#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NormalRefReads_WU	i_NormalVAF_WU	i_NormalVarReads_WU	i_ORegAnno_bin	i_RNARefReads_WU	i_RNAVAF_WU	i_RNAVarReads_WU	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TumorRefReads_WU	i_TumorVAF_WU	i_TumorVarReads_WU	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
ASB11	140456	genome.wustl.edu	37	X	15306084	15306084	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2923-03A-01W-0745-08	TCGA-AB-2923-11A-01W-0745-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	26973c94-f1c1-46a1-b753-4f561fd7d451	872c532a-f3d4-4cb5-8ebd-09ff6c9d5cdd	g.chrX:15306084G>A	ENST00000480796.1	-	6	816	c.766C>T	c.(766-768)Cgt>Tgt	p.R256C	ASB11_ENST00000380470.3_Missense_Mutation_p.R239C|ASB11_ENST00000537676.1_Missense_Mutation_p.R235C|ASB11_ENST00000344384.4_Missense_Mutation_p.R235C			Q8WXH4	ASB11_HUMAN	ankyrin repeat and SOCS box containing 11, E3 ubiquitin protein ligase	256					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					breast(2)|central_nervous_system(4)|endometrium(1)|large_intestine(1)|lung(5)|ovary(2)|skin(1)	16	Hepatocellular(33;0.183)					GCATTTCTACGCTTCAGGTTA	0.572																																						dbGAP											0			X											133.0	106.0	115.0					X																	15306084		2203	4300	6503	15216005	SO:0001583	missense	0			AF425642	CCDS14164.1, CCDS35209.1, CCDS56596.1	Xp22.31	2014-02-10	2014-02-10		ENSG00000165192	ENSG00000165192		"""Ankyrin repeat domain containing"""	17186	protein-coding gene	gene with protein product		300626	"""ankyrin repeat and SOCS box-containing 11"", ""ankyrin repeat and SOCS box containing 11"""			24337577	Standard	NM_080873		Approved	DKFZp779E2460	uc004cwp.2	Q8WXH4	OTTHUMG00000021173	ENST00000480796.1:c.766C>T	X.37:g.15306084G>A	ENSP00000417914:p.Arg256Cys	Somatic	30	6.25	2		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	15216005	27	22.22	8	E9PEN1|Q3SYC4|Q7Z667	Missense_Mutation	SNP	HMMPfam_SOCS_box,HMMPfam_Ank,HMMSmart_ANK,superfamily_ANK	p.R256C	ENST00000480796.1	37	c.766	CCDS14164.1	X	.	.	.	.	.	.	.	.	.	.	G	9.804	1.181231	0.21787	.	.	ENSG00000165192	ENST00000537676;ENST00000380470;ENST00000344384;ENST00000480796	T;T;T;T	0.64618	-0.11;-0.11;-0.11;-0.11	5.44	1.68	0.24146	Ankyrin repeat-containing domain (4);	0.669242	0.14936	N	0.289808	T	0.38983	0.1061	N	0.17800	0.525	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.0;0.001	T	0.22068	-1.0227	10	0.46703	T	0.11	2.1305	1.2629	0.02005	0.4498:0.1446:0.2584:0.1473	.	239;256;235	Q7Z667;Q8WXH4;E9PEN1	.;ASB11_HUMAN;.	C	235;239;235;256	ENSP00000445465:R235C;ENSP00000369837:R239C;ENSP00000343408:R235C;ENSP00000417914:R256C	ENSP00000343408:R235C	R	-	1	0	ASB11	15216005	0.002000	0.14202	0.045000	0.18777	0.912000	0.54170	0.151000	0.16283	0.321000	0.23259	0.523000	0.50628	CGT	-	HMMPfam_Ank,HMMSmart_ANK,superfamily_ANK		0.572	ASB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASB11	protein_coding	OTTHUMT00000055852.2	G			15216005	-1	no_errors	NM_080873.1	genbank	human	reviewed	54_36p	missense	SNP	0.006	A
NRAS	4893	genome.wustl.edu	37	1	115256529	115256529	+	Missense_Mutation	SNP	T	T	C	rs11554290	byFrequency	TCGA-AB-2923-03A-01W-0745-08	TCGA-AB-2923-11A-01W-0745-08	T	T	T	C	T	T	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	26973c94-f1c1-46a1-b753-4f561fd7d451	872c532a-f3d4-4cb5-8ebd-09ff6c9d5cdd	g.chr1:115256529T>C	ENST00000369535.4	-	3	435	c.182A>G	c.(181-183)cAa>cGa	p.Q61R		NM_002524.4	NP_002515.1	P01111	RASN_HUMAN	neuroblastoma RAS viral (v-ras) oncogene homolog	61			Q -> K (in CMNS and NCMS; somatic mutation). {ECO:0000269|PubMed:23392294}.|Q -> R (in CMNS, NCMS and KNEN; also found in lung carcinoma cell and melanoma; dbSNP:rs11554290). {ECO:0000269|PubMed:18633438, ECO:0000269|PubMed:22499344, ECO:0000269|PubMed:23392294, ECO:0000269|PubMed:3276402}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of skeletal muscle tissue development (GO:0048642)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|small GTPase mediated signal transduction (GO:0007264)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.Q61R(817)|p.Q61L(175)|p.Q61P(23)|p.Q61K(1)		NS(134)|adrenal_gland(9)|autonomic_ganglia(9)|biliary_tract(6)|bone(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(11)|eye(3)|haematopoietic_and_lymphoid_tissue(1115)|kidney(3)|large_intestine(105)|liver(10)|lung(42)|meninges(2)|ovary(7)|pancreas(5)|prostate(8)|skin(1144)|soft_tissue(37)|stomach(5)|testis(8)|thyroid(359)|upper_aerodigestive_tract(28)|urinary_tract(13)	3085	all_epithelial(7;5.11e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		GTACTCTTCTTGTCCAGCTGT	0.458	Q61L(C3A_LIVER)|Q61L(HEPG2_LIVER)|Q61L(HL60_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61L(IPC298_SKIN)|Q61L(KMS21BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61L(MELJUSO_SKIN)|Q61L(MHHES1_BONE)|Q61L(MOLP8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61L(OCIAML3_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61P(TF1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61R(HT1197_URINARY_TRACT)|Q61R(KMS27_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61R(KU1919_URINARY_TRACT)|Q61R(NCIH2347_LUNG)|Q61R(ONS76_CENTRAL_NERVOUS_SYSTEM)|Q61R(SKMEL2_SKIN)|Q61R(SW1271_LUNG)|Q61R(TT2609C02_THYROID)	50	Mis		"""melanoma, MM, AML, thyroid"""				Noonan syndrome	TSP Lung(23;0.16)|Multiple Myeloma(1;<1E-6)																												dbGAP		Dom	yes		1	1p13.2	4893	neuroblastoma RAS viral (v-ras) oncogene homolog		"""L, E"""	1016	Substitution - Missense(1016)	skin(466)|thyroid(279)|haematopoietic_and_lymphoid_tissue(124)|NS(50)|large_intestine(27)|lung(17)|urinary_tract(11)|adrenal_gland(7)|liver(7)|breast(7)|soft_tissue(4)|testis(3)|endometrium(3)|ovary(3)|central_nervous_system(2)|pancreas(2)|eye(1)|prostate(1)|meninges(1)|autonomic_ganglia(1)	1											180.0	156.0	164.0					1																	115256529		2203	4300	6503	115058052	SO:0001583	missense	0	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	BC005219	CCDS877.1	1p13.2	2014-09-17			ENSG00000213281	ENSG00000213281			7989	protein-coding gene	gene with protein product		164790					Standard	NM_002524		Approved	N-ras	uc009wgu.3	P01111	OTTHUMG00000012059	ENST00000369535.4:c.182A>G	1.37:g.115256529T>C	ENSP00000358548:p.Gln61Arg	Somatic	97	2.00	2		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	115058052	73	16.09	14	Q14971|Q15104|Q15282	Missense_Mutation	SNP	HMMSmart_SM00173,HMMSmart_SM00174,HMMSmart_SM00175,HMMPfam_Ras,superfamily_P-loop containing nucleoside triphosphate hydrolases	p.Q61R	ENST00000369535.4	37	c.182	CCDS877.1	1	.	.	.	.	.	.	.	.	.	.	T	20.5	4.004139	0.74932	.	.	ENSG00000213281	ENST00000369535	D	0.83673	-1.75	5.08	5.08	0.68730	Small GTP-binding protein domain (1);	0.000000	0.53938	U	0.000043	D	0.86489	0.5945	M	0.92604	3.325	0.80722	D	1	B	0.28512	0.214	B	0.39590	0.304	D	0.88255	0.2919	10	0.66056	D	0.02	.	15.0132	0.71565	0.0:0.0:0.0:1.0	rs11554290;rs11554290	61	P01111	RASN_HUMAN	R	61	ENSP00000358548:Q61R	ENSP00000358548:Q61R	Q	-	2	0	NRAS	115058052	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.761000	0.85260	2.120000	0.65058	0.533000	0.62120	CAA	-	HMMSmart_SM00173,HMMSmart_SM00174,HMMSmart_SM00175,HMMPfam_Ras,superfamily_P-loop containing nucleoside triphosphate hydrolases		0.458	NRAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NRAS	protein_coding	OTTHUMT00000033395.2	T	NM_002524		115058052	-1	no_errors	NM_002524.3	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
