#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NormalRefReads_WU	i_NormalVAF_WU	i_NormalVarReads_WU	i_ORegAnno_bin	i_RNARefReads_WU	i_RNAVAF_WU	i_RNAVarReads_WU	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TumorRefReads_WU	i_TumorVAF_WU	i_TumorVarReads_WU	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
IGSF21	84966	genome.wustl.edu	37	1	18661497	18661497	+	Silent	SNP	C	C	T	rs369333329		TCGA-AB-2996-03A-01D-0739-09	TCGA-AB-2996-11A-01D-0739-09	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	625950a0-f786-4158-90b7-89cb96e4a23b	2b2ba0f5-7ab3-4ae0-9828-097cc0e89a15	g.chr1:18661497C>T	ENST00000251296.1	+	4	800	c.417C>T	c.(415-417)aaC>aaT	p.N139N		NM_032880.4	NP_116269.3	Q96ID5	IGS21_HUMAN	immunoglobin superfamily, member 21	139						extracellular region (GO:0005576)		p.N139N(1)		endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(16)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	40		Colorectal(325;0.000147)|Renal(390;0.00145)|all_lung(284;0.00366)|Lung NSC(340;0.00376)|Breast(348;0.00387)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0121)|BRCA - Breast invasive adenocarcinoma(304;5.52e-05)|Kidney(64;0.00103)|KIRC - Kidney renal clear cell carcinoma(64;0.0102)|STAD - Stomach adenocarcinoma(196;0.0118)|READ - Rectum adenocarcinoma(331;0.157)		TCTTCCTCAACGTCATGGGTG	0.592																																						dbGAP											1	Substitution - coding silent(1)	haematopoietic_and_lymphoid_tissue(1)	1						C		1,4405	2.1+/-5.4	0,1,2202	91.0	65.0	74.0		417	-2.0	1.0	1		74	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	IGSF21	NM_032880.4		0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154		139/468	18661497	2,13004	2203	4300	6503	18534084	SO:0001819	synonymous_variant	0			AK075316	CCDS184.1	1p36.13	2013-01-29			ENSG00000117154	ENSG00000117154		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	28246	protein-coding gene	gene with protein product						12477932	Standard	NM_032880		Approved	MGC15730, RP11-121A23.1	uc001bau.2	Q96ID5	OTTHUMG00000002432	ENST00000251296.1:c.417C>T	1.37:g.18661497C>T		Somatic	486	1.82	9		1	0.00	0	WXS	Illumina HiSeq	Phase_IV	18534084	315	44.37	252	Q8NBR8	Silent	SNP	HMMSmart_IG,HMMPfam_V-set,superfamily_SSF48726	p.N139	ENST00000251296.1	37	c.417	CCDS184.1	1	.	.	.	.	.	.	.	.	.	.	c	10.23	1.291784	0.23564	2.27E-4	1.16E-4	ENSG00000117154	ENST00000412684	.	.	.	5.57	-1.97	0.07503	.	.	.	.	.	T	0.55737	0.1939	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51841	-0.8654	4	.	.	.	-7.6117	10.6758	0.45785	0.0:0.5089:0.0:0.4911	.	.	.	.	C	92	.	.	R	+	1	0	IGSF21	18534084	0.005000	0.15991	0.982000	0.44146	0.993000	0.82548	-1.535000	0.02210	-0.422000	0.07405	-0.141000	0.14075	CGT	-	HMMSmart_IG,HMMPfam_V-set,superfamily_SSF48726		0.592	IGSF21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGSF21	protein_coding	OTTHUMT00000006924.1	C	NM_032880		18534084	+1	no_errors	NM_032880.2	genbank	human	provisional	54_36p	silent	SNP	0.998	T
MPL	4352	genome.wustl.edu	37	1	43818405	43818405	+	Missense_Mutation	SNP	C	C	G			TCGA-AB-2996-03A-01D-0739-09	TCGA-AB-2996-11A-01D-0739-09	C	C	C	G	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	625950a0-f786-4158-90b7-89cb96e4a23b	2b2ba0f5-7ab3-4ae0-9828-097cc0e89a15	g.chr1:43818405C>G	ENST00000372470.3	+	12	1912	c.1870C>G	c.(1870-1872)Cat>Gat	p.H624D	RP1-92O14.3_ENST00000424948.1_RNA	NM_005373.2	NP_005364.1	P40238	TPOR_HUMAN	MPL proto-oncogene, thrombopoietin receptor	624					blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|homeostasis of number of cells (GO:0048872)|platelet activation (GO:0030168)|regulation of chemokine production (GO:0032642)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)|transmembrane signaling receptor activity (GO:0004888)	p.H624D(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(551)|large_intestine(3)|lung(7)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	567	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)			Eltrombopag(DB06210)|Romiplostim(DB05332)	CATTGCCAACCATTCCTACCT	0.562			Mis		MPD	MPD	congenital amegakaryocytic thrombocytopenia																														NSCLC(52;534 1204 10016 41452 44427)	dbGAP	yes	Dom	yes	Familial essential thrombocythemia	1	p34	4352	"""myeloproliferative leukemia virus oncogene, thrombopoietin receptor"""	yes	L	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	1											116.0	104.0	108.0					1																	43818405		2203	4300	6503	43590992	SO:0001583	missense	0			M90102	CCDS483.1	1p34	2014-09-17	2014-06-26		ENSG00000117400	ENSG00000117400		"""CD molecules"", ""Fibronectin type III domain containing"""	7217	protein-coding gene	gene with protein product		159530	"""myeloproliferative leukemia virus oncogene"""			1608974	Standard	NM_005373		Approved	CD110, TPOR	uc001ciw.3	P40238	OTTHUMG00000007429	ENST00000372470.3:c.1870C>G	1.37:g.43818405C>G	ENSP00000361548:p.His624Asp	Somatic	342	2.29	8		42	48.19	40	WXS	Illumina HiSeq	Phase_IV	43590992	148	49.49	145	Q5JUZ0	Missense_Mutation	SNP	PatternScan_HEMATOPO_REC_L_F1,HMMPfam_fn3,HMMSmart_SM00060,superfamily_Fibronectin type III,HMMPfam_EpoR_lig-bind	p.H624D	ENST00000372470.3	37	c.1870	CCDS483.1	1	.	.	.	.	.	.	.	.	.	.	c	12.10	1.837299	0.32513	.	.	ENSG00000117400	ENST00000372470	D	0.82255	-1.59	3.43	2.39	0.29439	.	.	.	.	.	D	0.86623	0.5977	L	0.60455	1.87	0.80722	D	1	D;D	0.58268	0.981;0.982	D;P	0.69824	0.966;0.702	D	0.85889	0.1427	9	0.72032	D	0.01	-9.3442	7.4883	0.27447	0.0:0.845:0.0:0.155	.	617;624	Q308M1;P40238	.;TPOR_HUMAN	D	624	ENSP00000361548:H624D	ENSP00000361548:H624D	H	+	1	0	MPL	43590992	1.000000	0.71417	1.000000	0.80357	0.206000	0.24218	2.346000	0.44027	1.725000	0.51514	0.306000	0.20318	CAT	-	NULL		0.562	MPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MPL	protein_coding	OTTHUMT00000019522.1	C	NM_005373		43590992	+1	no_errors	NM_005373.2	genbank	human	reviewed	54_36p	missense	SNP	0.996	G
