#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NormalRefReads_WU	i_NormalVAF_WU	i_NormalVarReads_WU	i_ORegAnno_bin	i_RNARefReads_WU	i_RNAVAF_WU	i_RNAVarReads_WU	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TumorRefReads_WU	i_TumorVAF_WU	i_TumorVarReads_WU	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
ARHGEF19	128272	genome.wustl.edu	37	1	16525645	16525645	+	Splice_Site	SNP	C	C	T			TCGA-AB-2828-03C-01W-0761-09	TCGA-AB-2828-11B-01W-0728-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	10851212-f1e2-4d19-a72c-e5b76befbf4e	c216d8ed-38df-4961-96a7-0e8a9184a17d	g.chr1:16525645C>T	ENST00000270747.3	-	15	2387	c.2251G>A	c.(2251-2253)Ggc>Agc	p.G751S	ARHGEF19_ENST00000478117.1_5'UTR|ARHGEF19-AS1_ENST00000457809.1_RNA	NM_153213.3	NP_694945.2	Q8IW93	ARHGJ_HUMAN	Rho guanine nucleotide exchange factor (GEF) 19	751	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				regulation of actin cytoskeleton organization (GO:0032956)|wound healing (GO:0042060)		GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			cervix(1)|endometrium(1)|lung(3)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	12		Colorectal(325;0.000147)|Renal(390;0.00145)|Breast(348;0.00224)|Lung NSC(340;0.00566)|all_lung(284;0.00831)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.018)|Colorectal(212;3.48e-07)|COAD - Colon adenocarcinoma(227;2.19e-05)|BRCA - Breast invasive adenocarcinoma(304;9.46e-05)|Kidney(64;0.000171)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.0117)|READ - Rectum adenocarcinoma(331;0.0649)		GCCCCCTCACCGTCACTGGTC	0.557																																						dbGAP											0			1											110.0	86.0	94.0					1																	16525645		2203	4300	6503	16398232	SO:0001630	splice_region_variant	0			BC012982	CCDS170.1	1p36.13	2011-11-16			ENSG00000142632	ENSG00000142632		"""Rho guanine nucleotide exchange factors"""	26604	protein-coding gene	gene with protein product		612496				12477932	Standard	NM_153213		Approved	FLJ33962, WGEF	uc001ayc.1	Q8IW93	OTTHUMG00000002219	ENST00000270747.3:c.2251+1G>A	1.37:g.16525645C>T		Somatic	161	3.59	6		1	0.00	0	WXS	Illumina HiSeq	Phase_IV	16398232	204	46.15	180	A6NJ04|Q5TEV2|Q6PJQ4|Q8N244	Missense_Mutation	SNP	HMMPfam_RhoGEF,HMMSmart_SM00325,superfamily_DBL homology domain (DH-domain),HMMPfam_SH3_1,HMMSmart_SM00326,superfamily_SH3-domain,HMMPfam_PH,HMMSmart_SM00233,superfamily_PH domain-like	p.G751S	ENST00000270747.3	37	c.2251	CCDS170.1	1	.	.	.	.	.	.	.	.	.	.	C	29.0	4.968306	0.92855	.	.	ENSG00000142632	ENST00000270747	T	0.41400	1.0	4.57	4.57	0.56435	Src homology-3 domain (4);	0.000000	0.64402	D	0.000003	T	0.74779	0.3761	H	0.96333	3.805	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.83567	0.0110	9	.	.	.	.	14.8969	0.70651	0.0:1.0:0.0:0.0	.	751	Q8IW93	ARHGJ_HUMAN	S	751	ENSP00000270747:G751S	.	G	-	1	0	ARHGEF19	16398232	1.000000	0.71417	0.991000	0.47740	0.873000	0.50193	6.399000	0.73248	2.395000	0.81488	0.561000	0.74099	GGC	-	HMMPfam_SH3_1,HMMSmart_SM00326,superfamily_SH3-domain		0.557	ARHGEF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF19	protein_coding	OTTHUMT00000006289.1	C	NM_153213	Missense_Mutation	16398232	-1	no_errors	NM_153213.3	genbank	human	provisional	54_36p	missense	SNP	0.999	T