CGN	57530	genome.wustl.edu	37	1	151506464	151506464	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2923-03A-01W-0745-08	TCGA-AB-2923-11A-01W-0745-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	26973c94-f1c1-46a1-b753-4f561fd7d451	872c532a-f3d4-4cb5-8ebd-09ff6c9d5cdd	g.chr1:151506464G>A	ENST00000271636.7	+	15	2889	c.2756G>A	c.(2755-2757)cGg>cAg	p.R919Q		NM_020770.2	NP_065821.1	Q9P2M7	CING_HUMAN	cingulin	913					transforming growth factor beta receptor signaling pathway (GO:0007179)	cell junction (GO:0030054)|myosin complex (GO:0016459)|tight junction (GO:0005923)	actin binding (GO:0003779)|motor activity (GO:0003774)			NS(1)|central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|liver(1)|lung(14)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	45	Ovarian(49;0.0273)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			CAGAGGCTGCGGCAGGCCCTG	0.632																																						dbGAP											0			1											31.0	34.0	33.0					1																	151506464		2136	4191	6327	149773088	SO:0001583	missense	0			AB037740	CCDS999.1	1q21	2008-02-05			ENSG00000143375	ENSG00000143375			17429	protein-coding gene	gene with protein product		609473				11042084, 12529927	Standard	NM_020770		Approved	KIAA1319	uc009wmw.3	Q9P2M7	OTTHUMG00000012497	ENST00000271636.7:c.2756G>A	1.37:g.151506464G>A	ENSP00000271636:p.Arg919Gln	Somatic	44	2.22	1		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	149773088	25	46.81	22	A6H8L3|A7MD22|Q5T386|Q9NR25	Missense_Mutation	SNP	HMMPfam_Myosin_tail_1	p.R919Q	ENST00000271636.7	37	c.2756	CCDS999.1	1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.505819	0.85282	.	.	ENSG00000143375	ENST00000271636	T	0.79845	-1.31	5.25	5.25	0.73442	Myosin tail (1);	0.056947	0.64402	D	0.000002	T	0.67850	0.2937	N	0.11818	0.18	0.38789	D	0.954935	D	0.69078	0.997	P	0.61477	0.889	T	0.72276	-0.4341	10	0.37606	T	0.19	-30.7645	8.1863	0.31341	0.1689:0.0:0.8311:0.0	.	913	Q9P2M7	CING_HUMAN	Q	919	ENSP00000271636:R919Q	ENSP00000271636:R919Q	R	+	2	0	CGN	149773088	1.000000	0.71417	1.000000	0.80357	0.897000	0.52465	6.030000	0.70903	2.457000	0.83068	0.563000	0.77884	CGG	-	NULL		0.632	CGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CGN	protein_coding	OTTHUMT00000034900.3	G	NM_020770		149773088	+1	no_errors	NM_020770.2	genbank	human	validated	54_36p	missense	SNP	1.000	A
CR1	1378	genome.wustl.edu	37	1	207785328	207785328	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2923-03A-01W-0745-08	TCGA-AB-2923-11A-01W-0745-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	26973c94-f1c1-46a1-b753-4f561fd7d451	872c532a-f3d4-4cb5-8ebd-09ff6c9d5cdd	g.chr1:207785328G>A	ENST00000367049.4	+	39	6517	c.6517G>A	c.(6517-6519)Gtg>Atg	p.V2173M	CR1_ENST00000367053.1_Missense_Mutation_p.V1723M|CR1_ENST00000367051.1_Missense_Mutation_p.V1723M|CR1_ENST00000400960.2_Missense_Mutation_p.V1723M|CR1_ENST00000367052.1_Missense_Mutation_p.V1723M	NM_000651.4	NP_000642.3	P17927	CR1_HUMAN	complement component (3b/4b) receptor 1 (Knops blood group)	1723					complement activation, classical pathway (GO:0006958)|complement receptor mediated signaling pathway (GO:0002430)|innate immune response (GO:0045087)|negative regulation of complement activation, alternative pathway (GO:0045957)|negative regulation of complement activation, classical pathway (GO:0045959)|negative regulation of serine-type endopeptidase activity (GO:1900004)|positive regulation of serine-type endopeptidase activity (GO:1900005)|regulation of complement activation (GO:0030449)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	complement component C3b binding (GO:0001851)|complement component C3b receptor activity (GO:0004877)|complement component C4b binding (GO:0001855)|complement component C4b receptor activity (GO:0001861)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(9)|kidney(11)|large_intestine(13)|lung(33)|ovary(3)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						TCATGGCCGTGTGCTACTTCC	0.488																																						dbGAP											0			1											288.0	275.0	279.0					1																	207785328		1945	4141	6086	205851951	SO:0001583	missense	0			Y00816	CCDS44308.1, CCDS44309.1	1q32	2014-07-19	2006-01-12		ENSG00000203710	ENSG00000203710		"""CD molecules"", ""Blood group antigens"", ""Complement system"""	2334	protein-coding gene	gene with protein product		120620	"""complement component (3b/4b) receptor 1, including Knops blood group system"""			1708809	Standard	XM_005273064		Approved	CD35, KN	uc001hfx.3	P17927	OTTHUMG00000036311	ENST00000367049.4:c.6517G>A	1.37:g.207785328G>A	ENSP00000356016:p.Val2173Met	Somatic	59	4.76	3		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	205851951	37	51.32	39	Q16744|Q16745|Q5SR43|Q5SR45|Q9UQV2	Missense_Mutation	SNP	HMMPfam_Sushi,HMMSmart_SM00032,superfamily_Complement control module/SCR domain	p.V2173M	ENST00000367049.4	37	c.6517	CCDS44308.1	1	.	.	.	.	.	.	.	.	.	.	G	9.541	1.113454	0.20795	.	.	ENSG00000203710	ENST00000367052;ENST00000367051;ENST00000367053;ENST00000400960;ENST00000367049	T;T;T;T;T	0.67345	-0.26;-0.26;-0.26;-0.26;-0.26	3.21	2.3	0.28687	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	T	0.77798	0.4184	M	0.74647	2.275	0.09310	N	1	D;D	0.76494	0.999;0.999	D;D	0.85130	0.997;0.988	T	0.63056	-0.6722	9	0.66056	D	0.02	.	6.4206	0.21742	0.1359:0.0:0.8641:0.0	.	1723;2173	P17927;E9PDY4	CR1_HUMAN;.	M	1723;1723;1723;1723;2173	ENSP00000356019:V1723M;ENSP00000356018:V1723M;ENSP00000356020:V1723M;ENSP00000383744:V1723M;ENSP00000356016:V2173M	ENSP00000356016:V2173M	V	+	1	0	CR1	205851951	0.328000	0.24687	0.004000	0.12327	0.211000	0.24417	1.637000	0.37155	0.910000	0.36722	0.511000	0.50034	GTG	-	HMMPfam_Sushi,HMMSmart_SM00032,superfamily_Complement control module/SCR domain		0.488	CR1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	CR1	protein_coding	OTTHUMT00000382527.1	G	NM_000573		205851951	+1	no_errors	NM_000651.3	genbank	human	reviewed	54_36p	missense	SNP	0.019	A
RNF25	64320	genome.wustl.edu	37	2	219533395	219533395	+	Missense_Mutation	SNP	G	G	T			TCGA-AB-2923-03A-01W-0745-08	TCGA-AB-2923-11A-01W-0745-08	G	G	G	T	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	26973c94-f1c1-46a1-b753-4f561fd7d451	872c532a-f3d4-4cb5-8ebd-09ff6c9d5cdd	g.chr2:219533395G>T	ENST00000295704.2	-	2	489	c.49C>A	c.(49-51)Ccc>Acc	p.P17T		NM_022453.2	NP_071898.2	Q96BH1	RNF25_HUMAN	ring finger protein 25	17					positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein ubiquitination (GO:0016567)	cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|NF-kappaB binding (GO:0051059)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	24		Renal(207;0.0474)		Epithelial(149;6.99e-07)|all cancers(144;0.000129)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		ACTTCAGAGGGAAGGACCCTA	0.463																																						dbGAP											0			2											120.0	125.0	123.0					2																	219533395		2203	4300	6503	219241639	SO:0001583	missense	0				CCDS2420.1	2q35	2008-02-05			ENSG00000163481	ENSG00000163481		"""RING-type (C3HC4) zinc fingers"""	14662	protein-coding gene	gene with protein product						12748188	Standard	NM_022453		Approved	AO7, FLJ13906	uc002vit.3	Q96BH1	OTTHUMG00000133077	ENST00000295704.2:c.49C>A	2.37:g.219533395G>T	ENSP00000295704:p.Pro17Thr	Somatic	74	0.00	0		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	219241639	54	41.94	39	A8K0D6|Q53HQ5|Q9H874	Missense_Mutation	SNP	HMMSmart_SM00184,HMMPfam_RWD,HMMSmart_SM00591,superfamily_UBC-like,HMMPfam_zf-C3HC4,superfamily_RING/U-box	p.P17T	ENST00000295704.2	37	c.49	CCDS2420.1	2	.	.	.	.	.	.	.	.	.	.	G	11.61	1.688508	0.29962	.	.	ENSG00000163481	ENST00000295704	T	0.41065	1.01	5.41	5.41	0.78517	.	0.291574	0.39020	N	0.001491	T	0.45617	0.1351	N	0.16567	0.415	0.42726	D	0.993692	D	0.59767	0.986	D	0.68621	0.959	T	0.25012	-1.0144	10	0.23891	T	0.37	-14.2993	14.5887	0.68347	0.0:0.1458:0.8542:0.0	.	17	Q96BH1	RNF25_HUMAN	T	17	ENSP00000295704:P17T	ENSP00000295704:P17T	P	-	1	0	RNF25	219241639	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	4.220000	0.58567	2.826000	0.97356	0.561000	0.74099	CCC	-	HMMPfam_RWD		0.463	RNF25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF25	protein_coding	OTTHUMT00000256721.1	G	NM_022453		219241639	-1	no_errors	NM_022453.2	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
