#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NormalRefReads_WU	i_NormalVAF_WU	i_NormalVarReads_WU	i_ORegAnno_bin	i_RNARefReads_WU	i_RNAVAF_WU	i_RNAVarReads_WU	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TumorRefReads_WU	i_TumorVAF_WU	i_TumorVarReads_WU	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
Unknown	0	genome.wustl.edu	37	X	89295110	89295110	+	IGR	SNP	C	C	G			TCGA-AB-2838-03A-01W-0726-08	TCGA-AB-2838-11A-01W-0727-08	C	C	C	G	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	5d0e7904-586a-4207-96aa-97c8daf3dd61	a9294e38-8585-47e2-b596-da4bb222433a	g.chrX:89295110C>G								TGIF2LX (117228 upstream) : RNU6-555P (557123 downstream)																							AGAGCAATTTCAAACACTAAG	0.373																																						dbGAP											0			X																																								89181766	SO:0001628	intergenic_variant	0																															X.37:g.89295110C>G		Somatic	77	0.00	0		7	0.00	0	WXS	Illumina HiSeq	Phase_IV	89181766	17	77.03	57		RNA	SNP	-	NULL		37	NULL		X																																																																																			-	-	0	0.373					LOC100130134			C			89181766	-1	pseudogene	XR_037810.1	genbank	human	model	54_36p	rna	SNP	1.000	G
PADI2	11240	genome.wustl.edu	37	1	17418973	17418973	+	Silent	SNP	G	G	A			TCGA-AB-2838-03A-01W-0726-08	TCGA-AB-2838-11A-01W-0727-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	5d0e7904-586a-4207-96aa-97c8daf3dd61	a9294e38-8585-47e2-b596-da4bb222433a	g.chr1:17418973G>A	ENST00000375486.4	-	6	648	c.585C>T	c.(583-585)ccC>ccT	p.P195P	PADI2_ENST00000444885.2_Intron|PADI2_ENST00000375481.1_Silent_p.P195P	NM_007365.2	NP_031391.2	Q9Y2J8	PADI2_HUMAN	peptidyl arginine deiminase, type II	195					chromatin-mediated maintenance of transcription (GO:0048096)|histone H3-R26 citrullination (GO:0036413)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of lymphocyte chemotaxis (GO:1901624)|protein citrullination (GO:0018101)|regulation of chromatin disassembly (GO:0010848)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|transcriptionally active chromatin (GO:0035327)	calcium ion binding (GO:0005509)|estrogen receptor binding (GO:0030331)|protein-arginine deiminase activity (GO:0004668)	p.P195Q(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(12)|ovary(4)|pancreas(1)|skin(5)|urinary_tract(3)	29		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000422)|Renal(390;0.000518)|all_lung(284;0.000546)|Ovarian(437;0.00671)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00583)|BRCA - Breast invasive adenocarcinoma(304;1.49e-05)|COAD - Colon adenocarcinoma(227;1.54e-05)|Kidney(64;0.000258)|KIRC - Kidney renal clear cell carcinoma(64;0.00348)|STAD - Stomach adenocarcinoma(196;0.0072)|READ - Rectum adenocarcinoma(331;0.0698)|Lung(427;0.201)	L-Citrulline(DB00155)	CGTATCCGGCGGGGAGGCGGT	0.537																																						dbGAP											1	Substitution - Missense(1)	lung(1)	1											92.0	83.0	86.0					1																	17418973		2203	4300	6503	17291560	SO:0001819	synonymous_variant	0			AB030176	CCDS177.1	1p35.2-p35.1	2008-02-05			ENSG00000117115	ENSG00000117115	3.5.3.15	"""Peptidyl arginine deiminases"""	18341	protein-coding gene	gene with protein product		607935				2768262	Standard	NM_007365		Approved	KIAA0994, PDI2	uc001baf.3	Q9Y2J8	OTTHUMG00000002295	ENST00000375486.4:c.585C>T	1.37:g.17418973G>A		Somatic	94	1.03	1		40	20.00	10	WXS	Illumina HiSeq	Phase_IV	17291560	47	37.33	28	Q96DA7|Q9UPN2	Silent	SNP	superfamily_Cupredoxin,HMMPfam_PAD,HMMPfam_PAD_N,HMMPfam_PAD_M,superfamily_PAD_central,superfamily_SSF55909	p.P195	ENST00000375486.4	37	c.585	CCDS177.1	1																																																																																			-	HMMPfam_PAD_M,superfamily_PAD_central		0.537	PADI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PADI2	protein_coding	OTTHUMT00000006624.1	G			17291560	-1	no_errors	NM_007365.2	genbank	human	reviewed	54_36p	silent	SNP	0.011	A
NRAS	4893	genome.wustl.edu	37	1	115256528	115256528	+	Missense_Mutation	SNP	T	T	A	rs121913255		TCGA-AB-2838-03A-01W-0726-08	TCGA-AB-2838-11A-01W-0727-08	T	T	T	A	T	T	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	5d0e7904-586a-4207-96aa-97c8daf3dd61	a9294e38-8585-47e2-b596-da4bb222433a	g.chr1:115256528T>A	ENST00000369535.4	-	3	436	c.183A>T	c.(181-183)caA>caT	p.Q61H		NM_002524.4	NP_002515.1	P01111	RASN_HUMAN	neuroblastoma RAS viral (v-ras) oncogene homolog	61			Q -> K (in CMNS and NCMS; somatic mutation). {ECO:0000269|PubMed:23392294}.|Q -> R (in CMNS, NCMS and KNEN; also found in lung carcinoma cell and melanoma; dbSNP:rs11554290). {ECO:0000269|PubMed:18633438, ECO:0000269|PubMed:22499344, ECO:0000269|PubMed:23392294, ECO:0000269|PubMed:3276402}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of skeletal muscle tissue development (GO:0048642)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|small GTPase mediated signal transduction (GO:0007264)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.Q61H(100)|p.Q61Q(3)|p.Q61L(3)|p.Q61R(2)|p.Q61K(1)|p.Q61_E62>HK(1)		NS(134)|adrenal_gland(9)|autonomic_ganglia(9)|biliary_tract(6)|bone(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(11)|eye(3)|haematopoietic_and_lymphoid_tissue(1115)|kidney(3)|large_intestine(105)|liver(10)|lung(42)|meninges(2)|ovary(7)|pancreas(5)|prostate(8)|skin(1144)|soft_tissue(37)|stomach(5)|testis(8)|thyroid(359)|upper_aerodigestive_tract(28)|urinary_tract(13)	3085	all_epithelial(7;5.11e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		TGTACTCTTCTTGTCCAGCTG	0.463	Q61H(ME1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61H(RD_SOFT_TISSUE)	50	Mis		"""melanoma, MM, AML, thyroid"""				Noonan syndrome	TSP Lung(23;0.16)|Multiple Myeloma(1;<1E-6)																												dbGAP		Dom	yes		1	1p13.2	4893	neuroblastoma RAS viral (v-ras) oncogene homolog		"""L, E"""	110	Substitution - Missense(106)|Substitution - coding silent(3)|Complex - compound substitution(1)	haematopoietic_and_lymphoid_tissue(48)|skin(43)|soft_tissue(8)|thyroid(6)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|NS(1)	1											180.0	156.0	164.0					1																	115256528		2203	4300	6503	115058051	SO:0001583	missense	0	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	BC005219	CCDS877.1	1p13.2	2014-09-17			ENSG00000213281	ENSG00000213281			7989	protein-coding gene	gene with protein product		164790					Standard	NM_002524		Approved	N-ras	uc009wgu.3	P01111	OTTHUMG00000012059	ENST00000369535.4:c.183A>T	1.37:g.115256528T>A	ENSP00000358548:p.Gln61His	Somatic	95	1.03	1		77	33.62	39	WXS	Illumina HiSeq	Phase_IV	115058051	77	26.85	29	Q14971|Q15104|Q15282	Missense_Mutation	SNP	HMMSmart_SM00173,HMMSmart_SM00174,HMMSmart_SM00175,HMMPfam_Ras,superfamily_P-loop containing nucleoside triphosphate hydrolases	p.Q61H	ENST00000369535.4	37	c.183	CCDS877.1	1	.	.	.	.	.	.	.	.	.	.	T	18.77	3.695276	0.68386	.	.	ENSG00000213281	ENST00000369535	D	0.84146	-1.81	5.08	3.93	0.45458	Small GTP-binding protein domain (1);	0.000000	0.53938	U	0.000043	D	0.87026	0.6075	H	0.94385	3.53	0.80722	D	1	B	0.30763	0.294	B	0.42087	0.375	D	0.89247	0.3588	10	0.72032	D	0.01	.	5.8174	0.18500	0.0:0.1721:0.0:0.8279	.	61	P01111	RASN_HUMAN	H	61	ENSP00000358548:Q61H	ENSP00000358548:Q61H	Q	-	3	2	NRAS	115058051	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.898000	0.28404	2.120000	0.65058	0.533000	0.62120	CAA	-	HMMSmart_SM00173,HMMSmart_SM00174,HMMSmart_SM00175,HMMPfam_Ras,superfamily_P-loop containing nucleoside triphosphate hydrolases		0.463	NRAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NRAS	protein_coding	OTTHUMT00000033395.2	T	NM_002524		115058051	-1	no_errors	NM_002524.3	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
