#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NormalRefReads_WU	i_NormalVAF_WU	i_NormalVarReads_WU	i_ORegAnno_bin	i_RNARefReads_WU	i_RNAVAF_WU	i_RNAVarReads_WU	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TumorRefReads_WU	i_TumorVAF_WU	i_TumorVarReads_WU	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
BRS3	680	genome.wustl.edu	37	X	135574280	135574280	+	Missense_Mutation	SNP	C	C	T			TCGA-AB-2876-03A-01W-0732-08	TCGA-AB-2876-11A-01W-0732-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	d48c086f-36b5-49ab-9e83-83520c701fd5	e4b17175-746c-47db-a509-7320119351b2	g.chrX:135574280C>T	ENST00000370648.3	+	3	1174	c.946C>T	c.(946-948)Cgg>Tgg	p.R316W		NM_001727.1	NP_001718.1	P32247	BRS3_HUMAN	bombesin-like receptor 3	316					adult feeding behavior (GO:0008343)|glucose metabolic process (GO:0006006)|regulation of blood pressure (GO:0008217)	integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	bombesin receptor activity (GO:0004946)			endometrium(2)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)|pancreas(1)|prostate(1)	23	Acute lymphoblastic leukemia(192;0.000127)					CATTTTCTCTCGGGTTTTGGC	0.443																																						dbGAP											0			X											257.0	227.0	237.0					X																	135574280		2203	4300	6503	135401946	SO:0001583	missense	0				CCDS14656.1	Xq26.3	2014-02-21			ENSG00000102239	ENSG00000102239		"""GPCR / Class A : Bombesin receptors"""	1113	protein-coding gene	gene with protein product		300107				8383682	Standard	NM_001727		Approved	BB3	uc004ezv.1	P32247	OTTHUMG00000022726	ENST00000370648.3:c.946C>T	X.37:g.135574280C>T	ENSP00000359682:p.Arg316Trp	Somatic	104	4.59	5		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	135401946	52	45.83	44		Missense_Mutation	SNP	HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1,superfamily_SSF81321	p.R316W	ENST00000370648.3	37	c.946	CCDS14656.1	X	.	.	.	.	.	.	.	.	.	.	C	19.30	3.801654	0.70682	.	.	ENSG00000102239	ENST00000370648	T	0.37752	1.18	5.81	5.81	0.92471	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000003	T	0.65719	0.2718	M	0.88775	2.98	0.53688	D	0.999975	D	0.89917	1.0	D	0.97110	1.0	T	0.71401	-0.4604	10	0.59425	D	0.04	-10.6137	13.921	0.63930	0.1517:0.8483:0.0:0.0	.	316	P32247	BRS3_HUMAN	W	316	ENSP00000359682:R316W	ENSP00000359682:R316W	R	+	1	2	BRS3	135401946	1.000000	0.71417	1.000000	0.80357	0.815000	0.46073	4.504000	0.60414	2.439000	0.82584	0.600000	0.82982	CGG	-	HMMPfam_7tm_1,superfamily_SSF81321		0.443	BRS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRS3	protein_coding	OTTHUMT00000059005.1	C	NM_001727		135401946	+1	no_errors	NM_001727.1	genbank	human	validated	54_36p	missense	SNP	1.000	T
TDRD10	126668	genome.wustl.edu	37	1	154516513	154516513	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2876-03A-01W-0732-08	TCGA-AB-2876-11A-01W-0732-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	d48c086f-36b5-49ab-9e83-83520c701fd5	e4b17175-746c-47db-a509-7320119351b2	g.chr1:154516513G>A	ENST00000368480.3	+	9	663	c.578G>A	c.(577-579)cGt>cAt	p.R193H	TDRD10_ENST00000368482.4_Missense_Mutation_p.R193H|TDRD10_ENST00000479937.1_3'UTR			Q5VZ19	TDR10_HUMAN	tudor domain containing 10	193							nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.R193L(2)		breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	29	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)			CATAGCGTCCGTGGGGAGGCG	0.617																																						dbGAP											2	Substitution - Missense(2)	lung(2)	1											139.0	117.0	124.0					1																	154516513		2203	4300	6503	152783137	SO:0001583	missense	0			AL713777	CCDS30878.2, CCDS41406.1	1q21.3	2013-02-12			ENSG00000163239	ENSG00000163239		"""Tudor domain containing"", ""RNA binding motif (RRM) containing"""	25316	protein-coding gene	gene with protein product						12975309	Standard	NM_182499		Approved	DKFZp434M202	uc009wow.3	Q5VZ19	OTTHUMG00000037264	ENST00000368480.3:c.578G>A	1.37:g.154516513G>A	ENSP00000357465:p.Arg193His	Somatic	169	2.31	4		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	152783137	126	40.65	87	A4FU09|B0QZ53|B4DXV4|Q3ZCP1|Q3ZCS7|Q5SXY7|Q6UXV2|Q8TCN3	Missense_Mutation	SNP	HMMPfam_RRM_1,HMMSmart_SM00360,HMMPfam_TUDOR,superfamily_RNA-binding domain RBD,superfamily_Tudor/PWWP/MBT	p.R193H	ENST00000368480.3	37	c.578	CCDS41406.1	1	.	