CCL20	6364	genome.wustl.edu	37	2	228680272	228680272	+	Missense_Mutation	SNP	T	T	A			TCGA-AB-2923-03A-01W-0745-08	TCGA-AB-2923-11A-01W-0745-08	T	T	T	A	T	T	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	26973c94-f1c1-46a1-b753-4f561fd7d451	872c532a-f3d4-4cb5-8ebd-09ff6c9d5cdd	g.chr2:228680272T>A	ENST00000358813.4	+	2	237	c.179T>A	c.(178-180)aTc>aAc	p.I60N	CCL20_ENST00000409189.3_Missense_Mutation_p.I59N|CCL20_ENST00000473642.1_3'UTR			P78556	CCL20_HUMAN	chemokine (C-C motif) ligand 20	60					cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|chemokinesis (GO:0042466)|chemotaxis (GO:0006935)|defense response to bacterium (GO:0042742)|immune response (GO:0006955)|inflammatory response (GO:0006954)|positive regulation of T cell migration (GO:2000406)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	chemokine activity (GO:0008009)			cervix(1)|lung(2)	3		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;7.3e-11)|all cancers(144;4.13e-08)|Lung(261;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.0115)		GGCTGTGACATCAATGCTATC	0.363																																						dbGAP											0			2											93.0	98.0	96.0					2																	228680272		2203	4300	6503	228388516	SO:0001583	missense	0			D86955	CCDS2469.1, CCDS46536.1	2q36.3	2013-02-25	2002-08-22	2002-08-23	ENSG00000115009	ENSG00000115009		"""Chemokine ligands"", ""Endogenous ligands"""	10619	protein-coding gene	gene with protein product		601960	"""small inducible cytokine subfamily A (Cys-Cys), member 20"""	SCYA20		9038201, 11352563	Standard	NM_004591		Approved	LARC, MIP-3a, exodus-1, ST38, CKb4	uc002vpl.2	P78556	OTTHUMG00000133189	ENST00000358813.4:c.179T>A	2.37:g.228680272T>A	ENSP00000351671:p.Ile60Asn	Somatic	73	3.95	3		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	228388516	42	45.45	35	Q53S51|Q99664	Missense_Mutation	SNP	PatternScan_SMALL_CYTOKINES_CC,HMMPfam_IL8,HMMSmart_SM00199,superfamily_Interleukin 8-like chemokines	p.I60N	ENST00000358813.4	37	c.179	CCDS2469.1	2	.	.	.	.	.	.	.	.	.	.	T	16.08	3.021691	0.54576	.	.	ENSG00000115009	ENST00000409189;ENST00000358813	T;T	0.05199	3.48;3.48	4.82	4.82	0.62117	CC chemokine, conserved site (1);Chemokine interleukin-8-like domain (3);	0.000000	0.85682	D	0.000000	T	0.22820	0.0551	.	.	.	0.47698	D	0.999495	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.00482	-1.1713	9	0.72032	D	0.01	-19.1325	10.7728	0.46332	0.0:0.0:0.0:1.0	.	59;60	P78556-2;P78556	.;CCL20_HUMAN	N	59;60	ENSP00000386273:I59N;ENSP00000351671:I60N	ENSP00000351671:I60N	I	+	2	0	CCL20	228388516	0.998000	0.40836	0.995000	0.50966	0.552000	0.35366	4.115000	0.57865	1.805000	0.52779	0.455000	0.32223	ATC	-	PatternScan_SMALL_CYTOKINES_CC,HMMPfam_IL8,HMMSmart_SM00199,superfamily_Interleukin 8-like chemokines		0.363	CCL20-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCL20	protein_coding	OTTHUMT00000331641.1	T	NM_004591		228388516	+1	no_errors	NM_004591.1	genbank	human	validated	54_36p	missense	SNP	0.996	A
PXYLP1	92370	genome.wustl.edu	37	3	141011154	141011154	+	Missense_Mutation	SNP	T	T	G			TCGA-AB-2923-03A-01W-0745-08	TCGA-AB-2923-11A-01W-0745-08	T	T	T	G	T	T	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	26973c94-f1c1-46a1-b753-4f561fd7d451	872c532a-f3d4-4cb5-8ebd-09ff6c9d5cdd	g.chr3:141011154T>G	ENST00000286353.4	+	6	687	c.550T>G	c.(550-552)Tat>Gat	p.Y184D	ACPL2_ENST00000393010.2_Missense_Mutation_p.Y184D|ACPL2_ENST00000504264.1_Missense_Mutation_p.Y167D|ACPL2_ENST00000393007.1_Missense_Mutation_p.Y168D|ACPL2_ENST00000508812.1_Missense_Mutation_p.Y175D|ACPL2_ENST00000502783.1_Missense_Mutation_p.Y146D|RP11-438D8.2_ENST00000507698.1_RNA	NM_001037172.1|NM_001282728.1	NP_001032249.1|NP_001269657.1	Q8TE99	PXYP1_HUMAN		184						extracellular region (GO:0005576)	acid phosphatase activity (GO:0003993)			endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|prostate(2)|skin(2)	23						GAGGGATATCTATCTAAAGAA	0.478																																						dbGAP											0			3											83.0	81.0	82.0					3																	141011154		2203	4300	6503	142493844	SO:0001583	missense	0																														ENST00000286353.4:c.550T>G	3.37:g.141011154T>G	ENSP00000286353:p.Tyr184Asp	Somatic	82	0.00	0		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	142493844	40	38.46	25	D3DNF5|Q49AJ2|W0TR04	Missense_Mutation	SNP	HMMPfam_Acid_phosphat_A,superfamily_Phosphoglycerate mutase-like	p.Y184D	ENST00000286353.4	37	c.550	CCDS3116.1	3	.	.	.	.	.	.	.	.	.	.	T	21.7	4.185642	0.78789	.	.	ENSG00000155893	ENST00000286353;ENST00000502783;ENST00000393010;ENST00000504264;ENST00000508812;ENST00000393007	D;D;D;D;D;D	0.91180	-2.8;-2.8;-2.8;-2.8;-2.8;-2.8	5.61	5.61	0.85477	.	0.059005	0.64402	D	0.000001	D	0.95818	0.8639	M	0.89414	3.03	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96442	0.9327	10	0.87932	D	0	.	14.0487	0.64722	0.0:0.0:0.0:1.0	.	167;184	B7Z3R9;Q8TE99	.;ACPL2_HUMAN	D	184;146;184;167;175;168	ENSP00000286353:Y184D;ENSP00000422558:Y146D;ENSP00000376733:Y184D;ENSP00000426877:Y167D;ENSP00000422901:Y175D;ENSP00000376731:Y168D	ENSP00000286353:Y184D	Y	+	1	0	ACPL2	142493844	1.000000	0.71417	0.995000	0.50966	0.969000	0.65631	7.853000	0.86934	2.254000	0.74563	0.533000	0.62120	TAT	-	HMMPfam_Acid_phosphat_A,superfamily_Phosphoglycerate mutase-like		0.478	ACPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACPL2	protein_coding	OTTHUMT00000359533.2	T			142493844	+1	no_errors	NM_001037172.1	genbank	human	validated	54_36p	missense	SNP	1.000	G
TET2	54790	genome.wustl.edu	37	4	106156747	106156747	+	Nonsense_Mutation	SNP	C	C	T	rs572712965	byFrequency	TCGA-AB-2923-03A-01W-0745-08	TCGA-AB-2923-11A-01W-0745-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	26973c94-f1c1-46a1-b753-4f561fd7d451	872c532a-f3d4-4cb5-8ebd-09ff6c9d5cdd	g.chr4:106156747C>T	ENST00000540549.1	+	3	2508	c.1648C>T	c.(1648-1650)Cga>Tga	p.R550*	TET2_ENST00000380013.4_Nonsense_Mutation_p.R550*|TET2_ENST00000545826.1_Nonsense_Mutation_p.R550*|TET2_ENST00000413648.2_Nonsense_Mutation_p.R550*|TET2_ENST00000513237.1_Nonsense_Mutation_p.R571*|TET2_ENST00000305737.2_Nonsense_Mutation_p.R550*|TET2_ENST00000394764.1_Nonsense_Mutation_p.R550*			Q6N021	TET2_HUMAN	tet methylcytosine dioxygenase 2	550					5-methylcytosine catabolic process (GO:0006211)|cell cycle (GO:0007049)|DNA demethylation (GO:0080111)|histone H3-K4 trimethylation (GO:0080182)|kidney development (GO:0001822)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|protein O-linked glycosylation (GO:0006493)		DNA binding (GO:0003677)|ferrous iron binding (GO:0008198)|methylcytosine dioxygenase activity (GO:0070579)|zinc ion binding (GO:0008270)	p.R550*(20)		NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1272)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	1314		Myeloproliferative disorder(5;0.0393)		OV - Ovarian serous cystadenocarcinoma(123;7.18e-08)		GGAGCAAACACGAGATCTTGT	0.468			"""Mis N, F"""		MDS								C|||	2	0.000399361	0.0	0.0014	5008	,	,		20410	0.001		0.0	False		,,,				2504	0.0					dbGAP		Rec	yes		4	4q24	54790	tet oncogene family member 2		L	20	Substitution - Nonsense(20)	haematopoietic_and_lymphoid_tissue(20)	4											93.0	92.0	92.0					4																	106156747		2203	4300	6503	106376196	SO:0001587	stop_gained	0			AB046766	CCDS3666.1, CCDS47120.1	4q24	2014-09-17	2011-09-30	2008-03-12	ENSG00000168769	ENSG00000168769			25941	protein-coding gene	gene with protein product		612839	"""KIAA1546"", ""tet oncogene family member 2"""	KIAA1546		10997877, 12646957	Standard	NM_017628		Approved	FLJ20032	uc003hxk.3	Q6N021	OTTHUMG00000131213	ENST00000540549.1:c.1648C>T	4.37:g.106156747C>T	ENSP00000442788:p.Arg550*	Somatic	118	3.25	4		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	106376196	71	40.50	49	B5MDU0|Q2TB88|Q3LIB8|Q96JX5|Q9HCM6|Q9NXW0	Nonsense_Mutation	SNP	NULL	p.R550*	ENST00000540549.1	37	c.1648	CCDS47120.1	4	.	