PYGO2	90780	genome.wustl.edu	37	1	154931409	154931409	+	Missense_Mutation	SNP	C	C	G			TCGA-AB-2838-03A-01W-0726-08	TCGA-AB-2838-11A-01W-0727-08	C	C	C	G	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	5d0e7904-586a-4207-96aa-97c8daf3dd61	a9294e38-8585-47e2-b596-da4bb222433a	g.chr1:154931409C>G	ENST00000368457.2	-	3	1238	c.1067G>C	c.(1066-1068)cGt>cCt	p.R356P	RP11-307C12.12_ENST00000605085.1_RNA|PBXIP1_ENST00000542459.1_5'Flank|PBXIP1_ENST00000368465.1_5'Flank|PBXIP1_ENST00000368463.3_5'Flank|PYGO2_ENST00000368456.1_Missense_Mutation_p.R319P|PYGO2_ENST00000483463.1_5'Flank|PBXIP1_ENST00000539880.1_5'Flank|PBXIP1_ENST00000368460.3_5'Flank	NM_138300.3	NP_612157.1	Q9BRQ0	PYGO2_HUMAN	pygopus family PHD finger 2	356					brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|developmental growth (GO:0048589)|in utero embryonic development (GO:0001701)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|mammary gland development (GO:0030879)|palate development (GO:0060021)|positive regulation of chromatin binding (GO:0035563)|post-embryonic development (GO:0009791)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of mammary gland epithelial cell proliferation (GO:0033599)|spermatid nucleus differentiation (GO:0007289)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone acetyltransferase regulator activity (GO:0035034)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|lung(3)|skin(2)|urinary_tract(1)	10	all_epithelial(22;4.9e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			TGTGCACTCACGGTGGAACCA	0.592																																					NSCLC(87;357 1460 1955 21029 23522)	dbGAP											0			1											86.0	67.0	74.0					1																	154931409		2203	4300	6503	153198033	SO:0001583	missense	0			BC006132	CCDS1075.1	1q22	2013-10-09	2013-10-09		ENSG00000163348	ENSG00000163348		"""Zinc fingers, PHD-type"""	30257	protein-coding gene	gene with protein product		606903	"""pygopus homolog 2 (Drosophila)"""			11988739	Standard	NM_138300		Approved		uc001fft.3	Q9BRQ0	OTTHUMG00000037370	ENST00000368457.2:c.1067G>C	1.37:g.154931409C>G	ENSP00000357442:p.Arg356Pro	Somatic	93	0.00	0		28	46.15	24	WXS	Illumina HiSeq	Phase_IV	153198033	25	55.36	31	Q8WYZ4|Q96CY2	Missense_Mutation	SNP	HMMSmart_SM00249,superfamily_FYVE/PHD zinc finger,PatternScan_ZF_PHD_1,HMMPfam_PHD	p.R356P	ENST00000368457.2	37	c.1067	CCDS1075.1	1	.	.	.	.	.	.	.	.	.	.	C	15.84	2.950575	0.53186	.	.	ENSG00000163348	ENST00000368457;ENST00000368456	T;T	0.62788	-0.0;-0.0	5.26	4.36	0.52297	Zinc finger, PHD-finger (2);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, PHD-type, conserved site (1);Zinc finger, PHD-type (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.64402	D	0.000001	T	0.59715	0.2214	L	0.31526	0.94	0.58432	D	0.999996	D	0.67145	0.996	D	0.78314	0.991	T	0.67428	-0.5673	10	0.87932	D	0	-8.1881	12.8858	0.58042	0.0:0.9209:0.0:0.0791	.	356	Q9BRQ0	PYGO2_HUMAN	P	356;319	ENSP00000357442:R356P;ENSP00000357441:R319P	ENSP00000357441:R319P	R	-	2	0	PYGO2	153198033	1.000000	0.71417	0.886000	0.34754	0.528000	0.34623	7.651000	0.83577	1.458000	0.47871	-0.136000	0.14681	CGT	-	HMMSmart_SM00249,superfamily_FYVE/PHD zinc finger,PatternScan_ZF_PHD_1,HMMPfam_PHD		0.592	PYGO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PYGO2	protein_coding	OTTHUMT00000090949.1	C	NM_138300		153198033	-1	no_errors	NM_138300.3	genbank	human	validated	54_36p	missense	SNP	0.995	G
SHC1	6464	genome.wustl.edu	37	1	154938214	154938214	+	Silent	SNP	C	C	G	rs61751623	byFrequency	TCGA-AB-2838-03A-01W-0726-08	TCGA-AB-2838-11A-01W-0727-08	C	C	C	G	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	5d0e7904-586a-4207-96aa-97c8daf3dd61	a9294e38-8585-47e2-b596-da4bb222433a	g.chr1:154938214C>G	ENST00000368445.5	-	11	1642	c.1428G>C	c.(1426-1428)tcG>tcC	p.S476S	SHC1_ENST00000368449.4_Silent_p.S247S|SHC1_ENST00000490667.1_5'UTR|SHC1_ENST00000368450.1_Silent_p.S366S|PYGO2_ENST00000483463.1_5'Flank|SHC1_ENST00000448116.2_Silent_p.S477S|SHC1_ENST00000606391.1_Silent_p.S277S|SHC1_ENST00000368453.4_Silent_p.S367S	NM_183001.4	NP_892113.4	P29353	SHC1_HUMAN	SHC (Src homology 2 domain containing) transforming protein 1	476	CH1.				actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|activation of signaling protein activity involved in unfolded protein response (GO:0006987)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet activation (GO:0030168)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|Ras protein signal transduction (GO:0007265)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of growth (GO:0040008)|single organismal cell-cell adhesion (GO:0016337)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|Shc-EGFR complex (GO:0070435)	ephrin receptor binding (GO:0046875)|epidermal growth factor receptor binding (GO:0005154)|insulin receptor binding (GO:0005158)|insulin-like growth factor receptor binding (GO:0005159)|neurotrophin TRKA receptor binding (GO:0005168)|phospholipid binding (GO:0005543)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)			breast(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(8)|prostate(1)|skin(1)	20	all_epithelial(22;4.9e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			CCATGGACACCGACTGGGGAG	0.627													C|||	71	0.0141773	0.0	0.0259	5008	,	,		18964	0.003		0.0368	False		,,,				2504	0.0133				NSCLC(4;32 234 1864 2492 3259 13747 17376)	dbGAP											0			1						C	,,,,	38,4368	40.0+/-72.8	0,38,2165	33.0	35.0	34.0		1431,1098,963,1101,1428	-9.5	0.0	1	dbSNP_129	34	374,8226	113.9+/-173.9	6,362,3932	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	SHC1	NM_001130040.1,NM_001130041.1,NM_001202859.1,NM_003029.4,NM_183001.4	,,,,	6,400,6097	GG,GC,CC		4.3488,0.8625,3.1678	,,,,	477/585,366/474,321/429,367/475,476/584	154938214	412,12594	2203	4300	6503	153204838	SO:0001819	synonymous_variant	0			U73377	CCDS1076.1, CCDS30881.1, CCDS44233.1, CCDS44234.1	1q21	2013-02-14	2002-01-14		ENSG00000160691	ENSG00000160691		"""SH2 domain containing"""	10840	protein-coding gene	gene with protein product		600560	"""SHC (Src homology 2 domain-containing) transforming protein 1"""	SHC		1623525	Standard	NM_003029		Approved	p66	uc001ffw.3	P29353	OTTHUMG00000037295	ENST00000368445.5:c.1428G>C	1.37:g.154938214C>G		Somatic	854	5.65	52		22	55.10	27	WXS	Illumina HiSeq	Phase_IV	153204838	42	44.74	34	B5BU19|D3DV78|O15290|Q5T180|Q5T183|Q5T184|Q5T185|Q5T186|Q8N4K5|Q96CL1	Silent	SNP	HMMPfam_SH2,HMMSmart_SM00252,HMMPfam_PID,HMMSmart_SM00462,superfamily_PH domain-like,superfamily_SH2 domain	p.S476	ENST00000368445.5	37	c.1428	CCDS30881.1	1	30	0.013736263736263736	0	0.0	5	0.013812154696132596	1	0.0017482517482517483	24	0.0316622691292876	C	0.055	-1.238169	0.01493	0.008625	0.043488	ENSG00000160691	ENST00000444664	.	.	.	4.76	-9.53	0.00575	.	.	.	.	.	T	0.11452	0.0279	.	.	.	0.09310	N	0.999996	.	.	.	.	.	.	T	0.20605	-1.0270	4	.	.	.	.	11.9871	0.53153	0.0707:0.6974:0.0846:0.1473	rs61751623	.	.	.	R	140	.	.	G	-	1	0	SHC1	153204838	0.000000	0.05858	0.000000	0.03702	0.203000	0.24098	-2.097000	0.01348	-3.406000	0.00170	-2.729000	0.00130	GGT	-	superfamily_SH2 domain		0.627	SHC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SHC1	protein_coding	OTTHUMT00000090781.2	C	NM_183001		153204838	-1	no_errors	NM_183001.1	genbank	human	validated	54_36p	silent	SNP	0.000	G
