#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NormalRefReads_WU	i_NormalVAF_WU	i_NormalVarReads_WU	i_ORegAnno_bin	i_RNARefReads_WU	i_RNAVAF_WU	i_RNAVarReads_WU	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TumorRefReads_WU	i_TumorVAF_WU	i_TumorVarReads_WU	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
SLC45A2	51151	genome.wustl.edu	37	5	33984527	33984527	+	Silent	SNP	C	C	T	rs202111567		TCGA-AB-2924-03A-01W-0745-08	TCGA-AB-2924-11A-01W-0745-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	16d51cf8-f922-4c2b-ac3f-744064cb04f4	207d9855-296b-4155-9e3a-6011d6102505	g.chr5:33984527C>T	ENST00000296589.4	-	1	308	c.162G>A	c.(160-162)gcG>gcA	p.A54A	SLC45A2_ENST00000509381.1_Silent_p.A54A|SLC45A2_ENST00000382102.3_Silent_p.A54A|SLC45A2_ENST00000345083.5_Silent_p.A54A|SLC45A2_ENST00000342059.3_Silent_p.A54A	NM_016180.3	NP_057264	Q9UMX9	S45A2_HUMAN	solute carrier family 45, member 2	54					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)				breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(25)|ovary(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	48						GGGTCACATACGCTGCCTCCA	0.592																																					Ovarian(31;380 859 8490 22203 49048)	dbGAP											0			5											64.0	54.0	57.0					5																	33984527		2203	4300	6503	34020284	SO:0001819	synonymous_variant	0			AF172849	CCDS3901.1, CCDS43308.1, CCDS75232.1	5p13.3	2013-08-06	2005-10-06	2005-10-06	ENSG00000164175	ENSG00000164175		"""Solute carriers"""	16472	protein-coding gene	gene with protein product		606202	"""membrane associated transporter"""	MATP		11916009, 11574907	Standard	NM_001012509		Approved	AIM-1, OCA4	uc003jid.3	Q9UMX9	OTTHUMG00000090719	ENST00000296589.4:c.162G>A	5.37:g.33984527C>T		Somatic	139	7.28	11		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	34020284	39	45.95	34	Q6P2P0|Q9BTM3	Silent	SNP	superfamily_MFS general substrate transporter	p.A54	ENST00000296589.4	37	c.162	CCDS3901.1	5																																																																																			-	superfamily_MFS general substrate transporter		0.592	SLC45A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC45A2	protein_coding	OTTHUMT00000207443.2	C	NM_016180		34020284	-1	no_errors	NM_016180.2	genbank	human	reviewed	54_36p	silent	SNP	0.858	T
PPAP2A	8611	genome.wustl.edu	37	5	54721756	54721756	+	Missense_Mutation	SNP	A	A	C			TCGA-AB-2924-03A-01W-0745-08	TCGA-AB-2924-11A-01W-0745-08	A	A	A	C	A	A	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	16d51cf8-f922-4c2b-ac3f-744064cb04f4	207d9855-296b-4155-9e3a-6011d6102505	g.chr5:54721756A>C	ENST00000307259.8	-	5	1081	c.661T>G	c.(661-663)Tat>Gat	p.Y221D	PPAP2A_ENST00000264775.5_Missense_Mutation_p.Y222D	NM_003711.2	NP_003702.2	O14494	LPP1_HUMAN	phosphatidic acid phosphatase type 2A	221					androgen receptor signaling pathway (GO:0030521)|germ cell migration (GO:0008354)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|lipid metabolic process (GO:0006629)|negative regulation of cell proliferation (GO:0008285)|phospholipid dephosphorylation (GO:0046839)|protein dephosphorylation (GO:0006470)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of lipid metabolic process (GO:0019216)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	phosphatidate phosphatase activity (GO:0008195)			breast(2)|endometrium(1)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)	9		Lung NSC(810;4.08e-05)|Prostate(74;0.0181)|Breast(144;0.0544)				TGGTGTTTATAATCAGAAACT	0.458																																						dbGAP											0			5											108.0	108.0	108.0					5																	54721756		2203	4300	6503	54757513	SO:0001583	missense	0			AB000888	CCDS34159.1, CCDS34160.1	5q11	2009-05-27			ENSG00000067113	ENSG00000067113	3.1.3.4		9228	protein-coding gene	gene with protein product		607124				9305923	Standard	NM_003711		Approved	PAP-2a, LPP1	uc003jpz.4	O14494	OTTHUMG00000162240	ENST00000307259.8:c.661T>G	5.37:g.54721756A>C	ENSP00000302229:p.Tyr221Asp	Somatic	260	3.33	9		2	75.00	6	WXS	Illumina HiSeq	Phase_IV	54757513	61	51.91	68	B7ZKN8|G3XA95|O60457|O60463|Q17RZ4	Missense_Mutation	SNP	HMMPfam_PAP2,HMMSmart_SM00014,superfamily_Acid phosphatase/Vanadium-dependent haloperoxidase	p.Y222D	ENST00000307259.8	37	c.664	CCDS34159.1	5	.	