.	.	.	.	.	.	.	.	.	C	27.3	4.822696	0.90873	.	.	ENSG00000168769	ENST00000305737;ENST00000540549;ENST00000545826;ENST00000513237;ENST00000380013;ENST00000394764;ENST00000413648;ENST00000535110	.	.	.	5.31	2.36	0.29203	.	1.946010	0.03107	N	0.161907	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	4.2924	0.10885	0.2721:0.532:0.0:0.1959	.	.	.	.	X	550;550;550;571;550;550;550;550	.	ENSP00000265149:R550X	R	+	1	2	TET2	106376196	0.005000	0.15991	0.006000	0.13384	0.002000	0.02628	1.370000	0.34238	1.250000	0.43966	-0.145000	0.13849	CGA	-	NULL		0.468	TET2-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	TET2	protein_coding	OTTHUMT00000253952.2	C	NM_017628		106376196	+1	no_errors	NM_017628.1	genbank	human	validated	54_36p	nonsense	SNP	0.001	T
MEGF10	84466	genome.wustl.edu	37	5	126674892	126674892	+	Missense_Mutation	SNP	G	G	T			TCGA-AB-2923-03A-01W-0745-08	TCGA-AB-2923-11A-01W-0745-08	G	G	G	T	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	26973c94-f1c1-46a1-b753-4f561fd7d451	872c532a-f3d4-4cb5-8ebd-09ff6c9d5cdd	g.chr5:126674892G>T	ENST00000274473.6	+	4	464	c.197G>T	c.(196-198)tGg>tTg	p.W66L	MEGF10_ENST00000418761.2_Missense_Mutation_p.W66L|MEGF10_ENST00000508365.1_Missense_Mutation_p.W66L|MEGF10_ENST00000503335.2_Missense_Mutation_p.W66L	NM_032446.2	NP_115822.1	Q96KG7	MEG10_HUMAN	multiple EGF-like-domains 10	66	EMI. {ECO:0000255|PROSITE- ProRule:PRU00384}.|Necessary for interaction with AP2M1, self-assembly and formation of the irregular, mosaic-like adhesion pattern.				homotypic cell-cell adhesion (GO:0034109)|muscle cell development (GO:0055001)|recognition of apoptotic cell (GO:0043654)|regulation of muscle cell differentiation (GO:0051147)|regulation of skeletal muscle tissue development (GO:0048641)|skeletal muscle satellite cell activation (GO:0014719)|skeletal muscle satellite cell differentiation (GO:0014816)|skeletal muscle satellite cell proliferation (GO:0014841)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)				breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(28)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	68		Prostate(80;0.165)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0657)|Epithelial(69;0.123)		ATTCTAAACTGGTTTAAATGC	0.398																																						dbGAP											0			5											114.0	101.0	106.0					5																	126674892		2203	4299	6502	126702791	SO:0001583	missense	0			AK021631	CCDS4142.1	5q33	2008-02-05			ENSG00000145794	ENSG00000145794			29634	protein-coding gene	gene with protein product		612453				11347906	Standard	NM_032446		Approved	KIAA1780	uc003kui.4	Q96KG7	OTTHUMG00000128984	ENST00000274473.6:c.197G>T	5.37:g.126674892G>T	ENSP00000274473:p.Trp66Leu	Somatic	169	4.52	8		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	126702791	101	39.29	66	Q68DE5|Q8WUL3	Missense_Mutation	SNP	HMMPfam_Laminin_EGF,HMMSmart_SM00180,HMMSmart_SM00181,superfamily_Plant inhibitors of proteinases and amylases,HMMPfam_EMI,PatternScan_EGF_1,PatternScan_EGF_2,HMMPfam_EGF_2,superfamily_EGF/Laminin	p.W66L	ENST00000274473.6	37	c.197	CCDS4142.1	5	.	.	.	.	.	.	.	.	.	.	G	25.3	4.622097	0.87460	.	.	ENSG00000145794	ENST00000503335;ENST00000508365;ENST00000418761;ENST00000274473	T;T;T;T	0.79454	-1.27;2.83;2.83;-1.27	5.91	5.91	0.95273	EMI domain (1);	0.000000	0.64402	D	0.000001	D	0.82342	0.5016	L	0.36672	1.1	0.80722	D	1	D;D	0.89917	0.995;1.0	D;D	0.91635	0.958;0.999	T	0.75249	-0.3384	10	0.10902	T	0.67	-20.8265	19.0678	0.93119	0.0:0.0:1.0:0.0	.	66;66	Q96KG7-2;Q96KG7	.;MEG10_HUMAN	L	66	ENSP00000423354:W66L;ENSP00000423195:W66L;ENSP00000416284:W66L;ENSP00000274473:W66L	ENSP00000274473:W66L	W	+	2	0	MEGF10	126702791	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.683000	0.98657	2.813000	0.96785	0.655000	0.94253	TGG	-	HMMPfam_EMI		0.398	MEGF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEGF10	protein_coding	OTTHUMT00000250973.2	G	NM_032446		126702791	+1	no_errors	NM_032446.2	genbank	human	validated	54_36p	missense	SNP	1.000	T
CAGE1	285782	genome.wustl.edu	37	6	7379008	7379008	+	Missense_Mutation	SNP	G	G	T			TCGA-AB-2923-03A-01W-0745-08	TCGA-AB-2923-11A-01W-0745-08	G	G	G	T	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	26973c94-f1c1-46a1-b753-4f561fd7d451	872c532a-f3d4-4cb5-8ebd-09ff6c9d5cdd	g.chr6:7379008G>T	ENST00000512086.1	-	4	731	c.529C>A	c.(529-531)Caa>Aaa	p.Q177K	CAGE1_ENST00000502583.1_Missense_Mutation_p.Q177K|CAGE1_ENST00000338150.4_Missense_Mutation_p.Q177K|CAGE1_ENST00000379918.4_Missense_Mutation_p.Q177K|CAGE1_ENST00000509324.1_Intron|CAGE1_ENST00000296742.7_Missense_Mutation_p.Q41K			Q8TC20	CAGE1_HUMAN	cancer antigen 1	177										breast(1)|cervix(1)|endometrium(3)|kidney(2)|lung(11)|urinary_tract(1)	19	Ovarian(93;0.0418)					TTACCAAGTTGGTCTGTATTT	0.383																																						dbGAP											0			6											144.0	137.0	139.0					6																	7379008		1842	4090	5932	7324007	SO:0001583	missense	0			BC026194	CCDS47367.1, CCDS54964.1, CCDS54965.1	6p24.3	2009-08-06	2005-01-26	2005-01-27	ENSG00000164304	ENSG00000164304			21622	protein-coding gene	gene with protein product	"""cancer/testis antigen 95"""	608304	"""cancer/testis antigen 3"""	CTAG3		12531476	Standard	NM_205864		Approved	bA69L16.7, CT95	uc003mxl.2	Q8TC20	OTTHUMG00000014200	ENST00000512086.1:c.529C>A	6.37:g.7379008G>T	ENSP00000427583:p.Gln177Lys	Somatic	91	4.21	4		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	7324007	70	44.53	57	D6RCT9|Q5TAM0|Q86TM4|Q8N7R5	Missense_Mutation	SNP	NULL	p.Q41K	ENST00000512086.1	37	c.121		6	.	.	.	.	.	.	.	.	.	.	G	9.643	1.139487	0.21205	.	.	ENSG00000164304	ENST00000541116;ENST00000379918;ENST00000502583;ENST00000296742;ENST00000512086;ENST00000338150;ENST00000542431;ENST00000512691	T;T;T;T;T;T	0.33438	1.41;1.41;1.41;1.41;1.41;1.41	4.95	0.73	0.18271	.	1.971180	0.02130	N	0.056348	T	0.15782	0.0380	L	0.56769	1.78	0.09310	N	1	B	0.28636	0.218	B	0.28011	0.085	T	0.36359	-0.9751	10	0.66056	D	0.02	1.2228	9.0591	0.36423	0.0:0.5141:0.3365:0.1494	.	177	Q8TC20	CAGE1_HUMAN	K	177;177;177;41;177;177;177;189	ENSP00000369250:Q177K;ENSP00000425493:Q177K;ENSP00000296742:Q41K;ENSP00000427583:Q177K;ENSP00000338107:Q177K;ENSP00000423789:Q189K	ENSP00000296742:Q41K	Q	-	1	0	CAGE1	7324007	0.019000	0.18553	0.000000	0.03702	0.016000	0.09150	0.855000	0.27805	0.235000	0.21160	-0.169000	0.13324	CAA	-	NULL		0.383	CAGE1-008	PUTATIVE	non_canonical_conserved|basic	protein_coding	CAGE1	protein_coding	OTTHUMT00000367136.1	G	NM_175745		7324007	-1	no_errors	NM_205864.2	genbank	human	validated	54_36p	missense	SNP	0.001	T