ARHGEF11	9826	genome.wustl.edu	37	1	156954161	156954161	+	Missense_Mutation	SNP	G	G	A	rs143441387		TCGA-AB-2838-03A-01W-0726-08	TCGA-AB-2838-11A-01W-0727-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	5d0e7904-586a-4207-96aa-97c8daf3dd61	a9294e38-8585-47e2-b596-da4bb222433a	g.chr1:156954161G>A	ENST00000361409.2	-	3	935	c.193C>T	c.(193-195)Cgc>Tgc	p.R65C	RN7SL612P_ENST00000497704.2_RNA|ARHGEF11_ENST00000368194.3_Missense_Mutation_p.R65C	NM_014784.3	NP_055599.1	O15085	ARHGB_HUMAN	Rho guanine nucleotide exchange factor (GEF) 11	65	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|cellular component movement (GO:0006928)|cytokinesis (GO:0000910)|establishment of cell polarity (GO:0030010)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell growth (GO:0001558)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)|striated muscle contraction (GO:0006941)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(27)|ovary(4)|pancreas(2)|pleura(1)|prostate(4)|skin(7)|stomach(1)|urinary_tract(2)	81	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					AGAACAATGCGATCCCCACTG	0.552													G|||	1	0.000199681	0.0008	0.0	5008	,	,		20487	0.0		0.0	False		,,,				2504	0.0					dbGAP											0			1						G	CYS/ARG,CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	150.0	84.0	106.0		193,193	4.2	0.4	1	dbSNP_134	106	0,8596		0,0,4298	yes	missense,missense	ARHGEF11	NM_014784.2,NM_198236.1	180,180	0,1,6500	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging	65/1523,65/1563	156954161	1,13001	2203	4298	6501	155220785	SO:0001583	missense	0			AB002378	CCDS1162.1, CCDS1163.1	1q21	2011-11-16			ENSG00000132694	ENSG00000132694		"""Rho guanine nucleotide exchange factors"""	14580	protein-coding gene	gene with protein product		605708				10526156, 9205841	Standard	NM_014784		Approved	KIAA0380, GTRAP48, PDZ-RHOGEF	uc001fqn.3	O15085	OTTHUMG00000041292	ENST00000361409.2:c.193C>T	1.37:g.156954161G>A	ENSP00000354644:p.Arg65Cys	Somatic	160	0.00	0		5	44.44	4	WXS	Illumina HiSeq	Phase_IV	155220785	76	28.97	31	D3DVD0|Q5VY40|Q6PFW2	Missense_Mutation	SNP	HMMPfam_RhoGEF,HMMSmart_RhoGEF,superfamily_DH-domain,HMMSmart_RGS,HMMPfam_PDZ,HMMSmart_PDZ,superfamily_PDZ,HMMSmart_PH,HMMPfam_RGS-like,superfamily_Regulat_G_prot_signal_superfam,superfamily_SSF50729	p.R65C	ENST00000361409.2	37	c.193	CCDS1162.1	1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	21.4	4.139628	0.77775	2.27E-4	0.0	ENSG00000132694	ENST00000368194;ENST00000361409	T;T	0.28069	1.63;1.63	5.08	4.16	0.48862	PDZ/DHR/GLGF (4);	0.000000	0.56097	D	0.000024	T	0.35393	0.0930	L	0.41492	1.28	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.997	T	0.28808	-1.0032	10	0.72032	D	0.01	-16.2905	13.8542	0.63515	0.0:0.0:0.8459:0.1541	.	65;65	O15085;O15085-2	ARHGB_HUMAN;.	C	65	ENSP00000357177:R65C;ENSP00000354644:R65C	ENSP00000354644:R65C	R	-	1	0	ARHGEF11	155220785	1.000000	0.71417	0.367000	0.25926	0.984000	0.73092	3.427000	0.52785	1.338000	0.45544	0.655000	0.94253	CGC	-	HMMPfam_PDZ,HMMSmart_PDZ,superfamily_PDZ		0.552	ARHGEF11-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ARHGEF11	protein_coding	OTTHUMT00000098931.1	G	NM_198236		155220785	-1	no_errors	NM_198236.2	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
BRINP3	339479	genome.wustl.edu	37	1	190068242	190068242	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2838-03A-01W-0726-08	TCGA-AB-2838-11A-01W-0727-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	5d0e7904-586a-4207-96aa-97c8daf3dd61	a9294e38-8585-47e2-b596-da4bb222433a	g.chr1:190068242G>A	ENST00000367462.3	-	8	1438	c.1207C>T	c.(1207-1209)Cgc>Tgc	p.R403C	BRINP3_ENST00000534846.1_Missense_Mutation_p.R301C	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3	403					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)											GACTGGATGCGAGTAAGCCAG	0.453																																						dbGAP											0			1											36.0	33.0	34.0					1																	190068242		2203	4300	6503	188334865	SO:0001583	missense	0			AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.1207C>T	1.37:g.190068242G>A	ENSP00000356432:p.Arg403Cys	Somatic	77	1.28	1		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	188334865	14	42.31	11	B3KVP1|B7Z260|O95726|Q2M330	Missense_Mutation	SNP	HMMPfam_MACPF,HMMSmart_SM00457	p.R403C	ENST00000367462.3	37	c.1207	CCDS1373.1	1	.	.	.	.	.	.	.	.	.	.	G	17.16	3.317456	0.60524	.	.	ENSG00000162670	ENST00000367462;ENST00000534846	T;T	0.56275	0.47;0.47	5.65	5.65	0.86999	.	0.172417	0.52532	D	0.000073	T	0.61874	0.2382	M	0.61703	1.905	0.54753	D	0.99998	D;D	0.67145	0.996;0.993	P;B	0.50754	0.649;0.446	T	0.65869	-0.6063	10	0.72032	D	0.01	.	17.2216	0.86959	0.0:0.0:1.0:0.0	.	301;403	B7Z260;Q76B58	.;FAM5C_HUMAN	C	403;301	ENSP00000356432:R403C;ENSP00000438022:R301C	ENSP00000356432:R403C	R	-	1	0	FAM5C	188334865	1.000000	0.71417	0.994000	0.49952	0.984000	0.73092	5.615000	0.67702	2.656000	0.90262	0.591000	0.81541	CGC	-	NULL		0.453	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM5C	protein_coding	OTTHUMT00000086278.1	G	NM_199051		188334865	-1	no_errors	NM_199051.1	genbank	human	provisional	54_36p	missense	SNP	0.986	A
BRINP3	339479	genome.wustl.edu	37	1	190250791	190250791	+	Missense_Mutation	SNP	C	C	T	rs144952455		TCGA-AB-2838-03A-01W-0726-08	TCGA-AB-2838-11A-01W-0727-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	5d0e7904-586a-4207-96aa-97c8daf3dd61	a9294e38-8585-47e2-b596-da4bb222433a	g.chr1:190250791C>T	ENST00000367462.3	-	3	557	c.326G>A	c.(325-327)cGc>cAc	p.R109H	RP11-547I7.1_ENST00000452178.1_RNA|BRINP3_ENST00000534846.1_Intron	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3	109	MACPF.				cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)		p.R109H(1)									TCTTATGTTGCGGAAGAATTC	0.448																																						dbGAP											1	Substitution - Missense(1)	lung(1)	1											88.0	83.0	85.0					1																	190250791		2203	4300	6503	188517414	SO:0001583	missense	0			AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.326G>A	1.37:g.190250791C>T	ENSP00000356432:p.Arg109His	Somatic	62	0.00	0		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	188517414	21	38.89	14	B3KVP1|B7Z260|O95726|Q2M330	Missense_Mutation	SNP	HMMPfam_MACPF,HMMSmart_SM00457	p.R109H	ENST00000367462.3	37	c.326	CCDS1373.1	1	.	.	.	.	.	.	.	.	.	.	C	24.6	4.544177	0.86022	.	.	ENSG00000162670	ENST00000367462	D	0.84589	-1.87	5.88	5.88	0.94601	Membrane attack complex component/perforin (MACPF) domain (2);	0.000000	0.85682	D	0.000000	T	0.77738	0.4175	N	0.20401	0.57	0.80722	D	1	B	0.21452	0.056	B	0.17433	0.018	T	0.72151	-0.4377	10	0.45353	T	0.12	-6.883	17.7103	0.88319	0.0:1.0:0.0:0.0	.	109	Q76B58	FAM5C_HUMAN	H	109	ENSP00000356432:R109H	ENSP00000356432:R109H	R	-	2	0	FAM5C	188517414	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.271000	0.51608	2.787000	0.95880	0.585000	0.79938	CGC	-	HMMPfam_MACPF,HMMSmart_SM00457		0.448	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM5C	protein_coding	OTTHUMT00000086278.1	C	NM_199051		188517414	-1	no_errors	NM_199051.1	genbank	human	provisional	54_36p	missense	SNP	1.000	T
