#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
DNAJC11	55735	broad.mit.edu	37	1	6712898	6712898	+	Silent	SNP	T	T	G			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr1:6712898T>G	ENST00000377577.5	-	6	744	c.621A>C	c.(619-621)ggA>ggC	p.G207G	DNAJC11_ENST00000542246.1_Silent_p.G169G|DNAJC11_ENST00000377573.5_Silent_p.G117G|DNAJC11_ENST00000349363.6_Silent_p.G169G|DNAJC11_ENST00000294401.7_Silent_p.G207G	NM_018198.3	NP_060668.2	Q9NVH1	DJC11_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 11	207						extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)		p.G207G(2)		NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(11)|lung(8)|ovary(2)|skin(1)|urinary_tract(1)	32	Ovarian(185;0.0265)|all_lung(157;0.154)	all_cancers(23;1.97e-27)|all_epithelial(116;1.76e-17)|all_lung(118;2.27e-05)|Lung NSC(185;9.97e-05)|Renal(390;0.00188)|Breast(487;0.00289)|Colorectal(325;0.00342)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.156)		Colorectal(212;2.34e-07)|COAD - Colon adenocarcinoma(227;2.05e-05)|Kidney(185;7.67e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000639)|KIRC - Kidney renal clear cell carcinoma(229;0.00128)|STAD - Stomach adenocarcinoma(132;0.00179)|READ - Rectum adenocarcinoma(331;0.0649)		CCTCTCCCCATCCCTTTGCCG	0.478																																							uc001aof.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)|skin(1)	2						c.(619-621)GGA>GGC		DnaJ (Hsp40) homolog, subfamily C, member 11							140.0	136.0	137.0					1																	6712898		2203	4300	6503	SO:0001819	synonymous_variant	55735				protein folding		heat shock protein binding|unfolded protein binding	g.chr1:6712898T>G	AF306695	CCDS87.1	1p36.23	2011-09-02			ENSG00000007923	ENSG00000007923		"""Heat shock proteins / DNAJ (HSP40)"""	25570	protein-coding gene	gene with protein product		614827				12964007	Standard	NM_018198		Approved	FLJ10737	uc001aof.2	Q9NVH1	OTTHUMG00000001443	ENST00000377577.5:c.621A>C	1.37:g.6712898T>G			Somatic				DNAJC11_uc010nzt.1_Silent_p.G169G|DNAJC11_uc001aog.2_Silent_p.G207G|DNAJC11_uc010nzu.1_Silent_p.G117G	p.G207G	NM_018198	NP_060668	WXS	Illumina HiSeq	Unspecified	Q9NVH1	DJC11_HUMAN		Colorectal(212;2.34e-07)|COAD - Colon adenocarcinoma(227;2.05e-05)|Kidney(185;7.67e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000639)|KIRC - Kidney renal clear cell carcinoma(229;0.00128)|STAD - Stomach adenocarcinoma(132;0.00179)|READ - Rectum adenocarcinoma(331;0.0649)	6	727	-	Ovarian(185;0.0265)|all_lung(157;0.154)	all_cancers(23;1.97e-27)|all_epithelial(116;1.76e-17)|all_lung(118;2.27e-05)|Lung NSC(185;9.97e-05)|Renal(390;0.00188)|Breast(487;0.00289)|Colorectal(325;0.00342)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.156)	207					Q4VWF5|Q5VZN0|Q6PK20|Q6PK70|Q8NDM2|Q96CL7	Silent	SNP	ENST00000377577.5	37	c.621A>C	CCDS87.1																																																																																				0.478	DNAJC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004216.3	NM_018198		3	111	0	0	0	0.000248	0	3	111				
PTCHD2	57540	broad.mit.edu	37	1	11561596	11561596	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr1:11561596C>A	ENST00000294484.6	+	2	685	c.547C>A	c.(547-549)Cca>Aca	p.P183T	PTCHD2_ENST00000389575.3_Missense_Mutation_p.P183T	NM_020780.1	NP_065831.1	Q9P2K9	PTHD2_HUMAN	patched domain containing 2	183					cholesterol homeostasis (GO:0042632)|regulation of lipid transport (GO:0032368)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	hedgehog receptor activity (GO:0008158)	p.P400T(1)		NS(3)|breast(2)|endometrium(9)|kidney(4)|large_intestine(5)|lung(34)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	76	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)		ACTCGGTGGCCCAGGCCCTTA	0.692																																							uc001ash.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|ovary(2)|pancreas(1)|breast(1)	7						c.(547-549)CCA>ACA		patched domain containing 2							12.0	15.0	14.0					1																	11561596		1914	4115	6029	SO:0001583	missense	57540				cholesterol homeostasis|regulation of lipid transport|smoothened signaling pathway	endoplasmic reticulum|integral to membrane|nuclear membrane	hedgehog receptor activity	g.chr1:11561596C>A	AB037758	CCDS41247.1	1p36.22	2010-02-17			ENSG00000204624	ENSG00000204624			29251	protein-coding gene	gene with protein product		611251				15738394	Standard	NM_020780		Approved	KIAA1337, DISP3	uc001ash.4	Q9P2K9	OTTHUMG00000002074	ENST00000294484.6:c.547C>A	1.37:g.11561596C>A	ENSP00000294484:p.Pro183Thr		Somatic				PTCHD2_uc001asi.1_Missense_Mutation_p.P183T	p.P183T	NM_020780	NP_065831	WXS	Illumina HiSeq	Unspecified	Q9P2K9	PTHD2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)	2	685	+	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)	183			Extracellular (Potential).		Q5VTU9|Q9UJD6	Missense_Mutation	SNP	ENST00000294484.6	37	c.547C>A	CCDS41247.1	.	.	.	.	.	.	.	.	.	.	C	1.270	-0.613438	0.03690	.	.	ENSG00000204624	ENST00000294484;ENST00000389575	T;T	0.22336	1.96;1.96	2.91	1.96	0.26148	.	.	.	.	.	T	0.10895	0.0266	N	0.14661	0.345	0.09310	N	1	B	0.26975	0.165	B	0.21360	0.034	T	0.24799	-1.0150	9	0.45353	T	0.12	.	6.0268	0.19660	0.1986:0.5707:0.2307:0.0	.	183	Q9P2K9	PTHD2_HUMAN	T	183	ENSP00000294484:P183T;ENSP00000374226:P183T	ENSP00000294484:P183T	P	+	1	0	PTCHD2	11484183	0.000000	0.05858	0.014000	0.15608	0.024000	0.10985	0.377000	0.20552	0.507000	0.28148	0.561000	0.74099	CCA		0.692	PTCHD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000005770.2	XM_052561		7	13	1	0	8.12818e-05	0.001984	0.000131796	7	13				