.	.	.	.	.	.	.	.	.	G	1.502	-0.551777	0.03996	.	.	ENSG00000163239	ENST00000368482;ENST00000368480	T;T	0.26223	1.76;1.75	4.47	-4.29	0.03721	.	1.720350	0.03817	N	0.266885	T	0.04998	0.0134	N	0.19112	0.55	0.09310	N	1	B;B	0.09022	0.001;0.002	B;B	0.04013	0.0;0.001	T	0.38478	-0.9659	10	0.62326	D	0.03	0.4588	5.7584	0.18186	0.5149:0.0:0.3529:0.1322	.	193;193	Q5VZ19;Q5VZ19-2	TDR10_HUMAN;.	H	193	ENSP00000357467:R193H;ENSP00000357465:R193H	ENSP00000357465:R193H	R	+	2	0	TDRD10	152783137	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.643000	0.05421	-1.241000	0.02526	-0.378000	0.06908	CGT	-	NULL		0.617	TDRD10-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TDRD10	protein_coding	OTTHUMT00000090700.2	G	NM_182499		152783137	+1	no_errors	NM_001098475.1	genbank	human	validated	54_36p	missense	SNP	0.000	A
TET2	54790	genome.wustl.edu	37	4	106156540	106156540	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AB-2876-03A-01W-0732-08	TCGA-AB-2876-11A-01W-0732-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	d48c086f-36b5-49ab-9e83-83520c701fd5	e4b17175-746c-47db-a509-7320119351b2	g.chr4:106156540C>T	ENST00000540549.1	+	3	2301	c.1441C>T	c.(1441-1443)Cag>Tag	p.Q481*	TET2_ENST00000380013.4_Nonsense_Mutation_p.Q481*|TET2_ENST00000305737.2_Nonsense_Mutation_p.Q481*|TET2_ENST00000513237.1_Nonsense_Mutation_p.Q502*|TET2_ENST00000394764.1_Nonsense_Mutation_p.Q481*|TET2_ENST00000413648.2_Nonsense_Mutation_p.Q481*|TET2_ENST00000545826.1_Nonsense_Mutation_p.Q481*			Q6N021	TET2_HUMAN	tet methylcytosine dioxygenase 2	481					5-methylcytosine catabolic process (GO:0006211)|cell cycle (GO:0007049)|DNA demethylation (GO:0080111)|histone H3-K4 trimethylation (GO:0080182)|kidney development (GO:0001822)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|protein O-linked glycosylation (GO:0006493)		DNA binding (GO:0003677)|ferrous iron binding (GO:0008198)|methylcytosine dioxygenase activity (GO:0070579)|zinc ion binding (GO:0008270)	p.Q481*(1)		NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1272)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	1314		Myeloproliferative disorder(5;0.0393)		OV - Ovarian serous cystadenocarcinoma(123;7.18e-08)		TGAAAGGCCTCAGAATAATTG	0.453			"""Mis N, F"""		MDS																																	dbGAP		Rec	yes		4	4q24	54790	tet oncogene family member 2		L	1	Substitution - Nonsense(1)	haematopoietic_and_lymphoid_tissue(1)	4											103.0	98.0	100.0					4																	106156540		2203	4300	6503	106375989	SO:0001587	stop_gained	0			AB046766	CCDS3666.1, CCDS47120.1	4q24	2014-09-17	2011-09-30	2008-03-12	ENSG00000168769	ENSG00000168769			25941	protein-coding gene	gene with protein product		612839	"""KIAA1546"", ""tet oncogene family member 2"""	KIAA1546		10997877, 12646957	Standard	NM_017628		Approved	FLJ20032	uc003hxk.3	Q6N021	OTTHUMG00000131213	ENST00000540549.1:c.1441C>T	4.37:g.106156540C>T	ENSP00000442788:p.Gln481*	Somatic	77	4.94	4		40	52.94	45	WXS	Illumina HiSeq	Phase_IV	106375989	109	46.83	96	B5MDU0|Q2TB88|Q3LIB8|Q96JX5|Q9HCM6|Q9NXW0	Nonsense_Mutation	SNP	NULL	p.Q481*	ENST00000540549.1	37	c.1441	CCDS47120.1	4	.	.	.	.	.	.	.	.	.	.	C	36	5.892296	0.97074	.	.	ENSG00000168769	ENST00000305737;ENST00000540549;ENST00000545826;ENST00000513237;ENST00000380013;ENST00000394764;ENST00000413648;ENST00000535110	.	.	.	5.17	5.17	0.71159	.	2.247170	0.02362	N	0.077003	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	15.8598	0.79012	0.0:1.0:0.0:0.0	.	.	.	.	X	481;481;481;502;481;481;481;481	.	ENSP00000265149:Q481X	Q	+	1	0	TET2	106375989	1.000000	0.71417	1.000000	0.80357	0.157000	0.22087	3.535000	0.53575	2.402000	0.81655	0.650000	0.86243	CAG	-	NULL		0.453	TET2-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	TET2	protein_coding	OTTHUMT00000253952.2	C	NM_017628		106375989	+1	no_errors	NM_017628.1	genbank	human	validated	54_36p	nonsense	SNP	1.000	T
