#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NormalRefReads_WU	i_NormalVAF_WU	i_NormalVarReads_WU	i_ORegAnno_bin	i_RNARefReads_WU	i_RNAVAF_WU	i_RNAVarReads_WU	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TumorRefReads_WU	i_TumorVAF_WU	i_TumorVarReads_WU	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
ATP1B4	23439	genome.wustl.edu	37	X	119505057	119505057	+	Missense_Mutation	SNP	T	T	C			TCGA-AB-2972-03A-01D-0739-09	TCGA-AB-2972-11A-01D-0739-09	T	T	T	C	T	T	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	6a7deace-79dc-4790-a415-07f0e933eb2a	4c00565d-2fd1-4fa8-ad7f-541683ece1b0	g.chrX:119505057T>C	ENST00000218008.3	+	4	611	c.554T>C	c.(553-555)tTt>tCt	p.F185S	ATP1B4_ENST00000361319.3_Missense_Mutation_p.F181S|ATP1B4_ENST00000539306.1_Missense_Mutation_p.F142S	NM_001142447.2	NP_001135919.1	Q9UN42	AT1B4_HUMAN	ATPase, Na+/K+ transporting, beta 4 polypeptide	185					monovalent inorganic cation transport (GO:0015672)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|nuclear inner membrane (GO:0005637)|sodium:potassium-exchanging ATPase complex (GO:0005890)	monovalent inorganic cation transmembrane transporter activity (GO:0015077)	p.F181S(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(14)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	33						CTAAATGGCTTTCTCCAGGGT	0.453																																						dbGAP											1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	X											104.0	86.0	92.0					X																	119505057		2203	4300	6503	119389085	SO:0001583	missense	0			AF158383	CCDS14598.1, CCDS48158.1	Xq24	2012-10-22	2010-04-20		ENSG00000101892	ENSG00000101892		"""ATPases / P-type"""	808	protein-coding gene	gene with protein product	"""Na,K-ATPase beta m-subunit"""		"""ATPase, (Na+)/K+ transporting, beta 4 polypeptide"""			10456317, 17592128	Standard	NM_012069		Approved		uc004esr.3	Q9UN42	OTTHUMG00000022299	ENST00000218008.3:c.554T>C	X.37:g.119505057T>C	ENSP00000218008:p.Phe185Ser	Somatic	832	0.12	1		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	119389085	339	43.00	258	Q17RR0|Q9UN41	Missense_Mutation	SNP	HMMPfam_Na_K-ATPase,PatternScan_ATPASE_NA_K_BETA_1,PatternScan_ATPASE_NA_K_BETA_2	p.F181S	ENST00000218008.3	37	c.542	CCDS48158.1	X	.	.	.	.	.	.	.	.	.	.	T	15.76	2.927721	0.52759	.	.	ENSG00000101892	ENST00000218008;ENST00000361319;ENST00000539306	T;T;T	0.38560	1.13;1.13;1.13	5.4	5.4	0.78164	.	0.150392	0.64402	D	0.000008	T	0.69495	0.3117	M	0.91920	3.255	0.49687	D	0.999815	D;D;D;D	0.67145	0.984;0.996;0.984;0.98	P;D;P;P	0.71870	0.903;0.975;0.903;0.844	T	0.76838	-0.2811	10	0.87932	D	0	-32.0439	12.094	0.53744	0.0:0.0:0.0:1.0	.	142;150;185;181	B7ZKW0;B7ZKV9;Q9UN42;Q9UN42-2	.;.;AT1B4_HUMAN;.	S	185;181;142	ENSP00000218008:F185S;ENSP00000355346:F181S;ENSP00000443334:F142S	ENSP00000218008:F185S	F	+	2	0	ATP1B4	119389085	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.462000	0.45049	1.789000	0.52484	0.441000	0.28932	TTT	-	HMMPfam_Na_K-ATPase		0.453	ATP1B4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATP1B4	protein_coding	OTTHUMT00000058095.1	T	NM_001142447		119389085	+1	no_errors	NM_012069.1	genbank	human	validated	54_36p	missense	SNP	1.000	C
STAG2	10735	genome.wustl.edu	37	X	123197716	123197716	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AB-2972-03A-01D-0739-09	TCGA-AB-2972-11A-01D-0739-09	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	6a7deace-79dc-4790-a415-07f0e933eb2a	4c00565d-2fd1-4fa8-ad7f-541683ece1b0	g.chrX:123197716C>T	ENST00000371160.1	+	20	2130	c.1840C>T	c.(1840-1842)Cga>Tga	p.R614*	STAG2_ENST00000469481.1_Intron|STAG2_ENST00000218089.9_Nonsense_Mutation_p.R614*|STAG2_ENST00000371157.3_Nonsense_Mutation_p.R614*|STAG2_ENST00000371144.3_Nonsense_Mutation_p.R614*|STAG2_ENST00000371145.3_Nonsense_Mutation_p.R614*|STAG2_ENST00000354548.5_Nonsense_Mutation_p.R545*	NM_001282418.1	NP_001269347.1	Q8N3U4	STAG2_HUMAN	stromal antigen 2	614					meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of DNA endoreduplication (GO:0032876)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	actin cytoskeleton (GO:0015629)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)	p.R614*(1)		breast(5)|central_nervous_system(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(9)|lung(21)|ovary(5)|prostate(2)|skin(5)|urinary_tract(4)	78						TGCCTTATTGCGACAGATCCG	0.353																																						dbGAP											1	Substitution - Nonsense(1)	haematopoietic_and_lymphoid_tissue(1)	X											84.0	72.0	76.0					X																	123197716		2203	4300	6503	123025397	SO:0001587	stop_gained	0			Z75331	CCDS14607.1, CCDS43990.1	Xq25	2014-09-17			ENSG00000101972	ENSG00000101972			11355	protein-coding gene	gene with protein product		300826				9305759	Standard	NM_001042750		Approved	SA-2, SCC3B	uc004eua.3	Q8N3U4	OTTHUMG00000022725	ENST00000371160.1:c.1840C>T	X.37:g.123197716C>T	ENSP00000360202:p.Arg614*	Somatic	587	0.00	0		7	89.23	58	WXS	Illumina HiSeq	Phase_IV	123025397	313	46.03	267	B1AMT5|D3DTF5|O00540|Q5JTI6|Q68DE9|Q9H1N8	Nonsense_Mutation	SNP	HMMPfam_STAG,superfamily_ARM-type_fold	p.R614*	ENST00000371160.1	37	c.1840	CCDS14607.1	X	.	.	.	.	.	.	.	.	.	.	C	39	7.665885	0.98422	.	.	ENSG00000101972	ENST00000218089;ENST00000354548;ENST00000371160;ENST00000371157;ENST00000371145;ENST00000371144	.	.	.	4.95	1.97	0.26223	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09590	T	0.72	-16.8113	13.2787	0.60202	0.4121:0.5879:0.0:0.0	.	.	.	.	X	614;545;614;614;614;614	.	ENSP00000218089:R614X	R	+	1	2	STAG2	123025397	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	0.977000	0.29475	0.320000	0.23234	-0.330000	0.08379	CGA	-	superfamily_ARM-type_fold		0.353	STAG2-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	STAG2	protein_coding	OTTHUMT00000156159.2	C	NM_006603		123025397	+1	no_errors	NM_001042749.1	genbank	human	validated	54_36p	nonsense	SNP	1.000	T
TUFT1	7286	genome.wustl.edu	37	1	151546791	151546791	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2972-03A-01D-0739-09	TCGA-AB-2972-11A-01D-0739-09	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	6a7deace-79dc-4790-a415-07f0e933eb2a	4c00565d-2fd1-4fa8-ad7f-541683ece1b0	g.chr1:151546791G>A	ENST00000368849.3	+	8	702	c.640G>A	c.(640-642)Gcc>Acc	p.A214T	TUFT1_ENST00000392712.3_Missense_Mutation_p.A159T|TUFT1_ENST00000368848.2_Missense_Mutation_p.A189T|TUFT1_ENST00000353024.3_Missense_Mutation_p.A155T|TUFT1_ENST00000538902.1_Missense_Mutation_p.A233T	NM_020127.2	NP_064512.1	Q9NNX1	TUFT1_HUMAN	tuftelin 1	214					bone mineralization (GO:0030282)|odontogenesis (GO:0042476)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	structural constituent of tooth enamel (GO:0030345)	p.A214T(1)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(3)|prostate(1)|skin(1)	13	Ovarian(49;0.0273)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			AAGTAATGTGGCCCTTCAGAG	0.517											OREG0003906	type=REGULATORY REGION|Gene=TUFT1|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																										dbGAP											1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	1											106.0	99.0	101.0					1																	151546791		2203	4300	6503	149813415	SO:0001583	missense	0			AF254260	CCDS1000.1, CCDS44223.1	1q21	2008-02-05			ENSG00000143367	ENSG00000143367			12422	protein-coding gene	gene with protein product		600087				7919663	Standard	NM_020127		Approved		uc001eyl.3	Q9NNX1	OTTHUMG00000012536	ENST00000368849.3:c.640G>A	1.37:g.151546791G>A	ENSP00000357842:p.Ala214Thr	Somatic	912	0.00	0	1741	NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	149813415	308	43.28	235	B2RD57|D3DV21|D3DV22|Q5T384|Q5T385|Q9BU28|Q9H5L1	Missense_Mutation	SNP	NULL	p.A214T	ENST00000368849.3	37	c.640	CCDS1000.1	1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.082640	0.76528	.	.	ENSG00000143367	ENST00000368849;ENST00000392712;ENST00000353024;ENST00000368848;ENST00000538902;ENST00000507671	T;T;T;T;T	0.29397	1.57;1.57;1.57;1.57;1.57	5.01	5.01	0.66863	.	0.313477	0.35525	N	0.003148	T	0.32133	0.0819	L	0.57536	1.79	0.36539	D	0.871209	D;P;P	0.57257	0.979;0.613;0.846	P;P;P	0.56563	0.801;0.69;0.557	T	0.04840	-1.0923	10	0.17832	T	0.49	-12.5761	16.1666	0.81759	0.0:0.0:1.0:0.0	.	233;189;214	F5H607;Q9NNX1-2;Q9NNX1	.;.;TUFT1_HUMAN	T	214;159;155;189;233;189	ENSP00000357842:A214T;ENSP00000376476:A159T;ENSP00000343781:A155T;ENSP00000357841:A189T;ENSP00000437997:A233T	ENSP00000343781:A155T	A	+	1	0	TUFT1	149813415	1.000000	0.71417	0.965000	0.40720	0.526000	0.34562	6.249000	0.72427	2.479000	0.83701	0.655000	0.94253	GCC	-	NULL		0.517	TUFT1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	TUFT1	protein_coding	OTTHUMT00000035022.1	G	NM_020127		149813415	+1	no_errors	NM_020127.1	genbank	human	validated	54_36p	missense	SNP	0.973	A