LCE1B	353132	genome.wustl.edu	37	1	152785067	152785067	+	Nonsense_Mutation	SNP	G	G	T	rs367907198		TCGA-AB-2996-03A-01D-0739-09	TCGA-AB-2996-11A-01D-0739-09	G	G	G	T	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	625950a0-f786-4158-90b7-89cb96e4a23b	2b2ba0f5-7ab3-4ae0-9828-097cc0e89a15	g.chr1:152785067G>T	ENST00000360090.3	+	1	621	c.145G>T	c.(145-147)Gga>Tga	p.G49*		NM_178349.1	NP_848126.1	Q5T7P3	LCE1B_HUMAN	late cornified envelope 1B	49	Gly-rich.				keratinization (GO:0031424)			p.G49*(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(5)|skin(2)	18	Lung NSC(65;9.06e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			TGTCAGCTCCGGAGGCTGCTG	0.647																																						dbGAP											1	Substitution - Nonsense(1)	haematopoietic_and_lymphoid_tissue(1)	1											72.0	78.0	76.0					1																	152785067		2203	4300	6503	151051691	SO:0001587	stop_gained	0			BI670515	CCDS1027.1	1q21.3	2008-02-05	2004-10-11	2004-10-15	ENSG00000196734	ENSG00000196734		"""Late cornified envelopes"""	16611	protein-coding gene	gene with protein product		612604	"""small proline rich-like (epidermal differentiation complex) 2A"""	SPRL2A		11698679	Standard	NM_178349		Approved	LEP2	uc001faq.3	Q5T7P3	OTTHUMG00000014402	ENST00000360090.3:c.145G>T	1.37:g.152785067G>T	ENSP00000353203:p.Gly49*	Somatic	70	2.78	2		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	151051691	91	41.88	67	A4IF40	Nonsense_Mutation	SNP	NULL	p.G49*	ENST00000360090.3	37	c.145	CCDS1027.1	1	.	.	.	.	.	.	.	.	.	.	G	39	7.424192	0.98275	.	.	ENSG00000196734	ENST00000360090;ENST00000439693	.	.	.	4.13	3.22	0.36961	.	0.000000	0.37809	N	0.001940	.	.	.	.	.	.	0.34906	D	0.746951	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	7.9292	0.29893	0.1148:0.0:0.8852:0.0	.	.	.	.	X	49	.	ENSP00000353203:G49X	G	+	1	0	LCE1B	151051691	0.830000	0.29337	0.745000	0.31077	0.990000	0.78478	2.531000	0.45650	1.077000	0.40990	0.650000	0.86243	GGA	-	NULL		0.647	LCE1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCE1B	protein_coding	OTTHUMT00000040060.1	G	NM_178349		151051691	+1	no_errors	NM_178349.1	genbank	human	validated	54_36p	nonsense	SNP	0.991	T
LAMC1	3915	genome.wustl.edu	37	1	183085911	183085911	+	Silent	SNP	T	T	C			TCGA-AB-2996-03A-01D-0739-09	TCGA-AB-2996-11A-01D-0739-09	T	T	T	C	T	T	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	625950a0-f786-4158-90b7-89cb96e4a23b	2b2ba0f5-7ab3-4ae0-9828-097cc0e89a15	g.chr1:183085911T>C	ENST00000258341.4	+	8	1694	c.1437T>C	c.(1435-1437)ccT>ccC	p.P479P		NM_002293.3	NP_002284.3	P11047	LAMC1_HUMAN	laminin, gamma 1 (formerly LAMB2)	479	Laminin EGF-like 4. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|endoderm development (GO:0007492)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|positive regulation of epithelial cell proliferation (GO:0050679)|protein complex assembly (GO:0006461)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)	p.P479P(1)		NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(27)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	76						GATGCAAACCTGGATTTTTTA	0.383																																						dbGAP											1	Substitution - coding silent(1)	haematopoietic_and_lymphoid_tissue(1)	1											112.0	110.0	111.0					1																	183085911		2203	4300	6503	181352534	SO:0001819	synonymous_variant	0			J03202	CCDS1351.1	1q31	2013-03-01			ENSG00000135862	ENSG00000135862		"""Laminins"""	6492	protein-coding gene	gene with protein product		150290		LAMB2		3234037	Standard	NM_002293		Approved		uc001gpy.4	P11047	OTTHUMG00000035418	ENST00000258341.4:c.1437T>C	1.37:g.183085911T>C		Somatic	196	0.00	0		1	0.00	0	WXS	Illumina HiSeq	Phase_IV	181352534	195	46.13	167	Q5VYE7	Silent	SNP	HMMPfam_Laminin_B,HMMPfam_Laminin_EGF,HMMSmart_EGF_Lam,PatternScan_EGF_LAM_1,HMMPfam_Laminin_N,HMMSmart_LamNT,superfamily_Grow_fac_recept,PatternScan_EGF_1,PatternScan_EGF_2,HMMSmart_LamB,superfamily_SSF57196	p.P479	ENST00000258341.4	37	c.1437	CCDS1351.1	1																																																																																			-	HMMPfam_Laminin_EGF,HMMSmart_EGF_Lam,PatternScan_EGF_LAM_1,superfamily_Grow_fac_recept,superfamily_SSF57196		0.383	LAMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMC1	protein_coding	OTTHUMT00000085954.2	T	NM_002293		181352534	+1	no_errors	NM_002293.3	genbank	human	reviewed	54_36p	silent	SNP	1.000	C
STK36	27148	genome.wustl.edu	37	2	219563599	219563599	+	Missense_Mutation	SNP	A	A	G	rs56278660		TCGA-AB-2996-03A-01D-0739-09	TCGA-AB-2996-11A-01D-0739-09	A	A	A	G	A	A	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	625950a0-f786-4158-90b7-89cb96e4a23b	2b2ba0f5-7ab3-4ae0-9828-097cc0e89a15	g.chr2:219563599A>G	ENST00000295709.3	+	26	3611	c.3332A>G	c.(3331-3333)tAt>tGt	p.Y1111C	STK36_ENST00000440309.1_Missense_Mutation_p.Y1111C|STK36_ENST00000392106.2_Missense_Mutation_p.Y1090C|STK36_ENST00000392105.3_Missense_Mutation_p.Y1090C	NM_015690.4	NP_056505.2			serine/threonine kinase 36									p.Y1111C(1)		biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(6)|lung(20)|ovary(4)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	52		Renal(207;0.0915)		Epithelial(149;9.65e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.00984)		GATGAATCCTATCGGCCCCTG	0.592													A|||	1	0.000199681	0.0008	0.0	5008	,	,		19249	0.0		0.0	False		,,,				2504	0.0					dbGAP											1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	2						A	CYS/TYR	1,4405	2.1+/-5.4	0,1,2202	48.0	49.0	49.0		3332	6.1	1.0	2	dbSNP_129	49	2,8598	2.2+/-6.3	0,2,4298	yes	missense	STK36	NM_015690.4	194	0,3,6500	GG,GA,AA		0.0233,0.0227,0.0231	probably-damaging	1111/1316	219563599	3,13003	2203	4300	6503	219271843	SO:0001583	missense	0			AB033104	CCDS2421.1, CCDS58750.1	2q35	2010-06-25	2010-06-25		ENSG00000163482	ENSG00000163482			17209	protein-coding gene	gene with protein product	"""fused homolog (Drosophila)"""	607652	"""serine/threonine kinase 36 (fused homolog, Drosophila)"""			10806483	Standard	NM_001243313		Approved	KIAA1278, FU	uc002viu.3	Q9NRP7	OTTHUMG00000133079	ENST00000295709.3:c.3332A>G	2.37:g.219563599A>G	ENSP00000295709:p.Tyr1111Cys	Somatic	331	0.60	2		1	85.71	6	WXS	Illumina HiSeq	Phase_IV	219271843	175	44.44	140		Missense_Mutation	SNP	HMMPfam_HEAT,HMMSmart_SM00219,HMMSmart_SM00220,PatternScan_PROTEIN_KINASE_ST,superfamily_Protein kinase-like (PK-like),superfamily_ARM repeat,PatternScan_PROTEIN_KINASE_ATP,HMMPfam_Pkinase	p.Y1111C	ENST00000295709.3	37	c.3332	CCDS2421.