#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NormalRefReads_WU	i_NormalVAF_WU	i_NormalVarReads_WU	i_ORegAnno_bin	i_RNARefReads_WU	i_RNAVAF_WU	i_RNAVarReads_WU	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TumorRefReads_WU	i_TumorVAF_WU	i_TumorVarReads_WU	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
DNMT3A	1788	genome.wustl.edu	37	2	25457242	25457242	+	Missense_Mutation	SNP	C	C	T	rs147001633	byFrequency	TCGA-AB-2949-03A-01W-0733-08	TCGA-AB-2949-11A-01W-0732-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	93918a62-e102-4cf1-a403-81845f830c3e	ed5227d3-b5bf-4356-a6c2-3af0065be735	g.chr2:25457242C>T	ENST00000264709.3	-	23	2982	c.2645G>A	c.(2644-2646)cGc>cAc	p.R882H	DNMT3A_ENST00000402667.1_Missense_Mutation_p.R659H|DNMT3A_ENST00000321117.5_Missense_Mutation_p.R882H|DNMT3A_ENST00000380746.4_Missense_Mutation_p.R693H|DNMT3A_ENST00000474887.1_5'Flank	NM_175629.2	NP_783328.1	Q9Y6K1	DNM3A_HUMAN	DNA (cytosine-5-)-methyltransferase 3 alpha	882	SAM-dependent MTase C5-type. {ECO:0000255|PROSITE-ProRule:PRU01016}.		R -> C (in a patient with chronic myelomonocytic leukemia; somatic mutation). {ECO:0000269|PubMed:21828135}.|R -> H (in a patient with chronic myelomonocytic leukemia; somatic mutation). {ECO:0000269|PubMed:21828135}.|R -> P (in a patient with chronic myelomonocytic leukemia; somatic mutation). {ECO:0000269|PubMed:21828135}.		C-5 methylation of cytosine (GO:0090116)|cellular response to amino acid stimulus (GO:0071230)|DNA methylation (GO:0006306)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation involved in gamete generation (GO:0043046)|DNA methylation on cytosine within a CG sequence (GO:0010424)|hypermethylation of CpG island (GO:0044027)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of gene expression by genetic imprinting (GO:0006349)|S-adenosylhomocysteine metabolic process (GO:0046498)|S-adenosylmethioninamine metabolic process (GO:0046499)|spermatogenesis (GO:0007283)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|euchromatin (GO:0000791)|nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA (cytosine-5-)-methyltransferase activity, acting on CpG substrates (GO:0051718)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|unmethylated CpG binding (GO:0045322)	p.R882H(209)|p.R882P(5)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(964)|kidney(3)|large_intestine(10)|lung(29)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	1021	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCTCGCCAAGCGGCTCATGTT	0.592			"""Mis, F, N, S"""		AML																																	dbGAP		Rec	yes		2	2p23	1788	DNA (cytosine-5-)-methyltransferase 3 alpha		L	214	Substitution - Missense(214)	haematopoietic_and_lymphoid_tissue(214)	2						C	HIS/ARG,HIS/ARG,HIS/ARG	4,4402	6.2+/-15.9	0,4,2199	56.0	51.0	53.0		2645,2078,2645	5.7	1.0	2	dbSNP_134	53	5,8595	3.0+/-9.4	0,5,4295	yes	missense,missense,missense	DNMT3A	NM_022552.3,NM_153759.2,NM_175629.1	29,29,29	0,9,6494	TT,TC,CC		0.0581,0.0908,0.0692	possibly-damaging,possibly-damaging,possibly-damaging	882/913,693/724,882/913	25457242	9,12997	2203	4300	6503	25310746	SO:0001583	missense	0				CCDS1718.2, CCDS33157.1, CCDS46232.1	2p23	2014-09-17			ENSG00000119772	ENSG00000119772			2978	protein-coding gene	gene with protein product		602769				9662389, 10433969	Standard	NM_175630		Approved		uc002rgc.4	Q9Y6K1	OTTHUMG00000094777	ENST00000264709.3:c.2645G>A	2.37:g.25457242C>T	ENSP00000264709:p.Arg882His	Somatic	112	6.67	8		45	57.14	60	WXS	Illumina HiSeq	Phase_IV	25310746	26	44.68	21	E9PEB8|Q86TE8|Q86XF5|Q8IZV0|Q8WXU9	Missense_Mutation	SNP	HMMPfam_PWWP,HMMSmart_SM00293,HMMPfam_DNA_methylase,superfamily_FYVE/PHD zinc finger,PatternScan_C5_MTASE_1,superfamily_S-adenosyl-L-methionine-dependent methyltransferases,superfamily_Tudor/PWWP/MBT	p.R882H	ENST00000264709.3	37	c.2645	CCDS33157.1	2	.	.	.	.	.	.	.	.	.	.	C	23.1	4.380427	0.82682	9.08E-4	5.81E-4	ENSG00000119772	ENST00000380746;ENST00000321117;ENST00000264709;ENST00000402667	D;D;D;D	0.97186	-4.28;-4.28;-4.28;-4.28	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	D	0.95843	0.8647	M	0.80982	2.52	0.80722	D	1	P;B	0.38922	0.651;0.11	B;B	0.23018	0.043;0.003	D	0.95939	0.8945	10	0.62326	D	0.03	-8.768	18.4404	0.90665	0.0:1.0:0.0:0.0	.	882;693	Q9Y6K1;E9PEB8	DNM3A_HUMAN;.	H	693;882;882;659	ENSP00000370122:R693H;ENSP00000324375:R882H;ENSP00000264709:R882H;ENSP00000384237:R659H	ENSP00000264709:R882H	R	-	2	0	DNMT3A	25310746	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.814000	0.86154	2.698000	0.92095	0.561000	0.74099	CGC	-	superfamily_S-adenosyl-L-methionine-dependent methyltransferases		0.592	DNMT3A-001	KNOWN	basic|CCDS	protein_coding	DNMT3A	protein_coding	OTTHUMT00000211587.1	C	NM_022552		25310746	-1	no_errors	NM_022552.3	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
TRABD2A	129293	genome.wustl.edu	37	2	85097654	85097654	+	Missense_Mutation	SNP	G	G	T			TCGA-AB-2949-03A-01W-0733-08	TCGA-AB-2949-11A-01W-0732-08	G	G	G	T	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	93918a62-e102-4cf1-a403-81845f830c3e	ed5227d3-b5bf-4356-a6c2-3af0065be735	g.chr2:85097654G>T	ENST00000409520.2	-	2	406	c.364C>A	c.(364-366)Cgc>Agc	p.R122S	TRABD2A_ENST00000335459.5_Missense_Mutation_p.R122S|TRABD2A_ENST00000409133.1_Missense_Mutation_p.R122S	NM_001277053.1	NP_001263982.1	Q86V40	TIKI1_HUMAN	TraB domain containing 2A	122					head development (GO:0060322)|metabolic process (GO:0008152)|negative regulation of Wnt signaling pathway (GO:0030178)|protein oxidation (GO:0018158)|Wnt signaling pathway (GO:0016055)	integral component of organelle membrane (GO:0031301)|integral component of plasma membrane (GO:0005887)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|Wnt-protein binding (GO:0017147)										CGCTTGAGGCGGCAGTAGATG	0.582																																						dbGAP											0			2											48.0	52.0	51.0					2																	85097654		2112	4227	6339	84951165	SO:0001583	missense	0			BC049209	CCDS46349.1, CCDS62946.1	2p11.2	2012-07-04	2012-07-04	2012-07-04	ENSG00000186854	ENSG00000186854			27013	protein-coding gene	gene with protein product		614912	"""chromosome 2 open reading frame 89"""	C2orf89		12477932	Standard	NM_001080824		Approved		uc010ysl.3	Q86V40	OTTHUMG00000152922	ENST00000409520.2:c.364C>A	2.37:g.85097654G>T	ENSP00000387075:p.Arg122Ser	Somatic	65	2.99	2		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	84951165	23	48.89	22	B4DKK8|I6UMB9	Missense_Mutation	SNP	NULL	p.R122S	ENST00000409520.2	37	c.364		2	.	