HMCN1	83872	genome.wustl.edu	37	1	185958621	185958621	+	Splice_Site	SNP	A	A	G			TCGA-AB-2972-03A-01D-0739-09	TCGA-AB-2972-11A-01D-0739-09	A	A	A	G	A	A	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	6a7deace-79dc-4790-a415-07f0e933eb2a	4c00565d-2fd1-4fa8-ad7f-541683ece1b0	g.chr1:185958621A>G	ENST00000271588.4	+	21	3279	c.3050A>G	c.(3049-3051)aAa>aGa	p.K1017R	HMCN1_ENST00000367492.2_Splice_Site_p.K1017R|HMCN1_ENST00000485744.1_3'UTR	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	1017	Ig-like C2-type 7.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.K1017R(1)		NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						GTTTTGCAGAAAGGAGAGCTG	0.418																																						dbGAP											1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	1											99.0	92.0	95.0					1																	185958621		2203	4300	6503	184225244	SO:0001630	splice_region_variant	0			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.3049-1A>G	1.37:g.185958621A>G		Somatic	672	0.15	1		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	184225244	361	48.58	341	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	PatternScan_ASX_HYDROXYL,PatternScan_CECROPIN,HMMPfam_TSP_1,HMMSmart_SM00209,superfamily_TSP-1 type 1 repeat,HMMSmart_SM00179,HMMSmart_SM00406,HMMSmart_SM00408,HMMSmart_SM00409,HMMPfam_EGF,HMMSmart_SM00181,HMMPfam_G2F,HMMSmart_SM00682,superfamily_GFP-like,PatternScan_EGF_2,HMMPfam_EGF_CA,HMMPfam_I-set,HMMPfam_ig,PatternScan_EGF_CA,superfamily_Immunoglobulin,superfamily_vWA-like,superfamily_EGF/Laminin	p.K1017R	ENST00000271588.4	37	c.3050	CCDS30956.1	1	.	.	.	.	.	.	.	.	.	.	A	17.93	3.509817	0.64522	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.39229	1.09;1.09	5.45	5.45	0.79879	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.256199	0.41396	D	0.000895	T	0.51890	0.1701	L	0.33189	0.99	0.34928	D	0.749091	B;D	0.71674	0.054;0.998	B;D	0.72338	0.049;0.977	T	0.58222	-0.7674	10	0.24483	T	0.36	.	15.542	0.76057	1.0:0.0:0.0:0.0	.	401;1017	Q96RW7-3;Q96RW7	.;HMCN1_HUMAN	R	1017	ENSP00000271588:K1017R;ENSP00000356462:K1017R	ENSP00000271588:K1017R	K	+	2	0	HMCN1	184225244	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.593000	0.61034	2.064000	0.61679	0.533000	0.62120	AAA	-	HMMSmart_SM00408,HMMSmart_SM00409,HMMPfam_I-set,superfamily_Immunoglobulin		0.418	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	protein_coding	OTTHUMT00000131848.1	A	NM_031935	Missense_Mutation	184225244	+1	no_errors	NM_031935.2	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
C2orf91	400950	genome.wustl.edu	37	2	42180432	42180432	+	Missense_Mutation	SNP	C	C	G			TCGA-AB-2972-03A-01D-0739-09	TCGA-AB-2972-11A-01D-0739-09	C	C	C	G	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	6a7deace-79dc-4790-a415-07f0e933eb2a	4c00565d-2fd1-4fa8-ad7f-541683ece1b0	g.chr2:42180432C>G	ENST00000378711.2	-	2	93	c.4G>C	c.(4-6)Gtg>Ctg	p.V2L	C2orf91_ENST00000403980.1_5'UTR	NM_001242815.1	NP_001229744.1	Q6ZV80	CB091_HUMAN	chromosome 2 open reading frame 91	2																	GACATCCTCACCATGTGTGAG	0.473																																						dbGAP											0			2																																								42033936	SO:0001583	missense	0				CCDS56116.1	2p21	2012-02-17			ENSG00000205086	ENSG00000205086			42966	protein-coding gene	gene with protein product							Standard	NM_001242815		Approved		uc002rsf.1	Q6ZV80	OTTHUMG00000152307	ENST00000378711.2:c.4G>C	2.37:g.42180432C>G	ENSP00000367983:p.Val2Leu	Somatic	462	0.00	0		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	42033936	219	39.34	142		Missense_Mutation	SNP	NULL	p.V40L	ENST00000378711.2	37	c.118	CCDS56116.1	2	.	.	.	.	.	.	.	.	.	.	C	3.500	-0.101978	0.06967	.	.	ENSG00000205086	ENST00000378711	.	.	.	2.59	-0.295	0.12828	.	.	.	.	.	T	0.12518	0.0304	N	0.08118	0	0.09310	N	1	P	0.37955	0.612	B	0.32342	0.144	T	0.15037	-1.0451	8	0.87932	D	0	.	5.0337	0.14423	0.0:0.5325:0.0:0.4675	.	40	E9PFR4	.	L	2	.	ENSP00000367983:V2L	V	-	1	0	AC013480.1	42033936	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	-0.620000	0.05565	-0.099000	0.12263	-0.350000	0.07774	GTG	-	NULL		0.473	C2orf91-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	uc002rsf.1	protein_coding	OTTHUMT00000325755.1	C	NM_001242815		42033936	-1	no_errors	ENST00000403980	ensembl	human	known	54_36p	missense	SNP	0.000	G
ASTL	431705	genome.wustl.edu	37	2	96801149	96801149	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2972-03A-01D-0739-09	TCGA-AB-2972-11A-01D-0739-09	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	6a7deace-79dc-4790-a415-07f0e933eb2a	4c00565d-2fd1-4fa8-ad7f-541683ece1b0	g.chr2:96801149G>A	ENST00000342380.2	-	3	183	c.184C>T	c.(184-186)Ctc>Ttc	p.L62F		NM_001002036.3	NP_001002036.3			astacin-like metallo-endopeptidase (M12 family)									p.L62F(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(13)|ovary(1)|prostate(1)|skin(2)	30						TCCAGGATGAGCCCTGGGAAA	0.557																																						dbGAP											1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	2											87.0	73.0	78.0					2																	96801149		2203	4300	6503	96164876	SO:0001583	missense	0			AJ537600	CCDS33249.1	2q11.1	2014-07-23	2006-10-10		ENSG00000188886	ENSG00000188886	3.4.24.21		31704	protein-coding gene	gene with protein product	"""sperm acrosomal SLLP1 binding"""	608860	"""astacin-like metalloendopeptidase (M12 family)"""			15087446	Standard	NM_001002036		Approved	ovastacin, SAS1B	uc010yui.2	Q6HA08	OTTHUMG00000155212	ENST00000342380.2:c.184C>T	2.37:g.96801149G>A	ENSP00000343674:p.Leu62Phe	Somatic	664	0.15	1		1	80.00	4	WXS	Illumina HiSeq	Phase_IV	96164876	126	36.95	75		Missense_Mutation	SNP	"HMMPfam_Astacin,HMMSmart_SM00235,superfamily_Metalloproteases (""zincins"") catalytic domain"	p.L62F	ENST00000342380.2	37	c.184	CCDS33249.1	2	.	.	.	.	.	.	.	.	.	.	G	15.62	2.887330	0.52014	.	.	ENSG00000188886	ENST00000342380	T	0.67865	-0.29	4.42	3.52	0.40303	.	0.000000	0.34777	N	0.003687	T	0.68284	0.2984	L	0.34521	1.04	0.28884	N	0.894255	D	0.76494	0.999	D	0.69307	0.963	T	0.61667	-0.7016	10	0.72032	D	0.01	-21.1592	7.6898	0.28561	0.1152:0.0:0.8848:0.0	.	62	Q6HA08	ASTL_HUMAN	F	62	ENSP00000343674:L62F	ENSP00000343674:L62F	L	-	1	0	ASTL	96164876	0.997000	0.39634	1.000000	0.80357	0.447000	0.32167	3.118000	0.50414	2.220000	0.72140	0.650000	0.86243	CTC	-	NULL		0.557	ASTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASTL	protein_coding	OTTHUMT00000338801.1	G			96164876	-1	no_errors	NM_001002036.3	genbank	human	validated	54_36p	missense	SNP	0.996	A
DNAH5	1767	genome.wustl.edu	37	5	13894834	13894834	+	Missense_Mutation	SNP	G	G	T			TCGA-AB-2972-03A-01D-0739-09	TCGA-AB-2972-11A-01D-0739-09	G	G	G	T	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	6a7deace-79dc-4790-a415-07f0e933eb2a	4c00565d-2fd1-4fa8-ad7f-541683ece1b0	g.chr5:13894834G>T	ENST00000265104.4	-	16	2460	c.2356C>A	c.(2356-2358)Caa>Aaa	p.Q786K	CTB-51A17.1_ENST00000503244.1_RNA	NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	786	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.Q786K(1)		NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					AAGCCAGGTTGGAGAGCTTCA	0.423									Kartagener syndrome																													dbGAP											1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	5											170.0	158.0	162.0					5																	13894834		2203	4300	6503	13947834	SO:0001583	missense	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.2356C>A	5.37:g.13894834G>T	ENSP00000265104:p.Gln786Lys	Somatic	1142	0.17	2		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	13947834	577	44.73	467	Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	HMMSmart_AAA,HMMPfam_Dynein_heavy,HMMPfam_AAA_5,HMMPfam_DHC_N1,HMMPfam_DHC_N2,superfamily_Spectrin,superfamily_SSF52540	p.Q786K	ENST00000265104.4	37	c.2356	CCDS3882.1	5	.	.	.	.	.	.	.	.	.	.	G	6.853	0.526663	0.13066	.	.	ENSG00000039139	ENST00000265104	T	0.52295	0.67	5.44	5.44	0.79542	Dynein heavy chain, domain-1 (1);	0.053883	0.85682	D	0.000000	T	0.37732	0.1014	L	0.38953	1.18	0.58432	D	0.999999	B	0.06786	0.001	B	0.14023	0.01	T	0.33624	-0.9861	10	0.02654	T	1	.	19.2435	0.93893	0.0:0.0:1.0:0.0	.	786	Q8TE73	DYH5_HUMAN	K	786	ENSP00000265104:Q786K	ENSP00000265104:Q786K	Q	-	1	0	DNAH5	13947834	1.000000	0.71417	0.975000	0.42487	0.639000	0.38242	8.975000	0.93437	2.551000	0.86045	0.491000	0.48974	CAA	-	HMMPfam_DHC_N1		0.423	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH5	protein_coding	OTTHUMT00000207057.2	G	NM_001369		13947834	-1	no_errors	NM_001369.2	genbank	human	validated	54_36p	missense	SNP	1.000	T
