#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NormalRefReads_WU	i_NormalVAF_WU	i_NormalVarReads_WU	i_ORegAnno_bin	i_RNARefReads_WU	i_RNAVAF_WU	i_RNAVarReads_WU	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TumorRefReads_WU	i_TumorVAF_WU	i_TumorVarReads_WU	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
MED12	9968	genome.wustl.edu	37	X	70347217	70347217	+	Missense_Mutation	SNP	C	C	T	rs80338758		TCGA-AB-2917-03A-01W-0732-08	TCGA-AB-2917-11A-01W-0732-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	77b0ecc5-d93d-44bf-b2da-fda304c4810b	52fc3d72-1205-44db-8c5b-1e8750a98313	g.chrX:70347217C>T	ENST00000374080.3	+	21	2913	c.2881C>T	c.(2881-2883)Cgg>Tgg	p.R961W	MED12_ENST00000333646.6_Missense_Mutation_p.R961W|MED12_ENST00000374102.1_Missense_Mutation_p.R961W|MED12_ENST00000462984.1_3'UTR			Q93074	MED12_HUMAN	mediator complex subunit 12	961			R -> W (in OKS). {ECO:0000269|PubMed:17334363}.		androgen receptor signaling pathway (GO:0030521)|axis elongation involved in somitogenesis (GO:0090245)|canonical Wnt signaling pathway (GO:0060070)|gene expression (GO:0010467)|heart development (GO:0007507)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|oligodendrocyte development (GO:0014003)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|Schwann cell development (GO:0014044)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|receptor activity (GO:0004872)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(6)|central_nervous_system(2)|endometrium(22)|kidney(5)|large_intestine(8)|lung(31)|ovary(2)|pancreas(1)|prostate(11)|skin(5)|soft_tissue(323)|upper_aerodigestive_tract(1)|urinary_tract(3)	420	Renal(35;0.156)					TGGGATGAACCGGTCCGATGG	0.517			"""M, S"""		uterine leiomyoma		Opitz-Kaveggia Syndrome																															dbGAP		Dom	yes		X	Xq13	9968	mediator complex subunit 12	Yes	M	0			X	GRCh37	CM071860	MED12	M	rs80338758						80.0	80.0	80.0					X																	70347217		2070	4171	6241	70263942	SO:0001583	missense	0			U80742	CCDS43970.1	Xq13	2011-02-14	2007-07-30	2004-11-26	ENSG00000184634	ENSG00000184634			11957	protein-coding gene	gene with protein product		300188	"""trinucleotide repeat containing 11 (THR-associated protein, 230kDa subunit)"", ""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)"", ""FG syndrome 1"""	TNRC11, FGS1		9225980, 10198638, 17334363, 20507344	Standard	NM_005120		Approved	CAGH45, HOPA, OPA1, TRAP230, KIAA0192, OKS	uc004dyy.3	Q93074	OTTHUMG00000021788	ENST00000374080.3:c.2881C>T	X.37:g.70347217C>T	ENSP00000363193:p.Arg961Trp	Somatic	465	5.61	28		2	95.24	40	WXS	Illumina HiSeq	Phase_IV	70263942	199	41.47	141	O15410|O75557|Q9UHV6|Q9UND7	Missense_Mutation	SNP	HMMPfam_Med12	p.R961W	ENST00000374080.3	37	c.2881	CCDS43970.1	X	.	.	.	.	.	.	.	.	.	.	.	32	5.121577	0.94385	.	.	ENSG00000184634	ENST00000333646;ENST00000536756;ENST00000374102;ENST00000374080;ENST00000430072	T;T;T;T	0.79554	-1.28;-1.28;-1.28;-1.28	5.0	5.0	0.66597	.	0.067470	0.64402	D	0.000010	D	0.82472	0.5044	N	0.22421	0.69	0.58432	A	0.999999	D;D;D;D	0.71674	0.997;0.998;0.998;0.997	D;P;D;P	0.63283	0.913;0.776;0.913;0.881	D	0.86163	0.1595	9	0.87932	D	0	-20.8211	17.5015	0.87733	0.0:1.0:0.0:0.0	.	961;808;961;961	F5H3Y1;Q7Z3Z5;Q93074-3;Q93074	.;.;.;MED12_HUMAN	W	961;961;961;961;929	ENSP00000333125:R961W;ENSP00000363215:R961W;ENSP00000363193:R961W;ENSP00000414203:R929W	ENSP00000333125:R961W	R	+	1	2	MED12	70263942	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.358000	0.66064	2.316000	0.78162	0.529000	0.55759	CGG	-	NULL		0.517	MED12-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	MED12	protein_coding	OTTHUMT00000057105.1	C	NM_005120		70263942	+1	no_errors	NM_005120.2	genbank	human	validated	54_36p	missense	SNP	1.000	T
DIAPH2	1730	genome.wustl.edu	37	X	96684726	96684726	+	Missense_Mutation	SNP	C	C	T			TCGA-AB-2917-03A-01W-0732-08	TCGA-AB-2917-11A-01W-0732-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	77b0ecc5-d93d-44bf-b2da-fda304c4810b	52fc3d72-1205-44db-8c5b-1e8750a98313	g.chrX:96684726C>T	ENST00000324765.8	+	26	3570	c.3223C>T	c.(3223-3225)Cgg>Tgg	p.R1075W	DIAPH2_ENST00000373054.4_Missense_Mutation_p.R1071W|DIAPH2_ENST00000373061.3_Missense_Mutation_p.R1075W|DIAPH2_ENST00000355827.4_Missense_Mutation_p.R1075W|DIAPH2_ENST00000373049.4_Missense_Mutation_p.R1075W|DIAPH2-AS1_ENST00000439759.2_RNA			O60879	DIAP2_HUMAN	diaphanous-related formin 2	1075	Arg/Lys-rich (basic).|DAD. {ECO:0000255|PROSITE- ProRule:PRU00577}.				actin filament polymerization (GO:0030041)|cytokinesis (GO:0000910)|female gamete generation (GO:0007292)|multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)	endosome (GO:0005768)	receptor binding (GO:0005102)	p.R1075W(1)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	51						CCGTCGAAAGCGGATTCCAAG	0.408																																						dbGAP											1	Substitution - Missense(1)	upper_aerodigestive_tract(1)	X											72.0	63.0	66.0					X																	96684726		2203	4300	6503	96571382	SO:0001583	missense	0			Y15909	CCDS14467.1, CCDS14468.1	Xq22	2013-05-24	2013-05-24		ENSG00000147202	ENSG00000147202			2877	protein-coding gene	gene with protein product		300108	"""diaphanous (Drosophila, homolog) 2"", ""diaphanous homolog 2 (Drosophila)"""			9360932	Standard	NM_006729		Approved	POF, DIA, POF2, DIA2	uc004efu.4	O60879	OTTHUMG00000022689	ENST00000324765.8:c.3223C>T	X.37:g.96684726C>T	ENSP00000321348:p.Arg1075Trp	Somatic	208	4.09	9		19	0.00	0	WXS	Illumina HiSeq	Phase_IV	96571382	103	45.26	86	A6NG19|O60878|Q8WX06|Q8WX48|Q9UJL2	Missense_Mutation	SNP	HMMSmart_SM00498,HMMPfam_Drf_DAD,HMMPfam_Drf_FH3,HMMPfam_Drf_GBD,HMMPfam_FH2,superfamily_Formin homology 2 domain (FH2 domain)	p.R1075W	ENST00000324765.8	37	c.3223	CCDS14467.1	X	.	