DRAXIN	374946	broad.mit.edu	37	1	11769501	11769501	+	Silent	SNP	C	C	G			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr1:11769501C>G	ENST00000294485.5	+	3	756	c.621C>G	c.(619-621)ccC>ccG	p.P207P		NM_198545.3	NP_940947.3			dorsal inhibitory axon guidance protein									p.P207P(2)									TGATCCTGCCCGTCACCTCCC	0.587																																							uc001asr.1		NA																	2	Substitution - coding silent(2)		large_intestine(1)|lung(1)		0						c.(619-621)CCC>CCG		chromosome 1 open reading frame 187 precursor							60.0	46.0	51.0					1																	11769501		2203	4300	6503	SO:0001819	synonymous_variant	374946				axon guidance|commissural neuron differentiation in spinal cord|dorsal spinal cord development|forebrain development|negative regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	extracellular region		g.chr1:11769501C>G	AY358750	CCDS135.1	1p36.22	2012-08-20	2012-08-14	2012-08-14	ENSG00000162490	ENSG00000162490			25054	protein-coding gene	gene with protein product	"""dorsal repulsive axon guidance protein"", ""neural tissue-specific cysteine-rich protein"""	612682	"""chromosome 1 open reading frame 187"""	C1orf187		19150847	Standard	NM_198545		Approved	FLJ34999, Draxin, Neucrin	uc001asr.1	Q8NBI3	OTTHUMG00000002227	ENST00000294485.5:c.621C>G	1.37:g.11769501C>G			Somatic					p.P207P	NM_198545	NP_940947	WXS	Illumina HiSeq	Unspecified	Q8NBI3	DRAXI_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.48e-06)|COAD - Colon adenocarcinoma(227;0.000283)|BRCA - Breast invasive adenocarcinoma(304;0.000316)|Kidney(185;0.000841)|KIRC - Kidney renal clear cell carcinoma(229;0.00269)|STAD - Stomach adenocarcinoma(313;0.00754)|READ - Rectum adenocarcinoma(331;0.0651)	3	761	+	Ovarian(185;0.249)	Lung NSC(185;4.15e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00826)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)	207						Silent	SNP	ENST00000294485.5	37	c.621C>G	CCDS135.1																																																																																				0.587	DRAXIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006325.1	NM_198545		7	11	0	0	0	0.00308	0	7	11				
CROCC	9696	broad.mit.edu	37	1	17272844	17272844	+	Missense_Mutation	SNP	G	G	A	rs368304788		TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr1:17272844G>A	ENST00000375541.5	+	16	2296	c.2227G>A	c.(2227-2229)Gcc>Acc	p.A743T	CROCC_ENST00000467938.1_3'UTR	NM_014675.3	NP_055490.3			ciliary rootlet coiled-coil, rootletin									p.A743T(1)		breast(3)|central_nervous_system(2)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(1)|lung(20)|ovary(3)|prostate(9)|skin(3)|urinary_tract(1)	62		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		CAAGCTGAGCGCCCTCAACGA	0.657																																							uc001azt.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|breast(2)|central_nervous_system(1)	5						c.(2227-2229)GCC>ACC		ciliary rootlet coiled-coil		G	THR/ALA	1,4401	2.1+/-5.4	0,1,2200	58.0	56.0	56.0		2227	4.3	1.0	1		56	0,8594		0,0,4297	no	missense	CROCC	NM_014675.3	58	0,1,6497	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	743/2018	17272844	1,12995	2201	4297	6498	SO:0001583	missense	9696				cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity	g.chr1:17272844G>A	AB007914	CCDS30616.1	1p36.13	2010-06-04	2009-03-04	2009-03-04	ENSG00000058453	ENSG00000058453			21299	protein-coding gene	gene with protein product	"""rootletin, ciliary rootlet protein"""	615776				12427867, 17971504	Standard	XM_006711056		Approved	rootletin, ROLT	uc001azt.2	Q5TZA2	OTTHUMG00000002200	ENST00000375541.5:c.2227G>A	1.37:g.17272844G>A	ENSP00000364691:p.Ala743Thr		Somatic				CROCC_uc009voz.1_Missense_Mutation_p.A506T|CROCC_uc001azu.2_Missense_Mutation_p.A46T	p.A743T	NM_014675	NP_055490	WXS	Illumina HiSeq	Unspecified	Q5TZA2	CROCC_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)	16	2296	+		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)	743			Potential.			Missense_Mutation	SNP	ENST00000375541.5	37	c.2227G>A	CCDS30616.1	.	.	.	.	.	.	.	.	.	.	G	19.26	3.793940	0.70452	2.27E-4	0.0	ENSG00000058453	ENST00000375541;ENST00000445545	T	0.14144	2.53	4.34	4.34	0.51931	.	.	.	.	.	T	0.21468	0.0517	L	0.47716	1.5	0.38506	D	0.948346	D;D;D	0.67145	0.989;0.996;0.991	P;P;P	0.53689	0.695;0.732;0.685	T	0.03139	-1.1068	9	0.17832	T	0.49	.	16.6496	0.85185	0.0:0.0:1.0:0.0	.	606;46;743	A1L0S8;Q5TZA2-2;Q5TZA2	.;.;CROCC_HUMAN	T	743;624	ENSP00000364691:A743T	ENSP00000364691:A743T	A	+	1	0	CROCC	17145431	0.975000	0.34042	0.981000	0.43875	0.990000	0.78478	1.826000	0.39092	2.709000	0.92574	0.563000	0.77884	GCC		0.657	CROCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006249.2	NM_014675		11	52	0	0	0	0.000978	0	11	52				
CSMD2	114784	broad.mit.edu	37	1	34082549	34082549	+	Silent	SNP	G	G	A	rs200149093		TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr1:34082549G>A	ENST00000373380.1	-	18	2812	c.2592C>T	c.(2590-2592)ccC>ccT	p.P864P	CSMD2_ENST00000373388.2_Silent_p.P90P|CSMD2_ENST00000373377.1_Silent_p.P90P|CSMD2_ENST00000373381.4_Silent_p.P1991P			Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	1951						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.P1951P(1)		NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				GCACTGTTCCGGGCATGCAGG	0.532																																							uc001bxn.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(6)|skin(5)|pancreas(1)	12						c.(5851-5853)CCC>CCT		CUB and Sushi multiple domains 2							93.0	87.0	89.0					1																	34082549		2203	4300	6503	SO:0001819	synonymous_variant	114784					integral to membrane|plasma membrane	protein binding	g.chr1:34082549G>A	AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373380.1:c.2592C>T	1.37:g.34082549G>A			Somatic				CSMD2_uc001bxm.1_Silent_p.P1991P|CSMD2_uc001bxo.1_Silent_p.P864P	p.P1951P	NM_052896	NP_443128	WXS	Illumina HiSeq	Unspecified	Q7Z408	CSMD2_HUMAN			39	5882	-		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)	1951			Sushi 11.|Extracellular (Potential).		B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Silent	SNP	ENST00000373380.1	37	c.5853C>T																																																																																					0.532	CSMD2-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000030635.4	NM_052896		22	55	0	0	0	0.001882	0	22	55				
HECTD3	79654	broad.mit.edu	37	1	45470021	45470021	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr1:45470021T>A	ENST00000372172.4	-	17	2242	c.2171A>T	c.(2170-2172)aAg>aTg	p.K724M	HECTD3_ENST00000372168.3_Missense_Mutation_p.K334M|HECTD3_ENST00000486132.1_5'UTR	NM_024602.5	NP_078878.3	Q5T447	HECD3_HUMAN	HECT domain containing E3 ubiquitin protein ligase 3	724	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.K724M(1)|p.K440M(1)|p.K334M(1)		breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(11)|prostate(1)|stomach(1)	28	Acute lymphoblastic leukemia(166;0.155)					TGGTACCACCTTCAGCAGACC	0.597																																							uc009vxk.2		NA																	3	Substitution - Missense(3)		lung(3)		0						c.