.	.	.	.	.	.	.	.	.	A	23.2	4.387647	0.82902	.	.	ENSG00000067113	ENST00000264775;ENST00000307259	T;T	0.74632	-0.86;-0.86	5.46	5.46	0.80206	Phosphatidic acid phosphatase/chloroperoxidase, N-terminal (1);	0.063178	0.64402	D	0.000003	D	0.87497	0.6192	M	0.85542	2.76	0.80722	D	1	D;D	0.89917	0.996;1.0	D;D	0.97110	0.979;1.0	D	0.89459	0.3735	10	0.72032	D	0.01	-15.6808	15.8331	0.78773	1.0:0.0:0.0:0.0	.	221;222	O14494;G3XA95	LPP1_HUMAN;.	D	222;221	ENSP00000264775:Y222D;ENSP00000302229:Y221D	ENSP00000264775:Y222D	Y	-	1	0	PPAP2A	54757513	1.000000	0.71417	0.996000	0.52242	0.817000	0.46193	8.910000	0.92685	2.192000	0.70111	0.460000	0.39030	TAT	-	HMMPfam_PAP2,HMMSmart_SM00014,superfamily_Acid phosphatase/Vanadium-dependent haloperoxidase		0.458	PPAP2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PPAP2A	protein_coding	OTTHUMT00000368073.1	A			54757513	-1	no_errors	NM_176895.2	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
DMRT3	58524	genome.wustl.edu	37	9	990602	990602	+	Missense_Mutation	SNP	C	C	G			TCGA-AB-2924-03A-01W-0745-08	TCGA-AB-2924-11A-01W-0745-08	C	C	C	G	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	16d51cf8-f922-4c2b-ac3f-744064cb04f4	207d9855-296b-4155-9e3a-6011d6102505	g.chr9:990602C>G	ENST00000190165.2	+	2	1054	c.1016C>G	c.(1015-1017)aCg>aGg	p.T339R		NM_021240.2	NP_067063.1	Q9NQL9	DMRT3_HUMAN	doublesex and mab-3 related transcription factor 3	339					adult walking behavior (GO:0007628)|male sex differentiation (GO:0046661)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|sex differentiation (GO:0007548)|transcription, DNA-templated (GO:0006351)|transmission of nerve impulse (GO:0019226)|ventral spinal cord interneuron specification (GO:0021521)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|large_intestine(5)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	26		all_lung(10;1.39e-08)|Lung NSC(10;1.42e-08)		Lung(218;0.0196)		GTCCCAGACACGTTGAGGTTT	0.592																																						dbGAP											0			9											108.0	100.0	103.0					9																	990602		2203	4300	6503	980602	SO:0001583	missense	0			AJ301581	CCDS6443.1	9p24.3	2008-07-21	2001-12-17	2001-12-07	ENSG00000064218	ENSG00000064218			13909	protein-coding gene	gene with protein product	"""testis-specific protein"""	614754	"""DMRT-like family A3"""	DMRTA3		11543627, 10729223	Standard	NM_021240		Approved		uc003zgw.2	Q9NQL9	OTTHUMG00000019436	ENST00000190165.2:c.1016C>G	9.37:g.990602C>G	ENSP00000190165:p.Thr339Arg	Somatic	130	5.80	8		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	980602	21	32.26	10	Q7LA03|Q7LCH8|Q96SC7|Q9NRQ9	Missense_Mutation	SNP	HMMPfam_DM,HMMSmart_DM,PatternScan_DM_1,superfamily_DM_DNA_bd,HMMPfam_DMA	p.T339R	ENST00000190165.2	37	c.1016	CCDS6443.1	9	.	.	.	.	.	.	.	.	.	.	C	16.83	3.232325	0.58777	.	.	ENSG00000064218	ENST00000190165	T	0.26373	1.74	4.95	4.95	0.65309	.	0.290155	0.33496	N	0.004856	T	0.36853	0.0982	L	0.29908	0.895	0.53688	D	0.999976	D	0.76494	0.999	D	0.63381	0.914	T	0.05767	-1.0865	10	0.27785	T	0.31	-31.3767	18.2198	0.89898	0.0:1.0:0.0:0.0	.	339	Q9NQL9	DMRT3_HUMAN	R	339	ENSP00000190165:T339R	ENSP00000190165:T339R	T	+	2	0	DMRT3	980602	1.000000	0.71417	0.934000	0.37439	0.794000	0.44872	7.095000	0.76952	2.308000	0.77769	0.561000	0.74099	ACG	-	NULL		0.592	DMRT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMRT3	protein_coding	OTTHUMT00000051490.1	C	NM_021240		980602	+1	no_errors	NM_021240.2	genbank	human	validated	54_36p	missense	SNP	0.998	G
