#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
PLEKHN1	84069	broad.mit.edu	37	1	905907	905907	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr1:905907A>T	ENST00000379409.2	+	4	367	c.337A>T	c.(337-339)Agc>Tgc	p.S113C	PLEKHN1_ENST00000379410.3_Missense_Mutation_p.S113C|PLEKHN1_ENST00000379407.3_Missense_Mutation_p.S113C			Q494U1	PKHN1_HUMAN	pleckstrin homology domain containing, family N member 1	113	PH 1.							p.S113C(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|lung(2)|skin(1)|urinary_tract(1)	9	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00459)|Epithelial(90;4.31e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.93e-23)|Colorectal(212;0.000159)|COAD - Colon adenocarcinoma(227;0.000193)|BRCA - Breast invasive adenocarcinoma(365;0.00095)|Kidney(185;0.0023)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0342)|Lung(427;0.199)		GCAGGATGTCAGCGACTGCTA	0.672																																							uc001ace.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(337-339)AGC>TGC		pleckstrin homology domain containing, family N							54.0	54.0	54.0					1																	905907		2202	4299	6501	SO:0001583	missense	84069							g.chr1:905907A>T	AL136730	CCDS4.1, CCDS53256.1	1p36.33	2013-01-11			ENSG00000187583	ENSG00000187583		"""Pleckstrin homology (PH) domain containing"""	25284	protein-coding gene	gene with protein product						11230166	Standard	NM_032129		Approved	DKFZP434H2010	uc001acd.3	Q494U1	OTTHUMG00000040756	ENST00000379409.2:c.337A>T	1.37:g.905907A>T	ENSP00000368719:p.Ser113Cys		Somatic				PLEKHN1_uc001acd.2_Missense_Mutation_p.S113C|PLEKHN1_uc001acf.2_Missense_Mutation_p.S113C	p.S113C	NM_032129	NP_115505	WXS	Illumina HiSeq	Unspecified	Q494U1	PKHN1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (11;0.00459)|Epithelial(90;4.31e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.93e-23)|Colorectal(212;0.000159)|COAD - Colon adenocarcinoma(227;0.000193)|BRCA - Breast invasive adenocarcinoma(365;0.00095)|Kidney(185;0.0023)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0342)|Lung(427;0.199)	4	372	+	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)	113			PH 1.		Q494U2|Q5SV98|Q9H0M7	Missense_Mutation	SNP	ENST00000379409.2	37	c.337A>T		.	.	.	.	.	.	.	.	.	.	A	14.42	2.531271	0.45073	.	.	ENSG00000187583	ENST00000379410;ENST00000379407;ENST00000379409	T;T;T	0.45276	0.9;0.9;0.9	5.11	5.11	0.69529	Pleckstrin homology domain (1);	0.170719	0.50627	D	0.000102	T	0.58293	0.2112	L	0.55481	1.735	0.26892	N	0.967299	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.80764	0.994;0.994;0.993	T	0.53655	-0.8408	10	0.54805	T	0.06	.	13.2846	0.60235	1.0:0.0:0.0:0.0	.	113;113;113	Q494U1-3;Q494U1;Q494U1-2	.;PKHN1_HUMAN;.	C	113	ENSP00000368720:S113C;ENSP00000368717:S113C;ENSP00000368719:S113C	ENSP00000368717:S113C	S	+	1	0	PLEKHN1	895770	0.044000	0.20184	0.681000	0.30009	0.450000	0.32258	1.213000	0.32407	2.153000	0.67306	0.523000	0.50628	AGC		0.672	PLEKHN1-005	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000473256.1	NM_032129		29	54	0	0	0	0.009535	0	29	54				
UBE2J2	118424	broad.mit.edu	37	1	1192480	1192480	+	Silent	SNP	C	C	A	rs201753274		TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr1:1192480C>A	ENST00000349431.6	-	5	525	c.306G>T	c.(304-306)ccG>ccT	p.P102P	UBE2J2_ENST00000491779.1_5'UTR|UBE2J2_ENST00000347370.2_Silent_p.P50P|UBE2J2_ENST00000348298.7_Silent_p.P50P|UBE2J2_ENST00000339385.6_Silent_p.P67P|UBE2J2_ENST00000400929.2_Silent_p.P50P|UBE2J2_ENST00000360466.2_Silent_p.P102P|UBE2J2_ENST00000400930.4_Silent_p.P118P	NM_058167.2	NP_477515.2	Q8N2K1	UB2J2_HUMAN	ubiquitin-conjugating enzyme E2, J2	102					protein ubiquitination (GO:0016567)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)	p.P118P(1)		cervix(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	13	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;6.66e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.53e-21)|Colorectal(212;0.00019)|COAD - Colon adenocarcinoma(227;0.000215)|Kidney(185;0.00255)|BRCA - Breast invasive adenocarcinoma(365;0.00266)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0371)|Lung(427;0.205)		TCCACGTGTCCGGGTGGAAAT	0.642																																							uc001adn.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(304-306)CCG>CCT		ubiquitin conjugating enzyme E2, J2 isoform 3							79.0	90.0	86.0					1																	1192480		2203	4300	6503	SO:0001819	synonymous_variant	118424				response to unfolded protein	endoplasmic reticulum membrane|integral to membrane	ATP binding|ubiquitin-protein ligase activity	g.chr1:1192480C>A	AF296658	CCDS14.1, CCDS15.1, CCDS16.1	1p36.33	2011-05-19	2011-05-19		ENSG00000160087	ENSG00000160087		"""Ubiquitin-conjugating enzymes E2"""	19268	protein-coding gene	gene with protein product			"""ubiquitin-conjugating enzyme E2, J2 (UBC6 homolog, yeast)"""			11278356	Standard	NM_058167		Approved	Ubc6p, NCUBE2	uc001ado.3	Q8N2K1	OTTHUMG00000001911	ENST00000349431.6:c.306G>T	1.37:g.1192480C>A			Somatic				UBE2J2_uc001adm.2_Silent_p.P67P|UBE2J2_uc001ado.2_Silent_p.P118P|UBE2J2_uc001adp.2_Silent_p.P102P|UBE2J2_uc001adq.2_Silent_p.P50P|UBE2J2_uc001adr.2_Silent_p.P50P|UBE2J2_uc001ads.2_Silent_p.P50P	p.P102P	NM_194458	NP_919440	WXS	Illumina HiSeq	Unspecified	Q8N2K1	UB2J2_HUMAN		Epithelial(90;6.66e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.53e-21)|Colorectal(212;0.00019)|COAD - Colon adenocarcinoma(227;0.000215)|Kidney(185;0.00255)|BRCA - Breast invasive adenocarcinoma(365;0.00266)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0371)|Lung(427;0.205)	5	616	-	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)	102			Cytoplasmic (Potential).		A8MYC7|Q504T9|Q96N26|Q96T84	Silent	SNP	ENST00000349431.6	37	c.306G>T	CCDS14.1																																																																																				0.642	UBE2J2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000005430.1	NM_058167		63	145	1	0	2.37532e-16	0.01441	3.32545e-16	63	145				
CFAP74	85452	broad.mit.edu	37	1	1854885	1854885	+	IGR	SNP	G	G	C			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr1:1854885G>C								TMEM52 (4173 upstream) : C1orf222 (64677 downstream)														p.F147L(1)									CGCCCTCCACGAACATCATGT	0.637																																							uc001aik.2		NA																	1	Substitution - Missense(1)		lung(1)		NA						c.(439-441)TTC>TTG		RecName: Full=Uncharacterized protein C1orf222;							29.0	30.0	29.0					1																	1854885		2196	4296	6492	SO:0001628	intergenic_variant	0							g.chr1:1854885G>C																													1.37:g.1854885G>C			Somatic				uc001ail.2_Missense_Mutation_p.F147L	p.F147L			WXS	Illumina HiSeq	Unspecified					8	1291	-									Missense_Mutation	SNP		37	c.441C>G		.	.	.	.	.	.	.	.	.	.	G	11.98	1.800573	0.31869	.	.	ENSG00000142609	ENST00000493964	T	0.37411	1.2	3.24	-5.49	0.02584	.	0.091297	0.46442	D	0.000289	T	0.48537	0.1505	M	0.72118	2.19	0.80722	D	1	D	0.71674	0.998	D	0.63957	0.92	T	0.54636	-0.8264	10	0.39692	T	0.17	.	13.6787	0.62469	0.8343:0.0:0.1657:0.0	.	147	Q69YW0	CA222_HUMAN	L	764	ENSP00000417061:F764L	ENSP00000417061:F764L	F	-	3	2	C1orf222	1844745	0.230000	0.23740	0.930000	0.37139	0.060000	0.15804	-0.472000	0.06623	-1.294000	0.02360	-1.800000	0.00619	TTC	0	0.637									5	14	0	0	0	0.001984	0	5	14				
PIK3CD	5293	broad.mit.edu	37	1	9713992	9713992	+	Intron	SNP	G	G	A	rs539332888		TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr1:9713992G>A	ENST00000377346.4	+	1	58				PIK3CD_ENST00000536656.1_Intron|C1orf200_ENST00000377320.3_Missense_Mutation_p.R117C	NM_005026.3	NP_005017.3	O00329	PK3CD_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit delta						adaptive immune response (GO:0002250)|B cell activation (GO:0042113)|B cell chemotaxis (GO:0035754)|B cell homeostasis (GO:0001782)|B cell receptor signaling pathway (GO:0050853)|cytokine production (GO:0001816)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|mast cell chemotaxis (GO:0002551)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|natural killer cell activation (GO:0030101)|natural killer cell chemotaxis (GO:0035747)|natural killer cell differentiation (GO:0001779)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|neutrophil extravasation (GO:0072672)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein phosphorylation (GO:0006468)|respiratory burst involved in defense response (GO:0002679)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell activation (GO:0042110)|T cell chemotaxis (GO:0010818)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|mast cell granule (GO:0042629)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)	p.R117C(1)		central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(12)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	31	all_lung(157;0.222)	all_lung(118;2.44e-05)|Lung NSC(185;4.08e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00314)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0231)|Colorectal(212;7.52e-08)|COAD - Colon adenocarcinoma(227;1.78e-05)|Kidney(185;0.000322)|KIRC - Kidney renal clear cell carcinoma(229;0.00114)|BRCA - Breast invasive adenocarcinoma(304;0.0021)|STAD - Stomach adenocarcinoma(132;0.00395)|READ - Rectum adenocarcinoma(331;0.0419)	Caffeine(DB00201)	Ggctgagagcggtagctcata	0.532													G|||	1	0.000199681	0.0	0.0014	5008	,	,		16745	0.0		0.0	False		,,,				2504	0.0						uc001aqc.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(349-351)CGC>TGC		RecName: Full=Putative uncharacterized protein C1orf200;							37.0	41.0	40.0					1																	9713992		1958	4161	6119	SO:0001627	intron_variant	644997							g.chr1:9713992G>A		CCDS104.1	1p36.2	2014-09-17	2012-07-13		ENSG00000171608	ENSG00000171608	2.7.1.153		8977	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase, catalytic, delta polypeptide"", ""phosphoinositide-3-kinase C"""	602839	"""phosphoinositide-3-kinase, catalytic, delta polypeptide"""			9113989, 9455486	Standard	NM_005026		Approved	p110D	uc001aqb.4	O00329	OTTHUMG00000001450	ENST00000377346.4:c.-138+2132G>A	1.37:g.9713992G>A			Somatic				PIK3CD_uc001aqa.2_Intron|PIK3CD_uc001aqb.3_Intron	p.R117C	NR_027045		WXS	Illumina HiSeq	Unspecified				UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;4.86e-08)|COAD - Colon adenocarcinoma(227;1.31e-05)|Kidney(185;0.000231)|KIRC - Kidney renal clear cell carcinoma(229;0.000879)|BRCA - Breast invasive adenocarcinoma(304;0.00178)|STAD - Stomach adenocarcinoma(132;0.00331)|READ - Rectum adenocarcinoma(331;0.0419)	2	499	-	all_lung(157;0.222)	Renal(390;0.000469)|all_lung(118;0.000521)|Lung NSC(185;0.000744)|Colorectal(325;0.0062)|Breast(348;0.0157)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)						A6NCG0|G1FFP1|O15445|Q5SR49	Missense_Mutation	SNP	ENST00000377346.4	37	c.349C>T	CCDS104.1	.	.	.	.	.	.	.	.	.	.	G	5.152	0.213666	0.09810	.	.	ENSG00000179840	ENST00000377320	T	0.01240	5.12	1.11	-2.21	0.06973	.	.	.	.	.	T	0.01254	0.0041	.	.	.	0.09310	N	1	D	0.71674	0.998	B	0.44044	0.439	T	0.37197	-0.9716	8	0.44086	T	0.13	.	0.3577	0.00359	0.2039:0.2461:0.3026:0.2474	.	117	Q5SR53	CA200_HUMAN	C	117	ENSP00000366537:R117C	ENSP00000366537:R117C	R	-	1	0	C1orf200	9636579	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.211000	0.17474	-1.176000	0.02747	-0.499000	0.04595	CGC		0.532	PIK3CD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004235.1	NM_005026		15	26	0	0	0	0.004007	0	15	26				
HNRNPCL1	343069	broad.mit.edu	37	1	12908093	12908093	+	Missense_Mutation	SNP	C	C	A	rs571544390	byFrequency	TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr1:12908093C>A	ENST00000317869.6	-	2	275	c.50G>T	c.(49-51)cGt>cTt	p.R17L		NM_001013631.1|NM_001136561.2|NM_001146181.1	NP_001013653.1|NP_001130033.2|NP_001139653.1	O60812	HNRC1_HUMAN	heterogeneous nuclear ribonucleoprotein C-like 1	17	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.					nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.R17L(1)		NS(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(15)|prostate(1)|skin(1)|stomach(2)	29						AATGAACACACGGGAGTTCAT	0.468																																							uc009vno.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(49-51)CGT>CTT		heterogeneous nuclear ribonucleoprotein C-like							188.0	175.0	180.0					1																	12908093		2203	4300	6503	SO:0001583	missense	649330						nucleic acid binding|nucleotide binding	g.chr1:12908093C>A	BC002696	CCDS30591.1	1p36.21	2013-02-12		2008-04-18	ENSG00000179172	ENSG00000179172		"""RNA binding motif (RRM) containing"""	29295	protein-coding gene	gene with protein product				HNRPCL1			Standard	NM_001013631		Approved			O60812	OTTHUMG00000001931	ENST00000317869.6:c.50G>T	1.37:g.12908093C>A	ENSP00000365370:p.Arg17Leu		Somatic				HNRNPCL1_uc010obf.1_Missense_Mutation_p.R17L	p.R17L	NM_001146181	NP_001139653	WXS	Illumina HiSeq	Unspecified	B7ZW38	B7ZW38_HUMAN			1	145	-			17					B2RP44	Missense_Mutation	SNP	ENST00000317869.6	37	c.50G>T	CCDS30591.1	.	.	.	.	.	.	.	.	.	.	C	13.59	2.283947	0.40394	.	.	ENSG00000179172	ENST00000317869	T	0.45276	0.9	1.09	-1.25	0.09405	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (2);	0.295460	0.32655	U	0.005818	T	0.54983	0.1892	M	0.93016	3.37	0.41853	D	0.990185	P	0.45283	0.855	P	0.50570	0.644	T	0.55866	-0.8073	10	0.87932	D	0	.	5.4144	0.16365	0.0:0.6148:0.0:0.3852	.	17	O60812	HNRCL_HUMAN	L	17	ENSP00000365370:R17L	ENSP00000365370:R17L	R	-	2	0	HNRNPCL1	12830680	0.985000	0.35326	0.511000	0.27724	0.485000	0.33311	5.250000	0.65432	-0.426000	0.07360	-0.482000	0.04802	CGT		0.468	HNRNPCL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005462.1	NM_001013631		16	174	1	0	1.67942e-08	0.006122	2.01256e-08	16	174				
CROCC	9696	broad.mit.edu	37	1	17257855	17257855	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr1:17257855C>T	ENST00000375541.5	+	8	988	c.919C>T	c.(919-921)Cgg>Tgg	p.R307W	CROCC_ENST00000467938.1_3'UTR	NM_014675.3	NP_055490.3			ciliary rootlet coiled-coil, rootletin									p.R307W(1)		breast(3)|central_nervous_system(2)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(1)|lung(20)|ovary(3)|prostate(9)|skin(3)|urinary_tract(1)	62		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		GGTGGGGTTCCGGCGGCTGGT	0.622																																							uc001azt.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|breast(2)|central_nervous_system(1)	5						c.(919-921)CGG>TGG		ciliary rootlet coiled-coil							96.0	81.0	86.0					1																	17257855		2203	4300	6503	SO:0001583	missense	9696				cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity	g.chr1:17257855C>T	AB007914	CCDS30616.1	1p36.13	2010-06-04	2009-03-04	2009-03-04	ENSG00000058453	ENSG00000058453			21299	protein-coding gene	gene with protein product	"""rootletin, ciliary rootlet protein"""	615776				12427867, 17971504	Standard	XM_006711056		Approved	rootletin, ROLT	uc001azt.2	Q5TZA2	OTTHUMG00000002200	ENST00000375541.5:c.919C>T	1.37:g.17257855C>T	ENSP00000364691:p.Arg307Trp		Somatic				CROCC_uc009voy.1_Intron|CROCC_uc009voz.1_Missense_Mutation_p.R70W	p.R307W	NM_014675	NP_055490	WXS	Illumina HiSeq	Unspecified	Q5TZA2	CROCC_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)	8	988	+		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)	307						Missense_Mutation	SNP	ENST00000375541.5	37	c.919C>T	CCDS30616.1	.	.	.	.	.	.	.	.	.	.	C	11.61	1.688845	0.29962	.	.	ENSG00000058453	ENST00000375541;ENST00000445545	T	0.25749	1.78	4.6	3.61	0.41365	.	.	.	.	.	T	0.49643	0.1569	M	0.75777	2.31	0.49299	D	0.999771	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.53968	-0.8363	9	0.87932	D	0	.	13.4088	0.60931	0.1574:0.8425:0.0:0.0	.	170;307	A1L0S8;Q5TZA2	.;CROCC_HUMAN	W	307;188	ENSP00000364691:R307W	ENSP00000364691:R307W	R	+	1	2	CROCC	17130442	1.000000	0.71417	0.398000	0.26321	0.117000	0.20001	1.336000	0.33850	2.532000	0.85374	0.561000	0.74099	CGG		0.622	CROCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006249.2	NM_014675		22	103	0	0	0	0.007291	0	22	103				
PAX7	5081	broad.mit.edu	37	1	19062359	19062359	+	Silent	SNP	C	C	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr1:19062359C>A	ENST00000375375.3	+	8	1987	c.1389C>A	c.(1387-1389)ggC>ggA	p.G463G	PAX7_ENST00000420770.2_Silent_p.G463G|PAX7_ENST00000400661.3_Silent_p.G461G	NM_002584.2|NM_013945.2	NP_002575.1|NP_039236.1	P23759	PAX7_HUMAN	paired box 7	463					anatomical structure morphogenesis (GO:0009653)|cartilage development (GO:0051216)|chromatin remodeling (GO:0006338)|dorsal/ventral neural tube patterning (GO:0021904)|embryonic skeletal system development (GO:0048706)|muscle tissue morphogenesis (GO:0060415)|negative regulation of apoptotic process (GO:0043066)|neuron fate commitment (GO:0048663)|positive regulation of histone methylation (GO:0031062)|positive regulation of myoblast proliferation (GO:2000288)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell fate commitment (GO:0010453)|regulation of protein binding (GO:0043393)|skeletal muscle satellite cell commitment (GO:0014813)|skeletal muscle tissue regeneration (GO:0043403)|spinal cord association neuron differentiation (GO:0021527)	nucleus (GO:0005634)	RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G463G(2)	PAX7/FOXO1(197)	breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(17)|ovary(1)|prostate(1)|skin(2)	31		Colorectal(325;3.46e-05)|all_lung(284;0.000439)|Renal(390;0.000518)|Lung NSC(340;0.000543)|Breast(348;0.00093)|Ovarian(437;0.00768)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00609)|BRCA - Breast invasive adenocarcinoma(304;4.71e-05)|Kidney(64;0.000279)|KIRC - Kidney renal clear cell carcinoma(64;0.00371)|STAD - Stomach adenocarcinoma(196;0.00658)|READ - Rectum adenocarcinoma(331;0.0576)		ATCAGTACGGCCAGTACGGCC	0.657			T	FOXO1A	alveolar rhabdomyosarcoma																																		uc001bay.2		NA		Dom	yes		1	1p36.2-p36.12	5081	T	paired box gene 7			M	FOXO1A		alveolar rhabdomyosarcoma	PAX7/FOXO1(197)	2	Substitution - coding silent(2)		lung(2)	soft_tissue(197)|lung(3)|prostate(1)|ovary(1)|breast(1)	203						c.(1387-1389)GGC>GGA		paired box 7 isoform 1							62.0	60.0	61.0					1																	19062359		2203	4300	6503	SO:0001819	synonymous_variant	5081				anti-apoptosis	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr1:19062359C>A	X96743	CCDS186.1, CCDS44074.1, CCDS44075.1	1p36.13	2011-06-20	2007-07-12		ENSG00000009709	ENSG00000009709		"""Paired boxes"", ""Homeoboxes / PRD class"""	8621	protein-coding gene	gene with protein product		167410	"""paired box gene 7"""			7981748, 8431641	Standard	NM_001135254		Approved	Hup1	uc001bay.3	P23759	OTTHUMG00000002433	ENST00000375375.3:c.1389C>A	1.37:g.19062359C>A			Somatic				PAX7_uc001baz.2_Silent_p.G461G|PAX7_uc010oct.1_Silent_p.G463G	p.G463G	NM_002584	NP_002575	WXS	Illumina HiSeq	Unspecified	P23759	PAX7_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00609)|BRCA - Breast invasive adenocarcinoma(304;4.71e-05)|Kidney(64;0.000279)|KIRC - Kidney renal clear cell carcinoma(64;0.00371)|STAD - Stomach adenocarcinoma(196;0.00658)|READ - Rectum adenocarcinoma(331;0.0576)	8	1987	+		Colorectal(325;3.46e-05)|all_lung(284;0.000439)|Renal(390;0.000518)|Lung NSC(340;0.000543)|Breast(348;0.00093)|Ovarian(437;0.00768)|Myeloproliferative disorder(586;0.0255)	463					E9PFV9|Q0VA99|Q2PJS5	Silent	SNP	ENST00000375375.3	37	c.1389C>A	CCDS186.1																																																																																				0.657	PAX7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000006928.1	NM_002584		13	68	1	0	1.33834e-09	0.007413	1.64862e-09	13	68				
TAS1R2	80834	broad.mit.edu	37	1	19181144	19181144	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr1:19181144C>T	ENST00000375371.3	-	3	841	c.820G>A	c.(820-822)Gtg>Atg	p.V274M	RP13-279N23.2_ENST00000494072.3_3'UTR	NM_152232.2	NP_689418.2	Q8TE23	TS1R2_HUMAN	taste receptor, type 1, member 2	274					detection of chemical stimulus involved in sensory perception of sweet taste (GO:0001582)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytokinesis (GO:0032467)|sensory perception of sweet taste (GO:0050916)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)	p.V274M(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(10)|lung(14)|ovary(1)|pancreas(3)|prostate(1)|skin(3)|stomach(1)	45		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00466)|BRCA - Breast invasive adenocarcinoma(304;3.56e-05)|Kidney(64;0.000177)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	Aspartame(DB00168)	GGCGAGAACACGACCACGACG	0.627																																							uc001bba.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)|central_nervous_system(1)	4						c.(820-822)GTG>ATG		taste receptor, type 1, member 2 precursor	Aspartame(DB00168)						70.0	61.0	64.0					1																	19181144		2203	4300	6503	SO:0001583	missense	80834				detection of chemical stimulus involved in sensory perception of sweet taste	plasma membrane	protein heterodimerization activity|taste receptor activity	g.chr1:19181144C>T		CCDS187.1	1p36.13	2012-08-22	2003-03-07		ENSG00000179002	ENSG00000179002		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	14905	protein-coding gene	gene with protein product		606226	"""G protein-coupled receptor 71"""	GPR71			Standard	NM_152232		Approved	T1R2, TR2	uc001bba.1	Q8TE23	OTTHUMG00000002442	ENST00000375371.3:c.820G>A	1.37:g.19181144C>T	ENSP00000364520:p.Val274Met		Somatic					p.V274M	NM_152232	NP_689418	WXS	Illumina HiSeq	Unspecified	Q8TE23	TS1R2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00466)|BRCA - Breast invasive adenocarcinoma(304;3.56e-05)|Kidney(64;0.000177)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	3	821	-		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)	274			Extracellular (Potential).		Q5TZ19	Missense_Mutation	SNP	ENST00000375371.3	37	c.820G>A	CCDS187.1	.	.	.	.	.	.	.	.	.	.	C	15.43	2.830089	0.50845	.	.	ENSG00000179002	ENST00000375371	D	0.83755	-1.76	4.99	-3.83	0.04269	Extracellular ligand-binding receptor (1);	0.856575	0.09782	N	0.756542	D	0.86957	0.6058	M	0.81682	2.555	0.19300	N	0.999979	D	0.69078	0.997	P	0.58130	0.833	T	0.80336	-0.1425	10	0.87932	D	0	.	8.5563	0.33483	0.0:0.3452:0.4546:0.2002	.	274	Q8TE23	TS1R2_HUMAN	M	274	ENSP00000364520:V274M	ENSP00000364520:V274M	V	-	1	0	TAS1R2	19053731	0.117000	0.22190	0.000000	0.03702	0.349000	0.29174	0.675000	0.25232	-0.997000	0.03450	0.561000	0.74099	GTG		0.627	TAS1R2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000006953.1			4	52	0	0	0	0.009096	0	4	52				
USP48	84196	broad.mit.edu	37	1	22083110	22083110	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr1:22083110C>T	ENST00000308271.9	-	3	989	c.341G>A	c.(340-342)cGg>cAg	p.R114Q	USP48_ENST00000400301.1_Missense_Mutation_p.R114Q|USP48_ENST00000529637.1_Missense_Mutation_p.R114Q|USP48_ENST00000421625.2_Missense_Mutation_p.R114Q	NM_032236.5	NP_115612.4	Q86UV5	UBP48_HUMAN	ubiquitin specific peptidase 48	114	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)	p.R114Q(1)		NS(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(14)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42		Colorectal(325;3.46e-05)|all_lung(284;4.29e-05)|Lung NSC(340;4.66e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|OV - Ovarian serous cystadenocarcinoma(117;4.74e-26)|COAD - Colon adenocarcinoma(152;1.3e-05)|GBM - Glioblastoma multiforme(114;1.86e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000614)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(1967;0.00711)|Lung(427;0.0327)|READ - Rectum adenocarcinoma(331;0.0657)|LUSC - Lung squamous cell carcinoma(448;0.0753)		GAGTGCCTGCCGAAGCTCCAA	0.468																																							uc001bfb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|lung(1)	2						c.(340-342)CGG>CAG		ubiquitin specific protease 48 isoform a							127.0	128.0	127.0					1																	22083110		2203	4300	6503	SO:0001583	missense	84196				ubiquitin-dependent protein catabolic process	mitochondrion|nucleus	cysteine-type peptidase activity|ubiquitin thiolesterase activity	g.chr1:22083110C>T	AF502942	CCDS30623.1, CCDS44084.1	1p36.12	2008-02-05	2005-08-08	2004-04-07	ENSG00000090686	ENSG00000090686		"""Ubiquitin-specific peptidases"""	18533	protein-coding gene	gene with protein product			"""ubiquitin specific protease 31"", ""ubiquitin specific protease 48"""	USP31		12838346	Standard	XM_005246009		Approved	FLJ23277, FLJ11328, FLJ20103, FLJ23054, MGC14879	uc001bfb.3	Q86UV5	OTTHUMG00000007798	ENST00000308271.9:c.341G>A	1.37:g.22083110C>T	ENSP00000309262:p.Arg114Gln		Somatic				USP48_uc010odq.1_Missense_Mutation_p.R114Q|USP48_uc009vqc.2_Missense_Mutation_p.R114Q|USP48_uc001bfc.2_Missense_Mutation_p.R114Q|USP48_uc001bfe.1_Missense_Mutation_p.R114Q|USP48_uc001bff.2_Missense_Mutation_p.R114Q	p.R114Q	NM_032236	NP_115612	WXS	Illumina HiSeq	Unspecified	Q86UV5	UBP48_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|OV - Ovarian serous cystadenocarcinoma(117;4.74e-26)|COAD - Colon adenocarcinoma(152;1.3e-05)|GBM - Glioblastoma multiforme(114;1.86e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000614)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(1967;0.00711)|Lung(427;0.0327)|READ - Rectum adenocarcinoma(331;0.0657)|LUSC - Lung squamous cell carcinoma(448;0.0753)	3	579	-		Colorectal(325;3.46e-05)|all_lung(284;4.29e-05)|Lung NSC(340;4.66e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)	114					B7ZKS7|Q2M3I4|Q5SZI4|Q5T3T5|Q6NX53|Q8N3F6|Q96F64|Q96IQ3|Q9H5N3|Q9H5T7|Q9NUJ6|Q9NXR0	Missense_Mutation	SNP	ENST00000308271.9	37	c.341G>A	CCDS30623.1	.	.	.	.	.	.	.	.	.	.	C	35	5.547042	0.96488	.	.	ENSG00000090686	ENST00000400301;ENST00000308271;ENST00000529637;ENST00000421625	T;T;T;T	0.35048	1.33;1.33;1.33;1.33	5.42	5.42	0.78866	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	T	0.64461	0.2600	M	0.80422	2.495	0.80722	D	1	D;D;D;D;D;D	0.89917	0.999;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.994;0.997;0.985;0.999;0.992;1.0	T	0.68965	-0.5270	10	0.87932	D	0	.	18.2009	0.89838	0.0:1.0:0.0:0.0	.	114;114;114;114;114;114	B7ZKS7;B7ZKS3;Q86UV5-7;Q86UV5-3;Q86UV5-2;Q86UV5	.;.;.;.;.;UBP48_HUMAN	Q	114	ENSP00000383157:R114Q;ENSP00000309262:R114Q;ENSP00000431949:R114Q;ENSP00000406256:R114Q	ENSP00000309262:R114Q	R	-	2	0	USP48	21955697	1.000000	0.71417	1.000000	0.80357	0.870000	0.49936	7.427000	0.80284	2.528000	0.85240	0.563000	0.77884	CGG		0.468	USP48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021372.1	NM_032236		31	157	0	0	0	0.007291	0	31	157				
CNR2	1269	broad.mit.edu	37	1	24201556	24201556	+	Silent	SNP	T	T	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr1:24201556T>A	ENST00000374472.4	-	2	713	c.552A>T	c.(550-552)ccA>ccT	p.P184P	CNR2_ENST00000536471.1_Silent_p.P184P	NM_001841.2	NP_001832.1	P34972	CNR2_HUMAN	cannabinoid receptor 2 (macrophage)	184					G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|immune response (GO:0006955)|inflammatory response (GO:0006954)|negative regulation of action potential (GO:0045759)|negative regulation of inflammatory response (GO:0050728)|negative regulation of mast cell activation (GO:0033004)|negative regulation of nitric-oxide synthase activity (GO:0051001)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|response to amphetamine (GO:0001975)|response to lipopolysaccharide (GO:0032496)|sensory perception of pain (GO:0019233)	dendrite (GO:0030425)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	cannabinoid receptor activity (GO:0004949)	p.P184P(2)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|lung(9)|pancreas(1)|skin(2)|stomach(6)|upper_aerodigestive_tract(2)	26		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Ovarian(437;0.00348)|Breast(348;0.00957)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;1.32e-24)|Colorectal(126;6.09e-08)|COAD - Colon adenocarcinoma(152;3.33e-06)|GBM - Glioblastoma multiforme(114;2.9e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00101)|KIRC - Kidney renal clear cell carcinoma(1967;0.00359)|STAD - Stomach adenocarcinoma(196;0.0131)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.146)	Dronabinol(DB00470)|Nabilone(DB00486)	TGGGGATCAGTGGGAAAAGCT	0.562																																							uc001bif.2		NA																	2	Substitution - coding silent(2)		lung(2)	skin(2)|central_nervous_system(1)	3						c.(550-552)CCA>CCT		cannabinoid receptor 2 (macrophage)	Nabilone(DB00486)						64.0	65.0	64.0					1																	24201556		2203	4300	6503	SO:0001819	synonymous_variant	1269				behavior|G-protein signaling, coupled to cyclic nucleotide second messenger|immune response|inflammatory response	dendrite|integral to plasma membrane|perikaryon	cannabinoid receptor activity	g.chr1:24201556T>A	X74328	CCDS245.1	1p	2012-08-08			ENSG00000188822	ENSG00000188822		"""GPCR / Class A : Cannabinoid receptors"""	2160	protein-coding gene	gene with protein product		605051					Standard	NM_001841		Approved	CB2	uc001bif.3	P34972	OTTHUMG00000013892	ENST00000374472.4:c.552A>T	1.37:g.24201556T>A			Somatic					p.P184P	NM_001841	NP_001832	WXS	Illumina HiSeq	Unspecified	P34972	CNR2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;1.32e-24)|Colorectal(126;6.09e-08)|COAD - Colon adenocarcinoma(152;3.33e-06)|GBM - Glioblastoma multiforme(114;2.9e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00101)|KIRC - Kidney renal clear cell carcinoma(1967;0.00359)|STAD - Stomach adenocarcinoma(196;0.0131)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.146)	2	679	-		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Ovarian(437;0.00348)|Breast(348;0.00957)|Myeloproliferative disorder(586;0.0255)	184			Extracellular (Potential).		C6ES44|Q4VBK8|Q5JRH7|Q6B0G7|Q6NSY0	Silent	SNP	ENST00000374472.4	37	c.552A>T	CCDS245.1																																																																																				0.562	CNR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038949.1	NM_001841		12	69	0	0	0	0.00245	0	12	69				
MATN1	4146	broad.mit.edu	37	1	31189047	31189047	+	Missense_Mutation	SNP	C	C	T	rs567114277		TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr1:31189047C>T	ENST00000373765.4	-	5	951	c.916G>A	c.(916-918)Gac>Aac	p.D306N	MATN1-AS1_ENST00000454613.1_RNA|MATN1-AS1_ENST00000414763.1_RNA|MATN1-AS1_ENST00000414532.2_RNA|MATN1_ENST00000477320.1_5'UTR	NM_002379.3	NP_002370.1	P21941	MATN1_HUMAN	matrilin 1, cartilage matrix protein	306	VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				extracellular matrix organization (GO:0030198)|growth plate cartilage chondrocyte morphogenesis (GO:0003429)|protein complex assembly (GO:0006461)|regulation of bone mineralization (GO:0030500)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)	p.D306N(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	12		Colorectal(325;0.00792)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)|Ovarian(437;0.0563)|Breast(348;0.0848)|Medulloblastoma(700;0.123)		Colorectal(126;1.29e-05)|COAD - Colon adenocarcinoma(152;0.000726)|STAD - Stomach adenocarcinoma(196;0.0183)|READ - Rectum adenocarcinoma(331;0.0649)		TCTGACACGTCCAGCGTATCC	0.562													C|||	1	0.000199681	0.0	0.0	5008	,	,		21323	0.0		0.0	False		,,,				2504	0.001						uc001brz.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(916-918)GAC>AAC		matrilin 1, cartilage matrix protein precursor							89.0	87.0	87.0					1																	31189047		2203	4300	6503	SO:0001583	missense	4146				protein complex assembly	proteinaceous extracellular matrix	extracellular matrix structural constituent|protein binding	g.chr1:31189047C>T	M55675	CCDS336.1	1p35	2008-02-05			ENSG00000162510	ENSG00000162510			6907	protein-coding gene	gene with protein product		115437		CRTM, CMP		2246248, 9083061	Standard	NM_002379		Approved		uc001brz.3	P21941	OTTHUMG00000003705	ENST00000373765.4:c.916G>A	1.37:g.31189047C>T	ENSP00000362870:p.Asp306Asn		Somatic				uc001bsb.1_5'Flank|MATN1_uc001bsa.1_Missense_Mutation_p.D224N	p.D306N	NM_002379	NP_002370	WXS	Illumina HiSeq	Unspecified	P21941	MATN1_HUMAN		Colorectal(126;1.29e-05)|COAD - Colon adenocarcinoma(152;0.000726)|STAD - Stomach adenocarcinoma(196;0.0183)|READ - Rectum adenocarcinoma(331;0.0649)	5	950	-		Colorectal(325;0.00792)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)|Ovarian(437;0.0563)|Breast(348;0.0848)|Medulloblastoma(700;0.123)	306			VWFA 2.		B2R7E3|Q5TBB9	Missense_Mutation	SNP	ENST00000373765.4	37	c.916G>A	CCDS336.1	.	.	.	.	.	.	.	.	.	.	C	31	5.068045	0.93950	.	.	ENSG00000162510	ENST00000373765	T	0.78707	-1.2	5.34	5.34	0.76211	von Willebrand factor, type A (3);	.	.	.	.	D	0.85309	0.5667	L	0.61218	1.895	0.80722	D	1	D;P	0.63046	0.992;0.65	P;P	0.60117	0.869;0.517	D	0.85121	0.0969	9	0.46703	T	0.11	-26.3599	19.0587	0.93078	0.0:1.0:0.0:0.0	.	290;306	A3KMG0;P21941	.;MATN1_HUMAN	N	306	ENSP00000362870:D306N	ENSP00000362870:D306N	D	-	1	0	MATN1	30961634	1.000000	0.71417	0.972000	0.41901	0.900000	0.52787	7.818000	0.86416	2.499000	0.84300	0.650000	0.86243	GAC		0.562	MATN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010458.1	NM_002379		30	74	0	0	0	0.007835	0	30	74				
ZMYM1	79830	broad.mit.edu	37	1	35579110	35579110	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr1:35579110A>T	ENST00000373330.1	+	11	1853	c.1679A>T	c.(1678-1680)aAt>aTt	p.N560I	ZMYM1_ENST00000359858.4_Missense_Mutation_p.N560I|ZMYM1_ENST00000373329.1_3'UTR			Q5SVZ6	ZMYM1_HUMAN	zinc finger, MYM-type 1	560						nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.N560I(1)		NS(1)|breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(5)|lung(8)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				ATAATTGAAAATATTTTATTT	0.318																																							uc001bym.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1678-1680)AAT>ATT		zinc finger, MYM domain containing 1							54.0	55.0	55.0					1																	35579110		1798	4053	5851	SO:0001583	missense	79830					nucleus	nucleic acid binding|protein dimerization activity|zinc ion binding	g.chr1:35579110A>T	AK096206	CCDS41302.1	1p34.3	2008-05-02	2005-09-12		ENSG00000197056	ENSG00000197056		"""Zinc fingers, MYM type"""	26253	protein-coding gene	gene with protein product			"""zinc finger, MYM domain containing 1"""			12477932	Standard	XM_005271216		Approved	FLJ23151, MYM	uc001bym.3	Q5SVZ6	OTTHUMG00000004374	ENST00000373330.1:c.1679A>T	1.37:g.35579110A>T	ENSP00000362427:p.Asn560Ile		Somatic				ZMYM1_uc001byn.2_Missense_Mutation_p.N560I|ZMYM1_uc010ohu.1_Missense_Mutation_p.N541I|ZMYM1_uc001byo.2_Missense_Mutation_p.N200I|ZMYM1_uc009vut.2_Missense_Mutation_p.N485I	p.N560I	NM_024772	NP_079048	WXS	Illumina HiSeq	Unspecified	Q5SVZ6	ZMYM1_HUMAN			11	1827	+		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)	560					D3DPR7|Q7Z3Q4	Missense_Mutation	SNP	ENST00000373330.1	37	c.1679A>T	CCDS41302.1	.	.	.	.	.	.	.	.	.	.	A	11.99	1.804677	0.31961	.	.	ENSG00000197056	ENST00000359858;ENST00000373329;ENST00000373330	T;T;T	0.13420	2.85;2.59;2.85	4.53	3.37	0.38596	.	0.387128	0.22322	N	0.061581	T	0.19805	0.0476	N	0.22421	0.69	0.29102	N	0.881437	D;D	0.89917	1.0;0.984	D;P	0.91635	0.999;0.893	T	0.02925	-1.1093	9	.	.	.	-17.214	8.8337	0.35100	0.6252:0.3748:0.0:0.0	.	541;560	B4DSJ9;Q5SVZ6	.;ZMYM1_HUMAN	I	560;485;560	ENSP00000352920:N560I;ENSP00000362426:N485I;ENSP00000362427:N560I	.	N	+	2	0	ZMYM1	35351697	1.000000	0.71417	1.000000	0.80357	0.706000	0.40770	1.052000	0.30429	1.020000	0.39573	0.533000	0.62120	AAT		0.318	ZMYM1-001	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012705.1	NM_024772		27	34	0	0	0	0.008361	0	27	34				
C1orf216	127703	broad.mit.edu	37	1	36181806	36181806	+	Silent	SNP	G	G	C			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr1:36181806G>C	ENST00000270815.4	-	2	887	c.117C>G	c.(115-117)gcC>gcG	p.A39A	C1orf216_ENST00000503824.1_5'UTR	NM_152374.1	NP_689587.1	Q8TAB5	CA216_HUMAN	chromosome 1 open reading frame 216	39								p.A39A(1)		kidney(2)|lung(3)|skin(2)|urinary_tract(1)	8		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.196)				TAGCATCCTTGGCACTTGCCA	0.577											OREG0013357	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001bzh.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(115-117)GCC>GCG		hypothetical protein LOC127703							91.0	82.0	85.0					1																	36181806		2203	4300	6503	SO:0001819	synonymous_variant	127703							g.chr1:36181806G>C	AK096303	CCDS395.1	1p34.3	2007-08-10			ENSG00000142686	ENSG00000142686			26800	protein-coding gene	gene with protein product						12477932	Standard	NM_152374		Approved	FLJ38984	uc001bzh.1	Q8TAB5	OTTHUMG00000004167	ENST00000270815.4:c.117C>G	1.37:g.36181806G>C			Somatic	OREG0013357	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	861		p.A39A	NM_152374	NP_689587	WXS	Illumina HiSeq	Unspecified	Q8TAB5	CA216_HUMAN			2	605	-		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.196)	39					D3DPS1|Q8N8N6	Silent	SNP	ENST00000270815.4	37	c.117C>G	CCDS395.1																																																																																				0.577	C1orf216-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012013.3	NM_152374		25	113	0	0	0	0.004656	0	25	113				
ATP6V0B	533	broad.mit.edu	37	1	44441472	44441472	+	Splice_Site	SNP	G	G	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr1:44441472G>T	ENST00000472174.2	+	2	461	c.68G>T	c.(67-69)gGa>gTa	p.G23V	ATP6V0B_ENST00000498664.1_5'Flank|ATP6V0B_ENST00000471859.2_Intron|ATP6V0B_ENST00000532642.1_Splice_Site_p.G23V|ATP6V0B_ENST00000236067.4_Intron|ATP6V0B_ENST00000472277.1_Intron	NM_004047.3	NP_004038.1	Q99437	VATO_HUMAN	ATPase, H+ transporting, lysosomal 21kDa, V0 subunit b	23					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|phagocytic vesicle membrane (GO:0030670)|proton-transporting V-type ATPase, V0 domain (GO:0033179)|vacuole (GO:0005773)	hydrogen ion transmembrane transporter activity (GO:0015078)|transporter activity (GO:0005215)	p.G23V(1)		breast(2)|kidney(1)|large_intestine(3)|lung(3)	9	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0511)				ACTGCTGCAGGAGTCTGCTAC	0.552																																							uc001cld.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(67-69)GGA>GTA		ATPase, H+ transporting, lysosomal 21kDa, V0							178.0	178.0	178.0					1																	44441472		2203	4300	6503	SO:0001630	splice_region_variant	533				ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	endosome membrane|integral to membrane|proton-transporting V-type ATPase, V0 domain|vacuolar membrane	hydrogen ion transmembrane transporter activity	g.chr1:44441472G>T	BC000423	CCDS505.1, CCDS41315.1, CCDS72772.1	1p32.3	2010-04-21	2006-01-20	2002-05-10	ENSG00000117410	ENSG00000117410		"""ATPases / V-type"""	861	protein-coding gene	gene with protein product		603717	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump) 21kD"", ""ATPase, H+ transporting, lysosomal 21kDa, V0 subunit c''"""	ATP6F		9653649	Standard	XM_005270944		Approved	VMA16, HATPL	uc001cld.3	Q99437	OTTHUMG00000008298	ENST00000472174.2:c.68-1G>T	1.37:g.44441472G>T			Somatic				ATP6V0B_uc001clc.2_Missense_Mutation_p.G23V|ATP6V0B_uc001cle.2_Intron|ATP6V0B_uc001clf.2_5'UTR	p.G23V	NM_004047	NP_004038	WXS	Illumina HiSeq	Unspecified	Q99437	VATO_HUMAN			2	179	+	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0511)	23			Helical; (Potential).		D3DPY5|Q6IB32	Missense_Mutation	SNP	ENST00000472174.2	37	c.68G>T	CCDS505.1	.	.	.	.	.	.	.	.	.	.	G	34	5.338998	0.95783	.	.	ENSG00000117410	ENST00000472174;ENST00000532642	.	.	.	4.89	4.89	0.63831	.	0.000000	0.85682	D	0.000000	T	0.56396	0.1982	L	0.58810	1.83	0.80722	D	1	B;B	0.24963	0.115;0.063	B;B	0.23574	0.047;0.023	T	0.56282	-0.8005	9	0.05959	T	0.93	.	18.0585	0.89370	0.0:0.0:1.0:0.0	.	23;23	Q99437;E9PNL3	VATO_HUMAN;.	V	23	.	ENSP00000431605:G23V	G	+	2	0	ATP6V0B	44214059	1.000000	0.71417	1.000000	0.80357	0.911000	0.54048	8.972000	0.93424	2.266000	0.75297	0.479000	0.44913	GGA		0.552	ATP6V0B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022854.2	NM_004047	Missense_Mutation	150	349	1	0	1.46247e-67	0.01441	2.53917e-67	150	349				
TCTEX1D1	200132	broad.mit.edu	37	1	67241985	67241985	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr1:67241985G>T	ENST00000282670.2	+	4	363	c.235G>T	c.(235-237)Gtc>Ttc	p.V79F		NM_152665.2	NP_689878.2	Q8N7M0	TC1D1_HUMAN	Tctex1 domain containing 1	79								p.V79F(1)		large_intestine(2)|lung(10)|skin(1)	13						TTTTCCTGTGGTCACCGTCAA	0.358																																							uc001dcv.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(235-237)GTC>TTC		Tctex1 domain containing 1							96.0	94.0	94.0					1																	67241985		2203	4300	6503	SO:0001583	missense	200132							g.chr1:67241985G>T	AK098192	CCDS633.1	1p31.2	2008-02-05			ENSG00000152760	ENSG00000152760			26882	protein-coding gene	gene with protein product							Standard	NM_152665		Approved	FLJ40873	uc001dcv.3	Q8N7M0	OTTHUMG00000009162	ENST00000282670.2:c.235G>T	1.37:g.67241985G>T	ENSP00000282670:p.Val79Phe		Somatic				TCTEX1D1_uc009wau.2_RNA|TCTEX1D1_uc009wav.2_Intron	p.V79F	NM_152665	NP_689878	WXS	Illumina HiSeq	Unspecified	Q8N7M0	TC1D1_HUMAN			4	366	+			79					Q06YR9|Q5VYE1	Missense_Mutation	SNP	ENST00000282670.2	37	c.235G>T	CCDS633.1	.	.	.	.	.	.	.	.	.	.	G	10.11	1.259059	0.23051	.	.	ENSG00000152760	ENST00000282670	T	0.14144	2.53	5.92	5.02	0.67125	.	0.843262	0.10799	N	0.632895	T	0.07413	0.0187	L	0.44542	1.39	0.09310	N	1	B	0.18013	0.025	B	0.28784	0.094	T	0.35025	-0.9805	10	0.56958	D	0.05	-11.4318	14.339	0.66611	0.072:0.0:0.928:0.0	.	79	Q8N7M0	TC1D1_HUMAN	F	79	ENSP00000282670:V79F	ENSP00000282670:V79F	V	+	1	0	TCTEX1D1	67014573	0.797000	0.28877	0.042000	0.18584	0.336000	0.28762	1.161000	0.31773	1.529000	0.49120	-0.122000	0.15005	GTC		0.358	TCTEX1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025399.2	NM_152665		15	32	1	0	3.99206e-14	0.007413	5.38378e-14	15	32				
LPHN2	23266	broad.mit.edu	37	1	82409048	82409048	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr1:82409048G>C	ENST00000370728.1	+	8	1438	c.793G>C	c.(793-795)Gac>Cac	p.D265H	LPHN2_ENST00000370715.1_Missense_Mutation_p.D265H|LPHN2_ENST00000370713.1_Missense_Mutation_p.D265H|LPHN2_ENST00000271029.4_Missense_Mutation_p.D265H|LPHN2_ENST00000370727.1_Missense_Mutation_p.D265H|LPHN2_ENST00000359929.3_Missense_Mutation_p.D265H|LPHN2_ENST00000394879.1_Missense_Mutation_p.D265H|LPHN2_ENST00000335786.5_Missense_Mutation_p.D265H|LPHN2_ENST00000370721.1_Missense_Mutation_p.D269H|LPHN2_ENST00000469377.2_Intron|LPHN2_ENST00000370725.1_Missense_Mutation_p.D265H|LPHN2_ENST00000370723.1_Missense_Mutation_p.D265H|LPHN2_ENST00000370730.1_Missense_Mutation_p.D265H|LPHN2_ENST00000319517.6_Missense_Mutation_p.D265H|LPHN2_ENST00000370717.2_Missense_Mutation_p.D265H			O95490	LPHN2_HUMAN	latrophilin 2	265	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)|latrotoxin receptor activity (GO:0016524)	p.D265H(2)		NS(3)|breast(6)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(37)|ovary(3)|pancreas(1)|prostate(3)|skin(22)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	119				all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)		GACTGATATCGACCTAGCAGT	0.408																																							uc001dit.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|lung(3)|breast(2)|central_nervous_system(1)	9						c.(793-795)GAC>CAC		latrophilin 2 precursor							142.0	135.0	137.0					1																	82409048		2203	4300	6503	SO:0001583	missense	23266				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|latrotoxin receptor activity|sugar binding	g.chr1:82409048G>C	AJ131581	CCDS689.1, CCDS72811.1	1p31.1	2014-08-08	2003-03-17	2003-05-02	ENSG00000117114	ENSG00000117114		"""-"", ""GPCR / Class B : Orphans"""	18582	protein-coding gene	gene with protein product		607018	"""latrophilin 1"""	LPHH1		10760572	Standard	XR_248786		Approved	KIAA0786, LEC1	uc001diu.3	O95490	OTTHUMG00000009844	ENST00000370728.1:c.793G>C	1.37:g.82409048G>C	ENSP00000359763:p.Asp265His		Somatic				LPHN2_uc001dis.2_Intron|LPHN2_uc001diu.2_Missense_Mutation_p.D265H|LPHN2_uc001div.2_Missense_Mutation_p.D265H|LPHN2_uc009wcd.2_Missense_Mutation_p.D265H	p.D265H	NM_012302	NP_036434	WXS	Illumina HiSeq	Unspecified	O95490	LPHN2_HUMAN		all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)	6	974	+			265			Extracellular (Potential).|Olfactomedin-like.		A5XEI2|B1ALT8|B1ALT9|B1ALU0|B1ALU2|B1ALU4|B1ALU5|B1ALU6|O94882|Q5VX76|Q9UKY5|Q9UKY6	Missense_Mutation	SNP	ENST00000370728.1	37	c.793G>C		.	.	.	.	.	.	.	.	.	.	G	18.63	3.665531	0.67700	.	.	ENSG00000117114	ENST00000370721;ENST00000370728;ENST00000370730;ENST00000370727;ENST00000370725;ENST00000370723;ENST00000359929;ENST00000370715;ENST00000370713;ENST00000319517;ENST00000370717;ENST00000394879;ENST00000271029;ENST00000335786	D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.94576	-3.46;-3.46;-3.46;-3.46;-3.46;-3.46;-3.46;-3.46;-3.46;-3.46;-3.46;-3.46;-3.46;-3.46	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	D	0.98166	0.9394	H	0.94886	3.595	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.997;0.998	D	0.99029	1.0820	10	0.87932	D	0	.	19.4356	0.94792	0.0:0.0:1.0:0.0	.	265;265;265	O95490-3;O95490-4;O95490-2	.;.;.	H	269;265;265;265;265;265;265;265;265;265;265;265;265;265	ENSP00000359756:D269H;ENSP00000359763:D265H;ENSP00000359765:D265H;ENSP00000359762:D265H;ENSP00000359760:D265H;ENSP00000359758:D265H;ENSP00000353006:D265H;ENSP00000359750:D265H;ENSP00000359748:D265H;ENSP00000322270:D265H;ENSP00000359752:D265H;ENSP00000378344:D265H;ENSP00000271029:D265H;ENSP00000337306:D265H	ENSP00000271029:D265H	D	+	1	0	LPHN2	82181636	1.000000	0.71417	0.990000	0.47175	0.981000	0.71138	9.476000	0.97823	2.591000	0.87537	0.455000	0.32223	GAC		0.408	LPHN2-007	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000027188.1	NM_012302		21	39	0	0	0	0.00333	0	21	39				
RPAP2	79871	broad.mit.edu	37	1	92789591	92789591	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr1:92789591G>C	ENST00000610020.1	+	8	1223	c.1114G>C	c.(1114-1116)Gag>Cag	p.E372Q	RPAP2_ENST00000484158.1_3'UTR	NM_024813.2	NP_079089.2	Q8IXW5	RPAP2_HUMAN	RNA polymerase II associated protein 2	372					dephosphorylation of RNA polymerase II C-terminal domain (GO:0070940)|snRNA transcription (GO:0009301)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|nucleolus (GO:0005730)|nucleus (GO:0005634)	CTD phosphatase activity (GO:0008420)|metal ion binding (GO:0046872)	p.E372Q(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	22		all_lung(203;0.0565)|Lung NSC(277;0.152)|Glioma(108;0.222)		all cancers(265;0.00647)|GBM - Glioblastoma multiforme(16;0.0234)|Epithelial(280;0.115)		AGTTTTGAAGGAGACTTTGAT	0.403																																							uc001dot.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1114-1116)GAG>CAG		RNA polymerase II associated protein 2							108.0	111.0	110.0					1																	92789591		2203	4300	6503	SO:0001583	missense	79871					integral to membrane|nucleus	metal ion binding|phosphoprotein phosphatase activity	g.chr1:92789591G>C	AK023212	CCDS740.1	1p22.1	2014-01-28	2007-07-26	2007-07-26	ENSG00000122484	ENSG00000122484			25791	protein-coding gene	gene with protein product		611476	"""chromosome 1 open reading frame 82"""	C1orf82		17643375	Standard	NM_024813		Approved	FLJ13150	uc001dot.2	Q8IXW5	OTTHUMG00000010288	ENST00000610020.1:c.1114G>C	1.37:g.92789591G>C	ENSP00000476948:p.Glu372Gln		Somatic				RPAP2_uc009wdh.2_RNA	p.E372Q	NM_024813	NP_079089	WXS	Illumina HiSeq	Unspecified	Q8IXW5	RPAP2_HUMAN		all cancers(265;0.00647)|GBM - Glioblastoma multiforme(16;0.0234)|Epithelial(280;0.115)	8	1223	+		all_lung(203;0.0565)|Lung NSC(277;0.152)|Glioma(108;0.222)	372					C9JKB5|Q49AS7|Q9H8Y2	Missense_Mutation	SNP	ENST00000610020.1	37	c.1114G>C	CCDS740.1	.	.	.	.	.	.	.	.	.	.	G	10.23	1.293595	0.23564	.	.	ENSG00000122484	ENST00000370343;ENST00000394482	.	.	.	5.93	5.01	0.66863	.	0.379295	0.31290	N	0.007917	T	0.09335	0.0230	N	0.12502	0.225	0.22017	N	0.999419	B	0.25772	0.134	B	0.17433	0.018	T	0.09143	-1.0688	8	0.02654	T	1	-7.8102	8.8316	0.35087	0.0817:0.2748:0.6435:0.0	.	372	Q8IXW5	RPAP2_HUMAN	Q	372	.	ENSP00000359368:E372Q	E	+	1	0	RPAP2	92562179	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	1.231000	0.32624	2.805000	0.96524	0.655000	0.94253	GAG		0.403	RPAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028368.2	NM_024813		17	89	0	0	0	0.006122	0	17	89				
VCAM1	7412	broad.mit.edu	37	1	101185437	101185437	+	Silent	SNP	G	G	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr1:101185437G>T	ENST00000294728.2	+	1	122	c.21G>T	c.(19-21)gtG>gtT	p.V7V	VCAM1_ENST00000370115.1_Silent_p.V7V|VCAM1_ENST00000347652.2_Silent_p.V7V|VCAM1_ENST00000370119.4_Silent_p.V7V	NM_001078.3	NP_001069.1	P19320	VCAM1_HUMAN	vascular cell adhesion molecule 1	7					acute inflammatory response (GO:0002526)|aging (GO:0007568)|amine metabolic process (GO:0009308)|B cell differentiation (GO:0030183)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell-matrix adhesion (GO:0007160)|cellular response to glucose stimulus (GO:0071333)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|chorio-allantoic fusion (GO:0060710)|chronic inflammatory response (GO:0002544)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|heterophilic cell-cell adhesion (GO:0007157)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte tethering or rolling (GO:0050901)|membrane to membrane docking (GO:0022614)|oxidation-reduction process (GO:0055114)|positive regulation of T cell proliferation (GO:0042102)|regulation of immune response (GO:0050776)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|response to lipopolysaccharide (GO:0032496)|response to nicotine (GO:0035094)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|viral process (GO:0016032)	alpha9-beta1 integrin-vascular cell adhesion molecule-1 complex (GO:0071065)|apical part of cell (GO:0045177)|cell surface (GO:0009986)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|podosome (GO:0002102)|sarcolemma (GO:0042383)	cell adhesion molecule binding (GO:0050839)|integrin binding (GO:0005178)|primary amine oxidase activity (GO:0008131)	p.V7V(1)		central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(27)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	56		all_epithelial(167;3.83e-06)|all_lung(203;0.000485)|Lung NSC(277;0.0011)		Epithelial(280;0.0227)|all cancers(265;0.0276)|COAD - Colon adenocarcinoma(174;0.149)|Colorectal(144;0.169)|Lung(183;0.196)	Carvedilol(DB01136)	AGATGGTCGTGATCCTTGGAG	0.413																																							uc001dti.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)	1						c.(19-21)GTG>GTT		vascular cell adhesion molecule 1 isoform a	Carvedilol(DB01136)						185.0	166.0	172.0					1																	101185437		2203	4300	6503	SO:0001819	synonymous_variant	7412				heterophilic cell-cell adhesion|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|leukocyte tethering or rolling|membrane to membrane docking|positive regulation of T cell proliferation|regulation of immune response	alpha9-beta1 integrin-vascular cell adhesion molecule-1 complex|apical part of cell|external side of plasma membrane|extracellular space|filopodium|integral to membrane|microvillus|podosome	cell adhesion molecule binding|integrin binding	g.chr1:101185437G>T	M60335	CCDS773.1, CCDS774.1, CCDS55617.1	1p32-p31	2014-01-30			ENSG00000162692	ENSG00000162692		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Endogenous ligands"""	12663	protein-coding gene	gene with protein product		192225					Standard	NM_080682		Approved	CD106	uc001dti.3	P19320	OTTHUMG00000010982	ENST00000294728.2:c.21G>T	1.37:g.101185437G>T			Somatic				VCAM1_uc001dtj.2_Silent_p.V7V|VCAM1_uc010ouj.1_Silent_p.V7V	p.V7V	NM_001078	NP_001069	WXS	Illumina HiSeq	Unspecified	P19320	VCAM1_HUMAN		Epithelial(280;0.0227)|all cancers(265;0.0276)|COAD - Colon adenocarcinoma(174;0.149)|Colorectal(144;0.169)|Lung(183;0.196)	1	141	+		all_epithelial(167;3.83e-06)|all_lung(203;0.000485)|Lung NSC(277;0.0011)	7					A8K6R7|B4DKS4|E9PDD1|Q6NUP8	Silent	SNP	ENST00000294728.2	37	c.21G>T	CCDS773.1																																																																																				0.413	VCAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030213.1	NM_001078		15	43	1	0	1.55795e-14	0.012319	2.11401e-14	15	43				
SEC22B	9554	broad.mit.edu	37	1	145115850	145115850	+	RNA	SNP	C	C	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr1:145115850C>A	ENST00000453618.1	+	0	936							O75396	SC22B_HUMAN	SEC22 vesicle trafficking protein homolog B (S. cerevisiae) (gene/pseudogene)						ER to Golgi vesicle-mediated transport (GO:0006888)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)											CTGTATTTTTCATCATGTTAA	0.413																																							uc001eml.1		NA																	0					0						c.(607-609)TTC>TTA		SEC22 vesicle trafficking protein homolog B							225.0	224.0	224.0					1																	145115850		2016	4189	6205			9554				ER to Golgi vesicle-mediated transport|protein transport	endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|Golgi membrane|integral to membrane|melanosome	protein binding	g.chr1:145115850C>A	AF047442		1q21.1	2012-04-20	2010-03-12	2006-04-25	ENSG00000223380				10700	protein-coding gene	gene with protein product		604029	"""SEC22, vesicle trafficking protein (S. cerevisiae)-like 1"", ""SEC22 vesicle trafficking protein-like 1 (S. cerevisiae)"", ""SEC22 vesicle trafficking protein homolog B (S. cerevisiae)"""	SEC22L1		9094723, 16354670	Standard	NM_004892		Approved	sec22b, ERS-24	uc031poa.1	O75396	OTTHUMG00000013745		1.37:g.145115850C>A			Somatic				NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron	p.F203L	NM_004892	NP_004883	WXS	Illumina HiSeq	Unspecified	O75396	SC22B_HUMAN			7	749	+			203			Helical; Anchor for type IV membrane protein; (Potential).		A8K1G0	Missense_Mutation	SNP	ENST00000453618.1	37	c.609C>A																																																																																					0.413	SEC22B-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000038523.5	NM_004892		17	117	1	0	1.96895e-08	0.00278	2.34045e-08	17	117				
FLG	2312	broad.mit.edu	37	1	152277110	152277110	+	Missense_Mutation	SNP	C	C	A	rs375062780		TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr1:152277110C>A	ENST00000368799.1	-	3	10287	c.10252G>T	c.(10252-10254)Gca>Tca	p.A3418S	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	3418	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.A3418S(1)		autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTGTCTCGTGCCTGCTCGTGG	0.597									Ichthyosis																														uc001ezu.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16						c.(10252-10254)GCA>TCA		filaggrin							177.0	193.0	188.0					1																	152277110		2203	4297	6500	SO:0001583	missense	2312	Ichthyosis	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity	g.chr1:152277110C>A	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.10252G>T	1.37:g.152277110C>A	ENSP00000357789:p.Ala3418Ser		Somatic					p.A3418S	NM_002016	NP_002007	WXS	Illumina HiSeq	Unspecified	P20930	FILA_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	10288	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		3418			Ser-rich.		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	c.10252G>T	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	C	11.54	1.669845	0.29693	.	.	ENSG00000143631	ENST00000368799	T	0.00873	5.59	3.94	-0.959	0.10343	.	.	.	.	.	T	0.00384	0.0012	L	0.55743	1.74	0.09310	N	1	P	0.37276	0.589	B	0.41088	0.347	T	0.38672	-0.9650	9	0.16896	T	0.51	.	2.6816	0.05095	0.1749:0.3761:0.3424:0.1067	.	3418	P20930	FILA_HUMAN	S	3418	ENSP00000357789:A3418S	ENSP00000357789:A3418S	A	-	1	0	FLG	150543734	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-2.537000	0.00939	-0.034000	0.13713	0.454000	0.30748	GCA		0.597	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016		87	582	1	0	3.34506e-74	0.01441	5.85385e-74	87	582				
KPRP	448834	broad.mit.edu	37	1	152733141	152733141	+	Silent	SNP	G	G	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr1:152733141G>A	ENST00000606109.1	+	1	1105	c.1077G>A	c.(1075-1077)ccG>ccA	p.P359P	KPRP_ENST00000368773.1_Silent_p.P359P			Q5T749	KPRP_HUMAN	keratinocyte proline-rich protein	359	Pro-rich.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)		p.P359P(2)		NS(1)|breast(1)|endometrium(9)|kidney(1)|large_intestine(10)|lung(21)|ovary(6)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			GCTGTGGCCCGCAGCCCTCCT	0.647																																							uc001fal.1		NA																	2	Substitution - coding silent(2)		large_intestine(1)|lung(1)	ovary(4)|pancreas(1)	5						c.(1075-1077)CCG>CCA		keratinocyte proline-rich protein							49.0	52.0	51.0					1																	152733141		2203	4300	6503	SO:0001819	synonymous_variant	448834					cytoplasm		g.chr1:152733141G>A	AY960854	CCDS30862.1	1q21.3	2008-02-05	2007-02-02	2006-12-07	ENSG00000203786	ENSG00000203786			31823	protein-coding gene	gene with protein product		613260	"""chromosome 1 open reading frame 45"""	C1orf45		16297201	Standard	NM_001025231		Approved		uc001fal.1	Q5T749	OTTHUMG00000012402	ENST00000606109.1:c.1077G>A	1.37:g.152733141G>A			Somatic					p.P359P	NM_001025231	NP_001020402	WXS	Illumina HiSeq	Unspecified	Q5T749	KPRP_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		2	1135	+	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		359			Pro-rich.			Silent	SNP	ENST00000606109.1	37	c.1077G>A	CCDS30862.1																																																																																				0.647	KPRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034522.2	NM_001025231		4	147	0	0	0	0.009096	0	4	147				
ATP8B2	57198	broad.mit.edu	37	1	154317977	154317977	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr1:154317977A>T	ENST00000368489.3	+	23	2749	c.2749A>T	c.(2749-2751)Atg>Ttg	p.M917L		NM_020452.3	NP_065185.1	P98198	AT8B2_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 2	903					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.M917L(1)	IL6R/ATP8B2(2)	breast(2)|endometrium(4)|kidney(3)|large_intestine(7)|lung(25)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	51	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			TGCTTTCACCATGGTCCACTT	0.493											OREG0013835	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001fex.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(2749-2751)ATG>TTG		ATPase, class I, type 8B, member 2 isoform a							244.0	258.0	253.0					1																	154317977		2203	4300	6503	SO:0001583	missense	57198				ATP biosynthetic process	plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity	g.chr1:154317977A>T	AB032963	CCDS1066.1, CCDS41405.1	1q21.3	2012-03-09	2012-03-09		ENSG00000143515	ENSG00000143515		"""ATPases / P-type"""	13534	protein-coding gene	gene with protein product		605867	"""ATPase, class I, type 8B, member 2"""			10574461, 11015572	Standard	NM_020452		Approved	ATPID, KIAA1137	uc001fex.3	P98198	OTTHUMG00000035979	ENST00000368489.3:c.2749A>T	1.37:g.154317977A>T	ENSP00000357475:p.Met917Leu		Somatic	OREG0013835	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1762		p.M917L	NM_020452	NP_065185	WXS	Illumina HiSeq	Unspecified	P98198	AT8B2_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.185)		23	2749	+	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		903			Helical; (Potential).		B4E3P4|Q6NT69|Q7Z486|Q96I43|Q96NQ7	Missense_Mutation	SNP	ENST00000368489.3	37	c.2749A>T	CCDS1066.1	.	.	.	.	.	.	.	.	.	.	A	4.106	0.017707	0.07959	.	.	ENSG00000143515	ENST00000368489	T	0.68765	-0.35	5.25	4.12	0.48240	.	0.000000	0.85682	D	0.000000	T	0.08492	0.0211	N	0.00162	-1.95	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.41502	-0.9505	10	0.02654	T	1	.	10.4923	0.44758	0.6878:0.3122:0.0:0.0	.	917	P98198-3	.	L	917	ENSP00000357475:M917L	ENSP00000357475:M917L	M	+	1	0	ATP8B2	152584601	0.993000	0.37304	1.000000	0.80357	0.999000	0.98932	2.505000	0.45424	0.979000	0.38497	0.533000	0.62120	ATG		0.493	ATP8B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087658.2	NM_020452		49	803	0	0	0	0.01441	0	49	803				
DCST2	127579	broad.mit.edu	37	1	155002563	155002563	+	Missense_Mutation	SNP	G	G	A	rs368042911		TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr1:155002563G>A	ENST00000368424.3	-	7	1232	c.1174C>T	c.(1174-1176)Ccg>Tcg	p.P392S	DCST2_ENST00000295536.5_Missense_Mutation_p.P392S	NM_144622.2	NP_653223.2	Q5T1A1	DCST2_HUMAN	DC-STAMP domain containing 2	392						integral component of membrane (GO:0016021)		p.P392S(1)		breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(13)|ovary(3)|prostate(1)|skin(1)	38	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			CCCTCACCCGGTGGGATGTAG	0.697																																							uc001fgm.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(1174-1176)CCG>TCG		DC-STAMP domain containing 2							55.0	56.0	56.0					1																	155002563		2203	4300	6503	SO:0001583	missense	127579					integral to membrane		g.chr1:155002563G>A	AK057496	CCDS1082.2	1q22	2008-02-05		2005-08-09	ENSG00000163354	ENSG00000163354			26562	protein-coding gene	gene with protein product							Standard	NM_144622		Approved	FLJ32934	uc001fgm.3	Q5T1A1	OTTHUMG00000037371	ENST00000368424.3:c.1174C>T	1.37:g.155002563G>A	ENSP00000357409:p.Pro392Ser		Somatic				DCST2_uc009wpb.2_RNA	p.P392S	NM_144622	NP_653223	WXS	Illumina HiSeq	Unspecified	Q5T1A1	DCST2_HUMAN	BRCA - Breast invasive adenocarcinoma(34;0.00034)		7	1254	-	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		392			Cytoplasmic (Potential).		Q2M2R2|Q8N810|Q96M03	Missense_Mutation	SNP	ENST00000368424.3	37	c.1174C>T	CCDS1082.2	.	.	.	.	.	.	.	.	.	.	G	14.86	2.662800	0.47572	.	.	ENSG00000163354	ENST00000368424;ENST00000295536	T;T	0.28255	1.62;1.62	4.68	4.68	0.58851	Dendritic cell-specific transmembrane protein-like (1);	0.000000	0.64402	D	0.000001	T	0.44052	0.1275	M	0.78801	2.425	0.36045	D	0.840335	D	0.89917	1.0	D	0.79784	0.993	T	0.37663	-0.9696	10	0.22109	T	0.4	.	14.6262	0.68624	0.0:0.0:1.0:0.0	.	392	Q5T1A1	DCST2_HUMAN	S	392	ENSP00000357409:P392S;ENSP00000295536:P392S	ENSP00000295536:P392S	P	-	1	0	DCST2	153269187	0.998000	0.40836	0.742000	0.31022	0.069000	0.16628	3.841000	0.55850	2.427000	0.82271	0.655000	0.94253	CCG		0.697	DCST2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090953.3	NM_144622		21	197	0	0	0	0.014323	0	21	197				
INSRR	3645	broad.mit.edu	37	1	156810734	156810734	+	Silent	SNP	G	G	T	rs535798216	byFrequency	TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr1:156810734G>T	ENST00000368195.3	-	22	4221	c.3825C>A	c.(3823-3825)acC>acA	p.T1275T	NTRK1_ENST00000392302.2_Intron	NM_014215.2	NP_055030.1	P14616	INSRR_HUMAN	insulin receptor-related receptor	1275					actin cytoskeleton reorganization (GO:0031532)|cellular response to alkaline pH (GO:0071469)|male sex determination (GO:0030238)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.T1275T(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(13)|ovary(7)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	42	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					GCTCTGCATCGGTGGTAGGCA	0.647																																							uc010pht.1		NA																	1	Substitution - coding silent(1)		lung(1)	lung(11)|ovary(5)|skin(2)|kidney(1)|central_nervous_system(1)	20						c.(3823-3825)ACC>ACA		insulin receptor-related receptor precursor							31.0	33.0	33.0					1																	156810734		2203	4300	6503	SO:0001819	synonymous_variant	3645				protein autophosphorylation|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|insulin receptor substrate binding|metal ion binding|phosphatidylinositol 3-kinase binding|transmembrane receptor protein tyrosine kinase activity	g.chr1:156810734G>T	J05046	CCDS1160.1	1q21-q23	2013-02-11			ENSG00000027644	ENSG00000027644		"""Fibronectin type III domain containing"""	6093	protein-coding gene	gene with protein product		147671				2768234, 2249481	Standard	NM_014215		Approved	IRR	uc010pht.2	P14616	OTTHUMG00000041291	ENST00000368195.3:c.3825C>A	1.37:g.156810734G>T			Somatic				NTRK1_uc001fqf.1_Intron|NTRK1_uc009wsi.1_Intron	p.T1275T	NM_014215	NP_055030	WXS	Illumina HiSeq	Unspecified	P14616	INSRR_HUMAN			22	4079	-	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)		1275			Cytoplasmic (Potential).		O60724|Q5VZS3	Silent	SNP	ENST00000368195.3	37	c.3825C>A	CCDS1160.1																																																																																				0.647	INSRR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098929.1	NM_014215		4	73	1	0	8.12818e-05	0.001984	8.76413e-05	4	73				
FCRL2	79368	broad.mit.edu	37	1	157738300	157738300	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr1:157738300G>T	ENST00000361516.3	-	5	835	c.787C>A	c.(787-789)Cca>Aca	p.P263T	FCRL2_ENST00000469986.1_5'Flank|FCRL2_ENST00000368181.4_Intron|FCRL2_ENST00000392274.3_Missense_Mutation_p.P263T	NM_030764.3	NP_110391.2	Q96LA5	FCRL2_HUMAN	Fc receptor-like 2	263	Ig-like C2-type 3.				cell-cell signaling (GO:0007267)|positive regulation of signal transduction (GO:0009967)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)	p.P263T(1)		central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(29)|ovary(1)|pancreas(1)|prostate(3)|skin(2)	51	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			TTCACAGCTGGGATCTCCAGC	0.512																																							uc001fre.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(787-789)CCA>ACA		Fc receptor-like 2 precursor							185.0	183.0	184.0					1																	157738300		2203	4300	6503	SO:0001583	missense	79368				cell-cell signaling	integral to membrane|plasma membrane|soluble fraction	receptor activity|SH3/SH2 adaptor activity	g.chr1:157738300G>T	AF319438	CCDS1168.1	1q23.1	2013-01-14	2002-01-14	2005-03-23	ENSG00000132704	ENSG00000132704		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14875	protein-coding gene	gene with protein product		606509	"""SH2 domain-containing phosphatase anchor protein 1"""	SPAP1		11162587	Standard	NM_030764		Approved	FCRH2, IRTA4, CD307b	uc001fre.2	Q96LA5	OTTHUMG00000019399	ENST00000361516.3:c.787C>A	1.37:g.157738300G>T	ENSP00000355157:p.Pro263Thr		Somatic				FCRL2_uc001frd.2_5'Flank|FCRL2_uc010phz.1_Missense_Mutation_p.P263T|FCRL2_uc009wsp.2_Intron	p.P263T	NM_030764	NP_110391	WXS	Illumina HiSeq	Unspecified	Q96LA5	FCRL2_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.24)		5	846	-	all_hematologic(112;0.0378)		263			Ig-like C2-type 3.|Extracellular (Potential).		A0N0M5|A1L307|A6NMS0|Q6NTA1|Q9BZI4|Q9BZI5|Q9BZI6	Missense_Mutation	SNP	ENST00000361516.3	37	c.787C>A	CCDS1168.1	.	.	.	.	.	.	.	.	.	.	G	10.95	1.496990	0.26861	.	.	ENSG00000132704	ENST00000361516;ENST00000392274	T;T	0.14144	2.53;2.53	4.09	2.19	0.27852	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.852484	0.09314	N	0.819179	T	0.05777	0.0151	L	0.56340	1.77	0.09310	N	1	B;B	0.33477	0.062;0.413	B;B	0.39935	0.219;0.314	T	0.45963	-0.9225	10	0.22109	T	0.4	.	6.494	0.22132	0.2252:0.0:0.7748:0.0	.	263;263	B4DVJ9;Q96LA5	.;FCRL2_HUMAN	T	263	ENSP00000355157:P263T;ENSP00000376100:P263T	ENSP00000355157:P263T	P	-	1	0	FCRL2	156004924	0.050000	0.20438	0.172000	0.22920	0.006000	0.05464	0.868000	0.27982	0.475000	0.27415	0.655000	0.94253	CCA		0.512	FCRL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051408.2	NM_030764		143	214	1	0	3.42498e-63	0.01441	5.9232e-63	143	214				
SPTA1	6708	broad.mit.edu	37	1	158615031	158615031	+	Nonsense_Mutation	SNP	C	C	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr1:158615031C>A	ENST00000368147.4	-	29	4321	c.4141G>T	c.(4141-4143)Gag>Tag	p.E1381*		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1381					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.E1381*(1)		NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					CAAGCCTTCTCCAAATCATCT	0.448																																							uc001fst.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8						c.(4141-4143)GAG>TAG		spectrin, alpha, erythrocytic 1							184.0	164.0	170.0					1																	158615031		1902	4127	6029	SO:0001587	stop_gained	6708				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton	g.chr1:158615031C>A	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.4141G>T	1.37:g.158615031C>A	ENSP00000357129:p.Glu1381*		Somatic					p.E1381*	NM_003126	NP_003117	WXS	Illumina HiSeq	Unspecified	P02549	SPTA1_HUMAN			29	4340	-	all_hematologic(112;0.0378)		1381			Spectrin 13.		Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Nonsense_Mutation	SNP	ENST00000368147.4	37	c.4141G>T	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	C	43	10.508555	0.99418	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	.	.	.	5.03	3.15	0.36227	.	0.323524	0.17681	N	0.165631	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.18276	T	0.48	.	10.4514	0.44524	0.0:0.8398:0.0:0.1602	.	.	.	.	X	1381	.	ENSP00000357129:E1381X	E	-	1	0	SPTA1	156881655	1.000000	0.71417	0.338000	0.25549	0.760000	0.43138	7.043000	0.76572	0.820000	0.34516	0.650000	0.86243	GAG		0.448	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126		144	140	1	0	1.97865e-72	0.01441	3.44895e-72	144	140				
OR10J3	441911	broad.mit.edu	37	1	159284169	159284169	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr1:159284169G>A	ENST00000332217.5	-	1	280	c.281C>T	c.(280-282)gCc>gTc	p.A94V		NM_001004467.1	NP_001004467.1	Q5JRS4	O10J3_HUMAN	olfactory receptor, family 10, subfamily J, member 3	94						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A94V(1)		breast(2)|endometrium(7)|kidney(4)|large_intestine(7)|lung(19)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	47	all_hematologic(112;0.0429)					GCTTTGGGTGGCAATGGGCTG	0.498																																							uc010piu.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(280-282)GCC>GTC		olfactory receptor, family 10, subfamily J,							113.0	109.0	110.0					1																	159284169		2203	4300	6503	SO:0001583	missense	441911				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:159284169G>A		CCDS30909.1	1q23.2	2012-08-09		2004-03-10	ENSG00000196266	ENSG00000196266		"""GPCR / Class A : Olfactory receptors"""	14992	protein-coding gene	gene with protein product				OR10J3P			Standard	NM_001004467		Approved		uc010piu.2	Q5JRS4	OTTHUMG00000037233	ENST00000332217.5:c.281C>T	1.37:g.159284169G>A	ENSP00000331789:p.Ala94Val		Somatic					p.A94V	NM_001004467	NP_001004467	WXS	Illumina HiSeq	Unspecified	Q5JRS4	O10J3_HUMAN			1	281	-	all_hematologic(112;0.0429)		94			Extracellular (Potential).			Missense_Mutation	SNP	ENST00000332217.5	37	c.281C>T	CCDS30909.1	.	.	.	.	.	.	.	.	.	.	G	9.181	1.023608	0.19433	.	.	ENSG00000196266	ENST00000332217	T	0.00414	7.52	5.93	-0.638	0.11500	GPCR, rhodopsin-like superfamily (1);	0.564869	0.13180	U	0.407601	T	0.00109	0.0003	L	0.43152	1.355	0.09310	N	1	B	0.13594	0.008	B	0.18561	0.022	T	0.35798	-0.9774	10	0.87932	D	0	.	4.8099	0.13339	0.2114:0.0:0.4244:0.3642	.	94	Q5JRS4	O10J3_HUMAN	V	94	ENSP00000331789:A94V	ENSP00000331789:A94V	A	-	2	0	OR10J3	157550793	0.000000	0.05858	0.000000	0.03702	0.201000	0.24016	0.475000	0.22164	-0.133000	0.11537	0.561000	0.74099	GCC		0.498	OR10J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090629.1			8	142	0	0	0	0.00308	0	8	142				
OR10J1	26476	broad.mit.edu	37	1	159410018	159410018	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr1:159410018T>A	ENST00000423932.3	+	1	507	c.470T>A	c.(469-471)cTg>cAg	p.L157Q	RP11-550P17.5_ENST00000431862.1_RNA	NM_012351.2	NP_036483.2	P30954	O10J1_HUMAN	olfactory receptor, family 10, subfamily J, member 1	157					G-protein coupled receptor signaling pathway (GO:0007186)|sensory perception of chemical stimulus (GO:0007606)|single fertilization (GO:0007338)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L157Q(1)		endometrium(2)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|skin(2)|stomach(1)	25	all_hematologic(112;0.0429)					CAACTTGTCCTGGGGGCCTGC	0.498																																							uc010piv.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(469-471)CTG>CAG		olfactory receptor, family 10, subfamily J,							138.0	131.0	133.0					1																	159410018		2203	4300	6503	SO:0001583	missense	26476				sensory perception of smell|single fertilization	integral to plasma membrane	olfactory receptor activity	g.chr1:159410018T>A	X64995	CCDS1185.1	1q23.2	2012-08-09			ENSG00000196184	ENSG00000196184		"""GPCR / Class A : Olfactory receptors"""	8175	protein-coding gene	gene with protein product						1370859	Standard	NM_012351		Approved	HGMP07J, HSHGMP07J	uc010piv.2	P30954	OTTHUMG00000022737	ENST00000423932.3:c.470T>A	1.37:g.159410018T>A	ENSP00000399078:p.Leu157Gln		Somatic				uc001fts.3_Intron	p.L157Q	NM_012351	NP_036483	WXS	Illumina HiSeq	Unspecified	P30954	O10J1_HUMAN			1	470	+	all_hematologic(112;0.0429)		157			Helical; Name=4; (Potential).		Q2M1M8|Q5VSV1|Q6IET5|Q96R56	Missense_Mutation	SNP	ENST00000423932.3	37	c.470T>A	CCDS1185.1	.	.	.	.	.	.	.	.	.	.	T	2.443	-0.328089	0.05314	.	.	ENSG00000196184	ENST00000423932	T	0.42900	0.96	4.58	-1.1	0.09872	GPCR, rhodopsin-like superfamily (1);	1.023760	0.07822	N	0.959959	T	0.20861	0.0502	M	0.76170	2.325	0.09310	N	1	B	0.24258	0.1	B	0.31191	0.125	T	0.46748	-0.9169	10	0.66056	D	0.02	.	1.9896	0.03443	0.1632:0.1142:0.4037:0.3189	.	157	P30954	O10J1_HUMAN	Q	157	ENSP00000399078:L157Q	ENSP00000399078:L157Q	L	+	2	0	OR10J1	157676642	0.000000	0.05858	0.000000	0.03702	0.019000	0.09904	-1.598000	0.02087	-0.302000	0.08869	-0.316000	0.08728	CTG		0.498	OR10J1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059020.1	NM_012351		150	116	0	0	0	0.01441	0	150	116				
TAGLN2	8407	broad.mit.edu	37	1	159888698	159888698	+	Silent	SNP	A	A	G			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr1:159888698A>G	ENST00000368097.4	-	5	802	c.492T>C	c.(490-492)gaT>gaC	p.D164D	TAGLN2_ENST00000478033.1_5'UTR|TAGLN2_ENST00000320307.4_Silent_p.D164D|TAGLN2_ENST00000368096.1_Silent_p.D185D	NM_001277223.1|NM_003564.1	NP_001264152.1|NP_003555.1	P37802	TAGL2_HUMAN	transgelin 2	164					epithelial cell differentiation (GO:0030855)	extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)		p.D164D(1)		endometrium(1)|large_intestine(2)|lung(6)	9	all_hematologic(112;0.0597)		BRCA - Breast invasive adenocarcinoma(70;0.111)			GCAGCTGGTTATCCGAGAAGT	0.567																																							uc001fum.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(490-492)GAT>GAC		transgelin 2							103.0	89.0	94.0					1																	159888698		2203	4300	6503	SO:0001819	synonymous_variant	8407				muscle organ development	nuclear membrane|plasma membrane	protein binding	g.chr1:159888698A>G	D21261	CCDS1189.1, CCDS60314.1	1q21-q25	2008-07-18			ENSG00000158710	ENSG00000158710			11554	protein-coding gene	gene with protein product	"""SM22-alpha homolog"""	604634				9693045	Standard	NM_001277223		Approved	KIAA0120, HA1756	uc031pqu.1	P37802	OTTHUMG00000022793	ENST00000368097.4:c.492T>C	1.37:g.159888698A>G			Somatic				CCDC19_uc001ful.2_Intron|TAGLN2_uc001fun.1_Silent_p.D164D|TAGLN2_uc001fuo.1_3'UTR	p.D164D	NM_003564	NP_003555	WXS	Illumina HiSeq	Unspecified	P37802	TAGL2_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.111)		4	542	-	all_hematologic(112;0.0597)		164					E9KL39|Q5JRQ6|Q5JRQ7|Q6FGI1|Q9BUH5|Q9H4P0	Silent	SNP	ENST00000368097.4	37	c.492T>C	CCDS1189.1																																																																																				0.567	TAGLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059105.1	NM_003564		34	256	0	0	0	0.004878	0	34	256				
NOS1AP	9722	broad.mit.edu	37	1	162313767	162313767	+	Splice_Site	SNP	G	G	C			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr1:162313767G>C	ENST00000361897.5	+	6	997		c.e6+1		NOS1AP_ENST00000530878.1_Splice_Site|MIR556_ENST00000384996.1_RNA	NM_001164757.1|NM_014697.2	NP_001158229.1|NP_055512.1	O75052	CAPON_HUMAN	nitric oxide synthase 1 (neuronal) adaptor protein						regulation of apoptotic process (GO:0042981)|regulation of nitric oxide biosynthetic process (GO:0045428)|regulation of nitric-oxide synthase activity (GO:0050999)		nitric-oxide synthase binding (GO:0050998)	p.?(2)		NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(12)|skin(1)|upper_aerodigestive_tract(2)	32	all_hematologic(112;0.203)		BRCA - Breast invasive adenocarcinoma(70;0.0537)			GGAGACCCAGGTAGGCACTGC	0.582																																							uc001gbv.2		NA																	2	Unknown(2)		lung(2)	lung(2)|upper_aerodigestive_tract(1)	3						c.e6+1		nitric oxide synthase 1 (neuronal) adaptor							91.0	83.0	86.0					1																	162313767		2203	4300	6503	SO:0001630	splice_region_variant	9722				regulation of apoptosis|regulation of nitric oxide biosynthetic process|regulation of nitric-oxide synthase activity		nitric-oxide synthase binding|PDZ domain binding	g.chr1:162313767G>C	AB007933	CCDS1237.1, CCDS44267.1, CCDS53421.1	1q23.3	2010-08-20			ENSG00000198929	ENSG00000198929			16859	protein-coding gene	gene with protein product	"""C-terminal PDZ domain ligand of neuronal nitric oxide synthase"""	605551				9455484, 9459447	Standard	NM_001126060		Approved	KIAA0464, CAPON	uc001gbv.2	O75052	OTTHUMG00000024049	ENST00000361897.5:c.595+1G>C	1.37:g.162313767G>C			Somatic				NOS1AP_uc010pkr.1_Splice_Site_p.G194_splice|NOS1AP_uc010pks.1_Splice_Site|NOS1AP_uc001gbw.2_Splice_Site_p.G194_splice	p.G199_splice	NM_014697	NP_055512	WXS	Illumina HiSeq	Unspecified	O75052	CAPON_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.0537)		6	982	+	all_hematologic(112;0.203)							B7ZLF5|O43564|Q3T551|Q5VU95	Splice_Site	SNP	ENST00000361897.5	37	c.595_splice	CCDS1237.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.354436	0.82243	.	.	ENSG00000198929	ENST00000530878;ENST00000361897	.	.	.	5.79	5.79	0.91817	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.6038	0.91259	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NOS1AP	160580391	1.000000	0.71417	1.000000	0.80357	0.775000	0.43874	6.567000	0.73983	2.733000	0.93635	0.655000	0.94253	.		0.582	NOS1AP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060555.2	NM_014697	Intron	48	31	0	0	0	0.01441	0	48	31				
METTL13	51603	broad.mit.edu	37	1	171755174	171755174	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr1:171755174A>G	ENST00000361735.3	+	3	1335	c.1069A>G	c.(1069-1071)Aga>Gga	p.R357G	METTL13_ENST00000458517.1_Missense_Mutation_p.R356G|METTL13_ENST00000367737.5_Missense_Mutation_p.R201G|METTL13_ENST00000362019.3_Missense_Mutation_p.R271G	NM_015935.4	NP_057019.3	Q8N6R0	MET13_HUMAN	methyltransferase like 13	357							methyltransferase activity (GO:0008168)	p.R357G(1)		breast(3)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(8)|lung(17)|stomach(3)	41						GCTGTCGGCTAGAGTCATGGA	0.572																																							uc001ghz.2		NA																	1	Substitution - Missense(1)		lung(1)	kidney(1)	1						c.(1069-1071)AGA>GGA		CGI-01 protein isoform 1							52.0	44.0	47.0					1																	171755174		2203	4300	6503	SO:0001583	missense	51603						methyltransferase activity|protein binding	g.chr1:171755174A>G	AF132936	CCDS1299.1, CCDS1300.1, CCDS30936.1	1q24-q25.3	2009-02-23	2009-02-23	2009-02-23	ENSG00000010165	ENSG00000010165			24248	protein-coding gene	gene with protein product			"""KIAA0859"""	KIAA0859		10810093, 10048485	Standard	NM_001007239		Approved	CGI-01	uc001ghz.3	Q8N6R0	OTTHUMG00000034912	ENST00000361735.3:c.1069A>G	1.37:g.171755174A>G	ENSP00000354920:p.Arg357Gly		Somatic				METTL13_uc001gia.2_Missense_Mutation_p.R271G|METTL13_uc001gib.2_Missense_Mutation_p.R201G|METTL13_uc010pml.1_Missense_Mutation_p.R356G	p.R357G	NM_015935	NP_057019	WXS	Illumina HiSeq	Unspecified	Q8N6R0	MTL13_HUMAN			3	1416	+			357					A6NFK0|A8K6S5|O94940|Q53EZ6|Q5TGP9|Q5TGQ0|Q8N2P8|Q96J11|Q96SQ0|Q9Y2Z1|Q9Y3M6	Missense_Mutation	SNP	ENST00000361735.3	37	c.1069A>G	CCDS1299.1	.	.	.	.	.	.	.	.	.	.	A	11.51	1.658937	0.29515	.	.	ENSG00000010165	ENST00000458517;ENST00000362019;ENST00000367737;ENST00000361735	T;T;T;T	0.10288	2.89;2.89;2.89;2.89	5.36	4.21	0.49690	.	0.436137	0.27591	N	0.018689	T	0.02727	0.0082	N	0.22421	0.69	0.32042	N	0.598078	B;P;B	0.35226	0.01;0.491;0.078	B;B;B	0.34824	0.021;0.19;0.035	T	0.45205	-0.9277	10	0.27082	T	0.32	-20.0269	11.4805	0.50322	0.8493:0.1507:0.0:0.0	.	356;201;357	B4E2X3;Q8N6R0-1;Q8N6R0	.;.;MTL13_HUMAN	G	356;271;201;357	ENSP00000401955:R356G;ENSP00000355393:R271G;ENSP00000356711:R201G;ENSP00000354920:R357G	ENSP00000354920:R357G	R	+	1	2	METTL13	170021797	0.994000	0.37717	0.996000	0.52242	0.960000	0.62799	2.881000	0.48538	1.007000	0.39238	0.459000	0.35465	AGA		0.572	METTL13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084528.5	NM_014955		5	75	0	0	0	0.00308	0	5	75				
TNR	7143	broad.mit.edu	37	1	175324739	175324739	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr1:175324739C>A	ENST00000367674.2	-	17	3857	c.3149G>T	c.(3148-3150)aGt>aTt	p.S1050I	TNR_ENST00000263525.2_Missense_Mutation_p.S1050I			Q92752	TENR_HUMAN	tenascin R	1050	Fibronectin type-III 9. {ECO:0000255|PROSITE-ProRule:PRU00316}.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)		p.S1050I(1)		NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					GGTGACTTCACTGGCTGTCAG	0.552																																							uc001gkp.1		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(5)|ovary(4)|central_nervous_system(1)|skin(1)	11						c.(3148-3150)AGT>ATT		tenascin R precursor							80.0	84.0	83.0					1																	175324739		2203	4300	6503	SO:0001583	missense	7143				axon guidance|cell adhesion|signal transduction	proteinaceous extracellular matrix		g.chr1:175324739C>A	X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.3149G>T	1.37:g.175324739C>A	ENSP00000356646:p.Ser1050Ile		Somatic				TNR_uc009wwu.1_Missense_Mutation_p.S1050I	p.S1050I	NM_003285	NP_003276	WXS	Illumina HiSeq	Unspecified	Q92752	TENR_HUMAN			15	3230	-	Renal(580;0.146)		1050			Fibronectin type-III 9.		C9J563|Q15568|Q5R3G0	Missense_Mutation	SNP	ENST00000367674.2	37	c.3149G>T	CCDS1318.1	.	.	.	.	.	.	.	.	.	.	C	19.90	3.913398	0.72983	.	.	ENSG00000116147	ENST00000367674;ENST00000263525;ENST00000367673	T;T	0.59364	0.27;0.27	4.93	3.95	0.45737	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.047879	0.85682	D	0.000000	T	0.65270	0.2675	M	0.64630	1.985	0.48901	D	0.999727	P	0.50369	0.934	P	0.53146	0.719	T	0.67818	-0.5572	10	0.49607	T	0.09	.	14.0008	0.64433	0.0:0.6696:0.3304:0.0	.	1050	Q92752	TENR_HUMAN	I	1050;1050;960	ENSP00000356646:S1050I;ENSP00000263525:S1050I	ENSP00000263525:S1050I	S	-	2	0	TNR	173591362	0.997000	0.39634	1.000000	0.80357	0.991000	0.79684	1.757000	0.38400	2.422000	0.82143	0.561000	0.74099	AGT		0.552	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084414.4	NM_003285		89	51	1	0	3.10586e-51	0.01441	5.32951e-51	89	51				
TNR	7143	broad.mit.edu	37	1	175372653	175372653	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr1:175372653G>A	ENST00000367674.2	-	4	1307	c.599C>T	c.(598-600)tCg>tTg	p.S200L	TNR_ENST00000263525.2_Missense_Mutation_p.S200L			Q92752	TENR_HUMAN	tenascin R	200	Cys-rich.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)		p.S200L(1)		NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					GTAGGGCTCCGAGCAATTCTT	0.582																																							uc001gkp.1		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(5)|ovary(4)|central_nervous_system(1)|skin(1)	11						c.(598-600)TCG>TTG		tenascin R precursor							86.0	93.0	91.0					1																	175372653		2203	4300	6503	SO:0001583	missense	7143				axon guidance|cell adhesion|signal transduction	proteinaceous extracellular matrix		g.chr1:175372653G>A	X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.599C>T	1.37:g.175372653G>A	ENSP00000356646:p.Ser200Leu		Somatic				TNR_uc009wwu.1_Missense_Mutation_p.S200L|TNR_uc010pmz.1_Missense_Mutation_p.S200L	p.S200L	NM_003285	NP_003276	WXS	Illumina HiSeq	Unspecified	Q92752	TENR_HUMAN			2	680	-	Renal(580;0.146)		200			Cys-rich.		C9J563|Q15568|Q5R3G0	Missense_Mutation	SNP	ENST00000367674.2	37	c.599C>T	CCDS1318.1	.	.	.	.	.	.	.	.	.	.	G	35	5.537745	0.96460	.	.	ENSG00000116147	ENST00000367674;ENST00000263525;ENST00000367673	T;T	0.08008	3.14;3.14	6.17	6.17	0.99709	.	0.069299	0.64402	D	0.000012	T	0.33527	0.0866	M	0.78916	2.43	0.80722	D	1	D;D	0.76494	0.999;0.994	D;P	0.72625	0.978;0.67	T	0.00553	-1.1674	10	0.72032	D	0.01	.	20.4745	0.99168	0.0:0.0:1.0:0.0	.	200;200	B4DIX8;Q92752	.;TENR_HUMAN	L	200	ENSP00000356646:S200L;ENSP00000263525:S200L	ENSP00000263525:S200L	S	-	2	0	TNR	173639276	1.000000	0.71417	0.974000	0.42286	0.996000	0.88848	9.731000	0.98807	2.941000	0.99782	0.655000	0.94253	TCG		0.582	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084414.4	NM_003285		38	310	0	0	0	0.009718	0	38	310				
BRINP2	57795	broad.mit.edu	37	1	177226496	177226496	+	Silent	SNP	C	C	A	rs528002829		TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr1:177226496C>A	ENST00000361539.4	+	4	957	c.645C>A	c.(643-645)atC>atA	p.I215I	BRINP2_ENST00000478325.1_3'UTR	NM_021165.2	NP_066988.1	Q9C0B6	BRNP2_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 2	215	MACPF.				cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	extracellular region (GO:0005576)		p.I215I(1)									TGCACCATATCCAGATAGCCA	0.612													C|||	1	0.000199681	0.0	0.0	5008	,	,		17771	0.0		0.0	False		,,,				2504	0.001						uc001glf.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(3)|ovary(2)|upper_aerodigestive_tract(1)	6						c.(643-645)ATC>ATA		family with sequence similarity 5, member B							30.0	30.0	30.0					1																	177226496		2203	4300	6503	SO:0001819	synonymous_variant	57795					extracellular region		g.chr1:177226496C>A		CCDS1320.1	1q24	2013-08-06	2013-08-06	2013-07-31	ENSG00000198797	ENSG00000198797			13746	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member B"""	FAM5B		15193423	Standard	NM_021165		Approved	DBCCR1L2	uc001glf.3	Q9C0B6	OTTHUMG00000034953	ENST00000361539.4:c.645C>A	1.37:g.177226496C>A			Somatic				FAM5B_uc010pna.1_5'UTR|FAM5B_uc001glg.2_Silent_p.I110I	p.I215I	NM_021165	NP_066988	WXS	Illumina HiSeq	Unspecified	Q9C0B6	FAM5B_HUMAN			4	957	+			215					O95560|Q6ZWC1|Q7LCZ9|Q8N360	Silent	SNP	ENST00000361539.4	37	c.645C>A	CCDS1320.1																																																																																				0.612	BRINP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084599.1	NM_021165		33	21	1	0	1.56738e-10	0.004289	1.96927e-10	33	21				
HMCN1	83872	broad.mit.edu	37	1	186086738	186086738	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr1:186086738A>G	ENST00000271588.4	+	77	12060	c.11831A>G	c.(11830-11832)tAt>tGt	p.Y3944C	HMCN1_ENST00000367492.2_Missense_Mutation_p.Y3944C	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	3944	Ig-like C2-type 38.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.Y3944C(1)		NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						GGAGATGGCTATAGAATTCTG	0.433																																							uc001grq.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(22)|skin(1)	23						c.(11830-11832)TAT>TGT		hemicentin 1 precursor							95.0	94.0	95.0					1																	186086738		2203	4300	6503	SO:0001583	missense	83872				response to stimulus|visual perception	basement membrane	calcium ion binding	g.chr1:186086738A>G	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.11831A>G	1.37:g.186086738A>G	ENSP00000271588:p.Tyr3944Cys		Somatic					p.Y3944C	NM_031935	NP_114141	WXS	Illumina HiSeq	Unspecified	Q96RW7	HMCN1_HUMAN			77	12060	+			3944			Ig-like C2-type 38.		A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	37	c.11831A>G	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	A	19.00	3.741369	0.69304	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.69306	-0.39;-0.39	5.65	5.65	0.86999	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.055136	0.85682	D	0.000000	D	0.84800	0.5552	M	0.90650	3.135	0.54753	D	0.999986	D	0.89917	1.0	D	0.91635	0.999	D	0.86877	0.2039	10	0.48119	T	0.1	.	15.8909	0.79296	1.0:0.0:0.0:0.0	.	3944	Q96RW7	HMCN1_HUMAN	C	3944	ENSP00000271588:Y3944C;ENSP00000356462:Y3944C	ENSP00000271588:Y3944C	Y	+	2	0	HMCN1	184353361	1.000000	0.71417	0.994000	0.49952	0.998000	0.95712	4.988000	0.63863	2.146000	0.66826	0.533000	0.62120	TAT		0.433	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935		69	42	0	0	0	0.01441	0	69	42				
LRRN2	10446	broad.mit.edu	37	1	204588748	204588748	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr1:204588748C>G	ENST00000367175.1	-	1	2585	c.373G>C	c.(373-375)Gag>Cag	p.E125Q	LRRN2_ENST00000367176.3_Missense_Mutation_p.E125Q|LRRN2_ENST00000496057.1_5'Flank|LRRN2_ENST00000367177.3_Missense_Mutation_p.E125Q			O75325	LRRN2_HUMAN	leucine rich repeat neuronal 2	125					cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.E125Q(1)		central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|liver(1)|lung(22)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	38	all_cancers(21;0.0519)|Breast(84;0.112)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)			TGGTTCTCCTCTAGGTGCAGG	0.602																																							uc001hbe.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)	2						c.(373-375)GAG>CAG		leucine rich repeat neuronal 2 precursor							102.0	105.0	104.0					1																	204588748		2203	4300	6503	SO:0001583	missense	10446				cell adhesion	integral to membrane	receptor activity	g.chr1:204588748C>G	AF030435	CCDS1448.1	1q32.1	2013-01-11	2007-01-31	2007-01-31	ENSG00000170382	ENSG00000170382		"""Immunoglobulin superfamily / I-set domain containing"""	16914	protein-coding gene	gene with protein product	"""leucine rich and ankyrin repeats 1"", ""fibronectin type III, immunoglobulin and leucine rich repeat domain 7"""	605492	"""leucine rich repeat neuronal 5"""	LRRN5		9662332	Standard	NM_006338		Approved	GAC1, LRANK1, FIGLER7	uc001hbf.1	O75325	OTTHUMG00000035989	ENST00000367175.1:c.373G>C	1.37:g.204588748C>G	ENSP00000356143:p.Glu125Gln		Somatic				MDM4_uc001hbd.1_Intron|LRRN2_uc001hbf.1_Missense_Mutation_p.E125Q|LRRN2_uc009xbf.1_Missense_Mutation_p.E125Q|MDM4_uc001hbc.2_Intron	p.E125Q	NM_006338	NP_006329	WXS	Illumina HiSeq	Unspecified	O75325	LRRN2_HUMAN	KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)		3	761	-	all_cancers(21;0.0519)|Breast(84;0.112)|Prostate(682;0.19)		125			LRR 3.|Extracellular (Potential).		B2R624|Q5T0Y0|Q6UXM0|Q8N182	Missense_Mutation	SNP	ENST00000367175.1	37	c.373G>C	CCDS1448.1	.	.	.	.	.	.	.	.	.	.	C	19.88	3.909486	0.72868	.	.	ENSG00000170382	ENST00000367176;ENST00000367177;ENST00000367175	T;T;T	0.24723	1.84;1.84;1.84	5.39	5.39	0.77823	.	0.328198	0.21599	N	0.071967	T	0.37019	0.0988	N	0.12920	0.275	0.51233	D	0.999916	D	0.89917	1.0	D	0.97110	1.0	T	0.37502	-0.9703	10	0.54805	T	0.06	.	18.8335	0.92151	0.0:1.0:0.0:0.0	.	125	O75325	LRRN2_HUMAN	Q	125	ENSP00000356144:E125Q;ENSP00000356145:E125Q;ENSP00000356143:E125Q	ENSP00000356143:E125Q	E	-	1	0	LRRN2	202855371	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.816000	0.86201	2.543000	0.85770	0.650000	0.86243	GAG		0.602	LRRN2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089894.1	NM_006338		4	420	0	0	0	0.001168	0	4	420				
CENPF	1063	broad.mit.edu	37	1	214791961	214791961	+	Silent	SNP	A	A	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr1:214791961A>T	ENST00000366955.3	+	4	573	c.405A>T	c.(403-405)gcA>gcT	p.A135A		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	0	Interaction with SNAP25 and required for localization to the cytoplasm. {ECO:0000250}.				cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)	p.A135A(1)		NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		CGCAGTCTGCAGATGTCTCTC	0.398																																					Colon(80;575 1284 11000 14801 43496)	Colon(80;575 1284 11000 14801 43496)	uc001hkm.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(6)|central_nervous_system(4)|large_intestine(2)|skin(1)	13						c.(403-405)GCA>GCT		centromere protein F							106.0	106.0	106.0					1																	214791961		2203	4300	6503	SO:0001819	synonymous_variant	1063				cell differentiation|cell division|cell proliferation|DNA replication|G2 phase of mitotic cell cycle|kinetochore assembly|metaphase plate congression|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|muscle organ development|negative regulation of transcription, DNA-dependent|protein transport|regulation of G2/M transition of mitotic cell cycle|regulation of striated muscle tissue development|response to drug	condensed chromosome outer kinetochore|cytosol|midbody|nuclear envelope|nuclear matrix|perinuclear region of cytoplasm|spindle pole	chromatin binding|dynein binding|protein C-terminus binding|protein homodimerization activity|transcription factor binding	g.chr1:214791961A>T	U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.405A>T	1.37:g.214791961A>T			Somatic					p.A135A	NM_016343	NP_057427	WXS	Illumina HiSeq	Unspecified	P49454	CENPF_HUMAN		all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)	4	579	+			135			Interaction with SNAP25 and required for localization to the cytoplasm (By similarity).|Potential.		Q13171|Q13246|Q5VVM7	Silent	SNP	ENST00000366955.3	37	c.405A>T	CCDS31023.1																																																																																				0.398	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089749.1	NM_016343		19	118	0	0	0	0.007413	0	19	118				
USH2A	7399	broad.mit.edu	37	1	215848813	215848813	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr1:215848813G>T	ENST00000307340.3	-	63	12826	c.12440C>A	c.(12439-12441)cCt>cAt	p.P4147H	USH2A_ENST00000366943.2_Missense_Mutation_p.P4147H	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	4147	Fibronectin type-III 26. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.P4147H(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TGTCCACAGAGGCTGAGGCGC	0.572										HNSCC(13;0.011)																													uc001hku.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26						c.(12439-12441)CCT>CAT		usherin isoform B							45.0	46.0	46.0					1																	215848813		2203	4300	6503	SO:0001583	missense	7399				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding	g.chr1:215848813G>T	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.12440C>A	1.37:g.215848813G>T	ENSP00000305941:p.Pro4147His	HNSCC(13;0.011)	Somatic					p.P4147H	NM_206933	NP_996816	WXS	Illumina HiSeq	Unspecified	O75445	USH2A_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)	63	12827	-			4147			Fibronectin type-III 26.|Extracellular (Potential).		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	c.12440C>A	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	G	9.074	0.997708	0.19043	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.53206	0.63;0.63	5.25	-0.27	0.12926	Fibronectin, type III (1);Immunoglobulin-like fold (1);	0.743893	0.11360	N	0.572015	T	0.35189	0.0923	L	0.44542	1.39	0.09310	N	1	P	0.38642	0.641	B	0.36959	0.237	T	0.16364	-1.0405	10	0.40728	T	0.16	.	6.6211	0.22804	0.2024:0.3663:0.4313:0.0	.	4147	O75445	USH2A_HUMAN	H	4147	ENSP00000305941:P4147H;ENSP00000355910:P4147H	ENSP00000305941:P4147H	P	-	2	0	USH2A	213915436	0.383000	0.25156	0.001000	0.08648	0.253000	0.25986	0.643000	0.24750	-0.025000	0.13918	-0.142000	0.14014	CCT		0.572	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123		12	61	1	0	5.50884e-06	0.013537	6.13484e-06	12	61				
EPRS	2058	broad.mit.edu	37	1	220178627	220178627	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr1:220178627C>T	ENST00000366923.3	-	16	2295	c.2026G>A	c.(2026-2028)Gga>Aga	p.G676R		NM_004446.2	NP_004437.2	P07814	SYEP_HUMAN	glutamyl-prolyl-tRNA synthetase	676	Glutamate--tRNA ligase.				cellular response to interferon-gamma (GO:0071346)|gene expression (GO:0010467)|glutamyl-tRNA aminoacylation (GO:0006424)|negative regulation of translation (GO:0017148)|prolyl-tRNA aminoacylation (GO:0006433)|protein complex assembly (GO:0006461)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|GAIT complex (GO:0097452)|membrane (GO:0016020)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|glutamate-tRNA ligase activity (GO:0004818)|proline-tRNA ligase activity (GO:0004827)|RNA stem-loop binding (GO:0035613)	p.G676R(1)		breast(2)|endometrium(11)|kidney(2)|large_intestine(13)|lung(24)|ovary(1)|prostate(3)|skin(2)|stomach(2)|urinary_tract(3)	63				GBM - Glioblastoma multiforme(131;0.0735)	L-Proline(DB00172)	ATGAAGAATCCTCTTCTCTGG	0.333																																							uc001hly.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(2026-2028)GGA>AGA		glutamyl-prolyl tRNA synthetase	L-Glutamic Acid(DB00142)|L-Proline(DB00172)						118.0	119.0	119.0					1																	220178627		2203	4298	6501	SO:0001583	missense	2058				glutamyl-tRNA aminoacylation|prolyl-tRNA aminoacylation|protein complex assembly	cytosol|soluble fraction	ATP binding|glutamate-tRNA ligase activity|proline-tRNA ligase activity|protein binding|RNA binding	g.chr1:220178627C>T	X54326	CCDS31027.1	1q41	2011-07-01			ENSG00000136628	ENSG00000136628	6.1.1.15, 6.1.1.17	"""Aminoacyl tRNA synthetases / Class I"", ""Aminoacyl tRNA synthetases / Class II"""	3418	protein-coding gene	gene with protein product	"""glutamate tRNA ligase"", ""proline tRNA ligase"""	138295		QPRS, QARS		1988429	Standard	NM_004446		Approved	EARS, PARS, GLUPRORS	uc001hly.1	P07814	OTTHUMG00000037433	ENST00000366923.3:c.2026G>A	1.37:g.220178627C>T	ENSP00000355890:p.Gly676Arg		Somatic				EPRS_uc010puf.1_Missense_Mutation_p.G427R|EPRS_uc001hlz.1_Missense_Mutation_p.G683R|EPRS_uc009xdt.1_Missense_Mutation_p.G264R	p.G676R	NM_004446	NP_004437	WXS	Illumina HiSeq	Unspecified	P07814	SYEP_HUMAN		GBM - Glioblastoma multiforme(131;0.0735)	16	2296	-			676			Glutamyl-tRNA synthetase.		A0AVA9|B9EGH3|Q05BP6|Q05DF8|Q5DSM1|Q5H9S5|Q6PD57|Q86X73	Missense_Mutation	SNP	ENST00000366923.3	37	c.2026G>A	CCDS31027.1	.	.	.	.	.	.	.	.	.	.	C	29.6	5.023310	0.93462	.	.	ENSG00000136628	ENST00000366923;ENST00000536921;ENST00000435048	T	0.54675	0.56	5.23	5.23	0.72850	Ribosomal protein L25/Gln-tRNA synthetase, anti-codon-binding domain (1);Ribosomal protein L25/Gln-tRNA synthetase, beta-barrel domain (1);Glutamyl/glutaminyl-tRNA synthetase, class Ib, anti-codon binding domain (1);	0.000000	0.85682	D	0.000000	D	0.82273	0.5001	H	0.96208	3.785	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.87974	0.2738	10	0.87932	D	0	-21.0189	19.1791	0.93615	0.0:1.0:0.0:0.0	.	700;683;683;676	E7EMN0;F5H7I7;Q3KQZ8;P07814	.;.;.;SYEP_HUMAN	R	676;683;700	ENSP00000355890:G676R	ENSP00000355890:G676R	G	-	1	0	EPRS	218245250	1.000000	0.71417	0.992000	0.48379	0.986000	0.74619	7.148000	0.77389	2.607000	0.88179	0.563000	0.77884	GGA		0.333	EPRS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091133.2	NM_004446		6	70	0	0	0	0.001984	0	6	70				
TAF1A	9015	broad.mit.edu	37	1	222761891	222761891	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr1:222761891A>T	ENST00000352967.4	-	2	203	c.15T>A	c.(13-15)agT>agA	p.S5R	RP11-378J18.3_ENST00000413074.1_RNA|TAF1A_ENST00000366890.1_5'UTR|RP11-378J18.3_ENST00000427540.1_RNA|TAF1A_ENST00000465263.1_5'UTR|TAF1A_ENST00000391882.1_5'UTR|RP11-378J18.3_ENST00000441835.1_RNA|TAF1A_ENST00000350027.4_Missense_Mutation_p.S5R|TAF1A_ENST00000543857.1_Missense_Mutation_p.S5R	NM_005681.3	NP_005672.1	Q15573	TAF1A_HUMAN	TATA box binding protein (TBP)-associated factor, RNA polymerase I, A, 48kDa	5					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)	intracellular membrane-bounded organelle (GO:0043231)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|RNA polymerase I transcription factor complex (GO:0000120)	DNA binding (GO:0003677)	p.S5R(1)		kidney(3)|large_intestine(3)|lung(11)|urinary_tract(1)	18				GBM - Glioblastoma multiforme(131;0.0186)		TTAATTCTTCACTGAAATCAC	0.378																																							uc009xdz.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(13-15)AGT>AGA		TBP-associated factor 1A isoform 2							147.0	141.0	143.0					1																	222761891		2203	4300	6503	SO:0001583	missense	9015				regulation of transcription, DNA-dependent|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter	RNA polymerase I transcription factor complex	DNA binding	g.chr1:222761891A>T	L39060	CCDS1531.1, CCDS1532.1	1q42	2008-02-05	2002-08-29		ENSG00000143498	ENSG00000143498			11532	protein-coding gene	gene with protein product		604903	"""TATA box binding protein (TBP)-associated factor, RNA polymerase I, A, 48kD"""			7801123	Standard	NM_005681		Approved	TAFI48, SL1	uc009xdz.2	Q15573	OTTHUMG00000037544	ENST00000352967.4:c.15T>A	1.37:g.222761891A>T	ENSP00000327072:p.Ser5Arg		Somatic				TAF1A_uc001hni.1_5'UTR|TAF1A_uc001hnj.2_Missense_Mutation_p.S5R|TAF1A_uc001hnk.2_5'UTR|TAF1A_uc010pur.1_Missense_Mutation_p.S5R	p.S5R	NM_139352	NP_647603	WXS	Illumina HiSeq	Unspecified	Q15573	TAF1A_HUMAN		GBM - Glioblastoma multiforme(131;0.0186)	2	204	-			5					B2RDZ8|D3DTB7|Q9NWA1	Missense_Mutation	SNP	ENST00000352967.4	37	c.15T>A	CCDS1531.1	.	.	.	.	.	.	.	.	.	.	A	18.66	3.671480	0.67814	.	.	ENSG00000143498	ENST00000350027;ENST00000352967;ENST00000433270;ENST00000391883;ENST00000543857	T;T;T;T	0.52983	0.7;0.7;0.64;0.66	5.81	3.37	0.38596	.	0.292512	0.44285	D	0.000473	T	0.51210	0.1661	L	0.52573	1.65	0.26292	N	0.978117	P;D	0.61080	0.95;0.989	P;P	0.58454	0.735;0.839	T	0.43988	-0.9357	10	0.56958	D	0.05	-2.5957	4.544	0.12073	0.7356:0.0:0.0997:0.1646	.	5;5	B4DS21;Q15573	.;TAF1A_HUMAN	R	5	ENSP00000339976:S5R;ENSP00000327072:S5R;ENSP00000375755:S5R;ENSP00000437725:S5R	ENSP00000339976:S5R	S	-	3	2	TAF1A	220828514	1.000000	0.71417	1.000000	0.80357	0.727000	0.41649	1.720000	0.38022	0.399000	0.25367	0.482000	0.46254	AGT		0.378	TAF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091493.2	NM_005681		19	218	0	0	0	0.012319	0	19	218				
SDE2	163859	broad.mit.edu	37	1	226183030	226183030	+	Missense_Mutation	SNP	T	T	C	rs530108297		TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr1:226183030T>C	ENST00000272091.7	-	2	193	c.175A>G	c.(175-177)Agt>Ggt	p.S59G		NM_152608.3	NP_689821.3	Q6IQ49	SDE2_HUMAN	SDE2 telomere maintenance homolog (S. pombe)	59								p.S59G(1)									ACTGTGTCACTGGTGTTAATG	0.383																																							uc001hpu.3		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)	1						c.(175-177)AGT>GGT		hypothetical protein LOC163859							154.0	142.0	146.0					1																	226183030		1913	4131	6044	SO:0001583	missense	163859							g.chr1:226183030T>C	BC071563	CCDS41473.1	1q42.12	2012-06-26	2012-06-26	2012-06-26	ENSG00000143751	ENSG00000143751			26643	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 55"""	C1orf55		21333630	Standard	NM_152608		Approved	FLJ35382	uc001hpu.4	Q6IQ49	OTTHUMG00000037504	ENST00000272091.7:c.175A>G	1.37:g.226183030T>C	ENSP00000272091:p.Ser59Gly		Somatic				C1orf55_uc001hpv.2_Missense_Mutation_p.S59G	p.S59G	NM_152608	NP_689821	WXS	Illumina HiSeq	Unspecified	Q6IQ49	CA055_HUMAN			2	228	-	Breast(184;0.197)		59					A8K4P3|Q5TD36|Q6ZS26|Q8NAG7	Missense_Mutation	SNP	ENST00000272091.7	37	c.175A>G	CCDS41473.1	.	.	.	.	.	.	.	.	.	.	T	9.726	1.160901	0.21538	.	.	ENSG00000143751	ENST00000272091	T	0.44083	0.93	6.01	-4.64	0.03349	.	1.285330	0.04405	N	0.364891	T	0.20618	0.0496	N	0.04508	-0.205	0.09310	N	1	B	0.06786	0.001	B	0.10450	0.005	T	0.24225	-1.0166	10	0.18276	T	0.48	0.0414	11.7331	0.51748	0.0:0.6867:0.1386:0.1747	.	59	Q6IQ49	CA055_HUMAN	G	59	ENSP00000272091:S59G	ENSP00000272091:S59G	S	-	1	0	C1orf55	224249653	0.000000	0.05858	0.000000	0.03702	0.794000	0.44872	0.099000	0.15210	-0.727000	0.04888	0.456000	0.33151	AGT		0.383	SDE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091310.1	NM_152608		21	220	0	0	0	0.008871	0	21	220				
SIPA1L2	57568	broad.mit.edu	37	1	232619633	232619633	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr1:232619633G>A	ENST00000366630.1	-	5	2244	c.1886C>T	c.(1885-1887)aCg>aTg	p.T629M	SIPA1L2_ENST00000262861.4_Missense_Mutation_p.T629M			Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like 2	629	Rap-GAP. {ECO:0000255|PROSITE- ProRule:PRU00165}.				regulation of small GTPase mediated signal transduction (GO:0051056)		GTPase activator activity (GO:0005096)	p.T629M(1)		NS(1)|breast(5)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(49)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	103		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)				TGGTCCCGCCGTCTCATTGTT	0.448																																							uc001hvg.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(2)|pancreas(1)|skin(1)	6						c.(1885-1887)ACG>ATG		signal-induced proliferation-associated 1 like							111.0	106.0	108.0					1																	232619633		1915	4155	6070	SO:0001583	missense	57568				regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity	g.chr1:232619633G>A	AB037810	CCDS41474.1	1q42.2	2008-02-05			ENSG00000116991	ENSG00000116991			23800	protein-coding gene	gene with protein product		611609					Standard	NM_020808		Approved	KIAA1389	uc001hvg.3	Q9P2F8	OTTHUMG00000037820	ENST00000366630.1:c.1886C>T	1.37:g.232619633G>A	ENSP00000355589:p.Thr629Met		Somatic					p.T629M	NM_020808	NP_065859	WXS	Illumina HiSeq	Unspecified	Q9P2F8	SI1L2_HUMAN			4	2044	-		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)	629			Rap-GAP.		Q2TV88|Q5VXR7|Q5VXR8|Q641Q4|Q8NA38|Q96DZ3|Q9H9F6	Missense_Mutation	SNP	ENST00000366630.1	37	c.1886C>T	CCDS41474.1	.	.	.	.	.	.	.	.	.	.	G	14.93	2.683403	0.47991	.	.	ENSG00000116991	ENST00000366630;ENST00000262861	D;D	0.93953	-3.32;-3.32	5.65	5.65	0.86999	Rap/ran-GAP (2);	0.098719	0.64402	D	0.000002	D	0.90896	0.7139	L	0.55213	1.73	0.42362	D	0.992411	B	0.19583	0.037	B	0.17098	0.017	D	0.86566	0.1844	10	0.42905	T	0.14	-23.8241	13.5198	0.61561	0.0795:0.0:0.9205:0.0	.	629	Q9P2F8	SI1L2_HUMAN	M	629	ENSP00000355589:T629M;ENSP00000262861:T629M	ENSP00000262861:T629M	T	-	2	0	SIPA1L2	230686256	0.996000	0.38824	0.982000	0.44146	0.987000	0.75469	2.590000	0.46154	2.941000	0.99782	0.655000	0.94253	ACG		0.448	SIPA1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092318.1	XM_045839		10	103	0	0	0	0.013537	0	10	103				
RYR2	6262	broad.mit.edu	37	1	237713886	237713886	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr1:237713886C>T	ENST00000366574.2	+	27	3426	c.3109C>T	c.(3109-3111)Ctt>Ttt	p.L1037F	RYR2_ENST00000542537.1_Missense_Mutation_p.L1021F|RYR2_ENST00000360064.6_Missense_Mutation_p.L1035F	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	1037	4 X approximate repeats.|B30.2/SPRY 2. {ECO:0000255|PROSITE- ProRule:PRU00548}.			L -> P (in Ref. 1; CAA66975 and 2; CAC18855). {ECO:0000305}.	BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.L1035F(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TCCCTACACTCTTCTGGATGA	0.512																																							uc001hyl.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(3109-3111)CTT>TTT		cardiac muscle ryanodine receptor							112.0	105.0	107.0					1																	237713886		1931	4142	6073	SO:0001583	missense	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237713886C>T	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.3109C>T	1.37:g.237713886C>T	ENSP00000355533:p.Leu1037Phe		Somatic					p.L1037F	NM_001035	NP_001026	WXS	Illumina HiSeq	Unspecified	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		27	3229	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	1037	L -> P (in Ref. 1; CAA66975 and 2; CAC18855).		Cytoplasmic (By similarity).|2.|B30.2/SPRY 2.|4 X approximate repeats.		Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	c.3109C>T	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	C	16.16	3.045724	0.55110	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.91792	-2.91;-2.91;-2.91	5.14	4.23	0.50019	B30.2/SPRY domain (1);Ryanodine receptor Ryr (1);	0.000000	0.48286	U	0.000200	D	0.94095	0.8107	L	0.59967	1.855	0.80722	D	1	D	0.71674	0.998	D	0.63488	0.915	D	0.93732	0.7042	10	0.51188	T	0.08	.	13.6664	0.62398	0.0:0.9252:0.0:0.0748	.	1037	Q92736	RYR2_HUMAN	F	1037;1035;1021	ENSP00000355533:L1037F;ENSP00000353174:L1035F;ENSP00000443798:L1021F	ENSP00000353174:L1035F	L	+	1	0	RYR2	235780509	0.998000	0.40836	0.382000	0.26119	0.998000	0.95712	3.885000	0.56182	1.172000	0.42781	0.563000	0.77884	CTT		0.512	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		15	12	0	0	0	0.003163	0	15	12				
OR2T33	391195	broad.mit.edu	37	1	248436566	248436566	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr1:248436566C>A	ENST00000318021.2	-	1	572	c.551G>T	c.(550-552)cGt>cTt	p.R184L		NM_001004695.1	NP_001004695.1	Q8NG76	O2T33_HUMAN	olfactory receptor, family 2, subfamily T, member 33	184						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R184L(1)		NS(2)|breast(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(41)|ovary(1)|prostate(1)|skin(4)	67	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			ACAAGCCAAACGCACCAGCAC	0.542																																							uc010pzi.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|ovary(1)	2						c.(550-552)CGT>CTT		olfactory receptor, family 2, subfamily T,							28.0	32.0	31.0					1																	248436566		2199	4285	6484	SO:0001583	missense	391195				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248436566C>A		CCDS31109.1	1q44	2012-08-09			ENSG00000177212	ENSG00000177212		"""GPCR / Class A : Olfactory receptors"""	31255	protein-coding gene	gene with protein product							Standard	NM_001004695		Approved		uc010pzi.2	Q8NG76	OTTHUMG00000040458	ENST00000318021.2:c.551G>T	1.37:g.248436566C>A	ENSP00000324687:p.Arg184Leu		Somatic					p.R184L	NM_001004695	NP_001004695	WXS	Illumina HiSeq	Unspecified	Q8NG76	O2T33_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0245)		1	551	-	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		184			Extracellular (Potential).		B2RNN0	Missense_Mutation	SNP	ENST00000318021.2	37	c.551G>T	CCDS31109.1	.	.	.	.	.	.	.	.	.	.	-	8.002	0.755563	0.15846	.	.	ENSG00000177212	ENST00000318021	T	0.00137	8.68	1.86	-0.327	0.12694	GPCR, rhodopsin-like superfamily (1);	0.529203	0.14321	U	0.327030	T	0.00144	0.0004	L	0.47716	1.5	0.09310	N	1	P	0.35780	0.52	B	0.40864	0.342	T	0.22138	-1.0225	10	0.59425	D	0.04	.	3.0617	0.06201	0.0:0.2921:0.2326:0.4753	.	184	Q8NG76	O2T33_HUMAN	L	184	ENSP00000324687:R184L	ENSP00000324687:R184L	R	-	2	0	OR2T33	246503189	0.000000	0.05858	0.477000	0.27303	0.472000	0.32918	-1.912000	0.01582	-0.067000	0.12976	-0.450000	0.05554	CGT		0.542	OR2T33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097354.1	NM_001004695		11	168	1	0	2.79863e-10	0.004656	3.50624e-10	11	168				
WDR37	22884	broad.mit.edu	37	10	1151165	1151165	+	Missense_Mutation	SNP	A	A	C			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr10:1151165A>C	ENST00000358220.1	+	11	1205	c.1061A>C	c.(1060-1062)gAc>gCc	p.D354A	WDR37_ENST00000263150.4_Missense_Mutation_p.D354A			Q9Y2I8	WDR37_HUMAN	WD repeat domain 37	354								p.D354A(1)		breast(2)|endometrium(2)|kidney(1)|lung(9)|prostate(2)|skin(1)	17		all_epithelial(10;0.0449)|Colorectal(49;0.142)		Epithelial(11;0.134)		GATTTCAGGGACCCCTCCATC	0.567																																							uc001igf.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1060-1062)GAC>GCC		WD repeat domain 37							79.0	63.0	69.0					10																	1151165		2203	4300	6503	SO:0001583	missense	22884							g.chr10:1151165A>C	AB023199	CCDS7057.1	10p15.3	2013-01-09			ENSG00000047056	ENSG00000047056		"""WD repeat domain containing"""	31406	protein-coding gene	gene with protein product						10231032, 11230166	Standard	NM_014023		Approved	KIAA0982	uc001igf.1	Q9Y2I8	OTTHUMG00000017540	ENST00000358220.1:c.1061A>C	10.37:g.1151165A>C	ENSP00000350954:p.Asp354Ala		Somatic				WDR37_uc009xhm.1_Missense_Mutation_p.D355A|WDR37_uc009xhn.1_RNA|WDR37_uc001igg.1_RNA	p.D354A	NM_014023	NP_054742	WXS	Illumina HiSeq	Unspecified	Q9Y2I8	WDR37_HUMAN		Epithelial(11;0.134)	11	1234	+		all_epithelial(10;0.0449)|Colorectal(49;0.142)	354			WD 4.		A8K976|D3DRQ7|Q5SW03|Q8WVG2|Q9NTJ6	Missense_Mutation	SNP	ENST00000358220.1	37	c.1061A>C	CCDS7057.1	.	.	.	.	.	.	.	.	.	.	A	29.1	4.979090	0.92982	.	.	ENSG00000047056	ENST00000358220;ENST00000263150	T;T	0.01369	4.97;4.97	5.6	5.6	0.85130	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.02494	0.0076	L	0.43152	1.355	0.80722	D	1	D;P	0.56521	0.976;0.817	P;B	0.47206	0.541;0.23	T	0.70710	-0.4797	10	0.14252	T	0.57	.	15.7724	0.78180	1.0:0.0:0.0:0.0	.	355;354	A8K976;Q9Y2I8	.;WDR37_HUMAN	A	354	ENSP00000350954:D354A;ENSP00000263150:D354A	ENSP00000263150:D354A	D	+	2	0	WDR37	1141165	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.979000	0.93455	2.133000	0.65898	0.459000	0.35465	GAC		0.567	WDR37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046418.1	NM_014023		4	24	0	0	0	0.008291	0	4	24				
FBXO18	84893	broad.mit.edu	37	10	5955787	5955787	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr10:5955787C>T	ENST00000362091.4	+	7	1404	c.1289C>T	c.(1288-1290)cCa>cTa	p.P430L	FBXO18_ENST00000397269.3_5'UTR|FBXO18_ENST00000379999.5_Missense_Mutation_p.P481L	NM_001258453.1|NM_178150.2	NP_001245382.1|NP_835363.1	Q8NFZ0	FBX18_HUMAN	F-box protein, helicase, 18	430					DNA catabolic process, endonucleolytic (GO:0000737)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902231)|positive regulation of protein phosphorylation (GO:0001934)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)	p.P481L(1)		NS(2)|breast(2)|kidney(2)|large_intestine(16)|lung(9)|ovary(2)|prostate(3)|skin(3)|stomach(1)	40						AAAGAGGAGCCATCTGTCTGG	0.413																																							uc001iis.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(1288-1290)CCA>CTA		F-box only protein, helicase, 18 isoform 2							172.0	145.0	154.0					10																	5955787		2203	4300	6503	SO:0001583	missense	84893				DNA repair	nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding	g.chr10:5955787C>T	AK095343	CCDS7072.1, CCDS7073.1, CCDS73064.1	10p15.1	2004-08-24	2004-06-15		ENSG00000134452	ENSG00000134452		"""F-boxes /  ""other"""""	13620	protein-coding gene	gene with protein product		607222	"""F-box only protein 18"""			10531037, 11956208	Standard	NM_032807		Approved	FBH1, FLJ14590, Fbx18	uc001iit.4	Q8NFZ0	OTTHUMG00000017609	ENST00000362091.4:c.1289C>T	10.37:g.5955787C>T	ENSP00000355415:p.Pro430Leu		Somatic				FBXO18_uc001iir.2_Missense_Mutation_p.P356L|FBXO18_uc009xig.2_Missense_Mutation_p.P356L|FBXO18_uc001iit.2_Missense_Mutation_p.P481L	p.P430L	NM_178150	NP_835363	WXS	Illumina HiSeq	Unspecified	Q8NFZ0	FBX18_HUMAN			7	1384	+			430					Q5JVB0|Q5JVB1|Q7Z4Q6|Q7Z4R0|Q8N1P5|Q8N586|Q96E82|Q96K67|Q96SW7|Q9UFB2	Missense_Mutation	SNP	ENST00000362091.4	37	c.1289C>T	CCDS7072.1	.	.	.	.	.	.	.	.	.	.	C	9.050	0.991774	0.18966	.	.	ENSG00000134452	ENST00000362091;ENST00000544954;ENST00000379999;ENST00000379994	.	.	.	5.63	4.73	0.59995	.	0.907131	0.09576	N	0.783519	T	0.46870	0.1415	L	0.36672	1.1	0.54753	D	0.999985	B;B;B	0.23442	0.085;0.029;0.002	B;B;B	0.21917	0.037;0.016;0.002	T	0.14282	-1.0478	9	0.11794	T	0.64	-0.8166	11.3365	0.49507	0.0:0.9153:0.0:0.0847	.	481;430;356	Q8NFZ0-2;Q8NFZ0;Q2TAK1	.;FBX18_HUMAN;.	L	430;167;481;167	.	ENSP00000355415:P430L	P	+	2	0	FBXO18	5995793	0.002000	0.14202	0.126000	0.21872	0.141000	0.21300	1.297000	0.33400	1.382000	0.46385	0.491000	0.48974	CCA		0.413	FBXO18-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046596.1	NM_032807		33	54	0	0	0	0.012213	0	33	54				
ITIH2	3698	broad.mit.edu	37	10	7759743	7759743	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr10:7759743C>T	ENST00000358415.4	+	6	788	c.622C>T	c.(622-624)Cac>Tac	p.H208Y	ITIH2_ENST00000379587.4_Missense_Mutation_p.H197Y|ITIH2_ENST00000480387.1_3'UTR	NM_002216.2	NP_002207.2	P19823	ITIH2_HUMAN	inter-alpha-trypsin inhibitor heavy chain 2	208					hyaluronan metabolic process (GO:0030212)|negative regulation of endopeptidase activity (GO:0010951)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.H208Y(1)		NS(2)|breast(1)|endometrium(8)|kidney(1)|large_intestine(17)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	64						GCTGGCCAAACACTTAGAGGT	0.502																																							uc001ijs.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)|skin(1)	3						c.(622-624)CAC>TAC		inter-alpha globulin inhibitor H2 polypeptide							126.0	120.0	122.0					10																	7759743		2203	4300	6503	SO:0001583	missense	3698				hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity	g.chr10:7759743C>T	X07173	CCDS31141.1	10p14	2011-10-26	2011-10-26		ENSG00000151655	ENSG00000151655			6167	protein-coding gene	gene with protein product		146640	"""inter-alpha (globulin) inhibitor, H2 polypeptide"""			1385302, 10100603	Standard	NM_002216		Approved	H2P	uc001ijs.3	P19823	OTTHUMG00000017633	ENST00000358415.4:c.622C>T	10.37:g.7759743C>T	ENSP00000351190:p.His208Tyr		Somatic					p.H208Y	NM_002216	NP_002207	WXS	Illumina HiSeq	Unspecified	P19823	ITIH2_HUMAN			6	784	+			208					Q14659|Q15484|Q5T986	Missense_Mutation	SNP	ENST00000358415.4	37	c.622C>T	CCDS31141.1	.	.	.	.	.	.	.	.	.	.	C	15.49	2.850120	0.51270	.	.	ENSG00000151655	ENST00000358415;ENST00000429820;ENST00000379587	T;T;T	0.18657	4.79;2.2;4.78	5.47	5.47	0.80525	.	0.200041	0.49916	D	0.000123	T	0.51890	0.1701	M	0.85630	2.765	0.52501	D	0.999951	D	0.76494	0.999	D	0.64410	0.925	T	0.58999	-0.7536	10	0.87932	D	0	-25.3851	19.3388	0.94332	0.0:1.0:0.0:0.0	.	208	P19823	ITIH2_HUMAN	Y	208;183;197	ENSP00000351190:H208Y;ENSP00000388826:H183Y;ENSP00000368906:H197Y	ENSP00000351190:H208Y	H	+	1	0	ITIH2	7799749	0.998000	0.40836	0.972000	0.41901	0.174000	0.22865	3.094000	0.50227	2.553000	0.86117	0.655000	0.94253	CAC		0.502	ITIH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046678.2	NM_002216		69	191	0	0	0	0.01441	0	69	191				
ARMC3	219681	broad.mit.edu	37	10	23270392	23270392	+	Nonsense_Mutation	SNP	C	C	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr10:23270392C>A	ENST00000298032.5	+	9	1124	c.1040C>A	c.(1039-1041)tCa>tAa	p.S347*	ARMC3_ENST00000409049.3_Nonsense_Mutation_p.S347*|ARMC3_ENST00000409983.3_Nonsense_Mutation_p.S347*|ARMC3_ENST00000376528.4_Nonsense_Mutation_p.S84*	NM_173081.3	NP_775104.2	Q5W041	ARMC3_HUMAN	armadillo repeat containing 3	347						extracellular vesicular exosome (GO:0070062)		p.S347*(1)		breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(24)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						TGTGAGAATTCAGGCAGCAAA	0.373																																							uc001irm.3		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(1039-1041)TCA>TAA		armadillo repeat containing 3							77.0	77.0	77.0					10																	23270392		2203	4300	6503	SO:0001587	stop_gained	219681						binding	g.chr10:23270392C>A	AK057389	CCDS7142.1, CCDS60499.1, CCDS60500.1, CCDS73073.1	10p12.31	2013-02-14			ENSG00000165309	ENSG00000165309		"""Armadillo repeat containing"""	30964	protein-coding gene	gene with protein product	"""cancer/testis antigen 81"""	611226					Standard	XM_005252380		Approved	FLJ32827, CT81	uc001irm.4	Q5W041	OTTHUMG00000017811	ENST00000298032.5:c.1040C>A	10.37:g.23270392C>A	ENSP00000298032:p.Ser347*		Somatic				ARMC3_uc010qcv.1_Nonsense_Mutation_p.S347*|ARMC3_uc010qcw.1_Nonsense_Mutation_p.S84*	p.S347*	NM_173081	NP_775104	WXS	Illumina HiSeq	Unspecified	Q5W041	ARMC3_HUMAN			9	1123	+			347			ARM 9.		A0PG76|A6NH64|B4DZL3|B7ZBN6|B7ZBN7|Q8IXS5|Q8N7B0|Q96M49	Nonsense_Mutation	SNP	ENST00000298032.5	37	c.1040C>A	CCDS7142.1	.	.	.	.	.	.	.	.	.	.	C	18.53	3.644274	0.67244	.	.	ENSG00000165309	ENST00000298032;ENST00000409983;ENST00000376523;ENST00000409049;ENST00000376528	.	.	.	5.05	1.55	0.23275	.	0.818678	0.11324	N	0.575738	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07990	T	0.79	-7.3014	7.479	0.27393	0.0:0.4874:0.0:0.5126	.	.	.	.	X	347;347;283;347;84	.	ENSP00000298032:S347X	S	+	2	0	ARMC3	23310398	0.000000	0.05858	0.194000	0.23346	0.987000	0.75469	0.278000	0.18753	0.597000	0.29811	0.561000	0.74099	TCA		0.373	ARMC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047197.2	NM_173081		19	42	1	0	7.45023e-12	0.010504	9.69189e-12	19	42				
