#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NormalRefReads_WU	i_NormalVAF_WU	i_NormalVarReads_WU	i_ORegAnno_bin	i_RNARefReads_WU	i_RNAVAF_WU	i_RNAVarReads_WU	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TumorRefReads_WU	i_TumorVAF_WU	i_TumorVarReads_WU	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
ETV3	2117	genome.wustl.edu	37	1	157105311	157105311	+	Missense_Mutation	SNP	C	C	T			TCGA-AB-2874-03A-01W-0732-08	TCGA-AB-2874-11A-01W-0732-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	0f1fb2e2-2463-4e1d-af0b-069bc0144e88	69a5771e-80a6-4c0e-af50-c10f51c985f6	g.chr1:157105311C>T	ENST00000368192.4	-	3	300	c.236G>A	c.(235-237)aGg>aAg	p.R79K	ETV3_ENST00000326786.4_Missense_Mutation_p.R79K|ETV3_ENST00000460850.1_5'UTR	NM_001145312.1	NP_001138784.1	P41162	ETV3_HUMAN	ets variant 3	79					cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|prostate(2)	9	Hepatocellular(266;0.158)	Prostate(1639;0.174)				TTTGCATTTCCTGCGGCCCCA	0.527																																						dbGAP											0			1											48.0	51.0	50.0					1																	157105311		2203	4297	6500	155371935	SO:0001583	missense	0			BC022868	CCDS1164.1, CCDS44250.1	1q21-q23	2008-09-12	2008-09-12		ENSG00000117036	ENSG00000117036			3492	protein-coding gene	gene with protein product		164873	"""ets variant gene 3, ETS family transcriptional repressor"", ""ets variant gene 3"""			8020980	Standard	NM_005240		Approved	PE-1	uc001fqr.2	P41162	OTTHUMG00000034298	ENST00000368192.4:c.236G>A	1.37:g.157105311C>T	ENSP00000357175:p.Arg79Lys	Somatic	317	4.23	14		6	50.00	6	WXS	Illumina HiSeq	Phase_IV	155371935	177	41.16	128	B4E3M7|Q8TAC8|Q9BX30	Missense_Mutation	SNP	HMMPfam_Ets,HMMSmart_ETS,PatternScan_ETS_DOMAIN_1,PatternScan_ETS_DOMAIN_2,superfamily_SSF46785	p.R79K	ENST00000368192.4	37	c.236	CCDS44250.1	1	.	.	.	.	.	.	.	.	.	.	C	34	5.361769	0.95877	.	.	ENSG00000117036	ENST00000368192;ENST00000326786	T;T	0.23348	1.91;1.91	5.62	5.62	0.85841	Winged helix-turn-helix transcription repressor DNA-binding (1);Ets (4);	0.000000	0.64402	D	0.000001	T	0.41811	0.1175	L	0.58583	1.82	0.80722	D	1	D;D	0.69078	0.979;0.997	P;D	0.74348	0.907;0.983	T	0.27640	-1.0068	10	0.87932	D	0	.	18.4165	0.90572	0.0:1.0:0.0:0.0	.	79;79	P41162-2;P41162	.;ETV3_HUMAN	K	79	ENSP00000357175:R79K;ENSP00000327316:R79K	ENSP00000327316:R79K	R	-	2	0	ETV3	155371935	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.768000	0.85345	2.647000	0.89833	0.655000	0.94253	AGG	-	HMMPfam_Ets,HMMSmart_ETS,superfamily_SSF46785		0.527	ETV3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ETV3	protein_coding	OTTHUMT00000082843.2	C	NM_005240		155371935	-1	no_errors	NM_005240.1	genbank	human	validated	54_36p	missense	SNP	1.000	T
GREM2	64388	genome.wustl.edu	37	1	240656704	240656704	+	Missense_Mutation	SNP	G	G	T			TCGA-AB-2874-03A-01W-0732-08	TCGA-AB-2874-11A-01W-0732-08	G	G	G	T	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	0f1fb2e2-2463-4e1d-af0b-069bc0144e88	69a5771e-80a6-4c0e-af50-c10f51c985f6	g.chr1:240656704G>T	ENST00000318160.4	-	2	338	c.72C>A	c.(70-72)aaC>aaA	p.N24K		NM_022469.3	NP_071914.3	Q9H772	GREM2_HUMAN	gremlin 2, DAN family BMP antagonist	24					BMP signaling pathway (GO:0030509)|cytokine-mediated signaling pathway (GO:0019221)|determination of dorsal identity (GO:0048263)|embryonic body morphogenesis (GO:0010172)|regulation of cytokine activity (GO:0060300)|sequestering of BMP from receptor via BMP binding (GO:0038098)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	heparin binding (GO:0008201)			endometrium(1)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	10		all_cancers(173;0.0196)	OV - Ovarian serous cystadenocarcinoma(106;0.0123)			CCGCCGGCCGGTTCTTCCGGG	0.627																																						dbGAP											0			1											12.0	14.0	14.0					1																	240656704		2150	4235	6385	238723327	SO:0001583	missense	0			AK024848	CCDS31070.1	1q43	2013-02-26	2013-02-26		ENSG00000180875	ENSG00000180875			17655	protein-coding gene	gene with protein product	"""protein related to DAN and cerberus"""	608832	"""gremlin 2, cysteine knot superfamily, homolog (Xenopus laevis)"", ""gremlin 2"""			15039429	Standard	XM_005273226		Approved	Prdc, FLJ21195, CKTSF1B2, DAND3	uc001hys.3	Q9H772	OTTHUMG00000039909	ENST00000318160.4:c.72C>A	1.37:g.240656704G>T	ENSP00000318650:p.Asn24Lys	Somatic	47	2.08	1		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	238723327	66	37.38	40	Q86UD9	Missense_Mutation	SNP	HMMPfam_DAN,HMMSmart_CT	p.N24K	ENST00000318160.4	37	c.72	CCDS31070.1	1	.	.	.	.	.	.	.	.	.	.	G	10.82	1.457709	0.26161	.	.	ENSG00000180875	ENST00000318160	T	0.30714	1.52	5.15	1.22	0.21188	.	0.366976	0.26915	U	0.021859	T	0.16769	0.0403	L	0.33485	1.01	0.50467	D	0.999878	B	0.11235	0.004	B	0.10450	0.005	T	0.25882	-1.0119	10	0.02654	T	1	1.3134	8.1646	0.31220	0.3902:0.0:0.6098:0.0	.	24	Q9H772	GREM2_HUMAN	K	24	ENSP00000318650:N24K	ENSP00000318650:N24K	N	-	3	2	GREM2	238723327	1.000000	0.71417	0.874000	0.34290	0.996000	0.88848	1.746000	0.38288	-0.024000	0.13941	0.557000	0.71058	AAC	-	NULL		0.627	GREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GREM2	protein_coding	OTTHUMT00000096286.1	G	NM_022469		238723327	-1	no_errors	NM_022469.3	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
