#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NormalRefReads_WU	i_NormalVAF_WU	i_NormalVarReads_WU	i_ORegAnno_bin	i_RNARefReads_WU	i_RNAVAF_WU	i_RNAVarReads_WU	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TumorRefReads_WU	i_TumorVAF_WU	i_TumorVarReads_WU	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
NRK	203447	genome.wustl.edu	37	X	105178382	105178382	+	Missense_Mutation	SNP	T	T	C			TCGA-AB-3005-03A-01D-0739-09	TCGA-AB-3005-11A-01D-0739-09	T	T	T	C	T	T	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	85335b80-6d61-4344-8ab3-1cf4be2ee53f	f02e1039-61d1-460f-a731-91d178483835	g.chrX:105178382T>C	ENST00000243300.9	+	20	3748	c.3445T>C	c.(3445-3447)Tct>Cct	p.S1149P	NRK_ENST00000428173.2_Missense_Mutation_p.S1150P	NM_198465.2	NP_940867.2	Q7Z2Y5	NRK_HUMAN	Nik related kinase	1149					activation of JNKK activity (GO:0007256)|negative regulation of cell proliferation (GO:0008285)|parturition (GO:0007567)|regulation of spongiotrophoblast cell proliferation (GO:0060721)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)	p.S1150P(1)|p.S1149P(1)		breast(8)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(14)|lung(36)|ovary(3)|prostate(1)|skin(2)	76						CAATCACTCATCTCCTTCCAA	0.428										HNSCC(51;0.14)																												dbGAP											2	Substitution - Missense(2)	haematopoietic_and_lymphoid_tissue(2)	X											163.0	151.0	155.0					X																	105178382		1982	4150	6132	105065038	SO:0001583	missense	0			BX538345	CCDS65305.1	Xq22.3	2008-02-05			ENSG00000123572	ENSG00000123572			25391	protein-coding gene	gene with protein product		300791					Standard	NM_198465		Approved	DKFZp686A17109	uc004emd.3	Q7Z2Y5	OTTHUMG00000022143	ENST00000243300.9:c.3445T>C	X.37:g.105178382T>C	ENSP00000434830:p.Ser1149Pro	Somatic	776	0.13	1		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	105065038	425	13.24	65	Q32ND6|Q5H9K2|Q6ZMP2	Missense_Mutation	SNP	HMMPfam_CNH,HMMSmart_SM00036,HMMSmart_SM00219,HMMSmart_SM00220,PatternScan_PROTEIN_KINASE_ST,superfamily_p53-like transcription factors,superfamily_Protein kinase-like (PK-like),PatternScan_PROTEIN_KINASE_ATP,HMMPfam_Pkinase	p.S1150P	ENST00000243300.9	37	c.3448		X	.	.	.	.	.	.	.	.	.	.	T	13.00	2.107012	0.37145	.	.	ENSG00000123572	ENST00000243300;ENST00000428173	T;T	0.79033	-1.22;-1.23	5.08	3.94	0.45596	.	0.290613	0.25275	N	0.031845	T	0.63604	0.2525	L	0.27053	0.805	0.58432	D	0.999997	B;B	0.33318	0.408;0.057	B;B	0.35727	0.209;0.02	T	0.64317	-0.6436	10	0.52906	T	0.07	.	5.7176	0.17968	0.0:0.1168:0.0:0.8832	.	817;1149	Q7Z2Y5-2;Q7Z2Y5	.;NRK_HUMAN	P	1149;1150	ENSP00000434830:S1149P;ENSP00000438378:S1150P	ENSP00000434830:S1149P	S	+	1	0	NRK	105065038	0.626000	0.27120	0.716000	0.30569	0.041000	0.13682	1.248000	0.32827	1.948000	0.56530	0.486000	0.48141	TCT	-	NULL		0.428	NRK-001	KNOWN	non_canonical_conserved|basic|appris_candidate	protein_coding	NRK	protein_coding	OTTHUMT00000106480.6	T	NM_198465		105065038	+1	no_errors	ENST00000243300	ensembl	human	known	54_36p	missense	SNP	0.982	C
LRRC47	57470	genome.wustl.edu	37	1	3700618	3700618	+	Silent	SNP	G	G	A	rs74764187	byFrequency	TCGA-AB-3005-03A-01D-0739-09	TCGA-AB-3005-11A-01D-0739-09	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	85335b80-6d61-4344-8ab3-1cf4be2ee53f	f02e1039-61d1-460f-a731-91d178483835	g.chr1:3700618G>A	ENST00000378251.1	-	4	1279	c.1252C>T	c.(1252-1254)Ctg>Ttg	p.L418L	RP1-286D6.5_ENST00000607459.1_RNA|RN7SL574P_ENST00000581512.1_RNA	NM_020710.2	NP_065761.1	Q8N1G4	LRC47_HUMAN	leucine rich repeat containing 47	418							phenylalanine-tRNA ligase activity (GO:0004826)|poly(A) RNA binding (GO:0044822)	p.L418L(1)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(5)|ovary(2)|prostate(1)|urinary_tract(1)	17	all_cancers(77;0.0375)|Ovarian(185;0.0634)|all_lung(157;0.208)|Lung NSC(156;0.21)	all_epithelial(116;1.34e-16)|all_lung(118;2.53e-06)|Lung NSC(185;0.00028)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Lung SC(97;0.0743)|Ovarian(437;0.127)		Epithelial(90;5.49e-39)|OV - Ovarian serous cystadenocarcinoma(86;1.43e-22)|GBM - Glioblastoma multiforme(42;3.69e-16)|Colorectal(212;1.21e-05)|COAD - Colon adenocarcinoma(227;5.87e-05)|Kidney(185;0.000367)|BRCA - Breast invasive adenocarcinoma(365;0.000704)|KIRC - Kidney renal clear cell carcinoma(229;0.00567)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.124)		TCGGCCTCCAGCTGCAGCTGC	0.662													G|||	35	0.00698882	0.0	0.0115	5008	,	,		14207	0.001		0.0239	False		,,,				2504	0.002					dbGAP											1	Substitution - coding silent(1)	haematopoietic_and_lymphoid_tissue(1)	1						G		8,4398	12.9+/-30.5	0,8,2195	34.0	34.0	34.0		1252	3.0	1.0	1	dbSNP_133	34	128,8470	61.7+/-123.6	1,126,4172	no	coding-synonymous	LRRC47	NM_020710.2		1,134,6367	AA,AG,GG		1.4887,0.1816,1.0458		418/584	3700618	136,12868	2203	4299	6502	3690478	SO:0001819	synonymous_variant	0			AB033011	CCDS51.1	1p36.32	2008-02-05			ENSG00000130764	ENSG00000130764			29207	protein-coding gene	gene with protein product						10574461	Standard	NM_020710		Approved	KIAA1185, RP1-286D6.3	uc001akx.1	Q8N1G4	OTTHUMG00000003506	ENST00000378251.1:c.1252C>T	1.37:g.3700618G>A		Somatic	345	0.00	0		22	40.00	18	WXS	Illumina HiSeq	Phase_IV	3690478	59	53.12	68	Q9ULN5	Silent	SNP	HMMPfam_LRR_1,HMMSmart_LRR_TYP,HMMPfam_B3_4,superfamily_SSF52047	p.L418	ENST00000378251.1	37	c.1252	CCDS51.1	1																																																																																			-	HMMPfam_B3_4		0.662	LRRC47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC47	protein_coding	OTTHUMT00000009744.1	G	NM_020710		3690478	-1	no_errors	NM_020710.2	genbank	human	validated	54_36p	silent	SNP	0.603	A
NOTCH2NL	388677	genome.wustl.edu	37	1	145273366	145273366	+	Nonsense_Mutation	SNP	C	C	T	rs140871032	byFrequency	TCGA-AB-3005-03A-01D-0739-09	TCGA-AB-3005-11A-01D-0739-09	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	85335b80-6d61-4344-8ab3-1cf4be2ee53f	f02e1039-61d1-460f-a731-91d178483835	g.chr1:145273366C>T	ENST00000369340.3	+	4	664	c.220C>T	c.(220-222)Cga>Tga	p.R74*	NOTCH2NL_ENST00000362074.6_Nonsense_Mutation_p.R74*|NOTCH2NL_ENST00000344859.3_Nonsense_Mutation_p.R74*|RP11-458D21.5_ENST00000468030.1_Nonsense_Mutation_p.R74*			Q7Z3S9	NT2NL_HUMAN	notch 2 N-terminal like	74	EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|Notch signaling pathway (GO:0007219)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	calcium ion binding (GO:0005509)	p.R74*(2)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	27						CTTTGTGTCTCGACCTTGCCT	0.547																																						dbGAP											2	Substitution - Nonsense(2)	haematopoietic_and_lymphoid_tissue(2)	1						C	stop/ARG	30,4376	27.2+/-55.0	0,30,2173	503.0	457.0	473.0		220	2.8	0.8	1	dbSNP_134	473	104,8496	44.9+/-103.4	0,104,4196	no	stop-gained	NOTCH2NL	NM_203458.3		0,134,6369	TT,TC,CC		1.2093,0.6809,1.0303		74/237	145273366	134,12872	2203	4300	6503	143984723	SO:0001587	stop_gained	0				CCDS72880.1	1q21.2	2010-06-24	2010-06-24		ENSG00000213240	ENSG00000213240			31862	protein-coding gene	gene with protein product			"""Notch homolog 2 (Drosophila) N-terminal like"""			14673143	Standard	NM_203458		Approved	N2N	uc001emn.4	Q7Z3S9	OTTHUMG00000013754	ENST00000369340.3:c.220C>T	1.37:g.145273366C>T	ENSP00000358346:p.Arg74*	Somatic	5403	0.09	5		66	18.52	15	WXS	Illumina HiSeq	Phase_IV	143984723	3924	14.20	650	Q5BKT8|Q5VTG9|Q5XG84|Q6P192|Q8NC23|Q8WUQ9|Q96FY1	Nonsense_Mutation	SNP	PatternScan_ASX_HYDROXYL,HMMSmart_SM00179,HMMPfam_EGF,HMMSmart_SM00181,PatternScan_EGF_1,PatternScan_EGF_2,HMMPfam_EGF_CA,PatternScan_EGF_CA,superfamily_EGF/Laminin	p.R74*	ENST00000369340.3	37	c.220	CCDS909.1	1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.373173	0.82573	0.006809	0.012093	ENSG00000213240	ENST00000362074;ENST00000344859;ENST00000369340	.	.	.	2.75	2.75	0.32379	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.20046	T	0.44	.	11.2552	0.49050	0.0:1.0:0.0:0.0	.	.	.	.	X	74	.	ENSP00000344557:R74X	R	+	1	2	NOTCH2NL	143984723	0.982000	0.34865	0.838000	0.33150	0.100000	0.18952	5.568000	0.67385	1.532000	0.49169	0.394000	0.25966	CGA	-	HMMSmart_SM00179,HMMPfam_EGF,HMMSmart_SM00181,superfamily_EGF/Laminin		0.547	NOTCH2NL-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NOTCH2NL	protein_coding	OTTHUMT00000038546.1	C	NM_203458		143984723	+1	no_errors	NM_203458.3	genbank	human	validated	54_36p	nonsense	SNP	0.852	T