PSAP	5660	broad.mit.edu	37	10	73579275	73579275	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr10:73579275G>T	ENST00000394936.3	-	11	1444	c.1297C>A	c.(1297-1299)Ctg>Atg	p.L433M	PSAP_ENST00000394934.1_Missense_Mutation_p.L435M			P07602	SAP_HUMAN	prosaposin	433	Saposin B-type 4. {ECO:0000255|PROSITE- ProRule:PRU00415}.				blood coagulation (GO:0007596)|cellular response to organic substance (GO:0071310)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|glycosphingolipid metabolic process (GO:0006687)|lipid transport (GO:0006869)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of catalytic activity (GO:0043085)|prostate gland growth (GO:0060736)|regulation of lipid metabolic process (GO:0019216)|regulation of MAPK cascade (GO:0043408)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)	enzyme activator activity (GO:0008047)|lipid binding (GO:0008289)	p.L433M(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	13						AGAGCAGCCAGGATCTCCTGC	0.577																																							uc001jsm.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1297-1299)CTG>ATG		prosaposin isoform a preproprotein							105.0	98.0	100.0					10																	73579275		2203	4300	6503	SO:0001583	missense	5660				glycosphingolipid metabolic process|lipid transport|platelet activation|platelet degranulation	extracellular space|Golgi apparatus|integral to membrane|lysosomal lumen	enzyme activator activity|lipid binding	g.chr10:73579275G>T	BC004275	CCDS7311.1	10q21-q22	2014-01-30	2008-07-31		ENSG00000197746	ENSG00000197746		"""Endogenous ligands"""	9498	protein-coding gene	gene with protein product	"""variant Gaucher disease and variant metachromatic leukodystrophy"""	176801	"""sphingolipid activator protein-1"""	SAP1, GLBA		2717620	Standard	NM_001042465		Approved		uc001jsm.3	P07602	OTTHUMG00000018429	ENST00000394936.3:c.1297C>A	10.37:g.73579275G>T	ENSP00000378394:p.Leu433Met		Somatic				PSAP_uc001jsl.2_Missense_Mutation_p.L157M	p.L433M	NM_002778	NP_002769	WXS	Illumina HiSeq	Unspecified	P07602	SAP_HUMAN			11	1401	-			433			Saposin B-type 4.		P07292|P15793|P78538|P78541|P78546|P78547|P78558|Q53Y86|Q6IBQ6|Q92739|Q92740|Q92741|Q92742	Missense_Mutation	SNP	ENST00000394936.3	37	c.1297C>A	CCDS7311.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.019909	0.75275	.	.	ENSG00000197746	ENST00000394936;ENST00000373120;ENST00000357471;ENST00000394934;ENST00000394929;ENST00000404083;ENST00000394940	D;D	0.85484	-1.99;-1.99	5.77	5.77	0.91146	Saposin-like (2);Saposin-like type B, 1 (1);Saposin B (2);	0.257047	0.39083	N	0.001478	D	0.88872	0.6555	L	0.56280	1.765	0.31218	N	0.697761	D	0.89917	1.0	D	0.79108	0.992	D	0.86422	0.1755	10	0.33141	T	0.24	-15.2002	10.3522	0.43943	0.0:0.1821:0.6903:0.1276	.	433	P07602	SAP_HUMAN	M	433;433;436;435;149;439;359	ENSP00000378394:L433M;ENSP00000378392:L435M	ENSP00000350063:L436M	L	-	1	2	PSAP	73249281	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.410000	0.66381	2.728000	0.93425	0.655000	0.94253	CTG		0.577	PSAP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000048553.1	NM_002778		30	84	1	0	2.48696e-23	0.003271	3.75599e-23	30	84				
USP54	159195	broad.mit.edu	37	10	75258547	75258547	+	Missense_Mutation	SNP	C	C	T	rs577546144		TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr10:75258547C>T	ENST00000339859.4	-	23	4995	c.4895G>A	c.(4894-4896)cGa>cAa	p.R1632Q	PPP3CB_ENST00000394829.2_5'Flank|PPP3CB_ENST00000545874.1_5'Flank|USP54_ENST00000422491.2_Missense_Mutation_p.R767Q|RP11-137L10.6_ENST00000600607.1_RNA|RP11-137L10.6_ENST00000593790.1_RNA|PPP3CB_ENST00000394828.2_5'Flank|USP54_ENST00000408019.1_Missense_Mutation_p.R1632Q|PPP3CB_ENST00000342558.3_5'Flank|RP11-137L10.6_ENST00000600887.1_RNA|USP54_ENST00000394811.2_Missense_Mutation_p.R673Q|RP11-137L10.6_ENST00000595069.1_RNA|RP11-137L10.6_ENST00000597958.1_RNA|PPP3CB_ENST00000394822.2_5'Flank|USP54_ENST00000428547.1_Missense_Mutation_p.R1482Q|RP11-137L10.6_ENST00000596320.1_RNA|RP11-137L10.6_ENST00000595935.1_RNA|RP11-137L10.6_ENST00000600206.1_RNA|RP11-137L10.6_ENST00000442133.4_RNA|PPP3CB_ENST00000360663.5_5'Flank|RP11-137L10.6_ENST00000422977.1_RNA|USP54_ENST00000497106.1_5'UTR			Q70EL1	UBP54_HUMAN	ubiquitin specific peptidase 54	1632					ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitinyl hydrolase activity (GO:0036459)	p.R1632Q(1)|p.R715Q(1)		breast(5)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)	30	Prostate(51;0.0112)					ATCTACTCTTCGAGGACCAGG	0.517													C|||	1	0.000199681	0.0008	0.0	5008	,	,		15714	0.0		0.0	False		,,,				2504	0.0				Colon(195;880 2046 8854 25025 38456)	Colon(195;880 2046 8854 25025 38456)	uc001juo.2		NA																	2	Substitution - Missense(2)		lung(2)	breast(3)|lung(2)|kidney(1)	6						c.(4894-4896)CGA>CAA		ubiquitin specific peptidase 54							91.0	88.0	89.0					10																	75258547		2203	4300	6503	SO:0001583	missense	159195				ubiquitin-dependent protein catabolic process		protein binding|ubiquitin thiolesterase activity	g.chr10:75258547C>T	AJ583820	CCDS7329.2	10q22.3	2006-09-26	2005-08-08	2004-01-30	ENSG00000166348	ENSG00000166348		"""Ubiquitin-specific peptidases"""	23513	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 29"", ""ubiquitin specific protease 54"""	C10orf29		14715245	Standard	NM_152586		Approved	FLJ37318, bA137L10.3, bA137L10.4	uc001juo.3	Q70EL1	OTTHUMG00000018469	ENST00000339859.4:c.4895G>A	10.37:g.75258547C>T	ENSP00000345216:p.Arg1632Gln		Somatic				PPP3CB_uc001juf.2_5'Flank|PPP3CB_uc001jue.2_5'Flank|PPP3CB_uc001jug.2_5'Flank|PPP3CB_uc001jui.2_5'Flank|PPP3CB_uc001juh.2_5'Flank|USP54_uc010qkk.1_Missense_Mutation_p.R767Q|USP54_uc001juk.2_Missense_Mutation_p.R720Q|USP54_uc001jul.2_Missense_Mutation_p.R673Q|USP54_uc001jum.2_RNA|USP54_uc001jun.2_RNA	p.R1632Q	NM_152586	NP_689799	WXS	Illumina HiSeq	Unspecified	Q70EL1	UBP54_HUMAN			22	4912	-	Prostate(51;0.0112)		1632					A1L4Q4|A3KFK3|A3KFK5|A3KFK6|A3KFK7|A6PVS4|A6PVS5|A6PVS6|A6PVS7|B3KVY1|B9ZVM1|Q5F2F4|Q6P1N6|Q6ZSP1|Q6ZSR1|Q6ZTM0|Q8N1X2	Missense_Mutation	SNP	ENST00000339859.4	37	c.4895G>A	CCDS7329.2	.	.	.	.	.	.	.	.	.	.	C	24.7	4.565243	0.86439	.	.	ENSG00000166348	ENST00000339859;ENST00000408019;ENST00000428547;ENST00000394811;ENST00000422491	T;T;T;T;T	0.29917	1.71;1.71;1.7;1.55;1.56	5.36	5.36	0.76844	.	.	.	.	.	T	0.50990	0.1648	M	0.62723	1.935	0.80722	D	1	D;D	0.89917	1.0;0.999	D;P	0.74348	0.983;0.859	T	0.52185	-0.8609	9	0.87932	D	0	-2.9714	12.4463	0.55653	0.0:0.9231:0.0:0.0769	.	767;1632	E7EW90;Q70EL1	.;UBP54_HUMAN	Q	1632;1632;1482;673;767	ENSP00000345216:R1632Q;ENSP00000386080:R1632Q;ENSP00000408714:R1482Q;ENSP00000378290:R673Q;ENSP00000407368:R767Q	ENSP00000345216:R1632Q	R	-	2	0	USP54	74928553	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	1.474000	0.35398	2.509000	0.84616	0.542000	0.68232	CGA		0.517	USP54-014	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316563.2	NM_152586		15	117	0	0	0	0.003163	0	15	117				
PLCE1	51196	broad.mit.edu	37	10	95791385	95791385	+	Silent	SNP	C	C	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr10:95791385C>T	ENST00000371380.3	+	1	817	c.582C>T	c.(580-582)gaC>gaT	p.D194D	PLCE1_ENST00000260766.3_Silent_p.D194D			Q9P212	PLCE1_HUMAN	phospholipase C, epsilon 1	194					activation of MAPK activity (GO:0000187)|calcium-mediated signaling (GO:0019722)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|diacylglycerol biosynthetic process (GO:0006651)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerulus development (GO:0032835)|heart development (GO:0007507)|inositol phosphate metabolic process (GO:0043647)|inositol phosphate-mediated signaling (GO:0048016)|lipid catabolic process (GO:0016042)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipid metabolic process (GO:0006644)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of GTPase activity (GO:0043547)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|Ras protein signal transduction (GO:0007265)|regulation of cell growth (GO:0001558)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of protein kinase activity (GO:0045859)|regulation of Ras protein signal transduction (GO:0046578)|regulation of smooth muscle contraction (GO:0006940)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)|guanyl-nucleotide exchange factor activity (GO:0005085)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|Ras GTPase binding (GO:0017016)|receptor signaling protein activity (GO:0005057)	p.D194D(1)		liver(1)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	8		Colorectal(252;0.0458)				ATGAAGTTGACAGAAGAATGT	0.418																																							uc001kjk.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|skin(1)	3						c.(580-582)GAC>GAT		phospholipase C, epsilon 1 isoform 1							91.0	88.0	89.0					10																	95791385		1925	4134	6059	SO:0001819	synonymous_variant	51196				activation of MAPK activity|activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|calcium-mediated signaling|cell proliferation|cytoskeleton organization|diacylglycerol biosynthetic process|elevation of cytosolic calcium ion concentration|epidermal growth factor receptor signaling pathway|glomerulus development|heart development|lipid catabolic process|Ras protein signal transduction|regulation of cell growth|regulation of G-protein coupled receptor protein signaling pathway|regulation of Ras protein signal transduction|regulation of smooth muscle contraction	cytosol|Golgi membrane|membrane fraction|plasma membrane	calcium ion binding|guanyl-nucleotide exchange factor activity|phosphatidylinositol phospholipase C activity|Ras GTPase binding|receptor signaling protein activity	g.chr10:95791385C>T		CCDS41552.1, CCDS53555.1	10q23	2010-02-22			ENSG00000138193	ENSG00000138193	3.1.4.11		17175	protein-coding gene	gene with protein product	"""nephrosis type 3"""	608414				11022047, 11022048	Standard	NM_016341		Approved	KIAA1516, PLCE, NPHS3	uc001kjk.3	Q9P212	OTTHUMG00000018789	ENST00000371380.3:c.582C>T	10.37:g.95791385C>T			Somatic				PLCE1_uc010qnx.1_Silent_p.D194D	p.D194D	NM_016341	NP_057425	WXS	Illumina HiSeq	Unspecified	Q9P212	PLCE1_HUMAN			2	1216	+		Colorectal(252;0.0458)	194					A6NGW0|A6NLA1|A7MBN7|A8K1D7|B9EIJ6|Q1X6H8|Q5VWL4|Q5VWL5|Q9H9X8|Q9HBX6|Q9HC53|Q9UHV3	Silent	SNP	ENST00000371380.3	37	c.582C>T	CCDS41552.1																																																																																				0.418	PLCE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049469.3	NM_016341		17	68	0	0	0	0.006122	0	17	68				
TLL2	7093	broad.mit.edu	37	10	98273371	98273371	+	Silent	SNP	C	C	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr10:98273371C>A	ENST00000357947.3	-	1	297	c.72G>T	c.(70-72)ggG>ggT	p.G24G	TLL2_ENST00000469598.1_5'UTR	NM_012465.3	NP_036597.1	Q9Y6L7	TLL2_HUMAN	tolloid-like 2	24					cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.G24G(1)		NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(15)|lung(22)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	58		Colorectal(252;0.0846)		Epithelial(162;1.51e-07)|all cancers(201;7.59e-06)		CCCCGAGTCCCCCGGCGCCGC	0.726																																							uc001kml.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|pancreas(1)|skin(1)	3						c.(70-72)GGG>GGT		tolloid-like 2 precursor							17.0	17.0	17.0					10																	98273371		2195	4293	6488	SO:0001819	synonymous_variant	7093				cell differentiation|multicellular organismal development|proteolysis	extracellular region	calcium ion binding|metalloendopeptidase activity|zinc ion binding	g.chr10:98273371C>A	AF059516	CCDS7449.1	10q23-q24	2008-07-29			ENSG00000095587	ENSG00000095587			11844	protein-coding gene	gene with protein product		606743				10516436	Standard	NM_012465		Approved		uc001kml.2	Q9Y6L7	OTTHUMG00000018833	ENST00000357947.3:c.72G>T	10.37:g.98273371C>A			Somatic				TLL2_uc009xvf.1_Silent_p.G24G	p.G24G	NM_012465	NP_036597	WXS	Illumina HiSeq	Unspecified	Q9Y6L7	TLL2_HUMAN		Epithelial(162;1.51e-07)|all cancers(201;7.59e-06)	1	298	-		Colorectal(252;0.0846)	24					A6NDK0|Q2M1H1|Q6PJN5|Q9UQ00	Silent	SNP	ENST00000357947.3	37	c.72G>T	CCDS7449.1																																																																																				0.726	TLL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049608.1			16	22	1	0	3.45872e-05	0.004007	3.77548e-05	16	22				
PIK3AP1	118788	broad.mit.edu	37	10	98469537	98469537	+	Missense_Mutation	SNP	C	C	T	rs146527410	byFrequency	TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr10:98469537C>T	ENST00000339364.5	-	2	336	c.217G>A	c.(217-219)Gcg>Acg	p.A73T		NM_152309.2	NP_689522.2	Q6ZUJ8	BCAP_HUMAN	phosphoinositide-3-kinase adaptor protein 1	73	Necessary and sufficent to mediate inhibition of NF-kappa-B downstream of activated TLRs; may mediate interaction with MYD88 and TIRAP. {ECO:0000250}.				negative regulation of toll-like receptor signaling pathway (GO:0034122)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|regulation of inflammatory response (GO:0050727)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 7 signaling pathway (GO:0034154)|toll-like receptor 9 signaling pathway (GO:0034162)	cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	phosphatidylinositol 3-kinase regulatory subunit binding (GO:0036312)	p.A73T(1)		NS(1)|autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(27)|ovary(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)	52		Colorectal(252;0.0442)		Epithelial(162;6.29e-08)|all cancers(201;3.18e-06)		ACCAGCTCCGCGGACAGCAGC	0.652																																							uc001kmq.2		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(3)|ovary(1)|skin(1)	5						c.(217-219)GCG>ACG		phosphoinositide-3-kinase adaptor protein 1							51.0	52.0	51.0					10																	98469537		2203	4300	6503	SO:0001583	missense	118788					cytoplasm|plasma membrane		g.chr10:98469537C>T	AK092883	CCDS31259.1	10q24.2	2008-10-23			ENSG00000155629	ENSG00000155629			30034	protein-coding gene	gene with protein product		607942				1251844, 11163197	Standard	NM_152309		Approved	BCAP, FLJ35564	uc001kmq.3	Q6ZUJ8	OTTHUMG00000018838	ENST00000339364.5:c.217G>A	10.37:g.98469537C>T	ENSP00000339826:p.Ala73Thr		Somatic					p.A73T	NM_152309	NP_689522	WXS	Illumina HiSeq	Unspecified	Q6ZUJ8	BCAP_HUMAN		Epithelial(162;6.29e-08)|all cancers(201;3.18e-06)	2	345	-		Colorectal(252;0.0442)	73					Q5TB56|Q5VXJ9|Q8N6J6|Q8NAC8	Missense_Mutation	SNP	ENST00000339364.5	37	c.217G>A	CCDS31259.1	.	.	.	.	.	.	.	.	.	.	C	5.794	0.330846	0.10956	.	.	ENSG00000155629	ENST00000339364	T	0.09723	2.95	5.01	3.06	0.35304	.	0.639258	0.14515	N	0.314814	T	0.08088	0.0202	L	0.40543	1.245	0.09310	N	0.999995	P	0.37914	0.611	B	0.31495	0.131	T	0.25187	-1.0139	10	0.30854	T	0.27	-7.5956	8.8328	0.35093	0.0:0.7619:0.1527:0.0854	.	73	Q6ZUJ8	BCAP_HUMAN	T	73	ENSP00000339826:A73T	ENSP00000339826:A73T	A	-	1	0	PIK3AP1	98459527	0.003000	0.15002	0.013000	0.15412	0.184000	0.23303	1.697000	0.37784	1.184000	0.42957	0.655000	0.94253	GCG		0.652	PIK3AP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049619.2	NM_152309		53	89	0	0	0	0.01441	0	53	89				
ABCC2	1244	broad.mit.edu	37	10	101606844	101606844	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr10:101606844G>T	ENST00000370449.4	+	30	4386	c.4273G>T	c.(4273-4275)Ggg>Tgg	p.G1425W		NM_000392.3	NP_000383	Q92887	MRP2_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 2	1425	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cellular chloride ion homeostasis (GO:0030644)|drug transmembrane transport (GO:0006855)|prostaglandin transport (GO:0015732)|response to arsenic-containing substance (GO:0046685)|response to estrogen (GO:0043627)|response to heat (GO:0009408)|response to methotrexate (GO:0031427)|response to oxidative stress (GO:0006979)|thyroid hormone transport (GO:0070327)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)	p.G1425W(1)		NS(1)|breast(5)|endometrium(9)|kidney(2)|large_intestine(20)|liver(1)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	67		Colorectal(252;0.234)		Epithelial(162;2.77e-10)|all cancers(201;2.47e-08)	Adenosine triphosphate(DB00171)|Aminohippurate(DB00345)|Arsenic trioxide(DB01169)|Atorvastatin(DB01076)|Canagliflozin(DB08907)|Carbamazepine(DB00564)|Carboplatin(DB00958)|Cisplatin(DB00515)|Clotrimazole(DB00257)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Eprosartan(DB00876)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Ezetimibe(DB00973)|Furosemide(DB00695)|Fusidic Acid(DB02703)|Gadoxetate(DB08884)|Glutathione(DB00143)|Glyburide(DB01016)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Leucovorin(DB00650)|Levetiracetam(DB01202)|Lomefloxacin(DB00978)|Lovastatin(DB00227)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Nifedipine(DB01115)|Norgestimate(DB00957)|Ofloxacin(DB01165)|Olmesartan(DB00275)|Oxaliplatin(DB00526)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pitavastatin(DB08860)|Pranlukast(DB01411)|Pravastatin(DB00175)|Probenecid(DB01032)|Quinidine(DB00908)|Reserpine(DB00206)|Rifampicin(DB01045)|Ritonavir(DB00503)|Saquinavir(DB01232)|Simvastatin(DB00641)|Sorafenib(DB00398)|Sparfloxacin(DB01208)|Spironolactone(DB00421)|Sulfasalazine(DB00795)|Sulfinpyrazone(DB01138)|Sunitinib(DB01268)|Tamoxifen(DB00675)|Telmisartan(DB00966)|Tenofovir(DB00300)|Tetrahydrofolic acid(DB00116)|Ursodeoxycholic acid(DB01586)|Vasopressin(DB00067)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)	CCTGCAACTTGGGTTATCCCA	0.537																																							uc001kqf.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(4273-4275)GGG>TGG		ATP-binding cassette, sub-family C (CFTR/MRP),	Adenosine triphosphate(DB00171)|Norgestimate(DB00957)|Pravastatin(DB00175)|Saquinavir(DB01232)|Sulfinpyrazone(DB01138)						104.0	97.0	99.0					10																	101606844		2203	4300	6503	SO:0001583	missense	1244					apical plasma membrane|integral to plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances|organic anion transmembrane transporter activity	g.chr10:101606844G>T	U63970	CCDS7484.1	10q24	2012-03-14			ENSG00000023839	ENSG00000023839		"""ATP binding cassette transporters / subfamily C"""	53	protein-coding gene	gene with protein product		601107	"""canalicular multispecific organic anion transporter 1"""	CMOAT		8797578, 9284939	Standard	XM_006717630		Approved	DJS, MRP2, cMRP	uc001kqf.2	Q92887	OTTHUMG00000018895	ENST00000370449.4:c.4273G>T	10.37:g.101606844G>T	ENSP00000359478:p.Gly1425Trp		Somatic					p.G1425W	NM_000392	NP_000383	WXS	Illumina HiSeq	Unspecified	Q92887	MRP2_HUMAN		Epithelial(162;2.77e-10)|all cancers(201;2.47e-08)	30	4412	+		Colorectal(252;0.234)	1425			Cytoplasmic (By similarity).|ABC transporter 2.		B2RMT8|Q14022|Q5T2B1|Q92500|Q92798|Q99663|Q9UMS2	Missense_Mutation	SNP	ENST00000370449.4	37	c.4273G>T	CCDS7484.1	.	.	.	.	.	.	.	.	.	.	G	12.82	2.053935	0.36277	.	.	ENSG00000023839	ENST00000370449	D	0.92858	-3.12	4.79	4.79	0.61399	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.158842	0.56097	D	0.000023	D	0.96722	0.8930	H	0.95611	3.695	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96700	0.9517	10	0.87932	D	0	-14.5225	8.8435	0.35157	0.1654:0.0:0.8346:0.0	.	1425	Q92887	MRP2_HUMAN	W	1425	ENSP00000359478:G1425W	ENSP00000359478:G1425W	G	+	1	0	ABCC2	101596834	0.965000	0.33210	0.229000	0.23960	0.033000	0.12548	1.782000	0.38654	2.490000	0.84030	0.650000	0.86243	GGG		0.537	ABCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049825.1	NM_000392		71	143	1	0	1.68136e-41	0.01441	2.80864e-41	71	143				
NEURL1	9148	broad.mit.edu	37	10	105330758	105330758	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr10:105330758C>T	ENST00000369780.4	+	2	624	c.215C>T	c.(214-216)tCc>tTc	p.S72F	NEURL_ENST00000369777.2_Missense_Mutation_p.S55F	NM_004210.4	NP_004201.3	O76050	NEUL1_HUMAN		72	NHR 1. {ECO:0000255|PROSITE- ProRule:PRU00400}.				brain development (GO:0007420)|cellular response to amino acid stimulus (GO:0071230)|lactation (GO:0007595)|negative regulation of cell proliferation (GO:0008285)|negative regulation of Notch signaling pathway (GO:0045746)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of apoptotic process (GO:0043065)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of synapse maturation (GO:0090129)|protein monoubiquitination (GO:0006513)|skeletal muscle tissue development (GO:0007519)|sperm axoneme assembly (GO:0007288)|sperm motility (GO:0030317)	apical dendrite (GO:0097440)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ligase activity (GO:0016874)|translation factor activity, non-nucleic acid binding (GO:0045183)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.S72F(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(4)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	17				Epithelial(162;2.12e-09)|all cancers(201;6.99e-08)|BRCA - Breast invasive adenocarcinoma(275;0.125)		ACCAAGGGCTCCCAGATCCTC	0.637																																							uc001kxh.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(214-216)TCC>TTC		neuralized-like							77.0	76.0	76.0					10																	105330758		2203	4300	6503	SO:0001583	missense	9148				nervous system development	perinuclear region of cytoplasm	zinc ion binding	g.chr10:105330758C>T																												ENST00000369780.4:c.215C>T	10.37:g.105330758C>T	ENSP00000358795:p.Ser72Phe		Somatic					p.S72F	NM_004210	NP_004201	WXS	Illumina HiSeq	Unspecified	O76050	NEU1A_HUMAN		Epithelial(162;2.12e-09)|all cancers(201;6.99e-08)|BRCA - Breast invasive adenocarcinoma(275;0.125)	2	625	+			72			NHR 1.		Q5TDR2|Q5TDR3|Q8TAN0|Q9H463	Missense_Mutation	SNP	ENST00000369780.4	37	c.215C>T	CCDS7551.1	.	.	.	.	.	.	.	.	.	.	C	27.0	4.795700	0.90453	.	.	ENSG00000107954	ENST00000369780;ENST00000437579;ENST00000369777	.	.	.	5.23	5.23	0.72850	NEUZ (3);	0.056185	0.64402	D	0.000001	T	0.79890	0.4524	M	0.74647	2.275	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.82374	-0.0489	9	0.87932	D	0	-7.069	18.7898	0.91969	0.0:1.0:0.0:0.0	.	72	O76050	NEU1A_HUMAN	F	72;55;55	.	ENSP00000358792:S55F	S	+	2	0	NEURL	105320748	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.307000	0.78920	2.417000	0.82017	0.561000	0.74099	TCC		0.637	NEURL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050170.1			65	161	0	0	0	0.01441	0	65	161				
KNDC1	85442	broad.mit.edu	37	10	134997434	134997434	+	Missense_Mutation	SNP	G	G	A	rs144320928		TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr10:134997434G>A	ENST00000304613.3	+	5	587	c.566G>A	c.(565-567)cGg>cAg	p.R189Q	KNDC1_ENST00000368571.2_Missense_Mutation_p.R124Q|KNDC1_ENST00000368572.2_Missense_Mutation_p.R189Q			Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND) containing 1	189	KIND 1. {ECO:0000255|PROSITE- ProRule:PRU00709}.				cerebellar granule cell differentiation (GO:0021707)|positive regulation of protein phosphorylation (GO:0001934)|regulation of dendrite morphogenesis (GO:0048814)|small GTPase mediated signal transduction (GO:0007264)	dendrite (GO:0030425)|guanyl-nucleotide exchange factor complex (GO:0032045)|neuronal cell body (GO:0043025)	protein serine/threonine kinase activity (GO:0004674)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)	p.R189Q(1)		NS(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(27)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	60		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		CGCGTGTGCCGGAGCCTCTCT	0.607																																							uc001llz.1		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|ovary(1)	2						c.(565-567)CGG>CAG		kinase non-catalytic C-lobe domain (KIND)			GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	174.0	148.0	157.0		566	2.3	0.9	10	dbSNP_134	157	0,8600		0,0,4300	yes	missense	KNDC1	NM_152643.6	43	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	possibly-damaging	189/1750	134997434	1,13005	2203	4300	6503	SO:0001583	missense	85442				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction			g.chr10:134997434G>A	AK074179	CCDS7674.1	10q26.3	2004-09-14	2004-04-07		ENSG00000171798	ENSG00000171798			29374	protein-coding gene	gene with protein product			"""RasGEF domain family, member 2"""	RASGEF2, C10orf23		11214970	Standard	NM_152643		Approved	KIAA1768, bB439H18.3, FLJ25027	uc001llz.1	Q76NI1	OTTHUMG00000019303	ENST00000304613.3:c.566G>A	10.37:g.134997434G>A	ENSP00000304437:p.Arg189Gln		Somatic				KNDC1_uc001lma.1_Missense_Mutation_p.R124Q	p.R189Q	NM_152643	NP_689856	WXS	Illumina HiSeq	Unspecified	Q76NI1	VKIND_HUMAN		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)	5	567	+		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)	189			KIND 1.		B0QZC5|Q5T233|Q6ZNH8|Q8TEE5|Q96LV7|Q9C095	Missense_Mutation	SNP	ENST00000304613.3	37	c.566G>A	CCDS7674.1	.	.	.	.	.	.	.	.	.	.	G	18.55	3.647868	0.67358	2.27E-4	0.0	ENSG00000171798	ENST00000304613;ENST00000368572;ENST00000368571	T;T;T	0.32023	1.84;1.84;1.47	4.15	2.26	0.28386	KIND (2);	0.000000	0.56097	U	0.000023	T	0.24431	0.0592	M	0.74881	2.28	0.37949	D	0.932598	P;B	0.42161	0.772;0.313	B;B	0.30855	0.121;0.015	T	0.16660	-1.0395	10	0.44086	T	0.13	-26.6291	5.9347	0.19158	0.2353:0.0:0.7647:0.0	.	124;189	Q76NI1-2;Q76NI1	.;VKIND_HUMAN	Q	189;189;124	ENSP00000304437:R189Q;ENSP00000357561:R189Q;ENSP00000357560:R124Q	ENSP00000304437:R189Q	R	+	2	0	KNDC1	134847424	0.989000	0.36119	0.910000	0.35882	0.491000	0.33493	0.982000	0.29539	1.051000	0.40369	0.450000	0.29827	CGG		0.607	KNDC1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000277044.3	NM_152643		24	170	0	0	0	0.003954	0	24	170				
Unknown	0	broad.mit.edu	37	10	135491123	135491123	+	IGR	SNP	G	G	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr10:135491123G>A								AL845259.1 (17944 upstream) : None (None downstream)																							GCCCACACCGGCGCGTGGGGA	0.786																																							uc010qvi.1		NA																	0					0						c.(733-735)GGC>GAC		double homeobox, 4-like							12.0	12.0	12.0					10																	135491123		1087	2139	3226	SO:0001628	intergenic_variant	653544					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr10:135491123G>A																													10.37:g.135491123G>A			Somatic					p.G245D	NM_001127389	NP_001120861	WXS	Illumina HiSeq	Unspecified	F5GZ66	F5GZ66_HUMAN			1	845	+			245						Missense_Mutation	SNP		37	c.734G>A																																																																																				0	0.786									4	18	0	0	0	0.006214	0	4	18				
OR51D1	390038	broad.mit.edu	37	11	4661752	4661752	+	Silent	SNP	G	G	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr11:4661752G>T	ENST00000357605.2	+	1	808	c.732G>T	c.(730-732)cgG>cgT	p.R244R	OR51E1_ENST00000396952.5_5'Flank	NM_001004751.2	NP_001004751.1	Q8NGF3	O51D1_HUMAN	olfactory receptor, family 51, subfamily D, member 1	244						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R244R(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|liver(2)|lung(14)|prostate(1)|skin(2)|urinary_tract(1)	27		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;2.74e-13)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|GBM - Glioblastoma multiforme(2;0.0841)|LUSC - Lung squamous cell carcinoma(625;0.19)		TGTCCTCTCGGAGGGCAGCAC	0.527																																							uc010qyk.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(730-732)CGG>CGT		olfactory receptor, family 51, subfamily D,							181.0	162.0	168.0					11																	4661752		2201	4298	6499	SO:0001819	synonymous_variant	390038				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:4661752G>T	AB065855	CCDS31357.1	11p15.4	2012-08-09			ENSG00000197428	ENSG00000197428		"""GPCR / Class A : Olfactory receptors"""	15193	protein-coding gene	gene with protein product							Standard	NM_001004751		Approved	OR51D1Q	uc010qyk.2	Q8NGF3	OTTHUMG00000165724	ENST00000357605.2:c.732G>T	11.37:g.4661752G>T			Somatic					p.R244R	NM_001004751	NP_001004751	WXS	Illumina HiSeq	Unspecified	Q8NGF3	O51D1_HUMAN		Epithelial(150;2.74e-13)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|GBM - Glioblastoma multiforme(2;0.0841)|LUSC - Lung squamous cell carcinoma(625;0.19)	1	732	+		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)	244			Cytoplasmic (Potential).		B9EIK4	Silent	SNP	ENST00000357605.2	37	c.732G>T	CCDS31357.1																																																																																				0.527	OR51D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385956.1	NM_001004751		65	151	1	0	1.7104e-27	0.01441	2.70353e-27	65	151				
OR2AG1	144125	broad.mit.edu	37	11	6806427	6806428	+	Silent	DNP	CC	CC	AA			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr11:6806427_6806428CC>AA	ENST00000307401.4	+	1	180_181	c.159_160CC>AA	c.(157-162)gcCCgg>gcAAgg	p.53_54AR>AR		NM_001004489.2	NP_001004489.1	Q9H205	O2AG1_HUMAN	olfactory receptor, family 2, subfamily AG, member 1	53						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.(=)(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(13)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	26		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)		Epithelial(150;2.19e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		CCATGGAAGCCCGGCTCCACAT	0.545																																							uc001mer.1		NA																	1	Unknown(1)		lung(1)	central_nervous_system(1)	1						c.(157-162)GCCCGG>GCAAGG		olfactory receptor, family 2, subfamily AG,																																				SO:0001819	synonymous_variant	144125				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:6806427_6806428CC>AA	AB065823	CCDS31414.1	11p15.4	2012-08-09			ENSG00000170803	ENSG00000170803		"""GPCR / Class A : Olfactory receptors"""	15142	protein-coding gene	gene with protein product				OR2AG3			Standard	NM_001004489		Approved		uc001mer.2	Q9H205	OTTHUMG00000165735	Exception_encountered	11.37:g.6806427_6806428delinsAA			Somatic					p.53_54AR>AR	NM_001004489	NP_001004489	WXS	Illumina HiSeq	Unspecified	Q9H205	O2AG1_HUMAN		Epithelial(150;2.19e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)	1	159_160	+		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)	53_54			Cytoplasmic (Potential).		B9EKV7|Q6IFG7|Q96R26	Silent	DNP	ENST00000307401.4	37	c.159_160CC>AA	CCDS31414.1																																																																																				0.545	OR2AG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385980.1	NM_001004489		79	160	0	0	0	0.004672	0	79	160				
TEAD1	7003	broad.mit.edu	37	11	12901386	12901386	+	Silent	SNP	G	G	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr11:12901386G>A	ENST00000526600.1	+	1	397	c.174G>A	c.(172-174)ccG>ccA	p.P58P	TEAD1_ENST00000527636.1_Silent_p.P154P|TEAD1_ENST00000334310.6_Silent_p.P143P|TEAD1_ENST00000527575.1_Silent_p.P154P|TEAD1_ENST00000361985.2_Silent_p.P154P|TEAD1_ENST00000361905.4_Silent_p.P139P			P28347	TEAD1_HUMAN	TEA domain family member 1 (SV40 transcriptional enhancer factor)	154					gene expression (GO:0010467)|hippo signaling (GO:0035329)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P139P(1)		breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(9)	17				Epithelial(150;0.00223)|BRCA - Breast invasive adenocarcinoma(625;0.236)		CAGGGGCGCCGGGGGTAAGTC	0.597																																							uc001mkj.3		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(415-417)CCG>CCA		TEA domain family member 1							45.0	47.0	46.0					11																	12901386		2200	4294	6494	SO:0001819	synonymous_variant	7003				hippo signaling cascade		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity	g.chr11:12901386G>A	X84839	CCDS7810.1, CCDS7810.2	11p15.4	2008-11-12				ENSG00000187079			11714	protein-coding gene	gene with protein product		189967	"""atrophia areata, peripapillary chorioretinal degeneration"""	TCF13, AA		1851669, 9889009, 15016762	Standard	NM_021961		Approved	TEF-1	uc021qdx.1	P28347		ENST00000526600.1:c.174G>A	11.37:g.12901386G>A			Somatic				TEAD1_uc001mkk.3_Silent_p.P58P|TEAD1_uc009ygl.2_Silent_p.P33P	p.P139P	NM_021961	NP_068780	WXS	Illumina HiSeq	Unspecified	P28347	TEAD1_HUMAN		Epithelial(150;0.00223)|BRCA - Breast invasive adenocarcinoma(625;0.236)	6	1082	+			154			Pro-rich.		A4FUP2|E7EV65	Silent	SNP	ENST00000526600.1	37	c.417G>A																																																																																					0.597	TEAD1-007	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000387220.1	NM_021961		17	142	0	0	0	0.010504	0	17	142				
PLEKHA7	144100	broad.mit.edu	37	11	16838843	16838843	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr11:16838843C>A	ENST00000355661.3	-	11	1380	c.1370G>T	c.(1369-1371)cGc>cTc	p.R457L	PLEKHA7_ENST00000448080.2_Missense_Mutation_p.R457L|PLEKHA7_ENST00000532079.1_Intron|PLEKHA7_ENST00000531066.1_Missense_Mutation_p.R457L			Q6IQ23	PKHA7_HUMAN	pleckstrin homology domain containing, family A member 7	457					epithelial cell-cell adhesion (GO:0090136)|zonula adherens maintenance (GO:0045218)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|zonula adherens (GO:0005915)	delta-catenin binding (GO:0070097)	p.R457L(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(13)|ovary(1)|prostate(2)|skin(7)|urinary_tract(1)	37						AGGACCCTGGCGAGGAAGCGT	0.587																																							uc001mmo.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|central_nervous_system(1)	3						c.(1369-1371)CGC>CTC		pleckstrin homology domain containing, family A							41.0	47.0	45.0					11																	16838843		2190	4271	6461	SO:0001583	missense	144100				epithelial cell-cell adhesion|zonula adherens maintenance	centrosome|zonula adherens	delta-catenin binding	g.chr11:16838843C>A	BC033239	CCDS31434.1	11p15	2013-01-10			ENSG00000166689	ENSG00000166689		"""Pleckstrin homology (PH) domain containing"""	27049	protein-coding gene	gene with protein product		612686				12477932	Standard	NM_175058		Approved	DKFZp686M22243	uc001mmo.3	Q6IQ23	OTTHUMG00000165954	ENST00000355661.3:c.1370G>T	11.37:g.16838843C>A	ENSP00000347883:p.Arg457Leu		Somatic				PLEKHA7_uc010rcu.1_Missense_Mutation_p.R457L|PLEKHA7_uc010rcv.1_Missense_Mutation_p.R31L|PLEKHA7_uc001mmn.2_Missense_Mutation_p.R165L	p.R457L	NM_175058	NP_778228	WXS	Illumina HiSeq	Unspecified	Q6IQ23	PKHA7_HUMAN			11	1385	-			457					B4DK33|B4DWC3|Q86VZ7	Missense_Mutation	SNP	ENST00000355661.3	37	c.1370G>T	CCDS31434.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.84|14.84	2.655068|2.655068	0.47467|0.47467	.|.	.|.	ENSG00000166689|ENSG00000166689	ENST00000530489|ENST00000531066;ENST00000355661;ENST00000448080	.|T;T;T	.|0.09445	.|2.98;3.01;3.01	4.6|4.6	2.58|2.58	0.30949|0.30949	.|.	.|0.117279	.|0.64402	.|D	.|0.000013	T|T	0.12135|0.12135	0.0295|0.0295	L|L	0.55743|0.55743	1.74|1.74	0.50313|0.50313	D|D	0.999864|0.999864	.|B;P;B;B	.|0.36683	.|0.005;0.565;0.031;0.385	.|B;B;B;B	.|0.38683	.|0.005;0.279;0.01;0.141	T|T	0.04767|0.04767	-1.0928|-1.0928	5|10	.|0.62326	.|D	.|0.03	-17.6413|-17.6413	9.7481|9.7481	0.40459|0.40459	0.1409:0.7802:0.0:0.079|0.1409:0.7802:0.0:0.079	.|.	.|31;457;457;457	.|Q6IQ23-3;E9PKC0;Q6IQ23;Q6IQ23-2	.|.;.;PKHA7_HUMAN;.	S|L	88|457	.|ENSP00000435389:R457L;ENSP00000347883:R457L;ENSP00000416895:R457L	.|ENSP00000347883:R457L	A|R	-|-	1|2	0|0	PLEKHA7|PLEKHA7	16795419|16795419	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.982000|0.982000	0.71751|0.71751	3.337000|3.337000	0.52120|0.52120	2.119000|2.119000	0.64992|0.64992	0.462000|0.462000	0.41574|0.41574	GCC|CGC		0.587	PLEKHA7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000387242.2	NM_175058		38	140	1	0	8.16277e-20	0.006999	1.19594e-19	38	140				
NELL1	4745	broad.mit.edu	37	11	20982079	20982079	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr11:20982079G>A	ENST00000357134.5	+	12	1425	c.1273G>A	c.(1273-1275)Gtc>Atc	p.V425I	NELL1_ENST00000532434.1_Missense_Mutation_p.V425I|NELL1_ENST00000325319.5_Missense_Mutation_p.V368I|NELL1_ENST00000298925.5_Missense_Mutation_p.V453I	NM_006157.3|NM_201551.1	NP_006148.2|NP_963845.1	Q92832	NELL1_HUMAN	NEL-like 1 (chicken)	425					cell differentiation (GO:0030154)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of osteoblast proliferation (GO:0033689)|nervous system development (GO:0007399)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of gene expression (GO:0010468)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)	p.V425I(1)		NS(1)|breast(3)|endometrium(5)|kidney(3)|large_intestine(15)|lung(36)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	70						TTACATCTCTGTCCAGGGAGA	0.413																																							uc001mqe.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|large_intestine(1)	3						c.(1273-1275)GTC>ATC		nel-like 1 isoform 1 precursor							193.0	174.0	180.0					11																	20982079		2203	4300	6503	SO:0001583	missense	4745				cell adhesion|nervous system development	extracellular region	calcium ion binding|structural molecule activity	g.chr11:20982079G>A	AK127805	CCDS7855.1, CCDS44555.1, CCDS73267.1, CCDS73268.1	11p15.1	2008-02-01	2001-11-28		ENSG00000165973	ENSG00000165973			7750	protein-coding gene	gene with protein product		602319	"""nel (chicken)-like 1"""			8975702	Standard	NM_006157		Approved	IDH3GL, FLJ45906	uc001mqe.3	Q92832	OTTHUMG00000166042	ENST00000357134.5:c.1273G>A	11.37:g.20982079G>A	ENSP00000349654:p.Val425Ile		Somatic				NELL1_uc001mqf.2_Missense_Mutation_p.V425I|NELL1_uc009yid.2_Missense_Mutation_p.V453I|NELL1_uc010rdo.1_Missense_Mutation_p.V368I|NELL1_uc010rdp.1_Missense_Mutation_p.V185I	p.V425I	NM_006157	NP_006148	WXS	Illumina HiSeq	Unspecified	Q92832	NELL1_HUMAN			12	1426	+			425			EGF-like 1.		B2CKC1|Q4VB90|Q4VB91|Q6NSY8|Q9Y472	Missense_Mutation	SNP	ENST00000357134.5	37	c.1273G>A	CCDS7855.1	.	.	.	.	.	.	.	.	.	.	G	10.13	1.265677	0.23136	.	.	ENSG00000165973	ENST00000298925;ENST00000357134;ENST00000325319;ENST00000532434	D;D;D;D	0.93712	-3.27;-3.27;-3.27;-3.27	5.38	0.0482	0.14284	Epidermal growth factor-like (1);	0.316078	0.30714	N	0.009037	T	0.80014	0.4546	N	0.03115	-0.41	0.35722	D	0.817231	B;B;B;B	0.06786	0.001;0.0;0.001;0.0	B;B;B;B	0.08055	0.001;0.0;0.003;0.001	T	0.68465	-0.5401	10	0.36615	T	0.2	-5.8782	6.6672	0.23047	0.3298:0.1141:0.5562:0.0	.	368;453;425;425	F5H6I3;B3KXR2;Q92832-2;Q92832	.;.;.;NELL1_HUMAN	I	453;425;368;425	ENSP00000298925:V453I;ENSP00000349654:V425I;ENSP00000317837:V368I;ENSP00000437170:V425I	ENSP00000298925:V453I	V	+	1	0	NELL1	20938655	0.978000	0.34361	0.998000	0.56505	0.998000	0.95712	0.356000	0.20181	0.046000	0.15833	0.655000	0.94253	GTC		0.413	NELL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387588.1	NM_006157		34	93	0	0	0	0.004878	0	34	93				
FIBIN	387758	broad.mit.edu	37	11	27016285	27016285	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr11:27016285A>T	ENST00000318627.2	+	1	658	c.212A>T	c.(211-213)cAg>cTg	p.Q71L		NM_203371.1	NP_976249.1	Q8TAL6	FIBIN_HUMAN	fin bud initiation factor homolog (zebrafish)	71						endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)		p.Q71L(1)		breast(1)|endometrium(2)|lung(7)|upper_aerodigestive_tract(1)	11						GAGGGGAGCCAGGTTGGCAGC	0.662																																							uc001mrd.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(211-213)CAG>CTG		fin bud initiation factor homolog precursor							32.0	30.0	30.0					11																	27016285		2203	4299	6502	SO:0001583	missense	387758					extracellular region|Golgi apparatus		g.chr11:27016285A>T	BC026873	CCDS7861.1	11p14.2	2008-12-03				ENSG00000176971			33747	protein-coding gene	gene with protein product						17196583	Standard	NM_203371		Approved	MGC24932	uc001mrd.3	Q8TAL6		ENST00000318627.2:c.212A>T	11.37:g.27016285A>T	ENSP00000321962:p.Gln71Leu		Somatic					p.Q71L	NM_203371	NP_976249	WXS	Illumina HiSeq	Unspecified	Q8TAL6	FIBIN_HUMAN			1	658	+			71						Missense_Mutation	SNP	ENST00000318627.2	37	c.212A>T	CCDS7861.1	.	.	.	.	.	.	.	.	.	.	A	10.33	1.320149	0.23994	.	.	ENSG00000176971	ENST00000318627	.	.	.	5.83	0.664	0.17890	.	0.598312	0.14768	N	0.299560	T	0.19005	0.0456	N	0.08118	0	0.33129	D	0.542838	B	0.30281	0.275	B	0.24269	0.052	T	0.18493	-1.0335	9	0.36615	T	0.2	-12.5897	7.6725	0.28468	0.4763:0.4475:0.0762:0.0	.	71	Q8TAL6	FIBIN_HUMAN	L	71	.	ENSP00000321962:Q71L	Q	+	2	0	FIBIN	26972861	0.999000	0.42202	0.665000	0.29768	0.173000	0.22820	0.697000	0.25556	-0.128000	0.11641	-0.274000	0.10170	CAG		0.662	FIBIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387945.1	NM_203371		18	32	0	0	0	0.010504	0	18	32				
OR5A2	219981	broad.mit.edu	37	11	59190046	59190046	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr11:59190046G>C	ENST00000302040.4	-	1	403	c.381C>G	c.(379-381)atC>atG	p.I127M		NM_001001954.1	NP_001001954.1	Q8NGI9	OR5A2_HUMAN	olfactory receptor, family 5, subfamily A, member 2	127						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.I127M(1)		large_intestine(3)|liver(1)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	21						AGGGGTTGCAGATTGCAGCAT	0.478																																							uc010rkt.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(379-381)ATC>ATG		olfactory receptor, family 5, subfamily A,							79.0	72.0	74.0					11																	59190046		2201	4295	6496	SO:0001583	missense	219981				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:59190046G>C	AB065805	CCDS31560.1	11q12.1	2012-08-09			ENSG00000172324	ENSG00000172324		"""GPCR / Class A : Olfactory receptors"""	15249	protein-coding gene	gene with protein product							Standard	NM_001001954		Approved		uc010rkt.2	Q8NGI9	OTTHUMG00000167419	ENST00000302040.4:c.381C>G	11.37:g.59190046G>C	ENSP00000303834:p.Ile127Met		Somatic					p.I127M	NM_001001954	NP_001001954	WXS	Illumina HiSeq	Unspecified	Q8NGI9	OR5A2_HUMAN			1	381	-			127			Cytoplasmic (Potential).		B9EH21|Q6IFF4|Q96RB0	Missense_Mutation	SNP	ENST00000302040.4	37	c.381C>G	CCDS31560.1	.	.	.	.	.	.	.	.	.	.	G	11.74	1.729198	0.30684	.	.	ENSG00000172324	ENST00000302040	T	0.59083	0.29	5.47	-3.0	0.05480	GPCR, rhodopsin-like superfamily (1);	0.674572	0.11360	U	0.572021	T	0.79741	0.4498	H	0.99011	4.4	0.25476	N	0.987784	D	0.59357	0.985	P	0.61201	0.885	T	0.69079	-0.5240	10	0.87932	D	0	.	6.1915	0.20526	0.4378:0.2249:0.3373:0.0	.	127	Q8NGI9	OR5A2_HUMAN	M	127	ENSP00000303834:I127M	ENSP00000303834:I127M	I	-	3	3	OR5A2	58946622	0.010000	0.17322	0.007000	0.13788	0.662000	0.39071	-1.090000	0.03372	-0.371000	0.08004	0.585000	0.79938	ATC		0.478	OR5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394552.1	NM_001001954		4	52	0	0	0	0.009096	0	4	52				
MS4A4A	51338	broad.mit.edu	37	11	60064740	60064740	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr11:60064740C>T	ENST00000337908.4	+	3	362	c.272C>T	c.(271-273)aCt>aTt	p.T91I	MS4A4A_ENST00000532114.1_Missense_Mutation_p.T91I|MS4A4A_ENST00000395016.3_Missense_Mutation_p.T72I|MS4A4A_ENST00000355131.3_Missense_Mutation_p.T72I	NM_148975.2	NP_683876.1	Q96JQ5	M4A4A_HUMAN	membrane-spanning 4-domains, subfamily A, member 4A	91						integral component of membrane (GO:0016021)		p.T72I(1)|p.T91I(1)		autonomic_ganglia(1)|breast(1)|endometrium(2)|large_intestine(2)|lung(12)|prostate(1)|skin(4)	23						GCATCTAATACTTATGGAAGT	0.373																																							uc001noz.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(271-273)ACT>ATT		membrane-spanning 4-domains, subfamily A, member							179.0	153.0	162.0					11																	60064740		2203	4300	6503	SO:0001583	missense	51338					integral to membrane	receptor activity	g.chr11:60064740C>T	AB013102	CCDS7982.1, CCDS58135.1	11q12	2012-02-28	2012-02-28		ENSG00000110079	ENSG00000110079			13371	protein-coding gene	gene with protein product		606547	"""membrane-spanning 4-domains, subfamily A, member 4"""	MS4A4		11245982, 11401424	Standard	NM_148975		Approved	CD20L1, MS4A7	uc001noz.3	Q96JQ5	OTTHUMG00000154949	ENST00000337908.4:c.272C>T	11.37:g.60064740C>T	ENSP00000338648:p.Thr91Ile		Somatic				MS4A4A_uc001npa.2_Missense_Mutation_p.T72I|MS4A4A_uc001npb.2_Missense_Mutation_p.T72I|MS4A4A_uc001npc.2_Missense_Mutation_p.T72I	p.T91I	NM_148975	NP_683876	WXS	Illumina HiSeq	Unspecified	Q96JQ5	M4A4A_HUMAN			3	282	+			91			Extracellular (Potential).		Q8TEZ6|Q96PG7|Q9BY18|Q9H3V3|Q9P1S3	Missense_Mutation	SNP	ENST00000337908.4	37	c.272C>T	CCDS7982.1	.	.	.	.	.	.	.	.	.	.	C	4.877	0.163017	0.09287	.	.	ENSG00000110079	ENST00000532114;ENST00000337908;ENST00000355131;ENST00000395016	T;T;T;T	0.17370	2.28;3.12;3.13;3.13	4.07	-8.13	0.01073	.	6.449090	0.00397	U	0.000052	T	0.05823	0.0152	N	0.02802	-0.49	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.001;0.002	T	0.27262	-1.0079	10	0.22109	T	0.4	-0.5016	5.9416	0.19196	0.2789:0.4941:0.0:0.227	.	91;91	Q96JQ5-2;Q96JQ5	.;M4A4A_HUMAN	I	91;91;72;72	ENSP00000434506:T91I;ENSP00000338648:T91I;ENSP00000347252:T72I;ENSP00000378462:T72I	ENSP00000338648:T91I	T	+	2	0	MS4A4A	59821316	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.064000	0.00622	-1.288000	0.02378	-0.670000	0.03821	ACT		0.373	MS4A4A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000337774.2			13	39	0	0	0	0.001855	0	13	39				
TUT1	64852	broad.mit.edu	37	11	62346199	62346199	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr11:62346199C>T	ENST00000476907.1	-	5	1685	c.994G>A	c.(994-996)Gag>Aag	p.E332K	TUT1_ENST00000308436.7_Missense_Mutation_p.E370K|MIR3654_ENST00000496634.2_Missense_Mutation_p.E332K			Q9H6E5	STPAP_HUMAN	terminal uridylyl transferase 1, U6 snRNA-specific	332					mRNA cleavage (GO:0006379)|mRNA polyadenylation (GO:0006378)|snRNA processing (GO:0016180)	intercellular bridge (GO:0045171)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|mRNA 3'-UTR binding (GO:0003730)|polynucleotide adenylyltransferase activity (GO:0004652)|RNA binding (GO:0003723)|RNA uridylyltransferase activity (GO:0050265)	p.E370K(1)|p.E332K(1)		breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29						GCTTTCTCCTCCTTTGGGGTC	0.617																																							uc001nto.2		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(1)|skin(1)	2						c.(1108-1110)GAG>AAG		terminal uridylyl transferase 1, U6							82.0	82.0	82.0					11																	62346199		2202	4299	6501	SO:0001583	missense	64852				mRNA cleavage|mRNA polyadenylation|snRNA processing	nuclear speck|nucleolus	ATP binding|enzyme binding|mRNA 3'-UTR binding|polynucleotide adenylyltransferase activity|RNA uridylyltransferase activity|zinc ion binding	g.chr11:62346199C>T	BC005013	CCDS8021.1, CCDS8021.2	11q12.2	2014-03-05	2006-10-06	2006-10-06	ENSG00000149016	ENSG00000149016	2.7.7.52	"""RNA binding motif (RRM) containing"""	26184	protein-coding gene	gene with protein product	"""RNA uridylyltransferase"", ""U6 TUTase"", ""TUTase 6"""	610641	"""RNA binding motif protein 21"""	RBM21		16790842	Standard	NM_022830		Approved	FLJ22347, FLJ22267, FLJ21850, PAPD2, TUTase	uc001nto.2	Q9H6E5	OTTHUMG00000158564	ENST00000476907.1:c.994G>A	11.37:g.62346199C>T	ENSP00000419607:p.Glu332Lys		Somatic				TUT1_uc001ntp.1_5'Flank	p.E370K	NM_022830	NP_073741	WXS	Illumina HiSeq	Unspecified	Q9H6E5	STPAP_HUMAN			5	1146	-			332					A1A527|A8K995|Q2NL65|Q7L583|Q9H6H7	Missense_Mutation	SNP	ENST00000476907.1	37	c.1108G>A		.	.	.	.	.	.	.	.	.	.	C	3.030	-0.199784	0.06219	.	.	ENSG00000149016	ENST00000308436;ENST00000476907	T;T	0.35973	1.28;1.29	5.44	0.191	0.15130	.	0.568378	0.18594	N	0.136643	T	0.19005	0.0456	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.29579	-1.0007	10	0.10111	T	0.7	-6.2424	10.5709	0.45200	0.0:0.549:0.3755:0.0756	.	370	F5H0R1	.	K	370;332	ENSP00000308000:E370K;ENSP00000419607:E332K	ENSP00000441670:E332K	E	-	1	0	TUT1	62102775	0.000000	0.05858	0.026000	0.17262	0.019000	0.09904	0.002000	0.13061	-0.211000	0.10124	-1.319000	0.01295	GAG		0.617	TUT1-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000351319.2	NM_022830		26	156	0	0	0	0.010818	0	26	156				
SLC22A11	55867	broad.mit.edu	37	11	64331815	64331815	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr11:64331815A>T	ENST00000301891.4	+	5	1231	c.857A>T	c.(856-858)aAg>aTg	p.K286M	SLC22A11_ENST00000490834.1_Intron|SLC22A11_ENST00000377581.3_Missense_Mutation_p.K286M|SLC22A11_ENST00000377585.3_Missense_Mutation_p.K286M	NM_018484.2	NP_060954.1	Q9NSA0	S22AB_HUMAN	solute carrier family 22 (organic anion/urate transporter), member 11	286					organic anion transport (GO:0015711)|transmembrane transport (GO:0055085)|urate metabolic process (GO:0046415)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|organic anion transmembrane transporter activity (GO:0008514)|sodium-independent organic anion transmembrane transporter activity (GO:0015347)	p.K286M(1)		breast(1)|central_nervous_system(3)|endometrium(3)|kidney(2)|large_intestine(5)|lung(6)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	23					Aminohippurate(DB00345)|Aspartame(DB00168)|Benzylpenicillin(DB01053)|Bumetanide(DB00887)|Cefalotin(DB00456)|Cefamandole(DB01326)|Cefazolin(DB01327)|Cefoperazone(DB01329)|Cefotaxime(DB00493)|Ceftriaxone(DB01212)|Cimetidine(DB00501)|Conjugated Estrogens(DB00286)|Diclofenac(DB00586)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Doxycycline(DB00254)|Estradiol(DB00783)|Furosemide(DB00695)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Methotrexate(DB00563)|Minocycline(DB01017)|Novobiocin(DB01051)|Oxytetracycline(DB00595)|Phenylbutazone(DB00812)|Piroxicam(DB00554)|Pravastatin(DB00175)|Probenecid(DB01032)|Salicylic acid(DB00936)|Tetracycline(DB00759)|Zidovudine(DB00495)	CTGATTATTAAGGGCAAACCA	0.587																																							uc001oai.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(856-858)AAG>ATG		solute carrier family 22 member 11	Probenecid(DB01032)						83.0	74.0	77.0					11																	64331815		2201	4297	6498	SO:0001583	missense	55867				urate metabolic process	apical plasma membrane|external side of plasma membrane|integral to plasma membrane	inorganic anion exchanger activity|protein binding|sodium-independent organic anion transmembrane transporter activity	g.chr11:64331815A>T	AB026116	CCDS8074.1	11q13.3	2013-05-22	2008-01-11		ENSG00000168065	ENSG00000168065		"""Solute carriers"""	18120	protein-coding gene	gene with protein product		607097				10660625, 15576633, 17229912	Standard	NM_018484		Approved	OAT4	uc001oai.3	Q9NSA0	OTTHUMG00000045142	ENST00000301891.4:c.857A>T	11.37:g.64331815A>T	ENSP00000301891:p.Lys286Met		Somatic				SLC22A11_uc001oah.1_Intron|SLC22A11_uc001oaj.2_Missense_Mutation_p.K286M|SLC22A11_uc009ypq.2_Missense_Mutation_p.K286M|SLC22A11_uc001oak.1_Missense_Mutation_p.K115M	p.K286M	NM_018484	NP_060954	WXS	Illumina HiSeq	Unspecified	Q9NSA0	S22AB_HUMAN			5	1231	+			286			Cytoplasmic (Potential).		A8K426|Q53GR2|Q6ZP72|Q8NBU4	Missense_Mutation	SNP	ENST00000301891.4	37	c.857A>T	CCDS8074.1	.	.	.	.	.	.	.	.	.	.	A	7.668	0.686329	0.14973	.	.	ENSG00000168065	ENST00000301891;ENST00000377585;ENST00000377581	T;T;T	0.78816	-1.21;-1.21;-1.21	4.33	-8.66	0.00866	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.956705	0.08621	N	0.918425	T	0.62392	0.2424	L	0.28556	0.865	0.09310	N	1	B;B;B;B	0.16802	0.006;0.019;0.009;0.004	B;B;B;B	0.24006	0.008;0.05;0.013;0.013	T	0.53165	-0.8477	10	0.44086	T	0.13	.	10.3598	0.43987	0.3666:0.5253:0.0:0.1081	.	286;80;286;286	Q9NSA0-2;Q8NBZ3;A6NCG2;Q9NSA0	.;.;.;S22AB_HUMAN	M	286	ENSP00000301891:K286M;ENSP00000366809:K286M;ENSP00000366804:K286M	ENSP00000301891:K286M	K	+	2	0	SLC22A11	64088391	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-3.033000	0.00636	-3.210000	0.00214	-0.446000	0.05623	AAG		0.587	SLC22A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000104886.4	NM_018484		26	79	0	0	0	0.008361	0	26	79				
EHBP1L1	254102	broad.mit.edu	37	11	65349621	65349621	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr11:65349621G>A	ENST00000309295.4	+	9	1743	c.1478G>A	c.(1477-1479)gGt>gAt	p.G493D		NM_001099409.1	NP_001092879.1	Q8N3D4	EH1L1_HUMAN	EH domain binding protein 1-like 1	493						membrane (GO:0016020)		p.G493D(1)		central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	23						GGGCAACTTGGTGACCTCGAG	0.682																																							uc001oeo.3		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(1477-1479)GGT>GAT		tangerin							16.0	19.0	18.0					11																	65349621		1946	4127	6073	SO:0001583	missense	254102							g.chr11:65349621G>A	AL834433	CCDS44649.1	11q13.1	2008-02-05			ENSG00000173442	ENSG00000173442			30682	protein-coding gene	gene with protein product							Standard	NM_001099409		Approved	DKFZp762C186, TANGERIN	uc001oeo.4	Q8N3D4	OTTHUMG00000166520	ENST00000309295.4:c.1478G>A	11.37:g.65349621G>A	ENSP00000312671:p.Gly493Asp		Somatic				EHBP1L1_uc001oep.1_Intron	p.G493D	NM_001099409	NP_001092879	WXS	Illumina HiSeq	Unspecified	Q8N3D4	EH1L1_HUMAN			9	1743	+			493					Q8TB89|Q9H7M7	Missense_Mutation	SNP	ENST00000309295.4	37	c.1478G>A	CCDS44649.1	.	.	.	.	.	.	.	.	.	.	G	12.17	1.857484	0.32791	.	.	ENSG00000173442	ENST00000309295	T	0.62788	-0.0	3.34	0.362	0.16113	.	1.006700	0.07997	N	0.988172	T	0.43166	0.1235	N	0.24115	0.695	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.24440	-1.0160	10	0.27785	T	0.31	.	5.1112	0.14809	0.4178:0.0:0.5822:0.0	.	493	Q8N3D4	EH1L1_HUMAN	D	493	ENSP00000312671:G493D	ENSP00000312671:G493D	G	+	2	0	EHBP1L1	65106197	0.001000	0.12720	0.006000	0.13384	0.007000	0.05969	0.821000	0.27338	0.254000	0.21573	-0.258000	0.10820	GGT		0.682	EHBP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390145.1	XM_170658		7	25	0	0	0	0.010729	0	7	25				
MYEOV	26579	broad.mit.edu	37	11	69063518	69063518	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr11:69063518G>T	ENST00000308946.3	+	3	1051	c.601G>T	c.(601-603)Gtg>Ttg	p.V201L	MYEOV_ENST00000535407.1_Missense_Mutation_p.V143L|MYEOV_ENST00000441339.2_Missense_Mutation_p.V201L	NM_138768.2	NP_620123.2	Q96EZ4	MYEOV_HUMAN	myeloma overexpressed	201								p.V201L(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(1)|lung(12)|prostate(2)|skin(1)|urinary_tract(1)	24	all_lung(4;2.21e-19)|Lung NSC(4;6.13e-19)|Melanoma(5;0.00128)		LUSC - Lung squamous cell carcinoma(11;3.33e-11)|STAD - Stomach adenocarcinoma(18;0.00654)|LUAD - Lung adenocarcinoma(13;0.0713)	Kidney(183;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(183;3.23e-08)|Lung(977;0.00361)|LUSC - Lung squamous cell carcinoma(976;0.0153)		GCGAATGGATGTGGCTCTGCG	0.607																																							uc001oov.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(601-603)GTG>TTG		myeloma overexpressed							130.0	119.0	123.0					11																	69063518		2200	4294	6494	SO:0001583	missense	26579							g.chr11:69063518G>T	AJ223366	CCDS8190.1, CCDS73340.1	11q13.2	2013-03-27	2013-03-27			ENSG00000172927			7563	protein-coding gene	gene with protein product		605625	"""myeloma overexpressed (in a subset of t(11;14) positive multiple myelomas)"""			10753852	Standard	XM_005273908		Approved	OCIM	uc001oov.3	Q96EZ4		ENST00000308946.3:c.601G>T	11.37:g.69063518G>T	ENSP00000308330:p.Val201Leu		Somatic				MYEOV_uc001oox.2_Intron|MYEOV_uc009ysl.2_Missense_Mutation_p.V201L|MYEOV_uc001oow.2_Missense_Mutation_p.V143L	p.V201L	NM_138768	NP_620123	WXS	Illumina HiSeq	Unspecified	Q96EZ4	MYEOV_HUMAN	LUSC - Lung squamous cell carcinoma(11;3.33e-11)|STAD - Stomach adenocarcinoma(18;0.00654)|LUAD - Lung adenocarcinoma(13;0.0713)	Kidney(183;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(183;3.23e-08)|Lung(977;0.00361)|LUSC - Lung squamous cell carcinoma(976;0.0153)	3	1051	+	all_lung(4;2.21e-19)|Lung NSC(4;6.13e-19)|Melanoma(5;0.00128)		201					Q9UGN6|Q9UGN7	Missense_Mutation	SNP	ENST00000308946.3	37	c.601G>T	CCDS8190.1	.	.	.	.	.	.	.	.	.	.	G	5.472	0.272116	0.10349	.	.	ENSG00000172927	ENST00000441339;ENST00000308946;ENST00000535407	T;T;T	0.22743	1.95;1.95;1.94	1.25	-2.51	0.06365	.	.	.	.	.	T	0.06735	0.0172	N	0.08118	0	0.09310	N	1	P	0.43701	0.815	B	0.34418	0.182	T	0.17228	-1.0376	9	0.87932	D	0	.	0.4154	0.00448	0.1984:0.2421:0.3158:0.2437	.	201	Q96EZ4	MYEOV_HUMAN	L	201;201;143	ENSP00000412482:V201L;ENSP00000308330:V201L;ENSP00000438100:V143L	ENSP00000308330:V201L	V	+	1	0	MYEOV	68820094	0.000000	0.05858	0.000000	0.03702	0.025000	0.11179	0.125000	0.15749	-1.035000	0.03291	0.313000	0.20887	GTG		0.607	MYEOV-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396548.1			74	156	1	0	1.37693e-34	0.01441	2.25735e-34	74	156				
PRKRIR	5612	broad.mit.edu	37	11	76063505	76063505	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr11:76063505C>A	ENST00000260045.3	-	5	794	c.689G>T	c.(688-690)tGt>tTt	p.C230F	PRKRIR_ENST00000531878.1_5'Flank	NM_004705.2	NP_004696.2	O43422	P52K_HUMAN	protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor)	230					negative regulation of cell proliferation (GO:0008285)|response to stress (GO:0006950)|signal transduction (GO:0007165)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.C230F(1)		cervix(1)|endometrium(3)|large_intestine(4)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	25						TGTTTTTGAACAAAACAACGT	0.438																																							uc001oxh.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|pancreas(1)	3						c.(688-690)TGT>TTT		protein-kinase, interferon-inducible double							21.0	21.0	21.0					11																	76063505		2159	4151	6310	SO:0001583	missense	5612				negative regulation of cell proliferation|response to stress|signal transduction		DNA binding|metal ion binding|protein dimerization activity	g.chr11:76063505C>A	AF007393	CCDS8243.1	11q13.5	2013-01-25			ENSG00000137492	ENSG00000137492		"""THAP (C2CH-type zinc finger) domain containing"""	9440	protein-coding gene	gene with protein product	"""THAP domain containing 12"""	607374				9447982	Standard	NM_004705		Approved	P52rIPK, DAP4, THAP12	uc001oxh.1	O43422	OTTHUMG00000165280	ENST00000260045.3:c.689G>T	11.37:g.76063505C>A	ENSP00000260045:p.Cys230Phe		Somatic				PRKRIR_uc010rrz.1_Missense_Mutation_p.C55F	p.C230F	NM_004705	NP_004696	WXS	Illumina HiSeq	Unspecified	O43422	P52K_HUMAN			5	689	-			230					A8K728|Q17RY9|Q8WTW1|Q9Y3Z4	Missense_Mutation	SNP	ENST00000260045.3	37	c.689G>T	CCDS8243.1	.	.	.	.	.	.	.	.	.	.	C	12.47	1.948898	0.34377	.	.	ENSG00000137492	ENST00000529901;ENST00000260045	.	.	.	4.92	4.92	0.64577	.	0.179834	0.64402	D	0.000011	T	0.57681	0.2070	M	0.63428	1.95	0.58432	D	0.999993	P	0.34837	0.472	B	0.27715	0.082	T	0.57871	-0.7736	9	0.21540	T	0.41	.	18.6323	0.91364	0.0:1.0:0.0:0.0	.	230	O43422	P52K_HUMAN	F	55;230	.	ENSP00000260045:C230F	C	-	2	0	PRKRIR	75741153	0.999000	0.42202	0.969000	0.41365	0.993000	0.82548	2.779000	0.47734	2.492000	0.84095	0.478000	0.44815	TGT		0.438	PRKRIR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383188.1	NM_004705		19	49	1	0	1.33986e-20	0.004656	1.98282e-20	19	49				
FAT3	120114	broad.mit.edu	37	11	92087733	92087733	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr11:92087733A>G	ENST00000298047.6	+	1	2472	c.2455A>G	c.(2455-2457)Atc>Gtc	p.I819V	FAT3_ENST00000541502.1_Missense_Mutation_p.I819V|FAT3_ENST00000525166.1_Missense_Mutation_p.I669V|FAT3_ENST00000409404.2_Missense_Mutation_p.I819V			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	819	Cadherin 7. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.I819V(2)		NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				ACTGCTGACCATCAATGTGGA	0.403										TCGA Ovarian(4;0.039)																													uc001pdj.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|pancreas(1)	5						c.(2455-2457)ATC>GTC		FAT tumor suppressor homolog 3							102.0	95.0	97.0					11																	92087733		1974	4169	6143	SO:0001583	missense	120114				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding	g.chr11:92087733A>G	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.2455A>G	11.37:g.92087733A>G	ENSP00000298047:p.Ile819Val	TCGA Ovarian(4;0.039)	Somatic					p.I819V	NM_001008781	NP_001008781	WXS	Illumina HiSeq	Unspecified	Q8TDW7	FAT3_HUMAN			1	2472	+		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)	819			Extracellular (Potential).|Cadherin 7.		B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	37	c.2455A>G		.	.	.	.	.	.	.	.	.	.	A	0.015	-1.562923	0.00903	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000541502;ENST00000525166	T;T;T;T	0.56941	0.43;0.43;0.43;0.43	5.71	-1.74	0.08056	.	.	.	.	.	T	0.22859	0.0552	N	0.03177	-0.4	0.26170	N	0.979874	B	0.02656	0.0	B	0.04013	0.001	T	0.30179	-0.9987	9	0.02654	T	1	.	11.8299	0.52288	0.3739:0.0:0.6261:0.0	.	819	Q8TDW7-3	.	V	819;819;819;669	ENSP00000298047:I819V;ENSP00000387040:I819V;ENSP00000443786:I819V;ENSP00000432586:I669V	ENSP00000298047:I819V	I	+	1	0	FAT3	91727381	1.000000	0.71417	0.927000	0.36925	0.911000	0.54048	1.691000	0.37721	-0.090000	0.12462	0.383000	0.25322	ATC		0.403	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781		23	46	0	0	0	0.003954	0	23	46				
FAT3	120114	broad.mit.edu	37	11	92498063	92498064	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr11:92498063_92498064GG>TT	ENST00000298047.6	+	5	4020_4021	c.4003_4004GG>TT	c.(4003-4005)GGg>TTg	p.G1335L	FAT3_ENST00000525166.1_Missense_Mutation_p.G1185L|RP11-203F8.1_ENST00000529884.1_RNA|FAT3_ENST00000409404.2_Missense_Mutation_p.G1335L			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	1335	Cadherin 12. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G1335L(2)		NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				AGTGGACAATGGGCGCCCACAG	0.485										TCGA Ovarian(4;0.039)																													uc001pdj.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|pancreas(1)	5						c.(4003-4005)GGG>TTG		FAT tumor suppressor homolog 3																																				SO:0001583	missense	120114				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding	g.chr11:92498063_92498064GG>TT	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	Exception_encountered	11.37:g.92498063_92498064delinsTT	ENSP00000298047:p.Gly1335Leu	TCGA Ovarian(4;0.039)	Somatic					p.G1335L	NM_001008781	NP_001008781	WXS	Illumina HiSeq	Unspecified	Q8TDW7	FAT3_HUMAN			5	4020_4021	+		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)	1335			Cadherin 12.|Extracellular (Potential).		B5MDB0|Q96AU6	Missense_Mutation	DNP	ENST00000298047.6	37	c.4003_4004GG>TT																																																																																					0.485	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781		17	39	0	0	0	0.004672	0	17	39				
DSCAML1	57453	broad.mit.edu	37	11	117395563	117395563	+	Silent	SNP	G	G	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr11:117395563G>A	ENST00000321322.6	-	5	1075	c.1074C>T	c.(1072-1074)aaC>aaT	p.N358N	DSCAML1_ENST00000527706.1_Silent_p.N88N	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	298	Ig-like C2-type 4.				axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)	p.N358N(1)		breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		AACCGAAGGTGTTGGTGACCT	0.632																																							uc001prh.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|large_intestine(2)|skin(2)|upper_aerodigestive_tract(1)	8						c.(1072-1074)AAC>AAT		Down syndrome cell adhesion molecule like 1							51.0	41.0	44.0					11																	117395563		2200	4296	6496	SO:0001819	synonymous_variant	57453				axonogenesis|brain development|cell fate determination|dorsal/ventral pattern formation|embryonic skeletal system morphogenesis|homophilic cell adhesion	cell surface|integral to membrane|plasma membrane	protein homodimerization activity	g.chr11:117395563G>A		CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.1074C>T	11.37:g.117395563G>A			Somatic				DSCAML1_uc001pri.1_Silent_p.N162N	p.N358N	NM_020693	NP_065744	WXS	Illumina HiSeq	Unspecified	Q8TD84	DSCL1_HUMAN		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)	5	1076	-	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)	298			Ig-like C2-type 3.|Extracellular (Potential).		Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Silent	SNP	ENST00000321322.6	37	c.1074C>T	CCDS8384.1																																																																																				0.632	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392907.2	NM_020693		4	21	0	0	0	0.001168	0	4	21				
TECTA	7007	broad.mit.edu	37	11	120996458	120996458	+	Missense_Mutation	SNP	G	G	A	rs200857366	byFrequency	TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr11:120996458G>A	ENST00000392793.1	+	8	1922	c.1651G>A	c.(1651-1653)Gtg>Atg	p.V551M	TECTA_ENST00000264037.2_Missense_Mutation_p.V551M			O75443	TECTA_HUMAN	tectorin alpha	551					cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)		p.V551M(1)	TECTA/TBCEL(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|liver(1)|lung(46)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	135	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		GCACAGCTGCGTGTATGACCT	0.567													G|||	2	0.000399361	0.0	0.0	5008	,	,		19714	0.0		0.002	False		,,,				2504	0.0						uc010rzo.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(6)|ovary(2)|skin(2)	10						c.(1651-1653)GTG>ATG		tectorin alpha precursor							120.0	114.0	116.0					11																	120996458		2203	4299	6502	SO:0001583	missense	7007				cell-matrix adhesion|sensory perception of sound	anchored to membrane|plasma membrane|proteinaceous extracellular matrix		g.chr11:120996458G>A	AF055136	CCDS8434.1	11q22-q24	2008-02-05			ENSG00000109927	ENSG00000109927			11720	protein-coding gene	gene with protein product		602574		DFNA12, DFNA8, DFNB21		9503015, 9590290	Standard	NM_005422		Approved		uc010rzo.2	O75443	OTTHUMG00000149908	ENST00000392793.1:c.1651G>A	11.37:g.120996458G>A	ENSP00000376543:p.Val551Met		Somatic					p.V551M	NM_005422	NP_005413	WXS	Illumina HiSeq	Unspecified	O75443	TECTA_HUMAN		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)	7	1651	+	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)	551						Missense_Mutation	SNP	ENST00000392793.1	37	c.1651G>A	CCDS8434.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	24.9	4.581426	0.86748	.	.	ENSG00000109927	ENST00000392793;ENST00000264037	T;T	0.79141	-1.24;-1.24	4.91	4.91	0.64330	Uncharacterised domain, cysteine-rich (2);	0.000000	0.85682	D	0.000000	D	0.87087	0.6090	M	0.69185	2.1	0.51767	D	0.999938	D	0.89917	1.0	D	0.91635	0.999	D	0.86970	0.2097	10	0.46703	T	0.11	.	18.4676	0.90761	0.0:0.0:1.0:0.0	.	551	O75443	TECTA_HUMAN	M	551	ENSP00000376543:V551M;ENSP00000264037:V551M	ENSP00000264037:V551M	V	+	1	0	TECTA	120501668	1.000000	0.71417	0.999000	0.59377	0.968000	0.65278	9.771000	0.98977	2.453000	0.82957	0.563000	0.77884	GTG		0.567	TECTA-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313850.1	NM_005422		80	197	0	0	0	0.01441	0	80	197				
SORL1	6653	broad.mit.edu	37	11	121403215	121403215	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr11:121403215G>A	ENST00000260197.7	+	12	1768	c.1639G>A	c.(1639-1641)Gga>Aga	p.G547R	SORL1_ENST00000532451.1_3'UTR	NM_003105.5	NP_003096	Q92673	SORL_HUMAN	sortilin-related receptor, L(DLR class) A repeats containing	547					cell death (GO:0008219)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|negative regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902960)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of metalloendopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902963)|negative regulation of neurofibrillary tangle assembly (GO:1902997)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron death (GO:1901215)|negative regulation of protein binding (GO:0032091)|negative regulation of protein oligomerization (GO:0032460)|negative regulation of tau-protein kinase activity (GO:1902948)|positive regulation of choline O-acetyltransferase activity (GO:1902771)|positive regulation of early endosome to recycling endosome transport (GO:1902955)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of ER to Golgi vesicle-mediated transport (GO:1902953)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|positive regulation of protein localization to early endosome (GO:1902966)|post-Golgi vesicle-mediated transport (GO:0006892)|protein maturation (GO:0051604)|protein retention in Golgi apparatus (GO:0045053)|protein targeting (GO:0006605)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|receptor-mediated endocytosis (GO:0006898)|regulation of smooth muscle cell migration (GO:0014910)|signal transduction (GO:0007165)	early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna (GO:0031985)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|nuclear envelope lumen (GO:0005641)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)|beta-amyloid binding (GO:0001540)|low-density lipoprotein particle binding (GO:0030169)|transmembrane signaling receptor activity (GO:0004888)	p.G547R(1)		NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(2)|lung(34)|ovary(5)|pancreas(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(2)	91		Breast(109;0.00119)|Medulloblastoma(222;0.0429)|all_neural(223;0.113)		BRCA - Breast invasive adenocarcinoma(274;3.34e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.108)		AGACCACGGCGGAATCATCAC	0.483																																							uc001pxx.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|breast(4)|large_intestine(2)|skin(2)|central_nervous_system(1)|pancreas(1)	15						c.(1639-1641)GGA>AGA		sortilin-related receptor containing LDLR class							122.0	108.0	113.0					11																	121403215		2203	4299	6502	SO:0001583	missense	6653				cholesterol metabolic process|lipid transport|receptor-mediated endocytosis	integral to plasma membrane|low-density lipoprotein particle	low-density lipoprotein particle binding|transmembrane receptor activity	g.chr11:121403215G>A	Y08110	CCDS8436.1	11q23.2-q24.4	2014-06-05	2011-01-25		ENSG00000137642	ENSG00000137642		"""Fibronectin type III domain containing"""	11185	protein-coding gene	gene with protein product	"""LDLR relative with 11 ligand-binding repeats"""	602005	"""chromosome 11 open reading frame 32"", ""sortilin-related receptor, L(DLR class) A repeats-containing"""	C11orf32		9157966, 8940146	Standard	NM_003105		Approved	gp250, LR11, LRP9, SorLA, SorLA-1	uc001pxx.3	Q92673	OTTHUMG00000166057	ENST00000260197.7:c.1639G>A	11.37:g.121403215G>A	ENSP00000260197:p.Gly547Arg		Somatic					p.G547R	NM_003105	NP_003096	WXS	Illumina HiSeq	Unspecified	Q92673	SORL_HUMAN		BRCA - Breast invasive adenocarcinoma(274;3.34e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.108)	12	1719	+		Breast(109;0.00119)|Medulloblastoma(222;0.0429)|all_neural(223;0.113)	547			Extracellular (Potential).		B2RNX7|Q92856	Missense_Mutation	SNP	ENST00000260197.7	37	c.1639G>A	CCDS8436.1	.	.	.	.	.	.	.	.	.	.	G	27.3	4.815387	0.90790	.	.	ENSG00000137642	ENST00000260197	T	0.60920	0.15	5.03	5.03	0.67393	VPS10 (1);	0.000000	0.85682	D	0.000000	T	0.81118	0.4756	M	0.90019	3.08	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.85685	0.1303	10	0.87932	D	0	.	17.9701	0.89111	0.0:0.0:1.0:0.0	.	547	Q92673	SORL_HUMAN	R	547	ENSP00000260197:G547R	ENSP00000260197:G547R	G	+	1	0	SORL1	120908425	1.000000	0.71417	0.979000	0.43373	0.863000	0.49368	8.020000	0.88740	2.317000	0.78254	0.655000	0.94253	GGA		0.483	SORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387626.2	NM_003105		4	69	0	0	0	0.009096	0	4	69				
RPL13AP20	387841	broad.mit.edu	37	12	13028826	13028826	+	IGR	SNP	G	G	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr12:13028826G>A								DDX47 (45911 upstream) : GPRC5A (14889 downstream)																							TCTGAAGCCTGCAAGAAAGTT	0.567																																							uc010sho.1		NA																	0					0						c.(394-396)GCA>ACA		SubName: Full=Ribosomal protein L13a variant; Flags: Fragment;																																				SO:0001628	intergenic_variant	387841							g.chr12:13028826G>A																													12.37:g.13028826G>A			Somatic					p.A132T	NR_003932		WXS	Illumina HiSeq	Unspecified					1	416	+									Missense_Mutation	SNP		37	c.394G>A																																																																																				0	0.567									3	19	0	0	0	0.009096	0	3	19				
KRAS	3845	broad.mit.edu	37	12	25398285	25398285	+	Missense_Mutation	SNP	C	C	A	rs121913530		TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr12:25398285C>A	ENST00000256078.4	-	2	97	c.34G>T	c.(34-36)Ggt>Tgt	p.G12C	KRAS_ENST00000557334.1_Missense_Mutation_p.G12C|KRAS_ENST00000311936.3_Missense_Mutation_p.G12C|KRAS_ENST00000556131.1_Missense_Mutation_p.G12C	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CCTACGCCACCAGCTCCAACT	0.348	G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	uc001rgp.1	G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12C(CALU1_LUNG)|G12C(NCIH2030_LUNG)|G12C(LU99_LUNG)|G12C(NCIH1792_LUNG)|G12R(KP2_PANCREAS)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(NCIH2122_LUNG)|G12C(NCIH358_LUNG)|G12R(PSN1_PANCREAS)|G12C(KYSE410_OESOPHAGUS)|G12S(A549_LUNG)|G12R(HUPT3_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12C(HCC44_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(SW1463_LARGE_INTESTINE)|G12C(NCIH23_LUNG)|G12C(LU65_LUNG)|G12C(NCIH1373_LUNG)|G12C(MIAPACA2_PANCREAS)|G12R(HS274T_BREAST)|G12S(LS123_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(OV56_OVARY)|G12C(IALM_LUNG)	119		Dom	yes		12	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog			"""L, E, M, O"""			pancreatic|colorectal|lung|thyroid|AML|others		5144	Substitution - Missense(5142)|Insertion - In frame(2)	p.G12D(7175)|p.G12V(4780)|p.G12C(2482)|p.G12A(1180)|p.G12S(1119)|p.G12R(691)|p.G12?(50)|p.G12F(34)|p.G12G(6)|p.G12N(6)|p.G12L(5)|p.G12I(4)|p.G12_G13insG(4)|p.G12E(3)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12fs*3(1)	large_intestine(2360)|lung(1649)|pancreas(656)|biliary_tract(125)|ovary(56)|endometrium(54)|haematopoietic_and_lymphoid_tissue(49)|thyroid(42)|stomach(21)|cervix(19)|upper_aerodigestive_tract(17)|urinary_tract(17)|soft_tissue(15)|small_intestine(13)|prostate(11)|breast(9)|skin(8)|testis(7)|liver(6)|oesophagus(3)|peritoneum(1)|autonomic_ganglia(1)|kidney(1)|central_nervous_system(1)|NS(1)|penis(1)|adrenal_gland(1)	large_intestine(12391)|pancreas(3285)|lung(2847)|biliary_tract(521)|ovary(443)|endometrium(339)|haematopoietic_and_lymphoid_tissue(318)|stomach(203)|thyroid(149)|prostate(85)|soft_tissue(77)|small_intestine(62)|upper_aerodigestive_tract(59)|cervix(49)|urinary_tract(48)|skin(38)|liver(31)|breast(28)|testis(17)|oesophagus(15)|central_nervous_system(9)|peritoneum(6)|salivary_gland(6)|kidney(5)|gastrointestinal_tract_(site_indeterminate)(5)|thymus(5)|eye(4)|autonomic_ganglia(2)|bone(2)|genital_tract(1)|penis(1)|adrenal_gland(1)	21052	GRCh37	CM076251	KRAS	M	rs121913530	c.(34-36)GGT>TGT		c-K-ras2 protein isoform a precursor							93.0	83.0	86.0					12																	25398285		2203	4300	6503	SO:0001583	missense	3845	Cardiofaciocutaneous_syndrome|Noonan_syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	activation of MAPKK activity|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	plasma membrane	GTP binding|GTPase activity|protein binding	g.chr12:25398285C>A	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.34G>T	12.37:g.25398285C>A	ENSP00000256078:p.Gly12Cys	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)	Somatic				KRAS_uc001rgq.1_Missense_Mutation_p.G12C|KRAS_uc001rgr.2_RNA	p.G12C	NM_033360	NP_203524	WXS	Illumina HiSeq	Unspecified	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)		2	215	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		12		G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation).|G -> R (in lung cancer and bladder cancer; somatic mutation).|G -> S (in lung carcinoma and GASC; somatic mutation).|G -> A (in a colorectal cancer sample; somatic mutation).|G -> C (in lung carcinoma; somatic mutation).|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation).	GTP.		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	c.34G>T	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.676185	0.88445	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.79141	-1.24;-1.24;-1.24;-1.24	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90466	0.7014	M	0.90650	3.135	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.993	D	0.91833	0.5477	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	C	12	ENSP00000308495:G12C;ENSP00000452512:G12C;ENSP00000256078:G12C;ENSP00000451856:G12C	ENSP00000256078:G12C	G	-	1	0	KRAS	25289552	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360		6	12	1	0	0.000157383	0.00308	0.000168053	6	12				
DDX11	1663	broad.mit.edu	37	12	31249591	31249592	+	Missense_Mutation	DNP	GT	GT	TA			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	GT	GT	-	-	GT	GT	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr12:31249591_31249592GT>TA	ENST00000407793.2	+	16	1793_1794	c.1542_1543GT>TA	c.(1540-1545)cgGTac>cgTAac	p.Y515N	DDX11_ENST00000539673.1_3'UTR|DDX11_ENST00000350437.4_Missense_Mutation_p.Y515N|DDX11_ENST00000545668.1_Missense_Mutation_p.Y515N|DDX11_ENST00000251758.5_3'UTR|DDX11_ENST00000228264.6_Missense_Mutation_p.Y489N|DDX11_ENST00000542838.1_Missense_Mutation_p.Y515N	NM_030653.3|NM_152438.1	NP_085911.2|NP_689651.1	Q96FC9	DDX11_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box helicase 11	515					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)	p.Y515N(2)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(11)|large_intestine(5)|lung(23)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	57	all_cancers(9;1.77e-11)|all_lung(12;6.21e-11)|all_epithelial(9;6.49e-11)|Lung NSC(12;1.06e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)					TCACTGAACGGTACGGAGCAGT	0.594										Multiple Myeloma(12;0.14)																													uc001rjt.1		NA																	2	Substitution - Missense(2)		lung(2)	breast(3)	3						c.(1540-1545)CGGTAC>CGTAAC		DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11																																				SO:0001583	missense	1663				G2/M transition of mitotic cell cycle|interspecies interaction between organisms|mitotic sister chromatid segregation|positive regulation of cell proliferation|S phase of mitotic cell cycle|sister chromatid cohesion	midbody|nuclear chromatin|nucleolus|spindle pole	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding|RNA binding	g.chr12:31249591_31249592GT>TA	U75969	CCDS8721.1, CCDS41767.1, CCDS44856.1, CCDS58224.1	12p11.21	2012-02-23	2012-02-23		ENSG00000013573	ENSG00000013573		"""DEAD-boxes"""	2736	protein-coding gene	gene with protein product	"""CHL1-like helicase homolog (S. cerevisiae)"""	601150	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11 (S.cerevisiae CHL1-like helicase)"", ""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11"""				Standard	NM_030653		Approved	CHLR1, KRG2, CHL1, ChlR1, WABS	uc001rjv.2	Q96FC9	OTTHUMG00000168435	Exception_encountered	12.37:g.31249591_31249592delinsTA	ENSP00000384703:p.Tyr515Asn	Multiple Myeloma(12;0.14)	Somatic				DDX11_uc001rjr.1_Missense_Mutation_p.Y515N|DDX11_uc001rjs.1_Missense_Mutation_p.Y515N|DDX11_uc001rju.1_Missense_Mutation_p.Y193N|DDX11_uc001rjv.1_Missense_Mutation_p.Y515N|DDX11_uc001rjw.1_Missense_Mutation_p.Y489N|DDX11_uc009zjn.1_RNA	p.Y515N	NM_152438	NP_689651	WXS	Illumina HiSeq	Unspecified	Q96FC9	DDX11_HUMAN			16	1793_1794	+	all_cancers(9;1.77e-11)|all_lung(12;6.21e-11)|all_epithelial(9;6.49e-11)|Lung NSC(12;1.06e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)		515					Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Missense_Mutation	DNP	ENST00000407793.2	37	c.1542_1543GT>TA	CCDS44856.1																																																																																				0.594	DDX11-202	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000399728.1	NM_030653		21	75	0	0	0	0.004672	0	21	75				
ARID2	196528	broad.mit.edu	37	12	46245320	46245320	+	Silent	SNP	G	G	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr12:46245320G>T	ENST00000334344.6	+	15	3586	c.3414G>T	c.(3412-3414)ggG>ggT	p.G1138G	ARID2_ENST00000422737.1_Silent_p.G989G|ARID2_ENST00000444670.1_Silent_p.G748G|ARID2_ENST00000457135.1_5'Flank|ARID2_ENST00000479608.1_3'UTR	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	1138					chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G1138G(1)		NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		CACCCTCAGGGGGAGTACAAA	0.512			"""N, S, F"""		hepatocellular carcinoma																																		uc001ros.1		NA		Rec	yes		12	12q12	196528		AT rich interactive domain 2			E					1	Substitution - coding silent(1)		lung(1)	ovary(6)|skin(3)|upper_aerodigestive_tract(1)	10						c.(3412-3414)GGG>GGT		AT rich interactive domain 2 (ARID, RFX-like)							91.0	87.0	88.0					12																	46245320		2203	4300	6503	SO:0001819	synonymous_variant	196528				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding	g.chr12:46245320G>T		CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.3414G>T	12.37:g.46245320G>T			Somatic				ARID2_uc001ror.2_Silent_p.G1138G|ARID2_uc009zkg.1_Silent_p.G594G|ARID2_uc009zkh.1_Silent_p.G765G|ARID2_uc001rou.1_Silent_p.G472G	p.G1138G	NM_152641	NP_689854	WXS	Illumina HiSeq	Unspecified	Q68CP9	ARID2_HUMAN	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)	15	3414	+	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	1138					Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	Silent	SNP	ENST00000334344.6	37	c.3414G>T	CCDS31783.1																																																																																				0.512	ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318380.2	XM_350875		41	108	1	0	2.37825e-27	0.010771	3.73241e-27	41	108				
KMT2D	8085	broad.mit.edu	37	12	49422684	49422684	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr12:49422684G>A	ENST00000301067.7	-	45	14308	c.14309C>T	c.(14308-14310)cCt>cTt	p.P4770L		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	4770					chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.P4770L(1)|p.P4500L(1)									AGTTGTGACAGGCAGCTTTCC	0.542																																							uc001rta.3		NA								N|F|Mis							medulloblastoma|renal		2	Substitution - Missense(2)		lung(2)	kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						c.(14308-14310)CCT>CTT		myeloid/lymphoid or mixed-lineage leukemia 2							147.0	151.0	150.0					12																	49422684		1955	4159	6114	SO:0001583	missense	8085				chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding	g.chr12:49422684G>A	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.14309C>T	12.37:g.49422684G>A	ENSP00000301067:p.Pro4770Leu	HNSCC(34;0.089)	Somatic					p.P4770L	NM_003482	NP_003473	WXS	Illumina HiSeq	Unspecified	O14686	MLL2_HUMAN			45	14309	-			4770					O14687	Missense_Mutation	SNP	ENST00000301067.7	37	c.14309C>T	CCDS44873.1	.	.	.	.	.	.	.	.	.	.	G	11.49	1.655052	0.29425	.	.	ENSG00000167548	ENST00000301067	T	0.79352	-1.26	5.04	5.04	0.67666	.	0.000000	0.36444	N	0.002594	T	0.61022	0.2314	N	0.14661	0.345	0.39604	D	0.969773	P	0.35844	0.524	B	0.24974	0.057	T	0.69793	-0.5049	10	0.87932	D	0	.	15.6744	0.77303	0.0:0.0:1.0:0.0	.	4770	O14686	MLL2_HUMAN	L	4770	ENSP00000301067:P4770L	ENSP00000301067:P4770L	P	-	2	0	MLL2	47708951	0.983000	0.35010	0.999000	0.59377	0.748000	0.42578	0.652000	0.24888	2.517000	0.84864	0.462000	0.41574	CCT		0.542	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2			86	231	0	0	0	0.01441	0	86	231				
DIP2B	57609	broad.mit.edu	37	12	51065097	51065097	+	Missense_Mutation	SNP	T	T	G			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr12:51065097T>G	ENST00000301180.5	+	5	590	c.556T>G	c.(556-558)Tca>Gca	p.S186A		NM_173602.2	NP_775873.2	Q9P265	DIP2B_HUMAN	DIP2 disco-interacting protein 2 homolog B (Drosophila)	186	Ser-rich.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	catalytic activity (GO:0003824)	p.S186A(1)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(15)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	60						GTCCACTTCTTCATCCGCATC	0.512																																							uc001rwv.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|breast(1)|pancreas(1)	6						c.(556-558)TCA>GCA		DIP2 disco-interacting protein 2 homolog B							145.0	124.0	131.0					12																	51065097		2203	4300	6503	SO:0001583	missense	57609					nucleus	catalytic activity|transcription factor binding	g.chr12:51065097T>G	AB040896	CCDS31799.1	12q13.12	2012-10-02	2006-01-13		ENSG00000066084	ENSG00000066084			29284	protein-coding gene	gene with protein product		611379					Standard	XM_005269044		Approved	KIAA1463, FLJ34278	uc001rwv.3	Q9P265	OTTHUMG00000169475	ENST00000301180.5:c.556T>G	12.37:g.51065097T>G	ENSP00000301180:p.Ser186Ala		Somatic				DIP2B_uc001rwu.2_Missense_Mutation_p.S186A|DIP2B_uc009zls.1_Missense_Mutation_p.S68A	p.S186A	NM_173602	NP_775873	WXS	Illumina HiSeq	Unspecified	Q9P265	DIP2B_HUMAN			5	712	+			186			Ser-rich.		Q6B011|Q8N1L5|Q8NB38	Missense_Mutation	SNP	ENST00000301180.5	37	c.556T>G	CCDS31799.1	.	.	.	.	.	.	.	.	.	.	T	17.82	3.483193	0.63962	.	.	ENSG00000066084	ENST00000455310;ENST00000301180	T	0.25414	1.8	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.49012	0.1532	M	0.73217	2.22	0.58432	D	0.999998	P;D	0.65815	0.568;0.995	B;D	0.73380	0.265;0.98	T	0.40289	-0.9571	10	0.31617	T	0.26	-12.2395	15.3936	0.74774	0.0:0.0:0.0:1.0	.	186;196	Q9P265;E9PHD6	DIP2B_HUMAN;.	A	196;186	ENSP00000301180:S186A	ENSP00000301180:S186A	S	+	1	0	DIP2B	49351364	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.522000	0.81844	2.225000	0.72522	0.477000	0.44152	TCA		0.512	DIP2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404243.1	NM_173602		37	82	0	0	0	0.005524	0	37	82				
CCT2	10576	broad.mit.edu	37	12	69983267	69983267	+	Missense_Mutation	SNP	C	C	T	rs373614293		TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr12:69983267C>T	ENST00000299300.6	+	7	637	c.449C>T	c.(448-450)tCc>tTc	p.S150F	CCT2_ENST00000544368.2_Missense_Mutation_p.S150F|CCT2_ENST00000543146.2_Missense_Mutation_p.S103F	NM_006431.2	NP_006422.1	P78371	TCPB_HUMAN	chaperonin containing TCP1, subunit 2 (beta)	150					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|chaperone-mediated protein complex assembly (GO:0051131)|protein folding (GO:0006457)	cell body (GO:0044297)|chaperonin-containing T-complex (GO:0005832)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|unfolded protein binding (GO:0051082)	p.S150F(1)		central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(10)|ovary(1)|prostate(2)|skin(2)|stomach(1)	24	all_cancers(2;7.7e-106)|Breast(13;2.15e-06)|Esophageal squamous(21;0.187)		Epithelial(6;2.72e-18)|GBM - Glioblastoma multiforme(2;2.58e-10)|Lung(24;0.000185)|OV - Ovarian serous cystadenocarcinoma(12;0.00126)|STAD - Stomach adenocarcinoma(21;0.00501)|Kidney(9;0.143)|LUSC - Lung squamous cell carcinoma(43;0.24)			TTATTTAGTTCCGATGAAGTT	0.299																																							uc001svb.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)|skin(1)	3						c.(448-450)TCC>TTC		chaperonin containing TCP1, subunit 2		C	PHE/SER,PHE/SER	0,4406		0,0,2203	70.0	69.0	69.0		308,449	5.1	1.0	12		69	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	CCT2	NM_001198842.1,NM_006431.2	155,155	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign	103/489,150/536	69983267	1,13005	2203	4300	6503	SO:0001583	missense	10576				'de novo' posttranslational protein folding	nucleus	ATP binding|unfolded protein binding	g.chr12:69983267C>T	AF026293	CCDS8991.1, CCDS55843.1	12q14	2011-09-02						"""Heat Shock Proteins / Chaperonins"""	1615	protein-coding gene	gene with protein product		605139				9819444	Standard	NM_001198842		Approved	Cctb	uc001svb.1	P78371	OTTHUMG00000169383	ENST00000299300.6:c.449C>T	12.37:g.69983267C>T	ENSP00000299300:p.Ser150Phe		Somatic				CCT2_uc009zrm.1_RNA|CCT2_uc009zrn.1_Missense_Mutation_p.S150F|CCT2_uc010stl.1_Missense_Mutation_p.S103F	p.S150F	NM_006431	NP_006422	WXS	Illumina HiSeq	Unspecified	P78371	TCPB_HUMAN	Epithelial(6;2.72e-18)|GBM - Glioblastoma multiforme(2;2.58e-10)|Lung(24;0.000185)|OV - Ovarian serous cystadenocarcinoma(12;0.00126)|STAD - Stomach adenocarcinoma(21;0.00501)|Kidney(9;0.143)|LUSC - Lung squamous cell carcinoma(43;0.24)		7	543	+	all_cancers(2;7.7e-106)|Breast(13;2.15e-06)|Esophageal squamous(21;0.187)		150					A8K402|B5BTY7|B7Z243|B7Z7K4|B7ZAT2|Q14D36|Q6IAT3	Missense_Mutation	SNP	ENST00000299300.6	37	c.449C>T	CCDS8991.1	.	.	.	.	.	.	.	.	.	.	C	14.70	2.614761	0.46631	0.0	1.16E-4	ENSG00000166226	ENST00000299300;ENST00000544368;ENST00000543146	T;T;T	0.79940	-1.32;-1.32;-1.32	6.07	5.11	0.69529	.	0.150709	0.56097	D	0.000027	T	0.72036	0.3411	N	0.17764	0.52	0.45567	D	0.998518	B;B	0.25850	0.021;0.136	B;B	0.39119	0.04;0.291	T	0.64943	-0.6288	9	.	.	.	-22.0481	11.8862	0.52604	0.3687:0.6313:0.0:0.0	.	150;150	F5GWF6;P78371	.;TCPB_HUMAN	F	150;150;103	ENSP00000299300:S150F;ENSP00000441847:S150F;ENSP00000445471:S103F	.	S	+	2	0	CCT2	68269534	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	3.526000	0.53509	2.884000	0.98904	0.655000	0.94253	TCC		0.299	CCT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403818.1	NM_006431		5	39	0	0	0	0.000602	0	5	39				
LGR5	8549	broad.mit.edu	37	12	71978333	71978333	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr12:71978333G>T	ENST00000266674.5	+	18	2854	c.2543G>T	c.(2542-2544)aGc>aTc	p.S848I	LGR5_ENST00000540815.2_Missense_Mutation_p.S824I|RP11-186F10.2_ENST00000546601.1_RNA|LGR5_ENST00000536515.1_Missense_Mutation_p.S776I			O75473	LGR5_HUMAN	leucine-rich repeat containing G protein-coupled receptor 5	848					G-protein coupled receptor signaling pathway (GO:0007186)|inner ear development (GO:0048839)|positive regulation of canonical Wnt signaling pathway (GO:0090263)	integral component of plasma membrane (GO:0005887)|trans-Golgi network membrane (GO:0032588)	G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)	p.S848I(1)	NUP107/LGR5(2)	endometrium(2)|kidney(3)|large_intestine(2)|lung(24)|ovary(1)|pancreas(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(3)	48						AAACACCCAAGCTTGATGTCA	0.448																																							uc001swl.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(4)|skin(3)|ovary(1)|pancreas(1)	9						c.(2542-2544)AGC>ATC		leucine-rich repeat-containing G protein-coupled							145.0	140.0	142.0					12																	71978333		2203	4300	6503	SO:0001583	missense	8549					integral to plasma membrane	protein-hormone receptor activity	g.chr12:71978333G>T	AF062006	CCDS9000.1, CCDS61194.1, CCDS61195.1	12q22-q23	2012-08-21	2011-01-25	2004-11-12				"""GPCR / Class A : Orphans"""	4504	protein-coding gene	gene with protein product		606667	"""G protein-coupled receptor 49"", ""leucine-rich repeat-containing G protein-coupled receptor 5"""	GPR67, GPR49		9642114	Standard	NM_003667		Approved	HG38, FEX	uc001swl.4	O75473	OTTHUMG00000169543	ENST00000266674.5:c.2543G>T	12.37:g.71978333G>T	ENSP00000266674:p.Ser848Ile		Somatic				LGR5_uc001swm.2_Missense_Mutation_p.S824I|LGR5_uc001swn.1_RNA	p.S848I	NM_003667	NP_003658	WXS	Illumina HiSeq	Unspecified	O75473	LGR5_HUMAN			18	2591	+			848			Cytoplasmic (Potential).		D8MCT0|Q4VAM0|Q4VAM2|Q9UP75	Missense_Mutation	SNP	ENST00000266674.5	37	c.2543G>T	CCDS9000.1	.	.	.	.	.	.	.	.	.	.	G	14.56	2.571525	0.45798	.	.	ENSG00000139292	ENST00000266674;ENST00000536515;ENST00000540815	T;T;T	0.40756	1.02;1.02;1.02	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	T	0.60025	0.2237	M	0.70595	2.14	0.37743	D	0.925701	P;P	0.50617	0.937;0.655	P;B	0.53649	0.731;0.231	T	0.63305	-0.6667	10	0.56958	D	0.05	.	20.3552	0.98837	0.0:0.0:1.0:0.0	.	824;848	O75473-2;O75473	.;LGR5_HUMAN	I	848;776;824	ENSP00000266674:S848I;ENSP00000443033:S776I;ENSP00000441035:S824I	ENSP00000266674:S848I	S	+	2	0	LGR5	70264600	1.000000	0.71417	0.993000	0.49108	0.902000	0.53008	4.989000	0.63870	2.812000	0.96745	0.557000	0.71058	AGC		0.448	LGR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404744.1	NM_003667		36	112	1	0	1.06647e-15	0.003755	1.46515e-15	36	112				
KCNC2	3747	broad.mit.edu	37	12	75442064	75442064	+	Missense_Mutation	SNP	G	G	A	rs142936560	byFrequency	TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr12:75442064G>A	ENST00000549446.1	-	4	2329	c.1649C>T	c.(1648-1650)cCg>cTg	p.P550L	KCNC2_ENST00000298972.1_Missense_Mutation_p.P550L|KCNC2_ENST00000550433.1_Missense_Mutation_p.P550L|KCNC2_ENST00000393288.2_Missense_Mutation_p.P550L|KCNC2_ENST00000548513.1_Missense_Mutation_p.P550L|KCNC2_ENST00000350228.2_Intron|KCNC2_ENST00000540018.1_Intron|KCNC2_ENST00000548243.1_Intron|KCNC2_ENST00000341669.3_Missense_Mutation_p.P550L	NM_001260497.1|NM_139137.3	NP_001247426.1|NP_631875.1	Q96PR1	KCNC2_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 2	550					action potential (GO:0001508)|energy reserve metabolic process (GO:0006112)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)	p.P550L(3)		breast(3)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(28)|ovary(1)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	54					Dalfampridine(DB06637)	TGATAGTGGCGGCTCACTTCC	0.483																																							uc001sxg.1		NA																	3	Substitution - Missense(3)	p.P550L(1)	lung(2)|pancreas(1)	breast(2)|pancreas(2)|skin(1)|lung(1)	6						c.(1648-1650)CCG>CTG		Shaw-related voltage-gated potassium channel		G	LEU/PRO,LEU/PRO,	5,4401	9.9+/-24.2	0,5,2198	162.0	134.0	143.0		1649,1649,	3.4	1.0	12	dbSNP_134	143	0,8600		0,0,4300	yes	missense,missense,intron	KCNC2	NM_139136.2,NM_139137.2,NM_153748.1	98,98,	0,5,6498	AA,AG,GG		0.0,0.1135,0.0384	benign,benign,	550/614,550/639,	75442064	5,13001	2203	4300	6503	SO:0001583	missense	3747				energy reserve metabolic process|regulation of insulin secretion	voltage-gated potassium channel complex	voltage-gated potassium channel activity	g.chr12:75442064G>A	AF268896	CCDS9005.1, CCDS9006.1, CCDS9007.1, CCDS58255.1, CCDS58256.1, CCDS58257.1	12q14.1	2012-07-05						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6234	protein-coding gene	gene with protein product		176256				8111118, 16382104	Standard	NM_139136		Approved	Kv3.2	uc001sxg.2	Q96PR1	OTTHUMG00000169717	ENST00000549446.1:c.1649C>T	12.37:g.75442064G>A	ENSP00000449253:p.Pro550Leu		Somatic				KCNC2_uc009zry.2_Missense_Mutation_p.P550L|KCNC2_uc001sxe.2_Missense_Mutation_p.P550L|KCNC2_uc001sxf.2_Intron|KCNC2_uc010stw.1_Intron	p.P550L	NM_139137	NP_631875	WXS	Illumina HiSeq	Unspecified	Q96PR1	KCNC2_HUMAN			4	2193	-			550			Cytoplasmic (Potential).		B7Z231|F5H030|J3KPP5|Q4LE77|Q86W09|Q8N1V9|Q96PR0	Missense_Mutation	SNP	ENST00000549446.1	37	c.1649C>T	CCDS9007.1	.	.	.	.	.	.	.	.	.	.	G	14.55	2.567523	0.45694	0.001135	0.0	ENSG00000166006	ENST00000550433;ENST00000548513;ENST00000549446;ENST00000341669;ENST00000298972;ENST00000393288	D;D;D;D;D;D	0.97041	-4.21;-4.19;-4.21;-4.21;-4.19;-4.22	5.55	3.42	0.39159	.	0.698951	0.13557	N	0.379054	D	0.89273	0.6668	N	0.03608	-0.345	0.38327	D	0.943709	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.04013	0.0;0.001;0.0	D	0.84904	0.0844	10	0.24483	T	0.36	.	7.9207	0.29843	0.0:0.1145:0.4719:0.4136	.	550;550;550	Q96PR1-2;Q96PR1;Q96PR1-3	.;KCNC2_HUMAN;.	L	550	ENSP00000448301:P550L;ENSP00000449941:P550L;ENSP00000449253:P550L;ENSP00000340121:P550L;ENSP00000298972:P550L;ENSP00000376966:P550L	ENSP00000298972:P550L	P	-	2	0	KCNC2	73728331	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.967000	0.49216	2.604000	0.88044	0.585000	0.79938	CCG		0.483	KCNC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405581.2	NM_153748		9	45	0	0	0	0.006214	0	9	45				
MYF6	4618	broad.mit.edu	37	12	81101854	81101854	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr12:81101854G>A	ENST00000228641.3	+	1	578	c.356G>A	c.(355-357)cGa>cAa	p.R119Q		NM_002469.2	NP_002460.1	P23409	MYF6_HUMAN	myogenic factor 6 (herculin)	119	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				muscle cell differentiation (GO:0042692)|muscle cell fate commitment (GO:0042693)|muscle tissue morphogenesis (GO:0060415)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal muscle cell differentiation (GO:0035914)|skeletal muscle tissue development (GO:0007519)|skeletal muscle tissue regeneration (GO:0043403)|somitogenesis (GO:0001756)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R119Q(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(12)|skin(1)	26						CTGAAGCGGCGAACTGTGGCC	0.597																																							uc001szf.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(355-357)CGA>CAA		myogenic factor 6							51.0	56.0	55.0					12																	81101854		2202	4299	6501	SO:0001583	missense	4618				muscle cell fate commitment|positive regulation of muscle cell differentiation|positive regulation of transcription from RNA polymerase II promoter|skeletal muscle tissue development	nucleoplasm	DNA binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity	g.chr12:81101854G>A		CCDS9019.1	12q21	2013-05-21				ENSG00000111046		"""Basic helix-loop-helix proteins"""	7566	protein-coding gene	gene with protein product	"""muscle-specific regulatory factor 4"""	159991				8978788	Standard	NM_002469		Approved	MRF4, bHLHc4	uc001szf.2	P23409		ENST00000228641.3:c.356G>A	12.37:g.81101854G>A	ENSP00000228641:p.Arg119Gln		Somatic					p.R119Q	NM_002469	NP_002460	WXS	Illumina HiSeq	Unspecified	P23409	MYF6_HUMAN			1	409	+			119			Helix-loop-helix motif.		B2R898|Q53X80|Q6FHI9	Missense_Mutation	SNP	ENST00000228641.3	37	c.356G>A	CCDS9019.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.177696	0.78564	.	.	ENSG00000111046	ENST00000228641	D	0.97831	-4.56	5.62	5.62	0.85841	Helix-loop-helix DNA-binding (5);	0.046141	0.85682	D	0.000000	D	0.97433	0.9160	L	0.52011	1.625	0.53688	D	0.999973	D	0.64830	0.994	P	0.54100	0.742	D	0.96399	0.9295	10	0.26408	T	0.33	.	19.6517	0.95819	0.0:0.0:1.0:0.0	.	119	P23409	MYF6_HUMAN	Q	119	ENSP00000228641:R119Q	ENSP00000228641:R119Q	R	+	2	0	MYF6	79625985	1.000000	0.71417	0.402000	0.26371	0.997000	0.91878	6.169000	0.71913	2.662000	0.90505	0.655000	0.94253	CGA		0.597	MYF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407756.1	NM_002469		36	101	0	0	0	0.010771	0	36	101				
HAL	3034	broad.mit.edu	37	12	96374622	96374622	+	Missense_Mutation	SNP	C	C	A	rs181093412	byFrequency	TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr12:96374622C>A	ENST00000261208.3	-	16	1675	c.1307G>T	c.(1306-1308)gGa>gTa	p.G436V	HAL_ENST00000538703.1_Missense_Mutation_p.G436V|HAL_ENST00000541929.1_Missense_Mutation_p.G228V	NM_002108.3	NP_002099.1	P42357	HUTH_HUMAN	histidine ammonia-lyase	436					biosynthetic process (GO:0009058)|cellular nitrogen compound metabolic process (GO:0034641)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	histidine ammonia-lyase activity (GO:0004397)	p.G436V(1)		NS(2)|breast(1)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	34					L-Histidine(DB00117)	AACTGTCTCTCCCCTATTGGC	0.423																																					NSCLC(169;943 2815 23563 30031)	NSCLC(169;943 2815 23563 30031)	uc001tem.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(1306-1308)GGA>GTA		histidine ammonia-lyase	L-Histidine(DB00117)						104.0	105.0	105.0					12																	96374622		2203	4300	6503	SO:0001583	missense	3034				biosynthetic process|histidine catabolic process	cytosol	histidine ammonia-lyase activity	g.chr12:96374622C>A		CCDS9058.1, CCDS58264.1, CCDS58265.1	12q22-q24.1	1991-07-12				ENSG00000084110	4.3.1.3		4806	protein-coding gene	gene with protein product		609457		HIS			Standard	NM_002108		Approved		uc001tem.2	P42357	OTTHUMG00000170354	ENST00000261208.3:c.1307G>T	12.37:g.96374622C>A	ENSP00000261208:p.Gly436Val		Somatic				HAL_uc009zti.1_RNA|HAL_uc010suw.1_Missense_Mutation_p.G228V|HAL_uc010sux.1_Missense_Mutation_p.G436V	p.G436V	NM_002108	NP_002099	WXS	Illumina HiSeq	Unspecified	P42357	HUTH_HUMAN			16	1604	-			436					B4DQC1|B4E0V8|F5GXF2|F5H1U5|Q4VB92|Q4VB93	Missense_Mutation	SNP	ENST00000261208.3	37	c.1307G>T	CCDS9058.1	.	.	.	.	.	.	.	.	.	.	C	8.645	0.896858	0.17686	.	.	ENSG00000084110	ENST00000261208;ENST00000541929;ENST00000538703	T;T;T	0.80123	-1.34;-1.34;-1.34	5.95	5.07	0.68467	L-Aspartase-like (1);	0.046947	0.85682	D	0.000000	D	0.82806	0.5117	M	0.91406	3.205	0.80722	D	1	B;B	0.22541	0.008;0.071	B;B	0.23716	0.028;0.048	T	0.81881	-0.0729	10	0.72032	D	0.01	-12.4967	7.4586	0.27280	0.0:0.6884:0.1317:0.1799	.	436;436	F5GXF2;P42357	.;HUTH_HUMAN	V	436;228;436	ENSP00000261208:G436V;ENSP00000446364:G228V;ENSP00000440861:G436V	ENSP00000261208:G436V	G	-	2	0	HAL	94898753	1.000000	0.71417	0.907000	0.35723	0.070000	0.16714	3.187000	0.50950	1.544000	0.49359	-0.119000	0.15052	GGA		0.423	HAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408644.1			37	114	1	0	3.54909e-21	0.011902	5.28766e-21	37	114				
GAS2L3	283431	broad.mit.edu	37	12	101005791	101005791	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr12:101005791G>C	ENST00000539410.1	+	5	703	c.317G>C	c.(316-318)aGa>aCa	p.R106T	GAS2L3_ENST00000547754.1_Missense_Mutation_p.R106T|GAS2L3_ENST00000537247.1_Missense_Mutation_p.R2T|GAS2L3_ENST00000266754.5_Missense_Mutation_p.R106T			Q86XJ1	GA2L3_HUMAN	growth arrest-specific 2 like 3	106	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin cytoskeleton organization (GO:0030036)|cell cycle arrest (GO:0007050)|microtubule cytoskeleton organization (GO:0000226)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)	actin binding (GO:0003779)|microtubule binding (GO:0008017)	p.R106T(1)		endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(15)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	35						TTTCCAATGAGAAAAGTGCCC	0.348																																							uc001thu.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(316-318)AGA>ACA		growth arrest-specific 2 like 3							103.0	102.0	102.0					12																	101005791		2203	4300	6503	SO:0001583	missense	283431				cell cycle arrest			g.chr12:101005791G>C	AK095594	CCDS9079.1	12q23.1	2014-09-11			ENSG00000139354	ENSG00000139354			27475	protein-coding gene	gene with protein product							Standard	NM_174942		Approved		uc001thu.3	Q86XJ1	OTTHUMG00000170439	ENST00000539410.1:c.317G>C	12.37:g.101005791G>C	ENSP00000439672:p.Arg106Thr		Somatic				GAS2L3_uc009zty.2_Missense_Mutation_p.R106T|GAS2L3_uc001thv.2_Missense_Mutation_p.R2T	p.R106T	NM_174942	NP_777602	WXS	Illumina HiSeq	Unspecified	Q86XJ1	GA2L3_HUMAN			6	543	+			106			CH.		B2RCN2	Missense_Mutation	SNP	ENST00000539410.1	37	c.317G>C	CCDS9079.1	.	.	.	.	.	.	.	.	.	.	G	12.20	1.866913	0.32977	.	.	ENSG00000139354	ENST00000266754;ENST00000547754;ENST00000537247;ENST00000539410	T;T;T;T	0.42900	0.96;0.96;1.42;0.96	5.81	4.91	0.64330	Calponin homology domain (5);	0.289408	0.43416	D	0.000564	T	0.37183	0.0994	L	0.53249	1.67	0.26466	N	0.975352	B	0.19331	0.035	B	0.25614	0.062	T	0.14727	-1.0462	10	0.18710	T	0.47	-9.2967	11.633	0.51187	0.135:0.0:0.865:0.0	.	106	Q86XJ1	GA2L3_HUMAN	T	106;106;2;106	ENSP00000266754:R106T;ENSP00000448955:R106T;ENSP00000442406:R2T;ENSP00000439672:R106T	ENSP00000266754:R106T	R	+	2	0	GAS2L3	99529922	1.000000	0.71417	1.000000	0.80357	0.702000	0.40608	2.696000	0.47052	2.763000	0.94921	0.558000	0.71614	AGA		0.348	GAS2L3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409143.1	NM_174942		21	76	0	0	0	0.010504	0	21	76				
MYO1H	283446	broad.mit.edu	37	12	109841826	109841826	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr12:109841826G>T	ENST00000431443.2	+	6	742	c.742G>T	c.(742-744)Gac>Tac	p.D248Y	MYO1H_ENST00000310903.5_Missense_Mutation_p.D248Y|MYO1H_ENST00000542883.1_3'UTR	NM_001101421.3	NP_001094891.3	Q8N1T3	MYO1H_HUMAN	myosin IH	248	Myosin motor.					myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.D248Y(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(17)|prostate(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	47						TGACAAGAATGACTGGAAAAC	0.418																																							uc010sxn.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(742-744)GAC>TAC		myosin 1H							101.0	104.0	103.0					12																	109841826		1895	4115	6010	SO:0001583	missense	283446					myosin complex	motor activity	g.chr12:109841826G>T		CCDS53826.1	12q24.11	2011-09-27			ENSG00000174527	ENSG00000174527		"""Myosins / Myosin superfamily : Class I"""	13879	protein-coding gene	gene with protein product		614636					Standard	NM_001101421		Approved	FLJ37587	uc010sxn.1	Q8N1T3	OTTHUMG00000169252	ENST00000431443.2:c.742G>T	12.37:g.109841826G>T	ENSP00000444076:p.Asp248Tyr		Somatic					p.D248Y	NM_001101421	NP_001094891	WXS	Illumina HiSeq	Unspecified	Q8N1T3	MYO1H_HUMAN			6	742	+			Error:Variant_position_missing_in_B4DNW6_after_alignment					F5H3C6	Missense_Mutation	SNP	ENST00000431443.2	37	c.742G>T		.	.	.	.	.	.	.	.	.	.	G	19.41	3.822862	0.71028	.	.	ENSG00000174527	ENST00000310903;ENST00000431443	T;T	0.73469	-0.75;-0.75	4.79	4.79	0.61399	.	.	.	.	.	D	0.87398	0.6167	M	0.91872	3.25	0.44966	D	0.99798	D	0.89917	1.0	D	0.74023	0.982	D	0.89330	0.3646	9	0.87932	D	0	.	10.8442	0.46733	0.0871:0.0:0.9129:0.0	.	248	F5H3C6	.	Y	248	ENSP00000439182:D248Y;ENSP00000444076:D248Y	ENSP00000439182:D248Y	D	+	1	0	MYO1H	108326209	1.000000	0.71417	0.967000	0.41034	0.915000	0.54546	3.604000	0.54081	2.389000	0.81357	0.650000	0.86243	GAC		0.418	MYO1H-201	KNOWN	basic	protein_coding	protein_coding		NM_173597		6	27	1	0	3.09899e-07	0.004482	3.54975e-07	6	27				
MYL2	4633	broad.mit.edu	37	12	111356969	111356969	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr12:111356969C>A	ENST00000228841.8	-	2	79	c.32G>T	c.(31-33)gGg>gTg	p.G11V	MYL2_ENST00000548438.1_Missense_Mutation_p.G11V	NM_000432.3	NP_000423.2	P10916	MLRV_HUMAN	myosin, light chain 2, regulatory, cardiac, slow	11					cardiac muscle contraction (GO:0060048)|cardiac myofibril assembly (GO:0055003)|heart contraction (GO:0060047)|muscle cell fate specification (GO:0042694)|muscle fiber development (GO:0048747)|muscle filament sliding (GO:0030049)|negative regulation of cell growth (GO:0030308)|post-embryonic development (GO:0009791)|regulation of striated muscle contraction (GO:0006942)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|myofibril (GO:0030016)|myosin complex (GO:0016459)|sarcomere (GO:0030017)	actin monomer binding (GO:0003785)|calcium ion binding (GO:0005509)|myosin heavy chain binding (GO:0032036)|structural constituent of muscle (GO:0008307)	p.G11V(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)	12						GTTGGCGCCCCCGGCTCTCTT	0.502																																					GBM(14;268 426 18829 21617 25540)	GBM(14;268 426 18829 21617 25540)	uc001try.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(31-33)GGG>GTG		slow cardiac myosin regulatory light chain 2							88.0	81.0	83.0					12																	111356969		2203	4300	6503	SO:0001583	missense	4633				cardiac myofibril assembly|heart contraction|muscle filament sliding|negative regulation of cell growth|regulation of striated muscle contraction|ventricular cardiac muscle tissue morphogenesis	cytosol|myosin complex|sarcomere	actin monomer binding|calcium ion binding|myosin heavy chain binding|structural constituent of muscle	g.chr12:111356969C>A		CCDS31901.1	12q24.11	2014-09-17	2006-09-29		ENSG00000111245	ENSG00000111245		"""Myosins / Light chain"", ""EF-hand domain containing"""	7583	protein-coding gene	gene with protein product	"""cardiac ventricular myosin light chain 2"""	160781	"""myosin, light polypeptide 2, regulatory, cardiac, slow"""			1386340	Standard	NM_000432		Approved	CMH10	uc001try.4	P10916	OTTHUMG00000169535	ENST00000228841.8:c.32G>T	12.37:g.111356969C>A	ENSP00000228841:p.Gly11Val		Somatic				MYL2_uc001trx.3_5'UTR	p.G11V	NM_000432	NP_000423	WXS	Illumina HiSeq	Unspecified	P10916	MLRV_HUMAN			2	103	-			11					Q16123	Missense_Mutation	SNP	ENST00000228841.8	37	c.32G>T	CCDS31901.1	.	.	.	.	.	.	.	.	.	.	C	7.951	0.744824	0.15710	.	.	ENSG00000111245	ENST00000228841;ENST00000548438	T;T	0.79141	-0.92;-1.24	5.33	4.18	0.49190	.	0.152449	0.64402	D	0.000019	T	0.72415	0.3457	L	0.59436	1.845	0.36289	D	0.856281	B	0.12013	0.005	B	0.08055	0.003	T	0.72253	-0.4347	10	0.59425	D	0.04	.	10.1545	0.42814	0.0:0.0803:0.0:0.9197	.	11	P10916	MLRV_HUMAN	V	11	ENSP00000228841:G11V;ENSP00000447154:G11V	ENSP00000228841:G11V	G	-	2	0	MYL2	109841352	0.998000	0.40836	0.125000	0.21846	0.110000	0.19582	3.756000	0.55205	0.873000	0.35799	-0.340000	0.08031	GGG		0.502	MYL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404677.2	NM_000432		10	41	1	0	6.40141e-05	0.010729	6.93617e-05	10	41				
MED13L	23389	broad.mit.edu	37	12	116401214	116401214	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr12:116401214T>A	ENST00000281928.3	-	30	6704	c.6498A>T	c.(6496-6498)ttA>ttT	p.L2166F	RP11-493P1.2_ENST00000549725.1_RNA	NM_015335.4	NP_056150.1	Q71F56	MD13L_HUMAN	mediator complex subunit 13-like	2166						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)	p.L2166F(1)		NS(2)|breast(1)|endometrium(9)|kidney(3)|large_intestine(18)|lung(34)|ovary(4)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	85	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0407)		GTATCTACCTTAAAACATCCG	0.428																																							uc001tvw.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(4)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)	8						c.(6496-6498)TTA>TTT		mediator complex subunit 13-like							118.0	102.0	108.0					12																	116401214		2203	4300	6503	SO:0001583	missense	23389				regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent			g.chr12:116401214T>A	AB028948	CCDS9177.1	12q24.22	2010-07-29	2007-07-30	2007-07-30	ENSG00000123066	ENSG00000123066			22962	protein-coding gene	gene with protein product		608771	"""thyroid hormone receptor associated protein 2"""	THRAP2			Standard	NM_015335		Approved	KIAA1025, TRAP240L	uc001tvw.3	Q71F56	OTTHUMG00000169404	ENST00000281928.3:c.6498A>T	12.37:g.116401214T>A	ENSP00000281928:p.Leu2166Phe		Somatic					p.L2166F	NM_015335	NP_056150	WXS	Illumina HiSeq	Unspecified	Q71F56	MD13L_HUMAN		BRCA - Breast invasive adenocarcinoma(302;0.0407)	30	6553	-	all_neural(191;0.117)|Medulloblastoma(191;0.163)		2166					A1L469|Q68DN4|Q9H8C0|Q9NSY9|Q9UFD8|Q9UPX5	Missense_Mutation	SNP	ENST00000281928.3	37	c.6498A>T	CCDS9177.1	.	.	.	.	.	.	.	.	.	.	T	24.0	4.485174	0.84854	.	.	ENSG00000123066	ENST00000281928	D	0.90900	-2.75	5.61	3.01	0.34805	.	0.000000	0.64402	D	0.000001	D	0.94251	0.8154	M	0.85630	2.765	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.93068	0.6480	10	0.87932	D	0	.	5.9798	0.19401	0.0:0.2994:0.0:0.7006	.	2166	Q71F56	MD13L_HUMAN	F	2166	ENSP00000281928:L2166F	ENSP00000281928:L2166F	L	-	3	2	MED13L	114885597	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	0.556000	0.23438	1.081000	0.41110	0.533000	0.62120	TTA		0.428	MED13L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403879.3			22	47	0	0	0	0.00278	0	22	47				
ATP8A2	51761	broad.mit.edu	37	13	26148945	26148945	+	Splice_Site	SNP	G	G	C			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr13:26148945G>C	ENST00000381655.2	+	19	1804		c.e19-1		ATP8A2_ENST00000255283.8_Splice_Site|ATP8A2_ENST00000491840.1_Splice_Site	NM_016529.4	NP_057613.4	Q9NTI2	AT8A2_HUMAN	ATPase, aminophospholipid transporter, class I, type 8A, member 2						aging (GO:0007568)|axonogenesis (GO:0007409)|detection of light stimulus involved in visual perception (GO:0050908)|eating behavior (GO:0042755)|inner ear morphogenesis (GO:0042472)|involuntary skeletal muscle contraction (GO:0003011)|negative regulation of cell proliferation (GO:0008285)|neurofilament cytoskeleton organization (GO:0060052)|neuromuscular process controlling posture (GO:0050884)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phospholipid translocation (GO:0061092)|response to auditory stimulus (GO:0010996)|retina layer formation (GO:0010842)|skin development (GO:0043588)	cell projection (GO:0042995)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.?(1)		breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(17)|lung(31)|ovary(4)|skin(3)|stomach(1)|urinary_tract(1)	72		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)		TCTTCCTTTAGATGGGACAGG	0.333																																							uc001uqk.2		NA																	1	Unknown(1)		lung(1)	ovary(2)|large_intestine(1)|skin(1)	4						c.e19-1		ATPase, aminophospholipid transporter-like,							118.0	115.0	116.0					13																	26148945		1834	4084	5918	SO:0001630	splice_region_variant	51761				ATP biosynthetic process|negative regulation of cell proliferation	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity	g.chr13:26148945G>C	AL137256	CCDS41873.1	13q12	2010-04-20	2010-03-31		ENSG00000132932	ENSG00000132932	3.6.3.1	"""ATPases / P-type"""	13533	protein-coding gene	gene with protein product		605870	"""ATPase, aminophospholipid transporter-like, Class I, type 8A, member 2"", ""ATPase, aminophospholipid transporter-like, class I, type 8A, member 2"""			11015572, 19778899	Standard	NM_016529		Approved	ATPIB, ML-1	uc001uqk.3	Q9NTI2	OTTHUMG00000016611	ENST00000381655.2:c.1663-1G>C	13.37:g.26148945G>C			Somatic				ATP8A2_uc010tdi.1_Splice_Site_p.M515_splice|ATP8A2_uc010tdj.1_Splice_Site|ATP8A2_uc010aaj.1_Splice_Site_p.M65_splice	p.M555_splice	NM_016529	NP_057613	WXS	Illumina HiSeq	Unspecified	Q9NTI2	AT8A2_HUMAN		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)	19	1805	+		Breast(139;0.0201)|Lung SC(185;0.0225)						Q9H527|Q9NPU6|Q9NTL2|Q9NYM3	Splice_Site	SNP	ENST00000381655.2	37	c.1663_splice	CCDS41873.1	.	.	.	.	.	.	.	.	.	.	G	16.73	3.204395	0.58234	.	.	ENSG00000132932	ENST00000381655;ENST00000255283;ENST00000544544	.	.	.	5.38	5.38	0.77491	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.1327	0.93414	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ATP8A2	25046945	1.000000	0.71417	0.998000	0.56505	0.797000	0.45037	7.623000	0.83113	2.520000	0.84964	0.563000	0.77884	.		0.333	ATP8A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044236.2	NM_016529	Intron	22	41	0	0	0	0.005443	0	22	41				
POSTN	10631	broad.mit.edu	37	13	38172804	38172804	+	Silent	SNP	G	G	A	rs138966400	byFrequency	TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr13:38172804G>A	ENST00000379747.4	-	1	177	c.60C>T	c.(58-60)aaC>aaT	p.N20N	POSTN_ENST00000541179.1_Silent_p.N20N|POSTN_ENST00000379742.4_Silent_p.N20N|POSTN_ENST00000379749.4_Silent_p.N20N|POSTN_ENST00000541481.1_Silent_p.N20N|POSTN_ENST00000379743.4_Silent_p.N20N	NM_006475.2	NP_006466.2	Q15063	POSTN_HUMAN	periostin, osteoblast specific factor	20					cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of Notch signaling pathway (GO:0008593)|skeletal system development (GO:0001501)|tissue development (GO:0009888)	proteinaceous extracellular matrix (GO:0005578)|trans-Golgi network (GO:0005802)	heparin binding (GO:0008201)	p.N20N(1)		cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(16)|lung(22)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	59		Lung NSC(96;2.09e-05)|Prostate(109;0.0513)|Breast(139;0.0538)|Lung SC(185;0.0743)		all cancers(112;2.48e-08)|Epithelial(112;2.78e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000853)|BRCA - Breast invasive adenocarcinoma(63;0.013)|GBM - Glioblastoma multiforme(144;0.0154)		GATTGTTGGCGTTTATAGGGT	0.413																																							uc001uwo.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(58-60)AAC>AAT		periostin, osteoblast specific factor isoform 1		G	,,,	2,4404	4.2+/-10.8	0,2,2201	156.0	144.0	148.0		60,60,60,60	-7.8	0.6	13	dbSNP_134	148	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	POSTN	NM_001135934.1,NM_001135935.1,NM_001135936.1,NM_006475.2	,,,	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	,,,	20/780,20/782,20/752,20/837	38172804	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	10631				cell adhesion|skeletal system development	proteinaceous extracellular matrix	heparin binding	g.chr13:38172804G>A	D13665	CCDS9364.1, CCDS45034.1, CCDS53864.1, CCDS66530.1, CCDS66531.1	13q13.3	2008-02-05			ENSG00000133110	ENSG00000133110			16953	protein-coding gene	gene with protein product		608777				8363580, 12235007	Standard	NM_006475		Approved	OSF-2, PN, periostin	uc001uwo.4	Q15063	OTTHUMG00000016751	ENST00000379747.4:c.60C>T	13.37:g.38172804G>A			Somatic				POSTN_uc001uwp.3_Silent_p.N20N|POSTN_uc001uwr.2_Silent_p.N20N|POSTN_uc001uwq.2_Silent_p.N20N|POSTN_uc010teu.1_Silent_p.N20N|POSTN_uc010tev.1_Silent_p.N20N|POSTN_uc010tew.1_Silent_p.N20N|POSTN_uc010tex.1_Intron	p.N20N	NM_006475	NP_006466	WXS	Illumina HiSeq	Unspecified	Q15063	POSTN_HUMAN		all cancers(112;2.48e-08)|Epithelial(112;2.78e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000853)|BRCA - Breast invasive adenocarcinoma(63;0.013)|GBM - Glioblastoma multiforme(144;0.0154)	1	178	-		Lung NSC(96;2.09e-05)|Prostate(109;0.0513)|Breast(139;0.0538)|Lung SC(185;0.0743)	20					B1ALD8|C0IMJ1|C0IMJ2|C0IMJ4|D2KRH7|F5H628|Q15064|Q29XZ0|Q3KPJ5|Q5VSY5|Q8IZF9	Silent	SNP	ENST00000379747.4	37	c.60C>T	CCDS9364.1																																																																																				0.413	POSTN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044566.2	NM_006475		8	53	0	0	0	0.004482	0	8	53				
TNFSF11	8600	broad.mit.edu	37	13	43181007	43181007	+	Nonsense_Mutation	SNP	C	C	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr13:43181007C>T	ENST00000239849.6	+	5	1058	c.907C>T	c.(907-909)Cag>Tag	p.Q303*	TNFSF11_ENST00000405262.2_Nonsense_Mutation_p.Q230*|TNFSF11_ENST00000398795.2_Nonsense_Mutation_p.Q230*|TNFSF11_ENST00000358545.2_Nonsense_Mutation_p.Q230*|TNFSF11_ENST00000544862.1_Nonsense_Mutation_p.Q230*			O14788	TNF11_HUMAN	tumor necrosis factor (ligand) superfamily, member 11	303					activation of JUN kinase activity (GO:0007257)|bone resorption (GO:0045453)|calcium ion homeostasis (GO:0055074)|cytokine-mediated signaling pathway (GO:0019221)|ERK1 and ERK2 cascade (GO:0070371)|immune response (GO:0006955)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell proliferation (GO:0033598)|monocyte chemotaxis (GO:0002548)|organ morphogenesis (GO:0009887)|ossification (GO:0001503)|osteoclast differentiation (GO:0030316)|osteoclast proliferation (GO:0002158)|positive regulation of bone resorption (GO:0045780)|positive regulation of corticotropin-releasing hormone secretion (GO:0051466)|positive regulation of ERK1 and ERK2 cascade via TNFSF11-mediated signaling (GO:0071848)|positive regulation of fever generation by positive regulation of prostaglandin secretion (GO:0071812)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of JNK cascade (GO:0046330)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of osteoclast development (GO:2001206)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell activation (GO:0050870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homooligomerization (GO:0051260)|TNFSF11-mediated signaling pathway (GO:0071847)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)	cytokine activity (GO:0005125)|tumor necrosis factor receptor binding (GO:0005164)|tumor necrosis factor receptor superfamily binding (GO:0032813)	p.Q303*(1)		kidney(1)|large_intestine(4)|lung(3)|prostate(1)|urinary_tract(1)	10		Lung NSC(96;1.11e-05)|Breast(139;0.00868)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000249)|GBM - Glioblastoma multiforme(144;0.00119)|BRCA - Breast invasive adenocarcinoma(63;0.073)	Denosumab(DB06643)|Lenalidomide(DB00480)	GGATCCGGATCAGGATGCAAC	0.398																																							uc001uyu.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(907-909)CAG>TAG		tumor necrosis factor ligand superfamily, member							92.0	95.0	94.0					13																	43181007		2203	4300	6503	SO:0001587	stop_gained	8600				immune response|monocyte chemotaxis|osteoclast differentiation|positive regulation of bone resorption|positive regulation of corticotropin-releasing hormone secretion|positive regulation of ERK1 and ERK2 cascade via TNFSF11-mediated signaling|positive regulation of fever generation by positive regulation of prostaglandin secretion|positive regulation of homotypic cell-cell adhesion|positive regulation of NF-kappaB transcription factor activity|positive regulation of osteoclast differentiation|positive regulation of T cell activation	cytoplasm|extracellular space|integral to plasma membrane	cytokine activity|receptor activity|tumor necrosis factor receptor binding	g.chr13:43181007C>T	AF013171	CCDS9384.1, CCDS9385.1	13q14	2008-02-05			ENSG00000120659	ENSG00000120659		"""Tumor necrosis factor (ligand) superfamily"", ""CD molecules"""	11926	protein-coding gene	gene with protein product		602642				9312132, 9367155	Standard	NM_003701		Approved	TRANCE, RANKL, OPGL, ODF, CD254	uc001uyu.2	O14788	OTTHUMG00000016807	ENST00000239849.6:c.907C>T	13.37:g.43181007C>T	ENSP00000239849:p.Gln303*		Somatic				TNFSF11_uc001uyt.2_Nonsense_Mutation_p.Q230*	p.Q303*	NM_003701	NP_003692	WXS	Illumina HiSeq	Unspecified	O14788	TNF11_HUMAN		OV - Ovarian serous cystadenocarcinoma(117;0.000249)|GBM - Glioblastoma multiforme(144;0.00119)|BRCA - Breast invasive adenocarcinoma(63;0.073)	5	1056	+		Lung NSC(96;1.11e-05)|Breast(139;0.00868)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)	303			Extracellular (Potential).		O14723|Q96Q17|Q9P2Q3	Nonsense_Mutation	SNP	ENST00000239849.6	37	c.907C>T	CCDS9384.1	.	.	.	.	.	.	.	.	.	.	C	37	6.527957	0.97637	.	.	ENSG00000120659	ENST00000358545;ENST00000405262;ENST00000239849;ENST00000398795;ENST00000544862	.	.	.	5.74	5.74	0.90152	.	0.200286	0.45606	D	0.000358	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.36615	T	0.2	-20.1209	20.2982	0.98569	0.0:1.0:0.0:0.0	.	.	.	.	X	230;230;303;230;230	.	ENSP00000239849:Q303X	Q	+	1	0	TNFSF11	42079007	1.000000	0.71417	1.000000	0.80357	0.775000	0.43874	5.317000	0.65822	2.873000	0.98535	0.563000	0.77884	CAG		0.398	TNFSF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044702.2			49	102	0	0	0	0.01441	0	49	102				