OR2M2	391194	genome.wustl.edu	37	1	248344003	248344003	+	Missense_Mutation	SNP	C	C	T			TCGA-AB-2828-03C-01W-0761-09	TCGA-AB-2828-11B-01W-0728-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	10851212-f1e2-4d19-a72c-e5b76befbf4e	c216d8ed-38df-4961-96a7-0e8a9184a17d	g.chr1:248344003C>T	ENST00000359682.2	+	1	716	c.716C>T	c.(715-717)aCg>aTg	p.T239M		NM_001004688.1	NP_001004688.1	Q96R28	OR2M2_HUMAN	olfactory receptor, family 2, subfamily M, member 2	239						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(45)|ovary(3)|prostate(1)|skin(3)	70	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			AAAGCTTTCACGACCTGTTCC	0.488																																						dbGAP											0			1											198.0	177.0	184.0					1																	248344003		2203	4300	6503	246410626	SO:0001583	missense	0			AF399616	CCDS31106.1	1q44	2012-08-09			ENSG00000198601	ENSG00000198601		"""GPCR / Class A : Olfactory receptors"""	8268	protein-coding gene	gene with protein product						12213199	Standard	NM_001004688		Approved	OST423, OR2M2Q	uc010pzf.2	Q96R28	OTTHUMG00000040460	ENST00000359682.2:c.716C>T	1.37:g.248344003C>T	ENSP00000352710:p.Thr239Met	Somatic	53	5.36	3		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	246410626	93	50.00	95	A3KFT4	Missense_Mutation	SNP	HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1,superfamily_SSF81321	p.T239M	ENST00000359682.2	37	c.716	CCDS31106.1	1	.	.	.	.	.	.	.	.	.	.	c	10.29	1.308482	0.23821	.	.	ENSG00000198601	ENST00000359682	T	0.00158	8.65	2.03	-0.221	0.13126	GPCR, rhodopsin-like superfamily (1);	1.058580	0.07625	U	0.927660	T	0.00300	0.0009	L	0.51422	1.61	0.09310	N	1	D	0.89917	1.0	D	0.67900	0.954	T	0.51426	-0.8707	10	0.72032	D	0.01	.	5.9397	0.19186	0.0:0.6839:0.1938:0.1223	.	239	Q96R28	OR2M2_HUMAN	M	239	ENSP00000352710:T239M	ENSP00000352710:T239M	T	+	2	0	OR2M2	246410626	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.020000	0.12525	-0.191000	0.10448	-0.396000	0.06452	ACG	-	HMMPfam_7tm_1,superfamily_SSF81321		0.488	OR2M2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2M2	protein_coding	OTTHUMT00000097356.2	C	NM_001004688		246410626	+1	no_errors	NM_001004688.1	genbank	human	provisional	54_36p	missense	SNP	0.002	T
CAMKMT	79823	genome.wustl.edu	37	2	44931441	44931441	+	Silent	SNP	G	G	A			TCGA-AB-2828-03C-01W-0761-09	TCGA-AB-2828-11B-01W-0728-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	10851212-f1e2-4d19-a72c-e5b76befbf4e	c216d8ed-38df-4961-96a7-0e8a9184a17d	g.chr2:44931441G>A	ENST00000378494.3	+	4	440	c.396G>A	c.(394-396)gaG>gaA	p.E132E		NM_024766.4	NP_079042.1	Q7Z624	CMKMT_HUMAN	calmodulin-lysine N-methyltransferase	132						Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	calmodulin-lysine N-methyltransferase activity (GO:0018025)			breast(2)|large_intestine(3)|lung(5)	10						CATCTGAAGAGGTTTTGGCTT	0.343																																						dbGAP											0			2											106.0	103.0	104.0					2																	44931441		2203	4300	6503	44784945	SO:0001819	synonymous_variant	0				CCDS1820.1	2p21	2011-06-22	2011-03-10	2011-03-10	ENSG00000143919	ENSG00000143919	2.1.1.60		26276	protein-coding gene	gene with protein product	"""CaM KMT"""	609559	"""chromosome 2 open reading frame 34"""	C2orf34		20975703	Standard	NM_024766		Approved	CLNMT	uc002rum.3	Q7Z624	OTTHUMG00000128761	ENST00000378494.3:c.396G>A	2.37:g.44931441G>A		Somatic	119	7.03	9		4	20.00	1	WXS	Illumina HiSeq	Phase_IV	44784945	112	44.06	89	Q4ZG15|Q53SS6|Q8N6P5|Q9H5G8	Silent	SNP	HMMPfam_Methyltransf_16,superfamily_S-adenosyl-L-methionine-dependent methyltransferases	p.E132	ENST00000378494.3	37	c.396	CCDS1820.1	2																																																																																			-	HMMPfam_Methyltransf_16,superfamily_S-adenosyl-L-methionine-dependent methyltransferases		0.343	CAMKMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2orf34	protein_coding	OTTHUMT00000250678.2	G	NM_024766		44784945	+1	no_errors	NM_024766.3	genbank	human	validated	54_36p	silent	SNP	1.000	A