ATP6V1G3	127124	genome.wustl.edu	37	1	198509740	198509740	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-3005-03A-01D-0739-09	TCGA-AB-3005-11A-01D-0739-09	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	85335b80-6d61-4344-8ab3-1cf4be2ee53f	f02e1039-61d1-460f-a731-91d178483835	g.chr1:198509740G>A	ENST00000367382.1	-	1	125	c.41C>T	c.(40-42)gCa>gTa	p.A14V	ATP6V1G3_ENST00000489986.1_Missense_Mutation_p.A14V|ATP6V1G3_ENST00000309309.7_Missense_Mutation_p.A14V|ATP6V1G3_ENST00000281087.2_Missense_Mutation_p.A14V|ATP6V1G3_ENST00000367381.1_Missense_Mutation_p.A14V			Q96LB4	VATG3_HUMAN	ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G3	14					cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase complex (GO:0016471)	ATPase binding (GO:0051117)|hydrogen-exporting ATPase activity, phosphorylative mechanism (GO:0008553)	p.A14V(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|prostate(1)	7						CCGTTTTTCTGCCTGAAGAAG	0.483																																						dbGAP											1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	1											212.0	187.0	195.0					1																	198509740		2203	4300	6503	196776363	SO:0001583	missense	0			AY039760	CCDS1395.1, CCDS1396.1	1q32.2	2010-04-21	2006-01-13		ENSG00000151418	ENSG00000151418		"""ATPases / V-type"""	18265	protein-coding gene	gene with protein product			"""ATPase, H+ transporting, lysosomal 13kD, V1 subunit G isoform 3"", ""ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G isoform 3"""			9442887	Standard	NM_133262		Approved	ATP6G3, Vma10	uc001gup.3	Q96LB4	OTTHUMG00000035661	ENST00000367382.1:c.41C>T	1.37:g.198509740G>A	ENSP00000356352:p.Ala14Val	Somatic	1583	0.13	2		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	196776363	603	38.62	380	Q495K2|Q495K4|Q5T9L6	Missense_Mutation	SNP	HMMPfam_V-ATPase_G	p.A14V	ENST00000367382.1	37	c.41	CCDS1395.1	1	.	.	.	.	.	.	.	.	.	.	G	26.6	4.753104	0.89753	.	.	ENSG00000151418	ENST00000367382;ENST00000309309;ENST00000367381;ENST00000281087;ENST00000489986	T;T;T;T;T	0.72394	-0.65;-0.65;-0.65;-0.65;-0.65	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	D	0.86648	0.5983	M	0.87269	2.87	0.58432	D	0.999996	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.998	D	0.87917	0.2701	10	0.72032	D	0.01	-19.7136	17.8461	0.88730	0.0:0.0:1.0:0.0	.	14;14;14	Q96LB4-4;Q96LB4;Q96LB4-3	.;VATG3_HUMAN;.	V	14	ENSP00000356352:A14V;ENSP00000309574:A14V;ENSP00000356351:A14V;ENSP00000281087:A14V;ENSP00000417171:A14V	ENSP00000281087:A14V	A	-	2	0	ATP6V1G3	196776363	1.000000	0.71417	1.000000	0.80357	0.835000	0.47333	6.508000	0.73721	2.821000	0.97095	0.484000	0.47621	GCA	-	HMMPfam_V-ATPase_G		0.483	ATP6V1G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP6V1G3	protein_coding	OTTHUMT00000086559.1	G	NM_133326		196776363	-1	no_errors	NM_133262.2	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
Unknown	0	genome.wustl.edu	37	2	883813	883813	+	IGR	SNP	C	C	G			TCGA-AB-3005-03A-01D-0739-09	TCGA-AB-3005-11A-01D-0739-09	C	C	C	G	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	85335b80-6d61-4344-8ab3-1cf4be2ee53f	f02e1039-61d1-460f-a731-91d178483835	g.chr2:883813C>G								AC113607.1 (19701 upstream) : AC113607.2 (12088 downstream)																							GAGGAGACCCCAACTGCCCTG	0.443																																						dbGAP											0			2																																								873813	SO:0001628	intergenic_variant	0																															2.37:g.883813C>G		Somatic	2319	0.00	0		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	873813	409	42.46	304		Missense_Mutation	SNP	NULL	p.W153S		37	c.458		2																																																																																			-	NULL	0	0.443					LOC200493			C			873813	-1	no_start_codon:pseudogene:no_stop_codon	XM_115715.5	genbank	human	model	54_36p	missense	SNP	0.011	G
PRR21	643905	genome.wustl.edu	37	2	240982243	240982243	+	Missense_Mutation	SNP	G	G	A	rs80033040	byFrequency	TCGA-AB-3005-03A-01D-0739-09	TCGA-AB-3005-11A-01D-0739-09	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	85335b80-6d61-4344-8ab3-1cf4be2ee53f	f02e1039-61d1-460f-a731-91d178483835	g.chr2:240982243G>A	ENST00000408934.1	-	1	156	c.157C>T	c.(157-159)Cgg>Tgg	p.R53W		NM_001080835.1	NP_001074304.1	Q8WXC7	PRR21_HUMAN	proline rich 21	53	Pro-rich.							p.R53W(2)		NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(7)|ovary(2)|prostate(5)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)	29						GTGAAGAGCCGTGGATGAAGG	0.582																																						dbGAP											2	Substitution - Missense(2)	haematopoietic_and_lymphoid_tissue(2)	2											121.0	107.0	112.0					2																	240982243		2203	4300	6503	240630916	SO:0001583	missense	0			AF453950	CCDS33417.1	2q37.3	2009-04-20			ENSG00000221961	ENSG00000221961			33866	protein-coding gene	gene with protein product							Standard	NM_001080835		Approved		uc010zod.2	Q8WXC7	OTTHUMG00000159174	ENST00000408934.1:c.157C>T	2.37:g.240982243G>A	ENSP00000386166:p.Arg53Trp	Somatic	4899	0.06	3		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	240630916	4376	13.27	670		Missense_Mutation	SNP	NULL	p.R53W	ENST00000408934.1	37	c.157	CCDS33417.1	2	.	.	.	.	.	.	.	.	.	.	N	7.137	0.581093	0.13686	.	.	ENSG00000221961	ENST00000408934;ENST00000486799	T;T	0.13657	2.57;2.57	1.19	-1.7	0.08159	.	.	.	.	.	T	0.05640	0.0148	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.35101	-0.9802	9	0.56958	D	0.05	.	2.7336	0.05234	0.2267:0.299:0.4742:0.0	.	53	Q8WXC7	PRR21_HUMAN	W	53	ENSP00000386166:R53W;ENSP00000418240:R53W	ENSP00000386166:R53W	R	-	1	2	PRR21	240630916	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.394000	0.07296	-0.428000	0.07339	-0.481000	0.04817	CGG	-	NULL		0.582	PRR21-201	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC643905	protein_coding		G	NM_001080835		240630916	-1	no_errors	NM_001080835.1	genbank	human	predicted	54_36p	missense	SNP	0.003	A