FLT3	2322	genome.wustl.edu	37	13	28592642	28592642	+	Missense_Mutation	SNP	C	C	A	rs121913486|rs121913488		TCGA-AB-2924-03A-01W-0745-08	TCGA-AB-2924-11A-01W-0745-08	C	C	C	A	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	16d51cf8-f922-4c2b-ac3f-744064cb04f4	207d9855-296b-4155-9e3a-6011d6102505	g.chr13:28592642C>A	ENST00000241453.7	-	20	2584	c.2503G>T	c.(2503-2505)Gat>Tat	p.D835Y	FLT3_ENST00000537084.1_Intron|FLT3_ENST00000380982.4_Missense_Mutation_p.D835Y	NM_004119.2	NP_004110.2	P36888	FLT3_HUMAN	fms-related tyrosine kinase 3	835	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		D -> E (in acute lymphoblastic leukemia patients and in acute myelogenous leukemia patients; somatic mutation; constitutively activated). {ECO:0000269|PubMed:11290608, ECO:0000269|PubMed:14504097}.|D -> H (in acute lymphoblastic leukemia patients and in acute myelogenous leukemia patients; somatic mutation; constitutively activated). {ECO:0000269|PubMed:11290608, ECO:0000269|PubMed:11442493, ECO:0000269|PubMed:14504097}.|D -> N (in acute lymphoblastic leukemia patients and in acute myelogenous leukemia patients; somatic mutation; constitutively activated). {ECO:0000269|PubMed:11290608}.|D -> V (in acute lymphoblastic leukemia patients and in acute myelogenous leukemia patients; somatic mutation; constitutively activated). {ECO:0000269|PubMed:11290608}.|D -> Y (in acute lymphoblastic leukemia patients and in acute myelogenous leukemia patients; somatic mutation; constitutively activated). {ECO:0000269|PubMed:11290608, ECO:0000269|PubMed:11442493, ECO:0000269|PubMed:14504097}.		B cell differentiation (GO:0030183)|cellular response to cytokine stimulus (GO:0071345)|common myeloid progenitor cell proliferation (GO:0035726)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell differentiation (GO:0097028)|hemopoiesis (GO:0030097)|leukocyte homeostasis (GO:0001776)|lymphocyte proliferation (GO:0046651)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)|pro-B cell differentiation (GO:0002328)|pro-T cell differentiation (GO:0002572)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor signaling pathway (GO:0038084)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|cytokine receptor activity (GO:0004896)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)	p.D835Y(190)|p.D835H(30)|p.?(23)|p.D835N(6)|p.D835del(1)|p.R834_D835del(1)|p.D835F(1)		NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(12329)|kidney(2)|large_intestine(8)|lung(30)|ovary(4)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	12390	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0156)|Ovarian(182;0.0392)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.00154)|all cancers(112;0.00459)|GBM - Glioblastoma multiforme(144;0.00562)|Epithelial(112;0.0959)|Lung(94;0.212)	Ponatinib(DB08901)|Sorafenib(DB00398)|Sunitinib(DB01268)	CTCATGATATCTCGAGCCAAT	0.453			"""Mis, O"""		"""AML, ALL"""																																	dbGAP		Dom	yes		13	13q12	2322	fms-related tyrosine kinase 3		L	252	Substitution - Missense(227)|Unknown(23)|Deletion - In frame(2)	haematopoietic_and_lymphoid_tissue(252)	13											187.0	141.0	156.0					13																	28592642		2203	4300	6503	27490642	SO:0001583	missense	0			U02687	CCDS31953.1	13q12	2014-09-17			ENSG00000122025	ENSG00000122025	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3765	protein-coding gene	gene with protein product		136351				8394751	Standard	NM_004119		Approved	STK1, FLK2, CD135	uc001urw.3	P36888	OTTHUMG00000016646	ENST00000241453.7:c.2503G>T	13.37:g.28592642C>A	ENSP00000241453:p.Asp835Tyr	Somatic	96	13.51	15		311	44.46	249	WXS	Illumina HiSeq	Phase_IV	27490642	34	38.60	22	A0AVG9|B7ZLT7|B7ZLT8|F5H0A0|Q13414	Missense_Mutation	SNP	HMMPfam_Pkinase_Tyr,HMMSmart_TyrKc,PatternScan_RECEPTOR_TYR_KIN_III,PatternScan_PROTEIN_KINASE_TYR,superfamily_Kinase_like,HMMPfam_ig,PatternScan_PROTEIN_KINASE_ATP,superfamily_SSF48726	p.D835Y	ENST00000241453.7	37	c.2503	CCDS31953.1	13	.	