DYSF	8291	genome.wustl.edu	37	2	71797454	71797454	+	Silent	SNP	C	C	T			TCGA-AB-2828-03C-01W-0761-09	TCGA-AB-2828-11B-01W-0728-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	10851212-f1e2-4d19-a72c-e5b76befbf4e	c216d8ed-38df-4961-96a7-0e8a9184a17d	g.chr2:71797454C>T	ENST00000258104.3	+	28	3298	c.3021C>T	c.(3019-3021)gtC>gtT	p.V1007V	DYSF_ENST00000410020.3_Silent_p.V1025V|DYSF_ENST00000394120.2_Silent_p.V1008V|DYSF_ENST00000429174.2_Silent_p.V1007V|DYSF_ENST00000409762.1_Silent_p.V1024V|DYSF_ENST00000409582.3_Silent_p.V1024V|DYSF_ENST00000409651.1_Silent_p.V1039V|DYSF_ENST00000410041.1_Silent_p.V1025V|DYSF_ENST00000413539.2_Silent_p.V1038V|DYSF_ENST00000409366.1_Silent_p.V1008V|DYSF_ENST00000409744.1_Silent_p.V994V	NM_001130976.1|NM_003494.3	NP_001124448.1|NP_003485.1	O75923	DYSF_HUMAN	dysferlin	1007					plasma membrane repair (GO:0001778)|vesicle fusion (GO:0006906)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phospholipid binding (GO:0005543)			autonomic_ganglia(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(57)|ovary(3)|pancreas(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	111						ACCGGGCTGTCGATGAGCAAG	0.597																																						dbGAP											0			2											77.0	70.0	72.0					2																	71797454		2203	4300	6503	71650962	SO:0001819	synonymous_variant	0			AF075575	CCDS1918.1, CCDS46323.1, CCDS46324.1, CCDS46325.1, CCDS46326.1, CCDS46327.1, CCDS46328.1, CCDS46329.1, CCDS46330.1, CCDS46331.1, CCDS46332.1	2p13.3	2014-09-17	2013-09-12		ENSG00000135636	ENSG00000135636			3097	protein-coding gene	gene with protein product	"""fer-1-like family member 1"""	603009	"""limb girdle muscular dystrophy 2B (autosomal recessive)"""	LGMD2B		8320700	Standard	NM_003494		Approved	FER1L1	uc010fen.3	O75923	OTTHUMG00000129757	ENST00000258104.3:c.3021C>T	2.37:g.71797454C>T		Somatic	51	0.00	0		43	17.31	9	WXS	Illumina HiSeq	Phase_IV	71650962	135	18.56	31	A0FK00|B1PZ70|B1PZ71|B1PZ72|B1PZ73|B1PZ74|B1PZ75|B1PZ76|B1PZ77|B1PZ78|B1PZ79|B1PZ80|B1PZ81|B3KQB9|O75696|Q09EX5|Q0H395|Q53QY3|Q53TD2|Q8TEL8|Q9UEN7	Silent	SNP	HMMPfam_C2,HMMSmart_SM00239,HMMSmart_SM00693,HMMSmart_SM00694,superfamily_C2 domain (Calcium/lipid-binding domain CaLB),HMMPfam_FerA,HMMPfam_FerB,HMMPfam_FerI	p.V1007	ENST00000258104.3	37	c.3021	CCDS1918.1	2																																																																																			-	NULL		0.597	DYSF-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DYSF	protein_coding	OTTHUMT00000251970.3	C	NM_003494		71650962	+1	no_errors	NM_003494.1	genbank	human	reviewed	54_36p	silent	SNP	0.913	T
PARP14	54625	genome.wustl.edu	37	3	122420027	122420027	+	Missense_Mutation	SNP	C	C	G			TCGA-AB-2828-03C-01W-0761-09	TCGA-AB-2828-11B-01W-0728-08	C	C	C	G	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	10851212-f1e2-4d19-a72c-e5b76befbf4e	c216d8ed-38df-4961-96a7-0e8a9184a17d	g.chr3:122420027C>G	ENST00000474629.2	+	6	2892	c.2626C>G	c.(2626-2628)Cac>Gac	p.H876D		NM_017554.2	NP_060024.2	Q460N5	PAR14_HUMAN	poly (ADP-ribose) polymerase family, member 14	876	Macro 1. {ECO:0000255|PROSITE- ProRule:PRU00490}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	NAD+ ADP-ribosyltransferase activity (GO:0003950)			NS(2)|breast(5)|cervix(2)|endometrium(7)|kidney(5)|large_intestine(8)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	50				GBM - Glioblastoma multiforme(114;0.0531)		GCCCTACCACCACGTGATCCA	0.592																																						dbGAP											0			3											29.0	30.0	30.0					3																	122420027		2008	4157	6165	123902717	SO:0001583	missense	0			AB033094	CCDS46894.1	3q21	2010-02-16			ENSG00000173193	ENSG00000173193		"""Poly (ADP-ribose) polymerases"""	29232	protein-coding gene	gene with protein product		610028				15273990	Standard	NM_017554		Approved	KIAA1268, pART8	uc003efq.4	Q460N5	OTTHUMG00000159552	ENST00000474629.2:c.2626C>G	3.37:g.122420027C>G	ENSP00000418194:p.His876Asp	Somatic	58	3.33	2		22	48.84	21	WXS	Illumina HiSeq	Phase_IV	123902717	82	50.60	85	B4E2H0|Q460N4|Q8J027|Q9H9X9|Q9NV60|Q9ULF2	Missense_Mutation	SNP	HMMPfam_Macro,HMMSmart_SM00506,HMMPfam_PARP,superfamily_Macro domain-like,superfamily_ADP-ribosylation	p.H876D	ENST00000474629.2	37	c.2626	CCDS46894.1	3	.	