(2170-2172)AAG>ATG		HECT domain containing 3							102.0	104.0	104.0					1																	45470021		2102	4240	6342	SO:0001583	missense	79654				proteasomal ubiquitin-dependent protein catabolic process|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	perinuclear region of cytoplasm	ubiquitin-protein ligase activity	g.chr1:45470021T>A	BC019105	CCDS41318.1	1p34.1	2012-02-23	2012-02-23		ENSG00000126107	ENSG00000126107			26117	protein-coding gene	gene with protein product			"""HECT domain containing 3"""			12477932	Standard	NM_024602		Approved	FLJ21156	uc009vxk.3	Q5T447	OTTHUMG00000008587	ENST00000372172.4:c.2171A>T	1.37:g.45470021T>A	ENSP00000361245:p.Lys724Met		Somatic				HECTD3_uc001cmx.3_Missense_Mutation_p.K73M|HECTD3_uc001cmy.3_Missense_Mutation_p.K334M|HECTD3_uc010olh.1_Missense_Mutation_p.K440M	p.K724M	NM_024602	NP_078878	WXS	Illumina HiSeq	Unspecified	Q5T447	HECD3_HUMAN			17	2269	-	Acute lymphoblastic leukemia(166;0.155)		724			HECT.		B3KPV7|B3KRH4|Q5T448|Q9H783	Missense_Mutation	SNP	ENST00000372172.4	37	c.2171A>T	CCDS41318.1	.	.	.	.	.	.	.	.	.	.	.	21.1	4.098036	0.76870	.	.	ENSG00000126107	ENST00000372172;ENST00000372168	T;T	0.59083	0.29;0.29	6.05	6.05	0.98169	HECT (4);	0.000000	0.85682	D	0.000000	T	0.64681	0.2620	L	0.41415	1.275	0.54753	D	0.999987	D;D	0.76494	0.996;0.999	P;D	0.63192	0.905;0.912	T	0.67480	-0.5660	10	0.72032	D	0.01	.	11.1509	0.48458	0.0:0.0764:0.0:0.9236	.	724;334	Q5T447;Q5T447-2	HECD3_HUMAN;.	M	724;334	ENSP00000361245:K724M;ENSP00000361241:K334M	ENSP00000361241:K334M	K	-	2	0	HECTD3	45242608	0.007000	0.16637	1.000000	0.80357	0.989000	0.77384	0.661000	0.25023	2.318000	0.78349	0.523000	0.50628	AAG		0.597	HECTD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023734.1	NM_024602		28	62	0	0	0	0.001786	0	28	62				
ST6GALNAC3	256435	broad.mit.edu	37	1	77093237	77093237	+	Missense_Mutation	SNP	T	T	G			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr1:77093237T>G	ENST00000328299.3	+	4	872	c.724T>G	c.(724-726)Tac>Gac	p.Y242D		NM_152996.2	NP_694541.2	Q8NDV1	SIA7C_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 3	242					glycoprotein metabolic process (GO:0009100)|glycosphingolipid metabolic process (GO:0006687)|glycosylceramide metabolic process (GO:0006677)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	sialyltransferase activity (GO:0008373)	p.Y242D(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(20)|ovary(3)|prostate(1)|skin(2)	36						AAATGACACCTACTGCAAGTA	0.403																																							uc001dhh.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(2)	5						c.(724-726)TAC>GAC		sialyltransferase 7C isoform 1							149.0	144.0	145.0					1																	77093237		2203	4300	6503	SO:0001583	missense	256435				protein glycosylation	integral to Golgi membrane	sialyltransferase activity	g.chr1:77093237T>G		CCDS672.1	1p31.1	2013-03-01	2005-02-07	2005-02-07	ENSG00000184005	ENSG00000184005		"""Sialyltransferases"""	19343	protein-coding gene	gene with protein product	"""ST6GALNAC III"""	610133	"""sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) C"""	SIAT7C			Standard	NM_152996		Approved		uc001dhh.2	Q8NDV1	OTTHUMG00000009615	ENST00000328299.3:c.724T>G	1.37:g.77093237T>G	ENSP00000329214:p.Tyr242Asp		Somatic				ST6GALNAC3_uc010orh.1_Intron	p.Y242D	NM_152996	NP_694541	WXS	Illumina HiSeq	Unspecified	Q8NDV1	SIA7C_HUMAN			4	887	+			242			Lumenal (Potential).		Q6PCE0|Q6UX29|Q8N259	Missense_Mutation	SNP	ENST00000328299.3	37	c.724T>G	CCDS672.1	.	.	.	.	.	.	.	.	.	.	T	16.71	3.197516	0.58126	.	.	ENSG00000184005	ENST00000328299;ENST00000394993	T	0.34472	1.36	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.47021	0.1423	M	0.82823	2.61	0.52501	D	0.999952	P	0.46912	0.886	P	0.52957	0.714	T	0.55425	-0.8143	10	0.72032	D	0.01	-21.6028	14.5253	0.67884	0.0:0.0:0.0:1.0	.	242	Q8NDV1	SIA7C_HUMAN	D	242;241	ENSP00000329214:Y242D	ENSP00000329214:Y242D	Y	+	1	0	ST6GALNAC3	76865825	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.888000	0.69758	2.238000	0.73509	0.528000	0.53228	TAC		0.403	ST6GALNAC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026501.1	NM_152996		29	140	0	0	0	0.007291	0	29	140				
CLCA4	22802	broad.mit.edu	37	1	87045796	87045796	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr1:87045796T>A	ENST00000370563.3	+	14	2570	c.2528T>A	c.(2527-2529)aTt>aAt	p.I843N	RP4-651E10.4_ENST00000456587.1_RNA	NM_012128.3	NP_036260.2	Q14CN2	CLCA4_HUMAN	chloride channel accessory 4	843					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	chloride channel activity (GO:0005254)	p.I843N(1)		breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|liver(2)|lung(21)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	44		Lung NSC(277;0.238)		all cancers(265;0.0202)|Epithelial(280;0.0404)		CACATATTTATTGCCATTAAA	0.343																																							uc009wcs.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(2527-2529)ATT>AAT		chloride channel accessory 4							77.0	69.0	72.0					1																	87045796		1820	4076	5896	SO:0001583	missense	22802					apical plasma membrane|extracellular region|integral to plasma membrane	chloride channel activity	g.chr1:87045796T>A	AF127035	CCDS41355.1	1p31-p22	2012-02-26	2009-01-29		ENSG00000016602	ENSG00000016602			2018	protein-coding gene	gene with protein product			"""chloride channel, calcium activated, family member 4"", ""chloride channel regulator 4"""			10437792	Standard	NM_012128		Approved	CaCC2	uc009wcs.3	Q14CN2	OTTHUMG00000010260	ENST00000370563.3:c.2528T>A	1.37:g.87045796T>A	ENSP00000359594:p.Ile843Asn		Somatic				CLCA4_uc009wct.2_Missense_Mutation_p.I606N|CLCA4_uc009wcu.2_Missense_Mutation_p.I663N	p.I843N	NM_012128	NP_036260	WXS	Illumina HiSeq	Unspecified	Q14CN2	CLCA4_HUMAN		all cancers(265;0.0202)|Epithelial(280;0.0404)	14	2572	+		Lung NSC(277;0.238)	843					A8MQC9|B7Z1Q5|Q6UX81|Q9UNF7	Missense_Mutation	SNP	ENST00000370563.3	37	c.2528T>A	CCDS41355.1	.	.	.	.	.	.	.	.	.	.	T	20.2	3.952298	0.73787	.	.	ENSG00000016602	ENST00000370563	T	0.03524	3.9	5.97	5.97	0.96955	.	0.202406	0.41097	D	0.000950	T	0.14485	0.0350	M	0.85462	2.755	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.74674	0.984;0.982	T	0.00583	-1.1659	10	0.87932	D	0	-17.0192	16.1149	0.81301	0.0:0.0:0.0:1.0	.	395;843	Q9NXP1;Q14CN2	.;CLCA4_HUMAN	N	843	ENSP00000359594:I843N	ENSP00000359594:I843N	I	+	2	0	CLCA4	86818384	1.000000	0.71417	0.998000	0.56505	0.727000	0.41649	5.410000	0.66381	2.285000	0.76669	0.477000	0.44152	ATT		0.343	CLCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028292.1	NM_012128		15	34	0	0	0	0.00245	0	15	34				