SCARA5	286133	genome.wustl.edu	37	8	27737199	27737199	+	Missense_Mutation	SNP	C	C	T			TCGA-AB-2876-03A-01W-0732-08	TCGA-AB-2876-11A-01W-0732-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	d48c086f-36b5-49ab-9e83-83520c701fd5	e4b17175-746c-47db-a509-7320119351b2	g.chr8:27737199C>T	ENST00000354914.3	-	8	1723	c.1238G>A	c.(1237-1239)cGt>cAt	p.R413H	SCARA5_ENST00000380385.2_Missense_Mutation_p.R188H	NM_173833.5	NP_776194.2	Q6ZMJ2	SCAR5_HUMAN	scavenger receptor class A, member 5	413	SRCR. {ECO:0000255|PROSITE- ProRule:PRU00196}.				cellular iron ion homeostasis (GO:0006879)|cellular response to heat (GO:0034605)|endocytosis (GO:0006897)|iron ion transmembrane transport (GO:0034755)|protein homotrimerization (GO:0070207)|receptor-mediated endocytosis (GO:0006898)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)	ferritin receptor activity (GO:0070287)|scavenger receptor activity (GO:0005044)			central_nervous_system(1)|large_intestine(6)|lung(5)|prostate(3)|skin(3)	18		Ovarian(32;0.0218)		UCEC - Uterine corpus endometrioid carcinoma (27;0.023)|KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)|Colorectal(74;0.228)		GGTGCCCCAACGCCGGTCGTG	0.667																																						dbGAP											0			8											104.0	85.0	92.0					8																	27737199		2203	4300	6503	27793118	SO:0001583	missense	0			AK172746	CCDS6064.1	8p21.1	2014-07-08	2014-07-08		ENSG00000168079	ENSG00000168079			28701	protein-coding gene	gene with protein product		611306	"""scavenger receptor class A, member 5 (putative)"""			19154717	Standard	NM_173833		Approved	FLJ23907, MGC45780, NET33	uc003xgj.3	Q6ZMJ2	OTTHUMG00000132172	ENST00000354914.3:c.1238G>A	8.37:g.27737199C>T	ENSP00000346990:p.Arg413His	Somatic	43	2.27	1		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	27793118	41	56.38	53	Q6UXZ1|Q7Z4A1|Q8N4Z7	Missense_Mutation	SNP	HMMPfam_SRCR,PatternScan_SRCR_1,HMMPfam_Collagen,HMMSmart_SM00202,superfamily_SRCR-like	p.R413H	ENST00000354914.3	37	c.1238	CCDS6064.1	8	.	.	.	.	.	.	.	.	.	.	C	19.58	3.853881	0.71719	.	.	ENSG00000168079	ENST00000354914;ENST00000380385	T;T	0.37411	1.2;1.2	4.87	4.87	0.63330	Speract/scavenger receptor (4);Speract/scavenger receptor-related (2);	0.067490	0.64402	D	0.000011	T	0.51991	0.1707	L	0.42744	1.35	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.77004	0.955;0.989	T	0.50415	-0.8831	10	0.49607	T	0.09	.	15.8518	0.78937	0.0:1.0:0.0:0.0	.	188;413	Q6ZMJ2-4;Q6ZMJ2	.;SCAR5_HUMAN	H	413;188	ENSP00000346990:R413H;ENSP00000369746:R188H	ENSP00000346990:R413H	R	-	2	0	SCARA5	27793118	0.990000	0.36364	0.999000	0.59377	0.984000	0.73092	1.142000	0.31540	2.406000	0.81754	0.591000	0.81541	CGT	-	HMMPfam_SRCR,PatternScan_SRCR_1,HMMSmart_SM00202,superfamily_SRCR-like		0.667	SCARA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCARA5	protein_coding	OTTHUMT00000255223.2	C	NM_173833		27793118	-1	no_errors	NM_173833.4	genbank	human	provisional	54_36p	missense	SNP	1.000	T