.	.	.	.	.	.	.	.	.	C	12.39	1.924411	0.34002	.	.	ENSG00000173193	ENST00000474629;ENST00000398162	T	0.23552	1.9	6.06	4.26	0.50523	Appr-1-p processing (3);	0.570215	0.17776	N	0.162413	T	0.40040	0.1101	M	0.85373	2.75	0.09310	N	1	P;P	0.49358	0.886;0.923	P;B	0.46419	0.516;0.433	T	0.34700	-0.9818	10	0.44086	T	0.13	.	12.3031	0.54887	0.0:0.8604:0.0:0.1396	.	876;876	Q460N5-4;Q460N5	.;PAR14_HUMAN	D	876;795	ENSP00000418194:H876D	ENSP00000381228:H795D	H	+	1	0	PARP14	123902717	0.000000	0.05858	0.001000	0.08648	0.051000	0.14879	-0.061000	0.11693	0.878000	0.35920	-0.150000	0.13652	CAC	-	HMMPfam_Macro,HMMSmart_SM00506,superfamily_Macro domain-like		0.592	PARP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARP14	protein_coding	OTTHUMT00000356173.2	C	NM_017554		123902717	+1	no_errors	NM_017554.2	genbank	human	validated	54_36p	missense	SNP	0.002	G
SCARA3	51435	genome.wustl.edu	37	8	27516940	27516940	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2828-03C-01W-0761-09	TCGA-AB-2828-11B-01W-0728-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	10851212-f1e2-4d19-a72c-e5b76befbf4e	c216d8ed-38df-4961-96a7-0e8a9184a17d	g.chr8:27516940G>A	ENST00000301904.3	+	5	1273	c.1253G>A	c.(1252-1254)aGc>aAc	p.S418N	SCARA3_ENST00000337221.4_Missense_Mutation_p.S418N	NM_016240.2	NP_057324.2	Q6AZY7	SCAR3_HUMAN	scavenger receptor class A, member 3	418					receptor-mediated endocytosis (GO:0006898)|response to oxidative stress (GO:0006979)|UV protection (GO:0009650)	collagen trimer (GO:0005581)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)			breast(1)|large_intestine(3)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	9		Ovarian(32;2.61e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0219)|Colorectal(74;0.148)		GAGCGCTTCAGCCTGCTCAGT	0.587																																						dbGAP											0			8											59.0	46.0	50.0					8																	27516940		2203	4300	6503	27572859	SO:0001583	missense	0			AB007829	CCDS34870.1, CCDS34871.1	8p21	2010-03-24			ENSG00000168077	ENSG00000168077			19000	protein-coding gene	gene with protein product	"""macrophage scavenger receptor-like 1"""	602728				9747040, 9580669	Standard	NM_182826		Approved	CSR1, CSR, MSLR1, APC7, MSRL1	uc003xga.1	Q6AZY7	OTTHUMG00000163898	ENST00000301904.3:c.1253G>A	8.37:g.27516940G>A	ENSP00000301904:p.Ser418Asn	Somatic	61	3.17	2		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	27572859	104	47.24	94	Q9UM15|Q9UM16	Missense_Mutation	SNP	HMMPfam_Collagen	p.S418N	ENST00000301904.3	37	c.1253	CCDS34871.1	8	.	.	.	.	.	.	.	.	.	.	G	13.25	2.182190	0.38511	.	.	ENSG00000168077	ENST00000337221;ENST00000301904	T;D	0.91351	2.51;-2.83	5.83	5.83	0.93111	.	0.454794	0.27876	N	0.017492	D	0.84848	0.5563	N	0.24115	0.695	0.30853	N	0.734341	B;B	0.23735	0.066;0.09	B;B	0.24006	0.05;0.02	T	0.77935	-0.2401	10	0.22706	T	0.39	-11.1613	17.6277	0.88097	0.0:0.0:1.0:0.0	.	418;418	Q6AZY7-2;Q6AZY7	.;SCAR3_HUMAN	N	418	ENSP00000337985:S418N;ENSP00000301904:S418N	ENSP00000301904:S418N	S	+	2	0	SCARA3	27572859	0.978000	0.34361	0.991000	0.47740	0.987000	0.75469	5.110000	0.64622	2.770000	0.95276	0.655000	0.94253	AGC	-	NULL		0.587	SCARA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCARA3	protein_coding	OTTHUMT00000376258.2	G	NM_016240		27572859	+1	no_errors	NM_016240.2	genbank	human	reviewed	54_36p	missense	SNP	0.997	A