DNTTIP2	30836	broad.mit.edu	37	1	94335424	94335424	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr1:94335424T>C	ENST00000436063.2	-	7	2311	c.2254A>G	c.(2254-2256)Aag>Gag	p.K752E		NM_014597.4	NP_055412.2	Q5QJE6	TDIF2_HUMAN	deoxynucleotidyltransferase, terminal, interacting protein 2	752					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.K752E(1)		NS(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(15)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	38		all_lung(203;0.0111)|Lung NSC(277;0.0347)		all cancers(265;0.00679)|GBM - Glioblastoma multiforme(16;0.0278)|Epithelial(280;0.128)		CGAAATTTCTTCTTCTTTCGG	0.338																																							uc001dqf.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2254-2256)AAG>GAG		deoxynucleotidyltransferase, terminal,							112.0	109.0	110.0					1																	94335424		1836	4079	5915	SO:0001583	missense	30836				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus		g.chr1:94335424T>C	AY394925	CCDS44174.1	1p22.1	2008-02-05			ENSG00000067334	ENSG00000067334			24013	protein-coding gene	gene with protein product	"""acidic 82 kDa protein mRNA"""	611199				15047147	Standard	NM_014597		Approved	HSU15552, ERBP, TdIF2	uc001dqf.3	Q5QJE6	OTTHUMG00000010268	ENST00000436063.2:c.2254A>G	1.37:g.94335424T>C	ENSP00000411010:p.Lys752Glu		Somatic				DNTTIP2_uc010otm.1_RNA	p.K752E	NM_014597	NP_055412	WXS	Illumina HiSeq	Unspecified	Q5QJE6	TDIF2_HUMAN		all cancers(265;0.00679)|GBM - Glioblastoma multiforme(16;0.0278)|Epithelial(280;0.128)	7	2292	-		all_lung(203;0.0111)|Lung NSC(277;0.0347)	752					Q12987|Q53H59|Q5TFJ4|Q6TLI0|Q76MJ8|Q86WX9	Missense_Mutation	SNP	ENST00000436063.2	37	c.2254A>G	CCDS44174.1	.	.	.	.	.	.	.	.	.	.	T	20.8	4.052191	0.75960	.	.	ENSG00000067334	ENST00000436063	T	0.21543	2.0	5.86	5.86	0.93980	.	.	.	.	.	T	0.34832	0.0911	L	0.59436	1.845	0.58432	D	0.999998	D	0.89917	1.0	D	0.87578	0.998	T	0.07578	-1.0765	9	0.54805	T	0.06	.	16.2466	0.82448	0.0:0.0:0.0:1.0	.	752	Q5QJE6	TDIF2_HUMAN	E	752	ENSP00000411010:K752E	ENSP00000411010:K752E	K	-	1	0	DNTTIP2	94108012	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.936000	0.63506	2.229000	0.72834	0.477000	0.44152	AAG		0.338	DNTTIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028317.2	NM_014597		18	34	0	0	0	0.00499	0	18	34				
PPIAL4G	644591	broad.mit.edu	37	1	143767569	143767569	+	Missense_Mutation	SNP	C	C	T	rs587598335	byFrequency	TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr1:143767569C>T	ENST00000419275.1	-	1	312	c.280G>A	c.(280-282)Ggt>Agt	p.G94S		NM_001123068.1	NP_001116540.1	A2BFH1	PAL4G_HUMAN	peptidylprolyl isomerase A (cyclophilin A)-like 4G	94	PPIase cyclophilin-type. {ECO:0000255|PROSITE-ProRule:PRU00156}.				protein folding (GO:0006457)	cytoplasm (GO:0005737)	peptidyl-prolyl cis-trans isomerase activity (GO:0003755)	p.G94S(1)		breast(1)|endometrium(2)|kidney(1)|lung(8)|ovary(1)|skin(1)	14						ATGCCAGAACCTGTATGCTTT	0.483													.|||	10	0.00199681	0.0	0.0	5008	,	,		38971	0.0		0.001	False		,,,				2504	0.0092						uc001ejt.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(280-282)GGT>AGT		peptidylprolyl isomerase A (cyclophilin A)-like																																				SO:0001583	missense	644591				protein folding	cytoplasm	peptidyl-prolyl cis-trans isomerase activity	g.chr1:143767569C>T		CCDS41375.1, CCDS41375.2	1q21.1	2010-06-03			ENSG00000236334	ENSG00000236334			33996	protein-coding gene	gene with protein product							Standard	NM_001123068		Approved		uc001ejt.3	A2BFH1	OTTHUMG00000013629	ENST00000419275.1:c.280G>A	1.37:g.143767569C>T	ENSP00000393845:p.Gly94Ser		Somatic					p.G94S	NM_001123068	NP_001116540	WXS	Illumina HiSeq	Unspecified	A2BFH1	PAL4G_HUMAN			1	313	-			94			PPIase cyclophilin-type.		A1L431	Missense_Mutation	SNP	ENST00000419275.1	37	c.280G>A	CCDS41375.1	.	.	.	.	.	.	.	.	.	.	.	15.70	2.912352	0.52439	.	.	ENSG00000236334	ENST00000419275	T	0.21031	2.03	0.523	-0.795	0.10915	Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (3);Cyclophilin-like (1);	0.000000	0.85682	U	0.000000	T	0.12774	0.0310	L	0.45285	1.41	0.24382	N	0.994781	D	0.53745	0.962	P	0.59221	0.854	T	0.09207	-1.0685	10	0.66056	D	0.02	.	4.7838	0.13215	0.0:0.7163:0.0:0.2837	.	94	A2BFH1	PAL4G_HUMAN	S	94	ENSP00000393845:G94S	ENSP00000393845:G94S	G	-	1	0	PPIAL4G	142559092	0.960000	0.32886	0.241000	0.24154	0.309000	0.27889	2.687000	0.46976	-0.252000	0.09528	0.403000	0.27427	GGT		0.483	PPIAL4G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000037969.1	NM_001123068		34	196	0	0	0	0.00361	0	34	196				
HRNR	388697	broad.mit.edu	37	1	152192644	152192644	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr1:152192644G>T	ENST00000368801.2	-	3	1536	c.1461C>A	c.(1459-1461)caC>caA	p.H487Q	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	487					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.H487Q(1)		autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GGCCGGAGGAGTGACCTGAGC	0.532																																							uc001ezt.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)	3						c.(1459-1461)CAC>CAA		hornerin							298.0	278.0	285.0					1																	152192644		2203	4300	6503	SO:0001583	missense	388697				keratinization		calcium ion binding|protein binding	g.chr1:152192644G>T	AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.1461C>A	1.37:g.152192644G>T	ENSP00000357791:p.His487Gln		Somatic					p.H487Q	NM_001009931	NP_001009931	WXS	Illumina HiSeq	Unspecified	Q86YZ3	HORN_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	1537	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		487			5.		Q5DT20|Q5U1F4	Missense_Mutation	SNP	ENST00000368801.2	37	c.1461C>A	CCDS30859.1	.	.	.	.	.	.	.	.	.	.	G	3.388	-0.124850	0.06795	.	.	ENSG00000197915	ENST00000368801	T	0.01455	4.87	3.52	-7.05	0.01573	.	.	.	.	.	T	0.00144	0.0004	N	0.01576	-0.805	0.09310	N	1	B	0.12013	0.005	B	0.01281	0.0	T	0.45687	-0.9244	9	0.11794	T	0.64	.	1.1636	0.01810	0.2257:0.2292:0.1148:0.4303	.	487	Q86YZ3	HORN_HUMAN	Q	487	ENSP00000357791:H487Q	ENSP00000357791:H487Q	H	-	3	2	HRNR	150459268	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-6.099000	0.00081	-2.335000	0.00629	-1.361000	0.01213	CAC		0.532	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034016.1	XM_373868		110	313	1	0	2.91707e-64	0.00361	8.08889e-64	110	313				