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.98|14.98	2.696319|2.696319	0.48202|0.48202	2.27E-4|2.27E-4	2.33E-4|2.33E-4	ENSG00000163482|ENSG00000163482	ENST00000431040|ENST00000295709;ENST00000392106;ENST00000392105;ENST00000440309	.|T;T;T;T	.|0.64803	.|0.72;0.72;-0.12;0.72	6.06|6.06	6.06|6.06	0.98353|0.98353	.|Armadillo-type fold (1);	.|0.000000	.|0.41194	.|D	.|0.000940	T|T	0.76054|0.76054	0.3934|0.3934	M|M	0.65498|0.65498	2.005|2.005	0.40001|0.40001	D|D	0.975168|0.975168	.|D;D;D	.|0.89917	.|1.0;1.0;0.999	.|D;D;D	.|0.77004	.|0.989;0.98;0.921	T|T	0.79110|0.79110	-0.1938|-0.1938	5|10	.|0.72032	.|D	.|0.01	-12.3498|-12.3498	11.7922|11.7922	0.52075|0.52075	0.8538:0.1462:0.0:0.0|0.8538:0.1462:0.0:0.0	rs56278660|rs56278660	.|1090;1090;1111	.|A8MU99;Q9NRP7-2;Q9NRP7	.|.;.;STK36_HUMAN	V|C	304|1111;1090;1090;1111	.|ENSP00000295709:Y1111C;ENSP00000375955:Y1090C;ENSP00000375954:Y1090C;ENSP00000394095:Y1111C	.|ENSP00000295709:Y1111C	I|Y	+|+	1|2	0|0	STK36|STK36	219271843|219271843	0.995000|0.995000	0.38212|0.38212	0.999000|0.999000	0.59377|0.59377	0.445000|0.445000	0.32107|0.32107	1.193000|1.193000	0.32162|0.32162	2.324000|2.324000	0.78689|0.78689	0.533000|0.533000	0.62120|0.62120	ATC|TAT	-	superfamily_ARM repeat		0.592	STK36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK36	protein_coding	OTTHUMT00000256723.2	A			219271843	+1	no_errors	NM_015690.3	genbank	human	validated	54_36p	missense	SNP	1.000	G
TET2	54790	genome.wustl.edu	37	4	106197269	106197269	+	Missense_Mutation	SNP	C	C	T			TCGA-AB-2996-03A-01D-0739-09	TCGA-AB-2996-11A-01D-0739-09	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	625950a0-f786-4158-90b7-89cb96e4a23b	2b2ba0f5-7ab3-4ae0-9828-097cc0e89a15	g.chr4:106197269C>T	ENST00000540549.1	+	11	6462	c.5602C>T	c.(5602-5604)Cat>Tat	p.H1868Y	TET2_ENST00000513237.1_Missense_Mutation_p.H1889Y|TET2_ENST00000380013.4_Missense_Mutation_p.H1868Y|TET2_ENST00000545826.1_3'UTR			Q6N021	TET2_HUMAN	tet methylcytosine dioxygenase 2	1868					5-methylcytosine catabolic process (GO:0006211)|cell cycle (GO:0007049)|DNA demethylation (GO:0080111)|histone H3-K4 trimethylation (GO:0080182)|kidney development (GO:0001822)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|protein O-linked glycosylation (GO:0006493)		DNA binding (GO:0003677)|ferrous iron binding (GO:0008198)|methylcytosine dioxygenase activity (GO:0070579)|zinc ion binding (GO:0008270)	p.H1868Y(2)|p.T1867_S1870del(2)		NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1272)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	1314		Myeloproliferative disorder(5;0.0393)		OV - Ovarian serous cystadenocarcinoma(123;7.18e-08)		GGCTCCAACTCATGGGTCAAT	0.542			"""Mis N, F"""		MDS																																	dbGAP		Rec	yes		4	4q24	54790	tet oncogene family member 2		L	4	Substitution - Missense(2)|Deletion - In frame(2)	haematopoietic_and_lymphoid_tissue(4)	4											57.0	51.0	53.0					4																	106197269		692	1591	2283	106416718	SO:0001583	missense	0			AB046766	CCDS3666.1, CCDS47120.1	4q24	2014-09-17	2011-09-30	2008-03-12	ENSG00000168769	ENSG00000168769			25941	protein-coding gene	gene with protein product		612839	"""KIAA1546"", ""tet oncogene family member 2"""	KIAA1546		10997877, 12646957	Standard	NM_017628		Approved	FLJ20032	uc003hxk.3	Q6N021	OTTHUMG00000131213	ENST00000540549.1:c.5602C>T	4.37:g.106197269C>T	ENSP00000442788:p.His1868Tyr	Somatic	119	1.65	2		32	50.77	33	WXS	Illumina HiSeq	Phase_IV	106416718	274	41.83	197	B5MDU0|Q2TB88|Q3LIB8|Q96JX5|Q9HCM6|Q9NXW0	Missense_Mutation	SNP	NULL	p.H670Y	ENST00000540549.1	37	c.2008	CCDS47120.1	4	.	.	.	.	.	.	.	.	.	.	C	24.7	4.561733	0.86335	.	.	ENSG00000168769	ENST00000540549;ENST00000513237;ENST00000380013	T;T;T	0.13778	2.56;2.56;2.56	5.43	5.43	0.79202	Methylcytosine dioxygenase TET, double-stranded beta helix fold domain (1);	.	.	.	.	T	0.43188	0.1236	M	0.81802	2.56	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.41928	-0.9481	9	0.87932	D	0	-18.0104	19.2511	0.93926	0.0:1.0:0.0:0.0	.	1889;1868	E7EQS8;Q6N021	.;TET2_HUMAN	Y	1868;1889;1868	ENSP00000442788:H1868Y;ENSP00000425443:H1889Y;ENSP00000369351:H1868Y	ENSP00000369351:H1868Y	H	+	1	0	TET2	106416718	1.000000	0.71417	0.472000	0.27241	0.980000	0.70556	7.277000	0.78572	2.534000	0.85438	0.591000	0.81541	CAT	-	NULL		0.542	TET2-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	TET2	protein_coding	OTTHUMT00000253952.2	C	NM_017628		106416718	+1	no_start_codon	ENST00000265149	ensembl	human	known	54_36p	missense	SNP	1.000	T
PCDHGA2	56113	genome.wustl.edu	37	5	140719342	140719342	+	Silent	SNP	C	C	T			TCGA-AB-2996-03A-01D-0739-09	TCGA-AB-2996-11A-01D-0739-09	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	625950a0-f786-4158-90b7-89cb96e4a23b	2b2ba0f5-7ab3-4ae0-9828-097cc0e89a15	g.chr5:140719342C>T	ENST00000394576.2	+	1	804	c.804C>T	c.(802-804)gaC>gaT	p.D268D	PCDHGA1_ENST00000517417.1_Intron	NM_018915.2	NP_061738.1	Q9Y5H1	PCDG2_HUMAN	protocadherin gamma subfamily A, 2	268	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D268D(2)		breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(32)|ovary(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCGCCACTGACGCAGATGAGG	0.507																																						dbGAP											2	Substitution - coding silent(2)	haematopoietic_and_lymphoid_tissue(1)|breast(1)	5											86.0	94.0	91.0					5																	140719342		2203	4300	6503	140699526	SO:0001819	synonymous_variant	0			AF152508	CCDS47289.1	5q31	2011-03-28			ENSG00000081853	ENSG00000081853		"""Cadherins / Protocadherins : Clustered"""	8700	other	protocadherin		606289				10380929	Standard	NM_018915		Approved	PCDH-GAMMA-A2		Q9Y5H1	OTTHUMG00000163679	ENST00000394576.2:c.804C>T	5.37:g.140719342C>T		Somatic	247	0.80	2		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	140699526	171	44.48	137	Q52LL6|Q9Y5D5	Silent	SNP	HMMPfam_Cadherin,HMMSmart_SM00112,PatternScan_CADHERIN_1,HMMPfam_Cadherin_2,superfamily_Cadherin-like	p.D268	ENST00000394576.2	37	c.804	CCDS47289.1	5																																																																																			-	HMMPfam_Cadherin,HMMSmart_SM00112,superfamily_Cadherin-like		0.507	PCDHGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA2	protein_coding	OTTHUMT00000374738.1	C	NM_018915		140699526	+1	no_errors	NM_018915.2	genbank	human	reviewed	54_36p	silent	SNP	0.635	T