MYO3A	53904	genome.wustl.edu	37	10	26305785	26305785	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2876-03A-01W-0732-08	TCGA-AB-2876-11A-01W-0732-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	d48c086f-36b5-49ab-9e83-83520c701fd5	e4b17175-746c-47db-a509-7320119351b2	g.chr10:26305785G>A	ENST00000265944.5	+	7	711	c.545G>A	c.(544-546)cGg>cAg	p.R182Q	MYO3A_ENST00000376302.1_Missense_Mutation_p.R182Q|MYO3A_ENST00000376301.1_Missense_Mutation_p.R182Q|MYO3A_ENST00000543632.1_Missense_Mutation_p.R182Q	NM_017433.4	NP_059129.3	Q8NEV4	MYO3A_HUMAN	myosin IIIA	182	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				ATP catabolic process (GO:0006200)|inner ear development (GO:0048839)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|stereocilium bundle tip (GO:0032426)	actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|plus-end directed microfilament motor activity (GO:0060002)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(9)|central_nervous_system(3)|endometrium(9)|kidney(10)|large_intestine(28)|liver(1)|lung(46)|ovary(11)|pancreas(1)|prostate(6)|skin(11)|stomach(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	146						CGGCACCGTCGGAACACATCC	0.438																																						dbGAP											0			10											110.0	103.0	105.0					10																	26305785		2203	4300	6503	26345791	SO:0001583	missense	0			AF229172	CCDS7148.1	10p11.1	2011-09-27	2004-05-19		ENSG00000095777	ENSG00000095777		"""Myosins / Myosin superfamily : Class III"""	7601	protein-coding gene	gene with protein product		606808	"""deafness, autosomal recessive 30"""	DFNB30		10936054	Standard	NM_017433		Approved		uc001isn.2	Q8NEV4	OTTHUMG00000017837	ENST00000265944.5:c.545G>A	10.37:g.26305785G>A	ENSP00000265944:p.Arg182Gln	Somatic	51	0.00	0		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	26345791	82	43.06	62	Q4G0X2|Q5VZ28|Q8WX17|Q9NYS8	Missense_Mutation	SNP	HMMPfam_IQ,HMMSmart_IQ,HMMPfam_Myosin_head,HMMSmart_MYSc,HMMSmart_S_TKc,PatternScan_PROTEIN_KINASE_ST,superfamily_Kinase_like,PatternScan_PROTEIN_KINASE_ATP,HMMPfam_Pkinase,superfamily_SSF52540	p.R182Q	ENST00000265944.5	37	c.545	CCDS7148.1	10	.	.	.	.	.	.	.	.	.	.	G	29.3	4.991960	0.93167	.	.	ENSG00000095777	ENST00000265944;ENST00000376302;ENST00000543632;ENST00000376301	T;T;T;T	0.64991	-0.13;-0.13;-0.13;-0.13	5.67	2.64	0.31445	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.155814	0.56097	D	0.000028	T	0.67069	0.2854	L	0.32530	0.975	0.49299	D	0.999776	D;D;D;D	0.76494	0.993;0.995;0.999;0.996	P;P;D;P	0.72625	0.745;0.834;0.978;0.875	T	0.66404	-0.5932	10	0.72032	D	0.01	.	11.2167	0.48830	0.0:0.1211:0.6136:0.2653	.	182;182;182;182	F5H0U9;Q0VD65;Q8NEV4;Q4G0X2	.;.;MYO3A_HUMAN;.	Q	182	ENSP00000265944:R182Q;ENSP00000365479:R182Q;ENSP00000445909:R182Q;ENSP00000365478:R182Q	ENSP00000265944:R182Q	R	+	2	0	MYO3A	26345791	1.000000	0.71417	0.987000	0.45799	0.958000	0.62258	4.761000	0.62243	0.252000	0.21531	-0.182000	0.12963	CGG	-	HMMSmart_S_TKc,superfamily_Kinase_like,HMMPfam_Pkinase		0.438	MYO3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO3A	protein_coding	OTTHUMT00000047259.1	G	NM_017433		26345791	+1	no_errors	NM_017433.4	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
DPP3	10072	genome.wustl.edu	37	11	66249800	66249800	+	Silent	SNP	C	C	T	rs200614411		TCGA-AB-2876-03A-01W-0732-08	TCGA-AB-2876-11A-01W-0732-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	d48c086f-36b5-49ab-9e83-83520c701fd5	e4b17175-746c-47db-a509-7320119351b2	g.chr11:66249800C>T	ENST00000360510.2	+	2	194	c.129C>T	c.(127-129)taC>taT	p.Y43Y	CTD-3074O7.5_ENST00000527274.2_RNA|DPP3_ENST00000541961.1_Silent_p.Y43Y|DPP3_ENST00000530165.1_Silent_p.Y43Y|CTD-3074O7.5_ENST00000525142.1_RNA|CTD-3074O7.5_ENST00000533502.1_RNA|DPP3_ENST00000531863.1_Silent_p.Y63Y|DPP3_ENST00000453114.1_Silent_p.Y43Y|DPP3_ENST00000532677.1_Silent_p.Y62Y|CTD-3074O7.5_ENST00000527092.1_RNA			Q9NY33	DPP3_HUMAN	dipeptidyl-peptidase 3	43					proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	dipeptidyl-peptidase activity (GO:0008239)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(2)|stomach(1)	23						CCGCCTGGTACGGAGGCCTGG	0.667																																						dbGAP											0			11											86.0	70.0	76.0					11																	66249800		2200	4295	6495	66006376	SO:0001819	synonymous_variant	0			AB017970	CCDS8141.1, CCDS58147.1	11q12-q13.1	2008-02-05	2006-01-12		ENSG00000254986	ENSG00000254986	3.4.14.4		3008	