#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NormalRefReads_WU	i_NormalVAF_WU	i_NormalVarReads_WU	i_ORegAnno_bin	i_RNARefReads_WU	i_RNAVAF_WU	i_RNAVarReads_WU	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TumorRefReads_WU	i_TumorVAF_WU	i_TumorVarReads_WU	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
WNK3	65267	genome.wustl.edu	37	X	54334368	54334368	+	Missense_Mutation	SNP	C	C	T			TCGA-AB-2915-03A-01W-0745-08	TCGA-AB-2915-11A-01W-0745-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	7f3f32b0-89db-4deb-84f1-5c0013f33668	733a0414-1086-4395-9859-9f85aad1863f	g.chrX:54334368C>T	ENST00000375159.2	-	4	1075	c.1076G>A	c.(1075-1077)cGg>cAg	p.R359Q	WNK3_ENST00000375169.3_Missense_Mutation_p.R359Q|WNK3_ENST00000354646.2_Missense_Mutation_p.R359Q			Q9BYP7	WNK3_HUMAN	WNK lysine deficient protein kinase 3	359	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of ion transmembrane transporter activity (GO:0032414)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of rubidium ion transmembrane transporter activity (GO:2000688)|positive regulation of rubidium ion transport (GO:2000682)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			autonomic_ganglia(1)|biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(24)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80						AGTTACTTTCCGGTATATTTG	0.343																																						dbGAP											0			X											142.0	126.0	132.0					X																	54334368		2203	4300	6503	54351093	SO:0001583	missense	0			AJ409088	CCDS14357.1, CCDS35302.1	Xp11.22	2008-05-14	2005-01-19	2005-01-22	ENSG00000196632	ENSG00000196632			14543	protein-coding gene	gene with protein product		300358	"""protein kinase, lysine deficient 3"""	PRKWNK3			Standard	NM_020922		Approved		uc004dtc.2	Q9BYP7	OTTHUMG00000021626	ENST00000375159.2:c.1076G>A	X.37:g.54334368C>T	ENSP00000364301:p.Arg359Gln	Somatic	66	1.47	1		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	54351093	144	37.71	89	B1AKG2|Q5JRC1|Q6JP76|Q8TCX6|Q9HCK6	Missense_Mutation	SNP	HMMSmart_S_TKc,PatternScan_PROTEIN_KINASE_ST,superfamily_Kinase_like,HMMPfam_Pkinase	p.R359Q	ENST00000375159.2	37	c.1076	CCDS14357.1	X	.	.	.	.	.	.	.	.	.	.	C	31	5.074768	0.94000	.	.	ENSG00000196632	ENST00000375169;ENST00000354646;ENST00000375159	T;T;T	0.25250	1.81;1.81;1.81	5.38	5.38	0.77491	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.56097	D	0.000024	T	0.35653	0.0939	N	0.13272	0.32	0.44104	D	0.996871	D;D	0.89917	1.0;1.0	D;D	0.77557	0.984;0.99	T	0.37731	-0.9693	10	0.72032	D	0.01	-9.603	17.083	0.86603	0.0:1.0:0.0:0.0	.	359;359	Q9BYP7-3;Q9BYP7	.;WNK3_HUMAN	Q	359	ENSP00000364312:R359Q;ENSP00000346667:R359Q;ENSP00000364301:R359Q	ENSP00000346667:R359Q	R	-	2	0	WNK3	54351093	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	7.731000	0.84895	2.386000	0.81285	0.544000	0.68410	CGG	-	HMMSmart_S_TKc,superfamily_Kinase_like,HMMPfam_Pkinase		0.343	WNK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WNK3	protein_coding	OTTHUMT00000056799.2	C	NM_020922		54351093	-1	no_errors	NM_020922.2	genbank	human	validated	54_36p	missense	SNP	1.000	T
TCEAL1	9338	genome.wustl.edu	37	X	102884907	102884907	+	Silent	SNP	G	G	A			TCGA-AB-2915-03A-01W-0745-08	TCGA-AB-2915-11A-01W-0745-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	7f3f32b0-89db-4deb-84f1-5c0013f33668	733a0414-1086-4395-9859-9f85aad1863f	g.chrX:102884907G>A	ENST00000372625.3	+	3	227	c.63G>A	c.(61-63)gaG>gaA	p.E21E	TCEAL1_ENST00000372626.3_Silent_p.E21E|TCEAL1_ENST00000469820.1_3'UTR|TCEAL1_ENST00000372624.3_Silent_p.E21E	NM_001006639.1|NM_004780.2	NP_001006640.1|NP_004771.2	Q15170	TCAL1_HUMAN	transcription elongation factor A (SII)-like 1	19	Arg/Ser-rich.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)			ovary(1)	1						CCGATGAGGAGAGGCCTCCGG	0.547																																						dbGAP											0			X											15.0	13.0	14.0					X																	102884907		2190	4274	6464	102771563	SO:0001819	synonymous_variant	0			M99701	CCDS35358.1	Xq22.1	2014-03-21			ENSG00000172465	ENSG00000172465			11616	protein-coding gene	gene with protein product		300237				8206389, 7971997, 16221301	Standard	NM_004780		Approved	p21, pp21, SIIR, P21, WEX9	uc004eku.3	Q15170	OTTHUMG00000022699	ENST00000372625.3:c.63G>A	X.37:g.102884907G>A		Somatic	30	0.00	0		27	0.00	0	WXS	Illumina HiSeq	Phase_IV	102771563	68	40.00	46	Q9UJQ9	Silent	SNP	HMMPfam_TFA	p.E21	ENST00000372625.3	37	c.63	CCDS35358.1	X	.	.	.	.	.	.	.	.	.	.	G	11.87	1.767977	0.31320	.	.	ENSG00000172465	ENST00000537029	.	.	.	4.52	-0.667	0.11395	.	.	.	.	.	T	0.20170	0.0485	.	.	.	0.09310	N	0.999995	.	.	.	.	.	.	T	0.23476	-1.0187	4	.	.	.	-6.1782	1.4913	0.02457	0.2845:0.1408:0.4283:0.1464	.	.	.	.	K	20	.	.	R	+	2	0	TCEAL1	102771563	0.085000	0.21516	0.000000	0.03702	0.656000	0.38851	0.157000	0.16402	-0.275000	0.09219	0.600000	0.82982	AGA	-	HMMPfam_TFA		0.547	TCEAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCEAL1	protein_coding	OTTHUMT00000058903.1	G	NM_004780		102771563	+1	no_errors	NM_001006639.1	genbank	human	reviewed	54_36p	silent	SNP	0.807	A
ARHGEF10L	55160	genome.wustl.edu	37	1	17948359	17948359	+	Splice_Site	SNP	G	G	A			TCGA-AB-2915-03A-01W-0745-08	TCGA-AB-2915-11A-01W-0745-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	7f3f32b0-89db-4deb-84f1-5c0013f33668	733a0414-1086-4395-9859-9f85aad1863f	g.chr1:17948359G>A	ENST00000361221.3	+	11	1102	c.943G>A	c.(943-945)Gtg>Atg	p.V315M	ARHGEF10L_ENST00000375420.3_Splice_Site_p.V73M|ARHGEF10L_ENST00000375408.3_Splice_Site_p.V93M|ARHGEF10L_ENST00000469726.1_3'UTR|ARHGEF10L_ENST00000452522.1_Splice_Site_p.V276M|ARHGEF10L_ENST00000434513.1_Splice_Site_p.V315M|ARHGEF10L_ENST00000375415.1_Splice_Site_p.V276M|ARHGEF10L_ENST00000167825.4_Splice_Site_p.V93M	NM_018125.3	NP_060595	Q9HCE6	ARGAL_HUMAN	Rho guanine nucleotide exchange factor (GEF) 10-like	315						cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(2)|lung(16)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	43		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00598)|COAD - Colon adenocarcinoma(227;1.62e-05)|BRCA - Breast invasive adenocarcinoma(304;1.68e-05)|Kidney(64;0.000269)|KIRC - Kidney renal clear cell carcinoma(64;0.00361)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0718)|Lung(427;0.204)		GCCCGAGCAGGTGGTCCGGAG	0.577																																						dbGAP											0			1											103.0	98.0	100.0					1																	17948359		2203	4300	6503	17820946	SO:0001630	splice_region_variant	0			AB046846	CCDS182.1, CCDS30617.1	1p36.13	2011-11-16			ENSG00000074964	ENSG00000074964		"""Rho guanine nucleotide exchange factors"""	25540	protein-coding gene	gene with protein product	"""GrinchGEF"""	612494				10997877, 16112081	Standard	XM_005245923		Approved	FLJ10521, KIAA1626	uc001ban.3	Q9HCE6	OTTHUMG00000002514	ENST00000361221.3:c.943-1G>A	1.37:g.17948359G>A		Somatic	36	0.00	0		11	42.11	8	WXS	Illumina HiSeq	Phase_IV	17820946	91	40.38	63	B7ZKS1|Q17RW1|Q3YFJ4|Q5VXI5|Q5VXI6|Q66K51|Q6P0L7|Q8NAV5|Q9NVT3	Missense_Mutation	SNP	HMMPfam_RhoGEF,HMMSmart_SM00325,superfamily_DBL homology domain (DH-domain),superfamily_WD40 repeat-like,superfamily_PH domain-like	p.V315M	ENST00000361221.3	37	c.943	CCDS182.1	1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.458294	0.84317	.	.	ENSG00000074964	ENST00000361221;ENST00000452522;ENST00000434513;ENST00000375415;ENST00000375420;ENST00000375408;ENST00000457829;ENST00000167825	T;T;T;T;T;T;T	0.32023	1.47;1.47;1.47;1.47;1.47;1.47;1.47	5.09	5.09	0.68999	Dbl homology (DH) domain (2);	0.000000	0.64402	D	0.000001	T	0.51329	0.1668	L	0.55990	1.75	0.80722	D	1	D;P;D;D;D;D;D;D	0.76494	0.985;0.913;0.998;0.999;0.968;0.995;0.999;0.998	P;P;D;D;P;D;D;D	0.83275	0.866;0.726;0.974;0.996;0.823;0.952;0.975;0.945	T	0.45249	-0.9274	9	.	.	.	-28.7297	17.0479	0.86509	0.0:0.0:1.0:0.0	.	93;73;315;93;81;276;276;315	Q5VXI4;B4DTE2;Q9HCE6-5;Q9HCE6-4;B3KX74;Q9HCE6-3;Q9HCE6-2;Q9HCE6	.;.;.;.;.;.;.;ARGAL_HUMAN	M	315;276;315;276;73;93;93;93	ENSP00000355060:V315M;ENSP00000399401:V276M;ENSP00000394621:V315M;ENSP00000364564:V276M;ENSP00000364569:V73M;ENSP00000364557:V93M;ENSP00000167825:V93M	.	V	+	1	0	ARHGEF10L	17820946	1.000000	0.71417	1.000000	0.80357	0.883000	0.51084	4.935000	0.63498	2.370000	0.80446	0.561000	0.74099	GTG	-	superfamily_DBL homology domain (DH-domain)		0.577	ARHGEF10L-001	KNOWN	basic|CCDS	protein_coding	ARHGEF10L	protein_coding	OTTHUMT00000007147.1	G	NM_018125	Missense_Mutation	17820946	+1	no_errors	NM_018125.2	genbank	human	validated	54_36p	missense	SNP	1.000	A