DROSHA	29102	genome.wustl.edu	37	5	31409392	31409392	+	Missense_Mutation	SNP	T	T	A			TCGA-AB-2972-03A-01D-0739-09	TCGA-AB-2972-11A-01D-0739-09	T	T	T	A	T	T	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	6a7deace-79dc-4790-a415-07f0e933eb2a	4c00565d-2fd1-4fa8-ad7f-541683ece1b0	g.chr5:31409392T>A	ENST00000511367.2	-	31	3959	c.3715A>T	c.(3715-3717)Act>Tct	p.T1239S	DROSHA_ENST00000344624.3_Missense_Mutation_p.T1239S|DROSHA_ENST00000513349.1_Missense_Mutation_p.T1202S|DROSHA_ENST00000442743.1_Missense_Mutation_p.T1202S	NM_013235.4	NP_037367.3	Q9NRR4	RNC_HUMAN	drosha, ribonuclease type III	1239	Necessary for interaction with DGCR8 and pri-miRNA processing activity.				defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|gene expression (GO:0010467)|miRNA metabolic process (GO:0010586)|pre-miRNA processing (GO:0031054)|primary miRNA processing (GO:0031053)|ribosome biogenesis (GO:0042254)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|rRNA catabolic process (GO:0016075)	nucleoplasm (GO:0005654)	lipopolysaccharide binding (GO:0001530)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|ribonuclease III activity (GO:0004525)	p.T1239S(1)		breast(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(19)|lung(33)|ovary(2)|skin(1)	66						TTCATGAAAGTATGAACATAT	0.348																																						dbGAP											1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	5											60.0	52.0	54.0					5																	31409392		1834	4092	5926	31445149	SO:0001583	missense	0			AF116910	CCDS47194.1, CCDS47195.1	5q11.2	2010-11-17	2010-10-28	2010-10-28	ENSG00000113360	ENSG00000113360	3.1.26.3		17904	protein-coding gene	gene with protein product	"""drosha, ribonuclease type III"", ""drosha, double-stranded RNA-specific endoribonuclease"""	608828	"""ribonuclease type III, nuclear"""	RNASEN		10713462, 10948199	Standard	NM_013235		Approved	RNASE3L, Etohi2, HSA242976, RN3	uc003jhg.2	Q9NRR4	OTTHUMG00000161976	ENST00000511367.2:c.3715A>T	5.37:g.31409392T>A	ENSP00000425979:p.Thr1239Ser	Somatic	743	0.13	1		35	43.55	27	WXS	Illumina HiSeq	Phase_IV	31445149	308	44.22	245	E7EMP9|Q7Z5V2|Q86YH0|Q9NW73|Q9Y2V9|Q9Y4Y0	Missense_Mutation	SNP	HMMPfam_Ribonuclease_3,HMMSmart_SM00535,PatternScan_RNASE_3_1,superfamily_RNase III catalytic domain-like (Pfam 00636),HMMPfam_dsrm,HMMSmart_SM00358,superfamily_dsRNA-binding domain-like	p.T1239S	ENST00000511367.2	37	c.3715	CCDS47195.1	5	.	.	.	.	.	.	.	.	.	.	T	13.59	2.282234	0.40394	.	.	ENSG00000113360	ENST00000511367;ENST00000344624;ENST00000442743;ENST00000513349;ENST00000265075	T;T;T;T	0.40476	1.03;1.03;1.03;1.03	5.34	5.34	0.76211	Ribonuclease III (3);	0.105501	0.64402	D	0.000005	T	0.27349	0.0671	N	0.11927	0.2	0.58432	D	0.999998	B;B	0.22414	0.069;0.005	B;B	0.24394	0.053;0.024	T	0.07712	-1.0758	10	0.22706	T	0.39	-17.5653	15.3311	0.74212	0.0:0.0:0.0:1.0	.	1202;1239	E7EMP9;Q9NRR4	.;RNC_HUMAN	S	1239;1239;1202;1202;1164	ENSP00000425979:T1239S;ENSP00000339845:T1239S;ENSP00000409335:T1202S;ENSP00000424161:T1202S	ENSP00000265075:T1164S	T	-	1	0	DROSHA	31445149	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.235000	0.78143	2.030000	0.59900	0.533000	0.62120	ACT	-	HMMSmart_SM00535,superfamily_RNase III catalytic domain-like (Pfam 00636)		0.348	DROSHA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RNASEN	protein_coding	OTTHUMT00000366561.3	T	NM_013235		31445149	-1	no_errors	NM_013235.1	genbank	human	validated	54_36p	missense	SNP	1.000	A
DOCK2	1794	genome.wustl.edu	37	5	169127134	169127134	+	Missense_Mutation	SNP	A	A	G			TCGA-AB-2972-03A-01D-0739-09	TCGA-AB-2972-11A-01D-0739-09	A	A	A	G	A	A	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	6a7deace-79dc-4790-a415-07f0e933eb2a	4c00565d-2fd1-4fa8-ad7f-541683ece1b0	g.chr5:169127134A>G	ENST00000256935.8	+	13	1329	c.1249A>G	c.(1249-1251)Atc>Gtc	p.I417V		NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	417					actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)	p.I417V(1)		NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CCCAGAGATCATCATGCCAGG	0.522																																						dbGAP											1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	5											136.0	126.0	129.0					5																	169127134		2203	4300	6503	169059712	SO:0001583	missense	0			BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.1249A>G	5.37:g.169127134A>G	ENSP00000256935:p.Ile417Val	Somatic	877	0.23	2		50	41.86	36	WXS	Illumina HiSeq	Phase_IV	169059712	451	40.21	304	Q2M3I0|Q96AK7	Missense_Mutation	SNP	HMMSmart_SM00326,superfamily_SH3-domain,superfamily_Cytochrome c,HMMPfam_SH3_2	p.I417V	ENST00000256935.8	37	c.1249	CCDS4371.1	5	.	.	.	.	.	.	.	.	.	.	A	28.8	4.948708	0.92660	.	.	ENSG00000134516	ENST00000256935	T	0.05199	3.48	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	T	0.16428	0.0395	M	0.92026	3.265	0.80722	D	1	P	0.47350	0.894	B	0.40410	0.328	T	0.13629	-1.0502	10	0.33940	T	0.23	.	16.3009	0.82811	1.0:0.0:0.0:0.0	.	417	Q92608	DOCK2_HUMAN	V	417	ENSP00000256935:I417V	ENSP00000256935:I417V	I	+	1	0	DOCK2	169059712	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.063000	0.93927	2.246000	0.74042	0.533000	0.62120	ATC	-	NULL		0.522	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK2	protein_coding	OTTHUMT00000252828.2	A	NM_004946		169059712	+1	no_errors	NM_004946.2	genbank	human	validated	54_36p	missense	SNP	1.000	G
GLTSCR1L	23506	genome.wustl.edu	37	6	42797687	42797687	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2972-03A-01D-0739-09	TCGA-AB-2972-11A-01D-0739-09	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	6a7deace-79dc-4790-a415-07f0e933eb2a	4c00565d-2fd1-4fa8-ad7f-541683ece1b0	g.chr6:42797687G>A	ENST00000314073.5	+	6	1792	c.1616G>A	c.(1615-1617)cGg>cAg	p.R539Q	GLTSCR1L_ENST00000394168.1_Missense_Mutation_p.R539Q			Q6AI39	GSC1L_HUMAN	GLTSCR1-like	539								p.R539Q(1)									GGACCTAGTCGGTTCCCTGCT	0.547																																						dbGAP											1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	6											102.0	85.0	91.0					6																	42797687		2203	4300	6503	42905665	SO:0001583	missense	0			AL833540	CCDS34451.1	6p21.1	2012-11-29	2012-11-29	2012-11-29	ENSG00000112624	ENSG00000112624			21111	protein-coding gene	gene with protein product			"""KIAA0240"""	KIAA0240			Standard	XM_005248972		Approved		uc003osp.1	Q6AI39	OTTHUMG00000014706	ENST00000314073.5:c.1616G>A	6.37:g.42797687G>A	ENSP00000313933:p.Arg539Gln	Somatic	794	0.50	4		19	38.71	12	WXS	Illumina HiSeq	Phase_IV	42905665	312	43.63	243	A1L3W2|Q5TFZ3|Q92514	Missense_Mutation	SNP	NULL	p.R539Q	ENST00000314073.5	37	c.1616	CCDS34451.1	6	.	.	.	.	.	.	.	.	.	.	G	20.9	4.068463	0.76301	.	.	ENSG00000112624	ENST00000394167;ENST00000536004;ENST00000314073;ENST00000394168	T;T	0.46819	0.86;0.86	6.07	6.07	0.98685	.	0.091159	0.48767	N	0.000171	T	0.55289	0.1911	L	0.51422	1.61	0.54753	D	0.999985	D;D;D	0.89917	0.998;1.0;1.0	D;D;D	0.83275	0.986;0.996;0.996	T	0.32161	-0.9917	10	0.15066	T	0.55	-25.061	20.6593	0.99626	0.0:0.0:1.0:0.0	.	539;539;539	F5H616;Q6AI39;B7Z2G7	.;K0240_HUMAN;.	Q	539	ENSP00000313933:R539Q;ENSP00000377723:R539Q	ENSP00000313933:R539Q	R	+	2	0	KIAA0240	42905665	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.562000	0.82300	2.885000	0.99019	0.655000	0.94253	CGG	-	NULL		0.547	GLTSCR1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0240	protein_coding	OTTHUMT00000040562.3	G	NM_015349		42905665	+1	no_errors	NM_015349.1	genbank	human	validated	54_36p	missense	SNP	0.988	A
