#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
UBE4B	10277	broad.mit.edu	37	1	10209284	10209284	+	Silent	SNP	A	A	T			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr1:10209284A>T	ENST00000253251.8	+	19	3086	c.2247A>T	c.(2245-2247)gcA>gcT	p.A749A	UBE4B_ENST00000343090.6_Silent_p.A878A|UBE4B_ENST00000377157.3_Silent_p.A633A					ubiquitination factor E4B									p.A878A(1)|p.A749A(1)		NS(3)|breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(14)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	48		all_lung(284;1.13e-05)|Lung NSC(185;1.74e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0268)|Colorectal(212;1.42e-07)|COAD - Colon adenocarcinoma(227;2.77e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000435)|Kidney(185;0.000482)|KIRC - Kidney renal clear cell carcinoma(229;0.00164)|STAD - Stomach adenocarcinoma(132;0.0117)|READ - Rectum adenocarcinoma(331;0.046)		AGGTATTTGCAGCGTTGCCTG	0.289																																							uc001aqs.3		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)|skin(2)	4						c.(2632-2634)GCA>GCT		ubiquitination factor E4B isoform 1							138.0	143.0	142.0					1																	10209284		2203	4299	6502	SO:0001819	synonymous_variant	10277				apoptosis|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to UV	cytoplasm|ubiquitin ligase complex	enzyme binding	g.chr1:10209284A>T	AF091093	CCDS110.1, CCDS41245.1	1p36.1	2013-01-28	2011-05-19		ENSG00000130939	ENSG00000130939		"""U-box domain containing"""	12500	protein-coding gene	gene with protein product		613565	"""ubiquitination factor E4B (homologous to yeast UFD2)"", ""ubiquitination factor E4B (UFD2 homolog, yeast)"""			9734811, 10089879	Standard	NM_006048		Approved	UBOX3, E4, UFD2, KIAA0684	uc001aqs.4	O95155	OTTHUMG00000001797	ENST00000253251.8:c.2247A>T	1.37:g.10209284A>T			Somatic				UBE4B_uc001aqr.3_Silent_p.A749A|UBE4B_uc010oai.1_RNA|UBE4B_uc010oaj.1_Silent_p.A333A|UBE4B_uc001aqt.1_Silent_p.A218A	p.A878A	NM_001105562	NP_001099032	WXS	Illumina HiSeq	Unspecified	O95155	UBE4B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0268)|Colorectal(212;1.42e-07)|COAD - Colon adenocarcinoma(227;2.77e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000435)|Kidney(185;0.000482)|KIRC - Kidney renal clear cell carcinoma(229;0.00164)|STAD - Stomach adenocarcinoma(132;0.0117)|READ - Rectum adenocarcinoma(331;0.046)	20	3347	+		all_lung(284;1.13e-05)|Lung NSC(185;1.74e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)	878						Silent	SNP	ENST00000253251.8	37	c.2634A>T	CCDS110.1																																																																																				0.289	UBE4B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005017.1	NM_006048		46	201	0	0	0	0.00361	0	46	201				
FAAH	2166	broad.mit.edu	37	1	46867858	46867858	+	Silent	SNP	C	C	T			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr1:46867858C>T	ENST00000243167.8	+	2	375	c.291C>T	c.(289-291)ctC>ctT	p.L97L	FAAH_ENST00000493735.1_3'UTR	NM_001441.2	NP_001432.2	O00519	FAAH1_HUMAN	fatty acid amide hydrolase	97					fatty acid catabolic process (GO:0009062)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|organelle membrane (GO:0031090)	acylglycerol lipase activity (GO:0047372)|carbon-nitrogen ligase activity, with glutamine as amido-N-donor (GO:0016884)|fatty acid amide hydrolase activity (GO:0017064)	p.L97L(1)		breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|skin(1)	22	Acute lymphoblastic leukemia(166;0.155)				Propofol(DB00818)|Thiopental(DB00599)	AGGCCGTGCTCTTCACCTATG	0.632																																							uc001cpu.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|breast(1)	2						c.(289-291)CTC>CTT		fatty acid amide hydrolase	Propofol(DB00818)|Thiopental(DB00599)						30.0	28.0	29.0					1																	46867858		2202	4299	6501	SO:0001819	synonymous_variant	2166				fatty acid catabolic process	cytoplasm|cytoskeleton|endomembrane system|integral to membrane|organelle membrane	carbon-nitrogen ligase activity, with glutamine as amido-N-donor|fatty acid amide hydrolase activity	g.chr1:46867858C>T	U82535	CCDS535.1	1p35-p34	2008-02-05			ENSG00000117480	ENSG00000117480			3553	protein-coding gene	gene with protein product		602935				9122178	Standard	NM_001441		Approved	FAAH-1	uc001cpu.2	O00519	OTTHUMG00000007811	ENST00000243167.8:c.291C>T	1.37:g.46867858C>T			Somatic					p.L97L	NM_001441	NP_001432	WXS	Illumina HiSeq	Unspecified	O00519	FAAH1_HUMAN			2	373	+	Acute lymphoblastic leukemia(166;0.155)		97			Cytoplasmic (By similarity).		D3DQ19|Q52M86|Q5TDF8	Silent	SNP	ENST00000243167.8	37	c.291C>T	CCDS535.1																																																																																				0.632	FAAH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021443.1	NM_001441		5	15	0	0	0	0.001168	0	5	15				
PTBP2	58155	broad.mit.edu	37	1	97278882	97278882	+	Missense_Mutation	SNP	A	A	C			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr1:97278882A>C	ENST00000426398.2	+	14	1560	c.1517A>C	c.(1516-1518)cAg>cCg	p.Q506P	PTBP2_ENST00000482253.1_3'UTR|PTBP2_ENST00000370197.1_Missense_Mutation_p.Q512P|PTBP2_ENST00000609116.1_Missense_Mutation_p.Q507P|PTBP2_ENST00000394184.3_Missense_Mutation_p.Q523P|PTBP2_ENST00000541987.1_3'UTR|PTBP2_ENST00000370198.1_Missense_Mutation_p.Q511P	NM_021190.2	NP_067013.1	Q9UKA9	PTBP2_HUMAN	polypyrimidine tract binding protein 2	506	RRM 4. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA splice site selection (GO:0006376)|negative regulation of RNA splicing (GO:0033119)|regulation of neural precursor cell proliferation (GO:2000177)	spliceosomal complex (GO:0005681)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.Q506P(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(15)|skin(1)	26		all_epithelial(167;2.95e-05)|all_lung(203;0.000396)|Lung NSC(277;0.00171)		all cancers(265;0.0582)|Epithelial(280;0.0716)|Colorectal(170;0.0879)|KIRC - Kidney renal clear cell carcinoma(1967;0.202)		GAAGCTATTCAGGCCTTGATT	0.348																																							uc001drq.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1516-1518)CAG>CCG		polypyrimidine tract binding protein 2							71.0	80.0	77.0					1																	97278882		2203	4300	6503	SO:0001583	missense	58155						nucleotide binding	g.chr1:97278882A>C	AB051232	CCDS754.1, CCDS72828.1, CCDS72829.1, CCDS72830.1	1p21.3	2013-07-16			ENSG00000117569	ENSG00000117569		"""RNA binding motif (RRM) containing"""	17662	protein-coding gene	gene with protein product		608449				11003644	Standard	XM_005271084		Approved	brPTB, nPTB, PTB, PTBLP	uc001drq.3	Q9UKA9	OTTHUMG00000010685	ENST00000426398.2:c.1517A>C	1.37:g.97278882A>C	ENSP00000412788:p.Gln506Pro		Somatic				PTBP2_uc001drn.2_Missense_Mutation_p.Q512P|PTBP2_uc001dro.2_Missense_Mutation_p.Q507P|PTBP2_uc010otz.1_Missense_Mutation_p.Q523P|PTBP2_uc001drp.2_RNA|PTBP2_uc009wdw.2_Missense_Mutation_p.Q455P|PTBP2_uc001drr.2_Missense_Mutation_p.Q511P|PTBP2_uc010oua.1_Missense_Mutation_p.Q515P|PTBP2_uc001dru.2_RNA|PTBP2_uc001drs.1_Missense_Mutation_p.Q126P|PTBP2_uc001drt.2_Missense_Mutation_p.Q125P	p.Q506P	NM_021190	NP_067013	WXS	Illumina HiSeq	Unspecified	Q9UKA9	PTBP2_HUMAN		all cancers(265;0.0582)|Epithelial(280;0.0716)|Colorectal(170;0.0879)|KIRC - Kidney renal clear cell carcinoma(1967;0.202)	14	1763	+		all_epithelial(167;2.95e-05)|all_lung(203;0.000396)|Lung NSC(277;0.00171)	506			RRM 4.		Q8N0Z1|Q8N160|Q8NFB0|Q8NFB1|Q969N9|Q96Q76	Missense_Mutation	SNP	ENST00000426398.2	37	c.1517A>C	CCDS754.1	.	.	.	.	.	.	.	.	.	.	A	13.34	2.208214	0.39003	.	.	ENSG00000117569	ENST00000236228;ENST00000543738;ENST00000370198;ENST00000370197;ENST00000426398;ENST00000394184	T;T;T;T;T	0.09445	2.98;2.98;2.98;2.98;2.98	5.5	4.38	0.52667	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.105241	0.64402	D	0.000003	T	0.18676	0.0448	M	0.69358	2.11	0.80722	D	1	B;B;P;B;B;B;B	0.45240	0.001;0.217;0.854;0.107;0.002;0.0;0.002	B;B;D;B;B;B;B	0.68943	0.035;0.416;0.961;0.218;0.056;0.021;0.021	T	0.00392	-1.1768	10	0.49607	T	0.09	-1.3802	11.3426	0.49541	0.9287:0.0:0.0713:0.0	.	515;523;179;511;506;507;512	B4DSU5;B4DSS8;B4DSI2;Q9UKA9-4;Q9UKA9;Q9UKA9-2;Q9UKA9-3	.;.;.;.;PTBP2_HUMAN;.;.	P	507;179;511;512;506;523	ENSP00000236228:Q507P;ENSP00000359217:Q511P;ENSP00000359216:Q512P;ENSP00000412788:Q506P;ENSP00000377738:Q523P	ENSP00000236228:Q507P	Q	+	2	0	PTBP2	97051470	1.000000	0.71417	0.999000	0.59377	0.989000	0.77384	9.283000	0.95860	1.025000	0.39708	0.528000	0.53228	CAG		0.348	PTBP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029453.1			19	50	0	0	0	0.010504	0	19	50				
VCAM1	7412	broad.mit.edu	37	1	101196962	101196962	+	Silent	SNP	C	C	A			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr1:101196962C>A	ENST00000294728.2	+	6	1514	c.1413C>A	c.(1411-1413)atC>atA	p.I471I	VCAM1_ENST00000370115.1_Intron|VCAM1_ENST00000347652.2_Silent_p.I379I|VCAM1_ENST00000370119.4_Silent_p.I409I	NM_001078.3	NP_001069.1	P19320	VCAM1_HUMAN	vascular cell adhesion molecule 1	471	Ig-like C2-type 5.				acute inflammatory response (GO:0002526)|aging (GO:0007568)|amine metabolic process (GO:0009308)|B cell differentiation (GO:0030183)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell-matrix adhesion (GO:0007160)|cellular response to glucose stimulus (GO:0071333)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|chorio-allantoic fusion (GO:0060710)|chronic inflammatory response (GO:0002544)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|heterophilic cell-cell adhesion (GO:0007157)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte tethering or rolling (GO:0050901)|membrane to membrane docking (GO:0022614)|oxidation-reduction process (GO:0055114)|positive regulation of T cell proliferation (GO:0042102)|regulation of immune response (GO:0050776)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|response to lipopolysaccharide (GO:0032496)|response to nicotine (GO:0035094)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|viral process (GO:0016032)	alpha9-beta1 integrin-vascular cell adhesion molecule-1 complex (GO:0071065)|apical part of cell (GO:0045177)|cell surface (GO:0009986)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|podosome (GO:0002102)|sarcolemma (GO:0042383)	cell adhesion molecule binding (GO:0050839)|integrin binding (GO:0005178)|primary amine oxidase activity (GO:0008131)	p.I471I(1)		central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(27)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	56		all_epithelial(167;3.83e-06)|all_lung(203;0.000485)|Lung NSC(277;0.0011)		Epithelial(280;0.0227)|all cancers(265;0.0276)|COAD - Colon adenocarcinoma(174;0.149)|Colorectal(144;0.169)|Lung(183;0.196)	Carvedilol(DB01136)	TGACCTTCATCCCTACCATTG	0.383																																							uc001dti.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)	1						c.(1411-1413)ATC>ATA		vascular cell adhesion molecule 1 isoform a	Carvedilol(DB01136)						107.0	105.0	106.0					1																	101196962		2203	4300	6503	SO:0001819	synonymous_variant	7412				heterophilic cell-cell adhesion|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|leukocyte tethering or rolling|membrane to membrane docking|positive regulation of T cell proliferation|regulation of immune response	alpha9-beta1 integrin-vascular cell adhesion molecule-1 complex|apical part of cell|external side of plasma membrane|extracellular space|filopodium|integral to membrane|microvillus|podosome	cell adhesion molecule binding|integrin binding	g.chr1:101196962C>A	M60335	CCDS773.1, CCDS774.1, CCDS55617.1	1p32-p31	2014-01-30			ENSG00000162692	ENSG00000162692		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Endogenous ligands"""	12663	protein-coding gene	gene with protein product		192225					Standard	NM_080682		Approved	CD106	uc001dti.3	P19320	OTTHUMG00000010982	ENST00000294728.2:c.1413C>A	1.37:g.101196962C>A			Somatic				VCAM1_uc001dtj.2_Silent_p.I379I|VCAM1_uc010ouj.1_Silent_p.I409I	p.I471I	NM_001078	NP_001069	WXS	Illumina HiSeq	Unspecified	P19320	VCAM1_HUMAN		Epithelial(280;0.0227)|all cancers(265;0.0276)|COAD - Colon adenocarcinoma(174;0.149)|Colorectal(144;0.169)|Lung(183;0.196)	6	1533	+		all_epithelial(167;3.83e-06)|all_lung(203;0.000485)|Lung NSC(277;0.0011)	471			Ig-like C2-type 5.|Extracellular (Potential).		A8K6R7|B4DKS4|E9PDD1|Q6NUP8	Silent	SNP	ENST00000294728.2	37	c.1413C>A	CCDS773.1																																																																																				0.383	VCAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030213.1	NM_001078		20	86	1	0	2.4624e-09	0.008871	2.90364e-09	20	86				
NOTCH2	4853	broad.mit.edu	37	1	120539844	120539844	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr1:120539844C>A	ENST00000256646.2	-	4	746	c.527G>T	c.(526-528)gGg>gTg	p.G176V	NOTCH2_ENST00000602566.1_Missense_Mutation_p.G137V	NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	176	EGF-like 4. {ECO:0000255|PROSITE- ProRule:PRU00076}.				apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)	p.G176V(1)|p.G137V(1)		breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		ACATTTCTGCCCTGTGAAGCC	0.547			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																														uc001eik.2		NA		Dom	yes		1	1p13-p11	4853	N|F|Mis	Notch homolog 2			L			marginal zone lymphoma|DLBCL		2	Substitution - Missense(2)		lung(2)	lung(8)|haematopoietic_and_lymphoid_tissue(7)|ovary(4)|central_nervous_system(2)|skin(2)|kidney(2)|breast(1)|prostate(1)	27						c.(526-528)GGG>GTG		notch 2 preproprotein							110.0	86.0	94.0					1																	120539844		2203	4300	6503	SO:0001583	missense	4853	Alagille_Syndrome	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	anti-apoptosis|bone remodeling|cell cycle arrest|cell fate determination|cell growth|hemopoiesis|induction of apoptosis|negative regulation of cell proliferation|nervous system development|Notch receptor processing|Notch signaling pathway|organ morphogenesis|positive regulation of Ras protein signal transduction|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|ligand-regulated transcription factor activity|protein binding|receptor activity	g.chr1:120539844C>A	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.527G>T	1.37:g.120539844C>A	ENSP00000256646:p.Gly176Val		Somatic				NOTCH2_uc001eil.2_Missense_Mutation_p.G176V|NOTCH2_uc001eim.3_Missense_Mutation_p.G93V	p.G176V	NM_024408	NP_077719	WXS	Illumina HiSeq	Unspecified	Q04721	NOTC2_HUMAN		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)	4	783	-	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)	176			Extracellular (Potential).|EGF-like 4.		Q5T3X7|Q99734|Q9H240	Missense_Mutation	SNP	ENST00000256646.2	37	c.527G>T	CCDS908.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.963656	0.74016	.	.	ENSG00000134250	ENST00000256646;ENST00000539617;ENST00000401649;ENST00000369342	D	0.94000	-3.33	5.71	5.71	0.89125	Epidermal growth factor-like (1);EGF-like region, conserved site (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.38217	U	0.001772	D	0.98131	0.9383	H	0.97440	4.005	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.97110	1.0;1.0;0.996	D	0.99198	1.0872	10	0.87932	D	0	.	18.8339	0.92153	0.0:1.0:0.0:0.0	.	137;176;176	D2WEZ3;Q6IQ50;Q04721	.;.;NOTC2_HUMAN	V	176;137;149;137	ENSP00000256646:G176V	ENSP00000256646:G176V	G	-	2	0	NOTCH2	120341367	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	6.070000	0.71220	2.686000	0.91538	0.585000	0.79938	GGG		0.547	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033679.1	NM_024408		30	126	1	0	3.90053e-15	0.012213	4.97317e-15	30	126				
FLG	2312	broad.mit.edu	37	1	152279982	152279982	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr1:152279982G>T	ENST00000368799.1	-	3	7415	c.7380C>A	c.(7378-7380)gaC>gaA	p.D2460E	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2460	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.D2460E(1)		autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CATGAATGGTGTCCTGACCCT	0.587									Ichthyosis																														uc001ezu.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16						c.(7378-7380)GAC>GAA		filaggrin							364.0	334.0	344.0					1																	152279982		2203	4300	6503	SO:0001583	missense	2312	Ichthyosis	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity	g.chr1:152279982G>T	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.7380C>A	1.37:g.152279982G>T	ENSP00000357789:p.Asp2460Glu		Somatic					p.D2460E	NM_002016	NP_002007	WXS	Illumina HiSeq	Unspecified	P20930	FILA_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	7416	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		2460			Ser-rich.		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	c.7380C>A	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	G	10.04	1.240452	0.22711	.	.	ENSG00000143631	ENST00000368799	T	0.01647	4.71	2.82	-5.53	0.02552	.	.	.	.	.	T	0.00524	0.0017	M	0.80982	2.52	0.09310	N	1	B	0.17852	0.024	B	0.09377	0.004	T	0.52555	-0.8560	9	0.02654	T	1	.	1.1999	0.01883	0.1351:0.1959:0.3403:0.3286	.	2460	P20930	FILA_HUMAN	E	2460	ENSP00000357789:D2460E	ENSP00000357789:D2460E	D	-	3	2	FLG	150546606	.	.	0.000000	0.03702	0.015000	0.08874	.	.	-0.648000	0.05437	0.306000	0.20318	GAC		0.587	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016		129	580	1	0	2.3678e-45	0.00361	3.42575e-45	129	580				
FLG	2312	broad.mit.edu	37	1	152281324	152281324	+	Nonsense_Mutation	SNP	G	G	C			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr1:152281324G>C	ENST00000368799.1	-	3	6073	c.6038C>G	c.(6037-6039)tCa>tGa	p.S2013*	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2013	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.S2013*(1)		autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GCTGTCTGCTGACTGGAGCTG	0.557									Ichthyosis																														uc001ezu.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16						c.(6037-6039)TCA>TGA		filaggrin							646.0	515.0	560.0					1																	152281324		2203	4300	6503	SO:0001587	stop_gained	2312	Ichthyosis	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity	g.chr1:152281324G>C	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.6038C>G	1.37:g.152281324G>C	ENSP00000357789:p.Ser2013*		Somatic					p.S2013*	NM_002016	NP_002007	WXS	Illumina HiSeq	Unspecified	P20930	FILA_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	6074	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		2013			Ser-rich.|Filaggrin 12.		Q01720|Q5T583|Q9UC71	Nonsense_Mutation	SNP	ENST00000368799.1	37	c.6038C>G	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	g	43	10.183833	0.99354	.	.	ENSG00000143631	ENST00000368799	.	.	.	3.74	1.59	0.23543	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	.	5.8302	0.18577	0.0:0.218:0.5576:0.2244	.	.	.	.	X	2013	.	ENSP00000357789:S2013X	S	-	2	0	FLG	150547948	0.014000	0.17966	0.024000	0.17045	0.051000	0.14879	2.156000	0.42310	0.872000	0.35775	0.586000	0.80456	TCA		0.557	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016		182	705	0	0	0	0.00361	0	182	705				
CDC73	79577	broad.mit.edu	37	1	193099332	193099332	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr1:193099332C>G	ENST00000367435.3	+	3	450	c.266C>G	c.(265-267)cCt>cGt	p.P89R		NM_024529.4	NP_078805.3	Q6P1J9	CDC73_HUMAN	cell division cycle 73	89					cell cycle (GO:0007049)|cellular response to lipopolysaccharide (GO:0071222)|endodermal cell fate commitment (GO:0001711)|histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|mRNA polyadenylation (GO:0006378)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of mRNA 3'-end processing (GO:0031442)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|protein destabilization (GO:0031648)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	Cdc73/Paf1 complex (GO:0016593)|nucleus (GO:0005634)	RNA polymerase II core binding (GO:0000993)	p.P89L(1)|p.P89R(1)		breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(14)|ovary(1)|pancreas(1)|parathyroid(51)|skin(1)|upper_aerodigestive_tract(1)	87						GTTAGAAGACCTGATCGAAAA	0.299																																							uc001gtb.2		NA																	2	Substitution - Missense(2)		lung(1)|endometrium(1)	parathyroid(46)|ovary(1)|breast(1)|pancreas(1)	49						c.(265-267)CCT>CGT		parafibromin							135.0	139.0	138.0					1																	193099332		2203	4300	6503	SO:0001583	missense	79577	Hyperparathyroidism_Familial_Isolated|Hyperparathyroidism-Jaw_Tumor_Syndrome			cell cycle|histone H2B ubiquitination|histone monoubiquitination|transcription, DNA-dependent	Cdc73/Paf1 complex	protein binding	g.chr1:193099332C>G	AF312865	CCDS1382.1	1q25	2014-09-17	2013-01-17	2005-07-20	ENSG00000134371	ENSG00000134371			16783	protein-coding gene	gene with protein product	"""Paf1/RNA polymerase II complex component"""	607393	"""chromosome 1 open reading frame 28"", ""hyperparathyroidism 2 (with jaw tumor)"", ""cell division cycle 73, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)"", ""hyperparathyroidism 1"""	C1orf28, HRPT2, HRPT1		11318611, 15632063, 18755853	Standard	NM_024529		Approved	parafibromin, FIHP	uc001gtb.3	Q6P1J9	OTTHUMG00000035676	ENST00000367435.3:c.266C>G	1.37:g.193099332C>G	ENSP00000356405:p.Pro89Arg		Somatic					p.P89R	NM_024529	NP_078805	WXS	Illumina HiSeq	Unspecified	Q6P1J9	CDC73_HUMAN			3	509	+			89					A6NLZ8|B2RBR2|Q6PK51|Q96A07|Q9H245|Q9H5L7	Missense_Mutation	SNP	ENST00000367435.3	37	c.266C>G	CCDS1382.1	.	.	.	.	.	.	.	.	.	.	C	28.1	4.889608	0.91889	.	.	ENSG00000134371	ENST00000367435;ENST00000445394	D	0.86030	-2.06	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	D	0.93360	0.7883	M	0.85710	2.77	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.93390	0.6751	10	0.56958	D	0.05	-17.4468	19.6662	0.95894	0.0:1.0:0.0:0.0	.	89	Q6P1J9	CDC73_HUMAN	R	89	ENSP00000356405:P89R	ENSP00000356405:P89R	P	+	2	0	CDC73	191365955	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.721000	0.84768	2.649000	0.89929	0.561000	0.74099	CCT		0.299	CDC73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086696.2	NM_024529		13	40	0	0	0	0.00245	0	13	40				
ESRRG	2104	broad.mit.edu	37	1	216737685	216737685	+	Silent	SNP	C	C	T			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr1:216737685C>T	ENST00000408911.3	-	5	891	c.738G>A	c.(736-738)ccG>ccA	p.P246P	ESRRG_ENST00000360012.3_Silent_p.P223P|ESRRG_ENST00000493603.1_Silent_p.P223P|ESRRG_ENST00000366938.2_Silent_p.P223P|ESRRG_ENST00000391890.3_Silent_p.P230P|ESRRG_ENST00000359162.2_Silent_p.P223P|ESRRG_ENST00000361525.3_Silent_p.P223P|ESRRG_ENST00000366940.2_Silent_p.P223P|ESRRG_ENST00000366937.1_Silent_p.P258P|ESRRG_ENST00000487276.1_Silent_p.P223P|ESRRG_ENST00000463665.1_Silent_p.P184P|ESRRG_ENST00000493748.1_Silent_p.P223P|ESRRG_ENST00000361395.2_Silent_p.P223P	NM_001438.3	NP_001429.2	P62508	ERR3_HUMAN	estrogen-related receptor gamma	246					gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	AF-2 domain binding (GO:0050682)|retinoic acid receptor activity (GO:0003708)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)	p.P246P(1)		endometrium(5)|kidney(1)|large_intestine(8)|liver(1)|lung(29)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	49				OV - Ovarian serous cystadenocarcinoma(81;0.0358)|all cancers(67;0.0693)|GBM - Glioblastoma multiforme(131;0.0713)	Diethylstilbestrol(DB00255)	AGATCTTCTCCGGTTCAGCCA	0.478																																							uc001hkw.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|kidney(1)	2						c.(736-738)CCG>CCA		estrogen-related receptor gamma isoform 1	Diethylstilbestrol(DB00255)						170.0	143.0	152.0					1																	216737685		2203	4300	6503	SO:0001819	synonymous_variant	2104				positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	AF-2 domain binding|retinoic acid receptor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding	g.chr1:216737685C>T	AF058291	CCDS1517.1, CCDS41468.1, CCDS58060.1, CCDS58061.1	1q41	2014-02-18			ENSG00000196482	ENSG00000196482		"""Nuclear hormone receptors"""	3474	protein-coding gene	gene with protein product		602969				9676434, 10072763	Standard	NM_001243505		Approved	NR3B3	uc001hkw.2	P62508	OTTHUMG00000037025	ENST00000408911.3:c.738G>A	1.37:g.216737685C>T			Somatic				ESRRG_uc001hky.1_Silent_p.P223P|ESRRG_uc009xdp.1_Silent_p.P223P|ESRRG_uc001hkz.1_Silent_p.P184P|ESRRG_uc010puc.1_Silent_p.P223P|ESRRG_uc001hla.1_Silent_p.P223P|ESRRG_uc001hlb.1_Silent_p.P223P|ESRRG_uc010pud.1_Silent_p.P54P|ESRRG_uc001hlc.1_Silent_p.P223P|ESRRG_uc001hld.1_Silent_p.P223P|ESRRG_uc001hkx.1_Silent_p.P258P|ESRRG_uc009xdo.1_Silent_p.P223P|ESRRG_uc001hle.1_Silent_p.P223P	p.P246P	NM_001438	NP_001429	WXS	Illumina HiSeq	Unspecified	P62508	ERR3_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0358)|all cancers(67;0.0693)|GBM - Glioblastoma multiforme(131;0.0713)	5	904	-			246					A8K4I0|A8K6I2|B3KY84|E9PGB7|F8W8J3|O75454|O96021|Q68DA0|Q6P274|Q6PK28|Q6TS38|Q9R1F3|Q9UNJ4	Silent	SNP	ENST00000408911.3	37	c.738G>A	CCDS41468.1																																																																																				0.478	ESRRG-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000089882.2	NM_206595		15	51	0	0	0	0.003163	0	15	51				
NVL	4931	broad.mit.edu	37	1	224424241	224424241	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr1:224424241G>A	ENST00000281701.6	-	20	2592	c.2333C>T	c.(2332-2334)gCa>gTa	p.A778V	NVL_ENST00000482491.1_Missense_Mutation_p.A502V|NVL_ENST00000340871.4_Missense_Mutation_p.A589V|NVL_ENST00000469075.1_Missense_Mutation_p.A687V|NVL_ENST00000391875.2_Missense_Mutation_p.A672V|NVL_ENST00000361463.3_3'UTR	NM_002533.3	NP_002524.2	O15381	NVL_HUMAN	nuclear VCP-like	778						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)	p.A778V(1)		breast(3)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(13)|ovary(1)|prostate(1)|skin(4)|soft_tissue(1)|urinary_tract(1)	42				GBM - Glioblastoma multiforme(131;0.00501)		ACCAGCAATTGCTTCCAAATT	0.403																																							uc001hok.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)	2						c.(2332-2334)GCA>GTA		nuclear VCP-like isoform 1							157.0	147.0	151.0					1																	224424241		2203	4300	6503	SO:0001583	missense	4931					aggresome|cytoplasm|nucleolus	ATP binding|nucleoside-triphosphatase activity	g.chr1:224424241G>A	U78772	CCDS1541.1, CCDS1542.1, CCDS58062.1, CCDS58063.1	1q41-q42.2	2010-04-21			ENSG00000143748	ENSG00000143748		"""ATPases / AAA-type"""	8070	protein-coding gene	gene with protein product	"""Nuclear valosin-containing protein-like"", ""nuclear VCP-like protein"""	602426				9286697	Standard	NM_002533		Approved		uc001hok.3	O15381	OTTHUMG00000037536	ENST00000281701.6:c.2333C>T	1.37:g.224424241G>A	ENSP00000281701:p.Ala778Val		Somatic				NVL_uc001hol.2_Missense_Mutation_p.A672V|NVL_uc010pvd.1_Missense_Mutation_p.A687V|NVL_uc010pve.1_Missense_Mutation_p.A589V|NVL_uc010pvf.1_RNA	p.A778V	NM_002533	NP_002524	WXS	Illumina HiSeq	Unspecified	O15381	NVL_HUMAN		GBM - Glioblastoma multiforme(131;0.00501)	20	2376	-			778					B4DMC4|B4DP98|Q96EM7	Missense_Mutation	SNP	ENST00000281701.6	37	c.2333C>T	CCDS1541.1	.	.	.	.	.	.	.	.	.	.	G	13.18	2.159194	0.38119	.	.	ENSG00000143748	ENST00000281701;ENST00000391875;ENST00000469075;ENST00000482491;ENST00000340871	D;D;D;D;D	0.95137	-3.62;-3.62;-3.62;-3.62;-3.62	5.67	3.66	0.41972	.	0.358654	0.31113	N	0.008223	D	0.88089	0.6343	N	0.25380	0.74	0.38510	D	0.948446	B;B;B	0.24768	0.029;0.111;0.015	B;B;B	0.11329	0.006;0.003;0.002	D	0.84664	0.0708	10	0.23891	T	0.37	-2.5925	10.9362	0.47247	0.0:0.0:0.6593:0.3407	.	589;687;778	B4DMC4;B4DP98;O15381	.;.;NVL_HUMAN	V	778;672;687;502;589	ENSP00000281701:A778V;ENSP00000375747:A672V;ENSP00000417826:A687V;ENSP00000417213:A502V;ENSP00000341362:A589V	ENSP00000281701:A778V	A	-	2	0	NVL	222490864	0.908000	0.30866	0.654000	0.29608	0.998000	0.95712	1.319000	0.33655	1.519000	0.48950	0.655000	0.94253	GCA		0.403	NVL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000091453.2	NM_002533		33	155	0	0	0	0.005524	0	33	155				
MTR	4548	broad.mit.edu	37	1	237052596	237052596	+	Silent	SNP	G	G	C			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr1:237052596G>C	ENST00000366577.5	+	28	3361	c.2967G>C	c.(2965-2967)ccG>ccC	p.P989P	MTR_ENST00000535889.1_Silent_p.P938P	NM_000254.2	NP_000245.2	Q99707	METH_HUMAN	5-methyltetrahydrofolate-homocysteine methyltransferase	989	AdoMet activation. {ECO:0000255|PROSITE- ProRule:PRU00346}.				cellular nitrogen compound metabolic process (GO:0034641)|cobalamin metabolic process (GO:0009235)|methylation (GO:0032259)|nervous system development (GO:0007399)|pteridine-containing compound metabolic process (GO:0042558)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	cobalamin binding (GO:0031419)|methionine synthase activity (GO:0008705)|S-adenosylmethionine-homocysteine S-methyltransferase activity (GO:0008898)|zinc ion binding (GO:0008270)	p.P989P(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(8)|lung(30)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	67	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;2.79e-22)|all_epithelial(177;4.84e-14)|Breast(1374;0.00123)|Prostate(94;0.0181)|Lung SC(1967;0.0262)|Acute lymphoblastic leukemia(190;0.117)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)	KIRC - Kidney renal clear cell carcinoma(1967;0.248)	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)|Tetrahydrofolic acid(DB00116)	GCAAGTACCCGAATCGAGGCT	0.473																																							uc001hyi.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|central_nervous_system(1)|pancreas(1)	3						c.(2965-2967)CCG>CCC		5-methyltetrahydrofolate-homocysteine	Hydroxocobalamin(DB00200)|L-Methionine(DB00134)|Tetrahydrofolic acid(DB00116)						104.0	100.0	101.0					1																	237052596		2203	4300	6503	SO:0001819	synonymous_variant	4548				nervous system development|xenobiotic metabolic process	cytosol	cobalamin binding|homocysteine S-methyltransferase activity|methionine synthase activity|protein binding|zinc ion binding	g.chr1:237052596G>C	U73338	CCDS1614.1, CCDS73054.1	1q43	2011-05-12			ENSG00000116984	ENSG00000116984	2.1.1.13		7468	protein-coding gene	gene with protein product		156570				8968735	Standard	NM_000254		Approved	cblG	uc001hyi.4	Q99707	OTTHUMG00000040060	ENST00000366577.5:c.2967G>C	1.37:g.237052596G>C			Somatic				MTR_uc010pxw.1_Silent_p.P582P|MTR_uc010pxx.1_Silent_p.P938P|MTR_uc010pxy.1_Silent_p.P843P	p.P989P	NM_000254	NP_000245	WXS	Illumina HiSeq	Unspecified	Q99707	METH_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0106)	KIRC - Kidney renal clear cell carcinoma(1967;0.248)	28	3390	+	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;2.79e-22)|all_epithelial(177;4.84e-14)|Breast(1374;0.00123)|Prostate(94;0.0181)|Lung SC(1967;0.0262)|Acute lymphoblastic leukemia(190;0.117)	989			AdoMet activation.		A1L4N8|A9Z1W4|B9EGF7|Q99713|Q99723	Silent	SNP	ENST00000366577.5	37	c.2967G>C	CCDS1614.1																																																																																				0.473	MTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096632.2	NM_000254		22	102	0	0	0	0.012319	0	22	102				
NLRP3	114548	broad.mit.edu	37	1	247587992	247587992	+	Missense_Mutation	SNP	G	G	C	rs180177496		TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr1:247587992G>C	ENST00000336119.3	+	3	1993	c.1247G>C	c.(1246-1248)tGg>tCg	p.W416S	NLRP3_ENST00000366497.2_Missense_Mutation_p.W416S|NLRP3_ENST00000348069.2_Missense_Mutation_p.W416S|NLRP3_ENST00000391828.3_Missense_Mutation_p.W416S|NLRP3_ENST00000474792.1_3'UTR|NLRP3_ENST00000366496.2_Missense_Mutation_p.W416S|NLRP3_ENST00000391827.2_Missense_Mutation_p.W416S	NM_001127462.2|NM_001243133.1|NM_004895.4	NP_001120934.1|NP_001230062.1|NP_004886.3	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3	416	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to lipopolysaccharide (GO:0071222)|defense response (GO:0006952)|defense response to virus (GO:0051607)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta production (GO:0032611)|interleukin-1 secretion (GO:0050701)|interleukin-18 production (GO:0032621)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta secretion (GO:0050713)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|NLRP3 inflammasome complex assembly (GO:0044546)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|NLRP3 inflammasome complex (GO:0072559)	ATP binding (GO:0005524)|peptidoglycan binding (GO:0042834)	p.W416S(1)		NS(1)|breast(3)|endometrium(6)|kidney(1)|large_intestine(19)|lung(85)|ovary(9)|pancreas(2)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	142	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			CTGGTCTGCTGGATCGTGTGC	0.547																																							uc001icr.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(8)|skin(8)|ovary(7)|upper_aerodigestive_tract(1)|breast(1)|pancreas(1)	26						c.(1246-1248)TGG>TCG		NLR family, pyrin domain containing 3 isoform a							105.0	83.0	91.0					1																	247587992		2203	4300	6503	SO:0001583	missense	114548				detection of biotic stimulus|induction of apoptosis|inflammatory response|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|positive regulation of interleukin-1 beta secretion|protein oligomerization|signal transduction	cytoplasm	ATP binding|peptidoglycan binding|protein binding	g.chr1:247587992G>C	AF054176	CCDS1632.1, CCDS1633.1, CCDS44346.1, CCDS44347.1	1q44	2014-09-17	2006-12-08	2006-12-08	ENSG00000162711	ENSG00000162711		"""Nucleotide-binding domain and leucine rich repeat containing"""	16400	protein-coding gene	gene with protein product	"""Cryopyrin"", ""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 3"""	606416	"""cold autoinflammatory syndrome 1"""	C1orf7, CIAS1		10741953	Standard	NM_183395		Approved	AGTAVPRL, AII, AVP, FCAS, FCU, NALP3, PYPAF1, MWS, CLR1.1	uc001icr.3	Q96P20	OTTHUMG00000040647	ENST00000336119.3:c.1247G>C	1.37:g.247587992G>C	ENSP00000337383:p.Trp416Ser		Somatic				NLRP3_uc001ics.2_Missense_Mutation_p.W416S|NLRP3_uc001icu.2_Missense_Mutation_p.W416S|NLRP3_uc001icw.2_Missense_Mutation_p.W416S|NLRP3_uc001icv.2_Missense_Mutation_p.W416S|NLRP3_uc010pyw.1_Missense_Mutation_p.W414S|NLRP3_uc001ict.1_Missense_Mutation_p.W414S	p.W416S	NM_001079821	NP_001073289	WXS	Illumina HiSeq	Unspecified	Q96P20	NALP3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0141)		5	1385	+	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	416			NACHT.		B2RC97|B7ZKS9|B7ZKT2|B7ZKT3|O75434|Q17RS2|Q59H68|Q5JQS8|Q5JQS9|Q6TG35|Q8TCW0|Q8TEU9|Q8WXH9	Missense_Mutation	SNP	ENST00000336119.3	37	c.1247G>C	CCDS1632.1	.	.	.	.	.	.	.	.	.	.	G	15.74	2.923068	0.52653	.	.	ENSG00000162711	ENST00000391828;ENST00000366497;ENST00000336119;ENST00000348069;ENST00000366496;ENST00000391827	D;D;D;D;D;D	0.85629	-2.01;-2.01;-2.01;-2.01;-2.01;-2.01	4.17	4.17	0.49024	NACHT nucleoside triphosphatase (1);	0.000000	0.49305	D	0.000144	D	0.91991	0.7463	M	0.85462	2.755	0.58432	D	0.999994	D;D;D;D;D	0.89917	0.996;1.0;1.0;0.999;0.995	D;D;D;D;D	0.97110	0.935;0.997;1.0;0.99;0.963	D	0.91848	0.5489	10	0.51188	T	0.08	.	12.2773	0.54744	0.0:0.0:1.0:0.0	.	416;416;416;416;416	B7ZKS9;Q96P20-4;Q96P20-2;Q96P20-5;Q96P20	.;.;.;.;NALP3_HUMAN	S	416	ENSP00000375704:W416S;ENSP00000355453:W416S;ENSP00000337383:W416S;ENSP00000294752:W416S;ENSP00000355452:W416S;ENSP00000375703:W416S	ENSP00000337383:W416S	W	+	2	0	NLRP3	245654615	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	4.508000	0.60441	2.612000	0.88384	0.655000	0.94253	TGG		0.547	NLRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097740.1	NM_004895		18	102	0	0	0	0.007413	0	18	102				
OR2M2	391194	broad.mit.edu	37	1	248343317	248343317	+	Silent	SNP	C	C	A	rs372047333		TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr1:248343317C>A	ENST00000359682.2	+	1	30	c.30C>A	c.(28-30)tcC>tcA	p.S10S		NM_001004688.1	NP_001004688.1	Q96R28	OR2M2_HUMAN	olfactory receptor, family 2, subfamily M, member 2	10						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S10S(2)		NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(45)|ovary(3)|prostate(1)|skin(3)	70	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			CCTTCAACTCCGACTTCATCC	0.433																																							uc010pzf.1		NA																	2	Substitution - coding silent(2)		lung(1)|endometrium(1)	ovary(3)|skin(1)	4						c.(28-30)TCC>TCA		olfactory receptor, family 2, subfamily M,							211.0	208.0	209.0					1																	248343317		2203	4300	6503	SO:0001819	synonymous_variant	391194				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248343317C>A	AF399616	CCDS31106.1	1q44	2012-08-09			ENSG00000198601	ENSG00000198601		"""GPCR / Class A : Olfactory receptors"""	8268	protein-coding gene	gene with protein product						12213199	Standard	NM_001004688		Approved	OST423, OR2M2Q	uc010pzf.2	Q96R28	OTTHUMG00000040460	ENST00000359682.2:c.30C>A	1.37:g.248343317C>A			Somatic					p.S10S	NM_001004688	NP_001004688	WXS	Illumina HiSeq	Unspecified	Q96R28	OR2M2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0245)		1	30	+	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		10			Extracellular (Potential).		A3KFT4	Silent	SNP	ENST00000359682.2	37	c.30C>A	CCDS31106.1																																																																																				0.433	OR2M2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097356.2	NM_001004688		29	138	1	0	2.85442e-18	0.010818	3.7327e-18	29	138				
MAPK8	5599	broad.mit.edu	37	10	49634457	49634457	+	Silent	SNP	G	G	T			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr10:49634457G>T	ENST00000374189.1	+	9	1087	c.906G>T	c.(904-906)ctG>ctT	p.L302L	MAPK8_ENST00000395611.3_Silent_p.L226L|MAPK8_ENST00000374182.3_Silent_p.L302L|MAPK8_ENST00000360332.3_Silent_p.L302L			P45983	MK08_HUMAN	mitogen-activated protein kinase 8	302	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to mechanical stimulus (GO:0071260)|cellular response to nitric oxide (GO:0071732)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|JNK cascade (GO:0007254)|JUN phosphorylation (GO:0007258)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein binding (GO:0032091)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of deacetylase activity (GO:0090045)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of gene expression (GO:0010628)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|programmed necrotic cell death (GO:0097300)|regulation of histone deacetylation (GO:0031063)|regulation of protein localization (GO:0032880)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|response to cadmium ion (GO:0046686)|response to stress (GO:0006950)|response to UV (GO:0009411)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|histone deacetylase binding (GO:0042826)|histone deacetylase regulator activity (GO:0035033)|JUN kinase activity (GO:0004705)|protein serine/threonine kinase activity (GO:0004674)	p.L302L(2)		breast(1)|central_nervous_system(3)|endometrium(4)|kidney(1)|large_intestine(6)|liver(3)|lung(11)|ovary(1)|skin(1)|stomach(1)|urinary_tract(2)	34		Ovarian(717;0.0221)|Lung SC(717;0.113)|all_neural(218;0.116)		Epithelial(53;3.46e-65)|Lung(62;0.125)		CCAAAATGCTGGTAATAGATG	0.358																																							uc009xnz.2		NA																	2	Substitution - coding silent(2)		lung(2)	central_nervous_system(3)|lung(2)|stomach(1)|ovary(1)|kidney(1)	8						c.(904-906)CTG>CTT		mitogen-activated protein kinase 8 isoform JNK1							100.0	95.0	97.0					10																	49634457		2203	4300	6503	SO:0001819	synonymous_variant	5599				activation of pro-apoptotic gene products|cellular response to mechanical stimulus|induction of apoptosis by intracellular signals|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of apoptosis|negative regulation of protein binding|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of deacetylase activity|regulation of protein localization|regulation of sequence-specific DNA binding transcription factor activity|response to UV|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|histone deacetylase binding|histone deacetylase regulator activity|JUN kinase activity|protein binding	g.chr10:49634457G>T	L26318	CCDS7223.1, CCDS7224.1, CCDS7225.1, CCDS7226.1, CCDS60527.1	10q11	2011-06-09			ENSG00000107643	ENSG00000107643	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinases"""	6881	protein-coding gene	gene with protein product	"""JUN N-terminal kinase"""	601158		PRKM8		8137421, 8654373	Standard	NM_002750		Approved	JNK, JNK1, SAPK1	uc001jgp.3	P45983	OTTHUMG00000018172	ENST00000374189.1:c.906G>T	10.37:g.49634457G>T			Somatic				MAPK8_uc001jgl.2_Silent_p.L302L|MAPK8_uc001jgm.2_Silent_p.L302L|MAPK8_uc001jgo.2_Silent_p.L302L|MAPK8_uc009xoa.2_Silent_p.L226L|MAPK8_uc001jgn.2_Silent_p.L302L|MAPK8_uc010qgk.1_Silent_p.L302L|MAPK8_uc001jgp.2_Silent_p.L302L|MAPK8_uc001jgq.2_Silent_p.L302L	p.L302L	NM_139047	NP_620635	WXS	Illumina HiSeq	Unspecified	P45983	MK08_HUMAN		Epithelial(53;3.46e-65)|Lung(62;0.125)	9	1130	+		Ovarian(717;0.0221)|Lung SC(717;0.113)|all_neural(218;0.116)	302			Protein kinase.		B5BTZ5|B7ZLV4|D3DX88|D3DX92|Q15709|Q15712|Q15713|Q308M2	Silent	SNP	ENST00000374189.1	37	c.906G>T	CCDS7224.1																																																																																				0.358	MAPK8-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047931.1			14	41	1	0	0.000422831	0.004007	0.000444627	14	41				
GLUD1	2746	broad.mit.edu	37	10	88819956	88819956	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr10:88819956C>G	ENST00000277865.4	-	9	1336	c.1240G>C	c.(1240-1242)Gac>Cac	p.D414H	GLUD1_ENST00000465164.1_5'Flank|GLUD1_ENST00000544149.1_Missense_Mutation_p.D281H|GLUD1_ENST00000537649.1_Missense_Mutation_p.D247H	NM_005271.3	NP_005262.1	P00367	DHE3_HUMAN	glutamate dehydrogenase 1	414					cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate biosynthetic process (GO:0006537)|glutamate catabolic process (GO:0006538)|glutamine metabolic process (GO:0006541)|positive regulation of insulin secretion (GO:0032024)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)|tricarboxylic acid metabolic process (GO:0072350)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|glutamate dehydrogenase (NAD+) activity (GO:0004352)|glutamate dehydrogenase [NAD(P)+] activity (GO:0004353)|GTP binding (GO:0005525)|identical protein binding (GO:0042802)|leucine binding (GO:0070728)|NAD+ binding (GO:0070403)	p.D414H(1)		endometrium(3)|kidney(2)|large_intestine(4)|liver(1)|lung(11)|prostate(1)	22					Hexachlorophene(DB00756)	AAGATCTTGTCAGCTTCTGGA	0.408																																							uc001keh.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1240-1242)GAC>CAC		glutamate dehydrogenase 1 precursor	L-Glutamic Acid(DB00142)|NADH(DB00157)						145.0	144.0	144.0					10																	88819956		2203	4296	6499	SO:0001583	missense	2746				glutamate biosynthetic process|glutamate catabolic process|positive regulation of insulin secretion	mitochondrial matrix	ADP binding|ATP binding|glutamate dehydrogenase|glutamate dehydrogenase activity|GTP binding|identical protein binding|leucine binding|NAD+ binding	g.chr10:88819956C>G	M20867	CCDS7382.1	10q23.2	2010-03-17			ENSG00000148672	ENSG00000148672	1.4.1.3		4335	protein-coding gene	gene with protein product		138130		GLUD		2757358	Standard	NM_005271		Approved	GDH	uc001keh.3	P00367	OTTHUMG00000018666	ENST00000277865.4:c.1240G>C	10.37:g.88819956C>G	ENSP00000277865:p.Asp414His		Somatic				GLUD1_uc001keg.2_Missense_Mutation_p.D247H|GLUD1_uc010qmp.1_Missense_Mutation_p.D281H	p.D414H	NM_005271	NP_005262	WXS	Illumina HiSeq	Unspecified	P00367	DHE3_HUMAN			9	1337	-			414					B3KV55|B4DGN5|Q5TBU3	Missense_Mutation	SNP	ENST00000277865.4	37	c.1240G>C	CCDS7382.1	.	.	.	.	.	.	.	.	.	.	C	18.91	3.723226	0.68959	.	.	ENSG00000148672	ENST00000277865;ENST00000394415;ENST00000537649;ENST00000535802;ENST00000513510;ENST00000544149	D;D;D	0.95238	-3.65;-3.65;-3.65	5.11	5.11	0.69529	Glutamate/phenylalanine/leucine/valine dehydrogenase, C-terminal (2);NAD(P)-binding domain (1);	0.046758	0.85682	D	0.000000	D	0.95790	0.8630	M	0.79805	2.47	0.80722	D	1	P;B	0.35714	0.517;0.218	B;B	0.43783	0.431;0.316	D	0.95776	0.8813	10	0.54805	T	0.06	.	18.9599	0.92674	0.0:1.0:0.0:0.0	.	281;414	B4DGN5;P00367	.;DHE3_HUMAN	H	414;371;247;113;346;281	ENSP00000277865:D414H;ENSP00000439291:D247H;ENSP00000444732:D281H	ENSP00000277865:D414H	D	-	1	0	GLUD1	88809936	1.000000	0.71417	0.982000	0.44146	0.988000	0.76386	7.441000	0.80485	2.541000	0.85698	0.558000	0.71614	GAC		0.408	GLUD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049188.1	NM_005271		19	114	0	0	0	0.012319	0	19	114				
PDCD11	22984	broad.mit.edu	37	10	105169541	105169541	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr10:105169541G>T	ENST00000369797.3	+	8	1050	c.956G>T	c.(955-957)gGa>gTa	p.G319V		NM_014976.1	NP_055791.1	Q14690	RRP5_HUMAN	programmed cell death 11	319	S1 motif 3. {ECO:0000255|PROSITE- ProRule:PRU00180}.				mRNA processing (GO:0006397)|rRNA processing (GO:0006364)	cytosol (GO:0005829)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)	p.G319V(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	64		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)		AAGAAAGCTGGAACATATTTC	0.433																																							uc001kwy.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|breast(2)|skin(2)|central_nervous_system(1)	7						c.(955-957)GGA>GTA		programmed cell death 11							115.0	108.0	110.0					10																	105169541		2203	4300	6503	SO:0001583	missense	22984				mRNA processing|rRNA processing	nucleolus	RNA binding|transcription factor binding	g.chr10:105169541G>T	D80007	CCDS31276.1	10q24.32	2010-07-06			ENSG00000148843	ENSG00000148843			13408	protein-coding gene	gene with protein product		612333				10229231	Standard	XM_005269647		Approved	KIAA0185, ALG-4, RRP5	uc001kwy.1	Q14690	OTTHUMG00000018988	ENST00000369797.3:c.956G>T	10.37:g.105169541G>T	ENSP00000358812:p.Gly319Val		Somatic					p.G319V	NM_014976	NP_055791	WXS	Illumina HiSeq	Unspecified	Q14690	RRP5_HUMAN		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)	8	1043	+		Colorectal(252;0.0747)|Breast(234;0.128)	319			S1 motif 3.		Q2TA92|Q5W093|Q6P2J3|Q86VQ8|Q9H4P1	Missense_Mutation	SNP	ENST00000369797.3	37	c.956G>T	CCDS31276.1	.	.	.	.	.	.	.	.	.	.	G	16.55	3.153440	0.57259	.	.	ENSG00000148843	ENST00000369797;ENST00000543503	T	0.17213	2.29	5.32	4.4	0.53042	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);RNA-binding domain, S1 (1);Ribosomal protein S1, RNA-binding domain (1);	0.562613	0.19797	N	0.105836	T	0.15696	0.0378	L	0.57536	1.79	0.23685	N	0.997111	B	0.33964	0.434	B	0.31442	0.13	T	0.14117	-1.0484	10	0.46703	T	0.11	-8.9192	6.8029	0.23762	0.0725:0.128:0.6674:0.1322	.	319	Q14690	RRP5_HUMAN	V	319	ENSP00000358812:G319V	ENSP00000358812:G319V	G	+	2	0	PDCD11	105159531	0.413000	0.25400	0.822000	0.32727	0.986000	0.74619	2.475000	0.45162	2.648000	0.89879	0.561000	0.74099	GGA		0.433	PDCD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050151.1			29	118	1	0	6.70999e-13	0.004289	8.34657e-13	29	118				
MICAL2	9645	broad.mit.edu	37	11	12281439	12281439	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr11:12281439C>T	ENST00000256194.4	+	26	3617	c.3329C>T	c.(3328-3330)cCc>cTc	p.P1110L	RP11-265D17.2_ENST00000527288.1_RNA|MICAL2_ENST00000537344.1_Missense_Mutation_p.P920L|MICAL2_ENST00000342902.5_Missense_Mutation_p.P1089L|MICAL2_ENST00000527546.1_Missense_Mutation_p.P920L|MICAL2_ENST00000379612.3_Missense_Mutation_p.P884L	NM_001282663.1|NM_014632.2	NP_001269592.1|NP_055447.1	O94851	MICA2_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 2	1110			P -> S (in dbSNP:rs35518829).		actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|heart development (GO:0007507)|heart looping (GO:0001947)|oxidation-reduction process (GO:0055114)|positive regulation of transcription via serum response element binding (GO:0010735)|sulfur oxidation (GO:0019417)	nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|NADPH:sulfur oxidoreductase activity (GO:0043914)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)	p.P1110L(1)		breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	47				Epithelial(150;0.00552)		GAAGGCAGCCCCCCAGGTATC	0.622																																							uc001mjz.2		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(2)	2						c.(3328-3330)CCC>CTC		microtubule associated monoxygenase, calponin							34.0	34.0	34.0					11																	12281439		2201	4294	6495	SO:0001583	missense	9645					cytoplasm|cytoskeleton	monooxygenase activity|zinc ion binding	g.chr11:12281439C>T	AB018293	CCDS7809.1, CCDS60726.1, CCDS60727.1, CCDS60728.1	11p15.3	2014-08-12	2013-03-26		ENSG00000133816	ENSG00000133816			24693	protein-coding gene	gene with protein product		608881				12110185	Standard	XM_005253249		Approved	KIAA0750	uc001mjz.3	O94851	OTTHUMG00000165744	ENST00000256194.4:c.3329C>T	11.37:g.12281439C>T	ENSP00000256194:p.Pro1110Leu		Somatic				MICAL2_uc010rch.1_Missense_Mutation_p.P920L|MICAL2_uc001mka.2_Missense_Mutation_p.P1110L|MICAL2_uc010rci.1_Missense_Mutation_p.P1089L|MICAL2_uc001mkb.2_Missense_Mutation_p.P884L|MICAL2_uc001mkc.2_Missense_Mutation_p.P863L|MICAL2_uc001mkd.2_Missense_Mutation_p.P692L|MICAL2_uc010rcj.1_Missense_Mutation_p.P322L|MICAL2_uc001mkf.2_RNA	p.P1110L	NM_014632	NP_055447	WXS	Illumina HiSeq	Unspecified	O94851	MICA2_HUMAN		Epithelial(150;0.00552)	26	3617	+			1110					B4DGZ0|B7Z849|D3DQW5|G3XAC8|Q5KTR3|Q5KTR4|Q7Z3A8	Missense_Mutation	SNP	ENST00000256194.4	37	c.3329C>T	CCDS7809.1	.	.	.	.	.	.	.	.	.	.	C	19.66	3.869735	0.72065	.	.	ENSG00000133816	ENST00000537344;ENST00000544073;ENST00000256194;ENST00000527546;ENST00000342902;ENST00000379612	T;T;T;T;T	0.62498	0.04;0.06;0.04;0.07;0.02	5.56	5.56	0.83823	.	0.359570	0.24301	N	0.039725	T	0.67211	0.2869	L	0.27053	0.805	0.49051	D	0.999747	D;P;P;P;P;D	0.63880	0.993;0.873;0.799;0.565;0.933;0.961	P;P;B;B;B;P	0.58520	0.84;0.599;0.162;0.114;0.357;0.617	T	0.70066	-0.4974	10	0.62326	D	0.03	.	19.1126	0.93323	0.0:1.0:0.0:0.0	.	453;1089;920;863;884;1110	B4DYS3;G3XAC8;B7Z849;Q5KTR3;Q5KTR4;O94851	.;.;.;.;.;MICA2_HUMAN	L	920;453;1110;920;1089;884	ENSP00000441689:P920L;ENSP00000256194:P1110L;ENSP00000433965:P920L;ENSP00000344894:P1089L;ENSP00000368932:P884L	ENSP00000256194:P1110L	P	+	2	0	MICAL2	12238015	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	4.117000	0.57877	2.594000	0.87642	0.591000	0.81541	CCC		0.622	MICAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385993.1	NM_014632		5	37	0	0	0	0.006214	0	5	37				
SPTY2D1	144108	broad.mit.edu	37	11	18637496	18637496	+	Nonsense_Mutation	SNP	G	G	A			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr11:18637496G>A	ENST00000336349.5	-	3	560	c.325C>T	c.(325-327)Cag>Tag	p.Q109*	SPTY2D1_ENST00000543776.1_5'UTR	NM_194285.2	NP_919261.2	Q68D10	SPT2_HUMAN	SPT2, Suppressor of Ty, domain containing 1 (S. cerevisiae)	109								p.Q109*(1)		breast(4)|cervix(3)|endometrium(2)|kidney(3)|large_intestine(7)|lung(9)|skin(1)|stomach(1)	30						TCTGTTGCCTGCCTCTTCTTT	0.448																																							uc001moy.2		NA																	1	Substitution - Nonsense(1)		lung(1)	breast(1)	1						c.(325-327)CAG>TAG		SPT2, Suppressor of Ty, domain containing 1							204.0	190.0	195.0					11																	18637496		2199	4293	6492	SO:0001587	stop_gained	144108							g.chr11:18637496G>A	BX647798	CCDS31441.1	11p15.1	2005-10-28			ENSG00000179119	ENSG00000179119			26818	protein-coding gene	gene with protein product							Standard	NM_194285		Approved	FLJ39441, DKFZp686I068	uc001moy.3	Q68D10	OTTHUMG00000167733	ENST00000336349.5:c.325C>T	11.37:g.18637496G>A	ENSP00000337991:p.Gln109*		Somatic				SPTY2D1_uc010rdi.1_Nonsense_Mutation_p.Q109*	p.Q109*	NM_194285	NP_919261	WXS	Illumina HiSeq	Unspecified	Q68D10	SPT2_HUMAN			3	541	-			109					Q6AWA5|Q6MZI5|Q7Z390|Q7Z470|Q86VG8|Q8N3E7|Q8N417|Q8N8I3	Nonsense_Mutation	SNP	ENST00000336349.5	37	c.325C>T	CCDS31441.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.428785	0.83667	.	.	ENSG00000179119	ENST00000336349;ENST00000333429	.	.	.	5.63	4.7	0.59300	.	0.493479	0.21254	N	0.077586	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08837	T	0.75	-0.8602	10.2411	0.43312	0.0:0.1212:0.6202:0.2587	.	.	.	.	X	109	.	ENSP00000331447:Q109X	Q	-	1	0	SPTY2D1	18594072	0.987000	0.35691	0.955000	0.39395	0.990000	0.78478	2.814000	0.48010	1.334000	0.45468	0.563000	0.77884	CAG		0.448	SPTY2D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395941.1	NM_194285		34	144	0	0	0	0.004878	0	34	144				
SLC17A6	57084	broad.mit.edu	37	11	22363306	22363306	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr11:22363306G>T	ENST00000263160.3	+	2	756	c.319G>T	c.(319-321)Ggg>Tgg	p.G107W		NM_020346.2	NP_065079.1	Q9P2U8	VGLU2_HUMAN	solute carrier family 17 (vesicular glutamate transporter), member 6	107					ion transport (GO:0006811)|neurotransmitter uptake (GO:0001504)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|synaptic vesicle membrane (GO:0030672)	L-glutamate transmembrane transporter activity (GO:0005313)|symporter activity (GO:0015293)	p.G107W(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(28)|ovary(3)|skin(4)|upper_aerodigestive_tract(3)	50						CATCCACCGCGGGGGCAAGGT	0.632																																							uc001mqk.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|breast(1)	4						c.(319-321)GGG>TGG		solute carrier family 17 (sodium-dependent							63.0	53.0	56.0					11																	22363306		2203	4300	6503	SO:0001583	missense	57084				sodium ion transport	cell junction|integral to membrane|synaptic vesicle membrane|synaptosome	L-glutamate transmembrane transporter activity|symporter activity	g.chr11:22363306G>T	AB032435	CCDS7856.1	11p14.3	2013-07-18	2013-07-18		ENSG00000091664	ENSG00000091664		"""Solute carriers"""	16703	protein-coding gene	gene with protein product	"""vesicular glutamate transporter 2"", ""differentiation-associated Na-dependent inorganic phosphate cotransporter"""	607563	"""solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6"""			11306821	Standard	NM_020346		Approved	DNPI, VGLUT2	uc001mqk.3	Q9P2U8	OTTHUMG00000166063	ENST00000263160.3:c.319G>T	11.37:g.22363306G>T	ENSP00000263160:p.Gly107Trp		Somatic					p.G107W	NM_020346	NP_065079	WXS	Illumina HiSeq	Unspecified	Q9P2U8	VGLU2_HUMAN			2	732	+			107			Vesicular (Potential).		A6NKS2	Missense_Mutation	SNP	ENST00000263160.3	37	c.319G>T	CCDS7856.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.178662	0.78564	.	.	ENSG00000091664	ENST00000263160	T	0.62364	0.03	5.87	5.87	0.94306	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.096296	0.64402	D	0.000001	T	0.76905	0.4053	L	0.61387	1.9	0.58432	D	0.999994	D	0.64830	0.994	D	0.71184	0.972	T	0.77968	-0.2388	10	0.87932	D	0	.	16.4984	0.84251	0.0:0.0:0.8687:0.1313	.	107	Q9P2U8	VGLU2_HUMAN	W	107	ENSP00000263160:G107W	ENSP00000263160:G107W	G	+	1	0	SLC17A6	22319882	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.445000	0.73456	2.785000	0.95823	0.655000	0.94253	GGG		0.632	SLC17A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387671.1	NM_020346		21	83	1	0	3.73808e-20	0.005443	4.95175e-20	21	83				