KLHL18	23276	genome.wustl.edu	37	3	47385201	47385201	+	Missense_Mutation	SNP	T	T	C			TCGA-AB-2838-03A-01W-0726-08	TCGA-AB-2838-11A-01W-0727-08	T	T	T	C	T	T	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	5d0e7904-586a-4207-96aa-97c8daf3dd61	a9294e38-8585-47e2-b596-da4bb222433a	g.chr3:47385201T>C	ENST00000232766.5	+	10	1515	c.1495T>C	c.(1495-1497)Tct>Cct	p.S499P	KLHL18_ENST00000455924.2_Missense_Mutation_p.S387P	NM_025010.4	NP_079286.2	O94889	KLH18_HUMAN	kelch-like family member 18	499										endometrium(2)|kidney(1)|large_intestine(7)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	21		Acute lymphoblastic leukemia(5;0.164)		BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00645)|Kidney(197;0.00741)		GATGTACAGCTCTGTGGCAGA	0.652																																						dbGAP											0			3											87.0	86.0	86.0					3																	47385201		2203	4300	6503	47360205	SO:0001583	missense	0			AB018338	CCDS33749.1	3p21	2013-01-30	2013-01-30		ENSG00000114648	ENSG00000114648		"""Kelch-like"", ""BTB/POZ domain containing"""	29120	protein-coding gene	gene with protein product			"""kelch-like 18 (Drosophila)"""			9872452	Standard	NM_025010		Approved	KIAA0795, FLJ13703	uc003crd.3	O94889	OTTHUMG00000156522	ENST00000232766.5:c.1495T>C	3.37:g.47385201T>C	ENSP00000232766:p.Ser499Pro	Somatic	112	0.00	0		13	51.85	14	WXS	Illumina HiSeq	Phase_IV	47360205	67	42.24	49	A8K612|Q7Z3E8|Q8N125	Missense_Mutation	SNP	HMMSmart_SM00225,HMMPfam_Kelch_1,HMMSmart_SM00612,superfamily_Galactose oxidase central domain,superfamily_POZ domain,HMMPfam_BACK,HMMPfam_BTB	p.S499P	ENST00000232766.5	37	c.1495	CCDS33749.1	3	.	.	.	.	.	.	.	.	.	.	T	5.404	0.259640	0.10239	.	.	ENSG00000114648	ENST00000232766;ENST00000455924	T;T	0.73575	-0.76;-0.76	5.06	3.89	0.44902	Galactose oxidase, beta-propeller (1);	0.058300	0.64402	D	0.000001	T	0.39886	0.1095	N	0.01003	-1.06	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.45454	-0.9260	10	0.02654	T	1	.	11.376	0.49728	0.0:0.0:0.1519:0.8481	.	499	O94889	KLH18_HUMAN	P	499;387	ENSP00000232766:S499P;ENSP00000405585:S387P	ENSP00000232766:S499P	S	+	1	0	KLHL18	47360205	1.000000	0.71417	0.982000	0.44146	0.987000	0.75469	2.520000	0.45554	0.926000	0.37118	0.402000	0.26972	TCT	-	HMMPfam_Kelch_1,HMMSmart_SM00612,superfamily_Galactose oxidase central domain		0.652	KLHL18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL18	protein_coding	OTTHUMT00000344493.1	T	NM_025010		47360205	+1	no_errors	NM_025010.4	genbank	human	validated	54_36p	missense	SNP	1.000	C
PLXNB1	5364	genome.wustl.edu	37	3	48451927	48451927	+	Silent	SNP	G	G	A	rs200999356		TCGA-AB-2838-03A-01W-0726-08	TCGA-AB-2838-11A-01W-0727-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	5d0e7904-586a-4207-96aa-97c8daf3dd61	a9294e38-8585-47e2-b596-da4bb222433a	g.chr3:48451927G>A	ENST00000358536.4	-	30	5726	c.5457C>T	c.(5455-5457)gaC>gaT	p.D1819D	PLXNB1_ENST00000448774.2_Silent_p.D430D|PLXNB1_ENST00000296440.6_Silent_p.D1819D|PLXNB1_ENST00000358459.4_Silent_p.D1636D|PLXNB1_ENST00000456774.1_Silent_p.D1636D	NM_002673.4	NP_002664.2	O43157	PLXB1_HUMAN	plexin B1	1819					axon guidance (GO:0007411)|cell migration (GO:0016477)|intracellular signal transduction (GO:0035556)|negative regulation of cell adhesion (GO:0007162)|negative regulation of osteoblast proliferation (GO:0033689)|neuron projection morphogenesis (GO:0048812)|ossification involved in bone maturation (GO:0043931)|positive regulation of axonogenesis (GO:0050772)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of cytoskeleton organization (GO:0051493)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in bone trabecula morphogenesis (GO:1900220)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	GTPase activating protein binding (GO:0032794)|receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)|semaphorin receptor binding (GO:0030215)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(10)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	47				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		TGACATCCTCGTCAGAAAGAA	0.607													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18533	0.0		0.0	False		,,,				2504	0.0					dbGAP											0			3						G	,	2,4404	4.2+/-10.8	0,2,2201	85.0	83.0	84.0		5457,5457	-5.6	0.8	3		84	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	PLXNB1	NM_001130082.1,NM_002673.4	,	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	,	1819/2136,1819/2136	48451927	2,13004	2203	4300	6503	48426931	SO:0001819	synonymous_variant	0			X87904	CCDS2765.1	3p21.31	2008-07-18			ENSG00000164050	ENSG00000164050		"""Plexins"""	9103	protein-coding gene	gene with protein product		601053		PLXN5		8570614, 11035813	Standard	XM_005265234		Approved	SEP, KIAA0407	uc003csw.2	O43157	OTTHUMG00000133527	ENST00000358536.4:c.5457C>T	3.37:g.48451927G>A		Somatic	72	0.00	0		1	0.00	0	WXS	Illumina HiSeq	Phase_IV	48426931	16	40.74	11	A6H8Y2|Q6NY20|Q9UIV7|Q9UJ92|Q9UJ93	Silent	SNP	HMMPfam_Sema,HMMSmart_SM00630,superfamily_Sema domain,HMMPfam_PSI,PatternScan_LIPOCALIN,HMMPfam_TIG,HMMSmart_SM00429,PatternScan_IG_MHC,HMMSmart_SM00423,superfamily_GTPase activation domain GAP,HMMPfam_Plexin_cytopl,superfamily_E set domains,superfamily_Plexin repeat	p.D1819	ENST00000358536.4	37	c.5457	CCDS2765.1	3																																																																																			-	superfamily_GTPase activation domain GAP,HMMPfam_Plexin_cytopl		0.607	PLXNB1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PLXNB1	protein_coding	OTTHUMT00000344454.1	G	NM_002673		48426931	-1	no_errors	NM_002673.1	genbank	human	validated	54_36p	silent	SNP	0.995	A
FEZF2	55079	genome.wustl.edu	37	3	62356948	62356948	+	Missense_Mutation	SNP	T	T	A			TCGA-AB-2838-03A-01W-0726-08	TCGA-AB-2838-11A-01W-0727-08	T	T	T	A	T	T	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	5d0e7904-586a-4207-96aa-97c8daf3dd61	a9294e38-8585-47e2-b596-da4bb222433a	g.chr3:62356948T>A	ENST00000283268.3	-	4	1358	c.1064A>T	c.(1063-1065)cAc>cTc	p.H355L	FEZF2_ENST00000486811.1_Missense_Mutation_p.H355L|PTPRG-AS1_ENST00000490916.1_RNA|PTPRG-AS1_ENST00000495542.1_RNA|FEZF2_ENST00000475839.1_Missense_Mutation_p.H355L	NM_018008.3	NP_060478.3	Q8TBJ5	FEZF2_HUMAN	FEZ family zinc finger 2	355					axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|cerebral cortex GABAergic interneuron migration (GO:0021853)|dendrite development (GO:0016358)|dentate gyrus development (GO:0021542)|forebrain anterior/posterior pattern specification (GO:0021797)|locomotory behavior (GO:0007626)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(8)|lung(8)|skin(1)	20		Lung SC(41;0.0262)		BRCA - Breast invasive adenocarcinoma(55;0.000221)|KIRC - Kidney renal clear cell carcinoma(15;0.00834)|Kidney(15;0.00957)		GTAGCCCGCGTGGATGCGGAT	0.557																																					NSCLC(170;1772 2053 12525 15604 23984)	dbGAP											0			3											128.0	117.0	120.0					3																	62356948		2203	4300	6503	62331988	SO:0001583	missense	0			AF064845	CCDS2897.1	3p21.1	2013-01-08	2006-08-15	2006-08-15	ENSG00000153266	ENSG00000153266		"""Zinc fingers, C2H2-type"""	13506	protein-coding gene	gene with protein product		607414	"""zinc finger protein 312"""	ZNF312			Standard	NM_018008		Approved	FLJ10142, FKSG36, TOF, FEZL, Zfp312	uc003dli.2	Q8TBJ5	OTTHUMG00000158705	ENST00000283268.3:c.1064A>T	3.37:g.62356948T>A	ENSP00000283268:p.His355Leu	Somatic	98	0.00	0		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	62331988	52	38.82	33	A8K349|Q9BZ91|Q9NWB9	Missense_Mutation	SNP	HMMPfam_zf-C2H2,PatternScan_ZINC_FINGER_C2H2_1,HMMSmart_SM00355,superfamily_C2H2 and C2HC zinc fingers	p.H355L	ENST00000283268.3	37	c.1064	CCDS2897.1	3	.	.	.	.	.	.	.	.	.	.	T	18.72	3.683897	0.68157	.	.	ENSG00000153266	ENST00000486811;ENST00000283268;ENST00000475839	D;D;D	0.81908	-1.55;-1.55;-1.55	6.07	6.07	0.98685	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.94532	0.8239	H	0.97440	4.005	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	D	0.96283	0.9208	10	0.87932	D	0	-24.4704	16.635	0.85050	0.0:0.0:0.0:1.0	.	355	Q8TBJ5	FEZF2_HUMAN	L	355	ENSP00000418589:H355L;ENSP00000283268:H355L;ENSP00000418804:H355L	ENSP00000283268:H355L	H	-	2	0	FEZF2	62331988	1.000000	0.71417	1.000000	0.80357	0.342000	0.28953	8.040000	0.89188	2.330000	0.79161	0.477000	0.44152	CAC	-	HMMPfam_zf-C2H2,PatternScan_ZINC_FINGER_C2H2_1,HMMSmart_SM00355,superfamily_C2H2 and C2HC zinc fingers		0.557	FEZF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FEZF2	protein_coding	OTTHUMT00000351813.1	T	NM_018008		62331988	-1	no_errors	NM_018008.3	genbank	human	validated	54_36p	missense	SNP	1.000	A
