGAP											0			4											105.0	107.0	106.0					4																	172735732		2203	4300	6503	172972307	SO:0001582	initiator_codon_variant	0				CCDS34104.1	4q34.1	2014-03-13	2014-03-13		ENSG00000174473	ENSG00000174473		"""Glycosyltransferase family 2 domain containing"""	33844	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase-like 6"""	615138	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 6"""				Standard	NM_001034845		Approved	GALNT17, GalNAc-T6L	uc003isv.3	Q49A17	OTTHUMG00000160807	ENST00000506823.1:c.1A>G	4.37:g.172735732A>G	ENSP00000423313:p.Met1Val	Somatic	33	0.00	0		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	172972307	49	47.31	44	Q2L4S6	Missense_Mutation	SNP	HMMPfam_Ricin_B_lectin,HMMSmart_SM00458,HMMPfam_Glycos_transf_2,superfamily_Ricin B-like lectins,superfamily_Nucleotide-diphospho-sugar transferases	p.M1V	ENST00000506823.1	37	c.1	CCDS34104.1	4	.	.	.	.	.	.	.	.	.	.	A	19.66	3.868690	0.72065	.	.	ENSG00000174473	ENST00000511251;ENST00000506823;ENST00000404275	T	0.56941	0.43	5.85	5.85	0.93711	.	.	.	.	.	T	0.68128	0.2967	.	.	.	0.80722	D	1	P	0.40332	0.713	P	0.54815	0.761	T	0.70666	-0.4809	8	0.72032	D	0.01	.	14.1792	0.65562	1.0:0.0:0.0:0.0	.	1	Q49A17	GLTL6_HUMAN	V	1	ENSP00000423313:M1V	ENSP00000385382:M1V	M	+	1	0	GALNTL6	172972307	1.000000	0.71417	1.000000	0.80357	0.859000	0.49053	7.182000	0.77689	2.234000	0.73211	0.460000	0.39030	ATG	-	NULL		0.428	GALNTL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNTL6	protein_coding	OTTHUMT00000362395.1	A	NM_001034845	Missense_Mutation	172972307	+1	no_errors	NM_001034845.2	genbank	human	validated	54_36p	missense	SNP	1.000	G
TTC26	79989	genome.wustl.edu	37	7	138853105	138853105	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AB-2820-03B-01W-0728-08	TCGA-AB-2820-11B-01W-0728-08	G	G	G	T	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	19900d81-576b-44c1-975d-a874c0b19b15	2f7227c5-2077-405c-ac7c-6589765d1f0b	g.chr7:138853105G>T	ENST00000464848.1	+	11	1047	c.967G>T	c.(967-969)Gga>Tga	p.G323*	TTC26_ENST00000495038.1_Nonsense_Mutation_p.G192*|TTC26_ENST00000481482.1_3'UTR|TTC26_ENST00000343187.4_Nonsense_Mutation_p.G292*|TTC26_ENST00000478836.2_Nonsense_Mutation_p.G216*|TTC26_ENST00000430935.1_Nonsense_Mutation_p.G323*			A0AVF1	TTC26_HUMAN	tetratricopeptide repeat domain 26	323					cilium assembly (GO:0042384)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|intraciliary transport particle B (GO:0030992)|primary cilium (GO:0072372)				breast(1)|endometrium(5)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	24						TATTCTCAAAGGAGTGGTCAA	0.368																																						dbGAP											0			7											136.0	122.0	126.0					7																	138853105		2203	4300	6503	138503645	SO:0001587	stop_gained	0			AK022633	CCDS5852.1, CCDS55172.1, CCDS55173.1, CCDS75665.1	7q34	2013-01-11			ENSG00000105948	ENSG00000105948		"""Intraflagellar transport homologs"", ""Tetratricopeptide (TTC) repeat domain containing"""	21882	protein-coding gene	gene with protein product							Standard	NM_001144920		Approved	FLJ12571, dyf-13, DYF13	uc003vus.2	A0AVF1	OTTHUMG00000157472	ENST00000464848.1:c.967G>T	7.37:g.138853105G>T	ENSP00000419279:p.Gly323*	Somatic	191	2.54	5		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	138503645	104	49.76	104	A4D1S3|B7Z5M0|C9J2N7|F8W724|Q9H9S8|Q9NTC0	Nonsense_Mutation	SNP	superfamily_SSF48452	p.G323*	ENST00000464848.1	37	c.967	CCDS5852.1	7	.	.	.	.	.	.	.	.	.	.	G	37	6.427109	0.97559	.	.	ENSG00000105948	ENST00000430935;ENST00000495038;ENST00000478836;ENST00000464848;ENST00000343187	.	.	.	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	18.3245	0.90248	0.0:0.0:1.0:0.0	.	.	.	.	X	323;192;216;323;292	.	ENSP00000339135:G292X	G	+	1	0	TTC26	138503645	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.175000	0.89684	2.628000	0.89032	0.591000	0.81541	GGA	-	superfamily_SSF48452		0.368	TTC26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC26	protein_coding	OTTHUMT00000348919.2	G	NM_024926		138503645	+1	no_errors	NM_024926.1	genbank	human	validated	54_36p	nonsense	SNP	1.000	T