GLTSCR1L	23506	genome.wustl.edu	37	6	42832492	42832492	+	Missense_Mutation	SNP	A	A	G			TCGA-AB-2996-03A-01D-0739-09	TCGA-AB-2996-11A-01D-0739-09	A	A	A	G	A	A	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	625950a0-f786-4158-90b7-89cb96e4a23b	2b2ba0f5-7ab3-4ae0-9828-097cc0e89a15	g.chr6:42832492A>G	ENST00000314073.5	+	13	2724	c.2548A>G	c.(2548-2550)Agc>Ggc	p.S850G	GLTSCR1L_ENST00000394168.1_Missense_Mutation_p.S850G			Q6AI39	GSC1L_HUMAN	GLTSCR1-like	850								p.S850G(1)									CAGTAAAGCAAGCAGCTCTCT	0.512																																						dbGAP											1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	6											122.0	101.0	108.0					6																	42832492		2203	4300	6503	42940470	SO:0001583	missense	0			AL833540	CCDS34451.1	6p21.1	2012-11-29	2012-11-29	2012-11-29	ENSG00000112624	ENSG00000112624			21111	protein-coding gene	gene with protein product			"""KIAA0240"""	KIAA0240			Standard	XM_005248972		Approved		uc003osp.1	Q6AI39	OTTHUMG00000014706	ENST00000314073.5:c.2548A>G	6.37:g.42832492A>G	ENSP00000313933:p.Ser850Gly	Somatic	234	2.50	6		20	44.44	16	WXS	Illumina HiSeq	Phase_IV	42940470	184	49.59	181	A1L3W2|Q5TFZ3|Q92514	Missense_Mutation	SNP	NULL	p.S850G	ENST00000314073.5	37	c.2548	CCDS34451.1	6	.	.	.	.	.	.	.	.	.	.	A	2.950	-0.216918	0.06101	.	.	ENSG00000112624	ENST00000394167;ENST00000314073;ENST00000394168	T;T	0.46063	0.88;0.88	5.24	-7.67	0.01272	.	1.200670	0.05794	N	0.611004	T	0.06234	0.0161	N	0.14661	0.345	0.09310	N	1	B	0.14438	0.01	B	0.18561	0.022	T	0.20773	-1.0265	10	0.30854	T	0.27	-0.0119	1.6387	0.02747	0.2118:0.2985:0.3198:0.1698	.	850	Q6AI39	K0240_HUMAN	G	850	ENSP00000313933:S850G;ENSP00000377723:S850G	ENSP00000313933:S850G	S	+	1	0	KIAA0240	42940470	0.000000	0.05858	0.004000	0.12327	0.324000	0.28378	-1.039000	0.03550	-0.845000	0.04179	-0.250000	0.11733	AGC	-	NULL		0.512	GLTSCR1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0240	protein_coding	OTTHUMT00000040562.3	A	NM_015349		42940470	+1	no_errors	NM_015349.1	genbank	human	validated	54_36p	missense	SNP	0.002	G
Unknown	0	genome.wustl.edu	37	8	74153737	74153737	+	IGR	SNP	G	G	T	rs545042212		TCGA-AB-2996-03A-01D-0739-09	TCGA-AB-2996-11A-01D-0739-09	G	G	G	T	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	625950a0-f786-4158-90b7-89cb96e4a23b	2b2ba0f5-7ab3-4ae0-9828-097cc0e89a15	g.chr8:74153737G>T								SBSPON (117414 upstream) : RPL7 (48768 downstream)																							TTGATTTTGTGGTTGTTTCCT	0.393																																						dbGAP											0			8																																								74316291	SO:0001628	intergenic_variant	0																															8.37:g.74153737G>T		Somatic	93	6.06	6		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	74316291	125	44.93	102		Silent	SNP	NULL	p.T147		37	c.441		8																																																																																			-	NULL	0	0.393					LOC100130301			G			74316291	-1	no_errors	XM_001721302.1	genbank	human	model	54_36p	silent	SNP	0.000	T
ADAMTSL1	92949	genome.wustl.edu	37	9	18639381	18639381	+	Missense_Mutation	SNP	G	G	T			TCGA-AB-2996-03A-01D-0739-09	TCGA-AB-2996-11A-01D-0739-09	G	G	G	T	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	625950a0-f786-4158-90b7-89cb96e4a23b	2b2ba0f5-7ab3-4ae0-9828-097cc0e89a15	g.chr9:18639381G>T	ENST00000380548.4	+	7	1145	c.806G>T	c.(805-807)gGa>gTa	p.G269V	ADAMTSL1_ENST00000327883.7_Missense_Mutation_p.G269V|ADAMTSL1_ENST00000380566.4_Missense_Mutation_p.G269V|ADAMTSL1_ENST00000276935.6_Missense_Mutation_p.G269V	NM_001040272.5	NP_001035362.3	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1	269						proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.G269A(2)|p.G269V(2)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(2)|lung(17)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(50;1.29e-17)		AGAATGGCTGGACCACTCACA	0.423																																						dbGAP											4	Substitution - Missense(4)	haematopoietic_and_lymphoid_tissue(2)|lung(2)	9											64.0	66.0	65.0					9																	18639381		2203	4299	6502	18629381	SO:0001583	missense	0			AF176313	CCDS6485.1, CCDS47954.1	9p21.3	2013-01-11			ENSG00000178031	ENSG00000178031		"""Immunoglobulin superfamily / I-set domain containing"""	14632	protein-coding gene	gene with protein product	"""punctin"""	609198	"""chromosome 9 open reading frame 94"""	C9orf94		9628581, 11805097	Standard	NM_001040272		Approved	ADAMTSR1, FLJ35283	uc003zne.4	Q8N6G6	OTTHUMG00000019604	ENST00000380548.4:c.806G>T	9.37:g.18639381G>T	ENSP00000369921:p.Gly269Val	Somatic	167	4.57	8		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	18629381	278	47.85	256	A6PVN1|A8K7E1|Q496M6|Q496M8|Q5T708|Q5VZT8|Q8NAI9|Q96RW4|Q9BXY3	Missense_Mutation	SNP	HMMPfam_TSP_1,HMMSmart_SM00209,superfamily_TSP-1 type 1 repeat,HMMSmart_SM00408,HMMSmart_SM00409,HMMPfam_PLAC,HMMPfam_I-set,HMMPfam_ig,superfamily_Immunoglobulin	p.G269V	ENST00000380548.4	37	c.806	CCDS47954.1	9	.	.	.	.	.	.	.	.	.	.	G	20.9	4.065185	0.76187	.	.	ENSG00000178031	ENST00000380548;ENST00000327883;ENST00000380566;ENST00000276935	T;T;T;T	0.78364	-1.17;0.32;0.32;0.32	5.77	5.77	0.91146	.	.	.	.	.	D	0.92312	0.7561	H	0.95816	3.725	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.978;0.998	D	0.93610	0.6938	9	0.87932	D	0	.	20.3472	0.98799	0.0:0.0:1.0:0.0	.	269;269	Q8N6G6;Q8N6G6-2	ATL1_HUMAN;.	V	269	ENSP00000369921:G269V;ENSP00000327887:G269V;ENSP00000369940:G269V;ENSP00000276935:G269V	ENSP00000276935:G269V	G	+	2	0	ADAMTSL1	18629381	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.687000	0.91255	2.890000	0.99128	0.650000	0.86243	GGA	-	NULL		0.423	ADAMTSL1-012	NOVEL	basic|appris_principal|CCDS	protein_coding	ADAMTSL1	protein_coding	OTTHUMT00000401206.1	G			18629381	+1	no_errors	NM_001040272.4	genbank	human	validated	54_36p	missense	SNP	1.000	T