MCM10	55388	genome.wustl.edu	37	10	13234451	13234451	+	Splice_Site	SNP	G	G	A			TCGA-AB-2828-03C-01W-0761-09	TCGA-AB-2828-11B-01W-0728-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	10851212-f1e2-4d19-a72c-e5b76befbf4e	c216d8ed-38df-4961-96a7-0e8a9184a17d	g.chr10:13234451G>A	ENST00000484800.2	+	13	1734	c.1631G>A	c.(1630-1632)gGg>gAg	p.G544E	MCM10_ENST00000378694.1_Splice_Site_p.G543E|MCM10_ENST00000378714.3_Splice_Site_p.G543E			Q7L590	MCM10_HUMAN	minichromosome maintenance complex component 10	544					cell proliferation (GO:0008283)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)			central_nervous_system(1)|large_intestine(4)|ovary(2)|skin(1)|stomach(1)	9						TCTGTTTCAGGGATTATGGGG	0.557																																						dbGAP											0			10											92.0	89.0	90.0					10																	13234451		2203	4300	6503	13274457	SO:0001630	splice_region_variant	0			AB042719	CCDS7095.1, CCDS7096.1	10p13	2008-08-01	2007-04-04		ENSG00000065328	ENSG00000065328			18043	protein-coding gene	gene with protein product		609357	"""MCM10 minichromosome maintenance deficient 10 (S. cerevisiae)"""			11095689, 17699597	Standard	NM_018518		Approved	PRO2249, CNA43, DNA43	uc001ima.3	Q7L590	OTTHUMG00000017694	ENST00000484800.2:c.1631-1G>A	10.37:g.13234451G>A		Somatic	64	7.25	5		12	51.85	14	WXS	Illumina HiSeq	Phase_IV	13274457	82	39.86	55	A8K9I6|B7ZKZ8|Q3MIR3|Q7LD55|Q96GX4|Q96NB6|Q9H0D7|Q9H3P9|Q9P177	Missense_Mutation	SNP	HMMPfam_zf-primase,HMMPfam_Mcm10	p.G544E	ENST00000484800.2	37	c.1631	CCDS7096.1	10	.	.	.	.	.	.	.	.	.	.	G	6.227	0.409939	0.11812	.	.	ENSG00000065328	ENST00000378714;ENST00000361282;ENST00000484800;ENST00000378694	T;T;T	0.30981	1.51;1.51;1.51	5.24	4.31	0.51392	Replication factor Mcm10 (1);	0.206543	0.49305	D	0.000154	T	0.23766	0.0575	L	0.51422	1.61	0.36667	D	0.878254	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.12156	0.007;0.004;0.007	T	0.15925	-1.0420	9	.	.	.	.	5.0334	0.14421	0.1274:0.0:0.6695:0.2031	.	543;543;544	Q5T670;Q7L590-2;Q7L590	.;.;MCM10_HUMAN	E	543;544;544;543	ENSP00000367986:G543E;ENSP00000418268:G544E;ENSP00000367966:G543E	.	G	+	2	0	MCM10	13274457	0.974000	0.33945	0.260000	0.24451	0.043000	0.13939	1.790000	0.38734	1.160000	0.42584	0.643000	0.83706	GGG	-	HMMPfam_Mcm10		0.557	MCM10-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MCM10	protein_coding	OTTHUMT00000356853.1	G	NM_182751	Missense_Mutation	13274457	+1	no_errors	NM_182751.3	genbank	human	reviewed	54_36p	missense	SNP	0.733	A
ASUN	55726	genome.wustl.edu	37	12	27066475	27066475	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AB-2828-03C-01W-0761-09	TCGA-AB-2828-11B-01W-0728-08	C	C	C	A	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	10851212-f1e2-4d19-a72c-e5b76befbf4e	c216d8ed-38df-4961-96a7-0e8a9184a17d	g.chr12:27066475C>A	ENST00000261191.7	-	14	2256	c.1720G>T	c.(1720-1722)Gga>Tga	p.G574*	ASUN_ENST00000539625.1_Nonsense_Mutation_p.G473*	NM_018164.2	NP_060634.2	Q9NVM9	ASUN_HUMAN	asunder spermatogenesis regulator	574					centrosome localization (GO:0051642)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|protein localization to nuclear envelope (GO:0090435)|regulation of fertilization (GO:0080154)|regulation of mitotic cell cycle (GO:0007346)|sperm motility (GO:0030317)	cytoplasm (GO:0005737)|nucleus (GO:0005634)											CTCTTTCTTCCTCGTTTCTTT	0.453																																						dbGAP											0			12											386.0	358.0	367.0					12																	27066475		2203	4300	6503	26957742	SO:0001587	stop_gained	0			AK001222	CCDS8708.1	12p12.3	2013-05-08	2013-05-08	2011-12-09	ENSG00000064102	ENSG00000064102			20174	protein-coding gene	gene with protein product	"""spermatogenesis associated 30"""	615079	"""chromosome 12 open reading frame 11"", ""asunder, spermatogenesis regulator homolog (Drosphila)"""	C12orf11		12414650, 19357193, 23097494	Standard	NM_018164		Approved	FLJ10637, NET48, Mat89Bb, SPATA30	uc001rhk.4	Q9NVM9	OTTHUMG00000169193	ENST00000261191.7:c.1720G>T	12.37:g.27066475C>A	ENSP00000261191:p.Gly574*	Somatic	128	3.03	4		23	30.30	10	WXS	Illumina HiSeq	Phase_IV	26957742	132	45.53	112	B4DNK1|Q86WE2|Q96HM2|Q9BTX2|Q9NTB6|Q9NVM5	Nonsense_Mutation	SNP	HMMPfam_DUF2151	p.G574*	ENST00000261191.7	37	c.1720	CCDS8708.