.	.	.	.	.	.	.	.	.	C	28.8	4.949190	0.92660	.	.	ENSG00000122025	ENST00000241453;ENST00000380982	D;D	0.83755	-1.76;-1.76	5.84	5.84	0.93424	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.074843	0.56097	D	0.000030	D	0.87981	0.6315	L	0.34521	1.04	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.88564	0.3125	10	0.87932	D	0	.	20.221	0.98325	0.0:1.0:0.0:0.0	.	835	P36888	FLT3_HUMAN	Y	835	ENSP00000241453:D835Y;ENSP00000370369:D835Y	ENSP00000241453:D835Y	D	-	1	0	FLT3	27490642	1.000000	0.71417	0.960000	0.40013	0.940000	0.58332	7.815000	0.86186	2.792000	0.96026	0.556000	0.70494	GAT	-	HMMPfam_Pkinase_Tyr,HMMSmart_TyrKc,superfamily_Kinase_like		0.453	FLT3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FLT3	protein_coding	OTTHUMT00000044319.2	C			27490642	-1	no_errors	NM_004119.2	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
DIO2	1734	genome.wustl.edu	37	14	80669394	80669394	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AB-2924-03A-01W-0745-08	TCGA-AB-2924-11A-01W-0745-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	16d51cf8-f922-4c2b-ac3f-744064cb04f4	207d9855-296b-4155-9e3a-6011d6102505	g.chr14:80669394C>T	ENST00000557125.1	-	2	83	c.84G>A	c.(82-84)tgG>tgA	p.W28*	DIO2_ENST00000422005.3_3'UTR|DIO2_ENST00000557010.1_Missense_Mutation_p.A154T|DIO2_ENST00000438257.4_Missense_Mutation_p.A154T|DIO2_ENST00000555750.1_Missense_Mutation_p.A190T			Q92813	IOD2_HUMAN	deiodinase, iodothyronine, type II	0					cellular nitrogen compound metabolic process (GO:0034641)|hormone biosynthetic process (GO:0042446)|selenocysteine incorporation (GO:0001514)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)|thyroid hormone metabolic process (GO:0042403)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	selenium binding (GO:0008430)|thyroxine 5'-deiodinase activity (GO:0004800)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(14)|skin(1)|stomach(1)	25				BRCA - Breast invasive adenocarcinoma(234;0.0281)		AGGAAGTCAGCCACTGAGGAG	0.547											OREG0022848	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0			14											56.0	61.0	59.0					14																	80669394		2104	4225	6329	79739147	SO:0001587	stop_gained	0			AF007144	CCDS45146.1, CCDS55934.1	14q24.2-q24.3	2014-05-02			ENSG00000211448	ENSG00000211448	1.97.1.10		2884	protein-coding gene	gene with protein product	"""thyroxine deiodinase, type II"", ""deiodonase-2"", ""deiodinase-2"""	601413				8755651, 10343107	Standard	NM_001007023		Approved	TXDI2, SelY	uc021rxb.1	Q92813	OTTHUMG00000171443	ENST00000557125.1:c.84G>A	14.37:g.80669394C>T	ENSP00000450547:p.Trp28*	Somatic	113	10.24	13	1200	1	0.00	0	WXS	Illumina HiSeq	Phase_IV	79739147	30	50.79	32	B9EGK0|G3V315|Q6B0A3|Q9HCP8|Q9P1W4|Q9UDZ1	Missense_Mutation	SNP	HMMPfam_T4_deiodinase	p.A190T	ENST00000557125.1	37	c.568		14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.68|18.68	3.675963|3.675963	0.67928|0.67928	.|.	.|.	ENSG00000211448|ENSG00000211448	ENST00000438257;ENST00000557010;ENST00000555750|ENST00000557125	T;T;T|.	0.37058|.	1.22;1.22;1.22|.	5.67|5.67	5.67|5.67	0.87782|0.87782	Thioredoxin-like fold (1);|.	0.000000|.	0.64402|.	D|.	0.000015|.	D|.	0.86887|.	0.6041|.	M|M	0.92077|0.92077	3.27|3.27	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.91635|.	0.998;0.999;0.998|.	D|.	0.89252|.	0.3591|.	10|.	0.66056|.	D|.	0.02|.	.|.	19.7712|19.7712	0.96366|0.96366	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	190;154;190|.	Q92813-2;Q92813;G3V315|.	.;IOD2_HUMAN;.|.	T|X	154;154;190|28	ENSP00000405854:A154T;ENSP00000451419:A154T;ENSP00000450980:A190T|.	ENSP00000405854:A154T|.	A|W	-|-	1|3	0|0	DIO2|DIO2	79739147|79739147	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.870000|0.870000	0.49936|0.49936	7.591000|7.591000	0.82666|0.82666	2.677000|2.677000	0.91161|0.91161	0.585000|0.585000	0.79938|0.79938	GCT|TGG	-	HMMPfam_T4_deiodinase		0.547	DIO2-010	PUTATIVE	basic	protein_coding	DIO2	protein_coding	OTTHUMT00000413753.1	C			79739147	-1	pseudogene	NM_001007023.4	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