PGBD1	84547	genome.wustl.edu	37	6	28269676	28269676	+	Missense_Mutation	SNP	A	A	G			TCGA-AB-2923-03A-01W-0745-08	TCGA-AB-2923-11A-01W-0745-08	A	A	A	G	A	A	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	26973c94-f1c1-46a1-b753-4f561fd7d451	872c532a-f3d4-4cb5-8ebd-09ff6c9d5cdd	g.chr6:28269676A>G	ENST00000405948.2	+	7	2465	c.2045A>G	c.(2044-2046)aAt>aGt	p.N682S	PGBD1_ENST00000259883.3_Missense_Mutation_p.N682S	NM_001184743.1|NM_032507.3	NP_001171672.1|NP_115896.1	Q96JS3	PGBD1_HUMAN	piggyBac transposable element derived 1	682						membrane (GO:0016020)|nucleus (GO:0005634)	scavenger receptor activity (GO:0005044)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(2)|large_intestine(7)|lung(16)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	41						GAAGAAAACAATGAGATAATT	0.393																																						dbGAP											0			6											146.0	147.0	147.0					6																	28269676		2203	4300	6503	28377655	SO:0001583	missense	0			D88259	CCDS4648.1	6p22.1	2013-01-09			ENSG00000137338	ENSG00000137338		"""-"""	19398	protein-coding gene	gene with protein product							Standard	NM_001184743		Approved	HUCEP-4, dJ874C20.4, SCAND4	uc003nkz.3	Q96JS3	OTTHUMG00000014520	ENST00000405948.2:c.2045A>G	6.37:g.28269676A>G	ENSP00000385213:p.Asn682Ser	Somatic	126	3.08	4		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	28377655	65	53.24	74	Q53F43|Q6NTF5|Q8WWS4	Missense_Mutation	SNP	HMMPfam_SCAN,HMMSmart_SCAN	p.N682S	ENST00000405948.2	37	c.2045	CCDS4648.1	6	.	.	.	.	.	.	.	.	.	.	A	3.451	-0.112094	0.06881	.	.	ENSG00000137338	ENST00000405948;ENST00000259883	T;T	0.16073	2.37;2.37	4.48	4.48	0.54585	.	0.712728	0.11408	N	0.567096	T	0.02380	0.0073	N	0.02539	-0.55	0.25373	N	0.98868	B	0.10296	0.003	B	0.13407	0.009	T	0.44190	-0.9344	10	0.28530	T	0.3	-25.9369	10.3621	0.44001	1.0:0.0:0.0:0.0	.	682	Q96JS3	PGBD1_HUMAN	S	682	ENSP00000385213:N682S;ENSP00000259883:N682S	ENSP00000259883:N682S	N	+	2	0	PGBD1	28377655	0.531000	0.26338	0.970000	0.41538	0.379000	0.30106	2.196000	0.42686	2.012000	0.59069	0.482000	0.46254	AAT	-	NULL		0.393	PGBD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PGBD1	protein_coding	OTTHUMT00000040188.2	A			28377655	+1	no_errors	NM_032507.2	genbank	human	reviewed	54_36p	missense	SNP	0.978	G
RPS10	6204	genome.wustl.edu	37	6	34392507	34392507	+	Silent	SNP	C	C	T			TCGA-AB-2923-03A-01W-0745-08	TCGA-AB-2923-11A-01W-0745-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	26973c94-f1c1-46a1-b753-4f561fd7d451	872c532a-f3d4-4cb5-8ebd-09ff6c9d5cdd	g.chr6:34392507C>T	ENST00000326199.8	-	3	354	c.261G>A	c.(259-261)ccG>ccA	p.P87P	RPS10_ENST00000494077.1_5'UTR|RPS10_ENST00000344700.3_Silent_p.P87P|RPS10-NUDT3_ENST00000605528.1_Silent_p.P87P	NM_001014.4|NM_001203245.2|NM_001204091.1	NP_001005.1|NP_001190174.1|NP_001191020.1	P46783	RS10_HUMAN	ribosomal protein S10	87					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleolus (GO:0005730)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|lung(4)	9						GCACAATCTCCGGGGGCAGAT	0.532																																					Colon(121;749 1624 4895 8687 22360)	dbGAP											0			6											29.0	29.0	29.0					6																	34392507		2202	4297	6499	34500485	SO:0001819	synonymous_variant	0			U14972	CCDS4792.1	6p21.31	2011-04-05			ENSG00000124614	ENSG00000124614		"""S ribosomal proteins"""	10383	protein-coding gene	gene with protein product		603632				7772601, 9582194	Standard	NM_001014		Approved	MGC88819, S10		P46783	OTTHUMG00000014546	ENST00000326199.8:c.261G>A	6.37:g.34392507C>T		Somatic	40	0.00	0		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	34500485	28	46.15	24	B2R4E3|Q5TZC0	Silent	SNP	HMMPfam_S10_plectin	p.P87	ENST00000326199.8	37	c.261	CCDS4792.1	6																																																																																			-	HMMPfam_S10_plectin		0.532	RPS10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPS10	protein_coding	OTTHUMT00000040230.1	C			34500485	-1	no_errors	NM_001014.3	genbank	human	reviewed	54_36p	silent	SNP	0.757	T
DST	667	genome.wustl.edu	37	6	56480893	56480893	+	Missense_Mutation	SNP	C	C	T			TCGA-AB-2923-03A-01W-0745-08	TCGA-AB-2923-11A-01W-0745-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	26973c94-f1c1-46a1-b753-4f561fd7d451	872c532a-f3d4-4cb5-8ebd-09ff6c9d5cdd	g.chr6:56480893C>T	ENST00000370765.6	-	24	7479	c.7372G>A	c.(7372-7374)Gaa>Aaa	p.E2458K	DST_ENST00000370788.2_Intron|DST_ENST00000312431.6_Intron|DST_ENST00000361203.3_Intron|DST_ENST00000421834.2_Intron|DST_ENST00000370769.4_Intron|DST_ENST00000446842.2_Intron|DST_ENST00000370754.5_Intron|DST_ENST00000244364.6_Intron	NM_001723.5	NP_001714.1	Q03001	DYST_HUMAN	dystonin	1754					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			GAGATCCTTTCCCCACTAGCA	0.483																																						dbGAP											0			6											65.0	68.0	67.0					6																	56480893		2203	4300	6503	56588852	SO:0001583	missense	0			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000370765.6:c.7372G>A	6.37:g.56480893C>T	ENSP00000359801:p.Glu2458Lys	Somatic	65	4.29	3		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	56588852	43	37.14	26	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	HMMPfam_Plectin,HMMSmart_PLEC,HMMPfam_Spectrin,HMMSmart_SPEC,superfamily_Spectrin,superfamily_SSF75399	p.E2458K	ENST00000370765.6	37	c.7372	CCDS4959.1	6	.	.	.	.	.	.	.	.	.	.	C	9.922	1.212466	0.22289	.	.	ENSG00000151914	ENST00000370765	T	0.70282	-0.47	5.87	5.0	0.66597	.	.	.	.	.	T	0.75184	0.3815	.	.	.	0.09310	N	0.999993	D	0.67145	0.996	D	0.77557	0.99	T	0.73956	-0.3819	7	0.22109	T	0.4	.	15.0357	0.71744	0.0:0.9319:0.0:0.0681	.	2458	Q03001-3	.	K	2458	ENSP00000359801:E2458K	ENSP00000359801:E2458K	E	-	1	0	DST	56588852	1.000000	0.71417	1.000000	0.80357	0.630000	0.37929	4.590000	0.61013	1.497000	0.48584	-0.145000	0.13849	GAA	-	HMMSmart_PLEC,superfamily_SSF75399		0.483	DST-010	KNOWN	basic|CCDS	protein_coding	DST	protein_coding	OTTHUMT00000041027.2	C	NM_001723		56588852	-1	no_errors	NM_001723.1	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
RMDN1	51115	genome.wustl.edu	37	8	87519294	87519294	+	Silent	SNP	A	A	G			TCGA-AB-2923-03A-01W-0745-08	TCGA-AB-2923-11A-01W-0745-08	A	A	A	G	A	A	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	26973c94-f1c1-46a1-b753-4f561fd7d451	872c532a-f3d4-4cb5-8ebd-09ff6c9d5cdd	g.chr8:87519294A>G	ENST00000406452.3	-	2	336	c.177T>C	c.(175-177)gcT>gcC	p.A59A	CPNE3_ENST00000198765.4_Intron|RMDN1_ENST00000518772.1_5'UTR|RMDN1_ENST00000430676.2_Silent_p.A59A|RMDN1_ENST00000523911.1_Silent_p.A15A|RMDN1_ENST00000519966.1_Silent_p.A59A	NM_016033.2	NP_057117.2	Q96DB5	RMD1_HUMAN	regulator of microtubule dynamics 1	59						microtubule (GO:0005874)|mitochondrion (GO:0005739)											AATACGACAAAGCTGAGAGTA	0.373																																						dbGAP											0			8											129.0	140.0	136.0					8																	87519294		2203	4300	6503	87588410	SO:0001819	synonymous_variant	0			AK000672	CCDS34918.1, CCDS69509.1, CCDS69510.1	8q21.3	2013-01-11	2013-01-11	2013-01-11	ENSG00000176623	ENSG00000176623			24285	protein-coding gene	gene with protein product		611871	"""family with sequence similarity 82, member B"""	FAM82B		10810093	Standard	NM_016033		Approved	CGI-90, FLJ20665, RMD1	uc003ydu.3	Q96DB5	OTTHUMG00000163692	ENST00000406452.3:c.177T>C	8.37:g.87519294A>G		Somatic	87	1.14	1		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	87588410	43	51.69	46	A9UMZ8|B4DNF5|B4DZW6|B5MC61|C9JSC6|E7EVI2|Q9Y398	Silent	SNP	superfamily_Prenyl_trans	p.A59	ENST00000406452.3	37	c.177	CCDS34918.1	8	.	.	.	.	.	.	.	.	.	.	A	8.870	0.948993	0.18356	.	.	ENSG00000176623	ENST00000519789	.	.	.	4.39	-3.29	0.05017	.	.	.	.	.	T	0.40423	0.1116	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.33548	-0.9864	4	.	.	.	-1.0825	3.4461	0.07481	0.4459:0.0:0.2292:0.3249	.	.	.	.	L	5	.	.	F	-	1	0	FAM82B	87588410	0.997000	0.39634	0.987000	0.45799	0.786000	0.44442	0.411000	0.21115	-0.447000	0.07138	-0.924000	0.02725	TTT	-	NULL		0.373	RMDN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM82B	protein_coding	OTTHUMT00000374770.2	A	NM_016033		87588410	-1	no_errors	NM_016033.2	genbank	human	validated	54_36p	silent	SNP	0.989	G