ASH1L	55870	broad.mit.edu	37	1	155327141	155327141	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr1:155327141G>C	ENST00000368346.3	-	15	7675	c.7036C>G	c.(7036-7038)Caa>Gaa	p.Q2346E	ASH1L_ENST00000392403.3_Missense_Mutation_p.Q2341E|RNU6-106P_ENST00000384405.1_RNA			Q9NR48	ASH1L_HUMAN	ash1 (absent, small, or homeotic)-like (Drosophila)	2346					cell-cell signaling (GO:0007267)|DNA packaging (GO:0006323)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|tight junction (GO:0005923)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)	p.Q2341E(1)		autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(13)|large_intestine(28)|lung(39)|ovary(2)|pancreas(1)|prostate(6)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(4)	124	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			ATCTGTAATTGGGGGGTCAAT	0.358																																							uc009wqq.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(5)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	11						c.(7036-7038)CAA>GAA		absent, small, or homeotic 1-like							128.0	126.0	127.0					1																	155327141		2203	4300	6503	SO:0001583	missense	55870				cell-cell signaling|DNA packaging|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	chromosome|Golgi apparatus|nucleus|tight junction	DNA binding|histone-lysine N-methyltransferase activity|zinc ion binding	g.chr1:155327141G>C	AB037841	CCDS1113.2	1q22	2013-01-28			ENSG00000116539	ENSG00000116539		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	19088	protein-coding gene	gene with protein product		607999				10860993, 16545939	Standard	NM_018489		Approved	huASH1, ASH1, ASH1L1, KMT2H	uc001fkt.3	Q9NR48	OTTHUMG00000014011	ENST00000368346.3:c.7036C>G	1.37:g.155327141G>C	ENSP00000357330:p.Gln2346Glu		Somatic				RAG1AP1_uc010pey.1_Intron|ASH1L_uc001fkt.2_Missense_Mutation_p.Q2341E	p.Q2346E	NM_018489	NP_060959	WXS	Illumina HiSeq	Unspecified	Q9NR48	ASH1L_HUMAN	Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)		15	7516	-	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		2346					Q59GP1|Q5T714|Q5T715|Q9P2C7	Missense_Mutation	SNP	ENST00000368346.3	37	c.7036C>G		.	.	.	.	.	.	.	.	.	.	g	14.40	2.524072	0.44866	.	.	ENSG00000116539	ENST00000368346;ENST00000392403	D;D	0.88046	-2.33;-2.33	4.67	4.67	0.58626	Bromodomain (1);	0.054739	0.85682	D	0.000000	D	0.82309	0.5009	N	0.14661	0.345	0.80722	D	1	P;P	0.52577	0.924;0.954	P;D	0.65140	0.857;0.932	T	0.80489	-0.1360	10	0.17369	T	0.5	.	17.351	0.87324	0.0:0.0:1.0:0.0	.	2346;2341	Q9NR48;Q9NR48-2	ASH1L_HUMAN;.	E	2346;2341	ENSP00000357330:Q2346E;ENSP00000376204:Q2341E	ENSP00000357330:Q2346E	Q	-	1	0	ASH1L	153593765	1.000000	0.71417	0.979000	0.43373	0.830000	0.47004	7.653000	0.83643	2.419000	0.82065	0.573000	0.79308	CAA		0.358	ASH1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000039400.1	NM_018489		9	96	0	0	0	0.006214	0	9	96				
TSACC	128229	broad.mit.edu	37	1	156314480	156314480	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr1:156314480G>T	ENST00000368255.3	+	3	504	c.144G>T	c.(142-144)caG>caT	p.Q48H	TSACC_ENST00000368251.1_Missense_Mutation_p.Q48H|TSACC_ENST00000368253.2_Missense_Mutation_p.Q48H|TSACC_ENST00000368254.1_Missense_Mutation_p.Q48H|TSACC_ENST00000466306.1_Missense_Mutation_p.Q48H|TSACC_ENST00000368252.1_Missense_Mutation_p.Q48H|TSACC_ENST00000481479.1_Missense_Mutation_p.Q48H|TSACC_ENST00000470342.1_Missense_Mutation_p.Q48H	NM_144627.3	NP_653228.1	Q96A04	TSACC_HUMAN	TSSK6 activating co-chaperone	48						cytoplasm (GO:0005737)	chaperone binding (GO:0051087)	p.Q48H(1)									TGAACATCCAGACAACAAAGC	0.507																																							uc001foo.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(142-144)CAG>CAT		SSTK-interacting protein							81.0	85.0	84.0					1																	156314480		2203	4300	6503	SO:0001583	missense	128229							g.chr1:156314480G>T	AY048672	CCDS1141.1	1q22	2012-08-16	2012-08-16	2012-08-16	ENSG00000163467	ENSG00000163467			30636	protein-coding gene	gene with protein product	"""SSTK-interacting protein"""		"""chromosome 1 open reading frame 182"""	C1orf182		20829357	Standard	NM_144627		Approved	SSTK-IP, SIP	uc001foo.3	Q96A04	OTTHUMG00000024060	ENST00000368255.3:c.144G>T	1.37:g.156314480G>T	ENSP00000357238:p.Gln48His		Somatic				C1orf182_uc009wry.2_Missense_Mutation_p.Q48H|C1orf182_uc001fop.3_Missense_Mutation_p.Q48H	p.Q48H	NM_144627	NP_653228	WXS	Illumina HiSeq	Unspecified	Q96A04	CA182_HUMAN			3	506	+	Hepatocellular(266;0.158)		48					D3DVB9	Missense_Mutation	SNP	ENST00000368255.3	37	c.144G>T	CCDS1141.1	.	.	.	.	.	.	.	.	.	.	G	16.37	3.103239	0.56183	.	.	ENSG00000163467	ENST00000368255;ENST00000368254;ENST00000368253;ENST00000368252;ENST00000368251	T;T;T;T;T	0.52526	0.66;0.66;0.66;0.66;0.66	4.95	4.95	0.65309	.	0.524166	0.16067	N	0.231190	T	0.33818	0.0876	L	0.27053	0.805	0.09310	N	1	P	0.44195	0.828	P	0.50617	0.646	T	0.22138	-1.0225	10	0.66056	D	0.02	0.1936	13.5567	0.61763	0.0:0.0:1.0:0.0	.	48	Q96A04	CA182_HUMAN	H	48	ENSP00000357238:Q48H;ENSP00000357237:Q48H;ENSP00000357236:Q48H;ENSP00000357235:Q48H;ENSP00000357234:Q48H	ENSP00000357234:Q48H	Q	+	3	2	C1orf182	154581104	0.237000	0.23815	0.023000	0.16930	0.941000	0.58515	3.651000	0.54431	2.567000	0.86603	0.561000	0.74099	CAG		0.507	TSACC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060594.1	NM_144627		36	103	1	0	2.26627e-22	0.007835	5.83337e-22	36	103				
CD1A	909	broad.mit.edu	37	1	158226720	158226720	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr1:158226720G>T	ENST00000289429.5	+	4	1282	c.749G>T	c.(748-750)gGg>gTg	p.G250V		NM_001763.2	NP_001754.2	P06126	CD1A_HUMAN	CD1a molecule	250	Ig-like.				antigen processing and presentation (GO:0019882)|immune response (GO:0006955)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)		p.G250V(1)		NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(14)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(1)	32	all_hematologic(112;0.0378)				Antithymocyte globulin(DB00098)	ACTCAGCGAGGGGACATCTTG	0.627																																							uc001frt.2		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(2)|skin(1)	3						c.(748-750)GGG>GTG		CD1A antigen precursor	Antithymocyte globulin(DB00098)						117.0	104.0	109.0					1																	158226720		2203	4300	6503	SO:0001583	missense	909				antigen processing and presentation|immune response	endosome membrane|integral to plasma membrane|MHC class I protein complex		g.chr1:158226720G>T	M28825	CCDS1174.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158477	ENSG00000158477		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1634	protein-coding gene	gene with protein product		188370	"""CD1A antigen, a polypeptide"", ""CD1a antigen"""	CD1		2447586, 2784820	Standard	NM_001763		Approved		uc001frt.3	P06126	OTTHUMG00000017512	ENST00000289429.5:c.749G>T	1.37:g.158226720G>T	ENSP00000289429:p.Gly250Val		Somatic					p.G250V	NM_001763	NP_001754	WXS	Illumina HiSeq	Unspecified	P06126	CD1A_HUMAN			4	1282	+	all_hematologic(112;0.0378)		250			Extracellular (Potential).|Ig-like.		D3DVD7|Q13962|Q5TDJ8|Q9UMM4|Q9Y5M5	Missense_Mutation	SNP	ENST00000289429.5	37	c.749G>T	CCDS1174.1	.	.	.	.	.	.	.	.	.	.	G	9.378	1.072345	0.20147	.	.	ENSG00000158477	ENST00000289429	T	0.02863	4.13	3.8	0.851	0.18989	Immunoglobulin-like (1);MHC class I-like antigen recognition (1);Immunoglobulin C1-set (2);	1.592370	0.03820	N	0.267288	T	0.05181	0.0138	M	0.69185	2.1	0.09310	N	0.999997	D	0.89917	1.0	D	0.81914	0.995	T	0.27331	-1.0077	10	0.87932	D	0	-0.4809	5.302	0.15783	0.3808:0.0:0.6192:0.0	.	250	P06126	CD1A_HUMAN	V	250	ENSP00000289429:G250V	ENSP00000289429:G250V	G	+	2	0	CD1A	156493344	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	0.472000	0.22116	0.397000	0.25310	0.485000	0.47835	GGG		0.627	CD1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046349.2	NM_001763		29	84	1	0	5.45727e-16	0.008361	1.26821e-15	29	84				