protein-coding gene	gene with protein product		606818	"""dipeptidylpeptidase III"", ""dipeptidylpeptidase 3"""			10773679	Standard	NM_005700		Approved		uc001oif.2	Q9NY33	OTTHUMG00000167143	ENST00000360510.2:c.129C>T	11.37:g.66249800C>T		Somatic	66	1.49	1		19	53.66	22	WXS	Illumina HiSeq	Phase_IV	66006376	46	36.99	27	B2RDB5|B4DLX4|F5H8L6|O95748|Q969H2|Q9BV67|Q9HAL6	Silent	SNP	HMMPfam_Peptidase_M49	p.Y43	ENST00000360510.2	37	c.129	CCDS8141.1	11																																																																																			-	NULL		0.667	DPP3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	DPP3	protein_coding	OTTHUMT00000393424.2	C			66006376	+1	no_errors	NM_005700.3	genbank	human	reviewed	54_36p	silent	SNP	0.795	T
EED	8726	genome.wustl.edu	37	11	85961447	85961447	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AB-2876-03A-01W-0732-08	TCGA-AB-2876-11A-01W-0732-08	C	C	C	A	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	d48c086f-36b5-49ab-9e83-83520c701fd5	e4b17175-746c-47db-a509-7320119351b2	g.chr11:85961447C>A	ENST00000263360.6	+	2	910	c.224C>A	c.(223-225)tCa>tAa	p.S75*	EED_ENST00000327320.4_Nonsense_Mutation_p.S75*|EED_ENST00000528180.1_Nonsense_Mutation_p.S75*|EED_ENST00000351625.6_Nonsense_Mutation_p.S75*	NM_003797.3	NP_003788.2	O75530	EED_HUMAN	embryonic ectoderm development	75					negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone H3-K27 methylation (GO:0061087)|regulation of gene expression by genetic imprinting (GO:0006349)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|ESC/E(Z) complex (GO:0035098)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)|sex chromatin (GO:0001739)	chromatin binding (GO:0003682)|histone methyltransferase activity (GO:0042054)|identical protein binding (GO:0042802)			haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	21		Acute lymphoblastic leukemia(157;7.24e-07)|all_hematologic(158;0.00092)				AAATGGAAGTCAAAGAAATGC	0.388																																						dbGAP											0			11											95.0	85.0	88.0					11																	85961447		2203	4299	6502	85639095	SO:0001587	stop_gained	0			AF078933	CCDS8273.1, CCDS8274.1	11q14.2-q22.3	2013-01-10			ENSG00000074266	ENSG00000074266		"""WD repeat domain containing"""	3188	protein-coding gene	gene with protein product	"""WD protein associating with integrin cytoplasmic tails 1"""	605984				9765275, 9806832	Standard	NM_003797		Approved	WAIT-1, HEED	uc001pbp.3	O75530	OTTHUMG00000167209	ENST00000263360.6:c.224C>A	11.37:g.85961447C>A	ENSP00000263360:p.Ser75*	Somatic	82	4.65	4		10	33.33	5	WXS	Illumina HiSeq	Phase_IV	85639095	102	35.85	57	A8K7V5|O00149|Q6NTH2|Q7LDA5|Q7LDG8|Q86VV2|Q9UNY7	Nonsense_Mutation	SNP	HMMSmart_SM00320,superfamily_WD40 repeat-like,PatternScan_WD_REPEATS_1,HMMPfam_WD40	p.S75*	ENST00000263360.6	37	c.224	CCDS8273.1	11	.	.	.	.	.	.	.	.	.	.	C	44	10.633772	0.99441	.	.	ENSG00000074266	ENST00000263360;ENST00000528180;ENST00000351625;ENST00000327320;ENST00000537092	.	.	.	4.8	4.8	0.61643	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-6.2209	17.9322	0.89000	0.0:1.0:0.0:0.0	.	.	.	.	X	75	.	.	S	+	2	0	EED	85639095	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.689000	0.84165	2.206000	0.71126	0.580000	0.79431	TCA	-	NULL		0.388	EED-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EED	protein_coding	OTTHUMT00000393733.1	C	NM_003797		85639095	+1	no_errors	NM_003797.2	genbank	human	reviewed	54_36p	nonsense	SNP	1.000	A