FLG	2312	genome.wustl.edu	37	1	152278709	152278709	+	Missense_Mutation	SNP	T	T	A			TCGA-AB-2915-03A-01W-0745-08	TCGA-AB-2915-11A-01W-0745-08	T	T	T	A	T	T	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	7f3f32b0-89db-4deb-84f1-5c0013f33668	733a0414-1086-4395-9859-9f85aad1863f	g.chr1:152278709T>A	ENST00000368799.1	-	3	8688	c.8653A>T	c.(8653-8655)Agg>Tgg	p.R2885W	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2885	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCCTGGCGCCTGCTTCTCCTG	0.567									Ichthyosis																													dbGAP											0			1											99.0	159.0	139.0					1																	152278709		2059	4278	6337	150545333	SO:0001583	missense	0	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.8653A>T	1.37:g.152278709T>A	ENSP00000357789:p.Arg2885Trp	Somatic	15	0.00	0		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	150545333	85	27.50	33	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	PatternScan_S100_CABP,HMMPfam_Filaggrin,HMMPfam_S_100,PatternScan_EF_HAND_1,superfamily_SSF47473	p.R2885W	ENST00000368799.1	37	c.8653	CCDS30860.1	1	.	.	.	.	.	.	.	.	.	.	T	11.04	1.521988	0.27211	.	.	ENSG00000143631	ENST00000368799;ENST00000368796	T	0.04454	3.62	3.61	-0.395	0.12431	.	.	.	.	.	T	0.05227	0.0139	M	0.72118	2.19	0.09310	N	1	D	0.56968	0.978	P	0.60068	0.868	T	0.28235	-1.0050	9	0.72032	D	0.01	.	2.1257	0.03738	0.2339:0.277:0.0:0.4891	.	2885	P20930	FILA_HUMAN	W	2885;147	ENSP00000357789:R2885W	ENSP00000357786:R147W	R	-	1	2	FLG	150545333	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-0.187000	0.09656	0.390000	0.25115	0.254000	0.18369	AGG	-	HMMPfam_Filaggrin		0.567	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	protein_coding	OTTHUMT00000033742.1	T	NM_002016		150545333	-1	no_errors	NM_002016.1	genbank	human	provisional	54_36p	missense	SNP	0.000	A
ZNF648	127665	genome.wustl.edu	37	1	182027086	182027086	+	Silent	SNP	A	A	C			TCGA-AB-2915-03A-01W-0745-08	TCGA-AB-2915-11A-01W-0745-08	A	A	A	C	A	A	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	7f3f32b0-89db-4deb-84f1-5c0013f33668	733a0414-1086-4395-9859-9f85aad1863f	g.chr1:182027086A>C	ENST00000339948.3	-	2	267	c.60T>G	c.(58-60)acT>acG	p.T20T		NM_001009992.1	NP_001009992.1	Q5T619	ZN648_HUMAN	zinc finger protein 648	20					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(7)|large_intestine(10)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	40						GAGCTTCCTCAGTCAAGCTGC	0.572																																					NSCLC(71;908 1374 5429 20458 35642)	dbGAP											0			1											83.0	73.0	76.0					1																	182027086		2203	4300	6503	180293709	SO:0001819	synonymous_variant	0			AK128654	CCDS30952.1	1q25.3	2013-01-08			ENSG00000179930	ENSG00000179930		"""Zinc fingers, C2H2-type"""	18190	protein-coding gene	gene with protein product							Standard	NM_001009992		Approved	FLJ46813	uc001goz.3	Q5T619	OTTHUMG00000037302	ENST00000339948.3:c.60T>G	1.37:g.182027086A>C		Somatic	51	1.92	1		0	0.00	0	WXS	Illumina HiSeq	Phase_IV	180293709	93	56.28	121	B2RP16	Silent	SNP	HMMPfam_zf-C2H2,PatternScan_ZINC_FINGER_C2H2_1,HMMSmart_ZnF_C2H2,superfamily_SSF57667	p.T20	ENST00000339948.3	37	c.60	CCDS30952.1	1																																																																																			-	NULL		0.572	ZNF648-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF648	protein_coding	OTTHUMT00000090794.1	A	XM_060597		180293709	-1	no_errors	NM_001009992.1	genbank	human	provisional	54_36p	silent	SNP	0.151	C
WDR35	57539	genome.wustl.edu	37	2	20153619	20153619	+	Missense_Mutation	SNP	C	C	T	rs146380332		TCGA-AB-2915-03A-01W-0745-08	TCGA-AB-2915-11A-01W-0745-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	7f3f32b0-89db-4deb-84f1-5c0013f33668	733a0414-1086-4395-9859-9f85aad1863f	g.chr2:20153619C>T	ENST00000345530.3	-	13	1524	c.1409G>A	c.(1408-1410)cGg>cAg	p.R470Q	WDR35_ENST00000416055.2_Missense_Mutation_p.R35Q|WDR35_ENST00000281405.4_Missense_Mutation_p.R459Q	NM_001006657.1	NP_001006658.1	Q9P2L0	WDR35_HUMAN	WD repeat domain 35	470					cilium assembly (GO:0042384)|intraciliary retrograde transport (GO:0035721)	axoneme (GO:0005930)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|intraciliary transport particle A (GO:0030991)		p.R470L(2)|p.R470Q(1)		breast(1)|endometrium(5)|kidney(8)|large_intestine(8)|lung(16)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTTTCGAGACCGTGTGATCTG	0.378																																						dbGAP											3	Substitution - Missense(3)	lung(2)|kidney(1)	2						C	GLN/ARG,GLN/ARG	0,4406		0,0,2203	222.0	209.0	213.0		1409,1376	5.7	1.0	2	dbSNP_134	213	2,8598	2.2+/-6.3	0,2,4298	yes	missense,missense	WDR35	NM_001006657.1,NM_020779.3	43,43	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	benign,benign	470/1182,459/1171	20153619	2,13004	2203	4300	6503	20017100	SO:0001583	missense	0			AB037757	CCDS1695.1, CCDS33152.1	2p24.3	2014-02-21			ENSG00000118965	ENSG00000118965		"""WD repeat domain containing"", ""Intraflagellar transport homologs"""	29250	protein-coding gene	gene with protein product		613602				10718198	Standard	NM_001006657		Approved	MGC33196, KIAA1336, IFT121, IFTA1	uc002rdi.3	Q9P2L0	OTTHUMG00000090737	ENST00000345530.3:c.1409G>A	2.37:g.20153619C>T	ENSP00000314444:p.Arg470Gln	Somatic	71	2.74	2		13	0.00	0	WXS	Illumina HiSeq	Phase_IV	20017100	179	45.62	151	B3KVI5|Q4ZG01|Q8NE11	Missense_Mutation	SNP	HMMSmart_SM00320,superfamily_WD40 repeat-like,HMMPfam_WD40	p.R470Q	ENST00000345530.3	37	c.1409	CCDS33152.1	2	.	.	.	.	.	.	.	.	.	.	C	16.44	3.124998	0.56721	0.0	2.33E-4	ENSG00000118965	ENST00000345530;ENST00000281405;ENST00000416055;ENST00000453014	D;D;D;D	0.95412	-3.7;-3.7;-3.7;-2.06	5.65	5.65	0.86999	.	0.111526	0.64402	D	0.000018	D	0.88894	0.6561	N	0.16790	0.44	0.49213	D	0.999761	P;P;B;B	0.40681	0.467;0.727;0.045;0.108	B;B;B;B	0.26693	0.05;0.072;0.007;0.014	D	0.88505	0.3085	10	0.25751	T	0.34	-9.7278	18.7155	0.91673	0.0:1.0:0.0:0.0	.	470;459;470;35	F8WB94;Q9P2L0-2;Q9P2L0;B3KR94	.;.;WDR35_HUMAN;.	Q	470;459;35;5	ENSP00000314444:R470Q;ENSP00000281405:R459Q;ENSP00000399159:R35Q;ENSP00000404409:R5Q	ENSP00000281405:R459Q	R	-	2	0	WDR35	20017100	1.000000	0.71417	0.990000	0.47175	0.993000	0.82548	4.648000	0.61425	2.672000	0.90937	0.561000	0.74099	CGG	-	superfamily_WD40 repeat-like		0.378	WDR35-001	KNOWN	basic|CCDS	protein_coding	WDR35	protein_coding	OTTHUMT00000207472.2	C	NM_020779		20017100	-1	no_errors	NM_001006657.1	genbank	human	reviewed	54_36p	missense	SNP	0.996	T
MAP2	4133	genome.wustl.edu	37	2	210561004	210561004	+	Silent	SNP	C	C	T	rs147926728		TCGA-AB-2915-03A-01W-0745-08	TCGA-AB-2915-11A-01W-0745-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	7f3f32b0-89db-4deb-84f1-5c0013f33668	733a0414-1086-4395-9859-9f85aad1863f	g.chr2:210561004C>T	ENST00000360351.4	+	7	4616	c.4110C>T	c.(4108-4110)gaC>gaT	p.D1370D	MAP2_ENST00000392194.1_Intron|MAP2_ENST00000199940.6_Intron|MAP2_ENST00000447185.1_Silent_p.D1366D|MAP2_ENST00000361559.4_Intron	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2	1370					axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)	p.D1370D(1)		breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	AAACCTATGACGATTACAAAG	0.458																																					Pancreas(27;423 979 28787 29963)	dbGAP											1	Substitution - coding silent(1)	kidney(1)	2						T	,,,	2,4404	4.2+/-10.8	0,2,2201	73.0	84.0	80.0		,4110,,	-10.5	0.1	2	dbSNP_134	80	0,8600		0,0,4300	no	intron,coding-synonymous,intron,intron	MAP2	NM_001039538.1,NM_002374.3,NM_031845.2,NM_031847.2	,,,	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	,,,	,1370/1828,,	210561004	2,13004	2203	4300	6503	210269249	SO:0001819	synonymous_variant	0				CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.4110C>T	2.37:g.210561004C>T		Somatic	73	0.00	0		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	210269249	109	43.88	86	Q17S04|Q8IUX2|Q99975|Q99976	Silent	SNP	HMMPfam_Tubulin-binding,PatternScan_TAU_MAP,HMMPfam_MAP2_projctn,HMMPfam_RII_binding_1	p.D1370	ENST00000360351.4	37	c.4110	CCDS2384.1	2																																																																																			-	HMMPfam_MAP2_projctn		0.458	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAP2	protein_coding	OTTHUMT00000256521.2	C	NM_001039538		210269249	+1	no_errors	NM_002374.1	genbank	human	reviewed	54_36p	silent	SNP	0.697	T