PKD2L1	9033	genome.wustl.edu	37	10	102048168	102048168	+	Silent	SNP	C	C	T			TCGA-AB-2923-03A-01W-0745-08	TCGA-AB-2923-11A-01W-0745-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	26973c94-f1c1-46a1-b753-4f561fd7d451	872c532a-f3d4-4cb5-8ebd-09ff6c9d5cdd	g.chr10:102048168C>T	ENST00000318222.3	-	16	2785	c.2403G>A	c.(2401-2403)acG>acA	p.T801T	PKD2L1_ENST00000338519.3_Silent_p.T726T|BLOC1S2_ENST00000370372.2_5'Flank|BLOC1S2_ENST00000441611.1_5'Flank|PKD2L1_ENST00000353274.3_3'UTR|BLOC1S2_ENST00000361832.2_5'Flank	NM_001253837.1|NM_016112.2	NP_001240766.1|NP_057196.2	Q9P0L9	PK2L1_HUMAN	polycystic kidney disease 2-like 1	801					cation transport (GO:0006812)|cellular response to acidic pH (GO:0071468)|detection of chemical stimulus involved in sensory perception of sour taste (GO:0001581)|detection of mechanical stimulus (GO:0050982)|potassium ion transmembrane transport (GO:0071805)|protein homotrimerization (GO:0070207)|sensory perception of sour taste (GO:0050915)|smoothened signaling pathway (GO:0007224)|sodium ion transmembrane transport (GO:0035725)	calcium channel complex (GO:0034704)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	alpha-actinin binding (GO:0051393)|calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-activated potassium channel activity (GO:0015269)|cation channel activity (GO:0005261)|cytoskeletal protein binding (GO:0008092)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|sodium channel activity (GO:0005272)|sour taste receptor activity (GO:0033040)			NS(2)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(12)|ovary(4)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	43		Colorectal(252;0.117)		Epithelial(162;6.15e-10)|all cancers(201;5.14e-08)		TCCTCTGCAACGTTGGAATCT	0.522																																						dbGAP											0			10											161.0	168.0	166.0					10																	102048168		2203	4300	6503	102038158	SO:0001819	synonymous_variant	0			AF094827	CCDS7492.1	10q24.31	2011-12-16			ENSG00000107593	ENSG00000107593		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9011	protein-coding gene	gene with protein product	"""transient receptor potential cation channel, subfamily P, member 3"""	604532		PKD2L, PKDL		9878261, 9748274	Standard	NM_016112		Approved	PCL, TRPP3	uc001kqx.1	Q9P0L9	OTTHUMG00000018910	ENST00000318222.3:c.2403G>A	10.37:g.102048168C>T		Somatic	79	3.66	3		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	102038158	50	45.05	41	O75972|Q5W039|Q9UP35|Q9UPA2	Silent	SNP	HMMPfam_PKD_channel,superfamily_Voltage-gated potassium channels	p.T801	ENST00000318222.3	37	c.2403	CCDS7492.1	10	.	.	.	.	.	.	.	.	.	.	C	2.519	-0.311260	0.05422	.	.	ENSG00000107593	ENST00000465680	.	.	.	3.43	0.149	0.14863	.	.	.	.	.	T	0.24812	0.0602	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.26360	-1.0105	4	.	.	.	12.8317	5.4773	0.16702	0.0:0.5303:0.0:0.4697	.	.	.	.	I	58	.	.	V	-	1	0	PKD2L1	102038158	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.072000	0.14617	0.045000	0.15804	0.555000	0.69702	GTT	-	NULL		0.522	PKD2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKD2L1	protein_coding	OTTHUMT00000049863.2	C	NM_016112		102038158	-1	no_errors	NM_016112.2	genbank	human	reviewed	54_36p	silent	SNP	0.000	T
OR5W2	390148	genome.wustl.edu	37	11	55681628	55681628	+	Missense_Mutation	SNP	A	A	T			TCGA-AB-2923-03A-01W-0745-08	TCGA-AB-2923-11A-01W-0745-08	A	A	A	T	A	A	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	26973c94-f1c1-46a1-b753-4f561fd7d451	872c532a-f3d4-4cb5-8ebd-09ff6c9d5cdd	g.chr11:55681628A>T	ENST00000344514.1	-	1	430	c.431T>A	c.(430-432)cTc>cAc	p.L144H		NM_001001960.1	NP_001001960.1	Q8NH69	OR5W2_HUMAN	olfactory receptor, family 5, subfamily W, member 2	144						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(28)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						CCCAGTCAAGAGTAGATAGCA	0.463																																					Melanoma(48;171 1190 15239 43886 49348)	dbGAP											0			11											68.0	62.0	64.0					11																	55681628		2201	4296	6497	55438204	SO:0001583	missense	0			BK004398	CCDS31513.1	11q11	2012-08-09		2004-03-10	ENSG00000187612	ENSG00000187612		"""GPCR / Class A : Olfactory receptors"""	15299	protein-coding gene	gene with protein product				OR5W2P, OR5W3P			Standard	NM_001001960		Approved		uc010rir.2	Q8NH69	OTTHUMG00000166818	ENST00000344514.1:c.431T>A	11.37:g.55681628A>T	ENSP00000342448:p.Leu144His	Somatic	100	3.85	4		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	55438204	42	53.85	49		Missense_Mutation	SNP	HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1,superfamily_SSF81321	p.L144H	ENST00000344514.1	37	c.431	CCDS31513.1	11	.	.	.	.	.	.	.	.	.	.	A	10.90	1.481271	0.26598	.	.	ENSG00000187612	ENST00000344514	T	0.45668	0.89	5.01	3.86	0.44501	GPCR, rhodopsin-like superfamily (1);	0.000000	0.28989	N	0.013487	T	0.76118	0.3943	H	0.98833	4.345	0.09310	N	1	D	0.76494	0.999	D	0.76575	0.988	T	0.72312	-0.4331	10	0.87932	D	0	.	10.1561	0.42823	0.8505:0.0:0.0:0.1495	.	144	Q8NH69	OR5W2_HUMAN	H	144	ENSP00000342448:L144H	ENSP00000342448:L144H	L	-	2	0	OR5W2	55438204	0.990000	0.36364	0.003000	0.11579	0.043000	0.13939	7.717000	0.84732	0.730000	0.32425	0.448000	0.29417	CTC	-	HMMPfam_7tm_1,superfamily_SSF81321		0.463	OR5W2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5W2	protein_coding	OTTHUMT00000391523.1	A	NM_001001960		55438204	-1	no_errors	NM_001001960.1	genbank	human	provisional	54_36p	missense	SNP	0.011	T
STRC	161497	genome.wustl.edu	37	15	43910179	43910179	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2923-03A-01W-0745-08	TCGA-AB-2923-11A-01W-0745-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	26973c94-f1c1-46a1-b753-4f561fd7d451	872c532a-f3d4-4cb5-8ebd-09ff6c9d5cdd	g.chr15:43910179G>A	ENST00000450892.2	-	2	517	c.440C>T	c.(439-441)gCc>gTc	p.A147V	STRC_ENST00000541030.1_5'UTR	NM_153700.2	NP_714544.1	Q7RTU9	STRC_HUMAN	stereocilin	147					auditory receptor cell stereocilium organization (GO:0060088)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)	kinocilium (GO:0060091)|stereocilium bundle tip (GO:0032426)				skin(4)	4		all_cancers(109;3.26e-15)|all_epithelial(112;1.48e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.56e-07)		AGGAACTAAGGCTCCCAGCAG	0.647																																						dbGAP											0			15											31.0	47.0	42.0					15																	43910179		2195	4295	6490	41697471	SO:0001583	missense	0			BK000138	CCDS10098.1	15q15.3	2010-02-26			ENSG00000242866	ENSG00000242866			16035	protein-coding gene	gene with protein product		606440		DFNB16		11687802, 9429146	Standard	NM_153700		Approved		uc001zsf.3	Q7RTU9	OTTHUMG00000059899	ENST00000450892.2:c.440C>T	15.37:g.43910179G>A	ENSP00000401513:p.Ala147Val	Somatic	61	0.00	0		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	41697471	45	23.73	14		Missense_Mutation	SNP	NULL	p.A147V	ENST00000450892.2	37	c.440	CCDS10098.1	15	.	.	.	.	.	.	.	.	.	.	G	13.99	2.402753	0.42613	.	.	ENSG00000242866	ENST00000450892;ENST00000299992;ENST00000456110;ENST00000432436	D	0.82526	-1.62	4.83	3.69	0.42338	.	0.297275	0.27043	N	0.021212	T	0.69324	0.3098	N	0.19112	0.55	0.80722	D	1	B;B	0.11235	0.004;0.001	B;B	0.09377	0.004;0.004	T	0.66791	-0.5834	10	0.48119	T	0.1	-0.1892	8.9681	0.35890	0.1205:0.0:0.8795:0.0	.	147;147	E9PBT5;Q7RTU9	.;STRC_HUMAN	V	147;147;147;87	ENSP00000401513:A147V	ENSP00000299992:A147V	A	-	2	0	STRC	41697471	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	1.859000	0.39418	2.244000	0.73946	0.632000	0.83419	GCC	-	NULL		0.647	STRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STRC	protein_coding	OTTHUMT00000133140.1	G	NM_153700		41697471	-1	no_errors	NM_153700.2	genbank	human	reviewed	54_36p	missense	SNP	0.996	A