BBOX1	8424	broad.mit.edu	37	11	27148881	27148881	+	Silent	SNP	C	C	A	rs200897398		TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr11:27148881C>A	ENST00000529202.1	+	8	1384	c.1045C>A	c.(1045-1047)Cga>Aga	p.R349R	BBOX1_ENST00000263182.3_Silent_p.R349R|BBOX1_ENST00000528583.1_Silent_p.R349R|RP11-1L12.3_ENST00000530430.1_RNA|RP11-1L12.3_ENST00000525302.1_RNA|RP11-1L12.3_ENST00000526061.1_RNA|BBOX1_ENST00000525090.1_Silent_p.R349R			O75936	BODG_HUMAN	butyrobetaine (gamma), 2-oxoglutarate dioxygenase (gamma-butyrobetaine hydroxylase) 1	349					carnitine biosynthetic process (GO:0045329)|cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	gamma-butyrobetaine dioxygenase activity (GO:0008336)|iron ion binding (GO:0005506)|zinc ion binding (GO:0008270)	p.R349R(1)		breast(1)|kidney(3)|large_intestine(3)|lung(10)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	23					Succinic acid(DB00139)|Vitamin C(DB00126)	ACTTCATGGCCGACGTAGCTA	0.408																																							uc001mre.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(1045-1047)CGA>AGA		gamma-butyrobetaine dioxygenase	Succinic acid(DB00139)|Vitamin C(DB00126)						126.0	110.0	116.0					11																	27148881		2202	4299	6501	SO:0001819	synonymous_variant	8424				carnitine biosynthetic process	actin cytoskeleton|cytosol|intracellular membrane-bounded organelle	gamma-butyrobetaine dioxygenase activity|iron ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding	g.chr11:27148881C>A	AF082868	CCDS7862.1	11p	2008-02-01			ENSG00000129151	ENSG00000129151	1.14.11.1		964	protein-coding gene	gene with protein product		603312		BBOX		9753662	Standard	XM_005253159		Approved	gamma-BBH, G-BBH, BBH	uc001mre.1	O75936	OTTHUMG00000166121	ENST00000529202.1:c.1045C>A	11.37:g.27148881C>A			Somatic				BBOX1_uc009yih.1_Silent_p.R349R|BBOX1_uc001mrg.1_Silent_p.R349R	p.R349R	NM_003986	NP_003977	WXS	Illumina HiSeq	Unspecified	O75936	BODG_HUMAN			9	1413	+			349					B2R8L7|D3DQZ1|Q6IBJ2	Silent	SNP	ENST00000529202.1	37	c.1045C>A	CCDS7862.1																																																																																				0.408	BBOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387946.1	NM_003986		14	89	1	0	1.15088e-07	0.004007	1.32644e-07	14	89				
TNKS1BP1	85456	broad.mit.edu	37	11	57087739	57087739	+	Missense_Mutation	SNP	C	C	A	rs142187077	byFrequency	TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr11:57087739C>A	ENST00000532437.1	-	2	853	c.542G>T	c.(541-543)cGc>cTc	p.R181L	TNKS1BP1_ENST00000358252.3_Missense_Mutation_p.R181L			Q9C0C2	TB182_HUMAN	tankyrase 1 binding protein 1, 182kDa	181	Pro-rich.				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|RNA metabolic process (GO:0016070)|telomere maintenance via telomerase (GO:0007004)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nuclear telomeric heterochromatin (GO:0005724)|nucleus (GO:0005634)	ankyrin binding (GO:0030506)|enzyme binding (GO:0019899)	p.R181L(1)		breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(24)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	64		all_epithelial(135;0.21)				ACCCCACAGGCGGTCGGGGCT	0.652																																							uc001njr.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(541-543)CGC>CTC		tankyrase 1-binding protein 1							55.0	60.0	58.0					11																	57087739		2201	4296	6497	SO:0001583	missense	85456				nuclear-transcribed mRNA poly(A) tail shortening|telomere maintenance via telomerase	cytoskeleton|cytosol|nuclear telomeric heterochromatin	ankyrin binding|enzyme binding	g.chr11:57087739C>A	AB051528	CCDS7951.1	11q12.2	2008-07-21			ENSG00000149115	ENSG00000149115			19081	protein-coding gene	gene with protein product		607104				11854288	Standard	NM_033396		Approved	TAB182, KIAA1741, FLJ45975	uc001njs.3	Q9C0C2	OTTHUMG00000167022	ENST00000532437.1:c.542G>T	11.37:g.57087739C>A	ENSP00000437271:p.Arg181Leu		Somatic				TNKS1BP1_uc001njs.2_Missense_Mutation_p.R181L|TNKS1BP1_uc009ymd.1_5'UTR	p.R181L	NM_033396	NP_203754	WXS	Illumina HiSeq	Unspecified	Q9C0C2	TB182_HUMAN			2	854	-		all_epithelial(135;0.21)	181			Pro-rich.		A7E2F8|Q6PJ35|Q6ZV74	Missense_Mutation	SNP	ENST00000532437.1	37	c.542G>T	CCDS7951.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.467562	0.84533	.	.	ENSG00000149115	ENST00000358252;ENST00000532437	T;T	0.38722	1.12;1.12	4.47	4.47	0.54385	.	0.000000	0.34200	N	0.004163	T	0.49779	0.1577	N	0.24115	0.695	0.33407	D	0.5781	D	0.89917	1.0	D	0.91635	0.999	T	0.60707	-0.7210	10	0.44086	T	0.13	-13.9993	15.0926	0.72207	0.0:1.0:0.0:0.0	.	181	Q9C0C2	TB182_HUMAN	L	181	ENSP00000350990:R181L;ENSP00000437271:R181L	ENSP00000350990:R181L	R	-	2	0	TNKS1BP1	56844315	0.998000	0.40836	1.000000	0.80357	0.947000	0.59692	0.980000	0.29513	2.284000	0.76573	0.462000	0.41574	CGC		0.652	TNKS1BP1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392455.1	NM_033396		21	83	1	0	4.40665e-25	0.009535	6.19969e-25	21	83				
UBE2L6	9246	broad.mit.edu	37	11	57319895	57319895	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr11:57319895G>A	ENST00000287156.4	-	4	593	c.398C>T	c.(397-399)cCg>cTg	p.P133L	UBE2L6_ENST00000340573.4_Missense_Mutation_p.P67L	NM_004223.4	NP_004214.1	O14933	UB2L6_HUMAN	ubiquitin-conjugating enzyme E2L 6	133					cellular protein modification process (GO:0006464)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|ISG15-protein conjugation (GO:0032020)|modification-dependent protein catabolic process (GO:0019941)|negative regulation of type I interferon production (GO:0032480)	cytosol (GO:0005829)	ISG15 ligase activity (GO:0042296)|ubiquitin-protein transferase activity (GO:0004842)	p.P133L(1)		large_intestine(1)|lung(3)|ovary(1)	5						GAACAGCTCCGGATTCTGTGT	0.577																																							uc001nkn.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(397-399)CCG>CTG		ubiquitin-conjugating enzyme E2L 6 isoform 1							173.0	165.0	168.0					11																	57319895		2201	4296	6497	SO:0001583	missense	9246				negative regulation of type I interferon production	cytosol	protein binding|ubiquitin-protein ligase activity	g.chr11:57319895G>A	AF031141, AK093462, BC032491	CCDS7960.1, CCDS7961.1	11q12.1	2008-02-01			ENSG00000156587	ENSG00000156587		"""Ubiquitin-conjugating enzymes E2"""	12490	protein-coding gene	gene with protein product		603890				9153201	Standard	NM_004223		Approved	UBCH8	uc001nkn.2	O14933	OTTHUMG00000167047	ENST00000287156.4:c.398C>T	11.37:g.57319895G>A	ENSP00000287156:p.Pro133Leu		Somatic				UBE2L6_uc001nko.1_Missense_Mutation_p.P67L	p.P133L	NM_004223	NP_004214	WXS	Illumina HiSeq	Unspecified	O14933	UB2L6_HUMAN			4	494	-			133					A6NDM6|A8MY53|Q8N5D8|Q9UEZ0	Missense_Mutation	SNP	ENST00000287156.4	37	c.398C>T	CCDS7960.1	.	.	.	.	.	.	.	.	.	.	G	17.59	3.426234	0.62733	.	.	ENSG00000156587	ENST00000340573;ENST00000287156	T;T	0.37915	1.17;1.17	5.52	3.59	0.41128	Ubiquitin-conjugating enzyme, E2 (2);Ubiquitin-conjugating enzyme/RWD-like (2);	0.170673	0.28521	N	0.015046	T	0.32285	0.0824	L	0.61036	1.89	0.47584	D	0.999469	B	0.23316	0.083	B	0.26864	0.074	T	0.32745	-0.9895	10	0.66056	D	0.02	.	4.2196	0.10551	0.0816:0.2969:0.4681:0.1534	.	133	O14933	UB2L6_HUMAN	L	67;133	ENSP00000341980:P67L;ENSP00000287156:P133L	ENSP00000287156:P133L	P	-	2	0	UBE2L6	57076471	0.393000	0.25237	0.394000	0.26270	0.257000	0.26127	1.000000	0.29770	1.436000	0.47453	0.655000	0.94253	CCG		0.577	UBE2L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392657.1	NM_004223		73	272	0	0	0	0.00361	0	73	272				
EHBP1L1	254102	broad.mit.edu	37	11	65351973	65351973	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr11:65351973G>A	ENST00000309295.4	+	11	3533	c.3268G>A	c.(3268-3270)Gac>Aac	p.D1090N		NM_001099409.1	NP_001092879.1	Q8N3D4	EH1L1_HUMAN	EH domain binding protein 1-like 1	1090	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.					membrane (GO:0016020)		p.D1090N(1)		central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	23						TGCCTCGCTAGACCCACTCAA	0.597																																							uc001oeo.3		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(3268-3270)GAC>AAC		tangerin							33.0	36.0	35.0					11																	65351973		2142	4242	6384	SO:0001583	missense	254102							g.chr11:65351973G>A	AL834433	CCDS44649.1	11q13.1	2008-02-05			ENSG00000173442	ENSG00000173442			30682	protein-coding gene	gene with protein product							Standard	NM_001099409		Approved	DKFZp762C186, TANGERIN	uc001oeo.4	Q8N3D4	OTTHUMG00000166520	ENST00000309295.4:c.3268G>A	11.37:g.65351973G>A	ENSP00000312671:p.Asp1090Asn		Somatic				EHBP1L1_uc001oep.1_Missense_Mutation_p.D110N	p.D1090N	NM_001099409	NP_001092879	WXS	Illumina HiSeq	Unspecified	Q8N3D4	EH1L1_HUMAN			11	3533	+			1090			CH.		Q8TB89|Q9H7M7	Missense_Mutation	SNP	ENST00000309295.4	37	c.3268G>A	CCDS44649.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.93|12.93	2.086828|2.086828	0.36855|0.36855	.|.	.|.	ENSG00000173442|ENSG00000173442	ENST00000309295;ENST00000533237|ENST00000533465	T;T|.	0.19250|.	2.16;2.16|.	5.31|5.31	3.39|3.39	0.38822|0.38822	Calponin homology domain (5);|.	0.063428|.	0.56097|.	N|.	0.000025|.	T|T	0.40791|0.40791	0.1131|0.1131	N|N	0.25426|0.25426	0.745|0.745	0.80722|0.80722	D|D	1|1	B;B|.	0.30973|.	0.302;0.1|.	B;B|.	0.31290|.	0.127;0.066|.	T|T	0.10847|0.10847	-1.0612|-1.0612	10|5	0.26408|.	T|.	0.33|.	.|.	7.1653|7.1653	0.25687|0.25687	0.2908:0.0:0.7092:0.0|0.2908:0.0:0.7092:0.0	.|.	507;1090|.	E9PIH6;Q8N3D4|.	.;EH1L1_HUMAN|.	N|K	1090;507|139	ENSP00000312671:D1090N;ENSP00000431996:D507N|.	ENSP00000312671:D1090N|.	D|R	+|+	1|2	0|0	EHBP1L1|EHBP1L1	65108549|65108549	0.966000|0.966000	0.33281|0.33281	0.859000|0.859000	0.33776|0.33776	0.803000|0.803000	0.45373|0.45373	2.046000|2.046000	0.41260|0.41260	0.601000|0.601000	0.29879|0.29879	0.561000|0.561000	0.74099|0.74099	GAC|AGA		0.597	EHBP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390145.1	XM_170658		11	23	0	0	0	0.001368	0	11	23				
DNAJB13	374407	broad.mit.edu	37	11	73662017	73662017	+	5'UTR	SNP	G	G	A			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr11:73662017G>A	ENST00000339764.1	+	0	654					NM_153614.2	NP_705842.2	P59910	DJB13_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 13						protein folding (GO:0006457)					large_intestine(3)|lung(2)	5	Breast(11;7.42e-05)					AACTCCCAGAGTGCACCTGTG	0.557																																							uc001ouo.2		NA																	0					0						c.(-99--95)GAGTG>GAATG		testis spermatogenesis apoptosis-related protein																																				SO:0001623	5_prime_UTR_variant	374407				apoptosis|protein folding|spermatogenesis		heat shock protein binding|unfolded protein binding	g.chr11:73662017G>A	AF516185	CCDS8227.1	11q13.3	2011-09-02	2010-04-21		ENSG00000187726	ENSG00000187726		"""Heat shock proteins / DNAJ (HSP40)"""	30718	protein-coding gene	gene with protein product	"""radial spoke 16 homolog A (Chlamydomonas)"""	610263	"""DnaJ (Hsp40) related, subfamily B, member 13"""				Standard	NM_153614		Approved	TSARG6, RSPH16A	uc001ouo.3	P59910	OTTHUMG00000168093	ENST00000339764.1:c.-98G>A	11.37:g.73662017G>A			Somatic						NM_153614	NP_705842	WXS	Illumina HiSeq	Unspecified	P59910	DJB13_HUMAN			1	654	+	Breast(11;7.42e-05)							B3LEP4|Q8IZW5	Translation_Start_Site	SNP	ENST00000339764.1	37	c.-97G>A	CCDS8227.1																																																																																				0.557	DNAJB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398100.1	NM_153614		3	10	0	0	0	0.004672	0	3	10				
PPME1	51400	broad.mit.edu	37	11	73950294	73950294	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr11:73950294A>G	ENST00000328257.8	+	9	1150	c.827A>G	c.(826-828)gAc>gGc	p.D276G	P4HA3_ENST00000540363.1_Intron|PPME1_ENST00000543525.1_Missense_Mutation_p.D89G|PPME1_ENST00000398427.4_Missense_Mutation_p.D276G			Q9Y570	PPME1_HUMAN	protein phosphatase methylesterase 1	276					negative regulation of catalytic activity (GO:0043086)|protein demethylation (GO:0006482)|regulation of catalytic activity (GO:0050790)		protein C-terminal methylesterase activity (GO:0051722)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|protein phosphatase inhibitor activity (GO:0004864)|protein phosphatase type 2A regulator activity (GO:0008601)	p.D276G(1)		endometrium(1)|large_intestine(2)|lung(2)	5	Breast(11;3.29e-05)					AAGGAAGATGACATGGAGGTG	0.403																																							uc001ouw.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(826-828)GAC>GGC		protein phosphatase methylesterase 1							112.0	114.0	113.0					11																	73950294		1920	4117	6037	SO:0001583	missense	51400				protein demethylation		carboxylesterase activity|protein C-terminal methylesterase activity|protein phosphatase 2A binding|protein phosphatase inhibitor activity|protein phosphatase type 2A regulator activity	g.chr11:73950294A>G		CCDS44678.1, CCDS60891.1	11q13.4	2014-03-14			ENSG00000214517	ENSG00000214517	3.1.1.89		30178	protein-coding gene	gene with protein product		611117				10318862	Standard	NM_016147		Approved	PME-1	uc009yty.4	Q9Y570	OTTHUMG00000168115	ENST00000328257.8:c.827A>G	11.37:g.73950294A>G	ENSP00000329867:p.Asp276Gly		Somatic				PPME1_uc009yty.2_Missense_Mutation_p.D146G|PPME1_uc001oux.2_Missense_Mutation_p.D89G	p.D276G	NM_016147	NP_057231	WXS	Illumina HiSeq	Unspecified	Q9Y570	PPME1_HUMAN			9	926	+	Breast(11;3.29e-05)		276					B3KMU6|B5MEE7|J3QT22|Q8WYG8|Q9NVT5|Q9UI18	Missense_Mutation	SNP	ENST00000328257.8	37	c.827A>G	CCDS44678.1	.	.	.	.	.	.	.	.	.	.	A	14.98	2.696498	0.48202	.	.	ENSG00000214517	ENST00000328257;ENST00000398427;ENST00000543525	T;T	0.68331	-0.2;-0.32	5.59	4.45	0.53987	.	0.086995	0.85682	N	0.000000	T	0.57021	0.2025	L	0.48642	1.525	0.80722	D	1	B;B	0.09022	0.0;0.002	B;B	0.12156	0.002;0.007	T	0.49661	-0.8916	10	0.22109	T	0.4	-20.413	11.0636	0.47961	0.9264:0.0:0.0736:0.0	.	89;276	Q9Y570-2;Q9Y570	.;PPME1_HUMAN	G	276;276;89	ENSP00000329867:D276G;ENSP00000381461:D276G	ENSP00000329867:D276G	D	+	2	0	PPME1	73627942	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.584000	0.74057	0.959000	0.37980	0.533000	0.62120	GAC		0.403	PPME1-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398254.1	NM_016147		10	41	0	0	0	0.008291	0	10	41				
RSF1	51773	broad.mit.edu	37	11	77412022	77412022	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr11:77412022T>A	ENST00000308488.6	-	6	2554	c.2252A>T	c.(2251-2253)aAa>aTa	p.K751I	RSF1_ENST00000480887.1_Missense_Mutation_p.K499I|RSF1_ENST00000360355.2_Missense_Mutation_p.K720I			Q96T23	RSF1_HUMAN	remodeling and spacing factor 1	751					CENP-A containing nucleosome assembly (GO:0034080)|chromatin remodeling (GO:0006338)|DNA-templated transcription, initiation (GO:0006352)|negative regulation of DNA binding (GO:0043392)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral transcription (GO:0050434)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|RSF complex (GO:0031213)	histone binding (GO:0042393)|zinc ion binding (GO:0008270)	p.K751I(1)		breast(3)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(9)|lung(14)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	43	all_cancers(14;1.54e-17)|all_epithelial(13;4.06e-20)|Ovarian(111;0.152)		Epithelial(5;3e-50)|all cancers(3;6.37e-47)|BRCA - Breast invasive adenocarcinoma(5;9.82e-31)			TTCTAGAACTTTGGGGGGAGA	0.413																																							uc001oyn.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(2)	4						c.(2251-2253)AAA>ATA		remodeling and spacing factor 1							150.0	158.0	155.0					11																	77412022		2200	4292	6492	SO:0001583	missense	51773				CenH3-containing nucleosome assembly at centromere|negative regulation of DNA binding|negative regulation of transcription, DNA-dependent|nucleosome positioning|positive regulation of transcription, DNA-dependent|positive regulation of viral transcription|transcription initiation, DNA-dependent	RSF complex	histone binding|protein binding|zinc ion binding	g.chr11:77412022T>A	AF380176, AF227948	CCDS8253.1	11q14.1	2013-01-28	2006-05-25	2006-05-25	ENSG00000048649	ENSG00000048649		"""Zinc fingers, PHD-type"""	18118	protein-coding gene	gene with protein product		608522	"""hepatitis B virus x associated protein"""	HBXAP		11788598, 12972596	Standard	NM_016578		Approved	XAP8, RSF-1, p325	uc001oyn.3	Q96T23	OTTHUMG00000150433	ENST00000308488.6:c.2252A>T	11.37:g.77412022T>A	ENSP00000311513:p.Lys751Ile		Somatic				RSF1_uc001oym.2_Missense_Mutation_p.K499I	p.K751I	NM_016578	NP_057662	WXS	Illumina HiSeq	Unspecified	Q96T23	RSF1_HUMAN	Epithelial(5;3e-50)|all cancers(3;6.37e-47)|BRCA - Breast invasive adenocarcinoma(5;9.82e-31)		6	2372	-	all_cancers(14;1.54e-17)|all_epithelial(13;4.06e-20)|Ovarian(111;0.152)		751					Q86X86|Q9H3L8|Q9NVZ8|Q9NYU0	Missense_Mutation	SNP	ENST00000308488.6	37	c.2252A>T	CCDS8253.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	10.74|10.74	1.434667|1.434667	0.25813|0.25813	.|.	.|.	ENSG00000048649|ENSG00000048649	ENST00000308488;ENST00000480887;ENST00000360355;ENST00000526324|ENST00000532556	D;D;D;D|.	0.86562|.	-2.14;-2.14;-2.14;-2.14|.	5.81|5.81	4.67|4.67	0.58626|0.58626	.|.	0.553950|0.553950	0.16428|0.16428	N|N	0.214826|0.214826	T|.	0.33294|.	0.0858|.	L|L	0.27053|0.27053	0.805|0.805	0.09310|0.09310	N|N	1|1	B|.	0.29085|.	0.232|.	B|.	0.27170|.	0.077|.	T|.	0.18777|.	-1.0326|.	10|.	0.72032|.	D|.	0.01|.	-7.1802|-7.1802	10.0253|10.0253	0.42068|0.42068	0.0:0.0:0.1697:0.8303|0.0:0.0:0.1697:0.8303	.|.	751|.	Q96T23|.	RSF1_HUMAN|.	I|X	751;499;720;552|8	ENSP00000311513:K751I;ENSP00000434509:K499I;ENSP00000353511:K720I;ENSP00000432022:K552I|.	ENSP00000311513:K751I|.	K|K	-|-	2|1	0|0	RSF1|RSF1	77089670|77089670	0.290000|0.290000	0.24343|0.24343	0.929000|0.929000	0.37066|0.37066	0.615000|0.615000	0.37417|0.37417	1.993000|1.993000	0.40747|0.40747	1.016000|1.016000	0.39470|0.39470	-0.323000|-0.323000	0.08544|0.08544	AAA|AAG		0.413	RSF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318075.2	NM_016578		73	229	0	0	0	0.00361	0	73	229				
CNTN5	53942	broad.mit.edu	37	11	99715850	99715850	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr11:99715850G>A	ENST00000524871.1	+	6	723	c.433G>A	c.(433-435)Gaa>Aaa	p.E145K	CNTN5_ENST00000527185.1_Missense_Mutation_p.E145K|CNTN5_ENST00000279463.3_Missense_Mutation_p.E145K|CNTN5_ENST00000528682.1_Missense_Mutation_p.E145K|CNTN5_ENST00000418526.2_Missense_Mutation_p.E71K	NM_014361.3	NP_055176.1	O94779	CNTN5_HUMAN	contactin 5	145	Ig-like C2-type 1.				cell adhesion (GO:0007155)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)		p.E145K(2)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(12)|lung(38)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	81		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		AATAGATCTGGAAAGTGATTA	0.368																																							uc001pga.2		NA																	2	Substitution - Missense(2)		lung(2)	skin(3)|ovary(2)|pancreas(2)|breast(1)	8						c.(433-435)GAA>AAA		contactin 5 isoform long							106.0	98.0	101.0					11																	99715850		1839	4095	5934	SO:0001583	missense	53942				cell adhesion	anchored to membrane|plasma membrane	protein binding	g.chr11:99715850G>A	AB013802	CCDS53696.1, CCDS53697.1, CCDS58168.1	11q22.1	2013-02-11			ENSG00000149972	ENSG00000149972		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2175	protein-coding gene	gene with protein product		607219					Standard	NM_014361		Approved	NB-2, hNB-2	uc021qpb.1	O94779	OTTHUMG00000167579	ENST00000524871.1:c.433G>A	11.37:g.99715850G>A	ENSP00000435637:p.Glu145Lys		Somatic				CNTN5_uc009ywv.1_Missense_Mutation_p.E145K|CNTN5_uc001pfz.2_Missense_Mutation_p.E145K|CNTN5_uc001pgb.2_Missense_Mutation_p.E71K	p.E145K	NM_014361	NP_055176	WXS	Illumina HiSeq	Unspecified	O94779	CNTN5_HUMAN		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)	6	772	+		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)	145			Ig-like C2-type 1.		A1L4P0|B7ZM07|E9PKE8|O94780|Q49AF3	Missense_Mutation	SNP	ENST00000524871.1	37	c.433G>A	CCDS53696.1	.	.	.	.	.	.	.	.	.	.	G	19.54	3.846504	0.71603	.	.	ENSG00000149972	ENST00000527185;ENST00000528682;ENST00000524871;ENST00000418526;ENST00000279463	T;T;T;T;T	0.39056	1.1;1.1;1.1;1.1;1.1	5.53	5.53	0.82687	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.290722	0.37955	N	0.001862	T	0.40272	0.1110	N	0.11313	0.125	0.80722	D	1	D;D;D	0.64830	0.992;0.99;0.994	P;P;P	0.60236	0.735;0.737;0.871	T	0.16988	-1.0384	10	0.09338	T	0.73	.	18.4469	0.90688	0.0:0.0:1.0:0.0	.	145;71;145	E9PKE8;O94779-2;O94779	.;.;CNTN5_HUMAN	K	145;145;145;71;145	ENSP00000433575:E145K;ENSP00000436185:E145K;ENSP00000435637:E145K;ENSP00000393229:E71K;ENSP00000279463:E145K	ENSP00000279463:E145K	E	+	1	0	CNTN5	99221060	1.000000	0.71417	0.997000	0.53966	0.987000	0.75469	6.387000	0.73191	2.597000	0.87782	0.650000	0.86243	GAA		0.368	CNTN5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395148.2	NM_014361		22	81	0	0	0	0.012319	0	22	81				
PVRL1	5818	broad.mit.edu	37	11	119547916	119547916	+	Silent	SNP	T	T	C			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr11:119547916T>C	ENST00000264025.3	-	4	1277	c.747A>G	c.(745-747)gtA>gtG	p.V249V	PVRL1_ENST00000341398.2_Silent_p.V249V|PVRL1_ENST00000524510.1_5'UTR|PVRL1_ENST00000340882.2_Silent_p.V249V	NM_002855.4	NP_002846.3	Q15223	PVRL1_HUMAN	poliovirus receptor-related 1 (herpesvirus entry mediator C)	249	Ig-like C2-type 2.				adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|desmosome organization (GO:0002934)|enamel mineralization (GO:0070166)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|immune response (GO:0006955)|iron ion transport (GO:0006826)|lens morphogenesis in camera-type eye (GO:0002089)|regulation of synapse assembly (GO:0051963)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|viral entry into host cell (GO:0046718)	adherens junction (GO:0005912)|axon (GO:0030424)|cell-cell adherens junction (GO:0005913)|extracellular region (GO:0005576)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)|synapse (GO:0045202)	carbohydrate binding (GO:0030246)|cell adhesion molecule binding (GO:0050839)|coreceptor activity (GO:0015026)|protein homodimerization activity (GO:0042803)|virion binding (GO:0046790)|virus receptor activity (GO:0001618)	p.V249V(3)		breast(1)|endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		Breast(348;0.037)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.29e-05)		CCTCAATGGTTACCTCAGGCT	0.552																																							uc001pwv.2		NA																	3	Substitution - coding silent(3)		lung(3)		0						c.(745-747)GTA>GTG		poliovirus receptor-related 1 isoform 1							100.0	83.0	89.0					11																	119547916		2199	4295	6494	SO:0001819	synonymous_variant	5818				adherens junction organization|cell junction assembly|entry of virus into host cell|heterophilic cell-cell adhesion|homophilic cell adhesion|immune response	cell-cell adherens junction|extracellular region|integral to membrane	cell adhesion molecule binding|coreceptor activity|protein homodimerization activity	g.chr11:119547916T>C	X76400	CCDS8425.1, CCDS8426.1, CCDS8427.1	11q23-q24	2013-01-29	2007-06-07		ENSG00000110400	ENSG00000110400		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9706	protein-coding gene	gene with protein product	"""nectin"""	600644		HVEC, ED4		7721102, 9616127	Standard	NM_203285		Approved	PRR, PRR1, PVRR1, SK-12, HIgR, CLPED1, CD111, OFC7	uc001pwv.3	Q15223	OTTHUMG00000166177	ENST00000264025.3:c.747A>G	11.37:g.119547916T>C			Somatic				PVRL1_uc001pwu.1_Silent_p.V249V|PVRL1_uc001pww.2_Silent_p.V249V	p.V249V	NM_002855	NP_002846	WXS	Illumina HiSeq	Unspecified	Q15223	PVRL1_HUMAN		BRCA - Breast invasive adenocarcinoma(274;4.29e-05)	4	919	-		Breast(348;0.037)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)	249			Extracellular (Potential).|Ig-like C2-type 2.		O75465|Q2M3D3|Q9HBE6|Q9HBW2	Silent	SNP	ENST00000264025.3	37	c.747A>G	CCDS8426.1																																																																																				0.552	PVRL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388231.1			22	105	0	0	0	0.00333	0	22	105				
NCAPD3	23310	broad.mit.edu	37	11	134062761	134062761	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr11:134062761C>A	ENST00000534548.2	-	16	1932	c.1868G>T	c.(1867-1869)gGg>gTg	p.G623V		NM_015261.2	NP_056076.1	P42695	CNDD3_HUMAN	non-SMC condensin II complex, subunit D3	623					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	germinal vesicle (GO:0042585)|membrane (GO:0016020)|nuclear condensin complex (GO:0000799)|nuclear pericentric heterochromatin (GO:0031618)|nucleoplasm (GO:0005654)	methylated histone binding (GO:0035064)	p.G623V(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)		CGGGACCACCCCCCGCAACCA	0.547																																							uc001qhd.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	5						c.(1867-1869)GGG>GTG		non-SMC condensin II complex, subunit D3							80.0	77.0	78.0					11																	134062761		2201	4297	6498	SO:0001583	missense	23310				cell division|mitotic chromosome condensation	nuclear centromeric heterochromatin|nuclear condensin complex	methylated histone residue binding	g.chr11:134062761C>A	AK124878	CCDS31723.1	11q25	2008-02-04			ENSG00000151503	ENSG00000151503			28952	protein-coding gene	gene with protein product		609276				7584044, 8619474, 14532007	Standard	NM_015261		Approved	hCAP-D3, CAP-D3, hHCP-6, KIAA0056, FLJ42888, hcp-6	uc001qhd.1	P42695	OTTHUMG00000167172	ENST00000534548.2:c.1868G>T	11.37:g.134062761C>A	ENSP00000433681:p.Gly623Val		Somatic				NCAPD3_uc010scm.1_RNA|NCAPD3_uc009zda.1_RNA	p.G623V	NM_015261	NP_056076	WXS	Illumina HiSeq	Unspecified	P42695	CNDD3_HUMAN		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)	16	2474	-	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)	623					A6NFS2|Q4KMQ9	Missense_Mutation	SNP	ENST00000534548.2	37	c.1868G>T	CCDS31723.1	.	.	.	.	.	.	.	.	.	.	C	16.91	3.253301	0.59212	.	.	ENSG00000151503	ENST00000534548	T	0.65364	-0.15	5.88	5.88	0.94601	Armadillo-like helical (1);Armadillo-type fold (1);	0.045973	0.85682	D	0.000000	T	0.79633	0.4479	M	0.76002	2.32	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.75071	-0.3447	10	0.30078	T	0.28	-28.6782	20.2166	0.98299	0.0:1.0:0.0:0.0	.	623	P42695	CNDD3_HUMAN	V	623	ENSP00000433681:G623V	ENSP00000431612:G623V	G	-	2	0	NCAPD3	133567971	1.000000	0.71417	0.187000	0.23214	0.005000	0.04900	7.466000	0.80914	2.781000	0.95711	0.591000	0.81541	GGG		0.547	NCAPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393575.2	NM_015261		35	100	1	0	2.40579e-17	0.00623	3.126e-17	35	100				
KLRC3	3823	broad.mit.edu	37	12	10573032	10573032	+	Nonsense_Mutation	SNP	G	G	A			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr12:10573032G>A	ENST00000396439.2	-	1	162	c.118C>T	c.(118-120)Caa>Taa	p.Q40*	KLRC3_ENST00000381903.2_Nonsense_Mutation_p.Q40*|KLRC3_ENST00000381904.2_Nonsense_Mutation_p.Q40*|NKG2-E_ENST00000539033.1_Intron	NM_002261.2	NP_002252.2	Q07444	NKG2E_HUMAN	killer cell lectin-like receptor subfamily C, member 3	40					cellular defense response (GO:0006968)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)	p.Q40*(1)		large_intestine(2)|lung(5)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	11						AATTCTACTTGGAATATTTCC	0.368																																							uc001qyf.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(2)|skin(1)	3						c.(118-120)CAA>TAA		killer cell lectin-like receptor subfamily C,							165.0	169.0	167.0					12																	10573032		2203	4300	6503	SO:0001587	stop_gained	3823				cellular defense response	integral to membrane	sugar binding|transmembrane receptor activity	g.chr12:10573032G>A	L14542	CCDS31744.1, CCDS41755.1	12p13	2008-08-05			ENSG00000205810	ENSG00000205810		"""Killer cell lectin-like receptors"""	6376	protein-coding gene	gene with protein product		602892				9598306	Standard	NM_002261		Approved	NKG2-E	uc001qyi.1	Q07444	OTTHUMG00000167149	ENST00000396439.2:c.118C>T	12.37:g.10573032G>A	ENSP00000379716:p.Gln40*		Somatic				KLRC3_uc001qyh.2_Intron|KLRC3_uc001qyi.1_Nonsense_Mutation_p.Q40*|KLRC3_uc010shc.1_Nonsense_Mutation_p.Q40*|KLRC3_uc010shd.1_Nonsense_Mutation_p.Q40*	p.Q40*	NM_002261	NP_002252	WXS	Illumina HiSeq	Unspecified	Q07444	NKG2E_HUMAN			1	163	-			40			Cytoplasmic (Potential).		Q8WXA4|Q96RL0|Q9UP04	Nonsense_Mutation	SNP	ENST00000396439.2	37	c.118C>T	CCDS41755.1	.	.	.	.	.	.	.	.	.	.	g	12.80	2.047228	0.36085	.	.	ENSG00000205810	ENST00000396439;ENST00000381904;ENST00000381903	.	.	.	2.55	-0.0141	0.13982	.	0.299183	0.24506	N	0.037929	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.32370	T	0.25	.	2.3542	0.04292	0.4818:0.2985:0.2197:0.0	.	.	.	.	X	40	.	ENSP00000371328:Q40X	Q	-	1	0	KLRC3	10464299	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.102000	0.15272	-0.005000	0.14395	0.585000	0.79938	CAA		0.368	KLRC3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000393471.1	NM_002261		15	77	0	0	0	0.012319	0	15	77				
KLRC3	3823	broad.mit.edu	37	12	10573045	10573045	+	Silent	SNP	T	T	C			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr12:10573045T>C	ENST00000396439.2	-	1	149	c.105A>G	c.(103-105)gaA>gaG	p.E35E	KLRC3_ENST00000381903.2_Silent_p.E35E|KLRC3_ENST00000381904.2_Silent_p.E35E|NKG2-E_ENST00000539033.1_Intron	NM_002261.2	NP_002252.2	Q07444	NKG2E_HUMAN	killer cell lectin-like receptor subfamily C, member 3	35					cellular defense response (GO:0006968)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)	p.E35E(1)		large_intestine(2)|lung(5)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	11						ATATTTCCTGTTCGGTTCCTG	0.378																																							uc001qyf.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|skin(1)	3						c.(103-105)GAA>GAG		killer cell lectin-like receptor subfamily C,							154.0	157.0	156.0					12																	10573045		2203	4300	6503	SO:0001819	synonymous_variant	3823				cellular defense response	integral to membrane	sugar binding|transmembrane receptor activity	g.chr12:10573045T>C	L14542	CCDS31744.1, CCDS41755.1	12p13	2008-08-05			ENSG00000205810	ENSG00000205810		"""Killer cell lectin-like receptors"""	6376	protein-coding gene	gene with protein product		602892				9598306	Standard	NM_002261		Approved	NKG2-E	uc001qyi.1	Q07444	OTTHUMG00000167149	ENST00000396439.2:c.105A>G	12.37:g.10573045T>C			Somatic				KLRC3_uc001qyh.2_Intron|KLRC3_uc001qyi.1_Silent_p.E35E|KLRC3_uc010shc.1_Silent_p.E35E|KLRC3_uc010shd.1_Silent_p.E35E	p.E35E	NM_002261	NP_002252	WXS	Illumina HiSeq	Unspecified	Q07444	NKG2E_HUMAN			1	150	-			35			Cytoplasmic (Potential).		Q8WXA4|Q96RL0|Q9UP04	Silent	SNP	ENST00000396439.2	37	c.105A>G	CCDS41755.1																																																																																				0.378	KLRC3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000393471.1	NM_002261		11	61	0	0	0	0.004007	0	11	61				
KLRC3	3823	broad.mit.edu	37	12	10588481	10588481	+	Silent	SNP	T	T	C			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr12:10588481T>C	ENST00000539033.1	-	1	119	c.105A>G	c.(103-105)gaA>gaG	p.E35E	KLRC2_ENST00000536833.2_Intron|KLRC2_ENST00000381901.1_Silent_p.E35E|KLRC2_ENST00000381902.2_Silent_p.E35E														p.E35E(1)									ATATTTCCTGTTCGGTTCCTG	0.378																																							uc001qyh.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|skin(1)	3						c.(103-105)GAA>GAG		killer cell lectin-like receptor subfamily C,							181.0	195.0	190.0					12																	10588481		2203	4300	6503	SO:0001819	synonymous_variant	3823				cellular defense response	integral to membrane	sugar binding|transmembrane receptor activity	g.chr12:10588481T>C																												ENST00000539033.1:c.105A>G	12.37:g.10588481T>C			Somatic				KLRC2_uc010she.1_Silent_p.E35E|KLRC2_uc001qyk.2_Silent_p.E35E	p.E35E	NM_002261	NP_002252	WXS	Illumina HiSeq	Unspecified	Q07444	NKG2E_HUMAN			1	112	-			35			Cytoplasmic (Potential).			Silent	SNP	ENST00000539033.1	37	c.105A>G																																																																																					0.378	NKG2-E-001	KNOWN	basic|appris_principal|readthrough_transcript	protein_coding	protein_coding	OTTHUMT00000400274.1			10	164	0	0	0	0.004007	0	10	164				
KRAS	3845	broad.mit.edu	37	12	25398285	25398285	+	Missense_Mutation	SNP	C	C	A	rs121913530		TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr12:25398285C>A	ENST00000256078.4	-	2	97	c.34G>T	c.(34-36)Ggt>Tgt	p.G12C	KRAS_ENST00000311936.3_Missense_Mutation_p.G12C|KRAS_ENST00000557334.1_Missense_Mutation_p.G12C|KRAS_ENST00000556131.1_Missense_Mutation_p.G12C	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CCTACGCCACCAGCTCCAACT	0.348	G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	uc001rgp.1	G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12C(CALU1_LUNG)|G12C(NCIH2030_LUNG)|G12C(LU99_LUNG)|G12C(NCIH1792_LUNG)|G12R(KP2_PANCREAS)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(NCIH2122_LUNG)|G12C(NCIH358_LUNG)|G12R(PSN1_PANCREAS)|G12C(KYSE410_OESOPHAGUS)|G12S(A549_LUNG)|G12R(HUPT3_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12C(HCC44_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(SW1463_LARGE_INTESTINE)|G12C(NCIH23_LUNG)|G12C(LU65_LUNG)|G12C(NCIH1373_LUNG)|G12C(MIAPACA2_PANCREAS)|G12R(HS274T_BREAST)|G12S(LS123_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(OV56_OVARY)|G12C(IALM_LUNG)	119		Dom	yes		12	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog			"""L, E, M, O"""			pancreatic|colorectal|lung|thyroid|AML|others		5144	Substitution - Missense(5142)|Insertion - In frame(2)	p.G12D(7175)|p.G12V(4780)|p.G12C(2482)|p.G12A(1180)|p.G12S(1119)|p.G12R(691)|p.G12?(50)|p.G12F(34)|p.G12G(6)|p.G12N(6)|p.G12L(5)|p.G12I(4)|p.G12_G13insG(4)|p.G12E(3)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12fs*3(1)	large_intestine(2360)|lung(1649)|pancreas(656)|biliary_tract(125)|ovary(56)|endometrium(54)|haematopoietic_and_lymphoid_tissue(49)|thyroid(42)|stomach(21)|cervix(19)|upper_aerodigestive_tract(17)|urinary_tract(17)|soft_tissue(15)|small_intestine(13)|prostate(11)|breast(9)|skin(8)|testis(7)|liver(6)|oesophagus(3)|peritoneum(1)|autonomic_ganglia(1)|kidney(1)|central_nervous_system(1)|NS(1)|penis(1)|adrenal_gland(1)	large_intestine(12391)|pancreas(3285)|lung(2847)|biliary_tract(521)|ovary(443)|endometrium(339)|haematopoietic_and_lymphoid_tissue(318)|stomach(203)|thyroid(149)|prostate(85)|soft_tissue(77)|small_intestine(62)|upper_aerodigestive_tract(59)|cervix(49)|urinary_tract(48)|skin(38)|liver(31)|breast(28)|testis(17)|oesophagus(15)|central_nervous_system(9)|peritoneum(6)|salivary_gland(6)|kidney(5)|gastrointestinal_tract_(site_indeterminate)(5)|thymus(5)|eye(4)|autonomic_ganglia(2)|bone(2)|genital_tract(1)|penis(1)|adrenal_gland(1)	21052	GRCh37	CM076251	KRAS	M	rs121913530	c.(34-36)GGT>TGT		c-K-ras2 protein isoform a precursor							93.0	83.0	86.0					12																	25398285		2203	4300	6503	SO:0001583	missense	3845	Cardiofaciocutaneous_syndrome|Noonan_syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	activation of MAPKK activity|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	plasma membrane	GTP binding|GTPase activity|protein binding	g.chr12:25398285C>A	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.34G>T	12.37:g.25398285C>A	ENSP00000256078:p.Gly12Cys	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)	Somatic				KRAS_uc001rgq.1_Missense_Mutation_p.G12C|KRAS_uc001rgr.2_RNA	p.G12C	NM_033360	NP_203524	WXS	Illumina HiSeq	Unspecified	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)		2	215	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		12		G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation).|G -> R (in lung cancer and bladder cancer; somatic mutation).|G -> S (in lung carcinoma and GASC; somatic mutation).|G -> A (in a colorectal cancer sample; somatic mutation).|G -> C (in lung carcinoma; somatic mutation).|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation).	GTP.		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	c.34G>T	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.676185	0.88445	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.79141	-1.24;-1.24;-1.24;-1.24	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90466	0.7014	M	0.90650	3.135	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.993	D	0.91833	0.5477	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	C	12	ENSP00000308495:G12C;ENSP00000452512:G12C;ENSP00000256078:G12C;ENSP00000451856:G12C	ENSP00000256078:G12C	G	-	1	0	KRAS	25289552	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360		6	8	1	0	0.00198382	0.001984	0.00207538	6	8				
CCDC91	55297	broad.mit.edu	37	12	28459852	28459852	+	Nonsense_Mutation	SNP	G	G	T			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr12:28459852G>T	ENST00000545336.1	+	8	864	c.445G>T	c.(445-447)Gaa>Taa	p.E149*	CCDC91_ENST00000306172.5_Nonsense_Mutation_p.E119*|CCDC91_ENST00000381256.1_Nonsense_Mutation_p.E149*|CCDC91_ENST00000540401.1_3'UTR|CCDC91_ENST00000539107.1_Nonsense_Mutation_p.E149*|CCDC91_ENST00000381259.1_Nonsense_Mutation_p.E149*			Q7Z6B0	CCD91_HUMAN	coiled-coil domain containing 91	149					protein transport (GO:0015031)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)		p.E149*(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(8)|skin(1)	22	Acute lymphoblastic leukemia(23;0.00718)|all_hematologic(23;0.0113)|Lung SC(9;0.184)					CAAAGTATCTGAAGAAGAAAA	0.313																																							uc001riq.2		NA																	1	Substitution - Nonsense(1)		lung(1)	central_nervous_system(1)	1						c.(445-447)GAA>TAA		GGA binding partner							44.0	47.0	46.0					12																	28459852		2203	4298	6501	SO:0001587	stop_gained	55297				protein transport	Golgi apparatus|membrane		g.chr12:28459852G>T	AK093152	CCDS8716.1	12p11.22	2006-03-17				ENSG00000123106			24855	protein-coding gene	gene with protein product	"""GGA binding partner"""					12808037	Standard	XM_005253413		Approved	p56, FLJ11088, DKFZp779L1558	uc001riq.3	Q7Z6B0		ENST00000545336.1:c.445G>T	12.37:g.28459852G>T	ENSP00000438040:p.Glu149*		Somatic				CCDC91_uc001rio.2_Nonsense_Mutation_p.E119*|CCDC91_uc009zjk.2_RNA|CCDC91_uc001rip.1_Nonsense_Mutation_p.E149*|CCDC91_uc001rir.2_5'UTR|CCDC91_uc009zjl.2_5'UTR	p.E149*	NM_018318	NP_060788	WXS	Illumina HiSeq	Unspecified	Q7Z6B0	CCD91_HUMAN			4	461	+	Acute lymphoblastic leukemia(23;0.00718)|all_hematologic(23;0.0113)|Lung SC(9;0.184)		149			Potential.		B3KSA3|C9JR07|Q68D43|Q6IA78|Q8NEN7|Q9NUW9	Nonsense_Mutation	SNP	ENST00000545336.1	37	c.445G>T	CCDS8716.1	.	.	.	.	.	.	.	.	.	.	G	28.6	4.933926	0.92458	.	.	ENSG00000123106	ENST00000539107;ENST00000536442;ENST00000545336;ENST00000545737;ENST00000381259;ENST00000381256;ENST00000306172	.	.	.	5.52	5.52	0.82312	.	0.096550	0.45126	D	0.000383	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-19.1136	14.9426	0.71006	0.0:0.0:1.0:0.0	.	.	.	.	X	149;149;149;149;149;149;119	.	ENSP00000305075:E119X	E	+	1	0	CCDC91	28351119	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.278000	0.65592	2.578000	0.87016	0.650000	0.86243	GAA		0.313	CCDC91-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402447.1	NM_018318		8	10	1	0	1.12685e-05	0.004482	1.20988e-05	8	10				
OVOS2	144203	broad.mit.edu	37	12	31283472	31283472	+	IGR	SNP	A	A	C			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr12:31283472A>C								RP11-551L14.1 (13067 upstream) : FAM60A (150045 downstream)														p.F1015C(1)									CTGCTGCCAAAACACACTATA	0.323																																							uc010sjy.1		NA																	1	Substitution - Missense(1)		lung(1)		NA						c.(3043-3045)TTT>TGT		RecName: Full=Ovostatin homolog 1; Flags: Precursor;							40.0	35.0	36.0					12																	31283472		1791	4066	5857	SO:0001628	intergenic_variant	0							g.chr12:31283472A>C																													12.37:g.31283472A>C			Somatic					p.F1015C			WXS	Illumina HiSeq	Unspecified					23	3044	-									Missense_Mutation	SNP		37	c.3044T>G																																																																																				0	0.323									6	8	0	0	0	0.001168	0	6	8				
OVOS2	144203	broad.mit.edu	37	12	31283475	31283475	+	IGR	SNP	A	A	T			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr12:31283475A>T								RP11-551L14.1 (13070 upstream) : FAM60A (150042 downstream)														p.V1014E(1)									CTGCCAAAACACACTATAGGA	0.318																																							uc010sjy.1		NA																	1	Substitution - Missense(1)		lung(1)		NA						c.(3040-3042)GTG>GAG		RecName: Full=Ovostatin homolog 1; Flags: Precursor;							39.0	34.0	36.0					12																	31283475		1791	4066	5857	SO:0001628	intergenic_variant	0							g.chr12:31283475A>T																													12.37:g.31283475A>T			Somatic					p.V1014E			WXS	Illumina HiSeq	Unspecified					23	3041	-									Missense_Mutation	SNP		37	c.3041T>A																																																																																				0	0.318									6	8	0	0	0	0.001168	0	6	8				
CNTN1	1272	broad.mit.edu	37	12	41387065	41387065	+	Missense_Mutation	SNP	G	G	T	rs370161709		TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr12:41387065G>T	ENST00000551295.2	+	17	2224	c.2107G>T	c.(2107-2109)Ggt>Tgt	p.G703C	CNTN1_ENST00000348761.2_Missense_Mutation_p.G692C|CNTN1_ENST00000347616.1_Missense_Mutation_p.G703C	NM_001843.3	NP_001834.2	Q12860	CNTN1_HUMAN	contactin 1	703	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|Notch signaling pathway (GO:0007219)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transport (GO:0010765)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)	p.G703C(2)		central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(21)|lung(49)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	90	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)				TAAAACAGACGGTGCTGGTAT	0.368																																							uc001rmm.1		NA																	2	Substitution - Missense(2)		large_intestine(1)|lung(1)	lung(4)|ovary(3)|large_intestine(1)|skin(1)	9						c.(2107-2109)GGT>TGT		contactin 1 isoform 1 precursor							62.0	64.0	64.0					12																	41387065		2203	4300	6503	SO:0001583	missense	1272				axon guidance|cell adhesion|Notch signaling pathway	anchored to membrane|membrane fraction|plasma membrane		g.chr12:41387065G>T	Z21488	CCDS8737.1, CCDS8738.1, CCDS58225.1	12q11-q12	2014-01-30				ENSG00000018236		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"", ""Endogenous ligands"""	2171	protein-coding gene	gene with protein product	"""glycoprotein gP135"""	600016				7959734, 8586965	Standard	NM_001843		Approved	F3, GP135	uc031qgz.1	Q12860		ENST00000551295.2:c.2107G>T	12.37:g.41387065G>T	ENSP00000447006:p.Gly703Cys		Somatic				CNTN1_uc001rmn.1_Missense_Mutation_p.G692C	p.G703C	NM_001843	NP_001834	WXS	Illumina HiSeq	Unspecified	Q12860	CNTN1_HUMAN			17	2220	+	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)	703					A8K0H9|A8K0Y3|Q12861|Q14030|Q7M4P0|Q8N466	Missense_Mutation	SNP	ENST00000551295.2	37	c.2107G>T	CCDS8737.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.142868	0.77888	.	.	ENSG00000018236	ENST00000551295;ENST00000347616;ENST00000348761	T;T;T	0.54279	0.58;0.58;0.58	5.2	5.2	0.72013	Fibronectin, type III (1);	0.104299	0.64402	D	0.000003	T	0.72252	0.3437	M	0.68317	2.08	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.76071	0.987;0.985	T	0.74999	-0.3472	10	0.87932	D	0	.	19.1136	0.93328	0.0:0.0:1.0:0.0	.	692;703	Q12860-2;Q12860	.;CNTN1_HUMAN	C	703;703;692	ENSP00000447006:G703C;ENSP00000325660:G703C;ENSP00000261160:G692C	ENSP00000325660:G703C	G	+	1	0	CNTN1	39673332	1.000000	0.71417	1.000000	0.80357	0.742000	0.42306	4.755000	0.62198	2.576000	0.86940	0.555000	0.69702	GGT		0.368	CNTN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403692.2	NM_001843		5	31	1	0	2.0095e-06	0.001984	2.21588e-06	5	31				
KMT2D	8085	broad.mit.edu	37	12	49438031	49438031	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr12:49438031G>A	ENST00000301067.7	-	21	5139	c.5140C>T	c.(5140-5142)Cct>Tct	p.P1714S		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	1714					chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.P1714S(1)|p.P1441S(1)									TGTGCAGCAGGCCCCTTTTTC	0.622											OREG0021780	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001rta.3		NA								N|F|Mis							medulloblastoma|renal		2	Substitution - Missense(2)		lung(2)	kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						c.(5140-5142)CCT>TCT		myeloid/lymphoid or mixed-lineage leukemia 2							49.0	57.0	55.0					12																	49438031		2134	4243	6377	SO:0001583	missense	8085				chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding	g.chr12:49438031G>A	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.5140C>T	12.37:g.49438031G>A	ENSP00000301067:p.Pro1714Ser	HNSCC(34;0.089)	Somatic	OREG0021780	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	962		p.P1714S	NM_003482	NP_003473	WXS	Illumina HiSeq	Unspecified	O14686	MLL2_HUMAN			21	5140	-			1714					O14687	Missense_Mutation	SNP	ENST00000301067.7	37	c.5140C>T	CCDS44873.1	.	.	.	.	.	.	.	.	.	.	G	13.05	2.121160	0.37436	.	.	ENSG00000167548	ENST00000301067	T	0.78707	-1.2	4.82	4.82	0.62117	.	0.000000	0.34932	N	0.003561	T	0.67477	0.2897	L	0.34521	1.04	0.27542	N	0.950769	B	0.15930	0.015	B	0.12156	0.007	T	0.63479	-0.6628	10	0.87932	D	0	.	10.9948	0.47569	0.0897:0.0:0.9103:0.0	.	1714	O14686	MLL2_HUMAN	S	1714	ENSP00000301067:P1714S	ENSP00000301067:P1714S	P	-	1	0	MLL2	47724298	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	2.233000	0.43027	2.498000	0.84270	0.563000	0.77884	CCT		0.622	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2			15	31	0	0	0	0.00499	0	15	31				
HOXC12	3228	broad.mit.edu	37	12	54350298	54350298	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr12:54350298G>A	ENST00000243103.3	+	2	893	c.797G>A	c.(796-798)aGa>aAa	p.R266K	AC012531.23_ENST00000603432.1_lincRNA	NM_173860.1	NP_776272.1	P31275	HXC12_HUMAN	homeobox C12	266					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.R266K(1)		large_intestine(3)|lung(8)|upper_aerodigestive_tract(1)	12						CAGAACCGGAGAATGAAAAAG	0.532																																							uc010soq.1		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)	1						c.(796-798)AGA>AAA		homeobox C12							93.0	101.0	98.0					12																	54350298		2203	4300	6503	SO:0001583	missense	3228				multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr12:54350298G>A	AF328962	CCDS8866.1	12q13.13	2011-06-20	2005-12-22		ENSG00000123407	ENSG00000123407		"""Homeoboxes / ANTP class : HOXL subclass"""	5124	protein-coding gene	gene with protein product		142975	"""homeo box C12"""	HOX3, HOX3F, HOC3F		1973146, 1358459	Standard	NM_173860		Approved		uc010soq.2	P31275	OTTHUMG00000160010	ENST00000243103.3:c.797G>A	12.37:g.54350298G>A	ENSP00000243103:p.Arg266Lys		Somatic					p.R266K	NM_173860	NP_776272	WXS	Illumina HiSeq	Unspecified	P31275	HXC12_HUMAN			2	797	+			266			Homeobox.		Q9BXJ6	Missense_Mutation	SNP	ENST00000243103.3	37	c.797G>A	CCDS8866.1	.	.	.	.	.	.	.	.	.	.	G	32	5.112759	0.94339	.	.	ENSG00000123407	ENST00000243103	D	0.98862	-5.19	4.2	4.2	0.49525	Homeobox, eukaryotic (1);Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.000000	0.64402	U	0.000002	D	0.99635	0.9866	H	0.99940	5	0.58432	D	0.999999	D	0.76494	0.999	D	0.87578	0.998	D	0.96859	0.9631	10	0.87932	D	0	.	15.6972	0.77509	0.0:0.0:1.0:0.0	.	266	P31275	HXC12_HUMAN	K	266	ENSP00000243103:R266K	ENSP00000243103:R266K	R	+	2	0	HOXC12	52636565	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.869000	0.99810	2.052000	0.61016	0.462000	0.41574	AGA		0.532	HOXC12-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358868.2	NM_173860		6	273	0	0	0	0.00308	0	6	273				
DTX3	196403	broad.mit.edu	37	12	58000753	58000753	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr12:58000753G>T	ENST00000548198.1	+	3	1611	c.107G>T	c.(106-108)cGg>cTg	p.R36L	DTX3_ENST00000337737.3_Missense_Mutation_p.R36L|DTX3_ENST00000551632.1_Missense_Mutation_p.R39L|DTX3_ENST00000548804.1_Missense_Mutation_p.R36L			Q8N9I9	DTX3_HUMAN	deltex 3, E3 ubiquitin ligase	36					Notch signaling pathway (GO:0007219)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.R36L(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(1)|lung(6)|urinary_tract(1)	12	Melanoma(17;0.122)					ACCCCAGCCCGGCTGGCCCGG	0.597																																							uc001sow.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)|central_nervous_system(1)	2						c.(106-108)CGG>CTG		deltex homolog 3							138.0	152.0	147.0					12																	58000753		1948	4144	6092	SO:0001583	missense	196403				Notch signaling pathway	cytoplasm	zinc ion binding	g.chr12:58000753G>T	AK094385	CCDS41800.1, CCDS66410.1	12q13.2	2014-01-28	2014-01-28			ENSG00000178498		"""RING-type (C3HC4) zinc fingers"""	24457	protein-coding gene	gene with protein product		613142	"""deltex 3 homolog (Drosophila)"", ""deltex homolog 3 (Drosophila)"""			12670957	Standard	XM_005268697		Approved	FLJ34766, RNF154	uc001sow.1	Q8N9I9		ENST00000548198.1:c.107G>T	12.37:g.58000753G>T	ENSP00000447873:p.Arg36Leu		Somatic				DTX3_uc001sov.1_Missense_Mutation_p.R29L|DTX3_uc001sox.1_Missense_Mutation_p.R29L|DTX3_uc001soy.1_Missense_Mutation_p.R29L	p.R36L	NM_178502	NP_848597	WXS	Illumina HiSeq	Unspecified	Q8N9I9	DTX3_HUMAN			5	444	+	Melanoma(17;0.122)		36					Q53ZZ2|Q8NAU6|Q8NDS8	Missense_Mutation	SNP	ENST00000548198.1	37	c.107G>T	CCDS41800.1	.	.	.	.	.	.	.	.	.	.	G	14.15	2.448887	0.43531	.	.	ENSG00000178498	ENST00000548804;ENST00000551835;ENST00000549583;ENST00000337737;ENST00000548198;ENST00000551632;ENST00000548478	T;T;T;T;T;T	0.50001	1.4;0.76;1.4;1.4;1.39;0.8	4.02	4.02	0.46733	.	0.194071	0.30676	N	0.009107	T	0.29716	0.0742	N	0.14661	0.345	0.34279	D	0.681863	B	0.28636	0.218	B	0.31390	0.129	T	0.42999	-0.9418	10	0.54805	T	0.06	-5.294	8.0122	0.30359	0.1146:0.0:0.8854:0.0	.	36	Q8N9I9	DTX3_HUMAN	L	36;36;39;36;36;39;29	ENSP00000449294:R36L;ENSP00000449688:R39L;ENSP00000338050:R36L;ENSP00000447873:R36L;ENSP00000448696:R39L;ENSP00000448224:R29L	ENSP00000338050:R36L	R	+	2	0	DTX3	56287020	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.329000	0.52060	1.966000	0.57179	0.462000	0.41574	CGG		0.597	DTX3-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000407848.1	NM_178502		110	418	1	0	1.02947e-67	0.00361	1.50009e-67	110	418				
IRAK3	11213	broad.mit.edu	37	12	66638373	66638373	+	Missense_Mutation	SNP	G	G	C	rs377162551		TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr12:66638373G>C	ENST00000261233.4	+	9	1416	c.995G>C	c.(994-996)aGc>aCc	p.S332T	IRAK3_ENST00000457197.2_Missense_Mutation_p.S271T	NM_007199.2	NP_009130.2			interleukin-1 receptor-associated kinase 3									p.S332T(1)		breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(17)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	36				GBM - Glioblastoma multiforme(28;0.0203)		AATATGACCAGCAGCAGCAGT	0.428																																							uc001sth.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(3)|ovary(2)|breast(2)|central_nervous_system(1)	8						c.(994-996)AGC>ACC		interleukin-1 receptor-associated kinase 3							134.0	122.0	126.0					12																	66638373		2203	4300	6503	SO:0001583	missense	11213				interleukin-1-mediated signaling pathway|MyD88-dependent toll-like receptor signaling pathway|negative regulation of innate immune response|negative regulation of interleukin-12 production|negative regulation of interleukin-6 production|negative regulation of macrophage cytokine production|negative regulation of MAP kinase activity|negative regulation of NF-kappaB transcription factor activity|negative regulation of protein catabolic process|negative regulation of protein complex disassembly|negative regulation of toll-like receptor signaling pathway|negative regulation of tumor necrosis factor production|positive regulation of macrophage tolerance induction|positive regulation of NF-kappaB transcription factor activity|response to exogenous dsRNA|response to lipopolysaccharide|response to peptidoglycan	cytoplasm|nucleus	ATP binding|magnesium ion binding|protein heterodimerization activity|protein homodimerization activity|protein serine/threonine kinase activity	g.chr12:66638373G>C	AF113136	CCDS8975.1, CCDS44937.1	12q13.13	2008-05-02			ENSG00000090376	ENSG00000090376			17020	protein-coding gene	gene with protein product		604459				10383454	Standard	NM_001142523		Approved	IRAK-M	uc001sth.3	Q9Y616	OTTHUMG00000169002	ENST00000261233.4:c.995G>C	12.37:g.66638373G>C	ENSP00000261233:p.Ser332Thr		Somatic				IRAK3_uc010ssy.1_Missense_Mutation_p.S271T	p.S332T	NM_007199	NP_009130	WXS	Illumina HiSeq	Unspecified	Q9Y616	IRAK3_HUMAN		GBM - Glioblastoma multiforme(28;0.0203)	9	1097	+			332			Protein kinase.			Missense_Mutation	SNP	ENST00000261233.4	37	c.995G>C	CCDS8975.1	.	.	.	.	.	.	.	.	.	.	G	1.407	-0.576447	0.03854	.	.	ENSG00000090376	ENST00000261233;ENST00000457197	T;T	0.64085	-0.08;-0.08	5.36	2.58	0.30949	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.315486	0.32533	N	0.005970	T	0.33644	0.0870	N	0.03224	-0.385	0.21147	N	0.999777	B;B	0.19200	0.028;0.034	B;B	0.24848	0.033;0.056	T	0.22312	-1.0220	9	.	.	.	-3.9939	7.73	0.28781	0.263:0.0:0.737:0.0	.	271;332	Q9Y616-2;Q9Y616	.;IRAK3_HUMAN	T	332;271	ENSP00000261233:S332T;ENSP00000409852:S271T	.	S	+	2	0	IRAK3	64924640	0.185000	0.23213	0.706000	0.30403	0.050000	0.14768	0.508000	0.22692	0.271000	0.22005	-0.140000	0.14226	AGC		0.428	IRAK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401908.1			4	154	0	0	0	0.001168	0	4	154				
DNAH10	196385	broad.mit.edu	37	12	124298433	124298433	+	Missense_Mutation	SNP	C	C	T	rs574166129	byFrequency	TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr12:124298433C>T	ENST00000409039.3	+	20	3425	c.3400C>T	c.(3400-3402)Cgt>Tgt	p.R1134C		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	1134	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.R1134C(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		GGAGCGATACCGTACCATGGC	0.378													C|||	3	0.000599042	0.0	0.0043	5008	,	,		20033	0.0		0.0	False		,,,				2504	0.0						uc001uft.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(2)|central_nervous_system(1)	6						c.(3400-3402)CGT>TGT		dynein, axonemal, heavy chain 10							71.0	69.0	69.0					12																	124298433		1960	4173	6133	SO:0001583	missense	196385				microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr12:124298433C>T	AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.3400C>T	12.37:g.124298433C>T	ENSP00000386770:p.Arg1134Cys		Somatic				DNAH10_uc010tav.1_3'UTR|DNAH10_uc010taw.1_3'UTR	p.R1134C	NM_207437	NP_997320	WXS	Illumina HiSeq	Unspecified	Q8IVF4	DYH10_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)	20	3425	+	all_neural(191;0.101)|Medulloblastoma(191;0.163)		1134			Stem (By similarity).		C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	ENST00000409039.3	37	c.3400C>T	CCDS9255.2	.	.	.	.	.	.	.	.	.	.	C	19.47	3.833341	0.71258	.	.	ENSG00000197653	ENST00000409039	T	0.23147	1.92	5.72	4.8	0.61643	.	.	.	.	.	T	0.53449	0.1797	M	0.84846	2.72	0.58432	D	0.999999	D	0.89917	1.0	D	0.71184	0.972	T	0.58295	-0.7661	9	0.59425	D	0.04	.	14.0396	0.64667	0.374:0.626:0.0:0.0	.	1134	Q8IVF4	DYH10_HUMAN	C	1134	ENSP00000386770:R1134C	ENSP00000386770:R1134C	R	+	1	0	DNAH10	122864386	1.000000	0.71417	0.881000	0.34555	0.823000	0.46562	3.087000	0.50167	2.695000	0.91970	0.655000	0.94253	CGT		0.378	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335420.3			10	35	0	0	0	0.00245	0	10	35				