CELSR3	1951	genome.wustl.edu	37	3	48694471	48694471	+	Silent	SNP	C	C	T	rs145229058	byFrequency	TCGA-AB-3005-03A-01D-0739-09	TCGA-AB-3005-11A-01D-0739-09	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	85335b80-6d61-4344-8ab3-1cf4be2ee53f	f02e1039-61d1-460f-a731-91d178483835	g.chr3:48694471C>T	ENST00000164024.4	-	2	4339	c.4059G>A	c.(4057-4059)caG>caA	p.Q1353Q	CELSR3_ENST00000544264.1_Silent_p.Q1353Q	NM_001407.2	NP_001398.2	Q9NYQ7	CELR3_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 3	1353					axonal fasciculation (GO:0007413)|cilium assembly (GO:0042384)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of protein localization (GO:0032880)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.Q1353Q(1)		NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(9)|prostate(6)|skin(7)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	83				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		ACAACTGCTCCTGCAGCTCCT	0.682													C|||	8	0.00159744	0.0	0.0043	5008	,	,		16494	0.0		0.005	False		,,,				2504	0.0					dbGAP											1	Substitution - coding silent(1)	haematopoietic_and_lymphoid_tissue(1)	3						C		5,4395	8.1+/-20.4	0,5,2195	42.0	44.0	43.0		4059	2.1	1.0	3	dbSNP_134	43	76,8518	44.9+/-103.4	1,74,4222	no	coding-synonymous	CELSR3	NM_001407.2		1,79,6417	TT,TC,CC		0.8843,0.1136,0.6234		1353/3313	48694471	81,12913	2200	4297	6497	48669475	SO:0001819	synonymous_variant	0			AF231023	CCDS2775.1	3p21.31	2014-08-08	2013-02-18		ENSG00000008300	ENSG00000008300		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3230	protein-coding gene	gene with protein product	"""flamingo homolog 1 (Drosophila)"""	604264	"""cadherin EGF LAG seven-pass G-type receptor 3, flamingo (Drosophila) homolog"""	EGFL1		9693030	Standard	NM_001407		Approved	MEGF2, HFMI1, FMI1, CDHF11	uc003cuf.1	Q9NYQ7	OTTHUMG00000133544	ENST00000164024.4:c.4059G>A	3.37:g.48694471C>T		Somatic	819	0.12	1		7	12.50	1	WXS	Illumina HiSeq	Phase_IV	48669475	162	47.59	148	O75092	Silent	SNP	PatternScan_ASX_HYDROXYL,HMMPfam_GPS,HMMSmart_SM00303,HMMPfam_7tm_2,HMMSmart_SM00282,HMMPfam_HRM,HMMSmart_SM00008,HMMSmart_SM00179,HMMPfam_Laminin_EGF,HMMSmart_SM00180,PatternScan_EGF_LAM_1,HMMPfam_Cadherin,HMMSmart_SM00112,PatternScan_CADHERIN_1,HMMPfam_EGF,HMMSmart_SM00181,superfamily_Concanavalin A-like lectins/glucanases,HMMPfam_Laminin_G_2,PatternScan_EGF_1,PatternScan_EGF_2,superfamily_Cadherin-like,PatternScan_G_PROTEIN_RECEP_F2_2,superfamily_EGF/Laminin	p.Q1353	ENST00000164024.4	37	c.4059	CCDS2775.1	3																																																																																			-	NULL		0.682	CELSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELSR3	protein_coding	OTTHUMT00000257523.1	C	NM_001407		48669475	-1	no_errors	NM_001407.2	genbank	human	reviewed	54_36p	silent	SNP	1.000	T
PCDHGA3	56112	genome.wustl.edu	37	5	140724205	140724205	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-3005-03A-01D-0739-09	TCGA-AB-3005-11A-01D-0739-09	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	85335b80-6d61-4344-8ab3-1cf4be2ee53f	f02e1039-61d1-460f-a731-91d178483835	g.chr5:140724205G>A	ENST00000253812.6	+	1	605	c.605G>A	c.(604-606)cGt>cAt	p.R202H	PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron	NM_018916.3|NM_032011.1	NP_061739.2|NP_114400.1	Q9Y5H0	PCDG3_HUMAN	protocadherin gamma subfamily A, 3	202	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R202H(1)		breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCCCTGGACCGTGAGAAAAAA	0.537																																						dbGAP											1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	5											50.0	53.0	52.0					5																	140724205		2141	4269	6410	140704389	SO:0001583	missense	0			AF152510	CCDS47290.1, CCDS75329.1	5q31	2010-01-26			ENSG00000254245	ENSG00000254245		"""Cadherins / Protocadherins : Clustered"""	8701	other	protocadherin		606290				10380929	Standard	NM_032011		Approved	PCDH-GAMMA-A3		Q9Y5H0	OTTHUMG00000163680	ENST00000253812.6:c.605G>A	5.37:g.140724205G>A	ENSP00000253812:p.Arg202His	Somatic	1100	0.27	3		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	140704389	276	26.60	100	Q9Y5D4	Missense_Mutation	SNP	HMMPfam_Cadherin,HMMSmart_SM00112,PatternScan_CADHERIN_1,HMMPfam_Cadherin_2,superfamily_Cadherin-like	p.R202H	ENST00000253812.6	37	c.605	CCDS47290.1	5	.	.	.	.	.	.	.	.	.	.	.	18.00	3.525160	0.64747	.	.	ENSG00000254245	ENST00000253812	T	0.27104	1.69	5.65	5.65	0.86999	Cadherin (3);Cadherin-like (1);	0.000000	0.32401	U	0.006154	T	0.63046	0.2478	M	0.92833	3.35	0.38066	D	0.936225	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.967	T	0.72207	-0.4360	10	0.56958	D	0.05	.	19.7068	0.96076	0.0:0.0:1.0:0.0	.	202;202	Q9Y5H0-2;Q9Y5H0	.;PCDG3_HUMAN	H	202	ENSP00000253812:R202H	ENSP00000253812:R202H	R	+	2	0	PCDHGA3	140704389	0.998000	0.40836	0.959000	0.39883	0.326000	0.28443	7.837000	0.86796	2.824000	0.97209	0.655000	0.94253	CGT	-	HMMPfam_Cadherin,HMMSmart_SM00112,superfamily_Cadherin-like		0.537	PCDHGA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA3	protein_coding	OTTHUMT00000377017.1	G	NM_018916		140704389	+1	no_errors	NM_018916.3	genbank	human	reviewed	54_36p	missense	SNP	0.968	A
MDFI	4188	genome.wustl.edu	37	6	41621216	41621216	+	Missense_Mutation	SNP	C	C	A			TCGA-AB-3005-03A-01D-0739-09	TCGA-AB-3005-11A-01D-0739-09	C	C	C	A	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	85335b80-6d61-4344-8ab3-1cf4be2ee53f	f02e1039-61d1-460f-a731-91d178483835	g.chr6:41621216C>A	ENST00000373050.4	+	4	648	c.461C>A	c.(460-462)cCc>cAc	p.P154H				Q99750	MDFI_HUMAN	MyoD family inhibitor	215					activation of JUN kinase activity (GO:0007257)|cytoplasmic sequestering of transcription factor (GO:0042994)|dorsal/ventral axis specification (GO:0009950)|embryo development (GO:0009790)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of DNA binding (GO:0043392)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of Wnt signaling pathway (GO:0030178)|trophoblast giant cell differentiation (GO:0060707)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.P215H(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|liver(2)|prostate(2)|skin(1)|urinary_tract(1)	8	Ovarian(28;0.0327)|Colorectal(47;0.121)		Colorectal(64;0.0123)|COAD - Colon adenocarcinoma(64;0.0264)|KIRC - Kidney renal clear cell carcinoma(1;0.138)			TGCGACCTGCCCTGCGACCTG	0.662																																						dbGAP											1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	6											114.0	101.0	105.0					6																	41621216		2203	4300	6503	41729194	SO:0001583	missense	0			U78313	CCDS4857.1, CCDS75451.1	6p21	2008-08-29			ENSG00000112559	ENSG00000112559			6967	protein-coding gene	gene with protein product	"""inhibitor of MyoD family a"""	604971				9250874, 17289077	Standard	NM_005586		Approved	I-mfa	uc003oqq.4	Q99750	OTTHUMG00000014681	ENST00000373050.4:c.461C>A	6.37:g.41621216C>A	ENSP00000362141:p.Pro154His	Somatic	1362	0.22	3		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	41729194	297	40.00	198		Missense_Mutation	SNP	PatternScan_TNFR_NGFR_1	p.P215H	ENST00000373050.4	37	c.644		6	.	.	.	.	.	.	.	.	.	.	C	24.0	4.486648	0.84854	.	.	ENSG00000112559	ENST00000419164;ENST00000373051;ENST00000230321;ENST00000543326;ENST00000373050	.	.	.	5.1	5.1	0.69264	.	0.123212	0.56097	D	0.000028	T	0.75759	0.3893	M	0.77313	2.365	0.42996	D	0.994508	D	0.89917	1.0	D	0.76071	0.987	T	0.77091	-0.2716	8	.	.	.	-15.0542	18.1318	0.89604	0.0:1.0:0.0:0.0	.	215	Q99750	MDFI_HUMAN	H	215;215;215;215;154	.	.	P	+	2	0	MDFI	41729194	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.894000	0.69806	2.371000	0.80710	0.555000	0.69702	CCC	-	NULL		0.662	MDFI-002	NOVEL	basic	protein_coding	MDFI	protein_coding	OTTHUMT00000040519.2	C	NM_005586		41729194	+1	no_errors	NM_005586.3	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