.	.	.	.	.	.	.	.	.	G	15.13	2.742659	0.49151	.	.	ENSG00000186854	ENST00000335459;ENST00000409520;ENST00000409133	T;T;T	0.26067	1.76;1.76;1.76	3.51	-0.393	0.12438	.	0.169259	0.36200	N	0.002721	T	0.36468	0.0968	.	.	.	0.30999	N	0.72056	D;D;D	0.89917	0.997;1.0;1.0	D;D;D	0.97110	0.995;1.0;1.0	T	0.30534	-0.9975	9	0.39692	T	0.17	.	2.7438	0.05262	0.3032:0.0:0.3668:0.33	.	122;122;122	Q86V40;C9IYB5;Q86V40-2	CB089_HUMAN;.;.	S	122	ENSP00000335004:R122S;ENSP00000387075:R122S;ENSP00000387183:R122S	ENSP00000335004:R122S	R	-	1	0	C2orf89	84951165	0.966000	0.33281	0.732000	0.30844	0.813000	0.45954	0.526000	0.22971	0.028000	0.15324	-0.391000	0.06502	CGC	-	NULL		0.582	TRABD2A-201	KNOWN	basic|appris_principal	protein_coding	LOC129293	protein_coding		G	NM_001080824		84951165	-1	no_errors	NM_001080824.1	genbank	human	predicted	54_36p	missense	SNP	0.997	T
IDH1	3417	genome.wustl.edu	37	2	209113112	209113112	+	Missense_Mutation	SNP	C	C	T	rs121913500		TCGA-AB-2949-03A-01W-0733-08	TCGA-AB-2949-11A-01W-0732-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	93918a62-e102-4cf1-a403-81845f830c3e	ed5227d3-b5bf-4356-a6c2-3af0065be735	g.chr2:209113112C>T	ENST00000415913.1	-	4	776	c.395G>A	c.(394-396)cGt>cAt	p.R132H	IDH1_ENST00000446179.1_Missense_Mutation_p.R132H|IDH1_ENST00000345146.2_Missense_Mutation_p.R132H	NM_001282387.1	NP_001269316.1	O75874	IDHC_HUMAN	isocitrate dehydrogenase 1 (NADP+), soluble	132			R -> C (in colorectal cancer and glioma samples; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha- ketoglutarate but instead alpha- ketoglutarate is converted to R(-)-2- hydroxyglutarate). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:19117336}.|R -> G (in a glioma sample; glioblastoma multiforme; somatic mutation). {ECO:0000269|PubMed:19117336}.|R -> H (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate). {ECO:0000269|PubMed:18772396}.|R -> L (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate). {ECO:0000269|PubMed:19117336}.|R -> S (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate). {ECO:0000269|PubMed:18772396}.		2-oxoglutarate metabolic process (GO:0006103)|cellular lipid metabolic process (GO:0044255)|female gonad development (GO:0008585)|glutathione metabolic process (GO:0006749)|glyoxylate cycle (GO:0006097)|isocitrate metabolic process (GO:0006102)|NADPH regeneration (GO:0006740)|response to oxidative stress (GO:0006979)|response to steroid hormone (GO:0048545)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	isocitrate dehydrogenase (NADP+) activity (GO:0004450)|magnesium ion binding (GO:0000287)|NAD binding (GO:0051287)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)	p.R132H(2774)|p.R132L(59)|p.R132V(1)|p.G131_R132>VL(1)		NS(1)|autonomic_ganglia(2)|biliary_tract(24)|bone(237)|central_nervous_system(3764)|endometrium(3)|haematopoietic_and_lymphoid_tissue(794)|kidney(2)|large_intestine(7)|lung(7)|prostate(6)|skin(5)|soft_tissue(12)|thyroid(22)|urinary_tract(1)	4887				Epithelial(149;0.0322)|LUSC - Lung squamous cell carcinoma(261;0.0711)|Lung(261;0.136)		ATAAGCATGACGACCTATGAT	0.393			Mis		gliobastoma																																Pancreas(158;264 1958 3300 35450 36047)	dbGAP		Dom	yes		2	2q33.3	3417	"""isocitrate dehydrogenase 1 (NADP+), soluble"""		O	2835	Substitution - Missense(2834)|Complex - compound substitution(1)	central_nervous_system(2579)|haematopoietic_and_lymphoid_tissue(205)|bone(43)|prostate(4)|biliary_tract(2)|urinary_tract(1)|skin(1)	2											79.0	73.0	75.0					2																	209113112		2203	4300	6503	208821357	SO:0001583	missense	0				CCDS2381.1	2q34	2014-09-17			ENSG00000138413	ENSG00000138413	1.1.1.42		5382	protein-coding gene	gene with protein product		147700					Standard	NM_005896		Approved		uc002vcu.3	O75874	OTTHUMG00000132943	ENST00000415913.1:c.395G>A	2.37:g.209113112C>T	ENSP00000390265:p.Arg132His	Somatic	86	6.52	6		37	38.33	23	WXS	Illumina HiSeq	Phase_IV	208821357	32	43.86	25	Q567U4|Q6FHQ6|Q7Z3V0|Q93090|Q9NTJ9|Q9UKW8	Missense_Mutation	SNP	HMMPfam_Iso_dh,PatternScan_IDH_IMDH,superfamily_Isocitrate/Isopropylmalate dehydrogenase-like	p.R132H	ENST00000415913.1	37	c.395	CCDS2381.1	2	.	.	.	.	.	.	.	.	.	.	C	25.6	4.657324	0.88154	.	.	ENSG00000138413	ENST00000345146;ENST00000446179;ENST00000415913;ENST00000415282	D;D;D;D	0.86956	-2.19;-2.19;-2.19;-2.19	5.57	4.69	0.59074	Isopropylmalate dehydrogenase-like domain (2);	0.000000	0.85682	D	0.000000	D	0.93145	0.7817	H	0.99379	4.54	0.80722	D	1	B	0.25486	0.127	B	0.25405	0.06	D	0.92324	0.5868	10	0.87932	D	0	-20.0399	14.3783	0.66895	0.0:0.9288:0.0:0.0712	.	132	O75874	IDHC_HUMAN	H	132	ENSP00000260985:R132H;ENSP00000410513:R132H;ENSP00000390265:R132H;ENSP00000391075:R132H	ENSP00000260985:R132H	R	-	2	0	IDH1	208821357	1.000000	0.71417	0.997000	0.53966	0.992000	0.81027	6.088000	0.71371	1.356000	0.45884	0.555000	0.69702	CGT	-	HMMPfam_Iso_dh,superfamily_Isocitrate/Isopropylmalate dehydrogenase-like		0.393	IDH1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	IDH1	protein_coding	OTTHUMT00000336672.1	C			208821357	-1	no_errors	NM_005896.2	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
