#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NormalRefReads_WU	i_NormalVAF_WU	i_NormalVarReads_WU	i_ORegAnno_bin	i_RNARefReads_WU	i_RNAVAF_WU	i_RNAVarReads_WU	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TumorRefReads_WU	i_TumorVAF_WU	i_TumorVarReads_WU	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
PEAR1	375033	genome.wustl.edu	37	1	156875138	156875138	+	Missense_Mutation	SNP	C	C	T			TCGA-AB-2920-03A-01W-0732-08	TCGA-AB-2920-11A-01W-0732-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	03508d3a-3bc2-4ec1-91cd-80a9f5aadad5	4ab04cad-cee0-4f9f-80b7-66d2472f5e31	g.chr1:156875138C>T	ENST00000338302.3	+	5	454	c.229C>T	c.(229-231)Cgt>Tgt	p.R77C	PEAR1_ENST00000292357.7_Missense_Mutation_p.R77C			Q5VY43	PEAR1_HUMAN	platelet endothelial aggregation receptor 1	77	EMI. {ECO:0000255|PROSITE- ProRule:PRU00384}.				recognition of apoptotic cell (GO:0043654)	integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)		p.R77S(1)		breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(6)|lung(22)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)	43	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					GACCGTGTACCGTCAGGTGGT	0.657																																						dbGAP											1	Substitution - Missense(1)	lung(1)	1											65.0	58.0	61.0					1																	156875138		2203	4300	6503	155141762	SO:0001583	missense	0			AK098809	CCDS30892.1	1q23.1	2008-02-05	2007-10-25	2007-10-25	ENSG00000187800	ENSG00000187800			33631	protein-coding gene	gene with protein product		610278	"""multiple EGF-like-domains 12"""	MEGF12		15851471	Standard	NM_001080471		Approved	JEDI, FLJ00193	uc001fqj.1	Q5VY43	OTTHUMG00000041293	ENST00000338302.3:c.229C>T	1.37:g.156875138C>T	ENSP00000344465:p.Arg77Cys	Somatic	59	1.67	1		1	50.00	1	WXS	Illumina HiSeq	Phase_IV	155141762	96	43.86	75	Q8TEK2	Missense_Mutation	SNP	HMMPfam_Laminin_EGF,HMMSmart_EGF_Lam,HMMSmart_EGF,superfamily_Grow_fac_recept,HMMPfam_EMI,PatternScan_EGF_1,PatternScan_EGF_2,HMMPfam_EGF_2	p.R77C	ENST00000338302.3	37	c.229	CCDS30892.1	1	.	.	.	.	.	.	.	.	.	.	C	18.52	3.641052	0.67244	.	.	ENSG00000187800	ENST00000338302;ENST00000455314;ENST00000292357	D;T;D	0.90844	-2.74;0.51;-2.74	3.92	3.92	0.45320	EMI domain (1);	0.180201	0.27035	N	0.021250	D	0.89818	0.6825	L	0.36672	1.1	0.58432	D	0.999997	D	0.89917	1.0	D	0.63488	0.915	D	0.91395	0.5138	10	0.87932	D	0	.	13.4913	0.61397	0.0:1.0:0.0:0.0	.	77	Q5VY43	PEAR1_HUMAN	C	77	ENSP00000344465:R77C;ENSP00000389742:R77C;ENSP00000292357:R77C	ENSP00000292357:R77C	R	+	1	0	PEAR1	155141762	1.000000	0.71417	0.997000	0.53966	0.904000	0.53231	1.860000	0.39428	2.015000	0.59207	0.655000	0.94253	CGT	-	HMMPfam_EMI		0.657	PEAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PEAR1	protein_coding	OTTHUMT00000098937.2	C	NM_001080471		155141762	+1	no_errors	NM_001080471.1	genbank	human	provisional	54_36p	missense	SNP	0.994	T
MAL	4118	genome.wustl.edu	37	2	95715340	95715340	+	Silent	SNP	C	C	T			TCGA-AB-2920-03A-01W-0732-08	TCGA-AB-2920-11A-01W-0732-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	03508d3a-3bc2-4ec1-91cd-80a9f5aadad5	4ab04cad-cee0-4f9f-80b7-66d2472f5e31	g.chr2:95715340C>T	ENST00000309988.4	+	3	385	c.276C>T	c.(274-276)caC>caT	p.H92H	MAL_ENST00000354078.3_Silent_p.H36H|AC103563.9_ENST00000442200.1_RNA|MAL_ENST00000349807.3_Intron|MAL_ENST00000353004.3_Intron	NM_002371.3	NP_002362.1	P21145	MAL_HUMAN	mal, T-cell differentiation protein	92	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				apical protein localization (GO:0045176)|apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|central nervous system development (GO:0007417)|membrane raft polarization (GO:0001766)|myelination (GO:0042552)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extrinsic component of membrane (GO:0019898)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)	channel activity (GO:0015267)|lipid binding (GO:0008289)|peptidase activator activity