CSMD1	64478	genome.wustl.edu	37	8	3200835	3200835	+	Silent	SNP	A	A	T			TCGA-AB-2820-03B-01W-0728-08	TCGA-AB-2820-11B-01W-0728-08	A	A	A	T	A	A	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	19900d81-576b-44c1-975d-a874c0b19b15	2f7227c5-2077-405c-ac7c-6589765d1f0b	g.chr8:3200835A>T	ENST00000520002.1	-	24	4170	c.3615T>A	c.(3613-3615)ggT>ggA	p.G1205G	CSMD1_ENST00000537824.1_Silent_p.G1204G|CSMD1_ENST00000602723.1_Silent_p.G1205G|CSMD1_ENST00000400186.3_Silent_p.G1205G|CSMD1_ENST00000542608.1_Silent_p.G1204G|CSMD1_ENST00000602557.1_Silent_p.G1205G|CSMD1_ENST00000539096.1_Silent_p.G1204G			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	1205	CUB 7. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TGAGTTGAAAACCTTGGTCGG	0.388																																						dbGAP											0			8											184.0	181.0	182.0					8																	3200835		1908	4128	6036	3188242	SO:0001819	synonymous_variant	0					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.3615T>A	8.37:g.3200835A>T		Somatic	110	5.04	6		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	3188242	94	57.85	140	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	HMMPfam_Sushi,HMMSmart_SM00032,HMMPfam_CUB,HMMSmart_SM00042,superfamily_Spermadhesin CUB domain,superfamily_Complement control module/SCR domain	p.F1206I	ENST00000520002.1	37	c.3616		8	.	.	.	.	.	.	.	.	.	.	A	2.158	-0.392963	0.04899	.	.	ENSG00000183117	ENST00000335551	.	.	.	5.76	-11.5	0.00074	.	.	.	.	.	T	0.29914	0.0748	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.41538	-0.9503	4	.	.	.	.	0.5129	0.00598	0.2836:0.2457:0.1264:0.3443	.	.	.	.	I	685	.	.	F	-	1	0	CSMD1	3188242	0.161000	0.22892	0.022000	0.16811	0.269000	0.26545	-0.594000	0.05733	-2.943000	0.00296	-1.079000	0.02226	TTT	-	NULL		0.388	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	CSMD1	protein_coding	OTTHUMT00000374500.2	A	NM_033225		3188242	-1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	NM_033225.4	genbank	human	validated	54_36p	missense	SNP	0.980	T
KCNK9	51305	genome.wustl.edu	37	8	140630863	140630863	+	Silent	SNP	G	G	T			TCGA-AB-2820-03B-01W-0728-08	TCGA-AB-2820-11B-01W-0728-08	G	G	G	T	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	19900d81-576b-44c1-975d-a874c0b19b15	2f7227c5-2077-405c-ac7c-6589765d1f0b	g.chr8:140630863G>T	ENST00000520439.1	-	2	826	c.763C>A	c.(763-765)Cgg>Agg	p.R255R	KCNK9_ENST00000523477.1_5'Flank|KCNK9_ENST00000303015.1_Silent_p.R255R	NM_001282534.1	NP_001269463.1	Q9NPC2	KCNK9_HUMAN	potassium channel, subfamily K, member 9	255					cochlea development (GO:0090102)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			NS(1)|endometrium(9)|kidney(1)|large_intestine(9)|lung(17)|ovary(2)|prostate(3)|skin(1)	43	all_cancers(97;3.94e-14)|all_epithelial(106;4.81e-13)|Lung NSC(106;8.18e-05)|all_lung(105;0.00015)|Ovarian(258;0.00235)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;0.134)	BRCA - Breast invasive adenocarcinoma(115;0.0855)		Doxapram(DB00561)|Halothane(DB01159)	GCATCCCGCCGCTCATCCTCA	0.602																																						dbGAP											0			8											39.0	44.0	42.0					8																	140630863		2203	4300	6503	140700045	SO:0001819	synonymous_variant	0			AF212829	CCDS6377.1	8q24.3	2012-03-07			ENSG00000169427	ENSG00000169427		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6283	protein-coding gene	gene with protein product		605874				10734076, 16382106	Standard	NM_001282534		Approved	K2p9.1, TASK3, TASK-3	uc003yvf.1	Q9NPC2	OTTHUMG00000164186	ENST00000520439.1:c.763C>A	8.37:g.140630863G>T		Somatic	88	0.00	0		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	140700045	72	33.64	37	Q2M290|Q540F2	Silent	SNP	HMMPfam_Ion_trans_2,superfamily_SSF81324	p.R255	ENST00000520439.1	37	c.763	CCDS6377.1	8																																																																																			-	superfamily_SSF81324		0.602	KCNK9-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNK9	protein_coding	OTTHUMT00000378473.1	G	NM_016601		140700045	-1	no_errors	NM_016601.2	genbank	human	reviewed	54_36p	silent	SNP	0.977	T