CD1E	913	broad.mit.edu	37	1	158324199	158324199	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr1:158324199G>T	ENST00000368167.3	+	2	330	c.91G>T	c.(91-93)Gca>Tca	p.A31S	CD1E_ENST00000368160.3_Missense_Mutation_p.A31S|CD1E_ENST00000452291.2_Intron|CD1E_ENST00000368155.3_Missense_Mutation_p.A31S|CD1E_ENST00000368156.1_Missense_Mutation_p.A31S|CD1E_ENST00000368164.3_Intron|CD1E_ENST00000368163.3_Missense_Mutation_p.A31S|CD1E_ENST00000368166.3_Intron|CD1E_ENST00000368161.3_Missense_Mutation_p.A31S|CD1E_ENST00000368165.3_Missense_Mutation_p.A31S|CD1E_ENST00000368157.1_Intron|CD1E_ENST00000464822.1_Intron|CD1E_ENST00000368154.1_Intron|CD1E_ENST00000434258.1_Missense_Mutation_p.A29S|CD1E_ENST00000444681.2_Intron	NM_030893.3	NP_112155.2	P15812	CD1E_HUMAN	CD1e molecule	31					antigen processing and presentation (GO:0019882)|immune response (GO:0006955)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	lipid binding (GO:0008289)	p.A31S(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(27)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|urinary_tract(1)	49	all_hematologic(112;0.0378)					TCATCTAGCAGCAGAGGAGCA	0.527																																							uc001fse.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)	3						c.(91-93)GCA>TCA		CD1E antigen isoform a precursor							137.0	140.0	139.0					1																	158324199		2132	4265	6397	SO:0001583	missense	913				antigen processing and presentation|immune response	early endosome|Golgi membrane|integral to plasma membrane|late endosome|lysosomal lumen		g.chr1:158324199G>T	AJ289111	CCDS41417.1, CCDS41418.1, CCDS41419.1, CCDS41420.1, CCDS41421.1, CCDS41422.1, CCDS53387.1, CCDS53388.1, CCDS53389.1, CCDS53390.1, CCDS53384.1, CCDS53385.1, CCDS53386.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158488	ENSG00000158488		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1638	protein-coding gene	gene with protein product		188411	"""CD1E antigen, e polypeptide"", ""CD1e antigen"""			10948205	Standard	NM_001042585		Approved		uc001fse.3	P15812	OTTHUMG00000017515	ENST00000368167.3:c.91G>T	1.37:g.158324199G>T	ENSP00000357149:p.Ala31Ser		Somatic				CD1E_uc010pid.1_Missense_Mutation_p.A29S|CD1E_uc010pie.1_Intron|CD1E_uc010pif.1_Intron|CD1E_uc001fsd.2_Missense_Mutation_p.A31S|CD1E_uc001fsk.2_Missense_Mutation_p.A31S|CD1E_uc001fsj.2_Missense_Mutation_p.A31S|CD1E_uc001fsc.2_Intron|CD1E_uc010pig.1_Intron|CD1E_uc001fsa.2_Intron|CD1E_uc001fsf.2_Missense_Mutation_p.A31S|CD1E_uc001fry.2_Missense_Mutation_p.A31S|CD1E_uc001fsg.2_Intron|CD1E_uc001fsh.2_Intron|CD1E_uc001fsi.2_Missense_Mutation_p.A31S|CD1E_uc009wsv.2_Intron|CD1E_uc001frz.2_Missense_Mutation_p.A31S|CD1E_uc009wsw.2_5'Flank	p.A31S	NM_030893	NP_112155	WXS	Illumina HiSeq	Unspecified	P15812	CD1E_HUMAN			2	330	+	all_hematologic(112;0.0378)		31					B4DZV3|E7EP01|Q5TDJ9|Q5TDK3|Q5TDK4|Q5TDK5|Q5TDK6|Q5TDK8|Q5TDL1|Q712E4|Q712E5|Q712E6|Q712E7|Q712E8|Q712E9|Q712F0|Q712F1|Q712F2|Q712F3|Q712F4|Q712F5|Q96TD0|Q96TD1|Q9UMM1|Q9Y5M3	Missense_Mutation	SNP	ENST00000368167.3	37	c.91G>T	CCDS41417.1	.	.	.	.	.	.	.	.	.	.	G	9.976	1.226841	0.22542	.	.	ENSG00000158488	ENST00000434258;ENST00000368167;ENST00000368165;ENST00000368163;ENST00000368160;ENST00000368161;ENST00000368156;ENST00000368155	T;T;T;T;T;T;T;T	0.17213	2.29;2.29;3.5;2.29;2.29;2.29;3.7;3.62	3.57	0.504	0.16946	.	0.621077	0.13387	N	0.391694	T	0.02571	0.0078	N	0.17764	0.52	0.09310	N	1	B;B;B;B;B;B;B;B	0.33318	0.021;0.194;0.408;0.03;0.007;0.075;0.194;0.022	B;B;B;B;B;B;B;B	0.26416	0.013;0.056;0.056;0.02;0.005;0.069;0.056;0.054	T	0.40739	-0.9547	10	0.40728	T	0.16	-0.6013	5.5885	0.17287	0.3799:0.0:0.6201:0.0	.	29;31;31;31;31;31;31;31	E7ET31;P15812-5;P15812-7;P15812-2;P15812;P15812-3;P15812-6;P15812-4	.;.;.;.;CD1E_HUMAN;.;.;.	S	29;31;31;31;31;31;31;31	ENSP00000401957:A29S;ENSP00000357149:A31S;ENSP00000357147:A31S;ENSP00000357145:A31S;ENSP00000357142:A31S;ENSP00000357143:A31S;ENSP00000357138:A31S;ENSP00000357137:A31S	ENSP00000357137:A31S	A	+	1	0	CD1E	156590823	.	.	0.003000	0.11579	0.149000	0.21700	.	.	0.110000	0.17919	0.563000	0.77884	GCA		0.527	CD1E-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046353.3	NM_030893		51	164	1	0	1.77205e-36	0.00361	4.7979e-36	51	164				
CD1E	913	broad.mit.edu	37	1	158324240	158324240	+	Silent	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr1:158324240C>A	ENST00000368167.3	+	2	371	c.132C>A	c.(130-132)tcC>tcA	p.S44S	CD1E_ENST00000368160.3_Silent_p.S44S|CD1E_ENST00000452291.2_Intron|CD1E_ENST00000368155.3_Silent_p.S44S|CD1E_ENST00000368156.1_Silent_p.S44S|CD1E_ENST00000368164.3_Intron|CD1E_ENST00000368163.3_Silent_p.S44S|CD1E_ENST00000368166.3_Intron|CD1E_ENST00000368161.3_Silent_p.S44S|CD1E_ENST00000368165.3_Silent_p.S44S|CD1E_ENST00000368157.1_Intron|CD1E_ENST00000464822.1_Intron|CD1E_ENST00000368154.1_Intron|CD1E_ENST00000434258.1_Silent_p.S42S|CD1E_ENST00000444681.2_Intron	NM_030893.3	NP_112155.2	P15812	CD1E_HUMAN	CD1e molecule	44					antigen processing and presentation (GO:0019882)|immune response (GO:0006955)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	lipid binding (GO:0008289)	p.S44S(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(27)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|urinary_tract(1)	49	all_hematologic(112;0.0378)					AAACTTCCTCCTTTGCCAACC	0.557																																							uc001fse.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(3)	3						c.