.	.	.	.	.	.	.	.	.	C	12.52	1.963775	0.34659	.	.	ENSG00000147202	ENST00000373061;ENST00000373054;ENST00000355827;ENST00000373049;ENST00000324765;ENST00000537885	D;D;D;D;D	0.84298	-1.76;-1.75;-1.83;-1.83;-1.76	5.31	2.44	0.29823	Diaphanous autoregulatory (1);	0.000000	0.64402	D	0.000002	D	0.92381	0.7582	M	0.82630	2.6	0.40951	D	0.984543	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.92387	0.5918	10	0.87932	D	0	.	16.0188	0.80464	0.3431:0.6569:0.0:0.0	.	1075;1075	O60879;O60879-2	DIAP2_HUMAN;.	W	1075;1071;1075;1075;1075;1082	ENSP00000362152:R1075W;ENSP00000362145:R1071W;ENSP00000348082:R1075W;ENSP00000362140:R1075W;ENSP00000321348:R1075W	ENSP00000321348:R1075W	R	+	1	2	DIAPH2	96571382	1.000000	0.71417	0.990000	0.47175	0.631000	0.37964	0.692000	0.25482	-0.085000	0.12573	-0.918000	0.02743	CGG	-	NULL		0.408	DIAPH2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DIAPH2	protein_coding	OTTHUMT00000058871.2	C	NM_006729, NM_007309		96571382	+1	no_errors	NM_006729.4	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
MMP23B	8510	genome.wustl.edu	37	1	1571791	1571791	+	IGR	SNP	G	G	A	rs201006058		TCGA-AB-2917-03A-01W-0732-08	TCGA-AB-2917-11A-01W-0732-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	77b0ecc5-d93d-44bf-b2da-fda304c4810b	52fc3d72-1205-44db-8c5b-1e8750a98313	g.chr1:1571791G>A	ENST00000356026.5	+	0	1326				CDK11B_ENST00000340677.5_Missense_Mutation_p.A647V|CDK11B_ENST00000317673.7_Missense_Mutation_p.A658V|CDK11B_ENST00000341832.6_Missense_Mutation_p.A613V|CDK11B_ENST00000407249.3_Missense_Mutation_p.A660V			O75900	MMP23_HUMAN	matrix metallopeptidase 23B						proteolysis (GO:0006508)|reproduction (GO:0000003)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			large_intestine(1)	1	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;5.61e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;5.26e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.54e-23)|GBM - Glioblastoma multiforme(42;9e-08)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|STAD - Stomach adenocarcinoma(132;0.00644)|BRCA - Breast invasive adenocarcinoma(365;0.00786)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)	Marimastat(DB00786)	CTTCTTGACTGCTGGGAGCTC	0.572																																						dbGAP											0			1											100.0	72.0	81.0					1																	1571791		1969	4139	6108	1561654	SO:0001628	intergenic_variant	0				CCDS30559.1	1p36.3	2013-01-11	2005-08-08		ENSG00000189409	ENSG00000189409		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7171	protein-coding gene	gene with protein product	"""matrix metalloproteinase 22"", ""femalysin"", ""matrix metalloproteinase in the female reproductive tract"""	603321	"""matrix metalloproteinase 23B"""	MMP22		9740677, 9750192	Standard	XM_005244810		Approved	MIFR, MIFR-1	uc001agp.3	O75900	OTTHUMG00000074713		1.37:g.1571791G>A		Somatic	30	0.00	0		47	4.08	2	WXS	Illumina HiSeq	Phase_IV	1561654	27	28.95	11	A2AGN0|A2AGN1|O75894|O75895|Q5QPQ8|Q76P96|Q7LDM6|Q7LDM7|Q9UBR9|Q9UJK8	Nonsense_Mutation	SNP	NULL	p.Q657*	ENST00000356026.5	37	c.1969	CCDS30559.1	1																																																																																			-	NULL		0.572	MMP23B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC2L2	protein_coding	OTTHUMT00000158492.2	G	NM_006983		1561654	-1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	NM_033529.2	genbank	human	reviewed	54_36p	nonsense	SNP	0.978	A
GJB3	2707	genome.wustl.edu	37	1	35251009	35251009	+	Nonsense_Mutation	SNP	C	C	T	rs201005859		TCGA-AB-2917-03A-01W-0732-08	TCGA-AB-2917-11A-01W-0732-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	77b0ecc5-d93d-44bf-b2da-fda304c4810b	52fc3d72-1205-44db-8c5b-1e8750a98313	g.chr1:35251009C>T	ENST00000373366.2	+	2	1261	c.646C>T	c.(646-648)Cga>Tga	p.R216*	RP1-34M23.5_ENST00000542839.1_RNA|GJB3_ENST00000373362.3_Nonsense_Mutation_p.R216*	NM_024009.2	NP_076872.1	O75712	CXB3_HUMAN	gap junction protein, beta 3, 31kDa	216					cell communication (GO:0007154)|in utero embryonic development (GO:0001701)|placenta development (GO:0001890)|sensory perception of sound (GO:0007605)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	connexon complex (GO:0005922)|cytoplasm (GO:0005737)|gap junction (GO:0005921)|integral component of membrane (GO:0016021)	gap junction channel activity (GO:0005243)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(2)|prostate(3)	15		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.234)				CAGGGTCCTGCGAGGCCTGCA	0.627																																						dbGAP											0			1						C	stop/ARG,stop/ARG	1,4405	2.1+/-5.4	0,1,2202	46.0	42.0	44.0		646,646	2.1	0.0	1		44	0,8600		0,0,4300	yes	stop-gained,stop-gained	GJB3	NM_001005752.1,NM_024009.2	,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,	216/271,216/271	35251009	1,13005	2203	4300	6503	35023596	SO:0001587	stop_gained	0			BC012918	CCDS384.1	1p34	2008-05-14	2007-01-16		ENSG00000188910	ENSG00000188910		"""Ion channels / Gap junction proteins (connexins)"""	4285	protein-coding gene	gene with protein product	"""connexin 31"""	603324	"""gap junction protein, beta 3, 31kD (connexin 31)"", ""gap junction protein, beta 3, 31kDa (connexin 31)"", ""erythrokeratodermia variabilis"""	DFNA2, EKV		9843210, 9704026	Standard	NM_024009		Approved	CX31	uc001bxy.3	O75712	OTTHUMG00000004051	ENST00000373366.2:c.646C>T	1.37:g.35251009C>T	ENSP00000362464:p.Arg216*	Somatic	64	0.00	0		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	35023596	66	46.40	58	B2R790|Q2TAZ8	Nonsense_Mutation	SNP	HMMPfam_Connexin,HMMSmart_SM00037,PatternScan_CONNEXINS_1,PatternScan_CONNEXINS_2,HMMPfam_Connexin_CCC	p.R216*	ENST00000373366.2	37	c.646	CCDS384.1	1	.	