involved in apoptotic process (GO:0016505)|structural constituent of myelin sheath (GO:0019911)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|prostate(2)	10				STAD - Stomach adenocarcinoma(1183;0.18)		CAGCCTACCACTGCACCGCTG	0.632																																						dbGAP											0			2											136.0	121.0	126.0					2																	95715340		2203	4300	6503	95079067	SO:0001819	synonymous_variant	0				CCDS2006.1, CCDS2007.1, CCDS2008.1, CCDS2009.1	2q11.1	2008-07-29			ENSG00000172005	ENSG00000172005			6817	protein-coding gene	gene with protein product		188860					Standard	NM_002371		Approved		uc002stx.2	P21145	OTTHUMG00000132011	ENST00000309988.4:c.276C>T	2.37:g.95715340C>T		Somatic	20	9.09	2		15	0.00	0	WXS	Illumina HiSeq	Phase_IV	95079067	46	43.37	36	Q6FH77	Silent	SNP	HMMPfam_MARVEL	p.H92	ENST00000309988.4	37	c.276	CCDS2006.1	2																																																																																			-	HMMPfam_MARVEL		0.632	MAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAL	protein_coding	OTTHUMT00000254982.3	C	NM_002371		95079067	+1	no_errors	NM_002371.2	genbank	human	reviewed	54_36p	silent	SNP	0.425	T
ABCF1	23	genome.wustl.edu	37	6	30554429	30554429	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2920-03A-01W-0732-08	TCGA-AB-2920-11A-01W-0732-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	03508d3a-3bc2-4ec1-91cd-80a9f5aadad5	4ab04cad-cee0-4f9f-80b7-66d2472f5e31	g.chr6:30554429G>A	ENST00000326195.8	+	20	2084	c.1972G>A	c.(1972-1974)Ggc>Agc	p.G658S	ABCF1_ENST00000376545.3_Missense_Mutation_p.G620S|ABCF1_ENST00000396515.4_Intron|MIR877_ENST00000401282.1_RNA	NM_001025091.1	NP_001020262.1	Q8NE71	ABCF1_HUMAN	ATP-binding cassette, sub-family F (GCN20), member 1	658	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				inflammatory response (GO:0006954)|positive regulation of translation (GO:0045727)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|polysomal ribosome (GO:0042788)|ribosome (GO:0005840)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|poly(A) RNA binding (GO:0044822)|ribosome binding (GO:0043022)|translation activator activity (GO:0008494)|translation factor activity, nucleic acid binding (GO:0008135)			breast(2)|endometrium(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(3)|skin(2)	21						TTGCATTGTGGGCCCTAATGG	0.567																																						dbGAP											0			6											184.0	144.0	158.0					6																	30554429		1511	2709	4220	30662408	SO:0001583	missense	0			AF027302	CCDS34380.1, CCDS34381.1	6p21.33	2012-03-14			ENSG00000204574	ENSG00000204574		"""ATP binding cassette transporters / subfamily F"""	70	protein-coding gene	gene with protein product		603429		ABC50		9790762	Standard	NM_001025091		Approved	EST123147	uc003nql.3	Q8NE71	OTTHUMG00000031094	ENST00000326195.8:c.1972G>A	6.37:g.30554429G>A	ENSP00000313603:p.Gly658Ser	Somatic	238	7.39	19		22	62.07	36	WXS	Illumina HiSeq	Phase_IV	30662408	281	40.95	199	A2BF75|O14897|Q69YP6	Missense_Mutation	SNP	HMMPfam_ABC_tran,HMMSmart_SM00382,PatternScan_ABC_TRANSPORTER_1,superfamily_P-loop containing nucleoside triphosphate hydrolases	p.G658S	ENST00000326195.8	37	c.1972	CCDS34380.1	6	.	.	.	.	.	.	.	.	.	.	G	28.4	4.921106	0.92249	.	.	ENSG00000204574	ENST00000326195;ENST00000376545	D;D	0.99863	-7.27;-7.27	5.63	5.63	0.86233	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.000000	0.85682	D	0.000000	D	0.99941	0.9974	H	0.99404	4.55	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.95992	0.8986	10	0.87932	D	0	-17.4068	18.4508	0.90703	0.0:0.0:1.0:0.0	.	620;658	Q2L6I2;Q8NE71	.;ABCF1_HUMAN	S	658;620	ENSP00000313603:G658S;ENSP00000365728:G620S	ENSP00000313603:G658S	G	+	1	0	ABCF1	30662408	1.000000	0.71417	1.000000	0.80357	0.651000	0.38670	8.521000	0.90569	2.651000	0.90000	0.555000	0.69702	GGC	-	HMMPfam_ABC_tran,HMMSmart_SM00382,superfamily_P-loop containing nucleoside triphosphate hydrolases		0.567	ABCF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ABCF1	protein_coding	OTTHUMT00000076137.3	G			30662408	+1	no_errors	NM_001025091.1	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