RIMS1	22999	genome.wustl.edu	37	6	72806854	72806854	+	Missense_Mutation	SNP	C	C	T			TCGA-AB-2972-03A-01D-0739-09	TCGA-AB-2972-11A-01D-0739-09	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	6a7deace-79dc-4790-a415-07f0e933eb2a	4c00565d-2fd1-4fa8-ad7f-541683ece1b0	g.chr6:72806854C>T	ENST00000521978.1	+	3	448	c.448C>T	c.(448-450)Cgg>Tgg	p.R150W	RIMS1_ENST00000517960.1_Missense_Mutation_p.R150W|RIMS1_ENST00000348717.5_Missense_Mutation_p.R150W|RIMS1_ENST00000518273.1_Missense_Mutation_p.R150W|RIMS1_ENST00000264839.7_Missense_Mutation_p.R150W|RIMS1_ENST00000520567.1_Missense_Mutation_p.R150W|RIMS1_ENST00000491071.2_Missense_Mutation_p.R150W|RIMS1_ENST00000522291.1_Missense_Mutation_p.R150W	NM_014989.5	NP_055804.2	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	150	RabBD. {ECO:0000255|PROSITE- ProRule:PRU00234}.				calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|glutamate secretion (GO:0014047)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|neurotransmitter secretion (GO:0007269)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|protein complex assembly (GO:0006461)|regulated secretory pathway (GO:0045055)|regulation of catalytic activity (GO:0050790)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of neurotransmitter secretion (GO:0046928)|response to stimulus (GO:0050896)|secretion (GO:0046903)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|visual perception (GO:0007601)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)|small GTPase regulator activity (GO:0005083)	p.R150W(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(25)|liver(4)|lung(35)|ovary(9)|pancreas(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	102		all_epithelial(107;0.179)|all_hematologic(105;0.212)				CGTGTCTCTACGGTCAAACAA	0.468																																						dbGAP											1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	6											71.0	74.0	73.0					6																	72806854		2085	4229	6314	72863575	SO:0001583	missense	0			AB002338	CCDS47449.1, CCDS55029.1, CCDS55030.1, CCDS55031.1, CCDS55032.1, CCDS55033.1	6q12-q13	2008-10-16	2002-06-12	2002-06-14	ENSG00000079841	ENSG00000079841			17282	protein-coding gene	gene with protein product	"""Rab3-interacting molecule"""	606629	"""RAB3 interacting protein 2"""	RAB3IP2, CORD7		9205841, 11438518	Standard	NM_001168407		Approved	RIM, KIAA0340, RIM1	uc003pga.4	Q86UR5	OTTHUMG00000015009	ENST00000521978.1:c.448C>T	6.37:g.72806854C>T	ENSP00000428417:p.Arg150Trp	Somatic	685	0.00	0		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	72863575	522	19.85	130	A7MBN6|B7Z2M0|B7Z2Q9|B7Z3S3|B7Z6S2|E7EX08|E9PCB7|E9PCZ1|E9PF48|E9PHF5|E9PHR1|O15048|Q5JY21|Q5JY25|Q5SZK1|Q8TDY9|Q8TDZ5|Q9HBA1|Q9HBA2|Q9HBA3|Q9HBA4|Q9HBA5|Q9HBA6	Missense_Mutation	SNP	HMMPfam_C2,HMMSmart_SM00239,HMMPfam_PDZ,HMMSmart_SM00228,superfamily_PDZ domain-like,superfamily_C2 domain (Calcium/lipid-binding domain CaLB),superfamily_FYVE/PHD zinc finger,PatternScan_GLYCOSYL_HYDROL_F1_1	p.R150W	ENST00000521978.1	37	c.448	CCDS47449.1	6	.	.	.	.	.	.	.	.	.	.	C	32	5.155237	0.94686	.	.	ENSG00000079841	ENST00000491071;ENST00000350827;ENST00000352008;ENST00000348717;ENST00000349908;ENST00000346609;ENST00000264839;ENST00000517960;ENST00000518273;ENST00000520567;ENST00000522291;ENST00000521978	T;T;T;T;T;T;T;T	0.77489	-1.1;-1.1;-1.1;-1.1;-1.1;-1.1;-1.1;-1.1	5.81	5.81	0.92471	Zinc finger, RING/FYVE/PHD-type (1);Rab-binding domain (1);Zinc finger, FYVE-related (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.52532	D	0.000074	D	0.88930	0.6571	M	0.85542	2.76	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.89543	0.3794	10	0.87932	D	0	-13.5863	20.0804	0.97772	0.0:1.0:0.0:0.0	.	150	Q86UR5	RIMS1_HUMAN	W	150	ENSP00000430101:R150W;ENSP00000275037:R150W;ENSP00000264839:R150W;ENSP00000429959:R150W;ENSP00000430408:R150W;ENSP00000430502:R150W;ENSP00000430932:R150W;ENSP00000428417:R150W	ENSP00000264839:R150W	R	+	1	2	RIMS1	72863575	1.000000	0.71417	0.997000	0.53966	0.835000	0.47333	4.719000	0.61937	2.738000	0.93877	0.655000	0.94253	CGG	-	superfamily_FYVE/PHD zinc finger		0.468	RIMS1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	RIMS1	protein_coding	OTTHUMT00000374968.1	C			72863575	+1	no_errors	NM_014989.3	genbank	human	validated	54_36p	missense	SNP	1.000	T
CALD1	800	genome.wustl.edu	37	7	134613518	134613518	+	Silent	SNP	A	A	C			TCGA-AB-2972-03A-01D-0739-09	TCGA-AB-2972-11A-01D-0739-09	A	A	A	C	A	A	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	6a7deace-79dc-4790-a415-07f0e933eb2a	4c00565d-2fd1-4fa8-ad7f-541683ece1b0	g.chr7:134613518A>C	ENST00000361675.2	+	4	314	c.85A>C	c.(85-87)Agg>Cgg	p.R29R	CALD1_ENST00000543443.1_Silent_p.R34R|CALD1_ENST00000361388.2_Silent_p.R29R|CALD1_ENST00000424922.1_Silent_p.R23R|CALD1_ENST00000422748.1_Silent_p.R29R|CALD1_ENST00000417172.1_Silent_p.R29R|CALD1_ENST00000361901.2_Silent_p.R29R|CALD1_ENST00000393118.2_Silent_p.R23R|CALD1_ENST00000495522.1_Silent_p.R23R			Q05682	CALD1_HUMAN	caldesmon 1	29	Myosin and calmodulin-binding. {ECO:0000250}.				cellular component movement (GO:0006928)|muscle contraction (GO:0006936)	actin cap (GO:0030478)|actin cytoskeleton (GO:0015629)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|calmodulin binding (GO:0005516)|tropomyosin binding (GO:0005523)	p.R29R(1)		NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(15)|lung(10)	43						CGCCTACCAGAGGAATGACGA	0.582																																						dbGAP											1	Substitution - coding silent(1)	haematopoietic_and_lymphoid_tissue(1)	7											51.0	47.0	49.0					7																	134613518		2203	4300	6503	134264058	SO:0001819	synonymous_variant	0			M64110	CCDS5834.1, CCDS5835.1, CCDS5836.1, CCDS47716.1, CCDS47717.1, CCDS5836.2	7q33	2007-04-23			ENSG00000122786	ENSG00000122786			1441	protein-coding gene	gene with protein product		114213				1885618	Standard	NM_004342		Approved	CDM, H-CAD, L-CAD	uc003vrz.3	Q05682	OTTHUMG00000155407	ENST00000361675.2:c.85A>C	7.37:g.134613518A>C		Somatic	790	1.00	8		3	0.00	0	WXS	Illumina HiSeq	Phase_IV	134264058	264	45.90	224	A8K0X1|Q13978|Q13979|Q14741|Q14742|Q9UD91	Silent	SNP	HMMPfam_Caldesmon,PatternScan_PHOSPHOPANTETHEINE	p.R29	ENST00000361675.2	37	c.85	CCDS5835.1	7																																																																																			-	HMMPfam_Caldesmon		0.582	CALD1-005	NOVEL	basic|appris_principal|CCDS	protein_coding	CALD1	protein_coding	OTTHUMT00000339939.1	A	NM_033138		134264058	+1	no_errors	NM_033138.5	genbank	human	reviewed	54_36p	silent	SNP	1.000	C
LARP4B	23185	genome.wustl.edu	37	10	871204	871204	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2972-03A-01D-0739-09	TCGA-AB-2972-11A-01D-0739-09	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	6a7deace-79dc-4790-a415-07f0e933eb2a	4c00565d-2fd1-4fa8-ad7f-541683ece1b0	g.chr10:871204G>A	ENST00000316157.3	-	12	1325	c.1285C>T	c.(1285-1287)Cct>Tct	p.P429S		NM_015155.1	NP_055970.1	Q92615	LAR4B_HUMAN	La ribonucleoprotein domain family, member 4B	429					positive regulation of translation (GO:0045727)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)|polysomal ribosome (GO:0042788)	poly(A) RNA binding (GO:0044822)	p.P429S(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(2)|skin(2)|urinary_tract(2)	38						AATAACCCAGGTCCCCTCTCT	0.398																																						dbGAP											1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	10											111.0	119.0	116.0					10																	871204		2203	4300	6503	861204	SO:0001583	missense	0			D86971	CCDS31131.1	10p15.3	2011-08-24	2009-06-09	2009-06-09	ENSG00000107929	ENSG00000107929		"""La ribonucleoprotein domain containing"""	28987	protein-coding gene	gene with protein product			"""KIAA0217"", ""La ribonucleoprotein domain family, member 5"""	KIAA0217, LARP5		9039502, 20573744	Standard	NM_015155		Approved		uc031ptb.1	Q92615	OTTHUMG00000017534	ENST00000316157.3:c.1285C>T	10.37:g.871204G>A	ENSP00000326128:p.Pro429Ser	Somatic	561	0.18	1		56	49.55	55	WXS	Illumina HiSeq	Phase_IV	861204	285	27.04	106	A7MD20|Q5T3R3|Q5T3R4|Q5T3R5|Q68CY4	Missense_Mutation	SNP	"HMMPfam_La,HMMSmart_SM00715,superfamily_""Winged helix"" DNA-binding domain"	p.P429S	ENST00000316157.3	37	c.1285	CCDS31131.1	10	.	.	.	.	.	.	.	.	.	.	G	10.02	1.235793	0.22626	.	.	ENSG00000107929	ENST00000316157	T	0.30981	1.51	5.57	3.71	0.42584	.	0.198228	0.53938	N	0.000041	T	0.14874	0.0359	N	0.10972	0.075	0.49582	D	0.999806	B	0.14012	0.009	B	0.12156	0.007	T	0.07065	-1.0792	10	0.30854	T	0.27	-12.9374	7.0614	0.25127	0.0682:0.1257:0.6757:0.1304	.	429	Q92615	LAR4B_HUMAN	S	429	ENSP00000326128:P429S	ENSP00000326128:P429S	P	-	1	0	LARP4B	861204	1.000000	0.71417	0.984000	0.44739	0.729000	0.41735	1.490000	0.35573	0.718000	0.32166	0.655000	0.94253	CCT	-	NULL		0.398	LARP4B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LARP5	protein_coding	OTTHUMT00000046395.2	G	NM_015155		861204	-1	no_errors	NM_015155.1	genbank	human	provisional	54_36p	missense	SNP	0.992	A