PPL	5493	genome.wustl.edu	37	16	4935049	4935049	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2923-03A-01W-0745-08	TCGA-AB-2923-11A-01W-0745-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	26973c94-f1c1-46a1-b753-4f561fd7d451	872c532a-f3d4-4cb5-8ebd-09ff6c9d5cdd	g.chr16:4935049G>A	ENST00000345988.2	-	22	3696	c.3607C>T	c.(3607-3609)Cgg>Tgg	p.R1203W	PPL_ENST00000590782.2_Missense_Mutation_p.R1201W	NM_002705.4	NP_002696	O60437	PEPL_HUMAN	periplakin	1203					keratinization (GO:0031424)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			breast(6)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(12)|lung(12)|ovary(4)|prostate(5)|skin(3)|stomach(1)|urinary_tract(2)	62						TCGGCACCCCGGTACTTTCGC	0.632																																						dbGAP											0			16											55.0	52.0	53.0					16																	4935049		2197	4300	6497	4875050	SO:0001583	missense	0			AF013717	CCDS10526.1	16p13.3	2008-02-05			ENSG00000118898	ENSG00000118898			9273	protein-coding gene	gene with protein product		602871				9570964, 9521878	Standard	NM_002705		Approved		uc002cyd.1	O60437	OTTHUMG00000129528	ENST00000345988.2:c.3607C>T	16.37:g.4935049G>A	ENSP00000340510:p.Arg1203Trp	Somatic	42	2.33	1		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	4875050	12	42.86	9	O60314|O60454|Q14C98	Missense_Mutation	SNP	HMMPfam_Plectin,HMMSmart_SM00250,HMMSmart_SM00150,superfamily_Spectrin repeat,superfamily_Plakin repeat	p.R1203W	ENST00000345988.2	37	c.3607	CCDS10526.1	16	.	.	.	.	.	.	.	.	.	.	G	14.43	2.533946	0.45073	.	.	ENSG00000118898	ENST00000345988	T	0.52526	0.66	5.65	1.14	0.20703	.	0.133103	0.48286	D	0.000198	T	0.64249	0.2581	M	0.62723	1.935	0.42767	D	0.993829	D	0.89917	1.0	D	0.77004	0.989	T	0.67205	-0.5729	10	0.66056	D	0.02	.	15.9282	0.79635	0.0:0.0:0.3165:0.6835	.	1203	O60437	PEPL_HUMAN	W	1203	ENSP00000340510:R1203W	ENSP00000340510:R1203W	R	-	1	2	PPL	4875050	1.000000	0.71417	0.963000	0.40424	0.552000	0.35366	1.695000	0.37763	-0.033000	0.13736	0.561000	0.74099	CGG	-	NULL		0.632	PPL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPL	protein_coding	OTTHUMT00000251715.1	G	NM_002705		4875050	-1	no_errors	NM_002705.4	genbank	human	reviewed	54_36p	missense	SNP	0.992	A
TMEM104	54868	genome.wustl.edu	37	17	72791745	72791745	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AB-2923-03A-01W-0745-08	TCGA-AB-2923-11A-01W-0745-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	26973c94-f1c1-46a1-b753-4f561fd7d451	872c532a-f3d4-4cb5-8ebd-09ff6c9d5cdd	g.chr17:72791745C>T	ENST00000335464.5	+	8	772	c.610C>T	c.(610-612)Cga>Tga	p.R204*	TMEM104_ENST00000582773.1_Nonsense_Mutation_p.R204*|TMEM104_ENST00000417024.2_Nonsense_Mutation_p.R217*|TMEM104_ENST00000582330.1_Nonsense_Mutation_p.R204*	NM_017728.3	NP_060198.3	Q8NE00	TM104_HUMAN	transmembrane protein 104	204						integral component of membrane (GO:0016021)				NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(5)|ovary(1)	19	all_lung(278;0.23)					GCCCCTGCGCCGAGTGGACGC	0.587																																						dbGAP											0			17											56.0	46.0	49.0					17																	72791745		2203	4300	6503	70303340	SO:0001587	stop_gained	0			AK074029	CCDS32723.1	17q25.1	2005-12-19				ENSG00000109066			25984	protein-coding gene	gene with protein product							Standard	NM_017728		Approved	FLJ20255, FLJ00021	uc002jls.4	Q8NE00		ENST00000335464.5:c.610C>T	17.37:g.72791745C>T	ENSP00000334849:p.Arg204*	Somatic	32	2.94	1		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	70303340	23	53.06	26	Q8TEU1|Q9NT56|Q9NXH1	Nonsense_Mutation	SNP	HMMPfam_Aa_trans	p.R204*	ENST00000335464.5	37	c.610	CCDS32723.1	17	.	.	.	.	.	.	.	.	.	.	C	25.9	4.682654	0.88542	.	.	ENSG00000109066	ENST00000335464;ENST00000417024	.	.	.	5.0	2.8	0.32819	.	0.108901	0.56097	D	0.000022	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.18276	T	0.48	-16.2745	12.9641	0.58473	0.4017:0.5983:0.0:0.0	.	.	.	.	X	204;217	.	ENSP00000334849:R204X	R	+	1	2	TMEM104	70303340	0.999000	0.42202	0.937000	0.37676	0.897000	0.52465	2.044000	0.41241	1.199000	0.43173	0.655000	0.94253	CGA	-	NULL		0.587	TMEM104-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM104	protein_coding	OTTHUMT00000444442.1	C	NM_017728		70303340	+1	no_errors	NM_017728.3	genbank	human	validated	54_36p	nonsense	SNP	0.969	T
ZNF420	147923	genome.wustl.edu	37	19	37618611	37618611	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AB-2923-03A-01W-0745-08	TCGA-AB-2923-11A-01W-0745-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	26973c94-f1c1-46a1-b753-4f561fd7d451	872c532a-f3d4-4cb5-8ebd-09ff6c9d5cdd	g.chr19:37618611C>T	ENST00000337995.3	+	5	933	c.718C>T	c.(718-720)Cga>Tga	p.R240*	ZNF585A_ENST00000588723.1_Intron|CTC-454I21.4_ENST00000587645.1_RNA|ZNF420_ENST00000304239.7_Nonsense_Mutation_p.R240*	NM_144689.3	NP_653290.2	Q8TAQ5	ZN420_HUMAN	zinc finger protein 420	240					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(2)|large_intestine(9)|lung(10)|prostate(1)|skin(3)	27			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			ACAACTTACCCGACATCAAAA	0.363																																						dbGAP											0			19											58.0	63.0	61.0					19																	37618611		2202	4300	6502	42310451	SO:0001587	stop_gained	0			AK056695	CCDS12498.1	19q13.12	2013-01-08			ENSG00000197050	ENSG00000197050		"""Zinc fingers, C2H2-type"", ""-"""	20649	protein-coding gene	gene with protein product							Standard	NM_144689		Approved	FLJ32191	uc002ofl.3	Q8TAQ5	OTTHUMG00000048168	ENST00000337995.3:c.718C>T	19.37:g.37618611C>T	ENSP00000338770:p.Arg240*	Somatic	73	3.95	3		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	42310451	32	52.94	36	B2RDY6|Q96ML5	Nonsense_Mutation	SNP	HMMPfam_KRAB,HMMSmart_KRAB,superfamily_Krueppel-associated_box,HMMPfam_zf-C2H2,PatternScan_ZINC_FINGER_C2H2_1,HMMSmart_ZnF_C2H2,superfamily_SSF57667	p.R240*	ENST00000337995.3	37	c.718	CCDS12498.1	19	.	.	.	.	.	.	.	.	.	.	C	23.1	4.370297	0.82573	.	.	ENSG00000197050	ENST00000304239;ENST00000337995	.	.	.	3.98	2.87	0.33458	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.13108	T	0.6	.	6.9974	0.24791	0.1929:0.6193:0.1878:0.0	.	.	.	.	X	240	.	ENSP00000306102:R240X	R	+	1	2	ZNF420	42310451	0.000000	0.05858	0.825000	0.32803	0.959000	0.62525	-3.290000	0.00524	2.046000	0.60703	0.655000	0.94253	CGA	-	HMMPfam_zf-C2H2,PatternScan_ZINC_FINGER_C2H2_1,HMMSmart_ZnF_C2H2,superfamily_SSF57667		0.363	ZNF420-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF420	protein_coding	OTTHUMT00000109587.3	C	NM_144689		42310451	+1	no_errors	NM_144689.3	genbank	human	provisional	54_36p	nonsense	SNP	0.002	T