TMEM132D	121256	broad.mit.edu	37	12	129563191	129563191	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr12:129563191A>T	ENST00000422113.2	-	8	2329	c.2003T>A	c.(2002-2004)cTc>cAc	p.L668H	TMEM132D_ENST00000389441.4_Missense_Mutation_p.L206H	NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	668					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)		p.L668H(1)		NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		CTGCACCCCGAGGTCTGTGAT	0.577																																							uc009zyl.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(10)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	14						c.(2002-2004)CTC>CAC		transmembrane protein 132D precursor							157.0	131.0	140.0					12																	129563191		2203	4300	6503	SO:0001583	missense	121256					integral to membrane		g.chr12:129563191A>T	AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.2003T>A	12.37:g.129563191A>T	ENSP00000408581:p.Leu668His		Somatic				TMEM132D_uc001uia.2_Missense_Mutation_p.L206H	p.L668H	NM_133448	NP_597705	WXS	Illumina HiSeq	Unspecified	Q14C87	T132D_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)	8	2331	-	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)	668			Extracellular (Potential).		Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Missense_Mutation	SNP	ENST00000422113.2	37	c.2003T>A	CCDS9266.1	.	.	.	.	.	.	.	.	.	.	A	25.1	4.603056	0.87157	.	.	ENSG00000151952	ENST00000389441;ENST00000422113	T;T	0.66280	-0.2;-0.2	5.06	5.06	0.68205	.	0.083297	0.47852	D	0.000220	D	0.82360	0.5020	M	0.90198	3.095	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.86111	0.1562	9	.	.	.	-36.0407	14.8074	0.69968	1.0:0.0:0.0:0.0	.	668;206	Q14C87;Q14C87-2	T132D_HUMAN;.	H	206;668	ENSP00000374092:L206H;ENSP00000408581:L668H	.	L	-	2	0	TMEM132D	128129144	1.000000	0.71417	0.995000	0.50966	0.995000	0.86356	9.046000	0.93817	1.894000	0.54839	0.460000	0.39030	CTC		0.577	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399592.1	NM_133448		35	162	0	0	0	0.004878	0	35	162				
ATP8A2	51761	broad.mit.edu	37	13	26116057	26116057	+	Splice_Site	SNP	G	G	A			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr13:26116057G>A	ENST00000381655.2	+	9	794	c.652G>A	c.(652-654)Ggt>Agt	p.G218S	ATP8A2_ENST00000255283.8_Splice_Site_p.G178S	NM_016529.4	NP_057613.4	Q9NTI2	AT8A2_HUMAN	ATPase, aminophospholipid transporter, class I, type 8A, member 2	178					aging (GO:0007568)|axonogenesis (GO:0007409)|detection of light stimulus involved in visual perception (GO:0050908)|eating behavior (GO:0042755)|inner ear morphogenesis (GO:0042472)|involuntary skeletal muscle contraction (GO:0003011)|negative regulation of cell proliferation (GO:0008285)|neurofilament cytoskeleton organization (GO:0060052)|neuromuscular process controlling posture (GO:0050884)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phospholipid translocation (GO:0061092)|response to auditory stimulus (GO:0010996)|retina layer formation (GO:0010842)|skin development (GO:0043588)	cell projection (GO:0042995)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.G218S(1)		breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(17)|lung(31)|ovary(4)|skin(3)|stomach(1)|urinary_tract(1)	72		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)		AATCTTTTAGGGTTTGAGTCA	0.423																																							uc001uqk.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|large_intestine(1)|skin(1)	4						c.(652-654)GGT>AGT		ATPase, aminophospholipid transporter-like,							94.0	88.0	90.0					13																	26116057		1901	4120	6021	SO:0001630	splice_region_variant	51761				ATP biosynthetic process|negative regulation of cell proliferation	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity	g.chr13:26116057G>A	AL137256	CCDS41873.1	13q12	2010-04-20	2010-03-31		ENSG00000132932	ENSG00000132932	3.6.3.1	"""ATPases / P-type"""	13533	protein-coding gene	gene with protein product		605870	"""ATPase, aminophospholipid transporter-like, Class I, type 8A, member 2"", ""ATPase, aminophospholipid transporter-like, class I, type 8A, member 2"""			11015572, 19778899	Standard	NM_016529		Approved	ATPIB, ML-1	uc001uqk.3	Q9NTI2	OTTHUMG00000016611	ENST00000381655.2:c.652-1G>A	13.37:g.26116057G>A			Somatic				ATP8A2_uc010tdi.1_Missense_Mutation_p.G178S|ATP8A2_uc010tdj.1_RNA|ATP8A2_uc001uql.1_Missense_Mutation_p.G178S	p.G218S	NM_016529	NP_057613	WXS	Illumina HiSeq	Unspecified	Q9NTI2	AT8A2_HUMAN		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)	9	794	+		Breast(139;0.0201)|Lung SC(185;0.0225)	178			Cytoplasmic (Potential).		Q9H527|Q9NPU6|Q9NTL2|Q9NYM3	Missense_Mutation	SNP	ENST00000381655.2	37	c.652G>A	CCDS41873.1	.	.	.	.	.	.	.	.	.	.	G	13.18	2.160581	0.38119	.	.	ENSG00000132932	ENST00000381655;ENST00000255283	T;T	0.72282	-0.64;-0.64	5.24	4.4	0.53042	ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.322122	0.37304	N	0.002158	T	0.67924	0.2945	N	0.25426	0.745	0.58432	D	0.999999	P;B;B	0.50272	0.933;0.067;0.036	P;B;B	0.53102	0.718;0.069;0.163	T	0.66056	-0.6018	9	.	.	.	.	14.1537	0.65403	0.0726:0.0:0.9274:0.0	.	178;178;178	B7Z880;Q9NTI2-3;Q9NTI2	.;.;AT8A2_HUMAN	S	218;178	ENSP00000371070:G218S;ENSP00000255283:G178S	.	G	+	1	0	ATP8A2	25014057	1.000000	0.71417	0.963000	0.40424	0.229000	0.25112	6.200000	0.72118	1.345000	0.45676	0.643000	0.83706	GGT		0.423	ATP8A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044236.2	NM_016529	Missense_Mutation	15	98	0	0	0	0.00499	0	15	98				
FLT1	2321	broad.mit.edu	37	13	29001963	29001963	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr13:29001963C>T	ENST00000282397.4	-	9	1453	c.1202G>A	c.(1201-1203)gGg>gAg	p.G401E	FLT1_ENST00000539099.1_Missense_Mutation_p.G401E|FLT1_ENST00000541932.1_Missense_Mutation_p.G401E	NM_002019.4	NP_002010.2	P17948	VGFR1_HUMAN	fms-related tyrosine kinase 1	401	Ig-like C2-type 4.				blood vessel morphogenesis (GO:0048514)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic morphogenesis (GO:0048598)|monocyte chemotaxis (GO:0002548)|patterning of blood vessels (GO:0001569)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor receptor-1 signaling pathway (GO:0036323)|vascular endothelial growth factor signaling pathway (GO:0038084)	endosome (GO:0005768)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|placental growth factor-activated receptor activity (GO:0036332)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)|VEGF-A-activated receptor activity (GO:0036326)|VEGF-B-activated receptor activity (GO:0036327)	p.G401E(2)		NS(1)|breast(2)|central_nervous_system(5)|endometrium(8)|kidney(3)|large_intestine(20)|lung(55)|ovary(3)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	115	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	TGTATAATTCCCTGCATCCTC	0.398																																							uc001usb.3		NA																	2	Substitution - Missense(2)		lung(2)	lung(10)|central_nervous_system(5)|ovary(3)|stomach(2)|skin(2)|urinary_tract(1)|breast(1)	24						c.(1201-1203)GGG>GAG		fms-related tyrosine kinase 1 isoform 1	Sunitinib(DB01268)						156.0	138.0	144.0					13																	29001963		2203	4300	6503	SO:0001583	missense	2321				cell differentiation|female pregnancy|positive regulation of vascular endothelial growth factor receptor signaling pathway	extracellular space|Golgi apparatus|integral to plasma membrane|nucleus	ATP binding|growth factor binding|vascular endothelial growth factor receptor activity	g.chr13:29001963C>T	AF063657	CCDS9330.1, CCDS53860.1, CCDS53861.1, CCDS73556.1	13q12	2014-09-17	2012-11-19		ENSG00000102755	ENSG00000102755	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3763	protein-coding gene	gene with protein product	"""vascular endothelial growth factor receptor 1"", ""vascular permeability factor receptor"""	165070	"""fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor)"""	FLT		2158038	Standard	NM_001159920		Approved	VEGFR1	uc001usb.3	P17948	OTTHUMG00000016648	ENST00000282397.4:c.1202G>A	13.37:g.29001963C>T	ENSP00000282397:p.Gly401Glu		Somatic				FLT1_uc010aar.1_Missense_Mutation_p.G401E|FLT1_uc001usc.3_Missense_Mutation_p.G401E|FLT1_uc010tdp.1_Missense_Mutation_p.G401E	p.G401E	NM_002019	NP_002010	WXS	Illumina HiSeq	Unspecified	P17948	VGFR1_HUMAN	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	9	1487	-	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	401			Ig-like C2-type 4.|Extracellular (Potential).		A3E342|A3E344|A8KA71|B0LPF1|B2BF46|B2BF47|B2BF48|B3FR89|B5A923|F5H5L6|O60722|P16057|Q12954	Missense_Mutation	SNP	ENST00000282397.4	37	c.1202G>A	CCDS9330.1	.	.	.	.	.	.	.	.	.	.	C	19.89	3.911445	0.72983	.	.	ENSG00000102755	ENST00000282397;ENST00000541932;ENST00000539099	T;T;T	0.80909	-1.43;-1.43;-1.43	5.85	5.85	0.93711	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Tyrosine-protein kinase, vascular endothelial growth factor receptor (VEGFR), N-terminal (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.94670	0.8281	H	0.99011	4.4	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.96286	0.9210	10	0.87932	D	0	.	20.1669	0.98153	0.0:1.0:0.0:0.0	.	401;401;401;401	P17948-4;P17948-3;P17948-2;P17948	.;.;.;VGFR1_HUMAN	E	401	ENSP00000282397:G401E;ENSP00000437631:G401E;ENSP00000442630:G401E	ENSP00000282397:G401E	G	-	2	0	FLT1	27899963	1.000000	0.71417	0.196000	0.23383	0.427000	0.31564	6.883000	0.75595	2.770000	0.95276	0.650000	0.86243	GGG		0.398	FLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044322.1			19	91	0	0	0	0.008871	0	19	91				
LCP1	3936	broad.mit.edu	37	13	46718649	46718649	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr13:46718649G>T	ENST00000398576.2	-	14	1569	c.1181C>A	c.(1180-1182)aCg>aAg	p.T394K	LCP1_ENST00000323076.2_Missense_Mutation_p.T394K|LCP1_ENST00000435666.2_5'Flank			P13796	PLSL_HUMAN	lymphocyte cytosolic protein 1 (L-plastin)	394	Actin-binding 2.|CH 3. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin filament bundle assembly (GO:0051017)|cell migration (GO:0016477)|organ regeneration (GO:0031100)|protein kinase A signaling (GO:0010737)|regulation of intracellular protein transport (GO:0033157)|T cell activation involved in immune response (GO:0002286)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|actin filament bundle (GO:0032432)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)	p.T394K(1)		breast(2)|kidney(1)|large_intestine(6)|lung(18)|ovary(4)|prostate(2)|skin(1)	34		Lung NSC(96;1.27e-05)|Breast(56;8.04e-05)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;5.39e-05)		CTCTTCTCTCGTCTCACCTAG	0.388			T	BCL6	NHL																																		uc001vaz.3		NA		Dom	yes		13	13q14.1-q14.3	3936	T	lymphocyte cytosolic protein 1 (L-plastin)			L	BCL6		NHL 		1	Substitution - Missense(1)		lung(1)	lung(4)|ovary(3)	7						c.(1180-1182)ACG>AAG		L-plastin							122.0	108.0	113.0					13																	46718649		2203	4300	6503	SO:0001583	missense	3936				regulation of intracellular protein transport|T cell activation involved in immune response	cell junction|cytosol|ruffle membrane	calcium ion binding	g.chr13:46718649G>T	M22300	CCDS9403.1	13q14.3	2013-01-10			ENSG00000136167	ENSG00000136167		"""EF-hand domain containing"""	6528	protein-coding gene	gene with protein product	"""plastin 2"""	153430				2111166	Standard	NM_002298		Approved	PLS2, CP64, L-PLASTIN, LC64P	uc001vba.4	P13796	OTTHUMG00000016864	ENST00000398576.2:c.1181C>A	13.37:g.46718649G>T	ENSP00000381581:p.Thr394Lys		Somatic				LCP1_uc010ack.2_5'Flank|LCP1_uc001vay.3_5'UTR|LCP1_uc001vba.3_Missense_Mutation_p.T394K	p.T394K	NM_002298	NP_002289	WXS	Illumina HiSeq	Unspecified	P13796	PLSL_HUMAN	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;5.39e-05)	11	1307	-		Lung NSC(96;1.27e-05)|Breast(56;8.04e-05)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	394			Actin-binding 2.|CH 3.		B2R613|B4DUA0|Q5TBN4	Missense_Mutation	SNP	ENST00000398576.2	37	c.1181C>A	CCDS9403.1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.413945	0.83449	.	.	ENSG00000136167	ENST00000323076;ENST00000398576	D;D	0.95412	-3.7;-3.7	6.03	6.03	0.97812	Calponin homology domain (3);	0.000000	0.85682	D	0.000000	D	0.98134	0.9384	M	0.88704	2.975	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97808	1.0249	10	0.48119	T	0.1	-15.4378	19.5478	0.95307	0.0:0.0:1.0:0.0	.	394	P13796	PLSL_HUMAN	K	394	ENSP00000315757:T394K;ENSP00000381581:T394K	ENSP00000315757:T394K	T	-	2	0	LCP1	45616650	1.000000	0.71417	0.971000	0.41717	0.848000	0.48234	7.761000	0.85260	2.868000	0.98415	0.555000	0.69702	ACG		0.388	LCP1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044800.3	NM_002298		23	66	1	0	2.89027e-11	0.002299	3.50961e-11	23	66				
PCDH17	27253	broad.mit.edu	37	13	58207613	58207613	+	Silent	SNP	T	T	C			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr13:58207613T>C	ENST00000377918.3	+	1	959	c.933T>C	c.(931-933)taT>taC	p.Y311Y		NM_001040429.2	NP_001035519.1	O14917	PCD17_HUMAN	protocadherin 17	311	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.Y311Y(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(30)|liver(2)|lung(54)|ovary(4)|pancreas(2)|prostate(5)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	120		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		ATCTGGACTATGAGGAAAACG	0.587																																					Melanoma(72;952 1291 1619 12849 33676)	Melanoma(72;952 1291 1619 12849 33676)	uc001vhq.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	7						c.(931-933)TAT>TAC		protocadherin 17 precursor							69.0	66.0	67.0					13																	58207613		2203	4300	6503	SO:0001819	synonymous_variant	27253				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding	g.chr13:58207613T>C	AF029343	CCDS31986.1	13q21.1	2010-01-26			ENSG00000118946	ENSG00000118946		"""Cadherins / Protocadherins : Non-clustered"""	14267	protein-coding gene	gene with protein product		611760				10835267	Standard	NM_001040429		Approved	PCDH68, PCH68	uc001vhq.1	O14917	OTTHUMG00000016992	ENST00000377918.3:c.933T>C	13.37:g.58207613T>C			Somatic				PCDH17_uc010aec.1_Silent_p.Y311Y	p.Y311Y	NM_001040429	NP_001035519	WXS	Illumina HiSeq	Unspecified	O14917	PCD17_HUMAN		GBM - Glioblastoma multiforme(99;1.06e-05)	1	1825	+		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)	311			Extracellular (Potential).|Cadherin 3.		A8K1R5|Q5VVW9|Q5VVX0	Silent	SNP	ENST00000377918.3	37	c.933T>C	CCDS31986.1																																																																																				0.587	PCDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045139.1	NM_001040429		19	75	0	0	0	0.007413	0	19	75				
POTEM	641455	broad.mit.edu	37	14	20020054	20020054	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr14:20020054G>T	ENST00000551509.1	-	1	218	c.167C>A	c.(166-168)aCa>aAa	p.T56K		NM_001145442.1	NP_001138914.1	A6NI47	POTEM_HUMAN	POTE ankyrin domain family, member M	56								p.T56K(2)		endometrium(4)|kidney(1)|lung(4)	9						GCTCCTGAGTGTCTTCATAGC	0.612																																							uc001vwc.3		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(166-168)ACA>AAA		prostate-specific P704P							11.0	14.0	14.0					14																	20020054		289	1000	1289	SO:0001583	missense	641455							g.chr14:20020054G>T		CCDS73609.1	14q11.2	2013-01-10			ENSG00000187537	ENSG00000187537		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	37096	protein-coding gene	gene with protein product	"""prostate-specific P704P"""					16364570	Standard	NM_001145442		Approved	POTE14beta, P704P, ACT	uc001vwc.3	A6NI47		ENST00000551509.1:c.167C>A	14.37:g.20020054G>T	ENSP00000452296:p.Thr56Lys		Somatic				P704P_uc001vwb.3_RNA	p.T56K	NM_001145442	NP_001138914	WXS	Illumina HiSeq	Unspecified	A6NI47	POTEM_HUMAN			1	219	-			56						Missense_Mutation	SNP	ENST00000551509.1	37	c.167C>A	CCDS45076.1	.	.	.	.	.	.	.	.	.	.	g	5.282	0.237528	0.10023	.	.	ENSG00000187537	ENST00000551509;ENST00000439503;ENST00000344684	T	0.29655	1.56	.	.	.	.	.	.	.	.	T	0.18882	0.0453	L	0.34521	1.04	0.09310	N	1	B	0.27559	0.181	B	0.24155	0.051	T	0.23440	-1.0188	6	.	.	.	.	.	.	.	.	56	A6NI47	POTEM_HUMAN	K	56	ENSP00000452296:T56K	.	T	-	2	0	POTEM	19090054	0.001000	0.12720	0.024000	0.17045	0.027000	0.11550	-0.353000	0.07691	0.149000	0.19098	0.152000	0.16155	ACA		0.612	POTEM-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409490.3	NM_001145442		11	349	1	0	5.03518e-11	0.007413	6.07797e-11	11	349				
OR4K2	390431	broad.mit.edu	37	14	20345046	20345046	+	Missense_Mutation	SNP	C	C	A	rs371172454		TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr14:20345046C>A	ENST00000298642.2	+	1	656	c.620C>A	c.(619-621)gCg>gAg	p.A207E		NM_001005501.1	NP_001005501.1	Q8NGD2	OR4K2_HUMAN	olfactory receptor, family 4, subfamily K, member 2	207						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A207V(1)|p.A207E(1)		NS(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(16)|ovary(2)|skin(9)|upper_aerodigestive_tract(2)	43	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		GGCATAATTGCGTTGTCCTGT	0.398																																							uc001vwh.1		NA																	2	Substitution - Missense(2)		lung(1)|endometrium(1)	ovary(2)|skin(2)	4						c.(619-621)GCG>GAG		olfactory receptor, family 4, subfamily K,							312.0	312.0	312.0					14																	20345046		2203	4300	6503	SO:0001583	missense	390431				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr14:20345046C>A		CCDS32023.1	14q11.2	2013-09-23			ENSG00000165762	ENSG00000165762		"""GPCR / Class A : Olfactory receptors"""	14728	protein-coding gene	gene with protein product							Standard	NM_001005501		Approved		uc001vwh.1	Q8NGD2	OTTHUMG00000170624	ENST00000298642.2:c.620C>A	14.37:g.20345046C>A	ENSP00000298642:p.Ala207Glu		Somatic					p.A207E	NM_001005501	NP_001005501	WXS	Illumina HiSeq	Unspecified	Q8NGD2	OR4K2_HUMAN	Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)	1	620	+	all_cancers(95;0.00108)		207			Helical; Name=5; (Potential).		B2RNK8|Q6IFA5	Missense_Mutation	SNP	ENST00000298642.2	37	c.620C>A	CCDS32023.1	.	.	.	.	.	.	.	.	.	.	.	11.57	1.679041	0.29783	.	.	ENSG00000165762	ENST00000298642	T	0.37058	1.22	5.0	4.11	0.48088	GPCR, rhodopsin-like superfamily (1);	0.139136	0.32884	N	0.005535	T	0.47544	0.1451	L	0.46741	1.465	0.29481	N	0.856349	D	0.60160	0.987	D	0.68483	0.958	T	0.44314	-0.9336	10	0.87932	D	0	.	7.7058	0.28648	0.0:0.8129:0.0:0.1871	.	207	Q8NGD2	OR4K2_HUMAN	E	207	ENSP00000298642:A207E	ENSP00000298642:A207E	A	+	2	0	OR4K2	19414886	0.000000	0.05858	0.866000	0.34008	0.186000	0.23388	-0.259000	0.08721	1.331000	0.45412	0.467000	0.42956	GCG		0.398	OR4K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409864.1			34	362	1	0	3.86903e-22	0.002836	5.29719e-22	34	362				
MYH7	4625	broad.mit.edu	37	14	23892851	23892851	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr14:23892851C>T	ENST00000355349.3	-	24	3166	c.3004G>A	c.(3004-3006)Gcc>Acc	p.A1002T		NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	1002					adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)	p.A1002T(1)		NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		TGTTGGTGGGCCTCTTGCAGA	0.542																																							uc001wjx.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(1)	4						c.(3004-3006)GCC>ACC		myosin, heavy chain 7, cardiac muscle, beta							161.0	158.0	159.0					14																	23892851		2203	4300	6503	SO:0001583	missense	4625				adult heart development|muscle filament sliding|regulation of heart rate|ventricular cardiac muscle tissue morphogenesis	focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle	g.chr14:23892851C>T	M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.3004G>A	14.37:g.23892851C>T	ENSP00000347507:p.Ala1002Thr		Somatic					p.A1002T	NM_000257	NP_000248	WXS	Illumina HiSeq	Unspecified	P12883	MYH7_HUMAN		GBM - Glioblastoma multiforme(265;0.00725)	24	3110	-	all_cancers(95;2.54e-05)		1002			Potential.		A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Missense_Mutation	SNP	ENST00000355349.3	37	c.3004G>A	CCDS9601.1	.	.	.	.	.	.	.	.	.	.	C	14.92	2.679901	0.47886	.	.	ENSG00000092054	ENST00000355349;ENST00000544444	D	0.83075	-1.68	5.06	5.06	0.68205	.	.	.	.	.	D	0.87912	0.6297	M	0.85777	2.775	0.48762	D	0.999701	B	0.30021	0.265	B	0.41946	0.371	D	0.87064	0.2155	9	0.45353	T	0.12	.	15.0372	0.71757	0.1424:0.8576:0.0:0.0	.	1002	P12883	MYH7_HUMAN	T	1002	ENSP00000347507:A1002T	ENSP00000347507:A1002T	A	-	1	0	MYH7	22962691	1.000000	0.71417	1.000000	0.80357	0.220000	0.24768	3.065000	0.49994	2.638000	0.89438	0.655000	0.94253	GCC		0.542	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071798.3	NM_000257		76	215	0	0	0	0.00361	0	76	215				
NEDD8	4738	broad.mit.edu	37	14	24687414	24687414	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr14:24687414C>T	ENST00000250495.5	-	3	260	c.74G>A	c.(73-75)cGa>cAa	p.R25Q	MDP1_ENST00000288087.7_5'Flank|MDP1_ENST00000532557.1_5'Flank|AL136419.6_ENST00000565988.1_RNA|MDP1_ENST00000396833.2_5'Flank|NEDD8_ENST00000524927.1_Missense_Mutation_p.R25Q|NEDD8-MDP1_ENST00000604306.1_5'UTR|NEDD8-MDP1_ENST00000534348.1_Missense_Mutation_p.R25Q	NM_006156.2	NP_006147.1	Q15843	NEDD8_HUMAN	neural precursor cell expressed, developmentally down-regulated 8	25					anatomical structure morphogenesis (GO:0009653)|cellular protein modification process (GO:0006464)|protein localization (GO:0008104)|protein neddylation (GO:0045116)|proteolysis (GO:0006508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to organic cyclic compound (GO:0014070)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ubiquitin protein ligase binding (GO:0031625)	p.R25Q(2)		breast(1)|central_nervous_system(1)|large_intestine(1)|lung(2)	5				GBM - Glioblastoma multiforme(265;0.0186)		CTCCTTGATTCGCTCCACCTT	0.517																																							uc001wnn.2		NA																	2	Substitution - Missense(2)		large_intestine(1)|lung(1)		0						c.(73-75)CGA>CAA		neural precursor cell expressed, developmentally							118.0	103.0	108.0					14																	24687414		2203	4300	6503	SO:0001583	missense	4738				anatomical structure morphogenesis|protein neddylation|ubiquitin-dependent protein catabolic process	nucleus	ubiquitin protein ligase binding	g.chr14:24687414C>T	D23662	CCDS9621.1	14q11.2	2008-08-13			ENSG00000129559	ENSG00000129559			7732	protein-coding gene	gene with protein product		603171				9353319	Standard	NM_006156		Approved	Nedd-8		Q15843	OTTHUMG00000029325	ENST00000250495.5:c.74G>A	14.37:g.24687414C>T	ENSP00000250495:p.Arg25Gln		Somatic				CHMP4A_uc001wnj.2_5'Flank|MDP1_uc001wnk.1_5'Flank|CHMP4A_uc001wnm.1_5'Flank|MDP1_uc001wnl.1_5'Flank|NEDD8_uc001wno.2_RNA	p.R25Q	NM_006156	NP_006147	WXS	Illumina HiSeq	Unspecified	Q15843	NEDD8_HUMAN		GBM - Glioblastoma multiforme(265;0.0186)	3	177	-			25					Q3SXN8|Q6LES6	Missense_Mutation	SNP	ENST00000250495.5	37	c.74G>A	CCDS9621.1	.	.	.	.	.	.	.	.	.	.	C	32	5.179410	0.94846	.	.	ENSG00000255526;ENSG00000129559;ENSG00000129559	ENST00000534348;ENST00000250495;ENST00000524927	T;T;T	0.71222	-0.55;-0.55;-0.55	5.15	5.15	0.70609	Ubiquitin supergroup (1);Ubiquitin (2);	0.068063	0.56097	N	0.000028	T	0.57330	0.2046	N	0.16862	0.45	0.80722	D	1	D	0.55605	0.972	B	0.40410	0.328	T	0.67106	-0.5754	10	0.87932	D	0	-5.2715	17.5536	0.87884	0.0:1.0:0.0:0.0	.	25	Q15843	NEDD8_HUMAN	Q	25	ENSP00000431482:R25Q;ENSP00000250495:R25Q;ENSP00000448192:R25Q	ENSP00000250495:R25Q	R	-	2	0	NEDD8-MDP1;NEDD8	23757254	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.780000	0.62382	2.675000	0.91044	0.655000	0.94253	CGA		0.517	NEDD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073146.2	NM_006156		31	97	0	0	0	0.009535	0	31	97				
SEC23A	10484	broad.mit.edu	37	14	39530984	39530984	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr14:39530984G>A	ENST00000307712.6	-	13	2007	c.1490C>T	c.(1489-1491)aCc>aTc	p.T497I	SEC23A_ENST00000553925.1_5'Flank|SEC23A_ENST00000537403.1_Missense_Mutation_p.T295I|SEC23A_ENST00000545328.2_Missense_Mutation_p.T468I|SEC23A_ENST00000536508.1_Missense_Mutation_p.T371I	NM_006364.2	NP_006355.2	Q15436	SC23A_HUMAN	Sec23 homolog A (S. cerevisiae)	497					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)|vesicle-mediated transport (GO:0016192)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|perinuclear region of cytoplasm (GO:0048471)	zinc ion binding (GO:0008270)	p.T497I(1)		kidney(2)|large_intestine(3)|liver(1)|lung(11)|ovary(4)|pancreas(1)|upper_aerodigestive_tract(1)	23	Hepatocellular(127;0.213)		Lung(238;0.00047)|LUAD - Lung adenocarcinoma(48;0.000565)	GBM - Glioblastoma multiforme(112;0.0151)		AGCAATGGTGGTCACTCGGAT	0.428																																							uc001wup.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|upper_aerodigestive_tract(1)	5						c.(1489-1491)ACC>ATC		SEC23-related protein A							141.0	122.0	129.0					14																	39530984		2203	4300	6503	SO:0001583	missense	10484				COPII vesicle coating|intracellular protein transport|post-translational protein modification|protein N-linked glycosylation via asparagine	COPII vesicle coat|cytosol|Golgi membrane|smooth endoplasmic reticulum membrane	protein binding|zinc ion binding	g.chr14:39530984G>A	X97064	CCDS9668.1	14q21.1	2008-05-14	2001-11-28		ENSG00000100934	ENSG00000100934			10701	protein-coding gene	gene with protein product		610511	"""Sec23 (S. cerevisiae) homolog A"""			8898360, 10329445	Standard	NM_006364		Approved		uc001wup.1	Q15436	OTTHUMG00000028812	ENST00000307712.6:c.1490C>T	14.37:g.39530984G>A	ENSP00000306881:p.Thr497Ile		Somatic				SEC23A_uc010tqa.1_Missense_Mutation_p.T359I|SEC23A_uc010tqb.1_Missense_Mutation_p.T468I|SEC23A_uc010tqc.1_Missense_Mutation_p.T359I	p.T497I	NM_006364	NP_006355	WXS	Illumina HiSeq	Unspecified	Q15436	SC23A_HUMAN	Lung(238;0.00047)|LUAD - Lung adenocarcinoma(48;0.000565)	GBM - Glioblastoma multiforme(112;0.0151)	13	1713	-	Hepatocellular(127;0.213)		497					B2R5P4|B3KXI2|Q8NE16	Missense_Mutation	SNP	ENST00000307712.6	37	c.1490C>T	CCDS9668.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.419752	0.83559	.	.	ENSG00000100934	ENST00000537403;ENST00000307712;ENST00000536508;ENST00000545328;ENST00000554645	T;D;T;D	0.87887	-1.09;-2.31;-1.09;-2.31	5.4	5.4	0.78164	Sec23/Sec24 beta-sandwich (1);	0.050234	0.85682	D	0.000000	D	0.95341	0.8488	M	0.92169	3.28	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.997	D;D;D;D	0.97110	1.0;0.998;0.998;0.952	D	0.95899	0.8913	10	0.72032	D	0.01	-10.7854	19.5304	0.95226	0.0:0.0:1.0:0.0	.	385;468;371;497	G3V531;F5H365;F5H6C4;Q15436	.;.;.;SC23A_HUMAN	I	295;497;371;468;385	ENSP00000444193:T295I;ENSP00000306881:T497I;ENSP00000437715:T371I;ENSP00000445393:T468I	ENSP00000306881:T497I	T	-	2	0	SEC23A	38600735	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.768000	0.85345	2.675000	0.91044	0.655000	0.94253	ACC		0.428	SEC23A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276728.2			15	85	0	0	0	0.007413	0	15	85				
OTX2	5015	broad.mit.edu	37	14	57268910	57268910	+	Nonsense_Mutation	SNP	G	G	T			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr14:57268910G>T	ENST00000555006.1	-	4	821	c.413C>A	c.(412-414)tCa>tAa	p.S138*	RP11-1085N6.6_ENST00000602485.1_lincRNA|OTX2_ENST00000554559.1_3'UTR|OTX2_ENST00000339475.5_Nonsense_Mutation_p.S146*|OTX2_ENST00000554788.1_3'UTR|OTX2_ENST00000408990.3_Nonsense_Mutation_p.S138*			P32243	OTX2_HUMAN	orthodenticle homeobox 2	138					axon guidance (GO:0007411)|cell fate specification (GO:0001708)|diencephalon morphogenesis (GO:0048852)|dorsal/ventral pattern formation (GO:0009953)|endoderm development (GO:0007492)|eye photoreceptor cell fate commitment (GO:0042706)|forebrain development (GO:0030900)|inner ear morphogenesis (GO:0042472)|metencephalon development (GO:0022037)|midbrain development (GO:0030901)|neuron fate determination (GO:0048664)|positive regulation of embryonic development (GO:0040019)|positive regulation of gastrulation (GO:2000543)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|primitive streak formation (GO:0090009)|protein complex assembly (GO:0006461)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of smoothened signaling pathway (GO:0008589)|somite rostral/caudal axis specification (GO:0032525)	cytoplasm (GO:0005737)|growth cone (GO:0030426)|nucleus (GO:0005634)|protein complex (GO:0043234)	eukaryotic initiation factor 4E binding (GO:0008190)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.S146*(1)		central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(7)|ovary(1)|prostate(1)|urinary_tract(1)	19	Medulloblastoma(1;0.00184)|all_neural(1;0.00414)					GGTCGGGACTGAGGTGCTAGA	0.542																																							uc001xcp.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)	1						c.(412-414)TCA>TAA		orthodenticle homeobox 2 isoform b							98.0	86.0	90.0					14																	57268910		2203	4300	6503	SO:0001587	stop_gained	5015				axon guidance|forebrain development|midbrain development|positive regulation of embryonic development|positive regulation of gastrulation|primitive streak formation|protein complex assembly|regulation of fibroblast growth factor receptor signaling pathway|regulation of smoothened signaling pathway	growth cone|nucleus|protein complex	eukaryotic initiation factor 4E binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|sequence-specific DNA binding	g.chr14:57268910G>T	AF298117	CCDS9728.1, CCDS41960.1	14q22.3	2014-09-17	2007-02-15		ENSG00000165588	ENSG00000165588		"""Homeoboxes / PRD class"""	8522	protein-coding gene	gene with protein product		600037	"""orthodenticle homolog 2 (Drosophila)"""			7959790	Standard	NM_021728		Approved		uc031qor.1	P32243	OTTHUMG00000152338	ENST00000555006.1:c.413C>A	14.37:g.57268910G>T	ENSP00000452336:p.Ser138*		Somatic				OTX2_uc010aou.2_Nonsense_Mutation_p.S138*|OTX2_uc001xcq.2_Nonsense_Mutation_p.S146*	p.S138*	NM_172337	NP_758840	WXS	Illumina HiSeq	Unspecified	P32243	OTX2_HUMAN			3	584	-	Medulloblastoma(1;0.00184)|all_neural(1;0.00414)		138					B2RAN5|Q6GTV3|Q9HAW3|Q9P2R1	Nonsense_Mutation	SNP	ENST00000555006.1	37	c.413C>A	CCDS41960.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.956128	0.73902	.	.	ENSG00000165588	ENST00000339475;ENST00000408990;ENST00000555006;ENST00000554845;ENST00000555804	.	.	.	5.82	4.92	0.64577	.	0.996793	0.08118	N	0.995111	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.4162	0.60970	0.0746:0.0:0.9254:0.0	.	.	.	.	X	146;138;138;146;138	.	ENSP00000343819:S146X	S	-	2	0	OTX2	56338663	1.000000	0.71417	1.000000	0.80357	0.771000	0.43674	9.787000	0.99055	2.767000	0.95098	0.655000	0.94253	TCA		0.542	OTX2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411522.1	NM_021728.		38	57	1	0	6.70999e-13	0.004289	8.34657e-13	38	57				
MARK3	4140	broad.mit.edu	37	14	103932328	103932328	+	Nonsense_Mutation	SNP	T	T	G			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr14:103932328T>G	ENST00000429436.2	+	9	1307	c.797T>G	c.(796-798)tTa>tGa	p.L266*	MARK3_ENST00000553942.1_Nonsense_Mutation_p.L266*|MARK3_ENST00000303622.9_Nonsense_Mutation_p.L266*|MARK3_ENST00000216288.7_Nonsense_Mutation_p.L266*|MARK3_ENST00000335102.5_Nonsense_Mutation_p.L289*|MARK3_ENST00000440884.3_Nonsense_Mutation_p.L187*|MARK3_ENST00000416682.2_Nonsense_Mutation_p.L289*|MARK3_ENST00000561071.1_Intron	NM_001128918.1|NM_001128919.1	NP_001122390.1|NP_001122391.1	P27448	MARK3_HUMAN	MAP/microtubule affinity-regulating kinase 3	266	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.L266*(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30		Melanoma(154;0.155)	Epithelial(46;0.241)			GAGAGAGTATTAAGAGGGAAA	0.403																																							uc001ymz.3		NA																	1	Substitution - Nonsense(1)		lung(1)	central_nervous_system(2)|ovary(1)|stomach(1)	4						c.(796-798)TTA>TGA		MAP/microtubule affinity-regulating kinase 3							85.0	82.0	83.0					14																	103932328		1835	4085	5920	SO:0001587	stop_gained	4140						ATP binding|protein binding|protein serine/threonine kinase activity	g.chr14:103932328T>G	M80359	CCDS41993.1, CCDS45165.1, CCDS45166.1, CCDS45167.1, CCDS55947.1	14q32.32	2014-04-07			ENSG00000075413	ENSG00000075413			6897	protein-coding gene	gene with protein product		602678				9533022	Standard	NM_002376		Approved	CTAK1, KP78, PAR-1A	uc001ymz.4	P27448	OTTHUMG00000171789	ENST00000429436.2:c.797T>G	14.37:g.103932328T>G	ENSP00000411397:p.Leu266*		Somatic				MARK3_uc001ymx.3_Nonsense_Mutation_p.L266*|MARK3_uc001ymw.3_Nonsense_Mutation_p.L266*|MARK3_uc001yna.3_Nonsense_Mutation_p.L266*|MARK3_uc001ymy.3_Nonsense_Mutation_p.L187*|MARK3_uc010awp.2_Nonsense_Mutation_p.L289*|MARK3_uc010tyb.1_Nonsense_Mutation_p.L77*	p.L266*	NM_001128918	NP_001122390	WXS	Illumina HiSeq	Unspecified	P27448	MARK3_HUMAN	Epithelial(46;0.241)		9	1463	+		Melanoma(154;0.155)	266			Protein kinase.		O60219|Q86TT8|Q8TB41|Q8WX83|Q96RG1|Q9UMY9|Q9UN34	Nonsense_Mutation	SNP	ENST00000429436.2	37	c.797T>G	CCDS45165.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	43|43	10.073017|10.073017	0.99330|0.99330	.|.	.|.	ENSG00000075413|ENSG00000075413	ENST00000335102;ENST00000440884;ENST00000416682;ENST00000429436;ENST00000303622;ENST00000216288;ENST00000553942|ENST00000554627	.|.	.|.	.|.	5.9|5.9	5.9|5.9	0.94986|0.94986	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|.	.|.	.|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.02654|.	T|.	1|.	.|.	16.3322|16.3322	0.83039|0.83039	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|.	.|.	.|.	X|E	289;187;289;266;266;266;266|34	.|.	ENSP00000216288:L266X|.	L|X	+|+	2|1	0|0	MARK3|MARK3	103002081|103002081	1.000000|1.000000	0.71417|0.71417	0.070000|0.070000	0.20053|0.20053	0.989000|0.989000	0.77384|0.77384	7.914000|7.914000	0.87478|0.87478	2.251000|2.251000	0.74343|0.74343	0.528000|0.528000	0.53228|0.53228	TTA|TAA		0.403	MARK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415144.1	NM_001128918		33	53	0	0	0	0.002836	0	33	53				
PACS2	23241	broad.mit.edu	37	14	105860917	105860917	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr14:105860917G>T	ENST00000325438.8	+	24	3082	c.2578G>T	c.(2578-2580)Gac>Tac	p.D860Y	PACS2_ENST00000547217.1_Missense_Mutation_p.D830Y|PACS2_ENST00000430725.2_Missense_Mutation_p.D785Y|PACS2_ENST00000447393.1_Missense_Mutation_p.D864Y|PACS2_ENST00000551743.1_Missense_Mutation_p.D374Y|PACS2_ENST00000458164.2_Missense_Mutation_p.D875Y|PACS2_ENST00000551801.1_Missense_Mutation_p.D61Y			Q86VP3	PACS2_HUMAN	phosphofurin acidic cluster sorting protein 2	860					apoptotic process (GO:0006915)|autophagic vacuole assembly (GO:0000045)|protein localization to pre-autophagosomal structure (GO:0034497)|protein targeting to plasma membrane (GO:0072661)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)		p.D860Y(1)		endometrium(2)|kidney(2)|lung(7)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	21		all_cancers(154;0.0351)|all_epithelial(191;0.153)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.0145)|Epithelial(46;0.036)	Epithelial(152;0.138)		GGAGTGCAGCGACGTCAAGTT	0.672																																							uc001yqt.2		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)	1						c.(2578-2580)GAC>TAC		phosphofurin acidic cluster sorting protein 2							131.0	97.0	109.0					14																	105860917		2203	4300	6503	SO:0001583	missense	23241				apoptosis|interspecies interaction between organisms	endoplasmic reticulum lumen|mitochondrion		g.chr14:105860917G>T	AB011174	CCDS32168.1, CCDS45178.1, CCDS45178.2, CCDS58339.1	14q32	2005-02-15	2005-02-15	2005-02-15		ENSG00000179364			23794	protein-coding gene	gene with protein product		610423	"""phosphofurin acidic cluster sorting protein 1-like"""	PACS1L		15692567	Standard	NM_001100913		Approved	KIAA0602	uc001yqu.3	Q86VP3	OTTHUMG00000170450	ENST00000325438.8:c.2578G>T	14.37:g.105860917G>T	ENSP00000321834:p.Asp860Tyr		Somatic				PACS2_uc001yqs.2_Missense_Mutation_p.D785Y|PACS2_uc001yqv.2_Missense_Mutation_p.D864Y|PACS2_uc001yqu.2_Missense_Mutation_p.D875Y	p.D860Y	NM_015197	NP_056012	WXS	Illumina HiSeq	Unspecified	Q86VP3	PACS2_HUMAN	OV - Ovarian serous cystadenocarcinoma(23;0.0145)|Epithelial(46;0.036)	Epithelial(152;0.138)	24	2753	+		all_cancers(154;0.0351)|all_epithelial(191;0.153)|Melanoma(154;0.155)	860					A2VDJ9|G8JLK3|O60342|Q6P191|Q96FL7	Missense_Mutation	SNP	ENST00000325438.8	37	c.2578G>T	CCDS32168.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.456466	0.84317	.	.	ENSG00000179364	ENST00000430725;ENST00000325438;ENST00000458164;ENST00000447393;ENST00000547217;ENST00000551743;ENST00000551801	T;T;T;T;T;T;T	0.53640	0.61;0.61;0.61;0.61;0.61;0.61;0.61	4.11	4.11	0.48088	.	0.000000	0.85682	D	0.000000	T	0.69584	0.3127	M	0.82056	2.57	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.997;0.996;0.989;0.999	T	0.75221	-0.3394	10	0.62326	D	0.03	-29.2451	15.285	0.73822	0.0:0.0:1.0:0.0	.	864;875;860;861	E9PB38;Q86VP3-2;Q86VP3;Q86VP3-3	.;.;PACS2_HUMAN;.	Y	785;860;875;864;830;374;61	ENSP00000393524:D785Y;ENSP00000321834:D860Y;ENSP00000399732:D875Y;ENSP00000393559:D864Y;ENSP00000449525:D830Y;ENSP00000449254:D374Y;ENSP00000447544:D61Y	ENSP00000321834:D860Y	D	+	1	0	PACS2	104931962	1.000000	0.71417	0.955000	0.39395	0.901000	0.52897	9.668000	0.98619	2.003000	0.58678	0.655000	0.94253	GAC		0.672	PACS2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000409209.1	XM_377355		45	56	1	0	1.61004e-24	0.00361	2.24964e-24	45	56				
OR4N4	283694	broad.mit.edu	37	15	22382965	22382965	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr15:22382965C>A	ENST00000328795.4	+	1	584	c.493C>A	c.(493-495)Cgc>Agc	p.R165S	RP11-69H14.6_ENST00000558896.1_RNA	NM_001005241.2	NP_001005241.2	Q8N0Y3	OR4N4_HUMAN	olfactory receptor, family 4, subfamily N, member 4	165						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R165S(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(19)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	40		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		CCTCATCCTCCGCTTGCCTTT	0.517																																							uc001yuc.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(1)	5						c.(493-495)CGC>AGC		olfactory receptor, family 4, subfamily N,							88.0	74.0	79.0					15																	22382965		2185	4255	6440	SO:0001583	missense	283694				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr15:22382965C>A	AI018459	CCDS32173.1	15q11.2	2012-08-09				ENSG00000183706		"""GPCR / Class A : Olfactory receptors"""	15375	protein-coding gene	gene with protein product							Standard	NM_001005241		Approved		uc010tzv.2	Q8N0Y3		ENST00000328795.4:c.493C>A	15.37:g.22382965C>A	ENSP00000332500:p.Arg165Ser		Somatic				LOC727924_uc001yub.1_Intron|OR4N4_uc010tzv.1_Missense_Mutation_p.R165S	p.R165S	NM_001005241	NP_001005241	WXS	Illumina HiSeq	Unspecified	Q8N0Y3	OR4N4_HUMAN	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)	7	1474	+		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	165			Extracellular (Potential).		Q6IEY3|Q6IF56	Missense_Mutation	SNP	ENST00000328795.4	37	c.493C>A	CCDS32173.1	.	.	.	.	.	.	.	.	.	.	.	0.170	-1.072453	0.01918	.	.	ENSG00000183706	ENST00000328795	T	0.00034	8.87	3.37	2.4	0.29515	GPCR, rhodopsin-like superfamily (1);	0.132210	0.35151	N	0.003417	T	0.00109	0.0003	N	0.21324	0.655	0.09310	N	1	B	0.27013	0.166	B	0.30105	0.111	T	0.02893	-1.1097	10	0.19590	T	0.45	-0.1645	8.0468	0.30553	0.4391:0.5609:0.0:0.0	.	165	Q8N0Y3	OR4N4_HUMAN	S	165	ENSP00000332500:R165S	ENSP00000332500:R165S	R	+	1	0	OR4N4	19884329	0.000000	0.05858	0.956000	0.39512	0.268000	0.26511	-1.328000	0.02680	0.689000	0.31550	0.404000	0.27445	CGC		0.517	OR4N4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414922.1			19	317	1	0	1.96292e-10	0.010504	2.34173e-10	19	317				
SCG3	29106	broad.mit.edu	37	15	51988120	51988120	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr15:51988120T>A	ENST00000220478.3	+	8	1320	c.917T>A	c.(916-918)cTg>cAg	p.L306Q	RP11-313P18.2_ENST00000559918.1_lincRNA|SCG3_ENST00000542355.2_Missense_Mutation_p.L74Q	NM_013243.3	NP_037375.2	Q8WXD2	SCG3_HUMAN	secretogranin III	306					blood coagulation (GO:0007596)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|membrane (GO:0016020)|secretory granule lumen (GO:0034774)	poly(A) RNA binding (GO:0044822)	p.L306Q(1)		breast(1)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21				all cancers(107;0.00488)		ATGAAAACACTGATTGACTTT	0.348																																							uc002abh.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(916-918)CTG>CAG		secretogranin III isoform 1 precursor							194.0	184.0	187.0					15																	51988120		2195	4293	6488	SO:0001583	missense	29106				platelet activation|platelet degranulation	extracellular region|stored secretory granule		g.chr15:51988120T>A	AF078851	CCDS10142.1, CCDS53947.1	15q21.2	2013-09-23			ENSG00000104112	ENSG00000104112			13707	protein-coding gene	gene with protein product		611796				2053134, 8825061	Standard	NM_013243		Approved	SGIII, FLJ90833	uc002abh.3	Q8WXD2	OTTHUMG00000131748	ENST00000220478.3:c.917T>A	15.37:g.51988120T>A	ENSP00000220478:p.Leu306Gln		Somatic				SCG3_uc010ufz.1_Missense_Mutation_p.L74Q	p.L306Q	NM_013243	NP_037375	WXS	Illumina HiSeq	Unspecified	Q8WXD2	SCG3_HUMAN		all cancers(107;0.00488)	8	1325	+			306					A8K2B0|B3KQP6|B4DK99|F5H3R8|Q96C83|Q96GE8|Q9Y6G7	Missense_Mutation	SNP	ENST00000220478.3	37	c.917T>A	CCDS10142.1	.	.	.	.	.	.	.	.	.	.	T	23.5	4.419826	0.83559	.	.	ENSG00000104112	ENST00000220478;ENST00000542355	T;T	0.39056	1.1;1.1	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	T	0.54647	0.1871	L	0.34521	1.04	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.58730	-0.7585	10	0.87932	D	0	-0.3233	15.4962	0.75653	0.0:0.0:0.0:1.0	.	306	Q8WXD2	SCG3_HUMAN	Q	306;74	ENSP00000220478:L306Q;ENSP00000445205:L74Q	ENSP00000220478:L306Q	L	+	2	0	SCG3	49775412	1.000000	0.71417	0.900000	0.35374	0.969000	0.65631	7.698000	0.84413	2.058000	0.61347	0.533000	0.62120	CTG		0.348	SCG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254670.2	NM_013243		51	247	0	0	0	0.00361	0	51	247				
ITGA11	22801	broad.mit.edu	37	15	68695330	68695330	+	Missense_Mutation	SNP	G	G	A	rs572157984		TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr15:68695330G>A	ENST00000315757.7	-	2	177	c.91C>T	c.(91-93)Cgg>Tgg	p.R31W	ITGA11_ENST00000423218.2_Missense_Mutation_p.R31W	NM_001004439.1	NP_001004439.1	Q9UKX5	ITA11_HUMAN	integrin, alpha 11	31					cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell-matrix adhesion (GO:0007160)|collagen-activated signaling pathway (GO:0038065)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle organ development (GO:0007517)|osteoblast differentiation (GO:0001649)|substrate-dependent cell migration (GO:0006929)	focal adhesion (GO:0005925)|integrin alpha11-beta1 complex (GO:0034681)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|collagen receptor activity (GO:0038064)|metal ion binding (GO:0046872)	p.R31W(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(6)|lung(22)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	52						GGGATGACCCGGGGCTTCCTG	0.617																																							uc002ari.2		NA																	1	Substitution - Missense(1)		lung(1)	kidney(2)|pancreas(1)	3						c.(91-93)CGG>TGG		integrin, alpha 11 precursor	Tirofiban(DB00775)						53.0	59.0	57.0					15																	68695330		2050	4195	6245	SO:0001583	missense	22801				cell-matrix adhesion|integrin-mediated signaling pathway|muscle organ development	integrin complex	collagen binding|receptor activity	g.chr15:68695330G>A	AF109681	CCDS45291.1	15q22.3-q23	2010-03-23				ENSG00000137809		"""Integrins"""	6136	protein-coding gene	gene with protein product		604789				10486209	Standard	NM_001004439		Approved	HsT18964	uc002ari.3	Q9UKX5		ENST00000315757.7:c.91C>T	15.37:g.68695330G>A	ENSP00000327290:p.Arg31Trp		Somatic				ITGA11_uc010bib.2_Missense_Mutation_p.R31W	p.R31W	NM_001004439	NP_001004439	WXS	Illumina HiSeq	Unspecified	Q9UKX5	ITA11_HUMAN			2	178	-			31			FG-GAP 1.|Extracellular (Potential).		J3KQM2|Q8WYI8|Q9UKQ1	Missense_Mutation	SNP	ENST00000315757.7	37	c.91C>T	CCDS45291.1	.	.	.	.	.	.	.	.	.	.	G	16.31	3.087241	0.55968	.	.	ENSG00000137809	ENST00000315757;ENST00000423218;ENST00000537153	T;T	0.71817	-0.6;-0.6	5.11	5.11	0.69529	.	0.124805	0.51477	D	0.000096	T	0.62146	0.2404	L	0.52126	1.63	0.43141	D	0.994898	P;B	0.40534	0.72;0.175	B;B	0.30572	0.117;0.023	T	0.66866	-0.5815	10	0.41790	T	0.15	.	16.398	0.83630	0.0:0.0:1.0:0.0	.	31;31	A8K8T0;Q9UKX5	.;ITA11_HUMAN	W	31	ENSP00000327290:R31W;ENSP00000403392:R31W	ENSP00000327290:R31W	R	-	1	2	ITGA11	66482384	0.938000	0.31826	0.873000	0.34254	0.787000	0.44495	2.506000	0.45433	2.526000	0.85167	0.467000	0.42956	CGG		0.617	ITGA11-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_012211		11	47	0	0	0	0.001368	0	11	47				
CCNF	899	broad.mit.edu	37	16	2481129	2481129	+	Splice_Site	SNP	A	A	T	rs111704404		TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr16:2481129A>T	ENST00000397066.4	+	2	104		c.e2-1			NM_001761.2	NP_001752.2	P41002	CCNF_HUMAN	cyclin F						mitotic nuclear division (GO:0007067)|negative regulation of centrosome duplication (GO:0010826)|placenta development (GO:0001890)|protein ubiquitination (GO:0016567)|re-entry into mitotic cell cycle (GO:0000320)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	centriole (GO:0005814)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)		p.?(2)		breast(3)|central_nervous_system(1)|kidney(4)|large_intestine(2)|lung(5)|prostate(4)|skin(1)	20		Ovarian(90;0.17)				TTTTTCCTTCAGTGGTCCACT	0.403																																							uc002cqd.1		NA																	2	Unknown(2)		lung(2)	central_nervous_system(1)|kidney(1)	2						c.e2-2		cyclin F							123.0	124.0	123.0					16																	2481129		2198	4300	6498	SO:0001630	splice_region_variant	899				cell division|mitosis|negative regulation of centrosome duplication|protein ubiquitination|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process	centriole|nucleus|SCF ubiquitin ligase complex	protein binding	g.chr16:2481129A>T	Z36714	CCDS10467.1	16p13.3	2008-02-05			ENSG00000162063	ENSG00000162063		"""F-boxes /  ""other"""""	1591	protein-coding gene	gene with protein product		600227				7896286	Standard	NM_001761		Approved	FBX1, FBXO1	uc002cqd.1	P41002	OTTHUMG00000128858	ENST00000397066.4:c.17-1A>T	16.37:g.2481129A>T			Somatic				CCNF_uc002cqe.1_Splice_Site	p.V6_splice	NM_001761	NP_001752	WXS	Illumina HiSeq	Unspecified	P41002	CCNF_HUMAN			2	105	+		Ovarian(90;0.17)						B2R8H3|Q96EG9	Splice_Site	SNP	ENST00000397066.4	37	c.17_splice	CCDS10467.1	.	.	.	.	.	.	.	.	.	.	A	13.09	2.134610	0.37630	.	.	ENSG00000162063	ENST00000397066	.	.	.	5.13	5.13	0.70059	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.086	0.64957	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CCNF	2421130	1.000000	0.71417	0.937000	0.37676	0.496000	0.33645	8.014000	0.88676	2.061000	0.61500	0.533000	0.62120	.		0.403	CCNF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250801.1	NM_001761	Intron	57	227	0	0	0	0.00361	0	57	227				
ZNF213	7760	broad.mit.edu	37	16	3187321	3187321	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr16:3187321G>A	ENST00000396878.3	+	2	515	c.40G>A	c.(40-42)Gag>Aag	p.E14K	ZNF213_ENST00000576416.1_Missense_Mutation_p.E14K|RP11-473M20.14_ENST00000575089.1_RNA|RP11-473M20.14_ENST00000571963.1_RNA|RP11-473M20.14_ENST00000576590.1_RNA|ZNF213_ENST00000574902.1_Missense_Mutation_p.E14K|ZNF213_ENST00000416391.2_5'Flank|RP11-473M20.14_ENST00000571449.1_RNA	NM_001134655.1|NM_004220.2	NP_001128127.1|NP_004211.1	O14771	ZN213_HUMAN	zinc finger protein 213	14					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E14K(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	16						GGCCCCTGGGGAGGGAGAAGG	0.622																																							uc010uws.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(40-42)GAG>AAG		zinc finger protein 213							32.0	37.0	35.0					16																	3187321		2195	4300	6495	SO:0001583	missense	7760				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr16:3187321G>A	AF017433	CCDS10495.1	16p13.3	2014-05-13	2007-02-20	2007-02-20	ENSG00000085644	ENSG00000085644		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13005	protein-coding gene	gene with protein product		608387				9653642, 10023065	Standard	NM_004220		Approved	CR53, ZKSCAN21, ZSCAN53	uc010uws.2	O14771	OTTHUMG00000177519	ENST00000396878.3:c.40G>A	16.37:g.3187321G>A	ENSP00000380087:p.Glu14Lys		Somatic				ZNF213_uc002cud.2_RNA|ZNF213_uc010btf.2_Missense_Mutation_p.E14K|ZNF213_uc010bth.2_Missense_Mutation_p.E14K|ZNF213_uc010uwt.1_Missense_Mutation_p.E14K	p.E14K	NM_004220	NP_004211	WXS	Illumina HiSeq	Unspecified	O14771	ZN213_HUMAN			2	487	+			14					A8K1B9|B4DMG6|Q96IS1	Missense_Mutation	SNP	ENST00000396878.3	37	c.40G>A	CCDS10495.1	.	.	.	.	.	.	.	.	.	.	G	8.917	0.960129	0.18507	.	.	ENSG00000085644	ENST00000396878	T	0.06371	3.31	5.12	5.12	0.69794	.	0.000000	0.46442	D	0.000290	T	0.11965	0.0291	M	0.81802	2.56	0.80722	D	1	P	0.43633	0.813	B	0.39617	0.305	T	0.01899	-1.1251	10	0.46703	T	0.11	.	13.7712	0.63026	0.0:0.1548:0.8452:0.0	.	14	O14771	ZN213_HUMAN	K	14	ENSP00000380087:E14K	ENSP00000380087:E14K	E	+	1	0	ZNF213	3127322	1.000000	0.71417	1.000000	0.80357	0.780000	0.44128	5.373000	0.66162	2.399000	0.81585	0.655000	0.94253	GAG		0.622	ZNF213-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437334.1	NM_004220		27	92	0	0	0	0.008361	0	27	92				
SH2B1	25970	broad.mit.edu	37	16	28877776	28877776	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr16:28877776G>T	ENST00000322610.8	+	4	800	c.361G>T	c.(361-363)Ggc>Tgc	p.G121C	SH2B1_ENST00000563674.1_Intron|SH2B1_ENST00000538342.1_Intron|SH2B1_ENST00000545570.1_Intron|SH2B1_ENST00000337120.5_Missense_Mutation_p.G121C|SH2B1_ENST00000359285.5_Missense_Mutation_p.G121C|SH2B1_ENST00000395532.4_Missense_Mutation_p.G121C			Q9NRF2	SH2B1_HUMAN	SH2B adaptor protein 1	121	Interaction with JAK2 (low-affinity binding; independent of JAK2 phosphorylation). {ECO:0000250}.|Interaction with RAC1. {ECO:0000250}.|Required for NGF signaling. {ECO:0000250}.				blood coagulation (GO:0007596)|cellular component movement (GO:0006928)|intracellular signal transduction (GO:0035556)|lamellipodium assembly (GO:0030032)|positive regulation of mitosis (GO:0045840)|regulation of DNA biosynthetic process (GO:2000278)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)	p.G121C(2)		endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25						GGCTGTGCTGGGCCCTTCTCG	0.632																																							uc002dri.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(361-363)GGC>TGC		SH2B adaptor protein 1 isoform 1							43.0	41.0	42.0					16																	28877776		2197	4300	6497	SO:0001583	missense	25970				blood coagulation|intracellular signal transduction	cytosol|membrane|nucleus	signal transducer activity	g.chr16:28877776G>T	AK055104	CCDS32424.1, CCDS53996.1, CCDS53997.1	16p11.2	2013-02-14						"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	30417	protein-coding gene	gene with protein product	"""SH2-B homolog"""	608937				11827956, 10594240	Standard	NM_001145812		Approved	FLJ30542, SH2B	uc002drl.3	Q9NRF2		ENST00000322610.8:c.361G>T	16.37:g.28877776G>T	ENSP00000321221:p.Gly121Cys		Somatic				uc010vct.1_Intron|SH2B1_uc010vdc.1_Intron|SH2B1_uc002drj.2_Missense_Mutation_p.G121C|SH2B1_uc002drk.2_Missense_Mutation_p.G121C|SH2B1_uc002drl.2_Missense_Mutation_p.G121C|SH2B1_uc010vdd.1_Intron|SH2B1_uc010vde.1_Missense_Mutation_p.G121C|SH2B1_uc002drm.2_Missense_Mutation_p.G121C	p.G121C	NM_001145795	NP_001139267	WXS	Illumina HiSeq	Unspecified	Q9NRF2	SH2B1_HUMAN			4	800	+			121			Interaction with JAK2 (low-affinity binding; independent of JAK2 phosphorylation) (By similarity).|Interaction with RAC1 (By similarity).|Required for NGF signaling (By similarity).		A8K2R7|Q96FK3|Q96SX3|Q9NRF1|Q9NRF3|Q9P2P7|Q9Y3Y3	Missense_Mutation	SNP	ENST00000322610.8	37	c.361G>T	CCDS53996.1	.	.	.	.	.	.	.	.	.	.	g	17.72	3.459297	0.63401	.	.	ENSG00000178188	ENST00000322610;ENST00000359285;ENST00000395532;ENST00000337120	T;T;T;T	0.50548	0.74;0.75;0.76;0.76	4.77	4.77	0.60923	.	0.000000	0.64402	D	0.000003	T	0.56156	0.1966	N	0.24115	0.695	0.36958	D	0.893201	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.87578	0.957;0.998;0.956	T	0.66532	-0.5900	10	0.66056	D	0.02	-31.6327	16.6033	0.84821	0.0:0.0:1.0:0.0	.	121;121;121	Q9NRF2-2;Q9NRF2-3;Q9NRF2	.;.;SH2B1_HUMAN	C	121	ENSP00000321221:G121C;ENSP00000352232:G121C;ENSP00000378903:G121C;ENSP00000337163:G121C	ENSP00000321221:G121C	G	+	1	0	SH2B1	28785277	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.159000	0.71856	2.208000	0.71279	0.436000	0.28706	GGC		0.632	SH2B1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000432666.1	NM_015503		20	55	1	0	8.34094e-07	0.008871	9.34918e-07	20	55				