C6orf211	79624	genome.wustl.edu	37	6	151775782	151775782	+	Silent	SNP	C	C	T			TCGA-AB-2838-03A-01W-0726-08	TCGA-AB-2838-11A-01W-0727-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	5d0e7904-586a-4207-96aa-97c8daf3dd61	a9294e38-8585-47e2-b596-da4bb222433a	g.chr6:151775782C>T	ENST00000367294.3	+	2	400	c.141C>T	c.(139-141)caC>caT	p.H47H	RMND1_ENST00000367303.4_5'Flank|C6orf211_ENST00000545879.1_Intron|C6orf211_ENST00000483931.1_3'UTR	NM_024573.1	NP_078849.1	Q9H993	CF211_HUMAN	chromosome 6 open reading frame 211	47										breast(1)|cervix(1)|endometrium(1)|large_intestine(5)|lung(7)	15			BRCA - Breast invasive adenocarcinoma(37;0.183)	OV - Ovarian serous cystadenocarcinoma(155;5.27e-11)		TTGAGAAACACGGAGAGGTAA	0.264																																						dbGAP											0			6											86.0	88.0	87.0					6																	151775782		2202	4296	6498	151817475	SO:0001819	synonymous_variant	0			AJ420548	CCDS5233.1, CCDS69224.1	6q25.1	2013-01-07			ENSG00000146476	ENSG00000146476			17872	protein-coding gene	gene with protein product							Standard	NM_001286562		Approved	FLJ12910	uc003qok.1	Q9H993	OTTHUMG00000015838	ENST00000367294.3:c.141C>T	6.37:g.151775782C>T		Somatic	87	0.00	0		8	46.67	7	WXS	Illumina HiSeq	Phase_IV	151817475	52	31.58	24	Q96FC6|Q9UFY5	Silent	SNP	HMMPfam_DUF89,superfamily_DUF89	p.H47	ENST00000367294.3	37	c.141	CCDS5233.1	6																																																																																			-	HMMPfam_DUF89,superfamily_DUF89		0.264	C6orf211-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C6orf211	protein_coding	OTTHUMT00000042724.1	C	NM_024573		151817475	+1	no_errors	NM_024573.1	genbank	human	predicted	54_36p	silent	SNP	1.000	T
CUL1	8454	genome.wustl.edu	37	7	148454181	148454181	+	Missense_Mutation	SNP	A	A	G			TCGA-AB-2838-03A-01W-0726-08	TCGA-AB-2838-11A-01W-0727-08	A	A	A	G	A	A	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	5d0e7904-586a-4207-96aa-97c8daf3dd61	a9294e38-8585-47e2-b596-da4bb222433a	g.chr7:148454181A>G	ENST00000325222.4	+	4	701	c.422A>G	c.(421-423)aAt>aGt	p.N141S	CUL1_ENST00000602748.1_Missense_Mutation_p.N141S|CUL1_ENST00000409469.1_Missense_Mutation_p.N141S	NM_003592.2	NP_003583.2	Q13616	CUL1_HUMAN	cullin 1	141					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway (GO:0097193)|mitotic cell cycle (GO:0000278)|negative regulation of cell proliferation (GO:0008285)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein monoubiquitination (GO:0006513)|protein ubiquitination (GO:0016567)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|viral process (GO:0016032)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|SCF ubiquitin ligase complex (GO:0019005)				breast(2)|central_nervous_system(2)|endometrium(1)|kidney(5)|large_intestine(10)|liver(2)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	40	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00291)			GCCTACCTCAATAGACATTGG	0.353																																						dbGAP											0			7											128.0	125.0	126.0					7																	148454181		2203	4300	6503	148085114	SO:0001583	missense	0			U58087	CCDS34772.1	7q36.1	2011-05-24			ENSG00000055130	ENSG00000055130			2551	protein-coding gene	gene with protein product		603134				8681378	Standard	NM_003592		Approved		uc003wey.3	Q13616	OTTHUMG00000152776	ENST00000325222.4:c.422A>G	7.37:g.148454181A>G	ENSP00000326804:p.Asn141Ser	Somatic	73	0.00	0		10	82.46	47	WXS	Illumina HiSeq	Phase_IV	148085114	17	71.67	43	D3DWG3|O60719|Q08AL6|Q8IYW1	Missense_Mutation	SNP	"HMMPfam_Cullin,PatternScan_CULLIN_1,HMMSmart_SM00182,superfamily_Cullin homology domain,superfamily_Cullin repeat,HMMPfam_Cullin_Nedd8,superfamily_""Winged helix"" DNA-binding domain"	p.N141S	ENST00000325222.4	37	c.422	CCDS34772.1	7	.	.	.	.	.	.	.	.	.	.	A	24.4	4.524425	0.85600	.	.	ENSG00000055130	ENST00000409469;ENST00000325222;ENST00000543583;ENST00000433865	T;T	0.79033	-1.23;-1.23	5.26	5.26	0.73747	Cullin, N-terminal (1);Cullin repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.87140	0.6103	M	0.93328	3.405	0.80722	D	1	D	0.53312	0.959	P	0.49853	0.624	D	0.90835	0.4719	10	0.87932	D	0	-17.2431	15.4723	0.75449	1.0:0.0:0.0:0.0	.	141	Q13616	CUL1_HUMAN	S	141;141;99;68	ENSP00000387160:N141S;ENSP00000326804:N141S	ENSP00000326804:N141S	N	+	2	0	CUL1	148085114	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	9.006000	0.93592	2.128000	0.65567	0.528000	0.53228	AAT	-	HMMPfam_Cullin,superfamily_Cullin repeat		0.353	CUL1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CUL1	protein_coding	OTTHUMT00000467785.1	A	NM_003592		148085114	+1	no_errors	NM_003592.2	genbank	human	validated	54_36p	missense	SNP	1.000	G
FAM83A	84985	genome.wustl.edu	37	8	124221776	124221776	+	3'UTR	SNP	G	G	T			TCGA-AB-2838-03A-01W-0726-08	TCGA-AB-2838-11A-01W-0727-08	G	G	G	T	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	5d0e7904-586a-4207-96aa-97c8daf3dd61	a9294e38-8585-47e2-b596-da4bb222433a	g.chr8:124221776G>T	ENST00000518448.1	+	0	5167				FAM83A_ENST00000276699.6_3'UTR|FAM83A_ENST00000522648.1_3'UTR			Q86UY5	FA83A_HUMAN	family with sequence similarity 83, member A											breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|ovary(3)|prostate(2)|skin(1)	17	Lung NSC(37;1.55e-09)|Ovarian(258;0.0205)		STAD - Stomach adenocarcinoma(47;0.00527)			TGACGGCTGAGATGAGGTTAG	0.438																																						dbGAP											0			8											68.0	56.0	60.0					8																	124221776		2203	4300	6503	124290957	SO:0001624	3_prime_UTR_variant	0			BC052300	CCDS6339.1, CCDS6340.1, CCDS75784.1	8q24.13	2014-03-13			ENSG00000147689	ENSG00000147689			28210	protein-coding gene	gene with protein product						22886303	Standard	XM_005251087		Approved	MGC14128, BJ-TSA-9	uc003ypx.3	Q86UY5	OTTHUMG00000165083	ENST00000518448.1:c.*1848G>T	8.37:g.124221776G>T		Somatic	141	0.00	0		9	0.00	0	WXS	Illumina HiSeq	Phase_IV	124290957	413	10.61	49	Q71HL2|Q8N7I1|Q96I47	3'UTR	SNP	-	NULL	ENST00000518448.1	37	c.*40	CCDS6340.1	8																																																																																			-	-		0.438	FAM83A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM83A	protein_coding	OTTHUMT00000381737.1	G	NM_032899		124290957	+1	no_errors	NM_207006.4	genbank	human	validated	54_36p	3_prime_untranslated_region	SNP	0.000	T