C3orf67	200844	genome.wustl.edu	37	3	58792122	58792122	+	Splice_Site	SNP	G	G	A			TCGA-AB-2915-03A-01W-0745-08	TCGA-AB-2915-11A-01W-0745-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	7f3f32b0-89db-4deb-84f1-5c0013f33668	733a0414-1086-4395-9859-9f85aad1863f	g.chr3:58792122G>A	ENST00000482387.1	-	11	1957	c.1861C>T	c.(1861-1863)Cgg>Tgg	p.R621W	C3orf67_ENST00000295966.7_Splice_Site_p.R495W			Q6ZVT6	CC067_HUMAN	chromosome 3 open reading frame 67	621										endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(3)|prostate(2)|skin(1)	19		all_cancers(2;0.000156)|all_epithelial(2;0.000493)|Breast(2;0.00446)|all_lung(2;0.074)|Lung NSC(2;0.248)		BRCA - Breast invasive adenocarcinoma(55;5.93e-06)|Kidney(10;0.00155)|KIRC - Kidney renal clear cell carcinoma(10;0.00172)|OV - Ovarian serous cystadenocarcinoma(275;0.23)		GATTCTTACCGGGGATTAGAA	0.338																																						dbGAP											0			3											127.0	125.0	126.0					3																	58792122		2203	4300	6503	58767162	SO:0001630	splice_region_variant	0			AK124920	CCDS33776.1	3p14.2	2011-01-25			ENSG00000163689	ENSG00000163689			24763	protein-coding gene	gene with protein product							Standard	NM_198463		Approved	FLJ42117, FLJ42930	uc003dkt.1	Q6ZVT6	OTTHUMG00000159151	ENST00000482387.1:c.1862+1C>T	3.37:g.58792122G>A		Somatic	49	5.66	3		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	58767162	183	39.81	123	B9EKV6|Q6ZV69	Missense_Mutation	SNP	NULL	p.R495W	ENST00000482387.1	37	c.1483		3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.43|16.43	3.121766|3.121766	0.56613|0.56613	.|.	.|.	ENSG00000163689|ENSG00000163689	ENST00000486145|ENST00000295966;ENST00000482387	.|T;T	.|0.61742	.|0.36;0.08	5.22|5.22	0.736|0.736	0.18307|0.18307	.|.	.|0.000000	.|0.64402	.|D	.|0.000001	T|T	0.71634|0.71634	0.3363|0.3363	M|M	0.69823|0.69823	2.125|2.125	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|P;D	.|0.97110	.|0.882;1.0	T|T	0.73569|0.73569	-0.3941|-0.3941	6|10	0.72032|0.87932	D|D	0.01|0	-10.4692|-10.4692	12.6623|12.6623	0.56822|0.56822	0.0:0.0:0.3918:0.6082|0.0:0.0:0.3918:0.6082	.|.	.|495;621	.|Q6ZVT6-2;Q6ZVT6	.|.;CC067_HUMAN	L|W	34|495;621	.|ENSP00000295966:R495W;ENSP00000417122:R621W	ENSP00000421046:P34L|ENSP00000295966:R495W	P|R	-|-	2|1	0|2	C3orf67|C3orf67	58767162|58767162	0.999000|0.999000	0.42202|0.42202	0.998000|0.998000	0.56505|0.56505	0.691000|0.691000	0.40173|0.40173	0.475000|0.475000	0.22164|0.22164	0.201000|0.201000	0.20466|0.20466	0.591000|0.591000	0.81541|0.81541	CCG|CGG	-	NULL		0.338	C3orf67-003	KNOWN	basic	protein_coding	C3orf67	protein_coding	OTTHUMT00000353803.1	G	NM_198463	Missense_Mutation	58767162	-1	no_errors	NM_198463.2	genbank	human	predicted	54_36p	missense	SNP	0.973	A
NME9	347736	genome.wustl.edu	37	3	138037001	138037001	+	Silent	SNP	G	G	A			TCGA-AB-2915-03A-01W-0745-08	TCGA-AB-2915-11A-01W-0745-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	7f3f32b0-89db-4deb-84f1-5c0013f33668	733a0414-1086-4395-9859-9f85aad1863f	g.chr3:138037001G>A	ENST00000333911.3	-	4	283	c.256C>T	c.(256-258)Ctg>Ttg	p.L86L	NME9_ENST00000536478.1_Silent_p.L64L|NME9_ENST00000317876.4_Silent_p.L64L|NME9_ENST00000341790.5_Intron|NME9_ENST00000484930.1_Intron|NME9_ENST00000383180.2_Silent_p.L64L			Q86XW9	TXND6_HUMAN	NME/NM23 family member 9	86	Thioredoxin.				cell redox homeostasis (GO:0045454)|CTP biosynthetic process (GO:0006241)|GTP biosynthetic process (GO:0006183)|UTP biosynthetic process (GO:0006228)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)										GCATAAAACAGAAAGGTTGGC	0.418																																						dbGAP											0			3											134.0	119.0	124.0					3																	138037001		2203	4300	6503	139519691	SO:0001819	synonymous_variant	0			AF196568	CCDS3099.1	3q22.3	2012-05-18	2012-05-18	2011-08-24	ENSG00000181322	ENSG00000181322			21343	protein-coding gene	gene with protein product			"""thioredoxin domain containing 6"", ""NME gene family member 9"", ""NME family member 9"""	TXNDC6		12569107, 19852809	Standard	NM_178130		Approved	TXL-2, NM23-H9	uc003ese.1	Q86XW9	OTTHUMG00000159823	ENST00000333911.3:c.256C>T	3.37:g.138037001G>A		Somatic	46	8.00	4		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	139519691	98	46.81	88	Q7Z4A8|Q8N1V7	Silent	SNP	HMMPfam_NDK,HMMSmart_NDK,superfamily_NDK,superfamily_Thiordxn-like_fd,PatternScan_THIOREDOXIN_1	p.L64	ENST00000333911.3	37	c.190		3	.	.	.	.	.	.	.	.	.	.	G	8.275	0.814285	0.16537	.	.	ENSG00000181322	ENST00000474690	.	.	.	5.08	5.08	0.68730	.	.	.	.	.	T	0.71710	0.3372	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.71059	-0.4702	4	.	.	.	-11.74	15.9633	0.79948	0.0:0.0:1.0:0.0	.	.	.	.	F	55	.	.	S	-	2	0	TXNDC6	139519691	1.000000	0.71417	1.000000	0.80357	0.889000	0.51656	7.074000	0.76791	2.357000	0.79964	0.491000	0.48974	TCT	-	superfamily_Thiordxn-like_fd		0.418	NME9-003	KNOWN	basic|appris_principal	protein_coding	TXNDC6	protein_coding	OTTHUMT00000357583.1	G	NM_178130		139519691	-1	no_errors	NM_178130.2	genbank	human	provisional	54_36p	silent	SNP	1.000	A
LOC101928978	101928978	genome.wustl.edu	37	4	85165371	85165371	+	IGR	SNP	G	G	A			TCGA-AB-2915-03A-01W-0745-08	TCGA-AB-2915-11A-01W-0745-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	7f3f32b0-89db-4deb-84f1-5c0013f33668	733a0414-1086-4395-9859-9f85aad1863f	g.chr4:85165371G>A								RNU6-774P (10455 upstream) : RP11-42A4.1 (127174 downstream)																							GCCGTCAGCTGCACTGTGGCG	0.502																																						dbGAP											0			4																																								85384395	SO:0001628	intergenic_variant	0																															4.37:g.85165371G>A		Somatic	64	2.99	2		3	0.00	0	WXS	Illumina HiSeq	Phase_IV	85384395	139	37.78	85		RNA	SNP	-	NULL		37	NULL		4																																																																																			-	-	0	0.502					LOC152845			G			85384395	+1	pseudogene	XR_038721.1	genbank	human	model	54_36p	rna	SNP	0.974	A
LOC101928978	101928978	genome.wustl.edu	37	4	85165890	85165890	+	IGR	SNP	C	C	T			TCGA-AB-2915-03A-01W-0745-08	TCGA-AB-2915-11A-01W-0745-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	7f3f32b0-89db-4deb-84f1-5c0013f33668	733a0414-1086-4395-9859-9f85aad1863f	g.chr4:85165890C>T								RNU6-774P (10974 upstream) : RP11-42A4.1 (126655 downstream)																							GCAGGAGCAGCTCAAGATCAA	0.577																																						dbGAP											0			4																																								85384914	SO:0001628	intergenic_variant	0																															4.37:g.85165890C>T		Somatic	91	0.00	0		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	85384914	173	43.28	132		RNA	SNP	-	NULL		37	NULL		4																																																																																			-	-	0	0.577					LOC152845			C			85384914	+1	pseudogene	XR_038721.1	genbank	human	model	54_36p	rna	SNP	1.000	T