ITGAL	3683	broad.mit.edu	37	16	30505572	30505572	+	Missense_Mutation	SNP	C	C	T	rs145951975		TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr16:30505572C>T	ENST00000356798.6	+	12	1433	c.1253C>T	c.(1252-1254)tCg>tTg	p.S418L	ITGAL_ENST00000358164.5_Missense_Mutation_p.S335L|ITGAL_ENST00000433423.2_Intron|ITGAL_ENST00000568012.1_3'UTR	NM_002209.2	NP_002200.2	P20701	ITAL_HUMAN	integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; alpha polypeptide)	418					activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell proliferation (GO:0042102)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:0002291)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integrin alphaL-beta2 complex (GO:0034687)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|ICAM-3 receptor activity (GO:0030369)|metal ion binding (GO:0046872)	p.S418L(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(10)|kidney(4)|large_intestine(12)|lung(32)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	76					Antithymocyte globulin(DB00098)|Efalizumab(DB00095)|Lovastatin(DB00227)	CAAAAGACTTCGTTGCTGGCC	0.602																																					NSCLC(110;1462 1641 3311 33990 49495)	NSCLC(110;1462 1641 3311 33990 49495)	uc002dyi.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|lung(3)|central_nervous_system(3)|breast(1)	10						c.(1252-1254)TCG>TTG		integrin alpha L isoform a precursor	Efalizumab(DB00095)	C	LEU/SER,LEU/SER	0,4394		0,0,2197	57.0	59.0	58.0		1004,1253	1.1	0.0	16	dbSNP_134	58	2,8598	2.2+/-6.3	0,2,4298	yes	missense,missense	ITGAL	NM_001114380.1,NM_002209.2	145,145	0,2,6495	TT,TC,CC		0.0233,0.0,0.0154	possibly-damaging,possibly-damaging	335/1087,418/1171	30505572	2,12992	2197	4300	6497	SO:0001583	missense	3683				blood coagulation|heterophilic cell-cell adhesion|inflammatory response|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|leukocyte migration|regulation of immune response|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell	integrin complex	cell adhesion molecule binding|receptor activity	g.chr16:30505572C>T		CCDS32433.1, CCDS45461.1	16p13.1-p11	2010-03-23				ENSG00000005844		"""CD molecules"", ""Integrins"""	6148	protein-coding gene	gene with protein product		153370		CD11A		3284962	Standard	NM_002209		Approved	LFA-1	uc002dyi.4	P20701		ENST00000356798.6:c.1253C>T	16.37:g.30505572C>T	ENSP00000349252:p.Ser418Leu		Somatic				ITGAL_uc002dyj.3_Missense_Mutation_p.S335L|ITGAL_uc010vev.1_Intron	p.S418L	NM_002209	NP_002200	WXS	Illumina HiSeq	Unspecified	P20701	ITAL_HUMAN			12	1429	+			418			FG-GAP 4.|Extracellular (Potential).		O43746|Q45H73|Q96HB1|Q9UBC8	Missense_Mutation	SNP	ENST00000356798.6	37	c.1253C>T	CCDS32433.1	.	.	.	.	.	.	.	.	.	.	C	5.882	0.346888	0.11126	0.0	2.33E-4	ENSG00000005844	ENST00000356798;ENST00000358164	T;T	0.71341	-0.56;-0.56	5.49	1.12	0.20585	.	1.307360	0.05088	N	0.484743	T	0.58409	0.2120	L	0.39397	1.21	0.09310	N	1	B;B	0.10296	0.003;0.001	B;B	0.08055	0.001;0.003	T	0.43861	-0.9365	10	0.38643	T	0.18	.	2.4149	0.04433	0.1727:0.3651:0.3352:0.127	.	335;418	Q96HB1;P20701	.;ITAL_HUMAN	L	418;335	ENSP00000349252:S418L;ENSP00000350886:S335L	ENSP00000349252:S418L	S	+	2	0	ITGAL	30413073	0.000000	0.05858	0.001000	0.08648	0.000000	0.00434	-0.149000	0.10204	0.786000	0.33708	-1.253000	0.01494	TCG		0.602	ITGAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434508.2			24	124	0	0	0	0.003954	0	24	124				
SETD6	79918	broad.mit.edu	37	16	58550115	58550115	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr16:58550115C>T	ENST00000219315.4	+	3	394	c.344C>T	c.(343-345)gCg>gTg	p.A115V	SETD6_ENST00000310682.2_Missense_Mutation_p.A91V|SETD6_ENST00000418480.1_3'UTR|SETD6_ENST00000394266.4_Missense_Mutation_p.A91V			Q8TBK2	SETD6_HUMAN	SET domain containing 6	115	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				negative regulation of NF-kappaB transcription factor activity (GO:0032088)|peptidyl-lysine monomethylation (GO:0018026)|regulation of inflammatory response (GO:0050727)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	NF-kappaB binding (GO:0051059)|protein-lysine N-methyltransferase activity (GO:0016279)	p.A91V(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	7						GAGCGAGTTGCGCTGCAGAGC	0.771																																							uc002ens.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(343-345)GCG>GTG		SET domain containing 6 isoform a							17.0	21.0	20.0					16																	58550115		2113	4172	6285	SO:0001583	missense	79918				negative regulation of NF-kappaB transcription factor activity|peptidyl-lysine monomethylation|regulation of inflammatory response	nucleus	NF-kappaB binding|protein-lysine N-methyltransferase activity	g.chr16:58550115C>T	AK024801	CCDS10798.1, CCDS54013.1	16q21	2008-02-05			ENSG00000103037	ENSG00000103037			26116	protein-coding gene	gene with protein product						12477932	Standard	NM_024860		Approved	FLJ21148	uc002ens.3	Q8TBK2	OTTHUMG00000150276	ENST00000219315.4:c.344C>T	16.37:g.58550115C>T	ENSP00000219315:p.Ala115Val		Somatic				SETD6_uc010cdl.2_Missense_Mutation_p.A115V|SETD6_uc002enr.2_Missense_Mutation_p.A91V|SETD6_uc010cdm.2_RNA|SETD6_uc010vij.1_Missense_Mutation_p.A39V	p.A115V	NM_001160305	NP_001153777	WXS	Illumina HiSeq	Unspecified	Q8TBK2	SETD6_HUMAN			3	403	+			115			SET.		A8K380|B5ME38|Q9H787	Missense_Mutation	SNP	ENST00000219315.4	37	c.344C>T	CCDS54013.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.33|14.33	2.502897|2.502897	0.44558|0.44558	.|.	.|.	ENSG00000103037|ENSG00000103037	ENST00000310682;ENST00000394266;ENST00000219315|ENST00000447443	T;T;T|T	0.16324|0.49432	2.62;2.35;2.6|0.78	5.17|5.17	5.17|5.17	0.71159|0.71159	SET domain (2);|.	0.255358|.	0.38897|.	N|.	0.001540|.	T|T	0.55847|0.55847	0.1946|0.1946	M|M	0.66939|0.66939	2.045|2.045	0.35629|0.35629	D|D	0.810073|0.810073	B;B;B|.	0.21606|.	0.006;0.058;0.001|.	B;B;B|.	0.19946|.	0.001;0.027;0.0|.	T|T	0.67956|0.67956	-0.5536|-0.5536	10|7	0.29301|0.72032	T|D	0.29|0.01	-2.2716|-2.2716	7.5584|7.5584	0.27837|0.27837	0.0:0.7424:0.1688:0.0888|0.0:0.7424:0.1688:0.0888	.|.	91;115;91|.	E9PC53;Q8TBK2;Q8TBK2-2|.	.;SETD6_HUMAN;.|.	V|C	91;91;115|43	ENSP00000310082:A91V;ENSP00000377809:A91V;ENSP00000219315:A115V|ENSP00000396437:R43C	ENSP00000219315:A115V|ENSP00000396437:R43C	A|R	+|+	2|1	0|0	SETD6|SETD6	57107616|57107616	0.010000|0.010000	0.17322|0.17322	0.984000|0.984000	0.44739|0.44739	0.454000|0.454000	0.32378|0.32378	1.690000|1.690000	0.37711|0.37711	2.389000|2.389000	0.81357|0.81357	0.491000|0.491000	0.48974|0.48974	GCG|CGC		0.771	SETD6-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000317274.2	NM_024860		9	51	0	0	0	0.006214	0	9	51				
PDP2	57546	broad.mit.edu	37	16	66919297	66919297	+	Silent	SNP	C	C	G			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr16:66919297C>G	ENST00000311765.2	+	2	1444	c.1110C>G	c.(1108-1110)acC>acG	p.T370T	RP11-61A14.2_ENST00000561475.1_lincRNA|PDP2_ENST00000568720.1_Intron	NM_020786.2	NP_065837.1	Q9P2J9	PDP2_HUMAN	pyruvate dehyrogenase phosphatase catalytic subunit 2	370					cellular metabolic process (GO:0044237)|peptidyl-threonine dephosphorylation (GO:0035970)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	[pyruvate dehydrogenase (lipoamide)] phosphatase activity (GO:0004741)|magnesium-dependent protein serine/threonine phosphatase activity (GO:0004724)|metal ion binding (GO:0046872)	p.T370T(1)		kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|urinary_tract(1)	12		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.088)|Epithelial(162;0.204)		GCTTCAATACCGAGGCCCTCA	0.577																																							uc002eqk.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(1108-1110)ACC>ACG		pyruvate dehydrogenase phosphatase isoenzyme 2							120.0	113.0	115.0					16																	66919297		2200	4300	6500	SO:0001819	synonymous_variant	57546				pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix|protein serine/threonine phosphatase complex	[pyruvate dehydrogenase (lipoamide)] phosphatase activity|metal ion binding	g.chr16:66919297C>G	AB037769	CCDS10822.1	16q22.1	2012-04-17			ENSG00000172840	ENSG00000172840		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	30263	protein-coding gene	gene with protein product	"""protein phosphatase 2C, magnesium-dependent, catalytic subunit 2"""	615499				9651365	Standard	NM_020786		Approved	KIAA1348, PPM2C2	uc002eqk.2	Q9P2J9	OTTHUMG00000137512	ENST00000311765.2:c.1110C>G	16.37:g.66919297C>G			Somatic					p.T370T	NM_020786	NP_065837	WXS	Illumina HiSeq	Unspecified	Q9P2J9	PDP2_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.088)|Epithelial(162;0.204)	2	1272	+		Ovarian(137;0.0563)	370					A8K924	Silent	SNP	ENST00000311765.2	37	c.1110C>G	CCDS10822.1																																																																																				0.577	PDP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268831.2	NM_020786		36	124	0	0	0	0.003755	0	36	124				
ZCCHC14	23174	broad.mit.edu	37	16	87446014	87446014	+	Silent	SNP	A	A	G			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr16:87446014A>G	ENST00000268616.4	-	12	2119	c.1902T>C	c.(1900-1902)cgT>cgC	p.R634R		NM_015144.2	NP_055959.1	Q8WYQ9	ZCH14_HUMAN	zinc finger, CCHC domain containing 14	634							nucleic acid binding (GO:0003676)|phosphatidylinositol binding (GO:0035091)|zinc ion binding (GO:0008270)	p.R634R(1)		breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	36				BRCA - Breast invasive adenocarcinoma(80;0.0285)		TGATGGGCGGACGGGCGGCGT	0.607																																							uc002fjz.1		NA																	1	Substitution - coding silent(1)		lung(1)	upper_aerodigestive_tract(1)|breast(1)	2						c.(1900-1902)CGT>CGC		zinc finger, CCHC domain containing 14							79.0	89.0	86.0					16																	87446014		2198	4300	6498	SO:0001819	synonymous_variant	23174				cell communication		nucleic acid binding|phosphatidylinositol binding|zinc ion binding	g.chr16:87446014A>G	AB011151	CCDS10961.1	16q24.2	2013-01-10			ENSG00000140948	ENSG00000140948		"""Zinc fingers, CCHC domain containing"", ""Sterile alpha motif (SAM) domain containing"""	24134	protein-coding gene	gene with protein product						9628581	Standard	XM_005255858		Approved	BDG29, MGC14139	uc002fjz.1	Q8WYQ9	OTTHUMG00000137655	ENST00000268616.4:c.1902T>C	16.37:g.87446014A>G			Somatic				ZCCHC14_uc002fka.1_RNA|ZCCHC14_uc002fkb.2_Silent_p.R410R	p.R634R	NM_015144	NP_055959	WXS	Illumina HiSeq	Unspecified	Q8WYQ9	ZCH14_HUMAN		BRCA - Breast invasive adenocarcinoma(80;0.0285)	12	1929	-			634					D3DUN1|O60324|Q3MJD8|Q9UFP0	Silent	SNP	ENST00000268616.4	37	c.1902T>C	CCDS10961.1																																																																																				0.607	ZCCHC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269107.1	NM_015144		33	193	0	0	0	0.004878	0	33	193				
ZMYND15	84225	broad.mit.edu	37	17	4648196	4648196	+	Silent	SNP	G	G	A			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr17:4648196G>A	ENST00000433935.1	+	12	1926	c.1869G>A	c.(1867-1869)acG>acA	p.T623T	ZMYND15_ENST00000269289.6_Silent_p.T584T|ZMYND15_ENST00000573751.2_Silent_p.T631T|ZMYND15_ENST00000592813.1_Silent_p.T584T	NM_001136046.2|NM_001267822.1	NP_001129518.1|NP_001254751.1	Q9H091	ZMY15_HUMAN	zinc finger, MYND-type containing 15	623					negative regulation of transcription, DNA-templated (GO:0045892)|spermatid development (GO:0007286)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)	p.T623T(1)|p.T584T(1)		endometrium(5)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|skin(2)	18						TCAAGGATACGTGGCTGAGGT	0.587																																							uc002fyt.2		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(1750-1752)ACG>ACA		zinc finger, MYND-type containing 15 isoform 2							108.0	115.0	113.0					17																	4648196		2203	4300	6503	SO:0001819	synonymous_variant	84225						zinc ion binding	g.chr17:4648196G>A	AL136893	CCDS11053.1, CCDS45584.1, CCDS58506.1	17p13.3	2008-05-02			ENSG00000141497	ENSG00000141497		"""Zinc fingers, MYND-type"""	20997	protein-coding gene	gene with protein product		614312				11230166	Standard	NM_001136046		Approved	DKFZp434N127	uc002fyu.3	Q9H091	OTTHUMG00000090760	ENST00000433935.1:c.1869G>A	17.37:g.4648196G>A			Somatic				ZMYND15_uc002fyv.2_Silent_p.T623T|ZMYND15_uc002fyu.2_Silent_p.T631T	p.T584T	NM_032265	NP_115641	WXS	Illumina HiSeq	Unspecified	Q9H091	ZMY15_HUMAN			11	1791	+			584					B4DXY5|I3L296	Silent	SNP	ENST00000433935.1	37	c.1752G>A	CCDS45584.1																																																																																				0.587	ZMYND15-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439580.1	NM_032265		31	143	0	0	0	0.002836	0	31	143				
MED1	5469	broad.mit.edu	37	17	37564483	37564483	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr17:37564483C>A	ENST00000300651.6	-	17	4214	c.3991G>T	c.(3991-3993)Gtg>Ttg	p.V1331L	MED1_ENST00000394287.3_Intron|CTB-131K11.1_ENST00000582842.1_RNA	NM_004774.3	NP_004765.2	O95243	MBD4_HUMAN	mediator complex subunit 1	0					base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|depyrimidination (GO:0045008)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mitotic G2 DNA damage checkpoint (GO:0007095)|response to radiation (GO:0009314)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	endodeoxyribonuclease activity (GO:0004520)|pyrimidine-specific mismatch base pair DNA N-glycosylase activity (GO:0008263)|satellite DNA binding (GO:0003696)	p.V1331L(1)		NS(1)|breast(2)|cervix(3)|kidney(3)|large_intestine(7)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(7)|urinary_tract(1)	59		Ovarian(249;1.78e-06)|Lung SC(565;0.0262)	Lung(15;0.0178)|LUAD - Lung adenocarcinoma(14;0.146)	UCEC - Uterine corpus endometrioid carcinoma (308;6.64e-05)|BRCA - Breast invasive adenocarcinoma(366;0.00136)|READ - Rectum adenocarcinoma(1115;0.0649)		TTTGTGCTCACCCCCATCTGG	0.493										HNSCC(31;0.082)																											Pancreas(21;279 768 2492 4877 24026)	Pancreas(21;279 768 2492 4877 24026)	uc002hrv.3		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)|ovary(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	8						c.(3991-3993)GTG>TTG		mediator complex subunit 1							93.0	100.0	98.0					17																	37564483		2203	4298	6501	SO:0001583	missense	5469				androgen biosynthetic process|androgen receptor signaling pathway|cellular lipid metabolic process|fat cell differentiation|positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription initiation from RNA polymerase II promoter	mediator complex	DNA binding|estrogen receptor binding|ligand-dependent nuclear receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|peroxisome proliferator activated receptor binding|receptor activity|retinoic acid receptor binding|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding	g.chr17:37564483C>A	L40366	CCDS11336.1	17q12	2007-07-30	2007-07-30	2007-07-30	ENSG00000125686	ENSG00000125686			9234	protein-coding gene	gene with protein product		604311	"""PPAR binding protein"""	TRIP2, PPARGBP, PPARBP		9325263, 10485914	Standard	NM_004774		Approved	PBP, TRAP220, RB18A, DRIP230, CRSP200, CRSP1	uc002hrv.4	Q15648	OTTHUMG00000133216	ENST00000300651.6:c.3991G>T	17.37:g.37564483C>A	ENSP00000300651:p.Val1331Leu	HNSCC(31;0.082)	Somatic				MED1_uc010wee.1_Missense_Mutation_p.V1159L|MED1_uc002hru.2_Intron	p.V1331L	NM_004774	NP_004765	WXS	Illumina HiSeq	Unspecified	Q15648	MED1_HUMAN	Lung(15;0.0178)|LUAD - Lung adenocarcinoma(14;0.146)	UCEC - Uterine corpus endometrioid carcinoma (308;6.64e-05)|BRCA - Breast invasive adenocarcinoma(366;0.00136)|READ - Rectum adenocarcinoma(1115;0.0649)	17	4203	-		Ovarian(249;1.78e-06)|Lung SC(565;0.0262)	1331			Ser-rich.|Interaction with TP53.		B4DZN2|D3DNC3|D3DNC4|E9PEE4|Q2MD36|Q7Z4T3|Q96F09	Missense_Mutation	SNP	ENST00000300651.6	37	c.3991G>T	CCDS11336.1	.	.	.	.	.	.	.	.	.	.	C	10.08	1.252135	0.22880	.	.	ENSG00000125686	ENST00000300651	T	0.32023	1.47	5.2	4.23	0.50019	.	.	.	.	.	T	0.15955	0.0384	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.17592	-1.0364	9	0.23891	T	0.37	-0.2259	10.1171	0.42598	0.0:0.7459:0.1747:0.0795	.	1331	Q15648	MED1_HUMAN	L	1331	ENSP00000300651:V1331L	ENSP00000300651:V1331L	V	-	1	0	MED1	34818009	0.964000	0.33143	0.864000	0.33941	0.971000	0.66376	2.311000	0.43717	1.558000	0.49541	0.655000	0.94253	GTG		0.493	MED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256943.3	NM_004774		43	156	1	0	1.06522e-23	0.013114	1.47826e-23	43	156				
C17orf104	284071	broad.mit.edu	37	17	42745037	42745037	+	Silent	SNP	T	T	C			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr17:42745037T>C	ENST00000409122.2	+	5	1900	c.1758T>C	c.(1756-1758)aaT>aaC	p.N586N	C17orf104_ENST00000359945.3_Silent_p.N586N|C17orf104_ENST00000409464.1_Silent_p.N420N	NM_001145080.2	NP_001138552.2	A2RUB1	CQ104_HUMAN	chromosome 17 open reading frame 104	586								p.N586N(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(2)|pancreas(1)|skin(1)	24						AGCAGCCAAATGGATTTTGTG	0.353																																							uc010czv.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)	1						c.(1756-1758)AAT>AAC		hypothetical protein LOC284071							25.0	25.0	25.0					17																	42745037		2202	4299	6501	SO:0001819	synonymous_variant	284071							g.chr17:42745037T>C		CCDS45703.1, CCDS45703.2	17q21.31	2009-09-08			ENSG00000180336	ENSG00000180336			26670	protein-coding gene	gene with protein product							Standard	NM_001145080		Approved	FLJ35848	uc002iha.3	A2RUB1	OTTHUMG00000153039	ENST00000409122.2:c.1758T>C	17.37:g.42745037T>C			Somatic				C17orf104_uc002igy.1_Silent_p.N420N|C17orf104_uc002igz.3_Silent_p.N420N|C17orf104_uc010wja.1_RNA|C17orf104_uc002iha.2_Silent_p.N420N	p.N586N	NM_001145080	NP_001138552	WXS	Illumina HiSeq	Unspecified	A2RUB1	CQ104_HUMAN			5	1758	+			586					B4DXJ2|B5MD93|B9EGQ6|C4AM97|Q4G0Y1|Q8IVZ7|Q8NA45	Silent	SNP	ENST00000409122.2	37	c.1758T>C	CCDS45703.2																																																																																				0.353	C17orf104-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329171.2	NM_001145080		10	21	0	0	0	0.006214	0	10	21				
ANKFN1	162282	broad.mit.edu	37	17	54554984	54554984	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr17:54554984G>C	ENST00000318698.2	+	15	1953	c.1918G>C	c.(1918-1920)Gtg>Ctg	p.V640L	ANKFN1_ENST00000566473.2_Missense_Mutation_p.V640L	NM_153228.2	NP_694960.2	Q8N957	ANKF1_HUMAN	ankyrin-repeat and fibronectin type III domain containing 1	640								p.V640L(1)		NS(1)|breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(11)|lung(27)|ovary(1)|prostate(1)|skin(1)	53						TCTCTGCCACGTGAAGATCCG	0.408																																							uc002iun.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|ovary(1)	2						c.(1918-1920)GTG>CTG		ankyrin-repeat and fibronectin type III domain							147.0	144.0	145.0					17																	54554984		2203	4300	6503	SO:0001583	missense	162282							g.chr17:54554984G>C	AK095654	CCDS32686.1	17q23.2	2014-02-12	2005-11-15		ENSG00000153930	ENSG00000153930		"""Ankyrin repeat domain containing"", ""Fibronectin type III domain containing"""	26766	protein-coding gene	gene with protein product							Standard	NM_153228		Approved	FLJ38335	uc002iun.1	Q8N957	OTTHUMG00000155010	ENST00000318698.2:c.1918G>C	17.37:g.54554984G>C	ENSP00000321627:p.Val640Leu		Somatic					p.V640L	NM_153228	NP_694960	WXS	Illumina HiSeq	Unspecified	Q8N957	ANKF1_HUMAN			15	1953	+			640						Missense_Mutation	SNP	ENST00000318698.2	37	c.1918G>C	CCDS32686.1	.	.	.	.	.	.	.	.	.	.	G	12.39	1.922205	0.33908	.	.	ENSG00000153930	ENST00000318698	T	0.23348	1.91	5.83	1.7	0.24286	.	0.402671	0.29900	N	0.010912	T	0.22589	0.0545	L	0.54323	1.7	0.18873	N	0.999987	P	0.35328	0.495	B	0.32393	0.145	T	0.10753	-1.0616	10	0.72032	D	0.01	-1.0577	10.6304	0.45532	0.2568:0.0:0.7432:0.0	.	640	Q8N957	ANKF1_HUMAN	L	640	ENSP00000321627:V640L	ENSP00000321627:V640L	V	+	1	0	ANKFN1	51909983	0.957000	0.32711	0.337000	0.25536	0.865000	0.49528	1.717000	0.37991	0.119000	0.18210	-0.123000	0.14984	GTG		0.408	ANKFN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338043.1	NM_153228		52	200	0	0	0	0.00361	0	52	200				
TBC1D3P2	440452	broad.mit.edu	37	17	60348763	60348763	+	IGR	SNP	G	G	A			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr17:60348763G>A	ENST00000602932.1	-	0	397				TBC1D3P2_ENST00000581291.1_RNA																							CAATGTTCAGGAGGACTGACC	0.557																																							uc002izq.2		NA																	0					0						c.(340-342)CTC>CTT		SubName: Full=Putative uncharacterized protein TBC1D3E;																																				SO:0001628	intergenic_variant	440452							g.chr17:60348763G>A																													17.37:g.60348763G>A			Somatic				TBC1D3P2_uc010woz.1_RNA|uc010wpa.1_5'Flank	p.L114L			WXS	Illumina HiSeq	Unspecified					6	454	-									Silent	SNP	ENST00000602932.1	37	c.342C>T																																																																																					0.557	RP11-51L5.7-001	KNOWN	basic|appris_principal|readthrough_transcript	nonsense_mediated_decay	protein_coding	OTTHUMT00000467667.1			25	86	0	0	0	0.00874	0	25	86				
SRSF2	6427	broad.mit.edu	37	17	74733003	74733003	+	Silent	SNP	C	C	G			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr17:74733003C>G	ENST00000392485.2	-	1	412	c.240G>C	c.(238-240)ctG>ctC	p.L80L	MFSD11_ENST00000590514.1_5'Flank|MIR636_ENST00000384825.1_RNA|MFSD11_ENST00000336509.4_5'Flank|SRSF2_ENST00000508921.3_Silent_p.L80L|SRSF2_ENST00000359995.5_Silent_p.L80L|MFSD11_ENST00000593181.1_5'Flank|RP11-318A15.7_ENST00000587459.1_Intron|MFSD11_ENST00000590393.1_5'Flank|MFSD11_ENST00000588460.1_5'UTR|MFSD11_ENST00000586622.1_5'UTR|MFSD11_ENST00000591864.1_5'UTR|MFSD11_ENST00000355954.3_5'Flank	NM_003016.4	NP_003007.2	Q01130	SRSF2_HUMAN	serine/arginine-rich splicing factor 2	80	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|regulation of RNA biosynthetic process (GO:2001141)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	extracellular vesicular exosome (GO:0070062)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|transcription corepressor activity (GO:0003714)	p.L80L(2)		haematopoietic_and_lymphoid_tissue(320)|kidney(2)|large_intestine(1)|lung(4)|prostate(2)	329						CGCGGCCGTCCAGCACGGCCC	0.716			Mis		"""MDS, CLL"""																																		uc002jsv.2		NA		Dom	yes		17	17q25	6427		serine/arginine-rich splicing factor 2			L					2	Substitution - coding silent(2)		lung(2)		0						c.(238-240)CTG>CTC		splicing factor, arginine/serine-rich 2							23.0	28.0	26.0					17																	74733003		2196	4294	6490	SO:0001819	synonymous_variant	6427				mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	nuclear speck	nucleotide binding|protein binding|RNA binding|transcription corepressor activity	g.chr17:74733003C>G	M90104	CCDS11749.1	17q25.2	2014-09-17	2010-06-22	2010-06-22	ENSG00000161547	ENSG00000161547		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10783	protein-coding gene	gene with protein product	"""SR splicing factor 2"""	600813	"""splicing factor, arginine/serine-rich 2"""	SFRS2		8530103, 20516191	Standard	NM_003016		Approved	SC-35, SC35, PR264, SFRS2A	uc002jsv.3	Q01130		ENST00000392485.2:c.240G>C	17.37:g.74733003C>G			Somatic				SFRS2_uc002jsw.1_5'Flank|SFRS2_uc002jsx.1_RNA|SFRS2_uc002jsy.3_Silent_p.L80L|SFRS2_uc010wtg.1_Silent_p.L80L|MFSD11_uc002jsz.1_RNA|MFSD11_uc002jta.2_5'UTR|MIR636_hsa-mir-636|MI0003651_5'Flank|MFSD11_uc002jtb.2_5'Flank|MFSD11_uc010dha.2_5'Flank|MFSD11_uc002jtc.2_5'Flank|MFSD11_uc002jtd.3_5'Flank|MFSD11_uc010dhb.2_5'Flank|MFSD11_uc002jte.2_5'Flank	p.L80L	NM_003016	NP_003007	WXS	Illumina HiSeq	Unspecified	Q01130	SRSF2_HUMAN			1	410	-			80			RRM.		B3KWD5|B4DN89|H0YG49	Silent	SNP	ENST00000392485.2	37	c.240G>C	CCDS11749.1																																																																																				0.716	SRSF2-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437489.1	NM_003016		6	28	0	0	0	0.004482	0	6	28				
LAMA1	284217	broad.mit.edu	37	18	7036072	7036072	+	Missense_Mutation	SNP	C	C	T	rs552082654	byFrequency	TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr18:7036072C>T	ENST00000389658.3	-	13	1846	c.1753G>A	c.(1753-1755)Gga>Aga	p.G585R		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	585	Laminin IV type A 1. {ECO:0000255|PROSITE-ProRule:PRU00458}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)	p.G585R(1)		NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				TTCAGGAATCCGCCAAACGCA	0.458													C|||	2	0.000399361	0.0	0.0	5008	,	,		21575	0.0		0.0	False		,,,				2504	0.002						uc002knm.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21						c.(1753-1755)GGA>AGA		laminin, alpha 1 precursor	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)						144.0	107.0	120.0					18																	7036072		2203	4300	6503	SO:0001583	missense	284217				axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding	g.chr18:7036072C>T	X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.1753G>A	18.37:g.7036072C>T	ENSP00000374309:p.Gly585Arg		Somatic				LAMA1_uc010wzj.1_Missense_Mutation_p.G61R	p.G585R	NM_005559	NP_005550	WXS	Illumina HiSeq	Unspecified	P25391	LAMA1_HUMAN			13	1847	-		Colorectal(10;0.172)	585			Laminin IV type A 1.			Missense_Mutation	SNP	ENST00000389658.3	37	c.1753G>A	CCDS32787.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.283286	0.80803	.	.	ENSG00000101680	ENST00000389658	T	0.39056	1.1	5.68	4.81	0.61882	Laminin B type IV (2);Laminin B, subgroup (1);	0.060794	0.64402	D	0.000004	T	0.69223	0.3087	M	0.90309	3.105	0.58432	D	0.999999	D	0.89917	1.0	D	0.85130	0.997	T	0.71715	-0.4509	10	0.36615	T	0.2	.	14.9247	0.70868	0.0:0.9302:0.0:0.0698	.	585	P25391	LAMA1_HUMAN	R	585	ENSP00000374309:G585R	ENSP00000374309:G585R	G	-	1	0	LAMA1	7026072	0.988000	0.35896	0.943000	0.38184	0.761000	0.43186	2.109000	0.41863	2.675000	0.91044	0.655000	0.94253	GGA		0.458	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257369.1	NM_005559		10	43	0	0	0	0.001368	0	10	43				
DSC1	1823	broad.mit.edu	37	18	28714691	28714691	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr18:28714691C>A	ENST00000257198.5	-	12	1981	c.1720G>T	c.(1720-1722)Gca>Tca	p.A574S	RP11-408H20.2_ENST00000581836.1_RNA|RP11-408H20.3_ENST00000582307.1_RNA|DSC1_ENST00000257197.3_Missense_Mutation_p.A574S	NM_024421.2	NP_077739.1	Q08554	DSC1_HUMAN	desmocollin 1	574	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|gap junction (GO:0005921)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A574S(2)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(20)|ovary(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	53			OV - Ovarian serous cystadenocarcinoma(10;0.00778)			ATTTGAGGTGCGTGATCGTTG	0.368																																							uc002kwn.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|skin(1)	4						c.(1720-1722)GCA>TCA		desmocollin 1 isoform Dsc1a preproprotein							76.0	69.0	71.0					18																	28714691		2203	4300	6503	SO:0001583	missense	1823				homophilic cell adhesion	desmosome|gap junction|integral to membrane|membrane fraction	calcium ion binding	g.chr18:28714691C>A	AF293358	CCDS11894.1, CCDS11895.1	18q12.1	2010-01-26			ENSG00000134765	ENSG00000134765		"""Cadherins / Major cadherins"""	3035	protein-coding gene	gene with protein product		125643				8486729	Standard	NM_024421		Approved	CDHF1	uc002kwn.3	Q08554	OTTHUMG00000131982	ENST00000257198.5:c.1720G>T	18.37:g.28714691C>A	ENSP00000257198:p.Ala574Ser		Somatic				DSC1_uc002kwm.2_Missense_Mutation_p.A574S	p.A574S	NM_024421	NP_077739	WXS	Illumina HiSeq	Unspecified	Q08554	DSC1_HUMAN	OV - Ovarian serous cystadenocarcinoma(10;0.00778)		12	1982	-			574			Extracellular (Potential).|Cadherin 4.		Q9HB01	Missense_Mutation	SNP	ENST00000257198.5	37	c.1720G>T	CCDS11894.1	.	.	.	.	.	.	.	.	.	.	C	3.078	-0.189603	0.06299	.	.	ENSG00000134765	ENST00000257197;ENST00000257198	T;T	0.61274	0.12;0.12	5.35	1.3	0.21679	Cadherin (4);Cadherin conserved site (1);Cadherin-like (2);	0.401217	0.21410	N	0.074987	T	0.39572	0.1083	L	0.28458	0.855	0.09310	N	0.999993	B;B	0.11235	0.001;0.004	B;B	0.09377	0.004;0.002	T	0.23976	-1.0173	10	0.40728	T	0.16	.	6.9279	0.24426	0.1263:0.5147:0.359:0.0	.	574;574	Q08554;Q9HB00	DSC1_HUMAN;.	S	574	ENSP00000257197:A574S;ENSP00000257198:A574S	ENSP00000257197:A574S	A	-	1	0	DSC1	26968689	0.141000	0.22595	1.000000	0.80357	0.016000	0.09150	-0.695000	0.05109	0.739000	0.32628	-0.203000	0.12734	GCA		0.368	DSC1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254946.1	NM_004948, NM_024421		6	9	1	0	1.06961e-07	0.00308	1.23978e-07	6	9				
SETBP1	26040	broad.mit.edu	37	18	42532845	42532845	+	Silent	SNP	C	C	A			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr18:42532845C>A	ENST00000282030.5	+	4	3836	c.3540C>A	c.(3538-3540)ggC>ggA	p.G1180G		NM_015559.2	NP_056374.2	Q9Y6X0	SETBP_HUMAN	SET binding protein 1	1180						nucleus (GO:0005634)	DNA binding (GO:0003677)	p.G1126G(3)|p.G1180G(3)		NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(20)|lung(47)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	104				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		AAGCCACAGGCTTCTCCAGCC	0.522									Schinzel-Giedion syndrome																														uc010dni.2		NA																	6	Substitution - coding silent(6)		prostate(4)|kidney(2)	upper_aerodigestive_tract(2)|large_intestine(1)	3						c.(3538-3540)GGC>GGA		SET binding protein 1 isoform a							60.0	68.0	65.0					18																	42532845		2203	4300	6503	SO:0001819	synonymous_variant	26040	Schinzel-Giedion_syndrome	Familial Cancer Database	SGC, Schinzel-Giedion Midface Retraction syndrome		nucleus	DNA binding	g.chr18:42532845C>A	AB022660	CCDS11923.2, CCDS45859.1	18q21.1	2008-08-01			ENSG00000152217	ENSG00000152217			15573	protein-coding gene	gene with protein product		611060				11231286	Standard	NM_015559		Approved	SEB, KIAA0437	uc010dni.3	Q9Y6X0	OTTHUMG00000132613	ENST00000282030.5:c.3540C>A	18.37:g.42532845C>A			Somatic					p.G1180G	NM_015559	NP_056374	WXS	Illumina HiSeq	Unspecified	Q9Y6X0	SETBP_HUMAN		Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)	4	3836	+			1180					A6H8W5|Q6P6C3|Q9UEF3	Silent	SNP	ENST00000282030.5	37	c.3540C>A	CCDS11923.2																																																																																				0.522	SETBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255854.4	NM_001130110		9	94	1	0	2.27111e-07	0.001368	2.5883e-07	9	94				
MUC16	94025	broad.mit.edu	37	19	9045932	9045932	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr19:9045932G>A	ENST00000397910.4	-	5	35902	c.35699C>T	c.(35698-35700)tCt>tTt	p.S11900F		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	11902	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.S11900F(1)|p.S7533F(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GGAAAGCCCAGAGACAGCAGG	0.502																																							uc002mkp.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(35698-35700)TCT>TTT		mucin 16							98.0	93.0	94.0					19																	9045932		1914	4135	6049	SO:0001583	missense	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9045932G>A	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.35699C>T	19.37:g.9045932G>A	ENSP00000381008:p.Ser11900Phe		Somatic					p.S11900F	NM_024690	NP_078966	WXS	Illumina HiSeq	Unspecified	Q8WXI7	MUC16_HUMAN			5	35903	-			11902			Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	c.35699C>T	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	G	8.331	0.826465	0.16749	.	.	ENSG00000181143	ENST00000397910	T	0.03242	4.0	3.59	-0.0941	0.13646	.	.	.	.	.	T	0.02193	0.0068	N	0.14661	0.345	.	.	.	B	0.22414	0.069	B	0.17979	0.02	T	0.42275	-0.9461	8	0.87932	D	0	.	2.7519	0.05283	0.189:0.0:0.2981:0.5128	.	11900	B5ME49	.	F	11900	ENSP00000381008:S11900F	ENSP00000381008:S11900F	S	-	2	0	MUC16	8906932	0.002000	0.14202	0.000000	0.03702	0.246000	0.25737	0.512000	0.22755	0.019000	0.15079	0.555000	0.69702	TCT		0.502	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		35	162	0	0	0	0.004289	0	35	162				
MUC16	94025	broad.mit.edu	37	19	9088208	9088208	+	Missense_Mutation	SNP	G	G	C	rs573135410		TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr19:9088208G>C	ENST00000397910.4	-	1	3810	c.3607C>G	c.(3607-3609)Cca>Gca	p.P1203A		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	1203	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.P1203A(2)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						ATATTACTTGGTGTCAAGGAA	0.478																																							uc002mkp.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(3607-3609)CCA>GCA		mucin 16							195.0	188.0	190.0					19																	9088208		2078	4214	6292	SO:0001583	missense	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9088208G>C	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.3607C>G	19.37:g.9088208G>C	ENSP00000381008:p.Pro1203Ala		Somatic					p.P1203A	NM_024690	NP_078966	WXS	Illumina HiSeq	Unspecified	Q8WXI7	MUC16_HUMAN			1	3811	-			1203			Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	c.3607C>G	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	2.473	-0.321476	0.05386	.	.	ENSG00000181143	ENST00000397910	T	0.03094	4.05	0.895	0.895	0.19247	.	.	.	.	.	T	0.02012	0.0063	N	0.08118	0	.	.	.	P	0.49961	0.93	B	0.40444	0.329	T	0.43766	-0.9371	8	0.87932	D	0	.	5.1105	0.14806	0.0:0.0:1.0:0.0	.	1203	B5ME49	.	A	1203	ENSP00000381008:P1203A	ENSP00000381008:P1203A	P	-	1	0	MUC16	8949208	0.001000	0.12720	0.004000	0.12327	0.214000	0.24535	0.238000	0.18004	0.786000	0.33708	0.305000	0.20034	CCA		0.478	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		84	270	0	0	0	0.00361	0	84	270				
KCNN1	3780	broad.mit.edu	37	19	18096157	18096157	+	Silent	SNP	G	G	A			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr19:18096157G>A	ENST00000222249.9	+	6	1273	c.954G>A	c.(952-954)ctG>ctA	p.L318L		NM_002248.3	NP_002239.2	Q92952	KCNN1_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 1	318					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)	p.L335L(2)		endometrium(1)|kidney(1)|lung(5)|urinary_tract(1)	8					Miconazole(DB01110)|Procaine(DB00721)	GCAACTTCCTGGGGGCCATGT	0.592																																							uc002nht.2		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(952-954)CTG>CTA		potassium intermediate/small conductance							75.0	81.0	79.0					19																	18096157		2139	4261	6400	SO:0001819	synonymous_variant	3780				synaptic transmission	voltage-gated potassium channel complex	calmodulin binding|small conductance calcium-activated potassium channel activity	g.chr19:18096157G>A	U69883	CCDS67611.1	19p13.1	2012-07-05				ENSG00000105642		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6290	protein-coding gene	gene with protein product		602982				8781233, 10516439, 16382103	Standard	NM_002248		Approved	KCa2.1, hSK1	uc002nht.3	Q92952		ENST00000222249.9:c.954G>A	19.37:g.18096157G>A			Somatic				KCNN1_uc010xqa.1_Silent_p.L318L	p.L318L	NM_002248	NP_002239	WXS	Illumina HiSeq	Unspecified	Q92952	KCNN1_HUMAN			6	1264	+			318					Q5KR10|Q6DJU4	Silent	SNP	ENST00000222249.9	37	c.954G>A																																																																																					0.592	KCNN1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000471896.2	NM_002248		7	24	0	0	0	0.001984	0	7	24				
HKR1	284459	broad.mit.edu	37	19	37854370	37854370	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr19:37854370G>T	ENST00000324411.4	+	6	1942	c.1673G>T	c.(1672-1674)tGt>tTt	p.C558F	HKR1_ENST00000591134.1_Intron|HKR1_ENST00000544914.1_Missense_Mutation_p.C285F|HKR1_ENST00000589392.1_Missense_Mutation_p.C540F|HKR1_ENST00000541583.2_Missense_Mutation_p.C497F|HKR1_ENST00000392153.3_Missense_Mutation_p.C539F|HKR1_ENST00000591471.1_Missense_Mutation_p.C285F	NM_181786.2	NP_861451.1	P10072	HKR1_HUMAN	HKR1, GLI-Kruppel zinc finger family member	558					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.C558F(1)		cervix(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	29			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TGCAGGGAGTGTGGCAGAAGG	0.502																																							uc002ogb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1672-1674)TGT>TTT		GLI-Kruppel family member HKR1							53.0	48.0	49.0					19																	37854370		2203	4300	6503	SO:0001583	missense	284459				multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:37854370G>T	M20675	CCDS12502.1	19q13.13	2013-01-08	2010-05-04			ENSG00000181666		"""Zinc fingers, C2H2-type"", ""-"""	4928	protein-coding gene	gene with protein product	"""oncogene HKR1"""	165250	"""GLI-Kruppel family member HKR1"""			2850480, 9813242	Standard	NM_181786		Approved	ZNF875	uc002ogb.3	P10072		ENST00000324411.4:c.1673G>T	19.37:g.37854370G>T	ENSP00000315505:p.Cys558Phe		Somatic				HKR1_uc002ofx.2_Missense_Mutation_p.C274F|HKR1_uc002ofy.2_Missense_Mutation_p.C274F|HKR1_uc002oga.2_Missense_Mutation_p.C540F|HKR1_uc010xto.1_Missense_Mutation_p.C540F|HKR1_uc002ogc.2_Missense_Mutation_p.C539F|HKR1_uc010xtp.1_Missense_Mutation_p.C497F|HKR1_uc002ogd.2_Missense_Mutation_p.C497F	p.C558F	NM_181786	NP_861451	WXS	Illumina HiSeq	Unspecified	P10072	HKR1_HUMAN	COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)		6	1942	+			558			C2H2-type 10.		A8MRS7|Q6PJD0|Q9BSW9|Q9UM09	Missense_Mutation	SNP	ENST00000324411.4	37	c.1673G>T	CCDS12502.1	.	.	.	.	.	.	.	.	.	.	G	17.16	3.318227	0.60524	.	.	ENSG00000181666	ENST00000544914;ENST00000414402;ENST00000392153;ENST00000542144;ENST00000324411;ENST00000541583	D;D;D;D	0.85861	-2.04;-2.04;-2.04;-2.04	2.77	2.77	0.32553	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.94019	0.8084	H	0.95780	3.72	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;0.999;0.999	D	0.95364	0.8458	9	0.87932	D	0	.	13.4253	0.61022	0.0:0.0:1.0:0.0	.	497;539;558;540	Q7Z6E1;P10072-2;P10072;B4DSY3	.;.;HKR1_HUMAN;.	F	285;337;539;594;558;497	ENSP00000437774:C285F;ENSP00000375994:C539F;ENSP00000315505:C558F;ENSP00000438261:C497F	ENSP00000315505:C558F	C	+	2	0	HKR1	42546210	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	5.970000	0.70431	1.862000	0.54008	0.650000	0.86243	TGT		0.502	HKR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458375.1	NM_181786		15	56	1	0	1.3612e-06	0.003163	1.50916e-06	15	56				
RYR1	6261	broad.mit.edu	37	19	38985136	38985136	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr19:38985136G>T	ENST00000359596.3	+	39	6419	c.6419G>T	c.(6418-6420)cGg>cTg	p.R2140L	RYR1_ENST00000360985.3_Missense_Mutation_p.R2140L|RYR1_ENST00000355481.4_Missense_Mutation_p.R2140L			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	2140	6 X approximate repeats.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)	p.R2140Q(1)|p.R2140L(1)		NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	GCCCTGCCGCGGGCGTACACC	0.672																																							uc002oit.2		NA																	2	Substitution - Missense(2)		large_intestine(1)|lung(1)	ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12						c.(6418-6420)CGG>CTG		skeletal muscle ryanodine receptor isoform 1	Dantrolene(DB01219)						55.0	50.0	52.0					19																	38985136		2203	4300	6503	SO:0001583	missense	6261				muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity	g.chr19:38985136G>T	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.6419G>T	19.37:g.38985136G>T	ENSP00000352608:p.Arg2140Leu		Somatic				RYR1_uc002oiu.2_Missense_Mutation_p.R2140L|RYR1_uc002oiv.1_5'Flank	p.R2140L	NM_000540	NP_000531	WXS	Illumina HiSeq	Unspecified	P21817	RYR1_HUMAN	Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		39	6549	+	all_cancers(60;7.91e-06)		2140			Cytoplasmic.|6 X approximate repeats.		Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	37	c.6419G>T	CCDS33011.1	.	.	.	.	.	.	.	.	.	.	G	12.34	1.908782	0.33721	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	D;D;D	0.97041	-4.22;-4.22;-4.22	4.56	3.53	0.40419	.	0.084823	0.45361	U	0.000374	D	0.93792	0.8015	L	0.60455	1.87	0.31266	N	0.692353	P;P	0.47191	0.891;0.826	B;B	0.38156	0.266;0.136	D	0.92578	0.6072	10	0.87932	D	0	.	5.3797	0.16183	0.3537:0.0:0.6463:0.0	.	2140;2140	P21817-2;P21817	.;RYR1_HUMAN	L	2140	ENSP00000352608:R2140L;ENSP00000347667:R2140L;ENSP00000354254:R2140L	ENSP00000347667:R2140L	R	+	2	0	RYR1	43676976	1.000000	0.71417	0.917000	0.36280	0.302000	0.27658	4.454000	0.60068	1.128000	0.42052	0.305000	0.20034	CGG		0.672	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1			13	55	1	0	3.99206e-14	0.007413	5.05826e-14	13	55				
DYRK1B	9149	broad.mit.edu	37	19	40317399	40317399	+	Missense_Mutation	SNP	C	C	A	rs371510061		TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr19:40317399C>A	ENST00000593685.1	-	9	1792	c.1324G>T	c.(1324-1326)Ggc>Tgc	p.G442C	DYRK1B_ENST00000323039.5_Missense_Mutation_p.G442C|DYRK1B_ENST00000430012.2_Missense_Mutation_p.G402C|DYRK1B_ENST00000348817.3_Missense_Mutation_p.G414C|DYRK1B_ENST00000597639.1_Missense_Mutation_p.G414C			Q9Y463	DYR1B_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1B	442					adipose tissue development (GO:0060612)|myoblast fusion (GO:0007520)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|transcription coactivator activity (GO:0003713)	p.G414C(1)		central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(7)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	24	all_cancers(60;5.79e-06)|all_lung(34;5.2e-08)|Lung NSC(34;6.14e-08)|Ovarian(47;0.06)		Epithelial(26;5.74e-25)|OV - Ovarian serous cystadenocarcinoma(5;3.13e-24)|all cancers(26;8.59e-23)			CCTGCCGGGCCCGTGTTGGTG	0.721																																							uc002omj.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|stomach(1)|central_nervous_system(1)|skin(1)	7						c.(1324-1326)GGC>TGC		dual-specificity tyrosine-(Y)-phosphorylation							10.0	10.0	10.0					19																	40317399		2157	4177	6334	SO:0001583	missense	9149				positive regulation of transcription, DNA-dependent	nucleus	ATP binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|transcription coactivator activity	g.chr19:40317399C>A	Y17999	CCDS12543.1, CCDS12544.1, CCDS46075.1	19q13.2	2012-10-02			ENSG00000105204	ENSG00000105204	2.7.12.1		3092	protein-coding gene	gene with protein product	"""minibrain-related kinase"""	604556				9918863	Standard	XM_005259395		Approved	MIRK	uc002omj.3	Q9Y463		ENST00000593685.1:c.1324G>T	19.37:g.40317399C>A	ENSP00000469863:p.Gly442Cys		Somatic				DYRK1B_uc002omi.2_Missense_Mutation_p.G414C|DYRK1B_uc002omk.2_Missense_Mutation_p.G402C	p.G442C	NM_004714	NP_004705	WXS	Illumina HiSeq	Unspecified	Q9Y463	DYR1B_HUMAN	Epithelial(26;5.74e-25)|OV - Ovarian serous cystadenocarcinoma(5;3.13e-24)|all cancers(26;8.59e-23)		9	1604	-	all_cancers(60;5.79e-06)|all_lung(34;5.2e-08)|Lung NSC(34;6.14e-08)|Ovarian(47;0.06)		442					O75258|O75788|O75789	Missense_Mutation	SNP	ENST00000593685.1	37	c.1324G>T	CCDS12543.1	.	.	.	.	.	.	.	.	.	.	C	16.04	3.008839	0.54361	.	.	ENSG00000105204	ENST00000323039;ENST00000348817;ENST00000430012	T;T;T	0.58060	0.36;0.4;0.36	4.5	3.47	0.39725	Protein kinase-like domain (1);	0.224643	0.38217	N	0.001762	T	0.53077	0.1774	N	0.19112	0.55	0.42816	D	0.993977	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.78314	0.969;0.972;0.991	T	0.52117	-0.8618	10	0.44086	T	0.13	.	8.5407	0.33390	0.0:0.8906:0.0:0.1094	.	402;442;414	Q9Y463-2;Q9Y463;Q9Y463-3	.;DYR1B_HUMAN;.	C	442;414;402	ENSP00000312789:G442C;ENSP00000221803:G414C;ENSP00000403182:G402C	ENSP00000312789:G442C	G	-	1	0	DYRK1B	45009239	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.791000	0.62460	0.878000	0.35920	0.563000	0.77884	GGC		0.721	DYRK1B-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462874.2	NM_004714		4	7	1	0	3.59834e-05	0.001168	3.84325e-05	4	7				
NLRP12	91662	broad.mit.edu	37	19	54314312	54314312	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr19:54314312C>T	ENST00000324134.6	-	3	769	c.601G>A	c.(601-603)Gag>Aag	p.E201K	NLRP12_ENST00000345770.5_Missense_Mutation_p.E201K|NLRP12_ENST00000354278.3_Missense_Mutation_p.E201K|NLRP12_ENST00000351894.4_Missense_Mutation_p.E201K|NLRP12_ENST00000391772.1_Missense_Mutation_p.E201K|NLRP12_ENST00000391773.1_Missense_Mutation_p.E201K|NLRP12_ENST00000535162.1_Missense_Mutation_p.E201K|NLRP12_ENST00000391775.3_Missense_Mutation_p.E201K	NM_001277126.1|NM_144687.2	NP_001264055.1|NP_653288.1	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12	201					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to cytokine stimulus (GO:0071345)|dendritic cell migration (GO:0036336)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 secretion (GO:0050711)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of signal transduction (GO:0009968)|negative regulation of Toll signaling pathway (GO:0045751)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of MHC class I biosynthetic process (GO:0045345)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of interleukin-18 biosynthetic process (GO:0045381)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)	p.E201K(1)		NS(1)|breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(36)|ovary(5)|pancreas(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	80	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		TCGTCTGGCTCAAAGAGGGTC	0.637																																							uc002qch.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|upper_aerodigestive_tract(2)|lung(1)	7						c.(601-603)GAG>AAG		NLR family, pyrin domain containing 12 isoform							102.0	82.0	89.0					19																	54314312		2203	4300	6503	SO:0001583	missense	91662				negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of interleukin-1 secretion|negative regulation of interleukin-6 biosynthetic process|negative regulation of protein autophosphorylation|negative regulation of Toll signaling pathway|positive regulation of inflammatory response|positive regulation of interleukin-1 beta secretion|regulation of interleukin-18 biosynthetic process|release of cytoplasmic sequestered NF-kappaB	cytoplasm	ATP binding|caspase activator activity|protein binding	g.chr19:54314312C>T	AY095146	CCDS12864.1, CCDS62784.1, CCDS62785.1	19q13.42	2014-09-17	2006-12-08	2006-12-08	ENSG00000142405	ENSG00000142405		"""Nucleotide-binding domain and leucine rich repeat containing"""	22938	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 12"""	609648	"""NACHT, leucine rich repeat and PYD containing 12"""	NALP12		12563287, 12019269	Standard	NM_001277129		Approved	RNO2, PYPAF7, Monarch1, PAN6, CLR19.3	uc002qcj.5	P59046	OTTHUMG00000060776	ENST00000324134.6:c.601G>A	19.37:g.54314312C>T	ENSP00000319377:p.Glu201Lys		Somatic				NLRP12_uc010eqw.2_5'Flank|NLRP12_uc002qci.3_Missense_Mutation_p.E201K|NLRP12_uc002qcj.3_Missense_Mutation_p.E201K|NLRP12_uc002qck.3_RNA|NLRP12_uc010eqx.2_Missense_Mutation_p.E201K	p.E201K	NM_144687	NP_653288	WXS	Illumina HiSeq	Unspecified	P59046	NAL12_HUMAN		GBM - Glioblastoma multiforme(134;0.026)	3	821	-	Ovarian(34;0.19)		201					A8MTQ2|B3KTE7|Q8NEU4|Q9BY26	Missense_Mutation	SNP	ENST00000324134.6	37	c.601G>A	CCDS12864.1	.	.	.	.	.	.	.	.	.	.	C	13.94	2.385742	0.42308	.	.	ENSG00000142405	ENST00000324134;ENST00000535162;ENST00000351894;ENST00000354278;ENST00000391775;ENST00000391773;ENST00000345770;ENST00000391772	D;D;D;D;D;D;D	0.88277	-2.36;-2.36;-2.36;-2.36;-2.36;-2.36;-2.36	4.25	2.03	0.26663	.	0.161425	0.29100	N	0.013143	D	0.91845	0.7419	M	0.77103	2.36	0.58432	D	0.999999	D;D;D;D	0.76494	0.997;0.999;0.999;0.998	D;D;D;D	0.80764	0.985;0.994;0.994;0.989	D	0.88376	0.2998	10	0.56958	D	0.05	.	3.214	0.06692	0.178:0.5498:0.173:0.0992	.	201;201;201;201	F2Z321;A8K407;A8MTQ2;P59046	.;.;.;NAL12_HUMAN	K	201	ENSP00000319377:E201K;ENSP00000438030:E201K;ENSP00000340473:E201K;ENSP00000346231:E201K;ENSP00000375655:E201K;ENSP00000375653:E201K;ENSP00000375652:E201K	ENSP00000319377:E201K	E	-	1	0	NLRP12	59006124	0.000000	0.05858	0.821000	0.32701	0.168000	0.22595	-0.022000	0.12480	0.364000	0.24374	0.306000	0.20318	GAG		0.637	NLRP12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000134340.1	NM_144687		40	106	0	0	0	0.013114	0	40	106				
BRSK1	84446	broad.mit.edu	37	19	55814152	55814152	+	Silent	SNP	G	G	A			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr19:55814152G>A	ENST00000309383.1	+	10	1222	c.945G>A	c.(943-945)ctG>ctA	p.L315L	BRSK1_ENST00000326848.7_Silent_p.L10L|BRSK1_ENST00000590333.1_Silent_p.L331L|BRSK1_ENST00000585418.1_Silent_p.L315L	NM_032430.1	NP_115806.1	Q8TDC3	BRSK1_HUMAN	BR serine/threonine kinase 1	315	UBA. {ECO:0000255|PROSITE- ProRule:PRU00212}.				axonogenesis (GO:0007409)|cellular response to DNA damage stimulus (GO:0006974)|centrosome duplication (GO:0051298)|establishment of cell polarity (GO:0030010)|G2 DNA damage checkpoint (GO:0031572)|neuron differentiation (GO:0030182)|neurotransmitter secretion (GO:0007269)|protein phosphorylation (GO:0006468)|response to UV (GO:0009411)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|gamma-tubulin binding (GO:0043015)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)	p.L315L(2)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(15)|ovary(2)|prostate(2)|skin(6)|stomach(1)	48		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0474)		ACGGAGAGCTGGACCCCGACG	0.667																																							uc002qkg.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)|stomach(1)|lung(1)|breast(1)|skin(1)	6						c.(943-945)CTG>CTA		BR serine/threonine kinase 1							59.0	52.0	54.0					19																	55814152		2203	4299	6502	SO:0001819	synonymous_variant	84446				establishment of cell polarity|G2/M transition DNA damage checkpoint|neuron differentiation|response to UV	cell junction|cytoplasm|nucleus	magnesium ion binding|protein serine/threonine kinase activity	g.chr19:55814152G>A	AB058714	CCDS12921.1	19q13.4	2008-02-05				ENSG00000160469			18994	protein-coding gene	gene with protein product		609235				14976552	Standard	NM_032430		Approved	KIAA1811	uc002qkg.3	Q8TDC3		ENST00000309383.1:c.945G>A	19.37:g.55814152G>A			Somatic				BRSK1_uc002qkf.2_Silent_p.L331L|BRSK1_uc002qkh.2_Silent_p.L10L	p.L315L	NM_032430	NP_115806	WXS	Illumina HiSeq	Unspecified	Q8TDC3	BRSK1_HUMAN	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0474)	10	1222	+		Renal(1328;0.245)	315			UBA.		F1DG44|Q5J5B5|Q8NDD0|Q8NDR4|Q8TDC2|Q96AV4|Q96JL4	Silent	SNP	ENST00000309383.1	37	c.945G>A	CCDS12921.1																																																																																				0.667	BRSK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452787.1	NM_032430		29	96	0	0	0	0.004289	0	29	96				
ZSCAN4	201516	broad.mit.edu	37	19	58190033	58190033	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr19:58190033C>A	ENST00000318203.5	+	5	1759	c.1062C>A	c.(1060-1062)gaC>gaA	p.D354E		NM_152677.2	NP_689890.1	Q8NAM6	ZSCA4_HUMAN	zinc finger and SCAN domain containing 4	354					telomere maintenance via telomere lengthening (GO:0010833)|transcription, DNA-templated (GO:0006351)	nuclear chromosome, telomeric region (GO:0000784)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D354E(1)		endometrium(3)|large_intestine(5)|liver(2)|lung(17)|ovary(1)|skin(1)|stomach(1)	30		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		AGATATCAGACCTACGGGTGC	0.443																																							uc002qpu.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1060-1062)GAC>GAA		zinc finger and SCAN domain containing 4							78.0	81.0	80.0					19																	58190033		2203	4300	6503	SO:0001583	missense	201516				telomere maintenance via telomere lengthening|viral reproduction	nuclear chromosome, telomeric region	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:58190033C>A	AK092424	CCDS12958.1	19q13.43	2013-01-08	2004-11-01	2004-11-02		ENSG00000180532		"""-"", ""Zinc fingers, C2H2-type"""	23709	protein-coding gene	gene with protein product		613419	"""zinc finger protein 494"""	ZNF494			Standard	NM_152677		Approved	FLJ35105	uc002qpu.3	Q8NAM6		ENST00000318203.5:c.1062C>A	19.37:g.58190033C>A	ENSP00000321963:p.Asp354Glu		Somatic					p.D354E	NM_152677	NP_689890	WXS	Illumina HiSeq	Unspecified	Q8NAM6	ZSCA4_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)	5	1759	+		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)	354			C2H2-type 2.		Q3MIQ2	Missense_Mutation	SNP	ENST00000318203.5	37	c.1062C>A	CCDS12958.1	.	.	.	.	.	.	.	.	.	.	C	9.554	1.116725	0.20795	.	.	ENSG00000180532	ENST00000318203	T	0.18657	2.2	4.89	-2.39	0.06602	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.118515	0.38548	N	0.001647	T	0.09247	0.0228	N	0.17082	0.46	0.09310	N	1	B	0.31383	0.321	B	0.35688	0.208	T	0.30966	-0.9960	10	0.17832	T	0.49	-20.0966	4.2226	0.10565	0.4646:0.2291:0.0:0.3063	.	354	Q8NAM6	ZSCA4_HUMAN	E	354	ENSP00000321963:D354E	ENSP00000321963:D354E	D	+	3	2	ZSCAN4	62881845	0.000000	0.05858	0.384000	0.26145	0.046000	0.14306	-1.148000	0.03185	-0.133000	0.11537	0.655000	0.94253	GAC		0.443	ZSCAN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466812.1	NM_152677		38	116	1	0	7.04047e-22	0.005524	9.51163e-22	38	116				
PREPL	9581	broad.mit.edu	37	2	44565618	44565618	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr2:44565618T>C	ENST00000409936.1	-	8	1464	c.1027A>G	c.(1027-1029)Atg>Gtg	p.M343V	PREPL_ENST00000378520.3_Missense_Mutation_p.M343V|PREPL_ENST00000378511.3_Intron|PREPL_ENST00000260648.6_Missense_Mutation_p.M343V|PREPL_ENST00000541738.1_Missense_Mutation_p.M254V|PREPL_ENST00000409957.1_Missense_Mutation_p.M254V|PREPL_ENST00000410081.1_Missense_Mutation_p.M343V|PREPL_ENST00000409411.1_Missense_Mutation_p.M254V|PREPL_ENST00000409272.1_Missense_Mutation_p.M343V	NM_001171606.1	NP_001165077.1	Q4J6C6	PPCEL_HUMAN	prolyl endopeptidase-like	343						cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)	serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)	p.M343V(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(19)|ovary(1)|prostate(1)|skin(2)	33		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				TTTCTCTTCATTGTAAAAAAT	0.358																																							uc002ruf.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1027-1029)ATG>GTG		prolyl endopeptidase-like isoform C							87.0	79.0	82.0					2																	44565618		2203	4300	6503	SO:0001583	missense	9581				proteolysis	cytosol	serine-type endopeptidase activity	g.chr2:44565618T>C	AB007896	CCDS33190.1, CCDS42675.1, CCDS42676.1, CCDS54353.1	2p22.1	2008-02-05			ENSG00000138078	ENSG00000138078			30228	protein-coding gene	gene with protein product		609557				11524703	Standard	NM_006036		Approved	KIAA0436	uc002ruk.2	Q4J6C6	OTTHUMG00000152791	ENST00000409936.1:c.1027A>G	2.37:g.44565618T>C	ENSP00000386543:p.Met343Val		Somatic				PREPL_uc002rug.2_Missense_Mutation_p.M343V|PREPL_uc002ruh.2_Intron|PREPL_uc010fax.2_Missense_Mutation_p.M343V|PREPL_uc002rui.3_Missense_Mutation_p.M254V|PREPL_uc002ruj.1_Missense_Mutation_p.M254V|PREPL_uc002ruk.1_Missense_Mutation_p.M343V	p.M343V	NM_006036	NP_006027	WXS	Illumina HiSeq	Unspecified	Q4J6C6	PPCEL_HUMAN			7	1062	-		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	343					A7E2X6|D6W5A3|O43163|Q4J6C3|Q4J6C4|Q4ZG39|Q6ZMW7|Q96DW7	Missense_Mutation	SNP	ENST00000409936.1	37	c.1027A>G	CCDS33190.1	.	.	.	.	.	.	.	.	.	.	T	3.975	-0.007678	0.07773	.	.	ENSG00000138078	ENST00000541738;ENST00000409411;ENST00000409957;ENST00000409936;ENST00000260648;ENST00000409272;ENST00000410081;ENST00000378520	T;T;T;T;T;T;T;T	0.40756	1.02;1.02;1.02;1.02;1.02;1.02;1.02;1.02	5.35	4.07	0.47477	Peptidase S9A/B/C, oligopeptidase, N-terminal beta-propeller (2);	0.310783	0.41396	D	0.000893	T	0.15003	0.0362	N	0.02539	-0.55	0.21915	N	0.999472	B;B	0.17852	0.002;0.024	B;B	0.12156	0.002;0.007	T	0.03981	-1.0987	10	0.49607	T	0.09	-21.0112	1.6969	0.02864	0.1389:0.1595:0.144:0.5577	.	343;343	Q4J6C6-2;Q4J6C6	.;PPCEL_HUMAN	V	254;254;254;343;343;343;343;343	ENSP00000439626:M254V;ENSP00000387095:M254V;ENSP00000387241:M254V;ENSP00000386543:M343V;ENSP00000260648:M343V;ENSP00000386909:M343V;ENSP00000386509:M343V;ENSP00000367781:M343V	ENSP00000260648:M343V	M	-	1	0	PREPL	44419122	0.669000	0.27502	0.999000	0.59377	0.935000	0.57460	0.834000	0.27518	2.021000	0.59480	0.533000	0.62120	ATG		0.358	PREPL-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327900.1	NM_006036		12	29	0	0	0	0.001855	0	12	29				