.	.	.	.	.	.	.	.	.	C	37	6.199139	0.97371	2.27E-4	0.0	ENSG00000188910	ENST00000373366;ENST00000373362;ENST00000543647	.	.	.	5.32	2.14	0.27477	.	0.488250	0.20531	N	0.090519	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.9213	0.70841	0.6351:0.3649:0.0:0.0	.	.	.	.	X	216;216;200	.	ENSP00000362460:R216X	R	+	1	2	GJB3	35023596	0.000000	0.05858	0.007000	0.13788	0.127000	0.20565	1.140000	0.31516	0.531000	0.28639	0.561000	0.74099	CGA	-	NULL		0.627	GJB3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	GJB3	protein_coding	OTTHUMT00000011559.1	C	NM_024009		35023596	+1	no_errors	NM_001005752.1	genbank	human	reviewed	54_36p	nonsense	SNP	0.009	T
PDC	5132	genome.wustl.edu	37	1	186415594	186415594	+	Missense_Mutation	SNP	C	C	A	rs143530887	byFrequency	TCGA-AB-2917-03A-01W-0732-08	TCGA-AB-2917-11A-01W-0732-08	C	C	C	A	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	77b0ecc5-d93d-44bf-b2da-fda304c4810b	52fc3d72-1205-44db-8c5b-1e8750a98313	g.chr1:186415594C>A	ENST00000391997.2	-	3	264	c.177G>T	c.(175-177)agG>agT	p.R59S	PDC_ENST00000497198.1_Missense_Mutation_p.R7S|PDC_ENST00000456239.2_Missense_Mutation_p.R7S|PDC_ENST00000340129.5_Missense_Mutation_p.R59S	NM_002597.4	NP_002588.3	P20941	PHOS_HUMAN	phosducin	59					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of catalytic activity (GO:0043086)|phototransduction (GO:0007602)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|photoreceptor outer segment (GO:0001750)	phospholipase inhibitor activity (GO:0004859)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(1)|prostate(1)|skin(1)	7		Breast(1374;1.53e-05)		KIRC - Kidney renal clear cell carcinoma(1967;3.23e-08)|Colorectal(1306;0.0129)		CTTTGCCATTCCTACTCTGAG	0.333																																						dbGAP											0			1											139.0	133.0	135.0					1																	186415594		2203	4300	6503	184682217	SO:0001583	missense	0			AF076464	CCDS1370.1, CCDS41447.1	1q25.2	2013-01-08			ENSG00000116703	ENSG00000116703			8759	protein-coding gene	gene with protein product		171490				8288249	Standard	NM_022576		Approved	MEKA	uc001gsa.4	P20941	OTTHUMG00000035575	ENST00000391997.2:c.177G>T	1.37:g.186415594C>A	ENSP00000375855:p.Arg59Ser	Somatic	237	2.45	6		2	0.00	0	WXS	Illumina HiSeq	Phase_IV	184682217	172	39.65	113	Q14816|Q9UP22|Q9UP23	Missense_Mutation	SNP	HMMPfam_Phosducin,superfamily_Thiordxn-like_fd	p.R59S	ENST00000391997.2	37	c.177	CCDS1370.1	1	.	.	.	.	.	.	.	.	.	.	C	6.936	0.542432	0.13250	.	.	ENSG00000116703	ENST00000391997;ENST00000497198;ENST00000456239;ENST00000340129	T;T;T;T	0.48836	0.8;0.8;0.8;0.8	5.36	3.06	0.35304	Thioredoxin-like fold (1);Phosducin, thioredoxin-like domain (1);Phosducin, domain 2 (1);	0.157851	0.53938	D	0.000054	T	0.18800	0.0451	N	0.02708	-0.52	0.27657	N	0.94722	B	0.27351	0.176	B	0.26310	0.068	T	0.29427	-1.0012	10	0.07175	T	0.84	-7.3128	9.0945	0.36632	0.0:0.1526:0.0:0.8474	.	59	P20941	PHOS_HUMAN	S	59;7;7;59	ENSP00000375855:R59S;ENSP00000422775:R7S;ENSP00000411564:R7S;ENSP00000342033:R59S	ENSP00000342033:R59S	R	-	3	2	PDC	184682217	0.987000	0.35691	0.888000	0.34837	0.076000	0.17211	0.777000	0.26718	0.352000	0.24053	-0.469000	0.05056	AGG	-	HMMPfam_Phosducin,superfamily_Thiordxn-like_fd		0.333	PDC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDC	protein_coding	OTTHUMT00000086347.2	C	NM_022577		184682217	-1	no_errors	NM_002597.3	genbank	human	reviewed	54_36p	missense	SNP	0.996	A
SCN1A	6323	genome.wustl.edu	37	2	166901716	166901716	+	Missense_Mutation	SNP	C	C	T	rs200176684	byFrequency	TCGA-AB-2917-03A-01W-0732-08	TCGA-AB-2917-11A-01W-0732-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	77b0ecc5-d93d-44bf-b2da-fda304c4810b	52fc3d72-1205-44db-8c5b-1e8750a98313	g.chr2:166901716C>T	ENST00000303395.4	-	10	1498	c.1499G>A	c.(1498-1500)cGg>cAg	p.R500Q	AC010127.3_ENST00000595647.1_RNA|SCN1A_ENST00000409050.1_Missense_Mutation_p.R500Q|SCN1A_ENST00000423058.2_Missense_Mutation_p.R500Q|SCN1A_ENST00000375405.3_Missense_Mutation_p.R500Q|AC010127.3_ENST00000599041.1_RNA|AC010127.3_ENST00000595268.1_RNA			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit	500					adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)	p.R500Q(2)		NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TTTCTTCCTCCGATTTCTTCT	0.463													C|||	3	0.000599042	0.0	0.0	5008	,	,		18041	0.003		0.0	False		,,,				2504	0.0					dbGAP											2	Substitution - Missense(2)	lung(2)	2											216.0	221.0	219.0					2																	166901716		2203	4300	6503	166609962	SO:0001583	missense	0			AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.1499G>A	2.37:g.166901716C>T	ENSP00000303540:p.Arg500Gln	Somatic	197	2.94	6		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	166609962	121	45.74	102	E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Missense_Mutation	SNP	HMMPfam_IQ,HMMSmart_IQ,HMMPfam_Ion_trans,HMMPfam_Na_trans_assoc,PatternScan_RIBONUCLEASE_P,superfamily_SSF81324	p.R500Q	ENST00000303395.4	37	c.1499	CCDS54413.1	2	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	24.8	4.572068	0.86542	.	.	ENSG00000144285	ENST00000423058;ENST00000303395;ENST00000375405;ENST00000409050	D;D;D;D	0.92199	-2.99;-2.99;-2.99;-2.99	6.17	5.28	0.74379	Domain of unknown function DUF3451 (1);	0.282824	0.24856	N	0.035053	D	0.93488	0.7922	M	0.91510	3.215	0.42305	D	0.992195	B;B;B	0.29646	0.086;0.253;0.253	B;B;B	0.22753	0.014;0.041;0.041	D	0.92683	0.6160	10	0.66056	D	0.02	.	17.0721	0.86577	0.0:0.8729:0.1271:0.0	.	500;500;500	P35498-2;E9PG49;P35498	.;.;SCN1A_HUMAN	Q	500	ENSP00000407030:R500Q;ENSP00000303540:R500Q;ENSP00000364554:R500Q;ENSP00000386312:R500Q	ENSP00000303540:R500Q	R	-	2	0	SCN1A	166609962	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.228000	0.51270	1.585000	0.49928	0.655000	0.94253	CGG	-	NULL		0.463	SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	SCN1A	protein_coding	OTTHUMT00000102661.1	C	NM_006920		166609962	-1	no_errors	NM_006920.4	genbank	human	validated	54_36p	missense	SNP	1.000	T