GRIK2	2898	genome.wustl.edu	37	6	102511871	102511871	+	Intron	SNP	C	C	T			TCGA-AB-3005-03A-01D-0739-09	TCGA-AB-3005-11A-01D-0739-09	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	85335b80-6d61-4344-8ab3-1cf4be2ee53f	f02e1039-61d1-460f-a731-91d178483835	g.chr6:102511871C>T	ENST00000421544.1	+	16	3052				GRIK2_ENST00000369134.4_Intron|GRIK2_ENST00000369137.3_Intron|GRIK2_ENST00000369138.1_Intron|GRIK2_ENST00000413795.1_Missense_Mutation_p.P866L|GRIK2_ENST00000318991.6_Missense_Mutation_p.P866L	NM_021956.4	NP_068775.1	Q13002	GRIK2_HUMAN	glutamate receptor, ionotropic, kainate 2						behavioral fear response (GO:0001662)|cellular calcium ion homeostasis (GO:0006874)|glutamate receptor signaling pathway (GO:0007215)|intracellular protein transport (GO:0006886)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|neuronal action potential (GO:0019228)|positive regulation of synaptic transmission (GO:0050806)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission (GO:0050804)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)	p.P866L(1)		NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(37)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	CCATACCATCCAGACACTGTT	0.289																																						dbGAP											1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	6											72.0	70.0	71.0					6																	102511871		2201	4292	6493	102618564	SO:0001627	intron_variant	0				CCDS5048.1, CCDS5049.1, CCDS55045.1	6q16.3	2012-08-29			ENSG00000164418	ENSG00000164418		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4580	protein-coding gene	gene with protein product		138244		GLUR6		8034316	Standard	NM_021956		Approved	GluK2, MRT6	uc003pqp.4	Q13002	OTTHUMG00000016328	ENST00000421544.1:c.2563-4351C>T	6.37:g.102511871C>T		Somatic	1077	0.09	1		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	102618564	88	42.58	66	A6NMY9|B5MCV0|D7RWZ3|D7RWZ4|D7RWZ5|D7RWZ6|D7RWZ7|Q8WWS1|Q96KS6|Q96KS7|Q96KS8	Missense_Mutation	SNP	HMMPfam_Lig_chan,HMMSmart_PBPe,HMMPfam_ANF_receptor,HMMPfam_Lig_chan-Glu_bd,superfamily_SSF53822,superfamily_SSF53850	p.P866L	ENST00000421544.1	37	c.2597	CCDS5048.1	6	.	.	.	.	.	.	.	.	.	.	C	12.14	1.849266	0.32699	.	.	ENSG00000164418	ENST00000413795;ENST00000318991;ENST00000540076	T;T	0.12361	2.69;2.69	5.05	5.05	0.67936	.	.	.	.	.	T	0.09949	0.0244	N	0.08118	0	0.80722	D	1	D	0.57899	0.981	D	0.70016	0.967	T	0.24764	-1.0151	9	0.37606	T	0.19	.	11.9017	0.52687	0.0:0.8247:0.1753:0.0	.	866	Q13002-2	.	L	866;866;641	ENSP00000405596:P866L;ENSP00000313276:P866L	ENSP00000313276:P866L	P	+	2	0	GRIK2	102618564	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.675000	0.25232	2.785000	0.95823	0.591000	0.81541	CCA	-	NULL		0.289	GRIK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIK2	protein_coding	OTTHUMT00000043718.1	C			102618564	+1	no_errors	NM_175768.3	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
FNDC1	84624	genome.wustl.edu	37	6	159653543	159653543	+	Missense_Mutation	SNP	C	C	T			TCGA-AB-3005-03A-01D-0739-09	TCGA-AB-3005-11A-01D-0739-09	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	85335b80-6d61-4344-8ab3-1cf4be2ee53f	f02e1039-61d1-460f-a731-91d178483835	g.chr6:159653543C>T	ENST00000297267.9	+	11	2199	c.1999C>T	c.(1999-2001)Cgg>Tgg	p.R667W	FNDC1_ENST00000340366.6_Missense_Mutation_p.R604W	NM_032532.2	NP_115921.2	Q4ZHG4	FNDC1_HUMAN	fibronectin type III domain containing 1	667					cellular response to hypoxia (GO:0071456)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of protein phosphorylation (GO:0001934)|regulation of protein transport (GO:0051223)	cell-cell junction (GO:0005911)|extracellular region (GO:0005576)|mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.R667W(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(29)|liver(2)|lung(23)|ovary(3)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)	93		Breast(66;0.000781)|Ovarian(120;0.0308)|Prostate(117;0.195)		OV - Ovarian serous cystadenocarcinoma(65;2.6e-16)|BRCA - Breast invasive adenocarcinoma(81;1.06e-05)		CGCCCAGCCCCGGCCAGCCCT	0.692																																						dbGAP											1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	6											14.0	18.0	17.0					6																	159653543		1969	4107	6076	159573533	SO:0001583	missense	0			AB058769	CCDS47512.1	6q25	2013-02-11			ENSG00000164694	ENSG00000164694		"""Fibronectin type III domain containing"""	21184	protein-coding gene	gene with protein product		609991	"""fibronectin type III domain containing 2"""	FNDC2		11347906	Standard	NM_032532		Approved	bA243O10.1, KIAA1866, dJ322A24.1	uc010kjv.3	Q4ZHG4	OTTHUMG00000015927	ENST00000297267.9:c.1999C>T	6.37:g.159653543C>T	ENSP00000297267:p.Arg667Trp	Somatic	277	0.36	1		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	159573533	103	53.91	124	A6H8X2|B7ZBR4|B7ZBR5|B9EK49|Q5JPI0|Q5VU31|Q5VU32|Q5VXX4|Q70CQ6|Q96JG1	Missense_Mutation	SNP	HMMPfam_fn3,HMMSmart_FN3,superfamily_FN_III-like	p.R667W	ENST00000297267.9	37	c.1999	CCDS47512.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.38|13.38	2.220696|2.220696	0.39201|0.39201	.|.	.|.	ENSG00000164694|ENSG00000164694	ENST00000329629|ENST00000297267;ENST00000340366	T|T;T	0.03301|0.08896	3.98|3.04;3.86	4.64|4.64	0.387|0.387	0.16259|0.16259	.|.	.|1.268200	.|0.05190	.|N	.|0.502856	T|T	0.06690|0.06690	0.0171|0.0171	N|N	0.24115|0.24115	0.695|0.695	0.09310|0.09310	N|N	1|1	.|D;D	.|0.89917	.|1.0;0.999	.|D;P	.|0.63703	.|0.917;0.762	T|T	0.45454|0.45454	-0.9260|-0.9260	7|10	0.72032|0.51188	D|T	0.01|0.08	-3.1622|-3.1622	11.4825|11.4825	0.50333|0.50333	0.618:0.382:0.0:0.0|0.618:0.382:0.0:0.0	.|.	.|604;667	.|Q4ZHG4-2;Q4ZHG4	.|.;FNDC1_HUMAN	L|W	562|667;604	ENSP00000333297:P562L|ENSP00000297267:R667W;ENSP00000342460:R604W	ENSP00000333297:P562L|ENSP00000297267:R667W	P|R	+|+	2|1	0|2	FNDC1|FNDC1	159573533|159573533	0.000000|0.000000	0.05858|0.05858	0.014000|0.014000	0.15608|0.15608	0.047000|0.047000	0.14425|0.14425	-0.071000|-0.071000	0.11505|0.11505	-0.273000|-0.273000	0.09246|0.09246	0.655000|0.655000	0.94253|0.94253	CCG|CGG	-	NULL		0.692	FNDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FNDC1	protein_coding	OTTHUMT00000042897.3	C	NM_032532		159573533	+1	no_errors	NM_032532.2	genbank	human	validated	54_36p	missense	SNP	0.002	T
MAGI2	9863	genome.wustl.edu	37	7	77649085	77649085	+	Silent	SNP	C	C	T	rs117054456	byFrequency	TCGA-AB-3005-03A-01D-0739-09	TCGA-AB-3005-11A-01D-0739-09	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	85335b80-6d61-4344-8ab3-1cf4be2ee53f	f02e1039-61d1-460f-a731-91d178483835	g.chr7:77649085C>T	ENST00000354212.4	-	22	4168	c.3915G>A	c.(3913-3915)caG>caA	p.Q1305Q	MAGI2_ENST00000522391.1_3'UTR|MAGI2_ENST00000419488.1_Silent_p.Q1291Q	NM_012301.3	NP_036433.2	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 2	1305					cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|glomerular visceral epithelial cell development (GO:0072015)|mitotic cell cycle arrest (GO:0071850)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein kinase B signaling (GO:0051898)|nerve growth factor signaling pathway (GO:0038180)|planar cell polarity pathway involved in axis elongation (GO:0003402)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of receptor internalization (GO:0002092)|protein heterooligomerization (GO:0051291)|receptor clustering (GO:0043113)|SMAD protein signal transduction (GO:0060395)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|late endosome (GO:0005770)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)|synapse (GO:0045202)|tight junction (GO:0005923)	beta-1 adrenergic receptor binding (GO:0031697)|phosphatase binding (GO:0019902)|receptor signaling complex scaffold activity (GO:0030159)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|type II activin receptor binding (GO:0070699)	p.Q1305Q(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(37)|ovary(5)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(3)	84		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				GCTGCTTCTTCTGGCCGCAGG	0.687													C|||	62	0.0123802	0.0008	0.0259	5008	,	,		5944	0.0		0.0348	False		,,,				2504	0.0082					dbGAP											1	Substitution - coding silent(1)	haematopoietic_and_lymphoid_tissue(1)	7						C		46,4360	47.5+/-82.1	1,44,2158	46.0	54.0	51.0		3915	3.6	1.0	7	dbSNP_132	51	341,8259	111.4+/-171.7	9,323,3968	no	coding-synonymous	MAGI2	NM_012301.3		10,367,6126	TT,TC,CC		3.9651,1.044,2.9755		1305/1456	77649085	387,12619	2203	4300	6503	77487021	SO:0001819	synonymous_variant	0			AB014605	CCDS5594.1, CCDS75623.1	7q21	2005-08-09			ENSG00000187391	ENSG00000187391			18957	protein-coding gene	gene with protein product		606382				10681527, 9734811	Standard	XM_005250725		Approved	AIP1, ARIP1, KIAA0705, ACVRIP1, MAGI-2	uc003ugx.3	Q86UL8	OTTHUMG00000130697	ENST00000354212.4:c.3915G>A	7.37:g.77649085C>T		Somatic	286	0.00	0		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	77487021	57	53.28	65	A4D1C1|A7E2C3|O60434|O60510|Q86UI7|Q9NP44|Q9UDQ5|Q9UDU1	Silent	SNP	HMMPfam_WW,HMMSmart_SM00456,PatternScan_WW_DOMAIN_1,superfamily_WW domain,HMMPfam_PDZ,HMMSmart_SM00228,superfamily_PDZ domain-like,HMMPfam_Guanylate_kin,HMMSmart_SM00072,PatternScan_GUANYLATE_KINASE_1,superfamily_P-loop containing nucleoside triphosphate hydrolases	p.Q1305	ENST00000354212.4	37	c.3915	CCDS5594.1	7																																																																																			-	NULL		0.687	MAGI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGI2	protein_coding	OTTHUMT00000253197.3	C	NM_012301		77487021	-1	no_errors	NM_012301.3	genbank	human	reviewed	54_36p	silent	SNP	1.000	T