VARS2	57176	genome.wustl.edu	37	6	30886617	30886617	+	Silent	SNP	G	G	A			TCGA-AB-2920-03A-01W-0732-08	TCGA-AB-2920-11A-01W-0732-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	03508d3a-3bc2-4ec1-91cd-80a9f5aadad5	4ab04cad-cee0-4f9f-80b7-66d2472f5e31	g.chr6:30886617G>A	ENST00000321897.5	+	10	1631	c.999G>A	c.(997-999)gtG>gtA	p.V333V	VARS2_ENST00000542001.1_Silent_p.V193V|VARS2_ENST00000541562.1_Silent_p.V363V|VARS2_ENST00000416670.2_Silent_p.V333V			Q5ST30	SYVM_HUMAN	valyl-tRNA synthetase 2, mitochondrial	333					gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)|valyl-tRNA aminoacylation (GO:0006438)	mitochondrion (GO:0005739)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|valine-tRNA ligase activity (GO:0004832)			central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(15)|ovary(3)|prostate(3)|skin(4)|urinary_tract(1)	46						CAGAGGTTGTGGTAGGAACCA	0.507																																						dbGAP											0			6											99.0	82.0	88.0					6																	30886617		1509	2709	4218	30994596	SO:0001819	synonymous_variant	0			AB067472	CCDS34387.1, CCDS54980.1	6p21.33	2012-10-26	2012-10-26	2007-02-23	ENSG00000137411	ENSG00000137411	6.1.1.9	"""Aminoacyl tRNA synthetases / Class I"""	21642	protein-coding gene	gene with protein product	"""valine tRNA ligase 2, mitochondrial"""	612802	"""valyl-tRNA synthetase 2-like"", ""valyl-tRNA synthetase like"", ""valyl-tRNA synthetase 2, mitochondrial (putative)"""	VARS2L, VARSL		1898367, 11572484, 18400783	Standard	NM_001167734		Approved	DKFZP434L1435, KIAA1885, G7a	uc011dmz.2	Q5ST30	OTTHUMG00000031263	ENST00000321897.5:c.999G>A	6.37:g.30886617G>A		Somatic	71	8.97	7		49	55.86	62	WXS	Illumina HiSeq	Phase_IV	30994596	123	47.26	112	A2ABL7|B4DET4|B4E3P5|F5GXJ0|F5H323|Q2M2A0|Q59FI1|Q5SQ96|Q5SS98|Q6DKJ5|Q6ZV24|Q96GN2|Q96H77|Q96Q02|Q9H6R2|Q9UFH7	Silent	SNP	PatternScan_AA_TRNA_LIGASE_I,HMMPfam_tRNA-synt_1,superfamily_ValRS/IleRS/LeuRS editing domain,superfamily_Anticodon-binding domain of a subclass of class I aminoacyl-tRNA synthetases,HMMPfam_Anticodon_1,superfamily_Nucleotidylyl transferase	p.V333	ENST00000321897.5	37	c.999	CCDS34387.1	6																																																																																			-	HMMPfam_tRNA-synt_1,superfamily_ValRS/IleRS/LeuRS editing domain,superfamily_Nucleotidylyl transferase		0.507	VARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VARS2	protein_coding	OTTHUMT00000076566.2	G	NM_020442		30994596	+1	no_errors	NM_020442.3	genbank	human	provisional	54_36p	silent	SNP	0.615	A
ACTL7A	10881	genome.wustl.edu	37	9	111625878	111625878	+	Missense_Mutation	SNP	G	G	C	rs534593253		TCGA-AB-2920-03A-01W-0732-08	TCGA-AB-2920-11A-01W-0732-08	G	G	G	C	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	03508d3a-3bc2-4ec1-91cd-80a9f5aadad5	4ab04cad-cee0-4f9f-80b7-66d2472f5e31	g.chr9:111625878G>C	ENST00000333999.3	+	1	1276	c.1276G>C	c.(1276-1278)Ggg>Cgg	p.G426R		NM_006687.2	NP_006678.1	Q9Y615	ACL7A_HUMAN	actin-like 7A	426						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|male germ cell nucleus (GO:0001673)|motile cilium (GO:0031514)|nucleus (GO:0005634)|protein complex (GO:0043234)	structural constituent of cytoskeleton (GO:0005200)			breast(1)|endometrium(2)|large_intestine(4)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						CGAGGAACACGGGCCTTTCTT	0.582																																					Esophageal Squamous(177;1480 3591 17554)	dbGAP											0			9											66.0	62.0	63.0					9																	111625878		2203	4300	6503	110665699	SO:0001583	missense	0			BC014610	CCDS6772.1	9q31	2008-02-05			ENSG00000187003	ENSG00000187003			161	protein-coding gene	gene with protein product		604303				10373328	Standard	NM_006687		Approved		uc004bdj.1	Q9Y615	OTTHUMG00000020461	ENST00000333999.3:c.1276G>C	9.37:g.111625878G>C	ENSP00000334300:p.Gly426Arg	Somatic	37	2.63	1		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	110665699	61	52.34	67	B2RC83|Q5JSV0	Missense_Mutation	SNP	HMMPfam_Actin,HMMSmart_SM00268,superfamily_Actin-like ATPase domain	p.G426R	ENST00000333999.3	37	c.1276	CCDS6772.1	9	.	