SLC4A3	6508	genome.wustl.edu	37	2	220505322	220505322	+	Splice_Site	SNP	G	G	A			TCGA-AB-2949-03A-01W-0733-08	TCGA-AB-2949-11A-01W-0732-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	93918a62-e102-4cf1-a403-81845f830c3e	ed5227d3-b5bf-4356-a6c2-3af0065be735	g.chr2:220505322G>A	ENST00000358055.3	+	21	3959		c.e21+1		SLC4A3_ENST00000373762.3_Splice_Site|SLC4A3_ENST00000373760.2_Splice_Site|SLC4A3_ENST00000273063.6_Splice_Site|SLC4A3_ENST00000317151.3_Splice_Site			P48751	B3A3_HUMAN	solute carrier family 4 (anion exchanger), member 3						bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|regulation of intracellular pH (GO:0051453)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)	51		Renal(207;0.0183)		Epithelial(149;2.53e-07)|all cancers(144;5.57e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TGTGACCAAGGTAGGGCCGGG	0.577																																						dbGAP											0			2											108.0	99.0	102.0					2																	220505322		2203	4300	6503	220213566	SO:0001630	splice_region_variant	0				CCDS2445.1, CCDS2446.1	2q35	2013-07-19	2013-07-19		ENSG00000114923	ENSG00000114923		"""Solute carriers"""	11029	protein-coding gene	gene with protein product	"""Anion exchanger 3, neuronal"""	106195	"""solute carrier family 4, anion exchanger, member 3"""			8001971	Standard	NM_005070		Approved	AE3, SLC2C	uc002vmo.4	P48751	OTTHUMG00000059238	ENST00000358055.3:c.3447+1G>A	2.37:g.220505322G>A		Somatic	110	0.89	1		0	0.00	0	WXS	Illumina HiSeq	Phase_IV	220213566	52	14.75	9	A6H8L2|A8K1Q9|B7ZVX6|B9EGD1|Q6YIQ9	Splice_Site	SNP	-	e20+1	ENST00000358055.3	37	c.3528+1	CCDS2445.1	2	.	.	.	.	.	.	.	.	.	.	G	23.7	4.446450	0.84101	.	.	ENSG00000114923	ENST00000358055;ENST00000373760;ENST00000273063;ENST00000373762;ENST00000317151	.	.	.	4.3	4.3	0.51218	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.3412	0.87297	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SLC4A3	220213566	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	9.601000	0.98297	2.396000	0.81511	0.563000	0.77884	.	-	-		0.577	SLC4A3-009	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SLC4A3	protein_coding	OTTHUMT00000316472.1	G	NM_005070	Intron	220213566	+1	no_errors	NM_201574.3	genbank	human	validated	54_36p	splice_site	SNP	1.000	A
SPHKAP	80309	genome.wustl.edu	37	2	228996763	228996763	+	Missense_Mutation	SNP	G	G	A	rs141195352		TCGA-AB-2949-03A-01W-0733-08	TCGA-AB-2949-11A-01W-0732-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	93918a62-e102-4cf1-a403-81845f830c3e	ed5227d3-b5bf-4356-a6c2-3af0065be735	g.chr2:228996763G>A	ENST00000392056.3	-	2	117	c.71C>T	c.(70-72)cCg>cTg	p.P24L	SPHKAP_ENST00000344657.5_Missense_Mutation_p.P24L	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	24						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)			NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		GCCCTGCTGCGGTTCCAAAAC	0.478																																						dbGAP											0			2						G	LEU/PRO,LEU/PRO	0,4406		0,0,2203	88.0	91.0	90.0		71,71	1.8	0.0	2	dbSNP_134	90	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	SPHKAP	NM_001142644.1,NM_030623.3	98,98	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign,benign	24/1701,24/1672	228996763	1,13005	2203	4300	6503	228705007	SO:0001583	missense	0				CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.71C>T	2.37:g.228996763G>A	ENSP00000375909:p.Pro24Leu	Somatic	85	1.16	1		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	228705007	54	37.21	32	Q68DA3|Q68DR8|Q9C0I5	Missense_Mutation	SNP	HMMPfam_AKAP_110	p.P24L	ENST00000392056.3	37	c.71	CCDS46537.1	2	.	.	.	.	.	.	.	.	.	.	G	6.037	0.375221	0.11409	0.0	1.16E-4	ENSG00000153820	ENST00000392056;ENST00000344657	T;T	0.55052	0.54;0.54	4.55	1.78	0.24846	.	1.862920	0.02479	N	0.088282	T	0.37945	0.1022	N	0.14661	0.345	0.09310	N	1	B;B	0.14438	0.006;0.01	B;B	0.09377	0.002;0.004	T	0.28808	-1.0032	10	0.51188	T	0.08	.	6.8536	0.24028	0.2869:0.0:0.7131:0.0	.	24;24	Q2M3C7;Q2M3C7-2	SPKAP_HUMAN;.	L	24	ENSP00000375909:P24L;ENSP00000339886:P24L	ENSP00000339886:P24L	P	-	2	0	SPHKAP	228705007	0.001000	0.12720	0.000000	0.03702	0.017000	0.09413	0.823000	0.27366	0.423000	0.26033	0.655000	0.94253	CCG	-	NULL		0.478	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPHKAP	protein_coding	OTTHUMT00000331750.1	G	NM_030623		228705007	-1	no_errors	NM_030623.1	genbank	human	validated	54_36p	missense	SNP	0.000	A
LRCH3	84859	genome.wustl.edu	37	3	197556523	197556523	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2949-03A-01W-0733-08	TCGA-AB-2949-11A-01W-0732-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	93918a62-e102-4cf1-a403-81845f830c3e	ed5227d3-b5bf-4356-a6c2-3af0065be735	g.chr3:197556523G>A	ENST00000425562.2	+	6	866	c.866G>A	c.(865-867)aGa>aAa	p.R289K	AC055764.1_ENST00000454526.1_RNA|LRCH3_ENST00000441090.2_Missense_Mutation_p.R163K|LRCH3_ENST00000536618.1_5'UTR|LRCH3_ENST00000334859.4_Missense_Mutation_p.R289K|LRCH3_ENST00000414675.2_Missense_Mutation_p.R289K|LRCH3_ENST00000438796.2_Missense_Mutation_p.R289K			Q96II8	LRCH3_HUMAN	leucine-rich repeats and calponin homology (CH) domain containing 3	289						cytoplasm (GO:0005737)|extracellular region (GO:0005576)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;4.82e-24)|all cancers(36;3.61e-22)|OV - Ovarian serous cystadenocarcinoma(49;7.08e-19)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.119)		TATGATAGGAGACCGTTGGGT	0.338																																						dbGAP											0			3											171.0	171.0	171.0					3																	197556523		2203	4300	6503	199040920	SO:0001583	missense	0			AL137527	CCDS3330.1	3q29	2006-04-12			ENSG00000186001	ENSG00000186001			28637	protein-coding gene	gene with protein product						12477932	Standard	NM_032773		Approved	MGC4126	uc003fyj.1	Q96II8	OTTHUMG00000155378	ENST00000425562.2:c.866G>A	3.37:g.197556523G>A	ENSP00000393579:p.Arg289Lys	Somatic	109	1.79	2		14	56.25	18	WXS	Illumina HiSeq	Phase_IV	199040920	65	46.77	58	B4E0T7|Q96FP9|Q9NT52	Missense_Mutation	SNP	HMMPfam_LRR_1,superfamily_Calponin-homology,superfamily_SSF52058	p.R289K	ENST00000425562.2	37	c.866		3	.	.	.	.	.	.	.	.	.	.	G	34	5.360591	0.95877	.	.	