PARD3	56288	genome.wustl.edu	37	10	34400214	34400214	+	Missense_Mutation	SNP	G	G	T			TCGA-AB-3005-03A-01D-0739-09	TCGA-AB-3005-11A-01D-0739-09	G	G	G	T	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	85335b80-6d61-4344-8ab3-1cf4be2ee53f	f02e1039-61d1-460f-a731-91d178483835	g.chr10:34400214G>T	ENST00000374789.3	-	25	4279	c.3954C>A	c.(3952-3954)gaC>gaA	p.D1318E	PARD3_ENST00000374788.3_Missense_Mutation_p.D1315E|PARD3_ENST00000346874.4_Missense_Mutation_p.D1281E|PARD3_ENST00000545693.1_Missense_Mutation_p.D1302E|PARD3_ENST00000545260.1_Missense_Mutation_p.D1228E|PARD3_ENST00000374790.3_Missense_Mutation_p.D1258E|PARD3_ENST00000350537.4_Missense_Mutation_p.D1272E|PARD3_ENST00000374794.3_Missense_Mutation_p.D1206E	NM_019619.3	NP_062565.2	Q8TEW0	PARD3_HUMAN	par-3 family cell polarity regulator	1318					apical constriction (GO:0003383)|asymmetric cell division (GO:0008356)|axonogenesis (GO:0007409)|cell cycle (GO:0007049)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|centrosome localization (GO:0051642)|establishment of epithelial cell polarity (GO:0090162)|establishment or maintenance of cell polarity (GO:0007163)|microtubule cytoskeleton organization (GO:0000226)|myelination in peripheral nervous system (GO:0022011)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|positive regulation of myelination (GO:0031643)|protein complex assembly (GO:0006461)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein targeting to membrane (GO:0006612)|regulation of actin filament-based process (GO:0032970)|regulation of cellular localization (GO:0060341)|tight junction assembly (GO:0070830)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing, spreading of cells (GO:0044319)	apical part of cell (GO:0045177)|axonal growth cone (GO:0044295)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|internode region of axon (GO:0033269)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spindle (GO:0005819)|tight junction (GO:0005923)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.D1318E(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	63		Breast(68;0.0707)				CGTAACTGGGGTCCTGGACTT	0.592																																						dbGAP											1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	10											53.0	51.0	51.0					10																	34400214		2203	4300	6503	34440220	SO:0001583	missense	0			AF252293	CCDS7178.1, CCDS53509.1, CCDS53510.1, CCDS53511.1, CCDS53512.1, CCDS53513.1, CCDS53514.1, CCDS53515.1, CCDS53516.1	10p11.22	2014-06-13	2013-08-28		ENSG00000148498	ENSG00000148498			16051	protein-coding gene	gene with protein product	"""atypical PKC isotype-specific interacting protein"", ""par-3 family cell polarity regulator alpha"", ""protein phosphatase 1, regulatory subunit 118"""	606745	"""par-3 (partitioning defective 3, C.elegans) homolog"", ""par-3 partitioning defective 3 homolog (C. elegans)"""			10934474	Standard	NM_001184790		Approved	PAR3, PARD3A, Bazooka, Baz, ASIP, PPP1R118	uc010qej.2	Q8TEW0	OTTHUMG00000017948	ENST00000374789.3:c.3954C>A	10.37:g.34400214G>T	ENSP00000363921:p.Asp1318Glu	Somatic	581	0.00	0		NA	NA	NA	WXS	Illumina HiSeq	Phase_IV	34440220	169	43.48	130	F5H5T0|Q5T2U1|Q5VUA2|Q5VUA3|Q5VWV0|Q5VWV1|Q5VWV3|Q5VWV4|Q5VWV5|Q6IQ47|Q8TCZ9|Q8TEW1|Q8TEW2|Q8TEW3|Q96K28|Q96RM6|Q96RM7|Q9BY57|Q9BY58|Q9HC48|Q9NWL4|Q9NYE6	Missense_Mutation	SNP	HMMPfam_PDZ,HMMSmart_SM00228,superfamily_PDZ domain-like	p.D1318E	ENST00000374789.3	37	c.3954	CCDS7178.1	10	.	.	.	.	.	.	.	.	.	.	G	12.90	2.077368	0.36662	.	.	ENSG00000148498	ENST00000545693;ENST00000545260;ENST00000374789;ENST00000374788;ENST00000346874;ENST00000374794;ENST00000350537;ENST00000374790	T;T;T;T;T;T;T;T	0.17854	2.31;2.25;2.39;2.39;2.31;2.26;2.26;2.32	5.69	3.83	0.44106	.	0.345695	0.32548	N	0.005954	T	0.21145	0.0509	N	0.14661	0.345	0.80722	D	1	B;D;D;D;D;D;B;B	0.69078	0.003;0.976;0.996;0.996;0.997;0.997;0.024;0.014	B;P;D;D;D;D;B;B	0.80764	0.009;0.576;0.987;0.987;0.991;0.994;0.034;0.015	T	0.03945	-1.0990	10	0.17369	T	0.5	.	11.9649	0.53029	0.1403:0.0:0.8597:0.0	.	1206;1228;1235;1272;1302;1281;1315;1318	Q8TEW0-5;Q8TEW0-3;Q8TEW0-7;Q8TEW0-6;F5H5T0;Q8TEW0-4;Q8TEW0-2;Q8TEW0	.;.;.;.;.;.;.;PARD3_HUMAN	E	1302;1228;1318;1315;1281;1206;1272;1258	ENSP00000443147:D1302E;ENSP00000440857:D1228E;ENSP00000363921:D1318E;ENSP00000363920:D1315E;ENSP00000340591:D1281E;ENSP00000363926:D1206E;ENSP00000311986:D1272E;ENSP00000363922:D1258E	ENSP00000340591:D1281E	D	-	3	2	PARD3	34440220	1.000000	0.71417	0.996000	0.52242	0.944000	0.59088	1.863000	0.39459	0.751000	0.32900	0.655000	0.94253	GAC	-	NULL		0.592	PARD3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PARD3	protein_coding	OTTHUMT00000047527.1	G	NM_019619		34440220	-1	no_errors	NM_019619.2	genbank	human	provisional	54_36p	missense	SNP	1.000	T
IGHMBP2	3508	genome.wustl.edu	37	11	68704310	68704310	+	Nonsense_Mutation	SNP	C	C	T	rs199839840		TCGA-AB-3005-03A-01D-0739-09	TCGA-AB-3005-11A-01D-0739-09	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	85335b80-6d61-4344-8ab3-1cf4be2ee53f	f02e1039-61d1-460f-a731-91d178483835	g.chr11:68704310C>T	ENST00000255078.3	+	13	2473	c.2362C>T	c.(2362-2364)Cga>Tga	p.R788*		NM_002180.2	NP_002171.2	P38935	SMBP2_HUMAN	immunoglobulin mu binding protein 2	788					ATP catabolic process (GO:0006200)|cell death (GO:0008219)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|protein homooligomerization (GO:0051260)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)	axon (GO:0030424)|cytoplasm (GO:0005737)|growth cone (GO:0030426)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|ATP-dependent 5'-3' DNA helicase activity (GO:0043141)|ATP-dependent 5'-3' RNA helicase activity (GO:0032575)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA-dependent ATPase activity (GO:0008094)|ribosome binding (GO:0043022)|RNA binding (GO:0003723)|RNA-dependent ATPase activity (GO:0008186)|single-stranded DNA binding (GO:0003697)|transcription factor binding (GO:0008134)|tRNA binding (GO:0000049)|zinc ion binding (GO:0008270)	p.R788*(2)		central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|liver(1)|lung(15)|ovary(2)|prostate(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			GAGGGCCCCGCGACCCCGAGC	0.692																																						dbGAP											2	Substitution - Nonsense(2)	haematopoietic_and_lymphoid_tissue(1)|endometrium(1)	11	GRCh37	CM034538	IGHMBP2	M		C	stop/ARG	0,4400		0,0,2200	35.0	35.0	35.0		2362	-0.3	0.0	11		35	1,8587	1.2+/-3.3	0,1,4293	yes	stop-gained	IGHMBP2	NM_002180.2		0,1,6493	TT,TC,CC		0.0116,0.0,0.0077		788/994	68704310	1,12987	2200	4294	6494	68460886	SO:0001587	stop_gained	0			L14754	CCDS8187.1	11q13.3	2014-09-17			ENSG00000132740	ENSG00000132740		"""Zinc fingers, AN1-type domain containing"""	5542	protein-coding gene	gene with protein product	"""cardiac transcription factor 1"", ""zinc finger, AN1-type domain 7"""	600502				8349627	Standard	NM_002180		Approved	ZFAND7, SMUBP2, CATF1, SMARD1, HCSA, HMN6	uc001ook.1	P38935	OTTHUMG00000167894	ENST00000255078.3:c.2362C>T	11.37:g.68704310C>T	ENSP00000255078:p.Arg788*	Somatic	470	0.00	0		7	30.00	3	WXS	Illumina HiSeq	Phase_IV	68460886	109	47.34	98	A0PJD2|Q00443|Q14177	Nonsense_Mutation	SNP	HMMSmart_SM00154,HMMPfam_R3H,HMMSmart_SM00393,HMMSmart_SM00382,HMMSmart_SM00487,superfamily_P-loop containing nucleoside triphosphate hydrolases,superfamily_R3H domain	p.R788*	ENST00000255078.3	37	c.2362	CCDS8187.1	11	.	