OGDHL	55753	genome.wustl.edu	37	10	50966567	50966567	+	Silent	SNP	G	G	A			TCGA-AB-2838-03A-01W-0726-08	TCGA-AB-2838-11A-01W-0727-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	5d0e7904-586a-4207-96aa-97c8daf3dd61	a9294e38-8585-47e2-b596-da4bb222433a	g.chr10:50966567G>A	ENST00000374103.4	-	2	157	c.72C>T	c.(70-72)gtC>gtT	p.V24V	OGDHL_ENST00000432695.1_Intron|OGDHL_ENST00000419399.1_Silent_p.V24V	NM_018245.2	NP_060715.2	Q9ULD0	OGDHL_HUMAN	oxoglutarate dehydrogenase-like	24					glycolytic process (GO:0006096)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)			central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|lung(30)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(1)	61						CAAACACCGGGACGTCATGTG	0.622																																						dbGAP											0			10											49.0	48.0	48.0					10																	50966567		2203	4300	6503	50636573	SO:0001819	synonymous_variant	0			AK001713	CCDS7234.1, CCDS44390.1, CCDS44391.1	10q11.23	2013-09-20			ENSG00000197444	ENSG00000197444			25590	protein-coding gene	gene with protein product						10574462	Standard	NM_018245		Approved	FLJ10851	uc001jie.3	Q9ULD0	OTTHUMG00000018200	ENST00000374103.4:c.72C>T	10.37:g.50966567G>A		Somatic	36	0.00	0		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	50636573	20	28.57	8	A8K2G1|B4DKG2|B4E193|Q8TAN9|Q9NVA0	Silent	SNP	HMMPfam_E1_dh,HMMPfam_Transket_pyr,superfamily_SSF52518	p.V24	ENST00000374103.4	37	c.72	CCDS7234.1	10																																																																																			-	NULL		0.622	OGDHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OGDHL	protein_coding	OTTHUMT00000048007.1	G	NM_018245		50636573	-1	no_errors	NM_018245.1	genbank	human	validated	54_36p	silent	SNP	0.001	A
PTPN5	84867	genome.wustl.edu	37	11	18762271	18762271	+	Missense_Mutation	SNP	T	T	C			TCGA-AB-2838-03A-01W-0726-08	TCGA-AB-2838-11A-01W-0727-08	T	T	T	C	T	T	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	5d0e7904-586a-4207-96aa-97c8daf3dd61	a9294e38-8585-47e2-b596-da4bb222433a	g.chr11:18762271T>C	ENST00000358540.2	-	8	1224	c.794A>G	c.(793-795)tAt>tGt	p.Y265C	PTPN5_ENST00000396170.1_Missense_Mutation_p.Y233C|RP11-1081L13.4_ENST00000527285.1_RNA|PTPN5_ENST00000396171.4_Missense_Mutation_p.Y265C|PTPN5_ENST00000496201.2_5'Flank|PTPN5_ENST00000396167.2_Missense_Mutation_p.Y233C|PTPN5_ENST00000477854.1_Missense_Mutation_p.Y69C|PTPN5_ENST00000396168.1_Missense_Mutation_p.Y241C	NM_006906.1	NP_008837.1	P54829	PTN5_HUMAN	protein tyrosine phosphatase, non-receptor type 5 (striatum-enriched)	265					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	phosphotyrosine binding (GO:0001784)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(13)|ovary(2)|prostate(1)|skin(4)	27						GGACATGAGATAGCCAAAGCC	0.607																																						dbGAP											0			11											64.0	55.0	58.0					11																	18762271		2199	4293	6492	18718847	SO:0001583	missense	0			BC064807	CCDS7845.1, CCDS41626.1, CCDS60746.1	11p15.1	2011-06-09			ENSG00000110786	ENSG00000110786		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9657	protein-coding gene	gene with protein product		176879				1714595	Standard	NM_001278236		Approved	STEP, PTPSTEP	uc001mpc.4	P54829	OTTHUMG00000134304	ENST00000358540.2:c.794A>G	11.37:g.18762271T>C	ENSP00000351342:p.Tyr265Cys	Somatic	139	0.00	0		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	18718847	87	26.89	32	B3KXG7|B7Z386|B7ZAF5|D3DQY7|Q6P1Z2|Q8N2A1|Q8NDP8	Missense_Mutation	SNP	HMMPfam_Y_phosphatase,HMMSmart_SM00194,HMMSmart_SM00404,PatternScan_TYR_PHOSPHATASE_1,superfamily_(Phosphotyrosine protein) phosphatases II	p.Y265C	ENST00000358540.2	37	c.794	CCDS7845.1	11	.	.	.	.	.	.	.	.	.	.	T	17.41	3.382523	0.61845	.	.	ENSG00000110786	ENST00000477854;ENST00000358540;ENST00000396170;ENST00000396171;ENST00000396167;ENST00000396168	T;T;T;T;T;T	0.03920	3.76;3.76;3.84;3.76;3.84;3.77	4.9	4.9	0.64082	.	0.265926	0.32386	N	0.006166	T	0.07052	0.0179	N	0.14661	0.345	0.37746	D	0.9258	B;D	0.76494	0.057;0.999	B;P	0.58820	0.052;0.846	T	0.45086	-0.9285	10	0.46703	T	0.11	.	9.1408	0.36903	0.0:0.0818:0.0:0.9182	.	265;233	P54829;B3KXG7	PTN5_HUMAN;.	C	69;265;233;265;233;241	ENSP00000435056:Y69C;ENSP00000351342:Y265C;ENSP00000379473:Y233C;ENSP00000379474:Y265C;ENSP00000379470:Y233C;ENSP00000379471:Y241C	ENSP00000351342:Y265C	Y	-	2	0	PTPN5	18718847	1.000000	0.71417	0.875000	0.34327	0.959000	0.62525	3.811000	0.55620	1.836000	0.53414	0.533000	0.62120	TAT	-	NULL		0.607	PTPN5-001	KNOWN	basic|CCDS	protein_coding	PTPN5	protein_coding	OTTHUMT00000259196.2	T	NM_001039970		18718847	-1	no_errors	NM_006906.1	genbank	human	validated	54_36p	missense	SNP	0.865	C
ANO2	57101	genome.wustl.edu	37	12	5672566	5672566	+	Missense_Mutation	SNP	C	C	A			TCGA-AB-2838-03A-01W-0726-08	TCGA-AB-2838-11A-01W-0727-08	C	C	C	A	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	5d0e7904-586a-4207-96aa-97c8daf3dd61	a9294e38-8585-47e2-b596-da4bb222433a	g.chr12:5672566C>A	ENST00000356134.5	-	27	2970	c.2899G>T	c.(2899-2901)Ggt>Tgt	p.G967C	ANO2_ENST00000546188.1_Missense_Mutation_p.G967C|ANO2_ENST00000327087.8_Missense_Mutation_p.G966C	NM_001278596.1	NP_001265525.1	Q9NQ90	ANO2_HUMAN	anoctamin 2, calcium activated chloride channel	971					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	chloride channel complex (GO:0034707)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)			central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(3)|upper_aerodigestive_tract(1)	58						CGATCCCCACCTCCTGGGCTC	0.557																																						dbGAP											0			12											28.0	30.0	29.0					12																	5672566		2025	4186	6211	5542827	SO:0001583	missense	0			AJ272204	CCDS44807.1, CCDS44807.2	12p13.3	2014-04-09	2014-04-09	2008-08-28		ENSG00000047617		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	1183	protein-coding gene	gene with protein product	"""transmembrane protein 16B (eight membrane-spanning domains)"""	610109	"""chromosome 12 open reading frame 3"", ""transmembrane protein 16B"", ""anoctamin 2"""	C12orf3, TMEM16B		12739008, 15067359, 24692353	Standard	NM_001278596		Approved		uc001qnm.2	Q9NQ90		ENST00000356134.5:c.2899G>T	12.37:g.5672566C>A	ENSP00000348453:p.Gly967Cys	Somatic	379	0.00	0		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	5542827	96	37.01	57	C4N787|Q9H847	Missense_Mutation	SNP	HMMPfam_DUF590	p.G967C	ENST00000356134.5	37	c.2899		12	.	.	.	.	.	.	.	.	.	.	C	12.03	1.816388	0.32145	.	.	ENSG00000047617	ENST00000327087;ENST00000356134;ENST00000546188;ENST00000541277;ENST00000543568	T;T;T	0.66460	-0.21;-0.21;-0.21	5.03	3.06	0.35304	.	0.284793	0.33110	N	0.005268	T	0.52008	0.1708	N	0.22421	0.69	0.09310	N	1	P	0.43885	0.82	P	0.46479	0.518	T	0.45920	-0.9228	10	0.59425	D	0.04	.	3.2523	0.06819	0.1913:0.5347:0.0:0.274	.	966	Q9NQ90-3	.	C	966;967;967;971;54	ENSP00000314048:G966C;ENSP00000348453:G967C;ENSP00000440981:G967C	ENSP00000314048:G966C	G	-	1	0	ANO2	5542827	0.000000	0.05858	0.002000	0.10522	0.003000	0.03518	-0.022000	0.12480	1.243000	0.43853	0.555000	0.69702	GGT	-	NULL		0.557	ANO2-001	KNOWN	basic	protein_coding	ANO2	protein_coding	OTTHUMT00000399019.4	C	NM_020373		5542827	-1	no_errors	NM_020373.2	genbank	human	validated	54_36p	missense	SNP	0.000	A
GUCY2C	2984	genome.wustl.edu	37	12	14798239	14798239	+	Missense_Mutation	SNP	T	T	A			TCGA-AB-2838-03A-01W-0726-08	TCGA-AB-2838-11A-01W-0727-08	T	T	T	A	T	T	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	5d0e7904-586a-4207-96aa-97c8daf3dd61	a9294e38-8585-47e2-b596-da4bb222433a	g.chr12:14798239T>A	ENST00000261170.3	-	16	1857	c.1721A>T	c.(1720-1722)aAt>aTt	p.N574I		NM_004963.3	NP_004954.2	P25092	GUC2C_HUMAN	guanylate cyclase 2C (heat stable enterotoxin receptor)	574	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of cell proliferation (GO:0042127)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|toxic substance binding (GO:0015643)			breast(3)|endometrium(7)|kidney(3)|large_intestine(9)|lung(17)|ovary(4)|skin(7)|urinary_tract(1)	51					Linaclotide(DB08890)	AATTGTGTCATTTAAAACTTC	0.338																																						dbGAP											0			12											93.0	93.0	93.0					12																	14798239		2203	4299	6502	14689506	SO:0001583	missense	0				CCDS8664.1	12p12	2008-08-18			ENSG00000070019	ENSG00000070019			4688	protein-coding gene	gene with protein product		601330		GUC2C		8661067	Standard	NM_004963		Approved	STAR	uc001rcd.3	P25092	OTTHUMG00000168732	ENST00000261170.3:c.1721A>T	12.37:g.14798239T>A	ENSP00000261170:p.Asn574Ile	Somatic	165	0.00	0		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	14689506	89	36.43	51	B2RMY6	Missense_Mutation	SNP	HMMPfam_Guanylate_cyc,HMMSmart_SM00044,superfamily_Adenylyl and guanylyl cyclase catalytic domain,HMMSmart_SM00219,HMMPfam_ANF_receptor,HMMSmart_SM00220,superfamily_Protein kinase-like (PK-like),HMMPfam_Pkinase,PatternScan_GUANYLATE_CYCLASE_1,superfamily_Periplasmic binding protein-like I	p.N574I	ENST00000261170.3	37	c.1721	CCDS8664.1	12	.	