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	29.4|29.4	5.000427|5.000427	0.93227|0.93227	.|.	.|.	ENSG00000064102|ENSG00000064102	ENST00000261190|ENST00000538155;ENST00000261191;ENST00000539625;ENST00000335745	.|.	.|.	.|.	5.07|5.07	5.07|5.07	0.68467|0.68467	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|.	0.72867|.	0.3514|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.72330|.	-0.4326|.	4|.	0.33141|0.39692	T|T	0.24|0.17	-20.088|-20.088	17.5062|17.5062	0.87746|0.87746	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	D|X	70|221;574;473;161	.|.	ENSP00000261190:E70D|ENSP00000261191:G574X	E|G	-|-	3|1	2|0	C12orf11|C12orf11	26957742|26957742	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	5.745000|5.745000	0.68672|0.68672	2.727000|2.727000	0.93392|0.93392	0.591000|0.591000	0.81541|0.81541	GAG|GGA	-	HMMPfam_DUF2151		0.453	ASUN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf11	protein_coding	OTTHUMT00000402819.1	C	NM_018164		26957742	-1	no_errors	NM_018164.2	genbank	human	validated	54_36p	nonsense	SNP	1.000	A
KRT2	3849	genome.wustl.edu	37	12	53045804	53045804	+	Silent	SNP	G	G	A			TCGA-AB-2828-03C-01W-0761-09	TCGA-AB-2828-11B-01W-0728-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	10851212-f1e2-4d19-a72c-e5b76befbf4e	c216d8ed-38df-4961-96a7-0e8a9184a17d	g.chr12:53045804G>A	ENST00000309680.3	-	1	144	c.123C>T	c.(121-123)tcC>tcT	p.S41S		NM_000423.2	NP_000414.2	P35908	K22E_HUMAN	keratin 2	41	Head.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte activation (GO:0032980)|keratinocyte migration (GO:0051546)|keratinocyte proliferation (GO:0043616)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(18)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	32				BRCA - Breast invasive adenocarcinoma(357;0.19)		GGCTCAAGCAGGAGAAGCTGG	0.607																																						dbGAP											0			12											38.0	41.0	40.0					12																	53045804		2203	4300	6503	51332071	SO:0001819	synonymous_variant	0				CCDS8835.1	12q13.13	2013-01-16	2008-08-01	2006-07-17	ENSG00000172867	ENSG00000172867		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6439	protein-coding gene	gene with protein product	"""epidermal ichthyosis bullosa of Siemens"""	600194	"""keratin 2A (epidermal ichthyosis bullosa of Siemens)"""	KRT2A		7524919, 16831889	Standard	NM_000423		Approved	KRTE	uc001sat.3	P35908	OTTHUMG00000169748	ENST00000309680.3:c.123C>T	12.37:g.53045804G>A		Somatic	23	4.17	1		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	51332071	38	43.28	29	Q4VAQ2	Silent	SNP	HMMPfam_Filament,PatternScan_IF	p.S41	ENST00000309680.3	37	c.123	CCDS8835.1	12																																																																																			-	NULL		0.607	KRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT2	protein_coding	OTTHUMT00000405704.1	G	NM_000423		51332071	-1	no_errors	NM_000423.2	genbank	human	reviewed	54_36p	silent	SNP	1.000	A