.	.	.	.	.	.	.	.	.	C	34	5.365698	0.95900	0.0	1.16E-4	ENSG00000132740	ENST00000255078	.	.	.	3.01	-0.312	0.12758	.	2.825600	0.01480	N	0.016640	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.15499	T	0.54	.	5.9226	0.19091	0.0:0.4566:0.4219:0.1216	.	.	.	.	X	788	.	ENSP00000255078:R788X	R	+	1	2	IGHMBP2	68460886	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.061000	0.03472	-0.157000	0.11059	0.306000	0.20318	CGA	-	NULL		0.692	IGHMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGHMBP2	protein_coding	OTTHUMT00000396862.1	C	NM_002180		68460886	+1	no_errors	NM_002180.2	genbank	human	reviewed	54_36p	nonsense	SNP	0.000	T
SELPLG	6404	genome.wustl.edu	37	12	109017680	109017680	+	Missense_Mutation	SNP	T	T	G	rs63748999|rs200527674|rs372173288	byFrequency	TCGA-AB-3005-03A-01D-0739-09	TCGA-AB-3005-11A-01D-0739-09	T	T	T	G	T	T	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	85335b80-6d61-4344-8ab3-1cf4be2ee53f	f02e1039-61d1-460f-a731-91d178483835	g.chr12:109017680T>G	ENST00000550948.1	-	2	628	c.404A>C	c.(403-405)cAa>cCa	p.Q135P	SELPLG_ENST00000228463.6_Missense_Mutation_p.Q151P|SELPLG_ENST00000388962.3_Intron			Q14242	SELPL_HUMAN	selectin P ligand	135	12 X 10 AA tandem repeats.		Missing (in short form; not an alternative splicing; dbSNP:rs63748999). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:7505206}.		blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular response to interleukin-6 (GO:0071354)|leukocyte adhesive activation (GO:0050902)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)	p.Q135P(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|prostate(3)|skin(1)	12						GGGCACTGGTTGAGTGGTCTG	0.617																																						dbGAP											1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	12											165.0	129.0	141.0					12																	109017680		2201	4282	6483	107541809	SO:0001583	missense	0				CCDS31895.1, CCDS31895.2, CCDS55881.1	12q24	2014-01-30						"""CD molecules"", ""Endogenous ligands"""	10722	protein-coding gene	gene with protein product		600738				7505206	Standard	NM_003006		Approved	PSGL-1, CD162	uc010sxe.2	Q14242		ENST00000550948.1:c.404A>C	12.37:g.109017680T>G	ENSP00000447752:p.Gln135Pro	Somatic	5024	0.30	15		80	6.98	6	WXS	Illumina HiSeq	Phase_IV	107541809	1323	20.35	340	A8K2Y0|B4DQC3|B7Z5C7|J3KMX6|Q12775|Q6GTW7|Q8N7J7	Missense_Mutation	SNP	NULL	p.Q135P	ENST00000550948.1	37	c.404	CCDS31895.2	12	.	.	.	.	.	.	.	.	.	.	N	7.318	0.616396	0.14129	.	.	ENSG00000110876	ENST00000550948;ENST00000228463	T;T	0.28666	1.6;1.6	3.51	-7.02	0.01589	.	3.684700	0.01036	N	0.004222	T	0.23727	0.0574	L	0.54323	1.7	0.09310	N	1	P;P	0.47604	0.898;0.898	B;B	0.40165	0.321;0.321	T	0.41088	-0.9528	10	0.29301	T	0.29	1.368	4.4646	0.11682	0.2642:0.4833:0.0955:0.157	.	151;135	B7Z5C7;Q14242	.;SELPL_HUMAN	P	135;151	ENSP00000447752:Q135P;ENSP00000228463:Q151P	ENSP00000228463:Q151P	Q	-	2	0	SELPLG	107541809	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-0.658000	0.05329	-1.703000	0.01409	-0.441000	0.05720	CAA	-	NULL		0.617	SELPLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SELPLG	protein_coding	OTTHUMT00000403904.1	T			107541809	-1	no_errors	ENST00000228463	ensembl	human	known	54_36p	missense	SNP	0.000	G
TBC1D4	9882	genome.wustl.edu	37	13	75930309	75930309	+	Missense_Mutation	SNP	C	C	T			TCGA-AB-3005-03A-01D-0739-09	TCGA-AB-3005-11A-01D-0739-09	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	85335b80-6d61-4344-8ab3-1cf4be2ee53f	f02e1039-61d1-460f-a731-91d178483835	g.chr13:75930309C>T	ENST00000377636.3	-	4	1595	c.1249G>A	c.(1249-1251)Gta>Ata	p.V417I	TBC1D4_ENST00000425511.1_5'UTR|TBC1D4_ENST00000377625.2_Missense_Mutation_p.V417I|TBC1D4_ENST00000431480.2_Missense_Mutation_p.V417I	NM_014832.2	NP_055647.2	O60343	TBCD4_HUMAN	TBC1 domain family, member 4	417	PID 2. {ECO:0000255|PROSITE- ProRule:PRU00148}.				cellular response to insulin stimulus (GO:0032869)|membrane organization (GO:0061024)|negative regulation of vesicle fusion (GO:0031339)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)	Rab GTPase activator activity (GO:0005097)	p.V417I(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(12)|lung(18)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Prostate(6;0.014)|Breast(118;0.0982)		GBM - Glioblastoma multiforme(99;0.0116)		CACTGGAATACATAACAAATA	0.488																																						dbGAP											1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	13											66.0	63.0	64.0					13																	75930309		1953	4153	6106	74828310	SO:0001583	missense	0			AB011175	CCDS41901.1, CCDS66563.1, CCDS66564.1	13q22.2	2013-07-09			ENSG00000136111	ENSG00000136111			19165	protein-coding gene	gene with protein product	"""Akt substrate of 160 kDa"""	612465				11829485, 11994271, 15304337	Standard	XM_005266603		Approved	KIAA0603, AS160, DKFZp779C0666	uc001vjl.1	O60343	OTTHUMG00000017088	ENST00000377636.3:c.1249G>A	13.37:g.75930309C>T	ENSP00000366863:p.Val417Ile	Somatic	3311	0.06	2		0	100.00	1	WXS	Illumina HiSeq	Phase_IV	74828310	604	36.35	345	A7E2X8|B4DU25|B4E235|B6ETN8|B6ETN9|Q5W0B9|Q68D14	Missense_Mutation	SNP	HMMPfam_TBC,HMMSmart_SM00164,superfamily_Ypt/Rab-GAP domain of gyp1p,HMMPfam_PID,HMMSmart_SM00462,superfamily_PH domain-like	p.V417I	ENST00000377636.3	37	c.1249	CCDS41901.1	13	.	.	.	.	.	.	.	.	.	.	C	28.2	4.897358	0.91962	.	.	ENSG00000136111	ENST00000377636;ENST00000431480;ENST00000377625	T;T;T	0.27104	1.69;1.69;1.69	6.07	6.07	0.98685	Phosphotyrosine interaction domain (3);Pleckstrin homology-type (1);	0.000000	0.64402	D	0.000015	T	0.32102	0.0818	L	0.47716	1.5	0.80722	D	1	P;P;P	0.44044	0.675;0.825;0.718	B;B;B	0.44085	0.44;0.373;0.309	T	0.00514	-1.1695	10	0.30854	T	0.27	-28.7993	20.6593	0.99626	0.0:1.0:0.0:0.0	.	417;417;417	O60343-2;O60343-3;O60343	.;.;TBCD4_HUMAN	I	417	ENSP00000366863:V417I;ENSP00000395986:V417I;ENSP00000366852:V417I	ENSP00000366852:V417I	V	-	1	0	TBC1D4	74828310	1.000000	0.71417	0.973000	0.42090	0.931000	0.56810	6.034000	0.70933	2.885000	0.99019	0.655000	0.94253	GTA	-	HMMPfam_PID,HMMSmart_SM00462,superfamily_PH domain-like		0.488	TBC1D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D4	protein_coding	OTTHUMT00000045283.1	C	NM_014832		74828310	-1	no_errors	NM_014832.2	genbank	human	validated	54_36p	missense	SNP	1.000	T
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	G	G	A			TCGA-AB-3005-03A-01D-0739-09	TCGA-AB-3005-11A-01D-0739-09	G	G	G	A	G	G	Verified	Invalid:failed_liftOver	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	85335b80-6d61-4344-8ab3-1cf4be2ee53f	f02e1039-61d1-460f-a731-91d178483835	g.chrUnknown:0G>A								None (None upstream) : None (None downstream)																								0.0																																						dbGAP											0			13																																								113606057	SO:0001628	intergenic_variant	0																															Unknown.37:g.0G>A		Somatic	219	0.00	0		0	0.00	0	WXS	Illumina HiSeq	Phase_IV	113606057	73	51.66	78		Missense_Mutation	SNP	NULL	p.P233L		37	c.698		13																																																																																			-	NULL	0	0					FAM70B			G			113606057	-1	no_errors	NM_182614.2	genbank	human	provisional	54_36p	missense	SNP	0.868	A