.	.	.	.	.	.	.	.	.	G	23.6	4.441144	0.83993	.	.	ENSG00000187003	ENST00000333999	D	0.81908	-1.55	5.44	5.44	0.79542	.	0.000000	0.47455	D	0.000229	D	0.94112	0.8112	H	0.96015	3.755	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95556	0.8625	10	0.87932	D	0	.	17.1282	0.86720	0.0:0.0:1.0:0.0	.	426	Q9Y615	ACL7A_HUMAN	R	426	ENSP00000334300:G426R	ENSP00000334300:G426R	G	+	1	0	ACTL7A	110665699	1.000000	0.71417	0.972000	0.41901	0.976000	0.68499	7.996000	0.88334	2.715000	0.92844	0.655000	0.94253	GGG	-	HMMPfam_Actin,HMMSmart_SM00268,superfamily_Actin-like ATPase domain		0.582	ACTL7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTL7A	protein_coding	OTTHUMT00000053570.1	G	NM_006687		110665699	+1	no_errors	NM_006687.2	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
FAM166A	401565	genome.wustl.edu	37	9	140140111	140140111	+	Missense_Mutation	SNP	G	G	A	rs74872755	byFrequency	TCGA-AB-2920-03A-01W-0732-08	TCGA-AB-2920-11A-01W-0732-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	03508d3a-3bc2-4ec1-91cd-80a9f5aadad5	4ab04cad-cee0-4f9f-80b7-66d2472f5e31	g.chr9:140140111G>A	ENST00000344774.4	-	2	305	c.251C>T	c.(250-252)cCc>cTc	p.P84L	FAM166A_ENST00000388932.2_Missense_Mutation_p.P84L	NM_001001710.1	NP_001001710.1	Q6J272	F166A_HUMAN	family with sequence similarity 166, member A	84						nucleus (GO:0005634)				kidney(3)|lung(7)|ovary(2)|prostate(1)|urinary_tract(2)	15						GGGGATGTAGGGCTCCGTCAG	0.637													G|||	76	0.0151757	0.003	0.062	5008	,	,		15276	0.0		0.0239	False		,,,				2504	0.0051					dbGAP											0			9						G	LEU/PRO	18,4386	25.3+/-52.1	0,18,2184	42.0	53.0	49.0		251	4.6	1.0	9	dbSNP_131	49	208,8392	88.9+/-151.2	2,204,4094	yes	missense	FAM166A	NM_001001710.1	98	2,222,6278	AA,AG,GG		2.4186,0.4087,1.7379	probably-damaging	84/318	140140111	226,12778	2202	4300	6502	139259932	SO:0001583	missense	0			BC132916	CCDS35186.1	9q34.3	2008-08-08			ENSG00000188163	ENSG00000188163			33818	protein-coding gene	gene with protein product							Standard	XR_245332		Approved		uc004cmi.1	Q6J272	OTTHUMG00000159545	ENST00000344774.4:c.251C>T	9.37:g.140140111G>A	ENSP00000344729:p.Pro84Leu	Somatic	6	0.00	0		0	100.00	1	WXS	Illumina HiSeq	Phase_IV	139259932	1	80.00	4	A6NND9|Q8N830	Missense_Mutation	SNP	HMMPfam_DUF2475	p.P84L	ENST00000344774.4	37	c.251	CCDS35186.1	9	47	0.02152014652014652	1	0.0020325203252032522	23	0.06353591160220995	0	0.0	23	0.030343007915567283	G	15.11	2.735707	0.49045	0.004087	0.024186	ENSG00000188163	ENST00000344774;ENST00000388932;ENST00000484720	.	.	.	4.57	4.57	0.56435	.	0.086033	0.47455	D	0.000231	T	0.19046	0.0457	L	0.34521	1.04	0.58432	D	0.999996	D	0.89917	1.0	D	0.83275	0.996	T	0.52525	-0.8564	9	0.62326	D	0.03	-21.0997	14.1886	0.65623	0.0:0.0:1.0:0.0	.	84	Q6J272	F166A_HUMAN	L	84	.	ENSP00000344729:P84L	P	-	2	0	FAM166A	139259932	0.997000	0.39634	0.994000	0.49952	0.008000	0.06430	5.226000	0.65299	2.362000	0.80069	0.462000	0.41574	CCC	-	NULL		0.637	FAM166A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM166A	protein_coding	OTTHUMT00000356125.1	G	NM_001001710		139259932	-1	no_errors	NM_001001710.1	genbank	human	predicted	54_36p	missense	SNP	0.990	A