SLC18A2	6571	genome.wustl.edu	37	10	119003781	119003781	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2820-03B-01W-0728-08	TCGA-AB-2820-11B-01W-0728-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	19900d81-576b-44c1-975d-a874c0b19b15	2f7227c5-2077-405c-ac7c-6589765d1f0b	g.chr10:119003781G>A	ENST00000298472.5	+	3	564	c.421G>A	c.(421-423)Gtc>Atc	p.V141I	SLC18A2_ENST00000497497.1_3'UTR|RP11-501J20.5_ENST00000425264.1_RNA	NM_003054.4	NP_003045.2	Q05940	VMAT2_HUMAN	solute carrier family 18 (vesicular monoamine transporter), member 2	141					aging (GO:0007568)|cellular response to ammonium ion (GO:0071242)|cellular response to drug (GO:0035690)|death (GO:0016265)|dopamine transport (GO:0015872)|endocytic recycling (GO:0032456)|glucose homeostasis (GO:0042593)|insulin secretion (GO:0030073)|locomotory behavior (GO:0007626)|monoamine transport (GO:0015844)|negative regulation of neurotransmitter transport (GO:0051589)|neurotransmitter loading into synaptic vesicle (GO:0098700)|neurotransmitter secretion (GO:0007269)|post-embryonic development (GO:0009791)|response to amphetamine (GO:0001975)|response to cocaine (GO:0042220)|response to corticosterone (GO:0051412)|response to herbicide (GO:0009635)|response to starvation (GO:0042594)|response to zinc ion (GO:0010043)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	clathrin-sculpted monoamine transport vesicle membrane (GO:0070083)|dense core granule (GO:0031045)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)|terminal bouton (GO:0043195)	amine transmembrane transporter activity (GO:0005275)|drug binding (GO:0008144)|monoamine transmembrane transporter activity (GO:0008504)|serotonin transmembrane transporter activity (GO:0015222)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(16)	29		Colorectal(252;0.19)		all cancers(201;0.029)	Amphetamine(DB00182)|Benzphetamine(DB00865)|Deserpidine(DB01089)|Dextroamphetamine(DB01576)|Ephedra(DB01363)|Ephedrine(DB01364)|Isometheptene(DB06706)|Methamphetamine(DB01577)|Norepinephrine(DB00368)|Propylhexedrine(DB06714)|Reserpine(DB00206)|Tetrabenazine(DB04844)	GAAAGCCACCGTCCAGCTCAT	0.478																																						dbGAP											0			10											63.0	59.0	60.0					10																	119003781		2203	4300	6503	118993771	SO:0001583	missense	0			L14269	CCDS7599.1	10q25	2013-07-18	2013-07-18		ENSG00000165646	ENSG00000165646		"""Solute carriers"""	10935	protein-coding gene	gene with protein product		193001		VMAT2			Standard	NM_003054		Approved	SVMT, SVAT	uc001ldd.2	Q05940	OTTHUMG00000019121	ENST00000298472.5:c.421G>A	10.37:g.119003781G>A	ENSP00000298472:p.Val141Ile	Somatic	90	2.17	2		0	100.00	3	WXS	Illumina HiSeq	Phase_IV	118993771	54	55.56	70	B2RC96|D3DRC4|Q15876|Q4G147|Q5VW49|Q9H3P6	Missense_Mutation	SNP	HMMPfam_MFS_1,superfamily_MFS general substrate transporter	p.V141I	ENST00000298472.5	37	c.421	CCDS7599.1	10	.	.	.	.	.	.	.	.	.	.	G	14.88	2.667592	0.47677	.	.	ENSG00000165646	ENST00000298472	T	0.57752	0.38	5.71	2.31	0.28768	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.122077	0.53938	N	0.000041	T	0.46308	0.1386	L	0.60455	1.87	0.52099	D	0.999947	B	0.18461	0.028	B	0.21360	0.034	T	0.40440	-0.9563	10	0.36615	T	0.2	-24.6891	10.5411	0.45033	0.2478:0.0:0.7522:0.0	.	141	Q05940	VMAT2_HUMAN	I	141	ENSP00000298472:V141I	ENSP00000298472:V141I	V	+	1	0	SLC18A2	118993771	1.000000	0.71417	0.672000	0.29872	0.978000	0.69477	3.545000	0.53648	0.726000	0.32339	0.655000	0.94253	GTC	-	HMMPfam_MFS_1,superfamily_MFS general substrate transporter		0.478	SLC18A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC18A2	protein_coding	OTTHUMT00000050563.1	G	NM_003054		118993771	+1	no_errors	NM_003054.3	genbank	human	provisional	54_36p	missense	SNP	0.971	A