PTPRG	5793	genome.wustl.edu	37	3	61728457	61728457	+	Intron	SNP	G	G	A			TCGA-AB-2917-03A-01W-0732-08	TCGA-AB-2917-11A-01W-0732-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	77b0ecc5-d93d-44bf-b2da-fda304c4810b	52fc3d72-1205-44db-8c5b-1e8750a98313	g.chr3:61728457G>A	ENST00000474889.1	+	2	462				PTPRG_ENST00000295874.10_Intron|PTPRG_ENST00000495879.1_Intron	NM_002841.3	NP_002832.3	P23470	PTPRG_HUMAN	protein tyrosine phosphatase, receptor type, G						brain development (GO:0007420)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of neuron projection development (GO:0010977)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|liver(2)|lung(15)|ovary(7)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	62				BRCA - Breast invasive adenocarcinoma(55;0.000376)|KIRC - Kidney renal clear cell carcinoma(10;0.0499)|Kidney(10;0.065)		GGCCAAAAACGCATCATACTT	0.483																																						dbGAP											0			3																																								61703497	SO:0001627	intron_variant	0			L09247	CCDS2895.1	3p21-p14	2013-02-11			ENSG00000144724	ENSG00000144724		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9671	protein-coding gene	gene with protein product		176886		PTPG		1711217	Standard	NM_002841		Approved	RPTPG	uc003dlb.3	P23470	OTTHUMG00000158660	ENST00000474889.1:c.86-6095G>A	3.37:g.61728457G>A		Somatic	114	2.56	3		1366	0.07	1	WXS	Illumina HiSeq	Phase_IV	61703497	105	46.70	92	B2RU12|B7ZLX5|Q15623|Q59EE0|Q68DU5	Missense_Mutation	SNP	HMMPfam_Ribosomal_L1,PatternScan_RIBOSOMAL_L1,superfamily_Ribosomal protein L1	p.A25V	ENST00000474889.1	37	c.74	CCDS2895.1	3																																																																																			-	HMMPfam_Ribosomal_L1,superfamily_Ribosomal protein L1		0.483	PTPRG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100128936	protein_coding	OTTHUMT00000351674.1	G	NM_002841		61703497	-1	pseudogene	XM_001726108.1	genbank	human	model	54_36p	missense	SNP	1.000	A
GPR78	27201	genome.wustl.edu	37	4	8588898	8588898	+	Silent	SNP	G	G	A	rs374353570		TCGA-AB-2917-03A-01W-0732-08	TCGA-AB-2917-11A-01W-0732-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	77b0ecc5-d93d-44bf-b2da-fda304c4810b	52fc3d72-1205-44db-8c5b-1e8750a98313	g.chr4:8588898G>A	ENST00000382487.4	+	3	1317	c.900G>A	c.(898-900)ccG>ccA	p.P300P	GPR78_ENST00000509216.1_3'UTR	NM_080819.4	NP_543009.2	Q96P69	GPR78_HUMAN	G protein-coupled receptor 78	300					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(4)|kidney(4)|large_intestine(1)|lung(8)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	26						TCCGCCGGCCGTTCCGCCAAG	0.662																																						dbGAP											0			4						G		0,4406		0,0,2203	40.0	42.0	41.0		900	1.4	0.0	4		41	1,8593	1.2+/-3.3	0,1,4296	no	coding-synonymous	GPR78	NM_080819.2		0,1,6499	AA,AG,GG		0.0116,0.0,0.0077		300/364	8588898	1,12999	2203	4297	6500	8639798	SO:0001819	synonymous_variant	0			AF411107	CCDS3403.1	4p16.1	2012-08-21			ENSG00000155269	ENSG00000155269		"""GPCR / Class A : Orphans"""	4528	protein-coding gene	gene with protein product		606921				11574155	Standard	NM_080819		Approved		uc003glk.4	Q96P69	OTTHUMG00000128483	ENST00000382487.4:c.900G>A	4.37:g.8588898G>A		Somatic	56	5.08	3		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	8639798	19	56.52	26	Q8NGV3	Silent	SNP	HMMPfam_7tm_1,superfamily_Family A G protein-coupled receptor-like	p.P300	ENST00000382487.4	37	c.900	CCDS3403.1	4																																																																																			-	superfamily_Family A G protein-coupled receptor-like		0.662	GPR78-005	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR78	protein_coding	OTTHUMT00000359201.1	G			8639798	+1	no_errors	NM_080819.2	genbank	human	validated	54_36p	silent	SNP	1.000	A
COL12A1	1303	genome.wustl.edu	37	6	75823318	75823318	+	Splice_Site	SNP	G	G	A			TCGA-AB-2917-03A-01W-0732-08	TCGA-AB-2917-11A-01W-0732-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	77b0ecc5-d93d-44bf-b2da-fda304c4810b	52fc3d72-1205-44db-8c5b-1e8750a98313	g.chr6:75823318G>A	ENST00000322507.8	-	50	8149	c.7840C>T	c.(7840-7842)Cct>Tct	p.P2614S	COL12A1_ENST00000483888.2_Splice_Site_p.P2614S|COL12A1_ENST00000416123.2_Splice_Site_p.P2614S|COL12A1_ENST00000345356.6_Splice_Site_p.P1450S	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	2614	Laminin G-like.|Nonhelical region (NC3).			P -> S (in Ref. 5; AAB23937). {ECO:0000305}.	cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						AAATTCTTACGATCTGCAATC	0.313																																						dbGAP											0			6											121.0	109.0	113.0					6																	75823318		1816	4070	5886	75880038	SO:0001630	splice_region_variant	0			U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.7840+1C>T	6.37:g.75823318G>A		Somatic	180	4.23	8		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	75880038	134	42.49	99	O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Missense_Mutation	SNP	HMMPfam_VWA,HMMSmart_SM00327,HMMSmart_SM00210,HMMPfam_fn3,HMMSmart_SM00060,HMMPfam_Collagen,superfamily_Fibronectin type III,superfamily_Concanavalin A-like lectins/glucanases,superfamily_vWA-like	p.P2614S	ENST00000322507.8	37	c.7840	CCDS43482.1	6	.	