GSTCD	79807	genome.wustl.edu	37	4	106638785	106638785	+	Silent	SNP	G	G	A			TCGA-AB-2915-03A-01W-0745-08	TCGA-AB-2915-11A-01W-0745-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	7f3f32b0-89db-4deb-84f1-5c0013f33668	733a0414-1086-4395-9859-9f85aad1863f	g.chr4:106638785G>A	ENST00000515279.1	+	2	235	c.15G>A	c.(13-15)aaG>aaA	p.K5K	GSTCD_ENST00000394730.3_Silent_p.K5K|GSTCD_ENST00000360505.5_Silent_p.K5K|GSTCD_ENST00000515255.1_Intron|GSTCD_ENST00000394728.3_Silent_p.K5K|GSTCD_ENST00000507281.1_Silent_p.K5K			Q8NEC7	GSTCD_HUMAN	glutathione S-transferase, C-terminal domain containing	5						extracellular vesicular exosome (GO:0070062)				breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(2)|ovary(1)|skin(1)	14		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;3.15e-07)|READ - Rectum adenocarcinoma(30;0.139)		AAGCCATAAAGAAAAGTCTTA	0.308																																						dbGAP											0			4											70.0	73.0	72.0					4																	106638785		2203	4300	6503	106858234	SO:0001819	synonymous_variant	0			BC032942	CCDS3672.2, CCDS43257.1	4q24	2008-02-05	2006-05-09		ENSG00000138780	ENSG00000138780			25806	protein-coding gene	gene with protein product		615912	"""Glutathione S-transferase, C-terminal domain containing"""			12477932	Standard	NM_001031720		Approved	FLJ13273	uc003hxz.4	Q8NEC7	OTTHUMG00000131211	ENST00000515279.1:c.15G>A	4.37:g.106638785G>A		Somatic	75	8.54	7		6	0.00	0	WXS	Illumina HiSeq	Phase_IV	106858234	115	35.56	64	A8K8J0|A8MVD3|H9KV97|Q9H8S3	Silent	SNP	superfamily_Glutathione S-transferase (GST) C-terminal domain,superfamily_S-adenosyl-L-methionine-dependent methyltransferases	p.K5	ENST00000515279.1	37	c.15	CCDS43257.1	4																																																																																			-	NULL		0.308	GSTCD-006	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	GSTCD	protein_coding	OTTHUMT00000363981.1	G	NM_024751		106858234	+1	no_errors	NM_001031720.2	genbank	human	validated	54_36p	silent	SNP	0.511	A
NAA15	80155	genome.wustl.edu	37	4	140270697	140270697	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AB-2915-03A-01W-0745-08	TCGA-AB-2915-11A-01W-0745-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	7f3f32b0-89db-4deb-84f1-5c0013f33668	733a0414-1086-4395-9859-9f85aad1863f	g.chr4:140270697G>A	ENST00000296543.5	+	7	1096	c.773G>A	c.(772-774)tGg>tAg	p.W258*	NAA15_ENST00000480277.2_3'UTR|NAA15_ENST00000398947.1_Nonsense_Mutation_p.W258*	NM_057175.3	NP_476516.1	Q9BXJ9	NAA15_HUMAN	N(alpha)-acetyltransferase 15, NatA auxiliary subunit	258					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|N-terminal protein amino acid acetylation (GO:0006474)|negative regulation of apoptotic process (GO:0043066)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|NatA complex (GO:0031415)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	N-acetyltransferase activity (GO:0008080)|poly(A) RNA binding (GO:0044822)|ribosome binding (GO:0043022)			NS(1)|endometrium(3)|large_intestine(7)|liver(2)|lung(8)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	29						CCTGAAAACTGGGCCTATTAC	0.328																																						dbGAP											0			4											48.0	45.0	46.0					4																	140270697		1799	4076	5875	140490147	SO:0001587	stop_gained	0			AY039242	CCDS43270.1	4q31.1	2010-01-14	2010-01-14	2010-01-14	ENSG00000164134	ENSG00000164134		"""N(alpha)-acetyltransferase subunits"""	30782	protein-coding gene	gene with protein product		608000	"""NMDA receptor regulated 1"""	NARG1		12140756, 11478804, 19660095	Standard	XM_005263236		Approved	TBDN100, NATH, FLJ13340	uc003ihu.1	Q9BXJ9	OTTHUMG00000137363	ENST00000296543.5:c.773G>A	4.37:g.140270697G>A	ENSP00000296543:p.Trp258*	Somatic	64	9.86	7		24	17.24	5	WXS	Illumina HiSeq	Phase_IV	140490147	159	40.81	111	D3DNY6|Q52LG9|Q8IWH4|Q8NEV2|Q9H8P6	Nonsense_Mutation	SNP	HMMPfam_TPR_2,HMMSmart_SM00028,superfamily_TPR-like	p.W258*	ENST00000296543.5	37	c.773	CCDS43270.1	4	.	.	.	.	.	.	.	.	.	.	G	39	7.650790	0.98412	.	.	ENSG00000164134	ENST00000296543;ENST00000544077;ENST00000398947	.	.	.	5.44	5.44	0.79542	.	0.064891	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.31617	T	0.26	-7.0255	19.4586	0.94906	0.0:0.0:1.0:0.0	.	.	.	.	X	258;132;258	.	ENSP00000296543:W258X	W	+	2	0	NAA15	140490147	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.112000	0.94314	2.828000	0.97474	0.655000	0.94253	TGG	-	superfamily_TPR-like		0.328	NAA15-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NARG1	protein_coding	OTTHUMT00000267839.2	G	NM_057175		140490147	+1	no_errors	NM_057175.3	genbank	human	validated	54_36p	nonsense	SNP	1.000	A
POLD2P1	391811	genome.wustl.edu	37	5	92603860	92603860	+	IGR	SNP	G	G	T			TCGA-AB-2915-03A-01W-0745-08	TCGA-AB-2915-11A-01W-0745-08	G	G	G	T	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	7f3f32b0-89db-4deb-84f1-5c0013f33668	733a0414-1086-4395-9859-9f85aad1863f	g.chr5:92603860G>T								CTD-2091N23.1 (199485 upstream) : NR2F1-AS1 (141204 downstream)																							CTCCACCCCTGCATGTTCCTG	0.577																																						dbGAP											0			5																																								92629616	SO:0001628	intergenic_variant	0																															5.37:g.92603860G>T		Somatic	37	0.00	0		15	0.00	0	WXS	Illumina HiSeq	Phase_IV	92629616	173	40.27	120		RNA	SNP	-	NULL		37	NULL		5																																																																																			-	-	0	0.577					LOC391811			G			92629616	+1	pseudogene	XR_016127.2	genbank	human	model	54_36p	rna	SNP	0.999	T
NPM1	4869	genome.wustl.edu	37	5	170834720	170834720	+	Missense_Mutation	SNP	A	A	G			TCGA-AB-2915-03A-01W-0745-08	TCGA-AB-2915-11A-01W-0745-08	A	A	A	G	A	A	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	7f3f32b0-89db-4deb-84f1-5c0013f33668	733a0414-1086-4395-9859-9f85aad1863f	g.chr5:170834720A>G	ENST00000296930.5	+	10	1089	c.788A>G	c.(787-789)aAa>aGa	p.K263R	NPM1_ENST00000351986.6_Missense_Mutation_p.K234R|NPM1_ENST00000517671.1_Missense_Mutation_p.K263R	NM_002520.6	NP_002511.1	P06748	NPM_HUMAN	nucleophosmin (nucleolar phosphoprotein B23, numatrin)	263	Required for nucleolar localization.				cell aging (GO:0007569)|CENP-A containing nucleosome assembly (GO:0034080)|centrosome cycle (GO:0007098)|DNA repair (GO:0006281)|intracellular protein transport (GO:0006886)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of centrosome duplication (GO:0010826)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|nucleocytoplasmic transport (GO:0006913)|nucleosome assembly (GO:0006334)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of translation (GO:0045727)|protein localization (GO:0008104)|protein oligomerization (GO:0051259)|regulation of centriole replication (GO:0046599)|regulation of eIF2 alpha phosphorylation by dsRNA (GO:0060735)|regulation of endodeoxyribonuclease activity (GO:0032071)|regulation of endoribonuclease activity (GO:0060699)|response to stress (GO:0006950)|ribosome assembly (GO:0042255)|signal transduction (GO:0007165)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spindle pole centrosome (GO:0031616)	histone binding (GO:0042393)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein kinase inhibitor activity (GO:0004860)|ribosomal large subunit binding (GO:0043023)|ribosomal small subunit binding (GO:0043024)|RNA binding (GO:0003723)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|unfolded protein binding (GO:0051082)		NPM1/ALK(632)	central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(4261)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	4269	Renal(175;0.000159)|Lung NSC(126;0.00576)|all_lung(126;0.00963)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			TCTCTTCCCAAAGTGGAAGCC	0.368			"""T, F """	"""ALK, RARA, MLF1"""	"""NHL, APL, AML"""																																	dbGAP		Dom	yes		5	5q35	4869	"""nucleophosmin (nucleolar phosphoprotein B23, numatrin)"""		L	0			5											111.0	112.0	112.0					5																	170834720		2203	4300	6503	170767325	SO:0001583	missense	0			M26697	CCDS4376.1, CCDS4377.1, CCDS43399.1	5q35.1	2014-09-17			ENSG00000181163	ENSG00000181163			7910	protein-coding gene	gene with protein product	"""nucleolar phosphoprotein B23"", ""numatrin"", ""nucleophosmin/nucleoplasmin family, member 1"""	164040				8471164, 8122112	Standard	NM_002520		Approved	B23, NPM	uc003mbi.3	P06748	OTTHUMG00000130465	ENST00000296930.5:c.788A>G	5.37:g.170834720A>G	ENSP00000296930:p.Lys263Arg	Somatic	60	0.00	0		99	46.20	85	WXS	Illumina HiSeq	Phase_IV	170767325	40	52.38	44	A8K3N7|B5BU00|D3DQL6|P08693|Q12826|Q13440|Q13441|Q14115|Q5EU94|Q5EU95|Q5EU96|Q5EU97|Q5EU98|Q5EU99|Q6V962|Q8WTW5|Q96AT6|Q96DC4|Q96EA5|Q9BYG9|Q9UDJ7	Missense_Mutation	SNP	HMMPfam_Nucleoplasmin,superfamily_Nucleoplasmin-like core domain	p.K263R	ENST00000296930.5	37	c.788	CCDS4376.1	5	.	.	.	.	.	.	.	.	.	.	A	16.81	3.226626	0.58668	.	.	ENSG00000181163	ENST00000517671;ENST00000296930;ENST00000351986	T;T;T	0.60040	0.51;0.51;0.22	4.87	4.87	0.63330	.	0.000000	0.85682	U	0.000000	T	0.58061	0.2096	M	0.71581	2.175	0.80722	D	1	B;B	0.25850	0.104;0.136	B;B	0.27076	0.052;0.076	T	0.61695	-0.7010	10	0.66056	D	0.02	.	13.0332	0.58854	1.0:0.0:0.0:0.0	.	234;263	P06748-2;P06748	.;NPM_HUMAN	R	263;263;234	ENSP00000428755:K263R;ENSP00000296930:K263R;ENSP00000341168:K234R	ENSP00000296930:K263R	K	+	2	0	NPM1	170767325	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.660000	0.68018	1.949000	0.56562	0.533000	0.62120	AAA	-	NULL		0.368	NPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPM1	protein_coding	OTTHUMT00000252858.2	A	NM_002520		170767325	+1	no_errors	NM_002520.1	genbank	human	validated	54_36p	missense	SNP	1.000	G