ENSG00000186001	ENST00000438796;ENST00000441090;ENST00000414675;ENST00000334859;ENST00000425562	T;T;T;T;T	0.38240	1.81;1.15;1.91;2.08;1.83	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.52964	0.1767	L	0.41824	1.3	0.80722	D	1	D;P;D;D	0.76494	0.997;0.605;0.999;0.978	D;B;D;P	0.68353	0.909;0.194;0.957;0.863	T	0.52983	-0.8502	10	0.62326	D	0.03	-14.7483	19.3151	0.94208	0.0:0.0:1.0:0.0	.	163;289;289;289	E9PD99;B4E0T7;Q96II8-2;Q96II8-3	.;.;.;.	K	289;163;289;289;289	ENSP00000399751:R289K;ENSP00000394609:R163K;ENSP00000394965:R289K;ENSP00000334375:R289K;ENSP00000393579:R289K	ENSP00000334375:R289K	R	+	2	0	LRCH3	199040920	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	7.377000	0.79668	2.561000	0.86390	0.650000	0.86243	AGA	-	superfamily_SSF52058		0.338	LRCH3-006	KNOWN	basic	protein_coding	LRCH3	protein_coding	OTTHUMT00000339965.1	G	NM_032773		199040920	+1	no_errors	NM_032773.2	genbank	human	provisional	54_36p	missense	SNP	1.000	A
ST8SIA4	7903	genome.wustl.edu	37	5	100222185	100222185	+	Missense_Mutation	SNP	T	T	C			TCGA-AB-2949-03A-01W-0733-08	TCGA-AB-2949-11A-01W-0732-08	T	T	T	C	T	T	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	93918a62-e102-4cf1-a403-81845f830c3e	ed5227d3-b5bf-4356-a6c2-3af0065be735	g.chr5:100222185T>C	ENST00000231461.5	-	3	675	c.365A>G	c.(364-366)cAt>cGt	p.H122R	ST8SIA4_ENST00000507360.2_5'UTR|ST8SIA4_ENST00000451528.2_Missense_Mutation_p.H122R	NM_005668.4	NP_005659.1	Q92187	SIA8D_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4	122					axon guidance (GO:0007411)|cellular protein modification process (GO:0006464)|ganglioside biosynthetic process (GO:0001574)|N-glycan processing (GO:0006491)|nervous system development (GO:0007399)|oligosaccharide metabolic process (GO:0009311)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity (GO:0003828)|sialic acid binding (GO:0033691)			NS(1)|central_nervous_system(1)|endometrium(3)|large_intestine(11)|lung(7)|stomach(1)|upper_aerodigestive_tract(1)	25		all_cancers(142;1.5e-07)|all_epithelial(76;1.43e-10)|Prostate(80;0.000644)|Lung NSC(167;0.0059)|all_lung(232;0.00914)|Ovarian(225;0.024)|Colorectal(57;0.09)|Breast(839;0.203)		COAD - Colon adenocarcinoma(37;0.00402)		ATGTAGATCATGAGAAATGTT	0.438																																						dbGAP											0			5											143.0	137.0	139.0					5																	100222185		2203	4300	6503	100250084	SO:0001583	missense	0			L41680	CCDS4091.1, CCDS47252.1	5q21	2013-03-01	2003-01-14	2005-02-07	ENSG00000113532	ENSG00000113532		"""Sialyltransferases"""	10871	protein-coding gene	gene with protein product	"""ST8Sia IV"""	602547	"""sialyltransferase 8 (alpha-2, 8-polysialytransferase) D"""	SIAT8D		7624364	Standard	NM_005668		Approved	PST, PST1	uc003knk.3	Q92187	OTTHUMG00000128727	ENST00000231461.5:c.365A>G	5.37:g.100222185T>C	ENSP00000231461:p.His122Arg	Somatic	56	3.33	2		30	45.45	25	WXS	Illumina HiSeq	Phase_IV	100250084	33	45.00	27	A8KA07|G3V104|Q8N1F4|Q92693	Missense_Mutation	SNP	HMMPfam_Glyco_transf_29	p.H122R	ENST00000231461.5	37	c.365	CCDS4091.1	5	.	.	.	.	.	.	.	.	.	.	T	15.59	2.877623	0.51801	.	.	ENSG00000113532	ENST00000231461;ENST00000451528	T;T	0.27890	1.64;1.64	5.92	4.76	0.60689	.	0.124765	0.53938	D	0.000047	T	0.12774	0.0310	N	0.02539	-0.55	0.38091	D	0.936979	B	0.02656	0.0	B	0.04013	0.001	T	0.10567	-1.0624	10	0.23302	T	0.38	.	11.2619	0.49089	0.0:0.0711:0.0:0.9289	.	122	Q92187	SIA8D_HUMAN	R	122	ENSP00000231461:H122R;ENSP00000428914:H122R	ENSP00000231461:H122R	H	-	2	0	ST8SIA4	100250084	1.000000	0.71417	0.807000	0.32361	0.991000	0.79684	5.952000	0.70282	1.072000	0.40860	0.455000	0.32223	CAT	-	HMMPfam_Glyco_transf_29		0.438	ST8SIA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ST8SIA4	protein_coding	OTTHUMT00000250632.3	T	NM_005668		100250084	-1	no_errors	NM_005668.4	genbank	human	reviewed	54_36p	missense	SNP	0.997	C
NMUR2	56923	genome.wustl.edu	37	5	151784554	151784554	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2949-03A-01W-0733-08	TCGA-AB-2949-11A-01W-0732-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	93918a62-e102-4cf1-a403-81845f830c3e	ed5227d3-b5bf-4356-a6c2-3af0065be735	g.chr5:151784554G>A	ENST00000255262.3	-	1	286	c.121C>T	c.(121-123)Cgc>Tgc	p.R41C	NMUR2_ENST00000518933.1_Intron	NM_020167.4	NP_064552.3	Q9GZQ4	NMUR2_HUMAN	neuromedin U receptor 2	41					activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|arachidonic acid secretion (GO:0050482)|calcium ion transport (GO:0006816)|calcium-mediated signaling (GO:0019722)|cell-cell signaling (GO:0007267)|central nervous system development (GO:0007417)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|feeding behavior (GO:0007631)|grooming behavior (GO:0007625)|inositol phosphate-mediated signaling (GO:0048016)|neuropeptide signaling pathway (GO:0007218)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|reduction of food intake in response to dietary excess (GO:0002023)|regulation of smooth muscle contraction (GO:0006940)|response to pain (GO:0048265)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|GTP binding (GO:0005525)|intracellular calcium activated chloride channel activity (GO:0005229)|neuromedin U binding (GO:0042924)|neuromedin U receptor activity (GO:0001607)			breast(1)|endometrium(1)|kidney(2)|large_intestine(12)|liver(1)|lung(15)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	44		Medulloblastoma(196;0.091)|all_hematologic(541;0.103)	Kidney(363;0.000106)|KIRC - Kidney renal clear cell carcinoma(527;0.000672)			AAGTGGCTGCGCCGAGGTCCG	0.537																																						dbGAP											0			5											97.0	93.0	94.0					5																	151784554		2203	4300	6503	151764747	SO:0001583	missense	0			AF242874	CCDS4321.1	5q33.1	2012-08-08		2004-05-28	ENSG00000132911	ENSG00000132911		"""GPCR / Class A : Neuromedin U receptors"""	16454	protein-coding gene	gene with protein product		605108		NMU2R		8940772, 10894543	Standard	NM_020167		Approved		uc003luv.2	Q9GZQ4	OTTHUMG00000130131	ENST00000255262.3:c.121C>T	5.37:g.151784554G>A	ENSP00000255262:p.Arg41Cys	Somatic	88	3.26	3		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	151764747	57	29.27	24	Q7LC54|Q96AM5|Q9NRA6	Missense_Mutation	SNP	HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1,superfamily_Family A G protein-coupled receptor-like	p.R41C	ENST00000255262.3	37	c.121	CCDS4321.1	5	.	