FAM171A1	221061	genome.wustl.edu	37	10	15290664	15290664	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2996-03A-01D-0739-09	TCGA-AB-2996-11A-01D-0739-09	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	625950a0-f786-4158-90b7-89cb96e4a23b	2b2ba0f5-7ab3-4ae0-9828-097cc0e89a15	g.chr10:15290664G>A	ENST00000378116.4	-	5	734	c.728C>T	c.(727-729)gCg>gTg	p.A243V	FAM171A1_ENST00000477161.1_5'UTR	NM_001010924.1	NP_001010924.1	Q5VUB5	F1711_HUMAN	family with sequence similarity 171, member A1	243						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.A243V(1)		breast(6)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	52						CCGCCACGCCGCGACATAGGC	0.552																																						dbGAP											1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	10											80.0	74.0	76.0					10																	15290664		2203	4300	6503	15330670	SO:0001583	missense	0			AK022946	CCDS31154.1	10p13	2008-06-16	2008-06-16	2008-06-16	ENSG00000148468	ENSG00000148468			23522	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 38"""	C10orf38			Standard	NM_001010924		Approved	FLJ12884	uc001iob.3	Q5VUB5	OTTHUMG00000017732	ENST00000378116.4:c.728C>T	10.37:g.15290664G>A	ENSP00000367356:p.Ala243Val	Somatic	246	0.00	0		3	70.00	7	WXS	Illumina HiSeq	Phase_IV	15330670	267	44.26	212	D3DRT9|Q32M49|Q8N4I0	Missense_Mutation	SNP	HMMPfam_UPF0560	p.A243V	ENST00000378116.4	37	c.728	CCDS31154.1	10	.	.	.	.	.	.	.	.	.	.	G	17.85	3.490241	0.64074	.	.	ENSG00000148468	ENST00000378116;ENST00000378114;ENST00000396781;ENST00000455654	T;T	0.33216	1.42;1.42	5.2	5.2	0.72013	.	0.301948	0.35466	N	0.003184	T	0.25158	0.0611	N	0.22421	0.69	0.24848	N	0.992427	B	0.33940	0.433	B	0.31245	0.126	T	0.27191	-1.0081	10	0.87932	D	0	-9.8625	19.1283	0.93394	0.0:0.0:1.0:0.0	.	243	Q5VUB5	F1711_HUMAN	V	243;190;244;190	ENSP00000367356:A243V;ENSP00000407796:A190V	ENSP00000367354:A190V	A	-	2	0	FAM171A1	15330670	1.000000	0.71417	0.106000	0.21319	0.644000	0.38419	8.264000	0.89866	2.584000	0.87258	0.563000	0.77884	GCG	-	HMMPfam_UPF0560		0.552	FAM171A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM171A1	protein_coding	OTTHUMT00000046984.1	G	XM_167709		15330670	-1	no_errors	NM_001010924.1	genbank	human	validated	54_36p	missense	SNP	0.765	A
ITGA8	8516	genome.wustl.edu	37	10	15658524	15658524	+	Silent	SNP	G	G	A			TCGA-AB-2996-03A-01D-0739-09	TCGA-AB-2996-11A-01D-0739-09	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	625950a0-f786-4158-90b7-89cb96e4a23b	2b2ba0f5-7ab3-4ae0-9828-097cc0e89a15	g.chr10:15658524G>A	ENST00000378076.3	-	14	1787	c.1434C>T	c.(1432-1434)gtC>gtT	p.V478V		NM_003638.1	NP_003629	P53708	ITA8_HUMAN	integrin, alpha 8	478					brain development (GO:0007420)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|integrin-mediated signaling pathway (GO:0007229)|kidney development (GO:0001822)|memory (GO:0007613)|mesodermal cell differentiation (GO:0048333)|metanephros development (GO:0001656)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle tissue development (GO:0048745)|substrate adhesion-dependent cell spreading (GO:0034446)	apical part of cell (GO:0045177)|cell surface (GO:0009986)|dendritic spine membrane (GO:0032591)|endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integrin alpha8-beta1 complex (GO:0034678)|integrin complex (GO:0008305)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	metal ion binding (GO:0046872)	p.V478V(1)		NS(2)|breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(57)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	96						TGTAAACAGCGACTTTTCCTG	0.333																																						dbGAP											1	Substitution - coding silent(1)	haematopoietic_and_lymphoid_tissue(1)	10											124.0	111.0	115.0					10																	15658524		2203	4300	6503	15698530	SO:0001819	synonymous_variant	0			L36531	CCDS31155.1	10p13	2010-03-23			ENSG00000077943	ENSG00000077943		"""Integrins"""	6144	protein-coding gene	gene with protein product		604063				7768999	Standard	XM_005252633		Approved		uc001ioc.1	P53708	OTTHUMG00000017733	ENST00000378076.3:c.1434C>T	10.37:g.15658524G>A		Somatic	270	1.10	3		6	0.00	0	WXS	Illumina HiSeq	Phase_IV	15698530	258	45.82	219	B0YJ31|Q5VX94	Silent	SNP	HMMPfam_Integrin_alpha,HMMPfam_FG-GAP,HMMSmart_Int_alpha,HMMPfam_Integrin_alpha2,PatternScan_INTEGRIN_ALPHA,superfamily_SSF69179,superfamily_SSF69318	p.V478	ENST00000378076.3	37	c.1434	CCDS31155.1	10																																																																																			-	HMMSmart_Int_alpha,superfamily_SSF69318		0.333	ITGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA8	protein_coding	OTTHUMT00000046987.1	G	NM_003638		15698530	-1	no_errors	NM_003638.1	genbank	human	provisional	54_36p	silent	SNP	0.954	A
MKX	283078	genome.wustl.edu	37	10	28023575	28023575	+	Silent	SNP	G	G	C			TCGA-AB-2996-03A-01D-0739-09	TCGA-AB-2996-11A-01D-0739-09	G	G	G	C	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	625950a0-f786-4158-90b7-89cb96e4a23b	2b2ba0f5-7ab3-4ae0-9828-097cc0e89a15	g.chr10:28023575G>C	ENST00000375790.5	-	5	1080	c.648C>G	c.(646-648)ccC>ccG	p.P216P	MKX_ENST00000419761.1_Silent_p.P216P			Q8IYA7	MKX_HUMAN	mohawk homeobox	216					collagen fibril organization (GO:0030199)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|positive regulation of collagen biosynthetic process (GO:0032967)|tendon cell differentiation (GO:0035990)|tendon sheath development (GO:0002932)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.P216P(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(6)|ovary(2)|skin(2)	16						TCTTGTATTTGGGGGGTGCCA	0.488																																						dbGAP											1	Substitution - coding silent(1)	haematopoietic_and_lymphoid_tissue(1)	10											160.0	154.0	156.0					10																	28023575		2203	4300	6503	28063581	SO:0001819	synonymous_variant	0			BC036207	CCDS7156.1	10p12.1	2011-06-20	2006-03-31	2006-03-31	ENSG00000150051	ENSG00000150051		"""Homeoboxes / TALE class"""	23729	protein-coding gene	gene with protein product		601332	"""chromosome 10 open reading frame 48"", ""iroquois homeobox protein-like 1"""	C10orf48, IRXL1		16408284	Standard	NM_173576		Approved	MGC39616	uc001itx.4	Q8IYA7	OTTHUMG00000017862	ENST00000375790.5:c.648C>G	10.37:g.28023575G>C		Somatic	257	1.91	5		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	28063581	131	50.93	137	B3KWM5	Silent	SNP	HMMPfam_Homeobox,HMMSmart_HOX,superfamily_Homeodomain_like,PatternScan_HOMEOBOX_1	p.P216	ENST00000375790.5	37	c.648	CCDS7156.1	10																																																																																			-	NULL		0.488	MKX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MKX	protein_coding	OTTHUMT00000047332.3	G	NM_173576		28063581	-1	no_errors	NM_173576.2	genbank	human	validated	54_36p	silent	SNP	0.635	C