EPHA7	2045	genome.wustl.edu	37	6	93967201	93967201	+	Silent	SNP	T	T	C	rs149452129	byFrequency	TCGA-AB-2915-03A-01W-0745-08	TCGA-AB-2915-11A-01W-0745-08	T	T	T	C	T	T	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	7f3f32b0-89db-4deb-84f1-5c0013f33668	733a0414-1086-4395-9859-9f85aad1863f	g.chr6:93967201T>C	ENST00000369303.4	-	12	2335	c.2151A>G	c.(2149-2151)ggA>ggG	p.G717G		NM_004440.3	NP_004431.1	Q15375	EPHA7_HUMAN	EPH receptor A7	717	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				brain development (GO:0007420)|branching morphogenesis of a nerve (GO:0048755)|ephrin receptor signaling pathway (GO:0048013)|negative chemotaxis (GO:0050919)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of cell-cell adhesion (GO:0022407)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of protein autophosphorylation (GO:0031952)|retinal ganglion cell axon guidance (GO:0031290)	dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|chemorepellent activity (GO:0045499)|GPI-linked ephrin receptor activity (GO:0005004)|protein tyrosine kinase activity (GO:0004713)			NS(1)|breast(1)|central_nervous_system(7)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|lung(43)|ovary(8)|pancreas(1)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(13)|urinary_tract(1)	112		all_cancers(76;7.47e-10)|Acute lymphoblastic leukemia(125;1.88e-09)|all_hematologic(75;1.75e-07)|all_epithelial(107;3.6e-05)|Lung NSC(302;0.0368)|all_lung(197;0.0509)|Colorectal(196;0.142)		BRCA - Breast invasive adenocarcinoma(108;0.0847)		CATCTAGGGCTCCATTTTCCA	0.343													T|||	6	0.00119808	0.0045	0.0	5008	,	,		15807	0.0		0.0	False		,,,				2504	0.0					dbGAP											0			6						T		16,4390	23.3+/-48.9	0,16,2187	89.0	91.0	90.0		2151	2.1	1.0	6	dbSNP_134	90	0,8600		0,0,4300	yes	coding-synonymous	EPHA7	NM_004440.3		0,16,6487	CC,CT,TT		0.0,0.3631,0.123		717/999	93967201	16,12990	2203	4300	6503	94023922	SO:0001819	synonymous_variant	0			L36642	CCDS5031.1, CCDS75494.1	6q16.3	2013-02-11	2004-10-28		ENSG00000135333	ENSG00000135333		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3390	protein-coding gene	gene with protein product		602190	"""EphA7"""			9267020	Standard	NM_004440		Approved	Hek11	uc003poe.3	Q15375	OTTHUMG00000015228	ENST00000369303.4:c.2151A>G	6.37:g.93967201T>C		Somatic	56	1.72	1		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	94023922	66	42.11	48	A0AUX7|B2R8W1|B7ZLJ9|B7ZLK0|Q59G40|Q5VTU0|Q8N368|Q9H124	Silent	SNP	HMMPfam_Ephrin_lbd,HMMSmart_SM00615,HMMPfam_Pkinase_Tyr,HMMSmart_SM00219,PatternScan_RECEPTOR_TYR_KIN_V_1,PatternScan_RECEPTOR_TYR_KIN_V_2,HMMPfam_SAM_1,HMMSmart_SM00454,HMMSmart_SM00220,HMMPfam_fn3,HMMSmart_SM00060,PatternScan_PROTEIN_KINASE_TYR,superfamily_Fibronectin type III,superfamily_Galactose-binding domain-like,superfamily_Growth factor receptor domain,superfamily_SAM/Pointed domain,superfamily_Protein kinase-like (PK-like),PatternScan_EGF_2,PatternScan_PROTEIN_KINASE_ATP	p.G717	ENST00000369303.4	37	c.2151	CCDS5031.1	6																																																																																			-	HMMPfam_Pkinase_Tyr,HMMSmart_SM00219,HMMSmart_SM00220,superfamily_Protein kinase-like (PK-like)		0.343	EPHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHA7	protein_coding	OTTHUMT00000041545.1	T			94023922	-1	no_errors	NM_004440.3	genbank	human	reviewed	54_36p	silent	SNP	1.000	C
NR2E1	7101	genome.wustl.edu	37	6	108501563	108501563	+	Missense_Mutation	SNP	G	G	T			TCGA-AB-2915-03A-01W-0745-08	TCGA-AB-2915-11A-01W-0745-08	G	G	G	T	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	7f3f32b0-89db-4deb-84f1-5c0013f33668	733a0414-1086-4395-9859-9f85aad1863f	g.chr6:108501563G>T	ENST00000368986.4	+	6	1387	c.679G>T	c.(679-681)Gtt>Ttt	p.V227F	NR2E1_ENST00000368983.3_Missense_Mutation_p.V264F	NM_003269.3	NP_003260.1	Q9Y466	NR2E1_HUMAN	nuclear receptor subfamily 2, group E, member 1	227	Ligand-binding. {ECO:0000250}.				aggressive behavior (GO:0002118)|amygdala development (GO:0021764)|anterior commissure morphogenesis (GO:0021960)|behavioral fear response (GO:0001662)|cell fate commitment (GO:0045165)|cerebral cortex neuron differentiation (GO:0021895)|dentate gyrus development (GO:0021542)|extracellular matrix organization (GO:0030198)|forebrain generation of neurons (GO:0021872)|gene expression (GO:0010467)|glial cell migration (GO:0008347)|layer formation in cerebral cortex (GO:0021819)|long-term synaptic potentiation (GO:0060291)|negative regulation of apoptotic process (GO:0043066)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron differentiation (GO:0045665)|nervous system development (GO:0007399)|olfactory bulb development (GO:0021772)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell cycle (GO:0045787)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of stem cell proliferation (GO:2000648)|regulation of cell migration involved in sprouting angiogenesis (GO:0090049)|regulation of dendrite morphogenesis (GO:0048814)|regulation of timing of neuron differentiation (GO:0060164)|retina development in camera-type eye (GO:0060041)|social behavior (GO:0035176)|somatic stem cell maintenance (GO:0035019)|transcription initiation from RNA polymerase II promoter (GO:0006367)|visual perception (GO:0007601)	nucleoplasm (GO:0005654)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(4)|liver(1)|lung(16)|prostate(1)|skin(3)	30		all_cancers(87;8.13e-05)|Acute lymphoblastic leukemia(125;3.07e-08)|all_hematologic(75;3.33e-06)|all_epithelial(87;0.00866)|Colorectal(196;0.0637)		BRCA - Breast invasive adenocarcinoma(108;0.013)|Epithelial(106;0.0521)|all cancers(137;0.068)|OV - Ovarian serous cystadenocarcinoma(136;0.0689)		AGAACTGTTTGTTCTAGGAAT	0.328																																						dbGAP											0			6											141.0	133.0	136.0					6																	108501563		2203	4300	6503	108608256	SO:0001583	missense	0			Y13276	CCDS5063.1, CCDS69165.1	6q21	2013-01-16			ENSG00000112333	ENSG00000112333		"""Nuclear hormone receptors"""	7973	protein-coding gene	gene with protein product		603849		TLX		9628820	Standard	NM_003269		Approved	TLL, XTLL	uc003psg.3	Q9Y466	OTTHUMG00000015319	ENST00000368986.4:c.679G>T	6.37:g.108501563G>T	ENSP00000357982:p.Val227Phe	Somatic	56	0.00	0		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	108608256	72	38.98	46	Q6ZMP8	Missense_Mutation	SNP	HMMPfam_Hormone_recep,HMMSmart_SM00430,HMMPfam_zf-C4,HMMSmart_SM00399,PatternScan_NUCLEAR_REC_DBD_1,superfamily_Nuclear receptor ligand-binding domain,superfamily_Glucocorticoid receptor-like (DNA-binding domain)	p.V227F	ENST00000368986.4	37	c.679	CCDS5063.1	6	.	.	.	.	.	.	.	.	.	.	G	21.2	4.108243	0.77096	.	.	ENSG00000112333	ENST00000368986;ENST00000368983	D;D	0.96491	-4.03;-4.03	5.97	5.97	0.96955	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.050581	0.85682	D	0.000000	D	0.98108	0.9376	M	0.81239	2.535	0.80722	D	1	D	0.71674	0.998	D	0.71414	0.973	D	0.98106	1.0417	10	0.66056	D	0.02	.	20.4136	0.99023	0.0:0.0:1.0:0.0	.	227	Q9Y466	NR2E1_HUMAN	F	227;264	ENSP00000357982:V227F;ENSP00000357979:V264F	ENSP00000357979:V264F	V	+	1	0	NR2E1	108608256	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.471000	0.97696	2.819000	0.97034	0.655000	0.94253	GTT	-	HMMPfam_Hormone_recep,HMMSmart_SM00430,superfamily_Nuclear receptor ligand-binding domain		0.328	NR2E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NR2E1	protein_coding	OTTHUMT00000041712.2	G			108608256	+1	no_errors	NM_003269.3	genbank	human	validated	54_36p	missense	SNP	1.000	T