(130-132)TCC>TCA		CD1E antigen isoform a precursor							102.0	106.0	105.0					1																	158324240		2177	4293	6470	SO:0001819	synonymous_variant	913				antigen processing and presentation|immune response	early endosome|Golgi membrane|integral to plasma membrane|late endosome|lysosomal lumen		g.chr1:158324240C>A	AJ289111	CCDS41417.1, CCDS41418.1, CCDS41419.1, CCDS41420.1, CCDS41421.1, CCDS41422.1, CCDS53387.1, CCDS53388.1, CCDS53389.1, CCDS53390.1, CCDS53384.1, CCDS53385.1, CCDS53386.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158488	ENSG00000158488		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1638	protein-coding gene	gene with protein product		188411	"""CD1E antigen, e polypeptide"", ""CD1e antigen"""			10948205	Standard	NM_001042585		Approved		uc001fse.3	P15812	OTTHUMG00000017515	ENST00000368167.3:c.132C>A	1.37:g.158324240C>A			Somatic				CD1E_uc010pid.1_Silent_p.S42S|CD1E_uc010pie.1_Intron|CD1E_uc010pif.1_Intron|CD1E_uc001fsd.2_Silent_p.S44S|CD1E_uc001fsk.2_Silent_p.S44S|CD1E_uc001fsj.2_Silent_p.S44S|CD1E_uc001fsc.2_Intron|CD1E_uc010pig.1_Intron|CD1E_uc001fsa.2_Intron|CD1E_uc001fsf.2_Silent_p.S44S|CD1E_uc001fry.2_Silent_p.S44S|CD1E_uc001fsg.2_Intron|CD1E_uc001fsh.2_Intron|CD1E_uc001fsi.2_Silent_p.S44S|CD1E_uc009wsv.2_Intron|CD1E_uc001frz.2_Silent_p.S44S|CD1E_uc009wsw.2_5'Flank	p.S44S	NM_030893	NP_112155	WXS	Illumina HiSeq	Unspecified	P15812	CD1E_HUMAN			2	371	+	all_hematologic(112;0.0378)		44					B4DZV3|E7EP01|Q5TDJ9|Q5TDK3|Q5TDK4|Q5TDK5|Q5TDK6|Q5TDK8|Q5TDL1|Q712E4|Q712E5|Q712E6|Q712E7|Q712E8|Q712E9|Q712F0|Q712F1|Q712F2|Q712F3|Q712F4|Q712F5|Q96TD0|Q96TD1|Q9UMM1|Q9Y5M3	Silent	SNP	ENST00000368167.3	37	c.132C>A	CCDS41417.1																																																																																				0.557	CD1E-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046353.3	NM_030893		33	116	1	0	2.70662e-09	0.001786	5.19599e-09	33	116				
OR10X1	128367	broad.mit.edu	37	1	158548798	158548798	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr1:158548798G>T	ENST00000368150.1	-	1	891	c.892C>A	c.(892-894)Ctc>Atc	p.L298I		NM_001004477.1	NP_001004477.1	Q8NGY0	O10X1_HUMAN	olfactory receptor, family 10, subfamily X, member 1 (gene/pseudogene)	298						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L298I(2)		breast(1)|cervix(1)|endometrium(2)|large_intestine(6)|lung(22)|ovary(2)|skin(2)|urinary_tract(1)	37	all_hematologic(112;0.0378)					ATGGGGCTGAGGAAGGGGGTA	0.398																																							uc010pin.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(892-894)CTC>ATC		olfactory receptor, family 10, subfamily X,							105.0	110.0	108.0					1																	158548798		2203	4300	6503	SO:0001583	missense	128367				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:158548798G>T	BK004194	CCDS30900.1	1q23.1	2013-10-10	2013-10-10	2004-03-10	ENSG00000186400	ENSG00000186400		"""GPCR / Class A : Olfactory receptors"""	14995	protein-coding gene	gene with protein product			"""olfactory receptor, family 10, subfamily X, member 1"""	OR10X1P			Standard	NM_001004477		Approved		uc010pin.2	Q8NGY0	OTTHUMG00000019635	ENST00000368150.1:c.892C>A	1.37:g.158548798G>T	ENSP00000357132:p.Leu298Ile		Somatic					p.L298I	NM_001004477	NP_001004477	WXS	Illumina HiSeq	Unspecified	Q8NGY0	O10X1_HUMAN			1	892	-	all_hematologic(112;0.0378)		298			Helical; Name=7; (Potential).		Q6IFR8	Missense_Mutation	SNP	ENST00000368150.1	37	c.892C>A	CCDS30900.1	.	.	.	.	.	.	.	.	.	.	G	15.83	2.949663	0.53186	.	.	ENSG00000186400	ENST00000368150	T	0.44083	0.93	4.5	3.58	0.41010	.	0.000000	0.43416	D	0.000565	T	0.45337	0.1337	L	0.49455	1.56	0.27444	N	0.953644	D	0.71674	0.998	D	0.80764	0.994	T	0.16778	-1.0391	10	0.87932	D	0	.	12.1501	0.54046	0.0908:0.0:0.9092:0.0	.	298	Q8NGY0	O10X1_HUMAN	I	298	ENSP00000357132:L298I	ENSP00000357132:L298I	L	-	1	0	OR10X1	156815422	0.286000	0.24305	1.000000	0.80357	0.839000	0.47603	-0.195000	0.09546	2.473000	0.83533	0.563000	0.77884	CTC		0.398	OR10X1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051850.2	NM_001004477		42	112	1	0	2.40579e-17	0.00623	5.75385e-17	42	112				
SPTA1	6708	broad.mit.edu	37	1	158582642	158582642	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr1:158582642C>A	ENST00000368147.4	-	51	7279	c.7099G>T	c.(7099-7101)Ggc>Tgc	p.G2367C	SPTA1_ENST00000485680.1_5'Flank	NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	2367	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.				actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.G2367C(1)		NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					TATGACTTGCCCTCTGCCAGG	0.453																																							uc001fst.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8						c.(7099-7101)GGC>TGC		spectrin, alpha, erythrocytic 1							131.0	127.0	128.0					1																	158582642		1928	4144	6072	SO:0001583	missense	6708				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton	g.chr1:158582642C>A	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.7099G>T	1.37:g.158582642C>A	ENSP00000357129:p.Gly2367Cys		Somatic					p.G2367C	NM_003126	NP_003117	WXS	Illumina HiSeq	Unspecified	P02549	SPTA1_HUMAN			51	7298	-	all_hematologic(112;0.0378)		2367			EF-hand 3.		Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	37	c.7099G>T	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	C	19.29	3.798416	0.70567	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.29142	1.58;1.58	5.39	5.39	0.77823	EF-hand, Ca insensitive (1);EF-hand-like domain (1);	0.000000	0.32836	N	0.005581	T	0.46034	0.1372	M	0.76574	2.34	0.37434	D	0.914151	D	0.63880	0.993	D	0.67382	0.951	T	0.48364	-0.9042	10	0.72032	D	0.01	.	13.6031	0.62031	0.0:0.8444:0.1556:0.0	.	2367	P02549	SPTA1_HUMAN	C	2367;2364	ENSP00000357130:G2367C;ENSP00000357129:G2364C	ENSP00000357129:G2364C	G	-	1	0	SPTA1	156849266	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	3.248000	0.51430	2.795000	0.96236	0.655000	0.94253	GGC		0.453	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126		45	97	1	0	9.84934e-19	0.002522	2.41603e-18	45	97				