NAA60	79903	genome.wustl.edu	37	16	3417714	3417714	+	Intron	SNP	G	G	A			TCGA-AB-3005-03A-01D-0739-09	TCGA-AB-3005-11A-01D-0739-09	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	85335b80-6d61-4344-8ab3-1cf4be2ee53f	f02e1039-61d1-460f-a731-91d178483835	g.chr16:3417714G>A	ENST00000576906.1	+	1	84							Q9H7X0	NAA60_HUMAN	N(alpha)-acetyltransferase 60, NatF catalytic subunit						cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|histone H4 acetylation (GO:0043967)|N-terminal peptidyl-methionine acetylation (GO:0017196)|nucleosome assembly (GO:0006334)	Golgi membrane (GO:0000139)	H4 histone acetyltransferase activity (GO:0010485)|peptide alpha-N-acetyltransferase activity (GO:0004596)			breast(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(1)	7						ttcctttttcGTTTAGGTTTT	0.358																																						dbGAP											0			16																																								3357715	SO:0001627	intron_variant	0				CCDS45396.1	16p13.3	2012-07-13	2011-08-02	2011-08-02	ENSG00000122390	ENSG00000122390	2.3.1.48, 2.3.1.88	"""N(alpha)-acetyltransferase subunits"""	25875	protein-coding gene	gene with protein product		614246	"""N-acetyltransferase 15 (GCN5-related, putative)"""	NAT15		12975309, 21750686	Standard	NM_001083600		Approved	FLJ14154	uc010btm.3	Q9H7X0	OTTHUMG00000150268	ENST00000576906.1:c.84+2532G>A	16.37:g.3417714G>A		Somatic	856	0.00	0		1	0.00	0	WXS	Illumina HiSeq	Phase_IV	3357715	219	36.96	129	B3KRQ0|B4DLZ0|B4DPZ8|B4DYC4|D3DUC2|E7EQ65|Q6IA31|Q6UX26	RNA	SNP	-	NULL	ENST00000576906.1	37	NULL		16																																																																																			-	-		0.358	NAA60-002	KNOWN	basic	processed_transcript	ENSG00000209508	protein_coding	OTTHUMT00000437841.1	G	NM_024845		3357715	+1	pseudogene	ENST00000386773	ensembl	human	novel	54_36p	rna	SNP	0.998	A
SLC25A11	8402	genome.wustl.edu	37	17	4843185	4843185	+	Silent	SNP	G	G	C	rs141424464		TCGA-AB-3005-03A-01D-0739-09	TCGA-AB-3005-11A-01D-0739-09	G	G	G	C	G	G	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	85335b80-6d61-4344-8ab3-1cf4be2ee53f	f02e1039-61d1-460f-a731-91d178483835	g.chr17:4843185G>C	ENST00000225665.7	-	1	361	c.21C>G	c.(19-21)gcC>gcG	p.A7A	RNF167_ENST00000575111.1_5'Flank|SLC25A11_ENST00000544061.2_Silent_p.A7A|RNF167_ENST00000576229.1_5'Flank|RNF167_ENST00000571816.1_5'Flank|RNF167_ENST00000262482.6_5'Flank|RNF167_ENST00000572430.1_5'Flank	NM_001165417.1|NM_003562.4	NP_001158889.1|NP_003553.2	Q02978	M2OM_HUMAN	solute carrier family 25 (mitochondrial carrier; oxoglutarate carrier), member 11	7					alpha-ketoglutarate transport (GO:0015742)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	oxoglutarate:malate antiporter activity (GO:0015367)|poly(A) RNA binding (GO:0044822)	p.A7A(1)		NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(5)	10						CGCCGGCCCCGGCACTCGCCG	0.721																																					Esophageal Squamous(144;1178 2388 18010 48797)	dbGAP											1	Substitution - coding silent(1)	haematopoietic_and_lymphoid_tissue(1)	17											13.0	15.0	14.0					17																	4843185		2127	4217	6344	4783930	SO:0001819	synonymous_variant	0			X66114	CCDS11059.1, CCDS54069.1	17p13.3	2013-05-22			ENSG00000108528	ENSG00000108528		"""Solute carriers"""	10981	protein-coding gene	gene with protein product		604165		SLC20A4		10072597, 1457818	Standard	NM_003562		Approved	OGC	uc002fzo.2	Q02978	OTTHUMG00000099395	ENST00000225665.7:c.21C>G	17.37:g.4843185G>C		Somatic	264	0.75	2		25	39.02	16	WXS	Illumina HiSeq	Phase_IV	4783930	22	42.11	16	F5GY65|O75537|Q969P7	Silent	SNP	superfamily_Mitochondrial carrier,HMMPfam_Mito_carr	p.A7	ENST00000225665.7	37	c.21	CCDS11059.1	17																																																																																			-	NULL		0.721	SLC25A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A11	protein_coding	OTTHUMT00000216852.4	G	NM_003562		4783930	-1	no_errors	NM_003562.3	genbank	human	provisional	54_36p	silent	SNP	0.997	C
RANBP3	8498	genome.wustl.edu	37	19	5914448	5914448	+	IGR	SNP	C	C	G			TCGA-AB-3005-03A-01D-0739-09	TCGA-AB-3005-11A-01D-0739-09	C	C	C	G	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	85335b80-6d61-4344-8ab3-1cf4be2ee53f	f02e1039-61d1-460f-a731-91d178483835	g.chr19:5914448C>G	ENST00000340578.6	-	0	3233				AC104532.4_ENST00000591109.1_RNA|CAPS_ENST00000588776.1_Missense_Mutation_p.L97V|AC104532.2_ENST00000588891.1_3'UTR|CAPS_ENST00000452990.2_Missense_Mutation_p.L11V|CAPS_ENST00000222125.5_Missense_Mutation_p.L11V	NM_003624.2|NM_007320.2|NM_007322.2	NP_003615.2|NP_015559.2|NP_015561.1	Q9H6Z4	RANB3_HUMAN	RAN binding protein 3						intracellular transport (GO:0046907)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	R-SMAD binding (GO:0070412)|Ran GTPase binding (GO:0008536)	p.L11V(1)		breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)	18						CATGGAGAAACTCCGGGCACA	0.682																																						dbGAP											1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	19											54.0	56.0	55.0					19																	5914448		2203	4300	6503	5865448	SO:0001628	intergenic_variant	0			Y08698	CCDS42477.1, CCDS42478.1, CCDS45935.1, CCDS74268.1	19p13.3	2008-02-05							9850	protein-coding gene	gene with protein product		603327				9637251	Standard	NM_007322		Approved		uc002mdw.3	Q9H6Z4			19.37:g.5914448C>G		Somatic	255	0.77	2		8	38.46	5	WXS	Illumina HiSeq	Phase_IV	5865448	72	32.71	35	B2RAT8|O60405|O75759|O75760|Q9BT47|Q9UG74	Missense_Mutation	SNP	HMMSmart_EFh,PatternScan_EF_HAND_1,HMMPfam_efhand,superfamily_SSF47473	p.L11V	ENST00000340578.6	37	c.31	CCDS42478.1	19	.	.	.	.	.	.	.	.	.	.	C	13.41	2.227870	0.39399	.	.	ENSG00000105519	ENST00000394521;ENST00000222125;ENST00000452990	T;T	0.55052	0.54;0.89	4.46	4.46	0.54185	.	0.000000	0.64402	D	0.000009	T	0.69151	0.3079	M	0.76574	2.34	0.39672	D	0.970768	D;B	0.60160	0.987;0.13	D;B	0.65987	0.94;0.097	T	0.70835	-0.4764	10	0.36615	T	0.2	-31.1574	14.6201	0.68579	0.0:1.0:0.0:0.0	.	144;11	Q8NF12;Q13938	.;CAYP1_HUMAN	V	144;11;11	ENSP00000222125:L11V;ENSP00000403263:L11V	ENSP00000222125:L11V	L	+	1	0	CAPS	5865448	1.000000	0.71417	1.000000	0.80357	0.242000	0.25591	2.933000	0.48948	2.307000	0.77673	0.561000	0.74099	CTC	-	superfamily_SSF47473		0.682	RANBP3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CAPS	protein_coding	OTTHUMT00000452304.1	C	NM_007322		5865448	+1	no_errors	NM_004058.3	genbank	human	validated	54_36p	missense	SNP	1.000	G
ELL	8178	genome.wustl.edu	37	19	18561476	18561476	+	Missense_Mutation	SNP	C	C	T	rs200447123	byFrequency	TCGA-AB-3005-03A-01D-0739-09	TCGA-AB-3005-11A-01D-0739-09	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	85335b80-6d61-4344-8ab3-1cf4be2ee53f	f02e1039-61d1-460f-a731-91d178483835	g.chr19:18561476C>T	ENST00000262809.4	-	8	1347	c.1276G>A	c.(1276-1278)Ggc>Agc	p.G426S	ELL_ENST00000596124.3_Missense_Mutation_p.G293S	NM_006532.3	NP_006523.1	P55199	ELL_HUMAN	elongation factor RNA polymerase II	426					gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of viral transcription (GO:0050434)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	phosphatase binding (GO:0019902)	p.G426S(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|liver(1)|lung(5)|prostate(1)	19				GBM - Glioblastoma multiforme(1328;7.81e-07)		AGGGGCAGGCCGAGGCGCACA	0.682			T	MLL	AL								C|||	3	0.000599042	0.0015	0.0	5008	,	,		11970	0.0		0.001	False		,,,				2504	0.0					dbGAP		Dom	yes		19	19p13.1	8178	ELL gene (11-19 lysine-rich leukemia gene)		L	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	19						C	SER/GLY	2,4322		0,2,2160	17.0	10.0	13.0		1276	-1.0	0.0	19		13	7,8503		0,7,4248	no	missense	ELL	NM_006532.3	56	0,9,6408	TT,TC,CC		0.0823,0.0463,0.0701	benign	426/622	18561476	9,12825	2162	4255	6417	18422476	SO:0001583	missense	0			U16282	CCDS12380.1	19p13.1	2012-04-17	2005-05-23			ENSG00000105656		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	23114	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 68"""	600284	"""chromosome 19 open reading frame 17"""	C19orf17		7991593, 8596958	Standard	NM_006532		Approved	Men, ELL1, PPP1R68	uc002njh.3	P55199		ENST00000262809.4:c.1276G>A	19.37:g.18561476C>T	ENSP00000262809:p.Gly426Ser	Somatic	90	0.00	0		7	22.22	2	WXS	Illumina HiSeq	Phase_IV	18422476	20	51.22	21		Missense_Mutation	SNP	HMMPfam_Occludin_ELL,HMMPfam_ELL	p.G426S	ENST00000262809.4	37	c.1276	CCDS12380.1	19	.	