C9orf91	203197	genome.wustl.edu	37	9	117396074	117396074	+	Silent	SNP	G	G	A			TCGA-AB-2915-03A-01W-0745-08	TCGA-AB-2915-11A-01W-0745-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	7f3f32b0-89db-4deb-84f1-5c0013f33668	733a0414-1086-4395-9859-9f85aad1863f	g.chr9:117396074G>A	ENST00000288502.4	+	6	938	c.501G>A	c.(499-501)ctG>ctA	p.L167L	C9orf91_ENST00000374049.4_Silent_p.L168L			Q5VZI3	CI091_HUMAN	chromosome 9 open reading frame 91	167						integral component of membrane (GO:0016021)				endometrium(2)|large_intestine(3)|lung(5)|pancreas(1)|skin(1)|urinary_tract(1)	13						ACCTGAGGCTGGCAGCTGCCA	0.592																																						dbGAP											0			9											85.0	74.0	78.0					9																	117396074		2203	4300	6503	116435895	SO:0001819	synonymous_variant	0			BX649023	CCDS6808.1	9q33.1	2008-02-05			ENSG00000157693	ENSG00000157693			24513	protein-coding gene	gene with protein product						14702039	Standard	NM_153045		Approved	DKFZp547P234, FLJ38045	uc004bjd.4	Q5VZI3	OTTHUMG00000020541	ENST00000288502.4:c.501G>A	9.37:g.117396074G>A		Somatic	33	0.00	0		12	50.00	12	WXS	Illumina HiSeq	Phase_IV	116435895	59	48.25	55	A0PJA3|Q3KNS4|Q5VZI2|Q6P5Z7|Q8N1P3|Q8ND43	Silent	SNP	NULL	p.L167	ENST00000288502.4	37	c.501	CCDS6808.1	9																																																																																			-	NULL		0.592	C9orf91-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	C9orf91	protein_coding	OTTHUMT00000053780.1	G	NM_153045		116435895	+1	no_errors	NM_153045.3	genbank	human	validated	54_36p	silent	SNP	0.985	A
AIFM2	84883	genome.wustl.edu	37	10	71883242	71883242	+	Silent	SNP	C	C	A			TCGA-AB-2915-03A-01W-0745-08	TCGA-AB-2915-11A-01W-0745-08	C	C	C	A	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	7f3f32b0-89db-4deb-84f1-5c0013f33668	733a0414-1086-4395-9859-9f85aad1863f	g.chr10:71883242C>A	ENST00000307864.1	-	3	426	c.213G>T	c.(211-213)gtG>gtT	p.V71V	AIFM2_ENST00000373248.1_Silent_p.V71V	NM_001198696.1|NM_032797.5	NP_001185625.1|NP_116186.1	Q9BRQ8	AIFM2_HUMAN	apoptosis-inducing factor, mitochondrion-associated, 2	71					apoptotic mitochondrial changes (GO:0008637)|positive regulation of apoptotic process (GO:0043065)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	DNA binding (GO:0003677)|electron-transferring-flavoprotein dehydrogenase activity (GO:0004174)|flavin adenine dinucleotide binding (GO:0050660)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)|skin(2)|urinary_tract(2)	16						CCTTGAAAGTCACCGAGTAAG	0.577																																						dbGAP											0			10											115.0	103.0	107.0					10																	71883242		2203	4300	6503	71553248	SO:0001819	synonymous_variant	0			AK027403	CCDS7297.1	10q22.2	2006-11-16	2006-11-16	2006-11-16	ENSG00000042286	ENSG00000042286			21411	protein-coding gene	gene with protein product		605159	"""apoptosis-inducing factor (AIF)-like mitochondrion-associated inducer of death"""	AMID		12135761, 11980907, 15958387	Standard	NM_001198696		Approved	FLJ14497, PRG3	uc001jqp.2	Q9BRQ8	OTTHUMG00000018398	ENST00000307864.1:c.213G>T	10.37:g.71883242C>A		Somatic	37	2.63	1		7	30.00	3	WXS	Illumina HiSeq	Phase_IV	71553248	77	42.96	58	B3KXI0|Q63Z39	Silent	SNP	HMMPfam_Pyr_redox_2,superfamily_FAD/NAD(P)-binding domain	p.V71	ENST00000307864.1	37	c.213	CCDS7297.1	10																																																																																			-	HMMPfam_Pyr_redox_2,superfamily_FAD/NAD(P)-binding domain		0.577	AIFM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AIFM2	protein_coding	OTTHUMT00000048487.1	C	NM_032797		71553248	-1	no_errors	NM_032797.4	genbank	human	reviewed	54_36p	silent	SNP	0.972	A
GALNT18	374378	genome.wustl.edu	37	11	11314707	11314707	+	Missense_Mutation	SNP	C	C	T			TCGA-AB-2915-03A-01W-0745-08	TCGA-AB-2915-11A-01W-0745-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	7f3f32b0-89db-4deb-84f1-5c0013f33668	733a0414-1086-4395-9859-9f85aad1863f	g.chr11:11314707C>T	ENST00000227756.4	-	10	1957	c.1546G>A	c.(1546-1548)Gtg>Atg	p.V516M		NM_198516.2	NP_940918.2	Q6P9A2	GLT18_HUMAN	polypeptide N-acetylgalactosaminyltransferase 18	516	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)										AGAATGCCCACATGGATCTGC	0.587																																						dbGAP											0			11											83.0	66.0	72.0					11																	11314707		2201	4294	6495	11271283	SO:0001583	missense	0			AK055111	CCDS7807.1	11p15	2014-03-13	2014-03-13	2013-01-25	ENSG00000110328	ENSG00000110328	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	30488	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 18"""	615136	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 4"", ""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 18"""	GALNTL4		22186971	Standard	NM_198516		Approved	MGC71806, GALNT15, GalNAc-T18	uc001mjo.2	Q6P9A2	OTTHUMG00000165707	ENST00000227756.4:c.1546G>A	11.37:g.11314707C>T	ENSP00000227756:p.Val516Met	Somatic	36	0.00	0		2	0.00	0	WXS	Illumina HiSeq	Phase_IV	11271283	119	43.40	92	O95903|Q8NDY9	Missense_Mutation	SNP	HMMPfam_Ricin_B_lectin,HMMSmart_SM00458,HMMPfam_Glycos_transf_2,superfamily_Ricin B-like lectins,superfamily_Nucleotide-diphospho-sugar transferases	p.V516M	ENST00000227756.4	37	c.1546	CCDS7807.1	11	.	.	.	.	.	.	.	.	.	.	C	16.61	3.170858	0.57584	.	.	ENSG00000110328	ENST00000227756	T	0.27256	1.68	5.7	4.74	0.60224	Ricin B-related lectin (1);Ricin B lectin (3);	0.155924	0.29053	N	0.013288	T	0.33323	0.0859	M	0.65975	2.015	0.36959	D	0.893224	B	0.23316	0.083	B	0.37091	0.241	T	0.34129	-0.9841	10	0.46703	T	0.11	.	10.618	0.45462	0.0:0.7732:0.147:0.0798	.	516	Q6P9A2	GLTL4_HUMAN	M	516	ENSP00000227756:V516M	ENSP00000227756:V516M	V	-	1	0	GALNTL4	11271283	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.901000	0.39838	2.688000	0.91661	0.609000	0.83330	GTG	-	HMMPfam_Ricin_B_lectin,HMMSmart_SM00458,superfamily_Ricin B-like lectins		0.587	GALNT18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNTL4	protein_coding	OTTHUMT00000385848.1	C	NM_198516		11271283	-1	no_errors	NM_198516.2	genbank	human	validated	54_36p	missense	SNP	1.000	T
RPS2P48	645173	genome.wustl.edu	37	17	51834920	51834920	+	IGR	SNP	G	G	A			TCGA-AB-2915-03A-01W-0745-08	TCGA-AB-2915-11A-01W-0745-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	7f3f32b0-89db-4deb-84f1-5c0013f33668	733a0414-1086-4395-9859-9f85aad1863f	g.chr17:51834920G>A								AC090079.1 (219955 upstream) : KIF2B (65318 downstream)																							TCAAAACCTCGTCCTTAAGAG	0.512																																						dbGAP											0			17																																								49189919	SO:0001628	intergenic_variant	0																															17.37:g.51834920G>A		Somatic	15	0.00	0		0	0.00	0	WXS	Illumina HiSeq	Phase_IV	49189919	7	50.00	8		RNA	SNP	-	NULL		37	NULL		17																																																																																			-	-	0	0.512					LOC645173			G			49189919	-1	pseudogene	XR_017590.2	genbank	human	model	54_36p	rna	SNP	1.000	A