CCDC85A	114800	broad.mit.edu	37	2	56420011	56420011	+	Nonsense_Mutation	SNP	A	A	T			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr2:56420011A>T	ENST00000407595.2	+	2	1178	c.676A>T	c.(676-678)Aag>Tag	p.K226*	RP11-482H16.1_ENST00000607540.1_RNA	NM_001080433.1	NP_001073902.1	Q96PX6	CC85A_HUMAN	coiled-coil domain containing 85A	226	His-rich.							p.K226*(1)		breast(6)|cervix(2)|endometrium(5)|kidney(1)|lung(18)|ovary(2)|pancreas(1)|prostate(3)	38			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			GGACCACCACAAGCACCACGC	0.692																																							uc002rzn.2		NA																	1	Substitution - Nonsense(1)		lung(1)	breast(3)|ovary(2)	5						c.(676-678)AAG>TAG		coiled-coil domain containing 85A							25.0	35.0	32.0					2																	56420011		2180	4277	6457	SO:0001587	stop_gained	114800							g.chr2:56420011A>T	AB067499	CCDS46290.1	2p16.1	2006-03-29			ENSG00000055813	ENSG00000055813			29400	protein-coding gene	gene with protein product						11572484	Standard	NM_001080433		Approved	KIAA1912	uc002rzn.3	Q96PX6	OTTHUMG00000152033	ENST00000407595.2:c.676A>T	2.37:g.56420011A>T	ENSP00000384040:p.Lys226*		Somatic					p.K226*	NM_001080433	NP_001073902	WXS	Illumina HiSeq	Unspecified	Q96PX6	CC85A_HUMAN	LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)		2	1178	+			226			His-rich.			Nonsense_Mutation	SNP	ENST00000407595.2	37	c.676A>T	CCDS46290.1	.	.	.	.	.	.	.	.	.	.	A	43	10.034142	0.99321	.	.	ENSG00000055813	ENST00000407595	.	.	.	5.18	5.18	0.71444	.	0.250691	0.45867	D	0.000333	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	0.196	15.0278	0.71682	1.0:0.0:0.0:0.0	.	.	.	.	X	226	.	ENSP00000384040:K226X	K	+	1	0	CCDC85A	56273515	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	6.408000	0.73285	1.947000	0.56498	0.533000	0.62120	AAG		0.692	CCDC85A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324993.1			8	27	0	0	0	0.010729	0	8	27				
SLC4A5	57835	broad.mit.edu	37	2	74492357	74492357	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr2:74492357C>T	ENST00000377634.4	-	9	835	c.436G>A	c.(436-438)Ggc>Agc	p.G146S	SLC4A5_ENST00000358683.4_Missense_Mutation_p.G82S|RP11-287D1.3_ENST00000451608.2_3'UTR|SLC4A5_ENST00000359484.4_Missense_Mutation_p.G82S|SLC4A5_ENST00000377632.1_Missense_Mutation_p.G146S|SLC4A5_ENST00000346834.4_Missense_Mutation_p.G146S|SLC4A5_ENST00000423644.1_Missense_Mutation_p.G146S|SLC4A5_ENST00000483195.1_5'UTR|SLC4A5_ENST00000394019.2_Missense_Mutation_p.G146S|SLC4A5_ENST00000357822.5_Missense_Mutation_p.G146S					solute carrier family 4 (sodium bicarbonate cotransporter), member 5									p.G146S(2)		breast(5)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(12)|lung(13)|ovary(5)|pancreas(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	48						CAGCGTTCGCCGCCTTCCTCT	0.607																																							uc002sko.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(5)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	9						c.(436-438)GGC>AGC		sodium bicarbonate transporter 4 isoform a							141.0	134.0	137.0					2																	74492357		2203	4300	6503	SO:0001583	missense	57835					apical plasma membrane|integral to membrane	inorganic anion exchanger activity|sodium:bicarbonate symporter activity	g.chr2:74492357C>T	AF243499	CCDS1936.1, CCDS1937.1	2p13.1	2013-07-19	2013-07-19		ENSG00000188687	ENSG00000188687		"""Solute carriers"""	18168	protein-coding gene	gene with protein product		606757	"""solute carrier family 4, sodium bicarbonate cotransporter, member 5"""			10978526, 11087115	Standard	NM_133478		Approved	NBC4	uc002sko.1	Q9BY07	OTTHUMG00000090263	ENST00000377634.4:c.436G>A	2.37:g.74492357C>T	ENSP00000366861:p.Gly146Ser		Somatic				SLC4A5_uc002skl.2_RNA|SLC4A5_uc002skn.2_Missense_Mutation_p.G146S|SLC4A5_uc010ffc.1_Missense_Mutation_p.G146S|SLC4A5_uc002skp.1_Missense_Mutation_p.G82S|SLC4A5_uc002sks.1_Missense_Mutation_p.G146S	p.G146S	NM_021196	NP_067019	WXS	Illumina HiSeq	Unspecified	Q9BY07	S4A5_HUMAN			4	438	-			146			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000377634.4	37	c.436G>A	CCDS1936.1	.	.	.	.	.	.	.	.	.	.	C	36	5.602820	0.96614	.	.	ENSG00000188687	ENST00000394019;ENST00000451608;ENST00000346834;ENST00000359484;ENST00000423644;ENST00000358683;ENST00000357822;ENST00000377632;ENST00000377634;ENST00000425249;ENST00000432728	T;T;T;T;T;T;T;T;T;T	0.79845	-1.31;-1.31;-1.31;-1.31;-1.31;-1.31;-1.31;-1.31;-1.31;-1.31	4.77	4.77	0.60923	Bicarbonate transporter, cytoplasmic (2);Phosphotransferase/anion transporter (1);	0.000000	0.85682	D	0.000000	D	0.90188	0.6933	M	0.86178	2.8	0.58432	D	0.999999	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.993;0.999;1.0;1.0;0.999	D	0.90907	0.4773	10	0.54805	T	0.06	.	15.6577	0.77155	0.0:1.0:0.0:0.0	.	146;146;82;146;146	Q9BY07-4;E7EQT3;Q9BY07-7;Q9BY07;Q9BY07-3	.;.;.;S4A5_HUMAN;.	S	146;146;146;82;146;82;146;146;146;146;30	ENSP00000377587:G146S;ENSP00000251768:G146S;ENSP00000352461:G82S;ENSP00000395804:G146S;ENSP00000351513:G82S;ENSP00000350475:G146S;ENSP00000366859:G146S;ENSP00000366861:G146S;ENSP00000405678:G146S;ENSP00000414162:G30S	ENSP00000251768:G146S	G	-	1	0	SLC4A5	74345865	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.600000	0.82769	2.617000	0.88574	0.655000	0.94253	GGC		0.607	SLC4A5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206583.3			30	126	0	0	0	0.007291	0	30	126				
DPP10	57628	broad.mit.edu	37	2	116593780	116593780	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr2:116593780G>C	ENST00000410059.1	+	22	2478	c.1998G>C	c.(1996-1998)aaG>aaC	p.K666N	DPP10_ENST00000409163.1_Missense_Mutation_p.K616N|DPP10_ENST00000393147.2_Missense_Mutation_p.K670N|DPP10_ENST00000310323.8_Missense_Mutation_p.K659N	NM_001178037.1|NM_020868.3	NP_001171508.1|NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl-peptidase 10 (non-functional)	666						integral component of membrane (GO:0016021)|membrane (GO:0016020)	serine-type peptidase activity (GO:0008236)	p.K659N(1)|p.K666N(1)		breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(24)|liver(2)|lung(48)|ovary(6)|prostate(1)|skin(5)|soft_tissue(1)	101						CAGATGAAAAGCTTTTTAAAT	0.338																																							uc002tla.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(5)|large_intestine(2)|skin(2)|breast(1)	10						c.(1996-1998)AAG>AAC		dipeptidyl peptidase 10 isoform long							88.0	86.0	87.0					2																	116593780		2203	4300	6503	SO:0001583	missense	57628				proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity	g.chr2:116593780G>C	AY172661	CCDS33278.1, CCDS46400.1, CCDS54388.1, CCDS54389.1	2q14.1	2010-05-04	2010-05-04		ENSG00000175497	ENSG00000175497			20823	protein-coding gene	gene with protein product		608209	"""dipeptidylpeptidase 10"", ""dipeptidyl-peptidase 10"""			10819331, 12662155	Standard	NM_020868		Approved	DPRP3	uc002tle.3	Q8N608	OTTHUMG00000153294	ENST00000410059.1:c.1998G>C	2.37:g.116593780G>C	ENSP00000386565:p.Lys666Asn		Somatic				DPP10_uc002tlb.1_Missense_Mutation_p.K616N|DPP10_uc002tlc.1_Missense_Mutation_p.K662N|DPP10_uc002tle.2_Missense_Mutation_p.K670N|DPP10_uc002tlf.1_Missense_Mutation_p.K659N	p.K666N	NM_020868	NP_065919	WXS	Illumina HiSeq	Unspecified	Q8N608	DPP10_HUMAN			22	2455	+			666			Extracellular (Potential).		A8K1Q2|J3KPP2|J3KQ46|Q0GLB8|Q53QT3|Q53S86|Q53SL8|Q53SS4|Q6TTV4|Q86YR9|Q9P236	Missense_Mutation	SNP	ENST00000410059.1	37	c.1998G>C	CCDS46400.1	.	.	.	.	.	.	.	.	.	.	G	9.572	1.121176	0.20877	.	.	ENSG00000175497	ENST00000410059;ENST00000409163;ENST00000393147;ENST00000310323	T;T;T;T	0.40476	1.03;1.03;1.03;1.03	5.67	-1.47	0.08772	Peptidase S9, prolyl oligopeptidase, catalytic domain (1);	0.103141	0.64402	D	0.000006	T	0.14098	0.0341	N	0.03224	-0.385	0.21652	N	0.999608	B;B;B;B	0.06786	0.001;0.001;0.001;0.001	B;B;B;B	0.13407	0.003;0.005;0.008;0.009	T	0.10109	-1.0644	10	0.30854	T	0.27	-28.3146	3.0636	0.06207	0.3114:0.1107:0.4648:0.1131	.	659;670;662;666	Q8N608-2;Q0GLB8;Q0GLB9;Q8N608	.;.;.;DPP10_HUMAN	N	666;616;670;659	ENSP00000386565:K666N;ENSP00000387038:K616N;ENSP00000376855:K670N;ENSP00000309066:K659N	ENSP00000309066:K659N	K	+	3	2	DPP10	116310250	0.222000	0.23652	0.954000	0.39281	0.978000	0.69477	-0.004000	0.12878	0.012000	0.14892	-0.150000	0.13652	AAG		0.338	DPP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330580.4	NM_020868		7	35	0	0	0	0.004482	0	7	35				
C2orf76	130355	broad.mit.edu	37	2	120097480	120097480	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr2:120097480C>T	ENST00000409466.2	-	3	577	c.56G>A	c.(55-57)cGc>cAc	p.R19H	C2orf76_ENST00000334816.7_Missense_Mutation_p.R19H|C2orf76_ENST00000498049.1_5'UTR|C2orf76_ENST00000409877.1_Missense_Mutation_p.R19H|C2orf76_ENST00000409523.1_Missense_Mutation_p.R19H			Q3KRA6	CB076_HUMAN	chromosome 2 open reading frame 76	19								p.R19H(1)		large_intestine(1)|lung(3)|pancreas(1)	5						TTTGAAATTGCGATGTTCAAA	0.408																																							uc002tls.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(55-57)CGC>CAC		hypothetical protein LOC130355							123.0	116.0	118.0					2																	120097480		1903	4142	6045	SO:0001583	missense	130355							g.chr2:120097480C>T		CCDS42739.1	2q14.2	2011-05-09			ENSG00000186132	ENSG00000186132			27017	protein-coding gene	gene with protein product						12477932	Standard	NM_001017927		Approved	MGC104437, LOC130355, AIM29	uc002tls.2	Q3KRA6	OTTHUMG00000153298	ENST00000409466.2:c.56G>A	2.37:g.120097480C>T	ENSP00000386302:p.Arg19His		Somatic				C2orf76_uc010flf.1_Missense_Mutation_p.R19H|C2orf76_uc010yyg.1_RNA|C2orf76_uc002tlt.2_Missense_Mutation_p.R19H|C2orf76_uc002tlu.2_Missense_Mutation_p.R19H	p.R19H	NM_001017927	NP_001017927	WXS	Illumina HiSeq	Unspecified	Q3KRA6	CB076_HUMAN			3	597	-			19					B7ZLS8|Q4VC35	Missense_Mutation	SNP	ENST00000409466.2	37	c.56G>A	CCDS42739.1	.	.	.	.	.	.	.	.	.	.	C	18.97	3.735954	0.69189	.	.	ENSG00000186132	ENST00000409466;ENST00000334816;ENST00000409877;ENST00000409523;ENST00000414534	T;T;T;T;T	0.54479	0.57;0.57;0.57;0.57;0.57	6.02	5.14	0.70334	.	0.048372	0.85682	N	0.000000	T	0.68366	0.2993	M	0.91300	3.195	0.47547	D	0.999452	D	0.58970	0.984	P	0.49665	0.618	T	0.76075	-0.3092	10	0.54805	T	0.06	-0.8526	12.9514	0.58403	0.0:0.9221:0.0:0.0779	.	19	Q3KRA6	CB076_HUMAN	H	19;19;19;19;48	ENSP00000386302:R19H;ENSP00000335041:R19H;ENSP00000387234:R19H;ENSP00000386714:R19H;ENSP00000388482:R48H	ENSP00000335041:R19H	R	-	2	0	C2orf76	119813950	1.000000	0.71417	0.989000	0.46669	0.945000	0.59286	3.560000	0.53763	1.551000	0.49450	0.655000	0.94253	CGC		0.408	C2orf76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330582.2	NM_001017927		11	94	0	0	0	0.001855	0	11	94				
CNTNAP5	129684	broad.mit.edu	37	2	125555898	125555898	+	Splice_Site	SNP	G	G	T			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr2:125555898G>T	ENST00000431078.1	+	19	3578		c.e19+1			NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5						cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)		p.G1072V(1)		NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		TGCAAGAATGGTGAGTGTGAT	0.502																																							uc002tno.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(10)	10						c.e19+1		contactin associated protein-like 5 precursor							88.0	87.0	87.0					2																	125555898		1989	4172	6161	SO:0001630	splice_region_variant	129684				cell adhesion|signal transduction	integral to membrane	receptor binding	g.chr2:125555898G>T	AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.3214+1G>T	2.37:g.125555898G>T			Somatic				CNTNAP5_uc010flu.2_Splice_Site_p.G1073_splice	p.G1072_splice	NM_130773	NP_570129	WXS	Illumina HiSeq	Unspecified	Q8WYK1	CNTP5_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.248)	19	3578	+								Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Splice_Site	SNP	ENST00000431078.1	37	c.3214_splice	CCDS46401.1	.	.	.	.	.	.	.	.	.	.	G	27.2	4.812169	0.90707	.	.	ENSG00000155052	ENST00000431078	.	.	.	5.92	5.92	0.95590	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.3095	0.94179	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CNTNAP5	125272368	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	8.861000	0.92277	2.810000	0.96702	0.650000	0.86243	.		0.502	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330864.3		Intron	15	42	1	0	0.000219431	0.00245	0.000233146	15	42				
Unknown	0	broad.mit.edu	37	2	132120541	132120541	+	IGR	SNP	G	G	T			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr2:132120541G>T								PLEKHB2 (9259 upstream) : AC073869.19 (39932 downstream)																							ATCTCCACGAGACAGGCAGCA	0.378																																							uc002tsr.2		NA																	0					0						c.(751-753)GTC>GTA		RAB6C-like							81.0	83.0	82.0					2																	132120541		2145	4284	6429	SO:0001628	intergenic_variant	150786				protein transport|small GTPase mediated signal transduction		GTP binding	g.chr2:132120541G>T																													2.37:g.132120541G>T			Somatic					p.V251V	NM_001077637	NP_001071105	WXS	Illumina HiSeq	Unspecified	Q53S08	Q53S08_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.078)	1	1191	-			251						Silent	SNP		37	c.753C>A																																																																																				0	0.378									18	67	1	0	1.2644e-06	0.010504	1.4095e-06	18	67				
CCDC148	130940	broad.mit.edu	37	2	159196812	159196812	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr2:159196812T>C	ENST00000283233.5	-	5	741	c.428A>G	c.(427-429)cAc>cGc	p.H143R	CCDC148_ENST00000536771.1_Missense_Mutation_p.H57R|CCDC148_ENST00000409889.1_Missense_Mutation_p.H143R|CCDC148_ENST00000409187.1_Missense_Mutation_p.H152R	NM_138803.3	NP_620158.3	Q8NFR7	CC148_HUMAN	coiled-coil domain containing 148	143								p.H143R(1)		endometrium(2)|kidney(2)|large_intestine(6)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	23						CTGCAAAGTGTGATGCTGTCT	0.343																																							uc002tzq.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(427-429)CAC>CGC		coiled-coil domain containing 148							156.0	148.0	150.0					2																	159196812		2203	4300	6503	SO:0001583	missense	130940							g.chr2:159196812T>C		CCDS33304.1	2q24.1	2007-12-07			ENSG00000153237	ENSG00000153237			25191	protein-coding gene	gene with protein product							Standard	NM_138803		Approved	MGC125588	uc002tzq.3	Q8NFR7	OTTHUMG00000153973	ENST00000283233.5:c.428A>G	2.37:g.159196812T>C	ENSP00000283233:p.His143Arg		Somatic				CCDC148_uc002tzr.2_Intron|CCDC148_uc010foh.2_Intron|CCDC148_uc010foi.1_Missense_Mutation_p.H90R|CCDC148_uc010foj.1_Intron|CCDC148_uc010fok.1_Missense_Mutation_p.H57R|CCDC148_uc002tzs.1_Missense_Mutation_p.H143R	p.H143R	NM_138803	NP_620158	WXS	Illumina HiSeq	Unspecified	Q8NFR7	CC148_HUMAN			5	691	-			143					F5H839|Q3B7I3|Q3B7I4|Q3KR41|Q4ZG12|Q4ZG23|Q53TM6|Q96BN5|Q96LM2	Missense_Mutation	SNP	ENST00000283233.5	37	c.428A>G	CCDS33304.1	.	.	.	.	.	.	.	.	.	.	T	10.99	1.507601	0.27036	.	.	ENSG00000153237	ENST00000283233;ENST00000409187;ENST00000536771;ENST00000409889	T;T;T;T	0.44482	0.92;0.92;0.92;0.92	5.67	0.17	0.15021	.	.	.	.	.	T	0.38904	0.1058	M	0.65975	2.015	0.09310	N	1	P;B	0.43352	0.804;0.231	B;B	0.41619	0.361;0.025	T	0.21109	-1.0255	9	0.35671	T	0.21	-0.0859	7.3829	0.26866	0.0:0.0779:0.4186:0.5036	.	57;143	F5H839;Q8NFR7	.;CC148_HUMAN	R	143;152;57;143	ENSP00000283233:H143R;ENSP00000386674:H152R;ENSP00000443740:H57R;ENSP00000386583:H143R	ENSP00000283233:H143R	H	-	2	0	CCDC148	158905058	0.002000	0.14202	0.002000	0.10522	0.426000	0.31534	0.601000	0.24119	0.052000	0.16007	0.533000	0.62120	CAC		0.343	CCDC148-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333270.1	NM_138803		18	52	0	0	0	0.007413	0	18	52				
FAM124B	79843	broad.mit.edu	37	2	225266048	225266048	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr2:225266048A>T	ENST00000409685.3	-	1	703	c.438T>A	c.(436-438)ttT>ttA	p.F146L	FAM124B_ENST00000389874.3_Missense_Mutation_p.F146L|FAM124B_ENST00000243806.2_Missense_Mutation_p.F146L	NM_001122779.1	NP_001116251.1	Q9H5Z6	F124B_HUMAN	family with sequence similarity 124B	146								p.F146L(2)		endometrium(2)|large_intestine(2)|lung(7)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	16		Renal(207;0.0112)|all_lung(227;0.0126)|Lung NSC(271;0.0161)|all_hematologic(139;0.138)		Epithelial(121;4.4e-10)|all cancers(144;2.02e-07)|Lung(261;0.00766)|LUSC - Lung squamous cell carcinoma(224;0.00825)		CATAGTTATCAAAACTGCAGT	0.517																																							uc002vnx.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(436-438)TTT>TTA		hypothetical protein LOC79843 isoform a							82.0	78.0	79.0					2																	225266048		2203	4300	6503	SO:0001583	missense	79843						protein binding	g.chr2:225266048A>T	AK075126	CCDS2461.1, CCDS46527.1	2q36.2	2008-02-05			ENSG00000124019	ENSG00000124019			26224	protein-coding gene	gene with protein product						12477932	Standard	NM_001122779		Approved	FLJ22746	uc002vnx.3	Q9H5Z6	OTTHUMG00000133168	ENST00000409685.3:c.438T>A	2.37:g.225266048A>T	ENSP00000386895:p.Phe146Leu		Somatic				FAM124B_uc002vnw.2_Missense_Mutation_p.F146L	p.F146L	NM_001122779	NP_001116251	WXS	Illumina HiSeq	Unspecified	Q9H5Z6	F124B_HUMAN		Epithelial(121;4.4e-10)|all cancers(144;2.02e-07)|Lung(261;0.00766)|LUSC - Lung squamous cell carcinoma(224;0.00825)	1	664	-		Renal(207;0.0112)|all_lung(227;0.0126)|Lung NSC(271;0.0161)|all_hematologic(139;0.138)	146					A6NNC7|Q8NBZ4|Q8TAV7	Missense_Mutation	SNP	ENST00000409685.3	37	c.438T>A	CCDS46527.1	.	.	.	.	.	.	.	.	.	.	A	22.1	4.243345	0.79912	.	.	ENSG00000124019	ENST00000389874;ENST00000409685;ENST00000243806	T;T;T	0.42131	0.98;0.98;0.98	5.54	0.593	0.17478	.	0.158853	0.64402	D	0.000020	T	0.53546	0.1803	M	0.73962	2.25	0.38954	D	0.958419	D;P	0.63880	0.993;0.949	D;P	0.63488	0.915;0.596	T	0.53472	-0.8434	10	0.18276	T	0.48	-23.6627	9.1101	0.36723	0.7236:0.0:0.2764:0.0	.	146;146	Q9H5Z6;Q9H5Z6-2	F124B_HUMAN;.	L	146	ENSP00000374524:F146L;ENSP00000386895:F146L;ENSP00000243806:F146L	ENSP00000243806:F146L	F	-	3	2	FAM124B	224974292	0.628000	0.27138	0.993000	0.49108	0.876000	0.50452	-0.015000	0.12634	-0.122000	0.11766	0.533000	0.62120	TTT		0.517	FAM124B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330873.1	NM_024785		35	107	0	0	0	0.012213	0	35	107				
IFT52	51098	broad.mit.edu	37	20	42265860	42265860	+	Nonsense_Mutation	SNP	G	G	T			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr20:42265860G>T	ENST00000373030.3	+	12	1217	c.1087G>T	c.(1087-1089)Gag>Tag	p.E363*	IFT52_ENST00000373039.4_Nonsense_Mutation_p.E363*	NM_016004.2	NP_057088.2	Q9Y366	IFT52_HUMAN	intraflagellar transport 52	363					cilium morphogenesis (GO:0060271)|dorsal/ventral pattern formation (GO:0009953)|embryonic digit morphogenesis (GO:0042733)|heart looping (GO:0001947)|intraciliary transport (GO:0042073)|negative regulation of epithelial cell proliferation (GO:0050680)|neural tube formation (GO:0001841)|regulation of protein processing (GO:0070613)|smoothened signaling pathway (GO:0007224)	centriole (GO:0005814)|ciliary base (GO:0097546)|ciliary tip (GO:0097542)|cilium (GO:0005929)|dendrite terminus (GO:0044292)|intraciliary transport particle B (GO:0030992)|motile cilium (GO:0031514)|photoreceptor connecting cilium (GO:0032391)	protein C-terminus binding (GO:0008022)	p.E363*(1)		endometrium(5)|kidney(1)|large_intestine(2)|lung(10)|ovary(2)|urinary_tract(1)	21		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			GTTCTCCTCTGAGAAGGCACG	0.423																																							uc002xkw.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(2)	2						c.(1087-1089)GAG>TAG		intraflagellar transport 52 homolog							77.0	78.0	77.0					20																	42265860		2203	4300	6503	SO:0001587	stop_gained	51098					intraflagellar transport particle B|microtubule-based flagellum	protein C-terminus binding	g.chr20:42265860G>T	AF151811	CCDS33470.1	20q12-q13.1	2014-07-03	2014-07-03	2005-11-02	ENSG00000101052	ENSG00000101052		"""Intraflagellar transport homologs"""	15901	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 9"", ""intraflagellar transport 52 homolog (Chlamydomonas)"""	C20orf9		10810093	Standard	NM_016004		Approved	CGI-53, NGD5, dJ1028D15.1, NGD2	uc002xkw.3	Q9Y366	OTTHUMG00000032513	ENST00000373030.3:c.1087G>T	20.37:g.42265860G>T	ENSP00000362121:p.Glu363*		Somatic				IFT52_uc002xky.2_Nonsense_Mutation_p.E363*|IFT52_uc002xkx.2_RNA|IFT52_uc010ggn.2_Nonsense_Mutation_p.E339*|IFT52_uc002xkz.2_Nonsense_Mutation_p.E363*	p.E363*	NM_016004	NP_057088	WXS	Illumina HiSeq	Unspecified	Q9Y366	IFT52_HUMAN	COAD - Colon adenocarcinoma(18;0.0031)		12	1209	+		Myeloproliferative disorder(115;0.00452)	363					B3KMA1|E1P5W9|Q5H8Z0|Q9H1G3|Q9H1G4|Q9H1H2	Nonsense_Mutation	SNP	ENST00000373030.3	37	c.1087G>T	CCDS33470.1	.	.	.	.	.	.	.	.	.	.	G	38	6.889494	0.97912	.	.	ENSG00000101052	ENST00000373030;ENST00000373039	.	.	.	5.58	4.64	0.57946	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	-22.7884	13.7234	0.62743	0.0755:0.0:0.9244:0.0	.	.	.	.	X	363	.	ENSP00000362121:E363X	E	+	1	0	IFT52	41699274	1.000000	0.71417	0.985000	0.45067	0.989000	0.77384	9.586000	0.98226	1.512000	0.48834	0.655000	0.94253	GAG		0.423	IFT52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079317.1	NM_016004		20	70	1	0	7.33532e-06	0.003954	7.91749e-06	20	70				
TOX2	84969	broad.mit.edu	37	20	42574596	42574596	+	Missense_Mutation	SNP	G	G	T	rs575271004		TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr20:42574596G>T	ENST00000358131.5	+	1	252	c.44G>T	c.(43-45)cGc>cTc	p.R15L	TOX2_ENST00000423191.2_Intron|TOX2_ENST00000372999.1_Intron|TOX2_ENST00000341197.4_Intron	NM_001098798.1	NP_001092268.1	Q96NM4	TOX2_HUMAN	TOX high mobility group box family member 2	15					female gonad development (GO:0008585)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to gonadotropin (GO:0034698)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.R15L(1)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|skin(2)	26		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.00189)			GCGTTCTCTCGCTGCCTGGGC	0.542																																							uc002xlf.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(43-45)CGC>CTC		TOX high mobility group box family member 2							48.0	48.0	48.0					20																	42574596		1978	4158	6136	SO:0001583	missense	84969				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding	g.chr20:42574596G>T	BC007636	CCDS13324.1, CCDS42875.1, CCDS46603.1	20q13.12	2007-03-20	2007-03-20	2007-03-20					16095	protein-coding gene	gene with protein product	"""granulosa cell HMG box 1"""	611163	"""chromosome 20 open reading frame 100"""	C20orf100		14764631	Standard	NM_001098796		Approved	dJ1108D11.2, GCX-1	uc010ggo.3	Q96NM4		ENST00000358131.5:c.44G>T	20.37:g.42574596G>T	ENSP00000350849:p.Arg15Leu		Somatic				TOX2_uc010ggo.2_Intron|TOX2_uc002xle.3_Intron|TOX2_uc010ggp.2_Intron	p.R15L	NM_001098798	NP_001092268	WXS	Illumina HiSeq	Unspecified	Q96NM4	TOX2_HUMAN	COAD - Colon adenocarcinoma(18;0.00189)		1	61	+		Myeloproliferative disorder(115;0.00452)	15					A8K1J1|E1P5X0|G3XAC7|Q5TE33|Q5TE34|Q5TE35|Q96IC9|Q9BQN5	Missense_Mutation	SNP	ENST00000358131.5	37	c.44G>T	CCDS42875.1	.	.	.	.	.	.	.	.	.	.	G	15.12	2.740442	0.49045	.	.	ENSG00000124191	ENST00000358131	T	0.17054	2.3	4.35	-5.73	0.02398	.	2.933300	0.01885	U	0.038170	T	0.07954	0.0199	N	0.08118	0	0.54753	D	0.99998	B	0.23377	0.084	B	0.18561	0.022	T	0.16541	-1.0399	10	0.38643	T	0.18	.	5.7559	0.18172	0.4107:0.3852:0.2041:0.0	.	15	Q96NM4	TOX2_HUMAN	L	15	ENSP00000350849:R15L	ENSP00000350849:R15L	R	+	2	0	TOX2	42008010	0.388000	0.25197	0.943000	0.38184	0.949000	0.60115	-0.769000	0.04710	-0.774000	0.04590	-0.657000	0.03884	CGC		0.542	TOX2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000079329.2			16	42	1	0	4.35082e-09	0.010504	5.10096e-09	16	42				
GNAS	2778	broad.mit.edu	37	20	57430246	57430246	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr20:57430246G>A	ENST00000306120.3	+	1	1736	c.1736G>A	c.(1735-1737)cGg>cAg	p.R579Q	GNAS_ENST00000464624.2_3'UTR|GNAS_ENST00000371098.2_Intron|GNAS_ENST00000371099.2_Silent_p.A642A|GNAS_ENST00000371100.4_Silent_p.A642A|GNAS_ENST00000371075.3_Intron|GNAS_ENST00000371102.4_Silent_p.A642A|GNAS_ENST00000313949.7_Intron			P63092	GNAS2_HUMAN	GNAS complex locus	0					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|bone development (GO:0060348)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|cognition (GO:0050890)|developmental growth (GO:0048589)|energy reserve metabolic process (GO:0006112)|hair follicle placode formation (GO:0060789)|intracellular transport (GO:0046907)|platelet aggregation (GO:0070527)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of insulin secretion (GO:0050796)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intrinsic component of membrane (GO:0031224)|membrane (GO:0016020)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	adenylate cyclase activity (GO:0004016)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)	p.A642A(1)		adrenal_gland(12)|autonomic_ganglia(1)|biliary_tract(5)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(37)|liver(9)|lung(9)|ovary(16)|pancreas(56)|parathyroid(5)|pituitary(228)|prostate(2)|small_intestine(1)|stomach(1)|testis(2)|thyroid(35)|upper_aerodigestive_tract(3)|urinary_tract(1)	441	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			TACCCCTGGCGGAGAAGCGCA	0.592			Mis		pituitary adenoma		"""McCune-Albright syndrome; pseudohypoparathyroidism, type IA"""			TSP Lung(22;0.16)																											Colon(117;935 1597 6045 8307 46442)	Colon(117;935 1597 6045 8307 46442)	uc002xzw.2		NA		Dom	yes		20	20q13.2	2778	Mis	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	yes	McCune-Albright syndrome; pseudohypoparathyroidism|type IA	E			pituitary adenoma		1	Substitution - coding silent(1)		lung(1)	pituitary(201)|thyroid(35)|ovary(15)|adrenal_gland(9)|liver(7)|large_intestine(5)|parathyroid(5)|kidney(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|testis(1)|stomach(1)|small_intestine(1)|autonomic_ganglia(1)|pancreas(1)	292						c.(1924-1926)GCG>GCA		GNAS complex locus XLas							25.0	29.0	28.0					20																	57430246		2040	4207	6247	SO:0001583	missense	2778	3-Methylglutaconic_Aciduria_and_Myelodysplasia|McCune-Albright_syndrome|Mazabraud_syndrome			activation of adenylate cyclase activity|cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|intracellular transport|platelet activation|regulation of insulin secretion|sensory perception of smell|transmembrane transport|water transport	heterotrimeric G-protein complex|intrinsic to membrane|trans-Golgi network membrane	adenylate cyclase activity|GTP binding|GTPase activity|guanyl-nucleotide exchange factor activity|identical protein binding|signal transducer activity	g.chr20:57430246G>A	M21142	CCDS13471.1, CCDS13472.1, CCDS42892.1, CCDS46622.1, CCDS46623.1, CCDS46624.1	20q13.2-q13.3	2010-03-01	2001-12-19	2001-12-20	ENSG00000087460	ENSG00000087460			4392	protein-coding gene	gene with protein product	"""secretogranin VI"""	139320	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	GNAS1			Standard	NM_000516		Approved	NESP55, NESP, GNASXL, GPSA, SCG6	uc002xzw.3	O95467	OTTHUMG00000033069	ENST00000306120.3:c.1736G>A	20.37:g.57430246G>A	ENSP00000302237:p.Arg579Gln	TSP Lung(22;0.16)	Somatic				GNAS_uc002xzt.2_Intron|GNAS_uc002xzu.3_Intron|GNAS_uc010gjq.2_Intron|GNAS_uc002xzv.2_RNA	p.A642A	NM_080425	NP_536350	WXS	Illumina HiSeq	Unspecified	P63092	GNAS2_HUMAN	BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)		1	2211	+	all_lung(29;0.0104)		Error:Variant_position_missing_in_P63092_after_alignment					A6NI00|E1P5G5|P04895|Q12927|Q14433|Q32P26|Q5JWD2|Q5JWD4|Q5JWD5|Q6NR75|Q6NXS0|Q8TBC0|Q96H70	Silent	SNP	ENST00000306120.3	37	c.1926G>A		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.10|11.10	1.539930|1.539930	0.27563|0.27563	.|.	.|.	ENSG00000087460|ENSG00000087460	ENST00000450130|ENST00000306120;ENST00000423897	.|.	.|.	.|.	3.84|3.84	-0.822|-0.822	0.10819|0.10819	.|.	.|.	.|.	.|.	.|.	T|T	0.35913|0.35913	0.0948|0.0948	.|.	.|.	.|.	0.28029|0.28029	N|N	0.934222|0.934222	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.39941|0.39941	-0.9589|-0.9589	4|5	.|0.62326	.|D	.|0.03	.|.	4.518|4.518	0.11945|0.11945	0.209:0.3596:0.4314:0.0|0.209:0.3596:0.4314:0.0	.|.	.|.	.|.	.|.	R|Q	29|579;5	.|.	.|ENSP00000302237:R579Q	G|R	+|+	1|2	0|0	GNAS|GNAS	56863641|56863641	0.001000|0.001000	0.12720|0.12720	0.236000|0.236000	0.24074|0.24074	0.136000|0.136000	0.21042|0.21042	-0.945000|-0.945000	0.03909|0.03909	-0.211000|-0.211000	0.10124|0.10124	0.462000|0.462000	0.41574|0.41574	GGA|CGG		0.592	GNAS-050	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000267987.1	NM_000516		3	16	0	0	0	0.004672	0	3	16				
OSBPL2	9885	broad.mit.edu	37	20	60861678	60861678	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr20:60861678G>A	ENST00000313733.3	+	11	1238	c.1036G>A	c.(1036-1038)Gac>Aac	p.D346N	OSBPL2_ENST00000439951.2_Missense_Mutation_p.D254N|OSBPL2_ENST00000358053.2_Missense_Mutation_p.D334N	NM_144498.1	NP_653081.1	Q9H1P3	OSBL2_HUMAN	oxysterol binding protein-like 2	346					lipid transport (GO:0006869)		cholesterol binding (GO:0015485)	p.D346N(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	17	Breast(26;7.76e-09)		BRCA - Breast invasive adenocarcinoma(19;1.33e-06)			CGTGGCTGACGACGTGCCTGT	0.652																																							uc002yck.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(1036-1038)GAC>AAC		oxysterol-binding protein-like protein 2 isoform							96.0	86.0	89.0					20																	60861678		2203	4300	6503	SO:0001583	missense	9885				lipid transport		lipid binding	g.chr20:60861678G>A	AB018315	CCDS13494.1, CCDS13495.1, CCDS63323.1	20q13.3	2008-08-01	2001-11-28		ENSG00000130703	ENSG00000130703		"""Oxysterol binding proteins"""	15761	protein-coding gene	gene with protein product		606731	"""oxysterol-binding protein-like 2"""			10588946, 11861666	Standard	NM_144498		Approved	KIAA0772, ORP-2	uc002yck.1	Q9H1P3	OTTHUMG00000032909	ENST00000313733.3:c.1036G>A	20.37:g.60861678G>A	ENSP00000316649:p.Asp346Asn		Somatic				OSBPL2_uc002ycl.1_Missense_Mutation_p.D334N|OSBPL2_uc011aah.1_Missense_Mutation_p.D254N	p.D346N	NM_144498	NP_653081	WXS	Illumina HiSeq	Unspecified	Q9H1P3	OSBL2_HUMAN	BRCA - Breast invasive adenocarcinoma(19;1.33e-06)		11	1238	+	Breast(26;7.76e-09)		346					A8K736|Q6IBT0|Q9BZB1|Q9Y4B8	Missense_Mutation	SNP	ENST00000313733.3	37	c.1036G>A	CCDS13495.1	.	.	.	.	.	.	.	.	.	.	G	17.11	3.304711	0.60305	.	.	ENSG00000130703	ENST00000358053;ENST00000313733;ENST00000439951	T;T;T	0.46063	0.93;0.93;0.88	4.82	1.76	0.24704	.	0.636986	0.16712	N	0.202620	T	0.30572	0.0769	L	0.35723	1.085	0.43766	D	0.996282	B;B;B	0.28350	0.208;0.005;0.006	B;B;B	0.27170	0.077;0.005;0.009	T	0.09143	-1.0688	10	0.49607	T	0.09	-18.1997	8.5474	0.33430	0.2495:0.0:0.7505:0.0	.	254;334;346	E7ET92;Q9H1P3-2;Q9H1P3	.;.;OSBL2_HUMAN	N	334;346;254	ENSP00000350755:D334N;ENSP00000316649:D346N;ENSP00000397602:D254N	ENSP00000316649:D346N	D	+	1	0	OSBPL2	60295073	0.727000	0.28069	0.003000	0.11579	0.322000	0.28314	2.220000	0.42908	0.470000	0.27294	0.655000	0.94253	GAC		0.652	OSBPL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080021.1	NM_014835		46	186	0	0	0	0.00361	0	46	186				
KRTAP24-1	643803	broad.mit.edu	37	21	31655088	31655088	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr21:31655088G>T	ENST00000340345.4	-	1	188	c.163C>A	c.(163-165)Ctc>Atc	p.L55I		NM_001085455.1	NP_001078924.1	Q3LI83	KR241_HUMAN	keratin associated protein 24-1	55						keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.L55I(1)		breast(1)|large_intestine(3)|lung(7)|urinary_tract(3)	14						AGGAGCCAGAGATTTCCTTGG	0.498																																							uc002ynv.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(163-165)CTC>ATC		keratin associated protein 24-1							92.0	91.0	92.0					21																	31655088		1940	4158	6098	SO:0001583	missense	643803					keratin filament	structural molecule activity	g.chr21:31655088G>T	AB096935	CCDS42915.1	21q22.11	2007-11-23			ENSG00000188694	ENSG00000188694		"""Keratin associated proteins"""	33902	protein-coding gene	gene with protein product							Standard	NM_001085455		Approved	KAP24.1	uc002ynv.3	Q3LI83	OTTHUMG00000125483	ENST00000340345.4:c.163C>A	21.37:g.31655088G>T	ENSP00000339238:p.Leu55Ile		Somatic					p.L55I	NM_001085455	NP_001078924	WXS	Illumina HiSeq	Unspecified	Q3LI83	KR241_HUMAN			1	189	-			55					Q1XDX0	Missense_Mutation	SNP	ENST00000340345.4	37	c.163C>A	CCDS42915.1	.	.	.	.	.	.	.	.	.	.	G	13.63	2.295179	0.40594	.	.	ENSG00000188694	ENST00000340345	T	0.03212	4.01	5.06	2.22	0.28083	.	0.715384	0.12861	N	0.433134	T	0.05410	0.0143	L	0.54323	1.7	0.26840	N	0.968403	P	0.42078	0.77	B	0.44108	0.441	T	0.30822	-0.9965	10	0.49607	T	0.09	-7.8717	4.0246	0.09682	0.1927:0.0:0.619:0.1883	.	55	Q3LI83	KR241_HUMAN	I	55	ENSP00000339238:L55I	ENSP00000339238:L55I	L	-	1	0	KRTAP24-1	30576959	0.994000	0.37717	0.998000	0.56505	0.998000	0.95712	0.734000	0.26101	0.774000	0.33427	0.591000	0.81541	CTC		0.498	KRTAP24-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246806.2	NM_001085455		43	113	1	0	1.95508e-11	0.00361	2.38824e-11	43	113				
AIRE	326	broad.mit.edu	37	21	45713696	45713696	+	Missense_Mutation	SNP	G	G	A	rs373993732		TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr21:45713696G>A	ENST00000291582.5	+	11	1430	c.1303G>A	c.(1303-1305)Ggg>Agg	p.G435R	AIRE_ENST00000355347.4_Missense_Mutation_p.G228R|AIRE_ENST00000329347.4_Silent_p.A200A	NM_000383.3	NP_000374.1	O43918	AIRE_HUMAN	autoimmune regulator	435					humoral immune response (GO:0006959)|immune response (GO:0006955)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|transcription regulatory region DNA binding (GO:0044212)|translation regulator activity (GO:0045182)|zinc ion binding (GO:0008270)	p.G238R(1)|p.G435R(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|skin(2)|urinary_tract(1)	14				Colorectal(79;0.0806)		TGCGCGTTGCGGGGTGTGCGG	0.706									Autoimmune PolyEndocrinopathy Candidiasis Ectodermal Dystrophy				G|||	1	0.000199681	0.0008	0.0	5008	,	,		10778	0.0		0.0	False		,,,				2504	0.0						uc002zei.2		NA																	2	Substitution - Missense(2)		lung(2)	skin(1)	1						c.(1303-1305)GGG>AGG		autoimmune regulator isoform 1		G	ARG/GLY,ARG/GLY	5,4395	9.9+/-24.2	0,5,2195	62.0	54.0	57.0		1303,712	2.0	0.3	21		57	0,8590		0,0,4295	no	missense,missense	AIRE	NM_000383.2,NM_000658.2	125,125	0,5,6490	AA,AG,GG		0.0,0.1136,0.0385	probably-damaging,probably-damaging	435/546,238/349	45713696	5,12985	2200	4295	6495	SO:0001583	missense	326	Autoimmune_PolyEndocrinopathy_Candidiasis_Ectodermal_Dystrophy	Familial Cancer Database	APECED	positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	chromatin binding|histone binding|transcription regulatory region DNA binding|translation regulator activity|zinc ion binding	g.chr21:45713696G>A	AB006684	CCDS13706.1	21q22.3	2014-09-17	2007-06-20		ENSG00000160224	ENSG00000160224		"""Zinc fingers, PHD-type"""	360	protein-coding gene	gene with protein product	"""autoimmune polyendocrinopathy candidiasis ectodermal dystrophy"""	607358	"""autoimmune regulator (autoimmune polyendocrinopathy candidiasis ectodermal dystrophy)"""	APECED		9398840	Standard	NM_000383		Approved	PGA1, APS1	uc002zei.3	O43918	OTTHUMG00000086921	ENST00000291582.5:c.1303G>A	21.37:g.45713696G>A	ENSP00000291582:p.Gly435Arg		Somatic				AIRE_uc010gpq.2_RNA|AIRE_uc002zej.2_Missense_Mutation_p.G238R|AIRE_uc010gpr.2_Missense_Mutation_p.G238R	p.G435R	NM_000383	NP_000374	WXS	Illumina HiSeq	Unspecified	O43918	AIRE_HUMAN		Colorectal(79;0.0806)	11	1430	+			435			PHD-type 2.		B2RP50|O43922|O43932|O75745	Missense_Mutation	SNP	ENST00000291582.5	37	c.1303G>A	CCDS13706.1	.	.	.	.	.	.	.	.	.	.	G	12.90	2.076214	0.36662	0.001136	0.0	ENSG00000160224	ENST00000291582;ENST00000337909;ENST00000397994;ENST00000355347	D;D	0.87179	-2.22;-2.22	3.88	1.98	0.26296	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, PHD-type, conserved site (1);Zinc finger, PHD-type (1);Zinc finger, FYVE/PHD-type (1);	0.420447	0.19965	N	0.102123	D	0.88720	0.6513	M	0.64997	1.995	0.58432	D	0.999994	D;D	0.89917	1.0;0.997	D;P	0.69307	0.963;0.806	D	0.83562	0.0107	10	0.12103	T	0.63	-34.3938	6.9161	0.24361	0.232:0.0:0.768:0.0	.	238;435	B2RP50;O43918	.;AIRE_HUMAN	R	435;238;238;228	ENSP00000291582:G435R;ENSP00000347505:G228R	ENSP00000291582:G435R	G	+	1	0	AIRE	44538124	0.994000	0.37717	0.343000	0.25615	0.065000	0.16274	2.369000	0.44231	0.229000	0.21039	0.561000	0.74099	GGG		0.706	AIRE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195842.2			19	54	0	0	0	0.00278	0	19	54				
PRMT2	3275	broad.mit.edu	37	21	48068529	48068529	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr21:48068529G>A	ENST00000397637.1	+	5	1441	c.487G>A	c.(487-489)Gcg>Acg	p.A163T	PRMT2_ENST00000397628.1_Missense_Mutation_p.A163T|PRMT2_ENST00000491389.1_3'UTR|PRMT2_ENST00000458387.2_Missense_Mutation_p.A163T|PRMT2_ENST00000355680.3_Missense_Mutation_p.A163T|PRMT2_ENST00000291705.6_Missense_Mutation_p.A163T|PRMT2_ENST00000451211.2_Missense_Mutation_p.A163T|PRMT2_ENST00000397638.2_Missense_Mutation_p.A163T|PRMT2_ENST00000334494.4_Missense_Mutation_p.A163T|PRMT2_ENST00000440086.1_Missense_Mutation_p.A163T			P55345	ANM2_HUMAN	protein arginine methyltransferase 2	163	Interaction with ESR1.|Interaction with RB1. {ECO:0000250}.|SAM-dependent MTase PRMT-type. {ECO:0000255|PROSITE-ProRule:PRU01015}.				developmental cell growth (GO:0048588)|histone arginine methylation (GO:0034969)|histone methylation (GO:0016571)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription, DNA-templated (GO:0045893)|protein methylation (GO:0006479)|regulation of androgen receptor signaling pathway (GO:0060765)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (GO:0042054)|histone-arginine N-methyltransferase activity (GO:0008469)|peroxisome proliferator activated receptor binding (GO:0042975)|progesterone receptor binding (GO:0033142)|protein homodimerization activity (GO:0042803)|protein-arginine N-methyltransferase activity (GO:0016274)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)|retinoic acid receptor binding (GO:0042974)|signal transducer activity (GO:0004871)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)	p.A163T(2)		NS(1)|breast(3)|endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	16	Breast(49;0.247)	Lung NSC(3;0.245)		Epithelial(3;1.03e-07)|OV - Ovarian serous cystadenocarcinoma(3;4.68e-07)|all cancers(3;7.48e-07)|Colorectal(79;0.167)|Lung(125;0.203)|LUSC - Lung squamous cell carcinoma(216;0.23)|READ - Rectum adenocarcinoma(84;0.248)		GCGGCCTAGAGCGGTGAGTGG	0.587																																							uc002zjx.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(487-489)GCG>ACG		HMT1 hnRNP methyltransferase-like 1							125.0	113.0	117.0					21																	48068529		2203	4300	6503	SO:0001583	missense	3275				developmental cell growth|induction of apoptosis|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of NF-kappaB transcription factor activity|negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|regulation of androgen receptor signaling pathway	cytosol|nucleus	androgen receptor binding|estrogen receptor binding|histone-arginine N-methyltransferase activity|peroxisome proliferator activated receptor binding|progesterone receptor binding|protein homodimerization activity|retinoic acid receptor binding|signal transducer activity|thyroid hormone receptor binding|transcription coactivator activity	g.chr21:48068529G>A	U80213	CCDS13737.1, CCDS56219.1, CCDS56220.1, CCDS68230.1, CCDS68231.1, CCDS74806.1	21q22.3	2014-06-12	2006-02-16	2006-02-16	ENSG00000160310	ENSG00000160310	2.1.1.125	"""Protein arginine methyltransferases"""	5186	protein-coding gene	gene with protein product		601961	"""HMT1 (hnRNP methyltransferase, S. cerevisiae)-like 1"", ""HMT1 hnRNP methyltransferase-like 1 (S. cerevisiae)"""	HRMT1L1		9545638	Standard	XM_005261111		Approved	MGC111373	uc002zjy.3	P55345	OTTHUMG00000048806	ENST00000397637.1:c.487G>A	21.37:g.48068529G>A	ENSP00000380759:p.Ala163Thr		Somatic				PRMT2_uc002zjw.2_Missense_Mutation_p.A163T|PRMT2_uc002zjy.2_Missense_Mutation_p.A163T|PRMT2_uc010gqm.2_Missense_Mutation_p.A163T|PRMT2_uc011aga.1_Missense_Mutation_p.A163T|PRMT2_uc011agb.1_Missense_Mutation_p.A163T|PRMT2_uc011agc.1_Missense_Mutation_p.A163T|PRMT2_uc002zjz.1_Missense_Mutation_p.A49T	p.A163T	NM_206962	NP_996845	WXS	Illumina HiSeq	Unspecified	P55345	ANM2_HUMAN		Epithelial(3;1.03e-07)|OV - Ovarian serous cystadenocarcinoma(3;4.68e-07)|all cancers(3;7.48e-07)|Colorectal(79;0.167)|Lung(125;0.203)|LUSC - Lung squamous cell carcinoma(216;0.23)|READ - Rectum adenocarcinoma(84;0.248)	6	801	+	Breast(49;0.247)	Lung NSC(3;0.245)	163			Interaction with RB1 (By similarity).|Interaction with ESR1.		B7U630|B7U631|B7U632|P78350|Q498Y5|Q5U7D4|Q6FHF0|Q99781|Q9BW15|Q9UMC2	Missense_Mutation	SNP	ENST00000397637.1	37	c.487G>A	CCDS13737.1	.	.	.	.	.	.	.	.	.	.	G	15.88	2.963688	0.53507	.	.	ENSG00000160310	ENST00000355680;ENST00000397638;ENST00000458387;ENST00000451211;ENST00000291705;ENST00000397637;ENST00000334494;ENST00000397628;ENST00000440086	T;T;T;T;T;T;T;T;T	0.21361	2.01;2.01;2.01;2.01;2.01;2.01;2.01;2.01;2.01	5.05	5.05	0.67936	.	0.312789	0.30930	N	0.008586	T	0.24736	0.0600	N	0.21324	0.655	0.09310	N	0.999998	P;P;P;D;P;P	0.53619	0.673;0.833;0.896;0.961;0.737;0.459	B;B;P;P;B;B	0.52627	0.324;0.34;0.575;0.704;0.253;0.259	T	0.06607	-1.0817	10	0.42905	T	0.14	-16.3962	16.2791	0.82664	0.0:0.0:1.0:0.0	.	163;163;163;163;49;163	B7U632;B7U630;B7U631;Q498Y5;Q49AF9;P55345	.;.;.;.;.;ANM2_HUMAN	T	163	ENSP00000347906:A163T;ENSP00000380760:A163T;ENSP00000407463:A163T;ENSP00000411984:A163T;ENSP00000291705:A163T;ENSP00000380759:A163T;ENSP00000335490:A163T;ENSP00000380752:A163T;ENSP00000397266:A163T	ENSP00000291705:A163T	A	+	1	0	PRMT2	46892957	0.679000	0.27596	0.013000	0.15412	0.005000	0.04900	3.119000	0.50422	2.531000	0.85337	0.655000	0.94253	GCG		0.587	PRMT2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207401.1	NM_001535		33	130	0	0	0	0.003271	0	33	130				
RAB36	9609	broad.mit.edu	37	22	23495307	23495307	+	Silent	SNP	C	C	T			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr22:23495307C>T	ENST00000263116.2	+	5	553	c.513C>T	c.(511-513)ccC>ccT	p.P171P	RAB36_ENST00000341989.4_Silent_p.P149P	NM_004914.2	NP_004905.2	O95755	RAB36_HUMAN	RAB36, member RAS oncogene family	171					protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTP binding (GO:0005525)	p.P171P(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	all_hematologic(9;0.0197)|Acute lymphoblastic leukemia(84;0.181)			READ - Rectum adenocarcinoma(21;0.155)		CTGGGATTCCCTATAGCCTCC	0.507																																							uc002zwv.1		NA																	1	Substitution - coding silent(1)	p.P171S(1)	lung(1)	ovary(1)|central_nervous_system(1)	2						c.(511-513)CCC>CCT		RAB36, member RAS oncogene family							222.0	207.0	212.0					22																	23495307		2203	4300	6503	SO:0001819	synonymous_variant	9609				protein transport|small GTPase mediated signal transduction	Golgi membrane	GTP binding	g.chr22:23495307C>T	AB023061	CCDS13805.1	22q11.22	2008-06-11			ENSG00000100228	ENSG00000100228		"""RAB, member RAS oncogene"""	9775	protein-coding gene	gene with protein product		605662				9920784, 10591208	Standard	NM_004914		Approved		uc002zwv.1	O95755	OTTHUMG00000150601	ENST00000263116.2:c.513C>T	22.37:g.23495307C>T			Somatic				RAB36_uc010gtw.1_Silent_p.P149P	p.P171P	NM_004914	NP_004905	WXS	Illumina HiSeq	Unspecified	O95755	RAB36_HUMAN		READ - Rectum adenocarcinoma(21;0.155)	5	553	+	all_hematologic(9;0.0197)|Acute lymphoblastic leukemia(84;0.181)		171					Q2M390|Q7Z4A9|Q9UHP5	Silent	SNP	ENST00000263116.2	37	c.513C>T	CCDS13805.1																																																																																				0.507	RAB36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319046.1	NM_004914		49	191	0	0	0	0.00361	0	49	191				
MMP11	4320	broad.mit.edu	37	22	24122621	24122621	+	Silent	SNP	C	C	T	rs199514530		TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr22:24122621C>T	ENST00000215743.3	+	3	466	c.414C>T	c.(412-414)agC>agT	p.S138S	MMP11_ENST00000477567.1_3'UTR	NM_005940.3	NP_005931.2	P24347	MMP11_HUMAN	matrix metallopeptidase 11 (stromelysin 3)	138					basement membrane organization (GO:0071711)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|negative regulation of fat cell differentiation (GO:0045599)|proteolysis (GO:0006508)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.S138S(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|liver(2)|lung(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)	27		Medulloblastoma(6;9.86e-08)|all_neural(6;0.000318)			Marimastat(DB00786)	AGGTATGGAGCGATGTGACGC	0.627																																							uc002zxx.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(2)|large_intestine(1)	3						c.(412-414)AGC>AGT		matrix metalloproteinase 11 preproprotein							108.0	93.0	98.0					22																	24122621		2203	4300	6503	SO:0001819	synonymous_variant	4320				collagen catabolic process|multicellular organismal development|proteolysis	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding	g.chr22:24122621C>T		CCDS13816.1	22q11.23	2008-06-11	2005-08-08		ENSG00000099953	ENSG00000099953			7157	protein-coding gene	gene with protein product		185261	"""matrix metalloproteinase 11 (stromelysin 3)"""	STMY3		1639418, 7657606, 12006591	Standard	NM_005940		Approved		uc002zxx.3	P24347	OTTHUMG00000150742	ENST00000215743.3:c.414C>T	22.37:g.24122621C>T			Somatic				MMP11_uc002zxy.2_RNA|MMP11_uc002zxz.2_5'Flank	p.S138S	NM_005940	NP_005931	WXS	Illumina HiSeq	Unspecified	P24347	MMP11_HUMAN			3	436	+		Medulloblastoma(6;9.86e-08)|all_neural(6;0.000318)	138					Q5FX24|Q6PEZ6|Q9UC26	Silent	SNP	ENST00000215743.3	37	c.414C>T	CCDS13816.1																																																																																				0.627	MMP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319891.2	NM_005940		21	70	0	0	0	0.002299	0	21	70				
MYO18B	84700	broad.mit.edu	37	22	26423541	26423541	+	Missense_Mutation	SNP	C	C	T	rs532589500		TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr22:26423541C>T	ENST00000407587.2	+	43	7773	c.7604C>T	c.(7603-7605)gCg>gTg	p.A2535V	MYO18B_ENST00000335473.7_Missense_Mutation_p.A2534V|MYO18B_ENST00000536101.1_Missense_Mutation_p.A2534V			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	2534						cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.A2535V(1)		NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						CCACGACTTGCGGGTGACGGT	0.577													C|||	1	0.000199681	0.0	0.0014	5008	,	,		19086	0.0		0.0	False		,,,				2504	0.0						uc003abz.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|central_nervous_system(3)|large_intestine(2)|breast(2)	12						c.(7600-7602)GCG>GTG		myosin XVIIIB							43.0	45.0	44.0					22																	26423541		2010	4159	6169	SO:0001583	missense	84700					nucleus|sarcomere|unconventional myosin complex	actin binding|ATP binding|motor activity	g.chr22:26423541C>T	AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.7604C>T	22.37:g.26423541C>T	ENSP00000386096:p.Ala2535Val		Somatic				MYO18B_uc003aca.1_Missense_Mutation_p.A2415V|MYO18B_uc010guy.1_Missense_Mutation_p.A2416V|MYO18B_uc010guz.1_Missense_Mutation_p.A2414V|MYO18B_uc011aka.1_Missense_Mutation_p.A1688V|MYO18B_uc011akb.1_Missense_Mutation_p.A2047V|MYO18B_uc010gva.1_Missense_Mutation_p.A517V|MYO18B_uc010gvb.1_RNA	p.A2534V	NM_032608	NP_115997	WXS	Illumina HiSeq	Unspecified	Q8IUG5	MY18B_HUMAN			43	7851	+			2534					B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Missense_Mutation	SNP	ENST00000407587.2	37	c.7601C>T		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	6.602|6.602	0.479448|0.479448	0.12581|0.12581	.|.	.|.	ENSG00000133454|ENSG00000133454	ENST00000536101;ENST00000335473;ENST00000407587|ENST00000543971	D;D;D|.	0.86627|.	-2.14;-2.14;-2.15|.	5.17|5.17	0.669|0.669	0.17918|0.17918	.|.	0.734852|.	0.11264|.	N|.	0.582305|.	T|T	0.14356|0.14356	0.0347|0.0347	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	B;B;B;P;P|.	0.38677|.	0.371;0.378;0.378;0.642;0.512|.	B;B;B;B;B|.	0.26770|.	0.046;0.033;0.033;0.073;0.073|.	T|T	0.22695|0.22695	-1.0209|-1.0209	10|5	0.72032|.	D|.	0.01|.	.|.	2.3609|2.3609	0.04307|0.04307	0.5922:0.1511:0.1357:0.121|0.5922:0.1511:0.1357:0.121	.|.	2047;2536;2534;2535;2534|.	Q8IUG5-2;B0QYF5;Q8IUG5;F5GXR6;F5GYU7|.	.;.;MY18B_HUMAN;.;.|.	V|W	2534;2534;2535|484	ENSP00000441229:A2534V;ENSP00000334563:A2534V;ENSP00000386096:A2535V|.	ENSP00000334563:A2534V|.	A|R	+|+	2|1	0|2	MYO18B|MYO18B	24753541|24753541	0.140000|0.140000	0.22579|0.22579	0.001000|0.001000	0.08648|0.08648	0.001000|0.001000	0.01503|0.01503	1.485000|1.485000	0.35519|0.35519	0.323000|0.323000	0.23307|0.23307	-0.221000|-0.221000	0.12465|0.12465	GCG|CGG		0.577	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000400691.1	NM_032608		15	41	0	0	0	0.00499	0	15	41				
SMTN	6525	broad.mit.edu	37	22	31501067	31501067	+	IGR	SNP	C	C	G			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr22:31501067C>G	ENST00000347557.2	+	0	3130				SELM_ENST00000465536.1_5'UTR|SELM_ENST00000400299.2_Silent_p.V109V|SELM_ENST00000402395.1_Silent_p.V109V	NM_001207017.1|NM_006932.4	NP_001193946.1|NP_008863.3	P53814	SMTN_HUMAN	smoothelin						muscle organ development (GO:0007517)|smooth muscle contraction (GO:0006939)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|structural constituent of muscle (GO:0008307)	p.V109V(1)		breast(2)|endometrium(2)|large_intestine(5)|lung(9)|ovary(3)|pancreas(1)|prostate(3)	25						CGAGCTCCTGCACTAGCGCAT	0.692																																							uc011ali.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(325-327)GTG>GTC		selenoprotein M precursor							33.0	35.0	35.0					22																	31501067		1965	4128	6093	SO:0001628	intergenic_variant	140606					endoplasmic reticulum|Golgi apparatus|nucleus|perinuclear region of cytoplasm		g.chr22:31501067C>G	AY061972	CCDS13886.1, CCDS13887.1, CCDS13888.1, CCDS74845.1, CCDS74846.1	22q12	2006-01-27			ENSG00000183963	ENSG00000183963			11126	protein-coding gene	gene with protein product		602127				9244445, 8707825	Standard	NM_006932		Approved		uc011ale.2	P53814	OTTHUMG00000151203		22.37:g.31501067C>G			Somatic				SELM_uc011alj.1_RNA|INPP5J_uc010gwf.2_5'Flank	p.V109V	NM_080430	NP_536355	WXS	Illumina HiSeq	Unspecified	Q8WWX9	SELM_HUMAN			6	387	-			109					O00569|O95769|O95937|Q8N4H8|Q8WWW1|Q8WWW2|Q9P1S8|Q9UIT1|Q9UIT2	Silent	SNP	ENST00000347557.2	37	c.327G>C	CCDS13886.1																																																																																				0.692	SMTN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321766.1	NM_134270		23	78	0	0	0	0.009535	0	23	78				
TRANK1	9881	broad.mit.edu	37	3	36898996	36898996	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr3:36898996C>A	ENST00000429976.2	-	12	2332	c.2085G>T	c.(2083-2085)ttG>ttT	p.L695F	TRANK1_ENST00000428977.2_Missense_Mutation_p.L145F|TRANK1_ENST00000301807.6_Missense_Mutation_p.L145F	NM_014831.2	NP_055646.2	O15050	TRNK1_HUMAN	tetratricopeptide repeat and ankyrin repeat containing 1	695							ATP binding (GO:0005524)|hydrolase activity (GO:0016787)	p.L145F(2)|p.L695F(1)		NS(2)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(20)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	73						CCTGCTGAATCAAAACTGTGA	0.552																																							uc003cgj.2		NA																	3	Substitution - Missense(3)		lung(3)	ovary(1)|central_nervous_system(1)	2						c.(433-435)TTG>TTT		lupus brain antigen 1							44.0	45.0	45.0					3																	36898996		1963	4157	6120	SO:0001583	missense	9881				DNA repair		ATP binding|ATP-dependent DNA helicase activity|DNA binding	g.chr3:36898996C>A	AK096678	CCDS46789.1, CCDS46789.2	3p22.2	2013-01-11			ENSG00000168016	ENSG00000168016		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29011	protein-coding gene	gene with protein product	"""lupus brain antigen 1"", ""KIAA0342"""					9205841	Standard	NM_014831		Approved	LBA1, KIAA0342	uc003cgj.3	O15050	OTTHUMG00000155848	ENST00000429976.2:c.2085G>T	3.37:g.36898996C>A	ENSP00000416168:p.Leu695Phe		Somatic					p.L145F	NM_014831	NP_055646	WXS	Illumina HiSeq	Unspecified	O15050	TRNK1_HUMAN			3	737	-			695					Q8N8K0	Missense_Mutation	SNP	ENST00000429976.2	37	c.435G>T	CCDS46789.2	.	.	.	.	.	.	.	.	.	.	C	18.33	3.601276	0.66445	.	.	ENSG00000168016	ENST00000428977;ENST00000429976;ENST00000301807	T;T;T	0.51325	0.71;1.0;0.71	5.75	4.85	0.62838	.	0.000000	0.41097	D	0.000955	T	0.51312	0.1667	L	0.36672	1.1	0.42075	D	0.991225	D	0.69078	0.997	P	0.61940	0.896	T	0.54569	-0.8274	10	0.62326	D	0.03	.	6.9097	0.24329	0.0:0.6937:0.0:0.3063	.	695	O15050	TRNK1_HUMAN	F	145;695;145	ENSP00000416826:L145F;ENSP00000416168:L695F;ENSP00000301807:L145F	ENSP00000301807:L145F	L	-	3	2	TRANK1	36874000	1.000000	0.71417	0.993000	0.49108	0.635000	0.38103	1.612000	0.36889	1.520000	0.48965	0.655000	0.94253	TTG		0.552	TRANK1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_014831		12	56	1	0	4.3838e-07	0.001855	4.96831e-07	12	56				
PTPN23	25930	broad.mit.edu	37	3	47451187	47451187	+	Silent	SNP	C	C	T			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr3:47451187C>T	ENST00000265562.4	+	19	2069	c.1992C>T	c.(1990-1992)gcC>gcT	p.A664A	PTPN23_ENST00000431726.1_Silent_p.A538A	NM_015466.2	NP_056281.1	Q9H3S7	PTN23_HUMAN	protein tyrosine phosphatase, non-receptor type 23	664					cilium morphogenesis (GO:0060271)|negative regulation of epithelial cell migration (GO:0010633)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of adherens junction organization (GO:1903393)|positive regulation of early endosome to late endosome transport (GO:2000643)|positive regulation of homophilic cell adhesion (GO:1903387)|protein transport (GO:0015031)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)	p.A664A(1)		breast(3)|central_nervous_system(1)|large_intestine(5)|lung(7)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	23				BRCA - Breast invasive adenocarcinoma(193;0.000271)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		CGTATGAAGCCTATGAGGACC	0.632																																							uc003crf.1		NA																	1	Substitution - coding silent(1)		lung(1)	breast(1)|central_nervous_system(1)|skin(1)	3						c.(1990-1992)GCC>GCT		protein tyrosine phosphatase, non-receptor type							42.0	43.0	43.0					3																	47451187		2203	4300	6503	SO:0001819	synonymous_variant	25930				cilium morphogenesis	cilium|cytoplasmic membrane-bounded vesicle|microtubule basal body	protein tyrosine phosphatase activity	g.chr3:47451187C>T	AB025194	CCDS2754.1	3p21.3	2011-06-09			ENSG00000076201	ENSG00000076201		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	14406	protein-coding gene	gene with protein product		606584				11095967	Standard	NM_015466		Approved	DKFZP564F0923, KIAA1471, HD-PTP	uc003crf.1	Q9H3S7	OTTHUMG00000133520	ENST00000265562.4:c.1992C>T	3.37:g.47451187C>T			Somatic				PTPN23_uc011baw.1_Silent_p.A629A|PTPN23_uc011bax.1_RNA|PTPN23_uc011bay.1_Silent_p.A534A	p.A664A	NM_015466	NP_056281	WXS	Illumina HiSeq	Unspecified	Q9H3S7	PTN23_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000271)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)	19	2088	+			664					A8K0D7|Q7KZF8|Q8N6Z5|Q9BSR5|Q9P257|Q9UG03|Q9UMZ4	Silent	SNP	ENST00000265562.4	37	c.1992C>T	CCDS2754.1																																																																																				0.632	PTPN23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257492.2	NM_015466		9	25	0	0	0	0.006214	0	9	25				