BCO1	53630	genome.wustl.edu	37	16	81293292	81293292	+	Missense_Mutation	SNP	T	T	G			TCGA-AB-2924-03A-01W-0745-08	TCGA-AB-2924-11A-01W-0745-08	T	T	T	G	T	T	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	16d51cf8-f922-4c2b-ac3f-744064cb04f4	207d9855-296b-4155-9e3a-6011d6102505	g.chr16:81293292T>G	ENST00000258168.2	+	3	666	c.205T>G	c.(205-207)Tac>Gac	p.Y69D	BCMO1_ENST00000425577.2_Intron|BCMO1_ENST00000564552.1_Missense_Mutation_p.Y69D	NM_017429.2	NP_059125.2														breast(2)|endometrium(1)|large_intestine(4)|lung(9)|prostate(3)|skin(3)|stomach(1)	23						TGAAGTCTATTACAGGAGCAA	0.463																																						dbGAP											0			16											100.0	85.0	90.0					16																	81293292		2202	4300	6502	79850793	SO:0001583	missense	0																														ENST00000258168.2:c.205T>G	16.37:g.81293292T>G	ENSP00000258168:p.Tyr69Asp	Somatic	191	10.75	23		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	79850793	30	47.46	28		Missense_Mutation	SNP	HMMPfam_RPE65	p.Y69D	ENST00000258168.2	37	c.205	CCDS10934.1	16	.	.	.	.	.	.	.	.	.	.	T	14.75	2.627542	0.46944	.	.	ENSG00000135697	ENST00000258168	D	0.96587	-4.06	5.41	5.41	0.78517	.	0.468764	0.24843	N	0.035152	D	0.98353	0.9453	M	0.93283	3.4	0.80722	D	1	D	0.63046	0.992	P	0.60789	0.879	D	0.99556	1.0967	10	0.87932	D	0	-13.3108	15.5059	0.75739	0.0:0.0:0.0:1.0	.	69	Q9HAY6	BCDO1_HUMAN	D	69	ENSP00000258168:Y69D	ENSP00000258168:Y69D	Y	+	1	0	BCMO1	79850793	0.999000	0.42202	0.919000	0.36401	0.331000	0.28603	3.140000	0.50585	2.072000	0.62099	0.524000	0.50904	TAC	-	HMMPfam_RPE65		0.463	BCMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCMO1	protein_coding	OTTHUMT00000269056.1	T			79850793	+1	no_errors	NM_017429.2	genbank	human	reviewed	54_36p	missense	SNP	0.938	G
SNORD3C	780853	genome.wustl.edu	37	17	19091431	19091431	+	lincRNA	SNP	C	C	T	rs566845934	byFrequency	TCGA-AB-2924-03A-01W-0745-08	TCGA-AB-2924-11A-01W-0745-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	16d51cf8-f922-4c2b-ac3f-744064cb04f4	207d9855-296b-4155-9e3a-6011d6102505	g.chr17:19091431C>T	ENST00000362428.1	-	0	432				SNORD3A_ENST00000365494.1_lincRNA					small nucleolar RNA, C/D box 3C																		agcgttttctcctgagcgtga	0.493													c|||	27	0.00539137	0.0174	0.0014	5008	,	,		51708	0.0		0.003	False		,,,				2504	0.0					dbGAP											0			17											35.0	20.0	24.0					17																	19091431		874	1977	2851	19032024			0					17p11.2	2013-09-05			ENSG00000199298	ENSG00000264940			33191	non-coding RNA	RNA, small nucleolar						9365252	Standard	NR_006881		Approved	U3-3					17.37:g.19091431C>T		Somatic	379	5.25	21		50	12.28	7	WXS	Illumina HiSeq	Phase_IV	19032024	76	15.38	14		RNA	SNP	-	NULL	ENST00000362428.1	37	NULL		17																																																																																			-	-		0.493	SNORD3C-201	KNOWN	basic	snoRNA	SNORD3A	lincRNA		C	NR_006881		19032024	+1	no_errors	ENST00000365494	ensembl	human	known	54_36p	rna	SNP	1.000	T
KRT27	342574	genome.wustl.edu	37	17	38938537	38938537	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2924-03A-01W-0745-08	TCGA-AB-2924-11A-01W-0745-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	16d51cf8-f922-4c2b-ac3f-744064cb04f4	207d9855-296b-4155-9e3a-6011d6102505	g.chr17:38938537G>A	ENST00000301656.3	-	1	249	c.209C>T	c.(208-210)gCt>gTt	p.A70V		NM_181537.3	NP_853515.2			keratin 27									p.A70V(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(3)|skin(1)|stomach(1)	21		Breast(137;0.000812)				TGTGAAGGCAGCACAGGAAGC	0.587																																						dbGAP											1	Substitution - Missense(1)	endometrium(1)	17											120.0	103.0	109.0					17																	38938537		2203	4300	6503	36192063	SO:0001583	missense	0			AJ564206	CCDS11375.