DIAPH3	81624	broad.mit.edu	37	13	60582753	60582753	+	Silent	SNP	T	T	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr13:60582753T>A	ENST00000400324.4	-	9	1159	c.939A>T	c.(937-939)tcA>tcT	p.S313S	DIAPH3_ENST00000400320.1_Silent_p.S267S|DIAPH3_ENST00000465066.1_5'UTR|DIAPH3_ENST00000400319.1_Silent_p.S243S|DIAPH3_ENST00000267215.4_Silent_p.S313S|DIAPH3_ENST00000400330.1_Silent_p.S313S|DIAPH3_ENST00000377908.2_Silent_p.S302S	NM_001042517.1|NM_001258366.1	NP_001035982.1|NP_001245295.1	Q9NSV4	DIAP3_HUMAN	diaphanous-related formin 3	313	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				actin cytoskeleton organization (GO:0030036)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.S313S(1)		cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|liver(1)|lung(20)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	46		Breast(118;0.052)|Prostate(109;0.103)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;2.77e-05)		CTTCACCAGCTGAAGTTAAAG	0.328																																							uc001vht.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(937-939)TCA>TCT		diaphanous homolog 3 isoform a							88.0	91.0	90.0					13																	60582753		1792	4059	5851	SO:0001819	synonymous_variant	81624				actin cytoskeleton organization		actin binding|Rho GTPase binding	g.chr13:60582753T>A	AL137718	CCDS41898.1, CCDS58294.1, CCDS58295.1, CCDS58296.1, CCDS58297.1, CCDS73579.1, CCDS73580.1	13q21.2	2013-05-24	2013-05-24		ENSG00000139734	ENSG00000139734			15480	protein-coding gene	gene with protein product		614567	"""diaphanous (Drosophila, homolog) 3"", ""auditory neuropathy, autosomal dominant 1"", ""diaphanous homolog 3 (Drosophila)"""	AUNA1		14767582, 20624953	Standard	NM_030932		Approved	DRF3, FLJ34705, AN, NSDAN	uc001vht.4	Q9NSV4	OTTHUMG00000017004	ENST00000400324.4:c.939A>T	13.37:g.60582753T>A			Somatic				DIAPH3_uc001vhu.2_Silent_p.S50S|DIAPH3_uc001vhw.1_Silent_p.S302S|DIAPH3_uc010aed.1_Silent_p.S267S|DIAPH3_uc010aee.1_Silent_p.S243S	p.S313S	NM_001042517	NP_001035982	WXS	Illumina HiSeq	Unspecified	Q9NSV4	DIAP3_HUMAN		GBM - Glioblastoma multiforme(99;2.77e-05)	9	1158	-		Breast(118;0.052)|Prostate(109;0.103)|Hepatocellular(98;0.132)	313			GBD/FH3.		A2A3B8|A2A3B9|A2A3C0|Q18P99|Q18PA0|Q18PA1|Q2KPB6|Q3ZK23|Q5JTP8|Q5T2S7|Q5XKF6|Q6MZF0|Q6NUP0|Q86VS4|Q8NAV4	Silent	SNP	ENST00000400324.4	37	c.939A>T	CCDS41898.1																																																																																				0.328	DIAPH3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045166.3	NM_001042517		17	119	0	0	0	0.006122	0	17	119				
KLHL1	57626	broad.mit.edu	37	13	70413137	70413137	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr13:70413137T>C	ENST00000377844.4	-	6	2144	c.1385A>G	c.(1384-1386)tAt>tGt	p.Y462C	KLHL1_ENST00000545028.1_Missense_Mutation_p.Y269C	NM_020866.2	NP_065917.1	Q9NR64	KLHL1_HUMAN	kelch-like family member 1	462					actin cytoskeleton organization (GO:0030036)|adult walking behavior (GO:0007628)|cerebellar Purkinje cell layer development (GO:0021680)|dendrite development (GO:0016358)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	actin binding (GO:0003779)	p.Y462C(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(56)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	84		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)		TCCTACAGCATACAAAGTTCC	0.348																																							uc001vip.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1384-1386)TAT>TGT		kelch-like 1 protein							123.0	115.0	118.0					13																	70413137		2200	4299	6499	SO:0001583	missense	57626				actin cytoskeleton organization	cytoplasm|cytoskeleton	actin binding	g.chr13:70413137T>C	AB040923	CCDS9445.1, CCDS73582.1	13q21	2013-01-30	2013-01-30		ENSG00000150361	ENSG00000150361		"""Kelch-like"", ""BTB/POZ domain containing"""	6352	protein-coding gene	gene with protein product	"""Kelch-like protein 1"", ""Mayven-related protein 2"""	605332	"""kelch (Drosophila)-like 1"", ""kelch-like 1 (Drosophila)"""			10888605	Standard	NM_020866		Approved	KIAA1490, MRP2, FLJ30047	uc001vip.3	Q9NR64	OTTHUMG00000017056	ENST00000377844.4:c.1385A>G	13.37:g.70413137T>C	ENSP00000367075:p.Tyr462Cys		Somatic				KLHL1_uc010thm.1_Missense_Mutation_p.Y401C	p.Y462C	NM_020866	NP_065917	WXS	Illumina HiSeq	Unspecified	Q9NR64	KLHL1_HUMAN		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)	6	2179	-		Breast(118;0.000162)	462			Kelch 1.		A8K5X0|Q5VZ64|Q9H4X4|Q9NR65|Q9P238	Missense_Mutation	SNP	ENST00000377844.4	37	c.1385A>G	CCDS9445.1	.	.	.	.	.	.	.	.	.	.	T	17.12	3.309298	0.60414	.	.	ENSG00000150361	ENST00000377844;ENST00000545028	D;D	0.91686	-2.89;-2.89	5.14	5.14	0.70334	Galactose oxidase, beta-propeller (1);	0.000000	0.51477	D	0.000083	D	0.97701	0.9246	H	0.98682	4.3	0.41603	D	0.988863	D;D	0.76494	0.999;0.999	D;D	0.77004	0.989;0.981	D	0.99764	1.1022	10	0.87932	D	0	.	15.2513	0.73549	0.0:0.0:0.0:1.0	.	462;462	Q8TBJ7;Q9NR64	.;KLHL1_HUMAN	C	462;269	ENSP00000367075:Y462C;ENSP00000439602:Y269C	ENSP00000367075:Y462C	Y	-	2	0	KLHL1	69311138	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	3.858000	0.55979	2.074000	0.62210	0.482000	0.46254	TAT		0.348	KLHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045231.3	NM_020866		4	7	0	0	0	0.009096	0	4	7				
SLITRK1	114798	broad.mit.edu	37	13	84454289	84454289	+	Silent	SNP	G	G	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr13:84454289G>A	ENST00000377084.2	-	1	2239	c.1354C>T	c.(1354-1356)Ctg>Ttg	p.L452L		NM_001281503.1|NM_052910.1	NP_001268432.1|NP_443142.1	Q96PX8	SLIK1_HUMAN	SLIT and NTRK-like family, member 1	452					adult behavior (GO:0030534)|axonogenesis (GO:0007409)|homeostatic process (GO:0042592)|multicellular organism growth (GO:0035264)	integral component of membrane (GO:0016021)		p.L452L(1)		NS(2)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(36)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	80	Medulloblastoma(90;0.18)	Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.07)		TCCACGTTCAGGTACTCTAGG	0.512																																							uc001vlk.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5						c.(1354-1356)CTG>TTG		slit and trk like 1 protein precursor							103.0	93.0	96.0					13																	84454289		2203	4300	6503	SO:0001819	synonymous_variant	114798					integral to membrane		g.chr13:84454289G>A	AB067497	CCDS9464.1	13q31.1	2004-01-08	2004-01-08		ENSG00000178235	ENSG00000178235			20297	protein-coding gene	gene with protein product		609678	"""leucine rich repeat containing 12"""	LRRC12		14557068, 12975309	Standard	NM_001281503		Approved	KIAA1910	uc001vlk.3	Q96PX8	OTTHUMG00000017149	ENST00000377084.2:c.1354C>T	13.37:g.84454289G>A			Somatic					p.L452L	NM_052910	NP_443142	WXS	Illumina HiSeq	Unspecified	Q96PX8	SLIK1_HUMAN		GBM - Glioblastoma multiforme(99;0.07)	1	2240	-	Medulloblastoma(90;0.18)	Breast(118;0.212)	452			Extracellular (Potential).|LRR 10.		Q5U5I6|Q96SF9	Silent	SNP	ENST00000377084.2	37	c.1354C>T	CCDS9464.1																																																																																				0.512	SLITRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045396.1	NM_052910		54	139	0	0	0	0.01441	0	54	139				
SLITRK5	26050	broad.mit.edu	37	13	88330366	88330366	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr13:88330366A>G	ENST00000325089.6	+	2	2942	c.2723A>G	c.(2722-2724)gAc>gGc	p.D908G	SLITRK5_ENST00000400028.3_Missense_Mutation_p.D667G	NM_015567.1	NP_056382.1	O94991	SLIK5_HUMAN	SLIT and NTRK-like family, member 5	908					adult behavior (GO:0030534)|axonogenesis (GO:0007409)|cardiovascular system development (GO:0072358)|dendrite morphogenesis (GO:0048813)|grooming behavior (GO:0007625)|response to xenobiotic stimulus (GO:0009410)|skin development (GO:0043588)|striatum development (GO:0021756)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)		p.D908G(1)		breast(1)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(14)|lung(40)|ovary(2)|pancreas(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(4)	81	all_neural(89;0.101)|Medulloblastoma(90;0.163)					GGGGCAGGGGACAGCAGGCTA	0.552																																							uc001vln.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|pancreas(2)|central_nervous_system(1)	5						c.(2722-2724)GAC>GGC		SLIT and NTRK-like family, member 5 precursor							72.0	80.0	77.0					13																	88330366		2203	4300	6503	SO:0001583	missense	26050					integral to membrane		g.chr13:88330366A>G	AB020725	CCDS9465.1	13q31.1	2004-04-16	2004-01-08		ENSG00000165300	ENSG00000165300			20295	protein-coding gene	gene with protein product		609680	"""leucine rich repeat containing 11"""	LRRC11		10048485, 14557068	Standard	NM_015567		Approved	bA364G4.2, KIAA0918	uc001vln.3	O94991	OTTHUMG00000017167	ENST00000325089.6:c.2723A>G	13.37:g.88330366A>G	ENSP00000366283:p.Asp908Gly		Somatic				SLITRK5_uc010tic.1_Missense_Mutation_p.D667G	p.D908G	NM_015567	NP_056382	WXS	Illumina HiSeq	Unspecified	O94991	SLIK5_HUMAN			2	2942	+	all_neural(89;0.101)|Medulloblastoma(90;0.163)		908			Cytoplasmic (Potential).		B3KNB8|B4DSH5|Q5VT81	Missense_Mutation	SNP	ENST00000325089.6	37	c.2723A>G	CCDS9465.1	.	.	.	.	.	.	.	.	.	.	A	13.04	2.117014	0.37339	.	.	ENSG00000165300	ENST00000325089;ENST00000400028	T;T	0.62105	0.05;0.39	5.77	5.77	0.91146	.	0.534993	0.17990	N	0.155251	T	0.48333	0.1494	L	0.27053	0.805	0.31954	N	0.609348	B;B	0.29531	0.116;0.247	B;B	0.28139	0.043;0.086	T	0.54984	-0.8211	9	.	.	.	-16.1662	12.4942	0.55918	1.0:0.0:0.0:0.0	.	667;908	B4DSH5;O94991	.;SLIK5_HUMAN	G	908;667	ENSP00000366283:D908G;ENSP00000442244:D667G	.	D	+	2	0	SLITRK5	87128367	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.406000	0.66357	2.200000	0.70718	0.459000	0.35465	GAC		0.552	SLITRK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045416.3			40	251	0	0	0	0.007835	0	40	251				
NALCN	259232	broad.mit.edu	37	13	101755543	101755543	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr13:101755543C>A	ENST00000251127.6	-	26	3118	c.3037G>T	c.(3037-3039)Ggc>Tgc	p.G1013C		NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective	1013					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)	p.G1013C(1)		NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					TCCTTGAAGCCGCTGAAAAGT	0.453																																							uc001vox.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(8)|breast(4)|skin(2)|pancreas(1)|central_nervous_system(1)	16						c.(3037-3039)GGC>TGC		voltage gated channel like 1							107.0	114.0	112.0					13																	101755543		2203	4300	6503	SO:0001583	missense	259232					integral to membrane	sodium channel activity|voltage-gated ion channel activity	g.chr13:101755543C>A	AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.3037G>T	13.37:g.101755543C>A	ENSP00000251127:p.Gly1013Cys		Somatic					p.G1013C	NM_052867	NP_443099	WXS	Illumina HiSeq	Unspecified	Q8IZF0	NALCN_HUMAN			26	3226	-	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		1013			Cytoplasmic (Potential).		Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Missense_Mutation	SNP	ENST00000251127.6	37	c.3037G>T	CCDS9498.1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.457994	0.84317	.	.	ENSG00000102452	ENST00000251127	D	0.98419	-4.92	5.03	5.03	0.67393	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98937	0.9639	M	0.80028	2.48	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99861	1.1083	10	0.87932	D	0	.	18.7562	0.91833	0.0:1.0:0.0:0.0	.	1013	Q8IZF0	NALCN_HUMAN	C	1013	ENSP00000251127:G1013C	ENSP00000251127:G1013C	G	-	1	0	NALCN	100553544	1.000000	0.71417	0.978000	0.43139	0.924000	0.55760	7.345000	0.79337	2.488000	0.83962	0.650000	0.86243	GGC		0.453	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045663.2	NM_052867		38	108	1	0	8.69298e-16	0.006999	1.198e-15	38	108				
RNASE11	122651	broad.mit.edu	37	14	21052268	21052268	+	Silent	SNP	G	G	T	rs199907192		TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr14:21052268G>T	ENST00000610205.1	-	3	549	c.366C>A	c.(364-366)cgC>cgA	p.R122R	RNASE11_ENST00000555841.1_Silent_p.R122R|RNASE11_ENST00000553849.1_Silent_p.R122R|RNASE11_ENST00000432835.2_Silent_p.R122R|RNASE11_ENST00000398009.2_Silent_p.R122R|RNASE11_ENST00000398008.2_Silent_p.R122R	NM_145250.3	NP_660293.1	Q8TAA1	RNS11_HUMAN	ribonuclease, RNase A family, 11 (non-active)	122						extracellular region (GO:0005576)	endonuclease activity (GO:0004519)|nucleic acid binding (GO:0003676)	p.R122R(1)		endometrium(1)|large_intestine(6)|lung(7)|ovary(3)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	21	all_cancers(95;0.00238)	all_lung(585;0.235)	Epithelial(56;1.85e-06)|all cancers(55;1.46e-05)	GBM - Glioblastoma multiforme(265;0.0139)		CTGTGGAGCTGCGGATGAAGT	0.488																																							uc010ahv.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)	3						c.(364-366)CGC>CGA		ribonuclease, RNase A family, 11 (non-active)							94.0	79.0	84.0					14																	21052268		2203	4300	6503	SO:0001819	synonymous_variant	122651					extracellular region	nucleic acid binding|pancreatic ribonuclease activity	g.chr14:21052268G>T	BC025410	CCDS9553.1	14q11.1	2013-08-05	2004-11-18	2004-11-18	ENSG00000173464	ENSG00000173464		"""Ribonucleases, RNase A"""	19269	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 6"""	C14orf6			Standard	NM_145250		Approved		uc001vxs.3	Q8TAA1	OTTHUMG00000170990	ENST00000610205.1:c.366C>A	14.37:g.21052268G>T			Somatic				RNASE11_uc010ahx.2_Silent_p.R122R|RNASE11_uc010ahw.2_Silent_p.R122R|RNASE11_uc001vxs.2_Silent_p.R122R	p.R122R	NM_145250	NP_660293	WXS	Illumina HiSeq	Unspecified	Q8TAA1	RNS11_HUMAN	Epithelial(56;1.85e-06)|all cancers(55;1.46e-05)	GBM - Glioblastoma multiforme(265;0.0139)	2	551	-	all_cancers(95;0.00238)	all_lung(585;0.235)	122						Silent	SNP	ENST00000610205.1	37	c.366C>A	CCDS9553.1																																																																																				0.488	RNASE11-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073662.3	NM_145250		22	59	1	0	0.00188189	0.012319	0.0019807	22	59				
CMTM5	116173	broad.mit.edu	37	14	23847613	23847613	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr14:23847613C>A	ENST00000339180.4	+	2	398	c.182C>A	c.(181-183)gCc>gAc	p.A61D	CMTM5_ENST00000555731.1_Intron|CMTM5_ENST00000342473.4_Intron|CMTM5_ENST00000397227.3_Intron|CMTM5_ENST00000382809.2_Missense_Mutation_p.A61D|CMTM5_ENST00000359320.3_Missense_Mutation_p.A61D			Q96DZ9	CKLF5_HUMAN	CKLF-like MARVEL transmembrane domain containing 5	61	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				chemotaxis (GO:0006935)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)		p.A61D(2)		endometrium(1)|large_intestine(1)|lung(4)|prostate(1)|stomach(1)	8	all_cancers(95;2e-05)			GBM - Glioblastoma multiforme(265;0.0064)|READ - Rectum adenocarcinoma(4;0.0276)|Colorectal(4;0.0382)		GCCTACATGGCCGCGGCGCTA	0.572																																							uc010akm.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(181-183)GCC>GAC		chemokine-like factor superfamily 5 isoform a							206.0	161.0	176.0					14																	23847613		2203	4300	6503	SO:0001583	missense	116173				chemotaxis	extracellular space|integral to membrane	cytokine activity	g.chr14:23847613C>A	BC013109	CCDS9598.1, CCDS32050.1, CCDS73617.1, CCDS73618.1, CCDS73619.1	14q11.2	2005-11-08	2005-11-08	2005-11-08	ENSG00000166091	ENSG00000166091			19176	protein-coding gene	gene with protein product		607888	"""chemokine-like factor super family 5"", ""chemokine-like factor superfamily 5"""	CKLFSF5			Standard	NM_138460		Approved	FLJ37521	uc001wjs.3	Q96DZ9	OTTHUMG00000028751	ENST00000339180.4:c.182C>A	14.37:g.23847613C>A	ENSP00000344819:p.Ala61Asp		Somatic				CMTM5_uc001wjs.2_Missense_Mutation_p.A61D|CMTM5_uc001wjt.2_Missense_Mutation_p.A61D|CMTM5_uc010akn.2_Intron|CMTM5_uc001wju.2_Intron|CMTM5_uc010ako.2_Intron	p.A61D	NM_138460	NP_612469	WXS	Illumina HiSeq	Unspecified	Q96DZ9	CKLF5_HUMAN		GBM - Glioblastoma multiforme(265;0.0064)|READ - Rectum adenocarcinoma(4;0.0276)|Colorectal(4;0.0382)	2	626	+	all_cancers(95;2e-05)		61			Helical; (Potential).|MARVEL.		E9PH91|Q5PY48	Missense_Mutation	SNP	ENST00000339180.4	37	c.182C>A		.	.	.	.	.	.	.	.	.	.	C	21.3	4.125772	0.77436	.	.	ENSG00000166091	ENST00000359320;ENST00000382809;ENST00000339180	T;T;T	0.50813	1.42;0.73;1.42	5.94	5.05	0.67936	Marvel (1);	0.102906	0.43747	D	0.000531	T	0.60637	0.2284	L	0.53249	1.67	0.37873	D	0.930122	D;D;D	0.76494	0.98;0.963;0.999	P;P;D	0.66351	0.731;0.572;0.943	T	0.65639	-0.6119	10	0.87932	D	0	-28.2628	12.1518	0.54053	0.0:0.9185:0.0:0.0815	.	61;61;61	Q96DZ9;E9PH91;Q96DZ9-2	CKLF5_HUMAN;.;.	D	61	ENSP00000352270:A61D;ENSP00000372259:A61D;ENSP00000344819:A61D	ENSP00000344819:A61D	A	+	2	0	CMTM5	22917453	0.978000	0.34361	0.970000	0.41538	0.852000	0.48524	2.508000	0.45450	2.816000	0.96949	0.563000	0.77884	GCC		0.572	CMTM5-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000133708.2			82	137	1	0	1.15773e-35	0.01441	1.9122e-35	82	137				
EMC9	51016	broad.mit.edu	37	14	24610337	24610337	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr14:24610337C>G	ENST00000419198.2	-	1	457	c.177G>C	c.(175-177)atG>atC	p.M59I	EMC9_ENST00000216799.4_Missense_Mutation_p.M59I|PSME2_ENST00000471700.2_5'Flank|EMC9_ENST00000560403.1_Intron|RP11-468E2.5_ENST00000558478.1_lincRNA|EMC9_ENST00000558200.1_5'UTR			Q9Y3B6	EMC9_HUMAN	ER membrane protein complex subunit 9	59						cytoplasm (GO:0005737)|ER membrane protein complex (GO:0072546)		p.M59I(1)									CGACCTCCAACATGACGGACA	0.652											OREG0022618	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001wmi.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(175-177)ATG>ATC		hypothetical protein LOC51016							88.0	96.0	93.0					14																	24610337		2203	4300	6503	SO:0001583	missense	51016							g.chr14:24610337C>G	BF346999	CCDS9613.1	14q12	2012-05-30	2012-05-30	2012-05-30	ENSG00000100908	ENSG00000100908			20273	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 122"", ""family with sequence similarity 158, member A"""	C14orf122, FAM158A		22119785	Standard	NM_016049		Approved	CGI-112	uc001wmi.3	Q9Y3B6	OTTHUMG00000028796	ENST00000419198.2:c.177G>C	14.37:g.24610337C>G	ENSP00000403210:p.Met59Ile		Somatic	OREG0022618	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	772		p.M59I	NM_016049	NP_057133	WXS	Illumina HiSeq	Unspecified	Q9Y3B6	F158A_HUMAN			2	340	-			59					D3DS60|Q9BUM3	Missense_Mutation	SNP	ENST00000419198.2	37	c.177G>C	CCDS9613.1	.	.	.	.	.	.	.	.	.	.	C	15.62	2.888658	0.52014	.	.	ENSG00000100908	ENST00000419198;ENST00000216799	T;T	0.48522	0.81;0.81	5.84	5.84	0.93424	.	0.203295	0.52532	D	0.000080	T	0.35278	0.0926	L	0.28054	0.825	0.38259	D	0.941834	B	0.21225	0.053	B	0.20955	0.032	T	0.20207	-1.0282	10	0.32370	T	0.25	-10.3475	12.5543	0.56244	0.1662:0.8338:0.0:0.0	.	59	Q9Y3B6	F158A_HUMAN	I	59	ENSP00000403210:M59I;ENSP00000216799:M59I	ENSP00000216799:M59I	M	-	3	0	FAM158A	23680177	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.198000	0.51035	2.768000	0.95171	0.561000	0.74099	ATG		0.652	EMC9-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071917.4	NM_016049		55	168	0	0	0	0.01441	0	55	168				
TSSK4	283629	broad.mit.edu	37	14	24676508	24676508	+	Nonsense_Mutation	SNP	T	T	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr14:24676508T>A	ENST00000287913.6	+	3	765	c.597T>A	c.(595-597)tgT>tgA	p.C199*	CHMP4A_ENST00000542700.2_5'Flank|TSSK4_ENST00000339917.5_Nonsense_Mutation_p.C209*|TM9SF1_ENST00000530611.1_Intron|TSSK4_ENST00000556621.1_Nonsense_Mutation_p.C123*|TM9SF1_ENST00000556387.1_Intron|TSSK4_ENST00000428351.2_Intron|AL136419.6_ENST00000565988.1_RNA			Q6SA08	TSSK4_HUMAN	testis-specific serine kinase 4	199	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|positive regulation of CREB transcription factor activity (GO:0032793)|protein phosphorylation (GO:0006468)|spermatogenesis (GO:0007283)		ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)	p.C199*(2)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)	8				GBM - Glioblastoma multiforme(265;0.018)		AGACTTACTGTGGCAGCTTTG	0.527																																							uc001wng.2		NA																	2	Substitution - Nonsense(2)		lung(2)		0						c.(595-597)TGT>TGA		testis-specific serine kinase 4							212.0	168.0	183.0					14																	24676508		2203	4300	6503	SO:0001587	stop_gained	283629				cell differentiation|multicellular organismal development|positive regulation of CREB transcription factor activity|spermatogenesis		ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity	g.chr14:24676508T>A	AF542390	CCDS9618.1, CCDS53890.1	14q11.2	2006-03-31	2005-03-10	2005-03-12	ENSG00000139908	ENSG00000139908			19825	protein-coding gene	gene with protein product	"""chromosome 14 open reading frame 20"""	610711	"""serine/threonine kinase 22E"""	C14orf20, STK22E			Standard	NM_174944		Approved		uc001wnh.3	Q6SA08	OTTHUMG00000029323	ENST00000287913.6:c.597T>A	14.37:g.24676508T>A	ENSP00000287913:p.Cys199*		Somatic				TM9SF1_uc010tob.1_Intron|TSSK4_uc001wne.2_Nonsense_Mutation_p.C123*|TSSK4_uc001wnf.2_Nonsense_Mutation_p.C129*|TSSK4_uc001wnh.2_Nonsense_Mutation_p.C209*	p.C199*	NM_174944	NP_777604	WXS	Illumina HiSeq	Unspecified	Q6SA08	TSSK4_HUMAN		GBM - Glioblastoma multiforme(265;0.018)	3	765	+			199			Protein kinase.		Q2TA60|Q6ZNM2	Nonsense_Mutation	SNP	ENST00000287913.6	37	c.597T>A	CCDS9618.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	25.1|25.1	4.600741|4.600741	0.87055|0.87055	.|.	.|.	ENSG00000139908|ENSG00000139908	ENST00000339917;ENST00000556621;ENST00000287913|ENST00000553766	.|.	.|.	.|.	5.25|5.25	2.87|2.87	0.33458|0.33458	.|.	0.000000|.	0.64402|.	D|.	0.000009|.	.|T	.|0.54983	.|0.1892	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.45906	.|-0.9229	.|4	0.02654|.	T|.	1|.	.|.	6.7151|6.7151	0.23298|0.23298	0.0:0.2672:0.0:0.7328|0.0:0.2672:0.0:0.7328	.|.	.|.	.|.	.|.	X|E	209;123;199|16	.|.	ENSP00000287913:C199X|.	C|V	+|+	3|2	2|0	TSSK4|TSSK4	23746348|23746348	0.971000|0.971000	0.33674|0.33674	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	0.008000|0.008000	0.13197|0.13197	0.449000|0.449000	0.26747|0.26747	-0.290000|-0.290000	0.09829|0.09829	TGT|GTG		0.527	TSSK4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000073139.3	NM_174944		98	201	0	0	0	0.01441	0	98	201				
STRN3	29966	broad.mit.edu	37	14	31374709	31374709	+	Silent	SNP	T	T	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr14:31374709T>A	ENST00000357479.5	-	15	2140	c.1944A>T	c.(1942-1944)gtA>gtT	p.V648V	STRN3_ENST00000355683.5_Silent_p.V564V	NM_001083893.1	NP_001077362.1	Q13033	STRN3_HUMAN	striatin, calmodulin binding protein 3	648					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to estradiol (GO:0032355)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	armadillo repeat domain binding (GO:0070016)|calmodulin binding (GO:0005516)|protein complex binding (GO:0032403)|protein phosphatase 2A binding (GO:0051721)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.V564V(1)|p.V648V(1)		NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	20	Hepatocellular(127;0.0877)|Breast(36;0.148)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)|BRCA - Breast invasive adenocarcinoma(188;0.0805)	GBM - Glioblastoma multiforme(265;0.0124)		TGAAAGAGGTTACCATATGAG	0.368																																							uc001wqu.2		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(1942-1944)GTA>GTT		nuclear autoantigen isoform 1							118.0	106.0	110.0					14																	31374709		2203	4300	6503	SO:0001819	synonymous_variant	29966				negative regulation of estrogen receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|response to estradiol stimulus	cytoplasm|dendrite|Golgi apparatus|neuronal cell body|nucleoplasm|nucleus|plasma membrane|protein complex	armadillo repeat domain binding|calmodulin binding|protein complex binding|protein phosphatase 2A binding|sequence-specific DNA binding transcription factor activity	g.chr14:31374709T>A		CCDS9641.1, CCDS41938.1	14q13-q21	2013-01-10			ENSG00000196792	ENSG00000196792		"""WD repeat domain containing"""	15720	protein-coding gene	gene with protein product	"""cell cycle S/G2 nuclear autoantigen"""	614766				7864889, 10681496	Standard	NM_014574		Approved	SG2NA	uc001wqu.2	Q13033	OTTHUMG00000140201	ENST00000357479.5:c.1944A>T	14.37:g.31374709T>A			Somatic				STRN3_uc001wqv.2_Silent_p.V564V|STRN3_uc010tpj.1_RNA	p.V648V	NM_001083893	NP_001077362	WXS	Illumina HiSeq	Unspecified	Q13033	STRN3_HUMAN	LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)|BRCA - Breast invasive adenocarcinoma(188;0.0805)	GBM - Glioblastoma multiforme(265;0.0124)	15	2160	-	Hepatocellular(127;0.0877)|Breast(36;0.148)		648					A2RTX7|A6NHZ7|Q9NRA5	Silent	SNP	ENST00000357479.5	37	c.1944A>T	CCDS41938.1																																																																																				0.368	STRN3-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409713.1	NM_014574		4	21	0	0	0	0.001168	0	4	21				
MDGA2	161357	broad.mit.edu	37	14	47504503	47504503	+	Silent	SNP	T	T	A	rs146423621	byFrequency	TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr14:47504503T>A	ENST00000399232.2	-	8	1687	c.1323A>T	c.(1321-1323)ccA>ccT	p.P441P	MDGA2_ENST00000426342.1_Silent_p.P212P|MDGA2_ENST00000357362.3_Silent_p.P212P|MDGA2_ENST00000439988.3_Silent_p.P510P	NM_001113498.2	NP_001106970.3	Q7Z553	MDGA2_HUMAN	MAM domain containing glycosylphosphatidylinositol anchor 2	441					pattern specification process (GO:0007389)|spinal cord motor neuron differentiation (GO:0021522)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.P212P(2)|p.P510P(1)		breast(3)|endometrium(4)|kidney(2)|large_intestine(14)|lung(41)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(5)	76						TCAGATTGGGTGGAACTTGAA	0.373																																							uc001wwj.3		NA																	3	Substitution - coding silent(3)		lung(3)	ovary(4)|large_intestine(1)|pancreas(1)	6						c.(1321-1323)CCA>CCT		MAM domain containing 1 isoform 1							119.0	98.0	105.0					14																	47504503		1834	4089	5923	SO:0001819	synonymous_variant	161357				spinal cord motor neuron differentiation	anchored to membrane|plasma membrane		g.chr14:47504503T>A	AI859192	CCDS41948.1, CCDS45098.1, CCDS45098.2, CCDS45098.3	14q21.2	2013-01-29	2007-04-03	2007-04-03	ENSG00000139915	ENSG00000139915		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19835	protein-coding gene	gene with protein product		611128	"""MAM domain containing 1"""	MAMDC1		15019943	Standard	NM_001113498		Approved		uc001wwj.4	Q7Z553	OTTHUMG00000029429	ENST00000399232.2:c.1323A>T	14.37:g.47504503T>A			Somatic				MDGA2_uc001wwi.3_Silent_p.P212P|MDGA2_uc010ani.2_Intron	p.P441P	NM_001113498	NP_001106970	WXS	Illumina HiSeq	Unspecified	Q7Z553	MDGA2_HUMAN			8	1519	-			441					F6W3S7|J3KPX6	Silent	SNP	ENST00000399232.2	37	c.1323A>T		.	.	.	.	.	.	.	.	.	.	T	8.835	0.940824	0.18281	.	.	ENSG00000139915	ENST00000554762	.	.	.	5.66	5.66	0.87406	.	.	.	.	.	T	0.61515	0.2353	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.60880	-0.7175	4	.	.	.	.	10.033	0.42111	0.1504:0.0:0.0:0.8496	.	.	.	.	S	216	.	.	T	-	1	0	MDGA2	46574253	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.726000	0.25984	2.163000	0.67991	0.482000	0.46254	ACC		0.373	MDGA2-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000073352.5	NM_182830		24	44	0	0	0	0.003954	0	24	44				
SAV1	60485	broad.mit.edu	37	14	51131974	51131974	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr14:51131974T>C	ENST00000324679.4	-	2	821	c.458A>G	c.(457-459)cAt>cGt	p.H153R	RP11-248J18.2_ENST00000602954.1_RNA	NM_021818.3	NP_068590.1	Q9H4B6	SAV1_HUMAN	salvador family WW domain containing protein 1	153					hair follicle development (GO:0001942)|hippo signaling (GO:0035329)|intestinal epithelial cell differentiation (GO:0060575)|keratinocyte differentiation (GO:0030216)|lung epithelial cell differentiation (GO:0060487)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of epithelial cell proliferation (GO:0050680)|positive regulation of apoptotic process (GO:0043065)|regulation of stem cell maintenance (GO:2000036)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)		p.H153R(1)		breast(1)|kidney(2)|lung(2)|prostate(1)	6	all_epithelial(31;0.000611)|Breast(41;0.0333)					GTAGTCTTCATGTGCACGATC	0.383																																							uc001wyg.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(457-459)CAT>CGT		WW45 protein							42.0	44.0	43.0					14																	51131974		2200	4295	6495	SO:0001583	missense	60485				hippo signaling cascade	cytoplasm|nucleus	identical protein binding	g.chr14:51131974T>C	AK023071	CCDS9701.1	14q13-q23	2014-04-14	2014-04-14		ENSG00000151748	ENSG00000151748			17795	protein-coding gene	gene with protein product	"""WW domain-containing adaptor 45"""	607203	"""salvador homolog 1 (Drosophila)"""			12202036, 11027580	Standard	NM_021818		Approved	WW45, WWP4, salvador	uc001wyh.2	Q9H4B6	OTTHUMG00000140293	ENST00000324679.4:c.458A>G	14.37:g.51131974T>C	ENSP00000324729:p.His153Arg		Somatic				SAV1_uc001wyh.1_Missense_Mutation_p.H153R	p.H153R	NM_021818	NP_068590	WXS	Illumina HiSeq	Unspecified	Q9H4B6	SAV1_HUMAN			3	619	-	all_epithelial(31;0.000611)|Breast(41;0.0333)		153					A8K4B8|D3DSB6|Q6IA58|Q9H949|Q9HAK9	Missense_Mutation	SNP	ENST00000324679.4	37	c.458A>G	CCDS9701.1	.	.	.	.	.	.	.	.	.	.	T	13.36	2.214769	0.39102	.	.	ENSG00000151748	ENST00000555720;ENST00000324679;ENST00000535862;ENST00000553731	T;T	0.43688	0.94;0.96	5.29	4.13	0.48395	.	0.260089	0.44285	D	0.000466	T	0.25568	0.0622	L	0.27053	0.805	0.34448	D	0.700394	B	0.13145	0.007	B	0.08055	0.003	T	0.25467	-1.0131	10	0.05833	T	0.94	-5.7012	11.6384	0.51217	0.0:0.0:0.1491:0.8509	.	153	Q9H4B6	SAV1_HUMAN	R	85;153;120;37	ENSP00000451492:H85R;ENSP00000324729:H153R	ENSP00000324729:H153R	H	-	2	0	SAV1	50201724	0.998000	0.40836	0.999000	0.59377	0.883000	0.51084	2.694000	0.47035	0.832000	0.34804	0.460000	0.39030	CAT		0.383	SAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276879.1			17	40	0	0	0	0.00333	0	17	40				
SPTB	6710	broad.mit.edu	37	14	65216089	65216089	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr14:65216089G>T	ENST00000556626.1	-	36	7064	c.6922C>A	c.(6922-6924)Ccc>Acc	p.P2308T	SPTB_ENST00000342835.4_5'UTR|SPTB_ENST00000389722.3_Missense_Mutation_p.P2308T			P11277	SPTB1_HUMAN	spectrin, beta, erythrocytic	0					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)	actin cytoskeleton (GO:0015629)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ankyrin binding (GO:0030506)|structural constituent of cytoskeleton (GO:0005200)	p.P2308T(1)		breast(5)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(36)|ovary(8)|pancreas(1)|prostate(4)|skin(10)|urinary_tract(3)	106		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		CTGGCGTCGGGGCCGGAGAGG	0.652																																							uc001xhr.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(7)|skin(2)|lung(1)|central_nervous_system(1)	11						c.(6922-6924)CCC>ACC		spectrin beta isoform a							44.0	40.0	41.0					14																	65216089		2203	4300	6503	SO:0001583	missense	6710				actin filament capping|axon guidance	cell surface|cytosol|intrinsic to internal side of plasma membrane|protein complex|spectrin|spectrin-associated cytoskeleton	actin filament binding|structural constituent of cytoskeleton	g.chr14:65216089G>T		CCDS32099.1, CCDS32100.1	14q24.1-q24.2	2013-01-10	2008-07-29			ENSG00000070182		"""Pleckstrin homology (PH) domain containing"""	11274	protein-coding gene	gene with protein product	"""spherocytosis, clinical type I"""	182870				2209094	Standard	NM_001024858		Approved		uc001xhr.3	P11277		ENST00000556626.1:c.6922C>A	14.37:g.65216089G>T	ENSP00000451752:p.Pro2308Thr		Somatic				SPTB_uc001xhs.2_Missense_Mutation_p.P2308T|SPTB_uc010aqi.2_Missense_Mutation_p.P1004T	p.P2308T	NM_001024858	NP_001020029	WXS	Illumina HiSeq	Unspecified	P11277	SPTB1_HUMAN		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)	35	6976	-		all_lung(585;4.15e-09)	Error:Variant_position_missing_in_P11277_after_alignment					Q15510|Q15519	Missense_Mutation	SNP	ENST00000556626.1	37	c.6922C>A	CCDS32099.1	.	.	.	.	.	.	.	.	.	.	G	0.123	-1.123564	0.01770	.	.	ENSG00000070182	ENST00000389723;ENST00000389722;ENST00000335612;ENST00000553938;ENST00000556626	T;T;T	0.69685	-0.42;0.32;-0.42	4.85	2.79	0.32731	.	0.502780	0.17515	N	0.171465	T	0.31702	0.0805	N	0.02539	-0.55	0.80722	D	1	B;B	0.06786	0.001;0.001	B;B	0.08055	0.003;0.002	T	0.04737	-1.0930	10	0.11794	T	0.64	.	2.7865	0.05375	0.0987:0.1233:0.2873:0.4907	.	1127;2312	E7EV95;Q59FP5	.;.	T	2312;2308;1127;1008;2308	ENSP00000374372:P2308T;ENSP00000451324:P1008T;ENSP00000451752:P2308T	ENSP00000334218:P1127T	P	-	1	0	SPTB	64285842	0.757000	0.28394	0.228000	0.23943	0.034000	0.12701	0.032000	0.13732	0.397000	0.25310	-0.449000	0.05564	CCC		0.652	SPTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414076.1			8	9	1	0	1.58986e-06	0.008291	1.79317e-06	8	9				
ZFP36L1	677	broad.mit.edu	37	14	69256990	69256990	+	Nonsense_Mutation	SNP	C	C	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr14:69256990C>A	ENST00000439696.2	-	2	578	c.277G>T	c.(277-279)Gaa>Taa	p.E93*	ZFP36L1_ENST00000555997.1_3'UTR|ZFP36L1_ENST00000336440.3_Nonsense_Mutation_p.E93*	NM_001244701.1|NM_004926.3	NP_001231630.1|NP_004917.2	Q07352	TISB_HUMAN	ZFP36 ring finger protein-like 1	93					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|T cell differentiation in thymus (GO:0033077)|vasculogenesis (GO:0001570)	cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E93*(1)		breast(4)|kidney(1)|large_intestine(1)|liver(2)|lung(9)|ovary(1)|prostate(2)|urinary_tract(1)	21				all cancers(60;0.00203)|BRCA - Breast invasive adenocarcinoma(234;0.00205)|OV - Ovarian serous cystadenocarcinoma(108;0.0401)		TCGCCCCCTTCCGAGAAGGAG	0.667											OREG0022753	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001xkh.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)	1						c.(277-279)GAA>TAA		butyrate response factor 1							24.0	29.0	27.0					14																	69256990		2186	4259	6445	SO:0001587	stop_gained	677				regulation of mRNA stability	cytosol|nucleus	DNA binding|mRNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr14:69256990C>A	X79066	CCDS9791.1	14q22-q24	2012-11-27	2012-11-27	2001-11-23		ENSG00000185650		"""RING-type (C3HC4) zinc fingers"""	1107	protein-coding gene	gene with protein product		601064	"""zinc finger protein, C3H type, 36-like 1"", ""zinc finger protein 36, C3H type-like 1"""	BRF1		8024689	Standard	NM_004926		Approved	RNF162B, Berg36, ERF1, TIS11B, cMG1	uc021rve.1	Q07352		ENST00000439696.2:c.277G>T	14.37:g.69256990C>A	ENSP00000388402:p.Glu93*		Somatic	OREG0022753	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1113	ZFP36L1_uc001xki.1_Nonsense_Mutation_p.E93*	p.E93*	NM_004926	NP_004917	WXS	Illumina HiSeq	Unspecified	Q07352	TISB_HUMAN		all cancers(60;0.00203)|BRCA - Breast invasive adenocarcinoma(234;0.00205)|OV - Ovarian serous cystadenocarcinoma(108;0.0401)	2	407	-			93					Q13851	Nonsense_Mutation	SNP	ENST00000439696.2	37	c.277G>T	CCDS9791.1	.	.	.	.	.	.	.	.	.	.	c	26.3	4.721166	0.89205	.	.	ENSG00000185650	ENST00000439696;ENST00000336440;ENST00000435246;ENST00000557086;ENST00000557022;ENST00000553375	.	.	.	4.67	4.67	0.58626	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	1.0374	17.7977	0.88578	0.0:1.0:0.0:0.0	.	.	.	.	X	93;93;93;99;71;162	.	ENSP00000337386:E93X	E	-	1	0	ZFP36L1	68326743	1.000000	0.71417	0.951000	0.38953	0.966000	0.64601	7.251000	0.78297	2.419000	0.82065	0.580000	0.79431	GAA		0.667	ZFP36L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413227.1			11	38	1	0	6.50621e-10	0.013726	8.05966e-10	11	38				
PCNX	22990	broad.mit.edu	37	14	71514586	71514586	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr14:71514586C>G	ENST00000304743.2	+	22	4669	c.4223C>G	c.(4222-4224)cCt>cGt	p.P1408R	PCNX_ENST00000439984.3_Missense_Mutation_p.P1297R|PCNX_ENST00000238570.5_Missense_Mutation_p.P1408R	NM_014982.2	NP_055797.2	Q96RV3	PCX1_HUMAN	pecanex homolog (Drosophila)	1408						integral component of membrane (GO:0016021)		p.P1408R(1)		NS(2)|biliary_tract(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(14)|liver(2)|lung(40)|ovary(1)|prostate(7)|skin(2)|urinary_tract(1)	87			KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)		TTTAGCAGCCCTACATATCAG	0.383																																							uc001xmo.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(4222-4224)CCT>CGT		pecanex-like 1							229.0	197.0	208.0					14																	71514586		2203	4300	6503	SO:0001583	missense	22990					integral to membrane		g.chr14:71514586C>G	AF233450, AB018348	CCDS9806.1	14q24.2	2014-07-03							19740	protein-coding gene	gene with protein product			"""pecanex-like 1 (Drosophila)"""	PCNXL1		9244429, 15777640	Standard	NM_014982		Approved	KIAA0995, KIAA0805, pecanex	uc001xmo.2	Q96RV3		ENST00000304743.2:c.4223C>G	14.37:g.71514586C>G	ENSP00000304192:p.Pro1408Arg		Somatic				PCNX_uc010are.1_Missense_Mutation_p.P1297R|PCNX_uc010arf.1_Missense_Mutation_p.P268R	p.P1408R	NM_014982	NP_055797	WXS	Illumina HiSeq	Unspecified	Q96RV3	PCX1_HUMAN	KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)	22	4669	+			1408					B2RTR6|O94897|Q96AI7|Q9Y2J9	Missense_Mutation	SNP	ENST00000304743.2	37	c.4223C>G	CCDS9806.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.09|17.09	3.300733|3.300733	0.60195|0.60195	.|.	.|.	ENSG00000100731|ENSG00000100731	ENST00000554691|ENST00000304743;ENST00000238570;ENST00000439984	.|T;T;T	.|0.12361	.|3.05;2.87;2.69	5.32|5.32	5.32|5.32	0.75619|0.75619	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.42040|0.42040	0.1185|0.1185	M|M	0.86028|0.86028	2.79|2.79	0.80722|0.80722	D|D	1|1	.|P;D;D	.|0.89917	.|0.928;1.0;0.961	.|P;D;P	.|0.81914	.|0.734;0.995;0.708	T|T	0.41052|0.41052	-0.9530|-0.9530	5|10	.|0.87932	.|D	.|0	.|.	14.9076|14.9076	0.70733|0.70733	0.0:0.8571:0.1429:0.0|0.0:0.8571:0.1429:0.0	.|.	.|1408;1297;1408	.|Q96RV3-3;B2RTR6;Q96RV3	.|.;.;PCX1_HUMAN	V|R	467|1408;1408;1297	.|ENSP00000304192:P1408R;ENSP00000238570:P1408R;ENSP00000396617:P1297R	.|ENSP00000238570:P1408R	L|P	+|+	1|2	2|0	PCNX|PCNX	70584339|70584339	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.928000|0.928000	0.56348|0.56348	7.776000|7.776000	0.85560|0.85560	2.640000|2.640000	0.89533|0.89533	0.591000|0.591000	0.81541|0.81541	CTA|CCT		0.383	PCNX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412479.1	NM_014982		15	48	0	0	0	0.008871	0	15	48				
NEK9	91754	broad.mit.edu	37	14	75573382	75573382	+	Nonsense_Mutation	SNP	C	C	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr14:75573382C>A	ENST00000238616.5	-	12	1509	c.1351G>T	c.(1351-1353)Gga>Tga	p.G451*		NM_033116.4	NP_149107.4	Q8TD19	NEK9_HUMAN	NIMA-related kinase 9	451					mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)	p.G451*(1)		endometrium(4)|kidney(2)|large_intestine(4)|lung(13)|ovary(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	31				BRCA - Breast invasive adenocarcinoma(234;0.00718)		TAATCTGATCCGAAGGCATAG	0.468																																							uc001xrl.2		NA																	1	Substitution - Nonsense(1)		lung(1)	lung(2)|stomach(2)|ovary(1)	5						c.(1351-1353)GGA>TGA		NIMA-related kinase 9							76.0	73.0	74.0					14																	75573382		2203	4300	6503	SO:0001587	stop_gained	91754				cell division|mitosis	mitochondrion|nucleus	ATP binding|metal ion binding|protein kinase binding|protein serine/threonine kinase activity	g.chr14:75573382C>A	AY048580	CCDS9839.1	14q24.2	2012-11-15	2012-11-15		ENSG00000119638	ENSG00000119638			18591	protein-coding gene	gene with protein product		609798	"""NIMA (never in mitosis gene a)- related kinase 9"""			11864968	Standard	NM_033116		Approved	Nek8, NERCC, DKFZp434D0935, MGC16714	uc001xrl.3	Q8TD19	OTTHUMG00000171768	ENST00000238616.5:c.1351G>T	14.37:g.75573382C>A	ENSP00000238616:p.Gly451*		Somatic				NEK9_uc001xrk.2_5'UTR	p.G451*	NM_033116	NP_149107	WXS	Illumina HiSeq	Unspecified	Q8TD19	NEK9_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.00718)	12	1505	-			451			RCC1 2.		Q52LK6|Q8NCN0|Q8TCY4|Q9UPI4|Q9Y6S4|Q9Y6S5|Q9Y6S6	Nonsense_Mutation	SNP	ENST00000238616.5	37	c.1351G>T	CCDS9839.1	.	.	.	.	.	.	.	.	.	.	C	39	7.478446	0.98309	.	.	ENSG00000119638	ENST00000238616;ENST00000540227	.	.	.	5.14	5.14	0.70334	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	18.6039	0.91259	0.0:1.0:0.0:0.0	.	.	.	.	X	451;433	.	ENSP00000238616:G451X	G	-	1	0	NEK9	74643135	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	7.814000	0.86154	2.358000	0.79984	0.655000	0.94253	GGA		0.468	NEK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415021.1	NM_033116		17	40	1	0	1.87028e-06	0.012319	2.10407e-06	17	40				
CCDC88C	440193	broad.mit.edu	37	14	91779574	91779574	+	Silent	SNP	C	C	G			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr14:91779574C>G	ENST00000389857.6	-	15	2672	c.2586G>C	c.(2584-2586)ctG>ctC	p.L862L		NM_001080414.3	NP_001073883.2	Q9P219	DAPLE_HUMAN	coiled-coil domain containing 88C	862					protein destabilization (GO:0031648)|protein homooligomerization (GO:0051260)|regulation of protein phosphorylation (GO:0001932)|Wnt signaling pathway (GO:0016055)		PDZ domain binding (GO:0030165)|protein self-association (GO:0043621)	p.L862L(2)		central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(6)|pancreas(1)|urinary_tract(1)	24		all_cancers(154;0.0468)				CAACGGCGGACAGTTTGGCAG	0.622																																							uc010aty.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(3)	3						c.(2584-2586)CTG>CTC		DVL-binding protein DAPLE							112.0	117.0	116.0					14																	91779574		2153	4246	6399	SO:0001819	synonymous_variant	440193				microtubule cytoskeleton organization|protein destabilization|protein homooligomerization|regulation of protein phosphorylation|Wnt receptor signaling pathway	cytoplasm|insoluble fraction	microtubule binding|PDZ domain binding|protein self-association	g.chr14:91779574C>G		CCDS45151.1	14q32.12	2014-07-30	2007-05-31	2007-05-31		ENSG00000015133			19967	protein-coding gene	gene with protein product	"""Dvl-associating protein with a high frequency of leucine residues"", ""spinocerebellar ataxia 40"""	611204	"""KIAA1509"""	KIAA1509		17185515, 25062847	Standard	NM_001080414		Approved	DAPLE, HkRP2, SCA40	uc010aty.3	Q9P219		ENST00000389857.6:c.2586G>C	14.37:g.91779574C>G			Somatic					p.L862L	NM_001080414	NP_001073883	WXS	Illumina HiSeq	Unspecified	Q9P219	DAPLE_HUMAN			15	2685	-		all_cancers(154;0.0468)	862			Potential.		Q69YK1|Q7L1M2|Q86SX7|Q8IYG8	Silent	SNP	ENST00000389857.6	37	c.2586G>C	CCDS45151.1																																																																																				0.622	CCDC88C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411650.1	XM_029353		25	138	0	0	0	0.007291	0	25	138				
UNC79	57578	broad.mit.edu	37	14	94088409	94088409	+	Silent	SNP	A	A	G			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr14:94088409A>G	ENST00000393151.2	+	30	4830	c.4830A>G	c.(4828-4830)ctA>ctG	p.L1610L	UNC79_ENST00000256339.4_Silent_p.L1433L|UNC79_ENST00000555664.1_Silent_p.L1610L|UNC79_ENST00000553484.1_Silent_p.L1632L			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	1610					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.L1433L(1)|p.L1632L(1)		breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						TGATAGATCTATCCTCAGATT	0.463																																							uc001ybv.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(10)|skin(4)|large_intestine(3)	17						c.(4363-4365)CTA>CTG		hypothetical protein LOC57578							73.0	76.0	75.0					14																	94088409		2203	4300	6503	SO:0001819	synonymous_variant	57578					integral to membrane		g.chr14:94088409A>G	AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.4830A>G	14.37:g.94088409A>G			Somatic				KIAA1409_uc001ybs.1_Silent_p.L1433L	p.L1455L	NM_020818	NP_065869	WXS	Illumina HiSeq	Unspecified	Q9P2D8	UNC79_HUMAN		Epithelial(152;0.188)	28	4448	+		all_cancers(154;0.0354)|all_epithelial(191;0.216)	1610					B5MDL6|Q6ZUT7	Silent	SNP	ENST00000393151.2	37	c.4365A>G																																																																																					0.463	UNC79-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412766.1	XM_028395		49	96	0	0	0	0.01441	0	49	96				
MKRN3	7681	broad.mit.edu	37	15	23811308	23811308	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr15:23811308G>T	ENST00000314520.3	+	1	855	c.379G>T	c.(379-381)Gcc>Tcc	p.A127S	MKRN3_ENST00000568252.1_Intron|RP11-73C9.1_ENST00000563044.1_RNA|MKRN3_ENST00000564592.1_Intron	NM_005664.3	NP_005655.1	Q13064	MKRN3_HUMAN	makorin ring finger protein 3	127					protein ubiquitination (GO:0016567)	ribonucleoprotein complex (GO:0030529)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.A127S(1)		breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(33)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		all_cancers(20;8.44e-25)|all_epithelial(15;3.69e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000353)|Colorectal(260;0.14)		all cancers(64;3.02e-06)|Epithelial(43;1.94e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0012)		TCGGAAGATGGCCACTGAGGG	0.602																																							uc001ywh.3		NA																	1	Substitution - Missense(1)		lung(1)	lung(6)|large_intestine(2)|ovary(2)	10						c.(379-381)GCC>TCC		makorin ring finger protein 3							49.0	52.0	51.0					15																	23811308		2203	4300	6503	SO:0001583	missense	7681					ribonucleoprotein complex	ligase activity|nucleic acid binding|zinc ion binding	g.chr15:23811308G>T	U19107	CCDS10013.1	15q11-q13	2013-01-09	2008-08-13		ENSG00000179455	ENSG00000179455		"""RING-type (C3HC4) zinc fingers"""	7114	protein-coding gene	gene with protein product	"""zinc finger protein 127"""	603856		ZNF127, D15S9		10196367	Standard	NM_005664		Approved	RNF63, ZFP127, MGC88288	uc001ywh.4	Q13064	OTTHUMG00000129160	ENST00000314520.3:c.379G>T	15.37:g.23811308G>T	ENSP00000313881:p.Ala127Ser		Somatic				MKRN3_uc001ywi.2_Intron|MKRN3_uc010ayi.1_Missense_Mutation_p.A127S	p.A127S	NM_005664	NP_005655	WXS	Illumina HiSeq	Unspecified	Q13064	MKRN3_HUMAN		all cancers(64;3.02e-06)|Epithelial(43;1.94e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0012)	1	855	+		all_cancers(20;8.44e-25)|all_epithelial(15;3.69e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000353)|Colorectal(260;0.14)	127						Missense_Mutation	SNP	ENST00000314520.3	37	c.379G>T	CCDS10013.1	.	.	.	.	.	.	.	.	.	.	G	7.610	0.674573	0.14841	.	.	ENSG00000179455	ENST00000314520	T	0.32988	1.43	3.74	-0.735	0.11137	.	0.396998	0.25497	N	0.030265	T	0.09949	0.0244	N	0.11201	0.11	0.09310	N	1	B	0.32031	0.352	B	0.24269	0.052	T	0.39272	-0.9622	10	0.02654	T	1	-2.6828	8.2684	0.31829	0.0:0.4919:0.3404:0.1677	.	127	Q13064	MKRN3_HUMAN	S	127	ENSP00000313881:A127S	ENSP00000313881:A127S	A	+	1	0	MKRN3	21362401	0.107000	0.21998	0.000000	0.03702	0.132000	0.20833	1.187000	0.32090	-0.107000	0.12088	0.563000	0.77884	GCC		0.602	MKRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251225.1	NM_005664		48	87	1	0	2.43468e-25	0.01441	3.7281e-25	48	87				
HERC2	8924	broad.mit.edu	37	15	28414753	28414754	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr15:28414753_28414754CC>AA	ENST00000261609.7	-	66	10213_10214	c.10105_10106GG>TT	c.(10105-10107)GGt>TTt	p.G3369F		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2									p.G3369F(1)		NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		ATTACTTGCACCACTTATTTTA	0.376																																							uc001zbj.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13						c.(10105-10107)GGT>TTT		hect domain and RLD 2																																				SO:0001583	missense	8924				DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr15:28414753_28414754CC>AA	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.10105_10106delinsAA	15.37:g.28414753_28414754delinsAA	ENSP00000261609:p.Gly3369Phe		Somatic					p.G3369F	NM_004667	NP_004658	WXS	Illumina HiSeq	Unspecified	O95714	HERC2_HUMAN		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)	66	10211_10212	-		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)	3369						Missense_Mutation	DNP	ENST00000261609.7	37	c.10105_10106GG>TT	CCDS10021.1																																																																																				0.376	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	NM_004667		23	94	0	0	0	0.004672	0	23	94				
TJP1	7082	broad.mit.edu	37	15	30010701	30010701	+	Missense_Mutation	SNP	C	C	A	rs371242439		TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr15:30010701C>A	ENST00000346128.6	-	21	4119	c.3645G>T	c.(3643-3645)gaG>gaT	p.E1215D	TJP1_ENST00000356107.6_Missense_Mutation_p.E1215D|TJP1_ENST00000400011.2_Missense_Mutation_p.E1139D|TJP1_ENST00000545208.2_Missense_Mutation_p.E1135D	NM_003257.3|NM_175610.2	NP_003248.3|NP_783297.2	Q07157	ZO1_HUMAN	tight junction protein 1	1215					apoptotic process (GO:0006915)|blastocyst formation (GO:0001825)|cell-cell junction assembly (GO:0007043)|cell-cell signaling involved in cell-cell junction organization (GO:1901350)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to glucose stimulus (GO:0071333)|hippo signaling (GO:0035329)|membrane organization (GO:0061024)|negative regulation of vascular permeability (GO:0043116)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to magnetism (GO:0071000)|sensory perception of sound (GO:0007605)	apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|gap junction (GO:0005921)|intercalated disc (GO:0014704)|intercellular canaliculus (GO:0046581)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)		p.E1215D(1)		breast(4)|central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|urinary_tract(1)	68		all_lung(180;7.48e-11)|Breast(32;0.000153)		all cancers(64;3.29e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0034)|GBM - Glioblastoma multiforme(186;0.0139)|Lung(196;0.186)		CATGGAGAGGCTCAAAATGAC	0.522																																					Melanoma(77;681 1843 6309 6570)	Melanoma(77;681 1843 6309 6570)	uc001zcr.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|central_nervous_system(1)|pancreas(1)	6						c.(3643-3645)GAG>GAT		tight junction protein 1 isoform a							71.0	74.0	73.0					15																	30010701		2125	4255	6380	SO:0001583	missense	7082				cell-cell junction assembly|cellular component disassembly involved in apoptosis	basolateral plasma membrane|cell-cell adherens junction|Golgi apparatus|tight junction		g.chr15:30010701C>A		CCDS42007.1, CCDS45199.1, CCDS73702.1	15q13	2012-07-12	2012-07-12		ENSG00000104067	ENSG00000104067			11827	protein-coding gene	gene with protein product	"""zona occludens 1"", ""tight junction protein ZO-1"""	601009				8825647	Standard	XM_005254616		Approved	ZO-1, MGC133289, DKFZp686M05161	uc001zcr.3	Q07157	OTTHUMG00000137397	ENST00000346128.6:c.3645G>T	15.37:g.30010701C>A	ENSP00000281537:p.Glu1215Asp		Somatic				TJP1_uc010azl.2_Missense_Mutation_p.E1203D|TJP1_uc001zcq.2_Missense_Mutation_p.E1139D|TJP1_uc001zcs.2_Missense_Mutation_p.E1135D	p.E1215D	NM_003257	NP_003248	WXS	Illumina HiSeq	Unspecified	Q07157	ZO1_HUMAN		all cancers(64;3.29e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0034)|GBM - Glioblastoma multiforme(186;0.0139)|Lung(196;0.186)	21	4120	-		all_lung(180;7.48e-11)|Breast(32;0.000153)	1215					B4E3K1|Q2NKP3|Q4ZGJ6	Missense_Mutation	SNP	ENST00000346128.6	37	c.3645G>T	CCDS42007.1	.	.	.	.	.	.	.	.	.	.	C	6.546	0.468970	0.12461	.	.	ENSG00000104067	ENST00000346128;ENST00000400011;ENST00000545208;ENST00000400007;ENST00000356107	T;T;T	0.08370	3.19;3.26;3.1	5.9	1.85	0.25348	.	0.201737	0.51477	N	0.000082	T	0.07052	0.0179	L	0.53249	1.67	0.80722	D	1	B;B;B;B	0.17038	0.008;0.02;0.014;0.016	B;B;B;B	0.16722	0.005;0.016;0.01;0.011	T	0.28870	-1.0030	10	0.28530	T	0.3	.	2.5172	0.04671	0.1182:0.5097:0.1148:0.2573	.	1208;1135;1215;1139	A9CQZ8;Q07157-2;Q07157;G5E9E7	.;.;ZO1_HUMAN;.	D	1215;1139;1215;1135;1135	ENSP00000281537:E1215D;ENSP00000382890:E1139D;ENSP00000441202:E1215D	ENSP00000281537:E1215D	E	-	3	2	TJP1	27797993	0.267000	0.24122	0.996000	0.52242	0.169000	0.22640	-0.379000	0.07437	0.377000	0.24735	-0.182000	0.12963	GAG		0.522	TJP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268237.3	NM_003257		13	67	1	0	7.93312e-07	0.00245	9.01677e-07	13	67				
CEP152	22995	broad.mit.edu	37	15	49030868	49030868	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr15:49030868A>G	ENST00000380950.2	-	27	4898	c.4711T>C	c.(4711-4713)Tgc>Cgc	p.C1571R	CEP152_ENST00000399334.3_Missense_Mutation_p.C1515R	NM_001194998.1|NM_014985.3	NP_001181927.1|NP_055800.2	O94986	CE152_HUMAN	centrosomal protein 152kDa	1571					cell projection organization (GO:0030030)|centriole replication (GO:0007099)|centrosome duplication (GO:0051298)|de novo centriole assembly (GO:0098535)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)|deuterosome (GO:0098536)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)	p.C1515R(1)		breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(16)|lung(30)|ovary(1)|prostate(2)|skin(2)	63		all_lung(180;0.0428)		all cancers(107;1.08e-07)|GBM - Glioblastoma multiforme(94;2.32e-06)		CAGCCCAAGCAGTCACTAAGG	0.453																																							uc001zwy.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)	2						c.(4543-4545)TGC>CGC		centrosomal protein 152kDa							81.0	83.0	82.0					15																	49030868		1893	4104	5997	SO:0001583	missense	22995				centrosome duplication|G2/M transition of mitotic cell cycle	centrosome|cytosol	protein kinase binding	g.chr15:49030868A>G	AB020719	CCDS42033.1, CCDS58361.1	15q21.1	2014-02-20							29298	protein-coding gene	gene with protein product	"""asterless"""	613529	"""microcephaly, primary autosomal recessive 4"""	MCPH4		14654843, 21131973	Standard	NM_014985		Approved	KIAA0912, SCKL5	uc001zwz.3	O94986		ENST00000380950.2:c.4711T>C	15.37:g.49030868A>G	ENSP00000370337:p.Cys1571Arg		Somatic				CEP152_uc001zwz.2_Missense_Mutation_p.C1571R	p.C1515R	NM_014985	NP_055800	WXS	Illumina HiSeq	Unspecified	O94986	CE152_HUMAN		all cancers(107;1.08e-07)|GBM - Glioblastoma multiforme(94;2.32e-06)	26	4577	-		all_lung(180;0.0428)	1515					E7ER66|Q17RV1|Q6NTA0	Missense_Mutation	SNP	ENST00000380950.2	37	c.4543T>C	CCDS58361.1	.	.	.	.	.	.	.	.	.	.	A	10.30	1.311179	0.23821	.	.	ENSG00000103995	ENST00000399334	T	0.52754	0.65	4.9	2.56	0.30785	.	0.311585	0.23356	N	0.049072	T	0.23532	0.0569	N	0.08118	0	0.09310	N	0.999997	B	0.02656	0.0	B	0.01281	0.0	T	0.13361	-1.0512	10	0.48119	T	0.1	0.2154	5.3269	0.15910	0.7569:0.0:0.0871:0.156	.	1515	O94986	CE152_HUMAN	R	1515	ENSP00000382271:C1515R	ENSP00000382271:C1515R	C	-	1	0	CEP152	46818160	0.915000	0.31059	0.001000	0.08648	0.004000	0.04260	2.851000	0.48302	0.346000	0.23899	0.455000	0.32223	TGC		0.453	CEP152-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417365.1	NM_014985		7	30	0	0	0	0.004482	0	7	30				
COPS2	9318	broad.mit.edu	37	15	49431825	49431825	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr15:49431825C>G	ENST00000388901.5	-	4	345	c.272G>C	c.(271-273)aGa>aCa	p.R91T	COPS2_ENST00000299259.6_Missense_Mutation_p.R91T|Y_RNA_ENST00000363250.1_RNA|COPS2_ENST00000542928.1_Missense_Mutation_p.R27T	NM_001143887.1|NM_004236.3	NP_001137359.1|NP_004227.1	P61201	CSN2_HUMAN	COP9 signalosome subunit 2	91					cell proliferation (GO:0008283)|cullin deneddylation (GO:0010388)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron differentiation (GO:0030182)|signal transduction (GO:0007165)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase II promoter (GO:0006366)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)	signal transducer activity (GO:0004871)|transcription corepressor activity (GO:0003714)	p.R91K(1)|p.R91T(1)		cervix(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(8)|prostate(1)|skin(2)	18		all_lung(180;0.0428)		all cancers(107;1.34e-07)|GBM - Glioblastoma multiforme(94;3.02e-05)		CTGCTTATATCTATTCATCAT	0.289																																					NSCLC(36;322 1063 10349 30082 48062)|Esophageal Squamous(122;685 1633 15569 21293 52803)	NSCLC(36;322 1063 10349 30082 48062)|Esophageal Squamous(122;685 1633 15569 21293 52803)	uc001zxf.2		NA																	2	Substitution - Missense(2)		lung(1)|skin(1)	lung(1)	1						c.(271-273)AGA>ACA		COP9 constitutive photomorphogenic homolog							72.0	78.0	76.0					15																	49431825		2196	4290	6486	SO:0001583	missense	9318				cullin deneddylation|transcription from RNA polymerase II promoter	cytoplasm|signalosome	protein binding|signal transducer activity	g.chr15:49431825C>G	AF212227	CCDS32235.1, CCDS45257.1	15q21.2	2013-03-14	2013-03-14						30747	protein-coding gene	gene with protein product		604508	"""COP9 constitutive photomorphogenic homolog subunit 2 (Arabidopsis)"""			7776974, 9535219	Standard	NM_004236		Approved	TRIP15, ALIEN, CSN2	uc001zxh.3	P61201		ENST00000388901.5:c.272G>C	15.37:g.49431825C>G	ENSP00000373553:p.Arg91Thr		Somatic				COPS2_uc001zxh.2_Missense_Mutation_p.R91T|COPS2_uc010ufa.1_Missense_Mutation_p.R27T	p.R91T	NM_004236	NP_004227	WXS	Illumina HiSeq	Unspecified	P61201	CSN2_HUMAN		all cancers(107;1.34e-07)|GBM - Glioblastoma multiforme(94;3.02e-05)	4	351	-		all_lung(180;0.0428)	91					O88950|Q15647|Q6FGP4|Q9BY54|Q9R249|Q9UNI2|Q9UNQ5	Missense_Mutation	SNP	ENST00000388901.5	37	c.272G>C	CCDS32235.1	.	.	.	.	.	.	.	.	.	.	C	12.70	2.016892	0.35606	.	.	ENSG00000166200	ENST00000299259;ENST00000388901;ENST00000542928	.	.	.	5.48	4.54	0.55810	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	T	0.48295	0.1492	L	0.31120	0.905	0.80722	D	1	B;B;B	0.13145	0.004;0.007;0.007	B;B;B	0.12156	0.007;0.007;0.007	T	0.39663	-0.9603	9	0.09590	T	0.72	-9.2866	15.5288	0.75936	0.1391:0.8609:0.0:0.0	.	27;92;91	B4DIH5;Q59EL2;P61201	.;.;CSN2_HUMAN	T	91;91;27	.	ENSP00000299259:R91T	R	-	2	0	COPS2	47219117	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	1.273000	0.44346	0.655000	0.94253	AGA		0.289	COPS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417840.1	NM_004236		10	55	0	0	0	0.010729	0	10	55				
SLTM	79811	broad.mit.edu	37	15	59191867	59191867	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr15:59191867C>A	ENST00000380516.2	-	7	946	c.859G>T	c.(859-861)Gca>Tca	p.A287S	SLTM_ENST00000557950.1_5'Flank|SLTM_ENST00000536328.1_Intron	NM_001013843.1|NM_024755.2	NP_001013865.1|NP_079031.2	Q9NWH9	SLTM_HUMAN	SAFB-like, transcription modulator	287					apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.A287S(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						GGGCTCTGTGCAATGGCGTCC	0.453																																							uc002afp.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(859-861)GCA>TCA		modulator of estrogen induced transcription							172.0	163.0	166.0					15																	59191867		2192	4292	6484	SO:0001583	missense	79811				apoptosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleotide binding|RNA binding	g.chr15:59191867C>A	BC046119	CCDS10168.2	15q21.3	2013-02-12			ENSG00000137776	ENSG00000137776		"""RNA binding motif (RRM) containing"""	20709	protein-coding gene	gene with protein product							Standard	XR_243128		Approved	Met, FLJ13213	uc002afp.3	Q9NWH9	OTTHUMG00000074033	ENST00000380516.2:c.859G>T	15.37:g.59191867C>A	ENSP00000369887:p.Ala287Ser		Somatic				SLTM_uc002afo.2_Missense_Mutation_p.A269S|SLTM_uc002afq.2_Intron|SLTM_uc010bgd.2_Intron|SLTM_uc002afr.1_Missense_Mutation_p.A186S	p.A287S	NM_024755	NP_079031	WXS	Illumina HiSeq	Unspecified	Q9NWH9	SLTM_HUMAN			7	947	-			287					A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Missense_Mutation	SNP	ENST00000380516.2	37	c.859G>T	CCDS10168.2	.	.	.	.	.	.	.	.	.	.	C	7.245	0.602113	0.13939	.	.	ENSG00000137776	ENST00000380516;ENST00000249736	D;D	0.88354	-2.37;-2.37	5.78	4.81	0.61882	Nucleotide-binding, alpha-beta plait (1);	0.116896	0.38605	N	0.001632	D	0.82444	0.5038	L	0.31926	0.97	0.80722	D	1	B;B	0.15473	0.009;0.013	B;B	0.13407	0.009;0.008	T	0.76751	-0.2844	10	0.33141	T	0.24	.	12.2166	0.54410	0.1387:0.741:0.1203:0.0	.	269;287	C9IZZ3;Q9NWH9	.;SLTM_HUMAN	S	287;269	ENSP00000369887:A287S;ENSP00000249736:A269S	ENSP00000249736:A269S	A	-	1	0	SLTM	56979159	1.000000	0.71417	1.000000	0.80357	0.369000	0.29798	3.231000	0.51294	2.732000	0.93576	0.591000	0.81541	GCA		0.453	SLTM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157124.1	NM_024755		10	93	1	0	0.000978159	0.010729	0.00103198	10	93				
LOC645752	645752	broad.mit.edu	37	15	78211461	78211461	+	lincRNA	SNP	C	C	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr15:78211461C>A	ENST00000565869.1	+	0	111				RN7SL214P_ENST00000487317.2_RNA|RP11-114H24.2_ENST00000567226.1_RNA																							TCTCCTCCTGCTCCTGGAGTC	0.567																																							uc010bky.2		NA																	0					0						c.(304-306)GAG>GAT		SubName: Full=GOLGA6 protein; Flags: Fragment;																																						645752							g.chr15:78211461C>A																													15.37:g.78211461C>A			Somatic					p.E102D	NR_027024		WXS	Illumina HiSeq	Unspecified					11	1070	-									Missense_Mutation	SNP	ENST00000565869.1	37	c.306G>T																																																																																					0.567	RP11-114H24.7-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000421587.1			57	179	1	0	6.3237e-29	0.01441	1.00677e-28	57	179				
SYNM	23336	broad.mit.edu	37	15	99673193	99673193	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr15:99673193C>T	ENST00000560674.1	+	5	3303	c.2834C>T	c.(2833-2835)tCa>tTa	p.S945L	SYNM_ENST00000328642.7_Missense_Mutation_p.S1230L|SYNM_ENST00000336292.6_Missense_Mutation_p.S1542L|RP11-6O2.4_ENST00000566974.1_RNA|SYNM_ENST00000561323.1_3'UTR			O15061	SYNEM_HUMAN	synemin, intermediate filament protein	1543	Tail.				intermediate filament cytoskeleton organization (GO:0045104)	adherens junction (GO:0005912)|costamere (GO:0043034)|intermediate filament (GO:0005882)|membrane (GO:0016020)|neurofilament cytoskeleton (GO:0060053)	intermediate filament binding (GO:0019215)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)	p.S1230L(1)|p.S1542L(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(6)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	29						TCGGTGATTTCAGATGAAAAG	0.468																																					Pancreas(125;1071 1762 21750 40003 40381)	Pancreas(125;1071 1762 21750 40003 40381)	uc002bup.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|central_nervous_system(1)	4						c.(4627-4629)TCA>TTA		desmuslin isoform A							58.0	60.0	59.0					15																	99673193		1941	4136	6077	SO:0001583	missense	23336				intermediate filament cytoskeleton organization	adherens junction|costamere|intermediate filament|neurofilament cytoskeleton	intermediate filament binding|structural constituent of cytoskeleton|structural constituent of muscle|vinculin binding	g.chr15:99673193C>T	AK026420	CCDS73786.1, CCDS73787.1	15q26.3	2014-09-17	2008-09-19	2008-09-19	ENSG00000182253	ENSG00000182253		"""A-kinase anchor proteins"", ""Intermediate filaments type IV"""	24466	protein-coding gene	gene with protein product	"""synemin alpha"", ""synemin beta"""	606087	"""desmuslin"""	DMN		11737198, 11454237	Standard	NM_145728		Approved	KIAA0353, SYN	uc002bup.3	O15061		ENST00000560674.1:c.2834C>T	15.37:g.99673193C>T	ENSP00000453040:p.Ser945Leu		Somatic				SYNM_uc002buo.2_Missense_Mutation_p.S1231L|SYNM_uc002buq.2_RNA	p.S1543L	NM_145728	NP_663780	WXS	Illumina HiSeq	Unspecified	O15061	SYNEM_HUMAN			6	4748	+			1543			Tail.|Interaction with DMD and UTRN.		A7E2Y2|Q2TBJ4|Q5NJJ9|Q8TE61|Q8TE62	Missense_Mutation	SNP	ENST00000560674.1	37	c.4628C>T		.	.	.	.	.	.	.	.	.	.	C	27.7	4.855352	0.91355	.	.	ENSG00000182253	ENST00000336292;ENST00000328642	T;D	0.89050	2.1;-2.46	5.83	5.83	0.93111	.	.	.	.	.	D	0.94935	0.8362	.	.	.	0.32519	N	0.536503	D;D	0.89917	0.997;1.0	P;D	0.85130	0.861;0.997	D	0.95493	0.8571	8	0.87932	D	0	.	19.109	0.93309	0.0:1.0:0.0:0.0	.	1543;1230	O15061;C9JIE4	SYNEM_HUMAN;.	L	1542;1230	ENSP00000336775:S1542L;ENSP00000330469:S1230L	ENSP00000330469:S1230L	S	+	2	0	SYNM	97490716	0.966000	0.33281	0.897000	0.35233	0.984000	0.73092	2.276000	0.43408	2.758000	0.94735	0.655000	0.94253	TCA		0.468	SYNM-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000415698.2	NM_145728		6	39	0	0	0	0.001168	0	6	39				
ASB7	140460	broad.mit.edu	37	15	101170138	101170138	+	Silent	SNP	C	C	T	rs376420227		TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr15:101170138C>T	ENST00000332783.7	+	5	1493	c.708C>T	c.(706-708)taC>taT	p.Y236Y	ASB7_ENST00000558747.1_Intron|ASB7_ENST00000343276.4_Silent_p.Y236Y	NM_198243.2	NP_937886.1	Q9H672	ASB7_HUMAN	ankyrin repeat and SOCS box containing 7	236					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)			p.Y236Y(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|prostate(1)|skin(2)	16	Lung NSC(78;0.00121)|all_lung(78;0.00152)|Melanoma(26;0.00852)		OV - Ovarian serous cystadenocarcinoma(32;0.00168)|LUSC - Lung squamous cell carcinoma(107;0.0766)|Lung(145;0.103)			TATATAATTACGGAGCAGACA	0.453													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18816	0.0		0.0	False		,,,				2504	0.0						uc002bwk.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(706-708)TAC>TAT		ankyrin repeat and SOCS box-containing protein 7		C	,	1,4405	2.1+/-5.4	0,1,2202	113.0	105.0	107.0		708,708	-3.0	1.0	15		107	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	ASB7	NM_024708.3,NM_198243.2	,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,	236/275,236/319	101170138	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	140460				intracellular signal transduction			g.chr15:101170138C>T		CCDS10387.1, CCDS10388.1	15q26.3	2013-01-10	2011-01-25		ENSG00000183475	ENSG00000183475		"""Ankyrin repeat domain containing"""	17182	protein-coding gene	gene with protein product		615052	"""ankyrin repeat and SOCS box-containing 7"""				Standard	NM_024708		Approved		uc002bwk.3	Q9H672	OTTHUMG00000149868	ENST00000332783.7:c.708C>T	15.37:g.101170138C>T			Somatic				ASB7_uc002bwj.2_Silent_p.Y236Y	p.Y236Y	NM_198243	NP_937886	WXS	Illumina HiSeq	Unspecified	Q9H672	ASB7_HUMAN	OV - Ovarian serous cystadenocarcinoma(32;0.00168)|LUSC - Lung squamous cell carcinoma(107;0.0766)|Lung(145;0.103)		5	1477	+	Lung NSC(78;0.00121)|all_lung(78;0.00152)|Melanoma(26;0.00852)		236			ANK 7.		A8K1E5|Q6GSJ6|Q7Z4S3	Silent	SNP	ENST00000332783.7	37	c.708C>T	CCDS10387.1																																																																																				0.453	ASB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313617.1	NM_024708		16	86	0	0	0	0.014323	0	16	86				
OR4F15	390649	broad.mit.edu	37	15	102358761	102358761	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr15:102358761G>A	ENST00000332238.4	+	1	396	c.372G>A	c.(370-372)atG>atA	p.M124I		NM_001001674.1	NP_001001674.1	Q8NGB8	O4F15_HUMAN	olfactory receptor, family 4, subfamily F, member 15	124						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.M124I(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(10)	19	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.00039)|Lung(145;0.17)|LUSC - Lung squamous cell carcinoma(107;0.187)			ACAGATACATGGCCATATGTA	0.468																																							uc010uts.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(370-372)ATG>ATA		olfactory receptor, family 4, subfamily F,							193.0	175.0	181.0					15																	102358761		2203	4300	6503	SO:0001583	missense	390649				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr15:102358761G>A	BK004405	CCDS32342.1	15q26.3	2012-08-09				ENSG00000182854		"""GPCR / Class A : Olfactory receptors"""	15078	protein-coding gene	gene with protein product							Standard	NM_001001674		Approved		uc010uts.2	Q8NGB8		ENST00000332238.4:c.372G>A	15.37:g.102358761G>A	ENSP00000333184:p.Met124Ile		Somatic					p.M124I	NM_001001674	NP_001001674	WXS	Illumina HiSeq	Unspecified	Q8NGB8	O4F15_HUMAN	OV - Ovarian serous cystadenocarcinoma(32;0.00039)|Lung(145;0.17)|LUSC - Lung squamous cell carcinoma(107;0.187)		1	372	+	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		124			Cytoplasmic (Potential).		B2RNQ5|Q6IF57|Q96R70	Missense_Mutation	SNP	ENST00000332238.4	37	c.372G>A	CCDS32342.1	.	.	.	.	.	.	.	.	.	.	.	10.11	1.260646	0.23051	.	.	ENSG00000182854	ENST00000332238	T	0.01295	5.04	5.57	-1.17	0.09648	GPCR, rhodopsin-like superfamily (1);	0.230999	0.30285	N	0.009972	T	0.00637	0.0021	N	0.03967	-0.31	0.20489	N	0.999899	B	0.02656	0.0	B	0.01281	0.0	T	0.49113	-0.8973	9	.	.	.	.	6.494	0.22132	0.1547:0.0:0.2338:0.6115	.	124	Q8NGB8	O4F15_HUMAN	I	124	ENSP00000333184:M124I	.	M	+	3	0	OR4F15	100176284	0.002000	0.14202	0.645000	0.29479	0.770000	0.43624	-1.226000	0.02953	0.118000	0.18165	0.650000	0.86243	ATG		0.468	OR4F15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417594.1	NM_001001674		16	105	0	0	0	0.007413	0	16	105				
RHBDL1	9028	broad.mit.edu	37	16	727062	727062	+	Missense_Mutation	SNP	A	A	C			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr16:727062A>C	ENST00000219551.2	+	3	740	c.713A>C	c.(712-714)cAc>cCc	p.H238P	RHBDL1_ENST00000352681.3_Missense_Mutation_p.H173P|LA16c-313D11.9_ENST00000567091.1_RNA|LA16c-313D11.9_ENST00000571933.1_RNA			O75783	RHBL1_HUMAN	rhomboid, veinlet-like 1 (Drosophila)	238					signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)	p.H238P(1)		endometrium(1)|kidney(1)|lung(4)|urinary_tract(3)	9		Hepatocellular(780;0.0218)				CTTGTGTACCACCCCGGGCAC	0.637																																							uc002cis.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(712-714)CAC>CCC		rhomboid protease 1							61.0	69.0	66.0					16																	727062		2199	4300	6499	SO:0001583	missense	9028				proteolysis|signal transduction	integral to plasma membrane|membrane fraction	calcium ion binding|serine-type endopeptidase activity	g.chr16:727062A>C	Y17108	CCDS61779.1	16p13.3	2008-02-05	2001-11-28	2003-04-11	ENSG00000103269	ENSG00000103269			10007	protein-coding gene	gene with protein product		603264	"""rhomboid (veinlet, Drosophila)-like"""	RHBDL		9662444	Standard	NM_001278720		Approved	RRP	uc002cis.1	O75783	OTTHUMG00000121141	ENST00000219551.2:c.713A>C	16.37:g.727062A>C	ENSP00000219551:p.His238Pro		Somatic				RHBDL1_uc002cir.1_Missense_Mutation_p.H173P|RHBDL1_uc010uun.1_Missense_Mutation_p.H173P	p.H238P	NM_003961	NP_003952	WXS	Illumina HiSeq	Unspecified	O75783	RHBL1_HUMAN			3	740	+		Hepatocellular(780;0.0218)	238					A2IDC0|A2IDC1|Q0VAX4|Q9NQ85	Missense_Mutation	SNP	ENST00000219551.2	37	c.713A>C	CCDS10418.1	.	.	.	.	.	.	.	.	.	.	A	13.00	2.106354	0.37145	.	.	ENSG00000103269	ENST00000352681;ENST00000450775;ENST00000219551	T;T	0.09350	2.99;2.99	4.52	4.52	0.55395	.	0.000000	0.85682	D	0.000000	T	0.22589	0.0545	L	0.36672	1.1	0.58432	D	0.999999	D;D;D	0.76494	0.999;0.999;0.998	D;D;D	0.83275	0.996;0.993;0.985	T	0.00942	-1.1506	10	0.56958	D	0.05	-22.0117	12.6946	0.56997	1.0:0.0:0.0:0.0	.	173;238;173	B4DFK3;O75783;O75783-2	.;RHBL1_HUMAN;.	P	173;173;238	ENSP00000344206:H173P;ENSP00000219551:H238P	ENSP00000219551:H238P	H	+	2	0	RHBDL1	667063	1.000000	0.71417	0.998000	0.56505	0.063000	0.16089	6.909000	0.75735	1.678000	0.50952	0.455000	0.32223	CAC		0.637	RHBDL1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000241619.1	NM_003961		4	111	0	0	0	0.00245	0	4	111				
CACNA1H	8912	broad.mit.edu	37	16	1250434	1250434	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr16:1250434G>A	ENST00000348261.5	+	7	1230	c.982G>A	c.(982-984)Gag>Aag	p.E328K	CACNA1H_ENST00000358590.4_Missense_Mutation_p.E328K|CACNA1H_ENST00000565831.1_Missense_Mutation_p.E328K	NM_021098.2	NP_066921.2	O95180	CAC1H_HUMAN	calcium channel, voltage-dependent, T type, alpha 1H subunit	328					aldosterone biosynthetic process (GO:0032342)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|myoblast fusion (GO:0007520)|positive regulation of acrosome reaction (GO:2000344)|regulation of heart contraction (GO:0008016)|regulation of membrane potential (GO:0042391)|transport (GO:0006810)	caveola (GO:0005901)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)	p.E328K(4)		breast(4)|endometrium(5)|kidney(2)|lung(23)	34		Hepatocellular(780;0.00369)			Amiodarone(DB01118)|Bepridil(DB01244)|Cinnarizine(DB00568)|Felodipine(DB01023)|Flunarizine(DB04841)|Isradipine(DB00270)|Nifedipine(DB01115)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Zonisamide(DB00909)	GCCGCAGGCCGAGGGGGTGGG	0.667																																							uc002cks.2		NA																	4	Substitution - Missense(4)		lung(4)	breast(2)	2						c.(982-984)GAG>AAG		calcium channel, voltage-dependent, T type,	Flunarizine(DB04841)|Mibefradil(DB01388)						26.0	30.0	29.0					16																	1250434		2069	4176	6245	SO:0001583	missense	8912				aldosterone biosynthetic process|axon guidance|cellular response to hormone stimulus|cellular response to potassium ion|cortisol biosynthetic process|muscle contraction|myoblast fusion|positive regulation of acrosome reaction|regulation of heart contraction	voltage-gated calcium channel complex	low voltage-gated calcium channel activity	g.chr16:1250434G>A	AL031703	CCDS45375.1, CCDS45376.1	16p13.3	2012-03-07	2007-02-16					"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1395	protein-coding gene	gene with protein product		607904				9670923, 16382099	Standard	NM_021098		Approved	Cav3.2	uc002cks.3	O95180		ENST00000348261.5:c.982G>A	16.37:g.1250434G>A	ENSP00000334198:p.Glu328Lys		Somatic				CACNA1H_uc002ckt.2_Missense_Mutation_p.E328K	p.E328K	NM_021098	NP_066921	WXS	Illumina HiSeq	Unspecified	O95180	CAC1H_HUMAN			7	1230	+		Hepatocellular(780;0.00369)	328			Extracellular (Potential).|I.		B5ME00|F8WFD1|O95802|Q8WWI6|Q96QI6|Q96RZ9|Q9NYY4|Q9NYY5	Missense_Mutation	SNP	ENST00000348261.5	37	c.982G>A	CCDS45375.1	.	.	.	.	.	.	.	.	.	.	G	0.804	-0.754379	0.03041	.	.	ENSG00000196557	ENST00000348261;ENST00000358590	D;D	0.96396	-4.0;-3.95	2.88	2.88	0.33553	Ion transport (1);	.	.	.	.	D	0.90293	0.6964	L	0.35644	1.08	0.09310	N	1	P;P	0.48407	0.642;0.91	B;B	0.37731	0.062;0.257	T	0.83344	-0.0006	9	0.07325	T	0.83	.	8.0196	0.30402	0.0:0.253:0.747:0.0	.	328;328	O95180-2;O95180	.;CAC1H_HUMAN	K	328	ENSP00000334198:E328K;ENSP00000351401:E328K	ENSP00000334198:E328K	E	+	1	0	CACNA1H	1190435	1.000000	0.71417	0.843000	0.33291	0.055000	0.15305	4.663000	0.61532	1.931000	0.55961	0.586000	0.80456	GAG		0.667	CACNA1H-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000421601.1	NM_001005407		11	24	0	0	0	0.00245	0	11	24				
MYH11	4629	broad.mit.edu	37	16	15820896	15820896	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr16:15820896C>T	ENST00000300036.5	-	28	3776	c.3667G>A	c.(3667-3669)Gac>Aac	p.D1223N	MYH11_ENST00000396324.3_Missense_Mutation_p.D1230N|MYH11_ENST00000576790.2_Missense_Mutation_p.D1223N|AF001548.5_ENST00000574212.1_RNA|MYH11_ENST00000452625.2_Missense_Mutation_p.D1230N	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle	1223					axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)	p.D1223N(1)|p.D1230N(1)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						TTATTCTTGTCTAGGTTCGCC	0.597			T	CBFB	AML																																		uc002ddy.2		NA		Dom	yes		16	16p13.13-p13.12	4629	T	"""myosin, heavy polypeptide 11, smooth muscle"""			L	CBFB		AML		2	Substitution - Missense(2)		lung(2)	ovary(6)|skin(3)|lung(2)|breast(2)|upper_aerodigestive_tract(1)|pancreas(1)	15						c.(3667-3669)GAC>AAC		smooth muscle myosin heavy chain 11 isoform							117.0	125.0	122.0					16																	15820896		2197	4300	6497	SO:0001583	missense	4629				axon guidance|cardiac muscle fiber development|elastic fiber assembly|skeletal muscle myosin thick filament assembly|smooth muscle contraction	cytosol|melanosome|muscle myosin complex|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle	g.chr16:15820896C>T	X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.3667G>A	16.37:g.15820896C>T	ENSP00000300036:p.Asp1223Asn		Somatic				MYH11_uc002ddv.2_Missense_Mutation_p.D1230N|MYH11_uc002ddw.2_Missense_Mutation_p.D1223N|MYH11_uc002ddx.2_Missense_Mutation_p.D1230N|MYH11_uc010bvg.2_Missense_Mutation_p.D1055N|MYH11_uc010bvh.2_5'Flank	p.D1223N	NM_002474	NP_002465	WXS	Illumina HiSeq	Unspecified	P35749	MYH11_HUMAN			28	3774	-			1223			Potential.		D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Missense_Mutation	SNP	ENST00000300036.5	37	c.3667G>A	CCDS10565.1	.	.	.	.	.	.	.	.	.	.	C	33	5.278514	0.95459	.	.	ENSG00000133392	ENST00000300036;ENST00000338282;ENST00000396320;ENST00000396324;ENST00000452625	T;T;T;T	0.79554	-1.28;-1.28;-1.28;-1.28	5.07	5.07	0.68467	Myosin tail (1);	0.058464	0.64402	D	0.000002	T	0.81973	0.4936	L	0.46819	1.47	0.58432	D	0.999999	P;B;B;B;B	0.38250	0.624;0.293;0.293;0.293;0.293	P;P;P;P;P	0.45913	0.497;0.497;0.497;0.497;0.497	D	0.84119	0.0405	10	0.87932	D	0	.	17.4794	0.87669	0.0:1.0:0.0:0.0	.	1230;1223;1230;1223;1230	B1PS43;P35749;Q3MNF1;Q3MIV8;Q3MNF0	.;MYH11_HUMAN;.;.;.	N	1223;1223;1230;1230;1230	ENSP00000300036:D1223N;ENSP00000345136:D1223N;ENSP00000379616:D1230N;ENSP00000407821:D1230N	ENSP00000300036:D1223N	D	-	1	0	MYH11	15728397	1.000000	0.71417	0.991000	0.47740	0.896000	0.52359	7.818000	0.86416	2.368000	0.80403	0.655000	0.94253	GAC		0.597	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252192.2	NM_001040113		70	509	0	0	0	0.01441	0	70	509				
ZNF646	9726	broad.mit.edu	37	16	31092791	31092791	+	Silent	SNP	C	C	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr16:31092791C>T	ENST00000394979.2	+	1	5569	c.5146C>T	c.(5146-5148)Ctg>Ttg	p.L1716L	ZNF646_ENST00000300850.5_Silent_p.L1716L			O15015	ZN646_HUMAN	zinc finger protein 646	1716					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L1716L(1)		NS(1)|breast(4)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(1)|lung(21)|ovary(1)|prostate(4)|skin(3)	49						TCTCCCTAACCTGCTGTCTCT	0.632																																							uc002eap.2		NA																	1	Substitution - coding silent(1)		lung(1)	breast(2)	2						c.(5146-5148)CTG>TTG		zinc finger protein 646							121.0	129.0	127.0					16																	31092791		2197	4300	6497	SO:0001819	synonymous_variant	9726				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding	g.chr16:31092791C>T	AB002294	CCDS10702.1	16p11.2	2013-01-08			ENSG00000167395	ENSG00000167395		"""Zinc fingers, C2H2-type"""	29004	protein-coding gene	gene with protein product							Standard	NM_014699		Approved	KIAA0296	uc002eap.3	O15015	OTTHUMG00000047355	ENST00000394979.2:c.5146C>T	16.37:g.31092791C>T			Somatic					p.L1716L	NM_014699	NP_055514	WXS	Illumina HiSeq	Unspecified	O15015	ZN646_HUMAN			2	5435	+			1716			C2H2-type 29.		Q8IVD8	Silent	SNP	ENST00000394979.2	37	c.5146C>T																																																																																					0.632	ZNF646-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000108510.2	NM_014699		47	355	0	0	0	0.01441	0	47	355				
ZNF646	9726	broad.mit.edu	37	16	31092914	31092914	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr16:31092914C>T	ENST00000394979.2	+	1	5692	c.5269C>T	c.(5269-5271)Cgg>Tgg	p.R1757W	ZNF646_ENST00000300850.5_Missense_Mutation_p.R1757W			O15015	ZN646_HUMAN	zinc finger protein 646	1757					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R1757W(1)		NS(1)|breast(4)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(1)|lung(21)|ovary(1)|prostate(4)|skin(3)	49						CCATGCACCCCGGGAGGGGCC	0.692																																							uc002eap.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(2)	2						c.(5269-5271)CGG>TGG		zinc finger protein 646							24.0	29.0	27.0					16																	31092914		2193	4295	6488	SO:0001583	missense	9726				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding	g.chr16:31092914C>T	AB002294	CCDS10702.1	16p11.2	2013-01-08			ENSG00000167395	ENSG00000167395		"""Zinc fingers, C2H2-type"""	29004	protein-coding gene	gene with protein product							Standard	NM_014699		Approved	KIAA0296	uc002eap.3	O15015	OTTHUMG00000047355	ENST00000394979.2:c.5269C>T	16.37:g.31092914C>T	ENSP00000378429:p.Arg1757Trp		Somatic					p.R1757W	NM_014699	NP_055514	WXS	Illumina HiSeq	Unspecified	O15015	ZN646_HUMAN			2	5558	+			1757					Q8IVD8	Missense_Mutation	SNP	ENST00000394979.2	37	c.5269C>T		.	.	.	.	.	.	.	.	.	.	C	18.46	3.628003	0.66901	.	.	ENSG00000167395	ENST00000300850;ENST00000394979	T;T	0.09255	3.0;3.04	5.34	4.39	0.52855	.	.	.	.	.	T	0.14098	0.0341	M	0.70595	2.14	0.28835	N	0.89692	B	0.18741	0.03	B	0.14578	0.011	T	0.08249	-1.0731	9	0.56958	D	0.05	-3.3653	7.7198	0.28725	0.0:0.748:0.1639:0.0881	.	1757	O15015-2	.	W	1757	ENSP00000300850:R1757W;ENSP00000378429:R1757W	ENSP00000300850:R1757W	R	+	1	2	ZNF646	31000415	0.206000	0.23470	0.998000	0.56505	0.992000	0.81027	0.341000	0.19909	1.268000	0.44264	0.655000	0.94253	CGG		0.692	ZNF646-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000108510.2	NM_014699		19	121	0	0	0	0.007413	0	19	121				
PRSS36	146547	broad.mit.edu	37	16	31154786	31154786	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr16:31154786C>A	ENST00000268281.4	-	8	1035	c.977G>T	c.(976-978)gGg>gTg	p.G326V	PRSS36_ENST00000569305.1_Missense_Mutation_p.G326V|PRSS36_ENST00000418068.2_Missense_Mutation_p.G326V	NM_001258290.1|NM_173502.4	NP_001245219.1|NP_775773.2	Q5K4E3	POLS2_HUMAN	protease, serine, 36	326	Peptidase S1 2. {ECO:0000255|PROSITE- ProRule:PRU00274}.					cytoplasm (GO:0005737)|proteinaceous extracellular matrix (GO:0005578)	serine-type endopeptidase activity (GO:0004252)	p.G326V(1)		kidney(2)|large_intestine(4)|lung(8)|ovary(3)	17						CGGGGCCTTCCCGCACTCTGA	0.657																																							uc002ebd.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(976-978)GGG>GTG		protease, serine, 36 precursor							28.0	34.0	32.0					16																	31154786		2197	4300	6497	SO:0001583	missense	146547				proteolysis	cytoplasm|proteinaceous extracellular matrix	serine-type endopeptidase activity	g.chr16:31154786C>A	AK075142	CCDS32436.1, CCDS58452.1, CCDS58453.1	16p11.2	2014-09-04			ENSG00000178226			"""Serine peptidases / Serine peptidases"""	26906	protein-coding gene	gene with protein product	"""polyserase 2"""	610560				15536082	Standard	NM_173502		Approved	FLJ90661	uc002ebd.4	Q5K4E3	OTTHUMG00000176751	ENST00000268281.4:c.977G>T	16.37:g.31154786C>A	ENSP00000268281:p.Gly326Val		Somatic				PRSS36_uc010vff.1_Missense_Mutation_p.G101V|PRSS36_uc010vfg.1_Missense_Mutation_p.G326V|PRSS36_uc010vfh.1_Missense_Mutation_p.G326V	p.G326V	NM_173502	NP_775773	WXS	Illumina HiSeq	Unspecified	Q5K4E3	POLS2_HUMAN			8	1036	-			326			Peptidase S1 2.		A8K2P5|B4DW80|B7ZMK8|E7EX56|Q8NBY4	Missense_Mutation	SNP	ENST00000268281.4	37	c.977G>T	CCDS32436.1	.	.	.	.	.	.	.	.	.	.	C	19.51	3.841818	0.71488	.	.	ENSG00000178226	ENST00000268281;ENST00000418068	T;T	0.54279	0.58;0.58	4.11	4.11	0.48088	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	T	0.74550	0.3731	M	0.88842	2.985	0.58432	D	0.999998	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.79642	-0.1718	9	0.87932	D	0	.	11.7239	0.51698	0.0:1.0:0.0:0.0	.	326;326;326	E7EX56;B7ZMK8;Q5K4E3	.;.;POLS2_HUMAN	V	326	ENSP00000268281:G326V;ENSP00000407160:G326V	ENSP00000268281:G326V	G	-	2	0	PRSS36	31062287	0.037000	0.19845	0.997000	0.53966	0.847000	0.48162	2.261000	0.43276	2.125000	0.65367	0.491000	0.48974	GGG		0.657	PRSS36-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000433542.1	NM_173502		56	114	1	0	1.19403e-26	0.01441	1.86727e-26	56	114				
ARMC5	79798	broad.mit.edu	37	16	31476156	31476156	+	Silent	SNP	T	T	C	rs528087546		TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr16:31476156T>C	ENST00000563544.1	+	5	2358	c.1812T>C	c.(1810-1812)gaT>gaC	p.D604D	ARMC5_ENST00000538189.1_Silent_p.D636D|ARMC5_ENST00000457010.2_Silent_p.D604D|ARMC5_ENST00000412665.2_Silent_p.D248D|ARMC5_ENST00000408912.3_Silent_p.D699D|ARMC5_ENST00000268314.4_Silent_p.D604D			Q96C12	ARMC5_HUMAN	armadillo repeat containing 5	604								p.D699D(1)|p.D604D(1)		central_nervous_system(1)|endometrium(4)|large_intestine(3)|liver(2)|lung(12)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	28						CGCCTGACGATTGGCCGGCAC	0.701													T|||	1	0.000199681	0.0	0.0	5008	,	,		11975	0.0		0.0	False		,,,				2504	0.001						uc002ecc.2		NA																	2	Substitution - coding silent(2)		lung(2)	pancreas(1)	1						c.(1810-1812)GAT>GAC		armadillo repeat containing 5 isoform a							12.0	14.0	13.0					16																	31476156		2129	4254	6383	SO:0001819	synonymous_variant	79798						binding	g.chr16:31476156T>C	AY217348	CCDS42155.1, CCDS45472.1, CCDS73874.1	16p11	2013-02-14			ENSG00000140691	ENSG00000140691		"""Armadillo repeat containing"""	25781	protein-coding gene	gene with protein product		615549					Standard	NM_024742		Approved	FLJ13063	uc002ecc.3	Q96C12	OTTHUMG00000176618	ENST00000563544.1:c.1812T>C	16.37:g.31476156T>C			Somatic				ARMC5_uc010vfn.1_Silent_p.D699D|ARMC5_uc010vfo.1_Silent_p.D636D|ARMC5_uc002eca.3_Silent_p.D604D|ARMC5_uc010vfp.1_Silent_p.D412D|ARMC5_uc002ecb.2_Silent_p.D604D	p.D604D	NM_001105247	NP_001098717	WXS	Illumina HiSeq	Unspecified	Q96C12	ARMC5_HUMAN			4	2341	+			604					Q86WM9|Q9H7P8|Q9H925	Silent	SNP	ENST00000563544.1	37	c.1812T>C	CCDS45472.1																																																																																				0.701	ARMC5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432847.1	NM_024742		8	10	0	0	0	0.013537	0	8	10				
CES1P1	51716	broad.mit.edu	37	16	55806304	55806304	+	RNA	SNP	G	G	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr16:55806304G>A	ENST00000571348.1	+	0	606					NR_003276.2		Q9UKY3	CES1P_HUMAN	carboxylesterase 1 pseudogene 1						anatomical structure morphogenesis (GO:0009653)|metabolic process (GO:0008152)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)	carboxylic ester hydrolase activity (GO:0052689)										CACAGCCCGGGGAACTGGGGT	0.587																																							uc002eik.2		NA																	0					0						c.(154-156)GGG>GAG		RecName: Full=Inactive carboxylesterase 4; AltName: Full=Placental carboxylesterase 3;          Short=PCE-3; Flags: Precursor;																																						51716							g.chr16:55806304G>A	AF106005		16q12.2	2013-07-10	2010-10-12	2010-10-12	ENSG00000228695	ENSG00000228695			18546	pseudogene	pseudogene			"""carboxylesterase 4-like"", ""carboxylesterase 4, pseudogene"""	CES4		10452915, 20931200	Standard	NR_003276		Approved	PCE-3, CESR, CES1A3	uc010cce.3	Q9UKY3	OTTHUMG00000154668		16.37:g.55806304G>A			Somatic				CES4_uc010cce.2_Missense_Mutation_p.G52E	p.G52E	NR_003276		WXS	Illumina HiSeq	Unspecified					5	606	+								A2RRL8|B9ZVS2	Missense_Mutation	SNP	ENST00000571348.1	37	c.155G>A																																																																																					0.587	CES1P1-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000440035.1	NR_003276		15	12	0	0	0	0.008871	0	15	12				
MTSS1L	92154	broad.mit.edu	37	16	70712199	70712199	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr16:70712199G>A	ENST00000338779.6	-	8	854	c.580C>T	c.(580-582)Cgg>Tgg	p.R194W		NM_138383.2	NP_612392.1	Q765P7	MTSSL_HUMAN	metastasis suppressor 1-like	194	IMD. {ECO:0000255|PROSITE- ProRule:PRU00668}.				filopodium assembly (GO:0046847)|signal transduction (GO:0007165)			p.R194W(1)		breast(1)|central_nervous_system(2)|endometrium(1)|liver(1)|lung(1)|skin(1)	7						AAGCGGCCCCGCTCCTCGATC	0.672																																							uc002ezj.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(580-582)CGG>TGG		metastasis suppressor 1-like							68.0	72.0	71.0					16																	70712199		2198	4300	6498	SO:0001583	missense	92154				filopodium assembly|signal transduction		actin binding|cytoskeletal adaptor activity|SH3 domain binding	g.chr16:70712199G>A		CCDS32476.1	16q22.1	2008-12-16				ENSG00000132613			25094	protein-coding gene	gene with protein product	"""actin-bundling protein with BAIAP2 homology"""					12477932	Standard	XM_006721335		Approved	ABBA-1, LOC92154	uc002ezj.3	Q765P7		ENST00000338779.6:c.580C>T	16.37:g.70712199G>A	ENSP00000341171:p.Arg194Trp		Somatic				MTSS1L_uc002ezk.1_Missense_Mutation_p.R111W	p.R194W	NM_138383	NP_612392	WXS	Illumina HiSeq	Unspecified	Q765P7	MTSSL_HUMAN			8	840	-			194			IMD.		A6NJI7|Q9BUA8	Missense_Mutation	SNP	ENST00000338779.6	37	c.580C>T	CCDS32476.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.985453	0.74589	.	.	ENSG00000132613	ENST00000254951;ENST00000338779	T	0.65364	-0.15	4.6	3.56	0.40772	IRSp53/MIM homology domain (IMD) (3);	0.000000	0.85682	D	0.000000	T	0.81088	0.4750	M	0.88704	2.975	0.58432	D	0.999993	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.85450	0.1160	10	0.87932	D	0	-20.029	14.02	0.64547	0.0:0.0:0.7811:0.2189	.	191;194	Q765P7-2;Q765P7	.;MTSSL_HUMAN	W	191;194	ENSP00000341171:R194W	ENSP00000254951:R191W	R	-	1	2	MTSS1L	69269700	1.000000	0.71417	0.996000	0.52242	0.900000	0.52787	3.632000	0.54287	2.107000	0.64212	0.561000	0.74099	CGG		0.672	MTSS1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434927.3	NM_138383		17	193	0	0	0	0.014323	0	17	193				
ZNF19	7567	broad.mit.edu	37	16	71512893	71512893	+	Missense_Mutation	SNP	C	C	G	rs371059911		TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr16:71512893C>G	ENST00000288177.5	-	4	304	c.49G>C	c.(49-51)Gag>Cag	p.E17Q	AC010547.9_ENST00000561908.1_Missense_Mutation_p.E17Q|ZNF19_ENST00000565637.1_5'UTR|ZNF19_ENST00000564230.1_Missense_Mutation_p.E17Q|ZNF19_ENST00000567225.1_Missense_Mutation_p.E17Q|ZNF19_ENST00000565100.2_Intron	NM_006961.3	NP_008892.2	P17023	ZNF19_HUMAN	zinc finger protein 19	17	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E17Q(1)		NS(2)|endometrium(1)|kidney(2)|large_intestine(8)|lung(7)|prostate(1)|stomach(1)	22		Ovarian(137;0.00965)		BRCA - Breast invasive adenocarcinoma(221;0.0161)|Kidney(780;0.0598)		GCCACATCCTCGAAGGTCACC	0.562																																							uc010cgc.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(49-51)GAG>CAG		zinc finger protein 19							103.0	98.0	100.0					16																	71512893		2198	4300	6498	SO:0001583	missense	7567					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr16:71512893C>G	X52343	CCDS10901.1	16q22	2013-01-08	2006-05-10		ENSG00000157429	ENSG00000157429		"""Zinc fingers, C2H2-type"", ""-"""	12981	protein-coding gene	gene with protein product		194525	"""zinc finger protein 19 (KOX 12)"""			1505991, 1946370	Standard	NM_006961		Approved	KOX12, MGC51021	uc002fam.1	P17023	OTTHUMG00000137593	ENST00000288177.5:c.49G>C	16.37:g.71512893C>G	ENSP00000288177:p.Glu17Gln		Somatic				ZNF23_uc002fai.2_5'UTR|ZNF19_uc002fak.1_Missense_Mutation_p.E5Q|ZNF19_uc002fal.1_Missense_Mutation_p.E5Q|ZNF19_uc002fam.1_Missense_Mutation_p.E17Q	p.E17Q	NM_006961	NP_008892	WXS	Illumina HiSeq	Unspecified	P17023	ZNF19_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.0161)|Kidney(780;0.0598)	4	555	-		Ovarian(137;0.00965)	17			KRAB.		A8K895|Q86Y66|Q8NDE2|Q96M79|Q96NE5	Missense_Mutation	SNP	ENST00000288177.5	37	c.49G>C	CCDS10901.1	.	.	.	.	.	.	.	.	.	.	C	14.59	2.581022	0.46006	.	.	ENSG00000157429	ENST00000288177	T	0.02197	4.4	3.0	-2.57	0.06248	Krueppel-associated box (4);	0.230117	0.22416	N	0.060357	T	0.02156	0.0067	L	0.50919	1.6	0.21290	N	0.99974	B	0.18461	0.028	B	0.19666	0.026	T	0.38222	-0.9671	10	0.45353	T	0.12	.	4.9039	0.13788	0.0:0.4402:0.1527:0.4072	.	17	P17023	ZNF19_HUMAN	Q	17	ENSP00000288177:E17Q	ENSP00000288177:E17Q	E	-	1	0	ZNF19	70070394	0.000000	0.05858	0.140000	0.22221	0.971000	0.66376	-0.333000	0.07894	-0.582000	0.05929	-0.251000	0.11542	GAG		0.562	ZNF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268993.2	NM_006961		21	150	0	0	0	0.003954	0	21	150				
BCO1	53630	broad.mit.edu	37	16	81320986	81320986	+	Silent	SNP	G	G	A	rs183103921		TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr16:81320986G>A	ENST00000258168.2	+	10	1850	c.1389G>A	c.(1387-1389)gcG>gcA	p.A463A	BCMO1_ENST00000425577.2_Silent_p.A394A	NM_017429.2	NP_059125.2												p.A463A(1)		breast(2)|endometrium(1)|large_intestine(4)|lung(9)|prostate(3)|skin(3)|stomach(1)	23						TTGTGCCCGCGCCAGGTGCCA	0.517													G|||	1	0.000199681	0.0	0.0	5008	,	,		18135	0.001		0.0	False		,,,				2504	0.0						uc002fgn.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1387-1389)GCG>GCA		beta-carotene 15,15'-monooxygenase							61.0	61.0	61.0					16																	81320986		2202	4300	6502	SO:0001819	synonymous_variant	53630				retinoid metabolic process|steroid metabolic process	cytosol	beta-carotene 15,15'-monooxygenase activity|metal ion binding|monooxygenase activity	g.chr16:81320986G>A																												ENST00000258168.2:c.1389G>A	16.37:g.81320986G>A			Somatic				BCMO1_uc010vnp.1_Silent_p.A394A	p.A463A	NM_017429	NP_059125	WXS	Illumina HiSeq	Unspecified	Q9HAY6	BCDO1_HUMAN			10	1607	+			463						Silent	SNP	ENST00000258168.2	37	c.1389G>A	CCDS10934.1																																																																																				0.517	BCMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269056.1			59	102	0	0	0	0.01441	0	59	102				
GAN	8139	broad.mit.edu	37	16	81388292	81388292	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr16:81388292G>T	ENST00000568107.2	+	3	727	c.565G>T	c.(565-567)Gtt>Ttt	p.V189F		NM_022041.3	NP_071324.1	Q9H2C0	GAN_HUMAN	gigaxonin	189	BACK.				cell death (GO:0008219)|protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.V189F(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(12)|ovary(2)	25		Colorectal(91;0.153)				GAAGTTAAACGTTGGCAATGA	0.383																																					GBM(106;1239 1507 7582 9741 33976)	GBM(106;1239 1507 7582 9741 33976)	uc002fgo.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(565-567)GTT>TTT		gigaxonin							81.0	79.0	80.0					16																	81388292		2202	4300	6502	SO:0001583	missense	8139				cell death	cytoplasm|neurofilament	protein binding	g.chr16:81388292G>T	AF291673	CCDS10935.1	16q24.1	2014-09-17	2008-08-01		ENSG00000261609	ENSG00000261609		"""Kelch-like"", ""BTB/POZ domain containing"""	4137	protein-coding gene	gene with protein product	"""kelch-like family member 16"""	605379	"""giant axonal neuropathy (gigaxonin)"""			9450783, 11062483	Standard	NM_022041		Approved	GAN1, KLHL16	uc002fgo.3	Q9H2C0	OTTHUMG00000137627	ENST00000568107.2:c.565G>T	16.37:g.81388292G>T	ENSP00000476795:p.Val189Phe		Somatic					p.V189F	NM_022041	NP_071324	WXS	Illumina HiSeq	Unspecified	Q9H2C0	GAN_HUMAN			3	713	+		Colorectal(91;0.153)	189			BACK.			Missense_Mutation	SNP	ENST00000568107.2	37	c.565G>T	CCDS10935.1	.	.	.	.	.	.	.	.	.	.	G	24.3	4.512064	0.85389	.	.	ENSG00000127688	ENST00000248272	T	0.73575	-0.76	5.8	5.8	0.92144	BTB/Kelch-associated (2);	0.051565	0.85682	D	0.000000	D	0.90283	0.6961	M	0.93939	3.475	0.80722	D	1	D	0.71674	0.998	D	0.72982	0.979	D	0.92006	0.5614	10	0.87932	D	0	.	20.0637	0.97700	0.0:0.0:1.0:0.0	.	189	Q9H2C0	GAN_HUMAN	F	189	ENSP00000248272:V189F	ENSP00000248272:V189F	V	+	1	0	GAN	79945793	1.000000	0.71417	0.964000	0.40570	0.971000	0.66376	7.600000	0.82769	2.751000	0.94390	0.650000	0.86243	GTT		0.383	GAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269050.3			83	63	1	0	4.64247e-43	0.01441	7.87434e-43	83	63				
CTDNEP1	23399	broad.mit.edu	37	17	7150664	7150664	+	Splice_Site	SNP	T	T	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr17:7150664T>A	ENST00000573600.1	-	3	524		c.e3-2		CTDNEP1_ENST00000318988.6_Splice_Site|CTDNEP1_ENST00000574322.1_Splice_Site|RP1-4G17.5_ENST00000577138.1_Splice_Site|CTD-2545G14.7_ENST00000570760.2_5'Flank|CTDNEP1_ENST00000572043.1_Splice_Site			O95476	CNEP1_HUMAN	CTD nuclear envelope phosphatase 1						gamete generation (GO:0007276)|mesoderm development (GO:0007498)|nuclear envelope organization (GO:0006998)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of triglyceride biosynthetic process (GO:0010867)|protein dephosphorylation (GO:0006470)|protein localization to nucleus (GO:0034504)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|Nem1-Spo7 phosphatase complex (GO:0071595)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)	protein serine/threonine phosphatase activity (GO:0004722)	p.?(1)		central_nervous_system(9)|kidney(1)|large_intestine(2)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	15						CTGAATTACCTACAAATAGCA	0.438																																							uc002gfd.2		NA																	1	Unknown(1)		lung(1)		0						c.e2-1		dullard homolog							60.0	54.0	56.0					17																	7150664		2203	4300	6503	SO:0001630	splice_region_variant	23399				nuclear envelope organization|protein dephosphorylation	endoplasmic reticulum membrane|integral to membrane|nuclear membrane	protein serine/threonine phosphatase activity	g.chr17:7150664T>A	AJ011916	CCDS11093.1	17p13	2012-11-27	2010-10-27	2010-10-27	ENSG00000175826	ENSG00000175826		"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	19085	protein-coding gene	gene with protein product	"""C-terminal domain nuclear envelope phosphatase 1"""	610684	"""dullard homolog (Xenopus laevis)"""	DULLARD		12083771, 17141153	Standard	NM_015343		Approved	HSA011916, NET56	uc002gfd.2	O95476	OTTHUMG00000102180	ENST00000573600.1:c.103-2A>T	17.37:g.7150664T>A			Somatic				DULLARD_uc002gfe.2_Splice_Site_p.V35_splice|DULLARD_uc002gff.2_Splice_Site_p.V35_splice|DULLARD_uc002gfc.2_Splice_Site	p.V35_splice	NM_001143775	NP_001137247	WXS	Illumina HiSeq	Unspecified	O95476	CNEP1_HUMAN			2	483	-								D3DTN7|Q96GQ9	Splice_Site	SNP	ENST00000573600.1	37	c.103_splice	CCDS11093.1	.	.	.	.	.	.	.	.	.	.	T	13.93	2.382997	0.42207	.	.	ENSG00000175826	ENST00000318988	.	.	.	5.44	5.44	0.79542	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.4858	0.61364	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	CTDNEP1	7091388	1.000000	0.71417	0.952000	0.39060	0.646000	0.38490	5.981000	0.70524	2.285000	0.76669	0.528000	0.53228	.		0.438	CTDNEP1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440215.1	NM_015343	Intron	27	34	0	0	0	0.004656	0	27	34				
NLGN2	57555	broad.mit.edu	37	17	7317981	7317981	+	Splice_Site	SNP	G	G	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr17:7317981G>T	ENST00000302926.2	+	4	731		c.e4-1		NLGN2_ENST00000575301.1_Splice_Site	NM_020795.2	NP_065846.1	Q8NFZ4	NLGN2_HUMAN	neuroligin 2						cell-cell junction maintenance (GO:0045217)|gephyrin clustering (GO:0097116)|locomotory exploration behavior (GO:0035641)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein localization to synapse (GO:0035418)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of synaptic transmission (GO:0050804)|sensory perception of pain (GO:0019233)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|synapse organization (GO:0050808)|terminal button organization (GO:0072553)	cell junction (GO:0030054)|cell surface (GO:0009986)|inhibitory synapse (GO:0060077)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|receptor activity (GO:0004872)	p.?(1)		central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(7)|prostate(2)|skin(3)	22		Prostate(122;0.157)				TCTACTCCCAGGTTTTCTCAG	0.607																																							uc002ggt.1		NA																	1	Unknown(1)		lung(1)	central_nervous_system(1)	1						c.e4-1		neuroligin 2 precursor							60.0	68.0	65.0					17																	7317981		2203	4300	6503	SO:0001630	splice_region_variant	57555				cell-cell junction maintenance|neuron cell-cell adhesion|positive regulation of synaptogenesis|regulation of inhibitory postsynaptic membrane potential|synapse assembly	cell surface|integral to plasma membrane|postsynaptic membrane	neurexin binding|receptor activity	g.chr17:7317981G>T	AB037787	CCDS11103.1	17p13.2	2008-07-18			ENSG00000169992	ENSG00000169992			14290	protein-coding gene	gene with protein product		606479				10767552, 10819331	Standard	NM_020795		Approved	KIAA1366	uc002ggt.1	Q8NFZ4	OTTHUMG00000108138	ENST00000302926.2:c.659-1G>T	17.37:g.7317981G>T			Somatic					p.G220_splice	NM_020795	NP_065846	WXS	Illumina HiSeq	Unspecified	Q8NFZ4	NLGN2_HUMAN			4	732	+		Prostate(122;0.157)						Q9P2I1	Splice_Site	SNP	ENST00000302926.2	37	c.659_splice	CCDS11103.1	.	.	.	.	.	.	.	.	.	.	G	16.02	3.003578	0.54254	.	.	ENSG00000169992	ENST00000302926	.	.	.	4.69	4.69	0.59074	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.1673	0.72840	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NLGN2	7258705	1.000000	0.71417	0.998000	0.56505	0.821000	0.46438	9.648000	0.98483	2.457000	0.83068	0.462000	0.41574	.		0.607	NLGN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226941.2	NM_020795	Intron	68	120	1	0	1.25089e-41	0.01441	2.0975e-41	68	120				
CTC1	80169	broad.mit.edu	37	17	8141519	8141519	+	Silent	SNP	C	C	A	rs200658590	byFrequency	TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr17:8141519C>A	ENST00000315684.8	-	4	484	c.477G>T	c.(475-477)ctG>ctT	p.L159L	CTC1_ENST00000581671.1_5'UTR	NM_025099.5	NP_079375.3	Q2NKJ3	CTC1_HUMAN	CTS telomere maintenance complex component 1	159					bone marrow development (GO:0048539)|cellular response to DNA damage stimulus (GO:0006974)|hematopoietic stem cell proliferation (GO:0071425)|multicellular organism growth (GO:0035264)|positive regulation of DNA replication (GO:0045740)|positive regulation of fibroblast proliferation (GO:0048146)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|replicative senescence (GO:0090399)|spleen development (GO:0048536)|telomere maintenance (GO:0000723)|telomere maintenance via telomere lengthening (GO:0010833)|thymus development (GO:0048538)	nuclear chromosome, telomeric region (GO:0000784)|nucleus (GO:0005634)|Stn1-Ten1 complex (GO:0070188)	single-stranded DNA binding (GO:0003697)	p.L159L(1)		NS(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(8)|ovary(1)|skin(4)	29						AACGGGGGAACAGAAAAAGAT	0.532													C|||	40	0.00798722	0.003	0.0	5008	,	,		20014	0.002		0.0	False		,,,				2504	0.0348						uc002gkq.3		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(475-477)CTG>CTT		alpha accessory factor 132		C		8,3868		0,8,1930	69.0	75.0	73.0		477	-2.2	1.0	17		73	1,8291		0,1,4145	yes	coding-synonymous	CTC1	NM_025099.5		0,9,6075	AA,AC,CC		0.0121,0.2064,0.074		159/1218	8141519	9,12159	1938	4146	6084	SO:0001819	synonymous_variant	80169				positive regulation of DNA replication|telomere maintenance	Stn1-Ten1 complex	protein binding|single-stranded DNA binding	g.chr17:8141519C>A	AL831955	CCDS42259.1	17p13.1	2011-02-21	2011-02-21	2011-02-21	ENSG00000178971	ENSG00000178971			26169	protein-coding gene	gene with protein product	"""conserved telomere maintenance component 1"", ""alpha accessory factor 132"", ""conserved telomere capping protein 1"""	613129	"""tmp494178"", ""chromosome 17 open reading frame 68"""	C17orf68		19854130, 19854131	Standard	NM_025099		Approved	FLJ22170, AAF132	uc002gkq.4	Q2NKJ3		ENST00000315684.8:c.477G>T	17.37:g.8141519C>A			Somatic				C17orf68_uc010cnv.2_RNA	p.L159L	NM_025099	NP_079375	WXS	Illumina HiSeq	Unspecified	Q2NKJ3	CTC1_HUMAN			4	536	-			159					B3KR66|C9JEX5|Q1PCD1|Q2TBE3|Q8N3S6|Q9H6L0	Silent	SNP	ENST00000315684.8	37	c.477G>T	CCDS42259.1																																																																																				0.532	CTC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000442012.1	NM_025099		23	91	1	0	1.42536e-11	0.004656	1.8326e-11	23	91				
MYH1	4619	broad.mit.edu	37	17	10403991	10403991	+	Silent	SNP	G	G	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr17:10403991G>A	ENST00000226207.5	-	28	3911	c.3817C>T	c.(3817-3819)Ctg>Ttg	p.L1273L	RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	1273					muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.L1273L(1)		NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						TCATTGATCAGCCGCTGCTGC	0.483																																							uc002gmo.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(10)|skin(6)|breast(3)|upper_aerodigestive_tract(1)|kidney(1)	21						c.(3817-3819)CTG>TTG		myosin, heavy chain 1, skeletal muscle, adult							167.0	145.0	153.0					17																	10403991		2203	4300	6503	SO:0001819	synonymous_variant	4619					muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity	g.chr17:10403991G>A		CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.3817C>T	17.37:g.10403991G>A			Somatic				uc002gml.1_Intron	p.L1273L	NM_005963	NP_005954	WXS	Illumina HiSeq	Unspecified	P12882	MYH1_HUMAN			28	3911	-			1273			Potential.		Q14CA4|Q9Y622	Silent	SNP	ENST00000226207.5	37	c.3817C>T	CCDS11155.1																																																																																				0.483	MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252725.1	NM_005963		29	62	0	0	0	0.012213	0	29	62				
ADPRM	56985	broad.mit.edu	37	17	10608454	10608454	+	Nonsense_Mutation	SNP	C	C	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr17:10608454C>T	ENST00000379774.4	+	2	302	c.211C>T	c.(211-213)Cag>Tag	p.Q71*	ADPRM_ENST00000609540.1_Nonsense_Mutation_p.Q71*	NM_020233.4	NP_064618.3	Q3LIE5	ADPRM_HUMAN	ADP-ribose/CDP-alcohol diphosphatase, manganese-dependent	71							ADP-ribose diphosphatase activity (GO:0047631)|CDP-glycerol diphosphatase activity (GO:0047734)|metal ion binding (GO:0046872)	p.Q71*(1)									TTGTGTCCTTCAGCTTGGAGA	0.433																																							uc002gmt.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(211-213)CAG>TAG		ADP-ribose/CDP-alcohol pyrophosphatase							164.0	153.0	156.0					17																	10608454		2203	4300	6503	SO:0001587	stop_gained	56985						ADP-ribose diphosphatase activity|CDP-glycerol diphosphatase activity|metal ion binding	g.chr17:10608454C>T	BC070155	CCDS11159.2	17p13.1	2012-07-20	2012-07-20	2012-07-20	ENSG00000170222	ENSG00000170222	3.6.1.13, 3.6.1.16, 3.6.1.53		30925	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 48"""	C17orf48		18352857	Standard	XM_005256738		Approved	MDS006	uc002gmt.3	Q3LIE5	OTTHUMG00000130366	ENST00000379774.4:c.211C>T	17.37:g.10608454C>T	ENSP00000369099:p.Gln71*		Somatic				C17orf48_uc002gmu.2_RNA|C17orf48_uc002gmv.2_RNA|C17orf48_uc010vvg.1_Nonsense_Mutation_p.Q71*	p.Q71*	NM_020233	NP_064618	WXS	Illumina HiSeq	Unspecified	Q3LIE5	ADPRM_HUMAN			2	286	+			71					A8K9B4|D3DTS4|Q9BVD4|Q9NRU8	Nonsense_Mutation	SNP	ENST00000379774.4	37	c.211C>T	CCDS11159.2	.	.	.	.	.	.	.	.	.	.	C	22.8	4.335296	0.81801	.	.	ENSG00000170222	ENST00000379774	.	.	.	5.65	4.67	0.58626	.	0.053877	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.29301	T	0.29	-2.6574	15.7818	0.78267	0.1373:0.8627:0.0:0.0	.	.	.	.	X	71	.	ENSP00000369099:Q71X	Q	+	1	0	C17orf48	10549179	1.000000	0.71417	0.999000	0.59377	0.748000	0.42578	6.922000	0.75811	1.606000	0.50161	-0.182000	0.12963	CAG		0.433	ADPRM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252732.2	NM_020233		35	68	0	0	0	0.010771	0	35	68				
ZNF286A	57335	broad.mit.edu	37	17	15620368	15620368	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr17:15620368G>T	ENST00000464847.2	+	5	1883	c.1330G>T	c.(1330-1332)Ggg>Tgg	p.G444W	ZNF286A_ENST00000421016.1_Missense_Mutation_p.G444W|ZNF286A_ENST00000585171.1_Intron|ZNF286A_ENST00000413242.2_Missense_Mutation_p.G444W|ZNF286A_ENST00000593105.1_Missense_Mutation_p.G434W|ZNF286A_ENST00000583566.1_Missense_Mutation_p.G444W|ZNF286A_ENST00000395894.2_3'UTR			Q9HBT8	Z286A_HUMAN	zinc finger protein 286A	444					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G444W(1)		central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	24				UCEC - Uterine corpus endometrioid carcinoma (92;0.0822)|READ - Rectum adenocarcinoma(1115;0.0222)|BRCA - Breast invasive adenocarcinoma(8;0.0781)		TAATGAATGTGGGAAAACCTT	0.393																																							uc010cot.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(1330-1332)GGG>TGG		zinc finger protein 286							65.0	74.0	71.0					17																	15620368		2203	4300	6503	SO:0001583	missense	57335				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr17:15620368G>T	AF217226	CCDS11172.1, CCDS73997.1	17p11.2	2013-02-14	2007-01-05	2007-01-05		ENSG00000187607		"""Zinc fingers, C2H2-type"", ""-"""	13501	protein-coding gene	gene with protein product			"""zinc finger protein 286"""	ZNF286		11347906	Standard	NM_020652		Approved	KIAA1874	uc010cot.3	Q9HBT8	OTTHUMG00000166448	ENST00000464847.2:c.1330G>T	17.37:g.15620368G>T	ENSP00000464218:p.Gly444Trp		Somatic				ZNF286A_uc002goz.3_Missense_Mutation_p.G332W|ZNF286A_uc010vwa.1_Missense_Mutation_p.G444W|ZNF286A_uc002gpa.2_Missense_Mutation_p.G444W	p.G444W	NM_001130842	NP_001124314	WXS	Illumina HiSeq	Unspecified	Q9HBT8	Z286A_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (92;0.0822)|READ - Rectum adenocarcinoma(1115;0.0222)|BRCA - Breast invasive adenocarcinoma(8;0.0781)	6	1726	+			444			C2H2-type 8.		B4DKF9|Q96JF3	Missense_Mutation	SNP	ENST00000464847.2	37	c.1330G>T	CCDS11172.1	.	.	.	.	.	.	.	.	.	.	g	18.63	3.664454	0.67700	.	.	ENSG00000187607	ENST00000421016;ENST00000412988;ENST00000395894	T;T	0.22336	1.96;1.96	4.11	4.11	0.48088	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.42172	D	0.000745	T	0.54854	0.1884	M	0.92880	3.355	0.58432	D	0.999996	D	0.89917	1.0	D	0.97110	1.0	T	0.67146	-0.5744	10	0.72032	D	0.01	-17.1109	14.2622	0.66092	0.0:0.0:1.0:0.0	.	444	Q9HBT8	Z286A_HUMAN	W	444;434;444	ENSP00000397163:G444W;ENSP00000408168:G434W	ENSP00000435872:G444W	G	+	1	0	ZNF286A	15561093	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.391000	0.73208	2.296000	0.77279	0.650000	0.86243	GGG		0.393	ZNF286A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130696.4	NM_020652		9	34	1	0	1.76689e-08	0.006214	2.10595e-08	9	34				
MYO15A	51168	broad.mit.edu	37	17	18023558	18023558	+	Nonsense_Mutation	SNP	C	C	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr17:18023558C>T	ENST00000205890.5	+	2	1782	c.1444C>T	c.(1444-1446)Cga>Tga	p.R482*		NM_016239.3	NP_057323.3	Q9UKN7	MYO15_HUMAN	myosin XVA	482					inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.R482*(1)		breast(5)|central_nervous_system(2)|endometrium(17)|kidney(3)|large_intestine(16)|lung(27)|ovary(3)|pancreas(1)|prostate(6)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	99	all_neural(463;0.228)					CCTCTTCCCGCGACCCCAGGT	0.632																																							uc010vxh.1		NA																	1	Substitution - Nonsense(1)		lung(1)	skin(4)|ovary(2)|pancreas(1)|breast(1)|central_nervous_system(1)	9						c.(1444-1446)CGA>TGA		myosin XV							38.0	46.0	43.0					17																	18023558		2055	4193	6248	SO:0001587	stop_gained	51168				sensory perception of sound	cytoplasm|myosin complex|stereocilium	actin binding|ATP binding|calmodulin binding|motor activity	g.chr17:18023558C>T	AF144094	CCDS42271.1	17p11.2	2011-09-27			ENSG00000091536	ENSG00000091536		"""Myosins / Myosin superfamily : Class XV"""	7594	protein-coding gene	gene with protein product		602666		DFNB3, MYO15		9603736	Standard	NM_016239		Approved		uc021trl.1	Q9UKN7	OTTHUMG00000059390	ENST00000205890.5:c.1444C>T	17.37:g.18023558C>T	ENSP00000205890:p.Arg482*		Somatic					p.R482*	NM_016239	NP_057323	WXS	Illumina HiSeq	Unspecified	Q9UKN7	MYO15_HUMAN			2	1782	+	all_neural(463;0.228)		482			Myosin head-like.		B4DFC7	Nonsense_Mutation	SNP	ENST00000205890.5	37	c.1444C>T	CCDS42271.1	.	.	.	.	.	.	.	.	.	.	C	41	8.544268	0.98857	.	.	ENSG00000091536	ENST00000205890	.	.	.	5.1	4.1	0.47936	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.1036	0.53798	0.4393:0.5607:0.0:0.0	.	.	.	.	X	482	.	ENSP00000205890:R482X	R	+	1	2	MYO15A	17964283	0.992000	0.36948	1.000000	0.80357	0.973000	0.67179	3.073000	0.50057	1.102000	0.41551	0.561000	0.74099	CGA		0.632	MYO15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132048.1	NM_016239		29	46	0	0	0	0.013726	0	29	46				
SPECC1	92521	broad.mit.edu	37	17	20217341	20217341	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr17:20217341A>T	ENST00000261503.5	+	15	3221	c.3170A>T	c.(3169-3171)cAg>cTg	p.Q1057L	SPECC1_ENST00000395530.2_Missense_Mutation_p.Q976L|AC004702.2_ENST00000580225.1_lincRNA|SPECC1_ENST00000395527.4_Missense_Mutation_p.Q1057L|SPECC1_ENST00000536879.1_Missense_Mutation_p.Q397L	NM_001033553.2	NP_001028725.1	Q5M775	CYTSB_HUMAN	sperm antigen with calponin homology and coiled-coil domains 1	1057	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				cell adhesion (GO:0007155)	nucleus (GO:0005634)		p.Q1057L(1)		breast(1)|large_intestine(3)|ovary(4)	8				KIRC - Kidney renal clear cell carcinoma(2;0.166)|Kidney(2;0.196)		AGTGTGATGCAGTACGTGGCC	0.572																																							uc002gwq.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(3169-3171)CAG>CTG		spectrin domain with coiled-coils 1 NSP5b3b							106.0	82.0	90.0					17																	20217341		2203	4300	6503	SO:0001583	missense	92521					nucleus		g.chr17:20217341A>T	AY816329, AB041533	CCDS32590.1, CCDS42280.1, CCDS42281.1, CCDS45628.1, CCDS58531.1	17p11.2	2012-11-19	2010-09-17	2010-09-17	ENSG00000128487	ENSG00000128487			30615	protein-coding gene	gene with protein product	"""sperm antigen HCMOGT 1"", ""cytokinesis and spindle organization B"", ""cytospin B"""	608793				15602574, 18763323, 15087372	Standard	NM_001033553		Approved	HCMOGT-1, FLJ36955, NSP, CYTSB	uc002gwq.3	Q5M775	OTTHUMG00000179808	ENST00000261503.5:c.3170A>T	17.37:g.20217341A>T	ENSP00000261503:p.Gln1057Leu		Somatic				CYTSB_uc002gws.2_Missense_Mutation_p.Q1057L|CYTSB_uc002gwv.2_Missense_Mutation_p.Q976L|CYTSB_uc010vzf.1_Missense_Mutation_p.Q397L|CYTSB_uc002gww.2_Missense_Mutation_p.Q794L	p.Q1057L	NM_001033553	NP_001028725	WXS	Illumina HiSeq	Unspecified	Q5M775	CYTSB_HUMAN			15	3315	+			1057			CH.		B4DHH0|B7WNS8|Q5IBP1|Q5IBP2|Q5IBP3|Q5IBP4|Q5M772|Q5M773|Q5M774|Q86XT8|Q8N4U4|Q8WU84|Q9HCQ3	Missense_Mutation	SNP	ENST00000261503.5	37	c.3170A>T	CCDS32590.1	.	.	.	.	.	.	.	.	.	.	A	2.692	-0.272895	0.05716	.	.	ENSG00000128487	ENST00000395530;ENST00000261503;ENST00000536879;ENST00000395527	D;D	0.94931	-3.56;-3.56	3.48	2.36	0.29203	Calponin homology domain (5);	0.150128	0.44688	D	0.000437	T	0.81791	0.4897	N	0.03948	-0.315	0.35545	D	0.803355	B;P;B	0.35272	0.005;0.493;0.005	B;B;B	0.31101	0.026;0.124;0.006	T	0.79075	-0.1952	10	0.34782	T	0.22	-14.4315	5.6785	0.17761	0.8675:0.0:0.1325:0.0	.	1018;976;1057	A8MV89;Q5M775-4;Q5M775	.;.;CYTSB_HUMAN	L	1018;1057;397;976	ENSP00000261503:Q1057L;ENSP00000438294:Q397L	ENSP00000261503:Q1057L	Q	+	2	0	SPECC1	20157933	1.000000	0.71417	1.000000	0.80357	0.108000	0.19459	2.375000	0.44283	0.499000	0.27970	0.260000	0.18958	CAG		0.572	SPECC1-018	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441206.1	NM_152904		17	28	0	0	0	0.00499	0	17	28				
SUPT6H	6830	broad.mit.edu	37	17	27011938	27011938	+	Nonsense_Mutation	SNP	A	A	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr17:27011938A>T	ENST00000314616.6	+	19	2729	c.2446A>T	c.(2446-2448)Aaa>Taa	p.K816*	SUPT6H_ENST00000347486.4_Nonsense_Mutation_p.K816*	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)	816	Interaction with KDM6A. {ECO:0000250}.|Interaction with PAAF1.				chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.K816*(1)		NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					CCATTTTACCAAACGGCGAAC	0.493																																							uc002hby.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(2)|skin(1)	3						c.(2446-2448)AAA>TAA		suppressor of Ty 6 homolog							75.0	61.0	66.0					17																	27011938		2203	4300	6503	SO:0001587	stop_gained	6830				chromatin remodeling|regulation of transcription elongation, DNA-dependent|regulation of transcription from RNA polymerase II promoter	nucleus	hydrolase activity, acting on ester bonds|RNA binding|sequence-specific DNA binding transcription factor activity	g.chr17:27011938A>T	U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85		ENST00000314616.6:c.2446A>T	17.37:g.27011938A>T	ENSP00000319104:p.Lys816*		Somatic				SUPT6H_uc010crt.2_Nonsense_Mutation_p.K816*	p.K816*	NM_003170	NP_003161	WXS	Illumina HiSeq	Unspecified	Q7KZ85	SPT6H_HUMAN			19	2536	+	Lung NSC(42;0.00431)		816					A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Nonsense_Mutation	SNP	ENST00000314616.6	37	c.2446A>T	CCDS32596.1	.	.	.	.	.	.	.	.	.	.	A	42	9.532122	0.99198	.	.	ENSG00000109111	ENST00000314616	.	.	.	5.14	5.14	0.70334	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-18.3963	13.8226	0.63331	1.0:0.0:0.0:0.0	.	.	.	.	X	816	.	ENSP00000319104:K816X	K	+	1	0	SUPT6H	24036065	1.000000	0.71417	0.999000	0.59377	0.915000	0.54546	8.800000	0.91900	2.067000	0.61834	0.528000	0.53228	AAA		0.493	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446422.2	NM_003170		47	49	0	0	0	0.01441	0	47	49				
FNDC8	54752	broad.mit.edu	37	17	33448781	33448781	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr17:33448781C>A	ENST00000158009.5	+	1	184	c.69C>A	c.(67-69)aaC>aaA	p.N23K	RAD51D_ENST00000360276.3_5'Flank|RAD51D_ENST00000460118.2_5'Flank|RAD51D_ENST00000590380.1_5'Flank|RAD51D_ENST00000335858.7_5'Flank|RAD51D_ENST00000345365.6_5'Flank|RAD51D_ENST00000394589.4_5'Flank|RAD51L3-RFFL_ENST00000593039.1_5'Flank|RAD51D_ENST00000357906.3_5'Flank|RAD51D_ENST00000590016.1_5'Flank	NM_017559.2	NP_060029.1	Q8TC99	FNDC8_HUMAN	fibronectin type III domain containing 8	23						nucleus (GO:0005634)		p.N23K(1)		breast(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|skin(1)	11		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.022)		AAAACTTCAACATGATGAATG	0.502																																							uc002hix.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(67-69)AAC>AAA		fibronectin type III domain containing 8							192.0	165.0	174.0					17																	33448781		2203	4300	6503	SO:0001583	missense	54752							g.chr17:33448781C>A	BC024002	CCDS11290.1	17q12	2013-02-11			ENSG00000073598	ENSG00000073598		"""Fibronectin type III domain containing"""	25286	protein-coding gene	gene with protein product						12477932	Standard	XM_005257993		Approved	DKFZp434H2215	uc002hix.3	Q8TC99	OTTHUMG00000132932	ENST00000158009.5:c.69C>A	17.37:g.33448781C>A	ENSP00000158009:p.Asn23Lys		Somatic				RFFL_uc002hiq.2_5'Flank|RAD51L3_uc002hir.2_5'Flank|RAD51L3_uc010wcd.1_5'Flank|RAD51L3_uc002his.2_5'Flank|RAD51L3_uc010ctk.2_5'Flank|RAD51L3_uc010wce.1_5'Flank|RAD51L3_uc002hit.2_5'Flank|RAD51L3_uc002hiu.2_5'Flank|RAD51L3_uc010wcf.1_5'Flank|RAD51L3_uc002hiw.1_5'Flank|RAD51L3_uc002hiv.1_5'Flank|RAD51L3_uc010ctl.1_5'Flank|RAD51L3_uc010ctm.1_5'Flank	p.N23K	NM_017559	NP_060029	WXS	Illumina HiSeq	Unspecified	Q8TC99	FNDC8_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (308;0.022)	1	151	+		Ovarian(249;0.17)	23					B2R9G6|Q9UFC2	Missense_Mutation	SNP	ENST00000158009.5	37	c.69C>A	CCDS11290.1	.	.	.	.	.	.	.	.	.	.	C	10.08	1.252616	0.22880	.	.	ENSG00000073598	ENST00000158009	T	0.32515	1.45	4.16	-8.32	0.00996	.	0.284524	0.25335	N	0.031410	T	0.15262	0.0368	L	0.27053	0.805	0.09310	N	1	B	0.18461	0.028	B	0.12156	0.007	T	0.06144	-1.0843	10	0.87932	D	0	-5.84	9.5587	0.39355	0.1133:0.151:0.0:0.7358	.	23	Q8TC99	FNDC8_HUMAN	K	23	ENSP00000158009:N23K	ENSP00000158009:N23K	N	+	3	2	FNDC8	30472894	0.000000	0.05858	0.000000	0.03702	0.034000	0.12701	-3.774000	0.00370	-1.649000	0.01508	-0.362000	0.07510	AAC		0.502	FNDC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256459.2	NM_017559		18	159	1	0	0.00074312	0.006122	0.00078589	18	159				