MYF5	4617	genome.wustl.edu	37	12	81110903	81110903	+	Missense_Mutation	SNP	A	A	G	rs371882555		TCGA-AB-2876-03A-01W-0732-08	TCGA-AB-2876-11A-01W-0732-08	A	A	A	G	A	A	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	d48c086f-36b5-49ab-9e83-83520c701fd5	e4b17175-746c-47db-a509-7320119351b2	g.chr12:81110903A>G	ENST00000228644.3	+	1	213	c.61A>G	c.(61-63)Ata>Gta	p.I21V		NM_005593.2	NP_005584.2	P13349	MYF5_HUMAN	myogenic factor 5	21					camera-type eye development (GO:0043010)|cartilage condensation (GO:0001502)|embryonic skeletal system morphogenesis (GO:0048704)|extracellular matrix organization (GO:0030198)|muscle cell differentiation (GO:0042692)|muscle cell fate commitment (GO:0042693)|muscle organ development (GO:0007517)|muscle tissue morphogenesis (GO:0060415)|ossification (GO:0001503)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell-matrix adhesion (GO:0001952)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal muscle cell differentiation (GO:0035914)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)	protein heterodimerization activity (GO:0046982)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(8)|lung(15)|ovary(2)|pancreas(1)	30						CGGCTCCTGCATACCGTCCCC	0.612																																						dbGAP											0			12						A	VAL/ILE	1,4405	2.1+/-5.4	0,1,2202	59.0	54.0	55.0		61	6.2	1.0	12		55	0,8600		0,0,4300	no	missense	MYF5	NM_005593.2	29	0,1,6502	GG,GA,AA		0.0,0.0227,0.0077	benign	21/256	81110903	1,13005	2203	4300	6503	79635034	SO:0001583	missense	0				CCDS9020.1	12q21	2013-05-21			ENSG00000111049	ENSG00000111049		"""Basic helix-loop-helix proteins"""	7565	protein-coding gene	gene with protein product		159990				8978788, 12105204	Standard	NM_005593		Approved	bHLHc2	uc001szg.2	P13349	OTTHUMG00000170166	ENST00000228644.3:c.61A>G	12.37:g.81110903A>G	ENSP00000228644:p.Ile21Val	Somatic	33	8.33	3		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	79635034	44	32.31	21	Q6ISR9	Missense_Mutation	SNP	HMMPfam_HLH,HMMSmart_HLH,HMMPfam_Basic,HMMSmart_BASIC,superfamily_HLH_basic	p.I21V	ENST00000228644.3	37	c.61	CCDS9020.1	12	.	.	.	.	.	.	.	.	.	.	A	13.90	2.374254	0.42105	2.27E-4	0.0	ENSG00000111049	ENST00000228644	T	0.76316	-1.01	6.17	6.17	0.99709	Myogenic basic muscle-specific protein (2);	0.398932	0.30383	N	0.009755	T	0.76521	0.3999	M	0.63428	1.95	0.31733	N	0.636769	B	0.25351	0.124	B	0.31442	0.13	T	0.77800	-0.2452	10	0.44086	T	0.13	-3.3814	12.4758	0.55811	0.8513:0.1487:0.0:0.0	.	21	P13349	MYF5_HUMAN	V	21	ENSP00000228644:I21V	ENSP00000228644:I21V	I	+	1	0	MYF5	79635034	1.000000	0.71417	0.999000	0.59377	0.973000	0.67179	2.994000	0.49433	2.371000	0.80710	0.533000	0.62120	ATA	-	HMMPfam_Basic,HMMSmart_BASIC		0.612	MYF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYF5	protein_coding	OTTHUMT00000407757.1	A	NM_005593		79635034	+1	no_errors	NM_005593.2	genbank	human	validated	54_36p	missense	SNP	0.999	G
SMCHD1	23347	genome.wustl.edu	37	18	2763718	2763718	+	Silent	SNP	T	T	C			TCGA-AB-2876-03A-01W-0732-08	TCGA-AB-2876-11A-01W-0732-08	T	T	T	C	T	T	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	d48c086f-36b5-49ab-9e83-83520c701fd5	e4b17175-746c-47db-a509-7320119351b2	g.chr18:2763718T>C	ENST00000320876.6	+	37	4988	c.4650T>C	c.(4648-4650)gaT>gaC	p.D1550D	RP11-703M24.5_ENST00000583546.1_RNA|SMCHD1_ENST00000261598.8_Silent_p.D1550D	NM_015295.2	NP_056110.2	A6NHR9	SMHD1_HUMAN	structural maintenance of chromosomes flexible hinge domain containing 1	1550					chromosome organization (GO:0051276)|inactivation of X chromosome by DNA methylation (GO:0060821)	Barr body (GO:0001740)	ATP binding (GO:0005524)			NS(3)|breast(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(16)|lung(15)|pancreas(1)	45						AAGATACTGATACCCCACTTT	0.358																																						dbGAP											0			18											96.0	93.0	94.0					18																	2763718		1830	4094	5924	2753718	SO:0001819	synonymous_variant	0			AB014550	CCDS45822.1	18p11.32	2010-05-12			ENSG00000101596	ENSG00000101596			29090	protein-coding gene	gene with protein product		614982				9734811	Standard	NM_015295		Approved	KIAA0650	uc002klm.4	A6NHR9		ENST00000320876.6:c.4650T>C	18.37:g.2763718T>C		Somatic	49	5.77	3		47	46.59	41	WXS	Illumina HiSeq	Phase_IV	2753718	57	46.73	50	O75141|Q6AHX6|Q6ZTQ8|Q9H6Q2|Q9UG39	Silent	SNP	HMMPfam_HATPase_c,superfamily_ATPase domain of HSP90 chaperone/DNA topoisomerase II/histidine kinase,HMMPfam_SMC_hinge,superfamily_Smc hinge domain	p.D1550	ENST00000320876.6	37	c.4650	CCDS45822.1	18																																																																																			-	NULL		0.358	SMCHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMCHD1	protein_coding	OTTHUMT00000441082.2	T			2753718	+1	no_errors	NM_015295.2	genbank	human	validated	54_36p	silent	SNP	0.919	C