RPS3AP5	439992	genome.wustl.edu	37	10	86320745	86320745	+	IGR	SNP	G	G	C			TCGA-AB-2996-03A-01D-0739-09	TCGA-AB-2996-11A-01D-0739-09	G	G	G	C	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	625950a0-f786-4158-90b7-89cb96e4a23b	2b2ba0f5-7ab3-4ae0-9828-097cc0e89a15	g.chr10:86320745G>C								CCSER2 (42472 upstream) : AC091487.1 (302275 downstream)																							ATCATGACCCGAGAGGTGCAG	0.448																																						dbGAP											0			10																																								86310725	SO:0001628	intergenic_variant	0																															10.37:g.86320745G>C		Somatic	107	3.60	4		330	0.30	1	WXS	Illumina HiSeq	Phase_IV	86310725	135	44.67	109		Missense_Mutation	SNP	NULL	p.S59W		37	c.176		10																																																																																			-	NULL	0	0.448					LOC100131699			G			86310725	-1	no_errors	XM_001723921.1	genbank	human	model	54_36p	missense	SNP	1.000	C
OR5M5P	390166	genome.wustl.edu	37	11	56294543	56294543	+	IGR	SNP	C	C	A			TCGA-AB-2996-03A-01D-0739-09	TCGA-AB-2996-11A-01D-0739-09	C	C	C	A	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	625950a0-f786-4158-90b7-89cb96e4a23b	2b2ba0f5-7ab3-4ae0-9828-097cc0e89a15	g.chr11:56294543C>A								OR5M8 (35672 upstream) : OR5M11 (15202 downstream)														p.A66S(1)									TATGGACCAGCAATCAGGCGA	0.438																																						dbGAP											1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	11																																								56051119	SO:0001628	intergenic_variant	0																															11.37:g.56294543C>A		Somatic	282	0.70	2		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	56051119	223	44.80	181		Missense_Mutation	SNP	HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1,superfamily_Family A G protein-coupled receptor-like	p.A66S		37	c.196		11																																																																																			-	HMMPfam_7tm_1,superfamily_Family A G protein-coupled receptor-like	0	0.438					OR5M5P			C			56051119	-1	no_errors	ENST00000341231	ensembl	human	known	54_36p	missense	SNP	0.001	A
GDPD5	81544	genome.wustl.edu	37	11	75146565	75146565	+	Missense_Mutation	SNP	C	C	T			TCGA-AB-2996-03A-01D-0739-09	TCGA-AB-2996-11A-01D-0739-09	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	625950a0-f786-4158-90b7-89cb96e4a23b	2b2ba0f5-7ab3-4ae0-9828-097cc0e89a15	g.chr11:75146565C>T	ENST00000336898.3	-	17	2642	c.1805G>A	c.(1804-1806)cGg>cAg	p.R602Q	GDPD5_ENST00000376282.3_Missense_Mutation_p.R483Q|GDPD5_ENST00000526177.1_Missense_Mutation_p.R464Q|GDPD5_ENST00000443276.2_3'UTR|GDPD5_ENST00000529721.1_Missense_Mutation_p.R602Q|GDPD5_ENST00000533805.1_Missense_Mutation_p.R357Q|GDPD5_ENST00000533784.1_Missense_Mutation_p.R483Q	NM_030792.6	NP_110419.5	Q8WTR4	GDPD5_HUMAN	glycerophosphodiester phosphodiesterase domain containing 5	602					cerebral cortex neuron differentiation (GO:0021895)|glycerol metabolic process (GO:0006071)|lipid metabolic process (GO:0006629)|negative regulation of Notch signaling pathway (GO:0045746)|neuron projection development (GO:0031175)|positive regulation of neuron differentiation (GO:0045666)|regulation of timing of cell differentiation (GO:0048505)|spinal cord motor neuron differentiation (GO:0021522)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	glycerophosphodiester phosphodiesterase activity (GO:0008889)	p.R602Q(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(3)|skin(2)	20						ACGCCCACTCCGCTCTATGAG	0.582																																						dbGAP											1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	11											67.0	61.0	63.0					11																	75146565		2200	4293	6493	74824213	SO:0001583	missense	0			AF318377	CCDS8238.1	11q13.4-q13.5	2011-01-25				ENSG00000158555			28804	protein-coding gene	gene with protein product		609632				18667693, 17275818	Standard	NM_030792		Approved	PP1665, GDE2	uc001owp.4	Q8WTR4		ENST00000336898.3:c.1805G>A	11.37:g.75146565C>T	ENSP00000337972:p.Arg602Gln	Somatic	474	2.67	13		14	36.36	8	WXS	Illumina HiSeq	Phase_IV	74824213	90	45.12	74	Q49AQ5|Q6UX76|Q7Z4S0|Q8N781|Q8NCB7|Q8TB77	Missense_Mutation	SNP	HMMPfam_GDPD,superfamily_PLC-like phosphodiesterases	p.R602Q	ENST00000336898.3	37	c.1805	CCDS8238.1	11	.	.	.	.	.	.	.	.	.	.	C	14.44	2.535817	0.45176	.	.	ENSG00000158555	ENST00000526177;ENST00000533784;ENST00000529721;ENST00000336898;ENST00000533805;ENST00000376282	T;T;T;T;T;T	0.15017	2.46;2.46;2.47;2.47;2.47;2.46	4.84	-3.28	0.05033	.	1.125900	0.06844	N	0.796183	T	0.08714	0.0216	N	0.14661	0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.38693	-0.9649	10	0.30854	T	0.27	-11.7614	6.5086	0.22208	0.0:0.2392:0.1487:0.6121	.	483;602	Q8WTR4-2;Q8WTR4	.;GDPD5_HUMAN	Q	464;483;602;602;357;483	ENSP00000434050:R464Q;ENSP00000437049:R483Q;ENSP00000433214:R602Q;ENSP00000337972:R602Q;ENSP00000435196:R357Q;ENSP00000365459:R483Q	ENSP00000337972:R602Q	R	-	2	0	GDPD5	74824213	0.000000	0.05858	0.101000	0.21167	0.988000	0.76386	-0.759000	0.04761	-0.466000	0.06943	0.655000	0.94253	CGG	-	NULL		0.582	GDPD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GDPD5	protein_coding	OTTHUMT00000384409.1	C	NM_030792		74824213	-1	no_errors	NM_030792.6	genbank	human	validated	54_36p	missense	SNP	0.235	T