CCL23	6368	broad.mit.edu	37	17	34340789	34340789	+	Silent	SNP	A	A	C			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr17:34340789A>C	ENST00000591423.1	-	3	310	c.246T>G	c.(244-246)ggT>ggG	p.G82G	RP11-104J23.1_ENST00000588294.1_RNA|RP11-104J23.2_ENST00000590149.1_lincRNA|CCL23_ENST00000293280.2_Silent_p.G99G	NM_145898.1	NP_665905.1	P55773	CCL23_HUMAN	chemokine (C-C motif) ligand 23	82					cell-cell signaling (GO:0007267)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|monocyte chemotaxis (GO:0002548)|negative regulation of C-C chemokine binding (GO:2001264)|negative regulation of cell proliferation (GO:0008285)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	CCR1 chemokine receptor binding (GO:0031726)|chemokine activity (GO:0008009)|heparin binding (GO:0008201)	p.G99G(1)		large_intestine(2)|liver(1)|lung(2)|prostate(1)	6		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		CCTACATGACACCCGGCTTGG	0.542																																							uc002hkt.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(244-246)GGT>GGG		small inducible cytokine A23 isoform CKbeta8	Treprostinil(DB00374)						93.0	83.0	86.0					17																	34340789		2203	4300	6503	SO:0001819	synonymous_variant	6368				cell-cell signaling|cellular calcium ion homeostasis|chemotaxis|G-protein coupled receptor protein signaling pathway|immune response|inflammatory response|negative regulation of cell proliferation	extracellular space	chemokine activity|heparin binding	g.chr17:34340789A>C	U58913	CCDS11305.1, CCDS59282.1	17q11.2	2014-05-06	2002-08-22	2002-08-23	ENSG00000167236	ENSG00000274736		"""Chemokine ligands"", ""Endogenous ligands"""	10622	protein-coding gene	gene with protein product		602494	"""small inducible cytokine subfamily A (Cys-Cys), member 23"""	SCYA23		9104803, 10409433	Standard	XR_429910		Approved	Ckb-8, MPIF-1, MIP-3, CKb8	uc002hks.1	P55773	OTTHUMG00000188409	ENST00000591423.1:c.246T>G	17.37:g.34340789A>C			Somatic				CCL23_uc002hks.1_Silent_p.G99G	p.G82G	NM_145898	NP_665905	WXS	Illumina HiSeq	Unspecified	P55773	CCL23_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)	3	317	-		Ovarian(249;0.17)	82					B7ZKQ3|O00174|O75950|Q52LD4	Silent	SNP	ENST00000591423.1	37	c.246T>G	CCDS59282.1																																																																																				0.542	CCL23-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000450228.1	NM_005064, NM_145898		15	60	0	0	0	0.00499	0	15	60				
KRT33B	3884	broad.mit.edu	37	17	39521447	39521447	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr17:39521447G>T	ENST00000251646.3	-	5	905	c.856C>A	c.(856-858)Ctg>Atg	p.L286M		NM_002279.4	NP_002270.1	Q14525	KT33B_HUMAN	keratin 33B	286	Coil 2.|Rod.				aging (GO:0007568)|hair cycle (GO:0042633)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)	p.L286M(1)		NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(6)|lung(6)|pancreas(1)|stomach(1)|upper_aerodigestive_tract(1)	21		Breast(137;0.000496)				TGGGCCTGCAGCTCGATCTCC	0.592																																							uc002hwl.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(856-858)CTG>ATG		type I hair keratin 3B							100.0	91.0	94.0					17																	39521447		2192	4297	6489	SO:0001583	missense	3884					intermediate filament	protein binding|structural molecule activity	g.chr17:39521447G>T	X82634	CCDS11389.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000131738	ENSG00000131738		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6451	protein-coding gene	gene with protein product	"""hard keratin type I 3II"""	602762	"""keratin, hair, acidic, 3B"""	KRTHA3B		7565656, 16831889	Standard	NM_002279		Approved	Ha-3II	uc002hwl.4	Q14525	OTTHUMG00000133429	ENST00000251646.3:c.856C>A	17.37:g.39521447G>T	ENSP00000251646:p.Leu286Met		Somatic					p.L286M	NM_002279	NP_002270	WXS	Illumina HiSeq	Unspecified	Q14525	KT33B_HUMAN			5	901	-		Breast(137;0.000496)	286			Coil 2.|Rod.		O76010	Missense_Mutation	SNP	ENST00000251646.3	37	c.856C>A	CCDS11389.1	.	.	.	.	.	.	.	.	.	.	g	19.61	3.858996	0.71834	.	.	ENSG00000131738	ENST00000251646	D	0.93189	-3.18	4.93	3.96	0.45880	Filament (1);	0.000000	0.49305	D	0.000144	D	0.97300	0.9117	H	0.95917	3.74	0.38636	D	0.951486	D	0.56746	0.977	P	0.61940	0.896	D	0.99461	1.0943	10	0.87932	D	0	.	13.0625	0.59015	0.078:0.0:0.922:0.0	.	286	Q14525	KT33B_HUMAN	M	286	ENSP00000251646:L286M	ENSP00000251646:L286M	L	-	1	2	KRT33B	36774973	1.000000	0.71417	1.000000	0.80357	0.644000	0.38419	5.186000	0.65082	1.444000	0.47605	-0.127000	0.14921	CTG		0.592	KRT33B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257292.1	NM_002279		45	176	1	0	2.23044e-30	0.01441	3.58986e-30	45	176				
BECN1	8678	broad.mit.edu	37	17	40966604	40966604	+	Silent	SNP	A	A	G			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr17:40966604A>G	ENST00000361523.4	-	9	1050	c.918T>C	c.(916-918)gcT>gcC	p.A306A	BECN1_ENST00000590099.1_Silent_p.A306A|BECN1_ENST00000438274.3_Silent_p.A230A	NM_003766.3	NP_003757.1	Q14457	BECN1_HUMAN	beclin 1, autophagy related	306					autophagic vacuole assembly (GO:0000045)|beta-amyloid metabolic process (GO:0050435)|cellular defense response (GO:0006968)|cellular response to aluminum ion (GO:0071275)|cellular response to epidermal growth factor stimulus (GO:0071364)|cytokinesis (GO:0000910)|defense response to virus (GO:0051607)|lysosome organization (GO:0007040)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|neuron development (GO:0048666)|positive regulation of macroautophagy (GO:0016239)|regulation of catalytic activity (GO:0050790)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to vitamin E (GO:0033197)|viral process (GO:0016032)	dendrite (GO:0030425)|membrane (GO:0016020)|nucleus (GO:0005634)|phagocytic vesicle (GO:0045335)|protein complex (GO:0043234)|trans-Golgi network (GO:0005802)		p.A306A(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|skin(1)	13		Breast(137;0.00104)		BRCA - Breast invasive adenocarcinoma(366;0.0745)		TCTGGCCCCAAGCAGCATTAA	0.512																																							uc002ibo.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(916-918)GCT>GCC		beclin 1							107.0	98.0	101.0					17																	40966604		2203	4300	6503	SO:0001819	synonymous_variant	8678				anti-apoptosis|cell cycle|cellular defense response|cytokinesis|response to virus	membrane	protein binding	g.chr17:40966604A>G	AF077301	CCDS11441.1	17q21	2014-02-12	2008-01-14		ENSG00000126581	ENSG00000126581			1034	protein-coding gene	gene with protein product	"""ATG6 autophagy related 6 homolog (S. cerevisiae)"""	604378	"""beclin 1 (coiled-coil, moesin-like BCL2 interacting protein)"""			9765397	Standard	NM_003766		Approved	ATG6, VPS30	uc002ibn.2	Q14457		ENST00000361523.4:c.918T>C	17.37:g.40966604A>G			Somatic				BECN1_uc010whb.1_Silent_p.A219A|BECN1_uc010whc.1_Silent_p.A230A|BECN1_uc002ibn.2_Silent_p.A306A	p.A306A	NM_003766	NP_003757	WXS	Illumina HiSeq	Unspecified	Q14457	BECN1_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.0745)	9	1053	-		Breast(137;0.00104)	306					B2R6N7|O75595|Q9UNA8	Silent	SNP	ENST00000361523.4	37	c.918T>C	CCDS11441.1																																																																																				0.512	BECN1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452405.1	NM_003766		28	91	0	0	0	0.00632	0	28	91				
RP11-156P1.2	0	broad.mit.edu	37	17	45127206	45127206	+	IGR	SNP	G	G	C			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr17:45127206G>C	ENST00000571841.1	+	0	889				LRRC37A17P_ENST00000570478.1_RNA|RP11-156P1.3_ENST00000575173.1_RNA																							GTGAGAGACAGATGGAAAGAC	0.458																																							uc010wkj.1		NA																	0					NA						c.(403-405)AGA>ACA		SubName: Full=Putative uncharacterized protein LRRC37A3;																																				SO:0001628	intergenic_variant	0							g.chr17:45127206G>C																													17.37:g.45127206G>C			Somatic				uc010wkl.1_RNA	p.R135T			WXS	Illumina HiSeq	Unspecified					2	758	+									Missense_Mutation	SNP	ENST00000571841.1	37	c.404G>C																																																																																					0.458	RP11-156P1.2-001	KNOWN	basic|appris_principal|readthrough_transcript	nonsense_mediated_decay	protein_coding	OTTHUMT00000440447.1			61	135	0	0	0	0.01441	0	61	135				
HOXB4	3214	broad.mit.edu	37	17	46655326	46655326	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr17:46655326G>T	ENST00000332503.5	-	1	2147	c.356C>A	c.(355-357)cCg>cAg	p.P119Q	MIR10A_ENST00000385043.1_RNA|HOXB3_ENST00000489475.1_Intron|HOXB3_ENST00000465120.3_Intron|HOXB3_ENST00000472863.1_Intron|HOXB3_ENST00000498678.1_Intron|HOXB-AS3_ENST00000465846.2_RNA|HOXB3_ENST00000476342.1_Intron|HOXB3_ENST00000460160.1_Intron|HOXB3_ENST00000552000.2_Intron|HOXB3_ENST00000485909.2_5'Flank	NM_024015.4	NP_076920.1	P17483	HXB4_HUMAN	homeobox B4	119	Pro-rich (part of the transcriptional activation domain).				anterior/posterior pattern specification (GO:0009952)|bone marrow development (GO:0048539)|cell proliferation (GO:0008283)|definitive hemopoiesis (GO:0060216)|embryonic skeletal system morphogenesis (GO:0048704)|hematopoietic stem cell differentiation (GO:0060218)|morphogenesis of an epithelial sheet (GO:0002011)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of stem cell differentiation (GO:2000738)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|somatic stem cell division (GO:0048103)|spleen development (GO:0048536)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P119Q(1)		central_nervous_system(1)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)|urinary_tract(2)	9						GCAGGGAGGCGGCGGGGGGCT	0.756																																							uc002inp.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(355-357)CCG>CAG		homeobox B4							12.0	16.0	15.0					17																	46655326		2056	4044	6100	SO:0001583	missense	3214					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr17:46655326G>T		CCDS11529.1	17q21.32	2011-06-20	2005-12-22		ENSG00000182742	ENSG00000182742		"""Homeoboxes / ANTP class : HOXL subclass"""	5115	protein-coding gene	gene with protein product		142965	"""homeo box B4"""	HOX2, HOX2F		1973146, 1358459	Standard	NM_024015		Approved		uc002inp.3	P17483	OTTHUMG00000159920	ENST00000332503.5:c.356C>A	17.37:g.46655326G>T	ENSP00000328928:p.Pro119Gln		Somatic				HOXB3_uc010wlm.1_Intron|HOXB3_uc010dbf.2_Intron|HOXB3_uc010dbg.2_Intron|HOXB3_uc010wlk.1_5'Flank|HOXB3_uc010wll.1_Intron	p.P119Q	NM_024015	NP_076920	WXS	Illumina HiSeq	Unspecified	P17483	HXB4_HUMAN			1	418	-			119			Pro-rich (part of the transcriptional activation domain).		Q9NTA0	Missense_Mutation	SNP	ENST00000332503.5	37	c.356C>A	CCDS11529.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.176543	0.78564	.	.	ENSG00000182742	ENST00000332503	D	0.91894	-2.93	3.86	3.86	0.44501	.	0.701207	0.13398	N	0.390898	D	0.92116	0.7501	M	0.84082	2.675	0.58432	D	0.999995	B	0.16396	0.017	B	0.15870	0.014	D	0.89728	0.3924	10	0.36615	T	0.2	.	14.5613	0.68140	0.0:0.0:1.0:0.0	.	119	P17483	HXB4_HUMAN	Q	119	ENSP00000328928:P119Q	ENSP00000328928:P119Q	P	-	2	0	HOXB4	44010325	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.751000	0.68720	1.720000	0.51447	0.491000	0.48974	CCG		0.756	HOXB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358259.2			13	60	1	0	6.31663e-08	0.003163	7.46818e-08	13	60				
GIP	2695	broad.mit.edu	37	17	47041781	47041781	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr17:47041781G>A	ENST00000357424.2	-	3	248	c.148C>T	c.(148-150)Ccc>Tcc	p.P50S		NM_004123.2	NP_004114.1	P09681	GIP_HUMAN	gastric inhibitory polypeptide	50					adult locomotory behavior (GO:0008344)|cellular protein metabolic process (GO:0044267)|digestive system development (GO:0055123)|endocrine pancreas development (GO:0031018)|exploration behavior (GO:0035640)|female pregnancy (GO:0007565)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of glucagon secretion (GO:0070094)|positive regulation of glucose transport (GO:0010828)|positive regulation of insulin secretion (GO:0032024)|regulation of insulin secretion (GO:0050796)|response to amino acid (GO:0043200)|response to axon injury (GO:0048678)|response to drug (GO:0042493)|response to glucose (GO:0009749)|response to lipid (GO:0033993)|response to organic cyclic compound (GO:0014070)|response to peptide hormone (GO:0043434)|response to selenium ion (GO:0010269)|response to starvation (GO:0042594)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|triglyceride homeostasis (GO:0070328)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|secretory granule lumen (GO:0034774)	hormone activity (GO:0005179)	p.P50S(1)		lung(2)|skin(1)|stomach(1)	4						GCGTACCTGGGGCCTCGAGGT	0.567																																							uc002iol.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(148-150)CCC>TCC		gastric inhibitory polypeptide preproprotein							130.0	114.0	120.0					17																	47041781		2203	4300	6503	SO:0001583	missense	2695				energy reserve metabolic process|signal transduction	extracellular region|soluble fraction	hormone activity	g.chr17:47041781G>A		CCDS11542.1	17q21.3-q22	2013-02-26			ENSG00000159224	ENSG00000159224		"""Endogenous ligands"""	4270	protein-coding gene	gene with protein product	"""glucose-dependent insulinotropic polypeptide"""	137240				2739653	Standard	NM_004123		Approved		uc002iol.1	P09681	OTTHUMG00000161171	ENST00000357424.2:c.148C>T	17.37:g.47041781G>A	ENSP00000350005:p.Pro50Ser		Somatic					p.P50S	NM_004123	NP_004114	WXS	Illumina HiSeq	Unspecified	P09681	GIP_HUMAN			3	246	-			50					Q4VB42|Q6NTD3	Missense_Mutation	SNP	ENST00000357424.2	37	c.148C>T	CCDS11542.1	.	.	.	.	.	.	.	.	.	.	G	15.75	2.924469	0.52653	.	.	ENSG00000159224	ENST00000357424	T	0.22336	1.96	5.32	3.26	0.37387	.	0.565703	0.16305	N	0.220269	T	0.12902	0.0313	N	0.24115	0.695	0.09310	N	1	B	0.34103	0.437	B	0.30401	0.115	T	0.14896	-1.0456	10	0.45353	T	0.12	-6.5504	8.5376	0.33373	0.0:0.1678:0.658:0.1742	.	50	P09681	GIP_HUMAN	S	50	ENSP00000350005:P50S	ENSP00000350005:P50S	P	-	1	0	GIP	44396780	0.993000	0.37304	0.125000	0.21846	0.282000	0.26991	1.739000	0.38217	0.765000	0.33221	0.563000	0.77884	CCC		0.567	GIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364044.1	NM_004123		22	177	0	0	0	0.014323	0	22	177				
NGFR	4804	broad.mit.edu	37	17	47583901	47583901	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr17:47583901C>A	ENST00000172229.3	+	3	574	c.449C>A	c.(448-450)cCc>cAc	p.P150H	RP5-1029K10.2_ENST00000514506.1_RNA|NGFR_ENST00000504201.1_Missense_Mutation_p.P56H	NM_002507.3	NP_002498.1	P08138	TNR16_HUMAN	nerve growth factor receptor	150					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|central nervous system development (GO:0007417)|circadian regulation of gene expression (GO:0032922)|detection of temperature stimulus (GO:0016048)|glucose homeostasis (GO:0042593)|hair follicle morphogenesis (GO:0031069)|intracellular protein transport (GO:0006886)|membrane protein intracellular domain proteolysis (GO:0031293)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell cycle (GO:0045786)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of hair follicle development (GO:0051799)|nerve development (GO:0021675)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of axonogenesis (GO:0050772)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of odontogenesis of dentin-containing tooth (GO:0042488)|regulation of axonogenesis (GO:0050770)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of glucose import in response to insulin stimulus (GO:2001273)	cell surface (GO:0009986)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|neuronal postsynaptic density (GO:0097481)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	death receptor activity (GO:0005035)|Rab GTPase binding (GO:0017137)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)	p.P150H(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(7)|ovary(1)	17	all_cancers(4;1.45e-13)|Breast(4;6.34e-28)|all_epithelial(4;4.95e-17)					GAGGAGTGCCCCGACGGCACG	0.701																																							uc002ioz.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|lung(1)	2						c.(448-450)CCC>CAC		nerve growth factor receptor precursor							38.0	28.0	31.0					17																	47583901		2197	4288	6485	SO:0001583	missense	4804				anti-apoptosis|apoptosis|induction of apoptosis by extracellular signals|membrane protein intracellular domain proteolysis|negative regulation of axonogenesis|negative regulation of cell cycle|nerve growth factor receptor signaling pathway|positive regulation of axonogenesis	cell surface|cytosol|endosome|extracellular region|integral to plasma membrane|nucleoplasm		g.chr17:47583901C>A	M14764	CCDS11549.1	17q21-q22	2013-05-22	2010-04-28		ENSG00000064300	ENSG00000064300		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	7809	protein-coding gene	gene with protein product	"""low affinity nerve growth factor receptor"", ""TNFR superfamily, member 16"""	162010	"""nerve growth factor receptor (TNFR superfamily, member 16)"""			3022937, 3006050	Standard	NM_002507		Approved	TNFRSF16, CD271, p75NTR	uc002ioz.4	P08138	OTTHUMG00000161495	ENST00000172229.3:c.449C>A	17.37:g.47583901C>A	ENSP00000172229:p.Pro150His		Somatic					p.P150H	NM_002507	NP_002498	WXS	Illumina HiSeq	Unspecified	P08138	TNR16_HUMAN			3	574	+	all_cancers(4;1.45e-13)|Breast(4;6.34e-28)|all_epithelial(4;4.95e-17)		150			Extracellular (Potential).|TNFR-Cys 4.		B2R961|B4E096	Missense_Mutation	SNP	ENST00000172229.3	37	c.449C>A	CCDS11549.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.114816	0.77210	.	.	ENSG00000064300	ENST00000172229;ENST00000504201	D;D	0.91577	-2.87;-2.87	5.34	5.34	0.76211	TNFR/CD27/30/40/95 cysteine-rich region (4);	0.224169	0.45867	D	0.000327	D	0.95130	0.8422	M	0.80183	2.485	0.40042	D	0.975668	D	0.89917	1.0	D	0.71656	0.974	D	0.94036	0.7305	10	0.29301	T	0.29	-28.1036	18.6413	0.91397	0.0:1.0:0.0:0.0	.	150	P08138	TNR16_HUMAN	H	150;56	ENSP00000172229:P150H;ENSP00000421731:P56H	ENSP00000172229:P150H	P	+	2	0	NGFR	44938900	0.265000	0.24102	1.000000	0.80357	0.991000	0.79684	1.499000	0.35671	2.497000	0.84241	0.561000	0.74099	CCC		0.701	NGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365150.1			8	56	1	0	1.12685e-05	0.004482	1.24547e-05	8	56				
BCAS3	54828	broad.mit.edu	37	17	59445833	59445833	+	Silent	SNP	G	G	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr17:59445833G>T	ENST00000390652.5	+	24	2647	c.2616G>T	c.(2614-2616)cgG>cgT	p.R872R	BCAS3_ENST00000588874.1_Silent_p.R628R|BCAS3_ENST00000407086.3_Silent_p.R857R|BCAS3_ENST00000589222.1_Silent_p.R857R|BCAS3_ENST00000585812.1_3'UTR|BCAS3_ENST00000588462.1_Silent_p.R872R|BCAS3_ENST00000408905.3_Silent_p.R857R|RP11-332H18.5_ENST00000585765.1_RNA|BCAS3_ENST00000585744.1_Silent_p.R643R	NM_001099432.1	NP_001092902.1			breast carcinoma amplified sequence 3									p.R872R(1)		NS(1)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(24)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44			BRCA - Breast invasive adenocarcinoma(1;3.11e-12)|Epithelial(12;8.2e-07)|all cancers(12;5.33e-06)			CACCTAGCCGGGACGTCGTGG	0.612																																							uc002iyv.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|central_nervous_system(2)|skin(1)	5						c.(2614-2616)CGG>CGT		breast carcinoma amplified sequence 3 isoform 1							35.0	40.0	39.0					17																	59445833		2005	4152	6157	SO:0001819	synonymous_variant	54828					nucleus		g.chr17:59445833G>T	AF361219	CCDS11626.1, CCDS45749.1	17q23.2	2013-06-25			ENSG00000141376	ENSG00000141376		"""WD repeat domain containing"""	14347	protein-coding gene	gene with protein product		607470				12378525	Standard	NM_017679		Approved	FLJ20128	uc002iyv.4	Q9H6U6	OTTHUMG00000180064	ENST00000390652.5:c.2616G>T	17.37:g.59445833G>T			Somatic				BCAS3_uc002iyu.3_Silent_p.R857R|BCAS3_uc002iyw.3_Silent_p.R853R|BCAS3_uc002iyy.3_Silent_p.R628R|BCAS3_uc002iyz.3_Silent_p.R426R|BCAS3_uc002iza.3_Silent_p.R411R|BCAS3_uc002izb.3_RNA|BCAS3_uc002izc.3_RNA|BCAS3_uc002izd.3_5'UTR	p.R872R	NM_001099432	NP_001092902	WXS	Illumina HiSeq	Unspecified	Q9H6U6	BCAS3_HUMAN	BRCA - Breast invasive adenocarcinoma(1;3.11e-12)|Epithelial(12;8.2e-07)|all cancers(12;5.33e-06)		24	2725	+			872						Silent	SNP	ENST00000390652.5	37	c.2616G>T	CCDS45749.1																																																																																				0.612	BCAS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449578.1	NM_017679		10	47	1	0	3.99206e-14	0.007413	5.38378e-14	10	47				
ICAM2	3384	broad.mit.edu	37	17	62081303	62081303	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr17:62081303A>T	ENST00000412356.1	-	5	704	c.350T>A	c.(349-351)cTg>cAg	p.L117Q	ICAM2_ENST00000579788.1_Missense_Mutation_p.L117Q|ICAM2_ENST00000578892.1_Missense_Mutation_p.L93Q|ICAM2_ENST00000581417.1_5'UTR|ICAM2_ENST00000418105.1_Missense_Mutation_p.L117Q|ICAM2_ENST00000578379.1_Missense_Mutation_p.L16Q|ICAM2_ENST00000579687.1_Missense_Mutation_p.L117Q|ICAM2_ENST00000449662.2_Missense_Mutation_p.L117Q|C17orf72_ENST00000412177.1_3'UTR	NM_001099786.1	NP_001093256.1	P13598	ICAM2_HUMAN	intercellular adhesion molecule 2	117					extracellular matrix organization (GO:0030198)|regulation of immune response (GO:0050776)|single organismal cell-cell adhesion (GO:0016337)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|uropod (GO:0001931)	integrin binding (GO:0005178)	p.L117Q(1)		large_intestine(1)|lung(2)|ovary(1)|skin(2)	6						TTGCAGTGTCAGGATGACCTG	0.637																																							uc002jdu.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(349-351)CTG>CAG		intercellular adhesion molecule 2 precursor							42.0	39.0	40.0					17																	62081303		2203	4300	6503	SO:0001583	missense	3384				cell-cell adhesion|regulation of immune response	integral to plasma membrane	integrin binding	g.chr17:62081303A>T		CCDS11657.1	17q23.3	2014-01-30			ENSG00000108622	ENSG00000108622		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Endogenous ligands"""	5345	protein-coding gene	gene with protein product		146630				1769660	Standard	NM_001099786		Approved	CD102	uc002jdx.4	P13598		ENST00000412356.1:c.350T>A	17.37:g.62081303A>T	ENSP00000415283:p.Leu117Gln		Somatic				C17orf72_uc002jdt.3_3'UTR|C17orf72_uc010wpu.1_3'UTR|C17orf72_uc010wpv.1_3'UTR|C17orf72_uc010wpw.1_3'UTR|ICAM2_uc002jdw.3_Missense_Mutation_p.L117Q|ICAM2_uc010ded.2_Missense_Mutation_p.L117Q|ICAM2_uc002jdx.3_Missense_Mutation_p.L117Q|ICAM2_uc002jdv.3_Missense_Mutation_p.L117Q	p.L117Q	NM_000873	NP_000864	WXS	Illumina HiSeq	Unspecified	P13598	ICAM2_HUMAN			3	582	-			117			Extracellular (Potential).		Q14600	Missense_Mutation	SNP	ENST00000412356.1	37	c.350T>A	CCDS11657.1	.	.	.	.	.	.	.	.	.	.	A	13.84	2.356724	0.41801	.	.	ENSG00000108622	ENST00000412356;ENST00000418105;ENST00000449662	T;T;T	0.07688	3.17;3.17;3.17	5.41	5.41	0.78517	Intercellular adhesion molecule/vascular cell adhesion molecule, N-terminal (1);Immunoglobulin-like fold (1);	0.178238	0.38897	N	0.001538	T	0.31544	0.0800	M	0.84948	2.725	0.22639	N	0.998901	D	0.89917	1.0	D	0.87578	0.998	T	0.23154	-1.0196	10	0.87932	D	0	-21.4328	11.8407	0.52353	1.0:0.0:0.0:0.0	.	117	P13598	ICAM2_HUMAN	Q	117	ENSP00000415283:L117Q;ENSP00000388666:L117Q;ENSP00000392634:L117Q	ENSP00000415283:L117Q	L	-	2	0	ICAM2	59435035	0.340000	0.24792	0.705000	0.30386	0.004000	0.04260	2.915000	0.48805	2.042000	0.60477	0.379000	0.24179	CTG		0.637	ICAM2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443687.1			4	60	0	0	0	0.009096	0	4	60				
GPS1	2873	broad.mit.edu	37	17	80011904	80011904	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr17:80011904G>A	ENST00000306823.6	+	3	310	c.287G>A	c.(286-288)cGc>cAc	p.R96H	GPS1_ENST00000320548.4_Missense_Mutation_p.R80H|RFNG_ENST00000310496.4_5'Flank|GPS1_ENST00000392358.2_Missense_Mutation_p.R136H|GPS1_ENST00000578552.1_Missense_Mutation_p.R96H|RFNG_ENST00000429557.3_5'Flank|GPS1_ENST00000355130.2_Missense_Mutation_p.R136H			Q13098	CSN1_HUMAN	G protein pathway suppressor 1	96					cell cycle (GO:0007049)|cullin deneddylation (GO:0010388)|inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTPase inhibitor activity (GO:0005095)	p.R136H(1)		breast(1)|central_nervous_system(1)|endometrium(3)|liver(1)|lung(4)|prostate(1)|skin(2)	13	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0211)			GAGATCCACCGCAAGCTCTCA	0.632																																							uc002kdl.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(286-288)CGC>CAC		G protein pathway suppressor 1 isoform 2							42.0	34.0	37.0					17																	80011904		2200	4295	6495	SO:0001583	missense	2873				cell cycle|cullin deneddylation|inactivation of MAPK activity|JNK cascade	cytoplasm|signalosome	GTPase inhibitor activity|protein binding	g.chr17:80011904G>A		CCDS11800.1, CCDS32774.1	17q25.3	2013-03-14				ENSG00000169727			4549	protein-coding gene	gene with protein product	"""COP9 signalosome subunit 1"""	601934				9535219	Standard	NM_212492		Approved	COPS1, CSN1	uc002kdl.1	Q13098		ENST00000306823.6:c.287G>A	17.37:g.80011904G>A	ENSP00000302873:p.Arg96His		Somatic				RFNG_uc002kdj.2_5'Flank|GPS1_uc002kdk.1_Missense_Mutation_p.R136H|GPS1_uc010dij.1_Missense_Mutation_p.R136H|GPS1_uc002kdm.1_Missense_Mutation_p.R80H|GPS1_uc002kdn.1_Missense_Mutation_p.R96H|GPS1_uc002kdo.1_Missense_Mutation_p.R96H|GPS1_uc010wvh.1_Missense_Mutation_p.R88H	p.R96H	NM_004127	NP_004118	WXS	Illumina HiSeq	Unspecified	Q13098	CSN1_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0211)		3	332	+	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		96					Q8NA10|Q9BWL1	Missense_Mutation	SNP	ENST00000306823.6	37	c.287G>A	CCDS32774.1	.	.	.	.	.	.	.	.	.	.	G	16.76	3.212071	0.58452	.	.	ENSG00000169727	ENST00000392358;ENST00000306823;ENST00000355130	.	.	.	4.61	4.61	0.57282	.	.	.	.	.	T	0.32436	0.0829	N	0.13098	0.295	0.80722	D	1	B;P;B;B;P	0.39250	0.027;0.535;0.045;0.089;0.665	B;B;B;B;B	0.23419	0.006;0.021;0.013;0.007;0.046	T	0.31696	-0.9934	8	0.40728	T	0.16	.	17.6079	0.88044	0.0:0.0:1.0:0.0	.	88;136;96;96;136	B4DND6;A8K070;Q13098-5;Q13098;Q13098-7	.;.;.;CSN1_HUMAN;.	H	136;96;136	.	ENSP00000302873:R96H	R	+	2	0	GPS1	77605193	1.000000	0.71417	0.988000	0.46212	0.901000	0.52897	8.978000	0.93450	2.366000	0.80165	0.563000	0.77884	CGC		0.632	GPS1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000442176.1	NM_212492		25	21	0	0	0	0.008361	0	25	21				
TRAPPC8	22878	broad.mit.edu	37	18	29446938	29446938	+	Splice_Site	SNP	C	C	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr18:29446938C>A	ENST00000283351.4	-	18	2799	c.2464G>T	c.(2464-2466)Gca>Tca	p.A822S	TRAPPC8_ENST00000582539.1_Splice_Site_p.A768S	NM_014939.3	NP_055754	Q9Y2L5	TPPC8_HUMAN	trafficking protein particle complex 8	822					vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)		p.A822S(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(7)|liver(2)|lung(13)|ovary(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						TTTAGTCTTGCCTGTGGAGAT	0.358																																							uc002kxc.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2464-2466)GCA>TCA		hypothetical protein LOC22878							81.0	77.0	78.0					18																	29446938		2203	4300	6503	SO:0001630	splice_region_variant	22878				ER to Golgi vesicle-mediated transport	cis-Golgi network		g.chr18:29446938C>A	AB023229	CCDS11901.1	18q12.1	2011-10-10	2010-06-29	2010-06-29	ENSG00000153339	ENSG00000153339		"""Trafficking protein particle complex"""	29169	protein-coding gene	gene with protein product	"""general sporulation gene 1 homolog (S. cerevisiae)"""	614136	"""KIAA1012"""	KIAA1012		10231032, 11230166	Standard	NM_014939		Approved	HsT2706, TRS85, GSG1	uc002kxc.4	Q9Y2L5	OTTHUMG00000132267	ENST00000283351.4:c.2464-1G>T	18.37:g.29446938C>A			Somatic				KIAA1012_uc002kxb.3_Missense_Mutation_p.A768S|KIAA1012_uc002kxd.3_RNA	p.A822S	NM_014939	NP_055754	WXS	Illumina HiSeq	Unspecified	Q9Y2L5	TPPC8_HUMAN			18	2828	-			822					A0JP15|B3KME5|Q9H0L2	Missense_Mutation	SNP	ENST00000283351.4	37	c.2464G>T	CCDS11901.1	.	.	.	.	.	.	.	.	.	.	C	15.12	2.738662	0.49045	.	.	ENSG00000153339	ENST00000283351	T	0.09073	3.02	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	T	0.23014	0.0556	M	0.72118	2.19	0.80722	D	1	D	0.61697	0.99	P	0.53102	0.718	T	0.00749	-1.1582	10	0.72032	D	0.01	.	18.8441	0.92198	0.0:1.0:0.0:0.0	.	822	Q9Y2L5	TPPC8_HUMAN	S	822	ENSP00000283351:A822S	ENSP00000283351:A822S	A	-	1	0	TRAPPC8	27700936	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.995000	0.70631	2.460000	0.83146	0.467000	0.42956	GCA		0.358	TRAPPC8-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255355.1	NM_014939	Missense_Mutation	15	20	1	0	2.23348e-06	0.004007	2.50628e-06	15	20				
CDH7	1005	broad.mit.edu	37	18	63511297	63511297	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr18:63511297G>T	ENST00000397968.2	+	7	1657	c.1231G>T	c.(1231-1233)Gtg>Ttg	p.V411L	CDH7_ENST00000323011.3_Missense_Mutation_p.V411L|CDH7_ENST00000536984.2_Missense_Mutation_p.V411L	NM_004361.2	NP_004352.2	Q9ULB5	CADH7_HUMAN	cadherin 7, type 2	411	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V411L(2)		NS(1)|breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(43)|ovary(3)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	80		Esophageal squamous(42;0.129)				CAATAGCCCTGTGAGGTAAAA	0.423																																							uc002ljz.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|pancreas(1)|skin(1)	4						c.(1231-1233)GTG>TTG		cadherin 7, type 2 preproprotein							116.0	106.0	109.0					18																	63511297		2203	4300	6503	SO:0001583	missense	1005				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr18:63511297G>T	AB035301	CCDS11993.1	18q22.1	2010-01-26			ENSG00000081138	ENSG00000081138		"""Cadherins / Major cadherins"""	1766	protein-coding gene	gene with protein product		605806				9615235	Standard	NM_033646		Approved		uc002ljz.3	Q9ULB5	OTTHUMG00000132800	ENST00000397968.2:c.1231G>T	18.37:g.63511297G>T	ENSP00000381058:p.Val411Leu		Somatic				CDH7_uc002lka.2_Missense_Mutation_p.V411L|CDH7_uc002lkb.2_Missense_Mutation_p.V411L	p.V411L	NM_033646	NP_387450	WXS	Illumina HiSeq	Unspecified	Q9ULB5	CADH7_HUMAN			7	1556	+		Esophageal squamous(42;0.129)	411			Extracellular (Potential).|Cadherin 4.		Q9H157	Missense_Mutation	SNP	ENST00000397968.2	37	c.1231G>T	CCDS11993.1	.	.	.	.	.	.	.	.	.	.	G	16.19	3.054548	0.55218	.	.	ENSG00000081138	ENST00000323011;ENST00000536984;ENST00000397966;ENST00000397968	T;T;T	0.53206	0.63;0.63;0.63	4.75	4.75	0.60458	Cadherin (4);Cadherin-like (1);	0.148202	0.44902	D	0.000415	T	0.46288	0.1385	L	0.42686	1.345	0.47476	D	0.999439	P;B	0.39831	0.69;0.316	B;B	0.40410	0.328;0.074	T	0.53450	-0.8437	10	0.72032	D	0.01	.	17.9193	0.88961	0.0:0.0:1.0:0.0	.	411;411	F5H5X9;Q9ULB5	.;CADH7_HUMAN	L	411	ENSP00000319166:V411L;ENSP00000443030:V411L;ENSP00000381058:V411L	ENSP00000319166:V411L	V	+	1	0	CDH7	61662277	0.998000	0.40836	0.998000	0.56505	0.918000	0.54935	3.016000	0.49607	2.436000	0.82500	0.655000	0.94253	GTG		0.423	CDH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256217.2	NM_033646		9	53	1	0	3.09899e-07	0.004482	3.54975e-07	9	53				
TRIP10	9322	broad.mit.edu	37	19	6750571	6750571	+	Silent	SNP	G	G	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr19:6750571G>A	ENST00000313244.9	+	14	1619	c.1584G>A	c.(1582-1584)acG>acA	p.T528T	TRIP10_ENST00000600428.1_Silent_p.T364T|TRIP10_ENST00000596758.1_Silent_p.T472T|CTD-3128G10.6_ENST00000594056.1_RNA|TRIP10_ENST00000313285.8_Silent_p.T472T			Q15642	CIP4_HUMAN	thyroid hormone receptor interactor 10	528	Interaction with CDC42.|Interaction with DNM2 and WASL. {ECO:0000250}.|Interaction with PDE6G. {ECO:0000250}.|Required for interaction with FASLG and localization to lysosomes.				actin cytoskeleton organization (GO:0030036)|cell communication (GO:0007154)|endocytosis (GO:0006897)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)	p.T528T(1)|p.T472T(1)		NS(1)|breast(1)|endometrium(1)|large_intestine(1)|liver(2)|lung(7)|ovary(1)|prostate(1)|urinary_tract(1)	16						CCATTTACACGGAGTTTGATG	0.557																																							uc002mfs.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(1582-1584)ACG>ACA		thyroid hormone receptor interactor 10							107.0	92.0	97.0					19																	6750571		2203	4300	6503	SO:0001819	synonymous_variant	9322				actin cytoskeleton organization|cell communication|endocytosis|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cell cortex|cell projection|cytoskeleton|cytosol|Golgi apparatus|lysosome|perinuclear region of cytoplasm|phagocytic cup	GTPase activator activity|identical protein binding|lipid binding	g.chr19:6750571G>A	AB072596	CCDS12172.1, CCDS74271.1, CCDS74272.1	19p13.3	2008-02-05			ENSG00000125733	ENSG00000125733			12304	protein-coding gene	gene with protein product	"""Cdc42-interacting protein"""	604504	"""salt tolerator"""	STOT		7776974, 9210375, 11294612	Standard	XM_005259683		Approved	STP, HSTP, CIP4	uc002mfr.3	Q15642	OTTHUMG00000150255	ENST00000313244.9:c.1584G>A	19.37:g.6750571G>A			Somatic				TRIP10_uc010dux.1_Silent_p.T472T|TRIP10_uc002mfr.2_Silent_p.T472T|TRIP10_uc010duy.2_RNA|TRIP10_uc010duz.2_Silent_p.T291T	p.T528T	NM_004240	NP_004231	WXS	Illumina HiSeq	Unspecified	Q15642	CIP4_HUMAN			14	1650	+			528			Interaction with CDC42.|Interaction with PDE6G (By similarity).|Interaction with DNM2 and WASL (By similarity).|Required for interaction with FASLG and localization to lysosomes.		B2R8A6|B7WP22|D6W645|O15184|Q53G22|Q5TZN1|Q6FI24|Q8NFL1|Q8TCY1|Q8TDX3|Q96RJ1	Silent	SNP	ENST00000313244.9	37	c.1584G>A																																																																																					0.557	TRIP10-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000317129.2			18	126	0	0	0	0.010504	0	18	126				
MUC16	94025	broad.mit.edu	37	19	9062932	9062932	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr19:9062932G>T	ENST00000397910.4	-	3	24717	c.24514C>A	c.(24514-24516)Ctc>Atc	p.L8172I		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	8174	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.L8172I(2)|p.L3805I(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GACACTGTGAGCTGAGCAAAG	0.502																																							uc002mkp.2		NA																	3	Substitution - Missense(3)		lung(3)	lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(24514-24516)CTC>ATC		mucin 16							130.0	125.0	127.0					19																	9062932		2076	4218	6294	SO:0001583	missense	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9062932G>T	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.24514C>A	19.37:g.9062932G>T	ENSP00000381008:p.Leu8172Ile		Somatic					p.L8172I	NM_024690	NP_078966	WXS	Illumina HiSeq	Unspecified	Q8WXI7	MUC16_HUMAN			3	24718	-			8174			Ser-rich.|Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	c.24514C>A	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	5.869	0.344422	0.11126	.	.	ENSG00000181143	ENST00000397910	T	0.02890	4.12	3.31	-4.27	0.03744	.	.	.	.	.	T	0.01222	0.0040	N	0.08118	0	.	.	.	P	0.37955	0.612	B	0.31946	0.138	T	0.42832	-0.9428	8	0.87932	D	0	.	1.3374	0.02148	0.2562:0.163:0.4184:0.1623	.	8172	B5ME49	.	I	8172	ENSP00000381008:L8172I	ENSP00000381008:L8172I	L	-	1	0	MUC16	8923932	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.121000	0.15667	-0.819000	0.04323	-1.312000	0.01307	CTC		0.502	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		42	108	1	0	2.37825e-27	0.010771	3.73241e-27	42	108				
ZNF490	57474	broad.mit.edu	37	19	12719994	12719994	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr19:12719994C>T	ENST00000311437.6	-	2	262	c.140G>A	c.(139-141)gGa>gAa	p.G47E	ZNF791_ENST00000446165.1_5'Flank|ZNF791_ENST00000540038.1_5'Flank|ZNF791_ENST00000458122.3_5'Flank|ZNF490_ENST00000465656.1_5'UTR|ZNF791_ENST00000343325.4_5'Flank	NM_020714.2	NP_065765.1	Q9ULM2	ZN490_HUMAN	zinc finger protein 490	47					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G47E(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|skin(1)|urinary_tract(1)	18						GATGCTTTGTCCATGGTGTTC	0.418																																							uc002mtz.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(139-141)GGA>GAA		zinc finger protein 490							217.0	153.0	175.0					19																	12719994		2203	4300	6503	SO:0001583	missense	57474				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:12719994C>T	AB033024	CCDS12272.1	19p13.2	2013-01-08			ENSG00000188033	ENSG00000188033		"""Zinc fingers, C2H2-type"", ""-"""	23705	protein-coding gene	gene with protein product							Standard	NM_020714		Approved	KIAA1198	uc002mtz.2	Q9ULM2	OTTHUMG00000156398	ENST00000311437.6:c.140G>A	19.37:g.12719994C>T	ENSP00000311521:p.Gly47Glu		Somatic				ZNF791_uc002mua.2_5'Flank|ZNF791_uc010xml.1_5'Flank|ZNF791_uc010dyu.1_5'Flank|ZNF791_uc010xmm.1_5'Flank	p.G47E	NM_020714	NP_065765	WXS	Illumina HiSeq	Unspecified	Q9ULM2	ZN490_HUMAN			2	269	-			47						Missense_Mutation	SNP	ENST00000311437.6	37	c.140G>A	CCDS12272.1	.	.	.	.	.	.	.	.	.	.	C	6.825	0.521320	0.13005	.	.	ENSG00000188033	ENST00000311437	T	0.07688	3.17	1.12	-2.24	0.06909	.	.	.	.	.	T	0.01800	0.0057	N	0.08118	0	0.09310	N	1	P	0.47604	0.898	B	0.28784	0.094	T	0.36212	-0.9757	9	0.02654	T	1	.	2.8454	0.05541	0.2874:0.3083:0.4043:0.0	.	47	Q9ULM2	ZN490_HUMAN	E	47	ENSP00000311521:G47E	ENSP00000311521:G47E	G	-	2	0	ZNF490	12580994	0.020000	0.18652	0.000000	0.03702	0.075000	0.17131	0.083000	0.14871	-0.840000	0.04206	0.313000	0.20887	GGA		0.418	ZNF490-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344073.1	NM_020714		16	41	0	0	0	0.012319	0	16	41				
ZNF208	7757	broad.mit.edu	37	19	22154366	22154366	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr19:22154366C>A	ENST00000397126.4	-	4	3618	c.3470G>T	c.(3469-3471)aGt>aTt	p.S1157I	ZNF208_ENST00000599916.1_Intron|ZNF208_ENST00000601773.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	1157					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.S1029I(2)|p.S1157I(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				CTTATGATAACTAAGGGTTGA	0.358																																							uc002nqp.2		NA																	3	Substitution - Missense(3)		lung(3)	ovary(5)|skin(2)	7						c.(3085-3087)AGT>ATT		zinc finger protein 208							30.0	31.0	31.0					19																	22154366		2006	4149	6155	SO:0001583	missense	7757							g.chr19:22154366C>A	BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.3470G>T	19.37:g.22154366C>A	ENSP00000380315:p.Ser1157Ile		Somatic				ZNF208_uc002nqo.1_Intron	p.S1029I	NM_007153	NP_009084	WXS	Illumina HiSeq	Unspecified					6	3235	-		all_lung(12;0.0961)|Lung NSC(12;0.103)							Missense_Mutation	SNP	ENST00000397126.4	37	c.3086G>T	CCDS54240.1	.	.	.	.	.	.	.	.	.	.	C	0.539	-0.854435	0.02630	.	.	ENSG00000160321	ENST00000397126;ENST00000428290	T	0.15952	2.38	2.97	-5.95	0.02241	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.05502	0.0145	.	.	.	0.09310	N	1	B	0.12013	0.005	B	0.11329	0.006	T	0.37526	-0.9702	8	0.09843	T	0.71	.	2.7675	0.05324	0.1589:0.4354:0.2132:0.1924	.	1029	O43345	ZN208_HUMAN	I	1157;1029	ENSP00000380315:S1157I	ENSP00000380315:S1157I	S	-	2	0	ZNF208	21946206	.	.	0.000000	0.03702	0.001000	0.01503	.	.	-2.079000	0.00871	-0.837000	0.03062	AGT		0.358	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464302.1	NM_007153		8	20	1	0	1.06961e-07	0.00308	1.25119e-07	8	20				
RPSAP58	388524	broad.mit.edu	37	19	24010122	24010122	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr19:24010122G>C	ENST00000496398.1	+	4	582	c.159G>C	c.(157-159)agG>agC	p.R53S	RP11-255H23.2_ENST00000471224.1_RNA|RP11-255H23.4_ENST00000599944.1_lincRNA|RPSAP58_ENST00000354585.4_Missense_Mutation_p.R53S					ribosomal protein SA pseudogene 58									p.R53S(2)		endometrium(1)|kidney(5)|lung(2)|prostate(1)|urinary_tract(1)	10						ATCTCAAGAGGACCTGGGAGA	0.468																																							uc002nrn.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(157-159)AGG>AGC		ribosomal protein SA																																				SO:0001583	missense	388524							g.chr19:24010122G>C			19p12	2010-06-16			ENSG00000205246	ENSG00000205246			36809	pseudogene	pseudogene						19123937	Standard	NR_003662		Approved		uc002nrn.3		OTTHUMG00000158122	ENST00000496398.1:c.159G>C	19.37:g.24010122G>C	ENSP00000417240:p.Arg53Ser		Somatic					p.R53S	NM_002295	NP_002286	WXS	Illumina HiSeq	Unspecified					4	582	+									Missense_Mutation	SNP	ENST00000496398.1	37	c.159G>C		.	.	.	.	.	.	.	.	.	.	.	12.63	1.996953	0.35226	.	.	ENSG00000205246	ENST00000486528;ENST00000496398;ENST00000354585	T;T;T	0.21543	2.0;2.0;2.0	2.75	0.0712	0.14381	.	0.144422	0.42420	U	0.000705	T	0.22589	0.0545	.	.	.	0.30315	N	0.788125	P	0.41475	0.751	P	0.48840	0.592	T	0.11567	-1.0582	9	0.72032	D	0.01	.	2.9105	0.05736	0.4273:0.2359:0.3368:0.0	.	53	A6NE09	.	S	53	ENSP00000420173:R53S;ENSP00000417240:R53S;ENSP00000346598:R53S	ENSP00000346598:R53S	R	+	3	2	RPSAP58	23801962	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	0.370000	0.20433	0.304000	0.22809	0.627000	0.83407	AGG		0.468	RPSAP58-001	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000350238.1	NR_003662		6	54	0	0	0	0.006214	0	6	54				
RPSAP58	388524	broad.mit.edu	37	19	24010315	24010315	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr19:24010315G>A	ENST00000496398.1	+	4	775	c.352G>A	c.(352-354)Gag>Aag	p.E118K	RP11-255H23.2_ENST00000471224.1_RNA|RP11-255H23.4_ENST00000599944.1_lincRNA|RPSAP58_ENST00000354585.4_Missense_Mutation_p.E118K					ribosomal protein SA pseudogene 58									p.E118K(2)		endometrium(1)|kidney(5)|lung(2)|prostate(1)|urinary_tract(1)	10						AGCCTTCTGGGAGCCACGGCT	0.562																																							uc002nrn.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(352-354)GAG>AAG		ribosomal protein SA																																				SO:0001583	missense	388524							g.chr19:24010315G>A			19p12	2010-06-16			ENSG00000205246	ENSG00000205246			36809	pseudogene	pseudogene						19123937	Standard	NR_003662		Approved		uc002nrn.3		OTTHUMG00000158122	ENST00000496398.1:c.352G>A	19.37:g.24010315G>A	ENSP00000417240:p.Glu118Lys		Somatic					p.E118K	NM_002295	NP_002286	WXS	Illumina HiSeq	Unspecified					4	775	+									Missense_Mutation	SNP	ENST00000496398.1	37	c.352G>A		.	.	.	.	.	.	.	.	.	.	.	16.44	3.122916	0.56613	.	.	ENSG00000205246	ENST00000496398;ENST00000354585	T;T	0.21734	1.99;1.99	2.52	2.52	0.30459	.	0.000000	0.64402	U	0.000001	T	0.24661	0.0598	.	.	.	0.52501	D	0.999955	P	0.40398	0.716	B	0.43916	0.436	T	0.09662	-1.0664	9	0.87932	D	0	.	10.8987	0.47038	0.0:0.0:1.0:0.0	.	118	A6NE09	.	K	118	ENSP00000417240:E118K;ENSP00000346598:E118K	ENSP00000346598:E118K	E	+	1	0	RPSAP58	23802155	1.000000	0.71417	0.970000	0.41538	0.595000	0.36748	5.877000	0.69675	1.477000	0.48234	0.627000	0.83407	GAG		0.562	RPSAP58-001	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000350238.1	NR_003662		8	48	0	0	0	0.003163	0	8	48				
POP4	10775	broad.mit.edu	37	19	30102776	30102776	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr19:30102776C>G	ENST00000585603.1	+	4	2594	c.292C>G	c.(292-294)Ctt>Gtt	p.L98V	POP4_ENST00000221770.3_5'UTR|POP4_ENST00000392279.3_Missense_Mutation_p.L17V|POP4_ENST00000591824.1_3'UTR			O95707	RPP29_HUMAN	processing of precursor 4, ribonuclease P/MRP subunit (S. cerevisiae)	98					mRNA cleavage (GO:0006379)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|rRNA processing (GO:0006364)|tRNA processing (GO:0008033)	nucleolar ribonuclease P complex (GO:0005655)|ribonuclease MRP complex (GO:0000172)|ribonuclease P complex (GO:0030677)	ribonuclease P activity (GO:0004526)|ribonuclease P RNA binding (GO:0033204)|RNA binding (GO:0003723)	p.L98V(1)		breast(1)|endometrium(1)|lung(4)	6	Ovarian(5;0.000567)|Breast(6;0.0602)|Esophageal squamous(110;0.239)		UCEC - Uterine corpus endometrioid carcinoma (4;2.65e-06)|STAD - Stomach adenocarcinoma(5;1.7e-06)|Lung(7;0.0623)|LUAD - Lung adenocarcinoma(5;0.0989)|BRCA - Breast invasive adenocarcinoma(6;0.225)			CAGATACAGCCTTTTCCTCCC	0.463																																					Melanoma(89;1165 1449 14085 34436 43672)	Melanoma(89;1165 1449 14085 34436 43672)	uc002nsf.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(292-294)CTT>GTT		processing of precursor 4							200.0	167.0	178.0					19																	30102776		2203	4300	6503	SO:0001583	missense	10775				mRNA cleavage|rRNA processing|tRNA processing	nucleolar ribonuclease P complex|ribonuclease MRP complex	identical protein binding|ribonuclease P activity|RNA binding	g.chr19:30102776C>G	BC006098	CCDS12416.1	19q13.11	2012-05-21				ENSG00000105171			30081	protein-coding gene	gene with protein product		606114				10352175, 10024167	Standard	NM_006627		Approved	RPP29	uc002nsf.2	O95707		ENST00000585603.1:c.292C>G	19.37:g.30102776C>G	ENSP00000465213:p.Leu98Val		Somatic				POP4_uc002nsg.2_Missense_Mutation_p.L17V	p.L98V	NM_006627	NP_006618	WXS	Illumina HiSeq	Unspecified	O95707	RPP29_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (4;2.65e-06)|STAD - Stomach adenocarcinoma(5;1.7e-06)|Lung(7;0.0623)|LUAD - Lung adenocarcinoma(5;0.0989)|BRCA - Breast invasive adenocarcinoma(6;0.225)		4	348	+	Ovarian(5;0.000567)|Breast(6;0.0602)|Esophageal squamous(110;0.239)		98					Q5XKL7|Q6FHW9|Q9UQQ3	Missense_Mutation	SNP	ENST00000585603.1	37	c.292C>G	CCDS12416.1	.	.	.	.	.	.	.	.	.	.	C	10.30	1.312558	0.23908	.	.	ENSG00000105171	ENST00000221770;ENST00000392279	.	.	.	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	T	0.42337	0.1198	M	0.66297	2.02	0.53005	D	0.999969	B;P	0.37423	0.407;0.594	B;B	0.29598	0.086;0.104	T	0.30909	-0.9962	9	0.15499	T	0.54	-18.9069	8.426	0.32729	0.1547:0.7669:0.0:0.0784	.	17;98	A8MYC1;O95707	.;RPP29_HUMAN	V	98;17	.	ENSP00000221770:L98V	L	+	1	0	POP4	34794616	0.938000	0.31826	0.784000	0.31847	0.005000	0.04900	1.795000	0.38784	2.575000	0.86900	0.655000	0.94253	CTT		0.463	POP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458710.1	NM_006627		47	130	0	0	0	0.01441	0	47	130				
HSPB6	126393	broad.mit.edu	37	19	36244981	36244981	+	IGR	SNP	G	G	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr19:36244981G>A	ENST00000592984.1	-	0	1634				LIN37_ENST00000301159.9_Missense_Mutation_p.G170R|AC002398.9_ENST00000591613.2_3'UTR|AC002398.11_ENST00000591091.1_RNA|AC002398.12_ENST00000587767.1_RNA			O14558	HSPB6_HUMAN	heat shock protein, alpha-crystallin-related, B6						regulation of muscle contraction (GO:0006937)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)|structural constituent of eye lens (GO:0005212)	p.G170R(1)		lung(1)	1	all_lung(56;3.33e-07)|Lung NSC(56;5.02e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CACACCCCCGGGGCCACCCGG	0.642																																							uc002obm.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(508-510)GGG>AGG		lin-37 homolog							47.0	56.0	53.0					19																	36244981		1990	4165	6155	SO:0001628	intergenic_variant	55957						protein binding	g.chr19:36244981G>A	AJ278121	CCDS12475.1	19q13.13	2014-06-12			ENSG00000004776	ENSG00000004776		"""Heat shock proteins / HSPB"""	26511	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 91"""	610695				12820654, 14717697	Standard	NM_144617		Approved	FLJ32389, Hsp20, PPP1R91	uc002obn.2	O14558	OTTHUMG00000048122		19.37:g.36244981G>A			Somatic				uc002obl.2_5'Flank	p.G170R	NM_019104	NP_061977	WXS	Illumina HiSeq	Unspecified	Q96GY3	LIN37_HUMAN	LUSC - Lung squamous cell carcinoma(66;0.0515)		8	622	+	all_lung(56;3.33e-07)|Lung NSC(56;5.02e-07)|Esophageal squamous(110;0.162)		170			Pro-rich.		O14551|Q6NVI3|Q96MG9	Missense_Mutation	SNP	ENST00000592984.1	37	c.508G>A	CCDS12475.1	.	.	.	.	.	.	.	.	.	.	G	6.965	0.548042	0.13312	.	.	ENSG00000188223	ENST00000301159	T	0.29917	1.55	4.65	3.56	0.40772	.	0.202030	0.49916	D	0.000124	T	0.23611	0.0571	L	0.43152	1.355	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.09574	-1.0668	10	0.18276	T	0.48	-12.2034	11.6924	0.51523	0.0:0.0:0.8119:0.1881	.	170	Q96GY3	LIN37_HUMAN	R	170	ENSP00000301159:G170R	ENSP00000301159:G170R	G	+	1	0	LIN37	40936821	0.173000	0.23056	0.882000	0.34594	0.819000	0.46315	1.003000	0.29809	2.404000	0.81709	0.655000	0.94253	GGG		0.642	HSPB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109498.3	NM_144617		38	86	0	0	0	0.01441	0	38	86				
HKR1	284459	broad.mit.edu	37	19	37853356	37853356	+	Missense_Mutation	SNP	G	G	T	rs143859791		TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr19:37853356G>T	ENST00000324411.4	+	6	928	c.659G>T	c.(658-660)aGc>aTc	p.S220I	HKR1_ENST00000589392.1_Missense_Mutation_p.S202I|HKR1_ENST00000392153.3_Missense_Mutation_p.S201I|HKR1_ENST00000591471.1_5'UTR|HKR1_ENST00000591134.1_Intron|HKR1_ENST00000541583.2_Missense_Mutation_p.S159I|HKR1_ENST00000544914.1_5'UTR	NM_181786.2	NP_861451.1	P10072	HKR1_HUMAN	HKR1, GLI-Kruppel zinc finger family member	220					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S220I(1)		cervix(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	29			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			ATAGGGTCCAGCCCTGAACGG	0.473																																							uc002ogb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(658-660)AGC>ATC		GLI-Kruppel family member HKR1		G	ILE/SER	0,4406		0,0,2203	79.0	77.0	77.0		659	-0.8	0.0	19	dbSNP_134	77	1,8599	1.2+/-3.3	0,1,4299	no	missense	HKR1	NM_181786.2	142	0,1,6502	TT,TG,GG		0.0116,0.0,0.0077	possibly-damaging	220/660	37853356	1,13005	2203	4300	6503	SO:0001583	missense	284459				multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:37853356G>T	M20675	CCDS12502.1	19q13.13	2013-01-08	2010-05-04			ENSG00000181666		"""Zinc fingers, C2H2-type"", ""-"""	4928	protein-coding gene	gene with protein product	"""oncogene HKR1"""	165250	"""GLI-Kruppel family member HKR1"""			2850480, 9813242	Standard	NM_181786		Approved	ZNF875	uc002ogb.3	P10072		ENST00000324411.4:c.659G>T	19.37:g.37853356G>T	ENSP00000315505:p.Ser220Ile		Somatic				HKR1_uc002ofx.2_5'UTR|HKR1_uc002ofy.2_5'UTR|HKR1_uc002oga.2_Missense_Mutation_p.S202I|HKR1_uc010xto.1_Missense_Mutation_p.S202I|HKR1_uc002ogc.2_Missense_Mutation_p.S201I|HKR1_uc010xtp.1_Missense_Mutation_p.S159I|HKR1_uc002ogd.2_Missense_Mutation_p.S159I	p.S220I	NM_181786	NP_861451	WXS	Illumina HiSeq	Unspecified	P10072	HKR1_HUMAN	COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)		6	928	+			220					A8MRS7|Q6PJD0|Q9BSW9|Q9UM09	Missense_Mutation	SNP	ENST00000324411.4	37	c.659G>T	CCDS12502.1	.	.	.	.	.	.	.	.	.	.	G	7.628	0.678301	0.14841	0.0	1.16E-4	ENSG00000181666	ENST00000414402;ENST00000392153;ENST00000542144;ENST00000324411;ENST00000541583	T;T;T	0.08370	3.27;3.23;3.1	2.6	-0.759	0.11045	.	.	.	.	.	T	0.10165	0.0249	L	0.29908	0.895	0.09310	N	1	B;P;B;B	0.44734	0.232;0.842;0.435;0.232	B;P;B;B	0.52343	0.052;0.696;0.083;0.052	T	0.28902	-1.0029	9	0.52906	T	0.07	-0.8931	5.9774	0.19389	0.5445:0.0:0.4555:0.0	.	159;201;220;202	Q7Z6E1;P10072-2;P10072;B4DSY3	.;.;HKR1_HUMAN;.	I	159;201;256;220;159	ENSP00000375994:S201I;ENSP00000315505:S220I;ENSP00000438261:S159I	ENSP00000315505:S220I	S	+	2	0	HKR1	42545196	0.001000	0.12720	0.000000	0.03702	0.013000	0.08279	0.872000	0.28037	-0.081000	0.12662	-0.156000	0.13503	AGC		0.473	HKR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458375.1	NM_181786		48	97	1	0	1.05386e-31	0.01441	1.70238e-31	48	97				
ZNF527	84503	broad.mit.edu	37	19	37879423	37879423	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr19:37879423A>G	ENST00000436120.2	+	5	579	c.472A>G	c.(472-474)Act>Gct	p.T158A	ZNF527_ENST00000587349.1_Intron	NM_032453.1	NP_115829.1	Q8NB42	ZN527_HUMAN	zinc finger protein 527	158					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T158A(1)		NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	33			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GGAAATCTCTACTGGGAAAAG	0.398																																							uc010efk.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(472-474)ACT>GCT		zinc finger protein 527							89.0	83.0	85.0					19																	37879423		1831	4080	5911	SO:0001583	missense	84503				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:37879423A>G	AB058732, AK091585	CCDS42559.1	19q13.1	2013-01-08			ENSG00000189164	ENSG00000189164		"""Zinc fingers, C2H2-type"", ""-"""	29385	protein-coding gene	gene with protein product						11347906	Standard	NM_032453		Approved	KIAA1829	uc010efk.1	Q8NB42	OTTHUMG00000048173	ENST00000436120.2:c.472A>G	19.37:g.37879423A>G	ENSP00000390179:p.Thr158Ala		Somatic				ZNF527_uc002ogf.3_Missense_Mutation_p.T126A|ZNF527_uc010xtq.1_RNA	p.T158A	NM_032453	NP_115829	WXS	Illumina HiSeq	Unspecified	Q8NB42	ZN527_HUMAN	COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)		5	583	+			158					B4DVL5	Missense_Mutation	SNP	ENST00000436120.2	37	c.472A>G	CCDS42559.1	.	.	.	.	.	.	.	.	.	.	A	0.942	-0.709224	0.03230	.	.	ENSG00000189164	ENST00000356178;ENST00000317566;ENST00000436120	.	.	.	4.14	-2.02	0.07388	.	.	.	.	.	T	0.41236	0.1150	M	0.64404	1.975	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.39643	-0.9604	8	0.44086	T	0.13	.	8.9666	0.35881	0.416:0.0:0.584:0.0	.	158;126	Q8NB42;Q8NB42-2	ZN527_HUMAN;.	A	158;126;106	.	ENSP00000325231:T126A	T	+	1	0	ZNF527	42571263	0.000000	0.05858	0.001000	0.08648	0.073000	0.16967	0.671000	0.25172	-0.306000	0.08818	0.460000	0.39030	ACT		0.398	ZNF527-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458434.1	NM_032453		33	44	0	0	0	0.006999	0	33	44				
FBXO27	126433	broad.mit.edu	37	19	39522510	39522510	+	Missense_Mutation	SNP	C	C	A	rs377322565		TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr19:39522510C>A	ENST00000292853.4	-	2	477	c.358G>T	c.(358-360)Ggc>Tgc	p.G120C	CTB-189B5.3_ENST00000597303.1_RNA|FBXO27_ENST00000600828.1_Missense_Mutation_p.G120C|FBXO27_ENST00000509137.2_Missense_Mutation_p.G120C	NM_178820.3	NP_849142.1	Q8NI29	FBX27_HUMAN	F-box protein 27	120	FBA. {ECO:0000255|PROSITE- ProRule:PRU00482}.					SCF ubiquitin ligase complex (GO:0019005)	glycoprotein binding (GO:0001948)	p.G120C(1)		cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(5)|ovary(1)|urinary_tract(2)	17	all_cancers(60;3.79e-07)|all_lung(34;1.26e-07)|Lung NSC(34;1.46e-07)|all_epithelial(25;4.69e-07)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			CCACCTTGGCCGCAGGGGTTG	0.701																																							uc002okh.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(358-360)GGC>TGC		F-box protein 27		C	CYS/GLY	0,4306		0,0,2153	23.0	17.0	19.0		358	1.1	0.0	19		19	1,8401		0,1,4200	no	missense	FBXO27	NM_178820.3	159	0,1,6353	AA,AC,CC		0.0119,0.0,0.0079	probably-damaging	120/284	39522510	1,12707	2153	4201	6354	SO:0001583	missense	126433				protein catabolic process	SCF ubiquitin ligase complex	glycoprotein binding	g.chr19:39522510C>A	AF436061	CCDS12527.1	19q13.2	2008-02-05	2004-06-15			ENSG00000161243		"""F-boxes /  ""other"""""	18753	protein-coding gene	gene with protein product		609099	"""F-box only protein 27"""			126433	Standard	NM_178820		Approved	Fbg5, Fbx27	uc002okh.3	Q8NI29		ENST00000292853.4:c.358G>T	19.37:g.39522510C>A	ENSP00000292853:p.Gly120Cys		Somatic					p.G120C	NM_178820	NP_849142	WXS	Illumina HiSeq	Unspecified	Q8NI29	FBX27_HUMAN	Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)		2	440	-	all_cancers(60;3.79e-07)|all_lung(34;1.26e-07)|Lung NSC(34;1.46e-07)|all_epithelial(25;4.69e-07)|Ovarian(47;0.0454)		120			FBA.		Q96C87	Missense_Mutation	SNP	ENST00000292853.4	37	c.358G>T	CCDS12527.1	.	.	.	.	.	.	.	.	.	.	C	16.23	3.064014	0.55432	0.0	1.19E-4	ENSG00000161243	ENST00000292853;ENST00000509137	T;T	0.35048	1.33;1.33	3.3	1.12	0.20585	Galactose-binding domain-like (1);F-box associated (FBA) domain (2);	0.494628	0.15546	N	0.256680	T	0.55305	0.1912	M	0.78344	2.41	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.40515	-0.9559	10	0.87932	D	0	-12.3244	7.1648	0.25685	0.0:0.7663:0.0:0.2337	.	120	Q8NI29	FBX27_HUMAN	C	120	ENSP00000292853:G120C;ENSP00000437662:G120C	ENSP00000292853:G120C	G	-	1	0	FBXO27	44214350	0.528000	0.26314	0.007000	0.13788	0.006000	0.05464	2.601000	0.46249	0.241000	0.21283	-0.339000	0.08088	GGC		0.701	FBXO27-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000463281.1			12	38	1	0	2.32078e-09	0.003163	2.83509e-09	12	38				
ZNF780B	163131	broad.mit.edu	37	19	40541960	40541960	+	Missense_Mutation	SNP	C	C	A	rs560949536		TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr19:40541960C>A	ENST00000434248.1	-	5	871	c.806G>T	c.(805-807)aGt>aTt	p.S269I	ZNF780B_ENST00000221355.6_Missense_Mutation_p.S121I	NM_001005851.2	NP_001005851.1	Q9Y6R6	Z780B_HUMAN	zinc finger protein 780B	269					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S269I(2)		endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	23	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					AGCATGAATACTTTGATGCTG	0.358																																							uc002omu.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|pancreas(1)	2						c.(805-807)AGT>ATT		zinc finger protein 780B							108.0	116.0	113.0					19																	40541960		2201	4300	6501	SO:0001583	missense	163131				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:40541960C>A	AK127063	CCDS46077.1	19q13.2	2013-01-08	2006-08-15	2006-08-15	ENSG00000128000	ENSG00000128000		"""Zinc fingers, C2H2-type"", ""-"""	33109	protein-coding gene	gene with protein product			"""zinc finger protein 779"""	ZNF779			Standard	NM_001005851		Approved		uc002omu.3	Q9Y6R6	OTTHUMG00000155118	ENST00000434248.1:c.806G>T	19.37:g.40541960C>A	ENSP00000391641:p.Ser269Ile		Somatic				ZNF780B_uc002omv.2_Missense_Mutation_p.S121I	p.S269I	NM_001005851	NP_001005851	WXS	Illumina HiSeq	Unspecified	Q9Y6R6	Z780B_HUMAN			5	871	-	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)		269			C2H2-type 4.		B9EH00	Missense_Mutation	SNP	ENST00000434248.1	37	c.806G>T	CCDS46077.1	.	.	.	.	.	.	.	.	.	.	C	14.69	2.610751	0.46527	.	.	ENSG00000128000	ENST00000434248;ENST00000221355	T;T	0.52526	0.66;0.66	2.21	-0.4	0.12411	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.46210	0.1381	N	0.17082	0.46	0.09310	N	1	D	0.67145	0.996	D	0.70935	0.971	T	0.39035	-0.9633	9	0.49607	T	0.09	.	7.5605	0.27849	0.6611:0.3389:0.0:0.0	.	269	Q9Y6R6	Z780B_HUMAN	I	269;121	ENSP00000391641:S269I;ENSP00000221355:S121I	ENSP00000221355:S121I	S	-	2	0	ZNF780B	45233800	0.000000	0.05858	0.003000	0.11579	0.696000	0.40369	-2.447000	0.01010	-0.332000	0.08489	-0.678000	0.03780	AGT		0.358	ZNF780B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338466.1	NM_001005851		14	60	1	0	1.3612e-06	0.003163	1.54316e-06	14	60				
ZNF780A	284323	broad.mit.edu	37	19	40581109	40581109	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr19:40581109T>C	ENST00000595687.2	-	6	1449	c.1240A>G	c.(1240-1242)Ata>Gta	p.I414V	ZNF780A_ENST00000594395.1_Missense_Mutation_p.I415V|ZNF780A_ENST00000340963.5_Missense_Mutation_p.I414V|AC005614.5_ENST00000595508.1_RNA|ZNF780A_ENST00000414720.2_Intron|ZNF780A_ENST00000455521.1_Missense_Mutation_p.I415V|ZNF780A_ENST00000450241.2_Missense_Mutation_p.I380V	NM_001010880.2	NP_001010880.2	O75290	Z780A_HUMAN	zinc finger protein 780A	414					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.I415V(1)|p.I380V(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(16)|upper_aerodigestive_tract(3)|urinary_tract(1)	31	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					TATGGTTTTATACCAGCATGA	0.383																																							uc002omy.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(1240-1242)ATA>GTA		zinc finger protein 780A isoform b							178.0	182.0	180.0					19																	40581109		2203	4300	6503	SO:0001583	missense	284323				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:40581109T>C	AK091274	CCDS33026.2, CCDS46078.1, CCDS46079.1	19q13.2	2014-02-12	2006-08-15		ENSG00000197782	ENSG00000197782		"""Zinc fingers, C2H2-type"", ""-"""	27603	protein-coding gene	gene with protein product							Standard	NM_001142577		Approved	ZNF780	uc010xvh.2	O75290	OTTHUMG00000155119	ENST00000595687.2:c.1240A>G	19.37:g.40581109T>C	ENSP00000472189:p.Ile414Val		Somatic				ZNF780A_uc002omw.3_Intron|ZNF780A_uc002omz.2_Missense_Mutation_p.I414V|ZNF780A_uc010xvh.1_Missense_Mutation_p.I415V	p.I414V	NM_001010880	NP_001010880	WXS	Illumina HiSeq	Unspecified	O75290	Z780A_HUMAN			6	1465	-	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)		414					E9PB48|Q6ZN87	Missense_Mutation	SNP	ENST00000595687.2	37	c.1240A>G	CCDS33026.2	.	.	.	.	.	.	.	.	.	.	T	10.67	1.415046	0.25552	.	.	ENSG00000197782	ENST00000450241;ENST00000455521;ENST00000340963	T;T	0.16897	2.31;2.31	1.93	0.83	0.18854	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.08670	0.0215	N	0.05383	-0.06	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.31641	-0.9936	9	0.59425	D	0.04	.	8.0199	0.30404	0.0:0.8348:0.0:0.1652	.	415;414	E9PB48;O75290	.;Z780A_HUMAN	V	414;415;414	ENSP00000400997:I415V;ENSP00000341507:I414V	ENSP00000341507:I414V	I	-	1	0	ZNF780A	45272949	0.003000	0.15002	0.007000	0.13788	0.407000	0.30961	1.030000	0.30153	-0.222000	0.09958	-1.945000	0.00491	ATA		0.383	ZNF780A-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000470066.1	NM_001010880		3	201	0	0	0	0.004672	0	3	201				
PSG7	5676	broad.mit.edu	37	19	43430068	43430068	+	RNA	SNP	G	G	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr19:43430068G>T	ENST00000406070.2	-	0	1196				PSG7_ENST00000446844.3_RNA	NM_002783.2	NP_002774.2	Q13046	PSG7_HUMAN	pregnancy specific beta-1-glycoprotein 7 (gene/pseudogene)						female pregnancy (GO:0007565)	extracellular region (GO:0005576)							Prostate(69;0.00682)				CCCATTAATTGTCCAAGAATA	0.458																																							uc002ovl.3		NA																	0					0						c.(1099-1101)ACA>AAA		pregnancy specific beta-1-glycoprotein 7							174.0	184.0	180.0					19																	43430068		2201	4300	6501			5676				female pregnancy	extracellular region		g.chr19:43430068G>T			19q13.2	2013-01-29	2010-02-26		ENSG00000221878	ENSG00000221878		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9524	protein-coding gene	gene with protein product		176396	"""pregnancy specific beta-1-glycoprotein 7"""				Standard	NM_002783		Approved		uc010xwl.2	Q13046	OTTHUMG00000151125		19.37:g.43430068G>T			Somatic				PSG3_uc002ouf.2_Intron|PSG11_uc002ouw.2_Missense_Mutation_p.T280K|PSG7_uc002ous.1_RNA|PSG7_uc002out.1_Missense_Mutation_p.T93K|PSG10_uc002ouv.1_Intron|PSG6_uc002ovh.1_Intron|PSG6_uc002ovi.2_Intron|PSG6_uc010xwk.1_Intron|PSG11_uc002ovk.1_Missense_Mutation_p.T280K|PSG7_uc010xwl.1_Missense_Mutation_p.T245K	p.T367K	NM_002783	NP_002774	WXS	Illumina HiSeq	Unspecified	Q13046	PSG7_HUMAN			6	1202	-		Prostate(69;0.00682)	367			Ig-like C2-type 3.		Q15232	Missense_Mutation	SNP	ENST00000406070.2	37	c.1100C>A																																																																																					0.458	PSG7-001	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000321431.2	NM_001206650		86	232	1	0	4.31119e-35	0.01441	7.09416e-35	86	232				
ZNF227	7770	broad.mit.edu	37	19	44740634	44740634	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr19:44740634G>T	ENST00000313040.7	+	6	2256	c.2051G>T	c.(2050-2052)gGa>gTa	p.G684V	ZNF227_ENST00000391961.2_Missense_Mutation_p.G633V|ZNF227_ENST00000589005.1_Missense_Mutation_p.G633V|ZNF235_ENST00000589799.1_3'UTR	NM_182490.1	NP_872296.1	Q86WZ6	ZN227_HUMAN	zinc finger protein 227	684					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G684V(1)		central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(12)|ovary(2)|stomach(1)|urinary_tract(1)	24		Prostate(69;0.0435)				GGCCACACTGGAGAAAAACCT	0.468																																							uc002oyu.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(2050-2052)GGA>GTA		zinc finger protein 227							77.0	81.0	80.0					19																	44740634		2203	4300	6503	SO:0001583	missense	7770				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:44740634G>T	AK092253	CCDS12636.1, CCDS74388.1	19q13.32	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	13020	protein-coding gene	gene with protein product							Standard	XM_005259232		Approved		uc002oyu.3	Q86WZ6		ENST00000313040.7:c.2051G>T	19.37:g.44740634G>T	ENSP00000321049:p.Gly684Val		Somatic				ZNF227_uc010xwu.1_Missense_Mutation_p.G633V|ZNF227_uc002oyv.2_Missense_Mutation_p.G684V|ZNF227_uc010xwv.1_Missense_Mutation_p.G633V|ZNF227_uc010xww.1_Missense_Mutation_p.G605V|ZNF227_uc002oyw.2_Missense_Mutation_p.G656V|ZNF227_uc010ejh.2_Missense_Mutation_p.G677V|ZNF235_uc002oyx.1_Intron|ZNF235_uc010eji.2_3'UTR	p.G684V	NM_182490	NP_872296	WXS	Illumina HiSeq	Unspecified	Q86WZ6	ZN227_HUMAN			6	2256	+		Prostate(69;0.0435)	684					B3KRU7|B7Z5P9	Missense_Mutation	SNP	ENST00000313040.7	37	c.2051G>T	CCDS12636.1	.	.	.	.	.	.	.	.	.	.	G	17.05	3.290599	0.59976	.	.	ENSG00000131115	ENST00000313040;ENST00000328297;ENST00000391961;ENST00000418980;ENST00000377916	T;T	0.23552	1.9;1.9	3.55	2.48	0.30137	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.50582	0.1624	M	0.82132	2.575	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.99;1.0;1.0;0.99	T	0.56517	-0.7966	9	0.87932	D	0	.	12.2174	0.54414	0.0:0.1731:0.8269:0.0	.	605;663;636;684	B7Z6M2;Q658S5;Q9NS43;Q86WZ6	.;.;.;ZN227_HUMAN	V	684;641;633;663;323	ENSP00000321049:G684V;ENSP00000375823:G633V	ENSP00000321049:G684V	G	+	2	0	ZNF227	49432474	0.996000	0.38824	0.990000	0.47175	0.985000	0.73830	2.317000	0.43770	0.814000	0.34374	0.563000	0.77884	GGA		0.468	ZNF227-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460720.1	NM_182490		20	59	1	0	6.44725e-10	0.014323	8.00912e-10	20	59				
MED25	81857	broad.mit.edu	37	19	50334694	50334694	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr19:50334694G>T	ENST00000312865.6	+	10	1259	c.1206G>T	c.(1204-1206)tgG>tgT	p.W402C	MED25_ENST00000538643.1_Missense_Mutation_p.W189C	NM_030973.3	NP_112235.2	Q71SY5	MED25_HUMAN	mediator complex subunit 25	402	Interaction with CREBBP.|Interaction with VP16.				cell death (GO:0008219)|gene expression (GO:0010467)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of chromatin binding (GO:0035563)|positive regulation of mediator complex assembly (GO:2001178)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|transcription factor binding (GO:0008134)	p.W402C(2)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(6)|ovary(1)|stomach(1)|urinary_tract(1)	17		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00822)|GBM - Glioblastoma multiforme(134;0.0122)		TTCTGGCCTGGAGCGGGGTCC	0.687																																					GBM(51;894 1657 37868)	GBM(51;894 1657 37868)	uc002ppw.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(1204-1206)TGG>TGT		mediator complex subunit 25							24.0	27.0	26.0					19																	50334694		2203	4300	6503	SO:0001583	missense	81857				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm		g.chr19:50334694G>T	AL136746	CCDS33075.1	19q13.3	2014-09-17	2007-07-30			ENSG00000104973			28845	protein-coding gene	gene with protein product		610197	"""mediator of RNA polymerase II transcription, subunit 25 homolog (S. cerevisiae)"""			9110174, 11230166	Standard	NM_030973		Approved	ARC92, ACID1, TCBAP0758, DKFZp434K0512	uc002ppw.2	Q71SY5		ENST00000312865.6:c.1206G>T	19.37:g.50334694G>T	ENSP00000326767:p.Trp402Cys		Somatic				MED25_uc010ybe.1_Missense_Mutation_p.W189C|MED25_uc002ppx.1_Missense_Mutation_p.W183C	p.W402C	NM_030973	NP_112235	WXS	Illumina HiSeq	Unspecified	Q71SY5	MED25_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00822)|GBM - Glioblastoma multiforme(134;0.0122)	10	1259	+		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)	402			Interaction with VP16.|Interaction with CREBBP.		A8K095|B9TX30|O95783|Q6P143|Q6QMH5|Q707U4|Q8TB55|Q9H0L5|Q9HB34	Missense_Mutation	SNP	ENST00000312865.6	37	c.1206G>T	CCDS33075.1	.	.	.	.	.	.	.	.	.	.	G	16.58	3.163694	0.57476	.	.	ENSG00000104973	ENST00000355584;ENST00000377077;ENST00000312881;ENST00000312865;ENST00000456294;ENST00000538643;ENST00000377070	D;D	0.97688	-4.49;-4.3	5.18	5.18	0.71444	Mediator complex, subunit Med25, PTOV activation and synapsin 2 (1);	0.000000	0.85682	D	0.000000	D	0.98560	0.9519	M	0.76170	2.325	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.99852	1.1073	10	0.87932	D	0	.	17.4625	0.87623	0.0:0.0:1.0:0.0	.	189;402;402	B9TX30;B5ME50;Q71SY5	.;.;MED25_HUMAN	C	402;402;402;402;402;189;137	ENSP00000326767:W402C;ENSP00000437496:W189C	ENSP00000326767:W402C	W	+	3	0	MED25	55026506	1.000000	0.71417	1.000000	0.80357	0.289000	0.27227	5.809000	0.69172	2.411000	0.81874	0.561000	0.74099	TGG		0.687	MED25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465316.1	NM_030973		12	20	1	0	0.000308642	0.003163	0.000328771	12	20				
SHANK1	50944	broad.mit.edu	37	19	51189549	51189549	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr19:51189549G>T	ENST00000293441.1	-	20	2540	c.2522C>A	c.(2521-2523)cCc>cAc	p.P841H	SHANK1_ENST00000391813.1_Missense_Mutation_p.P228H|SHANK1_ENST00000359082.3_Missense_Mutation_p.P832H|SHANK1_ENST00000391814.1_Missense_Mutation_p.P849H	NM_016148.2	NP_057232.2	Q9Y566	SHAN1_HUMAN	SH3 and multiple ankyrin repeat domains 1	841					adult behavior (GO:0030534)|associative learning (GO:0008306)|cytoskeletal anchoring at plasma membrane (GO:0007016)|dendritic spine morphogenesis (GO:0060997)|determination of affect (GO:0050894)|habituation (GO:0046959)|long-term memory (GO:0007616)|negative regulation of actin filament bundle assembly (GO:0032232)|neuromuscular process controlling balance (GO:0050885)|olfactory behavior (GO:0042048)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|protein complex assembly (GO:0006461)|protein localization to synapse (GO:0035418)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|righting reflex (GO:0060013)|social behavior (GO:0035176)|synapse maturation (GO:0060074)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|excitatory synapse (GO:0060076)|intracellular (GO:0005622)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ankyrin repeat binding (GO:0071532)|GKAP/Homer scaffold activity (GO:0030160)|identical protein binding (GO:0042802)|ionotropic glutamate receptor binding (GO:0035255)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|scaffold protein binding (GO:0097110)|SH3 domain binding (GO:0017124)|somatostatin receptor binding (GO:0031877)	p.P841H(1)		breast(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	64		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(134;0.0199)		GAGGCCACCGGGACCAGGGCT	0.592																																							uc002psx.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(2)	2						c.(2521-2523)CCC>CAC		SH3 and multiple ankyrin repeat domains 1							108.0	92.0	97.0					19																	51189549		2203	4300	6503	SO:0001583	missense	50944				cytoskeletal anchoring at plasma membrane	cell junction|cytoplasm|dendrite|membrane fraction|postsynaptic density|postsynaptic membrane	ionotropic glutamate receptor binding	g.chr19:51189549G>T	AF163302	CCDS12799.1	19q13.3	2013-01-10			ENSG00000161681	ENSG00000161681		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	15474	protein-coding gene	gene with protein product	"""somatostatin receptor-interacting protein"""	604999				10551867	Standard	NM_016148		Approved	SSTRIP, SPANK-1, synamon	uc002psx.1	Q9Y566	OTTHUMG00000137380	ENST00000293441.1:c.2522C>A	19.37:g.51189549G>T	ENSP00000293441:p.Pro841His		Somatic				SHANK1_uc002psw.1_Missense_Mutation_p.P225H	p.P841H	NM_016148	NP_057232	WXS	Illumina HiSeq	Unspecified	Q9Y566	SHAN1_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(134;0.0199)	20	2541	-		all_neural(266;0.057)	841					A8MXP5|B7WNY6|Q9NYW9	Missense_Mutation	SNP	ENST00000293441.1	37	c.2522C>A	CCDS12799.1	.	.	.	.	.	.	.	.	.	.	G	14.80	2.644336	0.47258	.	.	ENSG00000161681	ENST00000293441;ENST00000391813;ENST00000359082;ENST00000391814	T;T;T;T	0.41758	0.99;0.99;0.99;0.99	3.91	2.87	0.33458	.	0.222231	0.26939	U	0.021729	T	0.54208	0.1844	L	0.50333	1.59	0.34903	D	0.746687	D;D	0.89917	0.996;1.0	P;D	0.85130	0.891;0.997	T	0.64508	-0.6391	10	0.59425	D	0.04	-10.1094	9.6149	0.39685	0.106:0.0:0.894:0.0	.	841;228	Q9Y566;Q9Y566-2	SHAN1_HUMAN;.	H	841;228;832;849	ENSP00000293441:P841H;ENSP00000375689:P228H;ENSP00000351984:P832H;ENSP00000375690:P849H	ENSP00000293441:P841H	P	-	2	0	SHANK1	55881361	0.969000	0.33509	0.216000	0.23742	0.957000	0.61999	5.234000	0.65343	1.009000	0.39289	0.478000	0.44815	CCC		0.592	SHANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268071.1	NM_016148		30	97	1	0	1.30897e-18	0.009535	1.88646e-18	30	97				
SIGLEC6	946	broad.mit.edu	37	19	52034721	52034721	+	Silent	SNP	C	C	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr19:52034721C>A	ENST00000425629.3	-	2	274	c.120G>T	c.(118-120)acG>acT	p.T40T	SIGLEC6_ENST00000391797.3_Silent_p.T40T|SIGLEC6_ENST00000343300.4_Silent_p.T40T|SIGLEC6_ENST00000346477.3_Silent_p.T40T|SIGLEC6_ENST00000436458.1_Intron|SIGLEC6_ENST00000359982.4_Silent_p.T40T	NM_001245.5	NP_001236.4	O43699	SIGL6_HUMAN	sialic acid binding Ig-like lectin 6	40	Ig-like V-type.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)	p.T29T(1)|p.T40T(1)		endometrium(3)|kidney(1)|large_intestine(6)|liver(1)|lung(15)|ovary(1)|stomach(1)	28		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.00115)|OV - Ovarian serous cystadenocarcinoma(262;0.0165)		CCTCCTGCACCGTCAGTGACT	0.627																																							uc002pwy.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(118-120)ACG>ACT		sialic acid binding Ig-like lectin 6 isoform 1							55.0	60.0	59.0					19																	52034721		2189	4291	6480	SO:0001819	synonymous_variant	946				cell adhesion|cell-cell signaling	cytoplasm|extracellular region|integral to plasma membrane|membrane fraction|nucleus		g.chr19:52034721C>A	D86358	CCDS12834.3, CCDS12835.3, CCDS12836.3, CCDS54307.1, CCDS54308.1, CCDS59417.1	19q13.3	2013-01-29			ENSG00000105492	ENSG00000105492		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10875	protein-coding gene	gene with protein product		604405		CD33L, CD33L1		9465907	Standard	NM_001245		Approved	OB-BP1, SIGLEC-6, CD327	uc002pwy.3	O43699	OTTHUMG00000133571	ENST00000425629.3:c.120G>T	19.37:g.52034721C>A			Somatic				SIGLEC6_uc002pwz.2_Silent_p.T40T|SIGLEC6_uc002pxa.2_Silent_p.T40T|SIGLEC6_uc010ydb.1_Intron|SIGLEC6_uc010ydc.1_Silent_p.T29T|SIGLEC6_uc010eoz.1_Silent_p.T29T|SIGLEC6_uc010epb.1_Intron|SIGLEC6_uc010epa.1_Silent_p.T29T	p.T40T	NM_001245	NP_001236	WXS	Illumina HiSeq	Unspecified	O43699	SIGL6_HUMAN		GBM - Glioblastoma multiforme(134;0.00115)|OV - Ovarian serous cystadenocarcinoma(262;0.0165)	2	282	-		all_neural(266;0.0199)	40			Extracellular (Potential).|Ig-like V-type.		A8MV71|B2RTS8|C9JBE5|F8WA78|O15388|O43700	Silent	SNP	ENST00000425629.3	37	c.120G>T	CCDS12834.3																																																																																				0.627	SIGLEC6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257670.3	NM_001245		11	85	1	0	5.50884e-06	0.013537	6.13484e-06	11	85				
ZNF320	162967	broad.mit.edu	37	19	53384141	53384141	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr19:53384141T>C	ENST00000595635.1	-	8	1739	c.1238A>G	c.(1237-1239)tAc>tGc	p.Y413C	ZNF320_ENST00000391781.2_Missense_Mutation_p.Y413C|ZNF320_ENST00000600930.1_Intron|ZNF320_ENST00000597909.1_Intron	NM_207333.2	NP_997216.2	A2RRD8	ZN320_HUMAN	zinc finger protein 320	413					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Y413C(1)		NS(1)|endometrium(2)|kidney(4)|large_intestine(5)|liver(1)|lung(10)|urinary_tract(1)	24				GBM - Glioblastoma multiforme(134;0.0534)		TTCACATTCGTAAAGTTTCTC	0.393																																							uc002qag.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1237-1239)TAC>TGC		zinc finger protein 320							87.0	81.0	83.0					19																	53384141		2203	4300	6503	SO:0001583	missense	162967				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:53384141T>C	AF086262	CCDS33095.1	19q13.41	2014-09-04			ENSG00000182986	ENSG00000182986		"""Zinc fingers, C2H2-type"", ""-"""	13842	protein-coding gene	gene with protein product		606427				11536051	Standard	XM_006723059		Approved	ZFPL, DKFZp686G16228	uc002qag.3	A2RRD8	OTTHUMG00000182797	ENST00000595635.1:c.1238A>G	19.37:g.53384141T>C	ENSP00000473091:p.Tyr413Cys		Somatic				ZNF320_uc010eqh.1_5'Flank|ZNF320_uc010eqi.1_Intron|ZNF320_uc002qah.2_Missense_Mutation_p.Y359C|ZNF320_uc002qai.2_Missense_Mutation_p.Y413C	p.Y413C	NM_207333	NP_997216	WXS	Illumina HiSeq	Unspecified	A2RRD8	ZN320_HUMAN		GBM - Glioblastoma multiforme(134;0.0534)	4	1429	-			413			C2H2-type 10.		Q8NDR6	Missense_Mutation	SNP	ENST00000595635.1	37	c.1238A>G	CCDS33095.1	.	.	.	.	.	.	.	.	.	.	-	5.976	0.364006	0.11296	.	.	ENSG00000182986	ENST00000391781	T	0.25414	1.8	1.74	1.74	0.24563	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.44871	0.1314	M	0.76170	2.325	0.09310	N	0.999991	D	0.89917	1.0	D	0.97110	1.0	T	0.16689	-1.0394	9	0.87932	D	0	.	4.562	0.12165	0.4853:0.0:0.0:0.5147	.	413	A2RRD8	ZN320_HUMAN	C	413	ENSP00000375660:Y413C	ENSP00000375660:Y413C	Y	-	2	0	ZNF320	58075953	0.000000	0.05858	0.079000	0.20413	0.122000	0.20287	-0.051000	0.11885	0.792000	0.33850	0.155000	0.16302	TAC		0.393	ZNF320-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463771.1	NM_207333		24	48	0	0	0	0.003271	0	24	48				
LILRB2	10288	broad.mit.edu	37	19	54782754	54782754	+	Missense_Mutation	SNP	A	A	G	rs143661416	byFrequency	TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr19:54782754A>G	ENST00000391749.4	-	6	1139	c.868T>C	c.(868-870)Tac>Cac	p.Y290H	LILRB2_ENST00000391746.1_Missense_Mutation_p.Y290H|LILRB2_ENST00000471216.1_5'Flank|LILRB2_ENST00000391748.1_Missense_Mutation_p.Y290H|LILRB2_ENST00000434421.1_Missense_Mutation_p.Y174H|LILRB2_ENST00000314446.5_Missense_Mutation_p.Y290H	NM_001278406.1	NP_001265335.1	Q8N423	LIRB2_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 2	290	Ig-like C2-type 3.				cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular defense response (GO:0006968)|cellular response to lipopolysaccharide (GO:0071222)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|heterotypic cell-cell adhesion (GO:0034113)|immune response (GO:0006955)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|negative regulation of antigen processing and presentation (GO:0002578)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T cell tolerance induction (GO:0002666)|regulation of dendritic cell differentiation (GO:2001198)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|inhibitory MHC class I receptor activity (GO:0032396)|MHC class I protein binding (GO:0042288)|MHC class Ib protein binding (GO:0023029)|protein phosphatase 1 binding (GO:0008157)|receptor activity (GO:0004872)	p.Y290H(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(30)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	44	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		TGGCCCCCGTAGGAGCGGCTC	0.667													.|||	34	0.00678914	0.0242	0.0	5008	,	,		13942	0.0		0.0	False		,,,				2504	0.002						uc002qfb.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(868-870)TAC>CAC		leukocyte immunoglobulin-like receptor,		G	HIS/TYR,HIS/TYR	64,4342	56.8+/-93.2	0,64,2139	38.0	39.0	38.0		868,868	1.2	0.0	19	dbSNP_134	38	0,8594		0,0,4297	no	missense,missense	LILRB2	NM_001080978.2,NM_005874.3	83,83	0,64,6436	GG,GA,AA		0.0,1.4526,0.4923	benign,benign	290/598,290/599	54782754	64,12936	2203	4297	6500	SO:0001583	missense	10288				cell surface receptor linked signaling pathway|cell-cell signaling|cellular defense response|immune response|regulation of immune response	integral to plasma membrane|membrane fraction	receptor activity	g.chr19:54782754A>G	AF000574	CCDS12886.1, CCDS42612.1, CCDS62791.1, CCDS62792.1	19q13.4	2013-01-11			ENSG00000131042	ENSG00000131042		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6606	protein-coding gene	gene with protein product		604815				9151699, 9079806	Standard	XM_006722966		Approved	LIR-2, ILT4, MIR-10, LIR2, CD85d, MIR10	uc002qfb.3	Q8N423	OTTHUMG00000064896	ENST00000391749.4:c.868T>C	19.37:g.54782754A>G	ENSP00000375629:p.Tyr290His		Somatic				LILRA6_uc002qew.1_Intron|LILRB2_uc010eri.2_Missense_Mutation_p.Y290H|LILRB2_uc010erj.2_RNA|LILRB2_uc002qfc.2_Missense_Mutation_p.Y290H|LILRB2_uc010yet.1_Missense_Mutation_p.Y174H|LILRB2_uc010yeu.1_RNA	p.Y290H	NM_005874	NP_005865	WXS	Illumina HiSeq	Unspecified	Q8N423	LIRB2_HUMAN		GBM - Glioblastoma multiforme(193;0.105)	6	1134	-	Ovarian(34;0.19)		290			Extracellular (Potential).|Ig-like C2-type 3.		A8MU67|C9JF29|O75017|Q8NHJ7|Q8NHJ8	Missense_Mutation	SNP	ENST00000391749.4	37	c.868T>C	CCDS12886.1	17	0.007783882783882784	14	0.028455284552845527	1	0.0027624309392265192	1	0.0017482517482517483	1	0.0013192612137203166	a	0.428	-0.904850	0.02453	0.014526	0.0	ENSG00000131042	ENST00000391748;ENST00000314446;ENST00000391749;ENST00000391746;ENST00000434421	T;T;T;T;T	0.00659	5.94;5.94;5.94;5.94;5.94	2.34	1.16	0.20824	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.827507	0.10311	N	0.690011	T	0.00073	0.0002	N	0.00113	-2.09	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.13407	0.004;0.009;0.006	T	0.43718	-0.9374	10	0.02654	T	1	.	2.8778	0.05638	0.167:0.0:0.5651:0.2679	.	290;307;290	A8MU67;E7EVY1;Q8N423	.;.;LIRB2_HUMAN	H	290;290;290;290;174	ENSP00000375628:Y290H;ENSP00000319960:Y290H;ENSP00000375629:Y290H;ENSP00000375626:Y290H;ENSP00000410117:Y174H	ENSP00000319960:Y290H	Y	-	1	0	LILRB2	59474566	0.000000	0.05858	0.000000	0.03702	0.568000	0.35870	-0.718000	0.04980	-0.084000	0.12595	-0.386000	0.06593	TAC		0.667	LILRB2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139510.1			26	39	0	0	0	0.004878	0	26	39				
LILRA2	11027	broad.mit.edu	37	19	55086877	55086877	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr19:55086877G>T	ENST00000251377.3	+	6	943	c.810G>T	c.(808-810)caG>caT	p.Q270H	LILRB1_ENST00000418536.2_Intron|LILRB1_ENST00000448689.1_Intron|LILRA2_ENST00000391738.3_Missense_Mutation_p.Q270H|LILRA2_ENST00000251376.3_Missense_Mutation_p.Q270H|LILRB1_ENST00000396321.2_Intron|LILRA2_ENST00000391737.1_Missense_Mutation_p.Q258H			Q8N149	LIRA2_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 2	270	Ig-like C2-type 3.				defense response (GO:0006952)|immune system process (GO:0002376)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	antigen binding (GO:0003823)|receptor activity (GO:0004872)	p.Q270H(1)		breast(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(33)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	50				GBM - Glioblastoma multiforme(193;0.0963)		CTGGTTGGCAGCCCCAGGCTG	0.617																																							uc002qgg.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(808-810)CAG>CAT		leukocyte immunoglobulin-like receptor,							72.0	71.0	72.0					19																	55086877		2203	4300	6503	SO:0001583	missense	11027				defense response	integral to membrane	antigen binding|receptor activity	g.chr19:55086877G>T	U82275	CCDS12900.1, CCDS46179.1, CCDS74453.1	19q13.4	2013-01-11			ENSG00000239998	ENSG00000239998		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6603	protein-coding gene	gene with protein product		604812				9079806, 9548455	Standard	XM_005258452		Approved	LIR-7, ILT1, CD85h, LIR7		Q8N149	OTTHUMG00000065703	ENST00000251377.3:c.810G>T	19.37:g.55086877G>T	ENSP00000251377:p.Gln270His		Somatic				LILRA2_uc010ern.2_Missense_Mutation_p.Q270H|LILRA2_uc002qgf.2_Missense_Mutation_p.Q270H|LILRA2_uc010yfe.1_Missense_Mutation_p.Q270H|LILRA2_uc010yff.1_Missense_Mutation_p.Q258H|LILRA2_uc010ero.2_Missense_Mutation_p.Q258H|LILRA2_uc010yfg.1_Intron	p.Q270H	NM_001130917	NP_001124389	WXS	Illumina HiSeq	Unspecified	Q8N149	LIRA2_HUMAN		GBM - Glioblastoma multiforme(193;0.0963)	5	899	+			270			Ig-like C2-type 3.|Extracellular (Potential).		O75020	Missense_Mutation	SNP	ENST00000251377.3	37	c.810G>T	CCDS46179.1	.	.	.	.	.	.	.	.	.	.	G	11.72	1.721352	0.30503	.	.	ENSG00000239998	ENST00000439534;ENST00000251377;ENST00000391738;ENST00000251376;ENST00000391737	T;T;T;T;T	0.00768	5.72;5.72;5.72;5.72;5.72	2.26	1.01	0.19927	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.065190	0.07468	N	0.901710	T	0.04724	0.0128	M	0.90309	3.105	0.09310	N	1	P;P;D;D	0.89917	0.877;0.951;1.0;0.993	B;P;D;D	0.79108	0.442;0.714;0.992;0.951	T	0.29274	-1.0017	10	0.87932	D	0	.	4.1579	0.10270	0.263:0.0:0.737:0.0	.	270;258;270;270	E9PDF4;A8MZH0;Q8N149;Q8N149-2	.;.;LIRA2_HUMAN;.	H	270;270;270;270;258	ENSP00000388131:Q270H;ENSP00000251377:Q270H;ENSP00000375618:Q270H;ENSP00000251376:Q270H;ENSP00000375617:Q258H	ENSP00000251376:Q270H	Q	+	3	2	LILRA2	59778689	0.000000	0.05858	0.002000	0.10522	0.058000	0.15608	0.398000	0.20899	0.363000	0.24346	0.400000	0.26472	CAG		0.617	LILRA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140813.2			56	107	1	0	2.12129e-23	0.01441	3.21473e-23	56	107				
LILRA1	11024	broad.mit.edu	37	19	55106723	55106723	+	Missense_Mutation	SNP	C	C	A	rs199861743		TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr19:55106723C>A	ENST00000251372.3	+	5	699	c.517C>A	c.(517-519)Cgt>Agt	p.R173S	LILRB1_ENST00000418536.2_Intron|LILRB1_ENST00000448689.1_Intron|LILRB1_ENST00000396321.2_Intron|LILRA1_ENST00000473156.1_3'UTR|LILRA1_ENST00000453777.1_Missense_Mutation_p.R173S	NM_006863.2	NP_006854.1	O75019	LIRA1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 1	173	Ig-like C2-type 2.				cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)|regulation of immune response (GO:0050776)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|transmembrane signaling receptor activity (GO:0004888)	p.R173S(1)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|liver(1)|lung(23)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	47				GBM - Glioblastoma multiforme(193;0.0348)		CTCACAGCCCCGTACCCATGG	0.567																																							uc002qgh.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)	3						c.(517-519)CGT>AGT		leukocyte immunoglobulin-like receptor,							178.0	172.0	174.0					19																	55106723		2203	4300	6503	SO:0001583	missense	11024				cell surface receptor linked signaling pathway|defense response|regulation of immune response	integral to membrane|plasma membrane	antigen binding|transmembrane receptor activity	g.chr19:55106723C>A	AF025530	CCDS12901.1, CCDS62802.1	19q13.4	2013-01-11			ENSG00000104974	ENSG00000104974		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6602	protein-coding gene	gene with protein product		604810				9548455	Standard	NM_006863		Approved	LIR-6, CD85i, LIR6	uc002qgh.2	O75019	OTTHUMG00000065701	ENST00000251372.3:c.517C>A	19.37:g.55106723C>A	ENSP00000251372:p.Arg173Ser		Somatic				LILRA2_uc010yfg.1_Intron|LILRA1_uc010yfh.1_Missense_Mutation_p.R173S	p.R173S	NM_006863	NP_006854	WXS	Illumina HiSeq	Unspecified	O75019	LIRA1_HUMAN		GBM - Glioblastoma multiforme(193;0.0348)	5	699	+			173			Ig-like C2-type 2.|Extracellular (Potential).		O75018|Q3MJA6	Missense_Mutation	SNP	ENST00000251372.3	37	c.517C>A	CCDS12901.1	.	.	.	.	.	.	.	.	.	.	C	0.053	-1.244939	0.01481	.	.	ENSG00000104974	ENST00000251372;ENST00000453777	T;T	0.03035	4.07;4.07	1.57	-3.14	0.05250	Immunoglobulin-like fold (1);	2.567660	0.01420	N	0.014340	T	0.02688	0.0081	N	0.21448	0.665	0.09310	N	1	B;B	0.20671	0.047;0.003	B;B	0.11329	0.006;0.004	T	0.41910	-0.9482	10	0.15952	T	0.53	.	3.9607	0.09409	0.3156:0.3636:0.3208:0.0	.	173;173	O75019-2;O75019	.;LIRA1_HUMAN	S	173	ENSP00000251372:R173S;ENSP00000413715:R173S	ENSP00000251372:R173S	R	+	1	0	LILRA1	59798535	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-5.232000	0.00139	-1.707000	0.01402	0.184000	0.17185	CGT		0.567	LILRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140807.2	NM_006863		77	210	1	0	6.8793e-45	0.01441	1.17134e-44	77	210				
NLRP7	199713	broad.mit.edu	37	19	55450745	55450745	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr19:55450745G>C	ENST00000590030.1	-	3	1482	c.1442C>G	c.(1441-1443)gCc>gGc	p.A481G	NLRP7_ENST00000588756.1_Missense_Mutation_p.A481G|NLRP7_ENST00000448121.2_Missense_Mutation_p.A481G|NLRP7_ENST00000446217.1_Missense_Mutation_p.A509G|NLRP7_ENST00000328092.5_Missense_Mutation_p.A481G|NLRP7_ENST00000592784.1_Missense_Mutation_p.A481G|NLRP7_ENST00000340844.2_Missense_Mutation_p.A481G			Q8WX94	NALP7_HUMAN	NLR family, pyrin domain containing 7	481	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.			A -> T (in Ref. 4; AAI09126). {ECO:0000305}.			ATP binding (GO:0005524)	p.A481G(2)		autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(17)|liver(1)|lung(33)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	73				GBM - Glioblastoma multiforme(193;0.0325)		CTTCTCCAGGGCGTAGAACAG	0.592																																							uc002qih.3		NA																	2	Substitution - Missense(2)		lung(2)	large_intestine(1)|breast(1)|central_nervous_system(1)	3						c.(1441-1443)GCC>GGC		NACHT, leucine rich repeat and PYD containing 7							50.0	48.0	49.0					19																	55450745		2203	4300	6503	SO:0001583	missense	199713						ATP binding	g.chr19:55450745G>C	AF464765	CCDS12912.1, CCDS33109.1, CCDS46183.1	19q13.42	2008-02-05	2006-12-08	2006-12-08		ENSG00000167634		"""Nucleotide-binding domain and leucine rich repeat containing"""	22947	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 7"""	609661	"""NACHT, leucine rich repeat and PYD containing 7"""	NALP7		12563287, 12019269	Standard	NM_139176		Approved	PYPAF3, NOD12, PAN7, CLR19.4	uc002qii.4	Q8WX94		ENST00000590030.1:c.1442C>G	19.37:g.55450745G>C	ENSP00000465520:p.Ala481Gly		Somatic				NLRP7_uc002qig.3_Missense_Mutation_p.A481G|NLRP7_uc002qii.3_Missense_Mutation_p.A481G|NLRP7_uc010esk.2_Missense_Mutation_p.A481G|NLRP7_uc010esl.2_Missense_Mutation_p.A509G	p.A481G	NM_206828	NP_996611	WXS	Illumina HiSeq	Unspecified	Q8WX94	NALP7_HUMAN		GBM - Glioblastoma multiforme(193;0.0325)	4	1518	-			481	A -> T (in Ref. 4; AAI09126).		NACHT.		E9PE16|Q32MH8|Q7RTR1	Missense_Mutation	SNP	ENST00000590030.1	37	c.1442C>G	CCDS33109.1	.	.	.	.	.	.	.	.	.	.	G	12.70	2.017805	0.35606	.	.	ENSG00000167634	ENST00000328092;ENST00000448121;ENST00000340844;ENST00000446217;ENST00000399724	T;T;T;T	0.74106	-0.74;-0.74;-0.81;-0.78	1.92	0.866	0.19079	.	2.124680	0.03209	N	0.175938	T	0.71375	0.3332	L	0.54323	1.7	0.09310	N	1	P;P;P	0.49862	0.883;0.883;0.929	B;B;P	0.46076	0.306;0.306;0.503	T	0.57277	-0.7839	10	0.87932	D	0	.	1.6137	0.02698	0.5044:0.0:0.2002:0.2953	.	509;481;481	E7EPM2;Q8WX94;Q8WX94-2	.;NALP7_HUMAN;.	G	481;481;481;509;248	ENSP00000329568:A481G;ENSP00000409137:A481G;ENSP00000339491:A481G;ENSP00000414273:A509G	ENSP00000329568:A481G	A	-	2	0	NLRP7	60142557	0.008000	0.16893	0.000000	0.03702	0.277000	0.26821	2.387000	0.44389	0.207000	0.20607	-0.379000	0.06801	GCC		0.592	NLRP7-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000451396.1	NM_139176		41	83	0	0	0	0.01441	0	41	83				
ZNF460	10794	broad.mit.edu	37	19	57802481	57802481	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr19:57802481C>T	ENST00000360338.3	+	3	894	c.572C>T	c.(571-573)cCt>cTt	p.P191L	ZNF460_ENST00000537645.1_Missense_Mutation_p.P150L	NM_006635.3	NP_006626.3	Q14592	ZN460_HUMAN	zinc finger protein 460	191					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.P191L(1)		breast(1)|endometrium(3)|large_intestine(2)|lung(9)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		CAGATTCTCCCTCGTGTGAAG	0.448																																							uc002qog.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(571-573)CCT>CTT		zinc finger protein 460							87.0	85.0	85.0					19																	57802481		2203	4300	6503	SO:0001583	missense	10794				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:57802481C>T	X78931	CCDS12949.1	19q13.4	2013-01-08				ENSG00000197714		"""Zinc fingers, C2H2-type"", ""-"""	21628	protein-coding gene	gene with protein product		604755	"""zinc finger protein 272"""	ZNF272		15004467	Standard	NM_006635		Approved	HZF8	uc002qog.2	Q14592		ENST00000360338.3:c.572C>T	19.37:g.57802481C>T	ENSP00000353491:p.Pro191Leu		Somatic				ZNF460_uc010ygv.1_Missense_Mutation_p.P150L	p.P191L	NM_006635	NP_006626	WXS	Illumina HiSeq	Unspecified	Q14592	ZN460_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)	3	894	+		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)	191					A4FU64|B4DNX9|Q2VPC7|Q6VSF8	Missense_Mutation	SNP	ENST00000360338.3	37	c.572C>T	CCDS12949.1	.	.	.	.	.	.	.	.	.	.	C	9.167	1.020225	0.19433	.	.	ENSG00000197714	ENST00000537645;ENST00000360338	T;T	0.14022	2.54;2.54	1.68	-2.75	0.05914	.	.	.	.	.	T	0.06962	0.0177	N	0.16307	0.4	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.34725	-0.9817	9	0.87932	D	0	.	3.6915	0.08347	0.0:0.4606:0.2037:0.3356	.	191	Q14592	ZN460_HUMAN	L	150;191	ENSP00000446167:P150L;ENSP00000353491:P191L	ENSP00000353491:P191L	P	+	2	0	ZNF460	62494293	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	1.076000	0.30729	-0.700000	0.05070	-0.355000	0.07637	CCT		0.448	ZNF460-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465727.1	NM_006635		59	126	0	0	0	0.01441	0	59	126				
ZNF416	55659	broad.mit.edu	37	19	58084737	58084737	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr19:58084737C>A	ENST00000196489.3	-	4	757	c.535G>T	c.(535-537)Gac>Tac	p.D179Y		NM_017879.1	NP_060349.1	Q9BWM5	ZN416_HUMAN	zinc finger protein 416	179					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.D179Y(1)		breast(1)|endometrium(3)|large_intestine(5)|lung(12)|prostate(1)	22		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0259)		GCTAGGAAGTCCTTCCCAACC	0.483																																							uc002qpf.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(535-537)GAC>TAC		zinc finger protein 416							92.0	90.0	91.0					19																	58084737		2203	4300	6503	SO:0001583	missense	55659				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:58084737C>A	BC000130	CCDS12954.1	19q13.4	2013-01-08				ENSG00000083817		"""Zinc fingers, C2H2-type"", ""-"""	20645	protein-coding gene	gene with protein product							Standard	NM_017879		Approved	FLJ20557	uc002qpf.3	Q9BWM5		ENST00000196489.3:c.535G>T	19.37:g.58084737C>A	ENSP00000196489:p.Asp179Tyr		Somatic				ZNF547_uc002qpm.3_Intron	p.D179Y	NM_017879	NP_060349	WXS	Illumina HiSeq	Unspecified	Q9BWM5	ZN416_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0259)	4	706	-		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.156)	179					Q9NWW8	Missense_Mutation	SNP	ENST00000196489.3	37	c.535G>T	CCDS12954.1	.	.	.	.	.	.	.	.	.	.	C	13.13	2.144729	0.37825	.	.	ENSG00000083817	ENST00000196489;ENST00000359489;ENST00000428052	T	0.11063	2.81	3.58	1.26	0.21427	.	.	.	.	.	T	0.20414	0.0491	L	0.59436	1.845	0.09310	N	1	D	0.71674	0.998	P	0.61397	0.888	T	0.08638	-1.0712	9	0.45353	T	0.12	.	5.5199	0.16927	0.0:0.7088:0.0:0.2912	.	179	Q9BWM5	ZN416_HUMAN	Y	179;165;159	ENSP00000196489:D179Y	ENSP00000196489:D179Y	D	-	1	0	ZNF416	62776549	0.000000	0.05858	0.001000	0.08648	0.025000	0.11179	0.404000	0.20999	0.255000	0.21593	-0.466000	0.05196	GAC		0.483	ZNF416-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466787.1	NM_017879		40	97	1	0	3.61848e-18	0.007835	5.17398e-18	40	97				
A1BG	1	broad.mit.edu	37	19	58858921	58858921	+	Silent	SNP	G	G	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr19:58858921G>T	ENST00000263100.3	-	7	1339	c.1278C>A	c.(1276-1278)ccC>ccA	p.P426P	A1BG-AS1_ENST00000593960.1_RNA|A1BG_ENST00000596924.1_5'UTR|A1BG-AS1_ENST00000599728.1_RNA|A1BG-AS1_ENST00000593374.1_RNA|A1BG-AS1_ENST00000600379.1_RNA|A1BG-AS1_ENST00000594950.1_RNA|A1BG-AS1_ENST00000600686.1_RNA|CTD-2619J13.8_ENST00000599109.1_RNA	NM_130786.3	NP_570602.2	P04217	A1BG_HUMAN	alpha-1-B glycoprotein	426	Ig-like V-type 5.					blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.P426P(1)		NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(7)|prostate(2)	15		all_cancers(17;3.04e-16)|all_epithelial(17;7.77e-12)|Lung NSC(17;3.25e-05)|Colorectal(82;5.46e-05)|all_lung(17;0.000129)|all_neural(62;0.0182)|Ovarian(87;0.0443)|Breast(46;0.0889)|Renal(17;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0269)		CGTCGGGGATGGGTCCCTCGC	0.741																																							uc002qsd.3		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1276-1278)CCC>CCA		alpha 1B-glycoprotein precursor							14.0	13.0	14.0					19																	58858921		2161	4243	6404	SO:0001819	synonymous_variant	1					extracellular region		g.chr19:58858921G>T		CCDS12976.1	19q13.43	2013-10-15			ENSG00000121410	ENSG00000121410		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5	protein-coding gene	gene with protein product		138670				2591067	Standard	NM_130786		Approved		uc002qsd.4	P04217	OTTHUMG00000183507	ENST00000263100.3:c.1278C>A	19.37:g.58858921G>T			Somatic				NCRNA00181_uc002qse.2_5'Flank	p.P426P	NM_130786	NP_570602	WXS	Illumina HiSeq	Unspecified	P04217	A1BG_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0269)	7	1340	-		all_cancers(17;3.04e-16)|all_epithelial(17;7.77e-12)|Lung NSC(17;3.25e-05)|Colorectal(82;5.46e-05)|all_lung(17;0.000129)|all_neural(62;0.0182)|Ovarian(87;0.0443)|Breast(46;0.0889)|Renal(17;0.157)	426			Ig-like V-type 5.		A8K052|Q68CK0|Q8IYJ6|Q96P39	Silent	SNP	ENST00000263100.3	37	c.1278C>A	CCDS12976.1																																																																																				0.741	A1BG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466930.1	NM_130786		10	16	1	0	3.07112e-06	0.010729	3.43747e-06	10	16				
TPO	7173	broad.mit.edu	37	2	1426848	1426848	+	Silent	SNP	C	C	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr2:1426848C>A	ENST00000345913.4	+	3	217	c.126C>A	c.(124-126)gtC>gtA	p.V42V	TPO_ENST00000382201.3_Silent_p.V42V|TPO_ENST00000349624.3_Silent_p.V42V|TPO_ENST00000382269.3_Silent_p.V42V|TPO_ENST00000539820.1_Silent_p.V42V|TPO_ENST00000329066.4_Silent_p.V42V|TPO_ENST00000337415.3_Silent_p.V42V|TPO_ENST00000346956.3_Silent_p.V42V|TPO_ENST00000497517.2_Intron|TPO_ENST00000382198.1_Silent_p.V42V	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase	42					cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)	p.V42V(1)		breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	TCTCTAGCGTCTTGGAGGAAA	0.582																																							uc002qww.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(7)|pancreas(6)|skin(5)|lung(1)|kidney(1)	20						c.(124-126)GTC>GTA		thyroid peroxidase isoform a	Carbimazole(DB00389)|Methimazole(DB00763)|Propylthiouracil(DB00550)						121.0	97.0	105.0					2																	1426848		2203	4300	6503	SO:0001819	synonymous_variant	7173				cellular nitrogen compound metabolic process|hormone biosynthetic process|hydrogen peroxide catabolic process	cell surface|cytoplasm|integral to plasma membrane	calcium ion binding|heme binding|iodide peroxidase activity	g.chr2:1426848C>A		CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.126C>A	2.37:g.1426848C>A			Somatic				TPO_uc010ewj.2_Intron|TPO_uc010yin.1_Silent_p.V42V|TPO_uc002qwu.2_Silent_p.V42V|TPO_uc002qwr.2_Silent_p.V42V|TPO_uc002qwx.2_Silent_p.V42V|TPO_uc010yio.1_Silent_p.V42V|TPO_uc010yip.1_Silent_p.V42V	p.V42V	NM_000547	NP_000538	WXS	Illumina HiSeq	Unspecified	P07202	PERT_HUMAN		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	3	217	+	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)	42			Extracellular (Potential).		P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Silent	SNP	ENST00000345913.4	37	c.126C>A	CCDS1643.1																																																																																				0.582	TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206594.2	NM_000547		27	73	1	0	7.11191e-15	0.013726	9.6801e-15	27	73				
APOB	338	broad.mit.edu	37	2	21233375	21233375	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr2:21233375G>T	ENST00000233242.1	-	26	6492	c.6365C>A	c.(6364-6366)gCt>gAt	p.A2122D		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	2122	Heparin-binding.				artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)	p.A2122D(1)		NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ATAATCATTAGCTTGCTGTGG	0.368																																							uc002red.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27						c.(6364-6366)GCT>GAT		apolipoprotein B precursor	Atorvastatin(DB01076)						63.0	65.0	64.0					2																	21233375		2203	4300	6503	SO:0001583	missense	338				cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity	g.chr2:21233375G>T	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.6365C>A	2.37:g.21233375G>T	ENSP00000233242:p.Ala2122Asp		Somatic					p.A2122D	NM_000384	NP_000375	WXS	Illumina HiSeq	Unspecified	P04114	APOB_HUMAN			26	6493	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		2122			Heparin-binding.		O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	ENST00000233242.1	37	c.6365C>A	CCDS1703.1	.	.	.	.	.	.	.	.	.	.	G	10.90	1.482655	0.26598	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.00705	5.81	5.61	1.66	0.24008	.	1.141800	0.06585	N	0.751014	T	0.00695	0.0023	N	0.08118	0	0.48696	D	0.999699	B	0.21381	0.055	B	0.20384	0.029	T	0.53837	-0.8382	10	0.87932	D	0	.	9.3863	0.38345	0.7931:0.0:0.2069:0.0	.	2122	P04114	APOB_HUMAN	D	2122	ENSP00000233242:A2122D	ENSP00000233242:A2122D	A	-	2	0	APOB	21086880	0.643000	0.27269	0.283000	0.24790	0.796000	0.44982	4.126000	0.57937	0.076000	0.16826	-0.459000	0.05422	GCT		0.368	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1			20	22	1	0	2.89027e-11	0.014323	3.65217e-11	20	22				
EIF2B4	8890	broad.mit.edu	37	2	27590037	27590037	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr2:27590037C>A	ENST00000347454.4	-	10	1088	c.917G>T	c.(916-918)cGg>cTg	p.R306L	EIF2B4_ENST00000451130.2_Missense_Mutation_p.R326L|EIF2B4_ENST00000445933.2_Missense_Mutation_p.R305L|EIF2B4_ENST00000493344.2_Missense_Mutation_p.R327L|AC074117.10_ENST00000412749.1_RNA	NM_001034116.1|NM_015636.3	NP_001029288.1|NP_056451.3	Q9UI10	EI2BD_HUMAN	eukaryotic translation initiation factor 2B, subunit 4 delta, 67kDa	306			R -> G (in dbSNP:rs78599355). {ECO:0000269|PubMed:11835386}.		cellular protein metabolic process (GO:0044267)|cellular response to stimulus (GO:0051716)|gene expression (GO:0010467)|myelination (GO:0042552)|negative regulation of translational initiation (GO:0045947)|negative regulation of translational initiation in response to stress (GO:0032057)|oligodendrocyte development (GO:0014003)|ovarian follicle development (GO:0001541)|positive regulation of GTPase activity (GO:0043547)|regulation of translation (GO:0006417)|regulation of translational initiation (GO:0006446)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to peptide hormone (GO:0043434)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation initiation factor 2B complex (GO:0005851)	translation initiation factor activity (GO:0003743)|translation initiation factor binding (GO:0031369)	p.R306L(1)|p.R326L(1)		breast(1)|cervix(1)|endometrium(1)|kidney(1)|lung(5)|skin(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTGCACATACCGATCAATGGC	0.433																																							uc002rkb.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(916-918)CGG>CTG		eukaryotic translation initiation factor 2B,							194.0	166.0	175.0					2																	27590037		2203	4300	6503	SO:0001583	missense	8890				myelination|negative regulation of translational initiation in response to stress|oligodendrocyte development|ovarian follicle development|response to glucose stimulus|response to heat|response to peptide hormone stimulus	cytosol|eukaryotic translation initiation factor 2B complex	translation initiation factor activity|translation initiation factor binding	g.chr2:27590037C>A	AJ011306	CCDS33164.1, CCDS46244.1, CCDS46245.1	2p23.3	2008-02-05	2002-08-29		ENSG00000115211	ENSG00000115211			3260	protein-coding gene	gene with protein product		606687	"""eukaryotic translation initiation factor 2B, subunit 4 (delta, 67kD)"""			8929216, 7982969	Standard	NM_172195		Approved	EIF2Bdelta, EIF-2B, DKFZP586J0119, EIF2B	uc002rjz.3	Q9UI10	OTTHUMG00000151927	ENST00000347454.4:c.917G>T	2.37:g.27590037C>A	ENSP00000233552:p.Arg306Leu		Somatic				EIF2B4_uc002rjz.2_Missense_Mutation_p.R326L|EIF2B4_uc002rka.2_Missense_Mutation_p.R291L|EIF2B4_uc002rkc.2_Missense_Mutation_p.R305L|EIF2B4_uc002rkd.2_Missense_Mutation_p.R100L|EIF2B4_uc002rke.2_Missense_Mutation_p.R275L|EIF2B4_uc002rkf.1_3'UTR	p.R306L	NM_001034116	NP_001029288	WXS	Illumina HiSeq	Unspecified	Q9UI10	EI2BD_HUMAN			10	1060	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		306		R -> G.			Q53RY7|Q5BJF4|Q9BUV9|Q9UBG4|Q9UIQ9|Q9UJ95	Missense_Mutation	SNP	ENST00000347454.4	37	c.917G>T	CCDS33164.1	.	.	.	.	.	.	.	.	.	.	C	6.451	0.451355	0.12223	.	.	ENSG00000115211	ENST00000347454;ENST00000414437;ENST00000445933;ENST00000451130;ENST00000493344	D;D;D;D	0.92348	-3.02;-3.02;-3.02;-3.02	5.97	5.1	0.69264	.	0.374448	0.30901	N	0.008653	D	0.85526	0.5717	L	0.27975	0.815	0.22656	N	0.998889	B;B;B;B	0.12013	0.005;0.002;0.003;0.001	B;B;B;B	0.17098	0.009;0.009;0.016;0.017	T	0.72520	-0.4268	10	0.26408	T	0.33	-6.978	10.9387	0.47260	0.0:0.8491:0.0:0.1509	.	303;305;306;326	F5H6W1;Q9UI10-3;Q9UI10;Q9UI10-2	.;.;EI2BD_HUMAN;.	L	306;303;305;326;327	ENSP00000233552:R306L;ENSP00000394397:R305L;ENSP00000394869:R326L;ENSP00000429323:R327L	ENSP00000233552:R306L	R	-	2	0	EIF2B4	27443541	0.025000	0.19082	0.645000	0.29479	0.118000	0.20060	1.411000	0.34702	1.543000	0.49345	0.655000	0.94253	CGG		0.433	EIF2B4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000324448.1			72	181	1	0	4.18771e-30	0.01441	6.71557e-30	72	181				
NRXN1	9378	broad.mit.edu	37	2	50318616	50318616	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr2:50318616C>A	ENST00000406316.2	-	19	5039	c.3563G>T	c.(3562-3564)gGa>gTa	p.G1188V	NRXN1_ENST00000342183.5_Missense_Mutation_p.G153V|NRXN1_ENST00000405472.3_Missense_Mutation_p.G1180V|NRXN1_ENST00000402717.3_Missense_Mutation_p.G1180V|NRXN1_ENST00000404971.1_Missense_Mutation_p.G1228V|NRXN1_ENST00000401669.2_Missense_Mutation_p.G1188V|NRXN1_ENST00000406859.3_Missense_Mutation_p.G1188V|NRXN1_ENST00000401710.1_Missense_Mutation_p.G206V	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	1188	Laminin G-like 6. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)	p.G1229V(1)|p.G153V(1)|p.G1228V(1)|p.G1188V(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			AAACTTAACTCCAATTTTTCC	0.363																																							uc010fbp.2		NA																	4	Substitution - Missense(4)		lung(4)	ovary(2)	2						c.(457-459)GGA>GTA		neurexin 1 isoform beta precursor							122.0	112.0	115.0					2																	50318616		2203	4300	6503	SO:0001583	missense	9378				angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding	g.chr2:50318616C>A	AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.3563G>T	2.37:g.50318616C>A	ENSP00000384311:p.Gly1188Val		Somatic				NRXN1_uc002rxb.3_Missense_Mutation_p.G860V|NRXN1_uc010fbq.2_Missense_Mutation_p.G1228V|NRXN1_uc002rxe.3_Missense_Mutation_p.G1188V	p.G153V	NM_138735	NP_620072	WXS	Illumina HiSeq	Unspecified	P58400	NRX1B_HUMAN	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)		3	1265	-		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	153			Extracellular (Potential).|Laminin G-like.		A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Missense_Mutation	SNP	ENST00000406316.2	37	c.458G>T	CCDS54360.1	.	.	.	.	.	.	.	.	.	.	C	8.334	0.827198	0.16749	.	.	ENSG00000179915	ENST00000342183;ENST00000536347;ENST00000401710;ENST00000404971;ENST00000406316;ENST00000405472;ENST00000401669;ENST00000536085;ENST00000402717;ENST00000406859	T;T;T;T;T;T;T;T	0.75367	-0.93;-0.93;-0.93;-0.93;-0.93;-0.93;-0.93;-0.93	5.74	5.74	0.90152	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.670270	0.12169	U	0.493254	T	0.81569	0.4850	L	0.35793	1.09	0.49051	D	0.99974	B;D;D;B	0.63880	0.304;0.993;0.993;0.446	B;D;P;B	0.70016	0.144;0.967;0.839;0.106	T	0.74216	-0.3737	10	0.19590	T	0.45	.	19.9015	0.96985	0.0:1.0:0.0:0.0	.	1228;153;1188;1180	Q9ULB1-3;P58400;F8WB18;A7E294	.;NRX1B_HUMAN;.;.	V	153;107;206;1228;1188;1180;1188;1229;1180;1188	ENSP00000341184:G153V;ENSP00000385580:G206V;ENSP00000385142:G1228V;ENSP00000384311:G1188V;ENSP00000434015:G1180V;ENSP00000385017:G1188V;ENSP00000385434:G1180V;ENSP00000385681:G1188V	ENSP00000341184:G153V	G	-	2	0	NRXN1	50172120	1.000000	0.71417	1.000000	0.80357	0.809000	0.45718	2.628000	0.46477	2.706000	0.92434	0.563000	0.77884	GGA		0.363	NRXN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325291.2			28	74	1	0	4.22769e-11	0.00632	5.3269e-11	28	74				
PPP3R1	5534	broad.mit.edu	37	2	68413773	68413773	+	Missense_Mutation	SNP	T	T	C	rs369235532		TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr2:68413773T>C	ENST00000234310.3	-	5	695	c.292A>G	c.(292-294)Atc>Gtc	p.I98V	PPP3R1_ENST00000409752.1_Missense_Mutation_p.I117V|RP11-474G23.1_ENST00000406334.3_Missense_Mutation_p.I88V|PPP3R1_ENST00000409377.1_Missense_Mutation_p.I88V	NM_000945.3	NP_000936.1	P63098	CANB1_HUMAN	protein phosphatase 3, regulatory subunit B, alpha	98	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.				apoptotic process (GO:0006915)|epithelial to mesenchymal transition (GO:0001837)|Fc-epsilon receptor signaling pathway (GO:0038095)|heart development (GO:0007507)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|lung epithelial cell differentiation (GO:0060487)|NFAT protein import into nucleus (GO:0051531)|patterning of blood vessels (GO:0001569)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|protein dephosphorylation (GO:0006470)	calcineurin complex (GO:0005955)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|sarcolemma (GO:0042383)	calcium ion binding (GO:0005509)|calcium-dependent protein serine/threonine phosphatase activity (GO:0004723)|calmodulin binding (GO:0005516)|protein domain specific binding (GO:0019904)	p.I98V(1)		large_intestine(1)	1						ATGTCATAGATACGGAAAGCA	0.348																																							uc002sei.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(292-294)ATC>GTC		protein phosphatase 3, regulatory subunit B,	Pimecrolimus(DB00337)	T	VAL/ILE	0,3878		0,0,1939	72.0	61.0	64.0		292	5.7	1.0	2		64	1,8399		0,1,4199	no	missense	PPP3R1	NM_000945.3	29	0,1,6138	CC,CT,TT		0.0119,0.0,0.0081	benign	98/171	68413773	1,12277	1939	4200	6139	SO:0001583	missense	5534				activation of pro-apoptotic gene products|induction of apoptosis by intracellular signals	calcineurin complex|cytosol	calcium ion binding|calcium-dependent protein serine/threonine phosphatase activity|calmodulin binding	g.chr2:68413773T>C	M30773	CCDS46310.1	2p14	2013-01-10	2010-04-14		ENSG00000221823	ENSG00000221823	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 3, regulatory subunits"", ""EF-hand domain containing"""	9317	protein-coding gene	gene with protein product	"""calcineurin B, type I (19kDa)"", ""protein phosphatase 2B regulatory subunit B alpha"""	601302	"""protein phosphatase 3 (formerly 2B), regulatory subunit B (19kD), alpha isoform (calcineurin B, type I)"", ""protein phosphatase 3 (formerly 2B), regulatory subunit B, 19kDa, alpha isoform (calcineurin B, type I)"", ""protein phosphatase 3 (formerly 2B), regulatory subunit B, alpha isoform"""			8978785, 2558868	Standard	NM_000945		Approved	CALNB1, CNB, CNB1	uc002sei.1	P63098	OTTHUMG00000129561	ENST00000234310.3:c.292A>G	2.37:g.68413773T>C	ENSP00000234310:p.Ile98Val		Somatic					p.I98V	NM_000945	NP_000936	WXS	Illumina HiSeq	Unspecified	P63098	CANB1_HUMAN			5	684	-			98			EF-hand 3.		B2RC10|B5MDU4|P06705|P15117|Q08044|Q53SL0	Missense_Mutation	SNP	ENST00000234310.3	37	c.292A>G	CCDS46310.1	.	.	.	.	.	.	.	.	.	.	T	17.54	3.415664	0.62511	0.0	1.19E-4	ENSG00000221823	ENST00000234310;ENST00000409752;ENST00000409377	T;T;T	0.70986	-0.53;-0.53;-0.53	5.66	5.66	0.87406	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	T	0.51736	0.1692	N	0.05441	-0.05	0.46678	D	0.999159	B	0.15473	0.013	B	0.23716	0.048	T	0.49781	-0.8903	10	0.12766	T	0.61	.	15.8894	0.79279	0.0:0.0:0.0:1.0	.	98	P63098	CANB1_HUMAN	V	98;117;88	ENSP00000234310:I98V;ENSP00000387216:I117V;ENSP00000387148:I88V	ENSP00000234310:I98V	I	-	1	0	PPP3R1	68267277	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.958000	0.87877	2.161000	0.67846	0.477000	0.44152	ATC		0.348	PPP3R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326765.4	NM_000945		7	11	0	0	0	0.00308	0	7	11				
PLEK	5341	broad.mit.edu	37	2	68607985	68607985	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr2:68607985C>A	ENST00000234313.7	+	3	508	c.329C>A	c.(328-330)gCc>gAc	p.A110D		NM_002664.2	NP_002655.2	P08567	PLEK_HUMAN	pleckstrin	110					actin cytoskeleton reorganization (GO:0031532)|blood coagulation (GO:0007596)|cell projection organization (GO:0030030)|cortical actin cytoskeleton organization (GO:0030866)|hematopoietic progenitor cell differentiation (GO:0002244)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of calcium-mediated signaling (GO:0050849)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|negative regulation of inositol phosphate biosynthetic process (GO:0010920)|phosphatidylinositol metabolic process (GO:0046488)|phospholipase C-inhibiting G-protein coupled receptor signaling pathway (GO:0030845)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of actin filament bundle assembly (GO:0032233)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of inositol-polyphosphate 5-phosphatase activity (GO:0010925)|positive regulation of integrin activation (GO:0033625)|positive regulation of platelet activation (GO:0010572)|protein kinase C signaling (GO:0070528)|protein secretion by platelet (GO:0070560)|regulation of cell diameter (GO:0060305)|ruffle organization (GO:0031529)|thrombin receptor signaling pathway (GO:0070493)|vesicle docking involved in exocytosis (GO:0006904)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|membrane (GO:0016020)|ruffle membrane (GO:0032587)	phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)	p.A110D(1)		autonomic_ganglia(1)|endometrium(3)|large_intestine(6)|lung(12)|ovary(1)|skin(1)	24		Ovarian(717;0.0129)		STAD - Stomach adenocarcinoma(1183;0.00159)|READ - Rectum adenocarcinoma(193;0.0419)		CAGAAATTTGCCAGGAAATCT	0.473																																							uc002sen.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(328-330)GCC>GAC		pleckstrin							144.0	138.0	140.0					2																	68607985		2203	4300	6503	SO:0001583	missense	5341				actin cytoskeleton reorganization|cortical actin cytoskeleton organization|hemopoietic progenitor cell differentiation|inhibition of phospholipase C activity involved in G-protein coupled receptor signaling pathway|integrin-mediated signaling pathway|negative regulation of calcium-mediated signaling|negative regulation of inositol phosphate biosynthetic process|phosphatidylinositol metabolic process|platelet aggregation|positive regulation of actin filament bundle assembly|positive regulation of actin filament depolymerization|positive regulation of inositol-polyphosphate 5-phosphatase activity|positive regulation of integrin activation|positive regulation of platelet activation|protein kinase C signaling cascade|protein secretion by platelet|regulation of cell diameter|ruffle organization|thrombin receptor signaling pathway|vesicle docking involved in exocytosis	cytosol|extracellular region|membrane fraction|ruffle membrane|soluble fraction	phosphatidylinositol-3,4-bisphosphate binding|protein homodimerization activity|protein kinase C binding	g.chr2:68607985C>A	X07743	CCDS1887.1	2p13.3	2013-01-10			ENSG00000115956	ENSG00000115956		"""Pleckstrin homology (PH) domain containing"""	9070	protein-coding gene	gene with protein product		173570				2897630, 12054651	Standard	NM_002664		Approved	P47	uc002sen.4	P08567	OTTHUMG00000129562	ENST00000234313.7:c.329C>A	2.37:g.68607985C>A	ENSP00000234313:p.Ala110Asp		Somatic				PLEK_uc010fde.2_Missense_Mutation_p.A110D	p.A110D	NM_002664	NP_002655	WXS	Illumina HiSeq	Unspecified	P08567	PLEK_HUMAN		STAD - Stomach adenocarcinoma(1183;0.00159)|READ - Rectum adenocarcinoma(193;0.0419)	3	491	+		Ovarian(717;0.0129)	110					B2R9E8|Q53SU8|Q6FGM8|Q6FGQ1|Q8WV81	Missense_Mutation	SNP	ENST00000234313.7	37	c.329C>A	CCDS1887.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.236922	0.79800	.	.	ENSG00000115956	ENST00000234313	T	0.20598	2.06	5.8	5.8	0.92144	.	0.192484	0.56097	D	0.000035	T	0.24236	0.0587	L	0.50333	1.59	0.80722	D	1	P;P	0.43477	0.808;0.747	B;B	0.37650	0.231;0.255	T	0.01276	-1.1398	10	0.45353	T	0.12	.	20.0608	0.97674	0.0:1.0:0.0:0.0	.	128;110	Q59GZ2;P08567	.;PLEK_HUMAN	D	110	ENSP00000234313:A110D	ENSP00000234313:A110D	A	+	2	0	PLEK	68461489	1.000000	0.71417	0.915000	0.36163	0.952000	0.60782	5.786000	0.69006	2.750000	0.94351	0.655000	0.94253	GCC		0.473	PLEK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251755.1	NM_002664		90	202	1	0	4.98208e-43	0.01441	8.41799e-43	90	202				
LRRTM4	80059	broad.mit.edu	37	2	77745546	77745546	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr2:77745546C>A	ENST00000409093.1	-	3	1785	c.1449G>T	c.(1447-1449)gaG>gaT	p.E483D	LRRTM4_ENST00000409282.1_Missense_Mutation_p.E484D|LRRTM4_ENST00000409884.1_Missense_Mutation_p.E483D|LRRTM4_ENST00000409911.1_Missense_Mutation_p.E484D|LRRTM4_ENST00000409088.3_Missense_Mutation_p.E483D			Q86VH4	LRRT4_HUMAN	leucine rich repeat transmembrane neuronal 4	483					alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|regulation of presynaptic membrane organization (GO:1901629)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)		p.E483D(2)		autonomic_ganglia(1)|endometrium(1)|large_intestine(6)|lung(49)|ovary(2)|pancreas(3)|prostate(1)|upper_aerodigestive_tract(1)	64				Colorectal(11;0.059)		CCACATAATACTCCTGTAAAG	0.473																																							uc002snr.2		NA																	2	Substitution - Missense(2)		lung(2)	pancreas(3)|ovary(1)	4						c.(1447-1449)GAG>GAT		leucine rich repeat transmembrane neuronal 4							92.0	90.0	90.0					2																	77745546		1868	4111	5979	SO:0001583	missense	80059					integral to membrane		g.chr2:77745546C>A	AK122612	CCDS46346.1, CCDS46347.1, CCDS74530.1	2p12	2008-02-05			ENSG00000176204	ENSG00000176204			19411	protein-coding gene	gene with protein product		610870				12676565	Standard	NM_024993		Approved	FLJ12568	uc002snr.3	Q86VH4	OTTHUMG00000152842	ENST00000409093.1:c.1449G>T	2.37:g.77745546C>A	ENSP00000386357:p.Glu483Asp		Somatic				LRRTM4_uc002snq.2_Missense_Mutation_p.E483D|LRRTM4_uc002sns.2_Missense_Mutation_p.E483D|LRRTM4_uc002snt.2_Missense_Mutation_p.E484D	p.E483D	NM_001134745	NP_001128217	WXS	Illumina HiSeq	Unspecified	Q86VH4	LRRT4_HUMAN		Colorectal(11;0.059)	3	1864	-			483			Cytoplasmic (Potential).		Q4FZ98|Q6UXJ7	Missense_Mutation	SNP	ENST00000409093.1	37	c.1449G>T	CCDS46346.1	.	.	.	.	.	.	.	.	.	.	C	14.83	2.652274	0.47362	.	.	ENSG00000176204	ENST00000409911;ENST00000409884;ENST00000409093;ENST00000409088;ENST00000409282	T;T;T;T;T	0.76839	-1.05;-1.05;-1.05;-1.05;-1.05	5.68	4.8	0.61643	.	0.000000	0.85682	D	0.000000	D	0.87059	0.6083	M	0.77103	2.36	0.52501	D	0.999958	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.87578	0.996;0.998;0.996	D	0.87615	0.2506	10	0.54805	T	0.06	.	12.5239	0.56075	0.0:0.9176:0.0:0.0824	.	484;483;483	Q4KMX1;Q86VH4-2;Q86VH4	.;.;LRRT4_HUMAN	D	484;483;483;483;484	ENSP00000387228:E484D;ENSP00000387297:E483D;ENSP00000386357:E483D;ENSP00000386236:E483D;ENSP00000386286:E484D	ENSP00000386236:E483D	E	-	3	2	LRRTM4	77599054	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.613000	0.46351	1.365000	0.46057	0.655000	0.94253	GAG		0.473	LRRTM4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000328225.1	NM_024993		3	24	1	0	0.004672	0.004672	0.00489395	3	24				
SLC9A4	389015	broad.mit.edu	37	2	103095664	103095664	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr2:103095664C>T	ENST00000295269.4	+	2	1080	c.623C>T	c.(622-624)cCa>cTa	p.P208L		NM_001011552.3	NP_001011552.2	Q6AI14	SL9A4_HUMAN	solute carrier family 9, subfamily A (NHE4, cation proton antiporter 4), member 4	208					epithelial cell development (GO:0002064)|gastric acid secretion (GO:0001696)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:proton antiporter activity (GO:0015385)	p.P208L(1)		NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(16)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43						GCCGTGGACCCAGTGGCCGTG	0.597																																							uc002tbz.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|central_nervous_system(1)	3						c.(622-624)CCA>CTA		solute carrier family 9 (sodium/hydrogen							43.0	36.0	38.0					2																	103095664		2203	4300	6503	SO:0001583	missense	389015				regulation of pH	apical plasma membrane|basolateral plasma membrane|integral to membrane	sodium:hydrogen antiporter activity	g.chr2:103095664C>T		CCDS33264.1	2q12.1	2013-05-22	2012-03-22		ENSG00000180251	ENSG00000180251		"""Solute carriers"""	11077	protein-coding gene	gene with protein product		600531	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 4"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 4"""			8199403	Standard	NM_001011552		Approved	NHE4	uc002tbz.4	Q6AI14	OTTHUMG00000153093	ENST00000295269.4:c.623C>T	2.37:g.103095664C>T	ENSP00000295269:p.Pro208Leu		Somatic					p.P208L	NM_001011552	NP_001011552	WXS	Illumina HiSeq	Unspecified	Q6AI14	SL9A4_HUMAN			2	1080	+			208			Helical; Name=F/M5A; (Potential).		Q69YK0	Missense_Mutation	SNP	ENST00000295269.4	37	c.623C>T	CCDS33264.1	.	.	.	.	.	.	.	.	.	.	C	32	5.114760	0.94339	.	.	ENSG00000180251	ENST00000295269	T	0.17691	2.26	5.26	5.26	0.73747	Cation/H+ exchanger (1);	0.000000	0.85682	D	0.000000	T	0.58921	0.2156	H	0.97077	3.935	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.75074	-0.3446	10	0.87932	D	0	.	18.881	0.92356	0.0:1.0:0.0:0.0	.	208	Q6AI14	SL9A4_HUMAN	L	208	ENSP00000295269:P208L	ENSP00000295269:P208L	P	+	2	0	SLC9A4	102462096	1.000000	0.71417	0.966000	0.40874	0.737000	0.42083	7.761000	0.85260	2.442000	0.82660	0.655000	0.94253	CCA		0.597	SLC9A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329498.1	NM_001011552.3		10	19	0	0	0	0.00245	0	10	19				