IPO7	10527	genome.wustl.edu	37	11	9455150	9455150	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2820-03B-01W-0728-08	TCGA-AB-2820-11B-01W-0728-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	19900d81-576b-44c1-975d-a874c0b19b15	2f7227c5-2077-405c-ac7c-6589765d1f0b	g.chr11:9455150G>A	ENST00000379719.3	+	17	2057	c.1915G>A	c.(1915-1917)Gtc>Atc	p.V639I	CTD-2371O3.2_ENST00000531111.1_RNA	NM_006391.2	NP_006382.1	O95373	IPO7_HUMAN	importin 7	639					innate immune response (GO:0045087)|protein import into nucleus (GO:0006606)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)|viral process (GO:0016032)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear pore (GO:0005643)	Ran GTPase binding (GO:0008536)|small GTPase regulator activity (GO:0005083)|transporter activity (GO:0005215)			NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(12)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				all cancers(16;8.29e-09)|Epithelial(150;4.76e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0217)		CTGCTTACAGGTCATTGGTAC	0.358																																						dbGAP											0			11											112.0	102.0	106.0					11																	9455150		2201	4295	6496	9411726	SO:0001583	missense	0			AF098799	CCDS31425.1	11p15.3	2010-12-02	2003-03-11	2003-03-14	ENSG00000205339	ENSG00000205339		"""Importins"""	9852	protein-coding gene	gene with protein product		605586	"""RAN binding protein 7"""	RANBP7		9214382	Standard	NM_006391		Approved	Imp7	uc001mho.3	O95373	OTTHUMG00000165753	ENST00000379719.3:c.1915G>A	11.37:g.9455150G>A	ENSP00000369042:p.Val639Ile	Somatic	66	2.94	2		17	72.58	45	WXS	Illumina HiSeq	Phase_IV	9411726	89	67.39	186	A6NNM5|B2R786|Q1RMF7|Q9H177|Q9NTE3	Missense_Mutation	SNP	HMMPfam_IBN_N,superfamily_ARM-type_fold	p.V639I	ENST00000379719.3	37	c.1915	CCDS31425.1	11	.	.	.	.	.	.	.	.	.	.	G	16.05	3.012682	0.54468	.	.	ENSG00000205339	ENST00000379719	T	0.41065	1.01	5.29	5.29	0.74685	Armadillo-like helical (1);Armadillo-type fold (1);	0.113194	0.64402	D	0.000014	T	0.33904	0.0879	L	0.29908	0.895	0.80722	D	1	B	0.16802	0.019	B	0.21360	0.034	T	0.11891	-1.0569	10	0.14252	T	0.57	.	18.9919	0.92796	0.0:0.0:1.0:0.0	.	639	O95373	IPO7_HUMAN	I	639	ENSP00000369042:V639I	ENSP00000369042:V639I	V	+	1	0	IPO7	9411726	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	9.868000	0.99621	2.495000	0.84180	0.460000	0.39030	GTC	-	superfamily_ARM-type_fold		0.358	IPO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IPO7	protein_coding	OTTHUMT00000386022.1	G	NM_006391		9411726	+1	no_errors	NM_006391.2	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
SUDS3	64426	genome.wustl.edu	37	12	118841283	118841283	+	Missense_Mutation	SNP	C	C	A			TCGA-AB-2820-03B-01W-0728-08	TCGA-AB-2820-11B-01W-0728-08	C	C	C	A	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	19900d81-576b-44c1-975d-a874c0b19b15	2f7227c5-2077-405c-ac7c-6589765d1f0b	g.chr12:118841283C>A	ENST00000543473.1	+	10	1076	c.764C>A	c.(763-765)gCt>gAt	p.A255D	SUDS3_ENST00000541280.1_3'UTR|SUDS3_ENST00000397564.2_Missense_Mutation_p.A256D	NM_022491.2	NP_071936.2	Q9H7L9	SDS3_HUMAN	suppressor of defective silencing 3 homolog (S. cerevisiae)	255					apoptotic process (GO:0006915)|histone deacetylation (GO:0016575)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|substantia nigra development (GO:0021762)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Sin3 complex (GO:0016580)	enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)			breast(1)|lung(1)	2	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					AGGTTCGAAGCTCGGATAGAA	0.473																																						dbGAP											0			12											50.0	49.0	49.0					12																	118841283		1938	4136	6074	117325666	SO:0001583	missense	0			AK023801	CCDS44993.1	12q24.23	2006-02-13	2006-02-13		ENSG00000111707	ENSG00000111707			29545	protein-coding gene	gene with protein product	"""sin3A-associated protein, 45kDa"""	608250	"""suppressor of defective silencing 3 homolog (SDS3, S. cerevisiae)"""			11909966	Standard	NM_022491		Approved	SDS3, FLJ00052, SAP45	uc001twz.3	Q9H7L9	OTTHUMG00000168884	ENST00000543473.1:c.764C>A	12.37:g.118841283C>A	ENSP00000443988:p.Ala255Asp	Somatic	99	0.00	0		11	31.25	5	WXS	Illumina HiSeq	Phase_IV	117325666	117	50.00	117	Q4KMQ5|Q8N6H0|Q9H8D2	Missense_Mutation	SNP	HMMPfam_Sds3	p.A255D	ENST00000543473.1	37	c.764	CCDS44993.1	12	.	.	.	.	.	.	.	.	.	.	C	32	5.120466	0.94385	.	.	ENSG00000111707	ENST00000543473;ENST00000397564	.	.	.	5.2	5.2	0.72013	.	0.000000	0.85682	D	0.000000	T	0.78013	0.4217	M	0.68593	2.085	0.80722	D	1	D	0.71674	0.998	D	0.76071	0.987	T	0.77362	-0.2616	9	0.46703	T	0.11	-7.3762	18.5243	0.90965	0.0:1.0:0.0:0.0	.	255	Q9H7L9	SDS3_HUMAN	D	255;256	.	ENSP00000380695:A256D	A	+	2	0	SUDS3	117325666	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.760000	0.74939	2.691000	0.91804	0.655000	0.94253	GCT	-	NULL		0.473	SUDS3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	SUDS3	protein_coding	OTTHUMT00000401504.1	C	NM_022491		117325666	+1	no_errors	NM_022491.2	genbank	human	validated	54_36p	missense	SNP	1.000	A