NALCN	259232	genome.wustl.edu	37	13	102047642	102047642	+	Silent	SNP	G	G	A			TCGA-AB-2996-03A-01D-0739-09	TCGA-AB-2996-11A-01D-0739-09	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	625950a0-f786-4158-90b7-89cb96e4a23b	2b2ba0f5-7ab3-4ae0-9828-097cc0e89a15	g.chr13:102047642G>A	ENST00000251127.6	-	3	264	c.183C>T	c.(181-183)ttC>ttT	p.F61F	NALCN_ENST00000470333.1_5'UTR|NALCN_ENST00000376196.3_Silent_p.F61F|NALCN_ENST00000376200.5_Silent_p.F61F	NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective	61					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)	p.F61F(1)		NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					GATAGTGCTCGAAGGTCATTG	0.453																																						dbGAP											1	Substitution - coding silent(1)	haematopoietic_and_lymphoid_tissue(1)	13											157.0	118.0	131.0					13																	102047642		2203	4300	6503	100845643	SO:0001819	synonymous_variant	0			AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.183C>T	13.37:g.102047642G>A		Somatic	131	2.96	4		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	100845643	228	44.93	186	Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Silent	SNP	HMMPfam_Ion_trans,superfamily_Voltage-gated potassium channels	p.F61	ENST00000251127.6	37	c.183	CCDS9498.1	13																																																																																			-	superfamily_Voltage-gated potassium channels		0.453	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NALCN	protein_coding	OTTHUMT00000045663.2	G	NM_052867		100845643	-1	no_errors	NM_052867.2	genbank	human	validated	54_36p	silent	SNP	1.000	A
ZNF213	7760	genome.wustl.edu	37	16	3188459	3188459	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2996-03A-01D-0739-09	TCGA-AB-2996-11A-01D-0739-09	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	625950a0-f786-4158-90b7-89cb96e4a23b	2b2ba0f5-7ab3-4ae0-9828-097cc0e89a15	g.chr16:3188459G>A	ENST00000396878.3	+	3	915	c.440G>A	c.(439-441)cGg>cAg	p.R147Q	ZNF213_ENST00000416391.2_Missense_Mutation_p.G14R|ZNF213_ENST00000576416.1_Missense_Mutation_p.R147Q|ZNF213_ENST00000574902.1_Missense_Mutation_p.R147Q	NM_001134655.1|NM_004220.2	NP_001128127.1|NP_004211.1	O14771	ZN213_HUMAN	zinc finger protein 213	147					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R147Q(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	16						GCTGCAGGCCGGGGATCCCAG	0.672																																						dbGAP											1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	16											33.0	41.0	38.0					16																	3188459		2197	4299	6496	3128460	SO:0001583	missense	0			AF017433	CCDS10495.1	16p13.3	2014-05-13	2007-02-20	2007-02-20	ENSG00000085644	ENSG00000085644		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13005	protein-coding gene	gene with protein product		608387				9653642, 10023065	Standard	NM_004220		Approved	CR53, ZKSCAN21, ZSCAN53	uc010uws.2	O14771	OTTHUMG00000177519	ENST00000396878.3:c.440G>A	16.37:g.3188459G>A	ENSP00000380087:p.Arg147Gln	Somatic	217	0.00	0		4	50.00	4	WXS	Illumina HiSeq	Phase_IV	3128460	171	47.76	160	A8K1B9|B4DMG6|Q96IS1	Missense_Mutation	SNP	HMMPfam_KRAB,HMMSmart_SM00349,superfamily_KRAB domain (Kruppel-associated box Pfam 01352),HMMPfam_SCAN,HMMSmart_SM00431,HMMPfam_zf-C2H2,PatternScan_ZINC_FINGER_C2H2_1,HMMSmart_SM00355,superfamily_C2H2 and C2HC zinc fingers	p.R147Q	ENST00000396878.3	37	c.440	CCDS10495.1	16	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.322|9.322	1.058376|1.058376	0.19987|0.19987	.|.	.|.	ENSG00000085644|ENSG00000085644	ENST00000416391|ENST00000396878	T|T	0.05081|0.04809	3.5|3.55	5.43|5.43	1.35|1.35	0.21983|0.21983	.|.	.|0.796770	.|0.10643	.|N	.|0.650809	T|T	0.01592|0.01592	0.0051|0.0051	N|N	0.01874|0.01874	-0.695|-0.695	0.09310|0.09310	N|N	1|1	.|B	.|0.06786	.|0.001	.|B	.|0.04013	.|0.001	T|T	0.48068|0.48068	-0.9067|-0.9067	7|10	0.20519|0.07482	T|T	0.43|0.82	.|.	4.6751|4.6751	0.12708|0.12708	0.636:0.1666:0.1974:0.0|0.636:0.1666:0.1974:0.0	.|.	.|147	.|O14771	.|ZN213_HUMAN	R|Q	14|147	ENSP00000403892:G14R|ENSP00000380087:R147Q	ENSP00000403892:G14R|ENSP00000380087:R147Q	G|R	+|+	1|2	0|0	ZNF213|ZNF213	3128460|3128460	0.066000|0.066000	0.20996|0.20996	0.046000|0.046000	0.18839|0.18839	0.030000|0.030000	0.12068|0.12068	0.068000|0.068000	0.14531|0.14531	0.312000|0.312000	0.23038|0.23038	-0.294000|-0.294000	0.09567|0.09567	GGG|CGG	-	NULL		0.672	ZNF213-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF213	protein_coding	OTTHUMT00000437334.1	G	NM_004220		3128460	+1	no_errors	NM_004220.1	genbank	human	validated	54_36p	missense	SNP	0.001	A
ZNF616	90317	genome.wustl.edu	37	19	52618223	52618223	+	Missense_Mutation	SNP	G	G	T			TCGA-AB-2996-03A-01D-0739-09	TCGA-AB-2996-11A-01D-0739-09	G	G	G	T	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	625950a0-f786-4158-90b7-89cb96e4a23b	2b2ba0f5-7ab3-4ae0-9828-097cc0e89a15	g.chr19:52618223G>T	ENST00000600228.1	-	4	2455	c.2194C>A	c.(2194-2196)Ctc>Atc	p.L732I	ZNF616_ENST00000330123.5_3'UTR	NM_178523.3	NP_848618.2	Q08AN1	ZN616_HUMAN	zinc finger protein 616	732					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L732I(1)		breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(14)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	48				GBM - Glioblastoma multiforme(134;0.00392)|OV - Ovarian serous cystadenocarcinoma(262;0.0189)		TGTTTGCTGAGGGAAAACAAC	0.398																																						dbGAP											1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	19											131.0	133.0	132.0					19																	52618223		2203	4300	6503	57310035	SO:0001583	missense	0			AK092266	CCDS33090.1	19q13.41	2013-01-08				ENSG00000204611		"""Zinc fingers, C2H2-type"", ""-"""	28062	protein-coding gene	gene with protein product							Standard	NM_178523		Approved	MGC45556	uc002pym.3	Q08AN1		ENST00000600228.1:c.2194C>A	19.37:g.52618223G>T	ENSP00000471000:p.Leu732Ile	Somatic	234	1.27	3		4	33.33	2	WXS	Illumina HiSeq	Phase_IV	57310035	116	48.44	109	B3KRV1|Q0P658|Q658V7	Missense_Mutation	SNP	HMMPfam_KRAB,HMMSmart_KRAB,superfamily_Krueppel-associated_box,HMMPfam_zf-C2H2,PatternScan_ZINC_FINGER_C2H2_1,HMMSmart_ZnF_C2H2,superfamily_SSF57667	p.L732I	ENST00000600228.1	37	c.2194	CCDS33090.1	19	.	.	.	.	.	.	.	.	.	.	G	12.22	1.872736	0.33069	.	.	ENSG00000204611	ENST00000330123	.	.	.	1.8	-1.12	0.09808	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.67988	0.2952	M	0.92738	3.34	0.09310	N	1	D	0.60575	0.988	D	0.74674	0.984	T	0.56517	-0.7966	8	0.87932	D	0	.	3.2047	0.06661	0.1841:0.0:0.5681:0.2478	.	732	Q08AN1	ZN616_HUMAN	I	732	.	ENSP00000328722:L732I	L	-	1	0	ZNF616	57310035	0.069000	0.21087	0.000000	0.03702	0.001000	0.01503	0.406000	0.21032	-0.420000	0.07427	-0.516000	0.04426	CTC	-	HMMPfam_zf-C2H2,PatternScan_ZINC_FINGER_C2H2_1,HMMSmart_ZnF_C2H2,superfamily_SSF57667		0.398	ZNF616-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF616	protein_coding	OTTHUMT00000462451.1	G	XM_030892		57310035	-1	no_errors	NM_178523.3	genbank	human	validated	54_36p	missense	SNP	0.066	T