CCDC186	55088	genome.wustl.edu	37	10	115891901	115891901	+	Missense_Mutation	SNP	A	A	C			TCGA-AB-2972-03A-01D-0739-09	TCGA-AB-2972-11A-01D-0739-09	A	A	A	C	A	A	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	6a7deace-79dc-4790-a415-07f0e933eb2a	4c00565d-2fd1-4fa8-ad7f-541683ece1b0	g.chr10:115891901A>C	ENST00000369287.3	-	11	1964	c.1698T>G	c.(1696-1698)agT>agG	p.S566R	C10orf118_ENST00000543782.1_Missense_Mutation_p.S164R|C10orf118_ENST00000497592.1_5'Flank	NM_018017.2	NP_060487.2	Q7Z3E2	CC186_HUMAN		566								p.S566R(1)		NS(1)|autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(9)|ovary(2)	24		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0161)|all cancers(201;0.0397)		AAGAATTAAGACTTTCCACTT	0.294																																						dbGAP											1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	10											62.0	59.0	60.0					10																	115891901		2201	4300	6501	115881891	SO:0001583	missense	0																														ENST00000369287.3:c.1698T>G	10.37:g.115891901A>C	ENSP00000358293:p.Ser566Arg	Somatic	514	0.39	2		15	34.78	8	WXS	Illumina HiSeq	Phase_IV	115881891	230	48.43	216	Q2M2V6|Q3ZB81|Q6NS91|Q7RTP1|Q8N117|Q8N3G3|Q8N6C2|Q9NWA3	Missense_Mutation	SNP	superfamily_Prefoldin	p.S566R	ENST00000369287.3	37	c.1698	CCDS7587.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	11.61|11.61	1.689822|1.689822	0.29962|0.29962	.|.	.|.	ENSG00000165813|ENSG00000165813	ENST00000428953|ENST00000369287;ENST00000543782;ENST00000430353	T|T;T	0.76186|0.29655	-1.0|1.56;1.56	5.79|5.79	4.66|4.66	0.58398|0.58398	.|.	0.175388|0.175388	0.64402|0.64402	D|D	0.000010|0.000010	T|T	0.28101|0.28101	0.0693|0.0693	L|L	0.41236|0.41236	1.265|1.265	0.35085|0.35085	D|D	0.763786|0.763786	.|P;P	.|0.49090	.|0.859;0.919	.|B;P	.|0.46275	.|0.316;0.51	T|T	0.32955|0.32955	-0.9887|-0.9887	8|10	0.10902|0.25106	T|T	0.67|0.35	.|.	9.7544|9.7544	0.40494|0.40494	0.921:0.0:0.079:0.0|0.921:0.0:0.079:0.0	.|.	.|164;566	.|F6VCB7;Q7Z3E2	.|.;CJ118_HUMAN	A|R	195|566;164;672	ENSP00000415344:S195A|ENSP00000358293:S566R;ENSP00000441576:S164R	ENSP00000415344:S195A|ENSP00000358293:S566R	S|S	-|-	1|3	0|2	C10orf118|C10orf118	115881891|115881891	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	2.327000|2.327000	0.43858|0.43858	1.039000|1.039000	0.40074|0.40074	0.529000|0.529000	0.55759|0.55759	TCT|AGT	-	superfamily_Prefoldin		0.294	C10orf118-006	KNOWN	basic|appris_principal|CCDS	protein_coding	C10orf118	protein_coding	OTTHUMT00000050455.1	A			115881891	-1	no_errors	NM_018017.2	genbank	human	validated	54_36p	missense	SNP	1.000	C
RNU6-779P	0	genome.wustl.edu	37	11	59266511	59266511	+	RNA	SNP	C	C	T			TCGA-AB-2972-03A-01D-0739-09	TCGA-AB-2972-11A-01D-0739-09	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	6a7deace-79dc-4790-a415-07f0e933eb2a	4c00565d-2fd1-4fa8-ad7f-541683ece1b0	g.chr11:59266511C>T	ENST00000516609.1	+	0	47									RNA, U6 small nuclear 779, pseudogene																		caggatggcacgcaatttagt	0.363																																						dbGAP											0			11																																								59023087			0					11q12.1	2013-05-01			ENSG00000252418				47742	pseudogene	RNA, pseudogene							Standard			Approved						11.37:g.59266511C>T		Somatic	662	0.00	0		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	59023087	426	14.60	73		RNA	SNP	-	NULL	ENST00000516609.1	37	NULL		11																																																																																			-	-		0.363	RNU6-779P-201	KNOWN	basic	snRNA	ENSG00000209815	snRNA		C			59023087	+1	pseudogene	ENST00000387080	ensembl	human	novel	54_36p	rna	SNP	0.000	T
FRMD8	83786	genome.wustl.edu	37	11	65161099	65161099	+	Silent	SNP	G	G	A			TCGA-AB-2972-03A-01D-0739-09	TCGA-AB-2972-11A-01D-0739-09	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	6a7deace-79dc-4790-a415-07f0e933eb2a	4c00565d-2fd1-4fa8-ad7f-541683ece1b0	g.chr11:65161099G>A	ENST00000317568.5	+	4	472	c.309G>A	c.(307-309)gaG>gaA	p.E103E	FRMD8_ENST00000416776.2_Intron|FRMD8_ENST00000355991.5_Silent_p.E47E	NM_031904.3	NP_114110.1	Q9BZ67	FRMD8_HUMAN	FERM domain containing 8	103	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.					cytoskeleton (GO:0005856)		p.E103E(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(9)|pancreas(1)|urinary_tract(1)	17						AGTGGCCGGAGCTGCTGCTGC	0.647																																						dbGAP											1	Substitution - coding silent(1)	haematopoietic_and_lymphoid_tissue(1)	11											74.0	57.0	63.0					11																	65161099		2201	4297	6498	64917675	SO:0001819	synonymous_variant	0			AK074850	CCDS8102.1, CCDS73320.1	11q13.1	2007-08-14			ENSG00000126391	ENSG00000126391			25462	protein-coding gene	gene with protein product						12477932	Standard	NM_031904		Approved	FLJ90369, FKSG44	uc001odu.4	Q9BZ67	OTTHUMG00000166275	ENST00000317568.5:c.309G>A	11.37:g.65161099G>A		Somatic	793	0.25	2		8	50.00	8	WXS	Illumina HiSeq	Phase_IV	64917675	136	54.90	168	B4E2P1|Q86V56|Q8NCB5	Silent	SNP	HMMPfam_FERM_M,superfamily_Second domain of FERM,HMMSmart_SM00295	p.E103	ENST00000317568.5	37	c.309	CCDS8102.1	11																																																																																			-	HMMSmart_SM00295		0.647	FRMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRMD8	protein_coding	OTTHUMT00000388833.1	G	NM_031904		64917675	+1	no_errors	NM_031904.3	genbank	human	validated	54_36p	silent	SNP	0.999	A
PTPN11	5781	genome.wustl.edu	37	12	112926884	112926884	+	Missense_Mutation	SNP	T	T	C	rs121918458		TCGA-AB-2972-03A-01D-0739-09	TCGA-AB-2972-11A-01D-0739-09	T	T	T	C	T	T	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	6a7deace-79dc-4790-a415-07f0e933eb2a	4c00565d-2fd1-4fa8-ad7f-541683ece1b0	g.chr12:112926884T>C	ENST00000351677.2	+	13	1702	c.1504T>C	c.(1504-1506)Tca>Cca	p.S502P		NM_002834.3	NP_002825.3	Q06124	PTN11_HUMAN	protein tyrosine phosphatase, non-receptor type 11	506	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.		R -> L (in LEOPARD1). {ECO:0000269|PubMed:15121796}.|R -> W (in LEOPARD1; reduced phosphatase activity). {ECO:0000269|PubMed:15121796, ECO:0000269|PubMed:24891296}.		abortive mitotic cell cycle (GO:0033277)|activation of MAPK activity (GO:0000187)|atrioventricular canal development (GO:0036302)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|brain development (GO:0007420)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage checkpoint (GO:0000077)|ephrin receptor signaling pathway (GO:0048013)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|face morphogenesis (GO:0060325)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|genitalia development (GO:0048806)|glucose homeostasis (GO:0042593)|heart development (GO:0007507)|hormone metabolic process (GO:0042445)|hormone-mediated signaling pathway (GO:0009755)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|insulin receptor signaling pathway (GO:0008286)|integrin-mediated signaling pathway (GO:0007229)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte migration (GO:0050900)|megakaryocyte development (GO:0035855)|multicellular organismal reproductive process (GO:0048609)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cortisol secretion (GO:0051463)|negative regulation of growth hormone secretion (GO:0060125)|negative regulation of insulin secretion (GO:0046676)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ growth (GO:0035265)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet formation (GO:0030220)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of hormone secretion (GO:0046887)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of multicellular organism growth (GO:0040014)|regulation of protein export from nucleus (GO:0046825)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|T cell costimulation (GO:0031295)|triglyceride metabolic process (GO:0006641)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	insulin receptor binding (GO:0005158)|non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|SH3/SH2 adaptor activity (GO:0005070)	p.S502P(6)|p.S502A(1)|p.S502T(1)		NS(1)|autonomic_ganglia(2)|breast(1)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(406)|kidney(2)|large_intestine(6)|lung(16)|ovary(1)|skin(1)|soft_tissue(3)|stomach(3)	451						GTCTCAGAGGTCAGGGATGGT	0.468			Mis		"""JMML, AML, MDS"""		Noonan Syndrome		Noonan syndrome																													dbGAP		Dom	yes		12	12q24.1	5781	"""protein tyrosine phosphatase, non-receptor type 11"""	yes	L	8	Substitution - Missense(8)	haematopoietic_and_lymphoid_tissue(8)	12	GRCh37	CM022450|CM055504	PTPN11	M	rs121918458						179.0	167.0	171.0					12																	112926884		2203	4300	6503	111411267	SO:0001583	missense	0	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	D13540	CCDS9163.1, CCDS58280.1	12q24.1	2014-09-17	2008-07-31		ENSG00000179295	ENSG00000179295		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"", ""SH2 domain containing"""	9644	protein-coding gene	gene with protein product		176876	"""Noonan syndrome 1"""	NS1		7894486, 1280823	Standard	NM_080601		Approved	BPTP3, SH-PTP2, SHP-2, PTP2C, SHP2	uc001ttx.3	Q06124	OTTHUMG00000134334	ENST00000351677.2:c.1504T>C	12.37:g.112926884T>C	ENSP00000340944:p.Ser502Pro	Somatic	1221	0.08	1		20	39.39	13	WXS	Illumina HiSeq	Phase_IV	111411267	570	25.16	192	A8K1D9|Q96HD7	Missense_Mutation	SNP	HMMPfam_Y_phosphatase,HMMSmart_SM00194,HMMPfam_SH2,HMMSmart_SM00252,HMMSmart_SM00404,PatternScan_TYR_PHOSPHATASE_1,superfamily_(Phosphotyrosine protein) phosphatases II,superfamily_SH2 domain	p.S502P	ENST00000351677.2	37	c.1504	CCDS9163.1	12	.	.	.	.	.	.	.	.	.	.	T	32	5.127809	0.94473	.	.	ENSG00000179295	ENST00000351677	D	0.98978	-5.29	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	D	0.97892	0.9307	L	0.41573	1.285	0.80722	D	1	P	0.41214	0.742	P	0.46479	0.518	D	0.98427	1.0580	10	0.45353	T	0.12	.	15.2256	0.73348	0.0:0.0:0.0:1.0	.	502	Q06124-2	.	P	502	ENSP00000340944:S502P	ENSP00000340944:S502P	S	+	1	0	PTPN11	111411267	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.655000	0.83696	2.064000	0.61679	0.528000	0.53228	TCA	-	HMMPfam_Y_phosphatase,HMMSmart_SM00194,HMMSmart_SM00404,superfamily_(Phosphotyrosine protein) phosphatases II		0.468	PTPN11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN11	protein_coding	OTTHUMT00000259496.2	T			111411267	+1	no_errors	NM_002834.3	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