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000171446	ENSG00000171446		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	30841	protein-coding gene	gene with protein product			"""keratin 25C"""	KRT25C		16831889	Standard	NM_181537		Approved		uc002hvg.3	Q7Z3Y8	OTTHUMG00000133371	ENST00000301656.3:c.209C>T	17.37:g.38938537G>A	ENSP00000301656:p.Ala70Val	Somatic	148	5.70	9		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	36192063	35	50.00	35		Missense_Mutation	SNP	HMMPfam_Filament	p.A70V	ENST00000301656.3	37	c.209	CCDS11375.1	17	.	.	.	.	.	.	.	.	.	.	G	10.73	1.432414	0.25813	.	.	ENSG00000171446	ENST00000301656	D	0.82893	-1.66	5.54	3.45	0.39498	.	0.811143	0.11150	N	0.594244	T	0.74869	0.3773	L	0.55017	1.72	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.59600	-0.7424	10	0.27785	T	0.31	.	2.2637	0.04073	0.1683:0.2894:0.4021:0.1402	.	70	Q7Z3Y8	K1C27_HUMAN	V	70	ENSP00000301656:A70V	ENSP00000301656:A70V	A	-	2	0	KRT27	36192063	0.000000	0.05858	0.002000	0.10522	0.131000	0.20780	0.858000	0.27845	0.713000	0.32060	0.655000	0.94253	GCT	-	NULL		0.587	KRT27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT27	protein_coding	OTTHUMT00000257216.1	G	NM_181537		36192063	-1	no_errors	NM_181537.3	genbank	human	validated	54_36p	missense	SNP	0.000	A
PHLPP1	23239	genome.wustl.edu	37	18	60497429	60497429	+	Missense_Mutation	SNP	G	G	C			TCGA-AB-2924-03A-01W-0745-08	TCGA-AB-2924-11A-01W-0745-08	G	G	G	C	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	16d51cf8-f922-4c2b-ac3f-744064cb04f4	207d9855-296b-4155-9e3a-6011d6102505	g.chr18:60497429G>C	ENST00000262719.5	+	2	1972	c.1738G>C	c.(1738-1740)Gga>Cga	p.G580R	PHLPP1_ENST00000400316.4_Missense_Mutation_p.G68R			O60346	PHLP1_HUMAN	PH domain and leucine rich repeat protein phosphatase 1	580	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic process (GO:0006915)|entrainment of circadian clock (GO:0009649)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)			endometrium(2)|kidney(2)|lung(13)	17						CAGCTTGACCGGAAAGATGCA	0.448																																						dbGAP											0			18											100.0	97.0	98.0					18																	60497429		2049	4191	6240	58648409	SO:0001583	missense	0			AB011178	CCDS45881.1, CCDS45881.2	18q21.32	2013-01-11	2009-05-26	2009-05-26	ENSG00000081913	ENSG00000081913		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"", ""Pleckstrin homology (PH) domain containing"""	20610	protein-coding gene	gene with protein product		609396	"""pleckstrin homology domain containing, family E (with leucine rich repeats) member 1"", ""PH domain and leucine rich repeat protein phosphatase"""	PLEKHE1, PHLPP		10570941, 15808505	Standard	NM_194449		Approved	KIAA0606, SCOP	uc021ule.1	O60346	OTTHUMG00000150629	ENST00000262719.5:c.1738G>C	18.37:g.60497429G>C	ENSP00000262719:p.Gly580Arg	Somatic	331	6.76	24		16	55.56	20	WXS	Illumina HiSeq	Phase_IV	58648409	75	36.59	45	A1A4F5|Q641Q7|Q6P4C4|Q6PJI6|Q86TN6|Q96FK2|Q9NUY1	Missense_Mutation	SNP	HMMPfam_LRR_1,HMMPfam_PH,HMMSmart_SM00332,superfamily_Protein serine/threonine phosphatase 2C catalytic domain,HMMSmart_SM00369,HMMPfam_PP2C,HMMSmart_SM00364,superfamily_L domain-like	p.G68R	ENST00000262719.5	37	c.202	CCDS45881.2	18	.	.	.	.	.	.	.	.	.	.	G	29.9	5.049573	0.93740	.	.	ENSG00000081913	ENST00000400316;ENST00000262719	T;T	0.40756	1.02;1.02	4.98	4.98	0.66077	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	.	.	.	.	T	0.56963	0.2021	L	0.46157	1.445	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.46062	-0.9218	9	0.17369	T	0.5	-12.8033	18.4367	0.90649	0.0:0.0:1.0:0.0	.	580	O60346	PHLP1_HUMAN	R	68;580	ENSP00000383170:G68R;ENSP00000262719:G580R	ENSP00000262719:G580R	G	+	1	0	PHLPP1	58648409	1.000000	0.71417	0.932000	0.37286	0.975000	0.68041	9.657000	0.98554	2.590000	0.87494	0.555000	0.69702	GGA	-	HMMPfam_PH		0.448	PHLPP1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PHLPP	protein_coding	OTTHUMT00000319249.2	G	NM_194449		58648409	+1	no_errors	NM_194449.1	genbank	human	validated	54_36p	missense	SNP	1.000	C