SERPINB12	89777	genome.wustl.edu	37	18	61234228	61234228	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2915-03A-01W-0745-08	TCGA-AB-2915-11A-01W-0745-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	7f3f32b0-89db-4deb-84f1-5c0013f33668	733a0414-1086-4395-9859-9f85aad1863f	g.chr18:61234228G>A	ENST00000269491.1	+	7	1202	c.1202G>A	c.(1201-1203)aGg>aAg	p.R401K	SERPINB12_ENST00000382768.1_Missense_Mutation_p.R421K	NM_080474.1	NP_536722.1	Q96P63	SPB12_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 12	401					hematopoietic progenitor cell differentiation (GO:0002244)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of protein catabolic process (GO:0042177)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	enzyme binding (GO:0019899)|serine-type endopeptidase inhibitor activity (GO:0004867)			kidney(1)|large_intestine(5)|lung(19)|skin(1)	26						TTTTATGGCAGGGTCTGCTCT	0.428																																						dbGAP											0			18											55.0	54.0	54.0					18																	61234228		2203	4300	6503	59385208	SO:0001583	missense	0			AF411191	CCDS11984.1	18q21.33	2014-02-18	2005-08-18		ENSG00000166634	ENSG00000166634		"""Serine (or cysteine) peptidase inhibitors"""	14220	protein-coding gene	gene with protein product		615662	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 12"""			24172014	Standard	NM_080474		Approved	YUKOPIN	uc010xen.2	Q96P63	OTTHUMG00000132789	ENST00000269491.1:c.1202G>A	18.37:g.61234228G>A	ENSP00000269491:p.Arg401Lys	Somatic	156	1.88	3		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	59385208	223	43.53	175	Q3SYB4	Missense_Mutation	SNP	HMMPfam_Serpin,HMMSmart_SERPIN,PatternScan_SERPIN,superfamily_Prot_inh_serpin	p.R401K	ENST00000269491.1	37	c.1202	CCDS11984.1	18	.	.	.	.	.	.	.	.	.	.	G	7.640	0.680661	0.14907	.	.	ENSG00000166634	ENST00000269491;ENST00000382768	D;D	0.84442	-1.85;-1.85	6.01	4.97	0.65823	Serpin domain (3);	0.146330	0.48767	D	0.000169	T	0.75568	0.3867	L	0.33189	0.99	0.28780	N	0.899917	P;B	0.39443	0.674;0.37	B;B	0.36418	0.224;0.068	T	0.71807	-0.4481	10	0.38643	T	0.18	.	9.8327	0.40952	0.2135:0.0:0.7865:0.0	.	421;401	Q3SYB4;Q96P63	.;SPB12_HUMAN	K	401;421	ENSP00000269491:R401K;ENSP00000372218:R421K	ENSP00000269491:R401K	R	+	2	0	SERPINB12	59385208	0.018000	0.18449	1.000000	0.80357	0.015000	0.08874	1.604000	0.36804	2.860000	0.98153	0.655000	0.94253	AGG	-	HMMPfam_Serpin,HMMSmart_SERPIN,superfamily_Prot_inh_serpin		0.428	SERPINB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINB12	protein_coding	OTTHUMT00000256197.1	G	NM_080474		59385208	+1	no_errors	NM_080474.1	genbank	human	provisional	54_36p	missense	SNP	0.998	A
DOT1L	84444	genome.wustl.edu	37	19	2216684	2216684	+	Silent	SNP	G	G	C			TCGA-AB-2915-03A-01W-0745-08	TCGA-AB-2915-11A-01W-0745-08	G	G	G	C	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	7f3f32b0-89db-4deb-84f1-5c0013f33668	733a0414-1086-4395-9859-9f85aad1863f	g.chr19:2216684G>C	ENST00000398665.3	+	20	2364	c.2328G>C	c.(2326-2328)ccG>ccC	p.P776P	AC004490.1_ENST00000585593.1_RNA	NM_032482.2	NP_115871.1	Q8TEK3	DOT1L_HUMAN	DOT1-like histone H3K79 methyltransferase	776					histone lysine methylation (GO:0034968)|regulation of JAK-STAT cascade (GO:0046425)|regulation of transcription regulatory region DNA binding (GO:2000677)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription factor binding (GO:0008134)			NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|lung(14)|ovary(2)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(9)	42		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGCTGTCCCCGGCCAAGATTG	0.687																																						dbGAP											0			19											29.0	35.0	33.0					19																	2216684		2068	4178	6246	2167684	SO:0001819	synonymous_variant	0			AF509504	CCDS42460.1	19p13.3	2013-05-21	2013-05-21		ENSG00000104885	ENSG00000104885	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"""	24948	protein-coding gene	gene with protein product	"""histone methyltransferase DOT1L"""	607375	"""DOT1-like, histone H3 methyltransferase (S. cerevisiae)"""			11347906, 12123582	Standard	NM_032482		Approved	KIAA1814, DOT1, KMT4	uc002lvb.4	Q8TEK3	OTTHUMG00000150431	ENST00000398665.3:c.2328G>C	19.37:g.2216684G>C		Somatic	5	0.00	0		30	46.43	26	WXS	Illumina HiSeq	Phase_IV	2167684	3	70.00	7	O60379|Q96JL1	Silent	SNP	HMMPfam_DOT1,HMMPfam_AT_hook,HMMSmart_AT_hook,superfamily_SSF53335	p.P776	ENST00000398665.3	37	c.2328	CCDS42460.1	19	.	.	.	.	.	.	.	.	.	.	G	0.680	-0.798479	0.02841	.	.	ENSG00000104885	ENST00000440640	.	.	.	5.21	-10.4	0.00318	.	.	.	.	.	T	0.40743	0.1129	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53795	-0.8388	4	.	.	.	-24.0788	4.5218	0.11962	0.4267:0.064:0.0879:0.4214	.	.	.	.	P	563	.	.	R	+	2	0	DOT1L	2167684	0.000000	0.05858	0.009000	0.14445	0.142000	0.21351	-6.024000	0.00085	-3.832000	0.00101	-1.858000	0.00562	CGG	-	NULL		0.687	DOT1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOT1L	protein_coding	OTTHUMT00000318066.1	G	NM_032482		2167684	+1	no_errors	NM_032482.2	genbank	human	validated	54_36p	silent	SNP	0.759	C
TLE6	79816	genome.wustl.edu	37	19	2989633	2989633	+	Missense_Mutation	SNP	C	C	G			TCGA-AB-2915-03A-01W-0745-08	TCGA-AB-2915-11A-01W-0745-08	C	C	C	G	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	7f3f32b0-89db-4deb-84f1-5c0013f33668	733a0414-1086-4395-9859-9f85aad1863f	g.chr19:2989633C>G	ENST00000246112.4	+	13	1295	c.1094C>G	c.(1093-1095)gCg>gGg	p.A365G	TLE6_ENST00000452088.1_Missense_Mutation_p.A242G|TLE6_ENST00000478073.2_3'UTR	NM_001143986.1	NP_001137458.1	Q9H808	TLE6_HUMAN	transducin-like enhancer of split 6	365					regulation of transcription, DNA-templated (GO:0006355)	cell cortex (GO:0005938)|nucleus (GO:0005634)|protein complex (GO:0043234)				breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|urinary_tract(1)	10				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGGGACCTGGCGGCGCCCTCC	0.657																																						dbGAP											0			19											39.0	42.0	41.0					19																	2989633		2203	4300	6503	2940633	SO:0001583	missense	0			AK024071	CCDS12100.1, CCDS45910.1	19p13.3	2014-03-07	2014-03-07		ENSG00000104953	ENSG00000104953		"""WD repeat domain containing"""	30788	protein-coding gene	gene with protein product		612399	"""transducin-like enhancer of split 6 (E(sp1) homolog, Drosophila)"""			11486032	Standard	NM_024760		Approved	FLJ14009, GRG6	uc002lwt.2	Q9H808	OTTHUMG00000156793	ENST00000246112.4:c.1094C>G	19.37:g.2989633C>G	ENSP00000246112:p.Ala365Gly	Somatic	24	0.00	0		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	2940633	86	34.78	48	J3KMZ1	Missense_Mutation	SNP	HMMSmart_WD40,superfamily_WD40_like,PatternScan_WD_REPEATS_1	p.A242G	ENST00000246112.4	37	c.725	CCDS45910.1	19	.	.	.	.	.	.	.	.	.	.	C	13.52	2.261727	0.39995	.	.	ENSG00000104953	ENST00000447920;ENST00000246112;ENST00000452088;ENST00000441927	T;T	0.11385	2.78;2.78	3.16	-2.11	0.07187	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	.	.	.	.	T	0.09468	0.0233	L	0.35341	1.055	0.42771	D	0.993836	P;D;P;P	0.61697	0.949;0.99;0.761;0.901	B;P;B;B	0.52159	0.37;0.691;0.251;0.37	T	0.47774	-0.9091	9	0.52906	T	0.07	.	0.578	0.00707	0.1958:0.3674:0.1919:0.245	.	365;223;242;242	C9JGZ7;Q9Y6S1;Q9H808;Q6PJM9	.;.;TLE6_HUMAN;.	G	365;365;242;242	ENSP00000246112:A365G;ENSP00000406893:A242G	ENSP00000246112:A365G	A	+	2	0	TLE6	2940633	0.295000	0.24389	0.034000	0.17996	0.542000	0.35054	0.697000	0.25556	-0.265000	0.09352	-0.409000	0.06214	GCG	-	superfamily_WD40_like		0.657	TLE6-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TLE6	protein_coding	OTTHUMT00000345996.3	C	NM_024760		2940633	+1	no_errors	NM_024760.1	genbank	human	validated	54_36p	missense	SNP	0.999	G
MUC16	94025	genome.wustl.edu	37	19	9060044	9060044	+	Silent	SNP	G	G	A			TCGA-AB-2915-03A-01W-0745-08	TCGA-AB-2915-11A-01W-0745-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	7f3f32b0-89db-4deb-84f1-5c0013f33668	733a0414-1086-4395-9859-9f85aad1863f	g.chr19:9060044G>A	ENST00000397910.4	-	3	27605	c.27402C>T	c.(27400-27402)agC>agT	p.S9134S		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	9136	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CAGAGGGATGGCTTAGCCATG	0.493																																						dbGAP											0			19											77.0	73.0	74.0					19																	9060044		2017	4180	6197	8921044	SO:0001819	synonymous_variant	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.27402C>T	19.37:g.9060044G>A		Somatic	137	2.84	4		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	8921044	133	42.74	100	Q6ZQW5|Q96RK2	Silent	SNP	HMMPfam_SEA,HMMSmart_SM00200,PatternScan_ATPASE_ALPHA_BETA,superfamily_SEA domain	p.S9134	ENST00000397910.4	37	c.27402	CCDS54212.1	19																																																																																			-	NULL		0.493	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	protein_coding	OTTHUMT00000402806.1	G	NM_024690		8921044	-1	no_errors	NM_024690.2	genbank	human	validated	54_36p	silent	SNP	0.000	A