FAM155A	728215	genome.wustl.edu	37	13	108183564	108183564	+	Intron	SNP	G	G	T			TCGA-AB-2972-03A-01D-0739-09	TCGA-AB-2972-11A-01D-0739-09	G	G	G	T	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	6a7deace-79dc-4790-a415-07f0e933eb2a	4c00565d-2fd1-4fa8-ad7f-541683ece1b0	g.chr13:108183564G>T	ENST00000375915.2	-	2	1054				MIR1267_ENST00000408723.1_RNA	NM_001080396.2	NP_001073865.1	B1AL88	F155A_HUMAN	family with sequence similarity 155, member A							integral component of membrane (GO:0016021)				breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33						aatgctggaggtggggattac	0.458																																						dbGAP											0			13											75.0	78.0	77.0					13																	108183564		692	1591	2283	106981565	SO:0001627	intron_variant	0			L10374	CCDS32006.1	13q33.3	2008-04-15			ENSG00000204442	ENSG00000204442			33877	protein-coding gene	gene with protein product							Standard	NM_001080396		Approved		uc001vql.3	B1AL88	OTTHUMG00000017326	ENST00000375915.2:c.916-320461C>A	13.37:g.108183564G>T		Somatic	300	1.32	4		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	106981565	239	40.40	162	B2RUV1|B7Z334	RNA	SNP	-	NULL	ENST00000375915.2	37	NULL	CCDS32006.1	13																																																																																			-	-		0.458	FAM155A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIRN1267	protein_coding	OTTHUMT00000045736.2	G	NM_001080396		106981565	-1	no_errors	ENST00000408723	ensembl	human	known	54_36p	rna	SNP	0.023	T
FANCI	55215	genome.wustl.edu	37	15	89847119	89847119	+	Missense_Mutation	SNP	T	T	A			TCGA-AB-2972-03A-01D-0739-09	TCGA-AB-2972-11A-01D-0739-09	T	T	T	A	T	T	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	6a7deace-79dc-4790-a415-07f0e933eb2a	4c00565d-2fd1-4fa8-ad7f-541683ece1b0	g.chr15:89847119T>A	ENST00000310775.7	+	28	3117	c.3031T>A	c.(3031-3033)Tca>Aca	p.S1011T	FANCI_ENST00000300027.8_Missense_Mutation_p.S951T	NM_001113378.1	NP_001106849.1	Q9NVI1	FANCI_HUMAN	Fanconi anemia, complementation group I	1011					cell cycle (GO:0007049)|DNA repair (GO:0006281)|positive regulation of protein ubiquitination (GO:0031398)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA polymerase binding (GO:0070182)	p.S951T(1)		breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	Lung NSC(78;0.0472)|all_lung(78;0.089)					ATCCTGGACATCAAAGATTTG	0.373								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																													dbGAP											1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	15											98.0	102.0	101.0					15																	89847119		2200	4299	6499	87648123	SO:0001583	missense	0	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	BC004277	CCDS10349.2, CCDS45346.1	15q26.1	2014-09-17	2007-05-03	2007-05-03	ENSG00000140525	ENSG00000140525		"""Fanconi anemia, complementation groups"""	25568	protein-coding gene	gene with protein product		611360	"""KIAA1794"""	KIAA1794		14630800, 17460694, 17412408	Standard	NM_001113378		Approved	FLJ10719	uc010bnp.1	Q9NVI1	OTTHUMG00000132993	ENST00000310775.7:c.3031T>A	15.37:g.89847119T>A	ENSP00000310842:p.Ser1011Thr	Somatic	605	0.82	5		17	65.31	32	WXS	Illumina HiSeq	Phase_IV	87648123	225	43.95	178	A4ZVE4|A5YMH4|A6NJZ0|Q96JN1|Q96ST0|Q9BT96	Missense_Mutation	SNP	NULL	p.S951T	ENST00000310775.7	37	c.2851	CCDS45346.1	15	.	.	.	.	.	.	.	.	.	.	T	5.357	0.251087	0.10130	.	.	ENSG00000140525	ENST00000300027;ENST00000310775;ENST00000447611	T;T;T	0.69435	-0.4;-0.39;0.33	6.03	-5.54	0.02544	.	0.760396	0.12804	N	0.437780	T	0.43722	0.1260	L	0.34521	1.04	0.09310	N	1	B;B;B	0.31625	0.029;0.332;0.332	B;B;B	0.29440	0.029;0.102;0.102	T	0.36841	-0.9731	10	0.18276	T	0.48	0.5435	7.4	0.26958	0.5194:0.0:0.2712:0.2094	.	1011;951;951	Q9NVI1;Q9NVI1-2;Q9NVI1-1	FANCI_HUMAN;.;.	T	951;1011;951	ENSP00000300027:S951T;ENSP00000310842:S1011T;ENSP00000413249:S951T	ENSP00000300027:S951T	S	+	1	0	FANCI	87648123	0.043000	0.20138	0.000000	0.03702	0.546000	0.35178	1.474000	0.35398	-0.421000	0.07416	-0.509000	0.04479	TCA	-	NULL		0.373	FANCI-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FANCI	protein_coding	OTTHUMT00000421140.1	T	NM_018193		87648123	+1	no_errors	NM_018193.1	genbank	human	reviewed	54_36p	missense	SNP	0.084	A
DNAH3	55567	genome.wustl.edu	37	16	20994057	20994057	+	Missense_Mutation	SNP	G	G	C			TCGA-AB-2972-03A-01D-0739-09	TCGA-AB-2972-11A-01D-0739-09	G	G	G	C	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	6a7deace-79dc-4790-a415-07f0e933eb2a	4c00565d-2fd1-4fa8-ad7f-541683ece1b0	g.chr16:20994057G>C	ENST00000261383.3	-	49	7844	c.7845C>G	c.(7843-7845)gaC>gaG	p.D2615E	DNAH3_ENST00000415178.1_3'UTR	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	2615	AAA 4. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)	p.D2615E(2)		NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		CCCGAATGTTGTCATCAAGCT	0.423																																						dbGAP											2	Substitution - Missense(2)	haematopoietic_and_lymphoid_tissue(2)	16											72.0	69.0	70.0					16																	20994057		2201	4300	6501	20901558	SO:0001583	missense	0			U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.7845C>G	16.37:g.20994057G>C	ENSP00000261383:p.Asp2615Glu	Somatic	600	0.00	0		0	0.00	0	WXS	Illumina HiSeq	Phase_IV	20901558	195	47.15	174	O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	HMMSmart_SM00382,HMMPfam_Dynein_heavy,superfamily_Prefoldin,HMMPfam_AAA_5,HMMPfam_DHC_N2,superfamily_P-loop containing nucleoside triphosphate hydrolases	p.D2615E	ENST00000261383.3	37	c.7845	CCDS10594.1	16	.	.	.	.	.	.	.	.	.	.	G	8.385	0.838429	0.16891	.	.	ENSG00000158486	ENST00000261383	T	0.41400	1.0	5.83	1.14	0.20703	Dynein heavy chain, P-loop containing D4 domain (1);	0.061098	0.64402	N	0.000007	T	0.18002	0.0432	N	0.16862	0.45	0.58432	D	0.99999	P	0.39576	0.679	B	0.36959	0.237	T	0.26292	-1.0107	10	0.02654	T	1	.	6.4569	0.21934	0.3338:0.1358:0.5304:0.0	.	2615	Q8TD57	DYH3_HUMAN	E	2615	ENSP00000261383:D2615E	ENSP00000261383:D2615E	D	-	3	2	DNAH3	20901558	0.986000	0.35501	0.968000	0.41197	0.799000	0.45148	1.433000	0.34947	0.359000	0.24239	0.655000	0.94253	GAC	-	superfamily_P-loop containing nucleoside triphosphate hydrolases		0.423	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH3	protein_coding	OTTHUMT00000207361.1	G	NM_017539		20901558	-1	no_errors	NM_017539.1	genbank	human	provisional	54_36p	missense	SNP	0.829	C
ZC3H18	124245	genome.wustl.edu	37	16	88688690	88688690	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AB-2972-03A-01D-0739-09	TCGA-AB-2972-11A-01D-0739-09	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	6a7deace-79dc-4790-a415-07f0e933eb2a	4c00565d-2fd1-4fa8-ad7f-541683ece1b0	g.chr16:88688690C>T	ENST00000301011.5	+	9	1761	c.1561C>T	c.(1561-1563)Cga>Tga	p.R521*	ZC3H18_ENST00000452588.2_Nonsense_Mutation_p.R545*	NM_144604.3	NP_653205.3	Q86VM9	ZCH18_HUMAN	zinc finger CCCH-type containing 18	521						nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.R521*(1)		endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(9)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	42				BRCA - Breast invasive adenocarcinoma(80;0.0542)		CCCTTGGCGCCGATCCAAGTC	0.602																																					Ovarian(121;375 2276 20373 38669)	dbGAP											1	Substitution - Nonsense(1)	haematopoietic_and_lymphoid_tissue(1)	16											54.0	56.0	55.0					16																	88688690		2198	4300	6498	87216191	SO:0001587	stop_gained	0			BC001584	CCDS10967.1, CCDS73924.1	16q24.2-q24.3	2012-07-05			ENSG00000158545	ENSG00000158545		"""Zinc fingers, CCCH-type domain containing"""	25091	protein-coding gene	gene with protein product						17579712	Standard	NM_144604		Approved	NHN1	uc002fky.3	Q86VM9	OTTHUMG00000137679	ENST00000301011.5:c.1561C>T	16.37:g.88688690C>T	ENSP00000301011:p.Arg521*	Somatic	299	0.00	0		26	18.75	6	WXS	Illumina HiSeq	Phase_IV	87216191	83	43.15	63	Q96DG4|Q96MP7	Nonsense_Mutation	SNP	HMMPfam_zf-CCCH,HMMSmart_SM00356	p.R521*	ENST00000301011.5	37	c.1561	CCDS10967.1	16	.	.	.	.	.	.	.	.	.	.	C	41	9.031677	0.99042	.	.	ENSG00000158545	ENST00000301011;ENST00000289509;ENST00000452588	.	.	.	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-13.022	19.7135	0.96105	0.0:1.0:0.0:0.0	.	.	.	.	X	521;489;545	.	ENSP00000289509:R489X	R	+	1	2	ZC3H18	87216191	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	5.482000	0.66833	2.769000	0.95229	0.655000	0.94253	CGA	-	NULL		0.602	ZC3H18-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZC3H18	protein_coding	OTTHUMT00000269168.1	C	NM_144604		87216191	+1	no_errors	NM_144604.2	genbank	human	provisional	54_36p	nonsense	SNP	1.000	T