OR6B2	389090	genome.wustl.edu	37	2	240968952	240968952	+	Missense_Mutation	SNP	C	C	A			TCGA-AB-2874-03A-01W-0732-08	TCGA-AB-2874-11A-01W-0732-08	C	C	C	A	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	0f1fb2e2-2463-4e1d-af0b-069bc0144e88	69a5771e-80a6-4c0e-af50-c10f51c985f6	g.chr2:240968952C>A	ENST00000402971.2	-	1	954	c.895G>T	c.(895-897)Gac>Tac	p.D299Y		NM_001005853.1	NP_001005853.1	Q6IFH4	OR6B2_HUMAN	olfactory receptor, family 6, subfamily B, member 2	299						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(4)|lung(9)|prostate(1)	15		all_epithelial(40;1.64e-11)|Breast(86;0.000327)|Renal(207;0.00571)|Ovarian(221;0.104)|all_hematologic(139;0.182)|all_lung(227;0.229)|Melanoma(123;0.238)		Epithelial(121;3.4e-29)|all cancers(36;2.08e-27)|OV - Ovarian serous cystadenocarcinoma(60;4.63e-14)|Kidney(56;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.56e-05)|Lung(119;0.00344)|LUSC - Lung squamous cell carcinoma(224;0.0148)		TTCAAGGCGTCCTTAAATTCC	0.428																																						dbGAP											0			2											130.0	124.0	126.0					2																	240968952		1877	4108	5985	240617625	SO:0001583	missense	0				CCDS46559.1	2q37.3	2012-08-09	2004-10-07	2004-10-07	ENSG00000182083	ENSG00000182083		"""GPCR / Class A : Olfactory receptors"""	15041	protein-coding gene	gene with protein product			"""olfactory receptor, family 6, subfamily B, member 2 pseudogene"""	OR6B2P			Standard	XM_005247004		Approved		uc010zoc.2	Q6IFH4	OTTHUMG00000152400	ENST00000402971.2:c.895G>T	2.37:g.240968952C>A	ENSP00000384563:p.Asp299Tyr	Somatic	78	0.00	0		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	240617625	81	45.81	71	B2RPR3|Q8NGW0	Missense_Mutation	SNP	HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1,superfamily_Family A G protein-coupled receptor-like	p.D299Y	ENST00000402971.2	37	c.895	CCDS46559.1	2	.	.	.	.	.	.	.	.	.	.	C	7.542	0.660980	0.14645	.	.	ENSG00000182083	ENST00000402971	T	0.38077	1.16	4.36	1.55	0.23275	.	0.816976	0.10518	N	0.665310	T	0.40498	0.1119	L	0.45228	1.405	0.09310	N	1	P	0.39862	0.692	P	0.49387	0.609	T	0.34502	-0.9826	10	0.87932	D	0	.	7.8737	0.29582	0.0:0.7161:0.0:0.2839	.	299	Q6IFH4	OR6B2_HUMAN	Y	299	ENSP00000384563:D299Y	ENSP00000384563:D299Y	D	-	1	0	OR6B2	240617625	0.142000	0.22610	0.005000	0.12908	0.160000	0.22226	1.119000	0.31258	0.197000	0.20387	0.591000	0.81541	GAC	-	superfamily_Family A G protein-coupled receptor-like		0.428	OR6B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6B2	protein_coding	OTTHUMT00000326079.1	C	NM_001005853		240617625	-1	no_errors	NM_001005853.1	genbank	human	provisional	54_36p	missense	SNP	0.046	A
ARMC3	219681	genome.wustl.edu	37	10	23319672	23319672	+	Silent	SNP	C	C	A	rs201157292		TCGA-AB-2874-03A-01W-0732-08	TCGA-AB-2874-11A-01W-0732-08	C	C	C	A	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	0f1fb2e2-2463-4e1d-af0b-069bc0144e88	69a5771e-80a6-4c0e-af50-c10f51c985f6	g.chr10:23319672C>A	ENST00000298032.5	+	17	2277	c.2193C>A	c.(2191-2193)acC>acA	p.T731T	ARMC3_ENST00000376528.4_Silent_p.T468T|ARMC3_ENST00000409983.3_Silent_p.T724T	NM_173081.3	NP_775104.2	Q5W041	ARMC3_HUMAN	armadillo repeat containing 3	731						extracellular vesicular exosome (GO:0070062)				breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(24)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						ATGAGGTGACCAAATCAATAC	0.358													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18761	0.0		0.0	False		,,,				2504	0.0					dbGAP											0			10											158.0	142.0	147.0					10																	23319672		2203	4300	6503	23359678	SO:0001819	synonymous_variant	0			AK057389	CCDS7142.1, CCDS60499.1, CCDS60500.1, CCDS73073.1	10p12.31	2013-02-14			ENSG00000165309	ENSG00000165309		"""Armadillo repeat containing"""	30964	protein-coding gene	gene with protein product	"""cancer/testis antigen 81"""	611226					Standard	XM_005252380		Approved	FLJ32827, CT81	uc001irm.4	Q5W041	OTTHUMG00000017811	ENST00000298032.5:c.2193C>A	10.37:g.23319672C>A		Somatic	332	2.05	7		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	23359678	168	45.08	142	A0PG76|A6NH64|B4DZL3|B7ZBN6|B7ZBN7|Q8IXS5|Q8N7B0|Q96M49	Silent	SNP	HMMPfam_Arm,HMMSmart_SM00185,superfamily_ARM repeat	p.T731	ENST00000298032.5	37	c.2193	CCDS7142.1	10																																																																																			-	NULL		0.358	ARMC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARMC3	protein_coding	OTTHUMT00000047197.2	C	NM_173081		23359678	+1	no_errors	NM_173081.3	genbank	human	validated	54_36p	silent	SNP	1.000	A
WT1	7490	genome.wustl.edu	37	11	32413566	32413566	+	Missense_Mutation	SNP	G	G	A	rs121907900		TCGA-AB-2874-03A-01W-0732-08	TCGA-AB-2874-11A-01W-0732-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	0f1fb2e2-2463-4e1d-af0b-069bc0144e88	69a5771e-80a6-4c0e-af50-c10f51c985f6	g.chr11:32413566G>A	ENST00000379079.2	-	9	1021	c.748C>T	c.