MUC16	94025	genome.wustl.edu	37	19	9084715	9084715	+	Missense_Mutation	SNP	C	C	T			TCGA-AB-2924-03A-01W-0745-08	TCGA-AB-2924-11A-01W-0745-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	16d51cf8-f922-4c2b-ac3f-744064cb04f4	207d9855-296b-4155-9e3a-6011d6102505	g.chr19:9084715C>T	ENST00000397910.4	-	1	7303	c.7100G>A	c.(7099-7101)aGc>aAc	p.S2367N		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	2367	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AGAAGAACTGCTATCTGAGGG	0.433																																						dbGAP											0			19											151.0	147.0	148.0					19																	9084715		1951	4137	6088	8945715	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.7100G>A	19.37:g.9084715C>T	ENSP00000381008:p.Ser2367Asn	Somatic	530	7.34	42		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	8945715	144	40.00	96	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	HMMPfam_SEA,HMMSmart_SM00200,PatternScan_ATPASE_ALPHA_BETA,superfamily_SEA domain	p.S2367N	ENST00000397910.4	37	c.7100	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	c	1.475	-0.558784	0.03967	.	.	ENSG00000181143	ENST00000397910	T	0.02656	4.21	0.225	0.225	0.15325	.	.	.	.	.	T	0.02807	0.0084	N	0.08118	0	.	.	.	P	0.51449	0.945	P	0.51866	0.682	T	0.47058	-0.9146	7	0.87932	D	0	.	.	.	.	.	2367	B5ME49	.	N	2367	ENSP00000381008:S2367N	ENSP00000381008:S2367N	S	-	2	0	MUC16	8945715	0.006000	0.16342	0.016000	0.15963	0.016000	0.09150	0.673000	0.25203	0.300000	0.22699	0.305000	0.20034	AGC	-	NULL		0.433	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	protein_coding	OTTHUMT00000402806.1	C	NM_024690		8945715	-1	no_errors	NM_024690.2	genbank	human	validated	54_36p	missense	SNP	0.000	T
NPM1	4869	genome.wustl.edu	37	5	170837546	170837547	+	Frame_Shift_Ins	INS	-	-	TGTA			TCGA-AB-2924-03A-01W-0745-08	TCGA-AB-2924-11A-01W-0745-08	-	-	-	TGTA	-	-	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	16d51cf8-f922-4c2b-ac3f-744064cb04f4	207d9855-296b-4155-9e3a-6011d6102505	g.chr5:170837546_170837547insTGTA	ENST00000296930.5	+	11	1163_1164	c.862_863insTGTA	c.(862-864)tggfs	p.W288fs	NPM1_ENST00000517671.1_Frame_Shift_Ins_p.W288fs|NPM1_ENST00000351986.6_Frame_Shift_Ins_p.W259fs	NM_002520.6	NP_002511.1	P06748	NPM_HUMAN	nucleophosmin (nucleolar phosphoprotein B23, numatrin)	288	Required for nucleolar localization.			WQWRKSL -> CLAVEEVSLRK (in Ref. 6; AAW67752/AAW67755). {ECO:0000305}.|WQWRKSL -> CMAVEEVSLRK (in Ref. 6; AAW67753 and 7; ABC40399). {ECO:0000305}.|WQWRKSL -> CVAVEEVSLRK (in Ref. 6; AAW67754). {ECO:0000305}.	cell aging (GO:0007569)|CENP-A containing nucleosome assembly (GO:0034080)|centrosome cycle (GO:0007098)|DNA repair (GO:0006281)|intracellular protein transport (GO:0006886)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of centrosome duplication (GO:0010826)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|nucleocytoplasmic transport (GO:0006913)|nucleosome assembly (GO:0006334)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of translation (GO:0045727)|protein localization (GO:0008104)|protein oligomerization (GO:0051259)|regulation of centriole replication (GO:0046599)|regulation of eIF2 alpha phosphorylation by dsRNA (GO:0060735)|regulation of endodeoxyribonuclease activity (GO:0032071)|regulation of endoribonuclease activity (GO:0060699)|response to stress (GO:0006950)|ribosome assembly (GO:0042255)|signal transduction (GO:0007165)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spindle pole centrosome (GO:0031616)	histone binding (GO:0042393)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein kinase inhibitor activity (GO:0004860)|ribosomal large subunit binding (GO:0043023)|ribosomal small subunit binding (GO:0043024)|RNA binding (GO:0003723)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|unfolded