TUBA3C	7278	genome.wustl.edu	37	13	19751584	19751584	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2820-03B-01W-0728-08	TCGA-AB-2820-11B-01W-0728-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	19900d81-576b-44c1-975d-a874c0b19b15	2f7227c5-2077-405c-ac7c-6589765d1f0b	g.chr13:19751584G>A	ENST00000400113.3	-	4	643	c.539C>T	c.(538-540)gCc>gTc	p.A180V		NM_006001.2	NP_005992.1	Q13748	TBA3C_HUMAN	tubulin, alpha 3c	180					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(4)|prostate(7)|skin(7)|urinary_tract(1)	72		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)		CTCCACCACGGCCGTGGAGAC	0.542																																						dbGAP											0			13											151.0	154.0	153.0					13																	19751584		2203	4300	6503	18649584	SO:0001583	missense	0			AF005392	CCDS9284.1	13q12.11	2007-06-20	2007-02-12	2007-02-12	ENSG00000198033	ENSG00000198033		"""Tubulins"""	12408	protein-coding gene	gene with protein product		602528	"""tubulin, alpha 2"""	TUBA2		9465305	Standard	NM_006001		Approved	bA408E5.3	uc009zzj.3	Q13748	OTTHUMG00000016481	ENST00000400113.3:c.539C>T	13.37:g.19751584G>A	ENSP00000382982:p.Ala180Val	Somatic	66	1.49	1		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	18649584	98	22.22	28	A6NJQ0|Q5W099|Q6PEY3|Q96F18	Missense_Mutation	SNP	HMMPfam_Tubulin,superfamily_Tubulin C-terminal domain-like,PatternScan_TUBULIN,HMMPfam_Tubulin_C,superfamily_Tubulin nucleotide-binding domain-like	p.A180V	ENST00000400113.3	37	c.539	CCDS9284.1	13	.	.	.	.	.	.	.	.	.	.	g	10.85	1.467479	0.26335	.	.	ENSG00000198033	ENST00000400113;ENST00000360801	T	0.64438	-0.1	1.19	0.237	0.15475	.	0.000000	0.46758	U	0.000271	T	0.63931	0.2553	.	.	.	0.36367	D	0.861094	.	.	.	.	.	.	T	0.67019	-0.5776	7	0.87932	D	0	.	7.0315	0.24970	0.0:0.2868:0.7132:0.0	.	.	.	.	V	180	ENSP00000382982:A180V	ENSP00000354037:A180V	A	-	2	0	TUBA3C	18649584	1.000000	0.71417	0.983000	0.44433	0.518000	0.34316	6.101000	0.71479	0.056000	0.16144	0.162000	0.16502	GCC	-	HMMPfam_Tubulin,superfamily_Tubulin nucleotide-binding domain-like		0.542	TUBA3C-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	TUBA3C	protein_coding	OTTHUMT00000044007.2	G	NM_006001		18649584	-1	no_errors	NM_006001.1	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
TGM5	9333	genome.wustl.edu	37	15	43525775	43525775	+	Silent	SNP	G	G	A	rs146012721	byFrequency	TCGA-AB-2820-03B-01W-0728-08	TCGA-AB-2820-11B-01W-0728-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	19900d81-576b-44c1-975d-a874c0b19b15	2f7227c5-2077-405c-ac7c-6589765d1f0b	g.chr15:43525775G>A	ENST00000220420.5	-	12	1993	c.1986C>T	c.(1984-1986)ctC>ctT	p.L662L	TGM5_ENST00000349114.4_Silent_p.L580L	NM_201631.3	NP_963925.2	O43548	TGM5_HUMAN	transglutaminase 5	662					cellular protein modification process (GO:0006464)|epidermis development (GO:0008544)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(11)|lung(15)|skin(6)|urinary_tract(1)	44		all_cancers(109;1.37e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.216)		GBM - Glioblastoma multiforme(94;4e-07)	L-Glutamine(DB00130)	GTTTCTTGAAGAGGCCACTTC	0.507													G|||	3	0.000599042	0.0023	0.0	5008	,	,		21212	0.0		0.0	False		,,,				2504	0.0					dbGAP											0			15						G	,	17,4389	24.3+/-50.5	0,17,2186	116.0	115.0	115.0		1740,1986	4.0	1.0	15	dbSNP_134	115	0,8598		0,0,4299	no	coding-synonymous,coding-synonymous	TGM5	NM_004245.3,NM_201631.3	,	0,17,6485	AA,AG,GG		0.0,0.3858,0.1307	,	580/639,662/721	43525775	17,12987	2203	4299	6502	41313067	SO:0001819	synonymous_variant	0			AF035960	CCDS32211.1, CCDS32212.1	15q15	