MEX3C	51320	genome.wustl.edu	37	18	48702766	48702766	+	5'Flank	SNP	T	T	C	rs150981349	byFrequency	TCGA-AB-2876-03A-01W-0732-08	TCGA-AB-2876-11A-01W-0732-08	T	T	T	C	T	T	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	d48c086f-36b5-49ab-9e83-83520c701fd5	e4b17175-746c-47db-a509-7320119351b2	g.chr18:48702766T>C	ENST00000591040.1	-	0	799							Q5U5Q3	MEX3C_HUMAN	mex-3 RNA binding family member C						chondrocyte hypertrophy (GO:0003415)|energy homeostasis (GO:0097009)|regulation of fat cell differentiation (GO:0045598)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|lung(11)|ovary(1)|skin(1)	17		Colorectal(6;0.003)|all_epithelial(6;0.0473)		Colorectal(16;0.0175)|READ - Rectum adenocarcinoma(32;0.15)		TCTGGCAAACTGGACATGATG	0.408													T|||	4	0.000798722	0.003	0.0	5008	,	,		19021	0.0		0.0	False		,,,				2504	0.0					dbGAP											0			18						T		9,4397	14.3+/-33.2	0,9,2194	127.0	112.0	117.0		1935	4.6	1.0	18	dbSNP_134	117	0,8600		0,0,4300	no	coding-synonymous	MEX3C	NM_016626.4		0,9,6494	CC,CT,TT		0.0,0.2043,0.0692		645/660	48702766	9,12997	2203	4300	6503	46956764	SO:0001631	upstream_gene_variant	0			BC041122	CCDS11951.2	18q21.1	2013-08-21	2013-08-21	2007-07-18	ENSG00000176624	ENSG00000176624		"""RING-type (C3HC4) zinc fingers"", ""Mex-3 homologs"""	28040	protein-coding gene	gene with protein product		611005	"""ring finger and KH domain containing 2"", ""mex-3 homolog C (C. elegans)"""	RKHD2		17267406	Standard	NM_016626		Approved	FLJ38871, RNF194	uc002lfc.4	Q5U5Q3	OTTHUMG00000132693		18.37:g.48702766T>C	Exception_encountered	Somatic	116	2.52	3		21	59.62	31	WXS	Illumina HiSeq	Phase_IV	46956764	83	47.13	74	A1L022|Q9NZE3	Silent	SNP	HMMSmart_RING,HMMSmart_KH,PatternScan_ZF_RING_1,HMMPfam_KH_1,HMMPfam_zf-C3HC4,superfamily_SSF54791,superfamily_SSF57850	p.P645	ENST00000591040.1	37	c.1935		18																																																																																			-	HMMSmart_RING,HMMPfam_zf-C3HC4,superfamily_SSF57850		0.408	MEX3C-003	KNOWN	mRNA_end_NF|basic	processed_transcript	MEX3C	protein_coding	OTTHUMT00000449559.1	T	NM_016626		46956764	-1	no_errors	NM_016626.3	genbank	human	validated	54_36p	silent	SNP	1.000	C
BPIFB2	80341	genome.wustl.edu	37	20	31601736	31601736	+	Silent	SNP	C	C	T	rs141108798		TCGA-AB-2876-03A-01W-0732-08	TCGA-AB-2876-11A-01W-0732-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	d48c086f-36b5-49ab-9e83-83520c701fd5	e4b17175-746c-47db-a509-7320119351b2	g.chr20:31601736C>T	ENST00000170150.3	+	5	624	c.429C>T	c.(427-429)caC>caT	p.H143H		NM_025227.1	NP_079503.1	Q8N4F0	BPIB2_HUMAN	BPI fold containing family B, member 2	143						extracellular vesicular exosome (GO:0070062)	lipid binding (GO:0008289)										TCTCGGGCCACGCCAACGAGT	0.597																																						dbGAP											0			20						C		0,4406		0,0,2203	56.0	49.0	52.0		429	-6.7	0.0	20	dbSNP_134	52	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	BPIFB2	NM_025227.1		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		143/459	31601736	1,13005	2203	4300	6503	31065397	SO:0001819	synonymous_variant	0			AF465765	CCDS13210.