FCGBP	8857	genome.wustl.edu	37	19	40384036	40384036	+	Missense_Mutation	SNP	C	C	T			TCGA-AB-2923-03A-01W-0745-08	TCGA-AB-2923-11A-01W-0745-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	26973c94-f1c1-46a1-b753-4f561fd7d451	872c532a-f3d4-4cb5-8ebd-09ff6c9d5cdd	g.chr19:40384036C>T	ENST00000221347.6	-	21	9581	c.9574G>A	c.(9574-9576)Gcg>Acg	p.A3192T		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	3192	TIL 7.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			ACGAAACCCGCGTCGCACTGG	0.667																																						dbGAP											0			19											4.0	4.0	4.0					19																	40384036		1276	2904	4180	45075876	SO:0001583	missense	0			D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.9574G>A	19.37:g.40384036C>T	ENSP00000221347:p.Ala3192Thr	Somatic	29	3.33	1		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	45075876	28	37.78	17	O95784	Missense_Mutation	SNP	HMMSmart_VWC,HMMPfam_VWD,HMMSmart_VWD,superfamily_Cysrich_TIL,HMMPfam_TIL_assoc,HMMSmart_FOLN,HMMPfam_C8,HMMPfam_TIL	p.A3192T	ENST00000221347.6	37	c.9574	CCDS12546.1	19	.	.	.	.	.	.	.	.	.	.	C	0.357	-0.941342	0.02322	.	.	ENSG00000090920	ENST00000221347	T	0.29655	1.56	3.48	-6.96	0.01622	Protease inhibitor I8, cysteine-rich trypsin inhibitor-like (2);	.	.	.	.	T	0.12390	0.0301	L	0.28556	0.865	0.09310	N	1	P	0.42584	0.784	B	0.34452	0.183	T	0.07328	-1.0778	9	0.15499	T	0.54	.	3.6174	0.08082	0.1167:0.3315:0.384:0.1677	.	3192	Q9Y6R7	FCGBP_HUMAN	T	3192	ENSP00000221347:A3192T	ENSP00000221347:A3192T	A	-	1	0	FCGBP	45075876	0.000000	0.05858	0.000000	0.03702	0.049000	0.14656	-4.336000	0.00251	-2.714000	0.00392	-0.693000	0.03709	GCG	-	superfamily_Cysrich_TIL,HMMPfam_TIL		0.667	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCGBP	protein_coding	OTTHUMT00000462507.1	C	NM_003890		45075876	-1	no_errors	NM_003890.2	genbank	human	validated	54_36p	missense	SNP	0.014	T
IGLV3-22	28795	genome.wustl.edu	37	22	23047140	23047140	+	RNA	SNP	C	C	G	rs386819979		TCGA-AB-2923-03A-01W-0745-08	TCGA-AB-2923-11A-01W-0745-08	C	C	C	G	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	26973c94-f1c1-46a1-b753-4f561fd7d451	872c532a-f3d4-4cb5-8ebd-09ff6c9d5cdd	g.chr22:23047140C>G	ENST00000390307.2	+	0	242									immunoglobulin lambda variable 3-22 (gene/pseudogene)																		GAAGCCAGGCCAGGCCCCTGA	0.562																																						dbGAP											0			22											56.0	66.0	63.0					22																	23047140		1910	4100	6010	21377140			0			Z73666		22q11.2	2012-02-08	2008-09-12		ENSG00000211661	ENSG00000211661		"""Immunoglobulins / IGL locus"""	5906	other	immunoglobulin gene			"""immunoglobulin lambda variable 3-22"""				Standard	NG_000002		Approved				OTTHUMG00000151229		22.37:g.23047140C>G		Somatic	50	1.85	1		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	21377140	37	42.19	27		Missense_Mutation	SNP	HMMSmart_SM00406,HMMSmart_SM00409,HMMPfam_V-set,superfamily_Immunoglobulin	p.Q60E	ENST00000390307.2	37	c.178		22																																																																																			-	HMMSmart_SM00406,HMMSmart_SM00409,HMMPfam_V-set,superfamily_Immunoglobulin		0.562	IGLV3-22-001	KNOWN	not_best_in_genome_evidence|mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IGLV3-22	IG_V_gene	OTTHUMT00000321833.2	C	NG_000002		21377140	+1	no_stop_codon	ENST00000390307	ensembl	human	known	54_36p	missense	SNP	0.659	G
TET2	54790	genome.wustl.edu	37	4	106157969	106157970	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AB-2923-03A-01W-0745-08	TCGA-AB-2923-11A-01W-0745-08	-	-	-	A	-	-	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	26973c94-f1c1-46a1-b753-4f561fd7d451	872c532a-f3d4-4cb5-8ebd-09ff6c9d5cdd	g.chr4:106157969_106157970insA	ENST00000540549.1	+	3	3730_3731	c.2870_2871insA	c.(2869-2874)ttacagfs	p.Q958fs	TET2_ENST00000380013.4_Frame_Shift_Ins_p.Q958fs|TET2_ENST00000545826.1_Frame_Shift_Ins_p.Q958fs|TET2_ENST00000413648.2_Frame_Shift_Ins_p.Q958fs|TET2_ENST00000513237.1_Frame_Shift_Ins_p.Q979fs|TET2_ENST00000305737.2_Frame_Shift_Ins_p.Q958fs|TET2_ENST00000394764.1_Frame_Shift_Ins_p.Q958fs			Q6N021	TET2_HUMAN	tet methylcytosine dioxygenase 2	958	Gln-rich.				5-methylcytosine catabolic process (GO:0006211)|cell cycle (GO:0007049)|DNA demethylation (GO:0080111)|histone H3-K4 trimethylation (GO:0080182)|kidney development (GO:0001822)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|protein O-linked glycosylation (GO:0006493)		DNA binding (GO:0003677)|ferrous iron binding (GO:0008198)|methylcytosine dioxygenase activity (GO:0070579)|zinc ion binding (GO:0008270)	p.L957*(1)		NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1272)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	1314		Myeloproliferative disorder(5;0.0393)		OV - Ovarian serous cystadenocarcinoma(123;7.18e-08)		TGGCATCTCTTACAGAAGCAAG	0.505			"""Mis N, F"""		MDS																																	dbGAP		Rec	yes		4	4q24	54790	tet oncogene family member 2		L	1	Substitution - Nonsense(1)	haematopoietic_and_lymphoid_tissue(1)	4																																								106377419	SO:0001589	frameshift_variant	0			AB046766	CCDS3666.1, CCDS47120.1	4q24	2014-09-17	2011-09-30	2008-03-12	ENSG00000168769	ENSG00000168769			25941	protein-coding gene	gene with protein product		612839	"""KIAA1546"", ""tet oncogene family member 2"""	KIAA1546		10997877, 12646957	Standard	NM_017628		Approved	FLJ20032	uc003hxk.3	Q6N021	OTTHUMG00000131213	ENST00000540549.1:c.2871dupA	4.37:g.106157970_106157970dupA	ENSP00000442788:p.Gln958fs	Somatic	71	1.39	1		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	106377418	31	52.31	34	B5MDU0|Q2TB88|Q3LIB8|Q96JX5|Q9HCM6|Q9NXW0	Frame_Shift_Ins	INS	NULL	p.Q958fs	ENST00000540549.1	37	c.2870_2871	CCDS47120.1	4																																																																																			-	NULL		0.505	TET2-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	TET2	protein_coding	OTTHUMT00000253952.2	-	NM_017628		106377419	+1	no_errors	NM_017628.1	genbank	human	validated	54_36p	frame_shift_ins	INS	1.000:0.960	A
MBOAT1	154141	genome.wustl.edu	37	6	20102621	20102621	+	Frame_Shift_Del	DEL	T	T	-			TCGA-AB-2923-03A-01W-0745-08	TCGA-AB-2923-11A-01W-0745-08	T	T	T	-	T	T	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	26973c94-f1c1-46a1-b753-4f561fd7d451	872c532a-f3d4-4cb5-8ebd-09ff6c9d5cdd	g.chr6:20102621delT	ENST00000324607.7	-	13	1548	c.1384delA	c.(1384-1386)atcfs	p.I463fs	MBOAT1_ENST00000541730.1_Frame_Shift_Del_p.I314fs	NM_001080480.1	NP_001073949.1	Q6ZNC8	MBOA1_HUMAN	membrane bound O-acyltransferase domain containing 1	463					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	transferase activity, transferring acyl groups other than amino-acyl groups (GO:0016747)			breast(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(5)	20	all_cancers(95;0.244)|Breast(50;0.0379)|Ovarian(93;0.0473)|all_epithelial(95;0.109)		OV - Ovarian serous cystadenocarcinoma(7;0.00392)|all cancers(50;0.0117)|Epithelial(50;0.0454)			AGACTTATGATGTGCAAATAA	0.343																																						dbGAP											0			6											84.0	85.0	85.0					6																	20102621		2203	4300	6503	20210600	SO:0001589	frameshift_variant	0			AK093994	CCDS34346.1	6p22.3	2013-10-11	2006-06-29	2006-06-29	ENSG00000172197	ENSG00000172197			21579	protein-coding gene	gene with protein product	"""lysophosphatidylethanolamine acyltransferase 1"""	611732	"""O-acyltransferase (membrane bound) domain containing 1"""	OACT1		18287005	Standard	NM_001080480		Approved	MGC44669, dJ434O11.1, LPEAT1	uc003ncx.2	Q6ZNC8	OTTHUMG00000014334	ENST00000324607.7:c.1384delA	6.37:g.20102621delT	ENSP00000324944:p.Ile463fs	Somatic	80	4.71	4		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	20210600	38	42.47	31	A9EDQ5|B4DL59|B4E3J4|Q86XC2|Q8N9R5	Frame_Shift_Del	DEL	HMMPfam_MBOAT	p.I462fs	ENST00000324607.7	37	c.1384	CCDS34346.1	6																																																																																			-	NULL		0.343	MBOAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBOAT1	protein_coding	OTTHUMT00000039980.1	T			20210600	-1	no_errors	NM_001080480.1	genbank	human	provisional	54_36p	frame_shift_del	DEL	0.993	-