.	.	.	.	.	.	.	.	.	G	17.28	3.348860	0.61183	.	.	ENSG00000132911	ENST00000255262	T	0.38077	1.16	5.54	3.5	0.40072	.	0.000000	0.64402	D	0.000007	T	0.61311	0.2337	M	0.80746	2.51	0.54753	D	0.999988	D	0.89917	1.0	D	0.76575	0.988	T	0.69101	-0.5234	10	0.72032	D	0.01	-24.3232	14.9967	0.71436	0.0:0.0:0.7298:0.2702	.	41	Q9GZQ4	NMUR2_HUMAN	C	41	ENSP00000255262:R41C	ENSP00000255262:R41C	R	-	1	0	NMUR2	151764747	1.000000	0.71417	0.854000	0.33618	0.790000	0.44656	3.934000	0.56553	1.285000	0.44548	0.655000	0.94253	CGC	-	superfamily_Family A G protein-coupled receptor-like		0.537	NMUR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NMUR2	protein_coding	OTTHUMT00000252439.1	G	NM_020167		151764747	-1	no_errors	NM_020167.4	genbank	human	reviewed	54_36p	missense	SNP	0.866	A
VLDLR	7436	genome.wustl.edu	37	9	2652945	2652945	+	Missense_Mutation	SNP	C	C	G			TCGA-AB-2949-03A-01W-0733-08	TCGA-AB-2949-11A-01W-0732-08	C	C	C	G	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	93918a62-e102-4cf1-a403-81845f830c3e	ed5227d3-b5bf-4356-a6c2-3af0065be735	g.chr9:2652945C>G	ENST00000382100.3	+	18	2938	c.2582C>G	c.(2581-2583)cCa>cGa	p.P861R	VLDLR_ENST00000382099.2_Missense_Mutation_p.P833R	NM_003383.3	NP_003374.3	P98155	VLDLR_HUMAN	very low density lipoprotein receptor	861					cholesterol metabolic process (GO:0008203)|glycoprotein transport (GO:0034436)|lipid transport (GO:0006869)|memory (GO:0007613)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|positive regulation of dendrite development (GO:1900006)|positive regulation of protein kinase activity (GO:0045860)|receptor-mediated endocytosis (GO:0006898)|reelin-mediated signaling pathway (GO:0038026)|signal transduction (GO:0007165)|ventral spinal cord development (GO:0021517)|very-low-density lipoprotein particle clearance (GO:0034447)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|very-low-density lipoprotein particle (GO:0034361)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|glycoprotein binding (GO:0001948)|glycoprotein transporter activity (GO:0034437)|low-density lipoprotein receptor activity (GO:0005041)|reelin receptor activity (GO:0038025)|very-low-density lipoprotein particle binding (GO:0034189)|very-low-density lipoprotein particle receptor activity (GO:0030229)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(6)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	24				GBM - Glioblastoma multiforme(50;0.0668)|Lung(218;0.123)		CACACGTACCCAGCAGTAAGT	0.448																																						dbGAP											0			9											141.0	126.0	131.0					9																	2652945		2203	4300	6503	2642945	SO:0001583	missense	0				CCDS6446.1, CCDS34979.1	9p24	2014-01-24			ENSG00000147852	ENSG00000147852		"""Low density lipoprotein receptors"""	12698	protein-coding gene	gene with protein product		192977				8294473	Standard	XM_006716864		Approved	CARMQ1, CHRMQ1, VLDLRCH	uc003zhk.1	P98155	OTTHUMG00000019447	ENST00000382100.3:c.2582C>G	9.37:g.2652945C>G	ENSP00000371532:p.Pro861Arg	Somatic	76	1.30	1		1	0.00	0	WXS	Illumina HiSeq	Phase_IV	2642945	53	50.00	53	B2RMZ7|D3DRH6|Q5VVF6	Missense_Mutation	SNP	HMMPfam_Ldl_recept_b,HMMSmart_SM00135,PatternScan_ASX_HYDROXYL,HMMSmart_SM00179,HMMPfam_Ldl_recept_a,HMMSmart_SM00192,PatternScan_LDLRA_1,superfamily_LDL receptor-like module,HMMPfam_EGF,HMMSmart_SM00181,PatternScan_EGF_2,HMMPfam_EGF_CA,PatternScan_EGF_CA,superfamily_EGF/Laminin,superfamily_YWTD domain	p.P861R	ENST00000382100.3	37	c.2582	CCDS6446.1	9	.	.	.	.	.	.	.	.	.	.	C	27.3	4.815020	0.90790	.	.	ENSG00000147852	ENST00000382100;ENST00000382099;ENST00000382092	T;T	0.73681	-0.77;-0.77	5.58	5.58	0.84498	.	0.000000	0.52532	D	0.000066	D	0.88066	0.6337	M	0.82517	2.595	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.997	D;D;D	0.97110	1.0;0.999;0.937	D	0.88863	0.3327	10	0.87932	D	0	.	19.9348	0.97133	0.0:1.0:0.0:0.0	.	833;833;861	P98155-2;Q5VVF5;P98155	.;.;VLDLR_HUMAN	R	861;833;740	ENSP00000371532:P861R;ENSP00000371531:P833R	ENSP00000371524:P740R	P	+	2	0	VLDLR	2642945	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.776000	0.85560	2.789000	0.95967	0.591000	0.81541	CCA	-	NULL		0.448	VLDLR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VLDLR	protein_coding	OTTHUMT00000051519.2	C	NM_003383		2642945	+1	no_errors	NM_003383.1	genbank	human	validated	54_36p	missense	SNP	1.000	G
CHD4	1108	genome.wustl.edu	37	12	6701583	6701583	+	Missense_Mutation	SNP	C	C	T			TCGA-AB-2949-03A-01W-0733-08	TCGA-AB-2949-11A-01W-0732-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	93918a62-e102-4cf1-a403-81845f830c3e	ed5227d3-b5bf-4356-a6c2-3af0065be735	g.chr12:6701583C>T	ENST00000357008.2	-	19	3087	c.2924G>A	c.(2923-2925)cGt>cAt	p.R975H	CHD4_ENST00000544040.1_Missense_Mutation_p.R968H|CHD4_ENST00000544484.1_Missense_Mutation_p.R972H|CHD4_ENST00000309577.6_Missense_Mutation_p.R975H	NM_001273.2	NP_001264.2	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	975					ATP-dependent chromatin remodeling (GO:0043044)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spindle assembly (GO:0051225)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|RNA polymerase II repressing transcription factor binding (GO:0001103)|zinc ion binding (GO:0008270)	p.R975H(10)		central_nervous_system(2)	2						CAGCTCCACACGCACAATTAG	0.517																																					Colon(32;586 792 4568 16848 45314)	dbGAP											10	Substitution - Missense(10)	endometrium(8)|large_intestine(2)	12											88.0	82.0	84.0					12																	6701583		2203	4300	6503	6571844	SO:0001583	missense	0			X86691	CCDS8552.1	12p13	2013-01-28				ENSG00000111642		"""Zinc fingers, PHD-type"""	1919	protein-coding gene	gene with protein product		603277				7575689, 8843877	Standard	XM_006718958		Approved	Mi-2b, Mi2-BETA	uc001qpo.3	Q14839		ENST00000357008.2:c.2924G>A	12.37:g.6701583C>T	ENSP00000349508:p.Arg975His	Somatic	198	3.86	8		175	27.69	67	WXS	Illumina HiSeq	Phase_IV	6571844	146	26.87	54	Q8IXZ5	Missense_Mutation	SNP	HMMPfam_SNF2_N,HMMPfam_Chromo,HMMSmart_SM00298,PatternScan_CHROMO_1,HMMPfam_Helicase_C,HMMSmart_SM00490,HMMSmart_SM00249,PatternScan_DEAH_ATP_HELICASE,HMMPfam_DUF1086,HMMPfam_DUF1087,superfamily_FYVE/PHD zinc finger,HMMPfam_CHDCT2,HMMPfam_CHDNT,HMMSmart_SM00487,superfamily_Chromo domain-like,PatternScan_ZF_PHD_1,HMMPfam_PHD,superfamily_P-loop containing nucleoside triphosphate hydrolases	p.R975H	ENST00000357008.2	37	c.2924	CCDS8552.1	12	.	