(748-750)Cgg>Tgg	p.R250W	WT1_ENST00000530998.1_Missense_Mutation_p.R233W|WT1_ENST00000448076.3_Missense_Mutation_p.R462W|WT1_ENST00000332351.3_Missense_Mutation_p.R462W	NM_001198551.1	NP_001185480.1	P19544	WT1_HUMAN	Wilms tumor 1	394					adrenal cortex formation (GO:0035802)|adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye development (GO:0043010)|cardiac muscle cell fate commitment (GO:0060923)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|diaphragm development (GO:0060539)|epithelial cell differentiation (GO:0030855)|germ cell development (GO:0007281)|glomerular basement membrane development (GO:0032836)|glomerular visceral epithelial cell differentiation (GO:0072112)|glomerulus development (GO:0032835)|gonad development (GO:0008406)|heart development (GO:0007507)|kidney development (GO:0001822)|male genitalia development (GO:0030539)|male gonad development (GO:0008584)|mesenchymal to epithelial transition (GO:0060231)|metanephric epithelium development (GO:0072207)|metanephric mesenchyme development (GO:0072075)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of female gonad development (GO:2000195)|negative regulation of metanephric glomerular mesangial cell proliferation (GO:0072302)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of heart growth (GO:0060421)|positive regulation of male gonad development (GO:2000020)|positive regulation of metanephric ureteric bud development (GO:2001076)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|posterior mesonephric tubule development (GO:0072166)|regulation of organ formation (GO:0003156)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|sex determination (GO:0007530)|thorax and anterior abdomen determination (GO:0007356)|tissue development (GO:0009888)|ureteric bud development (GO:0001657)|vasculogenesis (GO:0001570)|visceral serous pericardium development (GO:0061032)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.R394W(5)|p.R394G(2)|p.V380_S410del(1)|p.R394R(1)|p.R250R(1)	EWSR1/WT1(234)	NS(1)|haematopoietic_and_lymphoid_tissue(348)|kidney(149)|large_intestine(9)|lung(20)|peritoneum(1)|pleura(2)|skin(2)|upper_aerodigestive_tract(1)	533	Breast(20;0.247)		OV - Ovarian serous cystadenocarcinoma(30;0.128)			TGGTCGGACCGGGAGAACTTT	0.433			"""D, Mis, N, F, S"""	EWSR1	"""Wilms, desmoplastic small round cell tumor"""	Wilms			Wilms' tumor-Aniridia-ambiguous Genitals-mental Retardation;Frasier syndrome;Familial Wilms' tumor;Denys-Drash syndrome																													dbGAP	yes	Rec	yes	"""Denys-Drash syndrome, Frasier syndrome, Familial Wilms tumor"""	11	11p13	7490	Wilms tumour 1 gene		O	10	Substitution - Missense(7)|Substitution - coding silent(2)|Deletion - In frame(1)	haematopoietic_and_lymphoid_tissue(5)|kidney(3)|lung(2)	11	GRCh37	CM910411	WT1	M	rs121907900						190.0	186.0	187.0					11																	32413566		2202	4299	6501	32370142	SO:0001583	missense	0	Familial Cancer Database	WAGR syndrome; ; ;incl.: Early Onset Nephrotic Syndrome-WT1 associated		CCDS7878.2, CCDS44561.1, CCDS44562.1, CCDS55750.1, CCDS55751.1	11p13	2014-09-17			ENSG00000184937	ENSG00000184937		"""Zinc fingers, C2H2-type"""	12796	protein-coding gene	gene with protein product		607102		GUD		14681303	Standard	NM_024424		Approved	WAGR, WIT-2, AWT1	uc001mtn.2	P19544	OTTHUMG00000039556	ENST00000379079.2:c.748C>T	11.37:g.32413566G>A	ENSP00000368370:p.Arg250Trp	Somatic	142	0.69	1		16	30.43	7	WXS	Illumina HiSeq	Phase_IV	32370142	124	26.90	46	A8K6S1|B3KSA5|Q15881|Q16256|Q16575|Q4VXV4|Q4VXV5|Q4VXV6|Q8IYZ5	Missense_Mutation	SNP	HMMPfam_WT1,HMMPfam_zf-C2H2,PatternScan_ZINC_FINGER_C2H2_1,HMMSmart_SM00355,superfamily_C2H2 and C2HC zinc fingers	p.R462W	ENST00000379079.2	37	c.1384	CCDS55751.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.0|23.0	4.362352|4.362352	0.82353|0.82353	.|.	.|.	ENSG00000184937|ENSG00000184937	ENST00000527882|ENST00000379079;ENST00000332351;ENST00000530998;ENST00000452863;ENST00000448076	.|T;T;T;T;T	.|0.61627	.|3.19;0.09;0.09;3.19;3.19	6.04|6.04	5.11|5.11	0.69529|0.69529	.|Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.|0.000000	.|0.64402	.|U	.|0.000011	T|T	0.74898|0.74898	0.3777|0.3777	M|M	0.75085|0.75085	2.285|2.285	0.80722|0.80722	A|A	1|1	.|D;D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0;1.0	.|D;D;D;D;D	.|0.97110	.|1.0;1.0;1.0;1.0;1.0	T|T	0.81716|0.81716	-0.0806|-0.0806	4|9	.|0.72032	.|D	.|0.01	.|.	13.4397|13.4397	0.61106|0.61106	0.0:0.0:0.5732:0.4268|0.0:0.0:0.5732:0.4268	.|.	.|450;394;467;233;250	.|P19544-8;P19544;P19544-7;B3KSA5;P19544-6	.|.;WT1_HUMAN;.;.;.	L|W	122|250;462;233;445;462	.|ENSP00000368370:R250W;ENSP00000331327:R462W;ENSP00000435307:R233W;ENSP00000415516:R445W;ENSP00000413452:R462W	.|ENSP00000331327:R462W	P|R	-|-	2|1	0|2	WT1|WT1	32370142|32370142	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	5.054000|5.054000	0.64275|0.64275	1.531000|1.531000	0.49152|0.49152	0.561000|0.561000	0.74099|0.74099	CCG|CGG	-	HMMPfam_zf-C2H2,PatternScan_ZINC_FINGER_C2H2_1,HMMSmart_SM00355,superfamily_C2H2 and C2HC zinc fingers		0.433	WT1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WT1	protein_coding	OTTHUMT00000095434.1	G	NM_000378		32370142	-1	no_errors	NM_024426.3	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