SULT1C3	442038	broad.mit.edu	37	2	108881745	108881745	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr2:108881745T>C	ENST00000329106.2	+	7	853	c.853T>C	c.(853-855)Ttt>Ctt	p.F285L		NM_001008743.1	NP_001008743.1	Q6IMI6	ST1C3_HUMAN	sulfotransferase family, cytosolic, 1C, member 3	285					sulfur compound metabolic process (GO:0006790)	cytoplasm (GO:0005737)	alcohol sulfotransferase activity (GO:0004027)|aryl sulfotransferase activity (GO:0004062)	p.F285L(1)		breast(1)|kidney(1)|large_intestine(1)|lung(8)|prostate(1)|skin(4)	16						AAATGAAGAATTTGACAAGGA	0.473																																							uc010ywo.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(853-855)TTT>CTT		sulfotransferase family, cytosolic, 1C, member							120.0	115.0	117.0					2																	108881745		2203	4300	6503	SO:0001583	missense	442038					cytoplasm	alcohol sulfotransferase activity	g.chr2:108881745T>C	BC146362	CCDS33267.1	2q12.3	2007-07-26			ENSG00000196228	ENSG00000196228		"""Sulfotransferases, cytosolic"""	33543	protein-coding gene	gene with protein product						14676822, 17425406	Standard	NM_001008743		Approved		uc010ywo.2	Q6IMI6	OTTHUMG00000153227	ENST00000329106.2:c.853T>C	2.37:g.108881745T>C	ENSP00000333310:p.Phe285Leu		Somatic					p.F285L	NM_001008743	NP_001008743	WXS	Illumina HiSeq	Unspecified	Q6IMI6	ST1C3_HUMAN			7	853	+			285					Q6IMI5	Missense_Mutation	SNP	ENST00000329106.2	37	c.853T>C	CCDS33267.1	.	.	.	.	.	.	.	.	.	.	T	24.2	4.507159	0.85282	.	.	ENSG00000196228	ENST00000329106	T	0.01767	4.65	5.11	5.11	0.69529	Sulfotransferase domain (1);	0.208574	0.34002	N	0.004351	T	0.07773	0.0195	M	0.62723	1.935	0.80722	D	1	P	0.42123	0.771	P	0.58331	0.837	T	0.03761	-1.1006	10	0.54805	T	0.06	.	14.2407	0.65954	0.0:0.0:0.0:1.0	.	285	Q6IMI6	ST1C3_HUMAN	L	285	ENSP00000333310:F285L	ENSP00000333310:F285L	F	+	1	0	SULT1C3	108248177	1.000000	0.71417	0.883000	0.34634	0.997000	0.91878	4.186000	0.58337	2.144000	0.66660	0.533000	0.62120	TTT		0.473	SULT1C3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000330255.1	NM_001008743		22	56	0	0	0	0.004656	0	22	56				
MAP3K2	10746	broad.mit.edu	37	2	128088066	128088066	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr2:128088066T>C	ENST00000409947.1	-	6	562	c.280A>G	c.(280-282)Act>Gct	p.T94A	MAP3K2_ENST00000344908.5_Missense_Mutation_p.T94A			Q9Y2U5	M3K2_HUMAN	mitogen-activated protein kinase kinase kinase 2	94	OPR.				activation of JUN kinase activity (GO:0007257)|activation of MAPK activity (GO:0000187)|cellular response to mechanical stimulus (GO:0071260)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)	p.T94A(1)		central_nervous_system(1)|large_intestine(1)|lung(3)|ovary(2)	7	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0706)	Bosutinib(DB06616)	TCTTGAGTAGTTAATGGAATT	0.378																																							uc002toj.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(3)|ovary(2)|large_intestine(1)|central_nervous_system(1)	7						c.(280-282)ACT>GCT		mitogen-activated protein kinase kinase kinase							67.0	60.0	62.0					2																	128088066		1887	4123	6010	SO:0001583	missense	10746				activation of JUN kinase activity|cellular response to mechanical stimulus	nucleus	ATP binding|MAP kinase kinase kinase activity|metal ion binding|protein kinase binding	g.chr2:128088066T>C	AF111105	CCDS46404.1	2q21.1	2011-06-09			ENSG00000169967	ENSG00000169967		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6854	protein-coding gene	gene with protein product	"""MAP/ERK kinase kinase 2"""	609487		MEKK2		8621389, 10085062	Standard	NM_006609		Approved	MEKK2B	uc002toj.2	Q9Y2U5	OTTHUMG00000153397	ENST00000409947.1:c.280A>G	2.37:g.128088066T>C	ENSP00000387246:p.Thr94Ala		Somatic				MAP3K2_uc010flz.1_Missense_Mutation_p.T94A	p.T94A	NM_006609	NP_006600	WXS	Illumina HiSeq	Unspecified	Q9Y2U5	M3K2_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.0706)	5	345	-	Colorectal(110;0.1)		94			OPR.		B9EG87|Q53QL9|Q53S75|Q59GZ6|Q8NC32|Q9NYK3	Missense_Mutation	SNP	ENST00000409947.1	37	c.280A>G	CCDS46404.1	.	.	.	.	.	.	.	.	.	.	T	14.59	2.581719	0.46006	.	.	ENSG00000169967	ENST00000409947;ENST00000344908	T;T	0.25579	1.79;1.79	6.07	6.07	0.98685	Phox/Bem1p (2);	0.232366	0.43110	D	0.000619	T	0.20536	0.0494	N	0.25647	0.755	0.48632	D	0.999681	B	0.14805	0.011	B	0.18871	0.023	T	0.06481	-1.0824	10	0.19590	T	0.45	.	16.635	0.85050	0.0:0.0:0.0:1.0	.	94	Q9Y2U5	M3K2_HUMAN	A	94	ENSP00000387246:T94A;ENSP00000343463:T94A	ENSP00000343463:T94A	T	-	1	0	MAP3K2	127804536	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	4.510000	0.60455	2.330000	0.79161	0.477000	0.44152	ACT		0.378	MAP3K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331014.1	NM_006609		2	10	0	0	0	0.004672	0	2	10				
LRP1B	53353	broad.mit.edu	37	2	141812830	141812830	+	Splice_Site	SNP	T	T	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr2:141812830T>A	ENST00000389484.3	-	10	2380		c.e10-2			NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B						protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.?(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		GGCTTCTGACTACAACAAATA	0.398										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	Colon(99;50 2074 2507 20106)	uc002tvj.1		NA																	1	Unknown(1)		lung(1)	lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50						c.e10-1		low density lipoprotein-related protein 1B							73.0	66.0	69.0					2																	141812830		2203	4300	6503	SO:0001630	splice_region_variant	53353				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding	g.chr2:141812830T>A	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.1409-2A>T	2.37:g.141812830T>A		TSP Lung(27;0.18)	Somatic				LRP1B_uc010fnl.1_Intron	p.V470_splice	NM_018557	NP_061027	WXS	Illumina HiSeq	Unspecified	Q9NZR2	LRP1B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)	10	2381	-		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)						Q8WY29|Q8WY30|Q8WY31	Splice_Site	SNP	ENST00000389484.3	37	c.1409_splice	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	T	23.2	4.393487	0.83011	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	.	.	.	5.45	5.45	0.79879	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.5204	0.75862	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	LRP1B	141529300	1.000000	0.71417	1.000000	0.80357	0.832000	0.47134	7.604000	0.82830	2.077000	0.62373	0.455000	0.32223	.		0.398	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	Intron	6	21	0	0	0	0.001168	0	6	21				
NEB	4703	broad.mit.edu	37	2	152522052	152522052	+	Splice_Site	SNP	T	T	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr2:152522052T>A	ENST00000172853.10	-	42	5180	c.5033A>T	c.(5032-5034)aAt>aTt	p.N1678I	NEB_ENST00000604864.1_Splice_Site_p.N1678I|NEB_ENST00000603639.1_Splice_Site_p.N1678I|NEB_ENST00000427231.2_Splice_Site_p.N1678I|NEB_ENST00000397345.3_Splice_Site_p.N1678I|NEB_ENST00000409198.1_Splice_Site_p.N1678I			P20929	NEBU_HUMAN	nebulin	1678					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)	p.N1678I(2)		NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		TTTGTACAGATTCTTTACAAT	0.398																																							uc010fnx.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20						c.(5032-5034)AAT>ATT		nebulin isoform 3							56.0	50.0	52.0					2																	152522052		1848	4090	5938	SO:0001630	splice_region_variant	4703				muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle	g.chr2:152522052T>A	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.5032-1A>T	2.37:g.152522052T>A			Somatic					p.N1678I	NM_004543	NP_004534	WXS	Illumina HiSeq	Unspecified	P20929	NEBU_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.219)	42	5224	-			1678			Nebulin 43.		F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	ENST00000172853.10	37	c.5033A>T		.	.	.	.	.	.	.	.	.	.	T	9.799	1.179994	0.21787	.	.	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000172853	T;T;T;T	0.30448	1.53;1.53;1.53;1.53	5.97	5.97	0.96955	.	0.227351	0.47455	D	0.000228	T	0.49474	0.1559	M	0.68728	2.09	0.80722	D	1	D	0.58620	0.983	P	0.61477	0.889	T	0.38415	-0.9662	10	0.16420	T	0.52	.	16.4608	0.84044	0.0:0.0:0.0:1.0	.	1678	P20929	NEBU_HUMAN	I	1678	ENSP00000386259:N1678I;ENSP00000380505:N1678I;ENSP00000416578:N1678I;ENSP00000172853:N1678I	ENSP00000172853:N1678I	N	-	2	0	NEB	152230298	0.967000	0.33354	0.992000	0.48379	0.774000	0.43823	1.692000	0.37731	2.288000	0.76882	0.533000	0.62120	AAT		0.398	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543	Missense_Mutation	9	15	0	0	0	0.008291	0	9	15				
SCN3A	6328	broad.mit.edu	37	2	165997321	165997321	+	Missense_Mutation	SNP	C	C	T	rs369720053		TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr2:165997321C>T	ENST00000360093.3	-	13	2350	c.1859G>A	c.(1858-1860)cGa>cAa	p.R620Q	SCN3A_ENST00000283254.7_Missense_Mutation_p.R620Q|SCN3A_ENST00000409101.3_Missense_Mutation_p.R620Q	NM_001081677.1	NP_001075146.1	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha subunit	620					membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.R620Q(4)		NS(1)|breast(7)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(19)|liver(2)|lung(47)|ovary(6)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(3)	120					Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	ACTGTTGCGTCGCTCTCCATG	0.498																																							uc002ucx.2		NA																	4	Substitution - Missense(4)		lung(4)	ovary(4)|breast(3)|skin(2)|central_nervous_system(1)	10						c.(1858-1860)CGA>CAA		sodium channel, voltage-gated, type III, alpha	Lamotrigine(DB00555)						248.0	179.0	202.0					2																	165997321		2203	4300	6503	SO:0001583	missense	6328					voltage-gated sodium channel complex	voltage-gated sodium channel activity	g.chr2:165997321C>T	AF035685	CCDS33312.1, CCDS46440.1	2q24	2012-02-26	2007-01-23		ENSG00000153253	ENSG00000153253		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10590	protein-coding gene	gene with protein product		182391	"""sodium channel, voltage-gated, type III, alpha polypeptide"""			9589372, 16382098	Standard	NM_001081676		Approved	Nav1.3	uc002ucx.3	Q9NY46	OTTHUMG00000044171	ENST00000360093.3:c.1859G>A	2.37:g.165997321C>T	ENSP00000353206:p.Arg620Gln		Somatic				SCN3A_uc002ucy.2_Missense_Mutation_p.R620Q|SCN3A_uc002ucz.2_Missense_Mutation_p.R620Q|SCN3A_uc002uda.1_Missense_Mutation_p.R489Q|SCN3A_uc002udb.1_Missense_Mutation_p.R489Q	p.R620Q	NM_006922	NP_008853	WXS	Illumina HiSeq	Unspecified	Q9NY46	SCN3A_HUMAN			13	2351	-			620					Q16142|Q53SX0|Q9BZB3|Q9C006|Q9NYK2|Q9P2J1|Q9UPD1|Q9Y6P4	Missense_Mutation	SNP	ENST00000360093.3	37	c.1859G>A		.	.	.	.	.	.	.	.	.	.	C	36	5.617194	0.96649	.	.	ENSG00000153253	ENST00000360093;ENST00000283254;ENST00000409101;ENST00000440431	D;D;D;D	0.92805	-3.11;-3.11;-3.11;-3.11	6.07	6.07	0.98685	Domain of unknown function DUF3451 (1);	0.000000	0.49916	D	0.000140	D	0.97142	0.9066	M	0.91717	3.235	0.80722	D	1	D;D;D;D;D	0.76494	0.999;0.999;0.987;0.987;0.998	P;D;P;P;P	0.72625	0.906;0.978;0.56;0.56;0.758	D	0.97109	0.9803	10	0.87932	D	0	.	20.6593	0.99626	0.0:1.0:0.0:0.0	.	620;620;620;620;620	Q9NY46;E7EUE6;Q9NY46-2;Q9NY46-4;Q9NY46-3	SCN3A_HUMAN;.;.;.;.	Q	620	ENSP00000353206:R620Q;ENSP00000283254:R620Q;ENSP00000386726:R620Q;ENSP00000403348:R620Q	ENSP00000283254:R620Q	R	-	2	0	SCN3A	165705567	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.012000	0.57131	2.885000	0.99019	0.655000	0.94253	CGA		0.498	SCN3A-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_006922		18	50	0	0	0	0.007413	0	18	50				
OLA1	29789	broad.mit.edu	37	2	175111467	175111467	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr2:175111467C>A	ENST00000409546.1	-	2	767	c.137G>T	c.(136-138)gGt>gTt	p.G46V	OLA1_ENST00000428402.2_Missense_Mutation_p.G26V|OLA1_ENST00000284719.3_Missense_Mutation_p.G26V|OLA1_ENST00000344357.5_Intron					Obg-like ATPase 1									p.G26V(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	11						TCCAACAATACCAATTTTCAG	0.398																																							uc002uih.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)	2						c.(76-78)GGT>GTT		Obg-like ATPase 1 isoform 1							81.0	82.0	82.0					2																	175111467		2203	4300	6503	SO:0001583	missense	29789				ATP catabolic process	cytoplasm	ATP binding|GTP binding|hydrolase activity|protein binding	g.chr2:175111467C>A		CCDS2255.1, CCDS42779.1	2q31.1	2014-06-24	2007-07-27	2007-07-27	ENSG00000138430	ENSG00000138430			28833	protein-coding gene	gene with protein product		611175	"""GTP-binding protein 9 (putative)"""	GTPBP9		17430889, 24486488	Standard	NM_013341		Approved	PTD004	uc002uih.3	Q9NTK5	OTTHUMG00000132335	ENST00000409546.1:c.137G>T	2.37:g.175111467C>A	ENSP00000386350:p.Gly46Val		Somatic				OLA1_uc002uii.2_Intron|OLA1_uc010fqq.2_Missense_Mutation_p.G26V|OLA1_uc002uij.2_Intron|OLA1_uc002uik.2_5'UTR|OLA1_uc010fqr.2_Missense_Mutation_p.G26V	p.G26V	NM_013341	NP_037473	WXS	Illumina HiSeq	Unspecified	Q9NTK5	OLA1_HUMAN			2	263	-			26						Missense_Mutation	SNP	ENST00000409546.1	37	c.77G>T		.	.	.	.	.	.	.	.	.	.	C	20.8	4.050290	0.75846	.	.	ENSG00000138430	ENST00000284719;ENST00000428402;ENST00000409546;ENST00000427472	T;T;T;T	0.21932	1.98;2.28;1.98;2.28	5.67	4.78	0.61160	GTP1/OBG (1);	0.047348	0.85682	D	0.000000	T	0.66616	0.2807	H	0.99516	4.605	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.82579	-0.0387	10	0.87932	D	0	.	14.8689	0.70441	0.1451:0.8549:0.0:0.0	.	26;26;26	Q9NTK5-3;D7EHM2;Q9NTK5	.;.;OLA1_HUMAN	V	26;26;46;26	ENSP00000284719:G26V;ENSP00000410385:G26V;ENSP00000386350:G46V;ENSP00000414568:G26V	ENSP00000284719:G26V	G	-	2	0	OLA1	174819713	1.000000	0.71417	0.997000	0.53966	0.961000	0.63080	6.551000	0.73909	1.355000	0.45865	-0.181000	0.13052	GGT		0.398	OLA1-003	PUTATIVE	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000333877.1	NM_013341		31	100	1	0	1.45844e-13	0.013726	1.95492e-13	31	100				
GPR155	151556	broad.mit.edu	37	2	175300882	175300882	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr2:175300882C>T	ENST00000392552.2	-	16	2813	c.2575G>A	c.(2575-2577)Gag>Aag	p.E859K	GPR155_ENST00000392551.2_Missense_Mutation_p.E859K|GPR155_ENST00000295500.4_Missense_Mutation_p.E859K|GPR155_ENST00000459996.1_5'Flank	NM_001267051.1|NM_152529.6	NP_001253980.1|NP_689742.4	Q7Z3F1	GP155_HUMAN	G protein-coupled receptor 155	859					cognition (GO:0050890)|intracellular signal transduction (GO:0035556)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.E859K(1)		breast(2)|endometrium(5)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(2)	26						GATGAATGCTCAATTTCTTTA	0.403																																							uc002uit.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(2575-2577)GAG>AAG		G protein-coupled receptor 155 isoform 9							119.0	129.0	125.0					2																	175300882		2203	4299	6502	SO:0001583	missense	151556				intracellular signal transduction|transmembrane transport	integral to membrane		g.chr2:175300882C>T	AY255528	CCDS2259.1, CCDS74605.1	2q31.1	2012-04-10			ENSG00000163328	ENSG00000163328			22951	protein-coding gene	gene with protein product						12679517	Standard	NM_001033045		Approved	DEPDC3, DEP.7, FLJ31819, PGR22	uc002uiu.4	Q7Z3F1	OTTHUMG00000132336	ENST00000392552.2:c.2575G>A	2.37:g.175300882C>T	ENSP00000376335:p.Glu859Lys		Somatic				GPR155_uc002uiu.2_Missense_Mutation_p.E859K|GPR155_uc002uiv.2_Missense_Mutation_p.E859K|GPR155_uc010fqs.2_Missense_Mutation_p.E831K	p.E859K	NM_001033045	NP_001028217	WXS	Illumina HiSeq	Unspecified	Q7Z3F1	GP155_HUMAN			17	2966	-			859					B2RCI2|D3DPE2|Q4G0Y6|Q53SJ3|Q53TA8|Q69YG8|Q86SP9|Q8N261|Q8N639|Q8N8K3|Q96MV6	Missense_Mutation	SNP	ENST00000392552.2	37	c.2575G>A	CCDS2259.1	.	.	.	.	.	.	.	.	.	.	C	28.0	4.880208	0.91740	.	.	ENSG00000163328	ENST00000392552;ENST00000392551;ENST00000295500	T;T;T	0.46451	0.87;0.87;0.87	5.87	5.87	0.94306	Winged helix-turn-helix transcription repressor DNA-binding (1);	0.098661	0.45606	D	0.000360	T	0.33469	0.0864	N	0.19112	0.55	0.30225	N	0.796479	B	0.29531	0.247	B	0.33392	0.163	T	0.34700	-0.9818	10	0.49607	T	0.09	-5.8602	16.0731	0.80948	0.0:1.0:0.0:0.0	.	859	Q7Z3F1	GP155_HUMAN	K	859	ENSP00000376335:E859K;ENSP00000376334:E859K;ENSP00000295500:E859K	ENSP00000295500:E859K	E	-	1	0	GPR155	175009128	0.760000	0.28428	1.000000	0.80357	0.791000	0.44710	2.381000	0.44336	2.941000	0.99782	0.655000	0.94253	GAG		0.403	GPR155-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255455.1	NM_152529		4	164	0	0	0	0.009096	0	4	164				
TTN	7273	broad.mit.edu	37	2	179415733	179415733	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr2:179415733A>T	ENST00000591111.1	-	286	86826	c.86602T>A	c.(86602-86604)Tca>Aca	p.S28868T	TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.S30509T|TTN_ENST00000342992.6_Missense_Mutation_p.S27941T|RP11-65L3.2_ENST00000603415.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.S21569T|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.S21636T|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.S21444T|TTN-AS1_ENST00000590932.1_RNA			Q8WZ42	TITIN_HUMAN	titin	28868	Fibronectin type-III 110. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.S21636T(1)|p.S21569T(1)|p.S27939T(1)|p.S21444T(1)|p.S27941T(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GAAGACTGTGAGGGCGGGCTT	0.388																																							uc010zfg.1		NA																	5	Substitution - Missense(5)		lung(5)	ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(83821-83823)TCA>ACA		titin isoform N2-A							66.0	62.0	63.0					2																	179415733		1846	4102	5948	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179415733A>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.86602T>A	2.37:g.179415733A>T	ENSP00000465570:p.Ser28868Thr		Somatic				uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.S21636T|TTN_uc010zfi.1_Missense_Mutation_p.S21569T|TTN_uc010zfj.1_Missense_Mutation_p.S21444T	p.S27941T	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		285	84045	-			28868					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.83821T>A		.	.	.	.	.	.	.	.	.	.	A	19.21	3.783815	0.70222	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.69926	-0.44;-0.44;-0.44;-0.44	5.9	5.9	0.94986	Fibronectin, type III (3);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.85588	0.5731	M	0.91561	3.22	0.80722	D	1	D;D;D;D	0.76494	0.999;0.997;0.997;0.999	D;D;D;D	0.81914	0.995;0.98;0.98;0.995	D	0.88807	0.3289	9	0.87932	D	0	.	16.3291	0.83001	1.0:0.0:0.0:0.0	.	21444;21569;21636;28868	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	T	27941;21444;21636;21569;21441	ENSP00000343764:S27941T;ENSP00000434586:S21444T;ENSP00000340554:S21636T;ENSP00000352154:S21569T	ENSP00000340554:S21636T	S	-	1	0	TTN	179123979	1.000000	0.71417	0.996000	0.52242	0.992000	0.81027	9.339000	0.96797	2.257000	0.74773	0.528000	0.53228	TCA		0.388	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		8	20	0	0	0	0.004482	0	8	20				
TTN	7273	broad.mit.edu	37	2	179422644	179422644	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr2:179422644A>T	ENST00000591111.1	-	278	82738	c.82514T>A	c.(82513-82515)gTt>gAt	p.V27505D	TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.V29146D|TTN_ENST00000342992.6_Missense_Mutation_p.V26578D|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.V20206D|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.V20273D|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.V20081D|TTN-AS1_ENST00000590932.1_RNA			Q8WZ42	TITIN_HUMAN	titin	27505	Fibronectin type-III 100. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.V20081D(1)|p.V26578D(1)|p.V20273D(1)|p.V26576D(1)|p.V20206D(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATCACTAATAACAACAGGGCC	0.433																																							uc010zfg.1		NA																	5	Substitution - Missense(5)		lung(5)	ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(79732-79734)GTT>GAT		titin isoform N2-A							187.0	189.0	189.0					2																	179422644		1923	4122	6045	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179422644A>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.82514T>A	2.37:g.179422644A>T	ENSP00000465570:p.Val27505Asp		Somatic				uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.V20273D|TTN_uc010zfi.1_Missense_Mutation_p.V20206D|TTN_uc010zfj.1_Missense_Mutation_p.V20081D	p.V26578D	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		277	79957	-			27505					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.79733T>A		.	.	.	.	.	.	.	.	.	.	A	11.44	1.640712	0.29157	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.57107	0.42;0.42;0.42;0.42	5.63	-0.134	0.13481	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.34221	0.0890	N	0.16066	0.365	0.40746	D	0.982879	B;B;B;B	0.21905	0.062;0.062;0.062;0.062	B;B;B;B	0.27608	0.044;0.044;0.081;0.081	T	0.12502	-1.0545	9	0.87932	D	0	.	9.3258	0.37993	0.6575:0.0:0.3425:0.0	.	20081;20206;20273;27505	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	D	26578;20081;20273;20206;20078	ENSP00000343764:V26578D;ENSP00000434586:V20081D;ENSP00000340554:V20273D;ENSP00000352154:V20206D	ENSP00000340554:V20273D	V	-	2	0	TTN	179130890	0.947000	0.32204	0.695000	0.30226	0.695000	0.40330	1.890000	0.39728	-0.167000	0.10871	-0.371000	0.07208	GTT		0.433	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		45	260	0	0	0	0.01441	0	45	260				
TTN	7273	broad.mit.edu	37	2	179474458	179474458	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr2:179474458C>A	ENST00000591111.1	-	222	46993	c.46769G>T	c.(46768-46770)aGt>aTt	p.S15590I	TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.S17231I|TTN_ENST00000342992.6_Missense_Mutation_p.S14663I|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.S8291I|TTN_ENST00000342175.6_Missense_Mutation_p.S8358I|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.S8166I|TTN-AS1_ENST00000589830.1_RNA			Q8WZ42	TITIN_HUMAN	titin	15590	Fibronectin type-III 13. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.S14663I(2)|p.S8358I(1)|p.S8166I(1)|p.S8291I(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGAAGGTTCACTAATACCCGC	0.448																																							uc010zfg.1		NA																	5	Substitution - Missense(5)		lung(5)	ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(43987-43989)AGT>ATT		titin isoform N2-A							197.0	190.0	192.0					2																	179474458		1860	4098	5958	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179474458C>A	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.46769G>T	2.37:g.179474458C>A	ENSP00000465570:p.Ser15590Ile		Somatic				uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.S8358I|TTN_uc010zfi.1_Missense_Mutation_p.S8291I|TTN_uc010zfj.1_Missense_Mutation_p.S8166I	p.S14663I	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		221	44212	-			15590					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.43988G>T		.	.	.	.	.	.	.	.	.	.	C	16.34	3.095878	0.56075	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.58797	0.31;0.31;0.31;0.31	5.85	5.85	0.93711	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.83760	0.5324	H	0.97265	3.97	0.48135	D	0.999592	P;P;P;P	0.42483	0.781;0.781;0.781;0.781	P;P;P;P	0.54965	0.765;0.765;0.765;0.765	D	0.87986	0.2746	9	0.87932	D	0	.	20.1649	0.98147	0.0:1.0:0.0:0.0	.	8166;8291;8358;15590	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	I	14663;8166;8358;8291;8166	ENSP00000343764:S14663I;ENSP00000434586:S8166I;ENSP00000340554:S8358I;ENSP00000352154:S8291I	ENSP00000340554:S8358I	S	-	2	0	TTN	179182703	1.000000	0.71417	0.917000	0.36280	0.992000	0.81027	7.818000	0.86416	2.753000	0.94483	0.655000	0.94253	AGT		0.448	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		52	138	1	0	2.43468e-25	0.01441	3.7281e-25	52	138				
TTN	7273	broad.mit.edu	37	2	179610734	179610734	+	Intron	SNP	G	G	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr2:179610734G>T	ENST00000591111.1	-	46	10585				TTN-AS1_ENST00000578746.1_RNA|TTN_ENST00000589042.1_Intron|TTN_ENST00000342992.6_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590773.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000360870.5_Silent_p.R5465R|TTN_ENST00000342175.6_Intron|TTN_ENST00000460472.2_Intron			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGGAATCCCCGACAGATAGCC	0.408																																							uc002unb.2		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(16393-16395)CGG>AGG		titin isoform novex-3							121.0	120.0	120.0					2																	179610734		2203	4300	6503	SO:0001627	intron_variant	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179610734G>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10361-4086C>A	2.37:g.179610734G>T			Somatic				TTN_uc010zfg.1_Intron|TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron	p.R5465R	NM_133379	NP_596870	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		46	16617	-			Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37	c.16393C>A																																																																																					0.408	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		36	92	1	0	1.04594e-18	0.00623	1.5173e-18	36	92				
MARS2	92935	broad.mit.edu	37	2	198571112	198571112	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr2:198571112G>A	ENST00000282276.6	+	1	1026	c.983G>A	c.(982-984)gGc>gAc	p.G328D	AC011997.1_ENST00000409845.1_Intron	NM_138395.3	NP_612404.1	Q96GW9	SYMM_HUMAN	methionyl-tRNA synthetase 2, mitochondrial	328					cell death (GO:0008219)|gene expression (GO:0010467)|methionyl-tRNA aminoacylation (GO:0006431)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|methionine-tRNA ligase activity (GO:0004825)	p.G328D(1)		breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	22					L-Methionine(DB00134)	TTAGGGGCCGGCATGAGCCCG	0.542																																							uc002uuq.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)|skin(1)	3						c.(982-984)GGC>GAC		methionine-tRNA synthetase 2 precursor	L-Methionine(DB00134)						128.0	126.0	127.0					2																	198571112		2203	4300	6503	SO:0001583	missense	92935				methionyl-tRNA aminoacylation	mitochondrial matrix	ATP binding|methionine-tRNA ligase activity	g.chr2:198571112G>A	BC009115	CCDS33358.1	2q33.1	2014-01-30	2007-02-26		ENSG00000247626	ENSG00000247626	6.1.1.10	"""Aminoacyl tRNA synthetases / Class I"""	25133	protein-coding gene	gene with protein product	"""methionine tRNA ligase 2, mitochondrial"""	609728				15274629	Standard	NM_138395		Approved	mtMetRS, SPAX3	uc002uuq.3	Q96GW9	OTTHUMG00000154487	ENST00000282276.6:c.983G>A	2.37:g.198571112G>A	ENSP00000282276:p.Gly328Asp		Somatic				uc002uup.2_Intron	p.G328D	NM_138395	NP_612404	WXS	Illumina HiSeq	Unspecified	Q96GW9	SYMM_HUMAN			1	1026	+			328					A0AVC3|Q76E79|Q8IW62|Q8N7N4	Missense_Mutation	SNP	ENST00000282276.6	37	c.983G>A	CCDS33358.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.352276	0.82132	.	.	ENSG00000247626	ENST00000282276;ENST00000499940	T	0.56611	0.45	5.45	5.45	0.79879	Aminoacyl-tRNA synthetase, class I (M) (1);Rossmann-like alpha/beta/alpha sandwich fold (1);	0.109437	0.64402	D	0.000007	T	0.55401	0.1918	L	0.56340	1.77	0.80722	D	1	P	0.40376	0.715	P	0.46685	0.524	T	0.47156	-0.9139	10	0.13108	T	0.6	-14.7498	16.7845	0.85571	0.0:0.0:1.0:0.0	.	328	Q96GW9	SYMM_HUMAN	D	328;255	ENSP00000282276:G328D	ENSP00000282276:G328D	G	+	2	0	MARS2	198279357	1.000000	0.71417	0.917000	0.36280	0.977000	0.68977	9.746000	0.98859	2.575000	0.86900	0.655000	0.94253	GGC		0.542	MARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335477.1	NM_138395		6	351	0	0	0	0.001984	0	6	351				
ADAM23	8745	broad.mit.edu	37	2	207437900	207437900	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr2:207437900G>T	ENST00000264377.3	+	18	2046	c.1718G>T	c.(1717-1719)tGt>tTt	p.C573F	ADAM23_ENST00000374415.3_Missense_Mutation_p.C573F|ADAM23_ENST00000374416.1_Missense_Mutation_p.C573F	NM_003812.2	NP_003803.1	O75077	ADA23_HUMAN	ADAM metallopeptidase domain 23	573	Disintegrin. {ECO:0000255|PROSITE- ProRule:PRU00068}.				cell adhesion (GO:0007155)|central nervous system development (GO:0007417)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.C573F(2)		NS(2)|breast(1)|endometrium(6)|kidney(3)|large_intestine(5)|liver(2)|lung(22)|ovary(2)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	51				LUSC - Lung squamous cell carcinoma(261;0.0961)|Lung(261;0.182)|Epithelial(149;0.205)		ACTGAATATTGTACTGGAGAC	0.413																																					Melanoma(194;1127 2130 19620 24042 27855)	Melanoma(194;1127 2130 19620 24042 27855)	uc002vbq.2		NA																	2	Substitution - Missense(2)		lung(2)	skin(2)|ovary(1)	3						c.(1717-1719)TGT>TTT		ADAM metallopeptidase domain 23 preproprotein							259.0	229.0	239.0					2																	207437900		2203	4300	6503	SO:0001583	missense	8745				cell adhesion|central nervous system development|proteolysis	extracellular region|integral to plasma membrane	integrin binding|metalloendopeptidase activity|zinc ion binding	g.chr2:207437900G>T	AB009672	CCDS2369.1	2q33	2008-06-12	2005-08-18		ENSG00000114948	ENSG00000114948		"""ADAM metallopeptidase domain containing"""	202	protein-coding gene	gene with protein product		603710	"""a disintegrin and metalloproteinase domain 23"""			9693107	Standard	NM_003812		Approved	MDC3	uc002vbq.4	O75077	OTTHUMG00000132919	ENST00000264377.3:c.1718G>T	2.37:g.207437900G>T	ENSP00000264377:p.Cys573Phe		Somatic				ADAM23_uc010ziv.1_RNA	p.C573F	NM_003812	NP_003803	WXS	Illumina HiSeq	Unspecified	O75077	ADA23_HUMAN		LUSC - Lung squamous cell carcinoma(261;0.0961)|Lung(261;0.182)|Epithelial(149;0.205)	18	1941	+			573			Disintegrin.|Extracellular (Potential).		A2RU59	Missense_Mutation	SNP	ENST00000264377.3	37	c.1718G>T	CCDS2369.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.185068	0.78677	.	.	ENSG00000114948	ENST00000264377;ENST00000374416;ENST00000431817;ENST00000374415	T;T;T	0.64618	-0.11;-0.11;-0.11	5.81	5.81	0.92471	Blood coagulation inhibitor, Disintegrin (5);	0.171941	0.41823	D	0.000811	D	0.89508	0.6735	H	0.99668	4.69	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93864	0.7156	10	0.87932	D	0	.	18.9069	0.92466	0.0:0.0:1.0:0.0	.	573	O75077	ADA23_HUMAN	F	573;573;467;573	ENSP00000264377:C573F;ENSP00000363537:C573F;ENSP00000363536:C573F	ENSP00000264377:C573F	C	+	2	0	ADAM23	207146145	1.000000	0.71417	0.957000	0.39632	0.998000	0.95712	8.216000	0.89764	2.755000	0.94549	0.650000	0.86243	TGT		0.413	ADAM23-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256431.2	NM_003812		63	161	1	0	1.55545e-33	0.01441	2.53119e-33	63	161				
ZNF142	7701	broad.mit.edu	37	2	219503486	219503486	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr2:219503486C>A	ENST00000449707.1	-	10	5061	c.4640G>T	c.(4639-4641)cGg>cTg	p.R1547L	ZNF142_ENST00000411696.2_Missense_Mutation_p.R1547L	NM_001105537.1	NP_001099007.1	P52746	ZN142_HUMAN	zinc finger protein 142	1547					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R1384L(1)|p.R1547L(1)		breast(7)|endometrium(7)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38		Renal(207;0.0474)		Epithelial(149;5.21e-07)|all cancers(144;0.000106)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)		TGCATCAGCCCGGTTGGTGCA	0.572																																					Colon(170;867 1942 8995 15834 18053)	Colon(170;867 1942 8995 15834 18053)	uc002vin.2		NA																	2	Substitution - Missense(2)		lung(2)	breast(2)|ovary(1)|skin(1)	4						c.(4639-4641)CGG>CTG		zinc finger protein 142							32.0	35.0	34.0					2																	219503486		2114	4232	6346	SO:0001583	missense	7701				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr2:219503486C>A	U09849	CCDS42817.1	2q35	2013-01-08	2006-06-13		ENSG00000115568	ENSG00000115568		"""Zinc fingers, C2H2-type"""	12927	protein-coding gene	gene with protein product		604083	"""zinc finger protein 142 (clone pHZ-49)"""				Standard	NM_001105537		Approved	KIAA0236, pHZ-49	uc002vin.4	P52746	OTTHUMG00000154736	ENST00000449707.1:c.4640G>T	2.37:g.219503486C>A	ENSP00000408643:p.Arg1547Leu		Somatic				ZNF142_uc002vil.2_Missense_Mutation_p.R1508L|ZNF142_uc010fvt.2_Missense_Mutation_p.R1384L|ZNF142_uc002vim.2_Missense_Mutation_p.R1384L	p.R1547L	NM_001105537	NP_001099007	WXS	Illumina HiSeq	Unspecified	P52746	ZN142_HUMAN		Epithelial(149;5.21e-07)|all cancers(144;0.000106)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	10	5076	-		Renal(207;0.0474)	1547			C2H2-type 28.		Q92510	Missense_Mutation	SNP	ENST00000449707.1	37	c.4640G>T	CCDS42817.1	.	.	.	.	.	.	.	.	.	.	C	36	5.715244	0.96830	.	.	ENSG00000115568	ENST00000449707;ENST00000411696	T;T	0.15256	2.44;2.44	6.1	6.1	0.99115	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.37652	0.1011	L	0.41124	1.26	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.87578	0.998;0.998	T	0.01570	-1.1322	10	0.66056	D	0.02	-32.0215	20.7114	0.99707	0.0:1.0:0.0:0.0	.	1547;1384	P52746;A8MWU9	ZN142_HUMAN;.	L	1547	ENSP00000408643:R1547L;ENSP00000398798:R1547L	ENSP00000398798:R1547L	R	-	2	0	ZNF142	219211730	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	6.012000	0.70767	2.902000	0.99343	0.603000	0.83216	CGG		0.572	ZNF142-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336833.1	NM_005081		12	32	1	0	1.02788e-11	0.00499	1.33323e-11	12	32				
STK36	27148	broad.mit.edu	37	2	219562210	219562210	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr2:219562210C>T	ENST00000295709.3	+	24	3065	c.2786C>T	c.(2785-2787)gCc>gTc	p.A929V	STK36_ENST00000440309.1_Missense_Mutation_p.A929V|STK36_ENST00000392105.3_Missense_Mutation_p.A908V|STK36_ENST00000392106.2_Missense_Mutation_p.A908V	NM_015690.4	NP_056505.2			serine/threonine kinase 36									p.A929V(1)		biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(6)|lung(20)|ovary(4)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	52		Renal(207;0.0915)		Epithelial(149;9.65e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.00984)		CTGAGCCTGGCCATGGCCACC	0.587																																							uc002viu.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|stomach(2)|lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)	11						c.(2785-2787)GCC>GTC		serine/threonine kinase 36							55.0	50.0	52.0					2																	219562210		2203	4300	6503	SO:0001583	missense	27148				cilium assembly|positive regulation of hh target transcription factor activity|positive regulation of smoothened signaling pathway|post-embryonic development	aggresome|cytoplasm|focal adhesion|intermediate filament cytoskeleton|nucleus	ATP binding|protein serine/threonine kinase activity|transcription factor binding	g.chr2:219562210C>T	AB033104	CCDS2421.1, CCDS58750.1	2q35	2010-06-25	2010-06-25		ENSG00000163482	ENSG00000163482			17209	protein-coding gene	gene with protein product	"""fused homolog (Drosophila)"""	607652	"""serine/threonine kinase 36 (fused homolog, Drosophila)"""			10806483	Standard	NM_001243313		Approved	KIAA1278, FU	uc002viu.3	Q9NRP7	OTTHUMG00000133079	ENST00000295709.3:c.2786C>T	2.37:g.219562210C>T	ENSP00000295709:p.Ala929Val		Somatic				STK36_uc002viv.2_Missense_Mutation_p.A908V|STK36_uc002viw.2_Missense_Mutation_p.A107V|STK36_uc002vix.2_5'UTR	p.A929V	NM_015690	NP_056505	WXS	Illumina HiSeq	Unspecified	Q9NRP7	STK36_HUMAN		Epithelial(149;9.65e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.00984)	24	3052	+		Renal(207;0.0915)	929						Missense_Mutation	SNP	ENST00000295709.3	37	c.2786C>T	CCDS2421.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.0|24.0	4.485417|4.485417	0.84854|0.84854	.|.	.|.	ENSG00000163482|ENSG00000163482	ENST00000295709;ENST00000392106;ENST00000392105;ENST00000440309|ENST00000431040	T;T;T;T|.	0.73575|.	-0.74;-0.76;-0.76;-0.74|.	5.24|5.24	5.24|5.24	0.73138|0.73138	.|.	0.000000|.	0.42294|.	D|.	0.000740|.	T|T	0.52837|0.52837	0.1759|0.1759	L|L	0.29908|0.29908	0.895|0.895	0.38886|0.38886	D|D	0.957006|0.957006	D;D;D|.	0.69078|.	0.997;0.996;0.981|.	D;P;P|.	0.75020|.	0.985;0.896;0.764|.	T|T	0.50541|0.50541	-0.8816|-0.8816	10|5	0.16896|.	T|.	0.51|.	-13.6448|-13.6448	12.5518|12.5518	0.56231|0.56231	0.0:0.9212:0.0:0.0788|0.0:0.9212:0.0:0.0788	.|.	908;908;929|.	A8MU99;Q9NRP7-2;Q9NRP7|.	.;.;STK36_HUMAN|.	V|S	929;908;908;929|122	ENSP00000295709:A929V;ENSP00000375955:A908V;ENSP00000375954:A908V;ENSP00000394095:A929V|.	ENSP00000295709:A929V|.	A|P	+|+	2|1	0|0	STK36|STK36	219270454|219270454	0.961000|0.961000	0.32948|0.32948	0.980000|0.980000	0.43619|0.43619	0.993000|0.993000	0.82548|0.82548	2.111000|2.111000	0.41883|0.41883	2.721000|2.721000	0.93114|0.93114	0.655000|0.655000	0.94253|0.94253	GCC|CCA		0.587	STK36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256723.2			17	61	0	0	0	0.006122	0	17	61				
STK36	27148	broad.mit.edu	37	2	219563440	219563440	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr2:219563440C>T	ENST00000295709.3	+	26	3452	c.3173C>T	c.(3172-3174)tCc>tTc	p.S1058F	STK36_ENST00000440309.1_Missense_Mutation_p.S1058F|STK36_ENST00000392105.3_Missense_Mutation_p.S1037F|STK36_ENST00000392106.2_Missense_Mutation_p.S1037F	NM_015690.4	NP_056505.2			serine/threonine kinase 36									p.S1058F(1)		biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(6)|lung(20)|ovary(4)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	52		Renal(207;0.0915)		Epithelial(149;9.65e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.00984)		GTGTCTGCCTCCCCTAGAACC	0.572																																							uc002viu.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|stomach(2)|lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)	11						c.(3172-3174)TCC>TTC		serine/threonine kinase 36							269.0	218.0	235.0					2																	219563440		2203	4300	6503	SO:0001583	missense	27148				cilium assembly|positive regulation of hh target transcription factor activity|positive regulation of smoothened signaling pathway|post-embryonic development	aggresome|cytoplasm|focal adhesion|intermediate filament cytoskeleton|nucleus	ATP binding|protein serine/threonine kinase activity|transcription factor binding	g.chr2:219563440C>T	AB033104	CCDS2421.1, CCDS58750.1	2q35	2010-06-25	2010-06-25		ENSG00000163482	ENSG00000163482			17209	protein-coding gene	gene with protein product	"""fused homolog (Drosophila)"""	607652	"""serine/threonine kinase 36 (fused homolog, Drosophila)"""			10806483	Standard	NM_001243313		Approved	KIAA1278, FU	uc002viu.3	Q9NRP7	OTTHUMG00000133079	ENST00000295709.3:c.3173C>T	2.37:g.219563440C>T	ENSP00000295709:p.Ser1058Phe		Somatic				STK36_uc002viv.2_Missense_Mutation_p.S1037F|STK36_uc002viw.2_Missense_Mutation_p.S236F|STK36_uc002vix.2_Missense_Mutation_p.S103F	p.S1058F	NM_015690	NP_056505	WXS	Illumina HiSeq	Unspecified	Q9NRP7	STK36_HUMAN		Epithelial(149;9.65e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.00984)	26	3439	+		Renal(207;0.0915)	1058						Missense_Mutation	SNP	ENST00000295709.3	37	c.3173C>T	CCDS2421.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.31|11.31	1.600253|1.600253	0.28534|0.28534	.|.	.|.	ENSG00000163482|ENSG00000163482	ENST00000431040|ENST00000295709;ENST00000392106;ENST00000392105;ENST00000440309	.|T;T;T;T	.|0.71698	.|-0.59;-0.59;-0.59;-0.59	6.06|6.06	4.24|4.24	0.50183|0.50183	.|.	.|0.162599	.|0.29529	.|N	.|0.011896	T|T	0.68714|0.68714	0.3031|0.3031	L|L	0.29908|0.29908	0.895|0.895	0.43959|0.43959	D|D	0.996637|0.996637	.|D;B;B	.|0.56521	.|0.976;0.003;0.111	.|P;B;B	.|0.51016	.|0.656;0.004;0.052	T|T	0.71234|0.71234	-0.4653|-0.4653	5|10	.|0.59425	.|D	.|0.04	-9.3568|-9.3568	15.5084|15.5084	0.75760|0.75760	0.0:0.7392:0.2608:0.0|0.0:0.7392:0.2608:0.0	.|.	.|1037;1037;1058	.|A8MU99;Q9NRP7-2;Q9NRP7	.|.;.;STK36_HUMAN	S|F	251|1058;1037;1037;1058	.|ENSP00000295709:S1058F;ENSP00000375955:S1037F;ENSP00000375954:S1037F;ENSP00000394095:S1058F	.|ENSP00000295709:S1058F	P|S	+|+	1|2	0|0	STK36|STK36	219271684|219271684	0.413000|0.413000	0.25400|0.25400	0.895000|0.895000	0.35142|0.35142	0.259000|0.259000	0.26198|0.26198	1.537000|1.537000	0.36083|0.36083	0.864000|0.864000	0.35578|0.35578	0.655000|0.655000	0.94253|0.94253	CCC|TCC		0.572	STK36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256723.2			116	284	0	0	0	0.01441	0	116	284				
ASIC4	55515	broad.mit.edu	37	2	220379514	220379514	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr2:220379514C>A	ENST00000347842.3	+	1	463	c.449C>A	c.(448-450)gCa>gAa	p.A150E	ASIC4_ENST00000358078.4_Missense_Mutation_p.A150E|AC053503.11_ENST00000429882.1_RNA	NM_182847.2	NP_878267.2	Q96FT7	ASIC4_HUMAN	acid-sensing (proton-gated) ion channel family member 4	150					ion transmembrane transport (GO:0034220)|sodium ion transmembrane transport (GO:0035725)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)	ion channel activity (GO:0005216)|sodium channel activity (GO:0005272)|sodium ion transmembrane transporter activity (GO:0015081)	p.A150E(1)									GAGAAGGAGGCAGGGGATGAG	0.632																																							uc002vma.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(448-450)GCA>GAA		amiloride-sensitive cation channel 4 isoform 2							48.0	52.0	50.0					2																	220379514		2203	4300	6503	SO:0001583	missense	55515					integral to plasma membrane	sodium channel activity|sodium ion transmembrane transporter activity	g.chr2:220379514C>A	AJ271643	CCDS2442.1	2q36.1	2012-02-22	2012-02-22	2012-02-22	ENSG00000072182	ENSG00000072182		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	21263	protein-coding gene	gene with protein product		606715	"""amiloride-sensitive cation channel 4, pituitary"", ""amiloride-sensitive cation channel family member 4, pituitary"""	ACCN4		10852210	Standard	NM_182847		Approved	BNAC4	uc002vma.3	Q96FT7	OTTHUMG00000058928	ENST00000347842.3:c.449C>A	2.37:g.220379514C>A	ENSP00000326627:p.Ala150Glu		Somatic				ACCN4_uc010fwi.1_Missense_Mutation_p.A150E|ACCN4_uc010fwj.1_Missense_Mutation_p.A150E|ACCN4_uc002vly.1_Missense_Mutation_p.A150E|ACCN4_uc002vlz.2_Missense_Mutation_p.A150E|ACCN4_uc002vmb.2_5'Flank	p.A150E	NM_182847	NP_878267	WXS	Illumina HiSeq	Unspecified	Q96FT7	ACCN4_HUMAN		Epithelial(149;5.47e-10)|all cancers(144;9e-08)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.0086)|READ - Rectum adenocarcinoma(5;0.156)	1	463	+		Renal(207;0.0183)	150			Cytoplasmic (Potential).		Q53SB7|Q6GMS1|Q6PIN9|Q9NQA4	Missense_Mutation	SNP	ENST00000347842.3	37	c.449C>A	CCDS2442.1	.	.	.	.	.	.	.	.	.	.	C	11.72	1.723388	0.30503	.	.	ENSG00000072182	ENST00000347842;ENST00000358078	T;T	0.61392	0.12;0.11	4.13	3.16	0.36331	.	0.762691	0.12060	N	0.503282	T	0.27832	0.0685	N	0.02539	-0.55	0.34957	D	0.751779	B;B;B	0.17667	0.023;0.006;0.006	B;B;B	0.15484	0.003;0.01;0.013	T	0.24764	-1.0151	10	0.06891	T	0.86	-4.793	11.1975	0.48722	0.2539:0.7461:0.0:0.0	.	150;150;150	Q96FT7;Q96FT7-4;Q96FT7-2	ACCN4_HUMAN;.;.	E	150	ENSP00000326627:A150E;ENSP00000350786:A150E	ENSP00000326627:A150E	A	+	2	0	ACCN4	220087758	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	2.802000	0.47916	2.137000	0.66172	0.462000	0.41574	GCA		0.632	ASIC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000130263.1	NM_018674		50	154	1	0	9.55421e-19	0.01441	1.39056e-18	50	154				
CUL3	8452	broad.mit.edu	37	2	225376300	225376300	+	Splice_Site	SNP	C	C	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr2:225376300C>T	ENST00000264414.4	-	6	993		c.e6-1		CUL3_ENST00000409777.1_Splice_Site|CUL3_ENST00000344951.4_Splice_Site|CUL3_ENST00000409096.1_Splice_Site|CUL3_ENST00000432260.2_5'Flank	NM_003590.4	NP_003581.1	Q13618	CUL3_HUMAN	cullin 3						cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|COPII vesicle coating (GO:0048208)|cyclin catabolic process (GO:0008054)|embryonic cleavage (GO:0040016)|ER to Golgi vesicle-mediated transport (GO:0006888)|G1/S transition of mitotic cell cycle (GO:0000082)|gastrulation (GO:0007369)|integrin-mediated signaling pathway (GO:0007229)|intrinsic apoptotic signaling pathway (GO:0097193)|mitotic metaphase plate congression (GO:0007080)|negative regulation of Rho protein signal transduction (GO:0035024)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|stem cell division (GO:0017145)|stress fiber assembly (GO:0043149)|trophectodermal cellular morphogenesis (GO:0001831)|Wnt signaling pathway (GO:0016055)	Cul3-RING ubiquitin ligase complex (GO:0031463)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|nucleus (GO:0005634)|polar microtubule (GO:0005827)	POZ domain binding (GO:0031208)	p.?(1)		endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(2)|liver(1)|lung(19)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	46		all_lung(227;0.00877)|Lung NSC(271;0.011)|Renal(207;0.0112)|all_hematologic(139;0.138)		Epithelial(121;1.58e-11)|all cancers(144;1.43e-08)|Lung(261;0.00863)|LUSC - Lung squamous cell carcinoma(224;0.00902)		GGCTTTCCATCTGCCatttaa	0.289																																							uc002vny.2		NA																	1	Unknown(1)		lung(1)	upper_aerodigestive_tract(1)|ovary(1)|liver(1)|kidney(1)	4						c.e6-1		cullin 3							55.0	55.0	55.0					2																	225376300		2201	4299	6500	SO:0001630	splice_region_variant	8452				cell cycle arrest|cell migration|cyclin catabolic process|cytokinesis|G1/S transition of mitotic cell cycle|induction of apoptosis by intracellular signals|mitotic anaphase|negative regulation of Rho protein signal transduction|positive regulation of cell proliferation|protein ubiquitination|stress fiber assembly	Cul3-RING ubiquitin ligase complex|Golgi apparatus|nucleus|polar microtubule	ubiquitin protein ligase binding	g.chr2:225376300C>T	U58089	CCDS2462.1, CCDS58751.1	2q36.2	2011-05-24			ENSG00000036257	ENSG00000036257			2553	protein-coding gene	gene with protein product		603136				8681378, 17192413	Standard	NM_003590		Approved		uc002vny.3	Q13618	OTTHUMG00000133167	ENST00000264414.4:c.655-1G>A	2.37:g.225376300C>T			Somatic				CUL3_uc010zls.1_Splice_Site_p.M153_splice|CUL3_uc010fwy.1_Splice_Site_p.M225_splice	p.M219_splice	NM_003590	NP_003581	WXS	Illumina HiSeq	Unspecified	Q13618	CUL3_HUMAN		Epithelial(121;1.58e-11)|all cancers(144;1.43e-08)|Lung(261;0.00863)|LUSC - Lung squamous cell carcinoma(224;0.00902)	6	1039	-		all_lung(227;0.00877)|Lung NSC(271;0.011)|Renal(207;0.0112)|all_hematologic(139;0.138)						A8K536|B8ZZC3|O75415|Q569L3|Q9UBI8|Q9UET7	Splice_Site	SNP	ENST00000264414.4	37	c.655_splice	CCDS2462.1	.	.	.	.	.	.	.	.	.	.	C	17.81	3.481507	0.63849	.	.	ENSG00000036257	ENST00000264414;ENST00000344951;ENST00000409096;ENST00000409777	.	.	.	5.64	5.64	0.86602	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.0627	0.97684	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CUL3	225084544	1.000000	0.71417	1.000000	0.80357	0.785000	0.44390	7.445000	0.80570	2.807000	0.96579	0.591000	0.81541	.		0.289	CUL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256871.2		Intron	17	31	0	0	0	0.004007	0	17	31				
ARMC9	80210	broad.mit.edu	37	2	232141472	232141472	+	Silent	SNP	C	C	G			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr2:232141472C>G	ENST00000349938.4	+	15	1652	c.1458C>G	c.(1456-1458)ctC>ctG	p.L486L	ARMC9_ENST00000483477.1_3'UTR	NM_001271466.1|NM_025139.4	NP_001258395.1|NP_079415	Q7Z3E5	ARMC9_HUMAN	armadillo repeat containing 9	486						extracellular vesicular exosome (GO:0070062)		p.L486L(2)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(5)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22		Renal(207;0.0112)|all_lung(227;0.0744)|all_hematologic(139;0.0749)|Acute lymphoblastic leukemia(138;0.167)|Medulloblastoma(418;0.184)|Lung NSC(271;0.205)		Epithelial(121;1.43e-10)|LUSC - Lung squamous cell carcinoma(224;0.017)|Lung(119;0.0189)		TCATGAACCTCTGCCTCCGCA	0.537																																							uc002vrq.3		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(1456-1458)CTC>CTG		armadillo repeat containing 9							131.0	118.0	123.0					2																	232141472		2203	4300	6503	SO:0001819	synonymous_variant	80210						binding	g.chr2:232141472C>G	BC004514	CCDS2484.1, CCDS74666.1	2q37.1	2013-02-14			ENSG00000135931	ENSG00000135931		"""Armadillo repeat containing"""	20730	protein-coding gene	gene with protein product						11347906	Standard	NM_025139		Approved	FLJ12584, KIAA1868, ARM, KU-MEL-1	uc031rrs.1	Q7Z3E5	OTTHUMG00000133229	ENST00000349938.4:c.1458C>G	2.37:g.232141472C>G			Somatic				ARMC9_uc002vrp.3_Silent_p.L486L|ARMC9_uc002vrr.1_RNA	p.L486L	NM_025139	NP_079415	WXS	Illumina HiSeq	Unspecified	Q7Z3E5	ARMC9_HUMAN		Epithelial(121;1.43e-10)|LUSC - Lung squamous cell carcinoma(224;0.017)|Lung(119;0.0189)	15	1570	+		Renal(207;0.0112)|all_lung(227;0.0744)|all_hematologic(139;0.0749)|Acute lymphoblastic leukemia(138;0.167)|Medulloblastoma(418;0.184)|Lung NSC(271;0.205)	486					Q53TI3|Q6P162|Q7L594|Q86WG2|Q96JF9|Q9H9R8	Silent	SNP	ENST00000349938.4	37	c.1458C>G	CCDS2484.1	.	.	.	.	.	.	.	.	.	.	C	5.724	0.317974	0.10845	.	.	ENSG00000135931	ENST00000424740	.	.	.	5.27	1.15	0.20763	.	.	.	.	.	T	0.51958	0.1705	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.37663	-0.9696	4	.	.	.	-19.3902	5.8806	0.18854	0.0:0.2935:0.5221:0.1844	.	.	.	.	C	189	.	.	S	+	2	0	ARMC9	231849716	0.993000	0.37304	1.000000	0.80357	0.723000	0.41478	0.216000	0.17585	0.160000	0.19432	0.563000	0.77884	TCT		0.537	ARMC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256966.3	NM_025139		12	144	0	0	0	0.003163	0	12	144				
DIS3L2	129563	broad.mit.edu	37	2	233075098	233075098	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr2:233075098G>T	ENST00000409307.1	+	9	1187	c.1187G>T	c.(1186-1188)tGc>tTc	p.C396F	DIS3L2_ENST00000273009.6_Missense_Mutation_p.C396F|DIS3L2_ENST00000325385.7_Missense_Mutation_p.C396F					DIS3 like 3'-5' exoribonuclease 2									p.C396F(1)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(18)|ovary(1)|prostate(2)|urinary_tract(1)	40		all_hematologic(139;0.00809)|Renal(207;0.0113)|Acute lymphoblastic leukemia(138;0.0195)|all_lung(227;0.0465)|Lung NSC(271;0.136)		Epithelial(121;1.6e-13)|BRCA - Breast invasive adenocarcinoma(100;0.00104)|LUSC - Lung squamous cell carcinoma(224;0.0109)|Lung(119;0.0149)		GCCCTCTCCTGCAAGCCACTC	0.507																																							uc010fxz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)|central_nervous_system(1)	3						c.(1186-1188)TGC>TTC		DIS3 mitotic control homolog (S.							97.0	98.0	98.0					2																	233075098		2068	4230	6298	SO:0001583	missense	129563						exonuclease activity|ribonuclease activity|RNA binding	g.chr2:233075098G>T	BC026166	CCDS42834.1, CCDS58752.1, CCDS58753.1	2q37.1	2014-09-17	2014-03-05		ENSG00000144535	ENSG00000144535			28648	protein-coding gene	gene with protein product		614184	"""family with sequence similarity 6, member A"", ""DIS3 mitotic control homolog (S. cerevisiae)-like 2"""	FAM6A		22306653, 23503588	Standard	NM_152383		Approved	FLJ36974, MGC42174	uc010fxz.3	Q8IYB7	OTTHUMG00000153385	ENST00000409307.1:c.1187G>T	2.37:g.233075098G>T	ENSP00000386799:p.Cys396Phe		Somatic				DIS3L2_uc002vsm.3_RNA|DIS3L2_uc002vso.2_RNA	p.C396F	NM_152383	NP_689596	WXS	Illumina HiSeq	Unspecified	Q8IYB7	DI3L2_HUMAN		Epithelial(121;1.6e-13)|BRCA - Breast invasive adenocarcinoma(100;0.00104)|LUSC - Lung squamous cell carcinoma(224;0.0109)|Lung(119;0.0149)	10	1463	+		all_hematologic(139;0.00809)|Renal(207;0.0113)|Acute lymphoblastic leukemia(138;0.0195)|all_lung(227;0.0465)|Lung NSC(271;0.136)	396						Missense_Mutation	SNP	ENST00000409307.1	37	c.1187G>T	CCDS42834.1	.	.	.	.	.	.	.	.	.	.	G	19.10	3.762013	0.69763	.	.	ENSG00000144535	ENST00000273009;ENST00000542873;ENST00000325385;ENST00000431466;ENST00000409307;ENST00000424049	T;T;T;T	0.34275	1.37;1.37;1.37;1.37	5.16	5.16	0.70880	Ribonuclease II/R (2);	0.000000	0.85682	D	0.000000	T	0.48205	0.1487	L	0.50847	1.595	0.80722	D	1	P	0.47677	0.899	P	0.54431	0.752	T	0.44847	-0.9301	10	0.54805	T	0.06	-13.8741	15.5538	0.76173	0.0:0.0:1.0:0.0	.	396	Q8IYB7	DI3L2_HUMAN	F	396;396;396;396;396;31	ENSP00000273009:C396F;ENSP00000315569:C396F;ENSP00000386799:C396F;ENSP00000415419:C31F	ENSP00000273009:C396F	C	+	2	0	DIS3L2	232783342	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.789000	0.75110	2.381000	0.81170	0.455000	0.32223	TGC		0.507	DIS3L2-015	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330988.1	NM_152383		19	57	1	0	6.32553e-13	0.004656	8.35197e-13	19	57				
NOP56	10528	broad.mit.edu	37	20	2638609	2638609	+	Missense_Mutation	SNP	A	A	C			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr20:2638609A>C	ENST00000329276.5	+	12	1970	c.1454A>C	c.(1453-1455)cAa>cCa	p.Q485P	SNORA51_ENST00000606420.1_RNA|IDH3B_ENST00000488299.1_5'Flank|SNORD86_ENST00000391196.1_RNA|NOP56_ENST00000492135.1_3'UTR|SNORD57_ENST00000448188.1_RNA|SNORD56_ENST00000413522.1_RNA	NM_006392.3	NP_006383.2	O00567	NOP56_HUMAN	NOP56 ribonucleoprotein	485	Lys-rich.				cell death (GO:0008219)|rRNA processing (GO:0006364)	box C/D snoRNP complex (GO:0031428)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|pre-snoRNP complex (GO:0070761)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|snoRNA binding (GO:0030515)	p.Q485P(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	25						AAGAAAAAGCAAAAGCCCCAG	0.428																																							uc002wgh.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(1453-1455)CAA>CCA		nucleolar protein 5A							89.0	107.0	101.0					20																	2638609		2184	4284	6468	SO:0001583	missense	10528				rRNA processing	box C/D snoRNP complex|pre-snoRNP complex	protein binding|snoRNA binding	g.chr20:2638609A>C	Y12065	CCDS13030.1	20p13	2012-12-10	2012-12-10	2009-01-13	ENSG00000101361	ENSG00000101361			15911	protein-coding gene	gene with protein product	"""spinocerebellar ataxia 36"""	614154	"""nucleolar protein 5A (56kD with KKE/D repeat)"", ""nucleolar protein 5A (56kDa with KKE/D repeat)"", ""NOP56 ribonucleoprotein homolog (yeast)"""	NOL5A		9372940, 21683323	Standard	NR_027700		Approved	SCA36	uc002wgh.3	O00567	OTTHUMG00000031703	ENST00000329276.5:c.1454A>C	20.37:g.2638609A>C	ENSP00000370589:p.Gln485Pro		Somatic				NOP56_uc010zpy.1_RNA|NOP56_uc002wgi.2_Missense_Mutation_p.Q319P|NOP56_uc002wgm.1_3'UTR	p.Q485P	NM_006392	NP_006383	WXS	Illumina HiSeq	Unspecified	O00567	NOP56_HUMAN			12	1507	+			485			Lys-rich.		Q2M3T6|Q9NQ05	Missense_Mutation	SNP	ENST00000329276.5	37	c.1454A>C	CCDS13030.1	.	.	.	.	.	.	.	.	.	.	A	13.54	2.266564	0.40095	.	.	ENSG00000101361	ENST00000329276	T	0.46819	0.86	4.78	3.66	0.41972	.	0.379404	0.31370	N	0.007765	T	0.31513	0.0799	N	0.24115	0.695	0.25162	N	0.990344	B	0.27882	0.192	B	0.28553	0.091	T	0.23762	-1.0179	10	0.56958	D	0.05	-6.7462	7.5922	0.28027	0.803:0.0:0.0:0.197	.	485	O00567	NOP56_HUMAN	P	485	ENSP00000370589:Q485P	ENSP00000370589:Q485P	Q	+	2	0	NOP56	2586609	1.000000	0.71417	0.995000	0.50966	0.981000	0.71138	2.582000	0.46085	1.107000	0.41642	0.528000	0.53228	CAA		0.428	NOP56-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077631.2	NM_006392		177	278	0	0	0	0.01441	0	177	278				
CRNKL1	51340	broad.mit.edu	37	20	20031146	20031146	+	Nonsense_Mutation	SNP	C	C	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr20:20031146C>A	ENST00000377340.2	-	3	686	c.655G>T	c.(655-657)Gaa>Taa	p.E219*	C20orf26_ENST00000245957.5_5'Flank|CRNKL1_ENST00000377327.4_Nonsense_Mutation_p.E207*|C20orf26_ENST00000377309.2_5'Flank|CRNKL1_ENST00000536226.1_Nonsense_Mutation_p.E58*|C20orf26_ENST00000389656.3_5'Flank|C20orf26_ENST00000377306.1_5'Flank	NM_001278628.1|NM_016652.4	NP_001265557.1|NP_057736.4	Q9BZJ0	CRNL1_HUMAN	crooked neck pre-mRNA splicing factor 1	219					mRNA splicing, via spliceosome (GO:0000398)|spliceosomal complex assembly (GO:0000245)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.E219*(1)		breast(2)|cervix(2)|endometrium(7)|large_intestine(11)|lung(12)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(6)	45						TCATTTAATTCTTCTTCATCT	0.388																																							uc002wrs.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(2)|large_intestine(1)	3						c.(655-657)GAA>TAA		crooked neck-like 1 protein							144.0	135.0	138.0					20																	20031146		2203	4300	6503	SO:0001587	stop_gained	51340				spliceosome assembly	catalytic step 2 spliceosome|cytoplasm|nuclear speck	RNA binding	g.chr20:20031146C>A	AF255443	CCDS33446.1, CCDS63238.1, CCDS63239.1	20p11.2	2013-10-03	2013-10-03		ENSG00000101343	ENSG00000101343			15762	protein-coding gene	gene with protein product	"""SYF3 pre-mRNA-splicing factor"""	610952	"""crooked neck (Drosophila Crn homolog)-like 1"", ""Crn, crooked neck-like 1 (Drosophila)"", ""crooked neck pre-mRNA splicing factor-like 1 (Drosophila)"""				Standard	NM_016652		Approved	CRN, CLF, SYF3, Clf1	uc002wrs.3	Q9BZJ0	OTTHUMG00000032000	ENST00000377340.2:c.655G>T	20.37:g.20031146C>A	ENSP00000366557:p.Glu219*		Somatic				C20orf26_uc010gcw.1_5'Flank|C20orf26_uc010zse.1_5'Flank|C20orf26_uc002wru.2_5'Flank|CRNKL1_uc002wrt.1_Nonsense_Mutation_p.E207*	p.E219*	NM_016652	NP_057736	WXS	Illumina HiSeq	Unspecified	Q9BZJ0	CRNL1_HUMAN			3	687	-			219					A8K9T4|Q5JY64|Q8WYI5|Q9BZI9|Q9BZJ1|Q9BZJ2|Q9GZW7|Q9H8F8|Q9NQH5|Q9NYD8	Nonsense_Mutation	SNP	ENST00000377340.2	37	c.655G>T	CCDS33446.1	.	.	.	.	.	.	.	.	.	.	C	38	6.873489	0.97901	.	.	ENSG00000101343	ENST00000377327;ENST00000377340;ENST00000536226	.	.	.	5.42	5.42	0.78866	.	0.044468	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-24.7725	19.4096	0.94665	0.0:1.0:0.0:0.0	.	.	.	.	X	207;219;58	.	ENSP00000366544:E207X	E	-	1	0	CRNKL1	19979146	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.609000	0.82925	2.817000	0.96982	0.563000	0.77884	GAA		0.388	CRNKL1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000127787.1			28	72	1	0	9.39395e-14	0.00632	1.26303e-13	28	72				
KIAA1755	85449	broad.mit.edu	37	20	36868046	36868046	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr20:36868046G>A	ENST00000279024.4	-	4	1902	c.1631C>T	c.(1630-1632)gCt>gTt	p.A544V		NM_001029864.1	NP_001025035.1	Q5JYT7	K1755_HUMAN	KIAA1755	544								p.A544V(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(5)|pancreas(2)|skin(4)|stomach(1)	54		Myeloproliferative disorder(115;0.00874)				GCCTGCAGAAGCTTCTGGCAA	0.602																																							uc002xhy.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|pancreas(1)	5						c.(1630-1632)GCT>GTT		hypothetical protein LOC85449							49.0	53.0	52.0					20																	36868046		2203	4300	6503	SO:0001583	missense	85449							g.chr20:36868046G>A	AB051542	CCDS33467.1	20q11.23	2007-12-07			ENSG00000149633	ENSG00000149633			29372	protein-coding gene	gene with protein product						11214970	Standard	NM_001029864		Approved	RP5-1054A22.3	uc002xhy.1	Q5JYT7	OTTHUMG00000032436	ENST00000279024.4:c.1631C>T	20.37:g.36868046G>A	ENSP00000279024:p.Ala544Val		Somatic				KIAA1755_uc002xhz.1_Missense_Mutation_p.A544V	p.A544V	NM_001029864	NP_001025035	WXS	Illumina HiSeq	Unspecified	Q5JYT7	K1755_HUMAN			4	1903	-		Myeloproliferative disorder(115;0.00874)	544					Q9C0A8	Missense_Mutation	SNP	ENST00000279024.4	37	c.1631C>T	CCDS33467.1	.	.	.	.	.	.	.	.	.	.	G	13.23	2.173721	0.38413	.	.	ENSG00000149633	ENST00000279024;ENST00000373398	T	0.06608	3.28	3.62	2.63	0.31362	.	0.474054	0.17839	N	0.160277	T	0.08537	0.0212	L	0.51422	1.61	0.22226	N	0.999279	D	0.57571	0.98	P	0.46389	0.515	T	0.19128	-1.0315	10	0.44086	T	0.13	.	8.139	0.31071	0.0:0.0:0.7481:0.2519	.	544	Q5JYT7	K1755_HUMAN	V	544;91	ENSP00000279024:A544V	ENSP00000279024:A544V	A	-	2	0	KIAA1755	36301460	0.989000	0.36119	0.851000	0.33527	0.467000	0.32768	0.923000	0.28757	1.042000	0.40150	0.456000	0.33151	GCT		0.602	KIAA1755-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079144.3	NM_001029864		37	116	0	0	0	0.011902	0	37	116				
HNF4A	3172	broad.mit.edu	37	20	43048493	43048493	+	Missense_Mutation	SNP	A	A	C			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr20:43048493A>C	ENST00000316099.4	+	7	958	c.869A>C	c.(868-870)aAa>aCa	p.K290T	HNF4A_ENST00000609795.1_Missense_Mutation_p.K268T|HNF4A_ENST00000316673.4_Missense_Mutation_p.K268T|HNF4A_ENST00000443598.2_Missense_Mutation_p.K290T|HNF4A_ENST00000457232.1_Missense_Mutation_p.K268T|HNF4A_ENST00000415691.2_Missense_Mutation_p.K290T	NM_000457.4|NM_001258355.1|NM_178849.2	NP_000448.3|NP_001245284.1|NP_849180.1	P41235	HNF4A_HUMAN	hepatocyte nuclear factor 4, alpha	290					blood coagulation (GO:0007596)|endocrine pancreas development (GO:0031018)|gene expression (GO:0010467)|glucose homeostasis (GO:0042593)|lipid homeostasis (GO:0055088)|lipid metabolic process (GO:0006629)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|ornithine metabolic process (GO:0006591)|phospholipid homeostasis (GO:0055091)|positive regulation of cholesterol homeostasis (GO:2000189)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gastrulation (GO:0010470)|regulation of growth hormone receptor signaling pathway (GO:0060398)|regulation of insulin secretion (GO:0050796)|regulation of lipid metabolic process (GO:0019216)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to glucose (GO:0009749)|sex differentiation (GO:0007548)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein signal transduction (GO:0060395)|transcription initiation from RNA polymerase II promoter (GO:0006367)|triglyceride homeostasis (GO:0070328)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|fatty acid binding (GO:0005504)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.K290T(2)|p.K268T(1)		endometrium(4)|large_intestine(7)|lung(17)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(2)	34		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			GCCTACCTCAAAGCCATCATC	0.547																																					Colon(79;2 1269 8820 14841 52347)	Colon(79;2 1269 8820 14841 52347)	uc002xma.2		NA																	3	Substitution - Missense(3)		lung(3)	ovary(1)|lung(1)|skin(1)	3						c.(868-870)AAA>ACA		hepatocyte nuclear factor 4 alpha isoform b							187.0	139.0	155.0					20																	43048493		2203	4300	6503	SO:0001583	missense	3172				blood coagulation|endocrine pancreas development|glucose homeostasis|negative regulation of cell growth|negative regulation of cell proliferation|ornithine metabolic process|phospholipid homeostasis|positive regulation of cholesterol homeostasis|regulation of growth hormone receptor signaling pathway|regulation of insulin secretion|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to glucose stimulus|triglyceride homeostasis|xenobiotic metabolic process	cytoplasm	activating transcription factor binding|protein homodimerization activity|receptor binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|steroid hormone receptor activity|transcription regulatory region DNA binding|zinc ion binding	g.chr20:43048493A>C	X76930	CCDS13330.1, CCDS13331.1, CCDS42876.1, CCDS46604.1, CCDS46605.1, CCDS68131.1, CCDS74728.1	20q13.12	2014-09-17			ENSG00000101076	ENSG00000101076		"""Nuclear hormone receptors"""	5024	protein-coding gene	gene with protein product		600281		TCF14, MODY, MODY1		7926813, 9048927	Standard	NM_001030003		Approved	NR2A1, HNF4	uc010zwo.1	P41235	OTTHUMG00000032531	ENST00000316099.4:c.869A>C	20.37:g.43048493A>C	ENSP00000312987:p.Lys290Thr		Somatic				HNF4A_uc002xlt.2_Missense_Mutation_p.K268T|HNF4A_uc002xlu.2_Missense_Mutation_p.K268T|HNF4A_uc002xlv.2_Missense_Mutation_p.K268T|HNF4A_uc002xly.2_Missense_Mutation_p.K290T|HNF4A_uc002xlz.2_Missense_Mutation_p.K290T|HNF4A_uc010ggq.2_Missense_Mutation_p.K283T	p.K290T	NM_000457	NP_000448	WXS	Illumina HiSeq	Unspecified	P41235	HNF4A_HUMAN	COAD - Colon adenocarcinoma(18;0.00189)		7	958	+		Myeloproliferative disorder(115;0.0122)	290					A5JW41|B2RPP8|O00659|O00723|Q14540|Q5QPB8|Q6B4V5|Q6B4V6|Q6B4V7|Q92653|Q92654|Q92655|Q99864|Q9NQH0	Missense_Mutation	SNP	ENST00000316099.4	37	c.869A>C	CCDS13330.1	.	.	.	.	.	.	.	.	.	.	A	24.9	4.583078	0.86748	.	.	ENSG00000101076	ENST00000316673;ENST00000457232;ENST00000316099;ENST00000443598;ENST00000338692;ENST00000415691	D;D;D;D;D	0.97209	-4.29;-4.29;-4.29;-4.29;-4.29	4.98	4.98	0.66077	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.000000	0.85682	D	0.000000	D	0.98651	0.9548	M	0.91510	3.215	0.80722	D	1	D;D;D;D;D;D;D	0.76494	0.999;0.973;0.973;0.996;0.999;0.999;0.994	D;D;D;D;D;D;D	0.81914	0.995;0.953;0.93;0.979;0.995;0.987;0.968	D	0.99758	1.1020	10	0.87932	D	0	.	14.6707	0.68942	1.0:0.0:0.0:0.0	.	283;290;290;290;268;268;268	Q5QPB7;P41235;F1D8S2;P41235-3;F1D8T0;P41235-6;P41235-7	.;HNF4A_HUMAN;.;.;.;.;.	T	268;268;290;290;320;290	ENSP00000315180:K268T;ENSP00000396216:K268T;ENSP00000312987:K290T;ENSP00000410911:K290T;ENSP00000412111:K290T	ENSP00000312987:K290T	K	+	2	0	HNF4A	42481907	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	9.339000	0.96797	1.851000	0.53745	0.460000	0.39030	AAA		0.547	HNF4A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079363.3			45	147	0	0	0	0.01441	0	45	147				
BIRC7	79444	broad.mit.edu	37	20	61870735	61870735	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr20:61870735G>T	ENST00000217169.3	+	6	889	c.675G>T	c.(673-675)caG>caT	p.Q225H	NKAIN4_ENST00000466885.1_5'Flank|BIRC7_ENST00000395306.1_Intron|MIR3196_ENST00000579556.1_RNA|BIRC7_ENST00000342412.6_Intron	NM_139317.1	NP_647478.1	Q96CA5	BIRC7_HUMAN	baculoviral IAP repeat containing 7	225					activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of natural killer cell apoptotic process (GO:0070247)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	cysteine-type endopeptidase inhibitor activity (GO:0004869)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.Q225H(1)		endometrium(1)|kidney(1)|lung(9)|ovary(1)	12	all_cancers(38;2.72e-09)					CCGAGGCCCAGAGGGCGTGGT	0.692																																							uc002yej.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|lung(1)|kidney(1)	3						c.(673-675)CAG>CAT		livin inhibitor of apoptosis isoform alpha							45.0	51.0	49.0					20																	61870735		2203	4299	6502	SO:0001583	missense	79444				activation of JUN kinase activity|anti-apoptosis|DNA fragmentation involved in apoptotic nuclear change	cytoplasm|nucleus	enzyme binding|zinc ion binding	g.chr20:61870735G>T	AF301009	CCDS13512.1, CCDS13513.1	20q13.3	2011-01-25	2011-01-25		ENSG00000101197	ENSG00000101197		"""Baculoviral IAP repeat containing"", ""RING-type (C3HC4) zinc fingers"""	13702	protein-coding gene	gene with protein product	"""melanoma inhibitor of apoptosis protein"", ""kidney inhibitor of apoptosis protein"", ""livin inhibitor-of-apoptosis"", ""livin"""	605737	"""baculoviral IAP repeat-containing 7"""			11024045, 11162435	Standard	NM_139317		Approved	mliap, ML-IAP, KIAP, RNF50	uc002yej.3	Q96CA5	OTTHUMG00000032957	ENST00000217169.3:c.675G>T	20.37:g.61870735G>T	ENSP00000217169:p.Gln225His		Somatic				BIRC7_uc010gkc.1_3'UTR|BIRC7_uc002yei.2_Intron	p.Q225H	NM_139317	NP_647478	WXS	Illumina HiSeq	Unspecified	Q96CA5	BIRC7_HUMAN			6	848	+	all_cancers(38;2.72e-09)		225					Q9BQV0|Q9H2A8|Q9HAP7	Missense_Mutation	SNP	ENST00000217169.3	37	c.675G>T	CCDS13513.1	.	.	.	.	.	.	.	.	.	.	G	7.572	0.666892	0.14710	.	.	ENSG00000101197	ENST00000217169	T	0.51574	0.7	2.86	0.771	0.18504	.	8.555390	0.00687	U	0.000704	T	0.30603	0.0770	N	0.08118	0	0.09310	N	1	B	0.27853	0.191	B	0.32465	0.146	T	0.26744	-1.0094	10	0.46703	T	0.11	.	3.9891	0.09529	0.1457:0.2479:0.6064:0.0	.	225	Q96CA5	BIRC7_HUMAN	H	225	ENSP00000217169:Q225H	ENSP00000217169:Q225H	Q	+	3	2	BIRC7	61341180	0.001000	0.12720	0.001000	0.08648	0.015000	0.08874	0.818000	0.27295	0.237000	0.21200	0.467000	0.42956	CAG		0.692	BIRC7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080114.2	NM_139317		63	56	1	0	9.65139e-37	0.01441	1.60614e-36	63	56				
POTED	317754	broad.mit.edu	37	21	14983042	14983042	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr21:14983042G>T	ENST00000299443.5	+	1	545	c.493G>T	c.(493-495)Gac>Tac	p.D165Y		NM_174981.3|NM_207355.2	NP_778146.2|NP_997238.2	Q86YR6	POTED_HUMAN	POTE ankyrin domain family, member D	165						plasma membrane (GO:0005886)		p.D165Y(1)		central_nervous_system(1)|large_intestine(10)|liver(2)|lung(8)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(1)	33						CAGGGACACTGACATGAACAA	0.577																																							uc002yjb.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(3)	6						c.(493-495)GAC>TAC		pote protein							17.0	31.0	28.0					21																	14983042		749	3079	3828	SO:0001583	missense	317754					plasma membrane		g.chr21:14983042G>T	AY172978	CCDS13562.1	21q11.2	2013-01-10	2008-11-26	2008-11-26	ENSG00000166351	ENSG00000166351		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	23822	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 1"""	607549	"""ankyrin repeat domain 21"", ""ANKRD26-like family B, member 3"""	ANKRD21, A26B3		12475935, 15276201, 16364570	Standard	NM_174981		Approved	POTE, POTE-21, POTE21, CT104.1	uc002yjb.1	Q86YR6	OTTHUMG00000074197	ENST00000299443.5:c.493G>T	21.37:g.14983042G>T	ENSP00000299443:p.Asp165Tyr		Somatic					p.D165Y	NM_174981	NP_778146	WXS	Illumina HiSeq	Unspecified	Q86YR6	POTED_HUMAN			1	545	+			165					C9JCF7	Missense_Mutation	SNP	ENST00000299443.5	37	c.493G>T	CCDS13562.1	.	.	.	.	.	.	.	.	.	.	G	10.38	1.334061	0.24253	.	.	ENSG00000166351	ENST00000299443	T	0.59224	0.28	1.29	1.29	0.21616	Ankyrin repeat-containing domain (4);	.	.	.	.	T	0.71239	0.3316	M	0.81942	2.565	0.09310	N	1	D	0.60160	0.987	D	0.68943	0.961	T	0.56565	-0.7958	9	0.72032	D	0.01	.	6.0062	0.19547	0.0:0.0:1.0:0.0	.	165	Q86YR6	POTED_HUMAN	Y	165	ENSP00000299443:D165Y	ENSP00000299443:D165Y	D	+	1	0	POTED	13904913	0.011000	0.17503	0.001000	0.08648	0.022000	0.10575	1.697000	0.37784	1.017000	0.39495	0.184000	0.17185	GAC		0.577	POTED-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157660.1	NM_174981		18	106	1	0	2.48779e-11	0.005443	3.15264e-11	18	106				
ADAMTS5	11096	broad.mit.edu	37	21	28296491	28296491	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr21:28296491C>G	ENST00000284987.5	-	8	2795	c.2674G>C	c.(2674-2676)Gac>Cac	p.D892H	AP001601.2_ENST00000426771.1_RNA	NM_007038.3	NP_008969.2	Q9UNA0	ATS5_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 5	892	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.				defense response to bacterium (GO:0042742)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.D892H(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(34)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	72						CAACCTGTGTCACAGGTCCTA	0.542																																					Esophageal Squamous(53;683 1080 10100 14424 45938)	Esophageal Squamous(53;683 1080 10100 14424 45938)	uc002ymg.2		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(2)|ovary(1)|pancreas(1)	4						c.(2674-2676)GAC>CAC		ADAM metallopeptidase with thrombospondin type 1							88.0	77.0	80.0					21																	28296491		2203	4300	6503	SO:0001583	missense	11096				proteolysis	proteinaceous extracellular matrix	integrin binding|metalloendopeptidase activity|zinc ion binding	g.chr21:28296491C>G	AF142099	CCDS13579.1	21q21.3	2008-07-31	2008-07-31		ENSG00000154736	ENSG00000154736		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	221	protein-coding gene	gene with protein product	"""aggrecanase-2"""	605007	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2)"""			10438522	Standard	NM_007038		Approved	ADMP-2, ADAMTS11	uc002ymg.3	Q9UNA0	OTTHUMG00000078686	ENST00000284987.5:c.2674G>C	21.37:g.28296491C>G	ENSP00000284987:p.Asp892His		Somatic					p.D892H	NM_007038	NP_008969	WXS	Illumina HiSeq	Unspecified	Q9UNA0	ATS5_HUMAN			8	3403	-			892			TSP type-1 2.		Q52LV4|Q9UKP2	Missense_Mutation	SNP	ENST00000284987.5	37	c.2674G>C	CCDS13579.1	.	.	.	.	.	.	.	.	.	.	C	24.9	4.578895	0.86645	.	.	ENSG00000154736	ENST00000284987	T	0.61510	0.1	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.74733	0.3755	L	0.55990	1.75	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.74359	-0.3691	10	0.87932	D	0	.	20.6439	0.99570	0.0:1.0:0.0:0.0	.	892	Q9UNA0	ATS5_HUMAN	H	892	ENSP00000284987:D892H	ENSP00000284987:D892H	D	-	1	0	ADAMTS5	27218362	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.270000	0.78493	2.884000	0.98904	0.655000	0.94253	GAC		0.542	ADAMTS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171648.1			26	73	0	0	0	0.005443	0	26	73				
KRTAP13-3	337960	broad.mit.edu	37	21	31798219	31798219	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr21:31798219G>T	ENST00000390690.2	-	1	67	c.12C>A	c.(10-12)aaC>aaA	p.N4K		NM_181622.1	NP_853653.1	Q3SY46	KR133_HUMAN	keratin associated protein 13-3	4						intermediate filament (GO:0005882)		p.N4K(1)		endometrium(1)|large_intestine(1)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	14						TAGAGCAACAGTTGTAGGACA	0.512																																							uc002yob.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|lung(1)	2						c.(10-12)AAC>AAA		keratin associated protein 13-3							88.0	87.0	87.0					21																	31798219		2203	4300	6503	SO:0001583	missense	337960					intermediate filament		g.chr21:31798219G>T	AP001708	CCDS13591.1	21q22.1	2006-03-13			ENSG00000240432	ENSG00000240432		"""Keratin associated proteins"""	18925	protein-coding gene	gene with protein product						12359730	Standard	NM_181622		Approved	KAP13.3	uc002yob.1	Q3SY46	OTTHUMG00000057776	ENST00000390690.2:c.12C>A	21.37:g.31798219G>T	ENSP00000375109:p.Asn4Lys		Somatic					p.N4K	NM_181622	NP_853653	WXS	Illumina HiSeq	Unspecified	Q3SY46	KR133_HUMAN			1	12	-			4					Q3LI78	Missense_Mutation	SNP	ENST00000390690.2	37	c.12C>A	CCDS13591.1	.	.	.	.	.	.	.	.	.	.	-	9.229	1.035460	0.19590	.	.	ENSG00000240432	ENST00000390690;ENST00000448917	T	0.03635	3.86	4.81	2.98	0.34508	.	0.726749	0.11680	U	0.539930	T	0.07954	0.0199	L	0.55990	1.75	0.09310	N	1	D	0.53312	0.959	P	0.51550	0.673	T	0.28744	-1.0034	10	0.52906	T	0.07	-3.3565	7.1658	0.25689	0.0957:0.1734:0.7309:0.0	.	4	Q3SY46	KR133_HUMAN	K	4	ENSP00000375109:N4K	ENSP00000375109:N4K	N	-	3	2	KRTAP13-3	30720090	0.804000	0.28969	0.001000	0.08648	0.000000	0.00434	1.810000	0.38932	0.696000	0.31696	-0.859000	0.03014	AAC		0.512	KRTAP13-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128228.2			19	91	1	0	6.33239e-15	0.010504	8.64577e-15	19	91				
KRTAP11-1	337880	broad.mit.edu	37	21	32253670	32253670	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr21:32253670C>G	ENST00000332378.4	-	1	204	c.174G>C	c.(172-174)gaG>gaC	p.E58D		NM_175858.2	NP_787054.1	Q8IUC1	KR111_HUMAN	keratin associated protein 11-1	58						keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.E58D(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(12)|pancreas(1)	18						CACAGCAGGTCTCTTGACAGT	0.557																																							uc002yov.2		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)	1						c.(172-174)GAG>GAC		keratin associated protein 11-1							72.0	68.0	69.0					21																	32253670		2203	4300	6503	SO:0001583	missense	337880					keratin filament	structural molecule activity	g.chr21:32253670C>G	AJ457065	CCDS13608.1	21q22.1	2003-03-11			ENSG00000182591	ENSG00000182591		"""Keratin associated proteins"""	18922	protein-coding gene	gene with protein product		600064				12359730	Standard	NM_175858		Approved	KAP11.1	uc002yov.3	Q8IUC1	OTTHUMG00000057773	ENST00000332378.4:c.174G>C	21.37:g.32253670C>G	ENSP00000330720:p.Glu58Asp		Somatic					p.E58D	NM_175858	NP_787054	WXS	Illumina HiSeq	Unspecified	Q8IUC1	KR111_HUMAN			1	205	-			58					A1L4I8	Missense_Mutation	SNP	ENST00000332378.4	37	c.174G>C	CCDS13608.1	.	.	.	.	.	.	.	.	.	.	C	13.92	2.382134	0.42207	.	.	ENSG00000182591	ENST00000332378	T	0.06687	3.27	5.4	3.56	0.40772	.	0.390007	0.25422	N	0.030783	T	0.13329	0.0323	M	0.64170	1.965	0.22842	N	0.998665	P	0.47484	0.896	P	0.46510	0.519	T	0.06006	-1.0851	10	0.46703	T	0.11	-2.7784	10.8339	0.46675	0.0:0.834:0.0:0.166	.	58	Q8IUC1	KR111_HUMAN	D	58	ENSP00000330720:E58D	ENSP00000330720:E58D	E	-	3	2	KRTAP11-1	31175541	0.988000	0.35896	0.770000	0.31555	0.541000	0.35023	1.238000	0.32707	1.447000	0.47661	-0.142000	0.14014	GAG		0.557	KRTAP11-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128225.1			28	67	0	0	0	0.004656	0	28	67				
SON	6651	broad.mit.edu	37	21	34922564	34922564	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr21:34922564C>T	ENST00000356577.4	+	3	1502	c.1027C>T	c.(1027-1029)Cct>Tct	p.P343S	SON_ENST00000381679.4_Missense_Mutation_p.P343S|SON_ENST00000290239.6_Missense_Mutation_p.P343S|SON_ENST00000381692.2_Intron|SON_ENST00000300278.4_Missense_Mutation_p.P343S	NM_138927.1	NP_620305	P18583	SON_HUMAN	SON DNA binding protein	343					cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of cell cycle (GO:0051726)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleic acid binding (GO:0003676)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.P343S(2)		breast(3)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(25)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	72						GCCAGAGCAGCCTGTAGACGT	0.517											OREG0003564	type=REGULATORY REGION|Gene=AK074269|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																											uc002yse.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|skin(2)	6						c.(1027-1029)CCT>TCT		SON DNA-binding protein isoform F							113.0	119.0	117.0					21																	34922564		2203	4300	6503	SO:0001583	missense	6651				anti-apoptosis|cytokinesis|mRNA processing|regulation of cell cycle|regulation of RNA splicing|RNA splicing|spindle pole body separation	nuclear speck	DNA binding|double-stranded RNA binding	g.chr21:34922564C>T	AF380181	CCDS13629.1, CCDS13631.1, CCDS74784.1	21q22.1-q22.2	2013-01-28			ENSG00000159140	ENSG00000159140		"""G patch domain containing"""	11183	protein-coding gene	gene with protein product	"""NRE-binding protein"", ""negative regulatory element-binding protein"", ""Bax antagonist selected in Saccharomyces 1"""	182465		C21orf50		8318737, 21551269	Standard	NM_032195		Approved	DBP-5, NREBP, KIAA1019, BASS1, FLJ21099, FLJ33914	uc002yse.1	P18583	OTTHUMG00000065806	ENST00000356577.4:c.1027C>T	21.37:g.34922564C>T	ENSP00000348984:p.Pro343Ser		Somatic	OREG0003564	type=REGULATORY REGION|Gene=AK074269|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	851	SON_uc002ysb.1_Missense_Mutation_p.P343S|SON_uc002ysc.2_Missense_Mutation_p.P343S|SON_uc002ysd.2_5'UTR|SON_uc002ysf.1_Intron|SON_uc002ysg.2_5'Flank	p.P343S	NM_138927	NP_620305	WXS	Illumina HiSeq	Unspecified	P18583	SON_HUMAN			3	1076	+			343					D3DSF5|D3DSF6|E7ETE8|E7EU67|E7EVW3|E9PFQ2|O14487|O95981|Q14120|Q6PKE0|Q9H7B1|Q9P070|Q9P072|Q9UKP9|Q9UPY0	Missense_Mutation	SNP	ENST00000356577.4	37	c.1027C>T	CCDS13629.1	.	.	.	.	.	.	.	.	.	.	C	14.50	2.554190	0.45487	.	.	ENSG00000159140	ENST00000356577;ENST00000290239;ENST00000300278;ENST00000381679	T;T;T;T	0.10477	3.06;3.04;3.04;2.87	5.54	3.61	0.41365	.	0.118823	0.38897	N	0.001522	T	0.05823	0.0152	N	0.19112	0.55	0.26757	N	0.970075	P;P;P	0.39352	0.539;0.669;0.499	B;B;B	0.34093	0.085;0.175;0.102	T	0.27434	-1.0074	10	0.41790	T	0.15	.	7.0926	0.25291	0.0:0.7349:0.1736:0.0914	.	343;343;343	P18583;P18583-3;P18583-6	SON_HUMAN;.;.	S	343	ENSP00000348984:P343S;ENSP00000290239:P343S;ENSP00000300278:P343S;ENSP00000371095:P343S	ENSP00000290239:P343S	P	+	1	0	SON	33844434	0.998000	0.40836	1.000000	0.80357	0.977000	0.68977	1.558000	0.36309	1.482000	0.48325	0.561000	0.74099	CCT		0.517	SON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140978.2	NM_138927		49	101	0	0	0	0.01441	0	49	101				
SON	6651	broad.mit.edu	37	21	34923302	34923302	+	Missense_Mutation	SNP	G	G	T	rs370368356		TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr21:34923302G>T	ENST00000356577.4	+	3	2240	c.1765G>T	c.(1765-1767)Gtg>Ttg	p.V589L	SON_ENST00000381679.4_Missense_Mutation_p.V589L|SON_ENST00000290239.6_Missense_Mutation_p.V589L|SON_ENST00000381692.2_Intron|SON_ENST00000300278.4_Missense_Mutation_p.V589L	NM_138927.1	NP_620305	P18583	SON_HUMAN	SON DNA binding protein	589					cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of cell cycle (GO:0051726)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleic acid binding (GO:0003676)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.V589L(2)		breast(3)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(25)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	72						GGGGCAGCCTGTGGCAACTGG	0.662																																							uc002yse.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|skin(2)	6						c.(1765-1767)GTG>TTG		SON DNA-binding protein isoform F							29.0	34.0	32.0					21																	34923302		2201	4295	6496	SO:0001583	missense	6651				anti-apoptosis|cytokinesis|mRNA processing|regulation of cell cycle|regulation of RNA splicing|RNA splicing|spindle pole body separation	nuclear speck	DNA binding|double-stranded RNA binding	g.chr21:34923302G>T	AF380181	CCDS13629.1, CCDS13631.1, CCDS74784.1	21q22.1-q22.2	2013-01-28			ENSG00000159140	ENSG00000159140		"""G patch domain containing"""	11183	protein-coding gene	gene with protein product	"""NRE-binding protein"", ""negative regulatory element-binding protein"", ""Bax antagonist selected in Saccharomyces 1"""	182465		C21orf50		8318737, 21551269	Standard	NM_032195		Approved	DBP-5, NREBP, KIAA1019, BASS1, FLJ21099, FLJ33914	uc002yse.1	P18583	OTTHUMG00000065806	ENST00000356577.4:c.1765G>T	21.37:g.34923302G>T	ENSP00000348984:p.Val589Leu		Somatic				SON_uc002ysb.1_Missense_Mutation_p.V589L|SON_uc002ysc.2_Missense_Mutation_p.V589L|SON_uc002ysd.2_5'UTR|SON_uc002ysf.1_Intron|SON_uc002ysg.2_5'Flank	p.V589L	NM_138927	NP_620305	WXS	Illumina HiSeq	Unspecified	P18583	SON_HUMAN			3	1814	+			589					D3DSF5|D3DSF6|E7ETE8|E7EU67|E7EVW3|E9PFQ2|O14487|O95981|Q14120|Q6PKE0|Q9H7B1|Q9P070|Q9P072|Q9UKP9|Q9UPY0	Missense_Mutation	SNP	ENST00000356577.4	37	c.1765G>T	CCDS13629.1	.	.	.	.	.	.	.	.	.	.	G	14.87	2.665650	0.47677	.	.	ENSG00000159140	ENST00000356577;ENST00000290239;ENST00000300278;ENST00000381679	T;T;T;T	0.14391	2.68;2.67;2.67;2.51	5.65	3.76	0.43208	.	0.384332	0.22614	N	0.057788	T	0.12518	0.0304	N	0.14661	0.345	0.22562	N	0.998987	D;D;D	0.56746	0.962;0.977;0.977	P;P;P	0.56434	0.633;0.798;0.798	T	0.14448	-1.0472	10	0.20046	T	0.44	.	7.2462	0.26124	0.0876:0.0:0.7454:0.167	.	589;589;589	P18583;P18583-3;P18583-6	SON_HUMAN;.;.	L	589	ENSP00000348984:V589L;ENSP00000290239:V589L;ENSP00000300278:V589L;ENSP00000371095:V589L	ENSP00000290239:V589L	V	+	1	0	SON	33845172	0.935000	0.31712	1.000000	0.80357	0.998000	0.95712	1.537000	0.36083	1.372000	0.46190	0.555000	0.69702	GTG		0.662	SON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140978.2	NM_138927		21	64	1	0	7.41877e-09	0.012319	8.98813e-09	21	64				
DOPEY2	9980	broad.mit.edu	37	21	37618548	37618548	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr21:37618548A>T	ENST00000399151.3	+	19	4355	c.4270A>T	c.(4270-4272)Att>Ttt	p.I1424F		NM_005128.2	NP_005119.2	Q9Y3R5	DOP2_HUMAN	dopey family member 2	1424					cognition (GO:0050890)|endoplasmic reticulum organization (GO:0007029)|Golgi to endosome transport (GO:0006895)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)		p.I1424F(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(6)|lung(25)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58						GGAGAGTCTCATTAACTTGGG	0.612																																							uc002yvg.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(4270-4272)ATT>TTT		pad-1-like							40.0	44.0	42.0					21																	37618548		2203	4300	6503	SO:0001583	missense	9980				endoplasmic reticulum organization|Golgi to endosome transport|multicellular organismal development|protein transport	Golgi membrane		g.chr21:37618548A>T	AJ237839	CCDS13643.1	21q22.2	2013-03-05	2006-02-02	2006-02-02	ENSG00000142197	ENSG00000142197			1291	protein-coding gene	gene with protein product		604803	"""chromosome 21 open reading frame 5"""	C21orf5		16301316, 16303751, 10931277	Standard	NM_005128		Approved	KIAA0933	uc002yvg.3	Q9Y3R5	OTTHUMG00000086619	ENST00000399151.3:c.4270A>T	21.37:g.37618548A>T	ENSP00000382104:p.Ile1424Phe		Somatic				DOPEY2_uc011aeb.1_Missense_Mutation_p.I1373F|DOPEY2_uc002yvh.2_Missense_Mutation_p.I275F	p.I1424F	NM_005128	NP_005119	WXS	Illumina HiSeq	Unspecified	Q9Y3R5	DOP2_HUMAN			19	4349	+			1424					D3DSG5|Q6PJQ7|Q9UEZ3	Missense_Mutation	SNP	ENST00000399151.3	37	c.4270A>T	CCDS13643.1	.	.	.	.	.	.	.	.	.	.	A	18.15	3.559418	0.65538	.	.	ENSG00000142197	ENST00000399151	T	0.46063	0.88	5.41	4.27	0.50696	.	0.111999	0.64402	D	0.000008	T	0.55737	0.1939	M	0.74881	2.28	0.54753	D	0.999989	D;D	0.63880	0.993;0.987	P;P	0.58620	0.842;0.698	T	0.55630	-0.8111	10	0.34782	T	0.22	.	10.669	0.45747	0.9254:0.0:0.0746:0.0	.	1424;1424	Q9Y3R5-2;Q9Y3R5	.;DOP2_HUMAN	F	1424	ENSP00000382104:I1424F	ENSP00000382104:I1424F	I	+	1	0	DOPEY2	36540418	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.744000	0.62118	2.064000	0.61679	0.533000	0.62120	ATT		0.612	DOPEY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194636.1	NM_005128		10	70	0	0	0	0.001855	0	10	70				
HLCS	3141	broad.mit.edu	37	21	38137445	38137445	+	Silent	SNP	A	A	G			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr21:38137445A>G	ENST00000399120.1	-	9	2778	c.1548T>C	c.(1546-1548)ccT>ccC	p.P516P	HLCS_ENST00000336648.4_Silent_p.P516P	NM_001242784.1	NP_001229713.1	P50747	BPL1_HUMAN	holocarboxylase synthetase (biotin-(proprionyl-CoA-carboxylase (ATP-hydrolysing)) ligase)	516	BPL/LPL catalytic. {ECO:0000255|PROSITE- ProRule:PRU01067}.				biotin metabolic process (GO:0006768)|cell proliferation (GO:0008283)|histone biotinylation (GO:0071110)|histone modification (GO:0016570)|protein biotinylation (GO:0009305)|response to biotin (GO:0070781)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nuclear lamina (GO:0005652)|nuclear matrix (GO:0016363)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin-[acetyl-CoA-carboxylase] ligase activity (GO:0004077)|biotin-[methylcrotonoyl-CoA-carboxylase] ligase activity (GO:0004078)|biotin-[methylmalonyl-CoA-carboxytransferase] ligase activity (GO:0004079)|biotin-[propionyl-CoA-carboxylase (ATP-hydrolyzing)] ligase activity (GO:0004080)|biotin-protein ligase activity (GO:0018271)|enzyme binding (GO:0019899)	p.P516P(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|liver(1)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	24		Myeloproliferative disorder(46;0.0422)			Biotin(DB00121)	CACATCCCACAGGGCTCAGCC	0.577																																							uc010gnb.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|breast(1)|kidney(1)|liver(1)	5						c.(1546-1548)CCT>CCC		holocarboxylase synthetase	Biotin(DB00121)						158.0	122.0	135.0					21																	38137445		2203	4300	6503	SO:0001819	synonymous_variant	3141				cell proliferation|histone biotinylation|response to biotin	chromatin|cytosol|mitochondrion|nuclear lamina|nuclear matrix	ATP binding|biotin binding|biotin-[acetyl-CoA-carboxylase] ligase activity|biotin-[methylcrotonoyl-CoA-carboxylase] ligase activity|biotin-[methylmalonyl-CoA-carboxytransferase] ligase activity|biotin-[propionyl-CoA-carboxylase (ATP-hydrolyzing)] ligase activity|enzyme binding	g.chr21:38137445A>G		CCDS13647.1	21q22.1	2012-07-13	2010-04-30		ENSG00000159267	ENSG00000159267	6.3.4.9, 6.3.4.10, 6.3.4.11, 6.3.4.15		4976	protein-coding gene	gene with protein product		609018	"""holocarboxylase synthetase (biotin-[proprionyl-Coenzyme A-carboxylase (ATP-hydrolysing)] ligase)"", ""holocarboxylase synthetase (biotin-(proprionyl-Coenzyme A-carboxylase (ATP-hydrolysing)) ligase)"""			7842009	Standard	NM_000411		Approved	HCS	uc021wjb.1	P50747	OTTHUMG00000086636	ENST00000399120.1:c.1548T>C	21.37:g.38137445A>G			Somatic				HLCS_uc002yvs.2_Silent_p.P516P	p.P516P	NM_000411	NP_000402	WXS	Illumina HiSeq	Unspecified	P50747	BPL1_HUMAN			8	2749	-		Myeloproliferative disorder(46;0.0422)	516					B2RAH1|D3DSG6|Q99451	Silent	SNP	ENST00000399120.1	37	c.1548T>C	CCDS13647.1																																																																																				0.577	HLCS-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194687.2			3	73	0	0	0	0.009096	0	3	73				
ETS2	2114	broad.mit.edu	37	21	40191577	40191577	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr21:40191577C>T	ENST00000360214.3	+	9	1422	c.962C>T	c.(961-963)tCt>tTt	p.S321F	ETS2_ENST00000360938.3_Missense_Mutation_p.S321F	NM_001256295.1	NP_001243224.1	P15036	ETS2_HUMAN	v-ets avian erythroblastosis virus E26 oncogene homolog 2	321					cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S321F(2)		NS(1)|breast(2)|endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	18		Prostate(19;6.33e-08)|all_epithelial(19;0.123)				TGCAGCCAGTCTCTCTGCCTC	0.532																																							uc002yxg.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|lung(1)|breast(1)|pancreas(1)	4						c.(961-963)TCT>TTT		v-ets erythroblastosis virus E26 oncogene							80.0	67.0	71.0					21																	40191577		2203	4300	6503	SO:0001583	missense	2114				positive regulation of transcription, DNA-dependent|skeletal system development	nucleus	protein binding|sequence-specific DNA binding transcription factor activity	g.chr21:40191577C>T		CCDS13659.1	21q22.3	2013-07-09	2013-07-09		ENSG00000157557	ENSG00000157557			3489	protein-coding gene	gene with protein product		164740	"""v-ets erythroblastosis virus E26 oncogene homolog 2 (avian)"""			17986575	Standard	NM_001256295		Approved		uc002yxf.3	P15036	OTTHUMG00000090769	ENST00000360214.3:c.962C>T	21.37:g.40191577C>T	ENSP00000353344:p.Ser321Phe		Somatic				ETS2_uc002yxf.2_Missense_Mutation_p.S461F	p.S321F	NM_005239	NP_005230	WXS	Illumina HiSeq	Unspecified	P15036	ETS2_HUMAN			8	1158	+		Prostate(19;6.33e-08)|all_epithelial(19;0.123)	321					A6NM68|D3DSH6|Q53Y89	Missense_Mutation	SNP	ENST00000360214.3	37	c.962C>T	CCDS13659.1	.	.	.	.	.	.	.	.	.	.	C	18.81	3.702546	0.68501	.	.	ENSG00000157557	ENST00000360214;ENST00000360938	T;T	0.12984	2.63;2.63	5.9	5.9	0.94986	.	0.595355	0.19708	N	0.107871	T	0.20901	0.0503	L	0.57536	1.79	0.43919	D	0.996566	B	0.29232	0.238	B	0.29785	0.107	T	0.01504	-1.1338	10	0.56958	D	0.05	.	20.2789	0.98501	0.0:1.0:0.0:0.0	.	321	P15036	ETS2_HUMAN	F	321	ENSP00000353344:S321F;ENSP00000354194:S321F	ENSP00000353344:S321F	S	+	2	0	ETS2	39113447	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	2.320000	0.43797	2.788000	0.95919	0.650000	0.86243	TCT		0.532	ETS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207544.1			8	29	0	0	0	0.008291	0	8	29				
COL6A2	1292	broad.mit.edu	37	21	47542430	47542430	+	Silent	SNP	C	C	G			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr21:47542430C>G	ENST00000300527.4	+	20	1697	c.1593C>G	c.(1591-1593)ggC>ggG	p.G531G	COL6A2_ENST00000310645.5_Silent_p.G531G|COL6A2_ENST00000357838.4_Silent_p.G531G|COL6A2_ENST00000397763.1_Silent_p.G531G|COL6A2_ENST00000409416.1_Silent_p.G531G	NM_001849.3	NP_001840.3	P12110	CO6A2_HUMAN	collagen, type VI, alpha 2	531	Triple-helical region.		G -> R (in UCMD). {ECO:0000269|PubMed:15689448}.		axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|protein heterotrimerization (GO:0070208)|response to glucose (GO:0009749)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)		p.G531G(3)		NS(1)|breast(1)|central_nervous_system(7)|endometrium(7)|kidney(5)|liver(1)|lung(15)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	43	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		GCGAGCCCGGCCCACGCGGCC	0.637																																							uc002zia.1		NA																	3	Substitution - coding silent(3)		lung(3)	central_nervous_system(7)|ovary(1)	8						c.(1591-1593)GGC>GGG		alpha 2 type VI collagen isoform 2C2 precursor							51.0	57.0	55.0					21																	47542430		2203	4299	6502	SO:0001819	synonymous_variant	1292				axon guidance|cell-cell adhesion|extracellular matrix organization|protein heterotrimerization	collagen|extracellular space|protein complex	extracellular matrix structural constituent|protein binding, bridging	g.chr21:47542430C>G	M20777	CCDS13728.1, CCDS13729.1, CCDS13730.1	21q22.3	2014-09-17			ENSG00000142173	ENSG00000142173		"""Collagens"""	2212	protein-coding gene	gene with protein product		120240					Standard	NM_001849		Approved		uc002zia.1	P12110	OTTHUMG00000090489	ENST00000300527.4:c.1593C>G	21.37:g.47542430C>G			Somatic				COL6A2_uc002zhy.1_Silent_p.G531G|COL6A2_uc002zhz.1_Silent_p.G531G|COL6A2_uc002zib.1_Intron	p.G531G	NM_001849	NP_001840	WXS	Illumina HiSeq	Unspecified	P12110	CO6A2_HUMAN		Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)	20	1675	+	Breast(49;0.245)		531		G -> R (in UCMD).	Triple-helical region.		Q13909|Q13910|Q13911|Q14048|Q14049|Q16259|Q16597|Q6P0Q1|Q9UML3|Q9Y4S8	Silent	SNP	ENST00000300527.4	37	c.1593C>G	CCDS13728.1																																																																																				0.637	COL6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206971.1			8	101	0	0	0	0.006214	0	8	101				
CCT8L2	150160	broad.mit.edu	37	22	17072057	17072057	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr22:17072057C>G	ENST00000359963.3	-	1	1643	c.1384G>C	c.(1384-1386)Gac>Cac	p.D462H		NM_014406.4	NP_055221.1	Q96SF2	TCPQM_HUMAN	chaperonin containing TCP1, subunit 8 (theta)-like 2	462					anion transport (GO:0006820)|cellular protein metabolic process (GO:0044267)|potassium ion transmembrane transport (GO:0071805)|transport (GO:0006810)	cytoplasm (GO:0005737)	anion channel activity (GO:0005253)|ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)	p.D462H(1)		breast(3)|endometrium(7)|kidney(1)|large_intestine(8)|liver(2)|lung(37)|ovary(3)|prostate(3)|skin(2)|stomach(1)	67	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)				GCCATCACGTCTGAGACAGCT	0.527																																							uc002zlp.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1384-1386)GAC>CAC		T-complex protein 1							125.0	128.0	127.0					22																	17072057		2203	4300	6503	SO:0001583	missense	150160				cellular protein metabolic process	cytoplasm	anion channel activity|ATP binding|calcium-activated potassium channel activity	g.chr22:17072057C>G	AP003553	CCDS13738.1	22q11.1	2011-09-01			ENSG00000198445	ENSG00000198445			15553	protein-coding gene	gene with protein product							Standard	NM_014406		Approved	CESK1	uc002zlp.1	Q96SF2	OTTHUMG00000141302	ENST00000359963.3:c.1384G>C	22.37:g.17072057C>G	ENSP00000353048:p.Asp462His		Somatic					p.D462H	NM_014406	NP_055221	WXS	Illumina HiSeq	Unspecified	Q96SF2	TCPQM_HUMAN			1	1644	-	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)	462					A4QPH3|Q9UJS3	Missense_Mutation	SNP	ENST00000359963.3	37	c.1384G>C	CCDS13738.1	.	.	.	.	.	.	.	.	.	.	c	0.243	-1.012225	0.02095	.	.	ENSG00000198445	ENST00000359963	T	0.80123	-1.34	1.98	0.837	0.18896	.	2.158260	0.02755	N	0.117840	T	0.75332	0.3835	N	0.20986	0.625	0.09310	N	1	P	0.34826	0.471	B	0.42851	0.4	T	0.64491	-0.6395	10	0.72032	D	0.01	-0.0012	6.1616	0.20368	0.0:0.6775:0.3225:0.0	.	462	Q96SF2	TCPQM_HUMAN	H	462	ENSP00000353048:D462H	ENSP00000353048:D462H	D	-	1	0	CCT8L2	15452057	0.000000	0.05858	0.007000	0.13788	0.011000	0.07611	-1.171000	0.03115	0.149000	0.19098	0.379000	0.24179	GAC		0.527	CCT8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280580.1			71	196	0	0	0	0.01441	0	71	196				
CCT8L2	150160	broad.mit.edu	37	22	17072155	17072155	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr22:17072155C>T	ENST00000359963.3	-	1	1545	c.1286G>A	c.(1285-1287)aGa>aAa	p.R429K		NM_014406.4	NP_055221.1	Q96SF2	TCPQM_HUMAN	chaperonin containing TCP1, subunit 8 (theta)-like 2	429					anion transport (GO:0006820)|cellular protein metabolic process (GO:0044267)|potassium ion transmembrane transport (GO:0071805)|transport (GO:0006810)	cytoplasm (GO:0005737)	anion channel activity (GO:0005253)|ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)	p.R429K(1)		breast(3)|endometrium(7)|kidney(1)|large_intestine(8)|liver(2)|lung(37)|ovary(3)|prostate(3)|skin(2)|stomach(1)	67	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)				CCCTTCCAATCTGCTTCCTTT	0.488																																							uc002zlp.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1285-1287)AGA>AAA		T-complex protein 1							61.0	66.0	64.0					22																	17072155		2203	4300	6503	SO:0001583	missense	150160				cellular protein metabolic process	cytoplasm	anion channel activity|ATP binding|calcium-activated potassium channel activity	g.chr22:17072155C>T	AP003553	CCDS13738.1	22q11.1	2011-09-01			ENSG00000198445	ENSG00000198445			15553	protein-coding gene	gene with protein product							Standard	NM_014406		Approved	CESK1	uc002zlp.1	Q96SF2	OTTHUMG00000141302	ENST00000359963.3:c.1286G>A	22.37:g.17072155C>T	ENSP00000353048:p.Arg429Lys		Somatic					p.R429K	NM_014406	NP_055221	WXS	Illumina HiSeq	Unspecified	Q96SF2	TCPQM_HUMAN			1	1546	-	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)	429					A4QPH3|Q9UJS3	Missense_Mutation	SNP	ENST00000359963.3	37	c.1286G>A	CCDS13738.1	.	.	.	.	.	.	.	.	.	.	c	0.005	-2.165016	0.00318	.	.	ENSG00000198445	ENST00000359963	T	0.78364	-1.17	1.98	-0.494	0.12034	.	1.829900	0.03717	N	0.251244	T	0.51618	0.1685	N	0.04746	-0.17	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.49495	-0.8934	10	0.02654	T	1	-1.0386	4.4111	0.11434	0.0:0.3979:0.0:0.6021	.	429	Q96SF2	TCPQM_HUMAN	K	429	ENSP00000353048:R429K	ENSP00000353048:R429K	R	-	2	0	CCT8L2	15452155	0.000000	0.05858	0.005000	0.12908	0.051000	0.14879	-0.438000	0.06905	-0.332000	0.08489	-0.552000	0.04208	AGA		0.488	CCT8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280580.1			40	79	0	0	0	0.011902	0	40	79				
CCT8L2	150160	broad.mit.edu	37	22	17072228	17072228	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr22:17072228C>G	ENST00000359963.3	-	1	1472	c.1213G>C	c.(1213-1215)Gat>Cat	p.D405H		NM_014406.4	NP_055221.1	Q96SF2	TCPQM_HUMAN	chaperonin containing TCP1, subunit 8 (theta)-like 2	405					anion transport (GO:0006820)|cellular protein metabolic process (GO:0044267)|potassium ion transmembrane transport (GO:0071805)|transport (GO:0006810)	cytoplasm (GO:0005737)	anion channel activity (GO:0005253)|ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)	p.D405H(1)		breast(3)|endometrium(7)|kidney(1)|large_intestine(8)|liver(2)|lung(37)|ovary(3)|prostate(3)|skin(2)|stomach(1)	67	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)				AGTCTGGGATCTTGACATAGC	0.557																																							uc002zlp.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1213-1215)GAT>CAT		T-complex protein 1							56.0	57.0	57.0					22																	17072228		2203	4300	6503	SO:0001583	missense	150160				cellular protein metabolic process	cytoplasm	anion channel activity|ATP binding|calcium-activated potassium channel activity	g.chr22:17072228C>G	AP003553	CCDS13738.1	22q11.1	2011-09-01			ENSG00000198445	ENSG00000198445			15553	protein-coding gene	gene with protein product							Standard	NM_014406		Approved	CESK1	uc002zlp.1	Q96SF2	OTTHUMG00000141302	ENST00000359963.3:c.1213G>C	22.37:g.17072228C>G	ENSP00000353048:p.Asp405His		Somatic					p.D405H	NM_014406	NP_055221	WXS	Illumina HiSeq	Unspecified	Q96SF2	TCPQM_HUMAN			1	1473	-	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)	405					A4QPH3|Q9UJS3	Missense_Mutation	SNP	ENST00000359963.3	37	c.1213G>C	CCDS13738.1	.	.	.	.	.	.	.	.	.	.	c	12.10	1.836883	0.32421	.	.	ENSG00000198445	ENST00000359963	T	0.16897	2.31	1.98	1.98	0.26296	.	0.000000	0.40469	U	0.001083	T	0.31765	0.0807	M	0.70275	2.135	0.41330	D	0.987237	D	0.59767	0.986	P	0.61275	0.886	T	0.08597	-1.0714	10	0.87932	D	0	-20.5735	7.4423	0.27190	0.0:1.0:0.0:0.0	.	405	Q96SF2	TCPQM_HUMAN	H	405	ENSP00000353048:D405H	ENSP00000353048:D405H	D	-	1	0	CCT8L2	15452228	0.871000	0.30034	0.993000	0.49108	0.391000	0.30476	2.959000	0.49153	1.115000	0.41800	0.379000	0.24179	GAT		0.557	CCT8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280580.1			34	60	0	0	0	0.003755	0	34	60				
CCT8L2	150160	broad.mit.edu	37	22	17072351	17072351	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr22:17072351C>G	ENST00000359963.3	-	1	1349	c.1090G>C	c.(1090-1092)Gaa>Caa	p.E364Q		NM_014406.4	NP_055221.1	Q96SF2	TCPQM_HUMAN	chaperonin containing TCP1, subunit 8 (theta)-like 2	364					anion transport (GO:0006820)|cellular protein metabolic process (GO:0044267)|potassium ion transmembrane transport (GO:0071805)|transport (GO:0006810)	cytoplasm (GO:0005737)	anion channel activity (GO:0005253)|ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)	p.E364Q(1)		breast(3)|endometrium(7)|kidney(1)|large_intestine(8)|liver(2)|lung(37)|ovary(3)|prostate(3)|skin(2)|stomach(1)	67	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)				CATTCCCATTCAAATACCACA	0.612																																							uc002zlp.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1090-1092)GAA>CAA		T-complex protein 1							84.0	80.0	81.0					22																	17072351		2203	4300	6503	SO:0001583	missense	150160				cellular protein metabolic process	cytoplasm	anion channel activity|ATP binding|calcium-activated potassium channel activity	g.chr22:17072351C>G	AP003553	CCDS13738.1	22q11.1	2011-09-01			ENSG00000198445	ENSG00000198445			15553	protein-coding gene	gene with protein product							Standard	NM_014406		Approved	CESK1	uc002zlp.1	Q96SF2	OTTHUMG00000141302	ENST00000359963.3:c.1090G>C	22.37:g.17072351C>G	ENSP00000353048:p.Glu364Gln		Somatic					p.E364Q	NM_014406	NP_055221	WXS	Illumina HiSeq	Unspecified	Q96SF2	TCPQM_HUMAN			1	1350	-	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)	364					A4QPH3|Q9UJS3	Missense_Mutation	SNP	ENST00000359963.3	37	c.1090G>C	CCDS13738.1	.	.	.	.	.	.	.	.	.	.	c	9.161	1.018646	0.19355	.	.	ENSG00000198445	ENST00000359963	T	0.78595	-1.19	1.98	1.98	0.26296	.	0.000000	0.39834	U	0.001251	T	0.70325	0.3211	L	0.47716	1.5	0.28345	N	0.921147	P	0.41978	0.767	P	0.45276	0.475	T	0.61422	-0.7066	10	0.28530	T	0.3	-23.5989	7.4423	0.27190	0.0:1.0:0.0:0.0	.	364	Q96SF2	TCPQM_HUMAN	Q	364	ENSP00000353048:E364Q	ENSP00000353048:E364Q	E	-	1	0	CCT8L2	15452351	0.800000	0.28916	0.235000	0.24058	0.103000	0.19146	0.599000	0.24089	1.115000	0.41800	0.379000	0.24179	GAA		0.612	CCT8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280580.1			38	116	0	0	0	0.006999	0	38	116				
CCT8L2	150160	broad.mit.edu	37	22	17072376	17072376	+	Silent	SNP	C	C	G			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr22:17072376C>G	ENST00000359963.3	-	1	1324	c.1065G>C	c.(1063-1065)ctG>ctC	p.L355L		NM_014406.4	NP_055221.1	Q96SF2	TCPQM_HUMAN	chaperonin containing TCP1, subunit 8 (theta)-like 2	355					anion transport (GO:0006820)|cellular protein metabolic process (GO:0044267)|potassium ion transmembrane transport (GO:0071805)|transport (GO:0006810)	cytoplasm (GO:0005737)	anion channel activity (GO:0005253)|ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)	p.L355L(1)		breast(3)|endometrium(7)|kidney(1)|large_intestine(8)|liver(2)|lung(37)|ovary(3)|prostate(3)|skin(2)|stomach(1)	67	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)				AACCATCTCCCAGCTCCTGCC	0.587																																							uc002zlp.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(1063-1065)CTG>CTC		T-complex protein 1							67.0	67.0	67.0					22																	17072376		2203	4296	6499	SO:0001819	synonymous_variant	150160				cellular protein metabolic process	cytoplasm	anion channel activity|ATP binding|calcium-activated potassium channel activity	g.chr22:17072376C>G	AP003553	CCDS13738.1	22q11.1	2011-09-01			ENSG00000198445	ENSG00000198445			15553	protein-coding gene	gene with protein product							Standard	NM_014406		Approved	CESK1	uc002zlp.1	Q96SF2	OTTHUMG00000141302	ENST00000359963.3:c.1065G>C	22.37:g.17072376C>G			Somatic					p.L355L	NM_014406	NP_055221	WXS	Illumina HiSeq	Unspecified	Q96SF2	TCPQM_HUMAN			1	1325	-	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)	355					A4QPH3|Q9UJS3	Silent	SNP	ENST00000359963.3	37	c.1065G>C	CCDS13738.1																																																																																				0.587	CCT8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280580.1			40	120	0	0	0	0.01441	0	40	120				
CCT8L2	150160	broad.mit.edu	37	22	17073279	17073279	+	Missense_Mutation	SNP	G	G	T	rs191641638		TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr22:17073279G>T	ENST00000359963.3	-	1	421	c.162C>A	c.(160-162)caC>caA	p.H54Q		NM_014406.4	NP_055221.1	Q96SF2	TCPQM_HUMAN	chaperonin containing TCP1, subunit 8 (theta)-like 2	54					anion transport (GO:0006820)|cellular protein metabolic process (GO:0044267)|potassium ion transmembrane transport (GO:0071805)|transport (GO:0006810)	cytoplasm (GO:0005737)	anion channel activity (GO:0005253)|ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)	p.H54Q(1)		breast(3)|endometrium(7)|kidney(1)|large_intestine(8)|liver(2)|lung(37)|ovary(3)|prostate(3)|skin(2)|stomach(1)	67	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)				TCTGCCGGCCGTGGGGGCCAT	0.637																																							uc002zlp.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(160-162)CAC>CAA		T-complex protein 1							65.0	67.0	66.0					22																	17073279		2203	4300	6503	SO:0001583	missense	150160				cellular protein metabolic process	cytoplasm	anion channel activity|ATP binding|calcium-activated potassium channel activity	g.chr22:17073279G>T	AP003553	CCDS13738.1	22q11.1	2011-09-01			ENSG00000198445	ENSG00000198445			15553	protein-coding gene	gene with protein product							Standard	NM_014406		Approved	CESK1	uc002zlp.1	Q96SF2	OTTHUMG00000141302	ENST00000359963.3:c.162C>A	22.37:g.17073279G>T	ENSP00000353048:p.His54Gln		Somatic					p.H54Q	NM_014406	NP_055221	WXS	Illumina HiSeq	Unspecified	Q96SF2	TCPQM_HUMAN			1	422	-	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)	54					A4QPH3|Q9UJS3	Missense_Mutation	SNP	ENST00000359963.3	37	c.162C>A	CCDS13738.1	.	.	.	.	.	.	.	.	.	.	g	6.821	0.520688	0.13005	.	.	ENSG00000198445	ENST00000359963	T	0.77620	-1.11	2.0	-1.86	0.07760	.	1.832210	0.03690	N	0.246977	T	0.54127	0.1839	N	0.04508	-0.205	0.23113	N	0.998277	B	0.11235	0.004	B	0.06405	0.002	T	0.44513	-0.9323	10	0.54805	T	0.06	-0.0012	2.643	0.04976	0.368:0.2625:0.3695:0.0	.	54	Q96SF2	TCPQM_HUMAN	Q	54	ENSP00000353048:H54Q	ENSP00000353048:H54Q	H	-	3	2	CCT8L2	15453279	0.000000	0.05858	0.950000	0.38849	0.693000	0.40251	-1.620000	0.02046	-0.208000	0.10171	-0.515000	0.04445	CAC		0.637	CCT8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280580.1			23	59	1	0	2.48779e-11	0.005443	3.15264e-11	23	59				
CCT8L2	150160	broad.mit.edu	37	22	17073380	17073380	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr22:17073380C>T	ENST00000359963.3	-	1	320	c.61G>A	c.(61-63)Gag>Aag	p.E21K		NM_014406.4	NP_055221.1	Q96SF2	TCPQM_HUMAN	chaperonin containing TCP1, subunit 8 (theta)-like 2	21					anion transport (GO:0006820)|cellular protein metabolic process (GO:0044267)|potassium ion transmembrane transport (GO:0071805)|transport (GO:0006810)	cytoplasm (GO:0005737)	anion channel activity (GO:0005253)|ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)	p.E21K(1)		breast(3)|endometrium(7)|kidney(1)|large_intestine(8)|liver(2)|lung(37)|ovary(3)|prostate(3)|skin(2)|stomach(1)	67	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)				CTCGGGCTCTCCCTTGGGTTC	0.657																																							uc002zlp.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(61-63)GAG>AAG		T-complex protein 1							40.0	46.0	44.0					22																	17073380		2203	4300	6503	SO:0001583	missense	150160				cellular protein metabolic process	cytoplasm	anion channel activity|ATP binding|calcium-activated potassium channel activity	g.chr22:17073380C>T	AP003553	CCDS13738.1	22q11.1	2011-09-01			ENSG00000198445	ENSG00000198445			15553	protein-coding gene	gene with protein product							Standard	NM_014406		Approved	CESK1	uc002zlp.1	Q96SF2	OTTHUMG00000141302	ENST00000359963.3:c.61G>A	22.37:g.17073380C>T	ENSP00000353048:p.Glu21Lys		Somatic					p.E21K	NM_014406	NP_055221	WXS	Illumina HiSeq	Unspecified	Q96SF2	TCPQM_HUMAN			1	321	-	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)	21					A4QPH3|Q9UJS3	Missense_Mutation	SNP	ENST00000359963.3	37	c.61G>A	CCDS13738.1	.	.	.	.	.	.	.	.	.	.	c	7.693	0.691548	0.15039	.	.	ENSG00000198445	ENST00000359963	T	0.55930	0.49	1.81	-1.22	0.09494	.	2.284280	0.02408	N	0.081412	T	0.33089	0.0851	N	0.08118	0	0.09310	N	1	B	0.20887	0.049	B	0.12837	0.008	T	0.34850	-0.9812	10	0.59425	D	0.04	-1.9223	7.3585	0.26733	0.0:0.5958:0.4042:0.0	.	21	Q96SF2	TCPQM_HUMAN	K	21	ENSP00000353048:E21K	ENSP00000353048:E21K	E	-	1	0	CCT8L2	15453380	0.000000	0.05858	0.000000	0.03702	0.027000	0.11550	-0.503000	0.06383	0.082000	0.17018	0.393000	0.25936	GAG		0.657	CCT8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280580.1			16	49	0	0	0	0.010504	0	16	49				
CCT8L2	150160	broad.mit.edu	37	22	17073395	17073395	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr22:17073395C>T	ENST00000359963.3	-	1	305	c.46G>A	c.(46-48)Gca>Aca	p.A16T		NM_014406.4	NP_055221.1	Q96SF2	TCPQM_HUMAN	chaperonin containing TCP1, subunit 8 (theta)-like 2	16					anion transport (GO:0006820)|cellular protein metabolic process (GO:0044267)|potassium ion transmembrane transport (GO:0071805)|transport (GO:0006810)	cytoplasm (GO:0005737)	anion channel activity (GO:0005253)|ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)	p.A16T(1)		breast(3)|endometrium(7)|kidney(1)|large_intestine(8)|liver(2)|lung(37)|ovary(3)|prostate(3)|skin(2)|stomach(1)	67	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)				GGGTTCAGTGCCAGCCGCTGG	0.647																																							uc002zlp.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(46-48)GCA>ACA		T-complex protein 1							35.0	41.0	39.0					22																	17073395		2203	4300	6503	SO:0001583	missense	150160				cellular protein metabolic process	cytoplasm	anion channel activity|ATP binding|calcium-activated potassium channel activity	g.chr22:17073395C>T	AP003553	CCDS13738.1	22q11.1	2011-09-01			ENSG00000198445	ENSG00000198445			15553	protein-coding gene	gene with protein product							Standard	NM_014406		Approved	CESK1	uc002zlp.1	Q96SF2	OTTHUMG00000141302	ENST00000359963.3:c.46G>A	22.37:g.17073395C>T	ENSP00000353048:p.Ala16Thr		Somatic					p.A16T	NM_014406	NP_055221	WXS	Illumina HiSeq	Unspecified	Q96SF2	TCPQM_HUMAN			1	306	-	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)	16					A4QPH3|Q9UJS3	Missense_Mutation	SNP	ENST00000359963.3	37	c.46G>A	CCDS13738.1	.	.	.	.	.	.	.	.	.	.	c	4.704	0.130852	0.08981	.	.	ENSG00000198445	ENST00000359963	T	0.57273	0.41	1.81	-0.899	0.10547	.	2.885550	0.01683	U	0.026240	T	0.29882	0.0747	N	0.08118	0	0.09310	N	1	B	0.20261	0.043	B	0.12156	0.007	T	0.08411	-1.0723	10	0.30078	T	0.28	4.2599	3.0924	0.06298	0.0:0.5221:0.2835:0.1944	.	16	Q96SF2	TCPQM_HUMAN	T	16	ENSP00000353048:A16T	ENSP00000353048:A16T	A	-	1	0	CCT8L2	15453395	0.003000	0.15002	0.001000	0.08648	0.003000	0.03518	-0.318000	0.08050	-0.306000	0.08818	-0.515000	0.04445	GCA		0.647	CCT8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280580.1			20	46	0	0	0	0.00333	0	20	46				
APOBEC3F	200316	broad.mit.edu	37	22	39445556	39445556	+	Silent	SNP	C	C	G	rs34578066		TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr22:39445556C>G	ENST00000308521.5	+	5	1050	c.693C>G	c.(691-693)gtC>gtG	p.V231V	APOBEC3G_ENST00000452957.2_Intron	NM_145298.5	NP_660341.2	Q8IUX4	ABC3F_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3F	231			V -> I (in dbSNP:rs2076101). {ECO:0000269|Ref.2}.		base conversion or substitution editing (GO:0016553)|cytidine deamination (GO:0009972)|defense response to virus (GO:0051607)|DNA cytosine deamination (GO:0070383)|DNA demethylation (GO:0080111)|innate immune response (GO:0045087)|negative regulation of single stranded viral RNA replication via double stranded DNA intermediate (GO:0045869)|negative regulation of transposition (GO:0010529)|negative regulation of viral genome replication (GO:0045071)|negative regulation of viral process (GO:0048525)|positive regulation of defense response to virus by host (GO:0002230)	apolipoprotein B mRNA editing enzyme complex (GO:0030895)|cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|ribonucleoprotein complex (GO:0030529)	cytidine deaminase activity (GO:0004126)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.V231V(1)		breast(3)|endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|skin(2)	16	Melanoma(58;0.04)					ACTCACCTGTCTCCTGGAAGA	0.463																																							uc003aww.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(691-693)GTC>GTG		apolipoprotein B mRNA editing enzyme, catalytic							133.0	119.0	124.0					22																	39445556		2203	4300	6503	SO:0001819	synonymous_variant	200316				base conversion or substitution editing|DNA cytosine deamination|innate immune response|interspecies interaction between organisms|negative regulation of retroviral genome replication|negative regulation of transposition|positive regulation of defense response to virus by host|response to virus|viral reproduction	apolipoprotein B mRNA editing enzyme complex|cytosol|mitochondrion	cytidine deaminase activity|dCTP deaminase activity|protein homodimerization activity|RNA binding|zinc ion binding	g.chr22:39445556C>G	BC038808	CCDS33648.1, CCDS33649.1	22q13.1-q13.2	2008-05-15			ENSG00000128394	ENSG00000128394		"""Apolipoprotein B mRNA editing enzymes"""	17356	protein-coding gene	gene with protein product		608993				11863358, 17121840	Standard	NM_145298		Approved	ARP8, BK150C2.4.MRNA, KA6	uc003aww.3	Q8IUX4	OTTHUMG00000151080	ENST00000308521.5:c.693C>G	22.37:g.39445556C>G			Somatic					p.V231V	NM_145298	NP_660341	WXS	Illumina HiSeq	Unspecified	Q9HC16	ABC3G_HUMAN			5	986	+	Melanoma(58;0.04)		233					B0QYD4|Q45F03|Q6ICH3|Q7Z2N2|Q7Z2N5	Silent	SNP	ENST00000308521.5	37	c.693C>G	CCDS33648.1																																																																																				0.463	APOBEC3F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321216.1	NM_145298		30	185	0	0	0	0.003271	0	30	185				
L3MBTL2	83746	broad.mit.edu	37	22	41615532	41615532	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr22:41615532A>T	ENST00000216237.5	+	6	868	c.710A>T	c.(709-711)cAg>cTg	p.Q237L	RP4-756G23.5_ENST00000451176.1_RNA|RP4-756G23.5_ENST00000441316.1_RNA	NM_031488.4	NP_113676.2	Q969R5	LMBL2_HUMAN	l(3)mbt-like 2 (Drosophila)	237					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.Q237L(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						TCTGTCATCCAGACAGCAGGT	0.552																																							uc003azo.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(709-711)CAG>CTG		l(3)mbt-like 2							108.0	75.0	86.0					22																	41615532		2203	4300	6503	SO:0001583	missense	83746				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	methylated histone residue binding|transcription corepressor activity|zinc ion binding	g.chr22:41615532A>T	AJ305226	CCDS14011.1	22q13.31-q13.33	2008-06-11			ENSG00000100395	ENSG00000100395			18594	protein-coding gene	gene with protein product		611865				11682070	Standard	NM_031488		Approved	H-l(3)mbt-l, DKFZP761I141, dJ756G23.3	uc003azo.3	Q969R5	OTTHUMG00000150942	ENST00000216237.5:c.710A>T	22.37:g.41615532A>T	ENSP00000216237:p.Gln237Leu		Somatic				L3MBTL2_uc010gyi.1_Missense_Mutation_p.Q146L|L3MBTL2_uc003azn.2_RNA|uc003azp.1_5'Flank	p.Q237L	NM_031488	NP_113676	WXS	Illumina HiSeq	Unspecified	Q969R5	LMBL2_HUMAN			6	764	+			237			MBT 1.		Q8TEN1|Q96SC4|Q9BQI2|Q9UGS4	Missense_Mutation	SNP	ENST00000216237.5	37	c.710A>T	CCDS14011.1	.	.	.	.	.	.	.	.	.	.	A	28.8	4.948356	0.92593	.	.	ENSG00000100395	ENST00000216237	T	0.44482	0.92	4.98	4.98	0.66077	.	0.226724	0.47455	D	0.000237	T	0.45256	0.1333	L	0.43152	1.355	0.80722	D	1	B;P	0.39071	0.372;0.658	B;P	0.45538	0.15;0.484	T	0.46610	-0.9179	10	0.59425	D	0.04	.	15.3722	0.74573	1.0:0.0:0.0:0.0	.	237;237	Q969R5-3;Q969R5	.;LMBL2_HUMAN	L	237	ENSP00000216237:Q237L	ENSP00000216237:Q237L	Q	+	2	0	L3MBTL2	39945478	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	6.169000	0.71913	2.179000	0.69175	0.533000	0.62120	CAG		0.552	L3MBTL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320613.1	NM_031488		18	32	0	0	0	0.014323	0	18	32				
PARVB	29780	broad.mit.edu	37	22	44527413	44527413	+	Silent	SNP	C	C	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr22:44527413C>T	ENST00000338758.7	+	5	486	c.423C>T	c.(421-423)tcC>tcT	p.S141S	PARVB_ENST00000404989.1_Silent_p.S104S|PARVB_ENST00000406477.3_Silent_p.S174S	NM_013327.4	NP_037459.2	Q9HBI1	PARVB_HUMAN	parvin, beta	141	CH 1. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin cytoskeleton reorganization (GO:0031532)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell projection assembly (GO:0030031)|establishment or maintenance of cell polarity regulating cell shape (GO:0071963)|lamellipodium assembly (GO:0030032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)		p.S174S(1)		NS(1)|breast(1)|endometrium(3)|large_intestine(7)|lung(8)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	25		Ovarian(80;0.0246)|all_neural(38;0.0423)				TGACACAGTCCGAAATAGGGC	0.577																																							uc003ben.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(421-423)TCC>TCT		parvin, beta isoform b							92.0	74.0	80.0					22																	44527413		2203	4300	6503	SO:0001819	synonymous_variant	29780				cell adhesion|cell junction assembly	cytoskeleton|cytosol|focal adhesion	actin binding	g.chr22:44527413C>T	AF151814	CCDS14056.1, CCDS46724.1, CCDS58808.1, CCDS74874.1	22q13.2-q13.33	2013-01-24			ENSG00000188677	ENSG00000188677		"""Parvins"""	14653	protein-coding gene	gene with protein product	"""affixin"""	608121				10810093, 11171322	Standard	NM_001003828		Approved	CGI-56	uc003ben.3	Q9HBI1	OTTHUMG00000150665	ENST00000338758.7:c.423C>T	22.37:g.44527413C>T			Somatic				PARVB_uc003bem.2_Silent_p.S174S|PARVB_uc010gzn.2_Silent_p.S89S|PARVB_uc003beo.2_Silent_p.S104S	p.S141S	NM_013327	NP_037459	WXS	Illumina HiSeq	Unspecified	Q9HBI1	PARVB_HUMAN			5	475	+		Ovarian(80;0.0246)|all_neural(38;0.0423)	141			CH 1.		B0QYM8|B0QYN1|B2R9X6|Q5TGJ5|Q86X93|Q96PN1|Q9NSP7|Q9UGT3|Q9Y368|Q9Y3L6|Q9Y3L7	Silent	SNP	ENST00000338758.7	37	c.423C>T	CCDS14056.1																																																																																				0.577	PARVB-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319518.2	NM_001003828		7	50	0	0	0	0.00308	0	7	50				