.	.	.	.	.	.	.	.	.	C	33	5.253892	0.95336	.	.	ENSG00000111642	ENST00000544484;ENST00000544040;ENST00000309577;ENST00000357008;ENST00000537464	T;T;T;T	0.75821	-0.97;-0.97;-0.97;-0.97	5.4	5.4	0.78164	SNF2-related (1);	0.000000	0.85682	D	0.000000	T	0.82024	0.4947	L	0.37630	1.12	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.97110	0.997;1.0;0.994	D	0.83812	0.0242	10	0.87932	D	0	.	19.1812	0.93623	0.0:1.0:0.0:0.0	.	975;975;968	Q14839-2;Q14839;F5GWX5	.;CHD4_HUMAN;.	H	972;968;975;975;949	ENSP00000440392:R972H;ENSP00000440542:R968H;ENSP00000312419:R975H;ENSP00000349508:R975H	ENSP00000312419:R975H	R	-	2	0	CHD4	6571844	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.743000	0.85020	2.530000	0.85305	0.563000	0.77884	CGT	-	HMMPfam_SNF2_N		0.517	CHD4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD4	protein_coding		C	NM_001273		6571844	-1	no_errors	NM_001273.2	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
ORAI1	84876	genome.wustl.edu	37	12	122078953	122078953	+	Missense_Mutation	SNP	A	A	G			TCGA-AB-2949-03A-01W-0733-08	TCGA-AB-2949-11A-01W-0732-08	A	A	A	G	A	A	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	93918a62-e102-4cf1-a403-81845f830c3e	ed5227d3-b5bf-4356-a6c2-3af0065be735	g.chr12:122078953A>G	ENST00000330079.7	+	2	509	c.316A>G	c.(316-318)Atg>Gtg	p.M106V		NM_032790.3	NP_116179	Q96D31	CRCM1_HUMAN	ORAI calcium release-activated calcium modulator 1	104					blood coagulation (GO:0007596)|immune system process (GO:0002376)|positive regulation of calcium ion transport (GO:0051928)|regulation of calcium ion transport (GO:0051924)|store-operated calcium entry (GO:0002115)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|protein complex (GO:0043234)	identical protein binding (GO:0042802)|store-operated calcium channel activity (GO:0015279)			breast(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|upper_aerodigestive_tract(1)	11	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000415)|Epithelial(86;0.00148)		GCAGGTGGCAATGGTGGAGGT	0.637																																						dbGAP											0			12											29.0	33.0	31.0					12																	122078953		2203	4299	6502	120563336	SO:0001583	missense	0			AK027372		12q24.31	2014-09-17	2007-08-14	2007-08-14	ENSG00000182500	ENSG00000276045		"""ORAI calcium release-activated calcium modulators"""	25896	protein-coding gene	gene with protein product	"""calcium release-activated calcium modulator 1"""	610277	"""transmembrane protein 142A"""	TMEM142A		16582901	Standard	NM_032790		Approved	FLJ14466, CRACM1	uc021rff.1	Q96D31		ENST00000330079.7:c.316A>G	12.37:g.122078953A>G	ENSP00000328216:p.Met106Val	Somatic	129	2.24	3		107	37.43	64	WXS	Illumina HiSeq	Phase_IV	120563336	52	29.73	22	Q3MHV3|Q6DHX2|Q96BP7|Q96K71	Missense_Mutation	SNP	HMMPfam_DUF1650	p.M106V	ENST00000330079.7	37	c.316	CCDS41851.1	12	.	.	.	.	.	.	.	.	.	.	A	19.06	3.753142	0.69648	.	.	ENSG00000182500	ENST00000330079;ENST00000537188	T;T	0.48522	0.81;0.81	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.68833	0.3044	M	0.75615	2.305	0.80722	D	1	D	0.59357	0.985	D	0.72338	0.977	T	0.72304	-0.4333	10	0.66056	D	0.02	-32.9328	15.9343	0.79691	1.0:0.0:0.0:0.0	.	104	Q96D31	CRCM1_HUMAN	V	106;1	ENSP00000328216:M106V;ENSP00000441198:M1V	ENSP00000328216:M106V	M	+	1	0	ORAI1	120563336	1.000000	0.71417	0.985000	0.45067	0.811000	0.45836	9.287000	0.95975	2.228000	0.72767	0.482000	0.46254	ATG	-	HMMPfam_DUF1650		0.637	ORAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ORAI1	protein_coding	OTTHUMT00000402151.1	A	NM_032790		120563336	+1	no_errors	NM_032790.3	genbank	human	reviewed	54_36p	missense	SNP	0.997	G
NRXN3	9369	genome.wustl.edu	37	14	79175740	79175740	+	Missense_Mutation	SNP	A	A	G			TCGA-AB-2949-03A-01W-0733-08	TCGA-AB-2949-11A-01W-0732-08	A	A	A	G	A	A	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	93918a62-e102-4cf1-a403-81845f830c3e	ed5227d3-b5bf-4356-a6c2-3af0065be735	g.chr14:79175740A>G	ENST00000554719.1	+	4	774	c.283A>G	c.(283-285)Atg>Gtg	p.M95V	RP11-232C2.2_ENST00000555680.1_RNA|NRXN3_ENST00000335750.5_Missense_Mutation_p.M95V	NM_004796.4	NP_004787.2	Q9HDB5	NRX3B_HUMAN	neurexin 3	0	Laminin G-like. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|angiogenesis (GO:0001525)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(23)|lung(40)|ovary(3)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(9)|urinary_tract(1)	104		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		CACTAAACGTATGGGCTCCAT	0.522																																						dbGAP											0			14											134.0	117.0	123.0					14																	79175740		2203	4300	6503	78245493	SO:0001583	missense	0			AB018286	CCDS9870.1, CCDS9871.1, CCDS45145.1, CCDS61515.1	14q31	2010-01-19				ENSG00000021645			8010	protein-coding gene	gene with protein product		600567	"""chromosome 14 open reading frame 60"""	C14orf60		11944992, 12379233	Standard	NM_004796		Approved	KIAA0743	uc001xun.4	Q9HDB5		ENST00000554719.1:c.283A>G	14.37:g.79175740A>G	ENSP00000451648:p.Met95Val	Somatic	115	1.71	2		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	78245493	50	33.77	26	A5PKW8|A8MPU5|B3KPM7|Q6NUR0|Q8IUD8	Missense_Mutation	SNP	PatternScan_ASX_HYDROXYL,HMMSmart_LamG,HMMSmart_4.1m,HMMPfam_EGF,HMMSmart_EGF,superfamily_ConA_like_lec_gl,HMMPfam_Laminin_G_2	p.M95V	ENST00000554719.1	37	c.283	CCDS9870.1	14	.	