CCDC60	160777	genome.wustl.edu	37	12	119968731	119968731	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2874-03A-01W-0732-08	TCGA-AB-2874-11A-01W-0732-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	0f1fb2e2-2463-4e1d-af0b-069bc0144e88	69a5771e-80a6-4c0e-af50-c10f51c985f6	g.chr12:119968731G>A	ENST00000327554.2	+	13	1879	c.1414G>A	c.(1414-1416)Gcc>Acc	p.A472T	RP11-768F21.1_ENST00000509470.2_lincRNA	NM_178499.3	NP_848594.2	Q8IWA6	CCD60_HUMAN	coiled-coil domain containing 60	472										endometrium(4)|kidney(3)|large_intestine(8)|lung(15)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.207)		CTTCCGCCCCGCCAAAAAGAT	0.483																																						dbGAP											0			12											87.0	85.0	85.0					12																	119968731		2203	4300	6503	118453114	SO:0001583	missense	0			BC040553	CCDS9190.1	12q24.23	2006-02-03			ENSG00000183273	ENSG00000183273			28610	protein-coding gene	gene with protein product						12477932	Standard	NM_178499		Approved	MGC39827	uc001txe.3	Q8IWA6	OTTHUMG00000168943	ENST00000327554.2:c.1414G>A	12.37:g.119968731G>A	ENSP00000333374:p.Ala472Thr	Somatic	161	1.83	3		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	118453114	123	46.86	112		Missense_Mutation	SNP	NULL	p.A472T	ENST00000327554.2	37	c.1414	CCDS9190.1	12	.	.	.	.	.	.	.	.	.	.	G	21.2	4.117063	0.77323	.	.	ENSG00000183273	ENST00000327554	T	0.23754	1.89	5.82	5.82	0.92795	.	0.196730	0.36303	N	0.002666	T	0.46983	0.1421	M	0.68317	2.08	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.34378	-0.9831	9	.	.	.	-30.3014	11.005	0.47629	0.0848:0.0:0.9152:0.0	.	472	Q8IWA6	CCD60_HUMAN	T	472	ENSP00000333374:A472T	.	A	+	1	0	CCDC60	118453114	0.949000	0.32298	0.970000	0.41538	0.965000	0.64279	2.579000	0.46059	2.751000	0.94390	0.655000	0.94253	GCC	-	NULL		0.483	CCDC60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC60	protein_coding	OTTHUMT00000401680.1	G	NM_178499		118453114	+1	no_errors	NM_178499.3	genbank	human	validated	54_36p	missense	SNP	0.954	A
SLITRK1	114798	genome.wustl.edu	37	13	84454094	84454094	+	Missense_Mutation	SNP	G	G	T			TCGA-AB-2874-03A-01W-0732-08	TCGA-AB-2874-11A-01W-0732-08	G	G	G	T	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	0f1fb2e2-2463-4e1d-af0b-069bc0144e88	69a5771e-80a6-4c0e-af50-c10f51c985f6	g.chr13:84454094G>T	ENST00000377084.2	-	1	2434	c.1549C>A	c.(1549-1551)Cag>Aag	p.Q517K		NM_001281503.1|NM_052910.1	NP_001268432.1|NP_443142.1	Q96PX8	SLIK1_HUMAN	SLIT and NTRK-like family, member 1	517					adult behavior (GO:0030534)|axonogenesis (GO:0007409)|homeostatic process (GO:0042592)|multicellular organism growth (GO:0035264)	integral component of membrane (GO:0016021)				NS(2)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(36)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	80	Medulloblastoma(90;0.18)	Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.07)		GAGGTTAACTGGTCCAGCACC	0.567																																						dbGAP											0			13											52.0	54.0	53.0					13																	84454094		2203	4300	6503	83352095	SO:0001583	missense	0			AB067497	CCDS9464.1	13q31.1	2004-01-08	2004-01-08		ENSG00000178235	ENSG00000178235			20297	protein-coding gene	gene with protein product		609678	"""leucine rich repeat containing 12"""	LRRC12		14557068, 12975309	Standard	NM_001281503		Approved	KIAA1910	uc001vlk.3	Q96PX8	OTTHUMG00000017149	ENST00000377084.2:c.1549C>A	13.37:g.84454094G>T	ENSP00000366288:p.Gln517Lys	Somatic	161	4.17	7		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	83352095	70	46.21	61	Q5U5I6|Q96SF9	Missense_Mutation	SNP	HMMSmart_LRRNT,HMMSmart_LRRCT,HMMPfam_LRR_1,HMMSmart_LRR_TYP,superfamily_SSF52058	p.Q517K	ENST00000377084.2	37	c.1549	CCDS9464.1	13	.	.	.	.	.	.	.	.	.	.	G	19.38	3.816466	0.70912	.	.	ENSG00000178235	ENST00000377084	T	0.51574	0.7	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	T	0.44787	0.1310	N	0.16130	0.375	0.80722	D	1	P	0.47604	0.898	P	0.52957	0.714	T	0.31779	-0.9931	10	0.27785	T	0.31	-11.1432	17.693	0.88273	0.0:0.0:1.0:0.0	.	517	Q96PX8	SLIK1_HUMAN	K	517	ENSP00000366288:Q517K	ENSP00000366288:Q517K	Q	-	1	0	SLITRK1	83352095	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.813000	0.99286	2.603000	0.88011	0.655000	0.94253	CAG	-	superfamily_SSF52058		0.567	SLITRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLITRK1	protein_coding	OTTHUMT00000045396.1	G	NM_052910		83352095	-1	no_errors	NM_052910.1	genbank	human	validated	54_36p	missense	SNP	1.000	T
IDH2	3418	genome.wustl.edu	37	15	90631934	90631934	+	Missense_Mutation	SNP	C	C	T	rs121913502		TCGA-AB-2874-03A-01W-0732-08	TCGA-AB-2874-11A-01W-0732-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	0f1fb2e2-2463-4e1d-af0b-069bc0144e88	69a5771e-80a6-4c0e-af50-c10f51c985f6	g.chr15:90631934C>T	ENST00000330062.3	-	4	532	c.419G>A	c.(418-420)cGg>cAg	p.R140Q	IDH2_ENST00000559482.1_Intron|IDH2_ENST00000539790.1_Missense_Mutation_p.R10Q|IDH2_ENST00000540499.2_Missense_Mutation_p.R88Q	NM_002168.2	NP_002159.2	P48735	IDHP_HUMAN	isocitrate dehydrogenase 2 (NADP+), mitochondrial	140	Substrate binding. {ECO:0000250}.		R -> G (in D2HGA2). {ECO:0000269|PubMed:20847235}.|R -> Q (in D2HGA2). {ECO:0000269|PubMed:20847235}.		