protein binding (GO:0051082)	p.W288fs*12(2112)|p.W288fs*10(9)|p.Q289fs*11(3)|p.W288fs*>9(2)	NPM1/ALK(632)	central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(4261)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	4269	Renal(175;0.000159)|Lung NSC(126;0.00576)|all_lung(126;0.00963)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			TCAAGATCTCTGGCAGTGGAGG	0.312			"""T, F """	"""ALK, RARA, MLF1"""	"""NHL, APL, AML"""																																	dbGAP		Dom	yes		5	5q35	4869	"""nucleophosmin (nucleolar phosphoprotein B23, numatrin)"""		L	2126	Insertion - Frameshift(2124)|Complex - frameshift(2)	haematopoietic_and_lymphoid_tissue(2126)	5																																								170770152	SO:0001589	frameshift_variant	0			M26697	CCDS4376.1, CCDS4377.1, CCDS43399.1	5q35.1	2014-09-17			ENSG00000181163	ENSG00000181163			7910	protein-coding gene	gene with protein product	"""nucleolar phosphoprotein B23"", ""numatrin"", ""nucleophosmin/nucleoplasmin family, member 1"""	164040				8471164, 8122112	Standard	NM_002520		Approved	B23, NPM	uc003mbi.3	P06748	OTTHUMG00000130465	Exception_encountered	5.37:g.170837546_170837547insTGTA	ENSP00000296930:p.Trp288fs	Somatic	NA	NA	NA		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	170770151	NA	NA	NA	A8K3N7|B5BU00|D3DQL6|P08693|Q12826|Q13440|Q13441|Q14115|Q5EU94|Q5EU95|Q5EU96|Q5EU97|Q5EU98|Q5EU99|Q6V962|Q8WTW5|Q96AT6|Q96DC4|Q96EA5|Q9BYG9|Q9UDJ7	Frame_Shift_Ins	INS	HMMPfam_Nucleoplasmin,superfamily_Nucleoplasmin-like core domain	p.W288fs	ENST00000296930.5	37	c.862_863	CCDS4376.1	5																																																																																			-	NULL		0.312	NPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPM1	protein_coding	OTTHUMT00000252858.2	-	NM_002520		170770152	+1	no_errors	NM_002520.1	genbank	human	validated	54_36p	frame_shift_ins	INS	1.000:1.000	TGTA
VWCE	220001	genome.wustl.edu	37	11	61045882	61045882	+	Frame_Shift_Del	DEL	G	G	-			TCGA-AB-2924-03A-01W-0745-08	TCGA-AB-2924-11A-01W-0745-08	G	G	G	-	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	16d51cf8-f922-4c2b-ac3f-744064cb04f4	207d9855-296b-4155-9e3a-6011d6102505	g.chr11:61045882delG	ENST00000335613.5	-	10	1777	c.1391delC	c.(1390-1392)accfs	p.T464fs		NM_152718.2	NP_689931.2	Q96DN2	VWCE_HUMAN	von Willebrand factor C and EGF domains	464	VWFC 2. {ECO:0000255|PROSITE- ProRule:PRU00220}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			biliary_tract(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(17)|ovary(3)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37						GACACAGACGGTGCAGTTCTC	0.493																																						dbGAP											0			11											158.0	134.0	142.0					11																	61045882		2203	4299	6502	60802458	SO:0001589	frameshift_variant	0			AK056571	CCDS8002.1	11q12.2	2006-08-04			ENSG00000167992	ENSG00000167992			26487	protein-coding gene	gene with protein product		611115				12869306	Standard	NM_152718		Approved	URG11, FLJ32009, VWC1	uc001nra.3	Q96DN2	OTTHUMG00000168208	ENST00000335613.5:c.1391delC	11.37:g.61045882delG	ENSP00000334186:p.Thr464fs	Somatic	251	0.00	0		1	0.00	0	WXS	Illumina HiSeq	Phase_IV	60802458	75	0.00	0	A5PKV0|Q7Z7L6|Q86WK8	Frame_Shift_Del	DEL	PatternScan_ASX_HYDROXYL,HMMPfam_VWC,HMMSmart_SM00214,PatternScan_VWFC_1,HMMSmart_SM00179,HMMSmart_SM00181,HMMSmart_SM00215,PatternScan_EGF_1,PatternScan_EGF_2,HMMPfam_EGF_CA,HMMPfam_EGF_2,PatternScan_EGF_CA,PatternScan_C_TYPE_LECTIN_1,superfamily_EGF/Laminin	p.V465fs	ENST00000335613.5	37	c.1391	CCDS8002.1	11																																																																																			-	HMMPfam_VWC,HMMSmart_SM00214,HMMSmart_SM00215		0.493	VWCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VWCE	protein_coding	OTTHUMT00000398811.1	G	NM_152718		60802458	-1	no_errors	NM_152718.2	genbank	human	validated	54_36p	frame_shift_del	DEL	1.000	-