MST1R	4486	broad.mit.edu	37	3	49927404	49927404	+	Silent	SNP	C	C	T			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr3:49927404C>T	ENST00000296474.3	-	19	3927	c.3900G>A	c.(3898-3900)ctG>ctA	p.L1300L	MST1R_ENST00000344206.4_Silent_p.L1251L	NM_002447.2	NP_002438	Q04912	RON_HUMAN	macrophage stimulating 1 receptor (c-met-related tyrosine kinase)	1300	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular component movement (GO:0006928)|defense response (GO:0006952)|innate immune response (GO:0045087)|macrophage colony-stimulating factor signaling pathway (GO:0038145)|multicellular organismal development (GO:0007275)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|response to virus (GO:0009615)|signal transduction (GO:0007165)|single fertilization (GO:0007338)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|macrophage colony-stimulating factor receptor activity (GO:0005011)	p.L1300L(2)		cervix(1)|endometrium(5)|large_intestine(3)|lung(17)|ovary(5)|prostate(2)|skin(1)|urinary_tract(3)	37				BRCA - Breast invasive adenocarcinoma(193;4.65e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00553)|Kidney(197;0.00625)		GACCCTGGGCCAGGAAGTGGG	0.592																																							uc003cxy.3		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(5)|lung(1)	6						c.(3898-3900)CTG>CTA		macrophage stimulating 1 receptor precursor							98.0	93.0	95.0					3																	49927404		2203	4300	6503	SO:0001819	synonymous_variant	4486				cellular component movement|defense response|multicellular organismal development|positive regulation of cell proliferation|single fertilization|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|macrophage colony-stimulating factor receptor activity|protein binding	g.chr3:49927404C>T	X70040	CCDS2807.1, CCDS58833.1	3p21	2008-08-18			ENSG00000164078	ENSG00000164078		"""CD molecules"""	7381	protein-coding gene	gene with protein product		600168	"""PTK8 protein tyrosine kinase 8"""	RON, PTK8		8386824	Standard	NM_002447		Approved	CDw136, CD136	uc003cxy.4	Q04912	OTTHUMG00000156709	ENST00000296474.3:c.3900G>A	3.37:g.49927404C>T			Somatic				MST1R_uc011bdc.1_Silent_p.L179L	p.L1300L	NM_002447	NP_002438	WXS	Illumina HiSeq	Unspecified	Q04912	RON_HUMAN		BRCA - Breast invasive adenocarcinoma(193;4.65e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00553)|Kidney(197;0.00625)	19	4164	-			1300			Cytoplasmic (Potential).|Protein kinase.		B5A944|B5A945|B5A946|B5A947	Silent	SNP	ENST00000296474.3	37	c.3900G>A	CCDS2807.1	.	.	.	.	.	.	.	.	.	.	C	8.148	0.786717	0.16189	.	.	ENSG00000164078	ENST00000434765	.	.	.	5.91	4.13	0.48395	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-16.0666	10.49	0.44746	0.2418:0.5238:0.2345:0.0	.	.	.	.	X	278	.	.	W	-	2	0	MST1R	49902408	0.997000	0.39634	0.998000	0.56505	0.915000	0.54546	0.456000	0.21859	0.844000	0.35094	-1.131000	0.01979	TGG		0.592	MST1R-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000345403.1			28	73	0	0	0	0.012213	0	28	73				
LRTM1	57408	broad.mit.edu	37	3	54958983	54958983	+	Silent	SNP	C	C	A			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr3:54958983C>A	ENST00000273286.5	-	2	429	c.267G>T	c.(265-267)ctG>ctT	p.L89L	CACNA2D3_ENST00000490478.1_Intron|LRTM1_ENST00000493075.1_Silent_p.L13L|CACNA2D3_ENST00000288197.5_Intron|CACNA2D3_ENST00000415676.2_Intron|CACNA2D3_ENST00000474759.1_Intron	NM_020678.2	NP_065729.1	Q9HBL6	LRTM1_HUMAN	leucine-rich repeats and transmembrane domains 1	89						integral component of membrane (GO:0016021)		p.L89L(2)		breast(1)|endometrium(2)|large_intestine(7)|lung(6)|prostate(1)|skin(4)	21				KIRC - Kidney renal clear cell carcinoma(284;0.00975)|Kidney(284;0.0112)|OV - Ovarian serous cystadenocarcinoma(275;0.0502)		CTCCAGGGGCCAGATTTGAAA	0.443																																							uc003dhl.2		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(265-267)CTG>CTT		leucine-rich repeats and transmembrane domains 1							57.0	56.0	56.0					3																	54958983		2203	4300	6503	SO:0001819	synonymous_variant	57408					integral to membrane		g.chr3:54958983C>A	AF225421	CCDS2876.1	3p14.3	2006-01-02			ENSG00000144771	ENSG00000144771			25023	protein-coding gene	gene with protein product						12477932	Standard	NM_020678		Approved	HT017	uc003dhl.3	Q9HBL6	OTTHUMG00000158578	ENST00000273286.5:c.267G>T	3.37:g.54958983C>A			Somatic				CACNA2D3_uc003dhf.2_Intron|CACNA2D3_uc003dhg.1_Intron|CACNA2D3_uc003dhh.1_Intron	p.L89L	NM_020678	NP_065729	WXS	Illumina HiSeq	Unspecified	Q9HBL6	LRTM1_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.00975)|Kidney(284;0.0112)|OV - Ovarian serous cystadenocarcinoma(275;0.0502)	2	401	-			89			Extracellular (Potential).|LRR 2.		Q8IUU2	Silent	SNP	ENST00000273286.5	37	c.267G>T	CCDS2876.1																																																																																				0.443	LRTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351399.1	NM_020678		10	45	1	0	5.50884e-06	0.001368	5.97767e-06	10	45				
RYBP	23429	broad.mit.edu	37	3	72495721	72495721	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr3:72495721G>C	ENST00000477973.2	-	1	348	c.349C>G	c.(349-351)Cgt>Ggt	p.R117G		NM_012234.5	NP_036366.3	Q8N488	RYBP_HUMAN	RING1 and YY1 binding protein	0	Lys-rich.				apoptotic process (GO:0006915)|histone H2A monoubiquitination (GO:0035518)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.S117S(1)		prostate(1)|upper_aerodigestive_tract(1)	2		Prostate(10;0.00174)|Lung NSC(201;0.0659)|Myeloproliferative disorder(1037;0.204)		BRCA - Breast invasive adenocarcinoma(55;0.000197)|Epithelial(33;0.00068)|LUSC - Lung squamous cell carcinoma(21;0.00228)|Lung(16;0.00677)|KIRC - Kidney renal clear cell carcinoma(39;0.198)|Kidney(39;0.232)		AGGTGCAGACGCTACAATCCC	0.522																																							uc003dpe.2		NA																	1	Substitution - coding silent(1)		upper_aerodigestive_tract(1)		0						c.(52-54)AGC>AGG		RING1 and YY1 binding protein							83.0	86.0	85.0					3																	72495721		1899	4124	6023	SO:0001583	missense	23429				apoptosis|histone H2A monoubiquitination|multicellular organismal development|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|nucleoplasm	DNA binding|protein binding|transcription corepressor activity|zinc ion binding	g.chr3:72495721G>C	AF179286		3p14.2	2008-07-18			ENSG00000163602	ENSG00000163602			10480	protein-coding gene	gene with protein product	"""YY1 and E4TF1 associated factor 1"", ""ring1 interactor RYBP"", ""apoptin-associating protein 1"", ""death effector domain-associated factor"""	607535				10369680	Standard	NM_012234		Approved	YEAF1, AAP1, DEDAF	uc003dpe.3	Q8N488	OTTHUMG00000159190	ENST00000477973.2:c.349C>G	3.37:g.72495721G>C	ENSP00000419494:p.Arg117Gly		Somatic					p.S18R	NM_012234	NP_036366	WXS	Illumina HiSeq	Unspecified	Q8N488	RYBP_HUMAN		BRCA - Breast invasive adenocarcinoma(55;0.000197)|Epithelial(33;0.00068)|LUSC - Lung squamous cell carcinoma(21;0.00228)|Lung(16;0.00677)|KIRC - Kidney renal clear cell carcinoma(39;0.198)|Kidney(39;0.232)	1	171	-		Prostate(10;0.00174)|Lung NSC(201;0.0659)|Myeloproliferative disorder(1037;0.204)	28			RanBP2-type.		Q9P2W5|Q9UMW4	Missense_Mutation	SNP	ENST00000477973.2	37	c.54C>G		.	.	.	.	.	.	.	.	.	.	G	20.8	4.042780	0.75732	.	.	ENSG00000163602	ENST00000477973	.	.	.	4.92	1.6	0.23607	.	.	.	.	.	T	0.72953	0.3525	M	0.90082	3.085	.	.	.	.	.	.	.	.	.	T	0.79936	-0.1593	4	.	.	.	-6.3991	9.5268	0.39169	0.3449:0.0:0.6551:0.0	.	.	.	.	G	117	.	.	R	-	1	0	RYBP	72578411	1.000000	0.71417	1.000000	0.80357	0.890000	0.51754	1.413000	0.34725	0.599000	0.29845	0.555000	0.69702	CGT		0.522	RYBP-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000353762.3	NM_012234		9	27	0	0	0	0.006214	0	9	27				
ROBO2	6092	broad.mit.edu	37	3	77666743	77666743	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr3:77666743G>T	ENST00000461745.1	+	22	4273	c.3373G>T	c.(3373-3375)Gat>Tat	p.D1125Y	ROBO2_ENST00000469233.1_3'UTR|ROBO2_ENST00000487694.3_Missense_Mutation_p.D1141Y|ROBO2_ENST00000332191.8_Missense_Mutation_p.D1125Y	NM_002942.4	NP_002933.1	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2 (Drosophila)	1125					apoptotic process involved in luteolysis (GO:0061364)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|cellular response to hormone stimulus (GO:0032870)|central nervous system development (GO:0007417)|homophilic cell adhesion (GO:0007156)|metanephros development (GO:0001656)|negative regulation of negative chemotaxis (GO:0050925)|negative regulation of synapse assembly (GO:0051964)|olfactory bulb interneuron development (GO:0021891)|positive regulation of axonogenesis (GO:0050772)|retinal ganglion cell axon guidance (GO:0031290)|ureteric bud development (GO:0001657)	axolemma (GO:0030673)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)	p.D1125Y(1)|p.D1141Y(1)		NS(1)|biliary_tract(5)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(23)|liver(1)|lung(52)|ovary(2)|pancreas(2)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	117				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		ACTGGAAGAAGATGATGATAG	0.473																																							uc003dpy.3		NA																	2	Substitution - Missense(2)		lung(2)	lung(5)|skin(3)|ovary(1)|large_intestine(1)|liver(1)	11						c.(3373-3375)GAT>TAT		roundabout, axon guidance receptor, homolog 2							124.0	117.0	119.0					3																	77666743		2017	4172	6189	SO:0001583	missense	6092				apoptosis involved in luteolysis|axon midline choice point recognition|cellular response to hormone stimulus|homophilic cell adhesion|metanephros development|negative regulation of negative chemotaxis|negative regulation of synaptogenesis|olfactory bulb interneuron development|positive regulation of axonogenesis|retinal ganglion cell axon guidance|ureteric bud development	axolemma|cell surface|integral to membrane	axon guidance receptor activity|identical protein binding	g.chr3:77666743G>T	AF040991	CCDS43109.1, CCDS54609.1	3p12.3	2013-02-11	2001-11-28		ENSG00000185008	ENSG00000185008		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10250	protein-coding gene	gene with protein product		602431	"""roundabout (axon guidance receptor, Drosophila) homolog 2"""			9458045	Standard	NM_002942		Approved	KIAA1568	uc003dpy.4	Q9HCK4	OTTHUMG00000158935	ENST00000461745.1:c.3373G>T	3.37:g.77666743G>T	ENSP00000417164:p.Asp1125Tyr		Somatic				ROBO2_uc003dpz.2_Missense_Mutation_p.D1129Y|ROBO2_uc011bgj.1_RNA|ROBO2_uc011bgk.1_Missense_Mutation_p.D1129Y|ROBO2_uc003dqa.2_Missense_Mutation_p.D252Y	p.D1125Y	NM_002942	NP_002933	WXS	Illumina HiSeq	Unspecified	Q9HCK4	ROBO2_HUMAN		Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)	22	4016	+			1125			Cytoplasmic (Potential).		O43608|Q19AB4|Q19AB5	Missense_Mutation	SNP	ENST00000461745.1	37	c.3373G>T	CCDS43109.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.3|22.3	4.273846|4.273846	0.80580|0.80580	.|.	.|.	ENSG00000185008|ENSG00000185008	ENST00000487694;ENST00000403211;ENST00000461745;ENST00000332191|ENST00000490991	T;T;T|.	0.63255|.	-0.03;0.0;0.01|.	5.58|5.58	5.58|5.58	0.84498|0.84498	.|.	0.000000|.	0.47455|.	D|.	0.000236|.	T|T	0.56262|0.56262	0.1973|0.1973	N|N	0.22421|0.22421	0.69|0.69	.|.	.|.	.|.	P;D;P|.	0.54047|.	0.681;0.964;0.681|.	B;P;B|.	0.49752|.	0.185;0.621;0.254|.	T|T	0.50004|0.50004	-0.8878|-0.8878	9|4	0.72032|.	D|.	0.01|.	.|.	19.5819|19.5819	0.95471|0.95471	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1141;1125;1125|.	Q19AB5;F8W703;Q9HCK4|.	.;.;ROBO2_HUMAN|.	Y|N	1141;1141;1125;1125|281	ENSP00000417335:D1141Y;ENSP00000417164:D1125Y;ENSP00000327536:D1125Y|.	ENSP00000327536:D1125Y|.	D|K	+|+	1|3	0|2	ROBO2|ROBO2	77749433|77749433	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.665000|0.665000	0.39181|0.39181	9.476000|9.476000	0.97823|0.97823	2.624000|2.624000	0.88883|0.88883	0.655000|0.655000	0.94253|0.94253	GAT|AAG		0.473	ROBO2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000352600.2	XM_031246		24	73	1	0	2.27525e-19	0.003954	2.99453e-19	24	73				
TOPBP1	11073	broad.mit.edu	37	3	133362940	133362940	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr3:133362940G>A	ENST00000260810.5	-	11	1903	c.1772C>T	c.(1771-1773)gCg>gTg	p.A591V	TOPBP1_ENST00000511439.1_Intron	NM_007027.3	NP_008958.2	Q92547	TOPB1_HUMAN	topoisomerase (DNA) II binding protein 1	591	BRCT 4. {ECO:0000255|PROSITE- ProRule:PRU00033}.				cellular response to DNA damage stimulus (GO:0006974)|DNA metabolic process (GO:0006259)|DNA repair (GO:0006281)|response to ionizing radiation (GO:0010212)	chromosome (GO:0005694)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|male germ cell nucleus (GO:0001673)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)	p.A504V(1)|p.A591V(1)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(5)|lung(14)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	40						AGCATAATCCGCAACAGTTCT	0.413								Other conserved DNA damage response genes																													Ovarian(21;193 658 4424 15423 17362)	Ovarian(21;193 658 4424 15423 17362)	uc003eps.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|kidney(2)|skin(1)|lung(1)|pancreas(1)	7						c.(1771-1773)GCG>GTG	Other_conserved_DNA_damage_response_genes	topoisomerase (DNA) II binding protein 1							96.0	91.0	93.0					3																	133362940		1925	4147	6072	SO:0001583	missense	11073				DNA repair|response to ionizing radiation	microtubule organizing center|PML body|spindle pole	DNA binding|protein C-terminus binding	g.chr3:133362940G>A	AB019397	CCDS46919.1	3q22.1	2004-06-21			ENSG00000163781	ENSG00000163781			17008	protein-coding gene	gene with protein product		607760				9461304, 9039502	Standard	NM_007027		Approved	KIAA0259, TOP2BP1	uc003eps.3	Q92547	OTTHUMG00000159773	ENST00000260810.5:c.1772C>T	3.37:g.133362940G>A	ENSP00000260810:p.Ala591Val		Somatic					p.A591V	NM_007027	NP_008958	WXS	Illumina HiSeq	Unspecified	Q92547	TOPB1_HUMAN			11	1904	-			591			BRCT 4.		B7Z7W8|Q7LGC1|Q9UEB9	Missense_Mutation	SNP	ENST00000260810.5	37	c.1772C>T	CCDS46919.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.467156	0.84533	.	.	ENSG00000163781	ENST00000260810	T	0.08634	3.07	5.72	5.72	0.89469	BRCT (2);	0.047491	0.85682	D	0.000000	T	0.12689	0.0308	L	0.59436	1.845	0.80722	D	1	D	0.54601	0.967	B	0.41646	0.362	T	0.07501	-1.0769	10	0.27082	T	0.32	.	19.876	0.96870	0.0:0.0:1.0:0.0	.	591	Q92547	TOPB1_HUMAN	V	591	ENSP00000260810:A591V	ENSP00000260810:A591V	A	-	2	0	TOPBP1	134845630	1.000000	0.71417	0.996000	0.52242	0.768000	0.43524	7.915000	0.87484	2.709000	0.92574	0.591000	0.81541	GCG		0.413	TOPBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357254.1	NM_007027		7	37	0	0	0	0.00308	0	7	37				
P2RY1	5028	broad.mit.edu	37	3	152553711	152553711	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr3:152553711C>T	ENST00000305097.3	+	1	976	c.140C>T	c.(139-141)aCg>aTg	p.T47M		NM_002563.3	NP_002554.1	P47900	P2RY1_HUMAN	purinergic receptor P2Y, G-protein coupled, 1	47					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|aging (GO:0007568)|blood coagulation (GO:0007596)|brain development (GO:0007420)|cell surface receptor signaling pathway (GO:0007166)|eating behavior (GO:0042755)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of binding (GO:0051100)|negative regulation of norepinephrine secretion (GO:0010700)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of hormone secretion (GO:0046887)|positive regulation of inositol trisphosphate biosynthetic process (GO:0032962)|positive regulation of ion transport (GO:0043270)|positive regulation of penile erection (GO:0060406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein localization to plasma membrane (GO:0072659)|regulation of receptor activity (GO:0010469)|regulation of vasodilation (GO:0042312)|relaxation of muscle (GO:0090075)|response to growth factor (GO:0070848)|response to mechanical stimulus (GO:0009612)|sensory perception of pain (GO:0019233)|signal transduction involved in regulation of gene expression (GO:0023019)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell body (GO:0044297)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ADP binding (GO:0043531)|ADP-activated nucleotide receptor activity (GO:0045032)|ATP binding (GO:0005524)|ATP-activated nucleotide receptor activity (GO:0045031)|G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|receptor activity (GO:0004872)|scaffold protein binding (GO:0097110)	p.T47M(1)		breast(1)|endometrium(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)	23			LUSC - Lung squamous cell carcinoma(72;0.0628)|Lung(72;0.11)			TTGACCAAGACGGGCTTCCAG	0.597																																							uc003ezq.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)	1						c.(139-141)ACG>ATG		purinergic receptor P2Y1							95.0	82.0	86.0					3																	152553711		2203	4300	6503	SO:0001583	missense	5028				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|platelet activation	integral to plasma membrane	purinergic nucleotide receptor activity, G-protein coupled	g.chr3:152553711C>T	U42029	CCDS3169.1	3q25.2	2012-08-08			ENSG00000169860	ENSG00000169860		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	8539	protein-coding gene	gene with protein product		601167				8579591	Standard	NM_002563		Approved	P2Y1	uc003ezq.3	P47900	OTTHUMG00000159694	ENST00000305097.3:c.140C>T	3.37:g.152553711C>T	ENSP00000304767:p.Thr47Met		Somatic					p.T47M	NM_002563	NP_002554	WXS	Illumina HiSeq	Unspecified	P47900	P2RY1_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.0628)|Lung(72;0.11)		1	976	+			47			Extracellular (Potential).			Missense_Mutation	SNP	ENST00000305097.3	37	c.140C>T	CCDS3169.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.090592	0.76756	.	.	ENSG00000169860	ENST00000305097	T	0.37752	1.18	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	T	0.41719	0.1171	N	0.08118	0	0.58432	D	0.999999	D	0.89917	1.0	D	0.73708	0.981	T	0.52555	-0.8560	10	0.52906	T	0.07	.	18.1148	0.89549	0.0:1.0:0.0:0.0	.	47	P47900	P2RY1_HUMAN	M	47	ENSP00000304767:T47M	ENSP00000304767:T47M	T	+	2	0	P2RY1	154036401	1.000000	0.71417	0.982000	0.44146	0.792000	0.44763	7.187000	0.77730	2.493000	0.84123	0.655000	0.94253	ACG		0.597	P2RY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356943.1	NM_002563		33	151	0	0	0	0.003755	0	33	151				
TRMT44	152992	broad.mit.edu	37	4	8470028	8470028	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr4:8470028A>T	ENST00000389737.4	+	9	1882	c.1882A>T	c.(1882-1884)Aca>Tca	p.T628S	TRMT44_ENST00000513449.2_Missense_Mutation_p.T387S	NM_152544.2	NP_689757.2	Q8IYL2	TRM44_HUMAN	tRNA methyltransferase 44 homolog (S. cerevisiae)	628					tRNA processing (GO:0008033)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)	p.T236S(1)|p.T628S(1)									GCAATTAAACACAAGAAGTTC	0.512																																							uc003glg.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(1195-1197)ACA>TCA		hypothetical protein LOC152992 isoform 2							71.0	79.0	77.0					4																	8470028		2203	4300	6503	SO:0001583	missense	152992				tRNA processing	cytoplasm	methyltransferase activity|nucleic acid binding|zinc ion binding	g.chr4:8470028A>T	AK093044	CCDS3402.1, CCDS3402.2	4p16.1	2012-06-12	2012-06-12	2012-06-12	ENSG00000155275	ENSG00000155275			26653	protein-coding gene	gene with protein product	"""tRNA methyltransferase 44 homolog (S. cerevisiae)"""	614309	"""chromosome 4 open reading frame 23"", ""methyltransferase like 19"""	C4orf23, METTL19		21658913	Standard	NM_152544		Approved	FLJ35725, TRM44	uc003glg.2	Q8IYL2	OTTHUMG00000160935	ENST00000389737.4:c.1882A>T	4.37:g.8470028A>T	ENSP00000374387:p.Thr628Ser		Somatic				C4orf23_uc003glf.1_Missense_Mutation_p.T387S|C4orf23_uc003glh.1_Missense_Mutation_p.T236S	p.T399S	NM_152544	NP_689757	WXS	Illumina HiSeq	Unspecified	Q8IYL2	TRM44_HUMAN			9	1383	+			628					Q8NA95	Missense_Mutation	SNP	ENST00000389737.4	37	c.1195A>T	CCDS3402.2	.	.	.	.	.	.	.	.	.	.	A	0.510	-0.866744	0.02590	.	.	ENSG00000155275	ENST00000513449;ENST00000389737;ENST00000285635	T;T	0.17854	2.32;2.25	3.93	-7.86	0.01187	.	2.107590	0.01958	N	0.043112	T	0.11537	0.0281	L	0.46157	1.445	0.09310	N	1	B;B	0.18968	0.003;0.032	B;B	0.12837	0.002;0.008	T	0.30707	-0.9969	10	0.09338	T	0.73	0.2841	4.6579	0.12628	0.1414:0.4432:0.2926:0.1228	.	628;387	Q8IYL2;Q8IYL2-2	TRM44_HUMAN;.	S	387;628;236	ENSP00000424643:T387S;ENSP00000374387:T628S	ENSP00000285635:T236S	T	+	1	0	METTL19	8520928	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	-2.104000	0.01340	-2.744000	0.00378	-0.648000	0.03929	ACA		0.512	TRMT44-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000359197.2	NM_152544		10	145	0	0	0	0.006214	0	10	145				
C1QTNF7	114905	broad.mit.edu	37	4	15444288	15444288	+	Silent	SNP	C	C	A			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr4:15444288C>A	ENST00000444304.2	+	3	1061	c.735C>A	c.(733-735)gtC>gtA	p.V245V	C1QTNF7_ENST00000429690.1_Silent_p.V245V|C1QTNF7_ENST00000295297.4_Silent_p.V252V			Q9BXJ2	C1QT7_HUMAN	C1q and tumor necrosis factor related protein 7	245	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.				protein homooligomerization (GO:0051260)	collagen trimer (GO:0005581)|extracellular space (GO:0005615)		p.V245V(1)		endometrium(5)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|stomach(1)	16						AAGATGAAGTCTGGCTGGAGA	0.493																																							uc011bxb.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(733-735)GTC>GTA		C1q and tumor necrosis factor related protein 7							79.0	85.0	83.0					4																	15444288		2203	4300	6503	SO:0001819	synonymous_variant	114905					collagen		g.chr4:15444288C>A	AF329839	CCDS3414.1, CCDS47025.1	4p15.3	2008-08-29			ENSG00000163145	ENSG00000163145			14342	protein-coding gene	gene with protein product							Standard	NM_001135170		Approved	CTRP7	uc003gnp.3	Q9BXJ2	OTTHUMG00000097095	ENST00000444304.2:c.735C>A	4.37:g.15444288C>A			Somatic				C1QTNF7_uc003gno.2_Silent_p.V252V|C1QTNF7_uc003gnp.2_Silent_p.V245V	p.V245V	NM_001135171	NP_001128643	WXS	Illumina HiSeq	Unspecified	Q9BXJ2	C1QT7_HUMAN			3	962	+			245			C1q.		B2RBT3|J3KPW3	Silent	SNP	ENST00000444304.2	37	c.735C>A	CCDS3414.1																																																																																				0.493	C1QTNF7-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000250891.2			62	122	1	0	2.40655e-23	0.00361	3.31714e-23	62	122				
FGFBP1	9982	broad.mit.edu	37	4	15938263	15938263	+	De_novo_Start_OutOfFrame	SNP	G	G	T			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr4:15938263G>T	ENST00000382333.1	-	0	287				FGFBP1_ENST00000259988.2_De_novo_Start_OutOfFrame	NM_005130.4	NP_005121.1	Q14512	FGFP1_HUMAN	fibroblast growth factor binding protein 1						cell-cell signaling (GO:0007267)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|signal transduction (GO:0007165)	cell surface (GO:0009986)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)			NS(1)|kidney(1)|large_intestine(2)|liver(1)|lung(2)|prostate(2)|skin(1)	10						CATGGCTGCAGCTGGGCGTTC	0.557																																							uc003gom.2		NA																	0					0						c.(-9--5)AGCTG>AGATG		fibroblast growth factor binding protein 1							33.0	33.0	33.0					4																	15938263		2057	4014	6071			9982				cell-cell signaling|negative regulation of cell proliferation|signal transduction	extracellular space|plasma membrane	heparin binding	g.chr4:15938263G>T	M60047	CCDS3418.1	4p15.32	2008-02-05			ENSG00000137440	ENSG00000137440			19695	protein-coding gene	gene with protein product		607737				11148217, 1885605	Standard	NM_005130		Approved	HBP17, FGFBP	uc003gom.3	Q14512	OTTHUMG00000097745	ENST00000382333.1:c.-8C>A	4.37:g.15938263G>T			Somatic						NM_005130	NP_005121	WXS	Illumina HiSeq	Unspecified	Q14512	FGFP1_HUMAN			2	111	-								A8K5J2	Translation_Start_Site	SNP	ENST00000382333.1	37	c.-7C>A	CCDS3418.1																																																																																				0.557	FGFBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214974.1	NM_005130		40	63	1	0	4.67007e-22	0.00874	6.35129e-22	40	63				
SLC34A2	10568	broad.mit.edu	37	4	25674865	25674865	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr4:25674865C>A	ENST00000382051.3	+	10	1255	c.1205C>A	c.(1204-1206)aCc>aAc	p.T402N	SLC34A2_ENST00000504570.1_Missense_Mutation_p.T401N|SLC34A2_ENST00000503434.1_Missense_Mutation_p.T401N	NM_001177998.1|NM_006424.2	NP_001171469.1|NP_006415	O95436	NPT2B_HUMAN	solute carrier family 34 (type II sodium/phosphate contransporter), member 2	402					aging (GO:0007568)|cellular phosphate ion homeostasis (GO:0030643)|in utero embryonic development (GO:0001701)|ion transport (GO:0006811)|phosphate ion transmembrane transport (GO:0035435)|phosphate ion transport (GO:0006817)|response to estradiol (GO:0032355)|response to estrogen (GO:0043627)|response to fructose (GO:0009750)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	phosphate ion binding (GO:0042301)|sodium ion binding (GO:0031402)|sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|sodium:phosphate symporter activity (GO:0005436)	p.T402N(1)	SLC34A2/ROS1(14)	breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(9)|lung(18)|ovary(1)|prostate(1)|skin(4)	41		Breast(46;0.0503)				ATCAAGAAGACCATCAACACT	0.537			T	ROS1	NSCLC																																		uc003grr.2		NA		Dom	yes		4	4p15.2	10568		"""solute carrier family 34 (sodium phosphate), member 2"""			E					1	Substitution - Missense(1)		lung(1)	skin(3)|ovary(1)|kidney(1)	5						c.(1204-1206)ACC>AAC		solute carrier family 34 (sodium phosphate),							122.0	100.0	107.0					4																	25674865		2203	4300	6503	SO:0001583	missense	10568				cellular phosphate ion homeostasis	apical plasma membrane|brush border membrane|integral to plasma membrane	phosphate binding|sodium ion binding|sodium-dependent phosphate transmembrane transporter activity|sodium:phosphate symporter activity	g.chr4:25674865C>A	AF111856	CCDS3435.1, CCDS54750.1	4p15.2	2013-07-17	2013-07-17		ENSG00000157765	ENSG00000157765		"""Solute carriers"""	11020	protein-coding gene	gene with protein product		604217	"""solute carrier family 34 (sodium phosphate), member 2"""			10329428, 10610722	Standard	NM_006424		Approved	NAPI-3B	uc003grr.3	O95436	OTTHUMG00000097757	ENST00000382051.3:c.1205C>A	4.37:g.25674865C>A	ENSP00000371483:p.Thr402Asn		Somatic				SLC34A2_uc003grs.2_Missense_Mutation_p.T401N|SLC34A2_uc010iev.2_Missense_Mutation_p.T401N	p.T402N	NM_006424	NP_006415	WXS	Illumina HiSeq	Unspecified	O95436	NPT2B_HUMAN			10	1286	+		Breast(46;0.0503)	402			Cytoplasmic (Potential).		A5PL17|Q8N2K2|Q8WYA9|Q9P0V7	Missense_Mutation	SNP	ENST00000382051.3	37	c.1205C>A	CCDS3435.1	.	.	.	.	.	.	.	.	.	.	C	18.53	3.643283	0.67244	.	.	ENSG00000157765	ENST00000504570;ENST00000382051;ENST00000503434	D;D;D	0.85955	-2.05;-2.05;-2.05	5.2	5.2	0.72013	.	0.125508	0.64402	D	0.000019	D	0.88265	0.6390	L	0.45228	1.405	0.45239	D	0.998246	D;D	0.76494	0.999;0.997	D;D	0.74348	0.983;0.962	D	0.87168	0.2219	10	0.42905	T	0.14	-45.3919	12.455	0.55700	0.0:0.923:0.0:0.077	.	401;402	O95436-2;O95436	.;NPT2B_HUMAN	N	401;402;401	ENSP00000425501:T401N;ENSP00000371483:T402N;ENSP00000423021:T401N	ENSP00000371483:T402N	T	+	2	0	SLC34A2	25283963	1.000000	0.71417	0.977000	0.42913	0.693000	0.40251	4.824000	0.62701	2.596000	0.87737	0.561000	0.74099	ACC		0.537	SLC34A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214990.1	NM_006424		26	51	1	0	1.37878e-21	0.00333	1.85047e-21	26	51				
NDST3	9348	broad.mit.edu	37	4	119059262	119059262	+	Silent	SNP	C	C	T			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr4:119059262C>T	ENST00000296499.5	+	5	1681	c.1278C>T	c.(1276-1278)ggC>ggT	p.G426G	NDST3_ENST00000433996.2_Silent_p.G345G	NM_004784.2	NP_004775.1	O95803	NDST3_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3	426	Heparan sulfate N-deacetylase 3.				heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)	p.G426G(1)		NS(1)|breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(23)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	54						ACCATTCGGGCGTCTACCCTG	0.468																																							uc003ibx.2		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(1)	1						c.(1276-1278)GGC>GGT		N-deacetylase/N-sulfotransferase (heparan							101.0	98.0	99.0					4																	119059262		2203	4300	6503	SO:0001819	synonymous_variant	9348					Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity	g.chr4:119059262C>T	AF074924	CCDS3708.1	4q26	2008-08-04			ENSG00000164100	ENSG00000164100		"""Sulfotransferases, membrane-bound"""	7682	protein-coding gene	gene with protein product		603950				9915799	Standard	NM_004784		Approved	HSST3	uc003ibx.3	O95803	OTTHUMG00000132959	ENST00000296499.5:c.1278C>T	4.37:g.119059262C>T			Somatic				NDST3_uc011cgf.1_Silent_p.G345G	p.G426G	NM_004784	NP_004775	WXS	Illumina HiSeq	Unspecified	O95803	NDST3_HUMAN			5	1681	+			426			Lumenal (Potential).|Heparan sulfate N-deacetylase 3.		B4DI67|Q4W5C1|Q4W5D0|Q6UWC5|Q9UP21	Silent	SNP	ENST00000296499.5	37	c.1278C>T	CCDS3708.1																																																																																				0.468	NDST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256517.4	NM_004784		11	98	0	0	0	0.001855	0	11	98				
DCHS2	54798	broad.mit.edu	37	4	155241865	155241865	+	Silent	SNP	G	G	T			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr4:155241865G>T	ENST00000357232.4	-	14	3320	c.3321C>A	c.(3319-3321)atC>atA	p.I1107I		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	1107	Cadherin 9. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.I1107I(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		ATGAGGGGTGGATGAGAAATG	0.443																																							uc003inw.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|pancreas(1)	4						c.(3319-3321)ATC>ATA		dachsous 2 isoform 1							351.0	377.0	368.0					4																	155241865		2203	4300	6503	SO:0001819	synonymous_variant	54798				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr4:155241865G>T	BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.3321C>A	4.37:g.155241865G>T			Somatic					p.I1107I	NM_017639	NP_060109	WXS	Illumina HiSeq	Unspecified	Q6V1P9	PCD23_HUMAN		LUSC - Lung squamous cell carcinoma(193;0.107)	14	3321	-	all_hematologic(180;0.208)	Renal(120;0.0854)	1107			Cadherin 9.		B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Silent	SNP	ENST00000357232.4	37	c.3321C>A	CCDS3785.1																																																																																				0.443	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365281.2	NM_001142552		12	249	1	0	7.93312e-07	0.00245	8.9412e-07	12	249				
RAPGEF2	9693	broad.mit.edu	37	4	160259617	160259617	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr4:160259617C>G	ENST00000264431.4	+	12	2226	c.1807C>G	c.(1807-1809)Cct>Gct	p.P603A		NM_014247.2	NP_055062.1	Q9Y4G8	RPGF2_HUMAN	Rap guanine nucleotide exchange factor (GEF) 2	603					adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|blood vessel development (GO:0001568)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|cellular response to nerve growth factor stimulus (GO:1990090)|establishment of endothelial barrier (GO:0061028)|forebrain neuron development (GO:0021884)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|MAPK cascade (GO:0000165)|negative regulation of cell proliferation (GO:0008285)|negative regulation of dendrite morphogenesis (GO:0050774)|negative regulation of melanin biosynthetic process (GO:0048022)|nerve growth factor signaling pathway (GO:0038180)|neuron migration (GO:0001764)|neuron projection development (GO:0031175)|neuropeptide signaling pathway (GO:0007218)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron migration (GO:2001224)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein binding (GO:0032092)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of vasculogenesis (GO:2001214)|Rap protein signal transduction (GO:0032486)|regulation of cell junction assembly (GO:1901888)|regulation of synaptic plasticity (GO:0048167)|small GTPase mediated signal transduction (GO:0007264)|ventricular system development (GO:0021591)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synapse (GO:0045202)	beta-1 adrenergic receptor binding (GO:0031697)|calcium ion binding (GO:0005509)|cAMP binding (GO:0030552)|diacylglycerol binding (GO:0019992)|PDZ domain binding (GO:0030165)|Rap GTPase activator activity (GO:0046582)|Rap guanyl-nucleotide exchange factor activity (GO:0017034)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|signal transducer activity (GO:0004871)|WW domain binding (GO:0050699)	p.P591A(1)		breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	70	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.0817)		CAGTGCTACTCCTGGTGAGTA	0.363																																							uc003iqg.3		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)|upper_aerodigestive_tract(1)|skin(1)	4						c.(1807-1809)CCT>GCT		Rap guanine nucleotide exchange factor 2							171.0	151.0	158.0					4																	160259617		1934	4136	6070	SO:0001583	missense	9693				cAMP-mediated signaling|MAPKKK cascade|small GTPase mediated signal transduction	integral to plasma membrane|intracellular	calcium ion binding|diacylglycerol binding|Rap GTPase activator activity|Rap guanyl-nucleotide exchange factor activity|signal transducer activity	g.chr4:160259617C>G	AB002311	CCDS43277.1	4q32.1	2004-03-01	2004-03-01	2004-03-01					16854	protein-coding gene	gene with protein product	"""Rap GEP"""	609530	"""PDZ domain containing guanine nucleotide exchange factor (GEF) 1"""	PDZGEF1		9205841, 10934204	Standard	NM_014247		Approved	PDZ-GEF1, RA-GEF, DKFZP586O1422, KIAA0313	uc003iqg.4	Q9Y4G8		ENST00000264431.4:c.1807C>G	4.37:g.160259617C>G	ENSP00000264431:p.Pro603Ala		Somatic					p.P603A	NM_014247	NP_055062	WXS	Illumina HiSeq	Unspecified	Q9Y4G8	RPGF2_HUMAN		COAD - Colon adenocarcinoma(41;0.0817)	12	2117	+	all_hematologic(180;0.24)		603					D3DP27	Missense_Mutation	SNP	ENST00000264431.4	37	c.1807C>G	CCDS43277.1	.	.	.	.	.	.	.	.	.	.	C	14.12	2.442072	0.43326	.	.	ENSG00000109756	ENST00000264431	T	0.36157	1.27	5.63	5.63	0.86233	Ras guanine nucleotide exchange factor, domain (1);	0.000000	0.85682	D	0.000000	T	0.32041	0.0816	L	0.34521	1.04	0.80722	D	1	B	0.11235	0.004	B	0.06405	0.002	T	0.04090	-1.0978	10	0.27785	T	0.31	.	19.6961	0.96026	0.0:1.0:0.0:0.0	.	603	Q9Y4G8	RPGF2_HUMAN	A	603	ENSP00000264431:P603A	ENSP00000264431:P603A	P	+	1	0	RAPGEF2	160479067	1.000000	0.71417	1.000000	0.80357	0.724000	0.41520	5.632000	0.67819	2.654000	0.90174	0.650000	0.86243	CCT		0.363	RAPGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364980.2	NM_014247		31	148	0	0	0	0.003755	0	31	148				
TLL1	7092	broad.mit.edu	37	4	166996110	166996110	+	Missense_Mutation	SNP	C	C	T	rs376797148		TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr4:166996110C>T	ENST00000061240.2	+	17	2916	c.2269C>T	c.(2269-2271)Cgt>Tgt	p.R757C	TLL1_ENST00000507499.1_Missense_Mutation_p.R780C	NM_012464.4	NP_036596.3	O43897	TLL1_HUMAN	tolloid-like 1	757	EGF-like 2; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.R757C(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(21)|lung(26)|ovary(2)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)		GBM - Glioblastoma multiforme(119;0.103)		GTGTCAATGCCGTAATGGATT	0.408																																							uc003irh.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|ovary(2)|breast(1)|central_nervous_system(1)	7						c.(2269-2271)CGT>TGT		tolloid-like 1 precursor		C	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	284.0	232.0	249.0		2269	4.9	1.0	4		249	0,8600		0,0,4300	no	missense	TLL1	NM_012464.4	180	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	757/1014	166996110	1,13005	2203	4300	6503	SO:0001583	missense	7092				cell differentiation|proteolysis|skeletal system development	extracellular region	calcium ion binding|metalloendopeptidase activity|zinc ion binding	g.chr4:166996110C>T	AF282732	CCDS3811.1, CCDS56342.1	4q32-q33	2008-07-29			ENSG00000038295	ENSG00000038295			11843	protein-coding gene	gene with protein product		606742				10516436	Standard	NM_012464		Approved		uc003irh.2	O43897	OTTHUMG00000161112	ENST00000061240.2:c.2269C>T	4.37:g.166996110C>T	ENSP00000061240:p.Arg757Cys		Somatic				TLL1_uc011cjn.1_Missense_Mutation_p.R780C|TLL1_uc011cjo.1_Missense_Mutation_p.R581C	p.R757C	NM_012464	NP_036596	WXS	Illumina HiSeq	Unspecified	O43897	TLL1_HUMAN		GBM - Glioblastoma multiforme(119;0.103)	17	2916	+	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)	757			EGF-like 2; calcium-binding (Potential).		B2RMU2|Q96AN3|Q9NQS4	Missense_Mutation	SNP	ENST00000061240.2	37	c.2269C>T	CCDS3811.1	.	.	.	.	.	.	.	.	.	.	C	16.88	3.244799	0.59103	2.27E-4	0.0	ENSG00000038295	ENST00000061240;ENST00000507499	D;D	0.96554	-4.05;-4.05	5.72	4.87	0.63330	EGF-like region, conserved site (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	U	0.000000	D	0.98473	0.9491	M	0.91090	3.175	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.995	D	0.99517	1.0957	10	0.72032	D	0.01	.	16.6347	0.85043	0.1307:0.8693:0.0:0.0	.	780;757	E9PD25;O43897	.;TLL1_HUMAN	C	757;780	ENSP00000061240:R757C;ENSP00000426082:R780C	ENSP00000061240:R757C	R	+	1	0	TLL1	167215560	0.998000	0.40836	0.985000	0.45067	0.006000	0.05464	1.959000	0.40412	1.522000	0.49001	0.650000	0.86243	CGT		0.408	TLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363821.1			28	123	0	0	0	0.00632	0	28	123				
MROH2B	133558	broad.mit.edu	37	5	41045927	41045927	+	Missense_Mutation	SNP	C	C	A	rs184956949	byFrequency	TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr5:41045927C>A	ENST00000399564.4	-	18	2207	c.1757G>T	c.(1756-1758)aGt>aTt	p.S586I	MROH2B_ENST00000506092.2_Missense_Mutation_p.S141I	NM_173489.4	NP_775760.3	Q7Z745	MRO2B_HUMAN	maestro heat-like repeat family member 2B	586								p.S586I(1)									GGCCACATCACTGATCTTCCA	0.423																																							uc003jmj.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|central_nervous_system(2)	8						c.(1756-1758)AGT>ATT		HEAT repeat family member 7B2							205.0	198.0	200.0					5																	41045927		1988	4164	6152	SO:0001583	missense	133558						binding	g.chr5:41045927C>A		CCDS47202.1	5p13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000171495	ENSG00000171495		"""maestro heat-like repeat containing"""	26857	protein-coding gene	gene with protein product			"""HEAT repeat family member 7B2"""	HEATR7B2		12477932	Standard	NM_173489		Approved	DKFZp781F0822, FLJ40243	uc003jmj.4	Q7Z745	OTTHUMG00000162151	ENST00000399564.4:c.1757G>T	5.37:g.41045927C>A	ENSP00000382476:p.Ser586Ile		Somatic				HEATR7B2_uc003jmi.3_Missense_Mutation_p.S141I	p.S586I	NM_173489	NP_775760	WXS	Illumina HiSeq	Unspecified	Q7Z745	HTRB2_HUMAN			18	2247	-			586			HEAT 7.		Q68DM1|Q7Z4U4|Q8N7X3	Missense_Mutation	SNP	ENST00000399564.4	37	c.1757G>T	CCDS47202.1	.	.	.	.	.	.	.	.	.	.	C	7.287	0.610275	0.14066	.	.	ENSG00000171495	ENST00000506092;ENST00000296803;ENST00000399564	T;T	0.67345	2.89;-0.26	5.51	-5.54	0.02544	Armadillo-type fold (1);	1.178000	0.06044	N	0.655444	T	0.64114	0.2569	L	0.53249	1.67	0.09310	N	1	P	0.35656	0.514	B	0.41236	0.351	T	0.63603	-0.6600	10	0.51188	T	0.08	.	12.4575	0.55712	0.0:0.3629:0.0:0.6371	.	586	Q7Z745	HTRB2_HUMAN	I	141;291;586	ENSP00000441504:S141I;ENSP00000382476:S586I	ENSP00000296803:S291I	S	-	2	0	HEATR7B2	41081684	0.000000	0.05858	0.005000	0.12908	0.001000	0.01503	-1.863000	0.01651	-0.966000	0.03587	-1.099000	0.02127	AGT		0.423	MROH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367558.2	NM_173489		28	105	1	0	1.06801e-11	0.009535	1.3125e-11	28	105				
MCCC2	64087	broad.mit.edu	37	5	70898367	70898367	+	Missense_Mutation	SNP	G	G	A	rs553444289		TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr5:70898367G>A	ENST00000340941.6	+	5	547	c.418G>A	c.(418-420)Gtc>Atc	p.V140I	MCCC2_ENST00000510895.2_3'UTR|MCCC2_ENST00000509358.2_Missense_Mutation_p.V140I|MCCC2_ENST00000323375.8_Missense_Mutation_p.V140I	NM_022132.4	NP_071415.1	Q9HCC0	MCCB_HUMAN	methylcrotonoyl-CoA carboxylase 2 (beta)	140	Carboxyltransferase.				biotin metabolic process (GO:0006768)|branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|coenzyme A metabolic process (GO:0015936)|leucine catabolic process (GO:0006552)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|methylcrotonoyl-CoA carboxylase activity (GO:0004485)	p.V140I(1)		endometrium(2)|kidney(15)|large_intestine(2)|lung(9)|ovary(1)|urinary_tract(1)	30		Lung NSC(167;0.000697)|Prostate(74;0.0107)|Ovarian(174;0.0175)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;2.04e-54)	Biotin(DB00121)	TGATGCCACCGTCAAAGGAGG	0.413																																							uc003kbs.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(418-420)GTC>ATC		methylcrotonoyl-Coenzyme A carboxylase 2 (beta)	Biotin(DB00121)						99.0	95.0	96.0					5																	70898367		2203	4300	6503	SO:0001583	missense	64087				leucine catabolic process	mitochondrial inner membrane|mitochondrial matrix	ATP binding|methylcrotonoyl-CoA carboxylase activity	g.chr5:70898367G>A	AF310971	CCDS34184.1	5q12-q13	2010-04-30	2010-04-30		ENSG00000131844	ENSG00000131844	6.4.1.4		6937	protein-coding gene	gene with protein product		609014	"""methylcrotonoyl-Coenzyme A carboxylase 2 (beta)"""				Standard	NM_022132		Approved	MCCB	uc003kbs.4	Q9HCC0	OTTHUMG00000162505	ENST00000340941.6:c.418G>A	5.37:g.70898367G>A	ENSP00000343657:p.Val140Ile		Somatic				MCCC2_uc010iyv.1_Missense_Mutation_p.V140I|MCCC2_uc003kbt.3_RNA|MCCC2_uc003kbu.1_Missense_Mutation_p.V9I	p.V140I	NM_022132	NP_071415	WXS	Illumina HiSeq	Unspecified	Q9HCC0	MCCB_HUMAN		OV - Ovarian serous cystadenocarcinoma(47;2.04e-54)	5	556	+		Lung NSC(167;0.000697)|Prostate(74;0.0107)|Ovarian(174;0.0175)|Breast(144;0.198)	140			Carboxyltransferase.		A6NIY9|Q96C27|Q9Y4L7	Missense_Mutation	SNP	ENST00000340941.6	37	c.418G>A	CCDS34184.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.084534	0.76642	.	.	ENSG00000131844	ENST00000340941;ENST00000509358;ENST00000323375	D;D;D	0.98249	-4.82;-4.82;-4.82	5.7	4.8	0.61643	Carboxyl transferase (1);Acetyl-coenzyme A carboxyltransferase, N-terminal (1);	0.055837	0.64402	N	0.000001	D	0.97660	0.9233	M	0.63169	1.94	0.80722	D	1	B;B;B	0.28439	0.212;0.137;0.08	B;B;B	0.41646	0.362;0.275;0.119	D	0.97155	0.9834	10	0.62326	D	0.03	-17.7719	12.805	0.57607	0.0829:0.0:0.9171:0.0	.	140;9;140	D6RDF7;B3KR24;Q9HCC0	.;.;MCCB_HUMAN	I	140	ENSP00000343657:V140I;ENSP00000420994:V140I;ENSP00000327308:V140I	ENSP00000327308:V140I	V	+	1	0	MCCC2	70934123	1.000000	0.71417	0.955000	0.39395	0.965000	0.64279	5.409000	0.66374	1.341000	0.45600	0.655000	0.94253	GTC		0.413	MCCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369243.4			30	123	0	0	0	0.003755	0	30	123				
KIF4B	285643	broad.mit.edu	37	5	154396120	154396120	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr5:154396120A>T	ENST00000435029.4	+	1	2861	c.2701A>T	c.(2701-2703)Atg>Ttg	p.M901L		NM_001099293.1	NP_001092763.1	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	901	Interaction with PRC1. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|plus-end-directed microtubule motor activity (GO:0008574)	p.M901L(2)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(27)|ovary(2)|upper_aerodigestive_tract(1)	58	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			CATGCAGAAGATGCTATTTGA	0.438																																							uc010jih.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(2701-2703)ATG>TTG		kinesin family member 4B							78.0	77.0	78.0					5																	154396120		2203	4300	6503	SO:0001583	missense	285643				axon guidance|blood coagulation|microtubule-based movement	cytosol|microtubule|nuclear matrix	ATP binding|DNA binding|microtubule motor activity	g.chr5:154396120A>T	AF241316	CCDS47324.1	5q33.2	2010-06-22			ENSG00000226650	ENSG00000226650		"""Kinesins"""	6322	protein-coding gene	gene with protein product		609184					Standard	NM_001099293		Approved		uc010jih.1	Q2VIQ3	OTTHUMG00000164143	ENST00000435029.4:c.2701A>T	5.37:g.154396120A>T	ENSP00000387875:p.Met901Leu		Somatic					p.M901L	NM_001099293	NP_001092763	WXS	Illumina HiSeq	Unspecified	Q2VIQ3	KIF4B_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)		1	2861	+	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	901			Interaction with PRC1 (By similarity).|Potential.			Missense_Mutation	SNP	ENST00000435029.4	37	c.2701A>T	CCDS47324.1	.	.	.	.	.	.	.	.	.	.	a	7.647	0.682195	0.14907	.	.	ENSG00000226650	ENST00000435029	T	0.66280	-0.2	1.48	1.48	0.22813	.	.	.	.	.	T	0.48314	0.1493	L	0.45581	1.43	0.35011	D	0.756868	B	0.13594	0.008	B	0.12156	0.007	T	0.47661	-0.9100	9	0.18710	T	0.47	.	6.9973	0.24789	1.0:0.0:0.0:0.0	.	901	Q2VIQ3	KIF4B_HUMAN	L	901	ENSP00000387875:M901L	ENSP00000387875:M901L	M	+	1	0	KIF4B	154376313	1.000000	0.71417	0.997000	0.53966	0.845000	0.48019	1.889000	0.39718	0.930000	0.37217	0.455000	0.32223	ATG		0.438	KIF4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377478.1			21	78	0	0	0	0.00278	0	21	78				
GABRA6	2559	broad.mit.edu	37	5	161128622	161128622	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr5:161128622T>C	ENST00000274545.5	+	9	1638	c.1205T>C	c.(1204-1206)gTc>gCc	p.V402A	GABRA6_ENST00000523217.1_Missense_Mutation_p.V392A			Q16445	GBRA6_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 6	402					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.V402A(1)		breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(9)|liver(2)|lung(22)|ovary(7)|skin(6)|urinary_tract(2)	57	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Acamprosate(DB00659)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)	TCAACACCTGTCACACCCCCA	0.473										TCGA Ovarian(5;0.080)																													uc003lyu.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(7)|skin(3)|large_intestine(1)|central_nervous_system(1)	12						c.(1204-1206)GTC>GCC		gamma-aminobutyric acid A receptor, alpha 6	Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)						110.0	103.0	105.0					5																	161128622		2203	4300	6503	SO:0001583	missense	2559				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity	g.chr5:161128622T>C		CCDS4356.1	5q34	2012-06-22			ENSG00000145863	ENSG00000145863		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4080	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 6"""	137143				8020978	Standard	NM_000811		Approved		uc003lyu.2	Q16445	OTTHUMG00000130351	ENST00000274545.5:c.1205T>C	5.37:g.161128622T>C	ENSP00000274545:p.Val402Ala	TCGA Ovarian(5;0.080)	Somatic				GABRA6_uc003lyv.2_Missense_Mutation_p.V173A	p.V402A	NM_000811	NP_000802	WXS	Illumina HiSeq	Unspecified	Q16445	GBRA6_HUMAN	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		9	1543	+	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	402			Cytoplasmic (Probable).		A8K096|Q4VAV2	Missense_Mutation	SNP	ENST00000274545.5	37	c.1205T>C	CCDS4356.1	.	.	.	.	.	.	.	.	.	.	T	1.033	-0.681305	0.03353	.	.	ENSG00000145863	ENST00000274545;ENST00000523217	D;D	0.83673	-1.75;-1.75	5.16	2.47	0.30058	Neurotransmitter-gated ion-channel transmembrane domain (1);	1.308190	0.04676	N	0.411445	T	0.68192	0.2974	N	0.11064	0.09	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.54173	-0.8333	10	0.17832	T	0.49	.	8.0769	0.30722	0.0:0.3305:0.0:0.6695	.	402	Q16445	GBRA6_HUMAN	A	402;392	ENSP00000274545:V402A;ENSP00000430527:V392A	ENSP00000274545:V402A	V	+	2	0	GABRA6	161061200	0.000000	0.05858	0.945000	0.38365	0.233000	0.25261	-0.625000	0.05534	0.908000	0.36671	-0.290000	0.09829	GTC		0.473	GABRA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252707.2			16	52	0	0	0	0.003954	0	16	52				
GMPR	2766	broad.mit.edu	37	6	16254908	16254908	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr6:16254908A>T	ENST00000259727.4	+	4	521	c.407A>T	c.(406-408)gAa>gTa	p.E136V		NM_006877.3	NP_006868.3	P36959	GMPR1_HUMAN	guanosine monophosphate reductase	136					nucleobase-containing small molecule metabolic process (GO:0055086)|nucleotide metabolic process (GO:0009117)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|response to cold (GO:0009409)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|GMP reductase complex (GO:1902560)	GMP reductase activity (GO:0003920)|metal ion binding (GO:0046872)	p.E136V(1)		NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)	20	Breast(50;0.0427)|Ovarian(93;0.103)	all_hematologic(90;0.0895)				GGGTATTCAGAACATTTTGTG	0.443																																							uc003nbs.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(406-408)GAA>GTA		guanosine monophosphate reductase							198.0	185.0	189.0					6																	16254908		2203	4300	6503	SO:0001583	missense	2766				nucleotide metabolic process|purine base metabolic process|purine-containing compound salvage|response to cold	cytosol	GMP reductase activity|metal ion binding	g.chr6:16254908A>T		CCDS4537.1	6p23	2009-07-10			ENSG00000137198	ENSG00000137198	1.7.1.7		4376	protein-coding gene	gene with protein product		139265				2194676	Standard	NM_006877		Approved		uc003nbs.3	P36959	OTTHUMG00000014302	ENST00000259727.4:c.407A>T	6.37:g.16254908A>T	ENSP00000259727:p.Glu136Val		Somatic					p.E136V	NM_006877	NP_006868	WXS	Illumina HiSeq	Unspecified	P36959	GMPR1_HUMAN			4	521	+	Breast(50;0.0427)|Ovarian(93;0.103)	all_hematologic(90;0.0895)	136					Q96HQ6	Missense_Mutation	SNP	ENST00000259727.4	37	c.407A>T	CCDS4537.1	.	.	.	.	.	.	.	.	.	.	A	26.9	4.780420	0.90195	.	.	ENSG00000137198	ENST00000259727	T	0.79454	-1.27	5.65	5.65	0.86999	Aldolase-type TIM barrel (1);IMP dehydrogenase/GMP reductase (1);	0.000000	0.85682	D	0.000000	D	0.84669	0.5523	M	0.79258	2.445	0.80722	D	1	D	0.60575	0.988	D	0.63877	0.919	D	0.86872	0.2036	10	0.66056	D	0.02	1.4947	15.8909	0.79296	1.0:0.0:0.0:0.0	.	136	P36959	GMPR1_HUMAN	V	136	ENSP00000259727:E136V	ENSP00000259727:E136V	E	+	2	0	GMPR	16362887	1.000000	0.71417	0.742000	0.31022	0.971000	0.66376	8.940000	0.92958	2.146000	0.66826	0.533000	0.62120	GAA		0.443	GMPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039942.2			52	195	0	0	0	0.00361	0	52	195				
TTBK1	84630	broad.mit.edu	37	6	43250827	43250827	+	Silent	SNP	G	G	T			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr6:43250827G>T	ENST00000259750.4	+	14	2432	c.2349G>T	c.(2347-2349)ggG>ggT	p.G783G		NM_032538.1	NP_115927.1	Q5TCY1	TTBK1_HUMAN	tau tubulin kinase 1	783					substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.G783G(1)		breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(10)|liver(1)|lung(21)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	53			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0125)|OV - Ovarian serous cystadenocarcinoma(102;0.0399)			AGGTGCTGGGGCCTCGTAGTG	0.627																																							uc003ouq.1		NA																	1	Substitution - coding silent(1)		lung(1)	lung(4)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	9						c.(2347-2349)GGG>GGT		tau tubulin kinase 1							11.0	10.0	11.0					6																	43250827		2192	4289	6481	SO:0001819	synonymous_variant	84630					cell junction|cytoplasm|nucleus	ATP binding|protein binding|protein serine/threonine kinase activity	g.chr6:43250827G>T	AB058758	CCDS34455.1	6p21.1	2008-02-05			ENSG00000146216	ENSG00000146216			19140	protein-coding gene	gene with protein product						11347906	Standard	XM_006715229		Approved	KIAA1855	uc003ouq.1	Q5TCY1	OTTHUMG00000014725	ENST00000259750.4:c.2349G>T	6.37:g.43250827G>T			Somatic					p.G783G	NM_032538	NP_115927	WXS	Illumina HiSeq	Unspecified	Q5TCY1	TTBK1_HUMAN	Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0125)|OV - Ovarian serous cystadenocarcinoma(102;0.0399)		14	2628	+			783					A2A2U5|Q2L6C6|Q6ZNH0|Q8N444|Q96JH2	Silent	SNP	ENST00000259750.4	37	c.2349G>T	CCDS34455.1																																																																																				0.627	TTBK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040584.3			3	5	1	0	0.004672	0.004672	0.00483801	3	5				
GCLC	2729	broad.mit.edu	37	6	53380938	53380938	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr6:53380938C>A	ENST00000229416.6	-	4	1012	c.529G>T	c.(529-531)Gat>Tat	p.D177Y	GCLC_ENST00000514004.1_Missense_Mutation_p.D177Y	NM_001197115.1|NM_001498.3	NP_001184044.1|NP_001489.1	P48506	GSH1_HUMAN	glutamate-cysteine ligase, catalytic subunit	177					apoptotic mitochondrial changes (GO:0008637)|cell redox homeostasis (GO:0045454)|cellular nitrogen compound metabolic process (GO:0034641)|cysteine metabolic process (GO:0006534)|glutamate metabolic process (GO:0006536)|glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|L-ascorbic acid metabolic process (GO:0019852)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|regulation of blood vessel size (GO:0050880)|regulation of mitochondrial depolarization (GO:0051900)|response to arsenic-containing substance (GO:0046685)|response to heat (GO:0009408)|response to hormone (GO:0009725)|response to nitrosative stress (GO:0051409)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|glutamate-cysteine ligase complex (GO:0017109)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|coenzyme binding (GO:0050662)|glutamate binding (GO:0016595)|glutamate-cysteine ligase activity (GO:0004357)|magnesium ion binding (GO:0000287)	p.D177Y(1)		breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	22	Lung NSC(77;0.0137)				L-Cysteine(DB00151)|Vitamin E(DB00163)	ATTGCTTCATCTGGAAAGAAG	0.473																																							uc003pbw.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(529-531)GAT>TAT		glutamate-cysteine ligase, catalytic subunit	L-Cysteine(DB00151)|L-Glutamic Acid(DB00142)						141.0	134.0	136.0					6																	53380938		2203	4300	6503	SO:0001583	missense	2729				anti-apoptosis|cell redox homeostasis|cysteine metabolic process|glutamate metabolic process|glutathione biosynthetic process|negative regulation of transcription, DNA-dependent|regulation of blood vessel size|response to heat|response to hormone stimulus|response to oxidative stress|xenobiotic metabolic process	cytosol	ADP binding|ATP binding|coenzyme binding|glutamate binding|glutamate-cysteine ligase activity|magnesium ion binding	g.chr6:53380938C>A	M90656	CCDS4952.1, CCDS75471.1	6p12	2008-02-05				ENSG00000001084	6.3.2.2		4311	protein-coding gene	gene with protein product		606857		GLCLC, GLCL		1350904	Standard	NM_001498		Approved	GCS	uc003pbw.2	P48506		ENST00000229416.6:c.529G>T	6.37:g.53380938C>A	ENSP00000229416:p.Asp177Tyr		Somatic				GCLC_uc003pbx.2_Missense_Mutation_p.D177Y	p.D177Y	NM_001498	NP_001489	WXS	Illumina HiSeq	Unspecified	P48506	GSH1_HUMAN			4	917	-	Lung NSC(77;0.0137)		177					Q14399	Missense_Mutation	SNP	ENST00000229416.6	37	c.529G>T	CCDS4952.1	.	.	.	.	.	.	.	.	.	.	C	32	5.167132	0.94768	.	.	ENSG00000001084	ENST00000229416;ENST00000514004;ENST00000514933	T;T;T	0.61158	0.13;0.13;0.13	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.81959	0.4933	H	0.94964	3.605	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.86242	0.1644	10	0.87932	D	0	.	19.7963	0.96484	0.0:1.0:0.0:0.0	.	177	P48506	GSH1_HUMAN	Y	177;177;124	ENSP00000229416:D177Y;ENSP00000421908:D177Y;ENSP00000423615:D124Y	ENSP00000229416:D177Y	D	-	1	0	GCLC	53488897	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.776000	0.85560	2.756000	0.94617	0.561000	0.74099	GAT		0.473	GCLC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359710.2			26	66	1	0	6.32553e-13	0.004656	7.96548e-13	26	66				