2-oxoglutarate metabolic process (GO:0006103)|carbohydrate metabolic process (GO:0005975)|cellular metabolic process (GO:0044237)|glyoxylate cycle (GO:0006097)|isocitrate metabolic process (GO:0006102)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	isocitrate dehydrogenase (NADP+) activity (GO:0004450)|magnesium ion binding (GO:0000287)|NAD binding (GO:0051287)	p.R140Q(292)|p.R140L(8)		biliary_tract(11)|bone(19)|central_nervous_system(107)|endometrium(1)|haematopoietic_and_lymphoid_tissue(953)|large_intestine(8)|lung(5)|skin(5)	1109	Melanoma(11;0.00551)|Lung NSC(78;0.0196)|all_lung(78;0.04)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.106)			CAGGATGTTCCGGATAGTTCC	0.537			M		GBM																																	dbGAP		Dom	yes		15	15q26.1	3418	"""socitrate dehydrogenase 2 (NADP+), mitochondrial """		M	300	Substitution - Missense(300)	haematopoietic_and_lymphoid_tissue(300)	15											103.0	103.0	103.0					15																	90631934		2200	4298	6498	88432938	SO:0001583	missense	0				CCDS10359.1	15q26.1	2014-09-17			ENSG00000182054	ENSG00000182054	1.1.1.42		5383	protein-coding gene	gene with protein product		147650					Standard	NM_001289910		Approved		uc002box.3	P48735	OTTHUMG00000149815	ENST00000330062.3:c.419G>A	15.37:g.90631934C>T	ENSP00000331897:p.Arg140Gln	Somatic	116	4.92	6		137	43.62	106	WXS	Illumina HiSeq	Phase_IV	88432938	91	46.20	79	B2R6L6|B4DFL2|Q96GT3	Missense_Mutation	SNP	HMMPfam_Iso_dh,PatternScan_IDH_IMDH,superfamily_Isocitrate/Isopropylmalate dehydrogenase-like	p.R140Q	ENST00000330062.3	37	c.419	CCDS10359.1	15	.	.	.	.	.	.	.	.	.	.	C	18.35	3.604397	0.66445	.	.	ENSG00000182054	ENST00000330062;ENST00000539790;ENST00000540499	D;D;D	0.87179	-2.22;-2.22;-2.22	5.67	4.75	0.60458	Isopropylmalate dehydrogenase-like domain (2);	0.000000	0.85682	D	0.000000	D	0.95449	0.8522	H	0.96833	3.89	0.48185	D	0.999601	D	0.89917	1.0	D	0.87578	0.998	D	0.96254	0.9185	10	0.87932	D	0	.	12.4459	0.55651	0.0:0.9189:0.0:0.0811	.	140	P48735	IDHP_HUMAN	Q	140;10;88	ENSP00000331897:R140Q;ENSP00000438457:R10Q;ENSP00000446147:R88Q	ENSP00000331897:R140Q	R	-	2	0	IDH2	88432938	1.000000	0.71417	1.000000	0.80357	0.051000	0.14879	7.797000	0.85911	1.397000	0.46682	-0.258000	0.10820	CGG	-	HMMPfam_Iso_dh,superfamily_Isocitrate/Isopropylmalate dehydrogenase-like		0.537	IDH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IDH2	protein_coding	OTTHUMT00000313426.1	C			88432938	-1	no_errors	NM_002168.2	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
MEFV	4210	genome.wustl.edu	37	16	3299462	3299462	+	Missense_Mutation	SNP	C	C	T			TCGA-AB-2874-03A-01W-0732-08	TCGA-AB-2874-11A-01W-0732-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	0f1fb2e2-2463-4e1d-af0b-069bc0144e88	69a5771e-80a6-4c0e-af50-c10f51c985f6	g.chr16:3299462C>T	ENST00000219596.1	-	3	1268	c.1229G>A	c.(1228-1230)cGc>cAc	p.R410H	MEFV_ENST00000339854.4_Missense_Mutation_p.R230H|MEFV_ENST00000536379.1_Missense_Mutation_p.R199H|MEFV_ENST00000541159.1_Missense_Mutation_p.R199H	NM_000243.2	NP_000234.1	O15553	MEFV_HUMAN	Mediterranean fever	410					inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of macrophage inflammatory protein 1 alpha production (GO:0071641)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity (GO:2001056)	cell projection (GO:0042995)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	actin binding (GO:0003779)|zinc ion binding (GO:0008270)			NS(2)|biliary_tract(1)|breast(5)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(19)|ovary(3)|prostate(1)|skin(6)	50						CTCAATGGGGCGCACCCGGTG	0.597																																						dbGAP											0			16											54.0	53.0	53.0					16																	3299462		2197	4300	6497	3239463	SO:0001583	missense	0			AF018080	CCDS10498.1, CCDS55981.1	16p13.3	2014-09-17			ENSG00000103313	ENSG00000103313		"""Tripartite motif containing / Tripartite motif containing"""	6998	protein-coding gene	gene with protein product	"""pyrin"""	608107		MEF		9288094	Standard	NM_000243		Approved	FMF, TRIM20	uc002cun.1	O15553	OTTHUMG00000129324	ENST00000219596.1:c.1229G>A	16.37:g.3299462C>T	ENSP00000219596:p.Arg410His	Somatic	140	1.40	2		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	3239463	61	54.74	75	D3DUC0|F5H0Q3|Q3MJ84|Q96PN4|Q96PN5	Missense_Mutation	SNP	HMMPfam_zf-B_box,HMMSmart_SM00336,HMMPfam_SPRY,HMMPfam_PAAD_DAPIN,HMMSmart_SM00589,superfamily_DEATH domain,HMMSmart_SM00449,superfamily_B-box zinc-binding domain	p.R410H	ENST00000219596.1	37	c.1229	CCDS10498.1	16	.	.	.	.	.	.	.	.	.	.	C	4.010	-0.000772	0.07819	.	.	ENSG00000103313	ENST00000545159;ENST00000219596;ENST00000339854;ENST00000541159;ENST00000536379;ENST00000534868	T;T;T;T	0.43688	0.94;0.94;0.94;0.94	5.35	0.977	0.19733	Zinc finger, B-box (3);	0.367311	0.23941	N	0.043056	T	0.32194	0.0821	M	0.80422	2.495	0.20563	N	0.999882	B	0.30281	0.275	B	0.21151	0.033	T	0.13361	-1.0512	10	0.15499	T	0.54	-26.3689	2.193	0.03904	0.1574:0.5222:0.1524:0.168	.	410	O15553	MEFV_HUMAN	H	410;410;230;199;199;199	ENSP00000219596:R410H;ENSP00000339639:R230H;ENSP00000438711:R199H;ENSP00000445079:R199H	ENSP00000219596:R410H	R	-	2	0	MEFV	3239463	0.001000	0.12720	0.636000	0.29352	0.001000	0.01503	0.162000	0.16501	0.487000	0.27698	-0.830000	0.03078	CGC	-	HMMPfam_zf-B_box,HMMSmart_SM00336,superfamily_B-box zinc-binding domain		0.597	MEFV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEFV	protein_coding	OTTHUMT00000251464.1	C	NM_000243		3239463	-1	no_errors	NM_000243.2	genbank	human	reviewed	54_36p	missense	SNP	0.025	T