.	.	.	.	.	.	.	.	.	A	10.78	1.445869	0.25987	.	.	ENSG00000021645	ENST00000330071;ENST00000332068;ENST00000553631;ENST00000554719;ENST00000335750;ENST00000557081	T;T;T;T	0.78364	-1.15;-1.17;-1.17;-1.15	5.38	5.38	0.77491	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);	0.143683	0.64402	D	0.000009	T	0.52948	0.1766	N	0.02120	-0.675	0.39591	D	0.969581	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.002	T	0.54282	-0.8317	9	.	.	.	.	15.3852	0.74691	1.0:0.0:0.0:0.0	.	468;95	Q9Y4C0;Q9Y4C0-3	NRX3A_HUMAN;.	V	468;466;39;95;95;39	ENSP00000451947:M39V;ENSP00000451648:M95V;ENSP00000338349:M95V;ENSP00000450462:M39V	.	M	+	1	0	NRXN3	78245493	1.000000	0.71417	0.997000	0.53966	0.918000	0.54935	4.447000	0.60020	2.037000	0.60232	0.460000	0.39030	ATG	-	HMMSmart_LamG,superfamily_ConA_like_lec_gl		0.522	NRXN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NRXN3	protein_coding	OTTHUMT00000413787.1	A	NM_001105250		78245493	+1	no_errors	NM_004796.1	genbank	human	reviewed	54_36p	missense	SNP	0.998	G
Unknown	0	genome.wustl.edu	37	15	20467150	20467150	+	IGR	SNP	G	G	C			TCGA-AB-2949-03A-01W-0733-08	TCGA-AB-2949-11A-01W-0732-08	G	G	G	C	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	93918a62-e102-4cf1-a403-81845f830c3e	ed5227d3-b5bf-4356-a6c2-3af0065be735	g.chr15:20467150G>C								RP11-173D3.1 (113944 upstream) : CHEK2P2 (20846 downstream)																							CCCATCTGCCGCGTGGGTGGG	0.577																																						dbGAP											0			15																																								18727164	SO:0001628	intergenic_variant	0																															15.37:g.20467150G>C		Somatic	276	2.44	7		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	18727164	53	32.91	26		RNA	SNP	-	NULL		37	NULL		15																																																																																			-	-	0	0.577					LOC646090			G			18727164	-1	pseudogene	XR_017120.2	genbank	human	model	54_36p	rna	SNP	0.961	C
SUZ12	23512	genome.wustl.edu	37	17	30310021	30310022	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-AB-2949-03A-01W-0733-08	TCGA-AB-2949-11A-01W-0732-08	CT	CT	CT	-	CT	CT	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	93918a62-e102-4cf1-a403-81845f830c3e	ed5227d3-b5bf-4356-a6c2-3af0065be735	g.chr17:30310021_30310022delCT	ENST00000322652.5	+	9	1150_1151	c.921_922delCT	c.(919-924)cgcttafs	p.L308fs	SUZ12_ENST00000580398.1_Frame_Shift_Del_p.L285fs	NM_015355.2	NP_056170.2	Q15022	SUZ12_HUMAN	SUZ12 polycomb repressive complex 2 subunit	308					histone ubiquitination (GO:0016574)|negative regulation of cell differentiation (GO:0045596)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell proliferation (GO:0008284)|transcription, DNA-templated (GO:0006351)	ESC/E(Z) complex (GO:0035098)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|sex chromatin (GO:0001739)	chromatin binding (GO:0003682)|histone methyltransferase activity (GO:0042054)|metal ion binding (GO:0046872)|methylated histone binding (GO:0035064)|RNA binding (GO:0003723)|sequence-specific DNA binding (GO:0043565)		SSH2/SUZ12(2)|JAZF1/SUZ12(133)	breast(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(4)|lung(5)|skin(1)	21		Myeloproliferative disorder(56;0.0255)|all_hematologic(16;0.041)|Ovarian(249;0.182)|Breast(31;0.231)				CTAACAGGCGCTTACAGCTTTT	0.332			T	JAZF1	endometrial stromal tumours																																	dbGAP		Dom	yes		17	17q11.2	23512	suppressor of zeste 12 homolog (Drosophila)		M	0			17																																								27334135	SO:0001589	frameshift_variant	0			D63881	CCDS11270.1	17q21	2013-06-05	2013-06-05		ENSG00000178691	ENSG00000178691		"""Zinc fingers, C2H2-type"""	17101	protein-coding gene	gene with protein product		606245	"""suppressor of zeste 12 homolog (Drosophila)"""			8590280, 11371647, 18784248	Standard	NM_015355		Approved	JJAZ1, KIAA0160, CHET9	uc002hgs.2	Q15022	OTTHUMG00000132813	ENST00000322652.5:c.921_922delCT	17.37:g.30310021_30310022delCT	ENSP00000316578:p.Leu308fs	Somatic	0	4.08	2		0	0.00	0	WXS	Illumina HiSeq	Phase_IV	27334134	0	40.74	11	Q96BD9	Frame_Shift_Del	DEL	PatternScan_ZINC_FINGER_C2H2_1,HMMSmart_ZnF_C2H2,HMMPfam_VEFS-Box	p.L308fs	ENST00000322652.5	37	c.921_922	CCDS11270.1	17																																																																																			-	NULL		0.332	SUZ12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUZ12	protein_coding	OTTHUMT00000256260.2	CT	NM_015355		27334135	+1	no_errors	NM_015355.2	genbank	human	reviewed	54_36p	frame_shift_del	DEL	0.998:0.998	-
CCL11	6356	genome.wustl.edu	37	17	32614641	32614641	+	Missense_Mutation	SNP	C	C	T			TCGA-AB-2949-03A-01W-0733-08	TCGA-AB-2949-11A-01W-0732-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	93918a62-e102-4cf1-a403-81845f830c3e	ed5227d3-b5bf-4356-a6c2-3af0065be735	g.chr17:32614641C>T	ENST00000305869.3	+	3	367	c.226C>T	c.