2004-07-07				ENSG00000104055		"""Transglutaminases"""	11781	protein-coding gene	gene with protein product		603805				9452468, 11390390	Standard	NM_201631		Approved	TGX	uc001zrd.2	O43548		ENST00000220420.5:c.1986C>T	15.37:g.43525775G>A		Somatic	111	0.00	0		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	41313067	98	40.96	68	O43549|Q0VF40|Q9UEZ4	Silent	SNP	HMMPfam_Transglut_N,HMMPfam_Transglut_core,HMMSmart_SM00460,HMMPfam_Transglut_C,superfamily_Transglutaminase two C-terminal domains,PatternScan_TRANSGLUTAMINASES,superfamily_E set domains,superfamily_Cysteine proteinases	p.L662	ENST00000220420.5	37	c.1986	CCDS32212.1	15																																																																																			-	HMMPfam_Transglut_C,superfamily_Transglutaminase two C-terminal domains		0.507	TGM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGM5	protein_coding	OTTHUMT00000432257.1	G	NM_004245		41313067	-1	no_errors	NM_201631.2	genbank	human	validated	54_36p	silent	SNP	0.927	A
SUZ12	23512	genome.wustl.edu	37	17	30267338	30267338	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2820-03B-01W-0728-08	TCGA-AB-2820-11B-01W-0728-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	19900d81-576b-44c1-975d-a874c0b19b15	2f7227c5-2077-405c-ac7c-6589765d1f0b	g.chr17:30267338G>A	ENST00000322652.5	+	2	537	c.308G>A	c.(307-309)cGg>cAg	p.R103Q	SUZ12_ENST00000580398.1_Missense_Mutation_p.R103Q	NM_015355.2	NP_056170.2	Q15022	SUZ12_HUMAN	SUZ12 polycomb repressive complex 2 subunit	103					histone ubiquitination (GO:0016574)|negative regulation of cell differentiation (GO:0045596)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell proliferation (GO:0008284)|transcription, DNA-templated (GO:0006351)	ESC/E(Z) complex (GO:0035098)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|sex chromatin (GO:0001739)	chromatin binding (GO:0003682)|histone methyltransferase activity (GO:0042054)|metal ion binding (GO:0046872)|methylated histone binding (GO:0035064)|RNA binding (GO:0003723)|sequence-specific DNA binding (GO:0043565)	p.R103Q(1)	SSH2/SUZ12(2)|JAZF1/SUZ12(133)	breast(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(4)|lung(5)|skin(1)	21		Myeloproliferative disorder(56;0.0255)|all_hematologic(16;0.041)|Ovarian(249;0.182)|Breast(31;0.231)				CTTCGAACTCGGAATCTCATA	0.303			T	JAZF1	endometrial stromal tumours																																	dbGAP		Dom	yes		17	17q11.2	23512	suppressor of zeste 12 homolog (Drosophila)		M	1	Substitution - Missense(1)	large_intestine(1)	17											85.0	79.0	81.0					17																	30267338		2203	4294	6497	27291451	SO:0001583	missense	0			D63881	CCDS11270.1	17q21	2013-06-05	2013-06-05		ENSG00000178691	ENSG00000178691		"""Zinc fingers, C2H2-type"""	17101	protein-coding gene	gene with protein product		606245	"""suppressor of zeste 12 homolog (Drosophila)"""			8590280, 11371647, 18784248	Standard	NM_015355		Approved	JJAZ1, KIAA0160, CHET9	uc002hgs.2	Q15022	OTTHUMG00000132813	ENST00000322652.5:c.308G>A	17.37:g.30267338G>A	ENSP00000316578:p.Arg103Gln	Somatic	98	0.00	0		19	36.67	11	WXS	Illumina HiSeq	Phase_IV	27291451	30	54.55	36	Q96BD9	Missense_Mutation	SNP	PatternScan_ZINC_FINGER_C2H2_1,HMMSmart_ZnF_C2H2,HMMPfam_VEFS-Box	p.R103Q	ENST00000322652.5	37	c.308	CCDS11270.1	17	.	.	.	.	.	.	.	.	.	.	.	14.57	2.575809	0.45902	.	.	ENSG00000178691	ENST00000322652	T	0.23552	1.9	4.81	4.81	0.61882	.	0.000000	0.85682	D	0.000000	T	0.47078	0.1426	M	0.62723	1.935	0.51233	D	0.999911	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.988	T	0.46148	-0.9212	10	0.87932	D	0	-5.88	12.7265	0.57174	0.0805:0.0:0.9195:0.0	.	103;103	A8K1U9;Q15022	.;SUZ12_HUMAN	Q	103	ENSP00000316578:R103Q	ENSP00000316578:R103Q	R	+	2	0	SUZ12	27291451	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.089000	0.94137	2.383000	0.81215	0.597000	0.82753	CGG	-	NULL		0.303	SUZ12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUZ12	protein_coding	OTTHUMT00000256260.2	G	NM_015355		27291451	+1	no_errors	NM_015355.2	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