SECISBP2L	9728	genome.wustl.edu	37	15	49301512	49301512	+	Missense_Mutation	SNP	C	C	T			TCGA-AB-2828-03C-01W-0761-09	TCGA-AB-2828-11B-01W-0728-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	10851212-f1e2-4d19-a72c-e5b76befbf4e	c216d8ed-38df-4961-96a7-0e8a9184a17d	g.chr15:49301512C>T	ENST00000559471.1	-	14	2191	c.1928G>A	c.(1927-1929)tGt>tAt	p.C643Y	SECISBP2L_ENST00000261847.3_Missense_Mutation_p.C598Y	NM_001193489.1	NP_001180418.1	Q93073	SBP2L_HUMAN	SECIS binding protein 2-like	643							poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(5)|kidney(8)|large_intestine(12)|lung(11)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|urinary_tract(1)	46						AGGTGTCATACAGTATGGAGA	0.433																																						dbGAP											0			15											174.0	156.0	162.0					15																	49301512		2197	4295	6492	47088804	SO:0001583	missense	0			BC033001	CCDS32234.1, CCDS53942.1	15q21.1	2014-02-12				ENSG00000138593			28997	protein-coding gene	gene with protein product		615756					Standard	NM_001193489		Approved	KIAA0256	uc001zxe.2	Q93073		ENST00000559471.1:c.1928G>A	15.37:g.49301512C>T	ENSP00000453854:p.Cys643Tyr	Somatic	178	4.30	8		18	51.35	19	WXS	Illumina HiSeq	Phase_IV	47088804	178	47.95	164	Q8N767	Missense_Mutation	SNP	HMMPfam_Ribosomal_L7Ae,superfamily_SSF55315	p.C598Y	ENST00000559471.1	37	c.1793	CCDS53942.1	15	.	.	.	.	.	.	.	.	.	.	C	25.0	4.592337	0.86953	.	.	ENSG00000138593	ENST00000261847;ENST00000380927	T	0.72725	-0.68	4.98	4.98	0.66077	.	0.044570	0.85682	D	0.000000	T	0.77075	0.4077	L	0.59436	1.845	0.58432	D	0.999993	D;D	0.65815	0.991;0.995	P;P	0.61201	0.687;0.885	T	0.70784	-0.4778	10	0.02654	T	1	.	18.7888	0.91965	0.0:1.0:0.0:0.0	.	643;598	Q93073;Q93073-2	SBP2L_HUMAN;.	Y	598;643	ENSP00000261847:C598Y	ENSP00000261847:C598Y	C	-	2	0	SECISBP2L	47088804	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.069000	0.76755	2.757000	0.94681	0.655000	0.94253	TGT	-	NULL		0.433	SECISBP2L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SECISBP2L	protein_coding	OTTHUMT00000417277.1	C	NM_014701		47088804	-1	no_errors	NM_014701.2	genbank	human	provisional	54_36p	missense	SNP	1.000	T
MBD3L3	653657	genome.wustl.edu	37	19	7058587	7058587	+	Silent	SNP	C	C	T			TCGA-AB-2828-03C-01W-0761-09	TCGA-AB-2828-11B-01W-0728-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	10851212-f1e2-4d19-a72c-e5b76befbf4e	c216d8ed-38df-4961-96a7-0e8a9184a17d	g.chr19:7058587C>T	ENST00000333843.4	-	1	64	c.30G>A	c.(28-30)ccG>ccA	p.P10P		NM_001164425.1	NP_001157897.1	A6NE82	MB3L3_HUMAN	methyl-CpG binding domain protein 3-like 3	10					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)					central_nervous_system(1)|lung(5)|stomach(1)	7						CAGGTGGGCTCGGAAAAGAGG	0.483																																						dbGAP											0			19											9.0	12.0	11.0					19																	7058587		168	483	651	7009587	SO:0001819	synonymous_variant	0				CCDS45944.1	19p13.2	2014-04-01			ENSG00000182315	ENSG00000182315			37205	protein-coding gene	gene with protein product							Standard	NM_001164425		Approved		uc021uns.1	A6NE82	OTTHUMG00000181976	ENST00000333843.4:c.30G>A	19.37:g.7058587C>T		Somatic	17	0.00	0		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	7009587	11	35.29	6		Silent	SNP	NULL	p.P10	ENST00000333843.4	37	c.30	CCDS45944.1	19																																																																																			-	NULL		0.483	MBD3L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC653657	protein_coding	OTTHUMT00000458500.1	C	NM_001164425		7009587	-1	no_errors	XM_928697.3	genbank	human	model	54_36p	silent	SNP	0.004	T
SYNE4	163183	genome.wustl.edu	37	19	36497458	36497458	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2828-03C-01W-0761-09	TCGA-AB-2828-11B-01W-0728-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	10851212-f1e2-4d19-a72c-e5b76befbf4e	c216d8ed-38df-4961-96a7-0e8a9184a17d	g.chr19:36497458G>A	ENST00000324444.3	-	5	845	c.734C>T	c.