.	.	.	.	.	.	.	.	.	G	17.52	3.410235	0.62399	.	.	ENSG00000111799	ENST00000322507;ENST00000425443;ENST00000432784;ENST00000345356;ENST00000416123;ENST00000483888;ENST00000493109	T;T;T;T;T;T	0.02197	4.4;4.4;4.4;4.4;4.4;4.4	6.03	6.03	0.97812	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G, thrombospondin-type, N-terminal (1);	0.103218	0.64402	N	0.000003	T	0.01489	0.0048	L	0.50333	1.59	0.58432	D	0.999992	P;P	0.45348	0.856;0.455	B;B	0.32211	0.142;0.037	T	0.67189	-0.5733	9	.	.	.	.	20.1857	0.98214	0.0:0.0:1.0:0.0	.	1450;2614	Q99715-2;Q99715	.;COCA1_HUMAN	S	2614;252;2614;1450;2614;2614;168	ENSP00000325146:P2614S;ENSP00000399812:P252S;ENSP00000305147:P1450S;ENSP00000412864:P2614S;ENSP00000421216:P2614S;ENSP00000423423:P168S	.	P	-	1	0	COL12A1	75880038	1.000000	0.71417	0.999000	0.59377	0.708000	0.40852	6.212000	0.72188	2.868000	0.98415	0.557000	0.71058	CCT	-	HMMSmart_SM00210,superfamily_Concanavalin A-like lectins/glucanases		0.313	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL12A1	protein_coding	OTTHUMT00000041249.3	G	NM_004370	Missense_Mutation	75880038	-1	no_errors	NM_004370.5	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
BAIAP2L1	55971	genome.wustl.edu	37	7	97937047	97937047	+	Missense_Mutation	SNP	C	C	T			TCGA-AB-2917-03A-01W-0732-08	TCGA-AB-2917-11A-01W-0732-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	77b0ecc5-d93d-44bf-b2da-fda304c4810b	52fc3d72-1205-44db-8c5b-1e8750a98313	g.chr7:97937047C>T	ENST00000005260.8	-	10	1332	c.1117G>A	c.(1117-1119)Gag>Aag	p.E373K	RP4-607J23.2_ENST00000608882.1_RNA|BAIAP2L1_ENST00000462558.1_5'Flank|RP4-607J23.2_ENST00000609873.1_RNA	NM_018842.4	NP_061330.2	Q9UHR4	BI2L1_HUMAN	BAI1-associated protein 2-like 1	373	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				filopodium assembly (GO:0046847)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of actin filament polymerization (GO:0030838)|response to bacterium (GO:0009617)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	proline-rich region binding (GO:0070064)			NS(1)|breast(1)|cervix(1)|endometrium(3)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)	23	all_cancers(62;4.34e-10)|all_epithelial(64;5e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0113)|all_lung(186;0.0126)		STAD - Stomach adenocarcinoma(171;0.215)			TCCTTCTCCTCGGGGATGAGC	0.587																																						dbGAP											0			7											165.0	120.0	135.0					7																	97937047		2203	4300	6503	97774983	SO:0001583	missense	0			AF119666	CCDS34687.1	7q22.1	2012-10-04			ENSG00000006453	ENSG00000006453			21649	protein-coding gene	gene with protein product		611877					Standard	NM_018842		Approved	IRTKS	uc003upj.3	Q9UHR4	OTTHUMG00000165117	ENST00000005260.8:c.1117G>A	7.37:g.97937047C>T	ENSP00000005260:p.Glu373Lys	Somatic	146	0.00	0		1	0.00	0	WXS	Illumina HiSeq	Phase_IV	97774983	131	13.07	20	A4D268|Q75L21|Q75L22|Q96CV4|Q9H5F5|Q9Y2M8	Missense_Mutation	SNP	HMMSmart_SH3,superfamily_SH3,HMMPfam_SH3_2,HMMPfam_IMD	p.E373K	ENST00000005260.8	37	c.1117	CCDS34687.1	7	.	.	.	.	.	.	.	.	.	.	C	35	5.552012	0.96501	.	.	ENSG00000006453	ENST00000005260	T	0.49432	0.78	4.87	4.87	0.63330	Src homology-3 domain (3);Variant SH3 (1);	0.094859	0.64402	D	0.000001	T	0.62221	0.2410	L	0.43598	1.365	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.63310	-0.6666	10	0.52906	T	0.07	-21.0739	17.3604	0.87348	0.0:1.0:0.0:0.0	.	373	Q9UHR4	BI2L1_HUMAN	K	373	ENSP00000005260:E373K	ENSP00000005260:E373K	E	-	1	0	AC093799.1	97774983	1.000000	0.71417	0.939000	0.37840	0.957000	0.61999	7.445000	0.80570	2.426000	0.82243	0.557000	0.71058	GAG	-	HMMSmart_SH3,superfamily_SH3,HMMPfam_SH3_2		0.587	BAIAP2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAIAP2L1	protein_coding	OTTHUMT00000334681.1	C	NM_018842		97774983	-1	no_errors	NM_018842.3	genbank	human	provisional	54_36p	missense	SNP	0.993	T
SLC7A13	157724	genome.wustl.edu	37	8	87242055	87242055	+	Missense_Mutation	SNP	C	C	T	rs144944362	byFrequency	TCGA-AB-2917-03A-01W-0732-08	TCGA-AB-2917-11A-01W-0732-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	77b0ecc5-d93d-44bf-b2da-fda304c4810b	52fc3d72-1205-44db-8c5b-1e8750a98313	g.chr8:87242055C>T	ENST00000297524.3	-	1	555	c.452G>A	c.(451-453)cGt>cAt	p.R151H	SLC7A13_ENST00000419776.2_Missense_Mutation_p.R151H|SLC7A13_ENST00000520624.1_Intron	NM_138817.2	NP_620172.2	Q8TCU3	S7A13_HUMAN	solute carrier family 7 (anionic amino acid transporter), member 13	151						integral component of membrane (GO:0016021)	amino acid transmembrane transporter activity (GO:0015171)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	45						TTTCACACCACGAGAAGTCAG	0.453													C|||	5	0.000998403	0.003	0.0014	5008	,	,		20477	0.0		0.0	False		,,,				2504	0.0					dbGAP											0			8						C	HIS/ARG	4,4402	8.1+/-20.4	0,4,2199	113.0	101.0	105.0		452	3.1	0.0	8	dbSNP_134	105	0,8600		0,0,4300	no	missense	SLC7A13	NM_138817.2	29	0,4,6499	TT,TC,CC		0.0,0.0908,0.0308	probably-damaging	151/471	87242055	4,13002	2203	4300	6503	87311171	SO:0001583	missense	0			AJ417661	CCDS34917.1	8q21.3	2013-07-15	2011-07-12		ENSG00000164893	ENSG00000164893		"""Solute carriers"""	23092	protein-coding gene	gene with protein product						11907033, 11943479	Standard	XM_005250804		Approved	AGT-1, XAT2	uc003ydq.1	Q8TCU3	OTTHUMG00000163663	ENST00000297524.3:c.452G>A	8.37:g.87242055C>T	ENSP00000297524:p.Arg151His	Somatic	173	0.00	0		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	87311171	170	20.09	43	Q05C37|Q08AH9|Q96N84	Missense_Mutation	SNP	HMMPfam_AA_permease	p.R151H	ENST00000297524.3	37	c.452	CCDS34917.1	8	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	6.726	0.502762	0.12822	9.08E-4	0.0	ENSG00000164893	ENST00000297524;ENST00000419776	D;D	0.90900	-2.75;-2.75	4.87	3.07	0.35406	Amino acid permease domain (1);	0.557178	0.17577	N	0.169258	D	0.91418	0.7292	L	0.54323	1.7	0.09310	N	1	D;D	0.89917	0.999;1.0	D;D	0.68192	0.921;0.956	T	0.81611	-0.0854	10	0.25106	T	0.35	.	