PFKFB4	5210	broad.mit.edu	37	3	48573763	48573763	+	Missense_Mutation	SNP	G	G	A	rs371118487		TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr3:48573763G>A	ENST00000232375.3	-	8	878	c.766C>T	c.(766-768)Cgg>Tgg	p.R256W	PFKFB4_ENST00000545984.1_3'UTR|PFKFB4_ENST00000490115.1_5'UTR|PFKFB4_ENST00000536104.1_Missense_Mutation_p.R245W|PFKFB4_ENST00000383734.2_Missense_Mutation_p.R256W|PFKFB4_ENST00000541519.1_Missense_Mutation_p.R222W|PFKFB4_ENST00000416568.1_Missense_Mutation_p.R256W	NM_004567.2	NP_004558.1	Q16877	F264_HUMAN	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4	256	Fructose-2,6-bisphosphatase.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 2,6-bisphosphate metabolic process (GO:0006003)|fructose metabolic process (GO:0006000)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	6-phosphofructo-2-kinase activity (GO:0003873)|ATP binding (GO:0005524)|fructose-2,6-bisphosphate 2-phosphatase activity (GO:0004331)	p.R256R(1)|p.R256W(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(5)|ovary(1)|urinary_tract(1)	14				BRCA - Breast invasive adenocarcinoma(193;0.0003)|KIRC - Kidney renal clear cell carcinoma(197;0.00596)|Kidney(197;0.00684)		TCCCCGTGCCGGCAGAGGTAG	0.637																																							uc003ctv.2		NA																	2	Substitution - Missense(1)|Substitution - coding silent(1)		urinary_tract(1)|lung(1)	breast(1)	1						c.(766-768)CGG>TGG		6-phosphofructo-2-kinase/fructose-2,		G	TRP/ARG	0,4406		0,0,2203	113.0	113.0	113.0		766	4.4	1.0	3		113	1,8599	1.2+/-3.3	0,1,4299	no	missense	PFKFB4	NM_004567.2	101	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	256/470	48573763	1,13005	2203	4300	6503	SO:0001583	missense	5210				fructose 2,6-bisphosphate metabolic process|glycolysis	cytosol	6-phosphofructo-2-kinase activity|ATP binding|fructose-2,6-bisphosphate 2-phosphatase activity	g.chr3:48573763G>A	BC010269	CCDS2771.1	3p22-p21	2004-03-02			ENSG00000114268	ENSG00000114268			8875	protein-coding gene	gene with protein product		605320				8830046, 10095107	Standard	NM_004567		Approved		uc003ctv.3	Q16877	OTTHUMG00000133528	ENST00000232375.3:c.766C>T	3.37:g.48573763G>A	ENSP00000232375:p.Arg256Trp		Somatic				PFKFB4_uc003ctw.2_Missense_Mutation_p.R65W|PFKFB4_uc010hkc.2_Missense_Mutation_p.R256W|PFKFB4_uc003ctx.2_Missense_Mutation_p.R213W|PFKFB4_uc010hkb.2_Missense_Mutation_p.R256W|PFKFB4_uc011bbm.1_Missense_Mutation_p.R245W|PFKFB4_uc011bbn.1_RNA	p.R256W	NM_004567	NP_004558	WXS	Illumina HiSeq	Unspecified	Q16877	F264_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.0003)|KIRC - Kidney renal clear cell carcinoma(197;0.00596)|Kidney(197;0.00684)	8	783	-			256			Fructose-2,6-bisphosphatase.		Q5S3G5|Q5XLC2|Q64EX5	Missense_Mutation	SNP	ENST00000232375.3	37	c.766C>T	CCDS2771.1	.	.	.	.	.	.	.	.	.	.	G	29.3	4.995192	0.93167	0.0	1.16E-4	ENSG00000114268	ENST00000232375;ENST00000536104;ENST00000416568;ENST00000383734;ENST00000541519;ENST00000452531	D;D;D;D;D;D	0.92199	-2.99;-2.99;-2.99;-2.99;-2.99;-2.99	4.43	4.43	0.53597	Histidine phosphatase superfamily, clade-1 (2);	0.000000	0.85682	D	0.000000	D	0.98153	0.9390	H	0.99919	4.95	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;1.0;1.0	D	0.98776	1.0730	10	0.87932	D	0	-21.3029	14.9457	0.71029	0.0:0.0:1.0:0.0	.	245;256;256;256	B7Z5C3;Q5XLC2;Q66S35;Q16877	.;.;.;F264_HUMAN	W	256;245;256;256;222;245	ENSP00000232375:R256W;ENSP00000438908:R245W;ENSP00000388394:R256W;ENSP00000373240:R256W;ENSP00000437446:R222W;ENSP00000407657:R245W	ENSP00000232375:R256W	R	-	1	2	PFKFB4	48548767	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.593000	0.98250	2.467000	0.83353	0.561000	0.74099	CGG		0.637	PFKFB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257503.2	NM_004567		4	291	0	0	0	0.009096	0	4	291				
DAG1	1605	broad.mit.edu	37	3	49569641	49569641	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr3:49569641A>G	ENST00000539901.1	+	3	2255	c.1697A>G	c.(1696-1698)gAc>gGc	p.D566G	DAG1_ENST00000538711.1_Missense_Mutation_p.D566G|DAG1_ENST00000515359.2_Missense_Mutation_p.D566G|DAG1_ENST00000545947.1_Missense_Mutation_p.D566G|DAG1_ENST00000308775.2_Missense_Mutation_p.D566G|DAG1_ENST00000541308.1_Missense_Mutation_p.D566G	NM_001177644.2	NP_001171115	Q14118	DAG1_HUMAN	dystroglycan 1 (dystrophin-associated glycoprotein 1)	566					basement membrane organization (GO:0071711)|branching involved in salivary gland morphogenesis (GO:0060445)|calcium-dependent cell-matrix adhesion (GO:0016340)|commissural neuron axon guidance (GO:0071679)|cytoskeletal anchoring at plasma membrane (GO:0007016)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|extracellular matrix organization (GO:0030198)|membrane protein ectodomain proteolysis (GO:0006509)|microtubule anchoring (GO:0034453)|modulation by virus of host morphology or physiology (GO:0019048)|morphogenesis of an epithelial sheet (GO:0002011)|myelination in peripheral nervous system (GO:0022011)|negative regulation of cell migration (GO:0030336)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of protein kinase B signaling (GO:0051898)|nerve maturation (GO:0021682)|NLS-bearing protein import into nucleus (GO:0006607)|response to peptide hormone (GO:0043434)	basement membrane (GO:0005604)|basolateral plasma membrane (GO:0016323)|cell outer membrane (GO:0009279)|cell-cell adherens junction (GO:0005913)|contractile ring (GO:0070938)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystroglycan complex (GO:0016011)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|membrane raft (GO:0045121)|node of Ranvier (GO:0033268)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|alpha-actinin binding (GO:0051393)|calcium ion binding (GO:0005509)|laminin-1 binding (GO:0043237)|SH2 domain binding (GO:0042169)|structural constituent of muscle (GO:0008307)|tubulin binding (GO:0015631)|vinculin binding (GO:0017166)|virus receptor activity (GO:0001618)	p.D566G(1)		NS(1)|autonomic_ganglia(2)|breast(2)|endometrium(1)|large_intestine(8)|lung(5)|ovary(2)|prostate(1)|skin(1)	23				BRCA - Breast invasive adenocarcinoma(193;5.13e-05)|Kidney(197;0.00241)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		GGCCTTCCCGACAGCAGCCAC	0.597																																							uc003cxc.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1696-1698)GAC>GGC		dystroglycan 1 preproprotein							63.0	59.0	60.0					3																	49569641		2203	4300	6503	SO:0001583	missense	1605				cytoskeletal anchoring at plasma membrane|interspecies interaction between organisms|microtubule anchoring|negative regulation of cell migration|negative regulation of MAPKKK cascade|negative regulation of protein kinase B signaling cascade	basement membrane|contractile ring|cytoplasm|cytoskeleton|dystrophin-associated glycoprotein complex|extracellular space|filopodium|integral to membrane|integral to membrane of membrane fraction|lamellipodium|nucleoplasm	actin binding|alpha-actinin binding|calcium ion binding|laminin-1 binding|receptor activity|structural constituent of muscle|tubulin binding|vinculin binding	g.chr3:49569641A>G	L19711	CCDS2799.1	3p21	2014-09-17			ENSG00000173402	ENSG00000173402			2666	protein-coding gene	gene with protein product	"""alpha-dystroglycan"", ""dystrophin-associated glycoprotein-1"", ""beta-dystroglycan"""	128239				7774920, 1741056	Standard	NM_001177643		Approved	A3a, 156DAG, AGRNR, DAG	uc021wyd.1	Q14118	OTTHUMG00000156869	ENST00000539901.1:c.1697A>G	3.37:g.49569641A>G	ENSP00000439334:p.Asp566Gly		Somatic					p.D566G	NM_004393	NP_004384	WXS	Illumina HiSeq	Unspecified	Q14118	DAG1_HUMAN		BRCA - Breast invasive adenocarcinoma(193;5.13e-05)|Kidney(197;0.00241)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)	3	2115	+			566			Peptidase S72.		A8K6M7|Q969J9	Missense_Mutation	SNP	ENST00000539901.1	37	c.1697A>G	CCDS2799.1	.	.	.	.	.	.	.	.	.	.	A	16.43	3.122134	0.56613	.	.	ENSG00000173402	ENST00000515359;ENST00000308775;ENST00000545947;ENST00000541308;ENST00000539901;ENST00000538711	D;D;D;D;D;D	0.98381	-4.9;-4.9;-4.9;-4.9;-4.9;-4.9	5.97	5.97	0.96955	Dystroglycan-type cadherin-like (1);Cadherin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.97439	0.9162	M	0.63428	1.95	0.80722	D	1	D	0.58970	0.984	P	0.46885	0.53	D	0.97101	0.9797	9	.	.	.	-31.5243	15.433	0.75116	1.0:0.0:0.0:0.0	.	566	Q14118	DAG1_HUMAN	G	566	ENSP00000440705:D566G;ENSP00000312435:D566G;ENSP00000442600:D566G;ENSP00000440590:D566G;ENSP00000439334:D566G;ENSP00000438421:D566G	.	D	+	2	0	DAG1	49544645	1.000000	0.71417	1.000000	0.80357	0.833000	0.47200	9.339000	0.96797	2.288000	0.76882	0.533000	0.62120	GAC		0.597	DAG1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346326.1			13	56	0	0	0	0.004007	0	13	56				
DOCK3	1795	broad.mit.edu	37	3	51392314	51392314	+	Splice_Site	SNP	A	A	G			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr3:51392314A>G	ENST00000266037.9	+	41	4132	c.4109A>G	c.(4108-4110)aAc>aGc	p.N1370S		NM_004947.4	NP_004938.1	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	1370	DHR-2.				small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)	p.N1370S(1)|p.N1359S(1)		breast(2)|cervix(1)|endometrium(10)|kidney(4)|lung(22)|prostate(5)|urinary_tract(1)	45				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		TTGTGGCAGAACAAAGAATAC	0.532																																							uc011bds.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(4108-4110)AAC>AGC		dedicator of cytokinesis 3							143.0	145.0	145.0					3																	51392314		2080	4210	6290	SO:0001630	splice_region_variant	1795					cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding	g.chr3:51392314A>G	AB002297	CCDS46835.1	3p21	2008-02-01			ENSG00000088538	ENSG00000088538			2989	protein-coding gene	gene with protein product		603123	"""dedicator of cyto-kinesis 3"""			9205841	Standard	NM_004947		Approved	KIAA0299, MOCA, PBP	uc011bds.2	Q8IZD9	OTTHUMG00000156892	ENST00000266037.9:c.4108-1A>G	3.37:g.51392314A>G			Somatic					p.N1370S	NM_004947	NP_004938	WXS	Illumina HiSeq	Unspecified	Q8IZD9	DOCK3_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)	41	4132	+			1370			DHR-2.		O15017	Missense_Mutation	SNP	ENST00000266037.9	37	c.4109A>G	CCDS46835.1	.	.	.	.	.	.	.	.	.	.	A	19.11	3.763375	0.69763	.	.	ENSG00000088538	ENST00000266037;ENST00000402669	T	0.06768	3.26	5.7	5.7	0.88788	.	0.098510	0.64402	D	0.000001	T	0.19446	0.0467	M	0.88906	2.99	0.80722	D	1	B	0.12013	0.005	B	0.17722	0.019	T	0.02037	-1.1225	10	0.66056	D	0.02	.	15.9796	0.80097	1.0:0.0:0.0:0.0	.	1370	Q8IZD9	DOCK3_HUMAN	S	1370;166	ENSP00000266037:N1370S	ENSP00000266037:N1370S	N	+	2	0	DOCK3	51367354	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.332000	0.96446	2.185000	0.69588	0.528000	0.53228	AAC		0.532	DOCK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346478.5	NM_004947	Missense_Mutation	58	151	0	0	0	0.01441	0	58	151				
STAB1	23166	broad.mit.edu	37	3	52553536	52553536	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr3:52553536G>A	ENST00000321725.6	+	50	5267	c.5191G>A	c.(5191-5193)Gcc>Acc	p.A1731T		NM_015136.2	NP_055951.2	Q9NY15	STAB1_HUMAN	stabilin 1	1731	FAS1 6. {ECO:0000255|PROSITE- ProRule:PRU00082, ECO:0000305}.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|negative regulation of angiogenesis (GO:0016525)|oxidation-reduction process (GO:0055114)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|protein disulfide oxidoreductase activity (GO:0015035)|scavenger receptor activity (GO:0005044)	p.A1731T(1)		breast(4)|central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(13)|liver(1)|lung(27)|ovary(1)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	76				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		TGTCACCGCCGCCGCCCAGGG	0.602																																							uc003dej.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(3)|upper_aerodigestive_tract(2)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	9						c.(5191-5193)GCC>ACC		stabilin 1 precursor							81.0	81.0	81.0					3																	52553536		2203	4300	6503	SO:0001583	missense	23166				cell adhesion|cell-cell signaling|defense response to bacterium|inflammatory response|negative regulation of angiogenesis|receptor-mediated endocytosis	integral to plasma membrane	bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity	g.chr3:52553536G>A	AJ275213	CCDS33768.1	3p21.31	2008-07-18			ENSG00000010327	ENSG00000010327			18628	protein-coding gene	gene with protein product	"""MS-1 antigen"", ""fasciclin egf-like, laminin-type egf-like, and link domain-containing scavenger receptor-1"", ""common lymphatic endothelial and vascular endothelial receptor-1"""	608560				11829752, 12077138	Standard	XM_005264973		Approved	KIAA0246, STAB-1, FEEL-1, CLEVER-1, FELE-1, FEX1	uc003dej.3	Q9NY15	OTTHUMG00000158574	ENST00000321725.6:c.5191G>A	3.37:g.52553536G>A	ENSP00000312946:p.Ala1731Thr		Somatic				STAB1_uc003dek.1_5'UTR|STAB1_uc003del.2_5'Flank	p.A1731T	NM_015136	NP_055951	WXS	Illumina HiSeq	Unspecified	Q9NY15	STAB1_HUMAN		BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)	50	5265	+			1731			Extracellular (Potential).|FAS1 6.		A7E297|Q8IUH0|Q8IUH1|Q93072	Missense_Mutation	SNP	ENST00000321725.6	37	c.5191G>A	CCDS33768.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.532006	0.85812	.	.	ENSG00000010327	ENST00000321725	D	0.91180	-2.8	5.05	5.05	0.67936	FAS1 domain (3);	0.000000	0.85682	D	0.000000	D	0.94879	0.8345	M	0.79123	2.44	0.37311	D	0.909141	D	0.89917	1.0	D	0.72982	0.979	D	0.95980	0.8977	10	0.51188	T	0.08	.	15.9364	0.79712	0.0:0.0:1.0:0.0	.	1731	Q9NY15	STAB1_HUMAN	T	1731	ENSP00000312946:A1731T	ENSP00000312946:A1731T	A	+	1	0	STAB1	52528576	1.000000	0.71417	0.504000	0.27639	0.024000	0.10985	3.774000	0.55341	2.504000	0.84457	0.655000	0.94253	GCC		0.602	STAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351380.2	NM_015136		17	93	0	0	0	0.008871	0	17	93				
ROBO2	6092	broad.mit.edu	37	3	77595510	77595510	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr3:77595510G>A	ENST00000461745.1	+	7	1856	c.956G>A	c.(955-957)cGg>cAg	p.R319Q	ROBO2_ENST00000332191.8_Missense_Mutation_p.R319Q|ROBO2_ENST00000487694.3_Missense_Mutation_p.R335Q	NM_002942.4	NP_002933.1	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2 (Drosophila)	319	Ig-like C2-type 4.				apoptotic process involved in luteolysis (GO:0061364)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|cellular response to hormone stimulus (GO:0032870)|central nervous system development (GO:0007417)|homophilic cell adhesion (GO:0007156)|metanephros development (GO:0001656)|negative regulation of negative chemotaxis (GO:0050925)|negative regulation of synapse assembly (GO:0051964)|olfactory bulb interneuron development (GO:0021891)|positive regulation of axonogenesis (GO:0050772)|retinal ganglion cell axon guidance (GO:0031290)|ureteric bud development (GO:0001657)	axolemma (GO:0030673)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)	p.R319Q(1)|p.R335Q(1)		NS(1)|biliary_tract(5)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(23)|liver(1)|lung(52)|ovary(2)|pancreas(2)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	117				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		TTTGTGGTTCGGCCAAGAGAT	0.398																																							uc003dpy.3		NA																	2	Substitution - Missense(2)		lung(2)	lung(5)|skin(3)|ovary(1)|large_intestine(1)|liver(1)	11						c.(955-957)CGG>CAG		roundabout, axon guidance receptor, homolog 2							151.0	145.0	147.0					3																	77595510		1833	4079	5912	SO:0001583	missense	6092				apoptosis involved in luteolysis|axon midline choice point recognition|cellular response to hormone stimulus|homophilic cell adhesion|metanephros development|negative regulation of negative chemotaxis|negative regulation of synaptogenesis|olfactory bulb interneuron development|positive regulation of axonogenesis|retinal ganglion cell axon guidance|ureteric bud development	axolemma|cell surface|integral to membrane	axon guidance receptor activity|identical protein binding	g.chr3:77595510G>A	AF040991	CCDS43109.1, CCDS54609.1	3p12.3	2013-02-11	2001-11-28		ENSG00000185008	ENSG00000185008		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10250	protein-coding gene	gene with protein product		602431	"""roundabout (axon guidance receptor, Drosophila) homolog 2"""			9458045	Standard	NM_002942		Approved	KIAA1568	uc003dpy.4	Q9HCK4	OTTHUMG00000158935	ENST00000461745.1:c.956G>A	3.37:g.77595510G>A	ENSP00000417164:p.Arg319Gln		Somatic				ROBO2_uc003dpz.2_Missense_Mutation_p.R323Q|ROBO2_uc011bgj.1_RNA|ROBO2_uc011bgk.1_Missense_Mutation_p.R323Q	p.R319Q	NM_002942	NP_002933	WXS	Illumina HiSeq	Unspecified	Q9HCK4	ROBO2_HUMAN		Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)	7	1599	+			319			Ig-like C2-type 4.|Extracellular (Potential).		O43608|Q19AB4|Q19AB5	Missense_Mutation	SNP	ENST00000461745.1	37	c.956G>A	CCDS43109.1	.	.	.	.	.	.	.	.	.	.	G	33	5.278816	0.95489	.	.	ENSG00000185008	ENST00000487694;ENST00000403211;ENST00000343019;ENST00000461745;ENST00000332191;ENST00000398467	T;T;T	0.66280	-0.2;-0.2;-0.2	5.66	5.66	0.87406	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.49916	D	0.000121	T	0.69142	0.3078	N	0.25380	0.74	0.43667	D	0.996094	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.79784	0.989;0.971;0.993	T	0.63488	-0.6626	9	0.21014	T	0.42	.	19.7452	0.96250	0.0:0.0:1.0:0.0	.	335;319;319	Q19AB5;F8W703;Q9HCK4	.;.;ROBO2_HUMAN	Q	335;335;339;319;319;40	ENSP00000417335:R335Q;ENSP00000417164:R319Q;ENSP00000327536:R319Q	ENSP00000327536:R319Q	R	+	2	0	ROBO2	77678200	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.869000	0.99810	2.672000	0.90937	0.591000	0.81541	CGG		0.398	ROBO2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000352600.2	XM_031246		21	86	0	0	0	0.008871	0	21	86				
ROBO2	6092	broad.mit.edu	37	3	77612382	77612382	+	Silent	SNP	G	G	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr3:77612382G>T	ENST00000461745.1	+	11	2484	c.1584G>T	c.(1582-1584)ccG>ccT	p.P528P	ROBO2_ENST00000332191.8_Silent_p.P528P|ROBO2_ENST00000487694.3_Silent_p.P544P	NM_002942.4	NP_002933.1	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2 (Drosophila)	528	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				apoptotic process involved in luteolysis (GO:0061364)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|cellular response to hormone stimulus (GO:0032870)|central nervous system development (GO:0007417)|homophilic cell adhesion (GO:0007156)|metanephros development (GO:0001656)|negative regulation of negative chemotaxis (GO:0050925)|negative regulation of synapse assembly (GO:0051964)|olfactory bulb interneuron development (GO:0021891)|positive regulation of axonogenesis (GO:0050772)|retinal ganglion cell axon guidance (GO:0031290)|ureteric bud development (GO:0001657)	axolemma (GO:0030673)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)	p.P528P(1)|p.P544P(1)		NS(1)|biliary_tract(5)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(23)|liver(1)|lung(52)|ovary(2)|pancreas(2)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	117				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		CATCCAAACCGCAGGTCACTG	0.463																																							uc003dpy.3		NA																	2	Substitution - coding silent(2)		lung(2)	lung(5)|skin(3)|ovary(1)|large_intestine(1)|liver(1)	11						c.(1582-1584)CCG>CCT		roundabout, axon guidance receptor, homolog 2							83.0	80.0	81.0					3																	77612382		1891	4108	5999	SO:0001819	synonymous_variant	6092				apoptosis involved in luteolysis|axon midline choice point recognition|cellular response to hormone stimulus|homophilic cell adhesion|metanephros development|negative regulation of negative chemotaxis|negative regulation of synaptogenesis|olfactory bulb interneuron development|positive regulation of axonogenesis|retinal ganglion cell axon guidance|ureteric bud development	axolemma|cell surface|integral to membrane	axon guidance receptor activity|identical protein binding	g.chr3:77612382G>T	AF040991	CCDS43109.1, CCDS54609.1	3p12.3	2013-02-11	2001-11-28		ENSG00000185008	ENSG00000185008		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10250	protein-coding gene	gene with protein product		602431	"""roundabout (axon guidance receptor, Drosophila) homolog 2"""			9458045	Standard	NM_002942		Approved	KIAA1568	uc003dpy.4	Q9HCK4	OTTHUMG00000158935	ENST00000461745.1:c.1584G>T	3.37:g.77612382G>T			Somatic				ROBO2_uc003dpz.2_Silent_p.P532P|ROBO2_uc011bgj.1_RNA|ROBO2_uc011bgk.1_Silent_p.P532P	p.P528P	NM_002942	NP_002933	WXS	Illumina HiSeq	Unspecified	Q9HCK4	ROBO2_HUMAN		Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)	11	2227	+			528			Extracellular (Potential).|Fibronectin type-III 1.		O43608|Q19AB4|Q19AB5	Silent	SNP	ENST00000461745.1	37	c.1584G>T	CCDS43109.1																																																																																				0.463	ROBO2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000352600.2	XM_031246		14	33	1	0	6.31663e-08	0.003163	7.46818e-08	14	33				
IMPG2	50939	broad.mit.edu	37	3	100963143	100963143	+	Nonsense_Mutation	SNP	C	C	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr3:100963143C>A	ENST00000193391.7	-	13	2219	c.2032G>T	c.(2032-2034)Gag>Tag	p.E678*		NM_016247.3	NP_057331.2	Q9BZV3	IMPG2_HUMAN	interphotoreceptor matrix proteoglycan 2	678					visual perception (GO:0007601)	integral component of membrane (GO:0016021)|proteinaceous extracellular matrix (GO:0005578)|receptor complex (GO:0043235)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|hyaluronic acid binding (GO:0005540)	p.E678*(1)		NS(1)|breast(2)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(14)|lung(32)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	64					Hyaluronan(DB08818)	GGCTCTTCCTCTGGAAAGTGT	0.448																																							uc003duq.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3						c.(2032-2034)GAG>TAG		interphotoreceptor matrix proteoglycan 2							102.0	97.0	98.0					3																	100963143		2203	4300	6503	SO:0001587	stop_gained	50939				visual perception	integral to membrane|proteinaceous extracellular matrix	extracellular matrix structural constituent|heparin binding|hyaluronic acid binding|receptor activity	g.chr3:100963143C>A	AF173155	CCDS2940.1	3q12.2-q12.3	2014-01-28			ENSG00000081148	ENSG00000081148			18362	protein-coding gene	gene with protein product		607056				10542133	Standard	NM_016247		Approved	IPM200, RP56	uc003duq.2	Q9BZV3	OTTHUMG00000159091	ENST00000193391.7:c.2032G>T	3.37:g.100963143C>A	ENSP00000193391:p.Glu678*		Somatic				IMPG2_uc011bhe.1_Nonsense_Mutation_p.E541*	p.E678*	NM_016247	NP_057331	WXS	Illumina HiSeq	Unspecified	Q9BZV3	IMPG2_HUMAN			13	2235	-			678			Extracellular (Potential).		A8MWT5|Q9UKD4|Q9UKK5	Nonsense_Mutation	SNP	ENST00000193391.7	37	c.2032G>T	CCDS2940.1	.	.	.	.	.	.	.	.	.	.	C	35	5.561094	0.96527	.	.	ENSG00000081148	ENST00000193391	.	.	.	5.06	5.06	0.68205	.	0.156529	0.42964	D	0.000629	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.31617	T	0.26	-4.3581	8.3878	0.32510	0.0:0.8641:0.0:0.1359	.	.	.	.	X	678	.	ENSP00000193391:E678X	E	-	1	0	IMPG2	102445833	0.013000	0.17824	0.751000	0.31187	0.434000	0.31775	1.779000	0.38624	2.732000	0.93576	0.591000	0.81541	GAG		0.448	IMPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353256.3			17	25	1	0	9.16793e-09	0.00499	1.10466e-08	17	25				
MYH15	22989	broad.mit.edu	37	3	108159970	108159970	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr3:108159970C>A	ENST00000273353.3	-	24	2909	c.2853G>T	c.(2851-2853)agG>agT	p.R951S		NM_014981.1	NP_055796.1	Q9Y2K3	MYH15_HUMAN	myosin, heavy chain 15	951						cytoplasm (GO:0005737)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.R951S(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(4)|endometrium(10)|kidney(4)|large_intestine(14)|lung(47)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	105						GTTTCCGCCCCCTGGCAGTCA	0.478																																							uc003dxa.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|central_nervous_system(2)	7						c.(2851-2853)AGG>AGT		myosin, heavy polypeptide 15							150.0	150.0	150.0					3																	108159970		1962	4153	6115	SO:0001583	missense	22989					myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity	g.chr3:108159970C>A	AB023217	CCDS43127.1	3q13	2011-09-27	2006-09-29		ENSG00000144821	ENSG00000144821		"""Myosins / Myosin superfamily : Class II"""	31073	protein-coding gene	gene with protein product		609929	"""myosin, heavy polypeptide 15"""			15014174, 15042088	Standard	NM_014981		Approved	KIAA1000	uc003dxa.1	Q9Y2K3	OTTHUMG00000159226	ENST00000273353.3:c.2853G>T	3.37:g.108159970C>A	ENSP00000273353:p.Arg951Ser		Somatic					p.R951S	NM_014981	NP_055796	WXS	Illumina HiSeq	Unspecified	Q9Y2K3	MYH15_HUMAN			24	2910	-			951			Potential.			Missense_Mutation	SNP	ENST00000273353.3	37	c.2853G>T	CCDS43127.1	.	.	.	.	.	.	.	.	.	.	C	14.36	2.513278	0.44660	.	.	ENSG00000144821	ENST00000273353	D	0.90900	-2.75	5.82	4.03	0.46877	.	.	.	.	.	D	0.84097	0.5397	N	0.24115	0.695	0.28675	N	0.905416	B	0.17268	0.021	B	0.25291	0.059	T	0.76170	-0.3057	9	0.52906	T	0.07	.	9.1308	0.36843	0.0:0.6659:0.0:0.3341	.	951	Q9Y2K3	MYH15_HUMAN	S	951	ENSP00000273353:R951S	ENSP00000273353:R951S	R	-	3	2	MYH15	109642660	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	0.984000	0.29565	0.797000	0.33971	0.585000	0.79938	AGG		0.478	MYH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353935.1	XM_036988		23	94	1	0	1.9806e-07	0.014323	2.3046e-07	23	94				
ARHGAP31	57514	broad.mit.edu	37	3	119134364	119134364	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr3:119134364G>T	ENST00000264245.4	+	12	4120	c.3588G>T	c.(3586-3588)caG>caT	p.Q1196H		NM_020754.2	NP_065805.2	Q2M1Z3	RHG31_HUMAN	Rho GTPase activating protein 31	1196					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	GTPase activator activity (GO:0005096)	p.Q1196H(1)		breast(5)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(3)|large_intestine(11)|lung(29)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	67						AAATGTGCCAGGCCAGGGCGG	0.582																																					Pancreas(7;176 297 5394 51128 51241)	Pancreas(7;176 297 5394 51128 51241)	uc003ecj.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(3586-3588)CAG>CAT		Cdc42 GTPase-activating protein							53.0	58.0	56.0					3																	119134364		2035	4189	6224	SO:0001583	missense	57514				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|focal adhesion|lamellipodium	GTPase activator activity	g.chr3:119134364G>T		CCDS43135.1	3q13.33	2011-06-29			ENSG00000031081	ENSG00000031081		"""Rho GTPase activating proteins"""	29216	protein-coding gene	gene with protein product		610911				9786927, 12819203, 16519628	Standard	NM_020754		Approved	CDGAP	uc003ecj.4	Q2M1Z3	OTTHUMG00000159362	ENST00000264245.4:c.3588G>T	3.37:g.119134364G>T	ENSP00000264245:p.Gln1196His		Somatic					p.Q1196H	NM_020754	NP_065805	WXS	Illumina HiSeq	Unspecified	Q2M1Z3	RHG31_HUMAN			12	4120	+			1196					Q9ULL6	Missense_Mutation	SNP	ENST00000264245.4	37	c.3588G>T	CCDS43135.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.962157	0.74016	.	.	ENSG00000031081	ENST00000264245	T	0.22539	1.95	6.17	6.17	0.99709	.	0.000000	0.64402	D	0.000020	T	0.40909	0.1136	L	0.36672	1.1	0.58432	D	0.999999	D	0.89917	1.0	D	0.83275	0.996	T	0.06092	-1.0846	10	0.87932	D	0	.	19.8676	0.96824	0.0:0.0:1.0:0.0	.	1196	Q2M1Z3	RHG31_HUMAN	H	1196	ENSP00000264245:Q1196H	ENSP00000264245:Q1196H	Q	+	3	2	ARHGAP31	120617054	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.323000	0.59221	2.941000	0.99782	0.655000	0.94253	CAG		0.582	ARHGAP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354942.2			12	78	1	0	2.32078e-09	0.003163	2.83509e-09	12	78				
POLQ	10721	broad.mit.edu	37	3	121206886	121206886	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr3:121206886C>G	ENST00000264233.5	-	16	5020	c.4892G>C	c.(4891-4893)tGg>tCg	p.W1631S		NM_199420.3	NP_955452.3	O75417	DPOLQ_HUMAN	polymerase (DNA directed), theta	1631					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|single-stranded DNA-dependent ATPase activity (GO:0043142)	p.W1766S(1)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(55)|ovary(5)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	120				GBM - Glioblastoma multiforme(114;0.0915)		TGCCCCTGACCATATGAATGA	0.383								DNA polymerases (catalytic subunits)																													Pancreas(152;907 1925 26081 31236 36904)	Pancreas(152;907 1925 26081 31236 36904)	uc003eee.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|breast(3)|lung(2)|upper_aerodigestive_tract(1)|skin(1)	11						c.(4891-4893)TGG>TCG	DNA_polymerases_(catalytic_subunits)	DNA polymerase theta							176.0	179.0	178.0					3																	121206886		2203	4300	6503	SO:0001583	missense	10721				DNA repair|DNA replication	nucleoplasm	ATP binding|ATP-dependent helicase activity|damaged DNA binding|DNA-directed DNA polymerase activity|single-stranded DNA-dependent ATPase activity	g.chr3:121206886C>G	AF052573	CCDS33833.1	3q13.3	2012-05-18			ENSG00000051341	ENSG00000051341	2.7.7.7	"""DNA polymerases"""	9186	protein-coding gene	gene with protein product		604419				10395804	Standard	NM_199420		Approved	POLH	uc003eee.4	O75417	OTTHUMG00000159396	ENST00000264233.5:c.4892G>C	3.37:g.121206886C>G	ENSP00000264233:p.Trp1631Ser		Somatic				POLQ_uc003eed.2_Missense_Mutation_p.W803S	p.W1631S	NM_199420	NP_955452	WXS	Illumina HiSeq	Unspecified	O75417	DPOLQ_HUMAN		GBM - Glioblastoma multiforme(114;0.0915)	16	5021	-			1631					O95160|Q6VMB5	Missense_Mutation	SNP	ENST00000264233.5	37	c.4892G>C	CCDS33833.1	.	.	.	.	.	.	.	.	.	.	C	15.73	2.918922	0.52546	.	.	ENSG00000051341	ENST00000543272;ENST00000264233;ENST00000393672	T	0.55930	0.49	6.17	6.17	0.99709	.	0.151693	0.47093	D	0.000252	T	0.61060	0.2317	L	0.36672	1.1	0.53005	D	0.99996	D;D	0.76494	0.997;0.999	D;D	0.74023	0.915;0.982	T	0.54214	-0.8327	10	0.29301	T	0.29	.	13.2493	0.60041	0.0:0.9279:0.0:0.0721	.	1631;803	O75417;O75417-2	DPOLQ_HUMAN;.	S	1254;1631;1767	ENSP00000264233:W1631S	ENSP00000264233:W1631S	W	-	2	0	POLQ	122689576	1.000000	0.71417	0.998000	0.56505	0.780000	0.44128	3.139000	0.50577	2.941000	0.99782	0.655000	0.94253	TGG		0.383	POLQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355097.1	NM_199420		50	130	0	0	0	0.01441	0	50	130				
PARP14	54625	broad.mit.edu	37	3	122420301	122420301	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr3:122420301T>A	ENST00000474629.2	+	6	3166	c.2900T>A	c.(2899-2901)gTt>gAt	p.V967D		NM_017554.2	NP_060024.2	Q460N5	PAR14_HUMAN	poly (ADP-ribose) polymerase family, member 14	967	Macro 1. {ECO:0000255|PROSITE- ProRule:PRU00490}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	NAD+ ADP-ribosyltransferase activity (GO:0003950)	p.V804D(1)|p.V967D(1)		NS(2)|breast(5)|cervix(2)|endometrium(7)|kidney(5)|large_intestine(8)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	50				GBM - Glioblastoma multiforme(114;0.0531)		GAGAAGACTGTTGAGGCCTTT	0.488																																							uc003efq.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|breast(2)|lung(1)|pancreas(1)	6						c.(2899-2901)GTT>GAT		poly (ADP-ribose) polymerase family, member 14							72.0	73.0	73.0					3																	122420301		1951	4153	6104	SO:0001583	missense	54625				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	NAD+ ADP-ribosyltransferase activity	g.chr3:122420301T>A	AB033094	CCDS46894.1	3q21	2010-02-16			ENSG00000173193	ENSG00000173193		"""Poly (ADP-ribose) polymerases"""	29232	protein-coding gene	gene with protein product		610028				15273990	Standard	NM_017554		Approved	KIAA1268, pART8	uc003efq.4	Q460N5	OTTHUMG00000159552	ENST00000474629.2:c.2900T>A	3.37:g.122420301T>A	ENSP00000418194:p.Val967Asp		Somatic				PARP14_uc010hrk.2_RNA|PARP14_uc003efr.2_Missense_Mutation_p.V684D|PARP14_uc003efs.1_Missense_Mutation_p.V684D	p.V967D	NM_017554	NP_060024	WXS	Illumina HiSeq	Unspecified	Q460N5	PAR14_HUMAN		GBM - Glioblastoma multiforme(114;0.0531)	6	2959	+			967			Macro 1.		B4E2H0|Q460N4|Q8J027|Q9H9X9|Q9NV60|Q9ULF2	Missense_Mutation	SNP	ENST00000474629.2	37	c.2900T>A	CCDS46894.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.43|16.43	3.121556|3.121556	0.56613|0.56613	.|.	.|.	ENSG00000173193|ENSG00000173193	ENST00000398157|ENST00000474629;ENST00000398162	.|T	.|0.24723	.|1.84	5.37|5.37	-2.85|-2.85	0.05734|0.05734	.|Appr-1-p processing (1);	.|0.687632	.|0.13365	.|N	.|0.393356	T|T	0.43100|0.43100	0.1232|0.1232	M|M	0.81614|0.81614	2.55|2.55	0.25039|0.25039	N|N	0.991217|0.991217	.|D;D	.|0.63046	.|0.963;0.992	.|P;P	.|0.58520	.|0.72;0.84	T|T	0.43718|0.43718	-0.9374|-0.9374	6|10	0.38643|0.72032	T|D	0.18|0.01	.|.	11.5473|11.5473	0.50700|0.50700	0.0:0.299:0.0:0.701|0.0:0.299:0.0:0.701	.|.	.|967;967	.|Q460N5-4;Q460N5	.|.;PAR14_HUMAN	M|D	7|967;886	.|ENSP00000418194:V967D	ENSP00000381224:L7M|ENSP00000381228:V886D	L|V	+|+	1|2	2|0	PARP14|PARP14	123902991|123902991	0.174000|0.174000	0.23070|0.23070	0.000000|0.000000	0.03702|0.03702	0.003000|0.003000	0.03518|0.03518	0.782000|0.782000	0.26788|0.26788	-0.276000|-0.276000	0.09206|0.09206	-0.182000|-0.182000	0.12963|0.12963	TTG|GTT		0.488	PARP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356173.2	NM_017554		8	32	0	0	0	0.004482	0	8	32				
RASA2	5922	broad.mit.edu	37	3	141327427	141327427	+	Nonsense_Mutation	SNP	C	C	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr3:141327427C>T	ENST00000452898.1	+	21	2151	c.2116C>T	c.(2116-2118)Cga>Tga	p.R706*	RASA2_ENST00000286364.3_Nonsense_Mutation_p.R705*|RASA2_ENST00000509118.1_3'UTR	NM_006506.2	NP_006497.2	Q15283	RASA2_HUMAN	RAS p21 protein activator 2	706	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				intracellular signal transduction (GO:0035556)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	metal ion binding (GO:0046872)|Ras GTPase activator activity (GO:0005099)	p.R705*(2)		NS(1)|breast(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(13)|ovary(2)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	34						CAGGGTGAGCCGATGCAATCA	0.448																																							uc003etz.1		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(2)|lung(2)|breast(1)|skin(1)	6						c.(2113-2115)CGA>TGA		RAS p21 protein activator 2							141.0	135.0	137.0					3																	141327427		2203	4300	6503	SO:0001587	stop_gained	5922				intracellular signal transduction|negative regulation of Ras protein signal transduction	intracellular membrane-bounded organelle|intrinsic to internal side of plasma membrane|perinuclear region of cytoplasm	metal ion binding|Ras GTPase activator activity	g.chr3:141327427C>T	AF115573	CCDS3117.1	3q22-q23	2013-01-10			ENSG00000155903	ENSG00000155903		"""Pleckstrin homology (PH) domain containing"""	9872	protein-coding gene	gene with protein product		601589				8699317	Standard	NM_006506		Approved	GAP1M	uc003etz.1	Q15283	OTTHUMG00000160221	ENST00000452898.1:c.2116C>T	3.37:g.141327427C>T	ENSP00000391677:p.Arg706*		Somatic				RASA2_uc010huq.1_Nonsense_Mutation_p.R709*|RASA2_uc003eua.1_Nonsense_Mutation_p.R706*	p.R705*	NM_006506	NP_006497	WXS	Illumina HiSeq	Unspecified	Q15283	RASA2_HUMAN			21	2113	+			705			PH.		A8K7K1|G3V0F9|O00695|Q15284|Q92594|Q99577|Q9UEQ2	Nonsense_Mutation	SNP	ENST00000452898.1	37	c.2113C>T		.	.	.	.	.	.	.	.	.	.	C	37	6.207058	0.97376	.	.	ENSG00000155903	ENST00000286364;ENST00000452898	.	.	.	5.39	4.49	0.54785	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.13853	T	0.58	.	13.2654	0.60131	0.356:0.644:0.0:0.0	.	.	.	.	X	705;706	.	ENSP00000286364:R705X	R	+	1	2	RASA2	142810117	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	3.775000	0.55349	1.446000	0.47643	0.650000	0.86243	CGA		0.448	RASA2-201	KNOWN	basic	protein_coding	protein_coding		NM_006506		6	32	0	0	0	0.004482	0	6	32				
ZBBX	79740	broad.mit.edu	37	3	167068302	167068302	+	Splice_Site	SNP	A	A	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr3:167068302A>T	ENST00000392766.2	-	9	774	c.434T>A	c.(433-435)gTa>gAa	p.V145E	ZBBX_ENST00000392764.1_Splice_Site_p.V116E|ZBBX_ENST00000455345.2_Splice_Site_p.V145E|ZBBX_ENST00000307529.5_Splice_Site_p.V145E|ZBBX_ENST00000392767.2_Splice_Site_p.V145E|ZBBX_ENST00000469220.1_Intron	NM_001199201.1|NM_024687.3	NP_001186130.1|NP_078963.2	A8MT70	ZBBX_HUMAN	zinc finger, B-box domain containing	145						intracellular (GO:0005622)	zinc ion binding (GO:0008270)	p.V145E(2)		NS(1)|breast(1)|endometrium(5)|kidney(5)|large_intestine(9)|liver(1)|lung(38)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	70						TTCAAGGCATACCTAAAAAGa	0.299																																							uc003fep.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(433-435)GTA>GAA		zinc finger, B-box domain containing							109.0	101.0	103.0					3																	167068302		1788	4058	5846	SO:0001630	splice_region_variant	79740					intracellular	zinc ion binding	g.chr3:167068302A>T	AK026702	CCDS3199.2, CCDS56295.1, CCDS56296.1	3q26.1	2010-03-23			ENSG00000169064	ENSG00000169064			26245	protein-coding gene	gene with protein product						12477932	Standard	NM_024687		Approved	FLJ23049	uc011bpc.2	A8MT70	OTTHUMG00000133560	ENST00000392766.2:c.433-1T>A	3.37:g.167068302A>T			Somatic				ZBBX_uc011bpc.1_Missense_Mutation_p.V145E|ZBBX_uc003feq.2_Missense_Mutation_p.V116E	p.V145E	NM_024687	NP_078963	WXS	Illumina HiSeq	Unspecified	A8MT70	ZBBX_HUMAN			9	757	-			145			B box-type; atypical.		A8MV69|B3KSC1|B5MDJ6|F2Z370|Q9H5T8	Missense_Mutation	SNP	ENST00000392766.2	37	c.434T>A	CCDS3199.2	.	.	.	.	.	.	.	.	.	.	A	13.83	2.355171	0.41700	.	.	ENSG00000169064	ENST00000392766;ENST00000392767;ENST00000455345;ENST00000307529;ENST00000392764;ENST00000474464	T;T;T;T;T;T	0.43688	0.94;0.94;0.94;0.94;0.94;1.43	5.71	4.56	0.56223	Zinc finger, B-box (1);	0.000000	0.29459	U	0.012086	T	0.48059	0.1479	L	0.29908	0.895	0.31616	N	0.650952	D;D	0.69078	0.99;0.997	P;D	0.68621	0.901;0.959	T	0.54636	-0.8264	10	0.48119	T	0.1	-8.5043	9.6473	0.39875	0.918:0.0:0.082:0.0	.	145;145	A8MT70-2;A8MT70	.;ZBBX_HUMAN	E	145;145;145;145;116;145	ENSP00000376519:V145E;ENSP00000376520:V145E;ENSP00000390232:V145E;ENSP00000305065:V145E;ENSP00000376517:V116E;ENSP00000419307:V145E	ENSP00000305065:V145E	V	-	2	0	ZBBX	168550996	1.000000	0.71417	0.584000	0.28653	0.196000	0.23810	3.414000	0.52693	0.998000	0.38996	0.477000	0.44152	GTA		0.299	ZBBX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000257657.3	NM_024687	Missense_Mutation	16	30	0	0	0	0.003163	0	16	30				
ZBBX	79740	broad.mit.edu	37	3	167086333	167086333	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr3:167086333A>T	ENST00000392766.2	-	5	438	c.98T>A	c.(97-99)gTa>gAa	p.V33E	ZBBX_ENST00000392764.1_Missense_Mutation_p.V4E|ZBBX_ENST00000455345.2_Missense_Mutation_p.V33E|ZBBX_ENST00000307529.5_Missense_Mutation_p.V33E|ZBBX_ENST00000392767.2_Missense_Mutation_p.V33E|ZBBX_ENST00000469220.1_Intron	NM_001199201.1|NM_024687.3	NP_001186130.1|NP_078963.2	A8MT70	ZBBX_HUMAN	zinc finger, B-box domain containing	33						intracellular (GO:0005622)	zinc ion binding (GO:0008270)	p.V33E(2)		NS(1)|breast(1)|endometrium(5)|kidney(5)|large_intestine(9)|liver(1)|lung(38)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	70						CTCTAACTGTACTTTCTCCAT	0.343																																							uc003fep.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(97-99)GTA>GAA		zinc finger, B-box domain containing							150.0	132.0	138.0					3																	167086333		1815	4065	5880	SO:0001583	missense	79740					intracellular	zinc ion binding	g.chr3:167086333A>T	AK026702	CCDS3199.2, CCDS56295.1, CCDS56296.1	3q26.1	2010-03-23			ENSG00000169064	ENSG00000169064			26245	protein-coding gene	gene with protein product						12477932	Standard	NM_024687		Approved	FLJ23049	uc011bpc.2	A8MT70	OTTHUMG00000133560	ENST00000392766.2:c.98T>A	3.37:g.167086333A>T	ENSP00000376519:p.Val33Glu		Somatic				ZBBX_uc011bpc.1_Missense_Mutation_p.V33E|ZBBX_uc003feq.2_Missense_Mutation_p.V4E	p.V33E	NM_024687	NP_078963	WXS	Illumina HiSeq	Unspecified	A8MT70	ZBBX_HUMAN			5	421	-			33			Potential.		A8MV69|B3KSC1|B5MDJ6|F2Z370|Q9H5T8	Missense_Mutation	SNP	ENST00000392766.2	37	c.98T>A	CCDS3199.2	.	.	.	.	.	.	.	.	.	.	A	15.49	2.850183	0.51270	.	.	ENSG00000169064	ENST00000392766;ENST00000392767;ENST00000455345;ENST00000307529;ENST00000392764;ENST00000474464;ENST00000485651	T;T;T;T;T;T	0.30981	2.95;2.95;2.95;2.95;2.52;1.51	5.21	5.21	0.72293	.	.	.	.	.	T	0.45115	0.1326	L	0.45581	1.43	0.34098	D	0.661533	D;D	0.76494	0.999;0.998	D;D	0.70016	0.967;0.928	T	0.55205	-0.8177	9	0.33141	T	0.24	-2.9392	11.4867	0.50358	1.0:0.0:0.0:0.0	.	33;33	A8MT70-2;A8MT70	.;ZBBX_HUMAN	E	33;33;33;33;4;33;4	ENSP00000376519:V33E;ENSP00000376520:V33E;ENSP00000390232:V33E;ENSP00000305065:V33E;ENSP00000376517:V4E;ENSP00000419307:V33E	ENSP00000305065:V33E	V	-	2	0	ZBBX	168569027	0.891000	0.30450	0.343000	0.25615	0.164000	0.22412	3.225000	0.51246	1.972000	0.57404	0.477000	0.44152	GTA		0.343	ZBBX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000257657.3	NM_024687		15	22	0	0	0	0.00499	0	15	22				
PIK3CA	5290	broad.mit.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	G	A	rs104886003		TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr3:178936091G>A	ENST00000263967.3	+	10	1790	c.1633G>A	c.(1633-1635)Gag>Aag	p.E545K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	545	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> A (in CWS5 and HCC; also found in a glioblastoma multiforme sample). {ECO:0000269|PubMed:15608678, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:23246288}.|E -> G (in KERSEB; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:17673550}.|E -> K (in MCAP, KERSEB, CRC and BC; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E545K(881)|p.E545Q(18)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TGAAATCACTGAGCAGGAGAA	0.353	E545K(BC3C_URINARY_TRACT)|E545K(BFTC909_KIDNEY)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(HCC202_BREAST)|E545K(HCT15_LARGE_INTESTINE)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(KYSE510_OESOPHAGUS)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(MCF7_BREAST)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(NCIH460_LUNG)|E545K(NCIH508_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(RERFLCSQ1_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	Colon(199;1504 1750 3362 26421 31210 32040)	uc003fjk.2	E545K(RERFLCSQ1_LUNG)|E545K(KYSE510_OESOPHAGUS)|E545K(NCIH508_LARGE_INTESTINE)|E545K(HCC202_BREAST)|E545K(BFTC909_KIDNEY)|E545K(HCT15_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(MCF7_BREAST)|E545K(NCIH460_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(BC3C_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57		Dom	yes		3	3q26.3	5290	Mis	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			"""E, O"""			colorectal|gastric|gliobastoma|breast		899	Substitution - Missense(899)	p.E545K(735)|p.E545A(75)|p.E545G(55)|p.E545?(19)|p.E545D(15)|p.E545Q(12)|p.E545V(4)	breast(308)|large_intestine(286)|urinary_tract(97)|lung(44)|endometrium(37)|ovary(25)|stomach(17)|upper_aerodigestive_tract(16)|skin(14)|central_nervous_system(13)|cervix(13)|thyroid(7)|oesophagus(7)|penis(4)|kidney(3)|soft_tissue(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(1)|biliary_tract(1)|NS(1)|pituitary(1)	breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553						c.(1633-1635)GAG>AAG		phosphoinositide-3-kinase, catalytic, alpha							61.0	60.0	60.0					3																	178936091		1813	4072	5885	SO:0001583	missense	5290				epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	g.chr3:178936091G>A		CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1633G>A	3.37:g.178936091G>A	ENSP00000263967:p.Glu545Lys	HNSCC(19;0.045)|TSP Lung(28;0.18)	Somatic					p.E545K	NM_006218	NP_006209	WXS	Illumina HiSeq	Unspecified	P42336	PK3CA_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		10	1790	+	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		545		E -> G (in KERSEB).|E -> A (in cancer).|E -> K (in KERSEB; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells).	PI3K helical.		Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	37	c.1633G>A	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	G	36	5.703347	0.96812	.	.	ENSG00000121879	ENST00000263967	T	0.63255	-0.03	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.73822	0.3636	L	0.51914	1.62	0.80722	D	1	D	0.62365	0.991	D	0.62955	0.909	T	0.68872	-0.5294	10	0.32370	T	0.25	-25.7963	20.0024	0.97423	0.0:0.0:1.0:0.0	.	545	P42336	PK3CA_HUMAN	K	545	ENSP00000263967:E545K	ENSP00000263967:E545K	E	+	1	0	PIK3CA	180418785	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAG		0.353	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2			4	12	0	0	0	0.001168	0	4	12				
YEATS2	55689	broad.mit.edu	37	3	183432964	183432964	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr3:183432964A>T	ENST00000305135.5	+	2	209	c.14A>T	c.(13-15)aAg>aTg	p.K5M		NM_018023.4	NP_060493.3	Q9ULM3	YETS2_HUMAN	YEATS domain containing 2	5					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|mitotic spindle (GO:0072686)	TBP-class protein binding (GO:0017025)	p.K5M(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(24)|ovary(3)|prostate(2)|skin(3)	49	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.38e-42)|Epithelial(37;1.9e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			TCTGGAATCAAGCGAACCATC	0.378																																							uc003fly.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|large_intestine(1)	4						c.(13-15)AAG>ATG		YEATS domain containing 2							129.0	126.0	127.0					3																	183432964		1879	4106	5985	SO:0001583	missense	55689				histone H3 acetylation|negative regulation of transcription from RNA polymerase II promoter	Ada2/Gcn5/Ada3 transcription activator complex	TBP-class protein binding	g.chr3:183432964A>T	AB033023	CCDS43175.1	3q27.3	2004-08-18			ENSG00000163872	ENSG00000163872			25489	protein-coding gene	gene with protein product		613373				10574462	Standard	NM_018023		Approved	FLJ10201, FLJ12841, FLJ13308, KIAA1197	uc003fly.2	Q9ULM3	OTTHUMG00000156898	ENST00000305135.5:c.14A>T	3.37:g.183432964A>T	ENSP00000306983:p.Lys5Met		Somatic					p.K5M	NM_018023	NP_060493	WXS	Illumina HiSeq	Unspecified	Q9ULM3	YETS2_HUMAN	all cancers(12;2.38e-42)|Epithelial(37;1.9e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)		2	209	+	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		5					A7E2B9|D3DNS9|Q641P6|Q9NW96	Missense_Mutation	SNP	ENST00000305135.5	37	c.14A>T	CCDS43175.1	.	.	.	.	.	.	.	.	.	.	A	23.1	4.373420	0.82573	.	.	ENSG00000163872	ENST00000421660;ENST00000305135	T	0.38887	1.11	5.65	5.65	0.86999	.	0.123452	0.53938	D	0.000050	T	0.51517	0.1679	L	0.50333	1.59	0.47737	D	0.999509	D	0.69078	0.997	P	0.57283	0.817	T	0.54925	-0.8220	10	0.87932	D	0	-18.7196	10.9876	0.47530	0.9253:0.0:0.0747:0.0	.	5	Q9ULM3	YETS2_HUMAN	M	5	ENSP00000306983:K5M	ENSP00000306983:K5M	K	+	2	0	YEATS2	184915658	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	6.033000	0.70925	2.159000	0.67721	0.383000	0.25322	AAG		0.378	YEATS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346507.2	NM_018023		38	48	0	0	0	0.006999	0	38	48				
SLC51A	200931	broad.mit.edu	37	3	195953990	195953990	+	Splice_Site	SNP	G	G	A	rs139345051		TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr3:195953990G>A	ENST00000296327.5	+	3	497	c.288G>A	c.(286-288)acG>acA	p.T96T		NM_152672.5	NP_689885.4	Q86UW1	OSTA_HUMAN	solute carrier family 51, alpha subunit	96					bile acid and bile salt transport (GO:0015721)|transport (GO:0006810)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|transporter activity (GO:0005215)	p.T96T(1)								Conjugated Estrogens(DB00286)|Digoxin(DB00390)|Dinoprostone(DB00917)	CGGCACCCACGGTGAGGCCCC	0.577																																							uc003fwd.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(286-288)ACG>ACA		organic solute transporter alpha		G		1,4405	2.1+/-5.4	0,1,2202	58.0	56.0	57.0		288	4.9	1.0	3	dbSNP_134	57	0,8600		0,0,4300	no	coding-synonymous-near-splice	OSTalpha	NM_152672.5		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		96/341	195953990	1,13005	2203	4300	6503	SO:0001630	splice_region_variant	200931					integral to membrane|plasma membrane	transporter activity	g.chr3:195953990G>A		CCDS3314.1	3q29	2013-05-22			ENSG00000163959	ENSG00000163959		"""Solute carriers"""	29955	protein-coding gene	gene with protein product	"""organic solute transporter, alpha subunit"""	612084				12719432, 20538072	Standard	NM_152672		Approved	OSTalpha	uc003fwd.3	Q86UW1	OTTHUMG00000155684	ENST00000296327.5:c.288+1G>A	3.37:g.195953990G>A			Somatic				OSTalpha_uc011btu.1_Silent_p.T96T|OSTalpha_uc010iac.1_5'Flank|OSTalpha_uc003fwe.2_5'Flank	p.T96T	NM_152672	NP_689885	WXS	Illumina HiSeq	Unspecified	Q86UW1	OSTA_HUMAN	Epithelial(36;8.83e-25)|all cancers(36;8.38e-23)|OV - Ovarian serous cystadenocarcinoma(49;7.08e-19)|LUSC - Lung squamous cell carcinoma(58;7.51e-07)|Lung(62;1.06e-06)	GBM - Glioblastoma multiforme(46;0.00202)	3	489	+	all_cancers(143;1.68e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		96			Helical; (Potential).		Q6ZMC7	Silent	SNP	ENST00000296327.5	37	c.288G>A	CCDS3314.1	.	.	.	.	.	.	.	.	.	.	G	9.347	1.064554	0.20067	2.27E-4	0.0	ENSG00000163959	ENST00000428985	.	.	.	5.86	4.94	0.65067	.	.	.	.	.	T	0.71273	0.3320	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.69117	-0.5230	4	.	.	.	.	15.5886	0.76506	0.0:0.1376:0.8624:0.0	.	.	.	.	H	67	.	.	R	+	2	0	AC069257.9	197438387	1.000000	0.71417	1.000000	0.80357	0.116000	0.19942	1.966000	0.40481	2.771000	0.95319	0.563000	0.77884	CGC		0.577	SLC51A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341253.1	NM_152672	Silent	21	103	0	0	0	0.005443	0	21	103				
PDE6B	5158	broad.mit.edu	37	4	647926	647926	+	Missense_Mutation	SNP	C	C	A	rs573290599		TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr4:647926C>A	ENST00000496514.1	+	5	931	c.910C>A	c.(910-912)Cgc>Agc	p.R304S	PDE6B_ENST00000429163.2_Missense_Mutation_p.R25S|PDE6B_ENST00000255622.6_Missense_Mutation_p.R304S|RP11-1191J2.2_ENST00000598370.1_RNA|RP11-1191J2.2_ENST00000489312.1_RNA|RP11-1191J2.2_ENST00000599030.1_RNA|RP11-1191J2.2_ENST00000468356.1_RNA			P35913	PDE6B_HUMAN	phosphodiesterase 6B, cGMP-specific, rod, beta	304	GAF 2.				cytosolic calcium ion homeostasis (GO:0051480)|GMP metabolic process (GO:0046037)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina development in camera-type eye (GO:0060041)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|metal ion binding (GO:0046872)	p.R304S(1)		NS(1)|breast(3)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(2)|prostate(2)|urinary_tract(1)	30					Caffeine(DB00201)	CTCGGGCCCACGCACGCCTGA	0.642																																					GBM(71;463 1194 9848 25922 46834)	GBM(71;463 1194 9848 25922 46834)	uc003gap.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(910-912)CGC>AGC		phosphodiesterase 6B isoform 1							44.0	48.0	46.0					4																	647926		2203	4299	6502	SO:0001583	missense	5158				cytosolic calcium ion homeostasis|GMP metabolic process|phototransduction, visible light|platelet activation|visual perception	cytosol|membrane	3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding	g.chr4:647926C>A	BC000249	CCDS33932.1, CCDS46993.1, CCDS54703.1	4p16.3	2014-01-28	2008-07-31		ENSG00000133256	ENSG00000133256	3.1.4.17	"""Phosphodiesterases"""	8786	protein-coding gene	gene with protein product	"""congenital stationary night blindness 3, autosomal dominant"""	180072		PDEB		1313787	Standard	NM_001145292		Approved	CSNB3, rd1, RP40, CSNBAD2	uc003gap.3	P35913	OTTHUMG00000159909	ENST00000496514.1:c.910C>A	4.37:g.647926C>A	ENSP00000420295:p.Arg304Ser		Somatic				PDE6B_uc003gao.3_Missense_Mutation_p.R304S|PDE6B_uc011buy.1_Missense_Mutation_p.R25S|PDE6B_uc010ibg.2_Missense_Mutation_p.R25S|uc003gaq.1_RNA	p.R304S	NM_000283	NP_000274	WXS	Illumina HiSeq	Unspecified	P35913	PDE6B_HUMAN			5	963	+			304			GAF 2.		B7Z9T9|E7ETT3|Q53XN5|Q9BWH5|Q9UD49	Missense_Mutation	SNP	ENST00000496514.1	37	c.910C>A	CCDS33932.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.125660	0.77436	.	.	ENSG00000133256	ENST00000255622;ENST00000496514;ENST00000465426;ENST00000487902;ENST00000429163	T;T;T;T;T	0.73363	-0.21;-0.21;-0.26;-0.74;-0.21	5.1	5.1	0.69264	GAF (2);	0.411101	0.26594	N	0.023515	T	0.78792	0.4339	L	0.54323	1.7	0.43579	D	0.995918	P;P;P	0.51147	0.942;0.942;0.929	P;P;P	0.54210	0.745;0.657;0.525	T	0.76680	-0.2870	10	0.31617	T	0.26	.	16.0314	0.80579	0.0:1.0:0.0:0.0	.	25;304;304	B4DHV7;P35913;P35913-2	.;PDE6B_HUMAN;.	S	304;304;25;25;25	ENSP00000255622:R304S;ENSP00000420295:R304S;ENSP00000418454:R25S;ENSP00000418256:R25S;ENSP00000406334:R25S	ENSP00000255622:R304S	R	+	1	0	PDE6B	637926	0.819000	0.29175	1.000000	0.80357	0.894000	0.52154	2.172000	0.42463	2.368000	0.80403	0.643000	0.83706	CGC		0.642	PDE6B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000358109.1	NM_000283		21	49	1	0	8.16277e-20	0.006999	1.19594e-19	21	49				
DCAF16	54876	broad.mit.edu	37	4	17805366	17805366	+	Silent	SNP	C	C	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr4:17805366C>A	ENST00000382247.1	-	3	1459	c.399G>T	c.(397-399)cgG>cgT	p.R133R	DCAF16_ENST00000507768.1_5'Flank|DCAF16_ENST00000536863.1_Silent_p.R133R	NM_017741.3	NP_060211.3	Q9NXF7	DCA16_HUMAN	DDB1 and CUL4 associated factor 16	133					protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)		p.R133R(1)		cervix(1)|endometrium(1)|lung(2)|ovary(1)	5						CTCTAGAGAGCCGGCTGGGAC	0.502																																							uc003gpn.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(397-399)CGG>CGT		DDB1 and CUL4 associated factor 16							172.0	178.0	176.0					4																	17805366		2203	4300	6503	SO:0001819	synonymous_variant	54876					CUL4 RING ubiquitin ligase complex		g.chr4:17805366C>A	AK000287	CCDS3423.1	4p15.32	2009-07-17	2009-07-17	2009-07-17	ENSG00000163257	ENSG00000163257		"""DDB1 and CUL4 associated factors"""	25987	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 30"""	C4orf30		12477932	Standard	XM_005248169		Approved	FLJ20280	uc003gpn.3	Q9NXF7	OTTHUMG00000128536	ENST00000382247.1:c.399G>T	4.37:g.17805366C>A			Somatic				DCAF16_uc003gpo.2_RNA	p.R133R	NM_017741	NP_060211	WXS	Illumina HiSeq	Unspecified	Q9NXF7	DCA16_HUMAN			3	1460	-			133					B3KPB7	Silent	SNP	ENST00000382247.1	37	c.399G>T	CCDS3423.1																																																																																				0.502	DCAF16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250371.1	NM_017741		75	144	1	0	1.32764e-51	0.01441	2.28707e-51	75	144				
PCDH7	5099	broad.mit.edu	37	4	31144129	31144129	+	Silent	SNP	G	G	T	rs372979435		TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr4:31144129G>T	ENST00000543491.1	+	3	3426	c.3426G>T	c.(3424-3426)ggG>ggT	p.G1142G				O60245	PCDH7_HUMAN	protocadherin 7	0					homophilic cell adhesion (GO:0007156)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G1087G(1)		NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(8)|liver(1)|lung(26)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	55						CCCTGACTGGGAAGTGCACTC	0.512																																							uc011bxx.1		NA																	1	Substitution - coding silent(1)		lung(1)	upper_aerodigestive_tract(1)|ovary(1)|liver(1)|skin(1)	4						c.(3400-3402)GGG>GGT		protocadherin 7 isoform a precursor							105.0	102.0	103.0					4																	31144129		2003	4186	6189	SO:0001819	synonymous_variant	5099				homophilic cell adhesion	integral to plasma membrane	calcium ion binding	g.chr4:31144129G>T	AB006755	CCDS33971.1, CCDS75116.1	4p15	2014-06-13	2007-02-12			ENSG00000169851		"""Cadherins / Protocadherins : Non-clustered"""	8659	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 120"""	602988	"""BH-protocadherin (brain-heart)"""			9615233	Standard	NM_002589		Approved	BH-Pcdh, PPP1R120	uc021xnd.1	O60245		ENST00000543491.1:c.3426G>T	4.37:g.31144129G>T			Somatic				PCDH7_uc011bxw.1_Silent_p.G1087G	p.G1134G	NM_002589	NP_002580	WXS	Illumina HiSeq	Unspecified	O60245	PCDH7_HUMAN			3	4410	+			Error:Variant_position_missing_in_O60245_after_alignment					O60246|O60247|Q4W5C4	Silent	SNP	ENST00000543491.1	37	c.3402G>T	CCDS54753.1	.	.	.	.	.	.	.	.	.	.	G	5.976	0.364082	0.11296	.	.	ENSG00000169851	ENST00000511884	.	.	.	5.86	3.12	0.35913	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.6723	0.28465	0.1353:0.2641:0.6006:0.0	.	.	.	.	X	824	.	.	E	+	1	0	PCDH7	30753227	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.041000	0.30291	0.439000	0.26476	0.650000	0.86243	GAA		0.512	PCDH7-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_032457, NM_002589		22	99	1	0	1.55469e-16	0.00333	2.1835e-16	22	99				
KLB	152831	broad.mit.edu	37	4	39408690	39408691	+	Missense_Mutation	DNP	CT	CT	AA			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	CT	CT	-	-	CT	CT	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr4:39408690_39408691CT>AA	ENST00000257408.4	+	1	218_219	c.121_122CT>AA	c.(121-123)CTg>AAg	p.L41K		NM_175737.3	NP_783864.1	Q86Z14	KLOTB_HUMAN	klotho beta	41					carbohydrate metabolic process (GO:0005975)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	fibroblast growth factor binding (GO:0017134)|hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)	p.L41K(1)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(11)|skin(6)	29						ATCTGTCATCCTGTCAGCACTT	0.416																																							uc003gua.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(121-123)CTG>AAG		klotho beta																																				SO:0001583	missense	152831				carbohydrate metabolic process	integral to membrane|plasma membrane	cation binding|fibroblast growth factor binding|hydrolase activity, hydrolyzing O-glycosyl compounds	g.chr4:39408690_39408691CT>AA	AB079373	CCDS3451.1	4p14	2008-02-05			ENSG00000134962	ENSG00000134962			15527	protein-coding gene	gene with protein product		611135					Standard	NM_175737		Approved		uc003gua.3	Q86Z14	OTTHUMG00000128577	Exception_encountered	4.37:g.39408690_39408691delinsAA	ENSP00000257408:p.Leu41Lys		Somatic				KLB_uc011byj.1_Missense_Mutation_p.L41K	p.L41K	NM_175737	NP_783864	WXS	Illumina HiSeq	Unspecified	Q86Z14	KLOTB_HUMAN			1	218_219	+			41			Extracellular (Potential).		Q2M3K8	Missense_Mutation	DNP	ENST00000257408.4	37	c.121_122CT>AA	CCDS3451.1																																																																																				0.416	KLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250429.1	NM_175737		26	84	0	0	0	0.004672	0	26	84				
ATP10D	57205	broad.mit.edu	37	4	47556801	47556801	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr4:47556801G>T	ENST00000273859.3	+	11	1963	c.1694G>T	c.(1693-1695)cGg>cTg	p.R565L	AC092597.3_ENST00000508081.1_RNA	NM_020453.3	NP_065186.3	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D	565					cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.R565L(1)		NS(2)|endometrium(5)|kidney(5)|large_intestine(14)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	66						ATTACACCTCGGCTCTTTATG	0.388																																							uc003gxk.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|pancreas(1)	3						c.(1693-1695)CGG>CTG		ATPase, class V, type 10D							101.0	101.0	101.0					4																	47556801		2203	4300	6503	SO:0001583	missense	57205				ATP biosynthetic process|cation transport	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity	g.chr4:47556801G>T	AB040920	CCDS3476.1	4p12	2010-04-20	2007-09-19		ENSG00000145246	ENSG00000145246		"""ATPases / P-type"""	13549	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10D"""			12532265	Standard	NM_020453		Approved	ATPVD, KIAA1487	uc003gxk.1	Q9P241	OTTHUMG00000160784	ENST00000273859.3:c.1694G>T	4.37:g.47556801G>T	ENSP00000273859:p.Arg565Leu		Somatic				ATP10D_uc003gxl.1_Intron	p.R565L	NM_020453	NP_065186	WXS	Illumina HiSeq	Unspecified	Q9P241	AT10D_HUMAN			11	1858	+			565			Cytoplasmic (Potential).		A2RRC8|D6REN2|Q8NC70|Q96SR3	Missense_Mutation	SNP	ENST00000273859.3	37	c.1694G>T	CCDS3476.1	.	.	.	.	.	.	.	.	.	.	G	4.780	0.145034	0.09134	.	.	ENSG00000145246	ENST00000273859	T	0.37584	1.19	5.19	2.74	0.32292	HAD-like domain (1);	0.819826	0.10816	N	0.631071	T	0.15349	0.0370	N	0.04959	-0.14	0.35402	D	0.791654	B	0.02656	0.0	B	0.04013	0.001	T	0.25537	-1.0129	10	0.11182	T	0.66	-1.9542	5.4628	0.16626	0.657:0.0:0.0769:0.2661	.	565	Q9P241	AT10D_HUMAN	L	565	ENSP00000273859:R565L	ENSP00000273859:R565L	R	+	2	0	ATP10D	47251558	0.143000	0.22626	0.696000	0.30242	0.676000	0.39594	1.545000	0.36169	0.371000	0.24564	-0.302000	0.09304	CGG		0.388	ATP10D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216900.1	NM_020453		25	94	1	0	7.07758e-08	0.004656	8.34549e-08	25	94				
GC	2638	broad.mit.edu	37	4	72631270	72631270	+	Nonsense_Mutation	SNP	C	C	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr4:72631270C>A	ENST00000273951.8	-	4	695	c.352G>T	c.(352-354)Gaa>Taa	p.E118*	GC_ENST00000513476.1_Nonsense_Mutation_p.E118*|GC_ENST00000504199.1_Nonsense_Mutation_p.E137*|GC_ENST00000503472.1_5'UTR	NM_000583.3|NM_001204306.1	NP_000574.2|NP_001191235.1	P02774	VTDB_HUMAN	group-specific component (vitamin D binding protein)	118	Albumin 1. {ECO:0000255|PROSITE- ProRule:PRU00769}.				small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)|vitamin transport (GO:0051180)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	actin binding (GO:0003779)|calcidiol binding (GO:1902118)|vitamin D binding (GO:0005499)|vitamin transporter activity (GO:0051183)	p.E118*(1)|p.E137*(1)		endometrium(5)|kidney(1)|large_intestine(4)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)	45		all_hematologic(202;0.107)	Lung(101;0.148)		Alfacalcidol(DB01436)|Cholecalciferol(DB00169)	AGCTTTCGTTCCAGGCCCTCT	0.527																																							uc003hge.2		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(2)|upper_aerodigestive_tract(1)	3						c.(352-354)GAA>TAA		vitamin D-binding protein precursor	Cholecalciferol(DB00169)						144.0	131.0	135.0					4																	72631270		2203	4300	6503	SO:0001587	stop_gained	2638				hormone biosynthetic process|vitamin D metabolic process	cytosol|lysosomal lumen	actin binding|vitamin D binding|vitamin transporter activity	g.chr4:72631270C>A	L10641	CCDS3550.1, CCDS56332.1	4q12-q13	2008-08-29			ENSG00000145321	ENSG00000145321			4187	protein-coding gene	gene with protein product		139200				558959	Standard	NM_000583		Approved	DBP, VDBP, hDBP	uc010iif.3	P02774	OTTHUMG00000129915	ENST00000273951.8:c.352G>T	4.37:g.72631270C>A	ENSP00000273951:p.Glu118*		Somatic				GC_uc003hgd.2_5'UTR|GC_uc010iie.2_Nonsense_Mutation_p.E118*|GC_uc010iif.2_Nonsense_Mutation_p.E137*	p.E118*	NM_000583	NP_000574	WXS	Illumina HiSeq	Unspecified	P02774	VTDB_HUMAN	Lung(101;0.148)		4	505	-		all_hematologic(202;0.107)	118			Albumin 1.		B4DPP2|D6RAK8|Q16309|Q16310|Q53F31|Q6GTG1	Nonsense_Mutation	SNP	ENST00000273951.8	37	c.352G>T	CCDS3550.1	.	.	.	.	.	.	.	.	.	.	C	24.2	4.503542	0.85176	.	.	ENSG00000145321	ENST00000273951;ENST00000504199;ENST00000513476;ENST00000506245	.	.	.	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	19.3614	0.94440	0.0:1.0:0.0:0.0	.	.	.	.	X	118;137;118;118	.	ENSP00000273951:E118X	E	-	1	0	GC	72850134	0.993000	0.37304	0.139000	0.22197	0.003000	0.03518	4.084000	0.57650	2.735000	0.93741	0.655000	0.94253	GAA		0.527	GC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252167.2			28	75	1	0	5.60225e-13	0.009535	7.41919e-13	28	75				
HELQ	113510	broad.mit.edu	37	4	84348734	84348734	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr4:84348734C>A	ENST00000295488.3	-	13	2820	c.2658G>T	c.(2656-2658)tgG>tgT	p.W886C	HELQ_ENST00000510985.1_Missense_Mutation_p.W819C	NM_133636.2	NP_598375	Q8TDG4	HELQ_HUMAN	helicase, POLQ-like	886					double-strand break repair via homologous recombination (GO:0000724)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)	p.W886C(1)		breast(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(10)|lung(17)|ovary(2)|skin(2)	38						AGTATATCATCCAATCAGGGT	0.368								Other identified genes with known or suspected DNA repair function																															uc003hom.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)|skin(1)	3						c.(2656-2658)TGG>TGT	Direct_reversal_of_damage|Other_identified_genes_with_known_or_suspected_DNA_repair_function	DNA helicase HEL308							100.0	98.0	99.0					4																	84348734		2203	4300	6503	SO:0001583	missense	113510						ATP binding|ATP-dependent helicase activity|nucleic acid binding	g.chr4:84348734C>A	AF436845	CCDS3603.1, CCDS75158.1	4q21.23	2009-02-26			ENSG00000163312	ENSG00000163312			18536	protein-coding gene	gene with protein product		606769				11751861	Standard	XM_005262711		Approved	Hel308	uc003hom.3	Q8TDG4	OTTHUMG00000130423	ENST00000295488.3:c.2658G>T	4.37:g.84348734C>A	ENSP00000295488:p.Trp886Cys		Somatic				HELQ_uc010ikb.2_Missense_Mutation_p.W819C|HELQ_uc003hol.3_RNA|HELQ_uc010ikc.2_RNA	p.W886C	NM_133636	NP_598375	WXS	Illumina HiSeq	Unspecified	Q8TDG4	HELQ_HUMAN			13	2837	-			886					Q05DF9|Q502W9|Q659B8|Q6ZQX4|Q6ZTS4|Q96EX7	Missense_Mutation	SNP	ENST00000295488.3	37	c.2658G>T	CCDS3603.1	.	.	.	.	.	.	.	.	.	.	C	19.04	3.749611	0.69533	.	.	ENSG00000163312	ENST00000295488;ENST00000510985	T;T	0.70986	-0.27;-0.53	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	D	0.86585	0.5968	M	0.86028	2.79	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.971	D	0.87812	0.2632	10	0.66056	D	0.02	.	19.6115	0.95608	0.0:1.0:0.0:0.0	.	819;886	E3W980;Q8TDG4	.;HELQ_HUMAN	C	886;819	ENSP00000295488:W886C;ENSP00000424539:W819C	ENSP00000295488:W886C	W	-	3	0	HELQ	84567758	1.000000	0.71417	1.000000	0.80357	0.743000	0.42351	7.800000	0.85949	2.631000	0.89168	0.563000	0.77884	TGG		0.368	HELQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252810.1	NM_133636		32	77	1	0	3.03874e-20	0.003271	4.48189e-20	32	77				
CFI	3426	broad.mit.edu	37	4	110687980	110687980	+	Splice_Site	SNP	C	C	G			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr4:110687980C>G	ENST00000394634.2	-	2	265	c.58G>C	c.(58-60)Gtc>Ctc	p.V20L	CFI_ENST00000394635.3_Splice_Site_p.V20L|CFI_ENST00000510800.1_Splice_Site_p.V20L|CFI_ENST00000512148.1_Splice_Site_p.V20L	NM_000204.3	NP_000195	P05156	CFAI_HUMAN	complement factor I	20					complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	metal ion binding (GO:0046872)|scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)	p.V20L(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|skin(2)|stomach(1)	27		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000331)		GTATAAGTGACCTGTAAAATG	0.388																																							uc003hzr.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(58-60)GTC>CTC		complement factor I preproprotein							79.0	78.0	78.0					4																	110687980		2203	4300	6503	SO:0001630	splice_region_variant	3426				complement activation, classical pathway|innate immune response|proteolysis	extracellular space|membrane	scavenger receptor activity|serine-type endopeptidase activity	g.chr4:110687980C>G	J02770	CCDS34049.1	4q25	2014-09-17	2006-02-10	2006-02-10		ENSG00000205403	3.4.21.45	"""Complement system"""	5394	protein-coding gene	gene with protein product	"""Konglutinogen-activating factor"", ""C3b-inactivator"""	217030	"""I factor (complement)"""	IF		2956252	Standard	NM_000204		Approved	FI, C3b-INA, KAF	uc003hzr.4	P05156		ENST00000394634.2:c.58-1G>C	4.37:g.110687980C>G			Somatic				CFI_uc011cft.1_Missense_Mutation_p.V20L|CFI_uc003hzs.3_Missense_Mutation_p.V20L	p.V20L	NM_000204	NP_000195	WXS	Illumina HiSeq	Unspecified	P05156	CFAI_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000331)	2	266	-		Hepatocellular(203;0.217)	20					O60442	Missense_Mutation	SNP	ENST00000394634.2	37	c.58G>C	CCDS34049.1	.	.	.	.	.	.	.	.	.	.	C	2.324	-0.354890	0.05138	.	.	ENSG00000205403	ENST00000394635;ENST00000394634;ENST00000540104;ENST00000512148;ENST00000536228;ENST00000510800	D;D;D	0.90133	-2.55;-2.57;-2.62	4.45	-8.29	0.01009	.	2.226600	0.01671	N	0.025589	T	0.75347	0.3837	N	0.10874	0.06	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.001;0.0	T	0.67169	-0.5738	10	0.19147	T	0.46	4.9846	3.2418	0.06783	0.4231:0.3509:0.1246:0.1014	.	20;20;20	E7ETH0;G3XAM2;P05156	.;.;CFAI_HUMAN	L	20;20;20;20;2;20	ENSP00000378131:V20L;ENSP00000378130:V20L;ENSP00000427438:V20L	ENSP00000378130:V20L	V	-	1	0	CFI	110907429	0.000000	0.05858	0.000000	0.03702	0.042000	0.13812	-2.001000	0.01465	-1.461000	0.01909	-0.368000	0.07277	GTC		0.388	CFI-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_000204	Missense_Mutation	8	55	0	0	0	0.006214	0	8	55				
ENPEP	2028	broad.mit.edu	37	4	111430928	111430928	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr4:111430928G>T	ENST00000265162.5	+	5	1501	c.1159G>T	c.(1159-1161)Gtg>Ttg	p.V387L	RP11-380D23.1_ENST00000503998.1_RNA	NM_001977.3	NP_001968.3	Q07075	AMPE_HUMAN	glutamyl aminopeptidase (aminopeptidase A)	387					angiogenesis (GO:0001525)|angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|cellular protein metabolic process (GO:0044267)|glomerulus development (GO:0032835)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|brush border (GO:0005903)|cytoplasmic vesicle (GO:0031410)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metalloaminopeptidase activity (GO:0070006)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(22)|ovary(1)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(1)	54		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.0031)		CCAACAGAGGGTGGCCACTGT	0.458																																							uc003iab.3		NA																	0				skin(3)|ovary(1)|breast(1)	5						c.(1159-1161)GTG>TTG		glutamyl aminopeptidase	L-Glutamic Acid(DB00142)						131.0	124.0	127.0					4																	111430928		2203	4300	6503	SO:0001583	missense	2028				cell migration|cell proliferation|cell-cell signaling|proteolysis	integral to plasma membrane	aminopeptidase activity|metalloexopeptidase activity|zinc ion binding	g.chr4:111430928G>T	L12468	CCDS3691.1	4q25	2008-02-05			ENSG00000138792	ENSG00000138792	3.4.11.7	"""CD molecules"""	3355	protein-coding gene	gene with protein product		138297				9268642	Standard	NM_001977		Approved	gp160, CD249	uc003iab.4	Q07075	OTTHUMG00000132546	ENST00000265162.5:c.1159G>T	4.37:g.111430928G>T	ENSP00000265162:p.Val387Leu		Somatic					p.V387L	NM_001977	NP_001968	WXS	Illumina HiSeq	Unspecified	Q07075	AMPE_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.0031)	5	1501	+		Hepatocellular(203;0.217)	387			Extracellular (Potential).		Q504U2	Missense_Mutation	SNP	ENST00000265162.5	37	c.1159G>T	CCDS3691.1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.225991	0.79576	.	.	ENSG00000138792	ENST00000265162	T	0.03468	3.92	5.63	5.63	0.86233	Peptidase M1, membrane alanine aminopeptidase, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.24547	0.0595	M	0.87682	2.9	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.01169	-1.1430	10	0.72032	D	0.01	.	19.67	0.95909	0.0:0.0:1.0:0.0	.	387	Q07075	AMPE_HUMAN	L	387	ENSP00000265162:V387L	ENSP00000265162:V387L	V	+	1	0	ENPEP	111650377	1.000000	0.71417	0.979000	0.43373	0.292000	0.27327	7.954000	0.87848	2.641000	0.89580	0.563000	0.77884	GTG		0.458	ENPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255747.2			36	58	1	0	3.61848e-18	0.007835	5.17398e-18	36	58				
ALPK1	80216	broad.mit.edu	37	4	113356422	113356422	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr4:113356422G>T	ENST00000458497.1	+	12	3432	c.3153G>T	c.(3151-3153)tgG>tgT	p.W1051C	ALPK1_ENST00000177648.9_Missense_Mutation_p.W1051C|ALPK1_ENST00000504176.2_Missense_Mutation_p.W973C	NM_001102406.1|NM_025144.3	NP_001095876.1|NP_079420.3	Q96QP1	ALPK1_HUMAN	alpha-kinase 1	1051	Alpha-type protein kinase. {ECO:0000255|PROSITE-ProRule:PRU00501}.						ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.W1051C(1)		NS(1)|breast(1)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(11)|lung(20)|ovary(6)|prostate(2)|urinary_tract(1)	53		Ovarian(17;0.0446)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00325)		ATGCTTTTTGGGTTCATCATC	0.358																																							uc003iap.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)	5						c.(3151-3153)TGG>TGT		alpha-kinase 1							141.0	164.0	156.0					4																	113356422		2203	4299	6502	SO:0001583	missense	80216						ATP binding|protein serine/threonine kinase activity	g.chr4:113356422G>T	AY044164	CCDS3697.1, CCDS58923.1	4q26	2008-02-05			ENSG00000073331	ENSG00000073331			20917	protein-coding gene	gene with protein product	"""lymphocyte alpha-kinase"""	607347				10021370, 10819331	Standard	NM_025144		Approved	Lak, FLJ22670, KIAA1527	uc003ian.4	Q96QP1	OTTHUMG00000132911	ENST00000458497.1:c.3153G>T	4.37:g.113356422G>T	ENSP00000398048:p.Trp1051Cys		Somatic				ALPK1_uc003ian.3_Missense_Mutation_p.W1051C|ALPK1_uc011cfx.1_Missense_Mutation_p.W973C|ALPK1_uc003iao.3_RNA|ALPK1_uc010imo.2_Missense_Mutation_p.W879C	p.W1051C	NM_025144	NP_079420	WXS	Illumina HiSeq	Unspecified	Q96QP1	ALPK1_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.00325)	12	3432	+		Ovarian(17;0.0446)|Hepatocellular(203;0.217)	1051			Alpha-type protein kinase.		B4E3G1|F5H138|Q68CI9|Q6P9F9|Q6ZNK4|Q9P201	Missense_Mutation	SNP	ENST00000458497.1	37	c.3153G>T	CCDS3697.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.204664	0.79127	.	.	ENSG00000073331	ENST00000458497;ENST00000177648;ENST00000504176	T;T;T	0.13657	2.57;2.57;2.57	5.94	5.94	0.96194	MHCK/EF2 kinase (3);Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.38719	0.1051	M	0.63428	1.95	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.79108	0.98;0.992;0.979	T	0.02676	-1.1125	10	0.87932	D	0	-11.7101	20.3594	0.98849	0.0:0.0:1.0:0.0	.	973;973;1051	F5H138;B4E3G1;Q96QP1	.;.;ALPK1_HUMAN	C	1051;1051;973	ENSP00000398048:W1051C;ENSP00000177648:W1051C;ENSP00000426044:W973C	ENSP00000177648:W1051C	W	+	3	0	ALPK1	113575871	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.493000	0.90474	2.816000	0.96949	0.563000	0.77884	TGG		0.358	ALPK1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256421.2	NM_025144		76	142	1	0	4.97629e-18	0.01441	7.05641e-18	76	142				
FAT4	79633	broad.mit.edu	37	4	126239750	126239750	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr4:126239750A>G	ENST00000394329.3	+	1	2197	c.2184A>G	c.(2182-2184)atA>atG	p.I728M		NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	728	Cadherin 7. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.I728M(2)		NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						AATATAGCATATCTGCTGGGG	0.468																																							uc003ifj.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18						c.(2182-2184)ATA>ATG		FAT tumor suppressor homolog 4 precursor							78.0	78.0	78.0					4																	126239750		1989	4162	6151	SO:0001583	missense	79633				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr4:126239750A>G	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.2184A>G	4.37:g.126239750A>G	ENSP00000377862:p.Ile728Met		Somatic					p.I728M	NM_024582	NP_078858	WXS	Illumina HiSeq	Unspecified	Q6V0I7	FAT4_HUMAN			1	2184	+			728			Cadherin 7.|Extracellular (Potential).		A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	ENST00000394329.3	37	c.2184A>G	CCDS3732.3	.	.	.	.	.	.	.	.	.	.	A	22.0	4.230135	0.79688	.	.	ENSG00000196159	ENST00000394329	T	0.01998	4.51	5.28	-2.41	0.06562	Cadherin (4);Cadherin-like (1);	0.000000	0.36409	U	0.002607	T	0.05777	0.0151	L	0.58354	1.805	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.40887	-0.9539	10	0.44086	T	0.13	.	3.7132	0.08428	0.2382:0.4833:0.0748:0.2037	.	728	Q6V0I7	FAT4_HUMAN	M	728	ENSP00000377862:I728M	ENSP00000377862:I728M	I	+	3	3	FAT4	126459200	0.994000	0.37717	0.690000	0.30148	0.554000	0.35429	0.479000	0.22228	-0.261000	0.09405	-0.313000	0.08912	ATA		0.468	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582		20	92	0	0	0	0.012319	0	20	92				
LRBA	987	broad.mit.edu	37	4	151773298	151773298	+	Silent	SNP	T	T	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr4:151773298T>A	ENST00000357115.3	-	23	3807	c.3564A>T	c.(3562-3564)tcA>tcT	p.S1188S	LRBA_ENST00000535741.1_Silent_p.S1188S|LRBA_ENST00000510413.1_Silent_p.S1188S|LRBA_ENST00000507224.1_Silent_p.S1188S	NM_006726.4	NP_006717.2	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and anchor containing	1188						cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.S1188S(1)		breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(20)|lung(32)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	91	all_hematologic(180;0.151)					GTGACATAGCTGAAGACCCTG	0.398																																							uc010ipj.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|breast(3)|skin(1)	7						c.(3562-3564)TCA>TCT		LPS-responsive vesicle trafficking, beach and							92.0	90.0	91.0					4																	151773298		2203	4300	6503	SO:0001819	synonymous_variant	987					endoplasmic reticulum|Golgi apparatus|integral to membrane|lysosome|plasma membrane	protein binding	g.chr4:151773298T>A	AF216648	CCDS3773.1, CCDS58928.1	4q13	2013-01-10		2001-10-05	ENSG00000198589	ENSG00000198589		"""WD repeat domain containing"""	1742	protein-coding gene	gene with protein product		606453		CDC4L		1505956, 11254716	Standard	NM_006726		Approved	BGL, LAB300, LBA	uc010ipj.3	P50851	OTTHUMG00000161443	ENST00000357115.3:c.3564A>T	4.37:g.151773298T>A			Somatic				LRBA_uc003ilt.3_5'Flank|LRBA_uc003ilu.3_Silent_p.S1188S	p.S1188S	NM_006726	NP_006717	WXS	Illumina HiSeq	Unspecified	P50851	LRBA_HUMAN			23	4038	-	all_hematologic(180;0.151)		1188					Q4W5J4|Q4W5L6|Q8NFQ0|Q9H2U3|Q9H2U4	Silent	SNP	ENST00000357115.3	37	c.3564A>T	CCDS3773.1																																																																																				0.398	LRBA-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364939.1			18	47	0	0	0	0.010504	0	18	47				
FHDC1	85462	broad.mit.edu	37	4	153864685	153864685	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr4:153864685C>T	ENST00000511601.1	+	2	664	c.476C>T	c.(475-477)tCc>tTc	p.S159F	FHDC1_ENST00000260008.3_Missense_Mutation_p.S159F			Q9C0D6	FHDC1_HUMAN	FH2 domain containing 1	159	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.							p.S159F(1)	ARFIP1/FHDC1(2)	NS(2)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|liver(2)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	43	all_hematologic(180;0.093)					TTAAATTCATCCTTCAGAGAA	0.438																																							uc003inf.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|ovary(1)	2						c.(475-477)TCC>TTC		FH2 domain containing 1							55.0	62.0	59.0					4																	153864685		2199	4299	6498	SO:0001583	missense	85462				actin cytoskeleton organization		actin binding	g.chr4:153864685C>T	AB051514	CCDS34081.1	4q31.3	2014-02-12	2007-11-29		ENSG00000137460	ENSG00000137460			29363	protein-coding gene	gene with protein product						15138637	Standard	NM_033393		Approved	KIAA1727	uc003inf.2	Q9C0D6	OTTHUMG00000161452	ENST00000511601.1:c.476C>T	4.37:g.153864685C>T	ENSP00000427567:p.Ser159Phe		Somatic					p.S159F	NM_033393	NP_203751	WXS	Illumina HiSeq	Unspecified	Q9C0D6	FHDC1_HUMAN			1	551	+	all_hematologic(180;0.093)		159			FH2.			Missense_Mutation	SNP	ENST00000511601.1	37	c.476C>T	CCDS34081.1	.	.	.	.	.	.	.	.	.	.	C	17.15	3.315641	0.60524	.	.	ENSG00000137460	ENST00000511601;ENST00000260008	T;T	0.64618	-0.11;-0.11	5.33	5.33	0.75918	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.363429	0.33515	N	0.004836	D	0.83128	0.5187	M	0.88570	2.965	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.85082	0.0946	10	0.54805	T	0.06	.	19.397	0.94611	0.0:1.0:0.0:0.0	.	159	Q9C0D6	FHDC1_HUMAN	F	159	ENSP00000427567:S159F;ENSP00000260008:S159F	ENSP00000260008:S159F	S	+	2	0	FHDC1	154084135	1.000000	0.71417	0.995000	0.50966	0.222000	0.24845	5.662000	0.68032	2.665000	0.90641	0.655000	0.94253	TCC		0.438	FHDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364981.2	NM_033393		21	93	0	0	0	0.010504	0	21	93				
SPOCK3	50859	broad.mit.edu	37	4	167656177	167656177	+	Silent	SNP	C	C	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr4:167656177C>T	ENST00000357154.3	-	12	1343	c.1206G>A	c.(1204-1206)gaG>gaA	p.E402E	SPOCK3_ENST00000421836.2_Silent_p.E351E|SPOCK3_ENST00000502330.1_Silent_p.E402E|SPOCK3_ENST00000507137.1_5'UTR|SPOCK3_ENST00000534949.1_Silent_p.E306E|SPOCK3_ENST00000512681.1_Silent_p.E304E|SPOCK3_ENST00000541637.1_Silent_p.E304E|SPOCK3_ENST00000535728.1_Silent_p.E270E|SPOCK3_ENST00000511269.1_Silent_p.E399E|SPOCK3_ENST00000541354.1_Silent_p.E282E|SPOCK3_ENST00000510741.1_Silent_p.E359E|SPOCK3_ENST00000357545.4_Silent_p.E399E|SPOCK3_ENST00000511531.1_Silent_p.E402E|SPOCK3_ENST00000506886.1_Silent_p.E402E|SPOCK3_ENST00000504953.1_Silent_p.E399E	NM_016950.2	NP_058646.2	Q9BQ16	TICN3_HUMAN	sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 3	402	Asp-rich.				negative regulation of endopeptidase activity (GO:0010951)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|signal transduction (GO:0007165)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|glycosaminoglycan binding (GO:0005539)|metalloendopeptidase inhibitor activity (GO:0008191)	p.E399E(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	38	all_hematologic(180;0.221)	Prostate(90;0.0181)|Renal(120;0.0184)|Melanoma(52;0.0198)		GBM - Glioblastoma multiforme(119;0.02)		cttcatcatcctcatcatcag	0.353																																							uc003iri.1		NA																	1	Substitution - coding silent(1)	p.E402*(1)	lung(1)	large_intestine(1)|ovary(1)|central_nervous_system(1)	3						c.(1204-1206)GAG>GAA		testican 3 isoform 2							186.0	171.0	176.0					4																	167656177		2203	4300	6503	SO:0001819	synonymous_variant	50859				signal transduction	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase inhibitor activity	g.chr4:167656177C>T	AJ001454	CCDS34095.1, CCDS54817.1, CCDS56343.1, CCDS56344.1, CCDS56346.1, CCDS56347.1, CCDS58931.1, CCDS75207.1	4q32.3	2011-10-10			ENSG00000196104	ENSG00000196104			13565	protein-coding gene	gene with protein product		607989				11751414	Standard	NM_001204352		Approved	testican-3	uc003iri.1	Q9BQ16	OTTHUMG00000161190	ENST00000357154.3:c.1206G>A	4.37:g.167656177C>T			Somatic				SPOCK3_uc011cjp.1_Silent_p.E359E|SPOCK3_uc011cjq.1_Silent_p.E411E|SPOCK3_uc011cjr.1_Silent_p.E282E|SPOCK3_uc003irj.1_Silent_p.E399E|SPOCK3_uc011cjs.1_Silent_p.E351E|SPOCK3_uc011cjt.1_Silent_p.E310E|SPOCK3_uc011cju.1_Silent_p.E295E|SPOCK3_uc011cjv.1_Silent_p.E304E	p.E402E	NM_016950	NP_058646	WXS	Illumina HiSeq	Unspecified	Q9BQ16	TICN3_HUMAN		GBM - Glioblastoma multiforme(119;0.02)	12	1347	-	all_hematologic(180;0.221)	Prostate(90;0.0181)|Renal(120;0.0184)|Melanoma(52;0.0198)	402			Asp-rich.		B2R7M7|B3KR67|B4DGK5|B4DHB4|B4DHV3|B4DI46|B4DJY3|E7EP61|F5H099|O75705|Q6UW53|Q96Q26	Silent	SNP	ENST00000357154.3	37	c.1206G>A	CCDS54817.1																																																																																				0.353	SPOCK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364091.1			4	6	0	0	0	0.000602	0	4	6				
TENM3	55714	broad.mit.edu	37	4	183676073	183676073	+	Missense_Mutation	SNP	A	A	C			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr4:183676073A>C	ENST00000511685.1	+	22	4676	c.4553A>C	c.(4552-4554)gAt>gCt	p.D1518A	TENM3_ENST00000406950.2_Missense_Mutation_p.D1518A|TENM3_ENST00000502950.1_3'UTR			Q9P273	TEN3_HUMAN	teneurin transmembrane protein 3	1518					camera-type eye morphogenesis (GO:0048593)|homophilic cell adhesion (GO:0007156)|positive regulation of neuron projection development (GO:0010976)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.D1518A(1)									TCTCCAACTGATCAAGAACTC	0.378																																							uc003ivd.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(4552-4554)GAT>GCT		odz, odd Oz/ten-m homolog 3							78.0	78.0	78.0					4																	183676073		1909	4121	6030	SO:0001583	missense	55714				signal transduction	integral to membrane		g.chr4:183676073A>C	AF195420	CCDS47165.1	4q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000218336	ENSG00000218336			29944	protein-coding gene	gene with protein product		610083	"""odz, odd Oz/ten-m homolog 3 (Drosophila)"""	ODZ3		10331952, 10625539	Standard	NM_001080477		Approved	Ten-M3, KIAA1455	uc003ivd.1	Q9P273	OTTHUMG00000160682	ENST00000511685.1:c.4553A>C	4.37:g.183676073A>C	ENSP00000424226:p.Asp1518Ala		Somatic				ODZ3_uc003ive.1_Missense_Mutation_p.D931A	p.D1518A	NM_001080477	NP_001073946	WXS	Illumina HiSeq	Unspecified	Q9P273	TEN3_HUMAN		all cancers(43;1.42e-24)|Epithelial(43;6.86e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.16e-11)|Colorectal(24;9.75e-06)|STAD - Stomach adenocarcinoma(60;2.96e-05)|COAD - Colon adenocarcinoma(29;0.00103)|GBM - Glioblastoma multiforme(59;0.00462)|LUSC - Lung squamous cell carcinoma(40;0.0391)|READ - Rectum adenocarcinoma(43;0.0487)	21	4590	+		all_lung(41;2.69e-14)|Lung NSC(41;1.92e-11)|Melanoma(52;1.74e-05)|Colorectal(36;0.0062)|Breast(14;0.00748)|all_hematologic(60;0.0162)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_neural(102;0.155)|Medulloblastoma(177;0.184)	1518			Extracellular (Potential).|YD 1.		Q5XUL9|Q96SY2|Q9NV77|Q9NVW1|Q9NZJ2	Missense_Mutation	SNP	ENST00000511685.1	37	c.4553A>C	CCDS47165.1	.	.	.	.	.	.	.	.	.	.	A	12.24	1.879856	0.33162	.	.	ENSG00000218336	ENST00000511685;ENST00000406950	T;T	0.16597	2.33;2.33	5.25	5.25	0.73442	.	.	.	.	.	T	0.11110	0.0271	N	0.12182	0.205	0.47621	D	0.999478	B	0.06786	0.001	B	0.04013	0.001	T	0.14783	-1.0460	9	0.28530	T	0.3	.	15.3157	0.74074	1.0:0.0:0.0:0.0	.	1518	Q9P273	TEN3_HUMAN	A	1518	ENSP00000424226:D1518A;ENSP00000385276:D1518A	ENSP00000385276:D1518A	D	+	2	0	ODZ3	183913067	1.000000	0.71417	0.997000	0.53966	0.983000	0.72400	5.585000	0.67497	2.210000	0.71456	0.460000	0.39030	GAT		0.378	TENM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361734.1			20	57	0	0	0	0.010504	0	20	57				
EXOC3	11336	broad.mit.edu	37	5	454086	454086	+	Silent	SNP	G	G	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr5:454086G>T	ENST00000512944.1	+	4	1155	c.966G>T	c.(964-966)cgG>cgT	p.R322R	EXOC3_ENST00000315013.5_Silent_p.R322R	NM_007277.4	NP_009208.2	O60645	EXOC3_HUMAN	exocyst complex component 3	333					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|protein transport (GO:0015031)	exocyst (GO:0000145)|secretory granule membrane (GO:0030667)		p.R322R(1)		breast(2)|cervix(1)|endometrium(4)|large_intestine(1)|lung(13)|ovary(1)|urinary_tract(1)	23		Ovarian(839;0.0563)	Epithelial(17;0.000529)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|all cancers(22;0.00186)|Lung(60;0.0863)			TGAGCACGCGGATGCAGGACC	0.517																																							uc003jba.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(964-966)CGG>CGT		Sec6 protein							40.0	40.0	40.0					5																	454086		2075	4212	6287	SO:0001819	synonymous_variant	11336				exocytosis|protein transport			g.chr5:454086G>T	BC034427	CCDS54830.1	5p15.33	2013-01-22	2005-11-01	2005-11-01	ENSG00000180104	ENSG00000180104			30378	protein-coding gene	gene with protein product		608186	"""SEC6-like 1 (S. cerevisiae)"""	SEC6L1		8619474	Standard	XM_005248238		Approved	Sec6p	uc003jba.3	O60645	OTTHUMG00000162205	ENST00000512944.1:c.966G>T	5.37:g.454086G>T			Somatic					p.R322R	NM_007277	NP_009208	WXS	Illumina HiSeq	Unspecified	O60645	EXOC3_HUMAN	Epithelial(17;0.000529)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|all cancers(22;0.00186)|Lung(60;0.0863)		4	1094	+		Ovarian(839;0.0563)	333					Q6P2E8|Q8TEN6|Q8WUW0|Q96DI4	Silent	SNP	ENST00000512944.1	37	c.966G>T	CCDS54830.1																																																																																				0.517	EXOC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367882.1	NM_007277		6	38	1	0	0.000157383	0.00308	0.000168053	6	38				
ADAMTS12	81792	broad.mit.edu	37	5	33577084	33577084	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr5:33577084G>T	ENST00000504830.1	-	19	3382	c.3047C>A	c.(3046-3048)cCa>cAa	p.P1016Q	ADAMTS12_ENST00000504582.1_5'UTR|ADAMTS12_ENST00000352040.3_Missense_Mutation_p.P931Q	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	1016	Spacer 2.				cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.P1016Q(1)		NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						TAGTGTTGGTGGGTTTTTTCC	0.537										HNSCC(64;0.19)																													uc003jia.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9						c.(3046-3048)CCA>CAA		ADAM metallopeptidase with thrombospondin type 1							150.0	144.0	146.0					5																	33577084		2203	4300	6503	SO:0001583	missense	81792				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr5:33577084G>T	AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.3047C>A	5.37:g.33577084G>T	ENSP00000422554:p.Pro1016Gln	HNSCC(64;0.19)	Somatic				ADAMTS12_uc010iuq.1_Missense_Mutation_p.P931Q	p.P1016Q	NM_030955	NP_112217	WXS	Illumina HiSeq	Unspecified	P58397	ATS12_HUMAN			19	3210	-			1016			Spacer 2.		A2RRN9|A5D6V6|Q6UWL3	Missense_Mutation	SNP	ENST00000504830.1	37	c.3047C>A	CCDS34140.1	.	.	.	.	.	.	.	.	.	.	G	1.080	-0.667348	0.03428	.	.	ENSG00000151388	ENST00000504830;ENST00000352040	T;T	0.58358	0.34;0.34	5.3	-2.13	0.07144	.	0.911979	0.09488	N	0.795396	T	0.26738	0.0654	N	0.14661	0.345	0.09310	N	0.999996	B;B	0.09022	0.002;0.0	B;B	0.08055	0.003;0.001	T	0.20706	-1.0267	10	0.12766	T	0.61	.	4.5171	0.11940	0.3425:0.0:0.3926:0.2649	.	931;1016	P58397-3;P58397	.;ATS12_HUMAN	Q	1016;931	ENSP00000422554:P1016Q;ENSP00000344847:P931Q	ENSP00000344847:P931Q	P	-	2	0	ADAMTS12	33612841	0.000000	0.05858	0.004000	0.12327	0.010000	0.07245	-0.095000	0.11077	-0.523000	0.06409	-0.345000	0.07892	CCA		0.537	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367164.2	NM_030955		31	158	1	0	4.02929e-09	0.010818	4.89508e-09	31	158				
ADAMTS12	81792	broad.mit.edu	37	5	33683976	33683976	+	Silent	SNP	G	G	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr5:33683976G>T	ENST00000504830.1	-	4	1154	c.819C>A	c.(817-819)acC>acA	p.T273T	ADAMTS12_ENST00000504582.1_5'UTR|ADAMTS12_ENST00000352040.3_Silent_p.T273T	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	273	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.T273T(1)		NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						TGTTCATGATGGTGAGGATGT	0.463										HNSCC(64;0.19)																													uc003jia.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9						c.(817-819)ACC>ACA		ADAM metallopeptidase with thrombospondin type 1							119.0	110.0	113.0					5																	33683976		2203	4300	6503	SO:0001819	synonymous_variant	81792				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr5:33683976G>T	AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.819C>A	5.37:g.33683976G>T		HNSCC(64;0.19)	Somatic				ADAMTS12_uc010iuq.1_Silent_p.T273T	p.T273T	NM_030955	NP_112217	WXS	Illumina HiSeq	Unspecified	P58397	ATS12_HUMAN			4	982	-			273			Peptidase M12B.		A2RRN9|A5D6V6|Q6UWL3	Silent	SNP	ENST00000504830.1	37	c.819C>A	CCDS34140.1																																																																																				0.463	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367164.2	NM_030955		25	59	1	0	1.04121e-07	0.005443	1.22121e-07	25	59				
MROH2B	133558	broad.mit.edu	37	5	41004553	41004553	+	Silent	SNP	A	A	G	rs528504910		TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr5:41004553A>G	ENST00000399564.4	-	37	4539	c.4089T>C	c.(4087-4089)tgT>tgC	p.C1363C	MROH2B_ENST00000506092.2_Silent_p.C918C	NM_173489.4	NP_775760.3	Q7Z745	MRO2B_HUMAN	maestro heat-like repeat family member 2B	1363								p.C1363C(1)									TCAAGCTTTCACAGACGACTT	0.423																																							uc003jmj.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(6)|central_nervous_system(2)	8						c.(4087-4089)TGT>TGC		HEAT repeat family member 7B2							113.0	105.0	108.0					5																	41004553		1849	4101	5950	SO:0001819	synonymous_variant	133558						binding	g.chr5:41004553A>G		CCDS47202.1	5p13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000171495	ENSG00000171495		"""maestro heat-like repeat containing"""	26857	protein-coding gene	gene with protein product			"""HEAT repeat family member 7B2"""	HEATR7B2		12477932	Standard	NM_173489		Approved	DKFZp781F0822, FLJ40243	uc003jmj.4	Q7Z745	OTTHUMG00000162151	ENST00000399564.4:c.4089T>C	5.37:g.41004553A>G			Somatic				HEATR7B2_uc003jmi.3_Silent_p.C918C	p.C1363C	NM_173489	NP_775760	WXS	Illumina HiSeq	Unspecified	Q7Z745	HTRB2_HUMAN			37	4579	-			1363			HEAT 15.		Q68DM1|Q7Z4U4|Q8N7X3	Silent	SNP	ENST00000399564.4	37	c.4089T>C	CCDS47202.1																																																																																				0.423	MROH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367558.2	NM_173489		32	91	0	0	0	0.012213	0	32	91				
ITGA2	3673	broad.mit.edu	37	5	52360751	52360751	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr5:52360751G>T	ENST00000296585.5	+	14	1755	c.1612G>T	c.(1612-1614)Ggt>Tgt	p.G538C		NM_002203.3	NP_002194.2	P17301	ITA2_HUMAN	integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)	538					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell proliferation (GO:0008283)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cellular response to hormone stimulus (GO:0032870)|collagen-activated signaling pathway (GO:0038065)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|hepatocyte differentiation (GO:0070365)|hypotonic response (GO:0006971)|integrin-mediated signaling pathway (GO:0007229)|mammary gland development (GO:0030879)|mesodermal cell differentiation (GO:0048333)|organ morphogenesis (GO:0009887)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell projection organization (GO:0031346)|positive regulation of collagen binding (GO:0033343)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of DNA binding (GO:0043388)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of inflammatory response (GO:0050729)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of translation (GO:0045727)|positive regulation of transmission of nerve impulse (GO:0051971)|response to amine (GO:0014075)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to L-ascorbic acid (GO:0033591)|response to muscle activity (GO:0014850)|response to organic cyclic compound (GO:0014070)|skin morphogenesis (GO:0043589)|substrate-dependent cell migration (GO:0006929)|tissue homeostasis (GO:0001894)|viral process (GO:0016032)	axon terminus (GO:0043679)|basal part of cell (GO:0045178)|cell outer membrane (GO:0009279)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integrin alpha2-beta1 complex (GO:0034666)|integrin complex (GO:0008305)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|collagen receptor activity (GO:0038064)|metal ion binding (GO:0046872)|virus receptor activity (GO:0001618)	p.G538C(2)		breast(3)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(8)|liver(1)|lung(18)|pancreas(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	47		Lung NSC(810;3.11e-05)|Breast(144;0.014)|Prostate(461;0.0181)				GGGCATTTTGGGTCAGCACCA	0.433																																							uc003joy.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(1)	1						c.(1612-1614)GGT>TGT		integrin alpha 2 precursor							108.0	112.0	111.0					5																	52360751		2203	4300	6503	SO:0001583	missense	3673				axon guidance|blood coagulation|cell-matrix adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|organ morphogenesis	integrin complex	collagen binding|identical protein binding|receptor activity	g.chr5:52360751G>T		CCDS3957.1	5q11.2	2010-03-23			ENSG00000164171	ENSG00000164171		"""CD molecules"", ""Integrins"""	6137	protein-coding gene	gene with protein product		192974		CD49B			Standard	NM_002203		Approved	CD49b	uc003joy.3	P17301	OTTHUMG00000131165	ENST00000296585.5:c.1612G>T	5.37:g.52360751G>T	ENSP00000296585:p.Gly538Cys		Somatic				ITGA2_uc011cqa.1_RNA|ITGA2_uc011cqb.1_RNA|ITGA2_uc011cqc.1_Missense_Mutation_p.G462C|ITGA2_uc011cqd.1_RNA|ITGA2_uc011cqe.1_RNA	p.G538C	NM_002203	NP_002194	WXS	Illumina HiSeq	Unspecified	P17301	ITA2_HUMAN			14	1755	+		Lung NSC(810;3.11e-05)|Breast(144;0.014)|Prostate(461;0.0181)	538			FG-GAP 5.|Extracellular (Potential).		Q14595	Missense_Mutation	SNP	ENST00000296585.5	37	c.1612G>T	CCDS3957.1	.	.	.	.	.	.	.	.	.	.	G	13.66	2.304441	0.40795	.	.	ENSG00000164171	ENST00000296585	T	0.11169	2.8	5.67	0.731	0.18277	.	0.505430	0.24124	N	0.041322	T	0.07007	0.0178	L	0.29908	0.895	0.23727	N	0.997002	B;P	0.47604	0.21;0.898	B;B	0.39876	0.037;0.312	T	0.29761	-1.0001	10	0.46703	T	0.11	.	7.8716	0.29569	0.5214:0.0:0.4786:0.0	.	538;538	E7ESP4;P17301	.;ITA2_HUMAN	C	538	ENSP00000296585:G538C	ENSP00000296585:G538C	G	+	1	0	ITGA2	52396508	1.000000	0.71417	0.947000	0.38551	0.913000	0.54294	2.331000	0.43894	0.181000	0.19994	-0.238000	0.12139	GGT		0.433	ITGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253857.2	NM_002203		21	47	1	0	1.50039e-11	0.012319	1.92347e-11	21	47				
FST	10468	broad.mit.edu	37	5	52778792	52778792	+	Nonsense_Mutation	SNP	C	C	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr5:52778792C>A	ENST00000256759.3	+	2	551	c.168C>A	c.(166-168)tgC>tgA	p.C56*	FST_ENST00000396947.3_Nonsense_Mutation_p.C56*	NM_013409.2	NP_037541.1	P19883	FST_HUMAN	follistatin	56	TB.				BMP signaling pathway (GO:0030509)|female gonad development (GO:0008585)|gamete generation (GO:0007276)|hair follicle morphogenesis (GO:0031069)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinocyte proliferation (GO:0043616)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of cell differentiation (GO:0045596)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|odontogenesis of dentin-containing tooth (GO:0042475)|pattern specification process (GO:0007389)|positive regulation of hair follicle development (GO:0051798)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nucleus (GO:0005634)	activin binding (GO:0048185)|signal transducer activity (GO:0004871)	p.C56*(1)		breast(1)|endometrium(1)|large_intestine(4)|lung(7)|prostate(1)|urinary_tract(1)	15		Ovarian(174;1.78e-06)|Lung NSC(810;3.55e-06)|Breast(144;4.08e-05)				AGGAGTGCTGCAGCACCGGCC	0.597											OREG0016608	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc003jpd.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(166-168)TGC>TGA		follistatin isoform FST344 precursor							60.0	57.0	58.0					5																	52778792		2203	4300	6503	SO:0001587	stop_gained	10468				hemopoietic progenitor cell differentiation|negative regulation of activin receptor signaling pathway|negative regulation of follicle-stimulating hormone secretion|negative regulation of transcription from RNA polymerase II promoter|positive regulation of hair follicle development	extracellular region	activin binding|protein binding|signal transducer activity	g.chr5:52778792C>A	M19481	CCDS3959.1, CCDS43315.1	5q11.2	2008-02-05			ENSG00000134363	ENSG00000134363			3971	protein-coding gene	gene with protein product		136470				10411917, 3380788	Standard	NM_006350		Approved	FS	uc003jpd.3	P19883	OTTHUMG00000131183	ENST00000256759.3:c.168C>A	5.37:g.52778792C>A	ENSP00000256759:p.Cys56*		Somatic	OREG0016608	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	987	FST_uc003jpc.2_Nonsense_Mutation_p.C56*	p.C56*	NM_013409	NP_037541	WXS	Illumina HiSeq	Unspecified	P19883	FST_HUMAN			2	195	+		Ovarian(174;1.78e-06)|Lung NSC(810;3.55e-06)|Breast(144;4.08e-05)	56			TB.		B5BU94|Q9BTH0	Nonsense_Mutation	SNP	ENST00000256759.3	37	c.168C>A	CCDS3959.1	.	.	.	.	.	.	.	.	.	.	C	29.6	5.018454	0.93404	.	.	ENSG00000134363	ENST00000256759;ENST00000511025;ENST00000396947	.	.	.	4.8	3.0	0.34707	.	0.086330	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.3587	10.692	0.45877	0.0:0.8433:0.0:0.1567	.	.	.	.	X	56	.	ENSP00000256759:C56X	C	+	3	2	FST	52814549	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	1.695000	0.37763	0.458000	0.26988	-0.339000	0.08088	TGC		0.597	FST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253906.1	NM_013409		24	43	1	0	3.1745e-13	0.008361	4.22946e-13	24	43				
SKIV2L2	23517	broad.mit.edu	37	5	54654435	54654435	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr5:54654435G>C	ENST00000230640.5	+	15	1822	c.1568G>C	c.(1567-1569)cGt>cCt	p.R523P	SKIV2L2_ENST00000545714.1_Missense_Mutation_p.R422P	NM_015360.4	NP_056175.3	P42285	SK2L2_HUMAN	superkiller viralicidic activity 2-like 2 (S. cerevisiae)	523	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				maturation of 5.8S rRNA (GO:0000460)|mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)	p.R523H(1)|p.R523P(1)		NS(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(5)|lung(12)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	41		Lung NSC(810;0.000744)|Breast(144;0.181)|Prostate(74;0.194)				ATGTCTGGTCGTGCTGGAAGG	0.323																																					Melanoma(2;92 134 23744 29976 33782)	Melanoma(2;92 134 23744 29976 33782)	uc003jpy.3		NA																	2	Substitution - Missense(2)		lung(1)|endometrium(1)	ovary(1)|skin(1)	2						c.(1567-1569)CGT>CCT		superkiller viralicidic activity 2-like 2							106.0	105.0	105.0					5																	54654435		2203	4300	6503	SO:0001583	missense	23517				maturation of 5.8S rRNA	catalytic step 2 spliceosome|nucleolus	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding	g.chr5:54654435G>C	D29641	CCDS3967.1	5q11.2	2008-11-25	2005-02-18	2005-02-18	ENSG00000039123	ENSG00000039123			18734	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 118"""		"""KIAA0052"""	KIAA0052			Standard	NM_015360		Approved	Mtr4, Dob1, fSAP118	uc003jpy.4	P42285	OTTHUMG00000097019	ENST00000230640.5:c.1568G>C	5.37:g.54654435G>C	ENSP00000230640:p.Arg523Pro		Somatic				SKIV2L2_uc011cqi.1_Missense_Mutation_p.R422P	p.R523P	NM_015360	NP_056175	WXS	Illumina HiSeq	Unspecified	P42285	SK2L2_HUMAN			15	1834	+		Lung NSC(810;0.000744)|Breast(144;0.181)|Prostate(74;0.194)	523			Helicase C-terminal.		Q2M386|Q6MZZ8|Q6P170|Q8N5R0|Q8TAG2	Missense_Mutation	SNP	ENST00000230640.5	37	c.1568G>C	CCDS3967.1	.	.	.	.	.	.	.	.	.	.	G	31	5.089683	0.94149	.	.	ENSG00000039123	ENST00000230640;ENST00000545714	D;D	0.99143	-5.48;-5.48	5.88	5.88	0.94601	Helicase, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.99753	0.9901	H	0.99933	4.98	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96778	0.9573	10	0.87932	D	0	-16.9694	20.2375	0.98362	0.0:0.0:1.0:0.0	.	422;523	F5H7E2;P42285	.;SK2L2_HUMAN	P	523;422	ENSP00000230640:R523P;ENSP00000442583:R422P	ENSP00000230640:R523P	R	+	2	0	SKIV2L2	54690192	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.716000	0.98752	2.790000	0.95986	0.655000	0.94253	CGT		0.323	SKIV2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214108.1			4	39	0	0	0	0.00308	0	4	39				
SV2C	22987	broad.mit.edu	37	5	75427939	75427939	+	Nonsense_Mutation	SNP	G	G	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr5:75427939G>T	ENST00000502798.2	+	2	806	c.364G>T	c.(364-366)Gag>Tag	p.E122*	SV2C_ENST00000322285.7_Nonsense_Mutation_p.E122*	NM_014979.1	NP_055794.1	Q496J9	SV2C_HUMAN	synaptic vesicle glycoprotein 2C	122					neurotransmitter transport (GO:0006836)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	transmembrane transporter activity (GO:0022857)	p.E122*(1)		NS(1)|breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37		all_lung(232;0.007)|Lung NSC(167;0.0148)|Ovarian(174;0.0798)|Prostate(461;0.184)		OV - Ovarian serous cystadenocarcinoma(47;1.16e-50)|all cancers(79;7.25e-40)		GGACCGGCGGGAGCTGGAATC	0.547																																							uc003kei.1		NA																	1	Substitution - Nonsense(1)		lung(1)	skin(1)	1						c.(364-366)GAG>TAG		synaptic vesicle glycoprotein 2C							106.0	122.0	117.0					5																	75427939		2056	4211	6267	SO:0001587	stop_gained	22987				neurotransmitter transport	cell junction|integral to membrane|synaptic vesicle membrane	transmembrane transporter activity	g.chr5:75427939G>T	AB028977	CCDS43331.1, CCDS75261.1	5q13	2008-02-05			ENSG00000122012	ENSG00000122012			30670	protein-coding gene	gene with protein product		610291				10470851, 9801366	Standard	XM_005248470		Approved		uc003kei.1	Q496J9	OTTHUMG00000162384	ENST00000502798.2:c.364G>T	5.37:g.75427939G>T	ENSP00000423541:p.Glu122*		Somatic					p.E122*	NM_014979	NP_055794	WXS	Illumina HiSeq	Unspecified	Q496J9	SV2C_HUMAN		OV - Ovarian serous cystadenocarcinoma(47;1.16e-50)|all cancers(79;7.25e-40)	2	498	+		all_lung(232;0.007)|Lung NSC(167;0.0148)|Ovarian(174;0.0798)|Prostate(461;0.184)	122			Cytoplasmic (Potential).		Q496K1|Q9UPU8	Nonsense_Mutation	SNP	ENST00000502798.2	37	c.364G>T	CCDS43331.1	.	.	.	.	.	.	.	.	.	.	G	40	8.506241	0.98841	.	.	ENSG00000122012	ENST00000502798;ENST00000322285	.	.	.	5.71	5.71	0.89125	.	0.581990	0.19038	N	0.124347	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27082	T	0.32	-9.1346	19.8415	0.96690	0.0:0.0:1.0:0.0	.	.	.	.	X	122	.	ENSP00000316983:E122X	E	+	1	0	SV2C	75463695	1.000000	0.71417	0.977000	0.42913	0.489000	0.33432	7.925000	0.87563	2.700000	0.92200	0.655000	0.94253	GAG		0.547	SV2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368700.4			19	35	1	0	3.62473e-10	0.012319	4.52835e-10	19	35				
THBS4	7060	broad.mit.edu	37	5	79375018	79375018	+	Silent	SNP	G	G	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr5:79375018G>A	ENST00000350881.2	+	19	2638	c.2448G>A	c.(2446-2448)acG>acA	p.T816T	CTD-2201I18.1_ENST00000503007.1_RNA|THBS4_ENST00000511733.1_Silent_p.T725T|THBS4_ENST00000504720.1_3'UTR|CTD-2201I18.1_ENST00000514042.1_RNA	NM_003248.4	NP_003239.2	P35443	TSP4_HUMAN	thrombospondin 4	816	TSP C-terminal. {ECO:0000255|PROSITE- ProRule:PRU00635}.				behavioral response to pain (GO:0048266)|endothelial cell-cell adhesion (GO:0071603)|myoblast migration (GO:0051451)|negative regulation of angiogenesis (GO:0016525)|positive regulation of cell division (GO:0051781)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of tissue remodeling (GO:0034103)|response to endoplasmic reticulum stress (GO:0034976)|response to unfolded protein (GO:0006986)|tissue remodeling (GO:0048771)	basement membrane (GO:0005604)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|sarcoplasmic reticulum (GO:0016529)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)|integrin binding (GO:0005178)	p.T816T(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|stomach(3)	34		Lung NSC(167;0.00328)|all_lung(232;0.00355)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;6.3e-45)|Epithelial(54;1.77e-39)|all cancers(79;3.2e-34)		GGAAGCAGACGGAGCAGACAT	0.488																																							uc003kgh.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(2446-2448)ACG>ACA		thrombospondin 4 precursor							106.0	92.0	97.0					5																	79375018		2203	4300	6503	SO:0001819	synonymous_variant	7060				endothelial cell-cell adhesion|myoblast migration|negative regulation of angiogenesis|positive regulation of endothelial cell proliferation|positive regulation of neutrophil chemotaxis|positive regulation of peptidyl-tyrosine phosphorylation	basement membrane|extracellular space	calcium ion binding|heparin binding|integrin binding|structural molecule activity	g.chr5:79375018G>A		CCDS4049.1	5q13	2008-05-15			ENSG00000113296	ENSG00000113296			11788	protein-coding gene	gene with protein product		600715				7852353	Standard	NM_003248		Approved		uc021yaw.1	P35443	OTTHUMG00000108173	ENST00000350881.2:c.2448G>A	5.37:g.79375018G>A			Somatic				uc003kgi.3_Intron	p.T816T	NM_003248	NP_003239	WXS	Illumina HiSeq	Unspecified	P35443	TSP4_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;6.3e-45)|Epithelial(54;1.77e-39)|all cancers(79;3.2e-34)	20	2771	+		Lung NSC(167;0.00328)|all_lung(232;0.00355)|Ovarian(174;0.0261)	816			TSP C-terminal.		B2R909|Q86TG2	Silent	SNP	ENST00000350881.2	37	c.2448G>A	CCDS4049.1																																																																																				0.488	THBS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226977.1			10	66	0	0	0	0.00245	0	10	66				
PCDHA2	56146	broad.mit.edu	37	5	140176000	140176000	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr5:140176000C>A	ENST00000526136.1	+	1	1451	c.1451C>A	c.(1450-1452)gCg>gAg	p.A484E	PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000520672.2_Missense_Mutation_p.A484E|PCDHA2_ENST00000378132.1_Missense_Mutation_p.A484E|PCDHA1_ENST00000394633.3_Intron	NM_018905.2	NP_061728.1	Q9Y5H9	PCDA2_HUMAN	protocadherin alpha 2	484	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.A484E(2)		NS(1)|breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(16)|lung(26)|ovary(4)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GATGCGGACGCGCAGGAGAAC	0.657																																							uc003lhd.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)	4						c.(1450-1452)GCG>GAG		protocadherin alpha 2 isoform 1 precursor							70.0	73.0	72.0					5																	140176000		2203	4300	6503	SO:0001583	missense	56146				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding	g.chr5:140176000C>A	AF152480	CCDS54914.1, CCDS64269.1	5q31	2010-11-26				ENSG00000204969		"""Cadherins / Protocadherins : Clustered"""	8668	other	complex locus constituent	"""KIAA0345-like 12"""	606308				10380929	Standard	NM_018905		Approved			Q9Y5H9		ENST00000526136.1:c.1451C>A	5.37:g.140176000C>A	ENSP00000431748:p.Ala484Glu		Somatic				PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhc.1_Missense_Mutation_p.A484E|PCDHA2_uc011czy.1_Missense_Mutation_p.A484E	p.A484E	NM_018905	NP_061728	WXS	Illumina HiSeq	Unspecified	Q9Y5H9	PCDA2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1557	+			484			Cadherin 5.|Extracellular (Potential).		O75287|Q9BTV3	Missense_Mutation	SNP	ENST00000526136.1	37	c.1451C>A	CCDS54914.1	.	.	.	.	.	.	.	.	.	.	c	6.277	0.419133	0.11870	.	.	ENSG00000204969	ENST00000520672;ENST00000378132;ENST00000526136	T;T;T	0.50001	0.76;0.76;0.76	3.94	2.99	0.34606	Cadherin (4);Cadherin-like (1);	0.000000	0.39475	U	0.001346	T	0.35364	0.0929	N	0.05177	-0.1	0.09310	N	1	B;P;B	0.38440	0.372;0.631;0.066	B;P;B	0.52031	0.211;0.688;0.143	T	0.10177	-1.0641	10	0.87932	D	0	.	4.8958	0.13749	0.1405:0.6099:0.1562:0.0934	.	484;484;484	Q9Y5H9-3;Q9Y5H9;Q9Y5H9-2	.;PCDA2_HUMAN;.	E	484	ENSP00000430584:A484E;ENSP00000367372:A484E;ENSP00000431748:A484E	ENSP00000367372:A484E	A	+	2	0	PCDHA2	140156184	0.000000	0.05858	0.998000	0.56505	0.326000	0.28443	-0.187000	0.09656	1.915000	0.55452	0.644000	0.83932	GCG		0.657	PCDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372877.3	NM_018905		34	99	1	0	1.21353e-23	0.01441	1.84541e-23	34	99				
PCDHA12	56137	broad.mit.edu	37	5	140256796	140256796	+	Nonsense_Mutation	SNP	T	T	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr5:140256796T>A	ENST00000398631.2	+	1	1739	c.1739T>A	c.(1738-1740)tTg>tAg	p.L580*	PCDHA9_ENST00000532602.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA4_ENST00000530339.1_Intron	NM_018903.2|NM_031864.2	NP_061726.1|NP_114070.1	Q9UN75	PCDAC_HUMAN	protocadherin alpha 12	580					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.L580*(1)		NS(4)|breast(2)|cervix(1)|endometrium(19)|kidney(8)|large_intestine(8)|liver(2)|lung(25)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTTAGCGAGTTGGTACCGCGG	0.662																																					Pancreas(113;759 1672 13322 24104 50104)	Pancreas(113;759 1672 13322 24104 50104)	uc003lic.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(1738-1740)TTG>TAG		protocadherin alpha 12 isoform 1 precursor							206.0	196.0	200.0					5																	140256796		2203	4299	6502	SO:0001587	stop_gained	56137				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding	g.chr5:140256796T>A	AF152477	CCDS47285.1, CCDS75327.1	5q31	2010-11-26			ENSG00000251664	ENSG00000251664		"""Cadherins / Protocadherins : Clustered"""	8666	other	complex locus constituent	"""KIAA0345-like 2"""	606318				10380929	Standard	NM_018903		Approved	PCDH-ALPHA12	uc003lic.2	Q9UN75	OTTHUMG00000163366	ENST00000398631.2:c.1739T>A	5.37:g.140256796T>A	ENSP00000381628:p.Leu580*		Somatic				PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc003lia.2_Intron|PCDHA12_uc011daf.1_Nonsense_Mutation_p.L580*	p.L580*	NM_018903	NP_061726	WXS	Illumina HiSeq	Unspecified	Q9UN75	PCDAC_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1866	+			580			Extracellular (Potential).		O75278|Q2M1N8	Nonsense_Mutation	SNP	ENST00000398631.2	37	c.1739T>A	CCDS47285.1	.	.	.	.	.	.	.	.	.	.	T	15.46	2.840910	0.51057	.	.	ENSG00000251664	ENST00000398631	.	.	.	4.71	-0.552	0.11818	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.1178	0.14845	0.0:0.3325:0.1524:0.5151	.	.	.	.	X	580	.	ENSP00000381628:L580X	L	+	2	0	PCDHA12	140236980	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-1.195000	0.03043	-0.358000	0.08162	0.459000	0.35465	TTG		0.662	PCDHA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372882.2	NM_018903		49	107	0	0	0	0.01441	0	49	107				
PCDHB16	57717	broad.mit.edu	37	5	140564342	140564342	+	Silent	SNP	G	G	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr5:140564342G>T	ENST00000361016.2	+	1	3363	c.2208G>T	c.(2206-2208)ctG>ctT	p.L736L		NM_020957.1	NP_066008.1	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16	736					calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.L736L(1)		breast(1)|endometrium(10)|kidney(3)|large_intestine(14)|lung(29)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|urinary_tract(1)	69			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CAGGGCGTCTGGTGGACGTAA	0.632																																							uc003liv.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(2206-2208)CTG>CTT		protocadherin beta 16 precursor							84.0	91.0	89.0					5																	140564342		2203	4300	6503	SO:0001819	synonymous_variant	57717				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140564342G>T	AF217757	CCDS4251.1	5q31	2014-04-11			ENSG00000196963			"""Cadherins / Protocadherins : Clustered"""	14546	other	protocadherin	"""cadherin ME1"", ""protocadherin-3x"", ""PCDHbeta 16"""	606345				11230163, 11322959	Standard	NM_020957		Approved	PCDHB8a, PCDH3X, KIAA1621, PCDH-BETA16, ME1	uc003liv.3	Q9NRJ7	OTTHUMG00000188325	ENST00000361016.2:c.2208G>T	5.37:g.140564342G>T			Somatic				PCDHB9_uc003liw.1_5'Flank	p.L736L	NM_020957	NP_066008	WXS	Illumina HiSeq	Unspecified	Q9NRJ7	PCDBG_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	3363	+			736			Cytoplasmic (Potential).		B3KPK5|Q8IYD5|Q96SE9|Q9HCF1	Silent	SNP	ENST00000361016.2	37	c.2208G>T	CCDS4251.1																																																																																				0.632	PCDHB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251800.1	NM_020957		38	160	1	0	2.40579e-17	0.00623	3.40049e-17	38	160				
PCDHGA10	56106	broad.mit.edu	37	5	140793377	140793377	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr5:140793377A>G	ENST00000398610.2	+	1	635	c.635A>G	c.(634-636)cAc>cGc	p.H212R	PCDHGA8_ENST00000398604.2_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA4_ENST00000571252.1_Intron	NM_018913.2|NM_032090.1	NP_061736.1|NP_114479.1	Q9Y5H3	PCDGA_HUMAN	protocadherin gamma subfamily A, 10	212	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.H212R(1)		breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	43			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAGGCCATTCACCACCTGGTC	0.582																																							uc003lkl.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(634-636)CAC>CGC		protocadherin gamma subfamily A, 10 isoform 1							40.0	45.0	43.0					5																	140793377		2077	4204	6281	SO:0001583	missense	56106				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140793377A>G		CCDS47292.1, CCDS75343.1	5q31	2010-01-26			ENSG00000253846	ENSG00000253846		"""Cadherins / Protocadherins : Clustered"""	8697	other	protocadherin		606297				10380929	Standard	NM_018913		Approved	PCDH-GAMMA-A10		Q9Y5H3	OTTHUMG00000163688	ENST00000398610.2:c.635A>G	5.37:g.140793377A>G	ENSP00000381611:p.His212Arg		Somatic				PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc011day.1_Missense_Mutation_p.H212R	p.H212R	NM_018913	NP_061736	WXS	Illumina HiSeq	Unspecified	Q9Y5H3	PCDGA_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	635	+			212			Extracellular (Potential).|Cadherin 2.		Q9Y5E0	Missense_Mutation	SNP	ENST00000398610.2	37	c.635A>G	CCDS47292.1	.	.	.	.	.	.	.	.	.	.	a	16.11	3.029345	0.54790	.	.	ENSG00000253846	ENST00000398610	T	0.52295	0.67	5.49	5.49	0.81192	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.81088	0.4750	H	0.99325	4.515	0.22521	N	0.999025	D;D	0.60575	0.985;0.988	D;D	0.65323	0.92;0.934	T	0.79614	-0.1730	9	0.62326	D	0.03	.	14.7708	0.69675	1.0:0.0:0.0:0.0	.	212;212	Q9Y5H3-2;Q9Y5H3	.;PCDGA_HUMAN	R	212	ENSP00000381611:H212R	ENSP00000381611:H212R	H	+	2	0	PCDHGA10	140773561	0.000000	0.05858	0.996000	0.52242	0.974000	0.67602	1.319000	0.33655	2.094000	0.63399	0.455000	0.32223	CAC		0.582	PCDHGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374747.1	NM_018913		30	65	0	0	0	0.012213	0	30	65				
PCDHGB7	56099	broad.mit.edu	37	5	140797646	140797646	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr5:140797646C>A	ENST00000398594.2	+	1	220	c.220C>A	c.(220-222)Cac>Aac	p.H74N	PCDHGA8_ENST00000398604.2_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA4_ENST00000571252.1_Intron	NM_018927.3	NP_061750.1	Q9Y5F8	PCDGJ_HUMAN	protocadherin gamma subfamily B, 7	74	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.H74Y(1)|p.H74N(1)		central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(13)|lung(15)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(3)	56			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGAGAAGCTGCACTTCAGCGT	0.562																																							uc003lkn.1		NA																	2	Substitution - Missense(2)		lung(1)|kidney(1)	ovary(2)	2						c.(220-222)CAC>AAC		protocadherin gamma subfamily B, 7 isoform 1							101.0	107.0	105.0					5																	140797646		1959	4151	6110	SO:0001583	missense	56099				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140797646C>A	AF152523	CCDS47293.1, CCDS75344.1	5q31	2010-01-26			ENSG00000254122	ENSG00000254122		"""Cadherins / Protocadherins : Clustered"""	8714	other	protocadherin	"""cadherin ME6"""	606304				10380929	Standard	NM_032101		Approved	ME6, PCDH-GAMMA-B7		Q9Y5F8	OTTHUMG00000164054	ENST00000398594.2:c.220C>A	5.37:g.140797646C>A	ENSP00000381594:p.His74Asn		Somatic				PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc003lkl.1_Intron|PCDHGB7_uc003lkm.2_Missense_Mutation_p.H74N|PCDHGA11_uc003lko.1_5'Flank|PCDHGA11_uc003lkp.1_5'Flank|PCDHGA11_uc003lkq.1_5'Flank	p.H74N	NM_018927	NP_061750	WXS	Illumina HiSeq	Unspecified	Q9Y5F8	PCDGJ_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	365	+			74			Extracellular (Potential).|Cadherin 1.		Q9UN63	Missense_Mutation	SNP	ENST00000398594.2	37	c.220C>A	CCDS47293.1	.	.	.	.	.	.	.	.	.	.	c	18.42	3.620900	0.66787	.	.	ENSG00000254122	ENST00000398594	T	0.27256	1.68	5.92	4.88	0.63580	Cadherin, N-terminal (1);Cadherin (3);Cadherin-like (1);	1.048000	0.07705	U	0.941071	T	0.31857	0.0810	L	0.45137	1.4	0.23487	N	0.997576	P;P	0.48589	0.912;0.714	P;B	0.49887	0.625;0.395	T	0.21930	-1.0231	10	0.87932	D	0	.	7.1855	0.25797	0.0:0.7685:0.0:0.2315	.	74;74	Q9Y5F8;Q9Y5F8-2	PCDGJ_HUMAN;.	N	74	ENSP00000381594:H74N	ENSP00000381594:H74N	H	+	1	0	PCDHGB7	140777830	0.020000	0.18652	1.000000	0.80357	0.939000	0.58152	0.411000	0.21115	2.822000	0.97130	0.650000	0.86243	CAC		0.562	PCDHGB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376973.1	NM_018927		37	88	1	0	3.62531e-18	0.004289	5.17398e-18	37	88				
FBXO38	81545	broad.mit.edu	37	5	147796641	147796641	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr5:147796641G>T	ENST00000340253.5	+	12	1660	c.1492G>T	c.(1492-1494)Gat>Tat	p.D498Y	FBXO38_ENST00000394370.3_Missense_Mutation_p.D498Y|FBXO38_ENST00000296701.6_Missense_Mutation_p.D498Y|FBXO38_ENST00000513826.1_Missense_Mutation_p.D498Y			Q6PIJ6	FBX38_HUMAN	F-box protein 38	498				D -> E (in Ref. 1; AAH33454). {ECO:0000305}.	cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.D498Y(1)	ATG4C/FBXO38(2)	NS(1)|breast(2)|endometrium(7)|kidney(5)|large_intestine(9)|lung(15)|ovary(5)|prostate(2)|skin(2)|stomach(2)|urinary_tract(1)	51			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAACAATGACGATAATAATGC	0.463																																							uc003lpf.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(2)	6						c.(1492-1494)GAT>TAT		F-box protein 38 isoform b							173.0	144.0	154.0					5																	147796641		2203	4300	6503	SO:0001583	missense	81545					cytoplasm|nucleus		g.chr5:147796641G>T	BC005873	CCDS43384.1, CCDS64285.1	5q33.1	2008-02-05			ENSG00000145868	ENSG00000145868		"""F-boxes /  ""other"""""	28844	protein-coding gene	gene with protein product		608533				12477932	Standard	NM_030793		Approved	MOKA, SP329, FLJ13962, Fbx38	uc003lpg.2	Q6PIJ6	OTTHUMG00000129929	ENST00000340253.5:c.1492G>T	5.37:g.147796641G>T	ENSP00000342023:p.Asp498Tyr		Somatic				FBXO38_uc003lpg.1_Missense_Mutation_p.D498Y|FBXO38_uc003lph.2_Missense_Mutation_p.D498Y	p.D498Y	NM_205836	NP_995308	WXS	Illumina HiSeq	Unspecified	Q6PIJ6	FBX38_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		12	1612	+			498	D -> E (in Ref. 1; AAH33454).				Q6PK72|Q7Z2U0|Q86VN3|Q9BXY6|Q9H837|Q9HC40	Missense_Mutation	SNP	ENST00000340253.5	37	c.1492G>T		.	.	.	.	.	.	.	.	.	.	G	20.8	4.055115	0.75960	.	.	ENSG00000145868	ENST00000340253;ENST00000296701;ENST00000394370;ENST00000513826	T;T;T;T	0.32023	1.47;1.47;1.47;1.47	5.52	5.52	0.82312	.	0.046014	0.85682	D	0.000000	T	0.36138	0.0956	N	0.08118	0	0.43043	D	0.994632	D;P;P	0.76494	0.999;0.828;0.785	D;P;P	0.68943	0.961;0.468;0.47	T	0.44682	-0.9312	10	0.59425	D	0.04	-16.043	17.2875	0.87146	0.0:0.0:1.0:0.0	.	498;498;498	Q6PIJ6-3;Q6PIJ6-2;Q6PIJ6	.;.;FBX38_HUMAN	Y	498	ENSP00000342023:D498Y;ENSP00000296701:D498Y;ENSP00000377895:D498Y;ENSP00000426410:D498Y	ENSP00000296701:D498Y	D	+	1	0	FBXO38	147776834	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	5.812000	0.69194	2.753000	0.94483	0.467000	0.42956	GAT		0.463	FBXO38-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000252185.2	NM_030793		8	25	1	0	3.09899e-07	0.004482	3.54975e-07	8	25				