CACNA1A	773	genome.wustl.edu	37	19	13370431	13370431	+	Silent	SNP	C	C	T			TCGA-AB-2972-03A-01D-0739-09	TCGA-AB-2972-11A-01D-0739-09	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	6a7deace-79dc-4790-a415-07f0e933eb2a	4c00565d-2fd1-4fa8-ad7f-541683ece1b0	g.chr19:13370431C>T	ENST00000360228.5	-	27	4334	c.4335G>A	c.(4333-4335)gtG>gtA	p.V1445V	CACNA1A_ENST00000573710.2_Silent_p.V1446V	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	1446					adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)	p.V1446V(1)		breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	GAGCCCACAGCACATTGTCGT	0.562																																						dbGAP											1	Substitution - coding silent(1)	haematopoietic_and_lymphoid_tissue(1)	19											58.0	61.0	60.0					19																	13370431		1993	4151	6144	13231431	SO:0001819	synonymous_variant	0			U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.4335G>A	19.37:g.13370431C>T		Somatic	1009	0.88	9		0	0.00	0	WXS	Illumina HiSeq	Phase_IV	13231431	295	41.72	214	J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Silent	SNP	HMMPfam_Ion_trans,HMMPfam_Ca_chan_IQ,superfamily_Voltage-gated potassium channels	p.V1446	ENST00000360228.5	37	c.4338	CCDS45998.1	19																																																																																			-	HMMPfam_Ion_trans,superfamily_Voltage-gated potassium channels		0.562	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1A	protein_coding	OTTHUMT00000104062.2	C	NM_000068		13231431	-1	no_errors	ENST00000325084	ensembl	human	known	54_36p	silent	SNP	1.000	T
CYP4F8	11283	genome.wustl.edu	37	19	15739592	15739592	+	RNA	SNP	G	G	A	rs370130539		TCGA-AB-2972-03A-01D-0739-09	TCGA-AB-2972-11A-01D-0739-09	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	6a7deace-79dc-4790-a415-07f0e933eb2a	4c00565d-2fd1-4fa8-ad7f-541683ece1b0	g.chr19:15739592G>A	ENST00000441682.2	+	0	1397							P98187	CP4F8_HUMAN	cytochrome P450, family 4, subfamily F, polypeptide 8						icosanoid metabolic process (GO:0006690)|prostaglandin metabolic process (GO:0006693)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	alkane 1-monooxygenase activity (GO:0018685)|aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)	p.D445N(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(14)|skin(1)	26						CTTCCGCTTCGACCCAGAAAA	0.602																																						dbGAP											1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	19											59.0	63.0	61.0					19																	15739592		1972	4160	6132	15600592			0			AF133298	CCDS74303.1	19p13.12	2013-11-11	2003-01-14		ENSG00000186526	ENSG00000186526		"""Cytochrome P450s"""	2648	protein-coding gene	gene with protein product		611545	"""cytochrome P450, subfamily IVF, polypeptide 8"""			10405341	Standard	NM_007253		Approved		uc002nbi.3	P98187	OTTHUMG00000182386		19.37:g.15739592G>A		Somatic	466	0.00	0		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	15600592	131	42.11	96		Missense_Mutation	SNP	HMMPfam_p450,superfamily_Cytochrome P450,PatternScan_CYTOCHROME_P450	p.D445N	ENST00000441682.2	37	c.1333		19	.	.	.	.	.	.	.	.	.	.	.	11.29	1.593807	0.28445	.	.	ENSG00000186526	ENST00000441682;ENST00000325723	.	.	.	3.32	2.27	0.28462	.	0.063724	0.64402	N	0.000013	T	0.40372	0.1114	.	.	.	0.43622	D	0.996008	P;B	0.35821	0.523;0.381	B;B	0.40940	0.344;0.159	T	0.51180	-0.8738	7	0.41790	T	0.15	.	8.1475	0.31121	0.1253:0.0:0.8747:0.0	.	258;446	B4DU85;P98187	.;CP4F8_HUMAN	N	445;258	.	ENSP00000314398:D258N	D	+	1	0	CYP4F8	15600592	1.000000	0.71417	0.615000	0.29064	0.340000	0.28889	4.794000	0.62482	0.595000	0.29777	0.436000	0.28706	GAC	-	HMMPfam_p450,superfamily_Cytochrome P450		0.602	CYP4F8-201	KNOWN	basic	processed_transcript	CYP4F8	processed_transcript		G	NM_007253		15600592	+1	no_errors	ENST00000325723	ensembl	human	known	54_36p	missense	SNP	0.996	A
ZNF43	7594	genome.wustl.edu	37	19	21991712	21991712	+	Missense_Mutation	SNP	C	C	T			TCGA-AB-2972-03A-01D-0739-09	TCGA-AB-2972-11A-01D-0739-09	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	6a7deace-79dc-4790-a415-07f0e933eb2a	4c00565d-2fd1-4fa8-ad7f-541683ece1b0	g.chr19:21991712C>T	ENST00000354959.4	-	4	1296	c.1127G>A	c.(1126-1128)gGt>gAt	p.G376D	ZNF43_ENST00000595461.1_Missense_Mutation_p.G370D|ZNF43_ENST00000598381.1_Missense_Mutation_p.G370D|ZNF43_ENST00000594012.1_Missense_Mutation_p.G370D	NM_003423.3	NP_003414.2	P17038	ZNF43_HUMAN	zinc finger protein 43	376					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G376D(1)		autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(16)|ovary(2)|prostate(3)|stomach(3)|upper_aerodigestive_tract(2)	51		Renal(1328;0.000219)|Hepatocellular(1079;0.121)		GBM - Glioblastoma multiforme(1328;5.97e-05)|STAD - Stomach adenocarcinoma(1328;0.0127)		AAAAGCTTCACCACATTCTGT	0.363																																						dbGAP											1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	19											64.0	65.0	64.0					19																	21991712		2203	4300	6503	21783552	SO:0001583	missense	0			X59244	CCDS12413.2, CCDS59367.1, CCDS74321.1	19p13.1-p12	2013-01-08	2006-05-11		ENSG00000198521	ENSG00000198521		"""Zinc fingers, C2H2-type"", ""-"""	13109	protein-coding gene	gene with protein product		603972	"""zinc finger protein 39-like 1 (KOX 27)"", ""zinc finger protein 43 (HTF6)"""	ZNF39L1		1711675	Standard	NM_001256649		Approved	HTF6, KOX27	uc031rka.1	P17038	OTTHUMG00000128543	ENST00000354959.4:c.1127G>A	19.37:g.21991712C>T	ENSP00000347045:p.Gly376Asp	Somatic	785	0.00	0		25	56.90	33	WXS	Illumina HiSeq	Phase_IV	21783552	235	48.91	225	A8K5N8|P28160|Q53XQ2|Q5H9T3|Q96DG1	Missense_Mutation	SNP	HMMPfam_KRAB,HMMSmart_SM00349,superfamily_KRAB domain (Kruppel-associated box Pfam 01352),HMMPfam_zf-C2H2,PatternScan_ZINC_FINGER_C2H2_1,HMMSmart_SM00355,superfamily_C2H2 and C2HC zinc fingers	p.G376D	ENST00000354959.4	37	c.1127	CCDS12413.2	19	.	.	.	.	.	.	.	.	.	.	C	12.31	1.898796	0.33535	.	.	ENSG00000198521	ENST00000397148;ENST00000354959	T	0.58358	0.34	1.86	-0.966	0.10320	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.42086	0.1187	N	0.21508	0.67	0.27728	N	0.944907	P	0.43788	0.817	P	0.49192	0.602	T	0.37244	-0.9714	9	0.56958	D	0.05	.	5.1945	0.15230	0.0:0.6498:0.2092:0.141	.	376	P17038	ZNF43_HUMAN	D	375;376	ENSP00000347045:G376D	ENSP00000347045:G376D	G	-	2	0	ZNF43	21783552	0.063000	0.20901	0.000000	0.03702	0.000000	0.00434	0.930000	0.28858	-0.319000	0.08652	-0.687000	0.03738	GGT	-	HMMPfam_zf-C2H2,PatternScan_ZINC_FINGER_C2H2_1,HMMSmart_SM00355,superfamily_C2H2 and C2HC zinc fingers		0.363	ZNF43-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF43	protein_coding	OTTHUMT00000250380.2	C	NM_003423		21783552	-1	no_errors	NM_003423.2	genbank	human	validated	54_36p	missense	SNP	0.636	T