.	.	.	.	.	.	.	.	.	T	23.9	4.470452	0.84533	.	.	ENSG00000070019	ENST00000261170	D	0.82711	-1.64	5.27	5.27	0.74061	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.043544	0.85682	D	0.000000	D	0.86091	0.5850	L	0.31804	0.96	0.80722	D	1	D	0.71674	0.998	D	0.77004	0.989	D	0.87922	0.2704	10	0.72032	D	0.01	.	15.1833	0.72978	0.0:0.0:0.0:1.0	.	574	P25092	GUC2C_HUMAN	I	574	ENSP00000261170:N574I	ENSP00000261170:N574I	N	-	2	0	GUCY2C	14689506	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.225000	0.72271	2.000000	0.58554	0.533000	0.62120	AAT	-	HMMSmart_SM00219,HMMSmart_SM00220,superfamily_Protein kinase-like (PK-like),HMMPfam_Pkinase		0.338	GUCY2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GUCY2C	protein_coding	OTTHUMT00000400835.1	T			14689506	-1	no_errors	NM_004963.3	genbank	human	validated	54_36p	missense	SNP	1.000	A
RFC3	5983	genome.wustl.edu	37	13	34409285	34409285	+	Splice_Site	SNP	G	G	A			TCGA-AB-2838-03A-01W-0726-08	TCGA-AB-2838-11A-01W-0727-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	5d0e7904-586a-4207-96aa-97c8daf3dd61	a9294e38-8585-47e2-b596-da4bb222433a	g.chr13:34409285G>A	ENST00000380071.3	+	8	940	c.810G>A	c.(808-810)agG>agA	p.R270R	RFC3_ENST00000434425.1_Splice_Site_p.R270R	NM_002915.3	NP_002906.1	P40938	RFC3_HUMAN	replication factor C (activator 1) 3, 38kDa	270					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA synthesis involved in DNA repair (GO:0000731)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|response to organophosphorus (GO:0046683)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	DNA replication factor C complex (GO:0005663)|nucleoplasm (GO:0005654)	DNA clamp loader activity (GO:0003689)			lung(2)|skin(1)	3		Hepatocellular(188;0.0191)|Lung SC(185;0.0548)		all cancers(112;5.09e-06)|Epithelial(112;6.52e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00107)|OV - Ovarian serous cystadenocarcinoma(117;0.0285)|GBM - Glioblastoma multiforme(144;0.123)		TTTTATGTAGGCTCCTTGAAG	0.323																																						dbGAP											0			13											85.0	84.0	84.0					13																	34409285		2203	4299	6502	33307285	SO:0001630	splice_region_variant	0				CCDS9352.1, CCDS45025.1	13q13.2	2010-04-21	2002-08-29		ENSG00000133119	ENSG00000133119		"""ATPases / AAA-type"""	9971	protein-coding gene	gene with protein product	"""RFC, 38 kD subunit"", ""A1 38 kDa subunit"""	600405	"""replication factor C (activator 1) 3 (38kD)"""			7774928	Standard	NM_002915		Approved	RFC38, MGC5276	uc001uuz.3	P40938	OTTHUMG00000016715	ENST00000380071.3:c.810-1G>A	13.37:g.34409285G>A		Somatic	35	0.00	0		14	44.00	11	WXS	Illumina HiSeq	Phase_IV	33307285	33	38.89	21	C9JU95|O15252|Q5W0E8	Silent	SNP	HMMSmart_SM00382,superfamily_DNA polymerase III clamp loader subunits C-terminal domain,HMMPfam_RFC-E_C,superfamily_P-loop containing nucleoside triphosphate hydrolases	p.R270	ENST00000380071.3	37	c.810	CCDS9352.1	13																																																																																			-	superfamily_DNA polymerase III clamp loader subunits C-terminal domain,HMMPfam_RFC-E_C		0.323	RFC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RFC3	protein_coding	OTTHUMT00000044450.2	G	NM_002915	Silent	33307285	+1	no_errors	NM_002915.3	genbank	human	reviewed	54_36p	silent	SNP	0.995	A
TBC1D21	161514	genome.wustl.edu	37	15	74177406	74177406	+	Missense_Mutation	SNP	G	G	C	rs146169837		TCGA-AB-2838-03A-01W-0726-08	TCGA-AB-2838-11A-01W-0727-08	G	G	G	C	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	5d0e7904-586a-4207-96aa-97c8daf3dd61	a9294e38-8585-47e2-b596-da4bb222433a	g.chr15:74177406G>C	ENST00000300504.2	+	6	624	c.541G>C	c.(541-543)Gag>Cag	p.E181Q	TBC1D21_ENST00000535547.2_Missense_Mutation_p.E145Q|TBC1D21_ENST00000562056.1_Missense_Mutation_p.E144Q	NM_153356.1	NP_699187.1	Q8IYX1	TBC21_HUMAN	TBC1 domain family, member 21	181	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.					acrosomal vesicle (GO:0001669)|extracellular vesicular exosome (GO:0070062)	Rab GTPase activator activity (GO:0005097)			breast(1)|endometrium(2)|large_intestine(2)|lung(6)|ovary(3)|skin(1)|stomach(1)|urinary_tract(1)	17						GCACGACCACGAGACCTTCTG	0.602																																						dbGAP											0			15											116.0	107.0	110.0					15																	74177406		2198	4297	6495	71964459	SO:0001583	missense	0			BC033516	CCDS10252.1, CCDS66822.1	15q24	2013-07-09			ENSG00000167139	ENSG00000167139			28536	protein-coding gene	gene with protein product	"""male germ cell-specific expressed, containing a RabGAP domain"""					21128978	Standard	XR_243080		Approved	MGC34741, MgcRabGAP	uc002avz.3	Q8IYX1	OTTHUMG00000137594	ENST00000300504.2:c.541G>C	15.37:g.74177406G>C	ENSP00000300504:p.Glu181Gln	Somatic	164	1.78	3		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	71964459	75	36.97	44	B9A6M2	Missense_Mutation	SNP	HMMSmart_TBC,superfamily_RabGAP_TBC	p.E181Q	ENST00000300504.2	37	c.541	CCDS10252.1	15	.	.	.	.	.	.	.	.	.	.	G	19.87	3.906646	0.72868	.	.	ENSG00000167139	ENST00000300504;ENST00000535547	T;T	0.04317	3.65;3.65	5.01	5.01	0.66863	Rab-GAP/TBC domain (4);	0.000000	0.56097	D	0.000030	T	0.12561	0.0305	L	0.29908	0.895	0.37031	D	0.89669	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.997	T	0.07271	-1.0781	10	0.66056	D	0.02	.	13.8246	0.63343	0.0:0.0:1.0:0.0	.	145;181	B9A6M2;Q8IYX1	.;TBC21_HUMAN	Q	181;145	ENSP00000300504:E181Q;ENSP00000439325:E145Q	ENSP00000300504:E181Q	E	+	1	0	TBC1D21	71964459	1.000000	0.71417	0.990000	0.47175	0.857000	0.48899	5.024000	0.64090	2.329000	0.79093	0.561000	0.74099	GAG	-	HMMSmart_TBC,superfamily_RabGAP_TBC		0.602	TBC1D21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D21	protein_coding	OTTHUMT00000268994.1	G	NM_153356		71964459	+1	no_errors	NM_153356.1	genbank	human	provisional	54_36p	missense	SNP	1.000	C
CLEC18B	497190	genome.wustl.edu	37	16	74444758	74444758	+	Intron	SNP	T	T	C	rs200267855	byFrequency	TCGA-AB-2838-03A-01W-0726-08	TCGA-AB-2838-11A-01W-0727-08	T	T	T	C	T	T	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	5d0e7904-586a-4207-96aa-97c8daf3dd61	a9294e38-8585-47e2-b596-da4bb222433a	g.chr16:74444758T>C	ENST00000339953.5	-	9	1236					NM_001011880.2	NP_001011880.2	Q6UXF7	CL18B_HUMAN	C-type lectin domain family 18, member B							extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)			endometrium(3)|kidney(9)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27						GGGTGGGGCATCACAACCCCT	0.627																																						dbGAP											0			16											1.0	1.0	1.0					16																	74444758		338	930	1268	73002259	SO:0001627	intron_variant	0			AY358373	CCDS32484.1	16q22.3	2010-04-27	2009-03-10	2009-03-10		ENSG00000140839		"""C-type lectin domain containing"""	33849	protein-coding gene	gene with protein product							Standard	NM_001011880		Approved		uc002fct.3	Q6UXF7		ENST00000339953.5:c.1114+44A>G	16.37:g.74444758T>C		Somatic	18	10.00	2		0	100.00	1	WXS	Illumina HiSeq	Phase_IV	73002259	2	80.00	8	B4DF90	Missense_Mutation	SNP	HMMPfam_Lectin_C,superfamily_C-type lectin-like,PatternScan_C_TYPE_LECTIN_1	p.D6G	ENST00000339953.5	37	c.17	CCDS32484.1	16																																																																																			-	NULL		0.627	CLEC18B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLEC18B	protein_coding	OTTHUMT00000434697.1	T	NM_001011880		73002259	-1	no_start_codon	ENST00000268492	ensembl	human	known	54_36p	missense	SNP	0.000	C