6.1931	0.20536	0.0:0.7218:0.0:0.2782	.	151;151	Q8TCU3-2;Q8TCU3	.;S7A13_HUMAN	H	151	ENSP00000297524:R151H;ENSP00000410982:R151H	ENSP00000297524:R151H	R	-	2	0	SLC7A13	87311171	0.001000	0.12720	0.010000	0.14722	0.214000	0.24535	1.087000	0.30865	1.424000	0.47217	0.609000	0.83330	CGT	-	NULL		0.453	SLC7A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC7A13	protein_coding	OTTHUMT00000374704.1	C	NM_138817		87311171	-1	no_errors	NM_138817.2	genbank	human	validated	54_36p	missense	SNP	0.114	T
CCDC180	100499483	genome.wustl.edu	37	9	100085148	100085148	+	Missense_Mutation	SNP	G	G	A	rs151161375	byFrequency	TCGA-AB-2917-03A-01W-0732-08	TCGA-AB-2917-11A-01W-0732-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	77b0ecc5-d93d-44bf-b2da-fda304c4810b	52fc3d72-1205-44db-8c5b-1e8750a98313	g.chr9:100085148G>A	ENST00000357054.1	+	26	2677	c.1742G>A	c.(1741-1743)cGc>cAc	p.R581H	CCDC180_ENST00000529487.1_Missense_Mutation_p.R442H|CCDC180_ENST00000460482.2_3'UTR|CCDC180_ENST00000375202.2_Missense_Mutation_p.R442H|CCDC180_ENST00000395220.1_Missense_Mutation_p.R541H|CCDC180_ENST00000411667.2_Missense_Mutation_p.R439H|RP11-23J9.4_ENST00000534123.1_RNA			Q9P1Z9	CC180_HUMAN	coiled-coil domain containing 180	581						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)											ATGCGGATCCGCCTGCTGTAT	0.537													G|||	3	0.000599042	0.0015	0.0	5008	,	,		21009	0.0		0.0	False		,,,				2504	0.001					dbGAP											0			9						G	HIS/ARG	4,4402	8.1+/-20.4	0,4,2199	114.0	89.0	97.0		1325	3.2	0.8	9	dbSNP_134	97	0,8600		0,0,4300	yes	missense	C9orf174	NM_020893.2	29	0,4,6499	AA,AG,GG		0.0,0.0908,0.0308	benign	442/1702	100085148	4,13002	2203	4300	6503	99124969	SO:0001583	missense	0			AK123391	CCDS35077.1, CCDS35077.2	9q22.33	2013-03-08	2013-03-08	2013-03-08		ENSG00000197816			29303	protein-coding gene	gene with protein product	"""Behcet's Disease Associated Gene 1"""		"""KIAA1529"", ""chromosome 9 open reading frame 174"""	KIAA1529, C9orf174		10819331	Standard	NM_020893		Approved	DKFZp434I2420, BDAG1	uc004axg.2	Q9P1Z9	OTTHUMG00000167001	ENST00000357054.1:c.1742G>A	9.37:g.100085148G>A	ENSP00000349562:p.Arg581His	Somatic	130	0.76	1		3	40.00	2	WXS	Illumina HiSeq	Phase_IV	99124969	128	18.40	30	Q2KHR6|Q5VV25|Q68DP5|Q69YV9|Q6AHY0	Missense_Mutation	SNP	NULL	p.R581H	ENST00000357054.1	37	c.1742		9	.	.	.	.	.	.	.	.	.	.	G	5.049	0.194723	0.09599	9.08E-4	0.0	ENSG00000197816	ENST00000357054;ENST00000395220;ENST00000375202;ENST00000411667;ENST00000541524;ENST00000529487	T;T;T;T;T	0.24723	1.84;1.84;1.84;1.84;1.84	5.08	3.17	0.36434	.	0.104257	0.43260	N	0.000584	T	0.14056	0.0340	N	0.17474	0.49	0.27324	N	0.956957	D;B;P;P	0.60160	0.987;0.078;0.606;0.606	P;B;B;B	0.45856	0.495;0.029;0.111;0.111	T	0.07673	-1.0760	10	0.09084	T	0.74	-10.085	7.7642	0.28970	0.2103:0.0:0.7897:0.0	.	439;581;442;581	F5H149;B7ZMG3;Q9P1Z9-2;Q9P1Z9	.;.;.;CI174_HUMAN	H	581;541;442;439;465;442	ENSP00000349562:R581H;ENSP00000378646:R541H;ENSP00000364348:R442H;ENSP00000414000:R439H;ENSP00000434727:R442H	ENSP00000349562:R581H	R	+	2	0	C9orf174	99124969	0.369000	0.25039	0.833000	0.33012	0.019000	0.09904	0.433000	0.21477	1.257000	0.44085	0.462000	0.41574	CGC	-	NULL		0.537	CCDC180-201	KNOWN	basic	protein_coding	KIAA1529	protein_coding		G	NM_020893		99124969	+1	no_errors	NM_020893.1	genbank	human	predicted	54_36p	missense	SNP	0.998	A
LTBP3	4054	genome.wustl.edu	37	11	65320427	65320427	+	Missense_Mutation	SNP	C	C	T			TCGA-AB-2917-03A-01W-0732-08	TCGA-AB-2917-11A-01W-0732-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	77b0ecc5-d93d-44bf-b2da-fda304c4810b	52fc3d72-1205-44db-8c5b-1e8750a98313	g.chr11:65320427C>T	ENST00000301873.5	-	6	1358	c.1090G>A	c.(1090-1092)Gtg>Atg	p.V364M	LTBP3_ENST00000322147.4_Missense_Mutation_p.V364M|LTBP3_ENST00000536982.1_Intron	NM_001130144.2	NP_001123616.1	Q9NS15	LTBP3_HUMAN	latent transforming growth factor beta binding protein 3	364	EGF-like 2; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|extracellular matrix organization (GO:0030198)|lung saccule development (GO:0060430)|negative regulation of bone mineralization (GO:0030502)|negative regulation of chondrocyte differentiation (GO:0032331)|positive regulation of bone resorption (GO:0045780)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of mesenchymal stem cell proliferation (GO:1902462)|transforming growth factor beta activation (GO:0036363)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|prostate(2)|upper_aerodigestive_tract(3)	23						TGGCGACACACGCCCGGCATT	0.597																																						dbGAP											0			11											158.0	116.0	130.0					11																	65320427		2201	4297	6498	65077003	SO:0001583	missense	0			AF135960	CCDS8103.1, CCDS44647.1	11q12	2011-10-20			ENSG00000168056	ENSG00000168056		"""Latent transforming growth factor, beta binding proteins"""	6716	protein-coding gene	gene with protein product		602090		LTBP2		7719025	Standard	NM_001164266		Approved		uc001oej.3	Q9NS15	OTTHUMG00000166575	ENST00000301873.5:c.1090G>A	11.37:g.65320427C>T	ENSP00000301873:p.Val364Met	Somatic	200	3.35	7		19	38.71	12	WXS	Illumina HiSeq	Phase_IV	65077003	61	42.45	45	O15107|Q96HB9|Q9H7K2|Q9UFN4	Missense_Mutation	SNP	PatternScan_ASX_HYDROXYL,HMMSmart_EGF_CA,HMMPfam_TB,superfamily_Fibril-assoc,HMMPfam_EGF,HMMSmart_EGF,PatternScan_EGF_1,PatternScan_EGF_2,HMMPfam_EGF_CA,PatternScan_EGF_CA,superfamily_SSF57196	p.V364M	ENST00000301873.5	37	c.1090	CCDS44647.1	11	.	