FAM83B	222584	broad.mit.edu	37	6	54735197	54735197	+	Silent	SNP	A	A	T			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr6:54735197A>T	ENST00000306858.7	+	2	269	c.153A>T	c.(151-153)cgA>cgT	p.R51R		NM_001010872.1	NP_001010872.1	Q5T0W9	FA83B_HUMAN	family with sequence similarity 83, member B	51								p.R51R(1)		autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(28)|ovary(6)|prostate(6)|skin(6)|upper_aerodigestive_tract(1)	71	Lung NSC(77;0.0178)|Renal(3;0.122)					TCCAGGAACGAGTTTCAGACT	0.388																																							uc003pck.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(6)	6						c.(151-153)CGA>CGT		hypothetical protein LOC222584							107.0	109.0	108.0					6																	54735197		2203	4300	6503	SO:0001819	synonymous_variant	222584							g.chr6:54735197A>T	AK055204	CCDS34479.1	6p12.1	2014-03-13	2006-03-23	2006-03-23	ENSG00000168143	ENSG00000168143			21357	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 143"""	C6orf143		22886302	Standard	NM_001010872		Approved	FLJ30642	uc003pck.4	Q5T0W9	OTTHUMG00000014899	ENST00000306858.7:c.153A>T	6.37:g.54735197A>T			Somatic					p.R51R	NM_001010872	NP_001010872	WXS	Illumina HiSeq	Unspecified	Q5T0W9	FA83B_HUMAN			2	269	+	Lung NSC(77;0.0178)|Renal(3;0.122)		51					Q2M1P3|Q96DQ2	Silent	SNP	ENST00000306858.7	37	c.153A>T	CCDS34479.1																																																																																				0.388	FAM83B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040994.1	XM_294139		25	99	0	0	0	0.004656	0	25	99				
HTR1E	3354	broad.mit.edu	37	6	87726137	87726137	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr6:87726137G>A	ENST00000305344.5	+	2	1788	c.1085G>A	c.(1084-1086)cGa>cAa	p.R362Q		NM_000865.2	NP_000856.1	P28566	5HT1E_HUMAN	5-hydroxytryptamine (serotonin) receptor 1E, G protein-coupled	362					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cAMP metabolic process (GO:0030815)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)	p.R362Q(1)		breast(3)|endometrium(2)|kidney(3)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(3)	41		all_cancers(76;7.11e-06)|Acute lymphoblastic leukemia(125;1.2e-09)|Prostate(29;3.51e-09)|all_hematologic(105;7.43e-06)|all_epithelial(107;0.00819)		BRCA - Breast invasive adenocarcinoma(108;0.055)	Aripiprazole(DB01238)|Clozapine(DB00363)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ketamine(DB01221)|Loxapine(DB00408)|Methysergide(DB00247)|Olanzapine(DB00334)|Quetiapine(DB01224)|Ziprasidone(DB00246)	ATTAGATGCCGAGAGCATACT	0.413																																							uc003pli.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(1084-1086)CGA>CAA		5-hydroxytryptamine (serotonin) receptor 1E	Eletriptan(DB00216)						47.0	50.0	49.0					6																	87726137		2166	4289	6455	SO:0001583	missense	3354				G-protein signaling, coupled to cyclic nucleotide second messenger|synaptic transmission	integral to plasma membrane	protein binding|serotonin binding|serotonin receptor activity	g.chr6:87726137G>A		CCDS5006.1	6q14-q15	2013-06-19	2012-02-03		ENSG00000168830	ENSG00000168830		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5291	protein-coding gene	gene with protein product		182132	"""5-hydroxytryptamine (serotonin) receptor 1E"""			1608964	Standard	NM_000865		Approved	5-HT1E	uc003pli.3	P28566	OTTHUMG00000015154	ENST00000305344.5:c.1085G>A	6.37:g.87726137G>A	ENSP00000307766:p.Arg362Gln		Somatic					p.R362Q	NM_000865	NP_000856	WXS	Illumina HiSeq	Unspecified	P28566	5HT1E_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.055)	2	1788	+		all_cancers(76;7.11e-06)|Acute lymphoblastic leukemia(125;1.2e-09)|Prostate(29;3.51e-09)|all_hematologic(105;7.43e-06)|all_epithelial(107;0.00819)	362			Cytoplasmic (By similarity).		E1P503|Q9P1Y1	Missense_Mutation	SNP	ENST00000305344.5	37	c.1085G>A	CCDS5006.1	.	.	.	.	.	.	.	.	.	.	G	12.55	1.972341	0.34754	.	.	ENSG00000168830	ENST00000305344;ENST00000369584	T;T	0.38560	1.13;1.13	4.74	4.74	0.60224	.	0.097389	0.38720	U	0.001593	T	0.14013	0.0339	L	0.39898	1.24	0.26007	N	0.982037	P	0.35411	0.5	B	0.26310	0.068	T	0.04991	-1.0913	10	0.25106	T	0.35	.	11.2699	0.49133	0.0847:0.0:0.9153:0.0	.	362	P28566	5HT1E_HUMAN	Q	362	ENSP00000307766:R362Q;ENSP00000358597:R362Q	ENSP00000307766:R362Q	R	+	2	0	HTR1E	87782856	1.000000	0.71417	1.000000	0.80357	0.761000	0.43186	4.329000	0.59260	2.190000	0.69967	0.514000	0.50259	CGA		0.413	HTR1E-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000472488.2	NM_000865		28	101	0	0	0	0.007291	0	28	101				
GABRR1	2569	broad.mit.edu	37	6	89907932	89907932	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr6:89907932A>G	ENST00000454853.2	-	5	489	c.379T>C	c.(379-381)Tac>Cac	p.Y127H	GABRR1_ENST00000369451.3_Missense_Mutation_p.Y40H|GABRR1_ENST00000435811.1_Missense_Mutation_p.Y110H	NM_001256704.1|NM_002042.4	NP_001243633.1|NP_002033.2	P24046	GBRR1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, rho 1	127					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.Y121H(1)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(7)|lung(16)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	35		all_cancers(76;9.49e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.46e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;0.000114)		BRCA - Breast invasive adenocarcinoma(108;0.00917)	Adinazolam(DB00546)|Bromazepam(DB01558)|Cinolazepam(DB01594)|Clotiazepam(DB01559)|Diazepam(DB00829)|Estazolam(DB01215)|Fludiazepam(DB01567)|Flurazepam(DB00690)|Halazepam(DB00801)|Midazolam(DB00683)|Nitrazepam(DB01595)|Oxazepam(DB00842)|Prazepam(DB01588)|Quazepam(DB01589)|Temazepam(DB00231)|Triazolam(DB00897)	TCCTTCCAGTAGTGCCTCAGG	0.537																																							uc003pna.2		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)	1						c.(379-381)TAC>CAC		gamma-aminobutyric acid (GABA) receptor, rho 1	Picrotoxin(DB00466)						238.0	223.0	228.0					6																	89907932		2203	4300	6503	SO:0001583	missense	2569				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity	g.chr6:89907932A>G		CCDS5019.2, CCDS59028.1, CCDS59029.1	6q15	2012-06-22	2012-02-03		ENSG00000146276	ENSG00000146276		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4090	protein-coding gene	gene with protein product	"""GABA(A) receptor, rho 1"""	137161	"""gamma-aminobutyric acid (GABA) receptor, rho 1"""			1849271, 1315307	Standard	NM_002042		Approved		uc003pna.2	P24046	OTTHUMG00000015195	ENST00000454853.2:c.379T>C	6.37:g.89907932A>G	ENSP00000412673:p.Tyr127His		Somatic				GABRR1_uc011dzv.1_Missense_Mutation_p.Y104H	p.Y127H	NM_002042	NP_002033	WXS	Illumina HiSeq	Unspecified	P24046	GBRR1_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.00917)	5	834	-		all_cancers(76;9.49e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.46e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;0.000114)	127			Extracellular (Probable).		A1L401|B4DJK8|B4DQT5|B7ZBQ7|Q9BX06	Missense_Mutation	SNP	ENST00000454853.2	37	c.379T>C	CCDS5019.2	.	.	.	.	.	.	.	.	.	.	A	17.72	3.460291	0.63401	.	.	ENSG00000146276	ENST00000454853;ENST00000435811;ENST00000369451;ENST00000436331	T;T;T	0.78364	-1.17;-1.17;-1.17	5.93	5.93	0.95920	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	D	0.83339	0.5233	L	0.61387	1.9	0.54753	D	0.999981	B;D	0.71674	0.069;0.998	B;D	0.77004	0.107;0.989	T	0.83273	-0.0042	9	.	.	.	-29.9283	16.3829	0.83481	1.0:0.0:0.0:0.0	.	110;127	P24046-2;P24046	.;GBRR1_HUMAN	H	127;110;40;40	ENSP00000412673:Y127H;ENSP00000394687:Y110H;ENSP00000358463:Y40H	.	Y	-	1	0	GABRR1	89964651	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	7.457000	0.80775	2.271000	0.75665	0.459000	0.35465	TAC		0.537	GABRR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041479.2			94	324	0	0	0	0.00361	0	94	324				
DSE	29940	broad.mit.edu	37	6	116757636	116757636	+	Missense_Mutation	SNP	A	A	G	rs145999978		TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr6:116757636A>G	ENST00000331677.3	+	7	2449	c.2005A>G	c.(2005-2007)Ata>Gta	p.I669V	DSE_ENST00000452085.3_Missense_Mutation_p.I669V|DSE_ENST00000537543.1_Missense_Mutation_p.I688V|DSE_ENST00000359564.2_Missense_Mutation_p.I669V			Q9UL01	DSE_HUMAN	dermatan sulfate epimerase	669					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	chondroitin-glucuronate 5-epimerase activity (GO:0047757)	p.I669V(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(2)|lung(12)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35		all_cancers(87;0.00019)|all_epithelial(87;0.000416)|Ovarian(999;0.133)|Colorectal(196;0.234)		Epithelial(106;0.00915)|OV - Ovarian serous cystadenocarcinoma(136;0.0149)|GBM - Glioblastoma multiforme(226;0.0189)|all cancers(137;0.0262)		AGGGCCATCTATAGATGTTCA	0.517																																							uc003pws.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(2005-2007)ATA>GTA		dermatan sulfate epimerase precursor		A	VAL/ILE,VAL/ILE	0,4406		0,0,2203	99.0	93.0	95.0		2005,2005	2.0	0.0	6	dbSNP_134	95	2,8598	2.2+/-6.3	0,2,4298	no	missense,missense	DSE	NM_001080976.1,NM_013352.2	29,29	0,2,6501	GG,GA,AA		0.0233,0.0,0.0154	benign,benign	669/959,669/959	116757636	2,13004	2203	4300	6503	SO:0001583	missense	29940				dermatan sulfate biosynthetic process	endoplasmic reticulum|Golgi apparatus|integral to membrane	chondroitin-glucuronate 5-epimerase activity	g.chr6:116757636A>G	AF098066	CCDS5107.1	6q22	2008-02-05	2007-01-29	2007-01-29	ENSG00000111817	ENSG00000111817	5.1.3.19		21144	protein-coding gene	gene with protein product		605942	"""squamous cell carcinoma antigen recognized by T cells 2"""	SART2		11920522, 16505484	Standard	NM_001080976		Approved	DSEPI	uc003pws.3	Q9UL01	OTTHUMG00000015434	ENST00000331677.3:c.2005A>G	6.37:g.116757636A>G	ENSP00000332151:p.Ile669Val		Somatic				DSE_uc011ebg.1_Missense_Mutation_p.I688V|DSE_uc003pwt.2_Missense_Mutation_p.I669V|DSE_uc003pwu.2_Missense_Mutation_p.I336V	p.I669V	NM_001080976	NP_001074445	WXS	Illumina HiSeq	Unspecified	Q9UL01	DSE_HUMAN		Epithelial(106;0.00915)|OV - Ovarian serous cystadenocarcinoma(136;0.0149)|GBM - Glioblastoma multiforme(226;0.0189)|all cancers(137;0.0262)	6	2199	+		all_cancers(87;0.00019)|all_epithelial(87;0.000416)|Ovarian(999;0.133)|Colorectal(196;0.234)	669					Q5R3K6	Missense_Mutation	SNP	ENST00000331677.3	37	c.2005A>G	CCDS5107.1	.	.	.	.	.	.	.	.	.	.	A	0.001	-3.012810	0.00042	0.0	2.33E-4	ENSG00000111817	ENST00000452085;ENST00000537543;ENST00000331677;ENST00000359564	T;T;T;T	0.62941	-0.01;-0.01;-0.01;-0.01	6.01	1.98	0.26296	.	0.433172	0.26903	N	0.021910	T	0.06735	0.0172	N	0.00841	-1.15	0.09310	N	0.999999	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.43956	-0.9359	10	0.02654	T	1	-5.3242	6.4011	0.21638	0.2757:0.0:0.6085:0.1158	.	688;669	B7Z765;Q9UL01	.;DSE_HUMAN	V	669;688;669;669	ENSP00000404049:I669V;ENSP00000441152:I688V;ENSP00000332151:I669V;ENSP00000352567:I669V	ENSP00000332151:I669V	I	+	1	0	DSE	116864329	0.784000	0.28713	0.017000	0.16124	0.155000	0.21991	0.719000	0.25881	0.062000	0.16340	-0.248000	0.11899	ATA		0.517	DSE-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041940.2	NM_013352		20	76	0	0	0	0.012319	0	20	76				
SLC35F1	222553	broad.mit.edu	37	6	118556737	118556737	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr6:118556737G>A	ENST00000360388.4	+	3	616	c.415G>A	c.(415-417)Gac>Aac	p.D139N		NM_001029858.3	NP_001025029.2	Q5T1Q4	S35F1_HUMAN	solute carrier family 35, member F1	139					transport (GO:0006810)	integral component of membrane (GO:0016021)		p.D139N(1)		breast(3)|kidney(1)|large_intestine(7)|lung(21)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	36				GBM - Glioblastoma multiforme(226;0.217)		GGGACTCATAGACCTGGAAGC	0.423																																							uc003pxx.3		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(415-417)GAC>AAC		solute carrier family 35, member F1							160.0	144.0	149.0					6																	118556737		2203	4300	6503	SO:0001583	missense	222553				transport	integral to membrane		g.chr6:118556737G>A	BC028615	CCDS34524.1	6q22.31	2013-05-22			ENSG00000196376	ENSG00000196376		"""Solute carriers"""	21483	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 169"""	C6orf169			Standard	NM_001029858		Approved	dJ230I3.1	uc003pxx.4	Q5T1Q4	OTTHUMG00000015460	ENST00000360388.4:c.415G>A	6.37:g.118556737G>A	ENSP00000353557:p.Asp139Asn		Somatic					p.D139N	NM_001029858	NP_001025029	WXS	Illumina HiSeq	Unspecified	Q5T1Q4	S35F1_HUMAN		GBM - Glioblastoma multiforme(226;0.217)	3	616	+			139			Helical; (Potential).		E1P564|Q1RMG1|Q4G0U9|Q4G167|Q6N007	Missense_Mutation	SNP	ENST00000360388.4	37	c.415G>A	CCDS34524.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.328185	0.81690	.	.	ENSG00000196376	ENST00000360388	T	0.68624	-0.34	5.76	5.76	0.90799	.	0.228598	0.42682	D	0.000678	D	0.83562	0.5281	M	0.88842	2.985	0.80722	D	1	D	0.60160	0.987	D	0.70487	0.969	D	0.84811	0.0790	10	0.66056	D	0.02	.	20.326	0.98701	0.0:0.0:1.0:0.0	.	139	Q5T1Q4	S35F1_HUMAN	N	139	ENSP00000353557:D139N	ENSP00000353557:D139N	D	+	1	0	SLC35F1	118663430	1.000000	0.71417	1.000000	0.80357	0.042000	0.13812	9.283000	0.95860	2.885000	0.99019	0.643000	0.83706	GAC		0.423	SLC35F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041991.2	XM_167044		21	75	0	0	0	0.002299	0	21	75				
ENPP3	5169	broad.mit.edu	37	6	132006597	132006597	+	Missense_Mutation	SNP	G	G	T	rs377322848		TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr6:132006597G>T	ENST00000414305.1	+	14	1542	c.1214G>T	c.(1213-1215)cGc>cTc	p.R405L	ENPP3_ENST00000358229.5_Missense_Mutation_p.R405L|ENPP3_ENST00000357639.3_Missense_Mutation_p.R405L			O14638	ENPP3_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 3	405	Phosphodiesterase.				immune response (GO:0006955)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleoside triphosphate catabolic process (GO:0009143)|phosphate-containing compound metabolic process (GO:0006796)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)	metal ion binding (GO:0046872)|NADH pyrophosphatase activity (GO:0035529)|nucleic acid binding (GO:0003676)|nucleoside-triphosphate diphosphatase activity (GO:0047429)|nucleotide diphosphatase activity (GO:0004551)|phosphodiesterase I activity (GO:0004528)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)	p.R405L(1)		NS(1)|breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(24)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	53	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0252)|OV - Ovarian serous cystadenocarcinoma(155;0.0511)		CCTGCCCCCCGCATCCGAGCT	0.378																																							uc003qcu.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(1)	4						c.(1213-1215)CGC>CTC		ectonucleotide pyrophosphatase/phosphodiesterase							131.0	149.0	143.0					6																	132006597		2203	4300	6503	SO:0001583	missense	5169				immune response|nucleoside triphosphate catabolic process|phosphate metabolic process	extracellular region|integral to plasma membrane|perinuclear region of cytoplasm	metal ion binding|nucleic acid binding|nucleoside-triphosphate diphosphatase activity|nucleotide diphosphatase activity|phosphodiesterase I activity|polysaccharide binding|scavenger receptor activity	g.chr6:132006597G>T	AF005632	CCDS5148.1	6q22	2010-06-23			ENSG00000154269	ENSG00000154269	3.1.4.1, 3.6.1.9	"""CD molecules"""	3358	protein-coding gene	gene with protein product		602182		PDNP3		9344668	Standard	NM_005021		Approved	PD-IBETA, gp130RB13-6, B10, CD203c	uc003qcv.3	O14638	OTTHUMG00000016292	ENST00000414305.1:c.1214G>T	6.37:g.132006597G>T	ENSP00000406261:p.Arg405Leu		Somatic				ENPP3_uc010kfq.2_RNA|ENPP3_uc003qcv.2_Missense_Mutation_p.R405L	p.R405L	NM_005021	NP_005012	WXS	Illumina HiSeq	Unspecified	O14638	ENPP3_HUMAN		GBM - Glioblastoma multiforme(226;0.0252)|OV - Ovarian serous cystadenocarcinoma(155;0.0511)	14	1561	+	Breast(56;0.0753)		405			Extracellular (Potential).|Phosphodiesterase.		Q5JTL3	Missense_Mutation	SNP	ENST00000414305.1	37	c.1214G>T	CCDS5148.1	.	.	.	.	.	.	.	.	.	.	G	19.87	3.906959	0.72868	.	.	ENSG00000154269	ENST00000414305;ENST00000357639;ENST00000358229	T;T;T	0.72725	-0.68;-0.68;-0.68	5.69	4.82	0.62117	Alkaline-phosphatase-like, core domain (1);	0.000000	0.85682	D	0.000000	T	0.76183	0.3952	L	0.60067	1.865	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.80324	-0.1430	10	0.87932	D	0	-9.6216	13.7942	0.63160	0.0751:0.0:0.9249:0.0	.	405	O14638	ENPP3_HUMAN	L	405	ENSP00000406261:R405L;ENSP00000350265:R405L;ENSP00000350964:R405L	ENSP00000350265:R405L	R	+	2	0	ENPP3	132048290	1.000000	0.71417	0.952000	0.39060	0.633000	0.38033	7.500000	0.81588	1.422000	0.47177	0.591000	0.81541	CGC		0.378	ENPP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043627.2			51	181	1	0	4.6707e-30	0.00361	6.6631e-30	51	181				
TNFAIP3	7128	broad.mit.edu	37	6	138199659	138199659	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr6:138199659C>A	ENST00000237289.4	+	7	1143	c.1077C>A	c.(1075-1077)aaC>aaA	p.N359K	TNFAIP3_ENST00000485192.1_3'UTR	NM_001270507.1|NM_001270508.1|NM_006290.3	NP_001257436.1|NP_001257437.1|NP_006281.1	P21580	TNAP3_HUMAN	tumor necrosis factor, alpha-induced protein 3	359					apoptotic process (GO:0006915)|B-1 B cell homeostasis (GO:0001922)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to lipopolysaccharide (GO:0071222)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of B cell activation (GO:0050869)|negative regulation of bone resorption (GO:0045779)|negative regulation of CD40 signaling pathway (GO:2000349)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of osteoclast proliferation (GO:0090291)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of toll-like receptor 2 signaling pathway (GO:0034136)|negative regulation of toll-like receptor 3 signaling pathway (GO:0034140)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of type I interferon production (GO:0032480)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of protein catabolic process (GO:0045732)|protein deubiquitination (GO:0016579)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked deubiquitination (GO:0070536)|protein oligomerization (GO:0051259)|regulation of defense response to virus by host (GO:0050691)|regulation of germinal center formation (GO:0002634)|regulation of vascular wound healing (GO:0061043)|response to molecule of bacterial origin (GO:0002237)|tolerance induction to lipopolysaccharide (GO:0072573)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|protease binding (GO:0002020)|protein self-association (GO:0043621)|ubiquitin binding (GO:0043130)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.0?(25)		breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(196)|kidney(1)|large_intestine(4)|lung(13)|ovary(4)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	225	Breast(32;0.135)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000849)|OV - Ovarian serous cystadenocarcinoma(155;0.00468)		GGCAGGAAAACAGCGAGCAGG	0.478			"""D, N, F"""		"""marginal zone B-cell lymphomas, Hodgkin's lymphoma, primary mediastinal B cell lymphoma"""																																GBM(130;153 1739 22295 28918 47987)	GBM(130;153 1739 22295 28918 47987)	uc003qhr.2		NA		Rec	yes		6	6q23	7128	D|N|F	"""tumor necrosis factor, alpha-induced protein 3"""			L			marginal zone B-cell lymphomas|Hodgkin's lymphoma|primary mediastinal B cell lymphoma		25	Whole gene deletion(25)	p.0?(22)	haematopoietic_and_lymphoid_tissue(25)	haematopoietic_and_lymphoid_tissue(133)|lung(3)|ovary(1)	137						c.(1075-1077)AAC>AAA		tumor necrosis factor, alpha-induced protein 3							72.0	69.0	70.0					6																	138199659		2203	4300	6503	SO:0001583	missense	7128				anti-apoptosis|apoptosis|B-1 B cell homeostasis|negative regulation of B cell activation|negative regulation of bone resorption|negative regulation of CD40 signaling pathway|negative regulation of endothelial cell apoptosis|negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of inflammatory response|negative regulation of interleukin-2 production|negative regulation of interleukin-6 production|negative regulation of NF-kappaB transcription factor activity|negative regulation of osteoclast proliferation|negative regulation of protein ubiquitination|negative regulation of smooth muscle cell proliferation|negative regulation of toll-like receptor 2 signaling pathway|negative regulation of toll-like receptor 3 signaling pathway|negative regulation of tumor necrosis factor production|negative regulation of type I interferon production|positive regulation of protein catabolic process|protein K48-linked ubiquitination|protein K63-linked deubiquitination|protein oligomerization|regulation of defense response to virus by host|regulation of germinal center formation|regulation of vascular wound healing|tolerance induction to lipopolysaccharide	centrosome|cytosol|nucleus	caspase inhibitor activity|DNA binding|protease binding|protein self-association|ubiquitin binding|ubiquitin thiolesterase activity|ubiquitin-protein ligase activity|ubiquitin-specific protease activity|zinc ion binding	g.chr6:138199659C>A	M59465	CCDS5187.1	6q23-q25	2013-01-21			ENSG00000118503	ENSG00000118503		"""OTU domain containing"""	11896	protein-coding gene	gene with protein product		191163				2118515	Standard	NM_006290		Approved	A20, OTUD7C	uc031spw.1	P21580	OTTHUMG00000015664	ENST00000237289.4:c.1077C>A	6.37:g.138199659C>A	ENSP00000237289:p.Asn359Lys		Somatic				TNFAIP3_uc003qhs.2_Missense_Mutation_p.N359K	p.N359K	NM_006290	NP_006281	WXS	Illumina HiSeq	Unspecified	P21580	TNAP3_HUMAN		GBM - Glioblastoma multiforme(68;0.000849)|OV - Ovarian serous cystadenocarcinoma(155;0.00468)	7	1143	+	Breast(32;0.135)|Colorectal(23;0.24)		359					B2R767|E1P588|Q2HIX9|Q5VXQ7|Q9NSR6	Missense_Mutation	SNP	ENST00000237289.4	37	c.1077C>A	CCDS5187.1	.	.	.	.	.	.	.	.	.	.	C	15.12	2.740144	0.49045	.	.	ENSG00000118503	ENST00000237289;ENST00000535574;ENST00000544646	T	0.23147	1.92	5.63	4.77	0.60923	.	0.144288	0.64402	D	0.000007	T	0.04952	0.0133	N	0.19112	0.55	0.44207	D	0.997031	B	0.30193	0.272	B	0.15484	0.013	T	0.16512	-1.0400	10	0.10377	T	0.69	-19.373	11.0037	0.47622	0.0:0.8517:0.0:0.1483	.	359	P21580	TNAP3_HUMAN	K	359	ENSP00000237289:N359K	ENSP00000237289:N359K	N	+	3	2	TNFAIP3	138241352	0.986000	0.35501	0.853000	0.33588	0.961000	0.63080	1.660000	0.37397	1.378000	0.46305	0.655000	0.94253	AAC		0.478	TNFAIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042414.1			6	97	1	0	0.00448238	0.004482	0.00466534	6	97				
GET4	51608	broad.mit.edu	37	7	931971	931971	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr7:931971A>T	ENST00000265857.3	+	6	756	c.662A>T	c.(661-663)cAg>cTg	p.Q221L	GET4_ENST00000407192.1_Missense_Mutation_p.Q168L	NM_015949.2	NP_057033.2	Q7L5D6	GET4_HUMAN	golgi to ER traffic protein 4 homolog (S. cerevisiae)	221					tail-anchored membrane protein insertion into ER membrane (GO:0071816)|transport (GO:0006810)	BAT3 complex (GO:0071818)|cytosol (GO:0005829)		p.Q221L(1)		breast(1)|large_intestine(1)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						ACGTACACCCAGAAGCACCCG	0.552																																							uc003sjl.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(661-663)CAG>CTG		hypothetical protein LOC51608							88.0	94.0	92.0					7																	931971		2203	4300	6503	SO:0001583	missense	51608				tail-anchored membrane protein insertion into ER membrane|transport	BAT3 complex	protein binding	g.chr7:931971A>T	AK023560	CCDS5317.1	7p22.3	2010-08-05	2010-03-24	2010-03-24	ENSG00000239857	ENSG00000239857			21690	protein-coding gene	gene with protein product	"""CGI-20 protein"", ""conserved edge protein"", ""transmembrane domain recognition complex, 35kDa"""	612056	"""chromosome 7 open reading frame 20"""	C7orf20		10810093, 20106980, 20676083	Standard	NM_015949		Approved	CGI-20, H_NH1244M04.5, CEE, TRC35	uc003sjl.1	Q7L5D6	OTTHUMG00000112459	ENST00000265857.3:c.662A>T	7.37:g.931971A>T	ENSP00000265857:p.Gln221Leu		Somatic				GET4_uc003sjj.1_RNA	p.Q221L	NM_015949	NP_057033	WXS	Illumina HiSeq	Unspecified	Q7L5D6	GET4_HUMAN			6	754	+			221					A4D2Q1|B3KNC7|Q9UFC9|Q9Y309	Missense_Mutation	SNP	ENST00000265857.3	37	c.662A>T	CCDS5317.1	.	.	.	.	.	.	.	.	.	.	a	17.92	3.507401	0.64410	.	.	ENSG00000239857	ENST00000265857;ENST00000407192	T	0.77489	-1.1	5.49	4.32	0.51571	.	0.156878	0.64402	N	0.000020	T	0.67211	0.2869	L	0.34521	1.04	0.58432	D	0.999998	B	0.02656	0.0	B	0.06405	0.002	T	0.61004	-0.7150	10	0.42905	T	0.14	-18.965	11.6187	0.51104	0.9293:0.0:0.0707:0.0	.	221	Q7L5D6	GET4_HUMAN	L	221;168	ENSP00000265857:Q221L	ENSP00000265857:Q221L	Q	+	2	0	GET4	898497	1.000000	0.71417	0.986000	0.45419	0.943000	0.58893	7.115000	0.77110	0.903000	0.36546	0.450000	0.29827	CAG		0.552	GET4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000231930.1	NM_015949		35	119	0	0	0	0.004878	0	35	119				
SNX13	23161	broad.mit.edu	37	7	17885294	17885294	+	Silent	SNP	T	T	A	rs202124601	byFrequency	TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr7:17885294T>A	ENST00000409389.1	-	12	1261	c.1089A>T	c.(1087-1089)gcA>gcT	p.A363A	SNX13_ENST00000428135.3_Silent_p.A363A			Q9Y5W8	SNX13_HUMAN	sorting nexin 13	363					intracellular protein transport (GO:0006886)|positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	early endosome (GO:0005769)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)	p.A363A(1)		breast(1)|central_nervous_system(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(13)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	38	Lung NSC(10;0.0261)|all_lung(11;0.0521)					CAAAGTTTGCTGCAAGTTTCA	0.313																																							uc003stw.1		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(2)|kidney(1)	3						c.(1087-1089)GCA>GCT		SubName: Full=Putative uncharacterized protein SNX13; SubName: Full=Sorting nexin 13, isoform CRA_g;							45.0	44.0	44.0					7																	17885294		1805	4074	5879	SO:0001819	synonymous_variant	23161				cell communication|intracellular protein transport|negative regulation of signal transduction|positive regulation of GTPase activity	early endosome membrane	phosphatidylinositol binding|signal transducer activity	g.chr7:17885294T>A	AF420470	CCDS47551.1	7p21.1	2008-03-11			ENSG00000071189	ENSG00000071189		"""Sorting nexins"""	21335	protein-coding gene	gene with protein product		606589				11485546, 11729322	Standard	NM_015132		Approved	RGS-PX1, KIAA0713	uc003stv.3	Q9Y5W8	OTTHUMG00000152730	ENST00000409389.1:c.1089A>T	7.37:g.17885294T>A			Somatic				SNX13_uc003stv.2_Silent_p.A363A|SNX13_uc010kuc.2_Silent_p.A160A	p.A363A			WXS	Illumina HiSeq	Unspecified	Q9Y5W8	SNX13_HUMAN			12	1302	-	Lung NSC(10;0.0261)|all_lung(11;0.0521)		363					B2RCI9|O94821|Q8WVZ2|Q8WXH8	Silent	SNP	ENST00000409389.1	37	c.1089A>T																																																																																					0.313	SNX13-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000327608.1	NM_015132		6	9	0	0	0	0.001168	0	6	9				
ADCY1	107	broad.mit.edu	37	7	45614391	45614391	+	Silent	SNP	G	G	C			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr7:45614391G>C	ENST00000297323.7	+	1	271	c.249G>C	c.(247-249)gcG>gcC	p.A83A	ADCY1_ENST00000432715.1_Intron	NM_021116.2	NP_066939.1	Q08828	ADCY1_HUMAN	adenylate cyclase 1 (brain)	83					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|axonogenesis (GO:0007409)|cellular response to glucagon stimulus (GO:0071377)|circadian rhythm (GO:0007623)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of circadian rhythm (GO:0042752)|response to drug (GO:0042493)|response to lithium ion (GO:0010226)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)	p.A83A(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(14)|lung(33)|ovary(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	71					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	TGCTgggcgcgccggggcccg	0.751																																							uc003tne.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	6						c.(247-249)GCG>GCC		adenylate cyclase 1	Adenosine(DB00640)|Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)						5.0	6.0	6.0					7																	45614391		1791	3804	5595	SO:0001819	synonymous_variant	107				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|calmodulin binding|metal ion binding	g.chr7:45614391G>C	L05500	CCDS34631.1, CCDS75593.1	7p13-p12	2013-02-04			ENSG00000164742	ENSG00000164742	4.6.1.1	"""Adenylate cyclases"""	232	protein-coding gene	gene with protein product		103072				8314585	Standard	NM_021116		Approved	AC1	uc003tne.4	Q08828	OTTHUMG00000155420	ENST00000297323.7:c.249G>C	7.37:g.45614391G>C			Somatic				ADCY1_uc003tnd.2_Intron	p.A83A	NM_021116	NP_066939	WXS	Illumina HiSeq	Unspecified	Q08828	ADCY1_HUMAN			1	267	+			83			Helical; (Potential).		A4D2L8|Q75MI1	Silent	SNP	ENST00000297323.7	37	c.249G>C	CCDS34631.1																																																																																				0.751	ADCY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340055.2	NM_021116		6	13	0	0	0	0.001984	0	6	13				
AUTS2	26053	broad.mit.edu	37	7	70254903	70254903	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr7:70254903C>T	ENST00000342771.4	+	19	3022	c.2701C>T	c.(2701-2703)Cgc>Tgc	p.R901C	AUTS2_ENST00000406775.2_Missense_Mutation_p.R877C	NM_015570.2	NP_056385.1	Q8WXX7	AUTS2_HUMAN	autism susceptibility candidate 2	901								p.R901C(1)		breast(2)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	50		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)		CTCGGAATCCCGCAAGGACCT	0.647																																							uc003tvw.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(2701-2703)CGC>TGC		autism susceptibility candidate 2 isoform 1							38.0	38.0	38.0					7																	70254903		2203	4300	6503	SO:0001583	missense	26053							g.chr7:70254903C>T	AF326917	CCDS5539.1, CCDS47601.1, CCDS47602.1	7q11.22	2014-01-06			ENSG00000158321	ENSG00000158321			14262	protein-coding gene	gene with protein product		607270				12160723	Standard	XM_005250257		Approved	KIAA0442, FBRSL2	uc003tvw.4	Q8WXX7	OTTHUMG00000023865	ENST00000342771.4:c.2701C>T	7.37:g.70254903C>T	ENSP00000344087:p.Arg901Cys		Somatic				AUTS2_uc003tvx.3_Missense_Mutation_p.R877C|AUTS2_uc011keg.1_Missense_Mutation_p.R353C	p.R901C	NM_015570	NP_056385	WXS	Illumina HiSeq	Unspecified	Q8WXX7	AUTS2_HUMAN		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)	19	3444	+		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)	901					A4D1Y9|L7QET3|L7QF75|Q5D049|Q6PJU5|Q9Y4F2	Missense_Mutation	SNP	ENST00000342771.4	37	c.2701C>T	CCDS5539.1	.	.	.	.	.	.	.	.	.	.	C	18.57	3.652855	0.67472	.	.	ENSG00000158321	ENST00000406775;ENST00000342771;ENST00000418686	T;T	0.33865	1.39;1.4	4.81	4.81	0.61882	.	0.121554	0.56097	D	0.000022	T	0.46521	0.1397	L	0.46157	1.445	0.80722	D	1	D;D;D	0.76494	0.995;0.999;0.999	P;P;P	0.60682	0.629;0.878;0.878	T	0.32268	-0.9913	9	.	.	.	-25.1083	11.4136	0.49939	0.0:0.917:0.0:0.083	.	353;877;901	B4DLG0;Q8WXX7-2;Q8WXX7	.;.;AUTS2_HUMAN	C	877;901;181	ENSP00000385263:R877C;ENSP00000344087:R901C	.	R	+	1	0	AUTS2	69892839	1.000000	0.71417	0.996000	0.52242	0.968000	0.65278	4.411000	0.59781	2.223000	0.72356	0.655000	0.94253	CGC		0.647	AUTS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251971.2			8	37	0	0	0	0.008291	0	8	37				
TMEM168	64418	broad.mit.edu	37	7	112424368	112424368	+	Silent	SNP	A	A	G			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr7:112424368A>G	ENST00000312814.6	-	2	1073	c.513T>C	c.(511-513)acT>acC	p.T171T	TMEM168_ENST00000454074.1_Silent_p.T171T	NM_022484.4	NP_071929.3	Q9H0V1	TM168_HUMAN	transmembrane protein 168	171						integral component of membrane (GO:0016021)|transport vesicle (GO:0030133)		p.T171T(1)		breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(10)|lung(12)|ovary(1)|prostate(2)|stomach(1)	32						CCACCAACATAGTTGTGCTGG	0.423																																							uc003vgn.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(511-513)ACT>ACC		transmembrane protein 168							64.0	63.0	63.0					7																	112424368		2203	4300	6503	SO:0001819	synonymous_variant	64418					integral to membrane|transport vesicle		g.chr7:112424368A>G		CCDS5757.1	7q31.32	2006-08-08			ENSG00000146802	ENSG00000146802			25826	protein-coding gene	gene with protein product						12477932	Standard	XM_005250527		Approved	DKFZp564C012,FLJ13576	uc003vgn.3	Q9H0V1	OTTHUMG00000155188	ENST00000312814.6:c.513T>C	7.37:g.112424368A>G			Somatic				TMEM168_uc010lju.2_Silent_p.T171T|TMEM168_uc011kmr.1_Intron	p.T171T	NM_022484	NP_071929	WXS	Illumina HiSeq	Unspecified	Q9H0V1	TM168_HUMAN			2	905	-			171					A4D0T9|B4DDS0|Q8NEK4|Q9H8J2	Silent	SNP	ENST00000312814.6	37	c.513T>C	CCDS5757.1																																																																																				0.423	TMEM168-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338696.4	NM_022484		23	47	0	0	0	0.00278	0	23	47				
MET	4233	broad.mit.edu	37	7	116380037	116380037	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr7:116380037C>T	ENST00000318493.6	+	4	1613	c.1426C>T	c.(1426-1428)Cat>Tat	p.H476Y	MET_ENST00000397752.3_Missense_Mutation_p.H476Y|MET_ENST00000436117.2_Missense_Mutation_p.H476Y|MET_ENST00000495962.1_3'UTR			Q9NWH9	SLTM_HUMAN	MET proto-oncogene, receptor tyrosine kinase	0					apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.H476Y(1)		NS(10)|breast(4)|central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(25)|large_intestine(8)|liver(3)|lung(70)|ovary(10)|pleura(2)|prostate(4)|skin(5)|stomach(6)|testis(1)|thyroid(4)|upper_aerodigestive_tract(64)|urinary_tract(3)	233	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			ATCAACCCCTCATGTGAATTT	0.398			Mis		"""papillary renal, head-neck squamous cell """	papillary renal			Hereditary Papillary Renal Carcinoma (type 1)																														uc003vij.2		NA		Dom	yes	Familial Papillary Renal Cancer	7	7q31	4233	Mis	met proto-oncogene (hepatocyte growth factor receptor)			E		papillary renal	papillary renal|head-neck squamous cell 		1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(63)|lung(41)|kidney(18)|NS(10)|ovary(5)|thyroid(4)|central_nervous_system(4)|stomach(3)|liver(3)|pleura(2)|large_intestine(2)|breast(2)|testis(1)|skin(1)	159						c.(1426-1428)CAT>TAT		met proto-oncogene isoform b precursor							206.0	186.0	192.0					7																	116380037		1858	4090	5948	SO:0001583	missense	4233	Hereditary_Papillary_Renal_Carcinoma_(type_1)	Familial Cancer Database	HPRC, Hereditary Papillary Renal Cell Cancer	axon guidance|cell proliferation	basal plasma membrane|integral to plasma membrane	ATP binding|hepatocyte growth factor receptor activity|protein binding	g.chr7:116380037C>T	M35073	CCDS43636.1, CCDS47689.1	7q31	2014-09-17	2014-06-26		ENSG00000105976	ENSG00000105976	2.7.10.1		7029	protein-coding gene	gene with protein product	"""hepatocyte growth factor receptor"""	164860	"""met proto-oncogene"""			1846706, 1611909	Standard	NM_001127500		Approved	HGFR, RCCP2	uc010lkh.3	P08581	OTTHUMG00000023299	ENST00000318493.6:c.1426C>T	7.37:g.116380037C>T	ENSP00000317272:p.His476Tyr		Somatic				MET_uc010lkh.2_Missense_Mutation_p.H476Y|MET_uc011knc.1_Missense_Mutation_p.H476Y|MET_uc011knd.1_Missense_Mutation_p.H476Y|MET_uc011kne.1_Missense_Mutation_p.H476Y|MET_uc011knf.1_Missense_Mutation_p.H476Y|MET_uc011kng.1_Missense_Mutation_p.H476Y|MET_uc011knh.1_Missense_Mutation_p.H476Y|MET_uc011kni.1_Missense_Mutation_p.H476Y|MET_uc011knj.1_Missense_Mutation_p.H46Y|MET_uc011kna.1_Missense_Mutation_p.H476Y|MET_uc011knb.1_Missense_Mutation_p.H476Y	p.H476Y	NM_000245	NP_000236	WXS	Illumina HiSeq	Unspecified	P08581	MET_HUMAN	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)		4	1613	+	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	476			Extracellular (Potential).|Sema.		A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Missense_Mutation	SNP	ENST00000318493.6	37	c.1426C>T	CCDS47689.1	.	.	.	.	.	.	.	.	.	.	C	18.91	3.723471	0.68959	.	.	ENSG00000105976	ENST00000397752;ENST00000318493;ENST00000436117	T;T;T	0.10860	2.83;2.83;2.83	5.91	5.91	0.95273	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.85682	D	0.000000	T	0.28962	0.0719	L	0.55990	1.75	0.80722	D	1	D;D;D;D;D;D;D;D;D;D	0.89917	0.999;1.0;0.999;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D	0.97110	0.996;1.0;0.989;1.0;1.0;1.0;1.0;1.0;0.999;0.998	T	0.01570	-1.1322	10	0.12766	T	0.61	.	20.2896	0.98541	0.0:1.0:0.0:0.0	.	476;476;476;476;476;476;476;476;476;476	B5A929;E7EQ94;B5A930;B5A934;B5A936;B5A937;B5A939;B5A941;P08581-2;P08581	.;.;.;.;.;.;.;.;.;MET_HUMAN	Y	476	ENSP00000380860:H476Y;ENSP00000317272:H476Y;ENSP00000410980:H476Y	ENSP00000317272:H476Y	H	+	1	0	MET	116167273	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	4.345000	0.59360	2.794000	0.96219	0.655000	0.94253	CAT		0.398	MET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059620.3			35	191	0	0	0	0.00623	0	35	191				
PIP	5304	broad.mit.edu	37	7	142836664	142836664	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr7:142836664C>A	ENST00000291009.3	+	4	410	c.370C>A	c.(370-372)Cct>Act	p.P124T		NM_002652.2	NP_002643.1	P12273	PIP_HUMAN	prolactin-induced protein	124					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|negative regulation of T cell apoptotic process (GO:0070233)|positive regulation of gene expression (GO:0010628)|proteolysis (GO:0006508)|regulation of immune system process (GO:0002682)|retina homeostasis (GO:0001895)	apical plasma membrane (GO:0016324)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	actin binding (GO:0003779)|aspartic-type endopeptidase activity (GO:0004190)|glycoprotein binding (GO:0001948)|IgG binding (GO:0019864)|protein dimerization activity (GO:0046983)	p.P124T(1)		NS(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(7)|ovary(1)|skin(1)	18	Melanoma(164;0.059)	Ovarian(593;2.82e-05)|Breast(660;0.012)		BRCA - Breast invasive adenocarcinoma(188;0.0026)|LUSC - Lung squamous cell carcinoma(290;0.0733)|Lung(243;0.08)		AGGCATCTGCCCTGATGATGC	0.468																																							uc003wcf.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(370-372)CCT>ACT		prolactin-induced protein precursor							174.0	167.0	169.0					7																	142836664		2203	4299	6502	SO:0001583	missense	5304					extracellular region	actin binding	g.chr7:142836664C>A		CCDS34768.1	7q34	2013-09-19			ENSG00000159763	ENSG00000159763			8993	protein-coding gene	gene with protein product	"""prolactin-inducible protein"""	176720				2727805, 1955075	Standard	NM_002652		Approved	GCDFP-15, GCDFP15, GPIP4	uc003wcf.1	P12273	OTTHUMG00000152635	ENST00000291009.3:c.370C>A	7.37:g.142836664C>A	ENSP00000291009:p.Pro124Thr		Somatic					p.P124T	NM_002652	NP_002643	WXS	Illumina HiSeq	Unspecified	P12273	PIP_HUMAN		BRCA - Breast invasive adenocarcinoma(188;0.0026)|LUSC - Lung squamous cell carcinoma(290;0.0733)|Lung(243;0.08)	4	406	+	Melanoma(164;0.059)	Ovarian(593;2.82e-05)|Breast(660;0.012)	124					A0A963|A0A9C3|A0A9F3|A4D2I1	Missense_Mutation	SNP	ENST00000291009.3	37	c.370C>A	CCDS34768.1	.	.	.	.	.	.	.	.	.	.	C	11.85	1.762052	0.31228	.	.	ENSG00000159763	ENST00000291009	T	0.15718	2.4	4.63	2.58	0.30949	.	0.000000	0.44688	D	0.000436	T	0.25306	0.0615	L	0.58669	1.825	0.34565	D	0.712782	D	0.56968	0.978	P	0.52758	0.708	T	0.40776	-0.9545	10	0.87932	D	0	.	9.009	0.36129	0.402:0.5979:0.0:0.0	.	124	P12273	PIP_HUMAN	T	124	ENSP00000291009:P124T	ENSP00000291009:P124T	P	+	1	0	PIP	142546786	0.815000	0.29118	0.983000	0.44433	0.104000	0.19210	0.582000	0.23834	1.186000	0.42985	0.655000	0.94253	CCT		0.468	PIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327089.1	NM_002652		66	272	1	0	1.37693e-34	0.00361	1.97813e-34	66	272				
ANGPT2	285	broad.mit.edu	37	8	6378821	6378821	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr8:6378821A>T	ENST00000325203.5	-	4	1151	c.677T>A	c.(676-678)aTc>aAc	p.I226N	ANGPT2_ENST00000338312.6_Missense_Mutation_p.I174N|ANGPT2_ENST00000415216.1_Missense_Mutation_p.I226N|ANGPT2_ENST00000523120.1_Missense_Mutation_p.I226N|MCPH1_ENST00000344683.5_Intron			O15123	ANGP2_HUMAN	angiopoietin 2	226					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cellular response to growth factor stimulus (GO:0071363)|germ cell development (GO:0007281)|glomerulus vasculature development (GO:0072012)|leukocyte migration (GO:0050900)|maternal process involved in female pregnancy (GO:0060135)|negative regulation of angiogenesis (GO:0016525)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of positive chemotaxis (GO:0050928)|organ regeneration (GO:0031100)|positive regulation of angiogenesis (GO:0045766)|response to activity (GO:0014823)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|response to organic cyclic compound (GO:0014070)|response to radiation (GO:0009314)|signal transduction (GO:0007165)|Tie signaling pathway (GO:0048014)	cell projection (GO:0042995)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)	p.I226N(2)		breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	17		Hepatocellular(245;0.0663)		Colorectal(4;0.0142)|READ - Rectum adenocarcinoma(4;0.19)|COAD - Colon adenocarcinoma(4;0.226)		TTCTTCAATGATGGAATTTTG	0.373																																							uc003wqj.3		NA																	2	Substitution - Missense(2)		lung(2)	upper_aerodigestive_tract(1)	1						c.(676-678)ATC>AAC		angiopoietin 2 isoform a precursor							190.0	175.0	180.0					8																	6378821		2203	4300	6503	SO:0001583	missense	285				angiogenesis|blood coagulation|leukocyte migration|negative regulation of blood vessel endothelial cell migration|negative regulation of positive chemotaxis|Tie receptor signaling pathway	extracellular space	metal ion binding|receptor tyrosine kinase binding	g.chr8:6378821A>T	AF004327	CCDS5958.1, CCDS47761.1	8p23	2013-02-06			ENSG00000091879	ENSG00000091879		"""Fibrinogen C domain containing"""	485	protein-coding gene	gene with protein product		601922				9545648	Standard	NM_001147		Approved	Ang2	uc003wqj.4	O15123	OTTHUMG00000090365	ENST00000325203.5:c.677T>A	8.37:g.6378821A>T	ENSP00000314897:p.Ile226Asn		Somatic				MCPH1_uc003wqi.2_Intron|ANGPT2_uc003wqk.3_Missense_Mutation_p.I226N|ANGPT2_uc010lri.2_Missense_Mutation_p.I174N|ANGPT2_uc003wql.3_Missense_Mutation_p.I226N	p.I226N	NM_001147	NP_001138	WXS	Illumina HiSeq	Unspecified	O15123	ANGP2_HUMAN		Colorectal(4;0.0142)|READ - Rectum adenocarcinoma(4;0.19)|COAD - Colon adenocarcinoma(4;0.226)	4	1006	-		Hepatocellular(245;0.0663)	226			Potential.		A0AV38|A8K205|B7ZLM7|Q9NRR7|Q9P2Y7	Missense_Mutation	SNP	ENST00000325203.5	37	c.677T>A	CCDS5958.1	.	.	.	.	.	.	.	.	.	.	A	16.51	3.143801	0.57044	.	.	ENSG00000091879	ENST00000325203;ENST00000415216;ENST00000338312;ENST00000523120	T;T;T;T	0.53857	0.6;0.6;0.61;1.29	5.91	5.91	0.95273	.	0.226652	0.44483	D	0.000453	T	0.55162	0.1903	L	0.50333	1.59	0.35219	D	0.775822	P;B;P;B	0.35174	0.488;0.286;0.488;0.136	B;B;B;B	0.44224	0.444;0.106;0.323;0.049	T	0.63143	-0.6703	10	0.27785	T	0.31	.	14.3004	0.66346	1.0:0.0:0.0:0.0	.	174;226;226;226	O15123-2;E7EVQ3;O15123-3;O15123	.;.;.;ANGP2_HUMAN	N	226;226;174;226	ENSP00000314897:I226N;ENSP00000400782:I226N;ENSP00000343517:I174N;ENSP00000428023:I226N	ENSP00000314897:I226N	I	-	2	0	ANGPT2	6366229	1.000000	0.71417	0.969000	0.41365	0.931000	0.56810	4.755000	0.62198	2.254000	0.74563	0.533000	0.62120	ATC		0.373	ANGPT2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206737.1	NM_001147		32	116	0	0	0	0.012213	0	32	116				
SGCZ	137868	broad.mit.edu	37	8	13948039	13948039	+	Silent	SNP	G	G	A			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr8:13948039G>A	ENST00000382080.1	-	8	1567	c.852C>T	c.(850-852)tgC>tgT	p.C284C	SGCZ_ENST00000421524.2_Silent_p.C237C	NM_139167.2	NP_631906.2	Q96LD1	SGCZ_HUMAN	sarcoglycan, zeta	271					membrane organization (GO:0061024)|muscle cell cellular homeostasis (GO:0046716)|muscle cell development (GO:0055001)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|sarcoglycan complex (GO:0016012)		p.C284C(2)		NS(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(14)|lung(15)|ovary(2)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	47				all cancers(2;0.000643)|Colorectal(111;0.00674)|COAD - Colon adenocarcinoma(73;0.0193)|GBM - Glioblastoma multiforme(2;0.026)		TGGGGCAGACGCAGAGTTCAT	0.483																																							uc003wwq.2		NA																	2	Substitution - coding silent(2)		lung(1)|central_nervous_system(1)	ovary(2)|central_nervous_system(1)	3						c.(850-852)TGC>TGT		sarcoglycan zeta							161.0	145.0	150.0					8																	13948039		2203	4300	6503	SO:0001819	synonymous_variant	137868				cytoskeleton organization	cytoplasm|cytoskeleton|integral to membrane|sarcolemma		g.chr8:13948039G>A	AY028700	CCDS5992.2	8p22	2014-09-17	2010-04-21		ENSG00000185053	ENSG00000185053			14075	protein-coding gene	gene with protein product		608113				12189167	Standard	XM_006716287		Approved	ZSG1	uc003wwq.3	Q96LD1	OTTHUMG00000090827	ENST00000382080.1:c.852C>T	8.37:g.13948039G>A			Somatic				SGCZ_uc010lss.2_Silent_p.C237C	p.C284C	NM_139167	NP_631906	WXS	Illumina HiSeq	Unspecified	Q96LD1	SGCZ_HUMAN		all cancers(2;0.000643)|Colorectal(111;0.00674)|COAD - Colon adenocarcinoma(73;0.0193)|GBM - Glioblastoma multiforme(2;0.026)	8	1512	-			271			Extracellular (Potential).		Q6REU0	Silent	SNP	ENST00000382080.1	37	c.852C>T	CCDS5992.2																																																																																				0.483	SGCZ-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207636.2	NM_139167		19	81	0	0	0	0.008871	0	19	81				
TTI2	80185	broad.mit.edu	37	8	33361291	33361291	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr8:33361291T>C	ENST00000431156.2	-	5	1708	c.1090A>G	c.(1090-1092)Aga>Gga	p.R364G	TTI2_ENST00000360742.5_Missense_Mutation_p.R364G|TTI2_ENST00000519356.1_5'UTR|TTI2_ENST00000520636.1_Missense_Mutation_p.R333G	NM_001102401.2	NP_001095871.1	Q6NXR4	TTI2_HUMAN	TELO2 interacting protein 2	364								p.R364G(1)									GGCAGGTTTCTTGCGTAGGTC	0.517																																							uc003xjl.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1090-1092)AGA>GGA		hypothetical protein LOC80185							40.0	36.0	38.0					8																	33361291		2203	4300	6503	SO:0001583	missense	80185						binding	g.chr8:33361291T>C	AK026916	CCDS6090.1	8p12	2011-11-10	2011-11-10	2011-09-22		ENSG00000129696			26262	protein-coding gene	gene with protein product		614426	"""chromosome 8 open reading frame 41"", ""Tel2 interacting protein 2 homolog (S. pombe)"""	C8orf41		20801936, 20810650	Standard	NM_025115		Approved	FLJ23263	uc003xjm.5	Q6NXR4		ENST00000431156.2:c.1090A>G	8.37:g.33361291T>C	ENSP00000411169:p.Arg364Gly		Somatic				C8orf41_uc003xjk.3_Missense_Mutation_p.R333G|C8orf41_uc010lvv.2_Intron|C8orf41_uc003xjm.3_Missense_Mutation_p.R364G|C8orf41_uc003xjn.1_Missense_Mutation_p.R364G	p.R364G	NM_025115	NP_079391	WXS	Illumina HiSeq	Unspecified	Q6NXR4	CH041_HUMAN		KIRC - Kidney renal clear cell carcinoma(67;0.0923)|Kidney(114;0.111)	4	1615	-			364					D3DSV7|Q96IM2|Q9H5N4	Missense_Mutation	SNP	ENST00000431156.2	37	c.1090A>G	CCDS6090.1	.	.	.	.	.	.	.	.	.	.	T	10.33	1.320776	0.23994	.	.	ENSG00000129696	ENST00000360742;ENST00000431156;ENST00000522668;ENST00000520636	T;T;T	0.77489	-1.1;-1.1;-1.1	5.5	1.84	0.25277	.	0.219310	0.41500	D	0.000872	T	0.67277	0.2876	L	0.54323	1.7	0.09310	N	0.999998	B;B	0.25772	0.035;0.134	B;B	0.25884	0.064;0.031	T	0.53669	-0.8406	10	0.30854	T	0.27	-9.7791	5.6163	0.17434	0.0:0.1412:0.2712:0.5876	.	364;333	Q6NXR4;E5RIH5	TTI2_HUMAN;.	G	364;364;364;333	ENSP00000353971:R364G;ENSP00000411169:R364G;ENSP00000428401:R333G	ENSP00000353971:R364G	R	-	1	2	C8orf41	33480833	0.003000	0.15002	0.010000	0.14722	0.520000	0.34377	1.216000	0.32443	0.165000	0.19558	0.528000	0.53228	AGA		0.517	TTI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376555.1	NM_025115		9	30	0	0	0	0.006214	0	9	30				
POLB	5423	broad.mit.edu	37	8	42196548	42196548	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr8:42196548A>G	ENST00000265421.4	+	2	250	c.80A>G	c.(79-81)aAg>aGg	p.K27R	POLB_ENST00000530566.1_Intron|POLB_ENST00000538005.1_Intron	NM_002690.2	NP_002681.1	P06746	DPOLB_HUMAN	polymerase (DNA directed), beta	27					base-excision repair (GO:0006284)|base-excision repair, gap-filling (GO:0006287)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|DNA-dependent DNA replication (GO:0006261)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|neuron apoptotic process (GO:0051402)|pyrimidine dimer repair (GO:0006290)|response to ethanol (GO:0045471)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)	damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|enzyme binding (GO:0019899)|lyase activity (GO:0016829)|metal ion binding (GO:0046872)|microtubule binding (GO:0008017)	p.K27R(2)		breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|liver(1)|lung(5)|ovary(1)	16	all_cancers(6;1.42e-24)|all_epithelial(6;1.02e-25)|all_lung(13;2.58e-12)|Lung NSC(13;4.24e-11)|Ovarian(28;0.00769)|Prostate(17;0.0119)|Colorectal(14;0.1)|Lung SC(25;0.211)	all_lung(54;0.00671)|Lung NSC(58;0.0184)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	BRCA - Breast invasive adenocarcinoma(8;3.18e-11)|Lung(22;0.00467)|OV - Ovarian serous cystadenocarcinoma(14;0.00523)|LUSC - Lung squamous cell carcinoma(45;0.024)		Cytarabine(DB00987)	AACTTTGAGAAGAACGTGAGC	0.483								DNA polymerases (catalytic subunits)																															uc003xoz.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|breast(1)	2						c.(79-81)AAG>AGG	DNA_polymerases_(catalytic_subunits)	DNA-directed DNA polymerase beta	Cytarabine(DB00987)						111.0	89.0	96.0					8																	42196548		2203	4300	6503	SO:0001583	missense	5423				DNA-dependent DNA replication	cytoplasm|nucleoplasm|spindle microtubule	DNA-(apurinic or apyrimidinic site) lyase activity|DNA-directed DNA polymerase activity|enzyme binding|metal ion binding|microtubule binding	g.chr8:42196548A>G		CCDS6129.1	8p12-p11	2012-10-02			ENSG00000070501	ENSG00000070501	2.7.7.7	"""DNA polymerases"""	9174	protein-coding gene	gene with protein product		174760					Standard	NM_002690		Approved		uc003xoz.2	P06746	OTTHUMG00000164093	ENST00000265421.4:c.80A>G	8.37:g.42196548A>G	ENSP00000265421:p.Lys27Arg		Somatic				POLB_uc003xpa.1_Missense_Mutation_p.K27R|POLB_uc011lcs.1_Intron	p.K27R	NM_002690	NP_002681	WXS	Illumina HiSeq	Unspecified	P06746	DPOLB_HUMAN	BRCA - Breast invasive adenocarcinoma(8;3.18e-11)|Lung(22;0.00467)|OV - Ovarian serous cystadenocarcinoma(14;0.00523)|LUSC - Lung squamous cell carcinoma(45;0.024)		2	193	+	all_cancers(6;1.42e-24)|all_epithelial(6;1.02e-25)|all_lung(13;2.58e-12)|Lung NSC(13;4.24e-11)|Ovarian(28;0.00769)|Prostate(17;0.0119)|Colorectal(14;0.1)|Lung SC(25;0.211)	all_lung(54;0.00671)|Lung NSC(58;0.0184)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	27					B2RC78|Q3KP48|Q6FI34	Missense_Mutation	SNP	ENST00000265421.4	37	c.80A>G	CCDS6129.1	.	.	.	.	.	.	.	.	.	.	A	12.09	1.832635	0.32421	.	.	ENSG00000070501	ENST00000265421;ENST00000518925	T;T	0.44083	0.93;0.93	5.16	4.02	0.46733	DNA-directed DNA polymerase X (1);DNA-directed DNA polymerase, family X, beta-like, N-terminal (2);	0.093291	0.64402	D	0.000001	T	0.20292	0.0488	N	0.11870	0.19	0.80722	D	1	B;B	0.10296	0.002;0.003	B;B	0.08055	0.002;0.003	T	0.09357	-1.0678	10	0.31617	T	0.26	-6.0855	3.974	0.09465	0.7327:0.0:0.2673:0.0	.	27;27	Q53EV2;P06746	.;DPOLB_HUMAN	R	27	ENSP00000265421:K27R;ENSP00000430784:K27R	ENSP00000265421:K27R	K	+	2	0	POLB	42315705	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.523000	0.53488	1.940000	0.56252	0.397000	0.26171	AAG		0.483	POLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377242.1	NM_002690		12	39	0	0	0	0.003163	0	12	39				
CHRNA6	8973	broad.mit.edu	37	8	42612132	42612132	+	Missense_Mutation	SNP	T	T	G			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr8:42612132T>G	ENST00000276410.2	-	4	668	c.313A>C	c.(313-315)Att>Ctt	p.I105L	CHRNA6_ENST00000530869.1_5'UTR|CHRNA6_ENST00000534622.1_Missense_Mutation_p.I90L	NM_004198.3	NP_004189.1	Q15825	ACHA6_HUMAN	cholinergic receptor, nicotinic, alpha 6 (neuronal)	105					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|membrane depolarization (GO:0051899)|regulation of dopamine secretion (GO:0014059)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)	p.I105L(1)		endometrium(2)|large_intestine(3)|liver(1)|lung(15)|ovary(1)	22	all_lung(13;3.33e-12)|Lung NSC(13;9.17e-11)|Ovarian(28;0.01)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.00439)|Lung NSC(58;0.0124)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	Lung(22;0.0252)|LUSC - Lung squamous cell carcinoma(45;0.0869)		Galantamine(DB00674)|Nicotine(DB00184)|Varenicline(DB01273)	AGAGTCTCAATGCCATCATAT	0.398																																							uc003xpj.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(313-315)ATT>CTT		cholinergic receptor, nicotinic, alpha 6							94.0	95.0	95.0					8																	42612132		2203	4300	6503	SO:0001583	missense	8973					cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity	g.chr8:42612132T>G	U62435	CCDS6135.1, CCDS56536.1	8p22	2012-02-11	2012-02-07					"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	15963	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 6 (neuronal)"""	606888	"""cholinergic receptor, nicotinic, alpha polypeptide 6"""			8906617	Standard	NM_004198		Approved		uc003xpj.3	Q15825		ENST00000276410.2:c.313A>C	8.37:g.42612132T>G	ENSP00000276410:p.Ile105Leu		Somatic				CHRNA6_uc011lcw.1_Missense_Mutation_p.I90L	p.I105L	NM_004198	NP_004189	WXS	Illumina HiSeq	Unspecified	Q15825	ACHA6_HUMAN	Lung(22;0.0252)|LUSC - Lung squamous cell carcinoma(45;0.0869)		4	359	-	all_lung(13;3.33e-12)|Lung NSC(13;9.17e-11)|Ovarian(28;0.01)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.00439)|Lung NSC(58;0.0124)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	105			Extracellular.		B2R8V4|B4DQH1	Missense_Mutation	SNP	ENST00000276410.2	37	c.313A>C	CCDS6135.1	.	.	.	.	.	.	.	.	.	.	T	9.938	1.216601	0.22373	.	.	ENSG00000147434	ENST00000276410;ENST00000534622;ENST00000533810	T;T;T	0.80738	-1.41;-1.41;-1.41	5.82	5.82	0.92795	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	T	0.77778	0.4181	L	0.42245	1.32	0.50813	D	0.999893	B;B	0.12630	0.006;0.003	B;B	0.28709	0.093;0.093	T	0.73212	-0.4054	10	0.46703	T	0.11	.	16.1832	0.81925	0.0:0.0:0.0:1.0	.	90;105	B4DQH1;Q15825	.;ACHA6_HUMAN	L	105;90;26	ENSP00000276410:I105L;ENSP00000433871:I90L;ENSP00000434659:I26L	ENSP00000276410:I105L	I	-	1	0	CHRNA6	42731289	0.762000	0.28451	1.000000	0.80357	0.008000	0.06430	1.245000	0.32790	2.218000	0.71995	0.533000	0.62120	ATT		0.398	CHRNA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383156.1			35	155	0	0	0	0.005524	0	35	155				