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000078898	ENSG00000078898		"""BPI fold containing"""	16177	protein-coding gene	gene with protein product		614108	"""bactericidal/permeability-increasing protein-like 1"""	C20orf184, BPIL1		12185532, 21787333	Standard	NM_025227		Approved	dJ726C3.2, LPLUNC2	uc002wyj.4	Q8N4F0	OTTHUMG00000032232	ENST00000170150.3:c.429C>T	20.37:g.31601736C>T		Somatic	67	9.46	7		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	31065397	47	50.00	47	Q6UWN3|Q6ZME0|Q8NFQ7	Silent	SNP	HMMPfam_LBP_BPI_CETP_C,HMMSmart_SM00329,HMMPfam_LBP_BPI_CETP,superfamily_Bactericidal permeability-increasing protein BPI	p.H143	ENST00000170150.3	37	c.429	CCDS13210.1	20																																																																																			-	HMMPfam_LBP_BPI_CETP,superfamily_Bactericidal permeability-increasing protein BPI		0.597	BPIFB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BPIL1	protein_coding	OTTHUMT00000078652.2	C	NM_025227		31065397	+1	no_errors	NM_025227.1	genbank	human	reviewed	54_36p	silent	SNP	0.000	T
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	DEL	A	A	-			TCGA-AB-2876-03A-01W-0732-08	TCGA-AB-2876-11A-01W-0732-08	A	A	A	-	A	A	Verified	Invalid:failed_liftOver	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	d48c086f-36b5-49ab-9e83-83520c701fd5	e4b17175-746c-47db-a509-7320119351b2	g.chrUnknown:0delA								None (None upstream) : None (None downstream)																								0.0																																						dbGAP											0			4																																								106376562	SO:0001628	intergenic_variant	0																															Unknown.37:g.0delA		Somatic	0	0.00	0		0	0.00	0	WXS	Illumina HiSeq	Phase_IV	106376562	0	0.00	0		Frame_Shift_Del	DEL	NULL	p.H672fs		37	c.2014		4																																																																																			-	NULL	0	0					TET2			A			106376562	+1	no_errors	NM_017628.1	genbank	human	validated	54_36p	frame_shift_del	DEL	0.114	-
PHACTR1	221692	genome.wustl.edu	37	6	13206134	13206135	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AB-2876-03A-01W-0732-08	TCGA-AB-2876-11A-01W-0732-08	-	-	-	G	-	-	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	d48c086f-36b5-49ab-9e83-83520c701fd5	e4b17175-746c-47db-a509-7320119351b2	g.chr6:13206134_13206135insG	ENST00000379350.1	+	7	881_882	c.752_753insG	c.(751-756)gtggggfs	p.VG251fs	PHACTR1_ENST00000457702.2_Frame_Shift_Ins_p.VG106fs|PHACTR1_ENST00000379345.2_Intron|PHACTR1_ENST00000332995.7_Frame_Shift_Ins_p.VG251fs			Q9C0D0	PHAR1_HUMAN	phosphatase and actin regulator 1	251					actin cytoskeleton reorganization (GO:0031532)|actomyosin structure organization (GO:0031032)|cell motility (GO:0048870)|stress fiber assembly (GO:0043149)	cell junction (GO:0030054)|cytosol (GO:0005829)|nucleus (GO:0005634)|synapse (GO:0045202)	actin binding (GO:0003779)|protein phosphatase inhibitor activity (GO:0004864)			breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	26	Breast(50;0.0427)|Ovarian(93;0.12)	all_hematologic(90;0.122)|Lung SC(78;0.195)	Epithelial(50;0.146)|BRCA - Breast invasive adenocarcinoma(129;0.239)			TGTATGCCCGTGGGGGGGCCAG	0.599																																						dbGAP											0			6																																								13314114	SO:0001589	frameshift_variant	0			AB051520	CCDS75401.1	6p23	2013-01-24	2004-05-20	2004-05-21	ENSG00000112137	ENSG00000112137		"""Phosphatase and actin regulators"""	20990	protein-coding gene	gene with protein product		608723	"""RPEL repeat containing 1"""	RPEL1		11214970, 15107502	Standard	NM_030948		Approved	KIAA1733, dJ257A7.2	uc010jpc.3	Q9C0D0	OTTHUMG00000014270	ENST00000379350.1:c.759dupG	6.37:g.13206141_13206141dupG	ENSP00000368655:p.Val251fs	Somatic	12	0.00	0		10	0.00	0	WXS	Illumina HiSeq	Phase_IV	13314113	34	17.07	7	A8K1V2|Q3MJ93|Q5JSJ2	Frame_Shift_Ins	INS	HMMPfam_RPEL,HMMSmart_SM00707	p.P254fs	ENST00000379350.1	37	c.752_753		6																																																																																			-	NULL		0.599	PHACTR1-001	KNOWN	basic|appris_candidate_longest	protein_coding	PHACTR1	protein_coding	OTTHUMT00000039876.1	-	XM_166420		13314114	+1	no_errors	NM_030948.1	genbank	human	validated	54_36p	frame_shift_ins	INS	0.638:0.521	G