TP53	7157	genome.wustl.edu	37	17	7579312	7579312	+	Splice_Site	SNP	C	C	T	rs55863639		TCGA-AB-2838-03A-01W-0726-08	TCGA-AB-2838-11A-01W-0727-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	5d0e7904-586a-4207-96aa-97c8daf3dd61	a9294e38-8585-47e2-b596-da4bb222433a	g.chr17:7579312C>T	ENST00000269305.4	-	4	564	c.375G>A	c.(373-375)acG>acA	p.T125T	TP53_ENST00000455263.2_Splice_Site_p.T125T|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Splice_Site_p.T125T|TP53_ENST00000445888.2_Splice_Site_p.T125T|TP53_ENST00000420246.2_Splice_Site_p.T125T|TP53_ENST00000359597.4_Splice_Site_p.T125T	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	125	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		T -> A (in a sporadic cancer; somatic mutation).|T -> K (in sporadic cancers; somatic mutation).|T -> M (in sporadic cancers; somatic mutation).|T -> P (in a sporadic cancer; somatic mutation).|T -> R (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.T125T(51)|p.0?(8)|p.?(2)|p.V73fs*9(1)|p.G105_T125del21(1)|p.Y126fs*11(1)|p.P13fs*18(1)|p.T125_Y126insX(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGCAACTGACCGTGCAAGTCA	0.537		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	66	Substitution - coding silent(51)|Whole gene deletion(8)|Deletion - Frameshift(3)|Unknown(2)|Deletion - In frame(1)|Insertion - In frame(1)	lung(21)|haematopoietic_and_lymphoid_tissue(14)|large_intestine(8)|upper_aerodigestive_tract(7)|bone(4)|central_nervous_system(3)|biliary_tract(3)|stomach(1)|liver(1)|urinary_tract(1)|kidney(1)|ovary(1)|pancreas(1)	17	GRCh37	CS004351|CS011573|CS971913	TP53	S	rs55863639						66.0	61.0	63.0					17																	7579312		2203	4300	6503	7520037	SO:0001630	splice_region_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.375+1G>A	17.37:g.7579312C>T		Somatic	283	0.00	0		4	91.30	42	WXS	Illumina HiSeq	Phase_IV	7520037	42	60.00	63	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Silent	SNP	PatternScan_P53,superfamily_p53-like transcription factors,HMMPfam_P53_tetramer,superfamily_p53 tetramerization domain,HMMPfam_P53,HMMPfam_P53_TAD	p.T125	ENST00000269305.4	37	c.375	CCDS11118.1	17																																																																																			-	superfamily_p53-like transcription factors,HMMPfam_P53		0.537	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	C	NM_000546	Silent	7520037	-1	no_errors	NM_000546.4	genbank	human	reviewed	54_36p	silent	SNP	1.000	T
KIF2B	84643	genome.wustl.edu	37	17	51900534	51900534	+	Missense_Mutation	SNP	C	C	T			TCGA-AB-2838-03A-01W-0726-08	TCGA-AB-2838-11A-01W-0727-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	5d0e7904-586a-4207-96aa-97c8daf3dd61	a9294e38-8585-47e2-b596-da4bb222433a	g.chr17:51900534C>T	ENST00000268919.4	+	1	296	c.140C>T	c.(139-141)aCg>aTg	p.T47M		NM_032559.4	NP_115948.4	Q8N4N8	KIF2B_HUMAN	kinesin family member 2B	47					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of chromosome segregation (GO:0051983)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(15)|lung(58)|ovary(5)|prostate(4)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						GCTGTGGTCACGGAGATCAAC	0.522																																						dbGAP											0			17											151.0	124.0	133.0					17																	51900534		2203	4300	6503	49255533	SO:0001583	missense	0			AF333335	CCDS32685.1	17q22	2014-08-12			ENSG00000141200	ENSG00000141200		"""Kinesins"""	29443	protein-coding gene	gene with protein product		615142				11416179	Standard	NM_032559		Approved		uc002iua.2	Q8N4N8	OTTHUMG00000177756	ENST00000268919.4:c.140C>T	17.37:g.51900534C>T	ENSP00000268919:p.Thr47Met	Somatic	86	0.00	0		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	49255533	36	47.06	32	Q96MA2|Q9BXG6	Missense_Mutation	SNP	HMMPfam_Kinesin,HMMSmart_SM00129,PatternScan_KINESIN_MOTOR_DOMAIN1,superfamily_P-loop containing nucleoside triphosphate hydrolases	p.T47M	ENST00000268919.4	37	c.140	CCDS32685.1	17	.	.	.	.	.	.	.	.	.	.	C	14.39	2.520837	0.44866	.	.	ENSG00000141200	ENST00000268919	T	0.75938	-0.98	4.83	4.83	0.62350	.	0.152084	0.30151	N	0.010283	T	0.81054	0.4743	L	0.46819	1.47	0.37751	D	0.925965	D	0.89917	1.0	D	0.66084	0.941	D	0.83820	0.0246	10	0.62326	D	0.03	.	15.1152	0.72394	0.0:1.0:0.0:0.0	.	47	Q8N4N8	KIF2B_HUMAN	M	47	ENSP00000268919:T47M	ENSP00000268919:T47M	T	+	2	0	KIF2B	49255533	0.996000	0.38824	0.986000	0.45419	0.662000	0.39071	3.544000	0.53640	2.644000	0.89710	0.563000	0.77884	ACG	-	NULL		0.522	KIF2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF2B	protein_coding	OTTHUMT00000438854.1	C	NM_032559		49255533	+1	no_errors	NM_032559.4	genbank	human	validated	54_36p	missense	SNP	0.977	T
PDE4A	5141	genome.wustl.edu	37	19	10528494	10528494	+	5'Flank	SNP	G	G	T			TCGA-AB-2838-03A-01W-0726-08	TCGA-AB-2838-11A-01W-0727-08	G	G	G	T	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	5d0e7904-586a-4207-96aa-97c8daf3dd61	a9294e38-8585-47e2-b596-da4bb222433a	g.chr19:10528494G>T	ENST00000352831.6	+	0	0				PDE4A_ENST00000592685.1_Silent_p.P69P|PDE4A_ENST00000380702.2_Silent_p.P69P	NM_001111307.1	NP_001104777.1	P27815	PDE4A_HUMAN	phosphodiesterase 4A, cAMP-specific						cAMP catabolic process (GO:0006198)|cellular response to drug (GO:0035690)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of protein kinase A signaling (GO:0010738)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)	cell projection (GO:0042995)|cytosol (GO:0005829)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|cAMP binding (GO:0030552)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	27			OV - Ovarian serous cystadenocarcinoma(20;5.8e-10)|Epithelial(33;7.58e-07)|all cancers(31;3.91e-06)		Caffeine(DB00201)|Dipyridamole(DB00975)|Drotaverine(DB06751)|Dyphylline(DB00651)|Enprofylline(DB00824)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Oxtriphylline(DB01303)|Pentoxifylline(DB00806)|Roflumilast(DB01656)|Theophylline(DB00277)|Tofisopam(DB08811)	CCACCCTGCCGCTGCTGATCC	0.706											OREG0025236	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0			19											8.0	7.0	7.0					19																	10528494		865	1976	2841	10389494	SO:0001631	upstream_gene_variant	0				CCDS12238.1, CCDS45961.1, CCDS45962.1, CCDS45963.1, CCDS58649.1	19p13.2	2010-06-24	2010-06-24			ENSG00000065989	3.1.4.17	"""Phosphodiesterases"""	8780	protein-coding gene	gene with protein product	"""phosphodiesterase E2 dunce homolog (Drosophila)"""	600126	"""phosphodiesterase 4A, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E2)"""	DPDE2		8009369	Standard	NM_006202		Approved		uc002moj.2	P27815			19.37:g.10528494G>T	Exception_encountered	Somatic	76	0.00	0	665	NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	10389494	32	33.33	16	O75522|O76092|Q16255|Q16691|Q5DM53|Q6PMT2|Q8IVA7|Q8WUQ3|Q9H3H2	Silent	SNP	HMMPfam_PDEase_I,PatternScan_PDEASE_I,HMMSmart_HDc,superfamily_SSF109604	p.P69	ENST00000352831.6	37	c.207	CCDS45961.1	19																																																																																			-	NULL		0.706	PDE4A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PDE4A	protein_coding	OTTHUMT00000451244.1	G			10389494	+1	no_errors	ENST00000380702	ensembl	human	known	54_36p	silent	SNP	0.941	T