KCNA4	3739	genome.wustl.edu	37	11	30033933	30033933	+	Missense_Mutation	SNP	C	C	T			TCGA-AB-2920-03A-01W-0732-08	TCGA-AB-2920-11A-01W-0732-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	03508d3a-3bc2-4ec1-91cd-80a9f5aadad5	4ab04cad-cee0-4f9f-80b7-66d2472f5e31	g.chr11:30033933C>T	ENST00000328224.6	-	2	1526	c.293G>A	c.(292-294)cGg>cAg	p.R98Q	KCNA4_ENST00000526518.1_5'Flank	NM_002233.3	NP_002224.1	P22459	KCNA4_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 4	98					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	potassium ion binding (GO:0030955)|voltage-gated potassium channel activity (GO:0005249)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(17)|lung(39)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	78					Dalfampridine(DB06637)	GCTGCTCTGCCGGTAGTGGGC	0.612																																						dbGAP											0			11											39.0	42.0	41.0					11																	30033933		2108	4231	6339	29990509	SO:0001583	missense	0			M55514	CCDS41629.1	11p14	2012-07-05	2002-07-10			ENSG00000182255		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6222	protein-coding gene	gene with protein product		176266	"""potassium voltage-gated channel, shaker-related subfamily, member 4-like"""	KCNA4L		2263489, 16382104	Standard	NM_002233		Approved	Kv1.4, HK1, HPCN2	uc001msk.3	P22459		ENST00000328224.6:c.293G>A	11.37:g.30033933C>T	ENSP00000328511:p.Arg98Gln	Somatic	112	6.61	8		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	29990509	118	48.50	113		Missense_Mutation	SNP	HMMSmart_SM00225,HMMPfam_K_tetra,HMMPfam_Ion_trans,superfamily_POZ domain,HMMPfam_K_channel_TID,superfamily_Voltage-gated potassium channels	p.R98Q	ENST00000328224.6	37	c.293	CCDS41629.1	11	.	.	.	.	.	.	.	.	.	.	C	11.61	1.688970	0.29962	.	.	ENSG00000182255	ENST00000328224	D	0.96940	-4.18	4.73	4.73	0.59995	.	.	.	.	.	D	0.89382	0.6699	N	0.14661	0.345	0.31141	N	0.706615	B	0.14438	0.01	B	0.04013	0.001	T	0.83056	-0.0150	9	0.15499	T	0.54	.	6.4799	0.22057	0.2354:0.6722:0.0:0.0924	.	98	P22459	KCNA4_HUMAN	Q	98	ENSP00000328511:R98Q	ENSP00000328511:R98Q	R	-	2	0	KCNA4	29990509	0.468000	0.25839	0.036000	0.18154	0.754000	0.42855	3.980000	0.56895	2.180000	0.69256	0.561000	0.74099	CGG	-	NULL		0.612	KCNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNA4	protein_coding	OTTHUMT00000388074.2	C	NM_002233		29990509	-1	no_errors	NM_002233.2	genbank	human	reviewed	54_36p	missense	SNP	0.941	T
OR4D8P	401696	genome.wustl.edu	37	11	59259781	59259781	+	IGR	SNP	G	G	T			TCGA-AB-2920-03A-01W-0732-08	TCGA-AB-2920-11A-01W-0732-08	G	G	G	T	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	03508d3a-3bc2-4ec1-91cd-80a9f5aadad5	4ab04cad-cee0-4f9f-80b7-66d2472f5e31	g.chr11:59259781G>T								OR4D10 (13912 upstream) : RNU6-779P (6683 downstream)																							TGTCCTACATGGTCATATTAT	0.478																																						dbGAP											0			11																																								59016357	SO:0001628	intergenic_variant	0																															11.37:g.59259781G>T		Somatic	139	4.79	7		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	59016357	155	40.81	111		Missense_Mutation	SNP	HMMPfam_7tm_1,superfamily_SSF81321	p.M184I		37	c.552		11																																																																																			-	HMMPfam_7tm_1,superfamily_SSF81321	0	0.478					ENSG00000204989			G			59016357	+1	no_errors	ENST00000378245	ensembl	human	known	54_36p	missense	SNP	0.000	T
OR3A2	4995	genome.wustl.edu	37	17	3181502	3181502	+	Missense_Mutation	SNP	C	C	T	rs201997751		TCGA-AB-2920-03A-01W-0732-08	TCGA-AB-2920-11A-01W-0732-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	03508d3a-3bc2-4ec1-91cd-80a9f5aadad5	4ab04cad-cee0-4f9f-80b7-66d2472f5e31	g.chr17:3181502C>T	ENST00000408891.2	-	1	766	c.728G>A	c.(727-729)cGa>cAa	p.R243Q	RP11-64J4.2_ENST00000573491.1_RNA	NM_002551.3	NP_002542.3	P47893	OR3A2_HUMAN	olfactory receptor, family 3, subfamily A, member 2	243					sensory perception of chemical stimulus (GO:0007606)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)|receptor activity (GO:0004872)			ovary(1)	1						GGCCTTCTTTCGGCCCTCCAC	0.532													C|||	1	0.000199681	0.0	0.0	5008	,	,		21371	0.0		0.001	False		,,,				2504	0.0				GBM(166;478 2018 3875 5042 31983)|Esophageal Squamous(77;407 1232 1405 14297 15272)	dbGAP											0			17						C	GLN/ARG	0,4406		0,0,2203	53.0	56.0	55.0		728	1.8	1.0	17		55	6,8594	