(733-735)aCa>aTa	p.T245I	SYNE4_ENST00000340477.5_Missense_Mutation_p.T132I|ALKBH6_ENST00000495116.2_5'Flank|AC002116.8_ENST00000473572.2_RNA	NM_001039876.1	NP_001034965.1	Q8N205	SYNE4_HUMAN	spectrin repeat containing, nuclear envelope family member 4	245					establishment of epithelial cell apical/basal polarity (GO:0045198)	integral component of nuclear outer membrane (GO:0031309)											CTCCAACTCTGTGGAAGTGGG	0.657																																						dbGAP											0			19											13.0	15.0	14.0					19																	36497458		1842	4079	5921	41189298	SO:0001583	missense	0			BC038360	CCDS42553.1	19q13.12	2014-01-28	2012-05-31	2012-05-31	ENSG00000181392	ENSG00000181392			26703	protein-coding gene	gene with protein product		615535	"""chromosome 19 open reading frame 46"", ""deafness, autosomal recessive 76"""	C19orf46, DFNB76		23348741	Standard	XM_005258597		Approved	FLJ36445, Nesprin-4, Nesp4	uc002ocq.1	Q8N205	OTTHUMG00000048135	ENST00000324444.3:c.734C>T	19.37:g.36497458G>A	ENSP00000316130:p.Thr245Ile	Somatic	68	4.23	3		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	41189298	41	36.92	24	A8MRS0|A8MYE3|Q7Z7L3	Missense_Mutation	SNP	HMMPfam_KASH	p.T245I	ENST00000324444.3	37	c.734	CCDS42553.1	19	.	.	.	.	.	.	.	.	.	.	G	12.25	1.881777	0.33255	.	.	ENSG00000181392	ENST00000340477;ENST00000324444	T;T	0.32272	1.46;1.62	5.74	1.49	0.22878	.	0.686003	0.15273	N	0.271124	T	0.12774	0.0310	N	0.08118	0	0.21553	N	0.999647	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.0	T	0.13098	-1.0522	10	0.38643	T	0.18	-24.7888	3.9479	0.09356	0.1862:0.0:0.5506:0.2632	.	132;245	Q8N205-2;Q8N205	.;SYNE4_HUMAN	I	132;245	ENSP00000343152:T132I;ENSP00000316130:T245I	ENSP00000316130:T245I	T	-	2	0	C19orf46	41189298	0.984000	0.35163	0.999000	0.59377	0.453000	0.32348	1.720000	0.38022	1.442000	0.47568	0.655000	0.94253	ACA	-	NULL		0.657	SYNE4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C19orf46	protein_coding	OTTHUMT00000109525.3	G	NM_001039876		41189298	-1	no_errors	NM_001039876.1	genbank	human	validated	54_36p	missense	SNP	0.973	A
FCGBP	8857	genome.wustl.edu	37	19	40376946	40376946	+	Missense_Mutation	SNP	G	G	A	rs139112212		TCGA-AB-2828-03C-01W-0761-09	TCGA-AB-2828-11B-01W-0728-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	10851212-f1e2-4d19-a72c-e5b76befbf4e	c216d8ed-38df-4961-96a7-0e8a9184a17d	g.chr19:40376946G>A	ENST00000221347.6	-	24	11483	c.11476C>T	c.(11476-11478)Ccc>Tcc	p.P3826S	FCGBP_ENST00000595713.1_5'UTR	NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	3826	VWFD 9. {ECO:0000255|PROSITE- ProRule:PRU00580}.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			GGAGAGTCGGGCACCACCTCC	0.642																																						dbGAP											0			19											10.0	12.0	11.0					19																	40376946		2089	4140	6229	45068786	SO:0001583	missense	0			D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.11476C>T	19.37:g.40376946G>A	ENSP00000221347:p.Pro3826Ser	Somatic	23	0.00	0		3	25.00	1	WXS	Illumina HiSeq	Phase_IV	45068786	29	9.38	3	O95784	Missense_Mutation	SNP	HMMSmart_VWC,HMMPfam_VWD,HMMSmart_VWD,superfamily_Cysrich_TIL,HMMPfam_TIL_assoc,HMMSmart_FOLN,HMMPfam_C8,HMMPfam_TIL	p.P3826S	ENST00000221347.6	37	c.11476	CCDS12546.1	19	.	.	.	.	.	.	.	.	.	.	g	14.59	2.581579	0.46006	.	.	ENSG00000090920	ENST00000221347	T	0.19532	2.14	3.23	2.14	0.27477	von Willebrand factor, type D domain (1);	.	.	.	.	T	0.21468	0.0517	M	0.66939	2.045	0.09310	N	1	B	0.30281	0.275	B	0.32465	0.146	T	0.28933	-1.0028	9	0.08179	T	0.78	.	11.3006	0.49302	0.0:0.1873:0.8127:0.0	.	3826	Q9Y6R7	FCGBP_HUMAN	S	3826	ENSP00000221347:P3826S	ENSP00000221347:P3826S	P	-	1	0	FCGBP	45068786	0.268000	0.24133	0.014000	0.15608	0.004000	0.04260	0.502000	0.22594	0.653000	0.30826	0.313000	0.20887	CCC	-	NULL		0.642	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCGBP	protein_coding	OTTHUMT00000462507.1	G	NM_003890		45068786	-1	no_errors	NM_003890.2	genbank	human	validated	54_36p	missense	SNP	0.554	A