U2AF1	7307	genome.wustl.edu	37	21	44524456	44524456	+	Missense_Mutation	SNP	G	G	A	rs371769427		TCGA-AB-2996-03A-01D-0739-09	TCGA-AB-2996-11A-01D-0739-09	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	625950a0-f786-4158-90b7-89cb96e4a23b	2b2ba0f5-7ab3-4ae0-9828-097cc0e89a15	g.chr21:44524456G>A	ENST00000291552.4	-	2	193	c.101C>T	c.(100-102)tCt>tTt	p.S34F	U2AF1_ENST00000380276.2_Missense_Mutation_p.S34F|U2AF1_ENST00000486519.1_5'UTR|U2AF1_ENST00000459639.1_5'UTR|U2AF1_ENST00000398137.1_5'UTR	NM_006758.2	NP_006749.1	Q01081	U2AF1_HUMAN	U2 small nuclear RNA auxiliary factor 1	34					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.S34F(45)|p.S34Y(12)		breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(111)|large_intestine(2)|lung(7)|prostate(2)|skin(1)	126						GTGCAACCGAGAGCACCTGTC	0.358			Mis		"""CLL, MDS"""																																	dbGAP		Dom	yes		21	21q22.3	7307	U2 small nuclear RNA auxiliary factor 1		L	57	Substitution - Missense(57)	haematopoietic_and_lymphoid_tissue(43)|lung(12)|endometrium(2)	21						G	PHE/SER,PHE/SER,	1,4405		0,1,2202	67.0	64.0	65.0		101,101,	5.5	1.0	21		65	0,8600		0,0,4300	no	missense,missense,utr-5	U2AF1	NM_001025203.1,NM_006758.2,NM_001025204.1	155,155,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging,	34/241,34/241,	44524456	1,13005	2203	4300	6503	43397525	SO:0001583	missense	0			BC001177	CCDS13694.1, CCDS33574.1, CCDS42948.1	21q22.3	2014-09-17	2006-04-11		ENSG00000160201	ENSG00000160201		"""RNA binding motif (RRM) containing"""	12453	protein-coding gene	gene with protein product		191317	"""U2(RNU2) small nuclear RNA auxiliary factor binding protein"", ""U2(RNU2) small nuclear RNA auxiliary factor 1"""	U2AFBP		8660980, 7956352	Standard	NM_006758		Approved	U2AF35, RNU2AF1, RN	uc002zdb.1	Q01081	OTTHUMG00000086836	ENST00000291552.4:c.101C>T	21.37:g.44524456G>A	ENSP00000291552:p.Ser34Phe	Somatic	220	3.08	7		71	51.68	77	WXS	Illumina HiSeq	Phase_IV	43397525	83	42.36	61	Q701P4|Q71RF1	Missense_Mutation	SNP	HMMPfam_RRM_1,HMMSmart_RRM,HMMPfam_zf-CCCH,HMMSmart_ZnF_C3H1,superfamily_SSF54928	p.S34F	ENST00000291552.4	37	c.101	CCDS13694.1	21	.	.	.	.	.	.	.	.	.	.	G	29.7	5.025187	0.93518	2.27E-4	0.0	ENSG00000160201	ENST00000380276;ENST00000291552	T;T	0.46063	0.88;0.88	5.47	5.47	0.80525	Zinc finger, CCCH-type (3);	0.000000	0.85682	D	0.000000	T	0.77239	0.4101	H	0.96430	3.82	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.997;0.997	D	0.84864	0.0821	10	0.87932	D	0	-15.7954	19.3169	0.94218	0.0:0.0:1.0:0.0	.	34;34;34	Q69YM7;Q01081;Q701P4	.;U2AF1_HUMAN;.	F	34	ENSP00000369629:S34F;ENSP00000291552:S34F	ENSP00000291552:S34F	S	-	2	0	U2AF1	43397525	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.864000	0.92294	2.560000	0.86352	0.563000	0.77884	TCT	-	HMMPfam_zf-CCCH,HMMSmart_ZnF_C3H1		0.358	U2AF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	U2AF1	protein_coding	OTTHUMT00000195541.1	G	NM_006758		43397525	-1	no_errors	NM_001025203.1	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
TET2	54790	genome.wustl.edu	37	4	106190782	106190783	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-AB-2996-03A-01D-0739-09	TCGA-AB-2996-11A-01D-0739-09	AG	AG	AG	-	AG	AG	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	625950a0-f786-4158-90b7-89cb96e4a23b	2b2ba0f5-7ab3-4ae0-9828-097cc0e89a15	g.chr4:106190782_106190783delAG	ENST00000540549.1	+	9	4920_4921	c.4060_4061delAG	c.(4060-4062)agafs	p.R1354fs	TET2_ENST00000513237.1_Frame_Shift_Del_p.R1375fs|TET2_ENST00000380013.4_Frame_Shift_Del_p.R1354fs|TET2_ENST00000545826.1_3'UTR			Q6N021	TET2_HUMAN	tet methylcytosine dioxygenase 2	1354					5-methylcytosine catabolic process (GO:0006211)|cell cycle (GO:0007049)|DNA demethylation (GO:0080111)|histone H3-K4 trimethylation (GO:0080182)|kidney development (GO:0001822)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|protein O-linked glycosylation (GO:0006493)		DNA binding (GO:0003677)|ferrous iron binding (GO:0008198)|methylcytosine dioxygenase activity (GO:0070579)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1272)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	1314		Myeloproliferative disorder(5;0.0393)		OV - Ovarian serous cystadenocarcinoma(123;7.18e-08)		ATATGAACACAGAGCACCAGAG	0.436			"""Mis N, F"""		MDS																																	dbGAP		Rec	yes		4	4q24	54790	tet oncogene family member 2		L	0			4																																								106410232	SO:0001589	frameshift_variant	0			AB046766	CCDS3666.1, CCDS47120.1	4q24	2014-09-17	2011-09-30	2008-03-12	ENSG00000168769	ENSG00000168769			25941	protein-coding gene	gene with protein product		612839	"""KIAA1546"", ""tet oncogene family member 2"""	KIAA1546		10997877, 12646957	Standard	NM_017628		Approved	FLJ20032	uc003hxk.3	Q6N021	OTTHUMG00000131213	ENST00000540549.1:c.4060_4061delAG	4.37:g.106190784_106190785delAG	ENSP00000442788:p.Arg1354fs	Somatic	0	3.95	7		0	0.00	0	WXS	Illumina HiSeq	Phase_IV	106410231	0	35.33	189	B5MDU0|Q2TB88|Q3LIB8|Q96JX5|Q9HCM6|Q9NXW0	Frame_Shift_Del	DEL	NULL	p.R156fs	ENST00000540549.1	37	c.466_467	CCDS47120.1	4																																																																																			-	NULL		0.436	TET2-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	TET2	protein_coding	OTTHUMT00000253952.2	AG	NM_017628		106410232	+1	no_start_codon	ENST00000265149	ensembl	human	known	54_36p	frame_shift_del	DEL	1.000:1.000	-