4.3+/-15.6	0,6,4294	yes	missense	OR3A2	NM_002551.3	43	0,6,6497	TT,TC,CC		0.0698,0.0,0.0461	probably-damaging	243/322	3181502	6,13000	2203	4300	6503	3128252	SO:0001583	missense	0			U04713	CCDS42233.1	17p13.3	2012-08-09				ENSG00000221882		"""GPCR / Class A : Olfactory receptors"""	8283	protein-coding gene	gene with protein product						8921386, 10673334	Standard	NM_002551		Approved	OLFRA04, OR228, OR17-228	uc002fvg.3	P47893		ENST00000408891.2:c.728G>A	17.37:g.3181502C>T	ENSP00000386180:p.Arg243Gln	Somatic	69	0.00	0		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	3128252	175	11.88	24	Q6IFM3|Q9P1Q3	Missense_Mutation	SNP	HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1,superfamily_SSF81321	p.R243Q	ENST00000408891.2	37	c.728	CCDS42233.1	17	5	0.0022893772893772895	4	0.008130081300813009	0	0.0	0	0.0	1	0.0013192612137203166	C	15.13	2.741226	0.49151	0.0	6.98E-4	ENSG00000221882	ENST00000408891	T	0.00311	8.15	4.9	1.79	0.24919	GPCR, rhodopsin-like superfamily (1);	0.282341	0.25219	N	0.032244	T	0.00356	0.0011	M	0.76838	2.35	0.19775	N	0.999957	D	0.71674	0.998	D	0.66351	0.943	T	0.47837	-0.9086	10	0.66056	D	0.02	-6.0729	5.3021	0.15783	0.1451:0.6151:0.0:0.2398	.	243	P47893	OR3A2_HUMAN	Q	243	ENSP00000386180:R243Q	ENSP00000386180:R243Q	R	-	2	0	OR3A2	3128252	0.000000	0.05858	0.956000	0.39512	0.037000	0.13140	0.212000	0.17497	0.355000	0.24131	0.561000	0.74099	CGA	-	HMMPfam_7tm_1,superfamily_SSF81321		0.532	OR3A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR3A2	protein_coding	OTTHUMT00000438370.1	C			3128252	-1	no_errors	NM_002551.3	genbank	human	validated	54_36p	missense	SNP	0.004	T
NF1	4763	genome.wustl.edu	37	17	29562747	29562747	+	Missense_Mutation	SNP	G	G	A	rs137854556		TCGA-AB-2920-03A-01W-0732-08	TCGA-AB-2920-11A-01W-0732-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	03508d3a-3bc2-4ec1-91cd-80a9f5aadad5	4ab04cad-cee0-4f9f-80b7-66d2472f5e31	g.chr17:29562747G>A	ENST00000358273.4	+	28	4210	c.3827G>A	c.(3826-3828)cGa>cAa	p.R1276Q	NF1_ENST00000356175.3_Missense_Mutation_p.R1276Q	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	1276	Ras-GAP. {ECO:0000255|PROSITE- ProRule:PRU00167}.		R -> G (in NF1; dbSNP:rs199474742). {ECO:0000269|PubMed:15060124}.|R -> P (in NF1; complete loss of GAP activity; dbSNP:rs137854556). {ECO:0000269|PubMed:10712197, ECO:0000269|PubMed:9668168}.|R -> Q (in NF1 and mismatch repair deficient cancer cells; dbSNP:rs137854556). {ECO:0000269|PubMed:10712197, ECO:0000269|PubMed:12522551, ECO:0000269|PubMed:15060124}.		actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(4)|p.R1276Q(2)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		ACTCTCTTCCGAGGCAACAGC	0.398			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																												dbGAP	yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	14	Whole gene deletion(8)|Unknown(4)|Substitution - Missense(2)	soft_tissue(7)|large_intestine(2)|autonomic_ganglia(2)|central_nervous_system(2)|lung(1)	17	GRCh37	CM000802|CM983421	NF1	M	rs137854556						165.0	161.0	163.0					17																	29562747		2203	4300	6503	26586873	SO:0001583	missense	0	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.3827G>A	17.37:g.29562747G>A	ENSP00000351015:p.Arg1276Gln	Somatic	66	5.71	4		0	100.00	11	WXS	Illumina HiSeq	Phase_IV	26586873	28	77.60	97	O00662|Q14284|Q14930|Q14931|Q9UMK3	Missense_Mutation	SNP	HMMSmart_SM00516,HMMPfam_RasGAP,HMMSmart_SM00323,PatternScan_RAS_GTPASE_ACTIV_1,superfamily_GTPase activation domain GAP	p.R1276Q	ENST00000358273.4	37	c.3827	CCDS42292.1	17	.	.	.	.	.	.	.	.	.	.	G	36	5.774352	0.96922	.	.	ENSG00000196712	ENST00000358273;ENST00000356175;ENST00000456735	D;D;D	0.93133	-3.17;-3.17;-3.17	6.16	6.16	0.99307	Rho GTPase activation protein (1);Armadillo-type fold (1);Ras GTPase-activating protein (3);	0.000000	0.85682	D	0.000000	D	0.98321	0.9443	H	0.97829	4.085	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.997;1.0	D;D;D;D	0.97110	1.0;1.0;0.964;1.0	D	0.98581	1.0650	10	0.87932	D	0	.	