VWA3B	200403	genome.wustl.edu	37	2	98810951	98810952	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AB-2915-03A-01W-0745-08	TCGA-AB-2915-11A-01W-0745-08	-	-	-	A	-	-	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	7f3f32b0-89db-4deb-84f1-5c0013f33668	733a0414-1086-4395-9859-9f85aad1863f	g.chr2:98810951_98810952insA	ENST00000477737.1	+	12	1937_1938	c.1733_1734insA	c.(1732-1737)ataaagfs	p.IK578fs	VWA3B_ENST00000435344.1_Frame_Shift_Ins_p.IK578fs|VWA3B_ENST00000451075.2_Frame_Shift_Ins_p.IK428fs	NM_144992.4	NP_659429.4	Q502W6	VWA3B_HUMAN	von Willebrand factor A domain containing 3B	578	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.									NS(3)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						ATTAGAGACATAAAGGTAAGTT	0.446																																						dbGAP											0			2																																								98177384	SO:0001589	frameshift_variant	0			AL832761	CCDS42718.1	2q11.2	2008-02-05			ENSG00000168658	ENSG00000168658			28385	protein-coding gene	gene with protein product						12477932	Standard	NM_144992		Approved	DKFZp686F2227, MGC26733	uc002syo.3	Q502W6	OTTHUMG00000153104	ENST00000477737.1:c.1736dupA	2.37:g.98810954_98810954dupA	ENSP00000417955:p.Ile578fs	Somatic	68	0.00	0		0	0.00	0	WXS	Illumina HiSeq	Phase_IV	98177383	168	34.88	90	B9EK71|Q86T73|Q8N2D0|Q8N770|Q8NA79|Q8ND63|Q8ND65|Q8WW02	Frame_Shift_Ins	INS	HMMPfam_VWA,HMMSmart_SM00327,superfamily_vWA-like	p.I580fs	ENST00000477737.1	37	c.1733_1734	CCDS42718.1	2																																																																																			-	HMMPfam_VWA,HMMSmart_SM00327,superfamily_vWA-like		0.446	VWA3B-020	KNOWN	basic|appris_principal|CCDS	protein_coding	VWA3B	protein_coding	OTTHUMT00000353469.2	-	NM_144992		98177384	+1	no_errors	NM_144992.4	genbank	human	provisional	54_36p	frame_shift_ins	INS	0.454:0.255	A
SSSCA1	10534	genome.wustl.edu	37	11	65339073	65339075	+	In_Frame_Del	DEL	CCT	CCT	-			TCGA-AB-2915-03A-01W-0745-08	TCGA-AB-2915-11A-01W-0745-08	CCT	CCT	CCT	-	CCT	CCT	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	7f3f32b0-89db-4deb-84f1-5c0013f33668	733a0414-1086-4395-9859-9f85aad1863f	g.chr11:65339073_65339075delCCT	ENST00000309328.3	+	4	530_532	c.468_470delCCT	c.(466-471)gccctc>gcc	p.L158del	SSSCA1_ENST00000527920.1_Intron|SSSCA1_ENST00000531405.1_In_Frame_Del_p.L121del|SSSCA1_ENST00000526877.1_3'UTR|SSSCA1-AS1_ENST00000567594.1_RNA|FAM89B_ENST00000530349.1_5'Flank|FAM89B_ENST00000316409.2_5'Flank|FAM89B_ENST00000449319.2_5'Flank	NM_006396.1	NP_006387.1	O60232	SSA27_HUMAN	Sjogren syndrome/scleroderma autoantigen 1	158					mitotic nuclear division (GO:0007067)					kidney(1)|lung(4)|ovary(1)|prostate(1)|skin(1)	8						CACAGACAGCCCTCTTGCAGAAG	0.616																																						dbGAP											0			11																																								65095651	SO:0001651	inframe_deletion	0			AB001740	CCDS8104.1	11q13.1	2007-10-04	2007-10-04			ENSG00000173465			11328	protein-coding gene	gene with protein product		606044	"""Sjogren's syndrome/scleroderma autoantigen 1"""			9486406	Standard	NM_006396		Approved	p27	uc001oek.3	O60232		ENST00000309328.3:c.468_470delCCT	11.37:g.65339073_65339075delCCT	ENSP00000312318:p.Leu158del	Somatic	0	3.70	1		0	23.81	10	WXS	Illumina HiSeq	Phase_IV	65095649	0	27.27	12		In_Frame_Del	DEL	HMMPfam_Auto_anti-p27	p.L158in_frame_del	ENST00000309328.3	37	c.468_470	CCDS8104.1	11																																																																																			-	NULL		0.616	SSSCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SSSCA1	protein_coding	OTTHUMT00000389511.1	CCT	NM_006396		65095651	+1	no_errors	NM_006396.1	genbank	human	provisional	54_36p	in_frame_del	DEL	0.997:1.000:1.000	-
FLT3	2322	genome.wustl.edu	37	13	28608260	28608261	+	In_Frame_Ins	INS	-	-	ATTCATATTCTCTGAAATCAACGTAGAAGTACTCATTATCTGAGGAGCCAG			TCGA-AB-2915-03A-01W-0745-08	TCGA-AB-2915-11A-01W-0745-08	-	-	-	ATTCATATTCTCTGAAATCAACGTAGAAGTACTCATTATCTGAGGAGCCAG	-	-	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	7f3f32b0-89db-4deb-84f1-5c0013f33668	733a0414-1086-4395-9859-9f85aad1863f	g.chr13:28608260_28608261insATTCATATTCTCTGAAATCAACGTAGAAGTACTCATTATCTGAGGAGCCAG	ENST00000241453.7	-	14	1876_1877	c.1795_1796insCTGGCTCCTCAGATAATGAGTACTTCTACGTTGATTTCAGAGAATATGAAT	c.(1795-1797)tat>tCTGGCTCCTCAGATAATGAGTACTTCTACGTTGATTTCAGAGAATATGAATat	p.598_599insSGSSDNEYFYVDFREYE	FLT3_ENST00000380982.4_In_Frame_Ins_p.598_599insSGSSDNEYFYVDFREYE|FLT3_ENST00000537084.1_In_Frame_Ins_p.598_599insSGSSDNEYFYVDFREYE	NM_004119.2	NP_004110.2	P36888	FLT3_HUMAN	fms-related tyrosine kinase 3	598					B cell differentiation (GO:0030183)|cellular response to cytokine stimulus (GO:0071345)|common myeloid progenitor cell proliferation (GO:0035726)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell differentiation (GO:0097028)|hemopoiesis (GO:0030097)|leukocyte homeostasis (GO:0001776)|lymphocyte proliferation (GO:0046651)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)|pro-B cell differentiation (GO:0002328)|pro-T cell differentiation (GO:0002572)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor signaling pathway (GO:0038084)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|cytokine receptor activity (GO:0004896)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)	p.Y599F(2)|p.E598_Y599ins22(1)|p.E598_Y599ins25(1)|p.E598_Y599insWDFREYE(1)|p.E598_Y599ins14(1)|p.Y599_D600>NEYFYVDFREYEY(1)|p.Y599_D600insFDFREYE(1)|p.E598_Y599insFYVDFREYE(1)		NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(12329)|kidney(2)|large_intestine(8)|lung(30)|ovary(4)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	12390	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0156)|Ovarian(182;0.0392)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.00154)|all cancers(112;0.00459)|GBM - Glioblastoma multiforme(144;0.00562)|Epithelial(112;0.0959)|Lung(94;0.212)	Ponatinib(DB08901)|Sorafenib(DB00398)|Sunitinib(DB01268)	TTTGAGATCATATTCATATTCT	0.371			"""Mis, O"""		"""AML, ALL"""																																	dbGAP		Dom	yes		13	13q12	2322	fms-related tyrosine kinase 3		L	9	Insertion - In frame(7)|Substitution - Missense(2)	haematopoietic_and_lymphoid_tissue(9)	13																																								27506261	SO:0001652	inframe_insertion	0			U02687	CCDS31953.1	13q12	2014-09-17			ENSG00000122025	ENSG00000122025	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3765	protein-coding gene	gene with protein product		136351				8394751	Standard	NM_004119		Approved	STK1, FLK2, CD135	uc001urw.3	P36888	OTTHUMG00000016646	ENST00000241453.7:c.1795_1796insCTGGCTCCTCAGATAATGAGTACTTCTACGTTGATTTCAGAGAATATGAAT	13.37:g.28608260_28608261insATTCATATTCTCTGAAATCAACGTAGAAGTACTCATTATCTGAGGAGCCAG	ENSP00000241453:p.Glu598_Tyr599insSerGlySerSerAspAsnGluTyrPheTyrValAspPheArgGluTyrGlu	Somatic	NA	NA	NA		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	27506260	NA	NA	NA	A0AVG9|B7ZLT7|B7ZLT8|F5H0A0|Q13414	In_Frame_Ins	INS	HMMPfam_Pkinase_Tyr,HMMSmart_TyrKc,PatternScan_RECEPTOR_TYR_KIN_III,PatternScan_PROTEIN_KINASE_TYR,superfamily_Kinase_like,HMMPfam_ig,PatternScan_PROTEIN_KINASE_ATP,superfamily_SSF48726	p.599in_frame_insSGSSDNEYFYVDFREYE	ENST00000241453.7	37	c.1796_1795	CCDS31953.1	13																																																																																			-	superfamily_Kinase_like		0.371	FLT3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FLT3	protein_coding	OTTHUMT00000044319.2	-			27506261	-1	no_errors	NM_004119.2	genbank	human	reviewed	54_36p	in_frame_ins	INS	1.000:0.999	ATTCATATTCTCTGAAATCAACGTAGAAGTACTCATTATCTGAGGAGCCAG