SRSF6	6431	genome.wustl.edu	37	20	42088521	42088521	+	Missense_Mutation	SNP	T	T	A			TCGA-AB-2972-03A-01D-0739-09	TCGA-AB-2972-11A-01D-0739-09	T	T	T	A	T	T	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	6a7deace-79dc-4790-a415-07f0e933eb2a	4c00565d-2fd1-4fa8-ad7f-541683ece1b0	g.chr20:42088521T>A	ENST00000244020.3	+	3	473	c.367T>A	c.(367-369)Tgg>Agg	p.W123R		NM_006275.5	NP_006266.2	Q13247	SRSF6_HUMAN	serine/arginine-rich splicing factor 6	123	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				alternative mRNA splicing, via spliceosome (GO:0000380)|gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splice site selection (GO:0006376)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of cell death (GO:0060548)|negative regulation of keratinocyte differentiation (GO:0045617)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of keratinocyte proliferation (GO:0010837)|regulation of wound healing (GO:0061041)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|pre-mRNA binding (GO:0036002)|RNA binding (GO:0003723)	p.W123R(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|upper_aerodigestive_tract(2)	5						TCGGTGCAGTTGGCAAGATTT	0.348																																						dbGAP											1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	20											127.0	121.0	123.0					20																	42088521		2203	4300	6503	41521935	SO:0001583	missense	0			U30883	CCDS13318.1	20q12-q13.1	2013-02-12	2010-06-22	2010-06-22	ENSG00000124193	ENSG00000124193		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10788	protein-coding gene	gene with protein product	"""pre-mRNA splicing factor SRP55"", ""SR splicing factor 6"""	601944	"""splicing factor, arginine/serine-rich 6"""	SFRS6		7556075, 20516191	Standard	NM_006275		Approved	SRP55, B52	uc010zwg.2	Q13247	OTTHUMG00000032502	ENST00000244020.3:c.367T>A	20.37:g.42088521T>A	ENSP00000244020:p.Trp123Arg	Somatic	571	0.17	1		136	56.47	179	WXS	Illumina HiSeq	Phase_IV	41521935	226	26.14	80	B7Z6J3|E1P5W6|Q13244|Q13245|Q96J06|Q9UJB8|Q9Y3N7	Missense_Mutation	SNP	HMMPfam_RRM_1,HMMSmart_SM00360,superfamily_RNA-binding domain RBD	p.W123R	ENST00000244020.3	37	c.367	CCDS13318.1	20	.	.	.	.	.	.	.	.	.	.	T	12.39	1.923858	0.34002	.	.	ENSG00000124193	ENST00000244020	T	0.15372	2.43	5.86	4.75	0.60458	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.50222	0.1603	M	0.92833	3.35	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	T	0.60757	-0.7200	10	0.87932	D	0	.	12.3072	0.54908	0.0:0.0:0.1419:0.8581	.	123;123	Q13247;A8K588	SRSF6_HUMAN;.	R	123	ENSP00000244020:W123R	ENSP00000244020:W123R	W	+	1	0	SRSF6	41521935	1.000000	0.71417	1.000000	0.80357	0.439000	0.31926	7.609000	0.82925	1.026000	0.39733	-0.438000	0.05819	TGG	-	HMMPfam_RRM_1,HMMSmart_SM00360,superfamily_RNA-binding domain RBD		0.348	SRSF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFRS6	protein_coding	OTTHUMT00000079292.1	T	NM_006275		41521935	+1	no_errors	NM_006275.5	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
MORC3	23515	genome.wustl.edu	37	21	37711165	37711165	+	Missense_Mutation	SNP	T	T	C			TCGA-AB-2972-03A-01D-0739-09	TCGA-AB-2972-11A-01D-0739-09	T	T	T	C	T	T	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	6a7deace-79dc-4790-a415-07f0e933eb2a	4c00565d-2fd1-4fa8-ad7f-541683ece1b0	g.chr21:37711165T>C	ENST00000400485.1	+	5	630	c.554T>C	c.(553-555)cTt>cCt	p.L185P	MORC3_ENST00000487909.1_3'UTR	NM_015358.2	NP_056173.1	Q14149	MORC3_HUMAN	MORC family CW-type zinc finger 3	185					cell aging (GO:0007569)|maintenance of protein location in nucleus (GO:0051457)|negative regulation of fibroblast proliferation (GO:0048147)|peptidyl-serine phosphorylation (GO:0018105)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)	PML body (GO:0016605)	zinc ion binding (GO:0008270)	p.L185P(1)		breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(9)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	35						CTGGCAGAACTTGATGCTATT	0.418																																						dbGAP											1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	21											178.0	158.0	164.0					21																	37711165		1928	4137	6065	36633035	SO:0001583	missense	0			AK025327	CCDS42924.1	21q22.13	2005-06-15	2005-06-15	2005-06-15	ENSG00000159256	ENSG00000159256			23572	protein-coding gene	gene with protein product		610078	"""zinc finger, CW-type with coiled-coil domain 3"", ""zinc finger, CW type with coiled-coil domain 3"""	ZCWCC3		14607086	Standard	NM_015358		Approved	ZCW5, NXP2, KIAA0136	uc002yvi.3	Q14149	OTTHUMG00000086620	ENST00000400485.1:c.554T>C	21.37:g.37711165T>C	ENSP00000383333:p.Leu185Pro	Somatic	1179	0.08	1		59	42.16	43	WXS	Illumina HiSeq	Phase_IV	36633035	290	44.25	231	A8KA92|Q9UEZ2	Missense_Mutation	SNP	HMMPfam_HATPase_c,superfamily_ATP_bd_ATPase,HMMPfam_zf-CW	p.L185P	ENST00000400485.1	37	c.554	CCDS42924.1	21	.	.	.	.	.	.	.	.	.	.	T	26.7	4.765428	0.90020	.	.	ENSG00000159256	ENST00000400485	T	0.16897	2.31	5.44	5.44	0.79542	ATPase-like, ATP-binding domain (1);	0.129557	0.52532	D	0.000066	T	0.37625	0.1010	L	0.58101	1.795	0.80722	D	1	D	0.76494	0.999	D	0.74674	0.984	T	0.05022	-1.0911	9	.	.	.	-14.8269	15.1685	0.72850	0.0:0.0:0.0:1.0	.	185	Q14149	MORC3_HUMAN	P	185	ENSP00000383333:L185P	.	L	+	2	0	MORC3	36633035	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.880000	0.87243	2.061000	0.61500	0.482000	0.46254	CTT	-	superfamily_ATP_bd_ATPase		0.418	MORC3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	MORC3	protein_coding	OTTHUMT00000194640.1	T	NM_015358		36633035	+1	no_errors	NM_015358.2	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
NPM1	4869	genome.wustl.edu	37	5	170837547	170837548	+	Frame_Shift_Ins	INS	-	-	TCTG			TCGA-AB-2972-03A-01D-0739-09	TCGA-AB-2972-11A-01D-0739-09	-	-	-	TCTG	-	-	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	6a7deace-79dc-4790-a415-07f0e933eb2a	4c00565d-2fd1-4fa8-ad7f-541683ece1b0	g.chr5:170837547_170837548insTCTG	ENST00000296930.5	+	11	1164_1165	c.863_864insTCTG	c.(862-867)tggcagfs	p.WQ288fs	NPM1_ENST00000517671.1_Frame_Shift_Ins_p.WQ288fs|NPM1_ENST00000351986.6_Frame_Shift_Ins_p.WQ259fs	NM_002520.6	NP_002511.1	P06748	NPM_HUMAN	nucleophosmin (nucleolar phosphoprotein B23, numatrin)	288	Required for nucleolar localization.			WQWRKSL -> CLAVEEVSLRK (in Ref. 6; AAW67752/AAW67755). {ECO:0000305}.|WQWRKSL -> CMAVEEVSLRK (in Ref. 6; AAW67753 and 7; ABC40399). {ECO:0000305}.|WQWRKSL -> CVAVEEVSLRK (in Ref. 6; AAW67754). {ECO:0000305}.	cell aging (GO:0007569)|CENP-A containing nucleosome assembly (GO:0034080)|centrosome cycle (GO:0007098)|DNA repair (GO:0006281)|intracellular protein transport (GO:0006886)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of centrosome duplication (GO:0010826)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|nucleocytoplasmic transport (GO:0006913)|nucleosome assembly (GO:0006334)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of translation (GO:0045727)|protein localization (GO:0008104)|protein oligomerization (GO:0051259)|regulation of centriole replication (GO:0046599)|regulation of eIF2 alpha phosphorylation by dsRNA (GO:0060735)|regulation of endodeoxyribonuclease activity (GO:0032071)|regulation of endoribonuclease activity (GO:0060699)|response to stress (GO:0006950)|ribosome assembly (GO:0042255)|signal transduction (GO:0007165)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spindle pole centrosome (GO:0031616)	histone binding (GO:0042393)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein kinase inhibitor activity (GO:0004860)|ribosomal large subunit binding (GO:0043023)|ribosomal small subunit binding (GO:0043024)|RNA binding (GO:0003723)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|unfolded protein binding (GO:0051082)	p.W288fs*12(2114)|p.W288fs*10(9)|p.Q289fs*11(3)|p.W288*(1)	NPM1/ALK(632)	central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(4261)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	4269	Renal(175;0.000159)|Lung NSC(126;0.00576)|all_lung(126;0.00963)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			CAAGATCTCTGGCAGTGGAGGA	0.312			"""T, F """	"""ALK, RARA, MLF1"""	"""NHL, APL, AML"""																																	dbGAP		Dom	yes		5	5q35	4869	"""nucleophosmin (nucleolar phosphoprotein B23, numatrin)"""		L	2127	Insertion - Frameshift(2118)|Complex - frameshift(8)|Substitution - Nonsense(1)	haematopoietic_and_lymphoid_tissue(2127)	5																																								170770153	SO:0001589	frameshift_variant	0			M26697	CCDS4376.1, CCDS4377.1, CCDS43399.1	5q35.1	2014-09-17			ENSG00000181163	ENSG00000181163			7910	protein-coding gene	gene with protein product	"""nucleolar phosphoprotein B23"", ""numatrin"", ""nucleophosmin/nucleoplasmin family, member 1"""	164040				8471164, 8122112	Standard	NM_002520		Approved	B23, NPM	uc003mbi.3	P06748	OTTHUMG00000130465	ENST00000296930.5:c.860_863dupTCTG	5.37:g.170837544_170837547dupTCTG	ENSP00000296930:p.Trp288fs	Somatic	NA	NA	NA		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	170770152	NA	NA	NA	A8K3N7|B5BU00|D3DQL6|P08693|Q12826|Q13440|Q13441|Q14115|Q5EU94|Q5EU95|Q5EU96|Q5EU97|Q5EU98|Q5EU99|Q6V962|Q8WTW5|Q96AT6|Q96DC4|Q96EA5|Q9BYG9|Q9UDJ7	Frame_Shift_Ins	INS	HMMPfam_Nucleoplasmin,superfamily_Nucleoplasmin-like core domain	p.W288fs	ENST00000296930.5	37	c.863_864	CCDS4376.1	5																																																																																			-	NULL		0.312	NPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPM1	protein_coding	OTTHUMT00000252858.2	-	NM_002520		170770153	+1	no_errors	NM_002520.1	genbank	human	validated	54_36p	frame_shift_ins	INS	1.000:1.000	TCTG