PSKH2	85481	broad.mit.edu	37	8	87076326	87076326	+	Silent	SNP	G	G	A			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr8:87076326G>A	ENST00000276616.2	-	2	794	c.720C>T	c.(718-720)acC>acT	p.T240T	PSKH2_ENST00000517981.1_5'UTR	NM_033126.1	NP_149117.1	Q96QS6	KPSH2_HUMAN	protein serine kinase H2	240	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.T240T(1)		NS(1)|breast(1)|kidney(11)|large_intestine(2)|lung(26)|ovary(1)|prostate(1)|stomach(3)|urinary_tract(1)	47			STAD - Stomach adenocarcinoma(118;0.129)			CCACTGCACTGGTATAAGGCT	0.473																																							uc011lfy.1		NA																	1	Substitution - coding silent(1)		lung(1)	stomach(2)|lung(2)|ovary(1)	5						c.(718-720)ACC>ACT		protein serine kinase H2							92.0	88.0	89.0					8																	87076326		2203	4300	6503	SO:0001819	synonymous_variant	85481						ATP binding|protein serine/threonine kinase activity	g.chr8:87076326G>A	AY037806	CCDS6240.1	8q21.13	2004-06-03				ENSG00000147613			18997	protein-coding gene	gene with protein product							Standard	NM_033126		Approved		uc011lfy.2	Q96QS6		ENST00000276616.2:c.720C>T	8.37:g.87076326G>A			Somatic					p.T240T	NM_033126	NP_149117	WXS	Illumina HiSeq	Unspecified	Q96QS6	KPSH2_HUMAN	STAD - Stomach adenocarcinoma(118;0.129)		2	720	-			240			Protein kinase.		A0AV22	Silent	SNP	ENST00000276616.2	37	c.720C>T	CCDS6240.1																																																																																				0.473	PSKH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374628.1	NM_033126		27	98	0	0	0	0.00632	0	27	98				
UTP23	84294	broad.mit.edu	37	8	117783936	117783936	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr8:117783936C>T	ENST00000309822.2	+	3	706	c.605C>T	c.(604-606)cCc>cTc	p.P202L	UTP23_ENST00000517820.1_Intron|UTP23_ENST00000357148.3_Intron|UTP23_ENST00000520733.1_Intron	NM_032334.2	NP_115710.2	Q9BRU9	UTP23_HUMAN	UTP23, small subunit (SSU) processome component, homolog (yeast)	202					rRNA processing (GO:0006364)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)	p.P202L(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|urinary_tract(1)	12						ATAAGTGGTCCCAATCCTCTT	0.363																																							uc003yoc.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(604-606)CCC>CTC		UTP23, small subunit (SSU) processome component,							51.0	53.0	53.0					8																	117783936		2203	4300	6503	SO:0001583	missense	84294				rRNA processing	nucleolus		g.chr8:117783936C>T		CCDS6320.1	8q24.11	2008-06-12	2008-06-12	2008-06-12		ENSG00000147679			28224	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 53"""	C8orf53		16769905	Standard	NM_032334		Approved	MGC14595	uc003yoc.3	Q9BRU9		ENST00000309822.2:c.605C>T	8.37:g.117783936C>T	ENSP00000308332:p.Pro202Leu		Somatic					p.P202L	NM_032334	NP_115710	WXS	Illumina HiSeq	Unspecified	Q9BRU9	UTP23_HUMAN			3	706	+			202					B2RE25|Q96NJ8	Missense_Mutation	SNP	ENST00000309822.2	37	c.605C>T	CCDS6320.1	.	.	.	.	.	.	.	.	.	.	C	31	5.102609	0.94245	.	.	ENSG00000147679	ENST00000309822	T	0.43688	0.94	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	T	0.71169	0.3308	M	0.90198	3.095	0.80722	D	1	D	0.76494	0.999	P	0.62491	0.903	T	0.76296	-0.3011	10	0.87932	D	0	-15.1798	20.4008	0.98991	0.0:1.0:0.0:0.0	.	202	Q9BRU9	UTP23_HUMAN	L	202	ENSP00000308332:P202L	ENSP00000308332:P202L	P	+	2	0	UTP23	117853117	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.158000	0.77470	2.826000	0.97356	0.655000	0.94253	CCC		0.363	UTP23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381173.1	NM_032334		18	51	0	0	0	0.007413	0	18	51				
TRMT12	55039	broad.mit.edu	37	8	125464025	125464025	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr8:125464025G>A	ENST00000328599.3	+	1	978	c.857G>A	c.(856-858)cGg>cAg	p.R286Q	TRMT12_ENST00000521443.1_Intron	NM_017956.3	NP_060426.2	Q53H54	TYW2_HUMAN	tRNA methyltransferase 12 homolog (S. cerevisiae)	286					tRNA processing (GO:0008033)		transferase activity (GO:0016740)	p.R286Q(1)		breast(2)|endometrium(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	15	Ovarian(258;0.00438)|all_neural(195;0.0779)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)			GTAGCAGATCGGTGCCAAATA	0.483																																							uc003yra.3		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)	1						c.(856-858)CGG>CAG		homolog of yeast tRNA methyltransferase 12							109.0	108.0	108.0					8																	125464025		2203	4300	6503	SO:0001583	missense	55039				tRNA processing		methyltransferase activity	g.chr8:125464025G>A	AF313041	CCDS6349.1	8q24.13	2011-05-09	2006-11-16		ENSG00000183665	ENSG00000183665			26091	protein-coding gene	gene with protein product	"""tRNA-yW synthesizing protein 2"""	611244	"""tRNA methyltranferase 12 homolog (S. cerevisiae)"""			16005430, 17150819	Standard	NM_017956		Approved	FLJ20772, Trm12, TYW2	uc003yra.4	Q53H54	OTTHUMG00000165022	ENST00000328599.3:c.857G>A	8.37:g.125464025G>A	ENSP00000329858:p.Arg286Gln		Somatic					p.R286Q	NM_017956	NP_060426	WXS	Illumina HiSeq	Unspecified	Q53H54	TYW2_HUMAN	STAD - Stomach adenocarcinoma(47;0.00288)		1	978	+	Ovarian(258;0.00438)|all_neural(195;0.0779)|Hepatocellular(40;0.108)		286					Q6PKB9|Q96F21|Q9NWK6	Missense_Mutation	SNP	ENST00000328599.3	37	c.857G>A	CCDS6349.1	.	.	.	.	.	.	.	.	.	.	G	15.34	2.805602	0.50315	.	.	ENSG00000183665	ENST00000328599	T	0.26660	1.72	5.55	3.77	0.43336	.	0.180091	0.49305	N	0.000150	T	0.28532	0.0706	M	0.71871	2.18	0.42249	D	0.991966	P	0.43662	0.814	B	0.42138	0.377	T	0.04216	-1.0968	10	0.44086	T	0.13	-15.209	7.9317	0.29905	0.2496:0.0:0.7504:0.0	.	286	Q53H54	TYW2_HUMAN	Q	286	ENSP00000329858:R286Q	ENSP00000329858:R286Q	R	+	2	0	TRMT12	125533206	1.000000	0.71417	0.913000	0.36048	0.690000	0.40134	4.138000	0.58017	0.845000	0.35118	-0.136000	0.14681	CGG		0.483	TRMT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381465.1	NM_017956		54	182	0	0	0	0.00361	0	54	182				
RFX3	5991	broad.mit.edu	37	9	3257077	3257077	+	Silent	SNP	C	C	A			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr9:3257077C>A	ENST00000382004.3	-	15	2039	c.1728G>T	c.(1726-1728)gtG>gtT	p.V576V	RFX3_ENST00000302303.1_Silent_p.V576V|RFX3_ENST00000358730.2_Silent_p.V576V	NM_001282116.1|NM_134428.1	NP_001269045.1|NP_602304.1	P48380	RFX3_HUMAN	regulatory factor X, 3 (influences HLA class II expression)	576					cell maturation (GO:0048469)|cilium assembly (GO:0042384)|cilium-dependent cell motility (GO:0060285)|endocrine pancreas development (GO:0031018)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type B pancreatic cell development (GO:2000078)|regulation of insulin secretion (GO:0050796)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|type B pancreatic cell maturation (GO:0072560)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.V576V(2)		central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(11)|large_intestine(3)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	40				GBM - Glioblastoma multiforme(50;0.00124)|Lung(2;0.0337)		CTTGCATCATCACATTGTCAA	0.473																																							uc003zhr.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)|central_nervous_system(1)|pancreas(1)	4						c.(1726-1728)GTG>GTT		regulatory factor X3 isoform b							151.0	141.0	145.0					9																	3257077		2203	4300	6503	SO:0001819	synonymous_variant	5991				cell maturation|ciliary cell motility|cilium assembly|cilium movement involved in determination of left/right asymmetry|endocrine pancreas development|negative regulation of transcription, DNA-dependent|positive regulation of transcription from RNA polymerase II promoter|positive regulation of type B pancreatic cell development|regulation of insulin secretion	nuclear chromatin	protein binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription regulatory region DNA binding	g.chr9:3257077C>A	AI811824	CCDS6449.1, CCDS6450.1, CCDS75809.1	9p24.2	2008-02-05			ENSG00000080298	ENSG00000080298			9984	protein-coding gene	gene with protein product		601337				8289803	Standard	XM_005251534		Approved		uc003zhr.3	P48380	OTTHUMG00000019456	ENST00000382004.3:c.1728G>T	9.37:g.3257077C>A			Somatic				RFX3_uc010mhd.2_Silent_p.V576V|RFX3_uc003zhs.1_Silent_p.V576V	p.V576V	NM_134428	NP_602304	WXS	Illumina HiSeq	Unspecified	P48380	RFX3_HUMAN		GBM - Glioblastoma multiforme(50;0.00124)|Lung(2;0.0337)	15	2040	-			576					A8K0H5|D3DRH8|D3DRH9|Q5JTL7|Q5JTL8|Q6NW13|Q8WTU4|Q95HL5|Q95HL6	Silent	SNP	ENST00000382004.3	37	c.1728G>T	CCDS6449.1																																																																																				0.473	RFX3-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051545.1	NM_002919		59	96	1	0	1.80625e-27	0.00361	2.55886e-27	59	96				
RANBP6	26953	broad.mit.edu	37	9	6013371	6013371	+	Missense_Mutation	SNP	C	C	T	rs202193240		TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr9:6013371C>T	ENST00000259569.5	-	1	2247	c.2237G>A	c.(2236-2238)gGc>gAc	p.G746D	RANBP6_ENST00000485372.1_5'Flank	NM_001243202.1|NM_001243203.1|NM_012416.3	NP_001230131.1|NP_001230132.1|NP_036548.1	O60518	RNBP6_HUMAN	RAN binding protein 6	746					protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.G746D(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(5)|large_intestine(8)|lung(9)|ovary(7)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	51		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00522)|Lung(218;0.101)		ATACTCTGGGCCACGAATTCT	0.423																																							uc003zjr.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(2236-2238)GGC>GAC		RAN binding protein 6							76.0	76.0	76.0					9																	6013371		2203	4300	6503	SO:0001583	missense	26953				protein transport	cytoplasm|nucleus	binding	g.chr9:6013371C>T	AF039023	CCDS6467.1	9p24.1	2008-03-26			ENSG00000137040	ENSG00000137040			9851	protein-coding gene	gene with protein product							Standard	NM_001243202		Approved		uc003zjr.3	O60518	OTTHUMG00000019512	ENST00000259569.5:c.2237G>A	9.37:g.6013371C>T	ENSP00000259569:p.Gly746Asp		Somatic				RANBP6_uc011lmf.1_Missense_Mutation_p.G394D|RANBP6_uc003zjs.2_Missense_Mutation_p.G334D	p.G746D	NM_012416	NP_036548	WXS	Illumina HiSeq	Unspecified	O60518	RNBP6_HUMAN		GBM - Glioblastoma multiforme(50;0.00522)|Lung(218;0.101)	1	2248	-		Acute lymphoblastic leukemia(23;0.158)	746					Q5T7X4|Q7Z3V2|Q96E78	Missense_Mutation	SNP	ENST00000259569.5	37	c.2237G>A	CCDS6467.1	.	.	.	.	.	.	.	.	.	.	C	17.48	3.399798	0.62177	.	.	ENSG00000137040	ENST00000259569	T	0.67171	-0.25	3.79	3.79	0.43588	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	U	0.000000	T	0.79070	0.4384	M	0.77820	2.39	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	T	0.75758	-0.3205	10	0.17369	T	0.5	-3.3927	13.9764	0.64275	0.0:1.0:0.0:0.0	.	334;746	B4DTX6;O60518	.;RNBP6_HUMAN	D	746	ENSP00000259569:G746D	ENSP00000259569:G746D	G	-	2	0	RANBP6	6003371	0.999000	0.42202	0.815000	0.32552	0.998000	0.95712	5.685000	0.68204	2.404000	0.81709	0.650000	0.86243	GGC		0.423	RANBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051650.1	NM_012416		49	49	0	0	0	0.00361	0	49	49				
TRPM3	80036	broad.mit.edu	37	9	73225623	73225623	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr9:73225623C>T	ENST00000377111.2	-	18	2776	c.2533G>A	c.(2533-2535)Gat>Aat	p.D845N	TRPM3_ENST00000408909.2_Missense_Mutation_p.D704N|TRPM3_ENST00000357533.2_Missense_Mutation_p.D849N|TRPM3_ENST00000377110.3_Missense_Mutation_p.D845N|TRPM3_ENST00000377106.1_Missense_Mutation_p.D717N|TRPM3_ENST00000396285.1_Missense_Mutation_p.D692N|TRPM3_ENST00000423814.3_Missense_Mutation_p.D872N|TRPM3_ENST00000358082.3_Missense_Mutation_p.D707N|TRPM3_ENST00000360823.2_Missense_Mutation_p.D707N|TRPM3_ENST00000396292.4_Missense_Mutation_p.D717N|TRPM3_ENST00000396280.5_Missense_Mutation_p.D694N|TRPM3_ENST00000377105.1_Missense_Mutation_p.D704N	NM_001007471.2	NP_001007472.2	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel, subfamily M, member 3	870					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|sensory perception of temperature stimulus (GO:0050951)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)	p.D845N(1)|p.D849N(1)|p.D717N(1)		NS(2)|breast(4)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(18)|liver(1)|lung(46)|ovary(3)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(1)	95						TCCTCTTCATCCTTCTTCCTG	0.473																																							uc004aid.2		NA																	3	Substitution - Missense(3)		lung(3)	ovary(3)|pancreas(2)|central_nervous_system(2)|skin(2)	9						c.(2533-2535)GAT>AAT		transient receptor potential cation channel,							225.0	191.0	202.0					9																	73225623		2203	4300	6503	SO:0001583	missense	80036					integral to membrane	calcium channel activity	g.chr9:73225623C>T	AB046836	CCDS6634.1, CCDS6635.1, CCDS6636.1, CCDS6637.1, CCDS43835.1, CCDS65064.1	9q21.11	2011-12-14			ENSG00000083067	ENSG00000083067		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17992	protein-coding gene	gene with protein product	"""melastatin 2"""	608961				16382100	Standard	NM_206946		Approved	KIAA1616, LTRPC3, GON-2	uc004aid.3	Q9HCF6	OTTHUMG00000019997	ENST00000377111.2:c.2533G>A	9.37:g.73225623C>T	ENSP00000366315:p.Asp845Asn		Somatic				TRPM3_uc004ahu.2_Missense_Mutation_p.D675N|TRPM3_uc004ahv.2_Missense_Mutation_p.D647N|TRPM3_uc004ahw.2_Missense_Mutation_p.D717N|TRPM3_uc004ahx.2_Missense_Mutation_p.D704N|TRPM3_uc004ahy.2_Missense_Mutation_p.D707N|TRPM3_uc004ahz.2_Missense_Mutation_p.D694N|TRPM3_uc004aia.2_Missense_Mutation_p.D692N|TRPM3_uc004aib.2_Missense_Mutation_p.D682N|TRPM3_uc004aic.2_Missense_Mutation_p.D845N	p.D845N	NM_001007471	NP_001007472	WXS	Illumina HiSeq	Unspecified	Q9HCF6	TRPM3_HUMAN			18	2777	-			870			Extracellular (Potential).		A2A3F6|A9Z1Y7|Q5VW02|Q5VW03|Q5VW04|Q5W5T7|Q86SH0|Q86SH6|Q86UL0|Q86WK1|Q86WK2|Q86WK3|Q86WK4|Q86YZ9|Q86Z00|Q86Z01|Q9H0X2	Missense_Mutation	SNP	ENST00000377111.2	37	c.2533G>A		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.01|17.01	3.278483|3.278483	0.59758|0.59758	.|.	.|.	ENSG00000083067|ENSG00000083067	ENST00000377111;ENST00000377110;ENST00000377106;ENST00000360823;ENST00000377105;ENST00000357533;ENST00000408909;ENST00000396285;ENST00000396292;ENST00000358082;ENST00000423814|ENST00000396280	T;T;T;T;T;T;T;T;T;T;T|.	0.63417|.	-0.04;-0.04;-0.04;-0.04;-0.04;-0.04;-0.04;-0.04;-0.04;-0.04;-0.04|.	6.17|6.17	6.17|6.17	0.99709|0.99709	.|.	0.168374|.	0.51477|.	D|.	0.000081|.	T|T	0.70824|0.70824	0.3268|0.3268	L|L	0.45581|0.45581	1.43|1.43	0.46654|0.46654	D|D	0.999149|0.999149	B;B;B;B;B;B;B;B|.	0.16166|.	0.001;0.001;0.005;0.001;0.0;0.016;0.001;0.0|.	B;B;B;B;B;B;B;B|.	0.24394|.	0.014;0.009;0.053;0.006;0.003;0.021;0.016;0.002|.	T|T	0.63287|0.63287	-0.6671|-0.6671	10|5	0.30078|.	T|.	0.28|.	-18.99|-18.99	20.8794|20.8794	0.99867|0.99867	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	845;845;835;849;707;704;817;692|.	Q9HCF6-2;Q9HCF6-10;Q9HCF6-4;A2A3F7;A2A3F4;G5E9G1;Q9HCF6-8;A2A3F3|.	.;.;.;.;.;.;.;.|.	N|E	845;845;717;707;704;849;704;692;717;707;872|693	ENSP00000366315:D845N;ENSP00000366314:D845N;ENSP00000366310:D717N;ENSP00000354066:D707N;ENSP00000366309:D704N;ENSP00000350140:D849N;ENSP00000386127:D704N;ENSP00000379581:D692N;ENSP00000379587:D717N;ENSP00000350791:D707N;ENSP00000389542:D872N|.	ENSP00000350140:D849N|.	D|G	-|-	1|2	0|0	TRPM3|TRPM3	72415443|72415443	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	6.006000|6.006000	0.70724|0.70724	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	GAT|GGA		0.473	TRPM3-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000214157.5	NM_206945		26	141	0	0	0	0.008361	0	26	141				
IL3RA	3563	broad.mit.edu	37	X	1471347	1471347	+	Silent	SNP	C	C	T			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chrX:1471347C>T	ENST00000331035.4	+	6	913	c.564C>T	c.(562-564)agC>agT	p.S188S	IL3RA_ENST00000381469.2_Silent_p.S110S	NM_001267713.1|NM_002183.3	NP_001254642.1|NP_002174.1	P26951	IL3RA_HUMAN	interleukin 3 receptor, alpha (low affinity)	188					cellular response to interleukin-3 (GO:0036016)|interleukin-3-mediated signaling pathway (GO:0038156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-3 receptor activity (GO:0004912)	p.S188S(1)		lung(1)|skin(2)	3		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	GGGGCAGGAGCGCAGCCTTCG	0.552																																							uc004cps.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(2)|lung(1)	3						c.(562-564)AGC>AGT		interleukin 3 receptor, alpha precursor	Sargramostim(DB00020)						227.0	224.0	225.0					X																	1471347		2203	4296	6499	SO:0001819	synonymous_variant	3563					integral to membrane|plasma membrane	interleukin-3 receptor activity	g.chrX:1471347C>T	M74782	CCDS14113.1, CCDS59158.1	Xp22.3 and Yp13.3	2008-07-21			ENSG00000185291	ENSG00000185291		"""Pseudoautosomal regions / PAR1"", ""Interleukins and interleukin receptors"", ""CD molecules"""	6012	protein-coding gene	gene with protein product		308385, 430000				1833064	Standard	NM_002183		Approved	CD123	uc004cps.3	P26951	OTTHUMG00000021059	ENST00000331035.4:c.564C>T	X.37:g.1471347C>T			Somatic				IL3RA_uc011mhd.1_Silent_p.S110S	p.S188S	NM_002183	NP_002174	WXS	Illumina HiSeq	Unspecified	P26951	IL3RA_HUMAN			6	913	+		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)	188			Extracellular (Potential).		A8K3F3|B9VI81|Q5HYQ7|Q5HYQ8|Q9UEH7	Silent	SNP	ENST00000331035.4	37	c.564C>T	CCDS14113.1																																																																																				0.552	IL3RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055600.3			4	146	0	0	0	0.009096	0	4	146				
NHS	4810	broad.mit.edu	37	X	17745407	17745407	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chrX:17745407T>C	ENST00000380060.3	+	6	3456	c.3118T>C	c.(3118-3120)Tcc>Ccc	p.S1040P	NHS_ENST00000398097.3_Missense_Mutation_p.S884P	NM_198270.2	NP_938011.1	Q6T4R5	NHS_HUMAN	Nance-Horan syndrome (congenital cataracts and dental anomalies)	1061					cell differentiation (GO:0030154)|lens development in camera-type eye (GO:0002088)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|tight junction (GO:0005923)		p.S884P(1)|p.S1040P(1)		breast(5)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(26)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	71	Hepatocellular(33;0.183)					AGAAAGAAAATCCTCACTACA	0.423																																							uc004cxx.2		NA																	2	Substitution - Missense(2)		lung(2)	skin(3)|ovary(2)|breast(1)|central_nervous_system(1)	7						c.(3118-3120)TCC>CCC		Nance-Horan syndrome protein isoform 1							119.0	114.0	116.0					X																	17745407		2203	4300	6503	SO:0001583	missense	4810					nucleus		g.chrX:17745407T>C		CCDS14181.1, CCDS48087.1	Xp22.3-p21.1	2014-06-18			ENSG00000188158	ENSG00000188158			7820	protein-coding gene	gene with protein product		300457					Standard	NM_001136024		Approved		uc004cxx.3	Q6T4R5	OTTHUMG00000022799	ENST00000380060.3:c.3118T>C	X.37:g.17745407T>C	ENSP00000369400:p.Ser1040Pro		Somatic				NHS_uc011mix.1_Missense_Mutation_p.S1061P|NHS_uc004cxy.2_Missense_Mutation_p.S884P|NHS_uc004cxz.2_Missense_Mutation_p.S863P|NHS_uc004cya.2_Missense_Mutation_p.S763P	p.S1040P	NM_198270	NP_938011	WXS	Illumina HiSeq	Unspecified	Q6T4R5	NHS_HUMAN			6	3456	+	Hepatocellular(33;0.183)		1040					B7ZVX8|E2DH69|Q5J7Q0|Q5J7Q1|Q68DR5	Missense_Mutation	SNP	ENST00000380060.3	37	c.3118T>C	CCDS14181.1	.	.	.	.	.	.	.	.	.	.	T	16.73	3.204162	0.58234	.	.	ENSG00000188158	ENST00000380060;ENST00000398097;ENST00000380057	T;T	0.78924	-1.22;-0.6	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	D	0.88284	0.6395	M	0.81802	2.56	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.997	D	0.88710	0.3222	10	0.48119	T	0.1	-12.9582	15.3381	0.74273	0.0:0.0:0.0:1.0	.	1061;882;884;1040	B7ZVX8;C9IYM8;Q6T4R5-2;Q6T4R5	.;.;.;NHS_HUMAN	P	1040;884;882	ENSP00000369400:S1040P;ENSP00000381170:S884P	ENSP00000369397:S882P	S	+	1	0	NHS	17655328	1.000000	0.71417	1.000000	0.80357	0.881000	0.50899	8.040000	0.89188	2.006000	0.58801	0.441000	0.28932	TCC		0.423	NHS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059120.1	NM_198270		3	109	0	0	0	0.009096	0	3	109				
FAM47B	170062	broad.mit.edu	37	X	34961502	34961502	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chrX:34961502G>C	ENST00000329357.5	+	1	590	c.554G>C	c.(553-555)gGg>gCg	p.G185A		NM_152631.2	NP_689844.2	Q8NA70	FA47B_HUMAN	family with sequence similarity 47, member B	185								p.G185A(1)		breast(3)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|lung(28)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	71						TATCCCTGTGGGGAATCCTGC	0.642																																							uc004ddi.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|breast(1)	4						c.(553-555)GGG>GCG		hypothetical protein LOC170062							27.0	30.0	29.0					X																	34961502		2202	4296	6498	SO:0001583	missense	170062							g.chrX:34961502G>C	BC035026	CCDS14236.1	Xp21.1	2004-08-09			ENSG00000189132	ENSG00000189132			26659	protein-coding gene	gene with protein product						14702039	Standard	NM_152631		Approved	FLJ35782	uc004ddi.2	Q8NA70	OTTHUMG00000021345	ENST00000329357.5:c.554G>C	X.37:g.34961502G>C	ENSP00000328307:p.Gly185Ala		Somatic					p.G185A	NM_152631	NP_689844	WXS	Illumina HiSeq	Unspecified	Q8NA70	FA47B_HUMAN			1	572	+			185					Q5JQN5|Q6PIG3	Missense_Mutation	SNP	ENST00000329357.5	37	c.554G>C	CCDS14236.1	.	.	.	.	.	.	.	.	.	.	G	0.178	-1.065009	0.01934	.	.	ENSG00000189132	ENST00000329357	T	0.23950	1.88	0.602	-0.433	0.12287	.	.	.	.	.	T	0.18215	0.0437	M	0.66939	2.045	0.09310	N	1	P	0.36837	0.571	B	0.30855	0.121	T	0.27536	-1.0071	8	0.10636	T	0.68	.	.	.	.	.	185	Q8NA70	FA47B_HUMAN	A	185	ENSP00000328307:G185A	ENSP00000328307:G185A	G	+	2	0	FAM47B	34871423	0.928000	0.31464	0.000000	0.03702	0.048000	0.14542	1.545000	0.36169	-0.285000	0.09089	0.292000	0.19580	GGG		0.642	FAM47B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056211.1	NM_152631		6	17	0	0	0	0.004482	0	6	17				
CXorf22	170063	broad.mit.edu	37	X	35974187	35974187	+	Silent	SNP	A	A	G			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chrX:35974187A>G	ENST00000297866.5	+	8	1350	c.1284A>G	c.(1282-1284)gaA>gaG	p.E428E		NM_152632.3	NP_689845.2	Q6ZTR5	CX022_HUMAN	chromosome X open reading frame 22	428								p.E428E(2)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(3)	44						TCATGGGTGAACGTTCAGAAA	0.363																																							uc004ddj.2		NA																	2	Substitution - coding silent(2)		lung(2)	large_intestine(1)|lung(1)|ovary(1)	3						c.(1282-1284)GAA>GAG		hypothetical protein LOC170063							80.0	75.0	77.0					X																	35974187		2202	4300	6502	SO:0001819	synonymous_variant	170063							g.chrX:35974187A>G	BC027936	CCDS14237.2	Xp21.1	2014-08-07			ENSG00000165164	ENSG00000165164			28546	protein-coding gene	gene with protein product						12477932	Standard	NM_152632		Approved	MGC34831	uc004ddj.3	Q6ZTR5	OTTHUMG00000021350	ENST00000297866.5:c.1284A>G	X.37:g.35974187A>G			Somatic				CXorf22_uc010ngv.2_RNA	p.E428E	NM_152632	NP_689845	WXS	Illumina HiSeq	Unspecified	Q6ZTR5	CX022_HUMAN			8	1343	+			428					Q5JRM8|Q8N6X8	Silent	SNP	ENST00000297866.5	37	c.1284A>G	CCDS14237.2																																																																																				0.363	CXorf22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056216.2	NM_152632		23	46	0	0	0	0.00278	0	23	46				
RBM10	8241	broad.mit.edu	37	X	47032557	47032557	+	Nonsense_Mutation	SNP	C	C	T			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chrX:47032557C>T	ENST00000377604.3	+	5	1205	c.463C>T	c.(463-465)Caa>Taa	p.Q155*	RBM10_ENST00000329236.7_Nonsense_Mutation_p.Q78*|RBM10_ENST00000345781.6_Nonsense_Mutation_p.Q78*	NM_001204467.1|NM_001204468.1|NM_005676.4	NP_001191396.1|NP_001191397.1|NP_005667.2	P98175	RBM10_HUMAN	RNA binding motif protein 10	155	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				3'-UTR-mediated mRNA stabilization (GO:0070935)|mRNA processing (GO:0006397)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|zinc ion binding (GO:0008270)	p.Q155*(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	48						GCACGGCGTGCAAGCACGGGA	0.602																																					Melanoma(171;120 2705 19495 39241)	Melanoma(171;120 2705 19495 39241)	uc004dhf.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)|large_intestine(1)|prostate(1)|breast(1)|pancreas(1)	5						c.(463-465)CAA>TAA		RNA binding motif protein 10 isoform 1							94.0	74.0	81.0					X																	47032557		2203	4300	6503	SO:0001587	stop_gained	8241				mRNA processing|RNA splicing	chromatin remodeling complex	nucleotide binding|RNA binding|zinc ion binding	g.chrX:47032557C>T	U35373	CCDS14274.1, CCDS56600.1, CCDS75969.1	Xp11.3	2014-06-09			ENSG00000182872	ENSG00000182872		"""Zinc fingers, RAN-binding domain containing"", ""G patch domain containing"", ""RNA binding motif (RRM) containing"""	9896	protein-coding gene	gene with protein product		300080				8590280, 8808293	Standard	NM_005676		Approved	DXS8237E, KIAA0122, GPATC9, ZRANB5, GPATCH9	uc004dhi.3	P98175	OTTHUMG00000021432	ENST00000377604.3:c.463C>T	X.37:g.47032557C>T	ENSP00000366829:p.Gln155*		Somatic				RBM10_uc004dhe.1_Nonsense_Mutation_p.Q145*|RBM10_uc004dhg.2_Nonsense_Mutation_p.Q78*|RBM10_uc004dhh.2_Nonsense_Mutation_p.Q155*|RBM10_uc010nhq.2_Nonsense_Mutation_p.Q78*|RBM10_uc004dhi.2_Nonsense_Mutation_p.Q220*	p.Q155*	NM_005676	NP_005667	WXS	Illumina HiSeq	Unspecified	P98175	RBM10_HUMAN			5	842	+			155			RRM 1.		C4AM81|Q14136|Q5JRR2|Q9BTE4|Q9BTX0|Q9NTB1	Nonsense_Mutation	SNP	ENST00000377604.3	37	c.463C>T	CCDS14274.1	.	.	.	.	.	.	.	.	.	.	C	39	7.334351	0.98217	.	.	ENSG00000182872	ENST00000377604;ENST00000329236;ENST00000345781	.	.	.	3.81	3.81	0.43845	.	0.157202	0.42821	D	0.000658	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	-3.4493	10.7407	0.46152	0.0:1.0:0.0:0.0	.	.	.	.	X	155;78;78	.	ENSP00000328848:Q78X	Q	+	1	0	RBM10	46917501	1.000000	0.71417	0.997000	0.53966	0.967000	0.64934	6.328000	0.72915	1.641000	0.50575	0.436000	0.28706	CAA		0.602	RBM10-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056381.1	NM_005676		9	28	0	0	0	0.008291	0	9	28				
RGAG1	57529	broad.mit.edu	37	X	109693957	109693957	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chrX:109693957G>C	ENST00000465301.2	+	3	358	c.112G>C	c.(112-114)Gac>Cac	p.D38H	RGAG1_ENST00000540313.1_Missense_Mutation_p.D38H	NM_020769.2	NP_065820.1	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1	38								p.D38H(1)		NS(1)|autonomic_ganglia(1)|breast(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	73						GACCAGAGCAGACGTACAGAT	0.463											OREG0019909	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc004eor.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)|upper_aerodigestive_tract(1)|ovary(1)	4						c.(112-114)GAC>CAC		retrotransposon gag domain containing 1							228.0	189.0	202.0					X																	109693957		2203	4300	6503	SO:0001583	missense	57529							g.chrX:109693957G>C	AY121804	CCDS14552.1	Xq23	2008-02-05			ENSG00000243978	ENSG00000243978			29245	protein-coding gene	gene with protein product						10718198, 15716091, 16093683	Standard	NM_020769		Approved	KIAA1318, Mart9, Mar9	uc004eor.2	Q8NET4	OTTHUMG00000022196	ENST00000465301.2:c.112G>C	X.37:g.109693957G>C	ENSP00000419786:p.Asp38His		Somatic	OREG0019909	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1421	RGAG1_uc011msr.1_Missense_Mutation_p.D38H	p.D38H	NM_020769	NP_065820	WXS	Illumina HiSeq	Unspecified	Q8NET4	RGAG1_HUMAN			3	358	+			38					Q9P2M8	Missense_Mutation	SNP	ENST00000465301.2	37	c.112G>C	CCDS14552.1	.	.	.	.	.	.	.	.	.	.	G	9.183	1.024174	0.19433	.	.	ENSG00000243978	ENST00000520821;ENST00000465301;ENST00000540313;ENST00000540483	T;T	0.49432	0.78;0.78	4.16	4.16	0.48862	.	0.419872	0.17405	N	0.175404	T	0.39279	0.1072	N	0.14661	0.345	0.09310	N	1	P	0.47677	0.899	P	0.51355	0.667	T	0.13415	-1.0510	9	.	.	.	-3.0746	10.762	0.46270	0.0:0.0:1.0:0.0	.	38	Q8NET4	RGAG1_HUMAN	H	38	ENSP00000419786:D38H;ENSP00000441452:D38H	.	D	+	1	0	RGAG1	109580613	0.945000	0.32115	0.032000	0.17829	0.023000	0.10783	2.940000	0.49003	2.302000	0.77476	0.600000	0.82982	GAC		0.463	RGAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057906.2	NM_020769		81	119	0	0	0	0.00361	0	81	119				
RGAG1	57529	broad.mit.edu	37	X	109696066	109696066	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chrX:109696066G>T	ENST00000465301.2	+	3	2467	c.2221G>T	c.(2221-2223)Gct>Tct	p.A741S	RGAG1_ENST00000540313.1_Missense_Mutation_p.A741S	NM_020769.2	NP_065820.1	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1	741								p.A741S(1)		NS(1)|autonomic_ganglia(1)|breast(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	73						GTCCATGACCGCTGGAGGGAT	0.512																																							uc004eor.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)|upper_aerodigestive_tract(1)|ovary(1)	4						c.(2221-2223)GCT>TCT		retrotransposon gag domain containing 1							149.0	130.0	136.0					X																	109696066		2203	4300	6503	SO:0001583	missense	57529							g.chrX:109696066G>T	AY121804	CCDS14552.1	Xq23	2008-02-05			ENSG00000243978	ENSG00000243978			29245	protein-coding gene	gene with protein product						10718198, 15716091, 16093683	Standard	NM_020769		Approved	KIAA1318, Mart9, Mar9	uc004eor.2	Q8NET4	OTTHUMG00000022196	ENST00000465301.2:c.2221G>T	X.37:g.109696066G>T	ENSP00000419786:p.Ala741Ser		Somatic				RGAG1_uc011msr.1_Missense_Mutation_p.A741S	p.A741S	NM_020769	NP_065820	WXS	Illumina HiSeq	Unspecified	Q8NET4	RGAG1_HUMAN			3	2467	+			741					Q9P2M8	Missense_Mutation	SNP	ENST00000465301.2	37	c.2221G>T	CCDS14552.1	.	.	.	.	.	.	.	.	.	.	G	0	-2.665684	0.00105	.	.	ENSG00000243978	ENST00000465301;ENST00000540313	T;T	0.41065	1.01;1.01	4.39	0.604	0.17547	.	0.652454	0.12743	N	0.442874	T	0.16428	0.0395	N	0.04508	-0.205	0.09310	N	1	B	0.10296	0.003	B	0.04013	0.001	T	0.24693	-1.0153	9	.	.	.	2.0984	4.552	0.12117	0.3204:0.0:0.3498:0.3297	.	741	Q8NET4	RGAG1_HUMAN	S	741	ENSP00000419786:A741S;ENSP00000441452:A741S	.	A	+	1	0	RGAG1	109582722	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.080000	0.03407	-0.001000	0.14495	-1.150000	0.01838	GCT		0.512	RGAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057906.2	NM_020769		37	68	1	0	1.49673e-21	0.00623	1.99564e-21	37	68				
MCF2	4168	broad.mit.edu	37	X	138687138	138687138	+	Nonsense_Mutation	SNP	A	A	C			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chrX:138687138A>C	ENST00000370576.4	-	14	1772	c.1563T>G	c.(1561-1563)taT>taG	p.Y521*	MCF2_ENST00000338585.6_Nonsense_Mutation_p.Y537*|MCF2_ENST00000536274.1_Nonsense_Mutation_p.Y482*|MCF2_ENST00000414978.1_Nonsense_Mutation_p.Y581*|MCF2_ENST00000520602.1_Nonsense_Mutation_p.Y581*|MCF2_ENST00000519895.1_Nonsense_Mutation_p.Y597*|MCF2_ENST00000370578.4_Nonsense_Mutation_p.Y666*|MCF2_ENST00000483690.1_5'Flank|MCF2_ENST00000370573.4_Nonsense_Mutation_p.Y521*	NM_001171879.1|NM_005369.4	NP_001165350.1|NP_005360.3	P10911	MCF2_HUMAN	MCF.2 cell line derived transforming sequence	521	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|dendrite development (GO:0016358)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.Y521*(2)|p.Y597*(1)		NS(2)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(15)|lung(34)|pancreas(1)|pleura(1)|prostate(1)	62	Acute lymphoblastic leukemia(192;0.000127)					TCTCCGCTCTATAACCCTACC	0.353																																							uc004fau.2		NA																	3	Substitution - Nonsense(3)		lung(3)	lung(1)|pleura(1)	2						c.(1561-1563)TAT>TAG		MCF.2 cell line derived transforming sequence							112.0	102.0	105.0					X																	138687138		2203	4300	6503	SO:0001587	stop_gained	4168				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytoskeleton|cytosol|membrane|membrane fraction	protein binding|Rho guanyl-nucleotide exchange factor activity	g.chrX:138687138A>C		CCDS14667.1, CCDS48175.1, CCDS55514.1, CCDS55515.1, CCDS55516.1, CCDS55517.1	Xq26.3-q27.1	2012-07-24			ENSG00000101977	ENSG00000101977		"""Rho guanine nucleotide exchange factors"""	6940	protein-coding gene	gene with protein product	"""Oncogene MCF2 (oncogene DBL)"""	311030				2577874, 1611909	Standard	NM_001099855		Approved	DBL, ARHGEF21	uc011mwo.1	P10911	OTTHUMG00000022537	ENST00000370576.4:c.1563T>G	X.37:g.138687138A>C	ENSP00000359608:p.Tyr521*		Somatic				MCF2_uc004fav.2_Nonsense_Mutation_p.Y537*|MCF2_uc011mwl.1_Nonsense_Mutation_p.Y498*|MCF2_uc010nsh.1_Nonsense_Mutation_p.Y521*|MCF2_uc011mwm.1_Nonsense_Mutation_p.Y482*|MCF2_uc011mwn.1_Nonsense_Mutation_p.Y666*|MCF2_uc004faw.2_Nonsense_Mutation_p.Y581*|MCF2_uc011mwo.1_Nonsense_Mutation_p.Y597*	p.Y521*	NM_005369	NP_005360	WXS	Illumina HiSeq	Unspecified	P10911	MCF2_HUMAN			14	1857	-	Acute lymphoblastic leukemia(192;0.000127)		521			DH.		B7Z3Y5|B7Z869|B7ZAV1|E9PH77|F5H091|P14919|Q5JYJ2|Q5JYJ3|Q5JYJ4|Q8IUF3|Q8IUF4|Q9UJB3	Nonsense_Mutation	SNP	ENST00000370576.4	37	c.1563T>G	CCDS14667.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	36|36	5.721901|5.721901	0.96839|0.96839	.|.	.|.	ENSG00000101977|ENSG00000101977	ENST00000437564|ENST00000520602;ENST00000370576;ENST00000536274;ENST00000370578;ENST00000414978;ENST00000446225;ENST00000519895;ENST00000370573;ENST00000338585	.|.	.|.	.|.	5.35|5.35	-3.35|-3.35	0.04928|0.04928	.|.	.|0.058579	.|0.64402	.|D	.|0.000001	.|.	.|.	.|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|0.02654	.|T	.|1	.|.	16.157|16.157	0.81675|0.81675	0.238:0.0:0.762:0.0|0.238:0.0:0.762:0.0	.|.	.|.	.|.	.|.	E|X	25|581;521;482;666;581;124;597;521;537	.|.	.|ENSP00000342204:Y537X	X|Y	-|-	1|3	0|2	MCF2|MCF2	138514804|138514804	1.000000|1.000000	0.71417|0.71417	0.056000|0.056000	0.19401|0.19401	0.693000|0.693000	0.40251|0.40251	0.824000|0.824000	0.27379|0.27379	-0.866000|-0.866000	0.04068|0.04068	0.441000|0.441000	0.28932|0.28932	TAG|TAT		0.353	MCF2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058560.1	NM_005369		20	23	0	0	0	0.010504	0	20	23				
UTY	7404	broad.mit.edu	37	Y	15467250	15467250	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chrY:15467250C>G	ENST00000331397.4	-	15	2410	c.1403G>C	c.(1402-1404)cGa>cCa	p.R468P	UTY_ENST00000382896.4_Missense_Mutation_p.R513P|UTY_ENST00000538878.1_Missense_Mutation_p.R435P|UTY_ENST00000540140.1_Missense_Mutation_p.R465P|UTY_ENST00000362096.4_Missense_Mutation_p.R468P|UTY_ENST00000329134.5_Missense_Mutation_p.R468P|UTY_ENST00000537580.1_Intron|UTY_ENST00000545955.1_Missense_Mutation_p.R543P	NM_001258267.1|NM_007125.4	NP_001245196.1|NP_009056.3	O14607	UTY_HUMAN	ubiquitously transcribed tetratricopeptide repeat containing, Y-linked	468					regulation of gene expression (GO:0010468)	nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)	p.R468P(2)		kidney(1)|lung(6)	7						TCCAGTAGTTCGTACCTGAGC	0.383																																					Colon(103;1740 2135 40732 45171)	Colon(103;1740 2135 40732 45171)	uc004fsx.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(1402-1404)CGA>CCA		tetratricopeptide repeat protein isoform 3							56.0	58.0	58.0					Y																	15467250		600	1933	2533	SO:0001583	missense	7404				chromatin modification	nucleus	metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen	g.chrY:15467250C>G	AF000994	CCDS14783.1, CCDS14784.1, CCDS14785.1, CCDS59184.1, CCDS76073.1, CCDS76074.1, CCDS76075.1, CCDS76076.1, CCDS76077.1, CCDS76078.1, CCDS76079.1	Yq11.221	2013-11-04	2012-11-15		ENSG00000183878	ENSG00000183878		"""Tetratricopeptide (TTC) repeat domain containing"""	12638	protein-coding gene	gene with protein product		400009	"""ubiquitously transcribed tetratricopeptide repeat gene, Y chromosome"", ""ubiquitously transcribed tetratricopeptide repeat gene, Y-linked"""			8944031, 9499428	Standard	NM_182659		Approved	KDM6AL	uc022ckf.2	O14607	OTTHUMG00000036319	ENST00000331397.4:c.1403G>C	Y.37:g.15467250C>G	ENSP00000328939:p.Arg468Pro		Somatic				UTY_uc004fsw.1_Missense_Mutation_p.R131P|UTY_uc010nwx.1_5'UTR|UTY_uc004fsy.2_Missense_Mutation_p.R468P|UTY_uc004fsz.2_Missense_Mutation_p.R468P	p.R468P	NM_007125	NP_009056	WXS	Illumina HiSeq	Unspecified	O14607	UTY_HUMAN			15	2408	-			468					A8K9Z3|E1U199|E1U1A0|F5H4V7|F8W8R7|O14608	Missense_Mutation	SNP	ENST00000331397.4	37	c.1403G>C	CCDS14783.1																																																																																				0.383	UTY-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000088394.1	NM_182660		5	25	0	0	0	0.004482	0	5	25				
RIMBP2	23504	broad.mit.edu	37	12	130912881	130912881	+	Splice_Site	DEL	G	G	-	rs373642018		TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr12:130912881delG	ENST00000261655.4	-	12	2367	c.2204delC	c.(2203-2205)ccg>cg	p.P735fs		NM_015347.4	NP_056162.4	O15034	RIMB2_HUMAN	RIMS binding protein 2	735					negative regulation of phosphatase activity (GO:0010923)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|synapse (GO:0045202)				NS(2)|breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(33)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	96	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		GCAACAGTGCGGCTGGGGGCC	0.587																																							uc001uil.2		NA																	0				upper_aerodigestive_tract(3)|ovary(3)|large_intestine(2)|central_nervous_system(2)|pancreas(1)	11						c.(2203-2205)CCGfs		RIM-binding protein 2							52.0	50.0	51.0					12																	130912881		2203	4300	6503	SO:0001630	splice_region_variant	23504					cell junction|synapse		g.chr12:130912881delG	AB002316	CCDS31925.1	12q24.33	2014-06-13				ENSG00000060709			30339	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 133"""	611602				10748113	Standard	NM_015347		Approved	KIAA0318, RBP2, MGC15831, RIM-BP2, PPP1R133	uc001uil.2	O15034		ENST00000261655.4:c.2203-1C>-	12.37:g.130912881delG			Somatic					p.P735fs	NM_015347	NP_056162	WXS	Illumina HiSeq	Unspecified	O15034	RIMB2_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)	12	2368	-	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)	735					Q96ID2	Frame_Shift_Del	DEL	ENST00000261655.4	37	c.2204delC	CCDS31925.1																																																																																				0.587	RIMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399520.1	NM_015347	Frame_Shift_Del	27	100	NA	NA	NA	NA	NA	27	100	---	---	---	---
DHODH	1723	broad.mit.edu	37	16	72050929	72050931	+	In_Frame_Del	DEL	ATT	ATT	-			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	ATT	ATT	-	-	ATT	ATT	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr16:72050929_72050931delATT	ENST00000219240.4	+	4	462_464	c.441_443delATT	c.(439-444)ggattt>ggt	p.F148del	DHODH_ENST00000573922.1_3'UTR|DHODH_ENST00000572887.1_In_Frame_Del_p.F148del	NM_001361.4	NP_001352.2	Q02127	PYRD_HUMAN	dihydroorotate dehydrogenase (quinone)	148	Substrate binding.				'de novo' pyrimidine nucleobase biosynthetic process (GO:0006207)|'de novo' UMP biosynthetic process (GO:0044205)|female pregnancy (GO:0007565)|lactation (GO:0007595)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of apoptotic process (GO:0043065)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside biosynthetic process (GO:0046134)|regulation of mitochondrial fission (GO:0090140)|response to caffeine (GO:0031000)|response to drug (GO:0042493)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|neuronal cell body (GO:0043025)	dihydroorotate dehydrogenase activity (GO:0004152)|dihydroorotate oxidase activity (GO:0004158)|drug binding (GO:0008144)|FMN binding (GO:0010181)|ubiquinone binding (GO:0048039)			breast(1)|endometrium(2)|large_intestine(4)|ovary(1)|skin(1)|stomach(1)	10		Ovarian(137;0.125)			Atovaquone(DB01117)|Leflunomide(DB01097)|Teriflunomide(DB08880)	GCAGGTATGGATTTAACAGTCAC	0.512																																							uc002fbp.2		NA																	0					0						c.(439-444)GGATTT>GGT		dihydroorotate dehydrogenase precursor	Atovaquone(DB01117)|Leflunomide(DB01097)																																			SO:0001651	inframe_deletion	1723				'de novo' pyrimidine base biosynthetic process|pyrimidine nucleoside biosynthetic process|UMP biosynthetic process	integral to membrane|mitochondrial inner membrane	dihydroorotate oxidase activity	g.chr16:72050929_72050931delATT		CCDS42192.1	16q22.2	2012-10-02	2011-09-05		ENSG00000102967	ENSG00000102967	1.3.5.2		2867	protein-coding gene	gene with protein product		126064	"""dihydroorotate dehydrogenase"""			8211381	Standard	NM_001361		Approved		uc002fbp.3	Q02127	OTTHUMG00000178093	ENST00000219240.4:c.441_443delATT	16.37:g.72050929_72050931delATT	ENSP00000219240:p.Phe148del		Somatic				DHODH_uc010cgk.2_RNA	p.F148del	NM_001361	NP_001352	WXS	Illumina HiSeq	Unspecified	Q02127	PYRD_HUMAN			4	462_464	+		Ovarian(137;0.125)	148			Mitochondrial intermembrane (By similarity).|Substrate binding.		A8K8C8|Q6P176	In_Frame_Del	DEL	ENST00000219240.4	37	c.441_443delATT	CCDS42192.1																																																																																				0.512	DHODH-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_001361		22	79	NA	NA	NA	NA	NA	22	79	---	---	---	---
HSDL1	83693	broad.mit.edu	37	16	84164817	84164818	+	Frame_Shift_Ins	INS	-	-	T			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr16:84164817_84164818insT	ENST00000219439.4	-	3	285_286	c.109_110insA	c.(109-111)agcfs	p.S37fs	HSDL1_ENST00000434463.3_Frame_Shift_Ins_p.S37fs	NM_001146051.1|NM_031463.4	NP_001139523.1|NP_113651.4	Q3SXM5	HSDL1_HUMAN	hydroxysteroid dehydrogenase like 1	37	Required for mitochondria translocation.					mitochondrion (GO:0005739)	oxidoreductase activity (GO:0016491)			endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	7						GACAGTGATGCTTTTTCTGGCC	0.49																																							uc002fhk.2		NA																	0					0						c.(109-111)AGCfs		hydroxysteroid dehydrogenase like 1 isoform a																																				SO:0001589	frameshift_variant	83693					mitochondrion	oxidoreductase activity|protein binding	g.chr16:84164817_84164818insT	AF237684	CCDS10942.1, CCDS54046.1	16q24	2011-09-20			ENSG00000103160	ENSG00000103160		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	16475	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 12C, member 3"""					12153137, 19027726	Standard	NM_031463		Approved	SDR12C3	uc002fhk.2	Q3SXM5	OTTHUMG00000137635	ENST00000219439.4:c.110dupA	16.37:g.84164822_84164822dupT	ENSP00000219439:p.Ser37fs		Somatic				HSDL1_uc010vnv.1_Frame_Shift_Ins_p.S37fs	p.S37fs	NM_031463	NP_113651	WXS	Illumina HiSeq	Unspecified	Q3SXM5	HSDL1_HUMAN			3	293_294	-			37			Required for mitochondria translocation.		B4DSL2|D3DUL4|Q3SXM4|Q8NC98|Q9BY22	Frame_Shift_Ins	INS	ENST00000219439.4	37	c.109_110insA	CCDS10942.1																																																																																				0.490	HSDL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269076.3	NM_031463		36	153	NA	NA	NA	NA	NA	36	153	---	---	---	---
ZNF831	128611	broad.mit.edu	37	20	57766823	57766823	+	Frame_Shift_Del	DEL	C	C	-			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr20:57766823delC	ENST00000371030.2	+	1	749	c.749delC	c.(748-750)gccfs	p.A250fs		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	250							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					TCTCCGGGTGCCCACGTGCCC	0.667																																							uc002yan.2		NA																	0				skin(13)|ovary(1)	14						c.(748-750)GCCfs		zinc finger protein 831							38.0	45.0	43.0					20																	57766823		1949	4138	6087	SO:0001589	frameshift_variant	128611					intracellular	nucleic acid binding|zinc ion binding	g.chr20:57766823delC	AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.749delC	20.37:g.57766823delC	ENSP00000360069:p.Ala250fs		Somatic					p.A250fs	NM_178457	NP_848552	WXS	Illumina HiSeq	Unspecified	Q5JPB2	ZN831_HUMAN			1	749	+	all_lung(29;0.0085)		250					Q5TDR4|Q8TCP0	Frame_Shift_Del	DEL	ENST00000371030.2	37	c.749delC	CCDS42894.1																																																																																				0.667	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000079916.2	NM_178457		35	121	NA	NA	NA	NA	NA	35	121	---	---	---	---
HS3ST5	222537	broad.mit.edu	37	6	114379073	114379075	+	In_Frame_Del	DEL	TCA	TCA	-			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	TCA	TCA	-	-	TCA	TCA	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr6:114379073_114379075delTCA	ENST00000312719.5	-	5	1575_1577	c.387_389delTGA	c.(385-390)gatgag>gag	p.D129del	RP3-399L15.3_ENST00000519104.1_RNA|RP3-399L15.3_ENST00000519270.1_RNA|RP3-399L15.3_ENST00000523087.1_RNA|HS3ST5_ENST00000411826.1_In_Frame_Del_p.D129del			Q8IZT8	HS3S5_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 5	129					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process, enzymatic modification (GO:0015015)|negative regulation of coagulation (GO:0050819)|protein sulfation (GO:0006477)|regulation of viral entry into host cell (GO:0046596)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity (GO:0008467)			breast(4)|endometrium(2)|kidney(1)|large_intestine(7)|lung(17)|ovary(1)|pancreas(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)	41		all_cancers(87;0.0587)|Colorectal(196;0.0676)|all_epithelial(87;0.154)		OV - Ovarian serous cystadenocarcinoma(136;0.00937)|all cancers(137;0.0117)|Epithelial(106;0.0274)|GBM - Glioblastoma multiforme(226;0.143)		ACCATAATTCTCATCATTATCAA	0.429																																							uc003pwg.3		NA																	0				ovary(1)|pancreas(1)	2						c.(385-390)GATGAG>GAG		heparan sulfate (glucosamine)																																				SO:0001651	inframe_deletion	222537				heparan sulfate proteoglycan biosynthetic process, enzymatic modification|negative regulation of coagulation|protein sulfation|regulation of virion penetration into host cell	Golgi membrane|integral to membrane	3'-phosphoadenosine 5'-phosphosulfate binding|[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity|protein binding	g.chr6:114379073_114379075delTCA	AF503292	CCDS34517.1	6q21	2011-11-16			ENSG00000249853	ENSG00000249853		"""Sulfotransferases, membrane-bound"""	19419	protein-coding gene	gene with protein product		609407				12138164	Standard	NM_153612		Approved	3-OST-5	uc003pwg.4	Q8IZT8	OTTHUMG00000015412	ENST00000312719.5:c.387_389delTGA	6.37:g.114379076_114379078delTCA	ENSP00000427888:p.Asp129del		Somatic				uc003pwf.2_Intron|HS3ST5_uc003pwh.3_In_Frame_Del_p.D129del	p.D129del	NM_153612	NP_705840	WXS	Illumina HiSeq	Unspecified	Q8IZT8	HS3S5_HUMAN		OV - Ovarian serous cystadenocarcinoma(136;0.00937)|all cancers(137;0.0117)|Epithelial(106;0.0274)|GBM - Glioblastoma multiforme(226;0.143)	2	419_421	-		all_cancers(87;0.0587)|Colorectal(196;0.0676)|all_epithelial(87;0.154)	129			Lumenal (Potential).		A8K1J2|Q52LI2|Q8N285	In_Frame_Del	DEL	ENST00000312719.5	37	c.387_389delTGA	CCDS34517.1																																																																																				0.429	HS3ST5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041911.2	NM_153612		39	256	NA	NA	NA	NA	NA	39	256	---	---	---	---
TAAR5	9038	broad.mit.edu	37	6	132910150	132910151	+	Frame_Shift_Ins	INS	-	-	A			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr6:132910150_132910151insA	ENST00000258034.2	-	1	726_727	c.675_676insT	c.(673-678)gttgctfs	p.A226fs		NM_003967.2	NP_003958.2	O14804	TAAR5_HUMAN	trace amine associated receptor 5	226					G-protein coupled receptor signaling pathway (GO:0007186)|sensory perception of chemical stimulus (GO:0007606)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|trimethylamine receptor activity (GO:1990081)			breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	32	Breast(56;0.112)			OV - Ovarian serous cystadenocarcinoma(155;0.00604)|GBM - Glioblastoma multiforme(226;0.015)		TGTCTGGTAGCAACCACAAAGA	0.5																																							uc003qdk.2		NA																	0				skin(1)	1						c.(673-678)GTTGCTfs		trace amine associated receptor 5																																				SO:0001589	frameshift_variant	9038				synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity	g.chr6:132910150_132910151insA	AF021818	CCDS5156.1	6q23.2	2012-08-08			ENSG00000135569	ENSG00000135569		"""GPCR / Class A : Trace amine associated receptors"""	30236	protein-coding gene	gene with protein product		607405				9464258, 15718104	Standard	NM_003967		Approved	PNR	uc003qdk.2	O14804	OTTHUMG00000015581	ENST00000258034.2:c.676dupT	6.37:g.132910152_132910152dupA	ENSP00000258034:p.Ala226fs		Somatic					p.V225fs	NM_003967	NP_003958	WXS	Illumina HiSeq	Unspecified	O14804	TAAR5_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;0.00604)|GBM - Glioblastoma multiforme(226;0.015)	1	727_728	-	Breast(56;0.112)		225_226			Cytoplasmic (Potential).		D8KZS1|Q2M1V1|Q4VBL1|Q5VUQ3|Q6NTA8	Frame_Shift_Ins	INS	ENST00000258034.2	37	c.675_676insT	CCDS5156.1																																																																																				0.500	TAAR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042257.1	NM_003967		17	104	NA	NA	NA	NA	NA	17	104	---	---	---	---
SYNE1	23345	broad.mit.edu	37	6	152557353	152557353	+	Frame_Shift_Del	DEL	C	C	-			TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr6:152557353delC	ENST00000367255.5	-	110	20886	c.20285delG	c.(20284-20286)tgcfs	p.C6762fs	SYNE1_ENST00000341594.5_Frame_Shift_Del_p.C6374fs|SYNE1_ENST00000448038.1_Frame_Shift_Del_p.C6691fs|SYNE1_ENST00000265368.4_Frame_Shift_Del_p.C6762fs|SYNE1_ENST00000423061.1_Frame_Shift_Del_p.C6691fs|SYNE1_ENST00000356820.4_Frame_Shift_Del_p.C1286fs	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	6762					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TAGATCTGAGCAGCTGATGGA	0.343										HNSCC(10;0.0054)																													uc010kiw.2		NA																	0				central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45						c.(20284-20286)TGCfs		spectrin repeat containing, nuclear envelope 1							153.0	147.0	149.0					6																	152557353		2203	4300	6503	SO:0001589	frameshift_variant	23345				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding	g.chr6:152557353delC	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.20285delG	6.37:g.152557353delC	ENSP00000356224:p.Cys6762fs	HNSCC(10;0.0054)	Somatic				SYNE1_uc010kiv.2_Frame_Shift_Del_p.C1286fs|SYNE1_uc003qos.3_Frame_Shift_Del_p.C1286fs|SYNE1_uc003qot.3_Frame_Shift_Del_p.C6691fs|SYNE1_uc003qou.3_Frame_Shift_Del_p.C6762fs	p.C6762fs	NM_182961	NP_892006	WXS	Illumina HiSeq	Unspecified	Q8NF91	SYNE1_HUMAN	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)	110	20887	-		Ovarian(120;0.0955)	6762			Cytoplasmic (Potential).		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Frame_Shift_Del	DEL	ENST00000367255.5	37	c.20285delG	CCDS5236.2																																																																																				0.343	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961		42	123	NA	NA	NA	NA	NA	42	123	---	---	---	---
KAT6A	7994	broad.mit.edu	37	8	41798420	41798422	+	In_Frame_Del	DEL	CTC	CTC	-	rs139076845		TCGA-05-4403-01A-01D-1265-08	TCGA-05-4403-10A-01D-1265-08	CTC	CTC	-	-	CTC	CTC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f	a17b5d32-f570-4d2d-9e97-f8b01de1be9f	g.chr8:41798420_41798422delCTC	ENST00000396930.3	-	16	3520_3522	c.2977_2979delGAG	c.(2977-2979)gagdel	p.E993del	KAT6A_ENST00000406337.1_In_Frame_Del_p.E993del|KAT6A_ENST00000265713.2_In_Frame_Del_p.E993del	NM_001099412.1	NP_001092882.1	Q92794	KAT6A_HUMAN	K(lysine) acetyltransferase 6A	993	Poly-Glu.				aorta morphogenesis (GO:0035909)|cellular senescence (GO:0090398)|chromatin organization (GO:0006325)|DNA packaging (GO:0006323)|embryonic hemopoiesis (GO:0035162)|face morphogenesis (GO:0060325)|heart morphogenesis (GO:0003007)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|myeloid cell differentiation (GO:0030099)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|protein acetylation (GO:0006473)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|PML body (GO:0016605)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)										GGCTTTCCGGCTCCTCCTCCTCC	0.567																																							uc010lxb.2		NA																	0				ovary(4)|pancreas(1)|central_nervous_system(1)|skin(1)	7						c.(2977-2979)GAGdel		MYST histone acetyltransferase (monocytic																																				SO:0001651	inframe_deletion	7994				histone H3 acetylation|myeloid cell differentiation|negative regulation of transcription, DNA-dependent|nucleosome assembly|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	MOZ/MORF histone acetyltransferase complex|nucleosome	DNA binding|histone acetyltransferase activity|transcription coactivator activity|transcription factor binding|zinc ion binding	g.chr8:41798420_41798422delCTC	U47742	CCDS6124.1	8p11	2013-01-28	2011-07-21	2011-07-21	ENSG00000083168	ENSG00000083168		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	13013	protein-coding gene	gene with protein product	"""Monocytic leukemia zinc finger protein"""	601408	"""runt-related transcription factor binding protein 2"", ""MYST histone acetyltransferase (monocytic leukemia) 3"""	ZNF220, RUNXBP2, MYST3		8849440, 8782817	Standard	NM_001099412		Approved	MOZ, ZC2HC6A	uc003xon.4	Q92794	OTTHUMG00000150453	ENST00000396930.3:c.2977_2979delGAG	8.37:g.41798429_41798431delCTC	ENSP00000380136:p.Glu993del		Somatic				MYST3_uc010lxc.2_In_Frame_Del_p.E993del|MYST3_uc003xon.3_In_Frame_Del_p.E993del	p.E993del	NM_001099412	NP_001092882	WXS	Illumina HiSeq	Unspecified	Q92794	MYST3_HUMAN	Epithelial(1;2.82e-19)|all cancers(1;1.15e-16)|BRCA - Breast invasive adenocarcinoma(8;9.17e-11)|OV - Ovarian serous cystadenocarcinoma(14;9.4e-05)|Colorectal(10;0.000728)|Lung(22;0.00153)|LUSC - Lung squamous cell carcinoma(45;0.00741)|COAD - Colon adenocarcinoma(11;0.0171)		16	3521_3523	-	all_epithelial(6;1.12e-27)|all_lung(13;3.94e-12)|Lung NSC(13;6.54e-11)|Ovarian(28;0.00744)|Prostate(17;0.0119)|Colorectal(14;0.0221)|Lung SC(25;0.211)	all_lung(54;0.000294)|Lung NSC(58;0.00105)|Hepatocellular(245;0.0524)|Esophageal squamous(32;0.0954)|Renal(179;0.0983)	993			Poly-Glu.		Q76L81	In_Frame_Del	DEL	ENST00000396930.3	37	c.2977_2979delGAG	CCDS6124.1																																																																																				0.567	KAT6A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318163.1	NM_006766		8	285	NA	NA	NA	NA	NA	8	285	---	---	---	---