SMG1	23049	genome.wustl.edu	37	16	18852940	18852940	+	Missense_Mutation	SNP	A	A	G			TCGA-AB-2874-03A-01W-0732-08	TCGA-AB-2874-11A-01W-0732-08	A	A	A	G	A	A	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	0f1fb2e2-2463-4e1d-af0b-069bc0144e88	69a5771e-80a6-4c0e-af50-c10f51c985f6	g.chr16:18852940A>G	ENST00000446231.2	-	41	7055	c.6643T>C	c.(6643-6645)Ttt>Ctt	p.F2215L	SMG1_ENST00000389467.3_Missense_Mutation_p.F2215L			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	2215	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						TAAAGACCAAATAAGGGTGTG	0.433																																						dbGAP											0			16											193.0	180.0	185.0					16																	18852940		1950	4151	6101	18760441	SO:0001583	missense	0			AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.6643T>C	16.37:g.18852940A>G	ENSP00000402515:p.Phe2215Leu	Somatic	469	2.49	12		51	49.00	49	WXS	Illumina HiSeq	Phase_IV	18760441	168	45.45	145	O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	Missense_Mutation	SNP	HMMPfam_HEAT,HMMPfam_PI3_PI4_kinase,HMMSmart_SM00146,HMMPfam_FATC,superfamily_Protein kinase-like (PK-like),superfamily_ARM repeat,PatternScan_PI3_4_KINASE_2	p.F2215L	ENST00000446231.2	37	c.6643	CCDS45430.1	16	.	.	.	.	.	.	.	.	.	.	A	25.5	4.647241	0.87958	.	.	ENSG00000157106	ENST00000446231;ENST00000389467	T;T	0.75589	-0.95;-0.95	5.48	5.48	0.80851	Protein kinase-like domain (1);Armadillo-type fold (1);Phosphatidylinositol 3-/4-kinase, catalytic (4);	0.000000	0.64402	D	0.000001	T	0.81375	0.4809	L	0.41906	1.305	0.48185	D	0.999604	D;D	0.57257	0.974;0.979	D;D	0.74023	0.953;0.982	T	0.83221	-0.0068	10	0.72032	D	0.01	.	15.8631	0.79040	1.0:0.0:0.0:0.0	.	2075;2215	Q96Q15-2;Q96Q15	.;SMG1_HUMAN	L	2215	ENSP00000402515:F2215L;ENSP00000374118:F2215L	ENSP00000374118:F2215L	F	-	1	0	SMG1	18760441	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	9.212000	0.95126	2.198000	0.70561	0.533000	0.62120	TTT	-	HMMPfam_PI3_PI4_kinase,HMMSmart_SM00146,superfamily_Protein kinase-like (PK-like)		0.433	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SMG1	protein_coding	OTTHUMT00000391817.1	A	NM_015092		18760441	-1	no_errors	NM_015092.4	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
GPATCH8	23131	genome.wustl.edu	37	17	42475690	42475690	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2874-03A-01W-0732-08	TCGA-AB-2874-11A-01W-0732-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	0f1fb2e2-2463-4e1d-af0b-069bc0144e88	69a5771e-80a6-4c0e-af50-c10f51c985f6	g.chr17:42475690G>A	ENST00000591680.1	-	8	3785	c.3755C>T	c.(3754-3756)aCc>aTc	p.T1252I	GPATCH8_ENST00000434000.1_Missense_Mutation_p.T1174I	NM_001002909.2	NP_001002909.1	Q9UKJ3	GPTC8_HUMAN	G patch domain containing 8	1252							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(4)|endometrium(7)|kidney(6)|large_intestine(4)|liver(2)|lung(21)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	50		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.206)		GGACTCCAGGGTGTCCCCATC	0.602																																						dbGAP											0			17											128.0	127.0	128.0					17																	42475690		2203	4300	6503	39831216	SO:0001583	missense	0			AB011125	CCDS32666.1	17q21.31	2013-01-28	2006-08-22	2006-12-13	ENSG00000186566	ENSG00000186566		"""G patch domain containing"""	29066	protein-coding gene	gene with protein product		614396	"""KIAA0553"""	KIAA0553, GPATC8		9628581	Standard	NM_001002909		Approved		uc002igw.2	Q9UKJ3	OTTHUMG00000181818	ENST00000591680.1:c.3755C>T	17.37:g.42475690G>A	ENSP00000467556:p.Thr1252Ile	Somatic	394	2.44	10		33	41.38	24	WXS	Illumina HiSeq	Phase_IV	39831216	157	49.36	154	B9EGP9|O60300|Q8TB99	Missense_Mutation	SNP	HMMPfam_G-patch,HMMSmart_SM00443,PatternScan_ZINC_FINGER_C2H2_1	p.T1252I	ENST00000591680.1	37	c.3755	CCDS32666.1	17	.	.	.	.	.	.	.	.	.	.	G	12.99	2.103506	0.37145	.	.	ENSG00000186566	ENST00000335500;ENST00000434000	T	0.12879	2.64	4.76	4.76	0.60689	.	0.294997	0.32218	N	0.006413	T	0.08088	0.0202	N	0.08118	0	0.30249	N	0.794227	B	0.24258	0.1	B	0.18561	0.022	T	0.08330	-1.0727	10	0.37606	T	0.19	-5.1939	15.1393	0.72599	0.0:0.1414:0.8586:0.0	.	1252	Q9UKJ3	GPTC8_HUMAN	I	1252;1174	ENSP00000395016:T1174I	ENSP00000335486:T1252I	T	-	2	0	GPATCH8	39831216	0.990000	0.36364	0.996000	0.52242	0.938000	0.57974	3.059000	0.49947	2.467000	0.83353	0.557000	0.71058	ACC	-	NULL		0.602	GPATCH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPATCH8	protein_coding	OTTHUMT00000457797.1	G	NM_001002909		39831216	-1	no_errors	NM_001002909.1	genbank	human	validated	54_36p	missense	SNP	1.000	A
CEBPA	1050	genome.wustl.edu	37	19	33792423	33792423	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2874-03A-01W-0732-08	TCGA-AB-2874-11A-01W-0732-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	0f1fb2e2-2463-4e1d-af0b-069bc0144e88	69a5771e-80a6-4c0e-af50-c10f51c985f6	g.chr19:33792423G>A	ENST00000498907.2	-	1	1047	c.898C>T	c.(898-900)Cgc>Tgc	p.R300C	CTD-2540B15.7_ENST00000587312.1_RNA|CTD-2540B15.11_ENST00000589932.1_RNA|CEBPA-AS1_ENST00000592982.2_RNA	NM_004364.3	NP_004355.2	P49715	CEBPA_HUMAN	CCAAT/enhancer binding protein (C/EBP), alpha	300	Basic motif. {ECO:0000255|PROSITE- ProRule:PRU00978}.|bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.				acute-phase response (GO:0006953)|brown fat cell differentiation (GO:0050873)|cell maturation (GO:0048469)|cellular response to lithium ion (GO:0071285)|cellular response to organic cyclic compound (GO:0071407)|cholesterol metabolic process (GO:0008203)|cytokine-mediated signaling pathway (GO:0019221)|embryonic placenta development (GO:0001892)|generation of precursor metabolites and energy (GO:0006091)|inner ear development (GO:0048839)|liver development (GO:0001889)|lung development (GO:0030324)|macrophage differentiation (GO:0030225)|mitochondrion organization (GO:0007005)|myeloid cell differentiation (GO:0030099)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ regeneration (GO:0031100)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|response to glucocorticoid (GO:0051384)|response to vitamin B2 (GO:0033274)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|urea cycle (GO:0000050)|viral process (GO:0016032)|white fat cell differentiation (GO:0050872)	nuclear matrix (GO:0016363)|nucleus (GO:0005634)|Rb-E2F complex (GO:0035189)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.R300G(1)|p.H200_K352>Q(1)|p.?