.	.	.	.	.	.	.	.	.	C	9.057	0.993532	0.19043	.	.	ENSG00000168056	ENST00000322147;ENST00000301873;ENST00000530866	D;D;D	0.92199	-2.99;-2.99;-2.25	4.12	1.69	0.24217	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.130382	0.51477	N	0.000091	D	0.85948	0.5816	L	0.49350	1.555	0.80722	D	1	B;B;B;B	0.20368	0.035;0.044;0.007;0.035	B;B;B;B	0.23275	0.015;0.023;0.015;0.045	T	0.74278	-0.3717	10	0.32370	T	0.25	.	3.2759	0.06898	0.0:0.2271:0.2118:0.5611	.	275;247;364;364	E9PKW1;B9EG76;Q9NS15;Q9NS15-2	.;.;LTBP3_HUMAN;.	M	364;364;275	ENSP00000326647:V364M;ENSP00000301873:V364M;ENSP00000435276:V275M	ENSP00000301873:V364M	V	-	1	0	LTBP3	65077003	0.947000	0.32204	0.996000	0.52242	0.951000	0.60555	0.636000	0.24644	0.147000	0.19030	-0.481000	0.04817	GTG	-	HMMSmart_EGF_CA,HMMPfam_EGF_CA,PatternScan_EGF_CA,superfamily_SSF57196		0.597	LTBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LTBP3	protein_coding	OTTHUMT00000390538.1	C	NM_021070		65077003	-1	no_errors	NM_021070.1	genbank	human	validated	54_36p	missense	SNP	1.000	T
KRAS	3845	genome.wustl.edu	37	12	25398211	25398211	+	Missense_Mutation	SNP	T	T	C			TCGA-AB-2917-03A-01W-0732-08	TCGA-AB-2917-11A-01W-0732-08	T	T	T	C	T	T	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	77b0ecc5-d93d-44bf-b2da-fda304c4810b	52fc3d72-1205-44db-8c5b-1e8750a98313	g.chr12:25398211T>C	ENST00000256078.4	-	2	171	c.108A>G	c.(106-108)atA>atG	p.I36M	KRAS_ENST00000311936.3_Missense_Mutation_p.I36M|KRAS_ENST00000557334.1_Missense_Mutation_p.I36M|KRAS_ENST00000556131.1_Missense_Mutation_p.I36M	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	36			I -> M (in NS3).		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)		UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GATTTACCTCTATTGTTGGAT	0.368		119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	dbGAP		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	0			12	GRCh37	CM070965	KRAS	M							60.0	51.0	54.0					12																	25398211		2203	4300	6503	25289478	SO:0001583	missense	0	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.108A>G	12.37:g.25398211T>C	ENSP00000256078:p.Ile36Met	Somatic	45	2.17	1		2	94.29	33	WXS	Illumina HiSeq	Phase_IV	25289478	27	60.29	41	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	HMMSmart_SM00176,HMMSmart_SM00173,HMMSmart_SM00174,HMMSmart_SM00175,HMMPfam_Ras,superfamily_P-loop containing nucleoside triphosphate hydrolases	p.I36M	ENST00000256078.4	37	c.108	CCDS8703.1	12	.	.	.	.	.	.	.	.	.	.	T	18.08	3.545040	0.65198	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	D;D;D;D	0.81908	-1.55;-1.55;-1.55;-1.55	5.68	4.51	0.55191	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.92912	0.7745	H	0.95712	3.71	0.80722	D	1	P;D	0.76494	0.927;0.999	D;D	0.74023	0.918;0.982	D	0.93470	0.6818	10	0.87932	D	0	.	11.2283	0.48897	0.1371:0.0:0.0:0.8629	.	36;36	P01116-2;P01116	.;RASK_HUMAN	M	36	ENSP00000308495:I36M;ENSP00000452512:I36M;ENSP00000256078:I36M;ENSP00000451856:I36M	ENSP00000256078:I36M	I	-	3	3	KRAS	25289478	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	0.782000	0.26788	0.937000	0.37394	0.460000	0.39030	ATA	-	HMMSmart_SM00176,HMMSmart_SM00173,HMMSmart_SM00174,HMMSmart_SM00175,HMMPfam_Ras,superfamily_P-loop containing nucleoside triphosphate hydrolases		0.368	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	KRAS	protein_coding	OTTHUMT00000412232.1	T	NM_033360		25289478	-1	no_errors	NM_033360.3	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
DBX2	440097	genome.wustl.edu	37	12	45410290	45410290	+	Missense_Mutation	SNP	G	G	A	rs148988684		TCGA-AB-2917-03A-01W-0732-08	TCGA-AB-2917-11A-01W-0732-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	77b0ecc5-d93d-44bf-b2da-fda304c4810b	52fc3d72-1205-44db-8c5b-1e8750a98313	g.chr12:45410290G>A	ENST00000332700.6	-	4	970	c.799C>T	c.(799-801)Cgg>Tgg	p.R267W		NM_001004329.2	NP_001004329.2	Q6ZNG2	DBX2_HUMAN	developing brain homeobox 2	267					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(3)|kidney(1)|large_intestine(3)|lung(9)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	22	Lung SC(27;0.192)	Lung NSC(34;0.142)		GBM - Glioblastoma multiforme(48;0.0515)		AGAGCAGACCGTGAGAGGGGA	0.488																																						dbGAP											0			12						G	TRP/ARG	0,4406		0,0,2203	132.0	137.0	135.0		799	0.3	0.0	12	dbSNP_134	135	1,8599	1.2+/-3.3	0,1,4299	no	missense	DBX2	NM_001004329.2	101	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	267/340	45410290	1,13005	2203	4300	6503	43696557	SO:0001583	missense	0				CCDS31781.1	12q12	2011-06-20				ENSG00000185610		"""Homeoboxes / ANTP class : NKL subclass"""	33186	protein-coding gene	gene with protein product						11239429	Standard	NM_001004329		Approved	FLJ16139	uc001rok.1	Q6ZNG2	OTTHUMG00000169559	ENST00000332700.6:c.799C>T	12.37:g.45410290G>A	ENSP00000331470:p.Arg267Trp	Somatic	182	2.66	5		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	43696557	81	61.50	131		Missense_Mutation	SNP	HMMPfam_Homeobox,HMMSmart_SM00389,superfamily_Homeodomain-like,PatternScan_HOMEOBOX_1	p.R267W	ENST00000332700.6	37	c.799	CCDS31781.1	12	.	.	.	.	.	.	.	.	.	.	G	18.18	3.567456	0.65651	0.0	1.16E-4	ENSG00000185610	ENST00000332700	D	0.91631	-2.88	5.95	0.339	0.15979	.	0.997902	0.08110	N	0.996336	D	0.89413	0.6708	L	0.32530	0.975	0.09310	N	1	D	0.69078	0.997	P	0.47299	0.543	T	0.79780	-0.1659	10	0.66056	D	0.02	0.0773	12.5062	0.55981	0.0:0.0767:0.3016:0.6217	.	267	Q6ZNG2	DBX2_HUMAN	W	267	ENSP00000331470:R267W	ENSP00000331470:R267W	R	-	1	2	DBX2	43696557	0.001000	0.12720	0.000000	0.03702	0.962000	0.63368	0.171000	0.16685	-0.153000	0.11137	0.650000	0.86243	CGG	-	NULL		0.488	DBX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DBX2	protein_coding	OTTHUMT00000404810.1	G	NM_001004329		43696557	-1	no_errors	NM_001004329.2	genbank	human	validated	54_36p	missense	SNP	0.001	A