(226-228)Ccc>Tcc	p.P76S		NM_002986.2	NP_002977.1	P51671	CCL11_HUMAN	chemokine (C-C motif) ligand 11	76					actin filament organization (GO:0007015)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cell adhesion (GO:0007155)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|chronic inflammatory response (GO:0002544)|cytoskeleton organization (GO:0007010)|eosinophil chemotaxis (GO:0048245)|ERK1 and ERK2 cascade (GO:0070371)|immune response (GO:0006955)|inflammatory response (GO:0006954)|mammary duct terminal end bud growth (GO:0060763)|mast cell chemotaxis (GO:0002551)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of Rac GTPase activity (GO:0032855)|protein phosphorylation (GO:0006468)|regulation of cell shape (GO:0008360)|response to interleukin-4 (GO:0070670)|response to radiation (GO:0009314)|response to virus (GO:0009615)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	chemokine activity (GO:0008009)			breast(1)|lung(1)|prostate(1)	3	Breast(3;0.00224)	Breast(31;0.151)|Ovarian(249;0.17)		BRCA - Breast invasive adenocarcinoma(366;0.155)		CTGTGCCGACCCCAAGAAGAA	0.438																																						dbGAP											0			17											76.0	70.0	72.0					17																	32614641		2203	4300	6503	29638754	SO:0001583	missense	0			AB063614	CCDS11279.1	17q21.1-q21.2	2013-02-25	2002-08-22	2002-08-23	ENSG00000172156	ENSG00000172156		"""Chemokine ligands"", ""Endogenous ligands"""	10610	protein-coding gene	gene with protein product	"""eotaxin-1"""	601156	"""small inducible cytokine subfamily A (Cys-Cys), member 11 (eotaxin)"""	SCYA11		9169149	Standard	NM_002986		Approved	eotaxin, MGC22554	uc002hia.1	P51671	OTTHUMG00000132884	ENST00000305869.3:c.226C>T	17.37:g.32614641C>T	ENSP00000302234:p.Pro76Ser	Somatic	53	1.82	1		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	29638754	49	42.35	36	P50877|Q92490|Q92491	Missense_Mutation	SNP	PatternScan_SMALL_CYTOKINES_CC,HMMPfam_IL8,HMMSmart_SM00199,superfamily_Interleukin 8-like chemokines	p.P76S	ENST00000305869.3	37	c.226	CCDS11279.1	17	.	.	.	.	.	.	.	.	.	.	C	17.23	3.336318	0.60963	.	.	ENSG00000172156	ENST00000305869	T	0.18174	2.23	5.1	5.1	0.69264	Chemokine interleukin-8-like domain (3);	0.000000	0.53938	D	0.000060	T	0.40398	0.1115	.	.	.	0.42641	D	0.993415	D	0.64830	0.994	D	0.66084	0.941	T	0.21042	-1.0257	9	0.87932	D	0	.	14.1919	0.65644	0.0:1.0:0.0:0.0	.	76	P51671	CCL11_HUMAN	S	76	ENSP00000302234:P76S	ENSP00000302234:P76S	P	+	1	0	CCL11	29638754	0.616000	0.27035	0.999000	0.59377	0.496000	0.33645	2.229000	0.42990	2.813000	0.96785	0.561000	0.74099	CCC	-	HMMPfam_IL8,HMMSmart_SM00199,superfamily_Interleukin 8-like chemokines		0.438	CCL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCL11	protein_coding	OTTHUMT00000256377.2	C	NM_002986		29638754	+1	no_errors	NM_002986.2	genbank	human	reviewed	54_36p	missense	SNP	0.992	T
NCOA3	8202	genome.wustl.edu	37	20	46264338	46264338	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AB-2949-03A-01W-0733-08	TCGA-AB-2949-11A-01W-0732-08	A	A	A	-	A	A	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	93918a62-e102-4cf1-a403-81845f830c3e	ed5227d3-b5bf-4356-a6c2-3af0065be735	g.chr20:46264338delA	ENST00000371998.3	+	11	1576	c.1385delA	c.(1384-1386)aacfs	p.N462fs	NCOA3_ENST00000371997.3_Frame_Shift_Del_p.N472fs|NCOA3_ENST00000341724.6_Frame_Shift_Del_p.N472fs|NCOA3_ENST00000372004.3_Frame_Shift_Del_p.N462fs			Q9Y6Q9	NCOA3_HUMAN	nuclear receptor coactivator 3	462					androgen receptor signaling pathway (GO:0030521)|developmental growth (GO:0048589)|histone acetylation (GO:0016573)|labyrinthine layer morphogenesis (GO:0060713)|mammary gland branching involved in thelarche (GO:0060744)|multicellular organism growth (GO:0035264)|positive regulation of gene expression (GO:0010628)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|receptor transactivation (GO:0035624)|regulation of RNA biosynthetic process (GO:2001141)|transcription, DNA-templated (GO:0006351)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|signal transducer activity (GO:0004871)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			breast(3)|endometrium(3)|kidney(4)|large_intestine(12)|lung(19)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						TATGGGCTCAACATGAGTAGC	0.507																																						dbGAP											0			20											72.0	68.0	70.0					20																	46264338		2203	4300	6503	45697745	SO:0001589	frameshift_variant	0			AF012108	CCDS13406.1, CCDS13407.1, CCDS54472.1	20q12	2011-07-01			ENSG00000124151	ENSG00000124151		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7670	protein-coding gene	gene with protein product	"""receptor-associated coactivator 3"", ""thyroid hormone receptor activator molecule 1"""	601937				9252329, 9346901	Standard	NM_181659		Approved	RAC3, AIB1, ACTR, p/CIP, TRAM-1, CAGH16, TNRC16, KAT13B, bHLHe42, SRC-3, SRC3	uc002xtk.3	Q9Y6Q9	OTTHUMG00000033061	ENST00000371998.3:c.1385delA	20.37:g.46264338delA	ENSP00000361066:p.Asn462fs	Somatic	141	0.00	0		28	0.00	0	WXS	Illumina HiSeq	Phase_IV	45697745	92	0.00	0	A4LAZ5|Q0VF45|Q5JYD9|Q5JYE0|Q9BR49|Q9UPC9|Q9UPG4|Q9UPG7	Frame_Shift_Del	DEL	HMMSmart_SM00091,HMMPfam_HLH,HMMSmart_SM00353,superfamily_Nuclear receptor coactivator interlocking domain,HMMPfam_DUF1518,superfamily_HLH helix-loop-helix DNA-binding domain,HMMPfam_PAS,HMMPfam_Nuc_rec_co-act,HMMPfam_SRC-1,superfamily_PYP-like sensor domain (PAS domain)	p.N462fs	ENST00000371998.3	37	c.1385	CCDS13407.1	20																																																																																			-	NULL		0.507	NCOA3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NCOA3	protein_coding	OTTHUMT00000080405.1	A	NM_006534		45697745	+1	no_errors	NM_181659.2	genbank	human	reviewed	54_36p	frame_shift_del	DEL	0.984	-
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	DEL	AG	AG	-			TCGA-AB-2949-03A-01W-0733-08	TCGA-AB-2949-11A-01W-0732-08	AG	AG	AG	-	AG	AG	Verified	Invalid:failed_liftOver	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	93918a62-e102-4cf1-a403-81845f830c3e	ed5227d3-b5bf-4356-a6c2-3af0065be735	g.chrUnknown:0delAG								None (None upstream) : None (None downstream)																								0.0																																						dbGAP											0			21																																								35093495	SO:0001628	intergenic_variant	0																															Unknown.37:g.0delAG		Somatic	0	0.00	0		0	0.00	0	WXS	Illumina HiSeq	Phase_IV	35093494	0	0.00	0		Frame_Shift_Del	DEL	superfamily_p53-like transcription factors,HMMPfam_Runt,HMMPfam_RunxI	p.S314fs		37	c.941_940		21																																																																																			-	NULL	0	0					RUNX1			AG			35093495	-1	no_errors	NM_001754.2	genbank	human	reviewed	54_36p	frame_shift_del	DEL	1.000:1.000	-