KIAA1683	80726	genome.wustl.edu	37	19	18368587	18368587	+	Silent	SNP	G	G	T			TCGA-AB-2820-03B-01W-0728-08	TCGA-AB-2820-11B-01W-0728-08	G	G	G	T	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	19900d81-576b-44c1-975d-a874c0b19b15	2f7227c5-2077-405c-ac7c-6589765d1f0b	g.chr19:18368587G>T	ENST00000600328.3	-	4	3139	c.2946C>A	c.(2944-2946)gcC>gcA	p.A982A	PDE4C_ENST00000596647.1_5'Flank|KIAA1683_ENST00000392413.4_Silent_p.A1169A|KIAA1683_ENST00000600359.3_Silent_p.A936A|PDE4C_ENST00000355502.3_5'Flank			Q9H0B3	K1683_HUMAN	KIAA1683	982	IQ 4. {ECO:0000255|PROSITE- ProRule:PRU00116}.					mitochondrion (GO:0005739)|nucleus (GO:0005634)				breast(1)|endometrium(7)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37						AGCCGCGCCAGGCAGACTGGA	0.701																																						dbGAP											0			19											24.0	28.0	26.0					19																	18368587		2161	4190	6351	18229587	SO:0001819	synonymous_variant	0			AB051470	CCDS32958.1, CCDS46017.1, CCDS46018.1	19p13.1	2008-02-05				ENSG00000130518			29350	protein-coding gene	gene with protein product						11214970, 11230166	Standard	NM_025249		Approved		uc010ebn.2	Q9H0B3		ENST00000600328.3:c.2946C>A	19.37:g.18368587G>T		Somatic	11	0.00	0		18	25.00	6	WXS	Illumina HiSeq	Phase_IV	18229587	12	42.86	9	B4DYH2|E9PDE0|E9PH54|Q2KHR5|Q8N4G8|Q96M14|Q9C0I0	Silent	SNP	HMMPfam_IQ,HMMSmart_SM00015,superfamily_P-loop containing nucleoside triphosphate hydrolases	p.A982	ENST00000600328.3	37	c.2946	CCDS32958.1	19																																																																																			-	HMMSmart_SM00015,superfamily_P-loop containing nucleoside triphosphate hydrolases		0.701	KIAA1683-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	KIAA1683	protein_coding	OTTHUMT00000466312.3	G			18229587	-1	no_errors	NM_025249.1	genbank	human	validated	54_36p	silent	SNP	0.384	T
DAB2	1601	genome.wustl.edu	37	5	39383029	39383030	+	Frame_Shift_Del	DEL	AC	AC	-			TCGA-AB-2820-03B-01W-0728-08	TCGA-AB-2820-11B-01W-0728-08	AC	AC	AC	-	AC	AC	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	19900d81-576b-44c1-975d-a874c0b19b15	2f7227c5-2077-405c-ac7c-6589765d1f0b	g.chr5:39383029_39383030delAC	ENST00000320816.6	-	10	1498_1499	c.1031_1032delGT	c.(1030-1032)ggtfs	p.G344fs	DAB2_ENST00000339788.6_Intron|DAB2_ENST00000545653.1_Frame_Shift_Del_p.G323fs|DAB2_ENST00000509337.1_Frame_Shift_Del_p.G323fs|DAB2_ENST00000512525.1_5'Flank	NM_001343.3	NP_001334.2	P98082	DAB2_HUMAN	Dab, mitogen-responsive phosphoprotein, homolog 2 (Drosophila)	344	Required for localization to clathrin- coated pits. {ECO:0000250}.				activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|cell morphogenesis involved in differentiation (GO:0000904)|cell proliferation (GO:0008283)|cellular response to transforming growth factor beta stimulus (GO:0071560)|clathrin coat assembly (GO:0048268)|endoderm development (GO:0007492)|excretion (GO:0007588)|in utero embryonic development (GO:0001701)|leading edge cell differentiation (GO:0035026)|membrane organization (GO:0061024)|myeloid cell differentiation (GO:0030099)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of protein binding (GO:0032091)|negative regulation of protein localization to plasma membrane (GO:1903077)|negative regulation of transcription, DNA-templated (GO:0045892)|pinocytosis (GO:0006907)|positive regulation of cell migration (GO:0030335)|positive regulation of clathrin-mediated endocytosis (GO:2000370)|positive regulation of early endosome to late endosome transport (GO:2000643)|positive regulation of endocytosis (GO:0045807)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of integrin-mediated signaling pathway (GO:2001046)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of receptor recycling (GO:0001921)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|Wnt signaling pathway (GO:0016055)	apical plasma membrane (GO:0016324)|clathrin coat of coated pit (GO:0030132)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	cargo receptor activity (GO:0038024)|clathrin adaptor activity (GO:0035615)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein C-terminus binding (GO:0008022)|SMAD