SETBP1	26040	genome.wustl.edu	37	18	42531907	42531907	+	Missense_Mutation	SNP	G	G	A	rs267607042		TCGA-AB-2917-03A-01W-0732-08	TCGA-AB-2917-11A-01W-0732-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	77b0ecc5-d93d-44bf-b2da-fda304c4810b	52fc3d72-1205-44db-8c5b-1e8750a98313	g.chr18:42531907G>A	ENST00000282030.5	+	4	2898	c.2602G>A	c.(2602-2604)Gac>Aac	p.D868N		NM_015559.2	NP_056374.2	Q9Y6X0	SETBP_HUMAN	SET binding protein 1	868			D -> A (in SGMFS). {ECO:0000269|PubMed:20436468}.|D -> G (in myeloid malignancies). {ECO:0000269|PubMed:23628959}.|D -> N (in SGMFS, ACML, JMML and MDS; also found in other myeloid malignancies; somatic mutation). {ECO:0000269|PubMed:20436468, ECO:0000269|PubMed:23222956, ECO:0000269|PubMed:23628959, ECO:0000269|PubMed:23648668, ECO:0000269|PubMed:23832011, ECO:0000269|PubMed:23832012}.|D -> Y (in myeloid malignancies). {ECO:0000269|PubMed:23628959, ECO:0000269|PubMed:23832012}.			nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(20)|lung(47)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	104				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		GATCCCCAGCGACAGCGGCAT	0.552									Schinzel-Giedion syndrome																													dbGAP											0			18											71.0	46.0	54.0					18																	42531907		2203	4300	6503	40785905	SO:0001583	missense	0	Familial Cancer Database	SGC, Schinzel-Giedion Midface Retraction syndrome	AB022660	CCDS11923.2, CCDS45859.1	18q21.1	2008-08-01			ENSG00000152217	ENSG00000152217			15573	protein-coding gene	gene with protein product		611060				11231286	Standard	NM_015559		Approved	SEB, KIAA0437	uc010dni.3	Q9Y6X0	OTTHUMG00000132613	ENST00000282030.5:c.2602G>A	18.37:g.42531907G>A	ENSP00000282030:p.Asp868Asn	Somatic	149	3.85	6		20	48.72	19	WXS	Illumina HiSeq	Phase_IV	40785905	100	50.25	102	A6H8W5|Q6P6C3|Q9UEF3	Missense_Mutation	SNP	HMMPfam_AT_hook,HMMSmart_AT_hook	p.D814N	ENST00000282030.5	37	c.2440	CCDS11923.2	18	.	.	.	.	.	.	.	.	.	.	G	21.9	4.211871	0.79240	.	.	ENSG00000152217	ENST00000282030	D	0.93019	-3.15	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	D	0.95211	0.8447	L	0.32530	0.975	0.53688	D	0.999978	D	0.89917	1.0	D	0.87578	0.998	D	0.95183	0.8301	10	0.87932	D	0	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	868	Q9Y6X0	SETBP_HUMAN	N	868	ENSP00000282030:D868N	ENSP00000282030:D868N	D	+	1	0	SETBP1	40785905	1.000000	0.71417	0.995000	0.50966	0.905000	0.53344	9.835000	0.99442	2.941000	0.99782	0.655000	0.94253	GAC	-	NULL		0.552	SETBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETBP1	protein_coding	OTTHUMT00000255854.4	G	NM_001130110		40785905	+1	no_errors	NM_015559.1	genbank	human	validated	54_36p	missense	SNP	1.000	A
OR7D4	125958	genome.wustl.edu	37	19	9324994	9324994	+	Missense_Mutation	SNP	T	T	A			TCGA-AB-2917-03A-01W-0732-08	TCGA-AB-2917-11A-01W-0732-08	T	T	T	A	T	T	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	77b0ecc5-d93d-44bf-b2da-fda304c4810b	52fc3d72-1205-44db-8c5b-1e8750a98313	g.chr19:9324994T>A	ENST00000308682.2	-	1	548	c.520A>T	c.(520-522)Att>Ttt	p.I174F		NM_001005191.2	NP_001005191.1	Q8NG98	OR7D4_HUMAN	olfactory receptor, family 7, subfamily D, member 4	174						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(10)|ovary(2)|skin(3)|stomach(1)	26						AAATGCGGAATCTCAGTGCCT	0.512																																						dbGAP											0			19											98.0	92.0	94.0					19																	9324994		2203	4300	6503	9185994	SO:0001583	missense	0				CCDS32901.1	19p13.2	2013-12-17		2004-03-10	ENSG00000174667	ENSG00000174667		"""GPCR / Class A : Olfactory receptors"""	8380	protein-coding gene	gene with protein product		611538		OR7D4P			Standard	NM_001005191		Approved	hg105, OR19-B	uc002mla.2	Q8NG98	OTTHUMG00000179936	ENST00000308682.2:c.520A>T	19.37:g.9324994T>A	ENSP00000310488:p.Ile174Phe	Somatic	235	4.42	11		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	9185994	197	47.20	177	A8CAH8|A8CAH9|A8CAI0|A8CAI1|B9EH79	Missense_Mutation	SNP	HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1,superfamily_Family A G protein-coupled receptor-like	p.I174F	ENST00000308682.2	37	c.520	CCDS32901.1	19	.	.	.	.	.	.	.	.	.	.	T	10.43	1.347135	0.24426	.	.	ENSG00000174667	ENST00000308682	T	0.00211	8.54	3.86	1.67	0.24075	GPCR, rhodopsin-like superfamily (1);	0.335127	0.25305	N	0.031629	T	0.00784	0.0026	H	0.98951	4.38	0.09310	N	0.999995	D	0.63046	0.992	D	0.65874	0.939	T	0.45175	-0.9279	10	0.87932	D	0	.	4.4329	0.11536	0.0:0.1942:0.1717:0.6341	.	174	Q8NG98	OR7D4_HUMAN	F	174	ENSP00000310488:I174F	ENSP00000310488:I174F	I	-	1	0	OR7D4	9185994	0.010000	0.17322	0.008000	0.14137	0.014000	0.08584	0.057000	0.14279	0.171000	0.19730	0.358000	0.22013	ATT	-	HMMPfam_7tm_1,superfamily_Family A G protein-coupled receptor-like		0.512	OR7D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR7D4	protein_coding	OTTHUMT00000449004.1	T			9185994	-1	no_errors	NM_001005191.1	genbank	human	provisional	54_36p	missense	SNP	0.000	A