20.8598	0.99761	0.0:0.0:1.0:0.0	.	1276;326;1276;1276	E1P657;Q59FX3;P21359-2;P21359	.;.;.;NF1_HUMAN	Q	1276;1276;942	ENSP00000351015:R1276Q;ENSP00000348498:R1276Q;ENSP00000389907:R942Q	ENSP00000348498:R1276Q	R	+	2	0	NF1	26586873	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.212000	0.95126	2.937000	0.99478	0.650000	0.86243	CGA	-	HMMPfam_RasGAP,HMMSmart_SM00323,superfamily_GTPase activation domain GAP		0.398	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NF1	protein_coding	OTTHUMT00000256351.2	G	NM_000267		26586873	+1	no_errors	NM_001042492.2	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
ARHGEF1	9138	genome.wustl.edu	37	19	42410133	42410133	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2920-03A-01W-0732-08	TCGA-AB-2920-11A-01W-0732-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	03508d3a-3bc2-4ec1-91cd-80a9f5aadad5	4ab04cad-cee0-4f9f-80b7-66d2472f5e31	g.chr19:42410133G>A	ENST00000354532.3	+	26	2595	c.2447G>A	c.(2446-2448)aGa>aAa	p.R816K	ARHGEF1_ENST00000337665.4_Missense_Mutation_p.R831K|ARHGEF1_ENST00000378152.4_Missense_Mutation_p.R798K|ARHGEF1_ENST00000347545.4_Missense_Mutation_p.R783K|ARHGEF1_ENST00000599846.1_Missense_Mutation_p.R872K|CTD-2575K13.6_ENST00000597630.1_RNA	NM_004706.3	NP_004697.2	Q92888	ARHG1_HUMAN	Rho guanine nucleotide exchange factor (GEF) 1	816					cell proliferation (GO:0008283)|negative regulation of axonogenesis (GO:0050771)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of axonogenesis (GO:0050770)|Rho protein signal transduction (GO:0007266)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|poly(A) RNA binding (GO:0044822)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|endometrium(8)|large_intestine(6)|lung(9)|ovary(3)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	37		Renal(1328;0.000518)|Hepatocellular(1079;0.0046)|Medulloblastoma(540;0.0425)		Epithelial(262;5.89e-46)|GBM - Glioblastoma multiforme(1328;2.49e-12)|STAD - Stomach adenocarcinoma(1328;0.00644)		CCCTTCTGCAGACCAGGCCCC	0.657																																						dbGAP											0			19											57.0	58.0	58.0					19																	42410133		2203	4300	6503	47101973	SO:0001583	missense	0			U64105	CCDS12590.1, CCDS12591.1, CCDS12592.1	19q13.13	2014-06-19			ENSG00000076928	ENSG00000076928		"""Rho guanine nucleotide exchange factors"""	681	protein-coding gene	gene with protein product		601855				8810315, 9135076	Standard	NM_004706		Approved	P115-RHOGEF, SUB1.5, LBCL2	uc002osa.3	Q92888	OTTHUMG00000182679	ENST00000354532.3:c.2447G>A	19.37:g.42410133G>A	ENSP00000346532:p.Arg816Lys	Somatic	36	5.26	2		275	43.44	212	WXS	Illumina HiSeq	Phase_IV	47101973	43	35.71	25	O00513|Q8N4J4|Q96BF4|Q96F17|Q9BSB1	Missense_Mutation	SNP	HMMPfam_RhoGEF,HMMSmart_RhoGEF,superfamily_DH-domain,HMMSmart_PH,HMMPfam_RGS-like,superfamily_Regulat_G_prot_signal_superfam,superfamily_SSF50729	p.R831K	ENST00000354532.3	37	c.2492	CCDS12591.1	19	.	.	.	.	.	.	.	.	.	.	G	20.9	4.072842	0.76415	.	.	ENSG00000076928	ENST00000354532;ENST00000347545;ENST00000337665;ENST00000378152	T;T;T;T	0.66099	-0.12;-0.08;-0.12;-0.19	4.1	3.04	0.35103	.	0.456471	0.18956	N	0.126526	T	0.45337	0.1337	L	0.29908	0.895	0.21064	N	0.999792	P;P;P;P	0.47191	0.66;0.891;0.891;0.826	B;P;P;B	0.45610	0.206;0.487;0.487;0.292	T	0.38779	-0.9645	10	0.06236	T	0.91	-4.2973	7.1294	0.25490	0.1251:0.0:0.8749:0.0	.	798;831;783;816	Q6NX52;Q92888-3;Q92888-2;Q92888	.;.;.;ARHG1_HUMAN	K	816;783;831;798	ENSP00000346532:R816K;ENSP00000344429:R783K;ENSP00000337261:R831K;ENSP00000367394:R798K	ENSP00000337261:R831K	R	+	2	0	ARHGEF1	47101973	0.998000	0.40836	0.997000	0.53966	0.998000	0.95712	1.810000	0.38932	2.008000	0.58898	0.550000	0.68814	AGA	-	NULL		0.657	ARHGEF1-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	ARHGEF1	protein_coding	OTTHUMT00000463360.1	G	NM_199002		47101973	+1	no_errors	NM_199002.3	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