.	.	.	.	.	.	.	.	.	C	3.151	-0.174165	0.06421	4.63E-4	8.23E-4	ENSG00000105656	ENST00000262809	T	0.20332	2.08	4.58	-0.991	0.10235	.	0.903408	0.09225	U	0.831419	T	0.06735	0.0172	N	0.03115	-0.41	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.39921	-0.9590	10	0.06236	T	0.91	-33.7384	5.7689	0.18241	0.0:0.4039:0.1822:0.4138	.	370;426	Q59HG4;P55199	.;ELL_HUMAN	S	426	ENSP00000262809:G426S	ENSP00000262809:G426S	G	-	1	0	ELL	18422476	0.000000	0.05858	0.000000	0.03702	0.055000	0.15305	-1.182000	0.03082	-0.095000	0.12351	0.643000	0.83706	GGC	-	NULL		0.682	ELL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELL	protein_coding	OTTHUMT00000466362.1	C	NM_006532		18422476	-1	no_errors	NM_006532.2	genbank	human	validated	54_36p	missense	SNP	0.270	T
SON	6651	genome.wustl.edu	37	21	34924607	34924607	+	Missense_Mutation	SNP	A	A	G	rs145573687		TCGA-AB-3005-03A-01D-0739-09	TCGA-AB-3005-11A-01D-0739-09	A	A	A	G	A	A	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	85335b80-6d61-4344-8ab3-1cf4be2ee53f	f02e1039-61d1-460f-a731-91d178483835	g.chr21:34924607A>G	ENST00000356577.4	+	3	3545	c.3070A>G	c.(3070-3072)Atg>Gtg	p.M1024V	SON_ENST00000381679.4_Missense_Mutation_p.M1024V|SON_ENST00000300278.4_Missense_Mutation_p.M1024V|SON_ENST00000290239.6_Missense_Mutation_p.M1024V|SON_ENST00000381692.2_Intron	NM_138927.1	NP_620305	P18583	SON_HUMAN	SON DNA binding protein	1024	14 X 6 AA repeats of [ED]-R-S-M-M-S.				cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of cell cycle (GO:0051726)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleic acid binding (GO:0003676)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.M1024V(2)		breast(3)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(25)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	72						TGAGCGGTCTATGATGTCCCC	0.493																																						dbGAP											2	Substitution - Missense(2)	haematopoietic_and_lymphoid_tissue(2)	21						A	VAL/MET,VAL/MET	1,4405	2.1+/-5.4	0,1,2202	130.0	112.0	118.0		3070,3070	6.1	1.0	21	dbSNP_134	118	0,8600		0,0,4300	no	missense,missense	SON	NM_032195.1,NM_138927.1	21,21	0,1,6502	GG,GA,AA		0.0,0.0227,0.0077	possibly-damaging,possibly-damaging	1024/2304,1024/2427	34924607	1,13005	2203	4300	6503	33846477	SO:0001583	missense	0			AF380181	CCDS13629.1, CCDS13631.1, CCDS74784.1	21q22.1-q22.2	2013-01-28			ENSG00000159140	ENSG00000159140		"""G patch domain containing"""	11183	protein-coding gene	gene with protein product	"""NRE-binding protein"", ""negative regulatory element-binding protein"", ""Bax antagonist selected in Saccharomyces 1"""	182465		C21orf50		8318737, 21551269	Standard	NM_032195		Approved	DBP-5, NREBP, KIAA1019, BASS1, FLJ21099, FLJ33914	uc002yse.1	P18583	OTTHUMG00000065806	ENST00000356577.4:c.3070A>G	21.37:g.34924607A>G	ENSP00000348984:p.Met1024Val	Somatic	1197	0.17	2		149	47.72	136	WXS	Illumina HiSeq	Phase_IV	33846477	315	43.04	238	D3DSF5|D3DSF6|E7ETE8|E7EU67|E7EVW3|E9PFQ2|O14487|O95981|Q14120|Q6PKE0|Q9H7B1|Q9P070|Q9P072|Q9UKP9|Q9UPY0	Missense_Mutation	SNP	HMMPfam_G-patch,HMMSmart_SM00443,HMMPfam_dsrm,superfamily_dsRNA-binding domain-like	p.M1024V	ENST00000356577.4	37	c.3070	CCDS13629.1	21	.	.	.	.	.	.	.	.	.	.	A	15.68	2.906102	0.52333	2.27E-4	0.0	ENSG00000159140	ENST00000356577;ENST00000290239;ENST00000300278;ENST00000381679	T;T;T;T	0.16073	2.52;2.51;2.51;2.37	6.05	6.05	0.98169	.	0.000000	0.64402	D	0.000003	T	0.36193	0.0958	M	0.68593	2.085	0.33622	D	0.604945	P;P;D;P;D	0.57257	0.934;0.891;0.979;0.934;0.963	D;P;P;D;D	0.66351	0.943;0.877;0.801;0.943;0.915	T	0.42982	-0.9419	10	0.15499	T	0.54	.	14.5452	0.68024	1.0:0.0:0.0:0.0	.	1024;1024;705;1024;1024	P18583-10;P18583;P18583-2;P18583-3;P18583-6	.;SON_HUMAN;.;.;.	V	1024	ENSP00000348984:M1024V;ENSP00000290239:M1024V;ENSP00000300278:M1024V;ENSP00000371095:M1024V	ENSP00000290239:M1024V	M	+	1	0	SON	33846477	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.659000	0.61504	2.320000	0.78422	0.528000	0.53228	ATG	-	NULL		0.493	SON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SON	protein_coding	OTTHUMT00000140978.2	A	NM_138927		33846477	+1	no_errors	NM_138927.1	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
GCAT	23464	genome.wustl.edu	37	22	38209532	38209532	+	Silent	SNP	C	C	T	rs142027407		TCGA-AB-3005-03A-01D-0739-09	TCGA-AB-3005-11A-01D-0739-09	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_I	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina GAIIx	85335b80-6d61-4344-8ab3-1cf4be2ee53f	f02e1039-61d1-460f-a731-91d178483835	g.chr22:38209532C>T	ENST00000248924.6	+	4	548	c.492C>T	c.(490-492)gaC>gaT	p.D164D	GCAT_ENST00000323205.6_Silent_p.D190D	NM_014291.3	NP_055106.1	O75600	KBL_HUMAN	glycine C-acetyltransferase	164					biosynthetic process (GO:0009058)|cellular amino acid metabolic process (GO:0006520)|L-threonine catabolic process to glycine (GO:0019518)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	glycine C-acetyltransferase activity (GO:0008890)|pyridoxal phosphate binding (GO:0030170)	p.D164D(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(8)|skin(1)	12	Melanoma(58;0.045)				Glycine(DB00145)	CCATCATCGACGGCATCCGGC	0.637																																						dbGAP											1	Substitution - coding silent(1)	haematopoietic_and_lymphoid_tissue(1)	22						C	,	1,4405	2.1+/-5.4	0,1,2202	45.0	37.0	40.0		570,492	-5.6	0.9	22	dbSNP_134	40	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	GCAT	NM_001171690.1,NM_014291.3	,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,	190/446,164/420	38209532	1,13005	2203	4300	6503	36539478	SO:0001819	synonymous_variant	0			AF077740	CCDS13957.1, CCDS54527.1	22q13.1	2010-01-19	2010-01-19		ENSG00000100116	ENSG00000100116	2.3.1.29		4188	protein-coding gene	gene with protein product	"""2-amino-3-ketobutyrate coenzyme A ligase"""	607422	"""glycine C-acetyltransferase (2-amino-3-ketobutyrate coenzyme A ligase)"""				Standard	NM_014291		Approved	KBL	uc003aua.2	O75600	OTTHUMG00000150664	ENST00000248924.6:c.492C>T	22.37:g.38209532C>T		Somatic	779	0.00	0		10	41.18	7	WXS	Illumina HiSeq	Phase_IV	36539478	180	39.39	117	E2QC23|Q6ZWF1|Q96CA9	Silent	SNP	PatternScan_AA_TRANSFER_CLASS_2,HMMPfam_Aminotran_1_2,superfamily_PyrdxlP-dep_Trfase_major	p.D164	ENST00000248924.6	37	c.492	CCDS13957.1	22	.	.	.	.	.	.	.	.	.	.	C	9.893	1.204867	0.22205	2.27E-4	0.0	ENSG00000100116	ENST00000451984	.	.	.	5.55	-5.63	0.02474	.	.	.	.	.	T	0.63402	0.2508	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.64339	-0.6431	4	.	.	.	-14.2408	15.6097	0.76707	0.0:0.5893:0.0:0.4107	.	.	.	.	M	211	.	.	T	+	2	0	GCAT	36539478	0.000000	0.05858	0.870000	0.34147	0.973000	0.67179	-2.503000	0.00965	-1.381000	0.02112	-0.768000	0.03414	ACG	-	HMMPfam_Aminotran_1_2,superfamily_PyrdxlP-dep_Trfase_major		0.637	GCAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCAT	protein_coding	OTTHUMT00000319506.1	C	NM_014291.2		36539478	+1	no_errors	NM_014291.2	genbank	human	reviewed	54_36p	silent	SNP	0.999	T