(1)		cervix(1)|haematopoietic_and_lymphoid_tissue(912)|lung(5)|prostate(1)|stomach(1)	920	Esophageal squamous(110;0.137)					GCCTTGTCGCGGCTCTTGCGC	0.657			"""Mis, N, F"""		"""AML, MDS"""				Acute Myeloid Leukemia, Familial, associated with CEBPA germline mutation																													dbGAP		Dom	yes		19	19q13.1	1050	"""CCAAT/enhancer binding protein (C/EBP), alpha"""		L	3	Substitution - Missense(1)|Unknown(1)|Complex - deletion inframe(1)	haematopoietic_and_lymphoid_tissue(3)	19											47.0	49.0	48.0					19																	33792423		2203	4300	6503	38484263	SO:0001583	missense	0	Familial Cancer Database	Familial AML	M37197	CCDS54243.1	19q13.1	2014-09-17				ENSG00000245848		"""basic leucine zipper proteins"""	1833	protein-coding gene	gene with protein product		116897		CEBP		1535333, 1840554	Standard	NM_004364		Approved	C/EBP-alpha	uc002nun.3	P49715		ENST00000498907.2:c.898C>T	19.37:g.33792423G>A	ENSP00000427514:p.Arg300Cys	Somatic	0	0.00	0		260	44.82	212	WXS	Illumina HiSeq	Phase_IV	38484263	65	41.96	47	A7LNP2|P78319|Q05CA4	Missense_Mutation	SNP	HMMSmart_BRLZ,PatternScan_BZIP_BASIC,HMMPfam_bZIP_2	p.R300C	ENST00000498907.2	37	c.898	CCDS54243.1	19	.	.	.	.	.	.	.	.	.	.	G	22.1	4.248465	0.80024	.	.	ENSG00000245848	ENST00000498907	T	0.72282	-0.64	4.7	4.7	0.59300	Basic-leucine zipper (bZIP) transcription factor (2);Basic leucine zipper (1);	.	.	.	.	D	0.88089	0.6343	H	0.95982	3.75	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.90975	0.4823	9	0.87932	D	0	.	11.8248	0.52261	0.0:0.0:0.8248:0.1752	.	300	P49715	CEBPA_HUMAN	C	300	ENSP00000427514:R300C	ENSP00000427514:R300C	R	-	1	0	CEBPA	38484263	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.589000	0.53972	2.133000	0.65898	0.462000	0.41574	CGC	-	HMMSmart_BRLZ,HMMPfam_bZIP_2		0.657	CEBPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEBPA	protein_coding	OTTHUMT00000365012.1	G	NM_004364		38484263	-1	no_errors	NM_004364.3	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
PDCD2L	84306	genome.wustl.edu	37	19	34904746	34904746	+	Missense_Mutation	SNP	T	T	C			TCGA-AB-2874-03A-01W-0732-08	TCGA-AB-2874-11A-01W-0732-08	T	T	T	C	T	T	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	0f1fb2e2-2463-4e1d-af0b-069bc0144e88	69a5771e-80a6-4c0e-af50-c10f51c985f6	g.chr19:34904746T>C	ENST00000246535.3	+	5	838	c.791T>C	c.(790-792)aTt>aCt	p.I264T	PDCD2L_ENST00000587065.2_Intron	NM_032346.1	NP_115722.1	Q9BRP1	PDD2L_HUMAN	programmed cell death 2-like	264					cell cycle (GO:0007049)	cytoplasm (GO:0005737)|membrane (GO:0016020)				breast(2)|kidney(1)|large_intestine(4)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.211)			CAGGAGCAGATTTTGAGGTAA	0.323																																						dbGAP											0			19											107.0	116.0	113.0					19																	34904746		2203	4299	6502	39596586	SO:0001583	missense	0			BC006146	CCDS12438.1	19q13.11	2008-02-05				ENSG00000126249			28194	protein-coding gene	gene with protein product		615661				16311922	Standard	NM_032346		Approved	MGC13096	uc002nvj.3	Q9BRP1		ENST00000246535.3:c.791T>C	19.37:g.34904746T>C	ENSP00000246535:p.Ile264Thr	Somatic	206	2.82	6		3	50.00	3	WXS	Illumina HiSeq	Phase_IV	39596586	86	44.94	71		Missense_Mutation	SNP	HMMPfam_PDCD2_C	p.I264T	ENST00000246535.3	37	c.791	CCDS12438.1	19	.	.	.	.	.	.	.	.	.	.	T	19.82	3.898296	0.72639	.	.	ENSG00000126249	ENST00000246535	.	.	.	5.52	5.52	0.82312	Programmed cell death protein 2, C-terminal (1);	0.095984	0.64402	D	0.000001	D	0.84401	0.5464	M	0.91768	3.24	0.46725	D	0.999173	D	0.76494	0.999	D	0.72625	0.978	D	0.87704	0.2562	9	0.72032	D	0.01	-17.7855	13.1611	0.59544	0.0:0.0:0.0:1.0	.	264	Q9BRP1	PDD2L_HUMAN	T	264	.	ENSP00000246535:I264T	I	+	2	0	PDCD2L	39596586	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	5.699000	0.68310	2.094000	0.63399	0.482000	0.46254	ATT	-	HMMPfam_PDCD2_C		0.323	PDCD2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDCD2L	protein_coding	OTTHUMT00000459251.3	T	NM_032346		39596586	+1	no_errors	NM_032346.1	genbank	human	provisional	54_36p	missense	SNP	1.000	C
FCGBP	8857	genome.wustl.edu	37	19	40384119	40384119	+	Missense_Mutation	SNP	C	C	G			TCGA-AB-2874-03A-01W-0732-08	TCGA-AB-2874-11A-01W-0732-08	C	C	C	G	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	0f1fb2e2-2463-4e1d-af0b-069bc0144e88	69a5771e-80a6-4c0e-af50-c10f51c985f6	g.chr19:40384119C>G	ENST00000221347.6	-	21	9498	c.9491G>C	c.(9490-9492)tGc>tCc	p.C3164S		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	3164	TIL 7.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			GCTGGCCGGGCAGGGTGGGCC	0.602																																						dbGAP											0			19											161.0	176.0	171.0					19																	40384119		2202	4298	6500	45075959	SO:0001583	missense	0			D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.9491G>C	19.37:g.40384119C>G	ENSP00000221347:p.Cys3164Ser	Somatic	375	0.79	3		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	45075959	193	18.83	45	O95784	Missense_Mutation	SNP	HMMSmart_VWC,HMMPfam_VWD,HMMSmart_VWD,superfamily_Cysrich_TIL,HMMPfam_TIL_assoc,HMMSmart_FOLN,HMMPfam_C8,HMMPfam_TIL	p.C3164S	ENST00000221347.6	37	c.9491	CCDS12546.1	19	.	