CBX7	23492	genome.wustl.edu	37	22	39534689	39534690	+	Frame_Shift_Ins	INS	-	-	GCTC			TCGA-AB-2920-03A-01W-0732-08	TCGA-AB-2920-11A-01W-0732-08	-	-	-	GCTC	-	-	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	03508d3a-3bc2-4ec1-91cd-80a9f5aadad5	4ab04cad-cee0-4f9f-80b7-66d2472f5e31	g.chr22:39534689_39534690insGCTC	ENST00000216133.5	-	4	402_403	c.197_198insGAGC	c.(196-198)gcafs	p.-67fs	CBX7_ENST00000401405.3_Frame_Shift_Ins_p.-67fs|CBX7_ENST00000475962.1_Intron	NM_175709.3	NP_783640.1	O95931	CBX7_HUMAN	chromobox homolog 7						chromatin modification (GO:0016568)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|sebaceous gland development (GO:0048733)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	chromatin binding (GO:0003682)|single-stranded RNA binding (GO:0003727)			endometrium(1)|large_intestine(2)|lung(2)|ovary(1)|skin(1)	7	Melanoma(58;0.04)					TATACCCCGATGCTCGGTCTCT	0.594																																					GBM(46;845 904 3560 9866 23971)	dbGAP											0			22																																								37864636	SO:0001589	frameshift_variant	0				CCDS13986.1	22q13.1	2010-07-06			ENSG00000100307	ENSG00000100307			1557	protein-coding gene	gene with protein product		608457					Standard	NM_175709		Approved		uc003axb.3	O95931	OTTHUMG00000150418	ENST00000216133.5:c.194_197dupGAGC	22.37:g.39534690_39534693dupGCTC	ENSP00000216133:p.Ser67fs	Somatic	NA	NA	NA		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	37864635	NA	NA	NA	Q86T17	Frame_Shift_Ins	INS	HMMPfam_Chromo,HMMSmart_CHROMO,PatternScan_CHROMO_1,superfamily_Chromodomain-like	p.G68fs	ENST00000216133.5	37	c.198_197	CCDS13986.1	22																																																																																			-	NULL		0.594	CBX7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CBX7	protein_coding	OTTHUMT00000318020.1	-	NM_175709		37864636	-1	no_errors	NM_175709.3	genbank	human	validated	54_36p	frame_shift_ins	INS	0.981:0.999	GCTC
CBX7	23492	genome.wustl.edu	37	22	39534690	39534691	+	Frame_Shift_Ins	INS	-	-	GCTC			TCGA-AB-2920-03A-01W-0732-08	TCGA-AB-2920-11A-01W-0732-08	-	-	-	GCTC	-	-	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	03508d3a-3bc2-4ec1-91cd-80a9f5aadad5	4ab04cad-cee0-4f9f-80b7-66d2472f5e31	g.chr22:39534690_39534691insGCTC	ENST00000216133.5	-	4	401_402	c.196_197insGAGC	c.(196-198)gcafs	p.-65fs	CBX7_ENST00000401405.3_Frame_Shift_Ins_p.-65fs|CBX7_ENST00000475962.1_Intron	NM_175709.3	NP_783640.1	O95931	CBX7_HUMAN	chromobox homolog 7						chromatin modification (GO:0016568)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|sebaceous gland development (GO:0048733)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	chromatin binding (GO:0003682)|single-stranded RNA binding (GO:0003727)			endometrium(1)|large_intestine(2)|lung(2)|ovary(1)|skin(1)	7	Melanoma(58;0.04)					ATACCCCGATGCTCGGTCTCTC	0.589																																					GBM(46;845 904 3560 9866 23971)	dbGAP											0			22																																								37864637	SO:0001589	frameshift_variant	0				CCDS13986.1	22q13.1	2010-07-06			ENSG00000100307	ENSG00000100307			1557	protein-coding gene	gene with protein product		608457					Standard	NM_175709		Approved		uc003axb.3	O95931	OTTHUMG00000150418	ENST00000216133.5:c.196_197insGAGC	22.37:g.39534690_39534691insGCTC	ENSP00000216133:p.Arg65fs	Somatic	NA	NA	NA		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	37864636	NA	NA	NA	Q86T17	Frame_Shift_Ins	INS	HMMPfam_Chromo,HMMSmart_CHROMO,PatternScan_CHROMO_1,superfamily_Chromodomain-like	p.A66fs	ENST00000216133.5	37	c.197_196	CCDS13986.1	22																																																																																			-	NULL		0.589	CBX7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CBX7	protein_coding	OTTHUMT00000318020.1	-	NM_175709		37864637	-1	no_errors	NM_175709.3	genbank	human	validated	54_36p	frame_shift_ins	INS	0.999:1.000	GCTC