binding (GO:0046332)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(1)|kidney(5)|large_intestine(9)|lung(19)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	47	all_lung(31;0.000197)		Epithelial(62;0.137)			CAAATTGCTGACCAAAGTAGTC	0.49																																						dbGAP											0			5																																								39418787	SO:0001589	frameshift_variant	0			U53446	CCDS34149.1, CCDS58946.1	5p13.1	2013-10-03	2013-03-08		ENSG00000153071	ENSG00000153071			2662	protein-coding gene	gene with protein product		601236	"""disabled (Drosophila) homolog 2 (mitogen-responsive phosphoprotein)"", ""disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila)"""			8660969, 9620555	Standard	NM_001343		Approved	DOC-2	uc003jlx.3	P98082	OTTHUMG00000162043	ENST00000320816.6:c.1031_1032delGT	5.37:g.39383029_39383030delAC	ENSP00000313391:p.Gly344fs	Somatic	0	0.00	0		0	0.00	0	WXS	Illumina HiSeq	Phase_IV	39418786	0	40.43	76	A6NES5|Q13598|Q9BTY0|Q9UK04	Frame_Shift_Del	DEL	PatternScan_PFKB_KINASES_1,HMMPfam_PID,HMMSmart_SM00462,superfamily_PH domain-like	p.G344fs	ENST00000320816.6	37	c.1032_1031	CCDS34149.1	5																																																																																			-	NULL		0.490	DAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DAB2	protein_coding	OTTHUMT00000367014.1	AC	NM_001343		39418787	-1	no_errors	NM_001343.2	genbank	human	validated	54_36p	frame_shift_del	DEL	0.972:1.000	-
TP53	7157	genome.wustl.edu	37	17	7578181	7578182	+	Frame_Shift_Ins	INS	-	-	GCGGCTC	rs138983188		TCGA-AB-2820-03B-01W-0728-08	TCGA-AB-2820-11B-01W-0728-08	-	-	-	GCGGCTC	-	-	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	19900d81-576b-44c1-975d-a874c0b19b15	2f7227c5-2077-405c-ac7c-6589765d1f0b	g.chr17:7578181_7578182insGCGGCTC	ENST00000269305.4	-	6	856_857	c.667_668insGAGCCGC	c.(667-669)cctfs	p.P223fs	TP53_ENST00000413465.2_Frame_Shift_Ins_p.P223fs|TP53_ENST00000420246.2_Frame_Shift_Ins_p.P223fs|TP53_ENST00000445888.2_Frame_Shift_Ins_p.P223fs|TP53_ENST00000455263.2_Frame_Shift_Ins_p.P223fs|TP53_ENST00000359597.4_Frame_Shift_Ins_p.P223fs|TP53_ENST00000574684.1_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	223	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		P -> A (in a sporadic cancer; somatic mutation).|P -> H (in sporadic cancers; somatic mutation).|P -> L (in sporadic cancers; somatic mutation).|P -> R (in a sporadic cancer; somatic mutation).|P -> S (in a sporadic cancer; somatic mutation).|P -> T (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(11)|p.0?(8)|p.P223L(4)|p.P223fs*1(3)|p.P223H(2)|p.Y220_P223delYEPP(1)|p.P223R(1)|p.P130fs*1(1)|p.P223S(1)|p.V218_E224delVPYEPPE(1)|p.P222fs*24(1)|p.P223A(1)|p.P223fs*24(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CCAGACCTCAGGCGGCTCATAG	0.545		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	36	Unknown(11)|Substitution - Missense(9)|Whole gene deletion(8)|Deletion - Frameshift(6)|Deletion - In frame(2)	biliary_tract(5)|endometrium(5)|ovary(5)|bone(4)|upper_aerodigestive_tract(3)|stomach(2)|central_nervous_system(2)|oesophagus(2)|thyroid(1)|soft_tissue(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|urinary_tract(1)|skin(1)|meninges(1)|prostate(1)	17																																								7518907	SO:0001589	frameshift_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.661_667dupGAGCCGC	17.37:g.7578182_7578188dupGCGGCTC	ENSP00000269305:p.Pro223fs	Somatic	NA	NA	NA		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	7518906	NA	NA	NA	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Ins	INS	PatternScan_P53,superfamily_p53-like transcription factors,HMMPfam_P53_tetramer,superfamily_p53 tetramerization domain,HMMPfam_P53,HMMPfam_P53_TAD	p.P223fs	ENST00000269305.4	37	c.668_667	CCDS11118.1	17																																																																																			-	superfamily_p53-like transcription factors,HMMPfam_P53		0.545	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	-	NM_000546		7518907	-1	no_errors	NM_000546.4	genbank	human	reviewed	54_36p	frame_shift_ins	INS	0.987:0.989	GCGGCTC