CSF1R	1436	broad.mit.edu	37	5	149435795	149435795	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr5:149435795A>G	ENST00000286301.3	-	18	2720	c.2429T>C	c.(2428-2430)aTt>aCt	p.I810T		NM_005211.3	NP_005202.2	P07333	CSF1R_HUMAN	colony stimulating factor 1 receptor	810	Activation loop.|Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		Missing (in HDLS). {ECO:0000269|PubMed:22197934}.		cell proliferation (GO:0008283)|cell-cell junction maintenance (GO:0045217)|cellular response to cytokine stimulus (GO:0071345)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cytokine-mediated signaling pathway (GO:0019221)|hemopoiesis (GO:0030097)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|macrophage differentiation (GO:0030225)|mammary gland duct morphogenesis (GO:0060603)|monocyte differentiation (GO:0030224)|multicellular organismal development (GO:0007275)|osteoclast differentiation (GO:0030316)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol metabolic process (GO:0046488)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell motility (GO:2000147)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|protein autophosphorylation (GO:0046777)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of bone resorption (GO:0045124)|regulation of cell shape (GO:0008360)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|macrophage colony-stimulating factor receptor activity (GO:0005011)|protein homodimerization activity (GO:0042803)	p.I810T(2)		NS(2)|breast(2)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(38)|kidney(2)|large_intestine(6)|liver(3)|lung(23)|ovary(2)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	93			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)		Imatinib(DB00619)|Sunitinib(DB01268)	GCCCTTGACAATGTAGTTGGA	0.592																																							uc003lrl.2		NA																	2	Substitution - Missense(2)		lung(2)	haematopoietic_and_lymphoid_tissue(38)|lung(6)|central_nervous_system(3)|liver(3)|breast(2)|endometrium(1)|ovary(1)	54						c.(2428-2430)ATT>ACT		colony stimulating factor 1 receptor precursor	Imatinib(DB00619)|Sunitinib(DB01268)						152.0	140.0	144.0					5																	149435795		2203	4300	6503	SO:0001583	missense	1436				cell proliferation|multicellular organismal development|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane|receptor complex	ATP binding|cytokine binding|macrophage colony-stimulating factor receptor activity|protein homodimerization activity	g.chr5:149435795A>G	U63963	CCDS4302.1	5q32	2013-01-11	2008-08-01		ENSG00000182578	ENSG00000182578		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	2433	protein-coding gene	gene with protein product		164770	"""McDonough feline sarcoma viral (v-fms) oncogene homolog"""	FMS		1611909	Standard	NM_005211		Approved	C-FMS, CSFR, CD115	uc003lrm.3	P07333	OTTHUMG00000130050	ENST00000286301.3:c.2429T>C	5.37:g.149435795A>G	ENSP00000286301:p.Ile810Thr		Somatic				CSF1R_uc011dcd.1_Intron|CSF1R_uc010jhc.2_RNA|CSF1R_uc003lrm.2_Missense_Mutation_p.I810T	p.I810T	NM_005211	NP_005202	WXS	Illumina HiSeq	Unspecified	P07333	CSF1R_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)		17	2624	-			810			Protein kinase.|Cytoplasmic (Potential).		B5A955|D3DQG2|Q6LDW5|Q6LDY4|Q86VW7	Missense_Mutation	SNP	ENST00000286301.3	37	c.2429T>C	CCDS4302.1	.	.	.	.	.	.	.	.	.	.	A	20.2	3.948503	0.73787	.	.	ENSG00000182578	ENST00000286301	D	0.81908	-1.55	5.03	5.03	0.67393	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.268033	0.25964	N	0.027169	T	0.73590	0.3606	N	0.03608	-0.345	0.80722	D	1	P	0.44281	0.831	P	0.48425	0.577	T	0.81070	-0.1099	10	0.87932	D	0	.	14.9244	0.70866	1.0:0.0:0.0:0.0	.	810	P07333	CSF1R_HUMAN	T	810	ENSP00000286301:I810T	ENSP00000286301:I810T	I	-	2	0	CSF1R	149415988	1.000000	0.71417	1.000000	0.80357	0.726000	0.41606	9.139000	0.94554	2.116000	0.64780	0.379000	0.24179	ATT		0.592	CSF1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252329.2	NM_005211		78	113	0	0	0	0.01441	0	78	113				
TENM2	57451	broad.mit.edu	37	5	167674480	167674480	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr5:167674480A>G	ENST00000518659.1	+	27	6575	c.6536A>G	c.(6535-6537)tAt>tGt	p.Y2179C	TENM2_ENST00000403607.2_Missense_Mutation_p.Y2003C|TENM2_ENST00000520394.1_Missense_Mutation_p.Y1940C|TENM2_ENST00000519204.1_Missense_Mutation_p.Y2058C|TENM2_ENST00000545108.1_Missense_Mutation_p.Y2178C	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	2179					axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)	p.Y2179C(1)|p.Y2058C(1)|p.Y2012C(1)									ACGGTGCAATATGACAGCATG	0.552																																							uc010jjd.2		NA																	3	Substitution - Missense(3)		lung(3)	ovary(6)|central_nervous_system(4)	10						c.(6508-6510)TAT>TGT		odz, odd Oz/ten-m homolog 2							103.0	100.0	101.0					5																	167674480		2074	4202	6276	SO:0001583	missense	57451							g.chr5:167674480A>G	AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.6536A>G	5.37:g.167674480A>G	ENSP00000429430:p.Tyr2179Cys		Somatic				ODZ2_uc003lzr.3_Missense_Mutation_p.Y1940C|ODZ2_uc003lzt.3_Missense_Mutation_p.Y1543C|ODZ2_uc010jje.2_Missense_Mutation_p.Y1434C	p.Y2170C	NM_001122679	NP_001116151	WXS	Illumina HiSeq	Unspecified			Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0444)|OV - Ovarian serous cystadenocarcinoma(192;0.0694)|Epithelial(171;0.124)	27	6509	+	Renal(175;0.00124)|Lung NSC(126;0.136)|all_lung(126;0.242)	Medulloblastoma(196;0.0241)|all_neural(177;0.026)						Q9ULU2	Missense_Mutation	SNP	ENST00000518659.1	37	c.6509A>G		.	.	.	.	.	.	.	.	.	.	A	17.78	3.473982	0.63737	.	.	ENSG00000145934	ENST00000518659;ENST00000545108;ENST00000519204;ENST00000520394;ENST00000403607	D;D;D;D;D	0.93076	-2.62;-2.61;-2.8;-3.1;-3.16	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	D	0.97451	0.9166	M	0.93106	3.38	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;0.997	D	0.98459	1.0595	10	0.87932	D	0	.	15.7601	0.78073	1.0:0.0:0.0:0.0	.	2178;2179;1940	F5H2D1;Q9NT68;F8VNQ3	.;TEN2_HUMAN;.	C	2179;2178;2058;1940;2003	ENSP00000429430:Y2179C;ENSP00000438635:Y2178C;ENSP00000428964:Y2058C;ENSP00000427874:Y1940C;ENSP00000384905:Y2003C	ENSP00000384905:Y2003C	Y	+	2	0	ODZ2	167607058	1.000000	0.71417	0.937000	0.37676	0.972000	0.66771	9.339000	0.96797	2.130000	0.65690	0.459000	0.35465	TAT		0.552	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000376096.1	NM_001122679		24	71	0	0	0	0.005443	0	24	71				
NSD1	64324	broad.mit.edu	37	5	176665401	176665401	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr5:176665401G>C	ENST00000439151.2	+	7	4130	c.4085G>C	c.(4084-4086)gGa>gCa	p.G1362A	NSD1_ENST00000347982.4_Missense_Mutation_p.G1093A|NSD1_ENST00000354179.4_Missense_Mutation_p.G1093A|NSD1_ENST00000361032.4_Missense_Mutation_p.G1259A	NM_022455.4	NP_071900.2	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	1362					gastrulation with mouth forming second (GO:0001702)|histone H3-K36 methylation (GO:0010452)|histone H4-K20 methylation (GO:0034770)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H4-K20 specific) (GO:0042799)|retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.G1362A(2)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(18)|lung(24)|ovary(2)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(3)	96	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		TCAGAACTTGGAGGTGGACAT	0.532			T	NUP98	AML		Sotos Syndrome		Weaver syndrome;Sotos syndrome;Beckwith-Wiedemann syndrome	HNSCC(47;0.14)																													uc003mfr.3		NA		Dom	yes		5	5q35	64324	T	nuclear receptor binding SET domain protein 1	yes	Sotos Syndrome	L	NUP98		AML		2	Substitution - Missense(2)		lung(2)	ovary(2)|kidney(1)	3						c.(4084-4086)GGA>GCA		nuclear receptor binding SET domain protein 1							102.0	100.0	101.0					5																	176665401		2203	4300	6503	SO:0001583	missense	64324	Beckwith-Wiedemann_syndrome|Sotos_syndrome|Weaver_syndrome	Familial Cancer Database	Weaver-Smith syndrome;Cerebral Gigantism;BWS, Exomphalos-Macroglossia-Gigantism (EMG) syndrome, Wiedemann-Beckwith syndrome, WBS	negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	androgen receptor binding|chromatin binding|estrogen receptor binding|histone methyltransferase activity (H3-K36 specific)|histone methyltransferase activity (H4-K20 specific)|ligand-dependent nuclear receptor binding|retinoid X receptor binding|thyroid hormone receptor binding|transcription corepressor activity|zinc ion binding	g.chr5:176665401G>C	AK026066	CCDS4412.1, CCDS4413.1	5q35	2014-09-17	2003-03-12		ENSG00000165671	ENSG00000165671		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	14234	protein-coding gene	gene with protein product		606681	"""Sotos syndrome"""	STO		9628876, 11896389	Standard	NM_022455		Approved	ARA267, FLJ22263, KMT3B	uc003mfr.4	Q96L73	OTTHUMG00000130846	ENST00000439151.2:c.4085G>C	5.37:g.176665401G>C	ENSP00000395929:p.Gly1362Ala	HNSCC(47;0.14)	Somatic				NSD1_uc003mft.3_Missense_Mutation_p.G1093A|NSD1_uc003mfs.1_Missense_Mutation_p.G1259A|NSD1_uc011dfx.1_Missense_Mutation_p.G1010A	p.G1362A	NM_022455	NP_071900	WXS	Illumina HiSeq	Unspecified	Q96L73	NSD1_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)	7	4223	+	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	1362					Q96PD8|Q96RN7	Missense_Mutation	SNP	ENST00000439151.2	37	c.4085G>C	CCDS4412.1	.	.	.	.	.	.	.	.	.	.	G	13.32	2.202618	0.38905	.	.	ENSG00000165671	ENST00000354179;ENST00000439151;ENST00000347982;ENST00000361032	D;D;D;D	0.92752	-3.0;-3.0;-3.0;-3.1	5.28	4.39	0.52855	.	0.301732	0.29225	N	0.012766	D	0.84088	0.5395	N	0.19112	0.55	0.31230	N	0.696414	B;P;B	0.50943	0.42;0.94;0.296	B;P;B	0.44946	0.143;0.465;0.046	T	0.80812	-0.1215	10	0.02654	T	1	.	11.5953	0.50970	0.0:0.1791:0.8209:0.0	.	1093;1259;1362	Q96L73-2;Q96L73-3;Q96L73	.;.;NSD1_HUMAN	A	1093;1362;1093;1259	ENSP00000346111:G1093A;ENSP00000395929:G1362A;ENSP00000343209:G1093A;ENSP00000354310:G1259A	ENSP00000343209:G1093A	G	+	2	0	NSD1	176598007	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.727000	0.38095	1.425000	0.47237	0.655000	0.94253	GGA		0.532	NSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253412.2	NM_172349		3	148	0	0	0	0.004672	0	3	148				
CANX	821	broad.mit.edu	37	5	179149988	179149988	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr5:179149988G>T	ENST00000247461.4	+	11	1566	c.1366G>T	c.(1366-1368)Ggc>Tgc	p.G456C	CANX_ENST00000504734.1_Missense_Mutation_p.G456C|CANX_ENST00000512607.2_Missense_Mutation_p.G348C|CANX_ENST00000415618.2_Missense_Mutation_p.G491C|CANX_ENST00000452673.2_Missense_Mutation_p.G456C	NM_001746.3	NP_001737.1	P27824	CALX_HUMAN	calnexin	456					aging (GO:0007568)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|chaperone-mediated protein folding (GO:0061077)|clathrin-mediated endocytosis (GO:0072583)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|protein secretion (GO:0009306)|synaptic vesicle endocytosis (GO:0048488)	axon (GO:0030424)|dendrite cytoplasm (GO:0032839)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|ER-mitochondrion membrane contact site (GO:0044233)|extracellular vesicular exosome (GO:0070062)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)|ribosome (GO:0005840)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|poly(A) RNA binding (GO:0044822)	p.G456C(1)		breast(1)|endometrium(3)|kidney(4)|large_intestine(2)|lung(7)|prostate(2)|urinary_tract(3)	22	all_cancers(89;0.000129)|all_epithelial(37;5.59e-05)|Renal(175;0.000159)|Lung NSC(126;0.00121)|all_lung(126;0.00218)	all_cancers(40;0.0413)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Antihemophilic Factor(DB00025)|Tenecteplase(DB00031)	TGATGGATGGGGCCTGAAGAA	0.438																																							uc003mkk.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1366-1368)GGC>TGC		calnexin precursor	Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Reteplase(DB00015)|Tenecteplase(DB00031)						218.0	211.0	213.0					5																	179149988		2203	4300	6503	SO:0001583	missense	821				post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine|protein secretion	endoplasmic reticulum lumen|endoplasmic reticulum membrane|integral to membrane|melanosome	calcium ion binding|sugar binding|unfolded protein binding	g.chr5:179149988G>T	L18887	CCDS4447.1	5q35	2008-07-18			ENSG00000127022	ENSG00000127022			1473	protein-coding gene	gene with protein product	"""major histocompatibility complex class I antigen-binding protein p88"""	114217				1326756, 8136357	Standard	NM_001746		Approved	CNX, IP90, P90	uc003mkl.3	P27824	OTTHUMG00000130910	ENST00000247461.4:c.1366G>T	5.37:g.179149988G>T	ENSP00000247461:p.Gly456Cys		Somatic				CANX_uc011dgp.1_Missense_Mutation_p.G491C|CANX_uc003mkl.2_Missense_Mutation_p.G456C|CANX_uc011dgq.1_Missense_Mutation_p.G348C	p.G456C	NM_001746	NP_001737	WXS	Illumina HiSeq	Unspecified	P27824	CALX_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		11	1543	+	all_cancers(89;0.000129)|all_epithelial(37;5.59e-05)|Renal(175;0.000159)|Lung NSC(126;0.00121)|all_lung(126;0.00218)	all_cancers(40;0.0413)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	456			Lumenal (Potential).		B2R5V8|B4DGP8|B4E2T8|D3DWQ3|D6R9K3	Missense_Mutation	SNP	ENST00000247461.4	37	c.1366G>T	CCDS4447.1	.	.	.	.	.	.	.	.	.	.	G	34	5.309263	0.95629	.	.	ENSG00000127022	ENST00000504734;ENST00000415618;ENST00000452673;ENST00000247461;ENST00000512607	T;T;T;T;T	0.52754	0.65;0.65;0.65;0.65;0.65	5.74	5.74	0.90152	Concanavalin A-like lectin/glucanase (1);	0.000000	0.85682	D	0.000000	T	0.67979	0.2951	M	0.82056	2.57	0.80722	D	1	D;D	0.60575	0.988;0.988	P;P	0.56700	0.804;0.804	T	0.70000	-0.4992	10	0.59425	D	0.04	-24.1138	20.2924	0.98543	0.0:0.0:1.0:0.0	.	491;456	B4DGP8;P27824	.;CALX_HUMAN	C	456;491;456;456;348	ENSP00000424063:G456C;ENSP00000394817:G491C;ENSP00000391646:G456C;ENSP00000247461:G456C;ENSP00000423588:G348C	ENSP00000247461:G456C	G	+	1	0	CANX	179082594	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.778000	0.75043	2.876000	0.98609	0.650000	0.86243	GGC		0.438	CANX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253500.2	NM_001024649		22	129	1	0	2.48779e-11	0.005443	3.15264e-11	22	129				
GABBR1	2550	broad.mit.edu	37	6	29574725	29574725	+	Silent	SNP	G	G	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr6:29574725G>A	ENST00000377034.4	-	18	2501	c.2166C>T	c.(2164-2166)gtC>gtT	p.V722V	GABBR1_ENST00000355973.3_Silent_p.V605V|GABBR1_ENST00000376977.3_3'UTR|GABBR1_ENST00000377012.4_Silent_p.V605V|GABBR1_ENST00000377016.4_Silent_p.V660V	NM_001470.2	NP_001461.1	Q9UBS5	GABR1_HUMAN	gamma-aminobutyric acid (GABA) B receptor, 1	722					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|G-protein coupled receptor heterodimeric complex (GO:0038039)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	G-protein coupled GABA receptor activity (GO:0004965)	p.V722V(1)		endometrium(3)|kidney(1)|large_intestine(13)|liver(1)|lung(16)|ovary(5)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47					Baclofen(DB00181)|Progabide(DB00837)|Vigabatrin(DB01080)	CGAGAGTGAGGACATCCATGC	0.572																																							uc003nmt.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(5)|liver(1)|skin(1)	7						c.(2164-2166)GTC>GTT		gamma-aminobutyric acid (GABA) B receptor 1	Baclofen(DB00181)|Progabide(DB00837)						101.0	90.0	94.0					6																	29574725		1511	2709	4220	SO:0001819	synonymous_variant	2550				gamma-aminobutyric acid signaling pathway|negative regulation of adenylate cyclase activity|synaptic transmission	cell junction|extracellular region|integral to plasma membrane|postsynaptic membrane	G-protein coupled receptor activity|GABA-B receptor activity	g.chr6:29574725G>A	Y11044	CCDS4663.1, CCDS4664.1, CCDS4665.1	6p21.3	2012-08-29			ENSG00000204681	ENSG00000204681		"""GABA receptors"", ""GPCR / Class C : GABA(B) receptors"""	4070	protein-coding gene	gene with protein product	"""GABA-B receptor"""	603540				9753614, 9798068	Standard	NM_001470		Approved	hGB1a, GPRC3A	uc003nmt.4	Q9UBS5	OTTHUMG00000031095	ENST00000377034.4:c.2166C>T	6.37:g.29574725G>A			Somatic				GABBR1_uc003nmp.3_Silent_p.V605V|GABBR1_uc003nms.3_Silent_p.V605V|GABBR1_uc003nmu.3_Silent_p.V660V|GABBR1_uc011dlr.1_Silent_p.V545V	p.V722V	NM_001470	NP_001461	WXS	Illumina HiSeq	Unspecified	Q9UBS5	GABR1_HUMAN			18	2502	-			722			Helical; Name=4; (Potential).		B0UXY7|O95375|O95468|O95975|O96022|Q5STL4|Q5SUJ8|Q5SUL3|Q71SG6|Q86W60|Q9UQQ0	Silent	SNP	ENST00000377034.4	37	c.2166C>T	CCDS4663.1	.	.	.	.	.	.	.	.	.	.	G	9.836	1.189694	0.21954	.	.	ENSG00000204681	ENST00000485026	.	.	.	4.27	1.19	0.21007	.	.	.	.	.	T	0.31358	0.0794	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.19484	-1.0304	4	.	.	.	-28.4414	4.3658	0.11223	0.1908:0.4086:0.4006:0.0	.	.	.	.	S	103	.	.	P	-	1	0	GABBR1	29682704	0.980000	0.34600	0.989000	0.46669	0.987000	0.75469	0.171000	0.16685	0.887000	0.36136	0.563000	0.77884	CCT		0.572	GABBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076141.3			35	94	0	0	0	0.005524	0	35	94				
SLC44A4	80736	broad.mit.edu	37	6	31843659	31843659	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr6:31843659G>A	ENST00000229729.6	-	4	232	c.212C>T	c.(211-213)aCt>aTt	p.T71I	SLC44A4_ENST00000375562.4_Missense_Mutation_p.T71I|SLC44A4_ENST00000465707.1_5'UTR|SLC44A4_ENST00000544672.1_5'UTR	NM_025257.2	NP_079533.2	Q53GD3	CTL4_HUMAN	solute carrier family 44, member 4	71					acetylcholine biosynthetic process (GO:0008292)|acetylcholine secretion (GO:0061526)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|positive regulation of cell growth (GO:0030307)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.T71I(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|prostate(3)|skin(1)|urinary_tract(2)	35					Choline(DB00122)	GTAGGCCCCAGTAGAGTTCCT	0.602																																							uc010jti.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(2)|ovary(1)|central_nervous_system(1)	4						c.(211-213)ACT>ATT		choline transporter-like protein 4	Choline(DB00122)						179.0	204.0	195.0					6																	31843659		1511	2709	4220	SO:0001583	missense	80736					integral to membrane|plasma membrane	choline transmembrane transporter activity	g.chr6:31843659G>A	AF134726	CCDS4724.2, CCDS54989.1, CCDS54990.1	6p21.3	2014-02-17	2005-09-06	2005-09-06	ENSG00000204385	ENSG00000204385		"""Solute carriers"""	13941	protein-coding gene	gene with protein product		606107	"""chromosome 6 open reading frame 29"""	C6orf29		10677542, 15715662, 24379411	Standard	NM_025257		Approved	NG22, CTL4, FLJ14491, TPPT	uc010jti.3	Q53GD3	OTTHUMG00000031133	ENST00000229729.6:c.212C>T	6.37:g.31843659G>A	ENSP00000229729:p.Thr71Ile		Somatic				SLC44A4_uc011dol.1_5'UTR|SLC44A4_uc011dom.1_Missense_Mutation_p.T71I	p.T71I	NM_025257	NP_079533	WXS	Illumina HiSeq	Unspecified	Q53GD3	CTL4_HUMAN			4	278	-			71			Extracellular (Potential).		A2BED3|B0UXX8|B0UZY8|B4DU94|B4DWM2|E9PEK7|Q5JP84|Q5JQ93|Q658S8|Q6UX89|Q8TEW4|Q96C58|Q96K59|Q9Y332	Missense_Mutation	SNP	ENST00000229729.6	37	c.212C>T	CCDS4724.2	.	.	.	.	.	.	.	.	.	.	G	13.64	2.298891	0.40694	.	.	ENSG00000204385	ENST00000229729;ENST00000375562	T;T	0.28069	1.63;1.63	4.56	4.56	0.56223	.	0.119880	0.56097	D	0.000039	T	0.23133	0.0559	M	0.74881	2.28	0.80722	D	1	B;B	0.26120	0.142;0.088	B;B	0.31016	0.123;0.091	T	0.05566	-1.0877	10	0.25751	T	0.34	-16.5998	14.8473	0.70270	0.0:0.0:1.0:0.0	.	71;71	E9PEK7;Q53GD3	.;CTL4_HUMAN	I	71	ENSP00000229729:T71I;ENSP00000364712:T71I	ENSP00000229729:T71I	T	-	2	0	SLC44A4	31951638	0.969000	0.33509	0.861000	0.33841	0.898000	0.52572	3.379000	0.52440	2.375000	0.81037	0.561000	0.74099	ACT		0.602	SLC44A4-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076234.3			143	296	0	0	0	0.01441	0	143	296				
KCNK17	89822	broad.mit.edu	37	6	39278775	39278775	+	Silent	SNP	G	G	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr6:39278775G>A	ENST00000373231.4	-	2	478	c.246C>T	c.(244-246)gtC>gtT	p.V82V	KCNK17_ENST00000453413.2_Silent_p.V82V	NM_031460.3	NP_113648.2	Q96T54	KCNKH_HUMAN	potassium channel, subfamily K, member 17	82					potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)	p.V82V(2)		endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(2)	14						TGTATGCTTGGACGACATCCT	0.562																																							uc003ooo.2		NA																	2	Substitution - coding silent(2)		lung(2)	skin(2)	2						c.(244-246)GTC>GTT		potassium channel, subfamily K, member 17							121.0	111.0	114.0					6																	39278775		2203	4300	6503	SO:0001819	synonymous_variant	89822					integral to membrane	potassium channel activity|voltage-gated ion channel activity	g.chr6:39278775G>A	AF358910	CCDS4842.1, CCDS47419.1	6p21	2012-03-07			ENSG00000124780	ENSG00000124780		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	14465	protein-coding gene	gene with protein product		607370				16382106	Standard	NM_031460		Approved	K2p17.1, TALK-2, TALK2, TASK4, TASK-4	uc003ooo.3	Q96T54	OTTHUMG00000014646	ENST00000373231.4:c.246C>T	6.37:g.39278775G>A			Somatic				KCNK17_uc003oop.2_Silent_p.V82V	p.V82V	NM_031460	NP_113648	WXS	Illumina HiSeq	Unspecified	Q96T54	KCNKH_HUMAN			2	386	-			82					E9PB46|Q5TCF4|Q8TAW4|Q9BXD1|Q9H592	Silent	SNP	ENST00000373231.4	37	c.246C>T	CCDS4842.1																																																																																				0.562	KCNK17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040453.2	NM_031460		43	122	0	0	0	0.010771	0	43	122				
KIF6	221458	broad.mit.edu	37	6	39330242	39330242	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr6:39330242C>A	ENST00000287152.7	-	17	2008	c.1914G>T	c.(1912-1914)aaG>aaT	p.K638N	KIF6_ENST00000229913.5_Missense_Mutation_p.K89N|KIF6_ENST00000541946.1_Missense_Mutation_p.K89N|KIF6_ENST00000373216.3_Missense_Mutation_p.K638N|KIF6_ENST00000373215.3_Missense_Mutation_p.K621N|KIF6_ENST00000538893.1_Missense_Mutation_p.K582N|KIF6_ENST00000373213.4_Missense_Mutation_p.K477N|KIF6_ENST00000394362.1_Missense_Mutation_p.K89N	NM_145027.4	NP_659464.3	Q6ZMV9	KIF6_HUMAN	kinesin family member 6	638					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|male germ cell nucleus (GO:0001673)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.K638N(2)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(16)|large_intestine(8)|lung(15)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	52						GTGATCGCAGCTTCTCCTCCT	0.547											OREG0017415	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc003oot.2		NA																	2	Substitution - Missense(2)		lung(2)	breast(2)|central_nervous_system(1)	3						c.(1912-1914)AAG>AAT		kinesin family member 6							233.0	208.0	217.0					6																	39330242		2203	4300	6503	SO:0001583	missense	221458				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity|protein binding	g.chr6:39330242C>A	AL832634	CCDS4844.1, CCDS75449.1	6p21.2	2010-03-30			ENSG00000164627	ENSG00000164627		"""Kinesins"""	21202	protein-coding gene	gene with protein product		613919	"""chromosome 6 open reading frame 102"""	C6orf102			Standard	NM_145027		Approved	dJ1043E3.1, MGC33317, dJ137F1.4, dJ188D3.1, DKFZp451I2418	uc003oot.2	Q6ZMV9	OTTHUMG00000014648	ENST00000287152.7:c.1914G>T	6.37:g.39330242C>A	ENSP00000287152:p.Lys638Asn		Somatic	OREG0017415	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	885	KIF6_uc003oos.2_Missense_Mutation_p.K89N|KIF6_uc010jwz.1_Missense_Mutation_p.K13N|KIF6_uc010jxa.1_Missense_Mutation_p.K429N|KIF6_uc011dua.1_Missense_Mutation_p.K621N|KIF6_uc010jxb.1_Missense_Mutation_p.K582N	p.K638N	NM_145027	NP_659464	WXS	Illumina HiSeq	Unspecified	Q6ZMV9	KIF6_HUMAN			17	2009	-			638			Potential.		Q2MDE3|Q2MDE4|Q5T8J6|Q6ZWE3|Q86T87|Q8WTV4	Missense_Mutation	SNP	ENST00000287152.7	37	c.1914G>T	CCDS4844.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	5.648|5.648	0.304183|0.304183	0.10678|0.10678	.|.	.|.	ENSG00000164627|ENSG00000164627	ENST00000287152;ENST00000394362;ENST00000373216;ENST00000373213;ENST00000229913;ENST00000373215;ENST00000538893;ENST00000541946;ENST00000540362|ENST00000458470	T;T;T;T;T;T;T;T|.	0.42900|.	0.96;0.96;0.96;0.96;0.96;0.96;0.96;0.96|.	5.23|5.23	1.92|1.92	0.25849|0.25849	.|.	.|.	.|.	.|.	.|.	T|T	0.30572|0.30572	0.0769|0.0769	L|L	0.44542|0.44542	1.39|1.39	0.39292|0.39292	D|D	0.964754|0.964754	B;B;B;B|.	0.23650|.	0.019;0.004;0.004;0.089|.	B;B;B;B|.	0.24848|.	0.005;0.005;0.005;0.056|.	T|T	0.10428|0.10428	-1.0630|-1.0630	9|5	0.20519|.	T|.	0.43|.	.|.	5.5822|5.5822	0.17256|0.17256	0.0:0.5175:0.0:0.4825|0.0:0.5175:0.0:0.4825	.|.	621;582;638;638|.	E7EUN7;F6VGH2;Q6ZMV9-3;Q6ZMV9|.	.;.;.;KIF6_HUMAN|.	N|I	638;89;638;477;89;621;582;89;89|530	ENSP00000287152:K638N;ENSP00000377889:K89N;ENSP00000362312:K638N;ENSP00000362309:K477N;ENSP00000229913:K89N;ENSP00000362311:K621N;ENSP00000441435:K582N;ENSP00000439064:K89N|.	ENSP00000229913:K89N|.	K|S	-|-	3|2	2|0	KIF6|KIF6	39438220|39438220	1.000000|1.000000	0.71417|0.71417	0.917000|0.917000	0.36280|0.36280	0.039000|0.039000	0.13416|0.13416	0.370000|0.370000	0.20433|0.20433	0.682000|0.682000	0.31407|0.31407	-0.136000|-0.136000	0.14681|0.14681	AAG|AGC		0.547	KIF6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040455.2	NM_145027		45	224	1	0	6.27289e-28	0.01441	9.95088e-28	45	224				
TINAG	27283	broad.mit.edu	37	6	54191689	54191689	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr6:54191689T>A	ENST00000259782.4	+	4	695	c.599T>A	c.(598-600)aTg>aAg	p.M200K	TINAG_ENST00000370869.3_Missense_Mutation_p.M196K|TINAG_ENST00000370864.3_Missense_Mutation_p.M182K	NM_014464.3	NP_055279.3	Q9UJW2	TINAG_HUMAN	tubulointerstitial nephritis antigen	200					cell adhesion (GO:0007155)|immune response (GO:0006955)	basement membrane (GO:0005604)	cysteine-type endopeptidase activity (GO:0004197)|nucleotide binding (GO:0000166)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)	p.M200K(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(4)|skin(1)	34	Lung NSC(77;0.0518)		LUSC - Lung squamous cell carcinoma(124;0.246)			CCTAGTCCCATGCTCCTGAGC	0.393																																							uc003pcj.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|central_nervous_system(1)	4						c.(598-600)ATG>AAG		tubulointerstitial nephritis antigen							138.0	123.0	128.0					6																	54191689		2203	4300	6503	SO:0001583	missense	27283				cell adhesion|immune response|Malpighian tubule morphogenesis|proteolysis	basement membrane	cysteine-type endopeptidase activity|nucleotide binding|polysaccharide binding|scavenger receptor activity	g.chr6:54191689T>A	AB022277	CCDS4955.1	6p12.1	2008-05-15			ENSG00000137251	ENSG00000137251			14599	protein-coding gene	gene with protein product		606749				10652240	Standard	NM_014464		Approved		uc003pcj.2	Q9UJW2	OTTHUMG00000014893	ENST00000259782.4:c.599T>A	6.37:g.54191689T>A	ENSP00000259782:p.Met200Lys		Somatic				TINAG_uc010jzt.2_RNA	p.M200K	NM_014464	NP_055279	WXS	Illumina HiSeq	Unspecified	Q9UJW2	TINAG_HUMAN	LUSC - Lung squamous cell carcinoma(124;0.246)		4	745	+	Lung NSC(77;0.0518)		200					Q5T467|Q9UJW1|Q9ULZ4	Missense_Mutation	SNP	ENST00000259782.4	37	c.599T>A	CCDS4955.1	.	.	.	.	.	.	.	.	.	.	T	8.241	0.806735	0.16467	.	.	ENSG00000137251	ENST00000370869;ENST00000339741;ENST00000259782;ENST00000370864	T;T;T	0.62364	2.08;0.03;2.09	5.7	-8.96	0.00761	.	1.575640	0.03253	N	0.182198	T	0.13457	0.0326	N	0.19112	0.55	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.05435	-1.0885	10	0.05436	T	0.98	.	7.815	0.29254	0.3407:0.5015:0.0:0.1578	.	200	Q9UJW2	TINAG_HUMAN	K	196;150;200;182	ENSP00000359906:M196K;ENSP00000259782:M200K;ENSP00000359901:M182K	ENSP00000259782:M200K	M	+	2	0	TINAG	54299648	0.000000	0.05858	0.001000	0.08648	0.352000	0.29268	-0.073000	0.11468	-1.680000	0.01450	-1.301000	0.01330	ATG		0.393	TINAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040984.1	NM_014464		39	67	0	0	0	0.009718	0	39	67				
BAI3	577	broad.mit.edu	37	6	69348714	69348714	+	Silent	SNP	T	T	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr6:69348714T>A	ENST00000370598.1	+	3	968	c.147T>A	c.(145-147)ccT>ccA	p.P49P		NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	49	CUB. {ECO:0000255|PROSITE- ProRule:PRU00059}.				G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.P49P(1)		NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				AAATGTTTCCTAAAAACTTTA	0.383																																							uc003pev.3		NA																	1	Substitution - coding silent(1)		lung(1)	lung(27)|ovary(8)|skin(6)|pancreas(4)|central_nervous_system(3)|urinary_tract(1)|breast(1)	50						c.(145-147)CCT>CCA		brain-specific angiogenesis inhibitor 3							80.0	81.0	81.0					6																	69348714		2203	4300	6503	SO:0001819	synonymous_variant	577				negative regulation of angiogenesis|neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr6:69348714T>A	AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.147T>A	6.37:g.69348714T>A			Somatic				BAI3_uc010kak.2_Silent_p.P49P	p.P49P	NM_001704	NP_001695	WXS	Illumina HiSeq	Unspecified	O60242	BAI3_HUMAN			3	595	+		all_lung(197;0.212)	49			CUB.|Extracellular (Potential).		B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Silent	SNP	ENST00000370598.1	37	c.147T>A	CCDS4968.1																																																																																				0.383	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041120.1			53	63	0	0	0	0.01441	0	53	63				
COL12A1	1303	broad.mit.edu	37	6	75844451	75844451	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr6:75844451C>A	ENST00000322507.8	-	32	5824	c.5515G>T	c.(5515-5517)Ggc>Tgc	p.G1839C	COL12A1_ENST00000416123.2_Missense_Mutation_p.G1839C|COL12A1_ENST00000345356.6_Missense_Mutation_p.G675C|COL12A1_ENST00000483888.2_Missense_Mutation_p.G1839C	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	1839	Fibronectin type-III 13. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)	p.G1839C(1)		breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						CTGGTCTTGCCTCTTCCCGTC	0.453																																							uc003phs.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|large_intestine(1)|breast(1)|skin(1)	9						c.(5515-5517)GGC>TGC		collagen, type XII, alpha 1 long isoform							121.0	119.0	119.0					6																	75844451		1919	4125	6044	SO:0001583	missense	1303				cell adhesion|collagen fibril organization|skeletal system development	collagen type XII|extracellular space	extracellular matrix structural constituent conferring tensile strength	g.chr6:75844451C>A	U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.5515G>T	6.37:g.75844451C>A	ENSP00000325146:p.Gly1839Cys		Somatic				COL12A1_uc003pht.2_Missense_Mutation_p.G675C	p.G1839C	NM_004370	NP_004361	WXS	Illumina HiSeq	Unspecified	Q99715	COCA1_HUMAN			32	5681	-			1839			Fibronectin type-III 13.		O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Missense_Mutation	SNP	ENST00000322507.8	37	c.5515G>T	CCDS43482.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.4|25.4	4.633904|4.633904	0.87660|0.87660	.|.	.|.	ENSG00000111799|ENSG00000111799	ENST00000322507;ENST00000432784;ENST00000345356;ENST00000416123;ENST00000483888|ENST00000419671	T;T;T;T|T	0.53206|0.04551	0.63;0.63;0.63;0.63|3.6	5.87|5.87	5.87|5.87	0.94306|0.94306	Fibronectin, type III (2);Immunoglobulin-like fold (1);|.	0.000000|.	0.64402|.	D|.	0.000001|.	T|T	0.21062|0.21062	0.0507|0.0507	M|M	0.91354|0.91354	3.2|3.2	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	0.996;1.0|.	T|T	0.04400|0.04400	-1.0954|-1.0954	10|7	0.72032|0.32370	D|T	0.01|0.25	.|.	20.1991|20.1991	0.98252|0.98252	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	675;1839|.	Q99715-2;Q99715|.	.;COCA1_HUMAN|.	C|M	1839;1839;675;1839;1839|573	ENSP00000325146:G1839C;ENSP00000305147:G675C;ENSP00000412864:G1839C;ENSP00000421216:G1839C|ENSP00000393217:R573M	ENSP00000325146:G1839C|ENSP00000393217:R573M	G|R	-|-	1|2	0|0	COL12A1|COL12A1	75901171|75901171	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.939000|0.939000	0.58152|0.58152	7.263000|7.263000	0.78421|0.78421	2.775000|2.775000	0.95449|0.95449	0.650000|0.650000	0.86243|0.86243	GGC|AGG		0.453	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041249.3	NM_004370		33	59	1	0	1.62565e-12	0.012213	2.14003e-12	33	59				
MDN1	23195	broad.mit.edu	37	6	90503894	90503894	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr6:90503894C>G	ENST00000369393.3	-	4	702	c.587G>C	c.(586-588)tGt>tCt	p.C196S	MDN1_ENST00000428876.1_Missense_Mutation_p.C196S			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	196					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)	p.C196S(1)		NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		TTCATTCATACAGGTAACCAA	0.338																																							uc003pnn.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(8)|skin(2)	10						c.(586-588)TGT>TCT		MDN1, midasin homolog							64.0	65.0	65.0					6																	90503894		2203	4300	6503	SO:0001583	missense	23195				protein complex assembly|regulation of protein complex assembly	nucleus	ATP binding|ATPase activity|unfolded protein binding	g.chr6:90503894C>G	AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.587G>C	6.37:g.90503894C>G	ENSP00000358400:p.Cys196Ser		Somatic				MDN1_uc003pnp.1_Missense_Mutation_p.C196S	p.C196S	NM_014611	NP_055426	WXS	Illumina HiSeq	Unspecified	Q9NU22	MDN1_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0193)	4	703	-		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)	196					O15019|Q5T794	Missense_Mutation	SNP	ENST00000369393.3	37	c.587G>C	CCDS5024.1	.	.	.	.	.	.	.	.	.	.	C	9.590	1.125934	0.20959	.	.	ENSG00000112159	ENST00000369393;ENST00000428876;ENST00000439638	T;T;T	0.26067	1.76;1.76;1.76	5.32	3.43	0.39272	.	0.394512	0.29431	N	0.012168	T	0.04907	0.0132	N	0.14661	0.345	0.34082	D	0.659717	B;B	0.18741	0.03;0.006	B;B	0.12837	0.007;0.008	T	0.24870	-1.0148	10	0.09843	T	0.71	.	12.5141	0.56021	0.0:0.7994:0.1286:0.072	.	196;196	Q6ZVV6;Q9NU22	.;MDN1_HUMAN	S	196	ENSP00000358400:C196S;ENSP00000413970:C196S;ENSP00000409664:C196S	ENSP00000358400:C196S	C	-	2	0	MDN1	90560615	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	1.533000	0.36040	1.241000	0.43820	-0.259000	0.10710	TGT		0.338	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041514.2			23	44	0	0	0	0.00632	0	23	44				
CASP8AP2	9994	broad.mit.edu	37	6	90576192	90576192	+	RNA	SNP	A	A	G			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr6:90576192A>G	ENST00000551025.1	+	0	4620									caspase 8 associated protein 2									p.S1061S(1)		NS(1)|endometrium(7)|kidney(6)|large_intestine(12)|lung(21)|ovary(2)|urinary_tract(2)	51		all_cancers(76;3.64e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;4.69e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0953)		CAAAATTTTCATTAATACAAT	0.289																																					Colon(187;1656 2025 17045 31481 39901)	Colon(187;1656 2025 17045 31481 39901)	uc003pnr.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(3181-3183)TCA>TCG		caspase 8 associated protein 2							25.0	23.0	24.0					6																	90576192		1793	4040	5833			9994				cell cycle|cellular response to mechanical stimulus|induction of apoptosis via death domain receptors|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	cytoplasm|nucleus	caspase activator activity|death receptor binding|transcription corepressor activity	g.chr6:90576192A>G	AB037736		6q15	2012-04-19	2008-10-30		ENSG00000118412	ENSG00000118412			1510	protein-coding gene	gene with protein product	"""FLICE-associated huge protein"""	606880	"""CASP8 associated protein 2"""			10235259, 17245429, 17003126	Standard	NM_001137668		Approved	FLASH, CED-4, RIP25, FLJ11208, KIAA1315	uc011dzz.2	Q9UKL3	OTTHUMG00000015212		6.37:g.90576192A>G			Somatic				CASP8AP2_uc003pns.2_Intron|CASP8AP2_uc003pnt.2_Silent_p.S1061S|CASP8AP2_uc011dzz.1_Silent_p.S1061S	p.S1061S	NM_001137667	NP_001131139	WXS	Illumina HiSeq	Unspecified	Q9UKL3	C8AP2_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0953)	8	3379	+		all_cancers(76;3.64e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;4.69e-05)|Lung NSC(302;0.238)	1061						Silent	SNP	ENST00000551025.1	37	c.3183A>G																																																																																					0.289	CASP8AP2-202	KNOWN	basic	processed_transcript	processed_transcript		NM_001137667		3	1	0	0	0	0.004672	0	3	1				
POPDC3	64208	broad.mit.edu	37	6	105609367	105609367	+	Missense_Mutation	SNP	T	T	G			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr6:105609367T>G	ENST00000254765.3	-	2	696	c.418A>C	c.(418-420)Aag>Cag	p.K140Q	BVES-AS1_ENST00000580854.1_RNA|POPDC3_ENST00000474760.1_Intron|BVES-AS1_ENST00000369120.2_RNA|BVES-AS1_ENST00000580511.1_RNA|BVES-AS1_ENST00000369122.3_RNA	NM_022361.4	NP_071756.2	Q9HBV1	POPD3_HUMAN	popeye domain containing 3	140					regulation of membrane potential (GO:0042391)	integral component of membrane (GO:0016021)		p.K140Q(1)		NS(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(10)|ovary(2)|skin(3)|urinary_tract(1)	26		all_cancers(87;4.87e-05)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0157)|Colorectal(196;0.202)|Lung NSC(302;0.238)				CAGTGTTCCTTTTCCAAAGTA	0.453																																							uc003prb.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|ovary(2)	5						c.(418-420)AAG>CAG		popeye protein 3							121.0	125.0	123.0					6																	105609367		2203	4300	6503	SO:0001583	missense	64208					integral to membrane		g.chr6:105609367T>G	BC022323	CCDS5052.1	6q21	2003-06-12			ENSG00000132429	ENSG00000132429			17649	protein-coding gene	gene with protein product		605824				10882522	Standard	NM_022361		Approved	POP3, MGC22671, bA355M14.1	uc003prb.3	Q9HBV1	OTTHUMG00000015293	ENST00000254765.3:c.418A>C	6.37:g.105609367T>G	ENSP00000254765:p.Lys140Gln		Somatic				uc003pqz.2_Intron|POPDC3_uc003pra.2_Intron	p.K140Q	NM_022361	NP_071756	WXS	Illumina HiSeq	Unspecified	Q9HBV1	POPD3_HUMAN			2	820	-		all_cancers(87;4.87e-05)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0157)|Colorectal(196;0.202)|Lung NSC(302;0.238)	140					B2RA98|Q5T3Y8|Q8TBW6	Missense_Mutation	SNP	ENST00000254765.3	37	c.418A>C	CCDS5052.1	.	.	.	.	.	.	.	.	.	.	T	15.76	2.928541	0.52759	.	.	ENSG00000132429	ENST00000254765	T	0.32023	1.47	5.72	5.72	0.89469	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);	0.168867	0.51477	D	0.000083	T	0.12390	0.0301	L	0.35414	1.06	0.39565	D	0.969198	B	0.33044	0.395	B	0.36504	0.226	T	0.09079	-1.0691	10	0.16896	T	0.51	-21.5631	11.9187	0.52779	0.0:0.0:0.1452:0.8548	.	140	Q9HBV1	POPD3_HUMAN	Q	140	ENSP00000254765:K140Q	ENSP00000254765:K140Q	K	-	1	0	POPDC3	105716060	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.835000	0.48175	2.183000	0.69458	0.533000	0.62120	AAG		0.453	POPDC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041651.1	NM_022361		54	145	0	0	0	0.01441	0	54	145				
LAMA2	3908	broad.mit.edu	37	6	129649532	129649532	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr6:129649532G>T	ENST00000421865.2	+	29	4335	c.4286G>T	c.(4285-4287)tGt>tTt	p.C1429F		NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2	1429	Laminin EGF-like 15. {ECO:0000255|PROSITE-ProRule:PRU00460}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)	p.C1429F(1)		NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		AGCAGCCTGTGTGACCCTGAA	0.532																																							uc003qbn.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(8)|breast(1)|skin(1)	10						c.(4285-4287)TGT>TTT		laminin alpha 2 subunit isoform a precursor							157.0	127.0	137.0					6																	129649532		2203	4300	6503	SO:0001583	missense	3908				cell adhesion|muscle organ development|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity	g.chr6:129649532G>T	Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.4286G>T	6.37:g.129649532G>T	ENSP00000400365:p.Cys1429Phe		Somatic				LAMA2_uc003qbo.2_Missense_Mutation_p.C1429F	p.C1429F	NM_000426	NP_000417	WXS	Illumina HiSeq	Unspecified	P24043	LAMA2_HUMAN		OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)	29	4391	+			1429			Laminin EGF-like 15.		Q14736|Q5VUM2|Q93022	Missense_Mutation	SNP	ENST00000421865.2	37	c.4286G>T	CCDS5138.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.009465	0.75046	.	.	ENSG00000196569	ENST00000358023;ENST00000354729;ENST00000421865	D	0.94330	-3.4	5.15	5.15	0.70609	EGF-like, laminin (3);	0.000000	0.85682	D	0.000000	D	0.98473	0.9491	H	0.99555	4.625	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.99878	1.1107	10	0.87932	D	0	.	18.626	0.91338	0.0:0.0:1.0:0.0	.	1429;1429	A6NF00;P24043	.;LAMA2_HUMAN	F	1429	ENSP00000400365:C1429F	ENSP00000346769:C1429F	C	+	2	0	LAMA2	129691225	1.000000	0.71417	0.999000	0.59377	0.974000	0.67602	8.160000	0.89653	2.393000	0.81446	0.467000	0.42956	TGT		0.532	LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042180.1			61	125	1	0	1.02016e-41	0.01441	1.71713e-41	61	125				
UTRN	7402	broad.mit.edu	37	6	144844318	144844318	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr6:144844318G>T	ENST00000367545.3	+	40	5900	c.5900G>T	c.(5899-5901)cGg>cTg	p.R1967L		NM_007124.2	NP_009055.2	P46939	UTRO_HUMAN	utrophin	1967					aging (GO:0007568)|muscle cell differentiation (GO:0042692)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|neuron projection morphogenesis (GO:0048812)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane (GO:0016020)|membrane raft (GO:0045121)|myofibril (GO:0030016)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)	p.R1967L(1)		NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|cervix(2)|endometrium(21)|kidney(10)|large_intestine(29)|lung(56)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	148		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		TACAGTGATCGGAAAGGGTAT	0.378																																							uc003qkt.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|pancreas(1)	5						c.(5899-5901)CGG>CTG		utrophin							69.0	67.0	68.0					6																	144844318		2203	4300	6503	SO:0001583	missense	7402				muscle contraction|muscle organ development|positive regulation of cell-matrix adhesion	cell junction|cytoplasm|cytoskeleton|membrane fraction|nucleus|postsynaptic membrane	actin binding|calcium ion binding|zinc ion binding	g.chr6:144844318G>T	AK023675	CCDS34547.1	6q24	2008-02-05	2006-12-13		ENSG00000152818	ENSG00000152818			12635	protein-coding gene	gene with protein product		128240	"""utrophin (homologous to dystrophin)"""	DMDL		1426262	Standard	NM_007124		Approved	DRP, DRP1	uc003qkt.3	P46939	OTTHUMG00000015746	ENST00000367545.3:c.5900G>T	6.37:g.144844318G>T	ENSP00000356515:p.Arg1967Leu		Somatic					p.R1967L	NM_007124	NP_009055	WXS	Illumina HiSeq	Unspecified	P46939	UTRO_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)	40	5992	+		Ovarian(120;0.218)	1967			Spectrin 13.		Q5SYY1|Q5SZ57|Q9UJ40	Missense_Mutation	SNP	ENST00000367545.3	37	c.5900G>T	CCDS34547.1	.	.	.	.	.	.	.	.	.	.	G	14.78	2.636208	0.47049	.	.	ENSG00000152818	ENST00000367545	T	0.48201	0.82	5.8	0.956	0.19608	.	0.119448	0.38217	N	0.001778	T	0.34832	0.0911	M	0.77103	2.36	0.80722	D	1	P	0.47409	0.895	B	0.43508	0.422	T	0.33471	-0.9867	10	0.52906	T	0.07	.	10.5887	0.45298	0.3182:0.0:0.6818:0.0	.	1967	P46939	UTRO_HUMAN	L	1967	ENSP00000356515:R1967L	ENSP00000356515:R1967L	R	+	2	0	UTRN	144886011	0.930000	0.31532	0.526000	0.27913	0.755000	0.42902	1.422000	0.34826	0.097000	0.17492	-0.216000	0.12614	CGG		0.378	UTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042551.1			23	32	1	0	4.26978e-12	0.00333	5.57092e-12	23	32				
GRM1	2911	broad.mit.edu	37	6	146720730	146720730	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr6:146720730C>A	ENST00000282753.1	+	7	2790	c.2555C>A	c.(2554-2556)aCc>aAc	p.T852N	GRM1_ENST00000507907.1_Missense_Mutation_p.T852N|GRM1_ENST00000361719.2_Missense_Mutation_p.T852N|GRM1_ENST00000355289.4_Missense_Mutation_p.T852N|GRM1_ENST00000392299.2_Missense_Mutation_p.T852N|GRM1_ENST00000492807.2_Missense_Mutation_p.T852N			Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1	852					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|cell death (GO:0008219)|cellular response to electrical stimulus (GO:0071257)|dimeric G-protein coupled receptor signaling pathway (GO:0038042)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|G-protein coupled receptor dimeric complex (GO:0038037)|G-protein coupled receptor homodimeric complex (GO:0038038)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)	p.T852N(2)		NS(2)|breast(5)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(54)|ovary(7)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	126		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)		GCCTTCACCACCTCTGATGTT	0.532																																							uc010khw.1		NA																	2	Substitution - Missense(2)		lung(2)	lung(8)|ovary(4)|central_nervous_system(3)|large_intestine(2)|breast(2)	19						c.(2554-2556)ACC>AAC		glutamate receptor, metabotropic 1 isoform alpha	Acamprosate(DB00659)|L-Glutamic Acid(DB00142)						87.0	73.0	78.0					6																	146720730		2203	4300	6503	SO:0001583	missense	2911				synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity	g.chr6:146720730C>A	U31215	CCDS5209.1, CCDS47497.1, CCDS64548.1	6q24	2014-06-12			ENSG00000152822	ENSG00000152822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4593	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 85"""	604473				9076744, 9376535	Standard	NM_001278064		Approved	GPRC1A, mGlu1, MGLUR1, PPP1R85	uc010khw.2	Q13255	OTTHUMG00000015752	ENST00000282753.1:c.2555C>A	6.37:g.146720730C>A	ENSP00000282753:p.Thr852Asn		Somatic				GRM1_uc010khv.1_Missense_Mutation_p.T852N|GRM1_uc003qll.2_Missense_Mutation_p.T852N|GRM1_uc011edz.1_Missense_Mutation_p.T852N|GRM1_uc011eea.1_Missense_Mutation_p.T852N	p.T852N	NM_000838	NP_000829	WXS	Illumina HiSeq	Unspecified	Q13255	GRM1_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)	8	3025	+		Ovarian(120;0.0387)	852			Cytoplasmic (Potential).		B9EG79|F8W805|Q13256|Q14757|Q14758|Q5VTF7|Q5VTF8|Q9NU10|Q9UGS9|Q9UGT0	Missense_Mutation	SNP	ENST00000282753.1	37	c.2555C>A	CCDS5209.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.157762	0.78114	.	.	ENSG00000152822	ENST00000361719;ENST00000392299;ENST00000492807;ENST00000282753;ENST00000355289;ENST00000507907	D;D;D;D;D;D	0.88354	-2.34;-2.37;-2.37;-2.34;-2.36;-2.37	5.68	5.68	0.88126	GPCR, family 3, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.94108	0.8111	M	0.80746	2.51	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.97110	1.0;0.994;1.0	D	0.92493	0.6002	10	0.39692	T	0.17	.	19.7753	0.96389	0.0:1.0:0.0:0.0	.	852;852;852	F8W805;Q13255;Q13255-2	.;GRM1_HUMAN;.	N	852	ENSP00000354896:T852N;ENSP00000376119:T852N;ENSP00000424095:T852N;ENSP00000282753:T852N;ENSP00000347437:T852N;ENSP00000425599:T852N	ENSP00000282753:T852N	T	+	2	0	GRM1	146762423	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.818000	0.86416	2.686000	0.91538	0.585000	0.79938	ACC		0.532	GRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042574.1	NM_000838		18	54	1	0	6.94344e-10	0.006122	8.57719e-10	18	54				
PLG	5340	broad.mit.edu	37	6	161135878	161135878	+	Silent	SNP	C	C	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr6:161135878C>A	ENST00000308192.9	+	6	663	c.600C>A	c.(598-600)acC>acA	p.T200T		NM_000301.3	NP_000292.1	P00747	PLMN_HUMAN	plasminogen	200	Kringle 2. {ECO:0000255|PROSITE- ProRule:PRU00121}.				blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion mediated by cadherin (GO:2000048)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of fibrinolysis (GO:0051918)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of fibrinolysis (GO:0051919)|tissue remodeling (GO:0048771)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	apolipoprotein binding (GO:0034185)|protein domain specific binding (GO:0019904)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.T200T(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(19)|ovary(1)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)	59				OV - Ovarian serous cystadenocarcinoma(65;5.24e-17)|BRCA - Breast invasive adenocarcinoma(81;7.08e-06)	Alteplase(DB00009)|Aminocaproic Acid(DB00513)|Anistreplase(DB00029)|Aprotinin(DB06692)|Reteplase(DB00015)|Streptokinase(DB00086)|Tenecteplase(DB00031)|Tranexamic Acid(DB00302)|Urokinase(DB00013)	TTTCCAAGACCATGTCTGGAC	0.463																																							uc003qtm.3		NA																	1	Substitution - coding silent(1)		lung(1)	skin(3)|ovary(1)	4						c.(598-600)ACC>ACA		plasminogen	Aminocaproic Acid(DB00513)|Streptokinase(DB00086)|Tranexamic Acid(DB00302)|Urokinase(DB00013)						73.0	70.0	71.0					6																	161135878		2203	4300	6503	SO:0001819	synonymous_variant	5340				extracellular matrix disassembly|fibrinolysis|negative regulation of cell proliferation|negative regulation of cell-substrate adhesion|negative regulation of fibrinolysis|platelet activation|platelet degranulation|positive regulation of fibrinolysis|proteolysis|tissue remodeling	extracellular space|extrinsic to external side of plasma membrane|platelet alpha granule lumen	apolipoprotein binding|cell surface binding|serine-type endopeptidase activity	g.chr6:161135878C>A	M74220	CCDS5279.1, CCDS55074.1	6q26	2012-10-02			ENSG00000122194	ENSG00000122194			9071	protein-coding gene	gene with protein product		173350					Standard	NM_000301		Approved		uc003qtm.4	P00747	OTTHUMG00000015957	ENST00000308192.9:c.600C>A	6.37:g.161135878C>A			Somatic					p.T200T	NM_000301	NP_000292	WXS	Illumina HiSeq	Unspecified	P00747	PLMN_HUMAN		OV - Ovarian serous cystadenocarcinoma(65;5.24e-17)|BRCA - Breast invasive adenocarcinoma(81;7.08e-06)	6	663	+			200			Kringle 2.		Q15146|Q5TEH4|Q6PA00	Silent	SNP	ENST00000308192.9	37	c.600C>A	CCDS5279.1																																																																																				0.463	PLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042959.2	NM_000301		26	45	1	0	1.06801e-11	0.009535	1.38121e-11	26	45				
TTLL2	83887	broad.mit.edu	37	6	167753913	167753913	+	Nonsense_Mutation	SNP	C	C	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr6:167753913C>A	ENST00000239587.5	+	3	613	c.525C>A	c.(523-525)taC>taA	p.Y175*		NM_031949.4	NP_114155.4	Q9BWV7	TTLL2_HUMAN	tubulin tyrosine ligase-like family, member 2	175	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				cellular protein modification process (GO:0006464)		ligase activity (GO:0016874)	p.Y175*(1)		central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(17)|ovary(1)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		Breast(66;7.8e-06)|Ovarian(120;0.024)		OV - Ovarian serous cystadenocarcinoma(33;2.22e-20)|BRCA - Breast invasive adenocarcinoma(81;6.17e-07)|GBM - Glioblastoma multiforme(31;0.00492)		CTTCCCTGTACCAGTTCATCC	0.507																																							uc003qvs.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)|central_nervous_system(1)|skin(1)	3						c.(523-525)TAC>TAA		tubulin tyrosine ligase-like family, member 2							150.0	147.0	148.0					6																	167753913		2203	4300	6503	SO:0001587	stop_gained	83887				protein modification process		ATP binding|tubulin-tyrosine ligase activity	g.chr6:167753913C>A	AK093039	CCDS5301.1	6q27	2013-02-14		2004-01-14	ENSG00000120440	ENSG00000120440		"""Tubulin tyrosine ligase-like family"""	21211	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 104"""	C6orf104		11054573	Standard	XM_006715572		Approved	NYD-TSPG, dJ366N23.3	uc003qvs.1	Q9BWV7	OTTHUMG00000016023	ENST00000239587.5:c.525C>A	6.37:g.167753913C>A	ENSP00000239587:p.Tyr175*		Somatic				TTLL2_uc011egr.1_RNA	p.Y175*	NM_031949	NP_114155	WXS	Illumina HiSeq	Unspecified	Q9BWV7	TTLL2_HUMAN		OV - Ovarian serous cystadenocarcinoma(33;2.22e-20)|BRCA - Breast invasive adenocarcinoma(81;6.17e-07)|GBM - Glioblastoma multiforme(31;0.00492)	3	613	+		Breast(66;7.8e-06)|Ovarian(120;0.024)	175			TTL.		B2RB11|B3KS77|Q7Z6R8|Q86X22	Nonsense_Mutation	SNP	ENST00000239587.5	37	c.525C>A	CCDS5301.1	.	.	.	.	.	.	.	.	.	.	C	8.321	0.824368	0.16678	.	.	ENSG00000120440	ENST00000239587;ENST00000540954	.	.	.	3.52	-5.48	0.02592	.	0.093837	0.44097	D	0.000481	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.0424	0.36325	0.0:0.1467:0.1258:0.7275	.	.	.	.	X	175;102	.	ENSP00000239587:Y175X	Y	+	3	2	TTLL2	167673903	0.825000	0.29262	0.000000	0.03702	0.013000	0.08279	-0.235000	0.09016	-1.289000	0.02375	-0.350000	0.07774	TAC		0.507	TTLL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043127.3	NM_031949		48	102	1	0	2.64894e-19	0.01441	3.86816e-19	48	102				
THBS2	7058	broad.mit.edu	37	6	169648860	169648860	+	Silent	SNP	C	C	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr6:169648860C>A	ENST00000366787.3	-	4	510	c.261G>T	c.(259-261)acG>acT	p.T87T		NM_003247.2	NP_003238.2	P35442	TSP2_HUMAN	thrombospondin 2	87	Heparin-binding. {ECO:0000255}.|Laminin G-like.				cell adhesion (GO:0007155)|negative regulation of angiogenesis (GO:0016525)|positive regulation of synapse assembly (GO:0051965)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|platelet alpha granule (GO:0031091)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)	p.T87T(1)		NS(3)|biliary_tract(1)|endometrium(8)|kidney(3)|large_intestine(23)|liver(1)|lung(56)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	111		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)		TGAGCTGGGCCGTGAGGAAGA	0.617																																					Esophageal Squamous(91;219 1934 18562 44706)	Esophageal Squamous(91;219 1934 18562 44706)	uc003qwt.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(5)	5						c.(259-261)ACG>ACT		thrombospondin 2 precursor							125.0	106.0	112.0					6																	169648860		2203	4300	6503	SO:0001819	synonymous_variant	7058				cell adhesion	extracellular region	calcium ion binding|heparin binding|protein binding|structural molecule activity	g.chr6:169648860C>A		CCDS34574.1	6q27	2008-07-28			ENSG00000186340	ENSG00000186340			11786	protein-coding gene	gene with protein product		188061				18455130	Standard	NM_003247		Approved	TSP2	uc003qwt.3	P35442	OTTHUMG00000045408	ENST00000366787.3:c.261G>T	6.37:g.169648860C>A			Somatic					p.T87T	NM_003247	NP_003238	WXS	Illumina HiSeq	Unspecified	P35442	TSP2_HUMAN		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)	4	509	-		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)	87			TSP N-terminal.|Heparin-binding (Potential).		A6H8N1|A7E232|Q5RI52	Silent	SNP	ENST00000366787.3	37	c.261G>T	CCDS34574.1																																																																																				0.617	THBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000105439.1	NM_003247		40	134	1	0	4.00102e-26	0.00623	6.19105e-26	40	134				
ANLN	54443	broad.mit.edu	37	7	36483457	36483457	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr7:36483457G>A	ENST00000265748.2	+	22	3285	c.3064G>A	c.(3064-3066)Gat>Aat	p.D1022N	ANLN_ENST00000396068.2_Missense_Mutation_p.D985N	NM_018685.2	NP_061155.2	Q9NQW6	ANLN_HUMAN	anillin, actin binding protein	1022	Localization to the cleavage furrow.|PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				hematopoietic progenitor cell differentiation (GO:0002244)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|regulation of exit from mitosis (GO:0007096)|septin ring assembly (GO:0000921)	actin cytoskeleton (GO:0015629)|actomyosin contractile ring (GO:0005826)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	actin binding (GO:0003779)	p.D1022N(1)		breast(2)|endometrium(5)|kidney(5)|large_intestine(9)|lung(17)|ovary(2)|prostate(3)|skin(2)	45						TTATCCAGATGATGAGAAACG	0.408																																							uc003tff.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(3064-3066)GAT>AAT		anillin, actin binding protein							121.0	107.0	112.0					7																	36483457		2202	4300	6502	SO:0001583	missense	54443				cytokinesis|mitosis|regulation of exit from mitosis|septin ring assembly	actomyosin contractile ring|nucleus	actin binding	g.chr7:36483457G>A	AF273437	CCDS5447.1, CCDS64628.1	7p15-p14	2013-01-10	2006-08-22		ENSG00000011426	ENSG00000011426		"""Pleckstrin homology (PH) domain containing"""	14082	protein-coding gene	gene with protein product			"""anillin (Drosophila Scraps homolog), actin binding protein"", ""anillin, actin binding protein (scraps homolog, Drosophila)"""			10931866	Standard	NM_001284301		Approved	ANILLIN, Scraps, scra	uc003tff.3	Q9NQW6	OTTHUMG00000023143	ENST00000265748.2:c.3064G>A	7.37:g.36483457G>A	ENSP00000265748:p.Asp1022Asn		Somatic				ANLN_uc011kaz.1_Missense_Mutation_p.D934N|ANLN_uc003tfg.2_Missense_Mutation_p.D985N|ANLN_uc010kxe.2_Missense_Mutation_p.D984N	p.D1022N	NM_018685	NP_061155	WXS	Illumina HiSeq	Unspecified	Q9NQW6	ANLN_HUMAN			22	3268	+			1022			PH.|Localization to the cleavage furrow.		Q5CZ78|Q6NSK5|Q9H8Y4|Q9NVN9|Q9NVP0	Missense_Mutation	SNP	ENST00000265748.2	37	c.3064G>A	CCDS5447.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	34|34	5.307491|5.307491	0.95629|0.95629	.|.	.|.	ENSG00000011426|ENSG00000011426	ENST00000265748;ENST00000396068|ENST00000457743	T;T|.	0.75821|.	-0.97;-0.97|.	5.29|5.29	5.29|5.29	0.74685|0.74685	Pleckstrin homology-type (1);Pleckstrin homology domain (3);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.78253|0.78253	0.4254|0.4254	M|M	0.80422|0.80422	2.495|2.495	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0|.	D;D;D;D|.	0.97110|.	1.0;0.998;0.997;0.998|.	T|T	0.79274|0.79274	-0.1871|-0.1871	10|5	0.87932|.	D|.	0|.	-23.9773|-23.9773	17.942|17.942	0.89028|0.89028	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	899;984;985;1022|.	B4DSL6;A8K5D9;Q9NQW6-2;Q9NQW6|.	.;.;.;ANLN_HUMAN|.	N|I	1022;985|243	ENSP00000265748:D1022N;ENSP00000379380:D985N|.	ENSP00000265748:D1022N|.	D|M	+|+	1|3	0|0	ANLN|ANLN	36449982|36449982	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.972000|0.972000	0.66771|0.66771	9.780000|9.780000	0.99024|0.99024	2.469000|2.469000	0.83416|0.83416	0.561000|0.561000	0.74099|0.74099	GAT|ATG		0.408	ANLN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218582.3	NM_018685		11	13	0	0	0	0.010729	0	11	13				
PCLO	27445	broad.mit.edu	37	7	82764745	82764745	+	Silent	SNP	C	C	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr7:82764745C>T	ENST00000333891.9	-	3	2458	c.2121G>A	c.(2119-2121)gtG>gtA	p.V707V	PCLO_ENST00000423517.2_Silent_p.V707V	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein									p.V707V(2)|p.V653V(1)		breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						TTGGTTGTTTCACTAGTGGTG	0.542																																							uc003uhx.2		NA																	3	Substitution - coding silent(3)		lung(3)	ovary(7)	7						c.(2119-2121)GTG>GTA		piccolo isoform 1							180.0	179.0	179.0					7																	82764745		2003	4168	6171	SO:0001819	synonymous_variant	27445				cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity	g.chr7:82764745C>T	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.2121G>A	7.37:g.82764745C>T			Somatic				PCLO_uc003uhv.2_Silent_p.V707V	p.V707V	NM_033026	NP_149015	WXS	Illumina HiSeq	Unspecified	Q9Y6V0	PCLO_HUMAN			3	2410	-			653			Pro-rich.			Silent	SNP	ENST00000333891.9	37	c.2121G>A	CCDS47630.1																																																																																				0.542	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510		15	78	0	0	0	0.007413	0	15	78				
RBM48	84060	broad.mit.edu	37	7	92164123	92164123	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr7:92164123A>G	ENST00000265732.5	+	4	897	c.856A>G	c.(856-858)Aga>Gga	p.R286G	RBM48_ENST00000481551.1_Missense_Mutation_p.R286G	NM_032120.2	NP_115496.2	Q5RL73	RBM48_HUMAN	RNA binding motif protein 48	286						nucleus (GO:0005634)	RNA binding (GO:0003723)	p.R286G(1)									GGAGCGCAAAAGAAGAAGAGA	0.428																																							uc003ulz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(856-858)AGA>GGA		hypothetical protein LOC84060							59.0	59.0	59.0					7																	92164123		1898	4107	6005	SO:0001583	missense	84060						nucleotide binding	g.chr7:92164123A>G	AL136619	CCDS43615.1	7q21.2	2013-02-12	2011-12-09	2011-12-09	ENSG00000127993	ENSG00000127993		"""RNA binding motif (RRM) containing"""	21785	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 64"""	C7orf64			Standard	NM_032120		Approved	DKFZp564O0523, HSPC304	uc003ulz.3	Q5RL73	OTTHUMG00000159535	ENST00000265732.5:c.856A>G	7.37:g.92164123A>G	ENSP00000265732:p.Arg286Gly		Somatic				C7orf64_uc003uma.2_Missense_Mutation_p.R286G	p.R286G	NM_032120	NP_115496	WXS	Illumina HiSeq	Unspecified	Q5RL73	CG064_HUMAN			4	897	+			286					B7Z2K5|B7ZL51|Q5H9T2|Q8IYW7|Q96NS0|Q9H0V7	Missense_Mutation	SNP	ENST00000265732.5	37	c.856A>G	CCDS43615.1	.	.	.	.	.	.	.	.	.	.	A	19.86	3.905963	0.72868	.	.	ENSG00000127993	ENST00000265732;ENST00000481551;ENST00000450580	.	.	.	5.37	1.3	0.21679	.	0.041948	0.85682	D	0.000000	T	0.76557	0.4004	M	0.78637	2.42	0.50467	D	0.999878	D;D	0.89917	1.0;1.0	D;D	0.74348	0.976;0.983	T	0.79308	-0.1857	9	0.87932	D	0	1.3576	13.219	0.59877	0.6253:0.3747:0.0:0.0	.	286;286	B7Z2K5;Q5RL73	.;CG064_HUMAN	G	286	.	ENSP00000265732:R286G	R	+	1	2	C7orf64	92002059	1.000000	0.71417	0.994000	0.49952	0.947000	0.59692	2.597000	0.46214	0.431000	0.26258	0.482000	0.46254	AGA		0.428	RBM48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356076.1	NM_032120		15	19	0	0	0	0.004007	0	15	19				
SERPINE1	5054	broad.mit.edu	37	7	100771819	100771819	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr7:100771819G>T	ENST00000223095.4	+	2	302	c.145G>T	c.(145-147)Gcc>Tcc	p.A49S	SERPINE1_ENST00000445463.2_Missense_Mutation_p.A34S	NM_000602.4	NP_000593.1	P05121	PAI1_HUMAN	serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1	49					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cellular response to lipopolysaccharide (GO:0071222)|chronological cell aging (GO:0001300)|defense response to Gram-negative bacterium (GO:0050829)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|gene expression (GO:0010467)|negative regulation of blood coagulation (GO:0030195)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cell migration (GO:0030336)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of plasminogen activation (GO:0010757)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of smooth muscle cell-matrix adhesion (GO:2000098)|negative regulation of vascular wound healing (GO:0061044)|negative regulation of wound healing (GO:0061045)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood coagulation (GO:0030194)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of leukotriene production involved in inflammatory response (GO:0035491)|positive regulation of monocyte chemotaxis (GO:0090026)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell proliferation (GO:0042127)|regulation of receptor activity (GO:0010469)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	protease binding (GO:0002020)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.A49S(1)		central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(3)	20	Lung NSC(181;0.136)|all_lung(186;0.182)				Alteplase(DB00009)|Anistreplase(DB00029)|Drotrecogin alfa(DB00055)|Reteplase(DB00015)|Tenecteplase(DB00031)|Urokinase(DB00013)	GGTGGCGCAGGCCTCCAAGGA	0.602																																							uc003uxt.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|lung(1)|central_nervous_system(1)	3						c.(145-147)GCC>TCC		plasminogen activator inhibitor-1 isoform 1	Atorvastatin(DB01076)|Dimethyl sulfoxide(DB01093)|Drotrecogin alfa(DB00055)|Simvastatin(DB00641)|Tenecteplase(DB00031)|Troglitazone(DB00197)|Urokinase(DB00013)						87.0	76.0	80.0					7																	100771819		2203	4300	6503	SO:0001583	missense	5054				angiogenesis|cellular response to chemical stimulus|cellular response to lipopolysaccharide|chronological cell aging|defense response to Gram-negative bacterium|fibrinolysis|negative regulation of apoptosis|negative regulation of cell adhesion mediated by integrin|negative regulation of fibrinolysis|negative regulation of plasminogen activation|negative regulation of smooth muscle cell migration|negative regulation of smooth muscle cell-matrix adhesion|negative regulation of vascular wound healing|platelet activation|platelet degranulation|positive regulation of angiogenesis|positive regulation of interleukin-8 production|positive regulation of leukotriene production involved in inflammatory response|positive regulation of monocyte chemotaxis|positive regulation of receptor-mediated endocytosis|regulation of receptor activity	extracellular matrix|extracellular space|plasma membrane|platelet alpha granule lumen	protease binding|serine-type endopeptidase inhibitor activity	g.chr7:100771819G>T	M16006	CCDS5711.1	7q22.1	2014-02-18	2005-08-18		ENSG00000106366	ENSG00000106366		"""Serine (or cysteine) peptidase inhibitors"""	8583	protein-coding gene	gene with protein product	"""plasminogen activator inhibitor, type I"""	173360	"""serine (or cysteine) proteinase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1"""	PLANH1, PAI1		3097076, 2891140, 24172014	Standard	NM_000602		Approved	PAI	uc003uxt.4	P05121	OTTHUMG00000157107	ENST00000223095.4:c.145G>T	7.37:g.100771819G>T	ENSP00000223095:p.Ala49Ser		Somatic				SERPINE1_uc011kkj.1_Missense_Mutation_p.A34S|SERPINE1_uc003uxu.1_5'Flank	p.A49S	NM_000602	NP_000593	WXS	Illumina HiSeq	Unspecified	P05121	PAI1_HUMAN			2	293	+	Lung NSC(181;0.136)|all_lung(186;0.182)		49					B7Z4S0|F8WD53	Missense_Mutation	SNP	ENST00000223095.4	37	c.145G>T	CCDS5711.1	.	.	.	.	.	.	.	.	.	.	G	4.101	0.016793	0.07959	.	.	ENSG00000106366	ENST00000223095;ENST00000445463;ENST00000441467	D;D	0.83837	-1.77;-1.77	5.57	4.5	0.54988	Serpin domain (3);	0.519231	0.19870	N	0.104219	T	0.58850	0.2151	N	0.04162	-0.26	0.22171	N	0.999314	B;B	0.06786	0.0;0.001	B;B	0.11329	0.003;0.006	T	0.47209	-0.9135	10	0.02654	T	1	.	8.5046	0.33179	0.1795:0.0:0.8205:0.0	.	34;49	F8WD53;P05121	.;PAI1_HUMAN	S	49;34;34	ENSP00000223095:A49S;ENSP00000396766:A34S	ENSP00000223095:A49S	A	+	1	0	SERPINE1	100558539	0.058000	0.20735	0.966000	0.40874	0.367000	0.29736	0.941000	0.29005	2.622000	0.88805	0.655000	0.94253	GCC		0.602	SERPINE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347458.1	NM_000602		31	49	1	0	2.08457e-15	0.010818	2.85495e-15	31	49				
RELN	5649	broad.mit.edu	37	7	103126853	103126853	+	Nonsense_Mutation	SNP	G	G	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr7:103126853G>T	ENST00000428762.1	-	61	9933	c.9774C>A	c.(9772-9774)tgC>tgA	p.C3258*	CTB-107G13.1_ENST00000422488.1_RNA|RELN_ENST00000424685.2_Nonsense_Mutation_p.C3258*|RN7SKP86_ENST00000410454.1_RNA|RELN_ENST00000473945.1_5'Flank|RELN_ENST00000343529.5_Nonsense_Mutation_p.C3258*	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	3258	EGF-like 8. {ECO:0000255|PROSITE- ProRule:PRU00076}.				associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)	p.C3258*(1)		NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		TGAAAACAGAGCAGTCATCAC	0.423																																					NSCLC(146;835 1944 15585 22231 52158)	NSCLC(146;835 1944 15585 22231 52158)	uc003vca.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19						c.(9772-9774)TGC>TGA		reelin isoform a							40.0	41.0	41.0					7																	103126853		2203	4300	6503	SO:0001587	stop_gained	5649				axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity	g.chr7:103126853G>T		CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.9774C>A	7.37:g.103126853G>T	ENSP00000392423:p.Cys3258*		Somatic				RELN_uc010liz.2_Nonsense_Mutation_p.C3258*	p.C3258*	NM_005045	NP_005036	WXS	Illumina HiSeq	Unspecified	P78509	RELN_HUMAN		COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)	61	9934	-			3258			EGF-like 8.		A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Nonsense_Mutation	SNP	ENST00000428762.1	37	c.9774C>A	CCDS47680.1	.	.	.	.	.	.	.	.	.	.	G	52	19.956847	0.99925	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000424828;ENST00000448171	.	.	.	5.86	4.8	0.61643	.	0.099031	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.8675	0.79076	0.0751:0.0:0.9249:0.0	.	.	.	.	X	3258;3258;3258;775;3258	.	ENSP00000345694:C3258X	C	-	3	2	RELN	102914089	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.232000	0.51302	2.775000	0.95449	0.655000	0.94253	TGC		0.423	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	NM_005045		41	35	1	0	3.54561e-26	0.009718	5.50568e-26	41	35				
GPR22	2845	broad.mit.edu	37	7	107115753	107115753	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr7:107115753T>A	ENST00000304402.4	+	3	2591	c.1248T>A	c.(1246-1248)ttT>ttA	p.F416L	COG5_ENST00000393603.2_Intron|COG5_ENST00000297135.3_Intron|COG5_ENST00000475638.2_Intron|COG5_ENST00000347053.3_Intron	NM_005295.2	NP_005286.2	Q99680	GPR22_HUMAN	G protein-coupled receptor 22	416					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)	p.F416L(1)		large_intestine(3)|lung(6)|ovary(2)|stomach(1)	12						AAATTACCTTTGAAGATAGTG	0.338																																							uc003vef.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1246-1248)TTT>TTA		G protein-coupled receptor 22							28.0	32.0	31.0					7																	107115753		2189	4275	6464	SO:0001583	missense	2845					integral to plasma membrane	G-protein coupled receptor activity	g.chr7:107115753T>A	U66581	CCDS5744.1	7q22-q31.1	2012-08-21			ENSG00000172209	ENSG00000172209		"""GPCR / Class A : Orphans"""	4477	protein-coding gene	gene with protein product		601910				9073069	Standard	NM_005295		Approved		uc003vef.3	Q99680	OTTHUMG00000154902	ENST00000304402.4:c.1248T>A	7.37:g.107115753T>A	ENSP00000302676:p.Phe416Leu		Somatic				COG5_uc003vec.2_Intron|COG5_uc003ved.2_Intron|COG5_uc003vee.2_Intron	p.F416L	NM_005295	NP_005286	WXS	Illumina HiSeq	Unspecified	Q99680	GPR22_HUMAN			3	2594	+			416			Cytoplasmic (Potential).		O14554	Missense_Mutation	SNP	ENST00000304402.4	37	c.1248T>A	CCDS5744.1	.	.	.	.	.	.	.	.	.	.	T	4.257	0.046741	0.08243	.	.	ENSG00000172209	ENST00000304402	T	0.28666	1.6	5.92	3.53	0.40419	.	0.261257	0.39759	N	0.001280	T	0.15349	0.0370	N	0.17082	0.46	0.38151	D	0.938734	B	0.30914	0.3	B	0.26202	0.067	T	0.10291	-1.0636	10	0.11485	T	0.65	-7.6659	9.987	0.41847	0.0:0.1946:0.0:0.8054	.	416	Q99680	GPR22_HUMAN	L	416	ENSP00000302676:F416L	ENSP00000302676:F416L	F	+	3	2	GPR22	106902989	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	0.967000	0.29344	1.024000	0.39682	0.477000	0.44152	TTT		0.338	GPR22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337598.1			7	5	0	0	0	0.00308	0	7	5				
PLXNA4	91584	broad.mit.edu	37	7	131888169	131888169	+	Nonsense_Mutation	SNP	C	C	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr7:131888169C>A	ENST00000359827.3	-	11	3270	c.2308G>T	c.(2308-2310)Gaa>Taa	p.E770*	PLXNA4_ENST00000321063.4_Nonsense_Mutation_p.E770*			Q9HCM2	PLXA4_HUMAN	plexin A4	770					anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)	p.E770*(2)		NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						TCCATCCCTTCATAGGAATAC	0.522																																							uc003vra.3		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(1)	1						c.(2308-2310)GAA>TAA		plexin A4 isoform 1							93.0	89.0	91.0					7																	131888169		1928	4133	6061	SO:0001587	stop_gained	91584					integral to membrane|intracellular|plasma membrane		g.chr7:131888169C>A	AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.2308G>T	7.37:g.131888169C>A	ENSP00000352882:p.Glu770*		Somatic					p.E770*	NM_020911	NP_065962	WXS	Illumina HiSeq	Unspecified	Q9HCM2	PLXA4_HUMAN			11	2537	-			770			Extracellular (Potential).		A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Nonsense_Mutation	SNP	ENST00000359827.3	37	c.2308G>T	CCDS43646.1	.	.	.	.	.	.	.	.	.	.	C	43	9.930548	0.99298	.	.	ENSG00000221866	ENST00000321063;ENST00000359827	.	.	.	4.76	4.76	0.60689	.	1.972690	0.02064	N	0.050987	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	.	18.1814	0.89779	0.0:1.0:0.0:0.0	.	.	.	.	X	770	.	ENSP00000323194:E770X	E	-	1	0	PLXNA4	131538709	1.000000	0.71417	0.995000	0.50966	0.884000	0.51177	7.776000	0.85560	2.363000	0.80096	0.561000	0.74099	GAA		0.522	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338422.2	NM_181775		4	138	1	0	0.00909568	0.009096	0.0093939	4	138				
DENND2A	27147	broad.mit.edu	37	7	140301877	140301877	+	Silent	SNP	C	C	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr7:140301877C>T	ENST00000275884.6	-	2	738	c.321G>A	c.(319-321)gaG>gaA	p.E107E	DENND2A_ENST00000492720.1_Silent_p.E107E|DENND2A_ENST00000537639.1_Silent_p.E107E|DENND2A_ENST00000496613.1_Silent_p.E107E			Q9ULE3	DEN2A_HUMAN	DENN/MADD domain containing 2A	107					positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.E107E(1)		breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(22)|ovary(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49	Melanoma(164;0.00956)					TCCTCTCCTTCTCTGTGCTCT	0.577																																							uc010lnj.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|breast(1)	4						c.(319-321)GAG>GAA		DENN/MADD domain containing 2A							171.0	171.0	171.0					7																	140301877		2067	4221	6288	SO:0001819	synonymous_variant	27147							g.chr7:140301877C>T	AB033103	CCDS43659.1	7q34	2012-10-03	2005-08-17	2005-08-17	ENSG00000146966	ENSG00000146966		"""DENN/MADD domain containing"""	22212	protein-coding gene	gene with protein product			"""KIAA1277"""	KIAA1277			Standard	NM_015689		Approved	FAM31D	uc010lnj.3	Q9ULE3	OTTHUMG00000157411	ENST00000275884.6:c.321G>A	7.37:g.140301877C>T			Somatic				DENND2A_uc011kre.1_RNA|DENND2A_uc010lnk.2_Silent_p.E107E|DENND2A_uc003vvw.2_Silent_p.E107E|DENND2A_uc003vvx.2_Silent_p.E107E	p.E107E	NM_015689	NP_056504	WXS	Illumina HiSeq	Unspecified	Q9ULE3	DEN2A_HUMAN			1	466	-	Melanoma(164;0.00956)		107					C9JUI3|Q1RMD5|Q86XY0	Silent	SNP	ENST00000275884.6	37	c.321G>A	CCDS43659.1																																																																																				0.577	DENND2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348742.1	NM_015689		157	153	0	0	0	0.01441	0	157	153				
BRAF	673	broad.mit.edu	37	7	140434413	140434413	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr7:140434413G>T	ENST00000288602.6	-	18	2345	c.2285C>A	c.(2284-2286)gCg>gAg	p.A762E		NM_004333.4	NP_004324.2	P15056	BRAF_HUMAN	B-Raf proto-oncogene, serine/threonine kinase	762					activation of MAPKK activity (GO:0000186)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|cellular response to calcium ion (GO:0071277)|cellular response to drug (GO:0035690)|fibroblast growth factor receptor signaling pathway (GO:0008543)|long-term synaptic potentiation (GO:0060291)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fibroblast migration (GO:0010764)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic vesicle exocytosis (GO:2000301)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive T cell selection (GO:0043368)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell proliferation (GO:0042127)|response to cAMP (GO:0051591)|response to epidermal growth factor (GO:0070849)|response to peptide hormone (GO:0043434)|small GTPase mediated signal transduction (GO:0007264)|somatic stem cell maintenance (GO:0035019)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	cell body (GO:0044297)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.A762E(1)	SLC45A3/BRAF(2)|AGTRAP/BRAF(2)|FAM131B_ENST00000443739/BRAF(7)|AKAP9_ENST00000356239/BRAF(10)|KIAA1549/BRAF(703)|FCHSD1/BRAF(2)	NS(588)|adrenal_gland(3)|autonomic_ganglia(3)|biliary_tract(29)|bone(7)|breast(21)|central_nervous_system(99)|cervix(6)|endometrium(33)|eye(72)|gastrointestinal_tract_(site_indeterminate)(2)|genital_tract(4)|haematopoietic_and_lymphoid_tissue(436)|kidney(3)|large_intestine(6953)|liver(17)|lung(192)|oesophagus(4)|ovary(275)|pancreas(15)|pituitary(1)|prostate(25)|salivary_gland(1)|skin(6285)|small_intestine(12)|soft_tissue(40)|stomach(11)|testis(7)|thyroid(12220)|upper_aerodigestive_tract(13)|urinary_tract(3)	27380	Melanoma(164;0.00956)				Dabrafenib(DB08912)|Regorafenib(DB08896)|Sorafenib(DB00398)|Vemurafenib(DB08881)	GACAGGAAACGCACCATATCC	0.403		61	"""Mis, T, O"""	"""AKAP9, KIAA1549"""	"""melanoma, colorectal, papillary thyroid, borderline ov, Non small-cell lung cancer (NSCLC), cholangiocarcinoma, pilocytic astrocytoma"""		Cardio-facio-cutaneous syndrome		Cardiofaciocutaneous syndrome																												Colon(40;35 892 2973 5743 27438)	Colon(40;35 892 2973 5743 27438)	uc003vwc.3		61		Dom	yes		7	7q34	673	Mis|T|O	v-raf murine sarcoma viral oncogene homolog B1	yes	Cardio-facio-cutaneous syndrome	E	AKAP9|KIAA1549		melanoma|colorectal|papillary thyroid|borderline ov|Non small-cell lung cancer (NSCLC)|cholangiocarcinoma|pilocytic astrocytoma	KIAA1549/BRAF(229)|AKAP9_ENST00000356239/BRAF(10)|AGTRAP/BRAF(2)|FCHSD1/BRAF(2)|SLC45A3/BRAF(2)	1	Substitution - Missense(1)		lung(1)	thyroid(8166)|large_intestine(5052)|skin(3798)|NS(368)|central_nervous_system(284)|ovary(236)|lung(78)|eye(53)|prostate(44)|endometrium(30)|biliary_tract(28)|soft_tissue(27)|haematopoietic_and_lymphoid_tissue(22)|breast(18)|upper_aerodigestive_tract(13)|stomach(13)|pancreas(10)|small_intestine(10)|testis(7)|bone(6)|cervix(5)|genital_tract(4)|oesophagus(3)|urinary_tract(3)|adrenal_gland(3)|gastrointestinal_tract_(site_indeterminate)(2)|liver(2)|meninges(1)|kidney(1)|autonomic_ganglia(1)|pituitary(1)|salivary_gland(1)	18290						c.(2284-2286)GCG>GAG		B-Raf	Sorafenib(DB00398)						244.0	257.0	253.0					7																	140434413		2203	4300	6503	SO:0001583	missense	673	Cardiofaciocutaneous_syndrome	Familial Cancer Database	CFC, CFCS	activation of MAPKK activity|anti-apoptosis|nerve growth factor receptor signaling pathway|organ morphogenesis|positive regulation of peptidyl-serine phosphorylation|small GTPase mediated signal transduction|synaptic transmission	cytosol|nucleus|plasma membrane	ATP binding|metal ion binding	g.chr7:140434413G>T	M95712	CCDS5863.1	7q34	2014-09-17	2014-06-26		ENSG00000157764	ENSG00000157764			1097	protein-coding gene	gene with protein product		164757	"""v-raf murine sarcoma viral oncogene homolog B"""			2284096, 1565476	Standard	NM_004333		Approved	BRAF1	uc003vwc.4	P15056	OTTHUMG00000157457	ENST00000288602.6:c.2285C>A	7.37:g.140434413G>T	ENSP00000288602:p.Ala762Glu		Somatic					p.A762E	NM_004333	NP_004324	WXS	Illumina HiSeq	Unspecified	P15056	BRAF_HUMAN			18	2346	-	Melanoma(164;0.00956)		762					A4D1T4|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q13878|Q3MIN6|Q9UDP8|Q9Y6T3	Missense_Mutation	SNP	ENST00000288602.6	37	c.2285C>A	CCDS5863.1	.	.	.	.	.	.	.	.	.	.	G	14.86	2.662557	0.47572	.	.	ENSG00000157764	ENST00000288602	T	0.75154	-0.91	5.82	3.88	0.44766	.	0.277757	0.40222	N	0.001148	T	0.57799	0.2078	N	0.14661	0.345	0.30314	N	0.788225	B	0.02656	0.0	B	0.04013	0.001	T	0.53208	-0.8471	10	0.26408	T	0.33	.	14.9624	0.71166	0.0:0.5325:0.4675:0.0	.	762	P15056	BRAF_HUMAN	E	762	ENSP00000288602:A762E	ENSP00000288602:A762E	A	-	2	0	BRAF	140080882	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.134000	0.57990	1.436000	0.47453	0.655000	0.94253	GCG		0.403	BRAF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348886.1	NM_004333		183	189	1	0	2.13639e-87	0.01441	3.75358e-87	183	189				
GIMAP2	26157	broad.mit.edu	37	7	150389570	150389570	+	Nonsense_Mutation	SNP	G	G	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr7:150389570G>T	ENST00000223293.5	+	3	290	c.196G>T	c.(196-198)Gga>Tga	p.G66*		NM_015660.2	NP_056475.1	Q9UG22	GIMA2_HUMAN	GTPase, IMAP family member 2	66	AIG1-type G.					cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)	GTP binding (GO:0005525)	p.G66*(1)		kidney(1)|large_intestine(1)|lung(8)|skin(2)|urinary_tract(1)	13			OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CAAAAGTCAGGGAAGCTGGGG	0.468																																							uc003who.2		NA																	1	Substitution - Nonsense(1)		lung(1)	skin(1)	1						c.(196-198)GGA>TGA		GTPase, IMAP family member 2							85.0	82.0	83.0					7																	150389570		2203	4300	6503	SO:0001587	stop_gained	26157					integral to membrane	GTP binding	g.chr7:150389570G>T	AL110151	CCDS5905.1	7q36.1	2014-04-04			ENSG00000106560	ENSG00000106560		"""GTPases, IMAP"""	21789	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 12"""	608085				15474311	Standard	NM_015660		Approved	DKFZp586D0824, HIMAP2, IMAP2, IAN12	uc003who.3	Q9UG22	OTTHUMG00000157488	ENST00000223293.5:c.196G>T	7.37:g.150389570G>T	ENSP00000223293:p.Gly66*		Somatic				GIMAP1_uc003whp.2_Intron	p.G66*	NM_015660	NP_056475	WXS	Illumina HiSeq	Unspecified	Q9UG22	GIMA2_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	3	284	+			66					Q96L25	Nonsense_Mutation	SNP	ENST00000223293.5	37	c.196G>T	CCDS5905.1	.	.	.	.	.	.	.	.	.	.	G	18.97	3.735974	0.69189	.	.	ENSG00000106560	ENST00000223293	.	.	.	3.8	-0.81	0.10860	.	0.734036	0.12543	N	0.459689	.	.	.	.	.	.	0.21256	N	0.999744	.	.	.	.	.	.	.	.	.	.	0.13470	T	0.59	.	3.8879	0.09107	0.2579:0.4017:0.3405:0.0	.	.	.	.	X	66	.	ENSP00000223293:G66X	G	+	1	0	GIMAP2	150020503	0.000000	0.05858	0.001000	0.08648	0.400000	0.30750	-0.478000	0.06575	0.038000	0.15604	0.609000	0.83330	GGA		0.468	GIMAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348948.1	NM_015660		44	21	1	0	6.21074e-16	0.011902	8.58601e-16	44	21				
KMT2C	58508	broad.mit.edu	37	7	151962157	151962157	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr7:151962157G>C	ENST00000262189.6	-	8	1368	c.1150C>G	c.(1150-1152)Caa>Gaa	p.Q384E	KMT2C_ENST00000355193.2_Missense_Mutation_p.Q384E	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	384					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.Q384E(2)									TCAGGACATTGCCAACCTGCA	0.428																																						Colon(68;14 1149 1884 27689 34759)	uc003wla.2		NA								N							medulloblastoma		2	Substitution - Missense(2)		lung(2)	large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63						c.(1150-1152)CAA>GAA		myeloid/lymphoid or mixed-lineage leukemia 3							357.0	323.0	335.0					7																	151962157		2203	4300	6503	SO:0001583	missense	58508				intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding	g.chr7:151962157G>C	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.1150C>G	7.37:g.151962157G>C	ENSP00000262189:p.Gln384Glu		Somatic					p.Q384E	NM_170606	NP_733751	WXS	Illumina HiSeq	Unspecified	Q8NEZ4	MLL3_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)	8	1369	-	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	384			PHD-type 1.|RING-type.		Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	37	c.1150C>G	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	G	16.89	3.247046	0.59103	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	D;D	0.98835	-5.17;-5.17	4.65	4.65	0.58169	Zinc finger, PHD-finger (1);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, PHD-type (1);Protein kinase C-like, phorbol ester/diacylglycerol binding (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.39909	U	0.001240	D	0.99064	0.9679	M	0.83012	2.62	0.80722	D	1	D	0.54964	0.969	D	0.64877	0.93	D	0.99628	1.0985	10	0.66056	D	0.02	.	17.9157	0.88950	0.0:0.0:1.0:0.0	.	384	Q8NEZ4	MLL3_HUMAN	E	384	ENSP00000262189:Q384E;ENSP00000347325:Q384E	ENSP00000262189:Q384E	Q	-	1	0	MLL3	151593090	1.000000	0.71417	1.000000	0.80357	0.889000	0.51656	9.813000	0.99286	2.271000	0.75665	0.557000	0.71058	CAA		0.428	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3			18	288	0	0	0	0.00632	0	18	288				
PTPRN2	5799	broad.mit.edu	37	7	157414082	157414082	+	Silent	SNP	G	G	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr7:157414082G>T	ENST00000389418.4	-	15	2325	c.2316C>A	c.(2314-2316)ccC>ccA	p.P772P	PTPRN2_ENST00000389416.4_Silent_p.P755P|PTPRN2_ENST00000389413.3_Silent_p.P743P|PTPRN2_ENST00000404321.2_Silent_p.P795P|PTPRN2_ENST00000409483.1_Silent_p.P734P	NM_002847.3	NP_002838.2	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N polypeptide 2	772	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				negative regulation of GTPase activity (GO:0034260)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	endoplasmic reticulum lumen (GO:0005788)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)|secretory granule (GO:0030141)|terminal bouton (GO:0043195)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.P772P(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(1)|lung(42)|ovary(4)|pleura(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	86	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		AGCGGTTCTTGGGCACGTTCT	0.637																																							uc003wno.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7						c.(2314-2316)CCC>CCA		protein tyrosine phosphatase, receptor type, N							163.0	160.0	161.0					7																	157414082		2203	4300	6503	SO:0001819	synonymous_variant	5799					integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity	g.chr7:157414082G>T	AB002385	CCDS5947.1, CCDS5948.1, CCDS5949.1	7q36	2011-06-09			ENSG00000155093	ENSG00000155093		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9677	protein-coding gene	gene with protein product	"""IAR PTPRP"""	601698				8954911, 9220540	Standard	NM_130842		Approved	KIAA0387, phogrin, ICAAR, IA-2beta	uc003wno.3	Q92932	OTTHUMG00000152646	ENST00000389418.4:c.2316C>A	7.37:g.157414082G>T			Somatic				PTPRN2_uc003wnp.2_Silent_p.P755P|PTPRN2_uc003wnq.2_Silent_p.P743P|PTPRN2_uc003wnr.2_Silent_p.P734P|PTPRN2_uc011kwa.1_Silent_p.P795P	p.P772P	NM_002847	NP_002838	WXS	Illumina HiSeq	Unspecified	Q92932	PTPR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)	15	2437	-	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	772			Cytoplasmic (Potential).|Tyrosine-protein phosphatase.		E9PC57|Q8N4I5|Q92662|Q9Y4F8|Q9Y4I6	Silent	SNP	ENST00000389418.4	37	c.2316C>A	CCDS5947.1																																																																																				0.637	PTPRN2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000353214.1			8	537	1	0	1.58986e-06	0.008291	1.79317e-06	8	537				
DLGAP2	9228	broad.mit.edu	37	8	1497520	1497520	+	Missense_Mutation	SNP	G	G	T	rs199838357		TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr8:1497520G>T	ENST00000421627.2	+	2	795	c.661G>T	c.(661-663)Gac>Tac	p.D221Y		NM_004745.3	NP_004736.2	Q9P1A6	DLGP2_HUMAN	discs, large (Drosophila) homolog-associated protein 2	300					neuron-neuron synaptic transmission (GO:0007270)	cell junction (GO:0030054)|neurofilament (GO:0005883)|postsynaptic membrane (GO:0045211)		p.D243Y(1)|p.D265Y(1)		breast(1)|endometrium(6)|lung(31)|prostate(3)	41		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)		GAGCTCGGACGACAACCTGGA	0.697																																							uc003wpl.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(661-663)GAC>TAC		discs large-associated protein 2							38.0	51.0	46.0					8																	1497520		2195	4290	6485	SO:0001583	missense	9228				neuron-neuron synaptic transmission	cell junction|neurofilament|postsynaptic density|postsynaptic membrane	protein binding	g.chr8:1497520G>T	AB000275	CCDS47760.1, CCDS75689.1	8p23	2007-12-06	2001-11-28		ENSG00000198010	ENSG00000198010			2906	protein-coding gene	gene with protein product		605438	"""discs, large (Drosophila) homolog-associated protein 2"""			9286858, 10854099	Standard	NM_004745		Approved	DAP-2	uc003wpl.4	Q9P1A6	OTTHUMG00000163599	ENST00000421627.2:c.661G>T	8.37:g.1497520G>T	ENSP00000400258:p.Asp221Tyr		Somatic				DLGAP2_uc003wpm.2_Missense_Mutation_p.D221Y	p.D221Y	NM_004745	NP_004736	WXS	Illumina HiSeq	Unspecified	Q9P1A6	DLGP2_HUMAN		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)	2	758	+		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)	300					A1QCF8|A1QCF9|A5D8Y2|O14488|O14664|Q9P1A7	Missense_Mutation	SNP	ENST00000421627.2	37	c.661G>T	CCDS47760.1	.	.	.	.	.	.	.	.	.	.	G	26.8	4.769089	0.90020	.	.	ENSG00000198010	ENST00000356067;ENST00000421627	T	0.45276	0.9	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	T	0.72724	0.3496	M	0.89785	3.06	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.78994	-0.1984	10	0.87932	D	0	-18.3393	19.1994	0.93704	0.0:0.0:1.0:0.0	.	300;300	Q9P1A6-2;Q9P1A6	.;DLGP2_HUMAN	Y	266;221	ENSP00000400258:D221Y	ENSP00000348366:D266Y	D	+	1	0	DLGAP2	1484927	1.000000	0.71417	0.970000	0.41538	0.986000	0.74619	8.922000	0.92789	2.534000	0.85438	0.655000	0.94253	GAC		0.697	DLGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374478.1	NM_004745		36	68	1	0	6.68952e-21	0.013114	9.93292e-21	36	68				
RP1L1	94137	broad.mit.edu	37	8	10470214	10470214	+	Nonsense_Mutation	SNP	G	G	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr8:10470214G>T	ENST00000382483.3	-	4	1617	c.1394C>A	c.(1393-1395)tCg>tAg	p.S465*		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	465					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)		p.S465*(1)		breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		CTCTGGCTCCGAGCCCTCGGG	0.716																																							uc003wtc.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(4)|breast(3)|central_nervous_system(1)	8						c.(1393-1395)TCG>TAG		retinitis pigmentosa 1-like 1							26.0	33.0	30.0					8																	10470214		1987	4145	6132	SO:0001587	stop_gained	94137				intracellular signal transduction			g.chr8:10470214G>T	AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.1394C>A	8.37:g.10470214G>T	ENSP00000371923:p.Ser465*		Somatic					p.S465*	NM_178857	NP_849188	WXS	Illumina HiSeq	Unspecified	Q8IWN7	RP1L1_HUMAN		COAD - Colon adenocarcinoma(149;0.0811)	4	1623	-			465					Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Nonsense_Mutation	SNP	ENST00000382483.3	37	c.1394C>A	CCDS43708.1	.	.	.	.	.	.	.	.	.	.	G	37	6.238413	0.97403	.	.	ENSG00000183638	ENST00000382483	.	.	.	5.2	2.32	0.28847	.	0.556287	0.13654	U	0.372084	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-1.1764	4.187	0.10402	0.3305:0.2351:0.4344:0.0	.	.	.	.	X	465	.	ENSP00000371923:S465X	S	-	2	0	RP1L1	10507624	0.004000	0.15560	0.001000	0.08648	0.090000	0.18270	1.375000	0.34295	0.579000	0.29504	0.561000	0.74099	TCG		0.716	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1			13	67	1	0	8.10497e-08	0.010504	9.53145e-08	13	67				
C8orf74	203076	broad.mit.edu	37	8	10555360	10555360	+	Nonsense_Mutation	SNP	G	G	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr8:10555360G>T	ENST00000304519.5	+	3	522	c.493G>T	c.(493-495)Gag>Tag	p.E165*	RP1L1_ENST00000329335.3_Intron	NM_001040032.1	NP_001035121	Q6P047	CH074_HUMAN	chromosome 8 open reading frame 74	165								p.E165*(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|urinary_tract(1)	13				COAD - Colon adenocarcinoma(149;0.0811)		GTGGATCCACGAGCAGCAGGT	0.677																																							uc003wtd.1		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(493-495)GAG>TAG		hypothetical protein LOC203076							42.0	46.0	44.0					8																	10555360		2130	4242	6372	SO:0001587	stop_gained	203076							g.chr8:10555360G>T	BC038534	CCDS47800.1	8p23.1	2012-04-17			ENSG00000171060	ENSG00000171060			32296	protein-coding gene	gene with protein product							Standard	NM_001040032		Approved		uc003wtd.1	Q6P047	OTTHUMG00000163807	ENST00000304519.5:c.493G>T	8.37:g.10555360G>T	ENSP00000307129:p.Glu165*		Somatic				C8orf74_uc003wte.1_RNA	p.E165*	NM_001040032	NP_001035121	WXS	Illumina HiSeq	Unspecified	Q6P047	CH074_HUMAN		COAD - Colon adenocarcinoma(149;0.0811)	3	522	+			165					A2RUD6	Nonsense_Mutation	SNP	ENST00000304519.5	37	c.493G>T	CCDS47800.1	.	.	.	.	.	.	.	.	.	.	G	10.51	1.370749	0.24771	.	.	ENSG00000171060	ENST00000304519	.	.	.	5.24	1.18	0.20946	.	0.567659	0.17307	N	0.179014	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	-22.8291	10.0487	0.42203	0.086:0.4524:0.4616:0.0	.	.	.	.	X	165	.	ENSP00000307129:E165X	E	+	1	0	C8orf74	10592770	0.773000	0.28580	0.046000	0.18839	0.000000	0.00434	1.006000	0.29847	-0.018000	0.14079	-2.362000	0.00238	GAG		0.677	C8orf74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375675.1	NM_001040032		26	45	1	0	3.1745e-13	0.008361	4.22946e-13	26	45				
TEX15	56154	broad.mit.edu	37	8	30704102	30704102	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr8:30704102T>A	ENST00000256246.2	-	1	2506	c.2432A>T	c.(2431-2433)aAt>aTt	p.N811I	TEX15_ENST00000523186.1_5'Flank	NM_031271.3	NP_112561.2	Q9BXT5	TEX15_HUMAN	testis expressed 15	811					fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia development (GO:0030539)|male meiosis (GO:0007140)|protein localization to chromosome (GO:0034502)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of protein localization (GO:0032880)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)			p.N811I(1)		NS(2)|breast(3)|cervix(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|lung(56)|ovary(5)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	138				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		ATCTTCCTTATTTATTTCCGG	0.368																																							uc003xil.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|upper_aerodigestive_tract(2)|skin(2)	7						c.(2431-2433)AAT>ATT		testis expressed 15							50.0	47.0	48.0					8																	30704102		2202	4296	6498	SO:0001583	missense	56154							g.chr8:30704102T>A	AF285605	CCDS6080.1	8p22	2009-03-25	2007-03-13			ENSG00000133863			11738	protein-coding gene	gene with protein product	"""cancer/testis antigen 42"""	605795	"""testis expressed sequence 15"""			11279525	Standard	NM_031271		Approved	CT42	uc003xil.3	Q9BXT5		ENST00000256246.2:c.2432A>T	8.37:g.30704102T>A	ENSP00000256246:p.Asn811Ile		Somatic					p.N811I	NM_031271	NP_112561	WXS	Illumina HiSeq	Unspecified	Q9BXT5	TEX15_HUMAN		KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)	1	2432	-			811						Missense_Mutation	SNP	ENST00000256246.2	37	c.2432A>T	CCDS6080.1	.	.	.	.	.	.	.	.	.	.	T	15.24	2.774223	0.49786	.	.	ENSG00000133863	ENST00000256246	T	0.11063	2.81	5.93	4.74	0.60224	.	0.188614	0.37577	N	0.002038	T	0.10165	0.0249	L	0.32530	0.975	0.30506	N	0.769884	P	0.40431	0.717	B	0.41271	0.352	T	0.03555	-1.1025	10	0.87932	D	0	.	9.5173	0.39113	0.1559:0.0:0.0:0.8441	.	811	Q9BXT5	TEX15_HUMAN	I	811	ENSP00000256246:N811I	ENSP00000256246:N811I	N	-	2	0	TEX15	30823644	0.809000	0.29036	0.986000	0.45419	0.169000	0.22640	1.338000	0.33873	2.265000	0.75225	0.533000	0.62120	AAT		0.368	TEX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376193.1			4	25	0	0	0	0.004482	0	4	25				
ADAM9	8754	broad.mit.edu	37	8	38884248	38884248	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr8:38884248G>T	ENST00000487273.2	+	11	1127	c.1049G>T	c.(1048-1050)gGt>gTt	p.G350V		NM_003816.2	NP_003807.1	Q13443	ADAM9_HUMAN	ADAM metallopeptidase domain 9	350	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				activation of MAPKK activity (GO:0000186)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell-cell adhesion mediated by integrin (GO:0033631)|cell-matrix adhesion (GO:0007160)|cellular response to lipopolysaccharide (GO:0071222)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|keratinocyte differentiation (GO:0030216)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte activation (GO:0042117)|PMA-inducible membrane protein ectodomain proteolysis (GO:0051088)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of keratinocyte migration (GO:0051549)|positive regulation of macrophage fusion (GO:0034241)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of protein secretion (GO:0050714)|response to calcium ion (GO:0051592)|response to glucocorticoid (GO:0051384)|response to hydrogen peroxide (GO:0042542)|response to laminar fluid shear stress (GO:0034616)|response to manganese ion (GO:0010042)|response to tumor necrosis factor (GO:0034612)|transforming growth factor beta receptor signaling pathway (GO:0007179)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intrinsic component of external side of plasma membrane (GO:0031233)	collagen binding (GO:0005518)|integrin binding (GO:0005178)|laminin binding (GO:0043236)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|protein kinase C binding (GO:0005080)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)	p.G350V(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		all_lung(54;0.00292)|Lung NSC(58;0.0115)|Hepatocellular(245;0.0153)	LUSC - Lung squamous cell carcinoma(45;2.74e-07)			CATGAATTGGGTCATAATCTT	0.423																																							uc003xmr.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(1048-1050)GGT>GTT		ADAM metallopeptidase domain 9 isoform 1							227.0	202.0	211.0					8																	38884248		2203	4300	6503	SO:0001583	missense	8754				activation of MAPKK activity|cell-cell adhesion mediated by integrin|cell-matrix adhesion|keratinocyte differentiation|monocyte activation|PMA-inducible membrane protein ectodomain proteolysis|PMA-inducible membrane protein ectodomain proteolysis|positive regulation of cell adhesion mediated by integrin|positive regulation of keratinocyte migration|positive regulation of macrophage fusion|positive regulation of membrane protein ectodomain proteolysis|positive regulation of protein secretion|response to calcium ion|response to glucocorticoid stimulus|response to hydrogen peroxide|response to manganese ion|response to tumor necrosis factor|transforming growth factor beta receptor signaling pathway	extracellular space|extracellular space|integral to membrane|intrinsic to external side of plasma membrane	collagen binding|integrin binding|laminin binding|metalloendopeptidase activity|protein kinase C binding|SH3 domain binding|zinc ion binding	g.chr8:38884248G>T	U41766	CCDS6112.1	8p11.23	2011-03-18	2010-06-24		ENSG00000168615	ENSG00000168615		"""ADAM metallopeptidase domain containing"""	216	protein-coding gene	gene with protein product	"""meltrin gamma"""	602713	"""a disintegrin and metalloproteinase domain 9 (meltrin gamma)"", ""cone rod dystrophy 9"""	CORD9		8647900, 11581183, 19409519	Standard	NR_027638		Approved	MDC9, KIAA0021, MCMP, Mltng	uc003xmr.3	Q13443	OTTHUMG00000159783	ENST00000487273.2:c.1049G>T	8.37:g.38884248G>T	ENSP00000419446:p.Gly350Val		Somatic				ADAM9_uc011lcf.1_RNA|ADAM9_uc011lcg.1_RNA|ADAM9_uc010lwr.2_RNA	p.G350V	NM_003816	NP_003807	WXS	Illumina HiSeq	Unspecified	Q13443	ADAM9_HUMAN	LUSC - Lung squamous cell carcinoma(45;2.74e-07)		11	1127	+		all_lung(54;0.00292)|Lung NSC(58;0.0115)|Hepatocellular(245;0.0153)	350			Extracellular (Potential).|Peptidase M12B.		B7ZLN7|Q10718|Q8NFM6	Missense_Mutation	SNP	ENST00000487273.2	37	c.1049G>T	CCDS6112.1	.	.	.	.	.	.	.	.	.	.	G	25.6	4.654361	0.88056	.	.	ENSG00000168615	ENST00000487273	T	0.40225	1.04	5.44	5.44	0.79542	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.000000	0.85682	D	0.000000	T	0.79197	0.4405	H	0.98155	4.16	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87245	0.2269	10	0.87932	D	0	.	19.2591	0.93961	0.0:0.0:1.0:0.0	.	350	Q13443	ADAM9_HUMAN	V	350	ENSP00000419446:G350V	ENSP00000369249:G350V	G	+	2	0	ADAM9	39003405	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.414000	0.97362	2.542000	0.85734	0.460000	0.39030	GGT		0.423	ADAM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357291.2			49	102	1	0	3.76525e-18	0.01441	5.35637e-18	49	102				
ADAM2	2515	broad.mit.edu	37	8	39624713	39624713	+	Missense_Mutation	SNP	C	C	A	rs202127432		TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr8:39624713C>A	ENST00000265708.4	-	13	1373	c.1270G>T	c.(1270-1272)Ggt>Tgt	p.G424C	ADAM2_ENST00000347580.4_Missense_Mutation_p.G405C|ADAM2_ENST00000379853.2_Missense_Mutation_p.G298C|ADAM2_ENST00000521880.1_Missense_Mutation_p.G424C	NM_001464.3	NP_001455.3	Q99965	ADAM2_HUMAN	ADAM metallopeptidase domain 2	424	Disintegrin. {ECO:0000255|PROSITE- ProRule:PRU00068}.				adult behavior (GO:0030534)|binding of sperm to zona pellucida (GO:0007339)|cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|visual learning (GO:0008542)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.G424C(1)		haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(11)|lung(29)|ovary(3)|prostate(1)|skin(5)|urinary_tract(1)	53		all_cancers(7;2.38e-28)|all_epithelial(6;8.85e-21)|all_lung(54;1.24e-07)|Lung NSC(58;1.94e-07)|Hepatocellular(245;0.00745)|Breast(189;0.00908)|Renal(179;0.0183)|Colorectal(162;0.246)	LUSC - Lung squamous cell carcinoma(45;0.000149)	READ - Rectum adenocarcinoma(644;0.0689)|Kidney(114;0.162)		CAGTTTGAACCGGCTTTAAAT	0.358																																							uc003xnj.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|lung(1)	2						c.(1270-1272)GGT>TGT		ADAM metallopeptidase domain 2 proprotein							176.0	168.0	170.0					8																	39624713		2203	4300	6503	SO:0001583	missense	2515				cell adhesion|fusion of sperm to egg plasma membrane|proteolysis	integral to plasma membrane	integrin binding|metalloendopeptidase activity|zinc ion binding	g.chr8:39624713C>A	U52370	CCDS34884.1, CCDS64882.1, CCDS64883.1	8p11.2	2009-03-25	2008-07-31		ENSG00000104755	ENSG00000104755		"""ADAM metallopeptidase domain containing"""	198	protein-coding gene	gene with protein product	"""cancer/testis antigen 15"""	601533	"""fertilin beta"""	FTNB		8702389, 9070941	Standard	NM_001278113		Approved	PH-30b, PH30, CT15	uc003xnj.4	Q99965	OTTHUMG00000164041	ENST00000265708.4:c.1270G>T	8.37:g.39624713C>A	ENSP00000265708:p.Gly424Cys		Somatic				ADAM2_uc003xnk.2_Missense_Mutation_p.G405C|ADAM2_uc011lck.1_Missense_Mutation_p.G424C|ADAM2_uc003xnl.2_Missense_Mutation_p.G298C	p.G424C	NM_001464	NP_001455	WXS	Illumina HiSeq	Unspecified	Q99965	ADAM2_HUMAN	LUSC - Lung squamous cell carcinoma(45;0.000149)	READ - Rectum adenocarcinoma(644;0.0689)|Kidney(114;0.162)	13	1345	-		all_cancers(7;2.38e-28)|all_epithelial(6;8.85e-21)|all_lung(54;1.24e-07)|Lung NSC(58;1.94e-07)|Hepatocellular(245;0.00745)|Breast(189;0.00908)|Renal(179;0.0183)|Colorectal(162;0.246)	424			Extracellular (Potential).|Disintegrin.		P78326|Q9UQQ8	Missense_Mutation	SNP	ENST00000265708.4	37	c.1270G>T	CCDS34884.1	.	.	.	.	.	.	.	.	.	.	C	14.16	2.451941	0.43531	.	.	ENSG00000104755	ENST00000347580;ENST00000379853;ENST00000265708;ENST00000521880	T;T;T;T	0.14516	2.5;2.5;2.5;2.5	4.82	0.973	0.19710	Blood coagulation inhibitor, Disintegrin (5);	.	.	.	.	T	0.46927	0.1418	H	0.97564	4.03	0.09310	N	1	D;D;D;D	0.89917	0.998;1.0;0.999;0.999	D;D;D;D	0.74674	0.972;0.982;0.973;0.984	T	0.31916	-0.9926	8	.	.	.	.	7.0021	0.24815	0.0:0.6113:0.0:0.3887	.	424;298;405;424	B4DWY7;Q6P2G0;Q99965-2;Q99965	.;.;.;ADAM2_HUMAN	C	405;298;424;424	ENSP00000343854:G405C;ENSP00000369182:G298C;ENSP00000265708:G424C;ENSP00000429352:G424C	.	G	-	1	0	ADAM2	39743870	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.073000	0.14640	-0.034000	0.13713	0.655000	0.94253	GGT		0.358	ADAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376926.1	NM_001464		65	161	1	0	5.96624e-29	0.01441	9.53302e-29	65	161				
TRPA1	8989	broad.mit.edu	37	8	72984007	72984007	+	Nonsense_Mutation	SNP	A	A	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr8:72984007A>T	ENST00000262209.4	-	2	414	c.207T>A	c.(205-207)taT>taA	p.Y69*		NM_007332.2	NP_015628.2	O75762	TRPA1_HUMAN	transient receptor potential cation channel, subfamily A, member 1	69					calcium ion transmembrane transport (GO:0070588)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to pain (GO:0048265)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium bundle (GO:0032421)	calcium channel activity (GO:0005262)|channel activity (GO:0015267)	p.Y69*(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(26)|lung(44)|ovary(4)|prostate(6)|stomach(1)	98			Epithelial(68;0.223)		Menthol(DB00825)	CTGCTGCAGCATAATGCAAGA	0.353																																							uc003xza.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(4)|lung(1)|kidney(1)	6						c.(205-207)TAT>TAA		ankyrin-like protein 1	Menthol(DB00825)						148.0	133.0	138.0					8																	72984007		2203	4300	6503	SO:0001587	stop_gained	8989					integral to plasma membrane		g.chr8:72984007A>T	Y10601	CCDS34908.1	8q13	2013-01-10	2003-11-20	2003-11-20	ENSG00000104321	ENSG00000104321		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	497	protein-coding gene	gene with protein product		604775	"""ankyrin-like with transmembrane domains 1"""	ANKTM1		16382100	Standard	NM_007332		Approved		uc003xza.3	O75762	OTTHUMG00000164516	ENST00000262209.4:c.207T>A	8.37:g.72984007A>T	ENSP00000262209:p.Tyr69*		Somatic					p.Y69*	NM_007332	NP_015628	WXS	Illumina HiSeq	Unspecified	O75762	TRPA1_HUMAN	Epithelial(68;0.223)		2	382	-			69			Cytoplasmic (Potential).|ANK 1.		A6NIN6	Nonsense_Mutation	SNP	ENST00000262209.4	37	c.207T>A	CCDS34908.1	.	.	.	.	.	.	.	.	.	.	A	19.87	3.906592	0.72868	.	.	ENSG00000104321	ENST00000262209	.	.	.	5.08	-1.43	0.08884	.	0.209152	0.49916	D	0.000139	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.6439	11.2874	0.49230	0.5671:0.0:0.4329:0.0	.	.	.	.	X	69	.	ENSP00000262209:Y69X	Y	-	3	2	TRPA1	73146561	0.375000	0.25089	0.929000	0.37066	0.013000	0.08279	-0.399000	0.07250	-0.251000	0.09542	-0.374000	0.07098	TAT		0.353	TRPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379079.2	NM_007332		8	28	0	0	0	0.004482	0	8	28				
RMDN1	51115	broad.mit.edu	37	8	87498776	87498776	+	Nonsense_Mutation	SNP	A	A	T	rs144513651		TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr8:87498776A>T	ENST00000406452.3	-	4	591	c.432T>A	c.(430-432)taT>taA	p.Y144*	RMDN1_ENST00000523911.1_Nonsense_Mutation_p.Y100*|RMDN1_ENST00000519966.1_Nonsense_Mutation_p.Y144*|CPNE3_ENST00000198765.4_Intron|RMDN1_ENST00000430676.2_Nonsense_Mutation_p.Y144*	NM_016033.2	NP_057117.2	Q96DB5	RMD1_HUMAN	regulator of microtubule dynamics 1	144						microtubule (GO:0005874)|mitochondrion (GO:0005739)		p.Y144*(1)									CTAGGGCTTCATACACCAATA	0.413																																							uc003ydu.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)	1						c.(430-432)TAT>TAA		regulator of microtubule dynamics 1							143.0	123.0	130.0					8																	87498776		2203	4300	6503	SO:0001587	stop_gained	51115					microtubule|spindle pole	binding	g.chr8:87498776A>T	AK000672	CCDS34918.1, CCDS69509.1, CCDS69510.1	8q21.3	2013-01-11	2013-01-11	2013-01-11	ENSG00000176623	ENSG00000176623			24285	protein-coding gene	gene with protein product		611871	"""family with sequence similarity 82, member B"""	FAM82B		10810093	Standard	NM_016033		Approved	CGI-90, FLJ20665, RMD1	uc003ydu.3	Q96DB5	OTTHUMG00000163692	ENST00000406452.3:c.432T>A	8.37:g.87498776A>T	ENSP00000385927:p.Tyr144*		Somatic				FAM82B_uc011lfz.1_Nonsense_Mutation_p.Y144*|FAM82B_uc011lga.1_Nonsense_Mutation_p.Y144*	p.Y144*	NM_016033	NP_057117	WXS	Illumina HiSeq	Unspecified	Q96DB5	RMD1_HUMAN			4	592	-			144					A9UMZ8|B4DNF5|B4DZW6|B5MC61|C9JSC6|E7EVI2|Q9Y398	Nonsense_Mutation	SNP	ENST00000406452.3	37	c.432T>A	CCDS34918.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	33|33	5.205104|5.205104	0.95033|0.95033	.|.	.|.	ENSG00000176623|ENSG00000176623	ENST00000519789|ENST00000406452;ENST00000523911;ENST00000519966;ENST00000430676;ENST00000520719	.|.	.|.	.|.	5.88|5.88	2.18|2.18	0.27775|0.27775	.|.	.|0.128019	.|0.53938	.|D	.|0.000041	.|.	.|.	.|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|0.02654	.|T	.|1	-10.8231|-10.8231	8.7521|8.7521	0.34622|0.34622	0.7701:0.0:0.2299:0.0|0.7701:0.0:0.2299:0.0	.|.	.|.	.|.	.|.	R|X	90|144;100;144;144;8	.|.	.|ENSP00000385927:Y144X	X|Y	-|-	1|3	0|2	FAM82B|FAM82B	87567892|87567892	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.994000|0.994000	0.84299|0.84299	2.995000|2.995000	0.49441|0.49441	0.447000|0.447000	0.26695|0.26695	0.528000|0.528000	0.53228|0.53228	TGA|TAT		0.413	RMDN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374770.2	NM_016033		27	36	0	0	0	0.008361	0	27	36				
CPQ	10404	broad.mit.edu	37	8	97797349	97797349	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr8:97797349G>T	ENST00000220763.5	+	2	434	c.224G>T	c.(223-225)gGa>gTa	p.G75V		NM_016134.2	NP_057218.1	Q9Y646	CBPQ_HUMAN	carboxypeptidase Q	75					peptide catabolic process (GO:0043171)|proteolysis (GO:0006508)|thyroid hormone generation (GO:0006590)|tissue regeneration (GO:0042246)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosome (GO:0005764)	carboxypeptidase activity (GO:0004180)|metal ion binding (GO:0046872)|metallodipeptidase activity (GO:0070573)|protein homodimerization activity (GO:0042803)	p.G75V(1)									GATACTGTTGGACCCAGACTG	0.468																																							uc003yhw.2		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)	1						c.(223-225)GGA>GTA		plasma glutamate carboxypeptidase precursor							112.0	104.0	106.0					8																	97797349		2203	4300	6503	SO:0001583	missense	10404				peptide metabolic process|proteolysis	cytoplasm|extracellular space	metal ion binding|metallocarboxypeptidase activity	g.chr8:97797349G>T	AF107834	CCDS6273.1	8q22.2	2012-02-17			ENSG00000104324	ENSG00000104324			16910	protein-coding gene	gene with protein product	"""lysosomal dipeptidase"", ""Ser-Met dipeptidase"", ""plasma glutamate carboxypeptidase"""					10206990	Standard	NM_016134		Approved	LDP, PGCP	uc003yhw.3	Q9Y646	OTTHUMG00000164690	ENST00000220763.5:c.224G>T	8.37:g.97797349G>T	ENSP00000220763:p.Gly75Val		Somatic				PGCP_uc010mbe.2_Missense_Mutation_p.G75V	p.G75V	NM_016134	NP_057218	WXS	Illumina HiSeq	Unspecified	Q9Y646	PGCP_HUMAN			2	390	+	Breast(36;1.86e-05)		75					B2RD88|Q8NBZ1|Q9UNM8|Q9Y5X6	Missense_Mutation	SNP	ENST00000220763.5	37	c.224G>T	CCDS6273.1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.372023	0.82573	.	.	ENSG00000104324	ENST00000220763;ENST00000519900;ENST00000517742;ENST00000519484;ENST00000521142	T;D	0.85629	-0.63;-2.01	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	D	0.94486	0.8225	M	0.92507	3.315	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.95451	0.8534	10	0.87932	D	0	-25.2591	19.1973	0.93695	0.0:0.0:1.0:0.0	.	75;75	B5MDX4;Q9Y646	.;PGCP_HUMAN	V	75	ENSP00000220763:G75V;ENSP00000429146:G75V	ENSP00000220763:G75V	G	+	2	0	AC010859.1	97866525	1.000000	0.71417	0.998000	0.56505	0.855000	0.48748	9.141000	0.94612	2.551000	0.86045	0.655000	0.94253	GGA		0.468	CPQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379757.2	NM_016134		12	64	1	0	2.27111e-07	0.013537	2.62188e-07	12	64				
NIPAL2	79815	broad.mit.edu	37	8	99264759	99264759	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr8:99264759C>A	ENST00000341166.3	-	3	563	c.308G>T	c.(307-309)gGg>gTg	p.G103V	NIPAL2_ENST00000430223.2_Missense_Mutation_p.G103V|NIPAL2_ENST00000520545.1_5'Flank	NM_024759.1	NP_079035.1	Q9H841	NPAL2_HUMAN	NIPA-like domain containing 2	103						integral component of membrane (GO:0016021)	magnesium ion transmembrane transporter activity (GO:0015095)	p.G103V(1)		cervix(3)|kidney(1)|large_intestine(2)|lung(5)|stomach(1)	12						TGCAAAGTTCCCCGTCTCTCC	0.502																																							uc003yil.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(307-309)GGG>GTG		NIPA-like domain containing 2							110.0	89.0	96.0					8																	99264759		2203	4300	6503	SO:0001583	missense	79815					integral to membrane		g.chr8:99264759C>A	AK024017	CCDS6278.1	8q22.2	2009-03-24		2009-03-24	ENSG00000104361	ENSG00000104361			25854	protein-coding gene	gene with protein product				NPAL2		14702039	Standard	NM_024759		Approved	FLJ13955	uc003yil.1	Q9H841	OTTHUMG00000164668	ENST00000341166.3:c.308G>T	8.37:g.99264759C>A	ENSP00000339256:p.Gly103Val		Somatic				NIPAL2_uc011lgw.1_5'Flank|NIPAL2_uc003yim.1_Missense_Mutation_p.G103V	p.G103V	NM_024759	NP_079035	WXS	Illumina HiSeq	Unspecified	Q9H841	NPAL2_HUMAN			3	564	-			103			Helical; (Potential).		A2RTY8	Missense_Mutation	SNP	ENST00000341166.3	37	c.308G>T	CCDS6278.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.954660	0.73902	.	.	ENSG00000104361	ENST00000430223;ENST00000341166	D;D	0.90732	-2.72;-2.72	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	D	0.96262	0.8781	M	0.90425	3.115	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96466	0.9345	10	0.72032	D	0.01	-12.0522	17.3107	0.87208	0.0:1.0:0.0:0.0	.	103;103	A2RTY8;Q9H841	.;NPAL2_HUMAN	V	103	ENSP00000407087:G103V;ENSP00000339256:G103V	ENSP00000339256:G103V	G	-	2	0	NIPAL2	99333935	1.000000	0.71417	0.450000	0.26969	0.752000	0.42762	5.433000	0.66520	2.830000	0.97506	0.585000	0.79938	GGG		0.502	NIPAL2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000379677.1	NM_024759		6	34	1	0	1.12685e-05	0.004482	1.24547e-05	6	34				
RIMS2	9699	broad.mit.edu	37	8	104955095	104955095	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr8:104955095C>A	ENST00000436393.2	+	12	2217	c.1976C>A	c.(1975-1977)cCt>cAt	p.P659H	RIMS2_ENST00000406091.3_Missense_Mutation_p.P881H|RIMS2_ENST00000262231.10_Missense_Mutation_p.P720H|RIMS2_ENST00000507740.1_Missense_Mutation_p.P673H			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	943					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)	p.P673H(2)|p.P881H(1)|p.P948H(1)|p.P659H(1)		NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			CTTCCCCACCCTTCTCCATAT	0.373										HNSCC(12;0.0054)																													uc003yls.2		NA																	5	Substitution - Missense(5)		lung(5)	ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15						c.(1975-1977)CCT>CAT		regulating synaptic membrane exocytosis 2							77.0	73.0	74.0					8																	104955095		1886	4121	6007	SO:0001583	missense	9699				intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding	g.chr8:104955095C>A	AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.1976C>A	8.37:g.104955095C>A	ENSP00000390665:p.Pro659His	HNSCC(12;0.0054)	Somatic				RIMS2_uc003ylp.2_Missense_Mutation_p.P881H|RIMS2_uc003ylw.2_Missense_Mutation_p.P673H|RIMS2_uc003ylq.2_Missense_Mutation_p.P673H|RIMS2_uc003ylr.2_Missense_Mutation_p.P720H|RIMS2_uc003ylt.2_Missense_Mutation_p.P266H	p.P659H	NM_014677	NP_055492	WXS	Illumina HiSeq	Unspecified	Q9UQ26	RIMS2_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)		12	2217	+			943					B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Missense_Mutation	SNP	ENST00000436393.2	37	c.1976C>A		.	.	.	.	.	.	.	.	.	.	C	25.5	4.649420	0.87958	.	.	ENSG00000176406	ENST00000504942;ENST00000329869;ENST00000406091;ENST00000402998;ENST00000262231;ENST00000507740;ENST00000408894;ENST00000436393	T;T;T;T;T;T	0.19938	2.11;2.57;2.29;2.26;2.18;2.58	5.17	5.17	0.71159	.	.	.	.	.	T	0.45498	0.1345	M	0.62723	1.935	0.80722	D	1	D;P;D;D;D;D	0.67145	0.988;0.736;0.996;0.975;0.996;0.988	P;P;D;P;D;P	0.69654	0.894;0.506;0.927;0.854;0.965;0.854	T	0.40515	-0.9559	9	0.72032	D	0.01	.	19.0411	0.92999	0.0:1.0:0.0:0.0	.	943;943;659;720;673;881	Q9UQ26;Q9UQ26-2;D6RA03;Q9UQ26-1;Q9UQ26-3;F8WD47	RIMS2_HUMAN;.;.;.;.;.	H	881;896;881;943;720;673;673;659	ENSP00000427018:P881H;ENSP00000384892:P881H;ENSP00000262231:P720H;ENSP00000423559:P673H;ENSP00000386228:P673H;ENSP00000390665:P659H	ENSP00000262231:P720H	P	+	2	0	RIMS2	105024271	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.822000	0.69265	2.552000	0.86080	0.591000	0.81541	CCT		0.373	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000367217.1	NM_001100117		19	20	1	0	2.21704e-12	0.00278	2.90986e-12	19	20				
ANGPT1	284	broad.mit.edu	37	8	108264099	108264099	+	Missense_Mutation	SNP	C	C	T	rs377442517		TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr8:108264099C>T	ENST00000520734.1	-	8	1166	c.881G>A	c.(880-882)cGa>cAa	p.R294Q	ANGPT1_ENST00000518386.1_5'UTR|AP000428.1_ENST00000390706.1_RNA|ANGPT1_ENST00000520052.1_Missense_Mutation_p.R293Q			Q15389	ANGP1_HUMAN	angiopoietin 1	494	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cell-substrate adhesion (GO:0031589)|glomerulus vasculature development (GO:0072012)|hemopoiesis (GO:0030097)|heparin biosynthetic process (GO:0030210)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of vascular permeability (GO:0043116)|positive chemotaxis (GO:0050918)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of receptor internalization (GO:0002092)|protein localization to cell surface (GO:0034394)|regulation of satellite cell proliferation (GO:0014842)|sprouting angiogenesis (GO:0002040)|Tie signaling pathway (GO:0048014)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	receptor tyrosine kinase binding (GO:0030971)	p.R494Q(1)		NS(1)|breast(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(13)|ovary(4)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)	43	Breast(1;5.06e-08)		OV - Ovarian serous cystadenocarcinoma(57;5.53e-09)			ATCTAAAGGTCGAATCATCAT	0.413													C|||	1	0.000199681	0.0	0.0	5008	,	,		18641	0.0		0.001	False		,,,				2504	0.0						uc003ymn.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(3)|upper_aerodigestive_tract(1)	7						c.(1480-1482)CGA>CAA		angiopoietin 1 precursor		C	GLN/ARG,GLN/ARG	0,4406		0,0,2203	149.0	139.0	143.0		1481,1478	5.9	1.0	8		143	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	ANGPT1	NM_001146.3,NM_001199859.1	43,43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	494/499,493/498	108264099	1,13005	2203	4300	6503	SO:0001583	missense	284				activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|blood coagulation|cell differentiation|heparin biosynthetic process|leukocyte migration|negative regulation of cell adhesion|negative regulation of endothelial cell apoptosis|negative regulation of vascular permeability|positive chemotaxis|positive regulation of blood vessel endothelial cell migration|positive regulation of ERK1 and ERK2 cascade|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of protein kinase B signaling cascade|positive regulation of protein ubiquitination|positive regulation of receptor internalization|protein localization at cell surface|regulation of satellite cell proliferation|sprouting angiogenesis|Tie receptor signaling pathway	extracellular space|membrane raft|microvillus|plasma membrane	receptor tyrosine kinase binding	g.chr8:108264099C>T	D13628	CCDS6306.1, CCDS56551.1	8q23.1	2013-02-06			ENSG00000154188	ENSG00000154188		"""Fibrinogen C domain containing"""	484	protein-coding gene	gene with protein product		601667				9545648	Standard	NM_001146		Approved	KIAA0003, Ang1	uc003ymn.3	Q15389	OTTHUMG00000164812	ENST00000520734.1:c.881G>A	8.37:g.108264099C>T	ENSP00000430750:p.Arg294Gln		Somatic				ANGPT1_uc011lhv.1_Missense_Mutation_p.R294Q|ANGPT1_uc003ymo.2_Missense_Mutation_p.R493Q	p.R494Q	NM_001146	NP_001137	WXS	Illumina HiSeq	Unspecified	Q15389	ANGP1_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;5.53e-09)		9	1949	-	Breast(1;5.06e-08)		494			Fibrinogen C-terminal.		Q5HYA0	Missense_Mutation	SNP	ENST00000520734.1	37	c.1481G>A		.	.	.	.	.	.	.	.	.	.	C	35	5.536010	0.96460	0.0	1.16E-4	ENSG00000154188	ENST00000517746;ENST00000297450;ENST00000520734;ENST00000520052	T;T;T;T	0.80480	-1.38;-1.38;-1.38;-1.38	5.9	5.9	0.94986	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);	0.000000	0.85682	D	0.000000	D	0.92551	0.7634	M	0.93106	3.38	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.72625	0.978;0.978	D	0.93402	0.6761	10	0.87932	D	0	.	20.2768	0.98488	0.0:1.0:0.0:0.0	.	494;494	Q5HYA0;Q15389	.;ANGP1_HUMAN	Q	494;493;294;293	ENSP00000428340:R494Q;ENSP00000297450:R493Q;ENSP00000430750:R294Q;ENSP00000429349:R293Q	ENSP00000297450:R493Q	R	-	2	0	ANGPT1	108333275	1.000000	0.71417	0.996000	0.52242	0.976000	0.68499	7.818000	0.86416	2.808000	0.96608	0.650000	0.86243	CGA		0.413	ANGPT1-002	PUTATIVE	alternative_5_UTR|basic	protein_coding	protein_coding	OTTHUMT00000380428.2	NM_001146, NM_139290		14	79	0	0	0	0.00245	0	14	79				