.	.	.	.	.	.	.	.	.	C	17.80	3.479414	0.63849	.	.	ENSG00000090920	ENST00000221347	D	0.96745	-4.11	3.44	3.44	0.39384	Protease inhibitor I8, cysteine-rich trypsin inhibitor-like (2);	.	.	.	.	D	0.98726	0.9572	H	0.97962	4.115	0.35390	D	0.790679	P	0.47409	0.895	D	0.64877	0.93	D	0.99969	1.1952	9	0.59425	D	0.04	.	14.0427	0.64687	0.0:1.0:0.0:0.0	.	3164	Q9Y6R7	FCGBP_HUMAN	S	3164	ENSP00000221347:C3164S	ENSP00000221347:C3164S	C	-	2	0	FCGBP	45075959	1.000000	0.71417	1.000000	0.80357	0.555000	0.35460	7.525000	0.81892	1.634000	0.50500	0.400000	0.26472	TGC	-	superfamily_Cysrich_TIL,HMMPfam_TIL		0.602	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCGBP	protein_coding	OTTHUMT00000462507.1	C	NM_003890		45075959	-1	no_errors	NM_003890.2	genbank	human	validated	54_36p	missense	SNP	1.000	G
AURKC	6795	genome.wustl.edu	37	19	57744037	57744037	+	Missense_Mutation	SNP	C	C	T			TCGA-AB-2874-03A-01W-0732-08	TCGA-AB-2874-11A-01W-0732-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	0f1fb2e2-2463-4e1d-af0b-069bc0144e88	69a5771e-80a6-4c0e-af50-c10f51c985f6	g.chr19:57744037C>T	ENST00000302804.7	+	4	610	c.424C>T	c.(424-426)Cgc>Tgc	p.R142C	AURKC_ENST00000599062.1_Missense_Mutation_p.R139C|AURKC_ENST00000598785.1_Missense_Mutation_p.R108C|AURKC_ENST00000415300.2_Missense_Mutation_p.R123C|AURKC_ENST00000448930.1_Missense_Mutation_p.R108C	NM_001015878.1	NP_001015878.1	Q9UQB9	AURKC_HUMAN	aurora kinase C	142	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				attachment of spindle microtubules to kinetochore (GO:0008608)|cytokinesis (GO:0000910)|histone modification (GO:0016570)|meiotic nuclear division (GO:0007126)|positive regulation of cytokinesis (GO:0032467)|protein phosphorylation (GO:0006468)|spindle midzone assembly involved in mitosis (GO:0051256)	chromosome passenger complex (GO:0032133)|chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle (GO:0005819)|spindle midzone (GO:0051233)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)			breast(1)|endometrium(1)|large_intestine(9)|lung(9)|ovary(3)|prostate(1)|stomach(1)	25		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0122)		AGATGAACAGCGCACAGCCAC	0.552																																						dbGAP											0			19											68.0	66.0	67.0					19																	57744037		2203	4300	6503	62435849	SO:0001583	missense	0				CCDS33128.1, CCDS46205.1, CCDS46206.1	19q13.43	2013-09-19	2003-07-21	2003-07-23	ENSG00000105146	ENSG00000105146			11391	protein-coding gene	gene with protein product		603495	"""serine/threonine kinase 13 (aurora/IPL1-like)"""	STK13		9799611	Standard	XR_430209		Approved	AurC, ARK3	uc002qoe.3	Q9UQB9	OTTHUMG00000183106	ENST00000302804.7:c.424C>T	19.37:g.57744037C>T	ENSP00000302898:p.Arg142Cys	Somatic	250	0.40	1		1	0.00	0	WXS	Illumina HiSeq	Phase_IV	62435849	156	14.67	27	O60681|O75442|Q6AZY8|Q6DLZ0|Q9UPK5	Missense_Mutation	SNP	HMMSmart_SM00219,HMMSmart_SM00220,PatternScan_PROTEIN_KINASE_ST,superfamily_Protein kinase-like (PK-like),PatternScan_PROTEIN_KINASE_ATP,HMMPfam_Pkinase	p.R142C	ENST00000302804.7	37	c.424	CCDS33128.1	19	.	.	.	.	.	.	.	.	.	.	C	11.81	1.749583	0.30955	.	.	ENSG00000105146	ENST00000415300;ENST00000448930;ENST00000302804	T;T;T	0.66280	-0.2;-0.2;-0.2	3.81	2.76	0.32466	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.184695	0.47093	D	0.000253	T	0.64068	0.2565	L	0.37466	1.105	0.49798	D	0.999827	D;D;D	0.89917	1.0;1.0;1.0	D;D;P	0.65323	0.934;0.919;0.889	T	0.64871	-0.6305	10	0.87932	D	0	-1.1314	6.8103	0.23801	0.2033:0.5997:0.197:0.0	.	139;142;123	Q5Y191;Q9UQB9;Q9UQB9-3	.;AURKC_HUMAN;.	C	123;108;142	ENSP00000407162:R123C;ENSP00000406798:R108C;ENSP00000302898:R142C	ENSP00000302898:R142C	R	+	1	0	AURKC	62435849	0.999000	0.42202	0.745000	0.31077	0.005000	0.04900	1.086000	0.30853	1.175000	0.42826	-0.305000	0.09177	CGC	-	HMMSmart_SM00219,HMMSmart_SM00220,superfamily_Protein kinase-like (PK-like),HMMPfam_Pkinase		0.552	AURKC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AURKC	protein_coding	OTTHUMT00000465089.1	C	NM_003160		62435849	+1	no_errors	NM_001015878.1	genbank	human	reviewed	54_36p	missense	SNP	0.983	T
Unknown	0	genome.wustl.edu	37	3	143574708	143574708	+	IGR	DEL	T	T	-			TCGA-AB-2874-03A-01W-0732-08	TCGA-AB-2874-11A-01W-0732-08	T	T	T	-	T	T	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	0f1fb2e2-2463-4e1d-af0b-069bc0144e88	69a5771e-80a6-4c0e-af50-c10f51c985f6	g.chr3:143574708delT								SLC9A9 (7335 upstream) : C3orf58 (115931 downstream)																							TTCAACGGTCTCCTGATCCAG	0.483																																						dbGAP											0			3																																								145057398	SO:0001628	intergenic_variant	0																															3.37:g.143574708delT		Somatic	110	0.00	0		0	0.00	0	WXS	Illumina HiSeq	Phase_IV	145057398	70	47.95	70		Frame_Shift_Del	DEL	HMMPfam_Ribosomal_S17e	p.E181fs		37	c.542		3																																																																																			-	HMMPfam_Ribosomal_S17e	0	0.483					LOC257039			T			145057398	-1	no_errors	XM_172230.1	genbank	human	model	54_36p	frame_shift_del	DEL	1.000	-