CSMD3	114788	broad.mit.edu	37	8	113314033	113314033	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr8:113314033G>T	ENST00000297405.5	-	53	8673	c.8429C>A	c.(8428-8430)aCc>aAc	p.T2810N	CSMD3_ENST00000352409.3_Missense_Mutation_p.T2740N|CSMD3_ENST00000455883.2_Missense_Mutation_p.T2641N|CSMD3_ENST00000343508.3_Missense_Mutation_p.T2770N	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	2810	Sushi 17. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.T2770N(1)|p.T2810N(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						TAGGCATCTGGTTTCAGATTC	0.438										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																													uc003ynu.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						c.(8428-8430)ACC>AAC		CUB and Sushi multiple domains 3 isoform 1							106.0	111.0	109.0					8																	113314033		2203	4300	6503	SO:0001583	missense	114788					integral to membrane|plasma membrane		g.chr8:113314033G>T	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.8429C>A	8.37:g.113314033G>T	ENSP00000297405:p.Thr2810Asn	HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)	Somatic				CSMD3_uc003yns.2_Missense_Mutation_p.T2012N|CSMD3_uc003ynt.2_Missense_Mutation_p.T2770N|CSMD3_uc011lhx.1_Missense_Mutation_p.T2641N	p.T2810N	NM_198123	NP_937756	WXS	Illumina HiSeq	Unspecified	Q7Z407	CSMD3_HUMAN			53	8588	-			2810			Extracellular (Potential).|Sushi 17.		Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	c.8429C>A	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	G	30	5.051216	0.93740	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.64085	-0.08;-0.08;-0.08;-0.08;-0.08	5.62	5.62	0.85841	Complement control module (2);Sushi/SCR/CCP (3);	0.072182	0.53938	D	0.000047	D	0.82618	0.5076	M	0.87180	2.865	0.80722	D	1	D;D;D	0.76494	0.977;0.981;0.999	P;D;D	0.71656	0.854;0.91;0.974	D	0.84628	0.0688	10	0.72032	D	0.01	.	20.024	0.97514	0.0:0.0:1.0:0.0	.	2641;2810;2770	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	N	2770;2810;2080;2641;2740	ENSP00000345799:T2770N;ENSP00000297405:T2810N;ENSP00000341558:T2080N;ENSP00000412263:T2641N;ENSP00000343124:T2740N	ENSP00000297405:T2810N	T	-	2	0	CSMD3	113383209	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.670000	0.98625	2.809000	0.96659	0.655000	0.94253	ACC		0.438	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900		13	42	1	0	1.49906e-05	0.00245	1.64859e-05	13	42				
CSMD3	114788	broad.mit.edu	37	8	113702259	113702259	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr8:113702259C>G	ENST00000297405.5	-	14	2237	c.1993G>C	c.(1993-1995)Ggt>Cgt	p.G665R	CSMD3_ENST00000352409.3_Missense_Mutation_p.G665R|CSMD3_ENST00000455883.2_Missense_Mutation_p.G561R|CSMD3_ENST00000343508.3_Missense_Mutation_p.G625R	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	665	Sushi 3. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.G665R(1)|p.G625R(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						CCAGGATCACCACAACTTTCT	0.363										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																													uc003ynu.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						c.(1993-1995)GGT>CGT		CUB and Sushi multiple domains 3 isoform 1							129.0	136.0	134.0					8																	113702259		2203	4300	6503	SO:0001583	missense	114788					integral to membrane|plasma membrane		g.chr8:113702259C>G	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.1993G>C	8.37:g.113702259C>G	ENSP00000297405:p.Gly665Arg	HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)	Somatic				CSMD3_uc003yns.2_5'UTR|CSMD3_uc003ynt.2_Missense_Mutation_p.G625R|CSMD3_uc011lhx.1_Missense_Mutation_p.G561R	p.G665R	NM_198123	NP_937756	WXS	Illumina HiSeq	Unspecified	Q7Z407	CSMD3_HUMAN			14	2152	-			665			Extracellular (Potential).|Sushi 3.		Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	c.1993G>C	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.048336	0.75846	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.64991	-0.13;-0.13;-0.13;-0.13;-0.13	5.09	5.09	0.68999	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.64402	D	0.000001	T	0.77003	0.4067	M	0.64567	1.98	0.50813	D	0.99989	P;D;D	0.89917	0.726;0.997;1.0	P;D;D	0.78314	0.553;0.991;0.991	T	0.74688	-0.3581	10	0.34782	T	0.22	.	18.8569	0.92255	0.0:1.0:0.0:0.0	.	561;665;625	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	R	625;665;5;561;665	ENSP00000345799:G625R;ENSP00000297405:G665R;ENSP00000341558:G5R;ENSP00000412263:G561R;ENSP00000343124:G665R	ENSP00000297405:G665R	G	-	1	0	CSMD3	113771435	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.776000	0.85560	2.525000	0.85131	0.585000	0.79938	GGT		0.363	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900		40	60	0	0	0	0.006999	0	40	60				
CSMD3	114788	broad.mit.edu	37	8	113988072	113988072	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr8:113988072G>T	ENST00000297405.5	-	7	1580	c.1336C>A	c.(1336-1338)Cat>Aat	p.H446N	CSMD3_ENST00000352409.3_Missense_Mutation_p.H446N|CSMD3_ENST00000455883.2_Intron|CSMD3_ENST00000343508.3_Missense_Mutation_p.H406N	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	446						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.H446N(1)|p.H406N(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						ATACCTCTATGAGTAACAACT	0.403										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																													uc003ynu.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						c.(1336-1338)CAT>AAT		CUB and Sushi multiple domains 3 isoform 1							179.0	177.0	178.0					8																	113988072		2203	4300	6503	SO:0001583	missense	114788					integral to membrane|plasma membrane		g.chr8:113988072G>T	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.1336C>A	8.37:g.113988072G>T	ENSP00000297405:p.His446Asn	HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)	Somatic				CSMD3_uc003ynt.2_Missense_Mutation_p.H406N|CSMD3_uc011lhx.1_Intron	p.H446N	NM_198123	NP_937756	WXS	Illumina HiSeq	Unspecified	Q7Z407	CSMD3_HUMAN			7	1495	-			446			Extracellular (Potential).		Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	c.1336C>A	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	G	14.18	2.459102	0.43634	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000352409	T;T;T	0.18174	2.23;2.23;2.23	6.17	6.17	0.99709	.	0.236553	0.26586	N	0.023554	T	0.31979	0.0814	L	0.29908	0.895	0.34276	D	0.681524	B;P	0.48294	0.036;0.908	B;D	0.64144	0.021;0.922	T	0.03608	-1.1020	10	0.31617	T	0.26	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	446;406	Q7Z407;Q7Z407-2	CSMD3_HUMAN;.	N	406;446;446	ENSP00000345799:H406N;ENSP00000297405:H446N;ENSP00000343124:H446N	ENSP00000297405:H446N	H	-	1	0	CSMD3	114057248	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.050000	0.64251	2.941000	0.99782	0.655000	0.94253	CAT		0.403	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900		23	43	1	0	3.28513e-13	0.003954	4.36368e-13	23	43				
RAD21	5885	broad.mit.edu	37	8	117868465	117868465	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr8:117868465G>C	ENST00000297338.2	-	8	1164	c.877C>G	c.(877-879)Caa>Gaa	p.Q293E	RAD21_ENST00000523547.1_5'Flank	NM_006265.2	NP_006256.1	O60216	RAD21_HUMAN	RAD21 homolog (S. pombe)	293	Interaction with WAPAL and PDS5B.				apoptotic process (GO:0006915)|chromosome segregation (GO:0007059)|DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|protein localization to chromatin (GO:0071168)|reciprocal meiotic recombination (GO:0007131)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear meiotic cohesin complex (GO:0034991)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.Q293E(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|skin(1)|stomach(1)	32	all_cancers(13;1.21e-21)|Lung NSC(37;0.000134)|Ovarian(258;0.0172)					AGTGTTGTTTGATCAGTCATG	0.363																																							uc003yod.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)|skin(1)	2						c.(877-879)CAA>GAA		RAD21 homolog							154.0	143.0	147.0					8																	117868465		2203	4300	6503	SO:0001583	missense	5885				apoptosis|cell division|chromosome segregation|double-strand break repair|mitotic metaphase/anaphase transition|mitotic prometaphase|protein localization to chromatin|reciprocal meiotic recombination|regulation of transcription from RNA polymerase II promoter	chromosome, centromeric region|cohesin complex|nuclear chromosome|nucleoplasm	protein binding	g.chr8:117868465G>C	BC050381	CCDS6321.1	8q24.11	2014-09-17	2001-11-28		ENSG00000164754	ENSG00000164754			9811	protein-coding gene	gene with protein product	"""sister chromatid cohesion 1"""	606462	"""RAD21 (S. pombe) homolog"""			8812457	Standard	NM_006265		Approved	KIAA0078, hHR21, SCC1	uc003yod.3	O60216	OTTHUMG00000164959	ENST00000297338.2:c.877C>G	8.37:g.117868465G>C	ENSP00000297338:p.Gln293Glu		Somatic					p.Q293E	NM_006265	NP_006256	WXS	Illumina HiSeq	Unspecified	O60216	RAD21_HUMAN			8	1165	-	all_cancers(13;1.21e-21)|Lung NSC(37;0.000134)|Ovarian(258;0.0172)		293			Interaction with WAPAL and PDS5B.		A8K0E0|Q15001|Q99568	Missense_Mutation	SNP	ENST00000297338.2	37	c.877C>G	CCDS6321.1	.	.	.	.	.	.	.	.	.	.	G	14.78	2.637094	0.47049	.	.	ENSG00000164754	ENST00000297338	T	0.54279	0.58	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	T	0.59018	0.2163	L	0.37561	1.115	0.80722	D	1	P	0.49447	0.924	P	0.62298	0.9	T	0.48714	-0.9011	10	0.02654	T	1	-10.8597	19.6408	0.95757	0.0:0.0:1.0:0.0	.	293	O60216	RAD21_HUMAN	E	293	ENSP00000297338:Q293E	ENSP00000297338:Q293E	Q	-	1	0	RAD21	117937646	1.000000	0.71417	0.999000	0.59377	0.818000	0.46254	9.855000	0.99526	2.643000	0.89663	0.650000	0.86243	CAA		0.363	RAD21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381184.1	NM_006265		3	73	0	0	0	0.004672	0	3	73				
NOV	4856	broad.mit.edu	37	8	120431528	120431528	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr8:120431528G>T	ENST00000259526.3	+	4	947	c.720G>T	c.(718-720)caG>caT	p.Q240H	RP11-775B15.2_ENST00000519786.1_RNA	NM_002514.3	NP_002505.1	Q9UIW2	PLXA1_HUMAN	nephroblastoma overexpressed	1560	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|multicellular organismal development (GO:0007275)|regulation of smooth muscle cell migration (GO:0014910)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)	p.Q240H(1)		NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|skin(3)	21	all_cancers(13;3.84e-26)|Lung NSC(37;1.19e-08)|Ovarian(258;0.0249)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.000507)			TGCTGAAACAGACTCGGCTCT	0.547																																							uc003yoq.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(2)|kidney(1)	5						c.(718-720)CAG>CAT		nephroblastoma overexpressed precursor	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)						134.0	126.0	129.0					8																	120431528		2203	4300	6503	SO:0001583	missense	4856				regulation of cell growth		growth factor activity|insulin-like growth factor binding	g.chr8:120431528G>T	X96584	CCDS6328.1	8q24.12	2012-02-27	2012-02-27		ENSG00000136999	ENSG00000136999			7885	protein-coding gene	gene with protein product		164958	"""nephroblastoma overexpressed gene"""			1334251	Standard	NM_002514		Approved	IGFBP9, CCN3	uc003yoq.2	P48745	OTTHUMG00000164984	ENST00000259526.3:c.720G>T	8.37:g.120431528G>T	ENSP00000259526:p.Gln240His		Somatic					p.Q240H	NM_002514	NP_002505	WXS	Illumina HiSeq	Unspecified	P48745	NOV_HUMAN	STAD - Stomach adenocarcinoma(47;0.000507)		4	941	+	all_cancers(13;3.84e-26)|Lung NSC(37;1.19e-08)|Ovarian(258;0.0249)|Hepatocellular(40;0.161)		240			TSP type-1.			Missense_Mutation	SNP	ENST00000259526.3	37	c.720G>T	CCDS6328.1	.	.	.	.	.	.	.	.	.	.	G	35	5.572602	0.96553	.	.	ENSG00000136999	ENST00000259526	T	0.61980	0.06	5.96	5.96	0.96718	.	0.055518	0.64402	D	0.000001	D	0.83667	0.5304	M	0.90870	3.155	0.58432	D	0.999998	D	0.65815	0.995	D	0.64321	0.924	D	0.86211	0.1625	10	0.87932	D	0	-16.0935	20.422	0.99049	0.0:0.0:1.0:0.0	.	240	P48745	NOV_HUMAN	H	240	ENSP00000259526:Q240H	ENSP00000259526:Q240H	Q	+	3	2	NOV	120500709	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.835000	0.99442	2.832000	0.97577	0.655000	0.94253	CAG		0.547	NOV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381301.1	NM_002514		51	151	1	0	1.27334e-21	0.01441	1.90353e-21	51	151				
SMARCA2	6595	broad.mit.edu	37	9	2101582	2101582	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr9:2101582G>C	ENST00000382203.1	+	22	3300	c.3091G>C	c.(3091-3093)Gaa>Caa	p.E1031Q	SMARCA2_ENST00000349721.2_Missense_Mutation_p.E1031Q|SMARCA2_ENST00000357248.2_Missense_Mutation_p.E1031Q|SMARCA2_ENST00000382194.1_Missense_Mutation_p.E1031Q			P51531	SMCA2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2	1031					aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|chromatin remodeling (GO:0006338)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)	p.E1031Q(1)|p.E1027Q(1)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)		ATCCTTTGCTGAACACCTAGG	0.299																																							uc003zhc.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|central_nervous_system(1)	3						c.(3091-3093)GAA>CAA		SWI/SNF-related matrix-associated							44.0	48.0	46.0					9																	2101582		2200	4295	6495	SO:0001583	missense	6595				chromatin remodeling|negative regulation of cell growth|negative regulation of transcription from RNA polymerase II promoter|nervous system development	intermediate filament cytoskeleton|nBAF complex|npBAF complex|nuclear chromatin|nucleoplasm|SWI/SNF complex|WINAC complex	ATP binding|DNA-dependent ATPase activity|helicase activity|protein binding|RNA polymerase II transcription coactivator activity|transcription regulatory region DNA binding	g.chr9:2101582G>C	D26155	CCDS34977.1, CCDS34978.1, CCDS75807.1, CCDS75808.1	9p24.3	2008-11-11	2006-11-09		ENSG00000080503	ENSG00000080503			11098	protein-coding gene	gene with protein product		600014		SNF2L2		8012116	Standard	NM_003070		Approved	BAF190, hSNF2a, hBRM, Sth1p, SNF2LA, BRM, SNF2, SWI2	uc003zhc.3	P51531	OTTHUMG00000019445	ENST00000382203.1:c.3091G>C	9.37:g.2101582G>C	ENSP00000371638:p.Glu1031Gln		Somatic				SMARCA2_uc003zhd.2_Missense_Mutation_p.E1031Q|SMARCA2_uc010mha.2_Missense_Mutation_p.E964Q	p.E1031Q	NM_003070	NP_003061	WXS	Illumina HiSeq	Unspecified	P51531	SMCA2_HUMAN		GBM - Glioblastoma multiforme(50;0.0475)	22	3190	+		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)	1031					B1ALG3|B1ALG4|D3DRH4|D3DRH5	Missense_Mutation	SNP	ENST00000382203.1	37	c.3091G>C	CCDS34977.1	.	.	.	.	.	.	.	.	.	.	G	25.0	4.595671	0.86953	.	.	ENSG00000080503	ENST00000349721;ENST00000357248;ENST00000382203;ENST00000382194	T;T;T;T	0.75821	-0.97;-0.97;-0.97;-0.97	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	D	0.83211	0.5205	L	0.48260	1.515	0.80722	D	1	B;D;D	0.61080	0.402;0.989;0.981	B;D;D	0.72982	0.439;0.979;0.954	T	0.82065	-0.0642	10	0.46703	T	0.11	-25.279	19.8632	0.96793	0.0:0.0:1.0:0.0	.	632;1031;1031	B4DK35;P51531-2;P51531	.;.;SMCA2_HUMAN	Q	1031	ENSP00000265773:E1031Q;ENSP00000349788:E1031Q;ENSP00000371638:E1031Q;ENSP00000371629:E1031Q	ENSP00000265773:E1031Q	E	+	1	0	SMARCA2	2091582	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.194000	0.94962	2.699000	0.92147	0.655000	0.94253	GAA		0.299	SMARCA2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000051505.1	NM_003070		5	28	0	0	0	0.001984	0	5	28				
RFX3	5991	broad.mit.edu	37	9	3263012	3263012	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr9:3263012G>C	ENST00000382004.3	-	14	1839	c.1528C>G	c.(1528-1530)Cgt>Ggt	p.R510G	RFX3_ENST00000302303.1_Missense_Mutation_p.R510G|RFX3_ENST00000358730.2_Missense_Mutation_p.R510G	NM_001282116.1|NM_134428.1	NP_001269045.1|NP_602304.1	P48380	RFX3_HUMAN	regulatory factor X, 3 (influences HLA class II expression)	510					cell maturation (GO:0048469)|cilium assembly (GO:0042384)|cilium-dependent cell motility (GO:0060285)|endocrine pancreas development (GO:0031018)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type B pancreatic cell development (GO:2000078)|regulation of insulin secretion (GO:0050796)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|type B pancreatic cell maturation (GO:0072560)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.R510G(2)		central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(11)|large_intestine(3)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	40				GBM - Glioblastoma multiforme(50;0.00124)|Lung(2;0.0337)		AGCACTGCACGAGCTGCCTGG	0.493																																							uc003zhr.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|central_nervous_system(1)|pancreas(1)	4						c.(1528-1530)CGT>GGT		regulatory factor X3 isoform b							185.0	162.0	170.0					9																	3263012		2203	4300	6503	SO:0001583	missense	5991				cell maturation|ciliary cell motility|cilium assembly|cilium movement involved in determination of left/right asymmetry|endocrine pancreas development|negative regulation of transcription, DNA-dependent|positive regulation of transcription from RNA polymerase II promoter|positive regulation of type B pancreatic cell development|regulation of insulin secretion	nuclear chromatin	protein binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription regulatory region DNA binding	g.chr9:3263012G>C	AI811824	CCDS6449.1, CCDS6450.1, CCDS75809.1	9p24.2	2008-02-05			ENSG00000080298	ENSG00000080298			9984	protein-coding gene	gene with protein product		601337				8289803	Standard	XM_005251534		Approved		uc003zhr.3	P48380	OTTHUMG00000019456	ENST00000382004.3:c.1528C>G	9.37:g.3263012G>C	ENSP00000371434:p.Arg510Gly		Somatic				RFX3_uc010mhd.2_Missense_Mutation_p.R510G|RFX3_uc003zhs.1_Missense_Mutation_p.R510G	p.R510G	NM_134428	NP_602304	WXS	Illumina HiSeq	Unspecified	P48380	RFX3_HUMAN		GBM - Glioblastoma multiforme(50;0.00124)|Lung(2;0.0337)	14	1840	-			510					A8K0H5|D3DRH8|D3DRH9|Q5JTL7|Q5JTL8|Q6NW13|Q8WTU4|Q95HL5|Q95HL6	Missense_Mutation	SNP	ENST00000382004.3	37	c.1528C>G	CCDS6449.1	.	.	.	.	.	.	.	.	.	.	G	34	5.325427	0.95708	.	.	ENSG00000080298	ENST00000382004;ENST00000358730;ENST00000302303;ENST00000458034	T;T;T;T	0.50277	0.75;0.75;0.75;0.75	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	T	0.77552	0.4147	M	0.91459	3.21	0.80722	D	1	D;D	0.76494	0.999;0.996	D;D	0.77004	0.989;0.928	T	0.80427	-0.1387	10	0.72032	D	0.01	-10.405	20.8598	0.99761	0.0:0.0:1.0:0.0	.	510;510	P48380-2;P48380	.;RFX3_HUMAN	G	510;510;510;83	ENSP00000371434:R510G;ENSP00000351574:R510G;ENSP00000303847:R510G;ENSP00000400026:R83G	ENSP00000303847:R510G	R	-	1	0	RFX3	3253012	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.937000	0.99478	0.650000	0.86243	CGT		0.493	RFX3-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051545.1	NM_002919		38	61	0	0	0	0.006999	0	38	61				
PTPRD	5789	broad.mit.edu	37	9	8484300	8484300	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr9:8484300C>G	ENST00000381196.4	-	27	3775	c.3232G>C	c.(3232-3234)Gag>Cag	p.E1078Q	PTPRD_ENST00000540109.1_Missense_Mutation_p.E1078Q|PTPRD_ENST00000355233.5_Missense_Mutation_p.E667Q|PTPRD_ENST00000358503.5_Missense_Mutation_p.E1056Q|PTPRD_ENST00000356435.5_Missense_Mutation_p.E1078Q|PTPRD_ENST00000486161.1_Missense_Mutation_p.E667Q|PTPRD_ENST00000397617.3_Missense_Mutation_p.E657Q|PTPRD_ENST00000360074.4_Missense_Mutation_p.E1065Q|PTPRD_ENST00000397611.3_Missense_Mutation_p.E664Q|PTPRD_ENST00000537002.1_Missense_Mutation_p.E664Q|PTPRD_ENST00000397606.3_Missense_Mutation_p.E657Q|PTPRD_ENST00000471274.1_5'Flank	NM_002839.3	NP_002830.1	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	1078	Fibronectin type-III 8. {ECO:0000255|PROSITE-ProRule:PRU00316}.		E -> D (in dbSNP:rs7869444).		heterophilic cell-cell adhesion (GO:0007157)|neuron differentiation (GO:0030182)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|protein dephosphorylation (GO:0006470)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cell adhesion molecule binding (GO:0050839)|receptor binding (GO:0005102)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.E1078Q(2)|p.E667Q(1)		NS(1)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(83)|ovary(4)|pancreas(1)|prostate(7)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	168		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		TATGATTTCTCAGGCTTCAGG	0.428										TSP Lung(15;0.13)																													uc003zkk.2		NA																	3	Substitution - Missense(3)		lung(3)	lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22						c.(3232-3234)GAG>CAG		protein tyrosine phosphatase, receptor type, D							112.0	101.0	105.0					9																	8484300		2203	4300	6503	SO:0001583	missense	5789				transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity	g.chr9:8484300C>G	X54133	CCDS6472.1, CCDS43786.1, CCDS6472.2, CCDS55288.1, CCDS55289.1, CCDS55290.1, CCDS75813.1	9p24.1-p23	2013-02-11			ENSG00000153707	ENSG00000153707		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9668	protein-coding gene	gene with protein product		601598				7896816, 8355697	Standard	NM_002839		Approved	PTPD, HPTP	uc003zkk.3	P23468	OTTHUMG00000021005	ENST00000381196.4:c.3232G>C	9.37:g.8484300C>G	ENSP00000370593:p.Glu1078Gln	TSP Lung(15;0.13)	Somatic				PTPRD_uc003zkp.2_Missense_Mutation_p.E667Q|PTPRD_uc003zkq.2_Missense_Mutation_p.E667Q|PTPRD_uc003zkr.2_Missense_Mutation_p.E662Q|PTPRD_uc003zks.2_Missense_Mutation_p.E657Q|PTPRD_uc003zkl.2_Missense_Mutation_p.E1069Q|PTPRD_uc003zkm.2_Missense_Mutation_p.E1065Q|PTPRD_uc003zkn.2_Missense_Mutation_p.E667Q|PTPRD_uc003zko.2_Missense_Mutation_p.E664Q	p.E1078Q	NM_002839	NP_002830	WXS	Illumina HiSeq	Unspecified	P23468	PTPRD_HUMAN		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)	29	3943	-		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)	1078			Fibronectin type-III 8.|Extracellular (Potential).		B1ALA0|F5GWT7|Q3KPJ0|Q3KPJ1|Q3KPJ2	Missense_Mutation	SNP	ENST00000381196.4	37	c.3232G>C	CCDS43786.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.319515	0.81469	.	.	ENSG00000153707	ENST00000381196;ENST00000356435;ENST00000360074;ENST00000358503;ENST00000355233;ENST00000397617;ENST00000397611;ENST00000537002;ENST00000540109;ENST00000486161;ENST00000397606	T;T;T;T;T;T;T;T;T;T;T	0.54071	0.59;0.59;0.59;0.59;0.59;0.59;0.59;0.59;0.59;0.59;0.59	5.96	5.96	0.96718	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.047350	0.85682	D	0.000000	T	0.40546	0.1121	N	0.16478	0.41	0.80722	D	1	B;P;P;P;B;P;B;B;B	0.39862	0.415;0.682;0.497;0.557;0.004;0.692;0.041;0.167;0.012	B;B;B;B;B;B;B;B;B	0.38020	0.171;0.212;0.067;0.091;0.037;0.263;0.05;0.15;0.035	T	0.16778	-1.0391	9	.	.	.	.	20.0112	0.97449	0.0:1.0:0.0:0.0	.	657;662;667;667;664;664;1065;1078;1078	Q3KPJ2;Q3KPI9;Q3KPJ0;Q3KPJ1;F5GWT7;F5GWY7;G3XAE2;Q2HXI4;P23468	.;.;.;.;.;.;.;.;PTPRD_HUMAN	Q	1078;1078;1065;1056;667;657;664;664;1078;667;657	ENSP00000370593:E1078Q;ENSP00000348812:E1078Q;ENSP00000353187:E1065Q;ENSP00000351293:E1056Q;ENSP00000347373:E667Q;ENSP00000380741:E657Q;ENSP00000380735:E664Q;ENSP00000440515:E664Q;ENSP00000438164:E1078Q;ENSP00000417093:E667Q;ENSP00000380731:E657Q	.	E	-	1	0	PTPRD	8474300	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	7.818000	0.86416	2.826000	0.97356	0.655000	0.94253	GAG		0.428	PTPRD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055395.3			3	65	0	0	0	0.004672	0	3	65				
MPDZ	8777	broad.mit.edu	37	9	13188859	13188859	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr9:13188859C>A	ENST00000319217.7	-	17	2535	c.2288G>T	c.(2287-2289)aGt>aTt	p.S763I	MPDZ_ENST00000546205.1_Missense_Mutation_p.S763I|MPDZ_ENST00000536827.1_Missense_Mutation_p.S763I|MPDZ_ENST00000381015.4_Missense_Mutation_p.S763I|MPDZ_ENST00000447879.1_Missense_Mutation_p.S763I|MPDZ_ENST00000541718.1_Missense_Mutation_p.S763I|MPDZ_ENST00000381022.2_Missense_Mutation_p.S763I	NM_001261406.1	NP_001248335.1	O75970	MPDZ_HUMAN	multiple PDZ domain protein	763	PDZ 5. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell adhesion (GO:0007155)|myelination (GO:0042552)|viral process (GO:0016032)	apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|neuron projection (GO:0043005)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)	protein C-terminus binding (GO:0008022)	p.S763I(2)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(15)|ovary(5)|prostate(7)|stomach(1)|urinary_tract(2)	61				GBM - Glioblastoma multiforme(50;2.03e-06)		TTCCTCAAGACTGCTGTTTTC	0.463																																							uc010mia.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(5)|central_nervous_system(1)	6						c.(2287-2289)AGT>ATT		multiple PDZ domain protein							231.0	229.0	230.0					9																	13188859		1996	4167	6163	SO:0001583	missense	8777				interspecies interaction between organisms	apical plasma membrane|dendrite|postsynaptic density|postsynaptic membrane|synaptosome|tight junction	protein C-terminus binding	g.chr9:13188859C>A	AF093419	CCDS47951.1, CCDS59119.1, CCDS59120.1	9p23	2008-05-15			ENSG00000107186	ENSG00000107186			7208	protein-coding gene	gene with protein product		603785					Standard	NM_003829		Approved	MUPP1	uc003zlb.4	O75970	OTTHUMG00000021031	ENST00000319217.7:c.2288G>T	9.37:g.13188859C>A	ENSP00000320006:p.Ser763Ile		Somatic				MPDZ_uc010mhy.2_Missense_Mutation_p.S763I|MPDZ_uc010mhz.2_Missense_Mutation_p.S763I|MPDZ_uc011lmn.1_Missense_Mutation_p.S763I|MPDZ_uc003zlb.3_Missense_Mutation_p.S763I	p.S763I	NM_003829	NP_003820	WXS	Illumina HiSeq	Unspecified	O75970	MPDZ_HUMAN		GBM - Glioblastoma multiforme(50;2.03e-06)	16	2345	-			763			PDZ 5.		A6NLC2|B2RTS3|B7ZMI4|O43798|Q4LE30|Q5CZ80|Q5JTX3|Q5JTX6|Q5JTX7|Q5JUC3|Q5JUC4|Q5VZ62|Q8N790	Missense_Mutation	SNP	ENST00000319217.7	37	c.2288G>T		.	.	.	.	.	.	.	.	.	.	C	24.2	4.505226	0.85282	.	.	ENSG00000107186	ENST00000319217;ENST00000541718;ENST00000381022;ENST00000536827;ENST00000447879;ENST00000381015;ENST00000399902;ENST00000546205	T;T;T;T;T;T;T	0.21361	2.01;2.01;2.01;2.01;2.01;2.01;2.01	5.9	4.98	0.66077	.	0.116741	0.38605	N	0.001624	T	0.56247	0.1972	H	0.94886	3.595	0.80722	D	1	D;D;D	0.61697	0.983;0.979;0.99	P;P;P	0.61658	0.892;0.827;0.871	T	0.72154	-0.4376	10	0.87932	D	0	.	16.6773	0.85282	0.0:0.8661:0.1339:0.0	.	763;763;763	B7ZMI4;O75970-3;O75970-2	.;.;.	I	763;763;763;763;763;763;713;763	ENSP00000320006:S763I;ENSP00000439807:S763I;ENSP00000370410:S763I;ENSP00000444151:S763I;ENSP00000415208:S763I;ENSP00000370403:S763I;ENSP00000446358:S763I	ENSP00000320006:S763I	S	-	2	0	MPDZ	13178859	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	3.035000	0.49759	1.458000	0.47871	0.655000	0.94253	AGT		0.463	MPDZ-001	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000055485.2	NM_003829		67	205	1	0	1.31311e-47	0.01441	2.2445e-47	67	205				
CCDC171	203238	broad.mit.edu	37	9	15784550	15784550	+	Missense_Mutation	SNP	T	T	G			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr9:15784550T>G	ENST00000380701.3	+	21	3453	c.3125T>G	c.(3124-3126)cTa>cGa	p.L1042R	CCDC171_ENST00000297641.3_Missense_Mutation_p.L1042R	NM_173550.2	NP_775821.2	Q6TFL3	CC171_HUMAN	coiled-coil domain containing 171	1042								p.L309R(1)|p.L1042R(1)									TGTGAAGAACTAAATAATGCA	0.373																																							uc003zmd.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(3124-3126)CTA>CGA		hypothetical protein LOC203238							87.0	78.0	81.0					9																	15784550		2203	4300	6503	SO:0001583	missense	203238							g.chr9:15784550T>G	AY422473	CCDS6481.1	9p22.2	2012-03-26	2012-03-26	2012-03-26	ENSG00000164989	ENSG00000164989			29828	protein-coding gene	gene with protein product	"""myosin tail domain containing protein"""		"""chromosome 9 open reading frame 93"""	C9orf93		14702039	Standard	NM_173550		Approved	FLJ39267, FLJ46740, Em:AL513423.1, bA778P13.1, bA536D16.1	uc003zmd.3	Q6TFL3	OTTHUMG00000019584	ENST00000380701.3:c.3125T>G	9.37:g.15784550T>G	ENSP00000370077:p.Leu1042Arg		Somatic				C9orf93_uc003zme.2_Missense_Mutation_p.L957R|C9orf93_uc011lmu.1_Missense_Mutation_p.L1050R|C9orf93_uc003zmf.1_Missense_Mutation_p.L350R	p.L1042R	NM_173550	NP_775821	WXS	Illumina HiSeq	Unspecified	Q6TFL3	CI093_HUMAN		GBM - Glioblastoma multiforme(50;4.84e-07)	21	3440	+			1042			Potential.		B7ZM22|Q5SU58|Q6P1W1|Q6ZR13|Q8N1Z4|Q8N8L3|Q8TBR2	Missense_Mutation	SNP	ENST00000380701.3	37	c.3125T>G	CCDS6481.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	18.49|18.49	3.636128|3.636128	0.67130|0.67130	.|.	.|.	ENSG00000164989|ENSG00000164989	ENST00000297641;ENST00000380689;ENST00000380701|ENST00000449575;ENST00000432954	T;T|.	0.69561|.	-0.41;-0.41|.	5.04|5.04	3.9|3.9	0.45041|0.45041	.|.	0.000000|.	0.64402|.	D|.	0.000001|.	T|.	0.51652|.	0.1687|.	L|L	0.32530|0.32530	0.975|0.975	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;0.999|.	D;D;D|.	0.74674|.	0.984;0.963;0.976|.	T|.	0.45512|.	-0.9256|.	10|.	0.44086|.	T|.	0.13|.	-4.9723|-4.9723	10.3965|10.3965	0.44203|0.44203	0.0:0.0775:0.0:0.9225|0.0:0.0775:0.0:0.9225	.|.	1050;309;1042|.	B7ZM22;A6NK04;Q6TFL3|.	.;.;CI093_HUMAN|.	R|E	1042;309;1042|282;96	ENSP00000297641:L1042R;ENSP00000370077:L1042R|.	ENSP00000297641:L1042R|.	L|X	+|+	2|1	0|0	C9orf93|C9orf93	15774550|15774550	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	4.453000|4.453000	0.60061|0.60061	2.022000|2.022000	0.59522|0.59522	0.533000|0.533000	0.62120|0.62120	CTA|TAA		0.373	CCDC171-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051768.4	NM_173550		5	22	0	0	0	0.000602	0	5	22				
BNC2	54796	broad.mit.edu	37	9	16436214	16436214	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr9:16436214G>T	ENST00000380672.4	-	6	2035	c.1978C>A	c.(1978-1980)Ccc>Acc	p.P660T	BNC2_ENST00000380666.2_Missense_Mutation_p.P660T|BNC2_ENST00000380667.2_Missense_Mutation_p.P593T|BNC2_ENST00000545497.1_Missense_Mutation_p.P565T	NM_017637.5	NP_060107.3			basonuclin 2									p.P660T(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(16)|liver(1)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(50;9.01e-08)		CCATCATTGGGGTCATCATCT	0.468																																							uc003zml.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(1978-1980)CCC>ACC		basonuclin 2							135.0	121.0	126.0					9																	16436214		2203	4300	6503	SO:0001583	missense	54796				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	zinc ion binding	g.chr9:16436214G>T	AK092247	CCDS6482.2	9p22.2	2013-05-20			ENSG00000173068	ENSG00000173068		"""Zinc fingers, C2H2-type"""	30988	protein-coding gene	gene with protein product		608669				14702039	Standard	XM_006716784		Approved	BSN2, FLJ20043	uc003zml.3	Q6ZN30	OTTHUMG00000019593	ENST00000380672.4:c.1978C>A	9.37:g.16436214G>T	ENSP00000370047:p.Pro660Thr		Somatic				BNC2_uc011lmw.1_Missense_Mutation_p.P565T|BNC2_uc003zmm.2_Missense_Mutation_p.P618T|BNC2_uc003zmq.1_Missense_Mutation_p.P674T|BNC2_uc003zmr.1_Missense_Mutation_p.P697T|BNC2_uc003zmp.1_Missense_Mutation_p.P688T|BNC2_uc010mij.1_Missense_Mutation_p.P582T|BNC2_uc011lmv.1_Missense_Mutation_p.P486T|BNC2_uc003zmo.1_Missense_Mutation_p.P582T|BNC2_uc003zmj.2_Missense_Mutation_p.P425T|BNC2_uc003zmk.2_RNA|BNC2_uc003zmi.2_Missense_Mutation_p.P425T|BNC2_uc003zmn.1_Missense_Mutation_p.P425T	p.P660T	NM_017637	NP_060107	WXS	Illumina HiSeq	Unspecified	Q6ZN30	BNC2_HUMAN		GBM - Glioblastoma multiforme(50;9.01e-08)	6	2118	-			660						Missense_Mutation	SNP	ENST00000380672.4	37	c.1978C>A	CCDS6482.2	.	.	.	.	.	.	.	.	.	.	G	8.661	0.900573	0.17686	.	.	ENSG00000173068	ENST00000380672;ENST00000411752;ENST00000418777;ENST00000380667;ENST00000545497;ENST00000544198;ENST00000380666;ENST00000540340	T;T;T;T;T;T	0.44083	1.56;0.93;1.56;1.58;1.58;1.56	6.17	5.26	0.73747	.	0.342939	0.33346	N	0.005001	T	0.23611	0.0571	N	0.08118	0	0.31641	N	0.647999	B;B;B;B;B;B;B;B;B	0.24721	0.013;0.008;0.065;0.11;0.065;0.016;0.039;0.067;0.039	B;B;B;B;B;B;B;B;B	0.22601	0.025;0.007;0.04;0.04;0.017;0.007;0.011;0.018;0.011	T	0.19451	-1.0305	10	0.39692	T	0.17	-14.9337	11.0178	0.47701	0.0:0.3187:0.5609:0.1204	.	565;593;660;486;660;617;660;565;425	F5H586;B1APH0;Q6ZN30-2;B4E3J2;F5H8G9;Q5H9S4;Q6ZN30;B4DR27;D3DRJ1	.;.;.;.;.;.;BNC2_HUMAN;.;.	T	660;53;617;593;565;486;660;660	ENSP00000370047:P660T;ENSP00000392212:P53T;ENSP00000408370:P617T;ENSP00000370042:P593T;ENSP00000444640:P565T;ENSP00000370041:P660T	ENSP00000370041:P660T	P	-	1	0	BNC2	16426214	1.000000	0.71417	1.000000	0.80357	0.871000	0.50021	3.937000	0.56575	1.585000	0.49928	0.655000	0.94253	CCC		0.468	BNC2-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000216901.5	NM_017637		11	76	1	0	0.00010058	0.013537	0.000108185	11	76				
ARID3C	138715	broad.mit.edu	37	9	34627853	34627853	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr9:34627853C>A	ENST00000378909.2	-	1	251	c.159G>T	c.(157-159)gaG>gaT	p.E53D		NM_001017363.1	NP_001017363.1	A6NKF2	ARI3C_HUMAN	AT rich interactive domain 3C (BRIGHT-like)	53	Glu-rich.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane raft (GO:0045121)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.E53D(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|skin(1)|stomach(1)	14	all_epithelial(49;0.102)		STAD - Stomach adenocarcinoma(86;0.178)	GBM - Glioblastoma multiforme(74;0.175)		cagcatcttcctcttcctcAG	0.682																																							uc011lon.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(157-159)GAG>GAT		AT rich interactive domain 3C (BRIGHT- like)							24.0	21.0	22.0					9																	34627853		2191	4284	6475	SO:0001583	missense	138715				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding	g.chr9:34627853C>A		CCDS35006.1	9p13.2	2013-02-07	2006-11-08		ENSG00000205143	ENSG00000205143		"""-"""	21209	protein-coding gene	gene with protein product			"""AT rich interactive domain 3C (BRIGHT- like)"""				Standard	NM_001017363		Approved		uc011lon.2	A6NKF2	OTTHUMG00000000445	ENST00000378909.2:c.159G>T	9.37:g.34627853C>A	ENSP00000368189:p.Glu53Asp		Somatic					p.E53D	NM_001017363	NP_001017363	WXS	Illumina HiSeq	Unspecified	A6NKF2	ARI3C_HUMAN	STAD - Stomach adenocarcinoma(86;0.178)	GBM - Glioblastoma multiforme(74;0.175)	1	159	-	all_epithelial(49;0.102)		53			Glu-rich.			Missense_Mutation	SNP	ENST00000378909.2	37	c.159G>T	CCDS35006.1	.	.	.	.	.	.	.	.	.	.	c	16.68	3.189695	0.57909	.	.	ENSG00000205143	ENST00000378909	T	0.48522	0.81	5.0	1.12	0.20585	.	1.023330	0.07809	N	0.957793	T	0.31796	0.0808	L	0.29908	0.895	0.29268	N	0.870851	B	0.27351	0.176	B	0.22386	0.039	T	0.29119	-1.0022	10	0.15952	T	0.53	-12.1614	7.7317	0.28791	0.0:0.6552:0.0:0.3448	.	53	A6NKF2	ARI3C_HUMAN	D	53	ENSP00000368189:E53D	ENSP00000368189:E53D	E	-	3	2	ARID3C	34617853	0.703000	0.27826	0.995000	0.50966	0.864000	0.49448	-0.342000	0.07801	0.043000	0.15746	0.486000	0.48141	GAG		0.682	ARID3C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348265.1	XM_071061		9	9	1	0	0.00621372	0.006214	0.00649348	9	9				
Unknown	0	broad.mit.edu	37	9	66499680	66499680	+	IGR	SNP	C	C	A	rs370931238		TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr9:66499680C>A								RP11-262H14.1 (30370 upstream) : RP11-262H14.7 (17525 downstream)																							TCATGTTAACCCCTTCCCAGG	0.582																																							uc004aee.1		NA																	0					0						c.(490-492)CCC>ACC		Homo sapiens hypothetical LOC442421, mRNA (cDNA clone IMAGE:40031134).																																				SO:0001628	intergenic_variant	442421							g.chr9:66499680C>A																													9.37:g.66499680C>A			Somatic				LOC442421_uc004aed.1_RNA	p.P164T			WXS	Illumina HiSeq	Unspecified					1	490	+									Missense_Mutation	SNP		37	c.490C>A																																																																																				0	0.582									11	65	1	0	6.40141e-05	0.010729	6.93617e-05	11	65				
TRPM3	80036	broad.mit.edu	37	9	73151524	73151524	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr9:73151524G>T	ENST00000377110.3	-	25	4712	c.4469C>A	c.(4468-4470)cCt>cAt	p.P1490H	TRPM3_ENST00000357533.2_Missense_Mutation_p.P1494H|TRPM3_ENST00000377106.1_Missense_Mutation_p.P1362H|TRPM3_ENST00000408909.2_Missense_Mutation_p.P1349H|TRPM3_ENST00000396292.4_Missense_Mutation_p.P1362H|TRPM3_ENST00000360823.2_Missense_Mutation_p.P1352H|TRPM3_ENST00000358082.3_Missense_Mutation_p.P1352H|TRPM3_ENST00000377105.1_Missense_Mutation_p.P1349H|TRPM3_ENST00000396285.1_Missense_Mutation_p.P1349H|TRPM3_ENST00000377111.2_Intron|TRPM3_ENST00000396280.5_Missense_Mutation_p.P1339H|TRPM3_ENST00000423814.3_Missense_Mutation_p.P1517H			Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel, subfamily M, member 3	1515					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|sensory perception of temperature stimulus (GO:0050951)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)	p.P1362H(1)|p.P1490H(1)|p.P1494H(1)		NS(2)|breast(4)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(18)|liver(1)|lung(46)|ovary(3)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(1)	95						GTACATCGGAGGCTCTGAGTC	0.493																																							uc004aid.2		NA																	3	Substitution - Missense(3)		lung(3)	ovary(3)|pancreas(2)|central_nervous_system(2)|skin(2)	9						c.(4468-4470)CCT>CAT		transient receptor potential cation channel,							108.0	111.0	110.0					9																	73151524		2203	4300	6503	SO:0001583	missense	80036					integral to membrane	calcium channel activity	g.chr9:73151524G>T	AB046836	CCDS6634.1, CCDS6635.1, CCDS6636.1, CCDS6637.1, CCDS43835.1, CCDS65064.1	9q21.11	2011-12-14			ENSG00000083067	ENSG00000083067		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17992	protein-coding gene	gene with protein product	"""melastatin 2"""	608961				16382100	Standard	NM_206946		Approved	KIAA1616, LTRPC3, GON-2	uc004aid.3	Q9HCF6	OTTHUMG00000019997	ENST00000377110.3:c.4469C>A	9.37:g.73151524G>T	ENSP00000366314:p.Pro1490His		Somatic				TRPM3_uc004ahu.2_Missense_Mutation_p.P1332H|TRPM3_uc004ahv.2_Missense_Mutation_p.P1292H|TRPM3_uc004ahw.2_Missense_Mutation_p.P1362H|TRPM3_uc004ahx.2_Missense_Mutation_p.P1349H|TRPM3_uc004ahy.2_Missense_Mutation_p.P1352H|TRPM3_uc004ahz.2_Missense_Mutation_p.P1339H|TRPM3_uc004aia.2_Missense_Mutation_p.P1337H|TRPM3_uc004aib.2_Missense_Mutation_p.P1327H|TRPM3_uc004aic.2_Intron	p.P1490H	NM_001007471	NP_001007472	WXS	Illumina HiSeq	Unspecified	Q9HCF6	TRPM3_HUMAN			25	4713	-			1515			Cytoplasmic (Potential).		A2A3F6|A9Z1Y7|Q5VW02|Q5VW03|Q5VW04|Q5W5T7|Q86SH0|Q86SH6|Q86UL0|Q86WK1|Q86WK2|Q86WK3|Q86WK4|Q86YZ9|Q86Z00|Q86Z01|Q9H0X2	Missense_Mutation	SNP	ENST00000377110.3	37	c.4469C>A	CCDS43835.1	.	.	.	.	.	.	.	.	.	.	G	16.85	3.235690	0.58886	.	.	ENSG00000083067	ENST00000377110;ENST00000377106;ENST00000360823;ENST00000377105;ENST00000357533;ENST00000408909;ENST00000396285;ENST00000396292;ENST00000358082;ENST00000423814	T;T;T;T;T;T;T;T;T;T	0.62364	0.16;0.05;0.04;0.04;0.16;0.04;0.03;0.05;0.04;0.14	6.02	5.13	0.70059	.	0.000000	0.85682	D	0.000000	T	0.62962	0.2471	L	0.27053	0.805	0.50171	D	0.999852	P;D;D;D;P;P;P	0.58268	0.956;0.982;0.97;0.957;0.956;0.867;0.926	P;P;P;P;P;P;P	0.53062	0.717;0.646;0.541;0.525;0.717;0.465;0.525	T	0.66567	-0.5891	10	0.52906	T	0.07	-13.3501	17.557	0.87894	0.0:0.1237:0.8763:0.0	.	1490;1480;1494;1352;1349;1462;1349	Q9HCF6-2;Q9HCF6-4;A2A3F7;A2A3F4;G5E9G1;Q9HCF6-8;A2A3F3	.;.;.;.;.;.;.	H	1490;1362;1352;1349;1494;1349;1349;1362;1352;1517	ENSP00000366314:P1490H;ENSP00000366310:P1362H;ENSP00000354066:P1352H;ENSP00000366309:P1349H;ENSP00000350140:P1494H;ENSP00000386127:P1349H;ENSP00000379581:P1349H;ENSP00000379587:P1362H;ENSP00000350791:P1352H;ENSP00000389542:P1517H	ENSP00000350140:P1494H	P	-	2	0	TRPM3	72341344	1.000000	0.71417	0.995000	0.50966	0.931000	0.56810	7.171000	0.77595	1.577000	0.49804	-0.121000	0.15023	CCT		0.493	TRPM3-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214158.3	NM_206945		40	64	1	0	8.01111e-26	0.010771	1.23528e-25	40	64				
TRPM3	80036	broad.mit.edu	37	9	73218374	73218374	+	Nonsense_Mutation	SNP	C	C	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr9:73218374C>A	ENST00000377111.2	-	19	2887	c.2644G>T	c.(2644-2646)Gga>Tga	p.G882*	TRPM3_ENST00000377110.3_Nonsense_Mutation_p.G882*|TRPM3_ENST00000357533.2_Nonsense_Mutation_p.G886*|TRPM3_ENST00000377106.1_Nonsense_Mutation_p.G754*|TRPM3_ENST00000408909.2_Nonsense_Mutation_p.G741*|TRPM3_ENST00000396292.4_Nonsense_Mutation_p.G754*|TRPM3_ENST00000360823.2_Nonsense_Mutation_p.G744*|TRPM3_ENST00000358082.3_Nonsense_Mutation_p.G744*|TRPM3_ENST00000377105.1_Nonsense_Mutation_p.G741*|TRPM3_ENST00000396285.1_Nonsense_Mutation_p.G729*|TRPM3_ENST00000396280.5_Nonsense_Mutation_p.G731*|TRPM3_ENST00000423814.3_Nonsense_Mutation_p.G909*	NM_001007471.2	NP_001007472.2	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel, subfamily M, member 3	907					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|sensory perception of temperature stimulus (GO:0050951)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)	p.G882*(1)|p.G754*(1)|p.G886*(1)		NS(2)|breast(4)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(18)|liver(1)|lung(46)|ovary(3)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(1)	95						ATCAGGTATCCGATATACGCC	0.522																																							uc004aid.2		NA																	3	Substitution - Nonsense(3)		lung(3)	ovary(3)|pancreas(2)|central_nervous_system(2)|skin(2)	9						c.(2644-2646)GGA>TGA		transient receptor potential cation channel,							90.0	74.0	79.0					9																	73218374		2203	4300	6503	SO:0001587	stop_gained	80036					integral to membrane	calcium channel activity	g.chr9:73218374C>A	AB046836	CCDS6634.1, CCDS6635.1, CCDS6636.1, CCDS6637.1, CCDS43835.1, CCDS65064.1	9q21.11	2011-12-14			ENSG00000083067	ENSG00000083067		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17992	protein-coding gene	gene with protein product	"""melastatin 2"""	608961				16382100	Standard	NM_206946		Approved	KIAA1616, LTRPC3, GON-2	uc004aid.3	Q9HCF6	OTTHUMG00000019997	ENST00000377111.2:c.2644G>T	9.37:g.73218374C>A	ENSP00000366315:p.Gly882*		Somatic				TRPM3_uc004ahu.2_Nonsense_Mutation_p.G712*|TRPM3_uc004ahv.2_Nonsense_Mutation_p.G684*|TRPM3_uc004ahw.2_Nonsense_Mutation_p.G754*|TRPM3_uc004ahx.2_Nonsense_Mutation_p.G741*|TRPM3_uc004ahy.2_Nonsense_Mutation_p.G744*|TRPM3_uc004ahz.2_Nonsense_Mutation_p.G731*|TRPM3_uc004aia.2_Nonsense_Mutation_p.G729*|TRPM3_uc004aib.2_Nonsense_Mutation_p.G719*|TRPM3_uc004aic.2_Nonsense_Mutation_p.G882*	p.G882*	NM_001007471	NP_001007472	WXS	Illumina HiSeq	Unspecified	Q9HCF6	TRPM3_HUMAN			19	2888	-			907			Helical; (Potential).		A2A3F6|A9Z1Y7|Q5VW02|Q5VW03|Q5VW04|Q5W5T7|Q86SH0|Q86SH6|Q86UL0|Q86WK1|Q86WK2|Q86WK3|Q86WK4|Q86YZ9|Q86Z00|Q86Z01|Q9H0X2	Nonsense_Mutation	SNP	ENST00000377111.2	37	c.2644G>T		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	44|44	10.702320|10.702320	0.99453|0.99453	.|.	.|.	ENSG00000083067|ENSG00000083067	ENST00000377111;ENST00000377110;ENST00000377106;ENST00000360823;ENST00000377105;ENST00000357533;ENST00000408909;ENST00000396285;ENST00000396292;ENST00000358082;ENST00000423814|ENST00000396280	.|.	.|.	.|.	5.59|5.59	5.59|5.59	0.84812|0.84812	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|T	.|0.79563	.|0.4467	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.77874	.|-0.2425	.|3	0.25751|.	T|.	0.34|.	-14.7374|-14.7374	19.6085|19.6085	0.95589|0.95589	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	X|L	882;882;754;744;741;886;741;729;754;744;909|730	.|.	ENSP00000350140:G886X|.	G|R	-|-	1|2	0|0	TRPM3|TRPM3	72408194|72408194	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.951000|0.951000	0.60555|0.60555	7.783000|7.783000	0.85696|0.85696	2.629000|2.629000	0.89072|0.89072	0.637000|0.637000	0.83480|0.83480	GGA|CGG		0.522	TRPM3-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000214157.5	NM_206945		26	38	1	0	3.73148e-12	0.007291	4.88303e-12	26	38				
TMEM2	23670	broad.mit.edu	37	9	74313084	74313084	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr9:74313084C>A	ENST00000377044.4	-	20	3953	c.3414G>T	c.(3412-3414)agG>agT	p.R1138S	TMEM2_ENST00000396272.3_Missense_Mutation_p.R131S|TMEM2_ENST00000377066.5_Missense_Mutation_p.R1075S	NM_001135820.1|NM_013390.2	NP_001129292.1|NP_037522.1	Q9UHN6	TMEM2_HUMAN	transmembrane protein 2	1138					multicellular organismal development (GO:0007275)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.R1138S(1)|p.R1138R(1)		central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(15)|liver(1)|lung(19)|ovary(2)|prostate(5)|skin(1)|stomach(1)|urinary_tract(2)	56		all_epithelial(88;4.56e-14)|Myeloproliferative disorder(762;0.0255)		GBM - Glioblastoma multiforme(74;7.45e-21)|OV - Ovarian serous cystadenocarcinoma(323;1.02e-16)		TGTGGCCATGCCTGTGGCTTT	0.418																																							uc011lsa.1		NA																	2	Substitution - Missense(1)|Substitution - coding silent(1)		lung(1)|endometrium(1)	ovary(2)	2						c.(3412-3414)AGG>AGT		transmembrane protein 2 isoform a							168.0	133.0	145.0					9																	74313084		2203	4300	6503	SO:0001583	missense	23670					integral to membrane		g.chr9:74313084C>A		CCDS6638.1, CCDS47979.1	9q21.13	2011-07-19			ENSG00000135048	ENSG00000135048			11869	protein-coding gene	gene with protein product		605835					Standard	NM_013390		Approved		uc011lsa.1	Q9UHN6	OTTHUMG00000020000	ENST00000377044.4:c.3414G>T	9.37:g.74313084C>A	ENSP00000366243:p.Arg1138Ser		Somatic				TMEM2_uc011lrz.1_Missense_Mutation_p.R131S|TMEM2_uc010mos.2_Missense_Mutation_p.R1075S|TMEM2_uc011lsb.1_RNA|TMEM2_uc004aik.2_5'UTR	p.R1138S	NM_013390	NP_037522	WXS	Illumina HiSeq	Unspecified	Q9UHN6	TMEM2_HUMAN		GBM - Glioblastoma multiforme(74;7.45e-21)|OV - Ovarian serous cystadenocarcinoma(323;1.02e-16)	20	3954	-		all_epithelial(88;4.56e-14)|Myeloproliferative disorder(762;0.0255)	1138					A6H8W9|B2RTQ6|Q5T838|Q5T839|Q5T840|Q5T841|Q8NBP6|Q9P2D5	Missense_Mutation	SNP	ENST00000377044.4	37	c.3414G>T	CCDS6638.1	.	.	.	.	.	.	.	.	.	.	C	19.94	3.920264	0.73098	.	.	ENSG00000135048	ENST00000377044;ENST00000377066;ENST00000396272	T;T;T	0.54675	0.56;0.56;0.56	5.8	0.765	0.18470	.	0.000000	0.85682	D	0.000000	T	0.69984	0.3172	M	0.82517	2.595	0.49051	D	0.999748	D;D	0.89917	0.999;1.0	D;D	0.87578	0.986;0.998	T	0.70267	-0.4919	10	0.66056	D	0.02	.	10.1858	0.42998	0.0:0.6685:0.0:0.3315	.	1138;1075	Q9UHN6;Q9UHN6-2	TMEM2_HUMAN;.	S	1138;1075;131	ENSP00000366243:R1138S;ENSP00000366266:R1075S;ENSP00000379569:R131S	ENSP00000366243:R1138S	R	-	3	2	TMEM2	73502904	0.897000	0.30589	0.997000	0.53966	0.966000	0.64601	-0.048000	0.11944	0.090000	0.17273	0.563000	0.77884	AGG		0.418	TMEM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052618.2	NM_013390		56	94	1	0	1.64573e-32	0.01441	2.66827e-32	56	94				
GCNT1	2650	broad.mit.edu	37	9	79118029	79118029	+	Silent	SNP	G	G	T	rs555199442		TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr9:79118029G>T	ENST00000376730.4	+	4	1215	c.732G>T	c.(730-732)acG>acT	p.T244T	GCNT1_ENST00000536223.1_Silent_p.T244T|GCNT1_ENST00000444201.2_Silent_p.T244T|GCNT1_ENST00000442371.1_Silent_p.T244T	NM_001097636.1|NM_001490.4	NP_001091105.1|NP_001481.2	Q02742	GCNT1_HUMAN	glucosaminyl (N-acetyl) transferase 1, core 2	244	Catalytic. {ECO:0000250}.				cell adhesion molecule production (GO:0060352)|cellular protein metabolic process (GO:0044267)|glycoprotein biosynthetic process (GO:0009101)|kidney morphogenesis (GO:0060993)|leukocyte tethering or rolling (GO:0050901)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to insulin (GO:0032868)|tissue morphogenesis (GO:0048729)	extracellular space (GO:0005615)|Golgi cisterna (GO:0031985)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|trans-Golgi network (GO:0005802)	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase activity (GO:0003829)	p.T244T(2)		breast(2)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(6)|lung(11)|prostate(2)|urinary_tract(1)	30						ACCTGGAAACGGAGAGGATGC	0.418																																							uc010mpf.2		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(730-732)ACG>ACT		beta-1,3-galactosyl-O-glycosyl-glycoprotein							70.0	63.0	65.0					9																	79118029		2203	4300	6503	SO:0001819	synonymous_variant	2650				protein O-linked glycosylation	Golgi membrane|integral to membrane	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase activity	g.chr9:79118029G>T	L41415	CCDS6653.1	9q13	2013-02-25	2010-03-16		ENSG00000187210	ENSG00000187210	2.4.1.102	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	4203	protein-coding gene	gene with protein product	"""core 2 beta1,6 N-acetylglucosaminyltransferase-I"", ""beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N--acetylglucosaminyltransferase"""	600391	"""glucosaminyl (N-acetyl) transferase 1, core 2 (beta-1,6-N-acetylglucosaminyltransferase)"""	NACGT2		8449405, 9915862	Standard	NM_001490		Approved	C2GNT, NAGCT2	uc004akf.4	Q02742	OTTHUMG00000020044	ENST00000376730.4:c.732G>T	9.37:g.79118029G>T			Somatic				GCNT1_uc010mpg.2_Silent_p.T244T|GCNT1_uc010mph.2_Silent_p.T244T|GCNT1_uc004akf.3_Silent_p.T244T|GCNT1_uc010mpi.2_Silent_p.T244T|GCNT1_uc004akh.3_Silent_p.T244T	p.T244T	NM_001490	NP_001481	WXS	Illumina HiSeq	Unspecified	Q02742	GCNT1_HUMAN			3	1073	+			244			Lumenal (Potential).|Catalytic (By similarity).		Q6DJZ4	Silent	SNP	ENST00000376730.4	37	c.732G>T	CCDS6653.1																																																																																				0.418	GCNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052725.1	NM_001097634		11	76	1	0	1.08611e-07	0.010729	1.26713e-07	11	76				
HNRNPK	3190	broad.mit.edu	37	9	86593299	86593299	+	De_novo_Start_OutOfFrame	SNP	T	T	C			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr9:86593299T>C	ENST00000376264.2	-	0	220				HNRNPK_ENST00000351839.3_De_novo_Start_OutOfFrame|HNRNPK_ENST00000360384.5_De_novo_Start_OutOfFrame|RP11-575L7.8_ENST00000448389.1_RNA|HNRNPK_ENST00000376281.4_De_novo_Start_OutOfFrame|HNRNPK_ENST00000376263.3_De_novo_Start_OutOfFrame|RMI1_ENST00000325875.3_5'Flank	NM_002140.3|NM_031262.2	NP_002131.2|NP_112552.1	P61978	HNRPK_HUMAN	heterogeneous nuclear ribonucleoprotein K						gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|positive regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045716)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of lipid transport by positive regulation of transcription from RNA polymerase II promoter (GO:0072369)|regulation of low-density lipoprotein particle clearance (GO:0010988)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|signal transduction (GO:0007165)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|single-stranded DNA binding (GO:0003697)			endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|skin(1)|stomach(1)	19						AGTTATTATATATCCTTGCAG	0.383																																							uc004ang.3		NA																	0				skin(1)	1						c.(-40--36)ATATA>ATGTA		heterogeneous nuclear ribonucleoprotein K																																						3190				interspecies interaction between organisms|positive regulation of low-density lipoprotein particle receptor biosynthetic process|positive regulation of receptor-mediated endocytosis|regulation of lipid transport by positive regulation of transcription from an RNA polymerase II promoter|regulation of low-density lipoprotein particle clearance|signal transduction	catalytic step 2 spliceosome|cytoplasm|heterogeneous nuclear ribonucleoprotein complex|nuclear chromatin|nucleoplasm	protein binding|RNA binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|single-stranded DNA binding	g.chr9:86593299T>C		CCDS6667.1, CCDS6668.1	9q21.32-q21.33	2011-10-24		2008-04-18	ENSG00000165119	ENSG00000165119			5044	protein-coding gene	gene with protein product	"""transformation upregulated nuclear protein"""	600712		HNRPK		8107114	Standard	NM_031263		Approved	CSBP, TUNP	uc004anf.4	P61978	OTTHUMG00000020107	ENST00000376264.2:c.-39A>G	9.37:g.86593299T>C			Somatic				HNRNPK_uc011lsw.1_5'Flank|HNRNPK_uc004and.3_5'Flank|HNRNPK_uc004ank.3_Translation_Start_Site|HNRNPK_uc004anf.3_Translation_Start_Site|HNRNPK_uc004anh.3_Translation_Start_Site|HNRNPK_uc011lsx.1_Translation_Start_Site|HNRNPK_uc004ani.3_Translation_Start_Site|HNRNPK_uc004anj.3_Translation_Start_Site|HNRNPK_uc004ann.3_Translation_Start_Site|HNRNPK_uc004anl.3_Translation_Start_Site|HNRNPK_uc004anm.3_Translation_Start_Site|RMI1_uc004anq.3_5'Flank|RMI1_uc004anr.3_5'Flank|RMI1_uc004anp.3_5'Flank		NM_031262	NP_112552	WXS	Illumina HiSeq	Unspecified	P61978	HNRPK_HUMAN			2	186	-								Q07244|Q15671|Q59F98|Q5T6W4|Q60577|Q922Y7|Q96J62	Translation_Start_Site	SNP	ENST00000376264.2	37	c.-38A>G	CCDS6667.1																																																																																				0.383	HNRNPK-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000052846.2			6	10	0	0	0	0.00308	0	6	10				
MURC	347273	broad.mit.edu	37	9	103348672	103348672	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr9:103348672A>T	ENST00000307584.5	+	2	1099	c.1034A>T	c.(1033-1035)aAa>aTa	p.K345I		NM_001018116.1	NP_001018126.1	Q5BKX8	MURC_HUMAN	muscle-related coiled-coil protein	345					cell differentiation (GO:0030154)|muscle organ development (GO:0007517)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	Z disc (GO:0030018)		p.K345I(1)		endometrium(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)	16		Acute lymphoblastic leukemia(62;0.0461)				GTTACTTTTAAATCTCAGGTG	0.423																																							uc004bba.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1033-1035)AAA>ATA		muscle-related coiled-coil protein							43.0	48.0	46.0					9																	103348672		2202	4299	6501	SO:0001583	missense	347273				cell differentiation|muscle organ development|transcription, DNA-dependent			g.chr9:103348672A>T	BC090888	CCDS35083.1	9q31.1	2014-09-17			ENSG00000170681	ENSG00000170681			33742	protein-coding gene	gene with protein product	"""muscle-restricted coiled-coil protein"""					18508909, 18332105	Standard	NM_001018116		Approved	cavin-4, CAVIN4	uc004bba.3	Q5BKX8	OTTHUMG00000020368	ENST00000307584.5:c.1034A>T	9.37:g.103348672A>T	ENSP00000418668:p.Lys345Ile		Somatic					p.K345I	NM_001018116	NP_001018126	WXS	Illumina HiSeq	Unspecified	Q5BKX8	MURC_HUMAN			2	1124	+		Acute lymphoblastic leukemia(62;0.0461)	345					B1PRL3|B4DT88	Missense_Mutation	SNP	ENST00000307584.5	37	c.1034A>T	CCDS35083.1	.	.	.	.	.	.	.	.	.	.	A	23.6	4.439756	0.83885	.	.	ENSG00000170681	ENST00000307584	T	0.68903	-0.36	5.28	5.28	0.74379	.	0.230034	0.30437	N	0.009630	T	0.68714	0.3031	L	0.27053	0.805	0.41303	D	0.987053	D	0.69078	0.997	P	0.61722	0.893	T	0.71517	-0.4569	10	0.51188	T	0.08	-31.0381	13.4493	0.61161	1.0:0.0:0.0:0.0	.	345	Q5BKX8	MURC_HUMAN	I	345	ENSP00000418668:K345I	ENSP00000418668:K345I	K	+	2	0	MURC	102388493	1.000000	0.71417	1.000000	0.80357	0.884000	0.51177	3.925000	0.56484	2.125000	0.65367	0.454000	0.30748	AAA		0.423	MURC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053419.2	NM_001018116		41	50	0	0	0	0.011902	0	41	50				
ALDOB	229	broad.mit.edu	37	9	104189921	104189921	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr9:104189921A>T	ENST00000374855.4	-	5	507	c.383T>A	c.(382-384)cTt>cAt	p.L128H	ALDOB_ENST00000468981.3_Intron	NM_000035.3	NP_000026.2	P05062	ALDOB_HUMAN	aldolase B, fructose-bisphosphate	128					carbohydrate metabolic process (GO:0005975)|fructose 1,6-bisphosphate metabolic process (GO:0030388)|fructose catabolic process (GO:0006001)|fructose metabolic process (GO:0006000)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|NADH oxidation (GO:0006116)|positive regulation of ATPase activity (GO:0032781)|small molecule metabolic process (GO:0044281)|vacuolar proton-transporting V-type ATPase complex assembly (GO:0070072)	centriolar satellite (GO:0034451)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule organizing center (GO:0005815)	ATPase binding (GO:0051117)|cytoskeletal protein binding (GO:0008092)|fructose binding (GO:0070061)|fructose-1-phosphate aldolase activity (GO:0061609)|fructose-bisphosphate aldolase activity (GO:0004332)|identical protein binding (GO:0042802)	p.L128H(1)		central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|liver(1)|lung(5)|prostate(2)|skin(4)|urinary_tract(1)	24		Acute lymphoblastic leukemia(62;0.0559)				GAGGCCATCAAGCCCTGCAAG	0.498																																							uc004bbk.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(382-384)CTT>CAT		aldolase B, fructose-bisphosphate							104.0	87.0	93.0					9																	104189921		2203	4300	6503	SO:0001583	missense	229				fructose 1,6-bisphosphate metabolic process|fructose catabolic process|gluconeogenesis|glycolysis|NADH oxidation|positive regulation of ATPase activity|vacuolar proton-transporting V-type ATPase complex assembly	centriolar satellite|cytosol	ATPase binding|cytoskeletal protein binding|fructose binding|fructose-bisphosphate aldolase activity|identical protein binding	g.chr9:104189921A>T	X01098	CCDS6756.1	9q21.3-q22.2	2008-02-05			ENSG00000136872	ENSG00000136872	4.1.2.13		417	protein-coding gene	gene with protein product		612724					Standard	NM_000035		Approved		uc004bbk.2	P05062	OTTHUMG00000020378	ENST00000374855.4:c.383T>A	9.37:g.104189921A>T	ENSP00000363988:p.Leu128His		Somatic					p.L128H	NM_000035	NP_000026	WXS	Illumina HiSeq	Unspecified	P05062	ALDOB_HUMAN			5	465	-		Acute lymphoblastic leukemia(62;0.0559)	128					Q13741|Q13742|Q5T7D6	Missense_Mutation	SNP	ENST00000374855.4	37	c.383T>A	CCDS6756.1	.	.	.	.	.	.	.	.	.	.	A	26.7	4.760765	0.89932	.	.	ENSG00000136872	ENST00000374855;ENST00000374853;ENST00000430164	D	0.93307	-3.2	6.17	6.17	0.99709	Aldolase-type TIM barrel (1);	0.000000	0.85682	D	0.000000	D	0.97476	0.9174	M	0.93106	3.38	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98030	1.0376	10	0.59425	D	0.04	-17.2447	16.0034	0.80327	1.0:0.0:0.0:0.0	.	128	P05062	ALDOB_HUMAN	H	128;55;128	ENSP00000363988:L128H	ENSP00000363986:L55H	L	-	2	0	ALDOB	103229742	1.000000	0.71417	0.973000	0.42090	0.994000	0.84299	9.339000	0.96797	2.371000	0.80710	0.533000	0.62120	CTT		0.498	ALDOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053434.2			12	54	0	0	0	0.00245	0	12	54				
OR13C2	392376	broad.mit.edu	37	9	107367202	107367202	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr9:107367202T>A	ENST00000542196.1	-	1	749	c.707A>T	c.(706-708)aAa>aTa	p.K236I		NM_001004481.1	NP_001004481.1	Q8NGS9	O13C2_HUMAN	olfactory receptor, family 13, subfamily C, member 2	236						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.K236I(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	22						AGAGGAAGCTTTGCTTCTCCC	0.393																																							uc011lvq.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(706-708)AAA>ATA		olfactory receptor, family 13, subfamily C,							105.0	100.0	102.0					9																	107367202		2201	4300	6501	SO:0001583	missense	392376				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr9:107367202T>A		CCDS35092.1	9q31.1	2012-10-03			ENSG00000257019	ENSG00000276119		"""GPCR / Class A : Olfactory receptors"""	14701	protein-coding gene	gene with protein product							Standard	NM_001004481		Approved		uc011lvq.2	Q8NGS9	OTTHUMG00000020415	ENST00000542196.1:c.707A>T	9.37:g.107367202T>A	ENSP00000438815:p.Lys236Ile		Somatic					p.K236I	NM_001004481	NP_001004481	WXS	Illumina HiSeq	Unspecified	Q8NGS9	O13C2_HUMAN			1	707	-			236			Cytoplasmic (Potential).		B9EGV8|Q6IF54	Missense_Mutation	SNP	ENST00000542196.1	37	c.707A>T	CCDS35092.1	.	.	.	.	.	.	.	.	.	.	T	14.12	2.441928	0.43326	.	.	ENSG00000257019	ENST00000542196	T	0.00377	7.69	3.41	3.41	0.39046	GPCR, rhodopsin-like superfamily (1);	0.000000	0.38164	U	0.001793	T	0.01976	0.0062	H	0.99545	4.62	0.28753	N	0.901345	D	0.89917	1.0	D	0.97110	1.0	T	0.11743	-1.0575	10	0.87932	D	0	.	9.8502	0.41053	0.0:0.0:0.0:1.0	.	236	Q8NGS9	O13C2_HUMAN	I	236	ENSP00000438815:K236I	ENSP00000438815:K236I	K	-	2	0	OR13C2	106407023	1.000000	0.71417	0.666000	0.29783	0.162000	0.22319	3.094000	0.50227	1.422000	0.47177	0.260000	0.18958	AAA		0.393	OR13C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053489.2	NM_001004481		31	55	0	0	0	0.013726	0	31	55				
ZNF483	158399	broad.mit.edu	37	9	114305028	114305028	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr9:114305028A>G	ENST00000309235.5	+	6	1971	c.1813A>G	c.(1813-1815)Aaa>Gaa	p.K605E	ZNF483_ENST00000358151.4_Intron	NM_133464.2	NP_597721.2	Q8TF39	ZN483_HUMAN	zinc finger protein 483	605					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.K605E(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(11)|lung(11)|ovary(1)|skin(5)	31						CACTGGAGAAAAACCATATTT	0.378																																							uc004bff.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(1813-1815)AAA>GAA		zinc finger protein 483 isoform a							58.0	61.0	60.0					9																	114305028		2203	4300	6503	SO:0001583	missense	158399				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr9:114305028A>G	AB075842	CCDS35105.1, CCDS35106.1	9q32	2013-01-09			ENSG00000173258	ENSG00000173258		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	23384	protein-coding gene	gene with protein product							Standard	NM_001007169		Approved	ZKSCAN16, KIAA1962, ZSCAN48	uc004bff.2	Q8TF39	OTTHUMG00000020490	ENST00000309235.5:c.1813A>G	9.37:g.114305028A>G	ENSP00000311679:p.Lys605Glu		Somatic				ZNF483_uc004bfg.2_Intron	p.K605E	NM_133464	NP_597721	WXS	Illumina HiSeq	Unspecified	Q8TF39	ZN483_HUMAN			6	2037	+			605					Q5VZN2|Q8NAE1	Missense_Mutation	SNP	ENST00000309235.5	37	c.1813A>G	CCDS35106.1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.221089	0.79464	.	.	ENSG00000173258	ENST00000309235	T	0.27104	1.69	3.84	3.84	0.44239	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.49916	D	0.000139	T	0.53384	0.1793	M	0.87097	2.86	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.61367	-0.7077	10	0.87932	D	0	-21.7113	11.2282	0.48897	1.0:0.0:0.0:0.0	.	605	Q8TF39	ZN483_HUMAN	E	605	ENSP00000311679:K605E	ENSP00000311679:K605E	K	+	1	0	ZNF483	113344849	0.897000	0.30589	0.997000	0.53966	0.923000	0.55619	5.954000	0.70298	1.972000	0.57404	0.533000	0.62120	AAA		0.378	ZNF483-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053641.1	XM_088567		22	31	0	0	0	0.014323	0	22	31				
ASTN2	23245	broad.mit.edu	37	9	119770520	119770520	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr9:119770520C>T	ENST00000313400.4	-	7	1542	c.1442G>A	c.(1441-1443)aGt>aAt	p.S481N	ASTN2_ENST00000373996.3_Missense_Mutation_p.S481N|ASTN2_ENST00000361209.2_Missense_Mutation_p.S430N|ASTN2_ENST00000361477.3_De_novo_Start_OutOfFrame			O75129	ASTN2_HUMAN	astrotactin 2	481					negative regulation of protein localization to cell surface (GO:2000009)	cell pole (GO:0060187)|endosome (GO:0005768)|integral component of membrane (GO:0016021)		p.S430N(1)		breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(21)|lung(45)|ovary(4)|pancreas(2)|prostate(2)|skin(9)|stomach(1)|urinary_tract(1)	102						GCTCCCTTCACTCACCACGAA	0.498																																							uc004bjs.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(4)|ovary(3)|breast(1)|kidney(1)	9						c.(1441-1443)AGT>AAT		astrotactin 2 isoform c							104.0	87.0	93.0					9																	119770520		2203	4300	6503	SO:0001583	missense	23245					integral to membrane		g.chr9:119770520C>T	AF116574	CCDS6814.1, CCDS6815.1, CCDS48009.1, CCDS48009.2, CCDS55334.1	9q33	2008-02-05			ENSG00000148219	ENSG00000148219			17021	protein-coding gene	gene with protein product		612856				9734811	Standard	NM_014010		Approved	KIAA0634	uc004bjt.2	O75129	OTTHUMG00000021013	ENST00000313400.4:c.1442G>A	9.37:g.119770520C>T	ENSP00000314038:p.Ser481Asn		Somatic				ASTN2_uc004bjr.1_Missense_Mutation_p.S481N|ASTN2_uc004bjt.1_Missense_Mutation_p.S430N	p.S481N	NM_198187	NP_937830	WXS	Illumina HiSeq	Unspecified	O75129	ASTN2_HUMAN			7	1543	-			481			Extracellular (Potential).		A2A2T7|A2A2T9|Q52LQ2|Q5JVX8|Q5JVX9|Q5JVY1|Q5VXG8|Q5VZX6|Q8N6P8|Q8WV47|Q96FL4|Q9UHW6	Missense_Mutation	SNP	ENST00000313400.4	37	c.1442G>A		.	.	.	.	.	.	.	.	.	.	C	13.47	2.246819	0.39697	.	.	ENSG00000148219	ENST00000313400;ENST00000373996;ENST00000373986;ENST00000361209	T;T;T;T	0.12672	2.84;2.84;2.66;2.86	5.56	5.56	0.83823	.	0.048541	0.85682	D	0.000000	T	0.21145	0.0509	N	0.19112	0.55	0.45704	D	0.998613	D;D;D	0.63880	0.993;0.958;0.978	P;P;P	0.59221	0.79;0.531;0.854	T	0.02983	-1.1086	9	.	.	.	-12.9717	19.5337	0.95240	0.0:1.0:0.0:0.0	.	430;481;481	O75129-2;O75129;O75129-3	.;ASTN2_HUMAN;.	N	481;481;208;430	ENSP00000314038:S481N;ENSP00000363108:S481N;ENSP00000363098:S208N;ENSP00000354504:S430N	.	S	-	2	0	ASTN2	118810341	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	5.911000	0.69939	2.602000	0.87976	0.655000	0.94253	AGT		0.498	ASTN2-201	KNOWN	basic	protein_coding	protein_coding		NM_014010		12	57	0	0	0	0.001855	0	12	57				
PRRC2B	84726	broad.mit.edu	37	9	134334625	134334625	+	Missense_Mutation	SNP	G	G	C	rs374463246		TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr9:134334625G>C	ENST00000357304.4	+	10	1341	c.1286G>C	c.(1285-1287)cGa>cCa	p.R429P	PRRC2B_ENST00000372249.1_5'UTR|PRRC2B_ENST00000405995.1_Missense_Mutation_p.R429P|PRRC2B_ENST00000458550.1_Missense_Mutation_p.R429P	NM_013318.3	NP_037450.2	Q5JSZ5	PRC2B_HUMAN	proline-rich coiled-coil 2B	429							poly(A) RNA binding (GO:0044822)	p.R429P(2)		cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(20)|ovary(2)	44						AAGCGGACTCGAGAGGAAGGG	0.592																																							uc004can.3		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(1285-1287)CGA>CCA		HLA-B associated transcript 2-like							95.0	106.0	102.0					9																	134334625		2191	4295	6486	SO:0001583	missense	84726						protein binding	g.chr9:134334625G>C	AB011087	CCDS48044.1	9q34.13	2010-12-09	2010-12-09	2010-12-09	ENSG00000130723	ENSG00000130723			28121	protein-coding gene	gene with protein product			"""KIAA0515"", ""HLA-B associated transcript 2-like"", ""HLA-B associated transcript 2-like 1"""	KIAA0515, BAT2L, BAT2L1		9628581	Standard	NM_013318		Approved	MGC10526, LQFBS-1	uc004can.4	Q5JSZ5	OTTHUMG00000020827	ENST00000357304.4:c.1286G>C	9.37:g.134334625G>C	ENSP00000349856:p.Arg429Pro		Somatic				BAT2L1_uc010mzj.1_Missense_Mutation_p.R13P	p.R429P	NM_013318	NP_037450	WXS	Illumina HiSeq	Unspecified	Q5JSZ5	PRC2B_HUMAN			10	1341	+			429					O60270|Q5JSZ7|Q66VZ2|Q68CR0|Q96EI9|Q9H683	Missense_Mutation	SNP	ENST00000357304.4	37	c.1286G>C	CCDS48044.1	.	.	.	.	.	.	.	.	.	.	A	10.82	1.457009	0.26161	.	.	ENSG00000130723	ENST00000405995;ENST00000357304;ENST00000458550	T;T;T	0.02446	4.29;4.63;4.29	5.62	4.43	0.53597	.	0.508693	0.14036	U	0.345765	T	0.01489	0.0048	N	0.08118	0	0.24232	N	0.995398	B	0.12013	0.005	B	0.06405	0.002	T	0.48340	-0.9044	10	0.21014	T	0.42	0.4387	1.5411	0.02555	0.5437:0.1271:0.0933:0.236	.	429	Q5JSZ5	PRC2B_HUMAN	P	429	ENSP00000384606:R429P;ENSP00000349856:R429P;ENSP00000398853:R429P	ENSP00000349856:R429P	R	+	2	0	PRRC2B	133324446	0.604000	0.26932	0.836000	0.33094	0.776000	0.43924	0.977000	0.29475	0.962000	0.38057	-0.332000	0.08345	CGA		0.592	PRRC2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				39	111	0	0	0	0.010771	0	39	111				
CEL	1056	broad.mit.edu	37	9	135947032	135947032	+	Missense_Mutation	SNP	C	C	A	rs201411101		TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr9:135947032C>A	ENST00000372080.4	+	11	2168	c.2152C>A	c.(2152-2154)Ccg>Acg	p.P718T	CEL_ENST00000351304.7_Missense_Mutation_p.P649T	NM_001807.3	NP_001798.2	P19835	CEL_HUMAN	carboxyl ester lipase	715	17 X 11 AA tandem repeats, glycodomain, O-linked (mucin type).				cholesterol catabolic process (GO:0006707)|fatty acid catabolic process (GO:0009062)|intestinal cholesterol absorption (GO:0030299)|intestinal lipid catabolic process (GO:0044258)|lipid digestion (GO:0044241)|lipid metabolic process (GO:0006629)|pancreatic juice secretion (GO:0030157)|protein esterification (GO:0018350)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	acylglycerol lipase activity (GO:0047372)|catalytic activity (GO:0003824)|heparin binding (GO:0008201)|hydrolase activity (GO:0016787)|sterol esterase activity (GO:0004771)|triglyceride lipase activity (GO:0004806)	p.P718T(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(9)|pancreas(2)|skin(1)	20				OV - Ovarian serous cystadenocarcinoma(145;1.03e-40)|Epithelial(140;3.58e-37)|GBM - Glioblastoma multiforme(294;0.00164)|READ - Rectum adenocarcinoma(205;0.196)		CGCCCCCGTGCCGCCCACGGG	0.766																																							uc010naa.1		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)	1						c.(2152-2154)CCG>ACG		carboxyl ester lipase precursor							7.0	9.0	8.0					9																	135947032		1666	3839	5505	SO:0001583	missense	1056				cholesterol catabolic process|fatty acid catabolic process|intestinal cholesterol absorption|intestinal lipid catabolic process|pancreatic juice secretion|protein esterification	cytosol|extracellular space	acylglycerol lipase activity|carboxylesterase activity|heparin binding|sterol esterase activity|triglyceride lipase activity	g.chr9:135947032C>A	M54994	CCDS43896.1	9q34.3	2013-03-13	2013-03-13		ENSG00000170835	ENSG00000170835	3.1.1.3, 3.1.1.13		1848	protein-coding gene	gene with protein product	"""bile salt-stimulated lipase"""	114840				1676983	Standard	NM_001807		Approved	BSSL, MODY8	uc010naa.2	P19835	OTTHUMG00000020855	ENST00000372080.4:c.2152C>A	9.37:g.135947032C>A	ENSP00000361151:p.Pro718Thr		Somatic					p.P718T	NM_001807	NP_001798	WXS	Illumina HiSeq	Unspecified	P19835	CEL_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;1.03e-40)|Epithelial(140;3.58e-37)|GBM - Glioblastoma multiforme(294;0.00164)|READ - Rectum adenocarcinoma(205;0.196)	11	2168	+			715			17 X 11 AA tandem repeats, glycodomain, O-linked (mucin type).|15.		Q16398|Q5T7U7|Q9UCH1|Q9UP41	Missense_Mutation	SNP	ENST00000372080.4	37	c.2152C>A	CCDS43896.1	.	.	.	.	.	.	.	.	.	.	c	9.217	1.032353	0.19590	.	.	ENSG00000170835	ENST00000372080;ENST00000351304;ENST00000303626	T;T	0.71341	-0.35;-0.56	2.24	1.28	0.21552	.	.	.	.	.	T	0.56031	0.1958	L	0.34521	1.04	0.09310	N	1	B	0.29862	0.259	B	0.23018	0.043	T	0.50294	-0.8845	9	0.87932	D	0	.	8.747	0.34591	0.0:0.7634:0.2366:0.0	.	715	P19835	CEL_HUMAN	T	718;649;684	ENSP00000361151:P718T;ENSP00000342217:P649T	ENSP00000304021:P684T	P	+	1	0	CEL	134936853	0.000000	0.05858	0.006000	0.13384	0.004000	0.04260	0.377000	0.20552	0.473000	0.27368	0.306000	0.20318	CCG		0.766	CEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054823.1			3	15	1	0	1.23904e-05	0.000602	1.36604e-05	3	15				
LCN9	392399	broad.mit.edu	37	9	138556120	138556120	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr9:138556120G>T	ENST00000277526.3	+	2	209	c.209G>T	c.(208-210)aGc>aTc	p.S70I	LCN9_ENST00000430290.2_3'UTR	NM_001001676.1	NP_001001676.1	Q8WX39	LCN9_HUMAN	lipocalin 9	70						extracellular region (GO:0005576)	pheromone binding (GO:0005550)|transporter activity (GO:0005215)	p.S70I(2)		kidney(1)|large_intestine(2)|lung(2)|urinary_tract(1)	6		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;3.43e-07)|Epithelial(140;1.97e-06)|all cancers(34;6.1e-05)		AAGAACGGCAGCCTAATATTT	0.473																																							uc004cgk.1		NA																	2	Substitution - Missense(2)		lung(2)	large_intestine(2)	2						c.(208-210)AGC>ATC		lipocalin 9							105.0	111.0	109.0					9																	138556120		2042	4201	6243	SO:0001583	missense	392399					extracellular region	pheromone binding|transporter activity	g.chr9:138556120G>T	AY301270	CCDS56593.1	9q34	2011-11-14			ENSG00000148386	ENSG00000148386		"""Lipocalins"""	17442	protein-coding gene	gene with protein product	"""MUP-like lipocalin"", ""epididymal-specific lipocalin-9"""	612903				15363845	Standard	NM_001001676		Approved		uc004cgk.2	Q8WX39	OTTHUMG00000020916	ENST00000277526.3:c.209G>T	9.37:g.138556120G>T	ENSP00000277526:p.Ser70Ile		Somatic					p.S70I	NM_001001676	NP_001001676	WXS	Illumina HiSeq	Unspecified	Q8WX39	LCN9_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;3.43e-07)|Epithelial(140;1.97e-06)|all cancers(34;6.1e-05)	2	209	+		Myeloproliferative disorder(178;0.0821)	70					C9J5F0|Q6JVE7	Missense_Mutation	SNP	ENST00000277526.3	37	c.209G>T	CCDS56593.1	.	.	.	.	.	.	.	.	.	.	G	13.22	2.172574	0.38315	.	.	ENSG00000148386	ENST00000277526	T	0.34072	1.38	3.08	-5.3	0.02738	Calycin-like (1);Lipocalin/cytosolic fatty-acid binding protein domain (1);Calycin (1);	1.574490	0.03982	N	0.293475	T	0.55955	0.1953	M	0.79805	2.47	0.09310	N	1	D	0.65815	0.995	D	0.66497	0.944	T	0.61486	-0.7053	10	0.87932	D	0	-6.5481	7.4319	0.27132	0.2077:0.5706:0.2216:0.0	.	70	Q8WX39	LCN9_HUMAN	I	70	ENSP00000277526:S70I	ENSP00000277526:S70I	S	+	2	0	LCN9	137695941	0.001000	0.12720	0.000000	0.03702	0.064000	0.16182	0.778000	0.26732	-1.228000	0.02568	0.462000	0.41574	AGC		0.473	LCN9-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410711.1	NM_001001676		63	97	1	0	4.66136e-34	0.01441	7.61356e-34	63	97				
TLR8	51311	broad.mit.edu	37	X	12938519	12938519	+	Nonsense_Mutation	SNP	C	C	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chrX:12938519C>T	ENST00000218032.6	+	2	1447	c.1360C>T	c.(1360-1362)Cga>Tga	p.R454*	TLR8_ENST00000311912.5_Nonsense_Mutation_p.R472*	NM_138636.4	NP_619542.1	Q9NR97	TLR8_HUMAN	toll-like receptor 8	454					cellular response to mechanical stimulus (GO:0071260)|defense response to virus (GO:0051607)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|immunoglobulin mediated immune response (GO:0016064)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|regulation of cytokine secretion (GO:0050707)|response to virus (GO:0009615)|toll-like receptor 8 signaling pathway (GO:0034158)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	endolysosome membrane (GO:0036020)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|drug binding (GO:0008144)|receptor activity (GO:0004872)|RNA binding (GO:0003723)|single-stranded RNA binding (GO:0003727)	p.R472*(1)		breast(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	50					Imiquimod(DB00724)	TATCCGGAAACGACGCTCAAC	0.388																																							uc004cve.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(4)|lung(2)|large_intestine(1)	7						c.(1360-1362)CGA>TGA		toll-like receptor 8 precursor							69.0	61.0	64.0					X																	12938519		2203	4300	6503	SO:0001587	stop_gained	51311				cellular response to mechanical stimulus|defense response to virus|I-kappaB kinase/NF-kappaB cascade|immunoglobulin mediated immune response|inflammatory response|innate immune response|positive regulation of innate immune response|positive regulation of interferon-alpha biosynthetic process|positive regulation of interferon-beta biosynthetic process|positive regulation of interferon-gamma biosynthetic process|positive regulation of interleukin-8 biosynthetic process	endosome membrane	DNA binding|double-stranded RNA binding|single-stranded RNA binding|transmembrane receptor activity	g.chrX:12938519C>T	AF246971	CCDS14152.1, CCDS14153.1	Xp22	2009-11-23			ENSG00000101916	ENSG00000101916		"""CD molecules"""	15632	protein-coding gene	gene with protein product		300366				11022119	Standard	NM_138636		Approved	CD288	uc004cve.3	Q9NR97	OTTHUMG00000021145	ENST00000218032.6:c.1360C>T	X.37:g.12938519C>T	ENSP00000218032:p.Arg454*		Somatic				TLR8_uc004cvd.2_Nonsense_Mutation_p.R472*	p.R454*	NM_138636	NP_619542	WXS	Illumina HiSeq	Unspecified	Q9NR97	TLR8_HUMAN			2	1428	+			454			Extracellular (Potential).		B3Y654|D1CS70|D1CS76|Q495P4|Q6UXL6|Q9NYG9	Nonsense_Mutation	SNP	ENST00000218032.6	37	c.1360C>T	CCDS14152.1	.	.	.	.	.	.	.	.	.	.	C	16.78	3.217249	0.58560	.	.	ENSG00000101916	ENST00000218032;ENST00000311912	.	.	.	5.04	3.24	0.37175	.	1.844770	0.03633	N	0.238189	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05351	T	0.99	.	3.4573	0.07521	0.2055:0.5749:0.0:0.2195	.	.	.	.	X	454;472	.	ENSP00000218032:R454X	R	+	1	2	TLR8	12848440	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-0.130000	0.10498	0.604000	0.29930	0.600000	0.82982	CGA		0.388	TLR8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055784.2	NM_016610		39	28	0	0	0	0.010771	0	39	28				
WAS	7454	broad.mit.edu	37	X	48546470	48546470	+	Silent	SNP	C	C	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chrX:48546470C>A	ENST00000376701.4	+	8	837	c.762C>A	c.(760-762)ccC>ccA	p.P254P	WAS_ENST00000483750.1_3'UTR	NM_000377.2	NP_000368.1	P42768	WASP_HUMAN	Wiskott-Aldrich syndrome	254					actin filament polymerization (GO:0030041)|actin filament-based movement (GO:0030048)|actin polymerization or depolymerization (GO:0008154)|blood coagulation (GO:0007596)|defense response (GO:0006952)|endosomal transport (GO:0016197)|epidermis development (GO:0008544)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|immune response (GO:0006955)|innate immune response (GO:0045087)|positive regulation of Arp2/3 complex-mediated actin nucleation (GO:2000601)|protein complex assembly (GO:0006461)|regulation of catalytic activity (GO:0050790)|T cell activation (GO:0042110)|T cell receptor signaling pathway (GO:0050852)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|vesicle membrane (GO:0012506)	identical protein binding (GO:0042802)|phospholipase binding (GO:0043274)|protein kinase binding (GO:0019901)|SH3 domain binding (GO:0017124)|small GTPase regulator activity (GO:0005083)	p.P254P(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)	28		all_lung(315;1.27e-10)				GGTGGGACCCCCAGAATGGAT	0.552			"""Mis, N, F, S"""			lymphoma																																	uc004dkm.3		NA		X-linked recessive		Wiskott-Aldrich syndrome	X	Xp11.23-p11.22	7454	Mis|N|F|S	Wiskott-Aldrich syndrome			L		lymphoma			1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(760-762)CCC>CCA		Wiskott-Aldrich syndrome protein							60.0	47.0	52.0					X																	48546470		2203	4300	6503	SO:0001819	synonymous_variant	7454	Wiskott-Aldrich_syndrome			blood coagulation|defense response|epidermis development|immune response|T cell receptor signaling pathway	actin cytoskeleton|cytosol	identical protein binding|small GTPase regulator activity	g.chrX:48546470C>A	AF115548	CCDS14303.1	Xp11.4-p11.21	2014-09-17	2012-07-12		ENSG00000015285	ENSG00000015285			12731	protein-coding gene	gene with protein product	"""eczema-thrombocytopenia"""	300392	"""thrombocytopenia 1 (X-linked)"", ""Wiskott-Aldrich syndrome (eczema-thrombocytopenia)"""	IMD2, THC		7795648	Standard	NM_000377		Approved	WASP	uc004dkm.4	P42768	OTTHUMG00000034483	ENST00000376701.4:c.762C>A	X.37:g.48546470C>A			Somatic					p.P254P	NM_000377	NP_000368	WXS	Illumina HiSeq	Unspecified	P42768	WASP_HUMAN			8	819	+		all_lung(315;1.27e-10)	254					Q9BU11|Q9UNJ9	Silent	SNP	ENST00000376701.4	37	c.762C>A	CCDS14303.1																																																																																				0.552	WAS-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083379.1	NM_000377		4	10	1	0	0.00909568	0.009096	0.0093939	4	10				
OGT	8473	broad.mit.edu	37	X	70774416	70774416	+	Silent	SNP	C	C	G			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chrX:70774416C>G	ENST00000373719.3	+	6	919	c.702C>G	c.(700-702)gtC>gtG	p.V234V	OGT_ENST00000373701.3_Silent_p.V224V	NM_181672.2|NM_181673.2	NP_858058.1|NP_858059.1	O15294	OGT1_HUMAN	O-linked N-acetylglucosamine (GlcNAc) transferase	234					apoptotic process (GO:0006915)|cellular response to retinoic acid (GO:0071300)|chromatin organization (GO:0006325)|circadian regulation of gene expression (GO:0032922)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|negative regulation of protein ubiquitination (GO:0031397)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of catalytic activity (GO:0043085)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of histone H3-K27 methylation (GO:0061087)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of proteolysis (GO:0045862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glycolytic process (GO:0006110)|regulation of insulin receptor signaling pathway (GO:0046626)|regulation of Rac protein signal transduction (GO:0035020)|response to insulin (GO:0032868)|response to nutrient (GO:0007584)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone acetyltransferase complex (GO:0000123)|microtubule organizing center (GO:0005815)|mitochondrion (GO:0005739)|MLL5-L complex (GO:0070688)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	acetylglucosaminyltransferase activity (GO:0008375)|enzyme activator activity (GO:0008047)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein N-acetylglucosaminyltransferase activity (GO:0016262)|protein O-GlcNAc transferase activity (GO:0097363)	p.V234V(1)|p.V224V(1)		breast(6)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(5)|liver(3)|lung(9)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Renal(35;0.156)					TAGGAAATGTCTTGAAAGAGG	0.358																																							uc004eaa.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(3)|kidney(1)|pancreas(1)	5						c.(700-702)GTC>GTG		O-linked GlcNAc transferase isoform 1							126.0	110.0	116.0					X																	70774416		2203	4300	6503	SO:0001819	synonymous_variant	8473				cellular response to retinoic acid|positive regulation of granulocyte differentiation|positive regulation of histone H3-K4 methylation|positive regulation of proteolysis|protein O-linked glycosylation|signal transduction	cytosol|MLL5-L complex	enzyme activator activity|protein binding|protein N-acetylglucosaminyltransferase activity	g.chrX:70774416C>G	U77413	CCDS14414.1, CCDS35502.1	Xq13	2013-07-24	2012-05-04		ENSG00000147162	ENSG00000147162	2.4.1.255	"""Tetratricopeptide (TTC) repeat domain containing"""	8127	protein-coding gene	gene with protein product	"""UDP-N-acetylglucosamine:polypeptide-N-acetylglucosaminyl transferase"""	300255	"""O-linked N-acetylglucosamine (GlcNAc) transferase (UDP-N-acetylglucosamine:polypeptide-N-acetylglucosaminyl transferase)"""			9083068	Standard	NM_181672		Approved	O-GLCNAC, HRNT1, MGC22921, FLJ23071	uc004eaa.2	O15294	OTTHUMG00000033316	ENST00000373719.3:c.702C>G	X.37:g.70774416C>G			Somatic				BCYRN1_uc011mpt.1_Intron|OGT_uc004eab.1_Silent_p.V224V|OGT_uc004eac.2_Silent_p.V95V|OGT_uc004ead.2_5'UTR	p.V234V	NM_181672	NP_858058	WXS	Illumina HiSeq	Unspecified	O15294	OGT1_HUMAN			6	919	+	Renal(35;0.156)		234			TPR 6.		Q7Z3K0|Q8WWM8|Q96CC1|Q9UG57	Silent	SNP	ENST00000373719.3	37	c.702C>G	CCDS14414.1	.	.	.	.	.	.	.	.	.	.	C	9.317	1.057047	0.19907	.	.	ENSG00000147162	ENST00000455587	.	.	.	4.74	0.847	0.18961	.	.	.	.	.	T	0.43366	0.1244	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.21655	-1.0239	4	.	.	.	-34.0702	2.6077	0.04882	0.122:0.4679:0.1179:0.2922	.	.	.	.	C	194	.	.	S	+	2	0	OGT	70691141	0.935000	0.31712	0.999000	0.59377	0.998000	0.95712	0.028000	0.13644	0.138000	0.18790	0.600000	0.82982	TCT		0.358	OGT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000081829.3	NM_003605, NM_181672		3	69	0	0	0	0.009096	0	3	69				
COL4A5	1287	broad.mit.edu	37	X	107814662	107814662	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chrX:107814662G>T	ENST00000361603.2	+	7	648	c.404G>T	c.(403-405)gGc>gTc	p.G135V	COL4A5_ENST00000328300.6_Missense_Mutation_p.G135V	NM_000495.4	NP_000486.1	P29400	CO4A5_HUMAN	collagen, type IV, alpha 5	135	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|neuromuscular junction (GO:0031594)	extracellular matrix structural constituent (GO:0005201)	p.G135V(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(32)|ovary(4)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	99						GGATTTCCAGGCAGTCCCGGT	0.373									Alport syndrome with Diffuse Leiomyomatosis																														uc004enz.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|central_nervous_system(1)	4						c.(403-405)GGC>GTC		type IV collagen alpha 5 isoform 2 precursor							150.0	155.0	153.0					X																	107814662		2203	4300	6503	SO:0001583	missense	1287	Alport_syndrome_with_Diffuse_Leiomyomatosis	Familial Cancer Database		axon guidance	collagen type IV	extracellular matrix structural constituent|protein binding	g.chrX:107814662G>T	M90464	CCDS14543.1, CCDS35366.1	Xq22	2014-09-17	2008-07-28		ENSG00000188153	ENSG00000188153		"""Collagens"""	2207	protein-coding gene	gene with protein product		303630	"""Alport syndrome"""	ASLN, ATS			Standard	NM_000495		Approved		uc004enz.2	P29400	OTTHUMG00000022182	ENST00000361603.2:c.404G>T	X.37:g.107814662G>T	ENSP00000354505:p.Gly135Val		Somatic				COL4A5_uc011mso.1_Missense_Mutation_p.G135V	p.G135V	NM_033380	NP_203699	WXS	Illumina HiSeq	Unspecified	P29400	CO4A5_HUMAN			7	606	+			135			Triple-helical region.		Q16006|Q16126|Q6LD84|Q7Z700|Q9NUB7	Missense_Mutation	SNP	ENST00000361603.2	37	c.404G>T	CCDS14543.1	.	.	.	.	.	.	.	.	.	.	G	18.04	3.534478	0.64972	.	.	ENSG00000188153	ENST00000328300;ENST00000361603;ENST00000508186	D;D	0.99637	-6.29;-6.29	6.13	6.13	0.99165	.	0.000000	0.85682	D	0.000000	D	0.99840	0.9927	H	0.98333	4.205	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96747	0.9551	10	0.87932	D	0	.	19.7251	0.96161	0.0:0.0:1.0:0.0	.	135;135	E7EVY4;P29400	.;CO4A5_HUMAN	V	135	ENSP00000331902:G135V;ENSP00000354505:G135V	ENSP00000331902:G135V	G	+	2	0	COL4A5	107701318	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.536000	0.90627	2.615000	0.88500	0.597000	0.82753	GGC		0.373	COL4A5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057880.2			64	33	1	0	3.39796e-24	0.01441	5.18512e-24	64	33				
ALG13	79868	broad.mit.edu	37	X	110988103	110988103	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chrX:110988103G>A	ENST00000394780.3	+	24	2915	c.2903G>A	c.(2902-2904)tGt>tAt	p.C968Y	ALG13_ENST00000470971.1_3'UTR|ALG13_ENST00000251943.4_Intron	NM_001099922.2|NM_001257231.1	NP_001093392.1|NP_001244160.1	Q9NP73	ALG13_HUMAN	ALG13, UDP-N-acetylglucosaminyltransferase subunit	968	Pro-rich.				cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|lipid glycosylation (GO:0030259)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)	carbohydrate binding (GO:0030246)|cysteine-type peptidase activity (GO:0008234)|N-acetylglucosaminyldiphosphodolichol N-acetylglucosaminyltransferase activity (GO:0004577)|poly(A) RNA binding (GO:0044822)	p.C968Y(1)		endometrium(2)|lung(10)|skin(1)	13						ccTTATTCCTGTGATCCAAGC	0.473																																							uc011msy.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)	1						c.(2902-2904)TGT>TAT		SubName: Full=Asparagine-linked glycosylation 13 homolog (S. cerevisiae);							77.0	61.0	66.0					X																	110988103		1568	3582	5150	SO:0001583	missense	79868				dolichol-linked oligosaccharide biosynthetic process|lipid glycosylation|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane	carbohydrate binding|N-acetylglucosaminyldiphosphodolichol N-acetylglucosaminyltransferase activity	g.chrX:110988103G>A	AF220051	CCDS14559.1, CCDS55477.1, CCDS59173.1, CCDS76011.1, CCDS76012.1, CCDS76013.1	Xq23	2014-02-24	2013-02-21	2006-11-07	ENSG00000101901	ENSG00000101901	2.4.1.141	"""Tudor domain containing"", ""OTU domain containing"""	30881	protein-coding gene	gene with protein product	"""tudor domain containing 13"", ""N-acetylglucosaminyldiphosphodolichol N-acetylglucosaminyltransferase"""	300776	"""glycosyltransferase 28 domain containing 1"", ""chromosome X open reading frame 45"", ""asparagine-linked glycosylation 13 homolog (S. cerevisiae)"""	GLT28D1, CXorf45		12477932	Standard	NM_018466		Approved	MDS031, YGL047W, FLJ23018, TDRD13	uc011msy.2	Q9NP73	OTTHUMG00000022209	ENST00000394780.3:c.2903G>A	X.37:g.110988103G>A	ENSP00000378260:p.Cys968Tyr		Somatic				ALG13_uc011msx.1_Intron|ALG13_uc011msz.1_Missense_Mutation_p.C890Y|ALG13_uc011mta.1_Intron|ALG13_uc011mtb.1_Intron	p.C968Y			WXS	Illumina HiSeq	Unspecified	Q9NP73	ALG13_HUMAN			24	2937	+			968			Pro-rich.		B1AKD6|B1AKM1|B2R5L5|B7Z6J0|B7Z804|B7Z847|B7Z9A8|B7ZAJ1|B7ZB57|Q17RC3|Q5JXY9|Q9H5U8	Missense_Mutation	SNP	ENST00000394780.3	37	c.2903G>A	CCDS55477.1	.	.	.	.	.	.	.	.	.	.	G	6.101	0.386968	0.11581	.	.	ENSG00000101901	ENST00000394780	T	0.21734	1.99	4.83	3.02	0.34903	.	0.265536	0.25146	N	0.032792	T	0.09949	0.0244	N	0.19112	0.55	0.80722	D	1	B;B	0.11235	0.004;0.002	B;B	0.13407	0.009;0.004	T	0.13818	-1.0495	10	0.02654	T	1	-1.8477	7.5124	0.27581	0.2221:0.0:0.7779:0.0	.	890;968	Q9NP73-3;Q9NP73	.;ALG13_HUMAN	Y	968	ENSP00000378260:C968Y	ENSP00000378260:C968Y	C	+	2	0	ALG13	110874759	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	0.826000	0.27407	1.125000	0.41998	0.600000	0.82982	TGT		0.473	ALG13-011	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000272895.1	NM_018466		10	4	0	0	0	0.013537	0	10	4				
TRPC5	7224	broad.mit.edu	37	X	111020010	111020010	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chrX:111020010G>T	ENST00000262839.2	-	11	3371	c.2453C>A	c.(2452-2454)cCa>cAa	p.P818Q		NM_012471.2	NP_036603.1	Q9UL62	TRPC5_HUMAN	transient receptor potential cation channel, subfamily C, member 5	818					axon guidance (GO:0007411)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|nervous system development (GO:0007399)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)	p.P818Q(1)		biliary_tract(1)|breast(4)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(38)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						ACTGGACCTTGGCATGGTTCT	0.498																																							uc004epl.1		NA																	1	Substitution - Missense(1)		lung(1)	urinary_tract(1)	1						c.(2452-2454)CCA>CAA		transient receptor potential cation channel,							142.0	131.0	135.0					X																	111020010		2203	4300	6503	SO:0001583	missense	7224				axon guidance	calcium channel complex|integral to plasma membrane	protein binding|store-operated calcium channel activity	g.chrX:111020010G>T	AF054568	CCDS14561.1	Xq23	2014-06-13			ENSG00000072315	ENSG00000072315		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12337	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 159"""	300334				10493832, 16382100	Standard	NM_012471		Approved	PPP1R159	uc004epl.1	Q9UL62	OTTHUMG00000022212	ENST00000262839.2:c.2453C>A	X.37:g.111020010G>T	ENSP00000262839:p.Pro818Gln		Somatic					p.P818Q	NM_012471	NP_036603	WXS	Illumina HiSeq	Unspecified	Q9UL62	TRPC5_HUMAN			11	3372	-			818			Cytoplasmic (Potential).		B2RP53|O75233|Q5JXY8|Q9Y514	Missense_Mutation	SNP	ENST00000262839.2	37	c.2453C>A	CCDS14561.1	.	.	.	.	.	.	.	.	.	.	G	11.67	1.708391	0.30322	.	.	ENSG00000072315	ENST00000262839	T	0.68331	-0.32	5.71	5.71	0.89125	.	0.256618	0.32258	N	0.006343	T	0.48589	0.1508	N	0.08118	0	0.34532	D	0.709287	B	0.23650	0.089	B	0.23150	0.044	T	0.53070	-0.8490	10	0.17369	T	0.5	-14.6775	18.8734	0.92325	0.0:0.0:1.0:0.0	.	818	Q9UL62	TRPC5_HUMAN	Q	818	ENSP00000262839:P818Q	ENSP00000262839:P818Q	P	-	2	0	TRPC5	110906666	1.000000	0.71417	0.999000	0.59377	0.933000	0.57130	5.988000	0.70579	2.404000	0.81709	0.600000	0.82982	CCA		0.498	TRPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057945.1	NM_012471		89	54	1	0	2.75442e-36	0.01441	4.56654e-36	89	54				
LHFPL1	340596	broad.mit.edu	37	X	111874652	111874652	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chrX:111874652G>T	ENST00000371968.3	-	4	898	c.659C>A	c.(658-660)cCt>cAt	p.P220H	LHFPL1_ENST00000478229.1_5'UTR|LHFPL1_ENST00000536453.1_Missense_Mutation_p.P187H	NM_178175.3	NP_835469.1	Q86WI0	LHPL1_HUMAN	lipoma HMGIC fusion partner-like 1	220						integral component of membrane (GO:0016021)		p.P220H(1)		breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)	13						CAAAGCTCAAGGTTTGAGGCA	0.463																																							uc004epq.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(658-660)CCT>CAT		lipoma HMGIC fusion partner-like 1 precursor							115.0	97.0	103.0					X																	111874652		2203	4300	6503	SO:0001583	missense	340596					integral to membrane		g.chrX:111874652G>T	AY217350	CCDS14562.1	Xq23	2008-02-05			ENSG00000182508	ENSG00000182508			6587	protein-coding gene	gene with protein product		300566				10329012	Standard	NM_178175		Approved		uc004epq.3	Q86WI0	OTTHUMG00000022214	ENST00000371968.3:c.659C>A	X.37:g.111874652G>T	ENSP00000361036:p.Pro220His		Somatic				LHFPL1_uc004epp.2_Missense_Mutation_p.P243H|LHFPL1_uc010nqa.2_RNA|LHFPL1_uc010nqb.2_Missense_Mutation_p.P187H	p.P220H	NM_178175	NP_835469	WXS	Illumina HiSeq	Unspecified	Q86WI0	LHPL1_HUMAN			4	992	-			220					A8K1N1|Q496M9|Q496N0|Q6UXU2	Missense_Mutation	SNP	ENST00000371968.3	37	c.659C>A	CCDS14562.1	.	.	.	.	.	.	.	.	.	.	g	16.40	3.113026	0.56398	.	.	ENSG00000182508	ENST00000371968;ENST00000536453	T;T	0.73681	-0.77;0.56	4.68	3.82	0.43975	.	0.156401	0.30695	N	0.009071	T	0.57080	0.2029	N	0.22421	0.69	0.26363	N	0.977015	B;B	0.28713	0.138;0.22	B;B	0.23150	0.044;0.018	T	0.54456	-0.8291	10	0.87932	D	0	-22.0588	7.7408	0.28841	0.1158:0.0:0.8842:0.0	.	187;220	Q86WI0-2;Q86WI0	.;LHPL1_HUMAN	H	220;187	ENSP00000361036:P220H;ENSP00000444573:P187H	ENSP00000361036:P220H	P	-	2	0	LHFPL1	111761308	1.000000	0.71417	0.996000	0.52242	0.989000	0.77384	2.138000	0.42140	0.974000	0.38366	0.597000	0.82753	CCT		0.463	LHFPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057947.1	NM_178175		40	38	1	0	1.41504e-22	0.011902	2.12255e-22	40	38				
ZSWIM5	57643	broad.mit.edu	37	1	45508890	45508890	+	Splice_Site	DEL	C	C	-			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr1:45508890delC	ENST00000359600.5	-	6	1815		c.e6+1			NM_020883.1	NP_065934.1	Q9P217	ZSWM5_HUMAN	zinc finger, SWIM-type containing 5							extracellular space (GO:0005615)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(2)|liver(1)|lung(13)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	28	Acute lymphoblastic leukemia(166;0.155)					GCTAGACTTACCAAGCCACAG	0.478																																							uc001cnd.2		NA																	0					0						c.e6+1		zinc finger, SWIM domain containing 5							90.0	93.0	92.0					1																	45508890		1911	4132	6043	SO:0001630	splice_region_variant	57643						zinc ion binding	g.chr1:45508890delC	AB040944	CCDS41319.1	1p34.1	2010-06-16			ENSG00000162415	ENSG00000162415		"""Zinc fingers, SWIM-type"""	29299	protein-coding gene	gene with protein product						10819331	Standard	NM_020883		Approved	KIAA1511	uc001cnd.2	Q9P217	OTTHUMG00000008950	ENST00000359600.5:c.1609+1G>-	1.37:g.45508890delC			Somatic					p.E537_splice	NM_020883	NP_065934	WXS	Illumina HiSeq	Unspecified	Q9P217	ZSWM5_HUMAN			6	1837	-	Acute lymphoblastic leukemia(166;0.155)							Q5SXQ9	Splice_Site	DEL	ENST00000359600.5	37	c.1609_splice	CCDS41319.1																																																																																				0.478	ZSWIM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024823.2	XM_046581	Intron	39	108	NA	NA	NA	NA	NA	39	108	---	---	---	---
BCL9	607	broad.mit.edu	37	1	147091501	147091501	+	Frame_Shift_Del	DEL	C	C	-			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr1:147091501delC	ENST00000234739.3	+	8	2280	c.1540delC	c.(1540-1542)cccfs	p.P517fs		NM_004326.2	NP_004317.2	O00512	BCL9_HUMAN	B-cell CLL/lymphoma 9	517	Poly-Pro.|Pro-rich.				canonical Wnt signaling pathway (GO:0060070)|myotube differentiation involved in skeletal muscle regeneration (GO:0014908)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell maintenance (GO:0035019)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)				breast(1)|large_intestine(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	7	all_hematologic(923;0.115)					GGTCCGAGGACCCCCCCCTCC	0.582			T	"""IGH@, IGL@"""	B-ALL																																		uc001epq.2		NA		Dom	yes		1	1q21	607	T	B-cell CLL/lymphoma 9			L	IGH@|IGL@		B-ALL		0				ovary(2)|large_intestine(2)|breast(1)|skin(1)	6						c.(1540-1542)CCCfs		B-cell CLL/lymphoma 9				35,42,4183		0,0,35,4,34,2057	60.0	70.0	66.0			3.6	1.0	1		67	38,97,8115		0,0,38,24,49,4014	no	codingComplex	BCL9	NM_004326.2		0,0,73,28,83,6071	A1A1,A1A2,A1R,A2A2,A2R,RR		1.6364,1.8075,1.6946			147091501	73,139,12298	2203	4300	6503	SO:0001589	frameshift_variant	607				Wnt receptor signaling pathway	nucleus	protein binding	g.chr1:147091501delC	Y13620	CCDS30833.1	1q21	2008-02-05			ENSG00000116128	ENSG00000116128			1008	protein-coding gene	gene with protein product		602597				9490669	Standard	NM_004326		Approved		uc001epq.3	O00512	OTTHUMG00000014031	ENST00000234739.3:c.1540delC	1.37:g.147091501delC	ENSP00000234739:p.Pro517fs		Somatic				BCL9_uc010ozr.1_Frame_Shift_Del_p.P440fs	p.P514fs	NM_004326	NP_004317	WXS	Illumina HiSeq	Unspecified	O00512	BCL9_HUMAN			8	2280	+	all_hematologic(923;0.115)		514			Poly-Pro.|Pro-rich.		Q5T489	Frame_Shift_Del	DEL	ENST00000234739.3	37	c.1540delC	CCDS30833.1																																																																																				0.582	BCL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039468.1	NM_004326		7	467	NA	NA	NA	NA	NA	7	467	---	---	---	---
OBSCN	84033	broad.mit.edu	37	1	228558786	228558786	+	Frame_Shift_Del	DEL	C	C	-			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr1:228558786delC	ENST00000422127.1	+	94	20351	c.20307delC	c.(20305-20307)ggcfs	p.G6769fs	OBSCN_ENST00000570156.2_Frame_Shift_Del_p.G7726fs|OBSCN_ENST00000366707.4_Frame_Shift_Del_p.G4403fs	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	6769					apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				TGCTGCGGGGCCCACCCGACA	0.662																																							uc009xez.1		NA																	0				stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28						c.(20305-20307)GGCfs		obscurin, cytoskeletal calmodulin and							35.0	41.0	39.0					1																	228558786		2078	4204	6282	SO:0001589	frameshift_variant	84033				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding	g.chr1:228558786delC	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.20307delC	1.37:g.228558786delC	ENSP00000409493:p.Gly6769fs		Somatic				OBSCN_uc001hsr.1_Frame_Shift_Del_p.G1398fs	p.G6769fs	NM_001098623	NP_001092093	WXS	Illumina HiSeq	Unspecified	Q5VST9	OBSCN_HUMAN			94	20351	+		Prostate(94;0.0405)	6769					Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Frame_Shift_Del	DEL	ENST00000422127.1	37	c.20307delC	CCDS58065.1																																																																																				0.662	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843		60	55	NA	NA	NA	NA	NA	60	55	---	---	---	---
PBLD	64081	broad.mit.edu	37	10	70048359	70048375	+	Frame_Shift_Del	DEL	CCTGTGTTTTCAACTTG	CCTGTGTTTTCAACTTG	-	rs201518214		TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	CCTGTGTTTTCAACTTG	CCTGTGTTTTCAACTTG	-	-	CCTGTGTTTTCAACTTG	CCTGTGTTTTCAACTTG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr10:70048359_70048375delCCTGTGTTTTCAACTTG	ENST00000358769.2	-	8	758_774	c.556_572delCAAGTTGAAAACACAGG	c.(556-573)caagttgaaaacacagggfs	p.QVENTG186fs	PBLD_ENST00000309049.4_Frame_Shift_Del_p.QVENTG186fs|PBLD_ENST00000336578.1_Frame_Shift_Del_p.QVENTG153fs|PBLD_ENST00000495025.2_Frame_Shift_Del_p.QVENTG186fs|PBLD_ENST00000432941.1_Frame_Shift_Del_p.QVENTG186fs	NM_022129.3	NP_071412.2	P30039	PBLD_HUMAN	phenazine biosynthesis-like protein domain containing	186					biosynthetic process (GO:0009058)|maintenance of gastrointestinal epithelium (GO:0030277)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of SMAD protein import into nucleus (GO:0060392)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	isomerase activity (GO:0016853)	p.G191V(1)		endometrium(4)|kidney(2)|large_intestine(2)|liver(1)|lung(8)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	21						TTTCACCTTCCCTGTGTTTTCAACTTGCAGCAGATTC	0.461																																							uc001jns.1		NA																	1	Substitution - Missense(1)		liver(1)	skin(2)|ovary(1)	3						c.(556-573)CAAGTTGAAAACACAGGGfs		MAWD binding protein isoform a																																				SO:0001589	frameshift_variant	64081				biosynthetic process		isomerase activity	g.chr10:70048359_70048375delCCTGTGTTTTCAACTTG	AK027673	CCDS7277.2, CCDS44413.1	10q21.3	2006-11-27			ENSG00000108187	ENSG00000108187			23301	protein-coding gene	gene with protein product	MAWD binding protein	612189				11355021	Standard	XM_005270028		Approved	MAWBP, MAWDBP, FLJ14767	uc001jns.1	P30039	OTTHUMG00000073949	ENST00000358769.2:c.556_572delCAAGTTGAAAACACAGG	10.37:g.70048359_70048375delCCTGTGTTTTCAACTTG	ENSP00000351619:p.Gln186fs		Somatic				PBLD_uc001jnr.1_Frame_Shift_Del_p.Q153fs|PBLD_uc001jnt.1_Frame_Shift_Del_p.Q186fs|PBLD_uc001jnu.1_Frame_Shift_Del_p.Q186fs|PBLD_uc001jnv.1_3'UTR	p.Q186fs	NM_022129	NP_071412	WXS	Illumina HiSeq	Unspecified	P30039	PBLD_HUMAN			8	759_775	-			186_191					A8MZJ3|C9JIM0|Q9HCC2	Frame_Shift_Del	DEL	ENST00000358769.2	37	c.556_572delCAAGTTGAAAACACAGG	CCDS7277.2																																																																																				0.461	PBLD-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048314.1	NM_022129		15	152	NA	NA	NA	NA	NA	15	152	---	---	---	---
RPH3A	22895	broad.mit.edu	37	12	113303262	113303262	+	Frame_Shift_Del	DEL	G	G	-			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr12:113303262delG	ENST00000389385.4	+	6	771	c.274delG	c.(274-276)ggafs	p.G92fs	RPH3A_ENST00000548866.1_Frame_Shift_Del_p.G43fs|RPH3A_ENST00000543106.2_Frame_Shift_Del_p.G92fs|RPH3A_ENST00000447659.2_Frame_Shift_Del_p.G43fs|RPH3A_ENST00000551052.1_Frame_Shift_Del_p.G88fs|RPH3A_ENST00000415485.3_Frame_Shift_Del_p.G92fs|RPH3A_ENST00000420983.2_Frame_Shift_Del_p.G92fs	NM_001143854.1|NM_014954.3	NP_001137326.1|NP_055769.2	Q9Y2J0	RP3A_HUMAN	rabphilin 3A	92	RabBD. {ECO:0000255|PROSITE- ProRule:PRU00234}.				intracellular protein transport (GO:0006886)	cell junction (GO:0030054)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phosphatidylinositol phosphate binding (GO:1901981)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(16)|ovary(3)|prostate(4)|skin(6)|urinary_tract(1)	47				BRCA - Breast invasive adenocarcinoma(302;0.00453)		GAACGTGGCTGGAGATGGGGT	0.532																																							uc010syl.1		NA																	0		p.N92N(1)		ovary(3)|central_nervous_system(2)|skin(2)	7						c.(274-276)GGAfs		rabphilin 3A homolog isoform 1							208.0	181.0	190.0					12																	113303262		2203	4300	6503	SO:0001589	frameshift_variant	22895				intracellular protein transport	cell junction|synaptic vesicle	Rab GTPase binding|transporter activity|zinc ion binding	g.chr12:113303262delG	AB023202	CCDS31904.1, CCDS44979.1	12q24.13	2014-07-02	2014-07-02		ENSG00000089169	ENSG00000089169		"""Synaptotagmins"""	17056	protein-coding gene	gene with protein product		612159	"""rabphilin 3A homolog (mouse)"""			10231032, 7822236	Standard	NM_014954		Approved	KIAA0985, rabphilin, exophilin-1	uc001ttz.3	Q9Y2J0	OTTHUMG00000169713	ENST00000389385.4:c.274delG	12.37:g.113303262delG	ENSP00000374036:p.Gly92fs		Somatic				RPH3A_uc001ttz.2_Frame_Shift_Del_p.G92fs|RPH3A_uc001tty.2_Frame_Shift_Del_p.G88fs|RPH3A_uc009zwe.1_Frame_Shift_Del_p.G88fs|RPH3A_uc010sym.1_Frame_Shift_Del_p.G43fs|RPH3A_uc001tua.2_5'Flank	p.G92fs	NM_001143854	NP_001137326	WXS	Illumina HiSeq	Unspecified	Q9Y2J0	RP3A_HUMAN		BRCA - Breast invasive adenocarcinoma(302;0.00453)	6	636	+			92			RabBD.|FYVE-type.		B7Z3C3|Q96AE0	Frame_Shift_Del	DEL	ENST00000389385.4	37	c.274delG	CCDS44979.1																																																																																				0.532	RPH3A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405561.1	NM_014954		70	167	NA	NA	NA	NA	NA	70	167	---	---	---	---
KRTAP1-1	81851	broad.mit.edu	37	17	39197262	39197262	+	Frame_Shift_Del	DEL	G	G	-			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr17:39197262delG	ENST00000306271.4	-	1	451	c.388delC	c.(388-390)ctgfs	p.L130fs		NM_030967.2	NP_112229.1	Q07627	KRA11_HUMAN	keratin associated protein 1-1	130						keratin filament (GO:0045095)				NS(2)|endometrium(2)|kidney(5)|lung(4)|prostate(1)	14		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			CAGGGGGGCAGGCAGGTACCC	0.667																																							uc002hvw.1		NA																	0					0						c.(388-390)CTGfs		keratin associated protein 1-1							23.0	28.0	26.0					17																	39197262		2064	4175	6239	SO:0001589	frameshift_variant	81851					extracellular region|keratin filament		g.chr17:39197262delG	AJ406926	CCDS42324.1	17q21.2	2014-06-05			ENSG00000188581	ENSG00000188581		"""Keratin associated proteins"""	16772	protein-coding gene	gene with protein product		608819				11279113	Standard	NM_030967		Approved	KAP1.1B, HB2A, KAP1.1, KAP1.1A	uc002hvw.1	Q07627	OTTHUMG00000133592	ENST00000306271.4:c.388delC	17.37:g.39197262delG	ENSP00000305975:p.Leu130fs		Somatic					p.L130fs	NM_030967	NP_112229	WXS	Illumina HiSeq	Unspecified	Q07627	KRA11_HUMAN	STAD - Stomach adenocarcinoma(17;0.000371)		1	452	-		Breast(137;0.000496)	130					A6NC32|Q96S60|Q96S67	Frame_Shift_Del	DEL	ENST00000306271.4	37	c.388delC	CCDS42324.1																																																																																				0.667	KRTAP1-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257696.1	NM_030967		8	74	NA	NA	NA	NA	NA	8	74	---	---	---	---
RUNDC1	146923	broad.mit.edu	37	17	41143406	41143406	+	Frame_Shift_Del	DEL	G	G	-			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr17:41143406delG	ENST00000361677.1	+	5	1527	c.1515delG	c.(1513-1515)acgfs	p.T505fs		NM_173079.2	NP_775102	Q96C34	RUND1_HUMAN	RUN domain containing 1	505	RUN. {ECO:0000255|PROSITE- ProRule:PRU00178}.									breast(1)|large_intestine(2)|lung(4)|prostate(1)	8		Breast(137;0.00499)		BRCA - Breast invasive adenocarcinoma(366;0.161)		TTCCTGTTACGGGAGGCACTG	0.542																																							uc002ici.1		NA																	0					0						c.(1513-1515)ACGfs		RUN domain containing 1							67.0	66.0	66.0					17																	41143406		2203	4300	6503	SO:0001589	frameshift_variant	146923							g.chr17:41143406delG	AL831813	CCDS11448.1	17q21.31	2004-02-27				ENSG00000198863			25418	protein-coding gene	gene with protein product						12477932	Standard	NM_173079		Approved	DKFZp761H0421	uc002ici.1	Q96C34		ENST00000361677.1:c.1515delG	17.37:g.41143406delG	ENSP00000354622:p.Thr505fs		Somatic				RUNDC1_uc010whi.1_Frame_Shift_Del_p.T275fs	p.T505fs	NM_173079	NP_775102	WXS	Illumina HiSeq	Unspecified	Q96C34	RUND1_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.161)	5	1527	+		Breast(137;0.00499)	505			RUN.		Q6Y2K8|Q8IXT9|Q8N3W1	Frame_Shift_Del	DEL	ENST00000361677.1	37	c.1515delG	CCDS11448.1																																																																																				0.542	RUNDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452464.1	NM_173079		72	91	NA	NA	NA	NA	NA	72	91	---	---	---	---
COL5A3	50509	broad.mit.edu	37	19	10080331	10080332	+	Frame_Shift_Ins	INS	-	-	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr19:10080331_10080332insT	ENST00000264828.3	-	56	4102_4103	c.4017_4018insA	c.(4015-4020)ccagggfs	p.G1340fs		NM_015719.3	NP_056534.2	P25940	CO5A3_HUMAN	collagen, type V, alpha 3	1340	Triple-helical region.				axon guidance (GO:0007411)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)			NS(2)|breast(3)|central_nervous_system(2)|endometrium(11)|kidney(23)|large_intestine(12)|liver(2)|lung(35)|ovary(8)|prostate(5)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	116			Epithelial(33;7.11e-05)			CCCGTCCTCCCTGGGGGCCCAT	0.673																																							uc002mmq.1		NA																	0				ovary(7)|lung(1)|central_nervous_system(1)|skin(1)	10						c.(4015-4020)CCAGGGfs		collagen, type V, alpha 3 preproprotein																																				SO:0001589	frameshift_variant	50509				collagen fibril organization|skin development	collagen type V	collagen binding|extracellular matrix structural constituent	g.chr19:10080331_10080332insT	AF177941	CCDS12222.1	19p13.2	2013-01-16			ENSG00000080573	ENSG00000080573		"""Collagens"""	14864	protein-coding gene	gene with protein product		120216				10722718	Standard	NM_015719		Approved		uc002mmq.1	P25940	OTTHUMG00000150019	ENST00000264828.3:c.4018dupA	19.37:g.10080332_10080332dupT	ENSP00000264828:p.Gly1340fs		Somatic					p.P1339fs	NM_015719	NP_056534	WXS	Illumina HiSeq	Unspecified	P25940	CO5A3_HUMAN	Epithelial(33;7.11e-05)		56	4103_4104	-			1339_1340			Triple-helical region.		Q9NZQ6	Frame_Shift_Ins	INS	ENST00000264828.3	37	c.4017_4018insA	CCDS12222.1																																																																																				0.673	COL5A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315788.1	NM_015719		12	36	NA	NA	NA	NA	NA	12	36	---	---	---	---
ZNF536	9745	broad.mit.edu	37	19	30935349	30935350	+	Frame_Shift_Ins	INS	-	-	T			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr19:30935349_30935350insT	ENST00000355537.3	+	2	1027_1028	c.880_881insT	c.(880-882)cgcfs	p.R294fs		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	294					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					CCGCCACATCCGCATCTTGCAC	0.644																																							uc002nsu.1		NA																	0				ovary(7)|large_intestine(2)|skin(2)	11						c.(880-882)CGCfs		zinc finger protein 536																																				SO:0001589	frameshift_variant	9745				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding	g.chr19:30935349_30935350insT		CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		Exception_encountered	19.37:g.30935349_30935350insT	ENSP00000347730:p.Arg294fs		Somatic				ZNF536_uc010edd.1_Frame_Shift_Ins_p.R294fs	p.R294fs	NM_014717	NP_055532	WXS	Illumina HiSeq	Unspecified	O15090	ZN536_HUMAN			2	1018_1019	+	Esophageal squamous(110;0.0834)		294			C2H2-type 3.		A2RU18	Frame_Shift_Ins	INS	ENST00000355537.3	37	c.880_881insT	CCDS32984.1																																																																																				0.644	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459667.2	NM_014717		68	183	NA	NA	NA	NA	NA	68	183	---	---	---	---
PSG8	440533	broad.mit.edu	37	19	43348706	43348706	+	Intron	DEL	G	G	-			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr19:43348706delG	ENST00000401467.2	-	1	136				PSG10P_ENST00000597171.1_RNA			Q9UQ74	PSG8_HUMAN	pregnancy specific beta-1-glycoprotein 8							extracellular region (GO:0005576)				breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(19)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	40		Prostate(69;0.00899)				GACAAGTAAAGGTTTTGTCCT	0.458																																							uc002oux.1		NA																	0				ovary(2)	2						c.(1090-1092)CTTfs		pregnancy specific beta-1-glycoprotein 1																																				SO:0001627	intron_variant	5669				female pregnancy	extracellular region		g.chr19:43348706delG	M74106	CCDS33037.1, CCDS46090.1, CCDS46091.1	19q13.2	2013-01-29			ENSG00000124467	ENSG00000124467		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9525	protein-coding gene	gene with protein product		176397				1672663, 1572651	Standard	NM_182707		Approved		uc002ouo.2	Q9UQ74	OTTHUMG00000151118	ENST00000401467.2:c.64+11001C>-	19.37:g.43348706delG			Somatic				PSG3_uc002ouf.2_Intron|PSG1_uc002oug.1_Intron|PSG11_uc002ouw.2_Intron|PSG7_uc002ous.1_Intron|PSG7_uc002out.1_Intron|PSG10_uc002ouv.1_Intron|PSG8_uc002ouj.3_Intron|PSG8_uc002ouk.3_Intron|PSG8_uc002oul.3_Intron|PSG8_uc002oum.3_Intron|PSG1_uc002oun.2_RNA|PSG8_uc002oup.3_Intron|PSG10_uc010eip.2_RNA|PSG1_uc002our.1_Intron|PSG1_uc010eio.1_Intron|PSG1_uc002ouy.1_Frame_Shift_Del_p.L342fs	p.L364fs	NM_006905	NP_008836	WXS	Illumina HiSeq	Unspecified	P11464	PSG1_HUMAN			5	1239	-		Prostate(69;0.00682)	350			Ig-like C2-type 3.		A5PKV3|B2RPL4|B4DTI6|O60410|Q68CR6	Frame_Shift_Del	DEL	ENST00000401467.2	37	c.1090delC																																																																																					0.458	PSG8-009	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000464525.1			96	212	NA	NA	NA	NA	NA	96	212	---	---	---	---
FRK	2444	broad.mit.edu	37	6	116289825	116289827	+	In_Frame_Del	DEL	TTC	TTC	-			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	TTC	TTC	-	-	TTC	TTC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr6:116289825_116289827delTTC	ENST00000606080.1	-	3	988_990	c.542_544delGAA	c.(541-546)agaatc>atc	p.R181del	FRK_ENST00000538210.1_In_Frame_Del_p.R39del	NM_002031.2	NP_002022.1	P42685	FRK_HUMAN	fyn-related Src family tyrosine kinase	181	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				cell differentiation (GO:0030154)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)			breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|ovary(3)|pancreas(1)|skin(1)|urinary_tract(1)	27		all_cancers(87;0.00559)|all_epithelial(87;0.00738)|Colorectal(196;0.0465)		all cancers(137;0.0128)|OV - Ovarian serous cystadenocarcinoma(136;0.0209)|GBM - Glioblastoma multiforme(226;0.0459)|Epithelial(106;0.0625)	Regorafenib(DB08896)	GTTGAAAAGATTCTTCTTCGCGT	0.409																																							uc003pwi.1		NA																	0				ovary(3)|lung(3)	6						c.(541-546)AGAATC>ATC		fyn-related kinase																																				SO:0001651	inframe_deletion	2444				negative regulation of cell proliferation	cytoplasm|nucleus	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding	g.chr6:116289825_116289827delTTC	U00803	CCDS5103.1	6q21-q22.3	2014-06-25	2014-06-25		ENSG00000111816	ENSG00000111816	2.7.10.1	"""SH2 domain containing"""	3955	protein-coding gene	gene with protein product		606573	"""PTK5 protein tyrosine kinase 5"", ""fyn-related kinase"""	PTK5		7510261	Standard	NM_002031		Approved	RAK, GTK	uc003pwi.1	P42685	OTTHUMG00000015424	ENST00000606080.1:c.542_544delGAA	6.37:g.116289831_116289833delTTC	ENSP00000476145:p.Arg181del		Somatic					p.R181del	NM_002031	NP_002022	WXS	Illumina HiSeq	Unspecified	P42685	FRK_HUMAN		all cancers(137;0.0128)|OV - Ovarian serous cystadenocarcinoma(136;0.0209)|GBM - Glioblastoma multiforme(226;0.0459)|Epithelial(106;0.0625)	3	989_991	-		all_cancers(87;0.00559)|all_epithelial(87;0.00738)|Colorectal(196;0.0465)	181			SH2.		B4DY49|Q13128|Q9NTR5	In_Frame_Del	DEL	ENST00000606080.1	37	c.542_544delGAA	CCDS5103.1																																																																																				0.409	FRK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041924.2	NM_002031		22	148	NA	NA	NA	NA	NA	22	148	---	---	---	---
SHPRH	257218	broad.mit.edu	37	6	146276182	146276182	+	Frame_Shift_Del	DEL	A	A	-	rs570913343		TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr6:146276182delA	ENST00000367505.2	-	2	541	c.277delT	c.(277-279)tccfs	p.S93fs	SHPRH_ENST00000275233.7_Frame_Shift_Del_p.S93fs|SHPRH_ENST00000367503.3_Frame_Shift_Del_p.S93fs|SHPRH_ENST00000438092.2_Frame_Shift_Del_p.S93fs			Q149N8	SHPRH_HUMAN	SNF2 histone linker PHD RING helicase, E3 ubiquitin protein ligase	93					DNA repair (GO:0006281)|nucleosome assembly (GO:0006334)|protein polyubiquitination (GO:0000209)	nucleosome (GO:0000786)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(33)|ovary(3)|pancreas(2)|prostate(7)|skin(1)|urinary_tract(1)	79		Ovarian(120;0.0365)		OV - Ovarian serous cystadenocarcinoma(155;1.47e-07)|GBM - Glioblastoma multiforme(68;0.0124)		GACAAAGGGGAAAAAATACCA	0.363																																							uc003qlf.2		NA																	0				ovary(1)|kidney(1)|central_nervous_system(1)	3						c.(277-279)TCCfs		SNF2 histone linker PHD RING helicase isoform a							115.0	107.0	110.0					6																	146276182		1814	4075	5889	SO:0001589	frameshift_variant	257218				DNA repair|nucleosome assembly	nucleosome|nucleus	ATP binding|DNA binding|helicase activity|ligase activity|zinc ion binding	g.chr6:146276182delA	AB095943	CCDS43513.1, CCDS47496.1, CCDS43513.2	6q24.2	2012-02-23	2012-02-23		ENSG00000146414	ENSG00000146414		"""RING-type (C3HC4) zinc fingers"""	19336	protein-coding gene	gene with protein product		608048	"""SNF2 histone linker PHD RING helicase"""			12837266	Standard	NM_001042683		Approved	FLJ90837, KIAA2023, bA545I5.2	uc003qlf.3	Q149N8	OTTHUMG00000015750	ENST00000367505.2:c.277delT	6.37:g.146276182delA	ENSP00000356475:p.Ser93fs		Somatic				SHPRH_uc003qld.2_Frame_Shift_Del_p.S93fs|SHPRH_uc003qle.2_Frame_Shift_Del_p.S93fs|SHPRH_uc003qlg.1_5'UTR|SHPRH_uc003qlj.1_Intron|SHPRH_uc003qlk.1_Frame_Shift_Del_p.S93fs	p.S93fs	NM_001042683	NP_001036148	WXS	Illumina HiSeq	Unspecified	Q149N8	SHPRH_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;1.47e-07)|GBM - Glioblastoma multiforme(68;0.0124)	2	676	-		Ovarian(120;0.0365)	93					Q149N9|Q5VV79|Q68DS5|Q7Z5J5|Q8IVE8|Q8IWQ9|Q8N1S8|Q8NBR7	Frame_Shift_Del	DEL	ENST00000367505.2	37	c.277delT	CCDS43513.2																																																																																				0.363	SHPRH-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000042571.2	NM_173082		8	74	NA	NA	NA	NA	NA	8	74	---	---	---	---
ISCA1	81689	broad.mit.edu	37	9	88881102	88881103	+	Frame_Shift_Ins	INS	-	-	A			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chr9:88881102_88881103insA	ENST00000375991.4	-	4	315_316	c.245_246insT	c.(244-246)gtcfs	p.V82fs	ISCA1_ENST00000452279.2_Frame_Shift_Ins_p.V129fs|ISCA1_ENST00000311534.6_5'UTR	NM_030940.3	NP_112202.2	Q9BUE6	ISCA1_HUMAN	iron-sulfur cluster assembly 1	82					iron-sulfur cluster assembly (GO:0016226)	mitochondrion (GO:0005739)	iron-sulfur cluster binding (GO:0051536)|metal ion binding (GO:0046872)|structural molecule activity (GO:0005198)			endometrium(2)|large_intestine(1)|lung(4)|pancreas(1)	8				OV - Ovarian serous cystadenocarcinoma(323;5.4e-34)|Lung(182;0.0375)		TGAATACTCTGACTCCTTGGAG	0.376																																							uc004aop.2		NA																	0					0						c.(244-246)GTCfs		HESB like domain containing 2 precursor																																				SO:0001589	frameshift_variant	81689				iron-sulfur cluster assembly	mitochondrion	iron-sulfur cluster binding|metal ion binding|structural molecule activity	g.chr9:88881102_88881103insA	AF038186	CCDS35056.1	9q22.1	2013-08-06	2013-08-06	2007-01-18	ENSG00000135070	ENSG00000135070			28660	protein-coding gene	gene with protein product		611006	"""HESB like domain containing 2"", ""iron-sulfur cluster assembly 1 homolog (S. cerevisiae)"""	HBLD2		15262227, 22323289	Standard	NM_030940		Approved	MGC4276, ISA1, hIscA	uc004aop.3	Q9BUE6	OTTHUMG00000020135	ENST00000375991.4:c.246dupT	9.37:g.88881103_88881103dupA	ENSP00000365159:p.Val82fs		Somatic				GOLM1_uc010mqd.1_Intron	p.V82fs	NM_030940	NP_112202	WXS	Illumina HiSeq	Unspecified	Q9BUE6	ISCA1_HUMAN		OV - Ovarian serous cystadenocarcinoma(323;5.4e-34)|Lung(182;0.0375)	4	362_363	-			82					B3KP34|B4DJI5|Q8ND75|Q9BZR2	Frame_Shift_Ins	INS	ENST00000375991.4	37	c.245_246insT	CCDS35056.1																																																																																				0.376	ISCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052914.1	NM_030940		16	102	NA	NA	NA	NA	NA	16	102	---	---	---	---
FAM58A	92002	broad.mit.edu	37	X	152860006	152860006	+	Splice_Site	DEL	T	T	-			TCGA-05-4249-01A-01D-1105-08	TCGA-05-4249-10A-01D-1105-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8be717b5-5b65-4631-a175-1f4c063d447e	5d48c4d0-e1bd-4a65-9ecf-b6bad02196d7	g.chrX:152860006delT	ENST00000406277.2	-	5	524	c.422delA	c.(421-423)aag>ag	p.K141fs	FAM58A_ENST00000370175.4_5'UTR	NM_001130997.1|NM_152274.3	NP_001124469.1|NP_689487.2	Q8N1B3	FA58A_HUMAN	family with sequence similarity 58, member A	143					regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of transcription, DNA-templated (GO:0006355)					endometrium(2)|kidney(1)|large_intestine(1)|liver(1)|lung(1)	6	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					AGTATGTACCTTGTGTGGATG	0.537																																							uc010nug.2		NA																	0					0						c.(241-243)AAGfs		RecName: Full=Cyclin-related protein FAM58B;							101.0	92.0	95.0					X																	152860006		2203	4300	6503	SO:0001630	splice_region_variant	92002				regulation of cyclin-dependent protein kinase activity|regulation of transcription, DNA-dependent		protein kinase binding	g.chrX:152860006delT	BC032121	CCDS76054.1	Xq28	2014-08-12	2012-11-30	2012-11-30	ENSG00000147382	ENSG00000262919			28434	protein-coding gene	gene with protein product	"""cyclin M"""	300708				18297069, 24218572	Standard	NM_152274		Approved	MGC29729, FLJ21610	uc011myr.2	Q8N1B3	OTTHUMG00000024206	ENST00000406277.2:c.423+1A>-	X.37:g.152860006delT			Somatic					p.K81fs			WXS	Illumina HiSeq	Unspecified	Q8N1B3	FA58A_HUMAN			2	345	-	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)		143					Q2I380|Q330J9|Q96IU5|Q9BUU1	Frame_Shift_Del	DEL	ENST00000406277.2	37	c.242delA																																																																																					0.537	FAM58A-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_152274	Frame_Shift_Del	76	55	NA	NA	NA	NA	NA	76	55	---	---	---	---