SPTA1	6708	broad.mit.edu	37	1	158627430	158627430	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr1:158627430A>G	ENST00000368147.4	-	19	2822	c.2642T>C	c.(2641-2643)aTg>aCg	p.M881T		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	881					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.M881T(1)		NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					GAGAGACTCCATATTCTGGTT	0.468																																							uc001fst.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8						c.(2641-2643)ATG>ACG		spectrin, alpha, erythrocytic 1							152.0	147.0	149.0					1																	158627430		1975	4169	6144	SO:0001583	missense	6708				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton	g.chr1:158627430A>G	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.2642T>C	1.37:g.158627430A>G	ENSP00000357129:p.Met881Thr		Somatic					p.M881T	NM_003126	NP_003117	WXS	Illumina HiSeq	Unspecified	P02549	SPTA1_HUMAN			19	2841	-	all_hematologic(112;0.0378)		881			Spectrin 9.		Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	37	c.2642T>C	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	A	16.56	3.157390	0.57259	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.49139	0.79;0.79	4.67	4.67	0.58626	.	0.000000	0.38837	N	0.001560	T	0.50446	0.1616	L	0.61036	1.89	0.40399	D	0.979626	D	0.57571	0.98	P	0.62089	0.898	T	0.56926	-0.7898	10	0.66056	D	0.02	.	9.2512	0.37555	0.7083:0.2917:0.0:0.0	.	881	P02549	SPTA1_HUMAN	T	881	ENSP00000357130:M881T;ENSP00000357129:M881T	ENSP00000357129:M881T	M	-	2	0	SPTA1	156894054	1.000000	0.71417	0.983000	0.44433	0.801000	0.45260	5.512000	0.67030	2.079000	0.62486	0.533000	0.62120	ATG		0.468	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126		14	190	0	0	0	0.00245	0	14	190				
APCS	325	broad.mit.edu	37	1	159558144	159558144	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr1:159558144G>T	ENST00000255040.2	+	2	415	c.318G>T	c.(316-318)aaG>aaT	p.K106N		NM_001639.3	NP_001630.1	P02743	SAMP_HUMAN	amyloid P component, serum	106	Pentaxin.				acute-phase response (GO:0006953)|chaperone-mediated protein complex assembly (GO:0051131)|innate immune response (GO:0045087)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of exo-alpha-sialidase activity (GO:1903016)|negative regulation of glycoprotein metabolic process (GO:1903019)|negative regulation of monocyte differentiation (GO:0045656)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral process (GO:0048525)|negative regulation of wound healing (GO:0061045)|protein folding (GO:0006457)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|complement component C1q binding (GO:0001849)|unfolded protein binding (GO:0051082)|virion binding (GO:0046790)	p.K106N(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|skin(2)	20	all_hematologic(112;0.0429)					TTATCGAAAAGTTCCCGGCTC	0.438																																							uc001ftv.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)	2						c.(316-318)AAG>AAT		serum amyloid P component precursor							87.0	87.0	87.0					1																	159558144		2203	4300	6503	SO:0001583	missense	325				acute-phase response|chaperone-mediated protein complex assembly|protein folding	extracellular space	metal ion binding|sugar binding|unfolded protein binding	g.chr1:159558144G>T		CCDS1186.1	1q21-q23	2012-10-02			ENSG00000132703	ENSG00000132703			584	protein-coding gene	gene with protein product	"""pentaxin-related"", ""9.5S alpha-1-glycoprotein"""	104770				2987268	Standard	NM_001639		Approved	SAP, PTX2, MGC88159	uc001ftv.3	P02743	OTTHUMG00000022741	ENST00000255040.2:c.318G>T	1.37:g.159558144G>T	ENSP00000255040:p.Lys106Asn		Somatic					p.K106N	NM_001639	NP_001630	WXS	Illumina HiSeq	Unspecified	P02743	SAMP_HUMAN			2	414	+	all_hematologic(112;0.0429)		106			Pentaxin.			Missense_Mutation	SNP	ENST00000255040.2	37	c.318G>T	CCDS1186.1	.	.	.	.	.	.	.	.	.	.	G	3.517	-0.098476	0.07010	.	.	ENSG00000132703	ENST00000255040	T	0.61742	0.08	4.25	-3.89	0.04193	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.783964	0.12336	N	0.477969	T	0.08758	0.0217	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.27739	-1.0065	10	0.15066	T	0.55	-0.0314	1.9974	0.03459	0.4177:0.1262:0.3284:0.1276	.	106	P02743	SAMP_HUMAN	N	106	ENSP00000255040:K106N	ENSP00000255040:K106N	K	+	3	2	APCS	157824768	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.896000	0.01605	-0.542000	0.06249	-0.136000	0.14681	AAG		0.438	APCS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059024.2	NM_001639		17	72	1	0	5.3912e-06	0.006122	9.29295e-06	17	72				
ATP1A4	480	broad.mit.edu	37	1	160156112	160156112	+	Missense_Mutation	SNP	G	G	T	rs373326298		TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr1:160156112G>T	ENST00000368081.4	+	21	3487	c.3016G>T	c.(3016-3018)Gtc>Ttc	p.V1006F	ATP1A4_ENST00000470705.1_Missense_Mutation_p.V142F	NM_144699.3	NP_653300.2	Q13733	AT1A4_HUMAN	ATPase, Na+/K+ transporting, alpha 4 polypeptide	1006				ITWWLCAIPYSILIFVYDEIRKLLIRQ -> WSFALTAQAG VKWRILGLLQPLPPRFK (in Ref. 6; BAC05228). {ECO:0000305}.	ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|fertilization (GO:0009566)|ion transmembrane transport (GO:0034220)|potassium ion transport (GO:0006813)|regulation of cellular pH (GO:0030641)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)	p.V1006F(1)		breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(34)|ovary(2)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	75	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			TCTCATCTTCGTCTATGATGA	0.557																																							uc001fve.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(2)	4						c.(3016-3018)GTC>TTC		Na+/K+ -ATPase alpha 4 subunit isoform 1							251.0	250.0	251.0					1																	160156112		2203	4300	6503	SO:0001583	missense	480				ATP biosynthetic process|ATP hydrolysis coupled proton transport|regulation of cellular pH|sperm motility	sodium:potassium-exchanging ATPase complex	ATP binding|metal ion binding|sodium:potassium-exchanging ATPase activity	g.chr1:160156112G>T	BC028297	CCDS1197.1, CCDS44255.1	1q23.2	2012-10-22	2002-02-25		ENSG00000132681	ENSG00000132681		"""ATPases / P-type"""	14073	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-4"", ""sodium pump subunit alpha-4"", ""sodium-potassium ATPase catalytic subunit alpha-4"""	607321	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 2"""	ATP1AL2		1981991, 3035563	Standard	NM_144699		Approved		uc001fve.4	Q13733	OTTHUMG00000031609	ENST00000368081.4:c.3016G>T	1.37:g.160156112G>T	ENSP00000357060:p.Val1006Phe		Somatic				ATP1A4_uc001fvf.3_RNA|ATP1A4_uc001fvg.2_Missense_Mutation_p.V509F|ATP1A4_uc001fvh.2_Missense_Mutation_p.V142F	p.V1006F	NM_144699	NP_653300	WXS	Illumina HiSeq	Unspecified	Q13733	AT1A4_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.111)		21	3495	+	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		1006	ITWWLCAIPYSILIFVYDEIRKLLIRQ -> WSFALTAQAG VKWRILGLLQPLPPRFK (in Ref. 6; BAC05228).		Helical; (Potential).		Q504T2|Q7Z4I9|Q8TBN8|Q8WXA7|Q8WXH7|Q8WY13	Missense_Mutation	SNP	ENST00000368081.4	37	c.3016G>T	CCDS1197.1	.	.	.	.	.	.	.	.	.	.	a	8.323	0.824832	0.16678	.	.	ENSG00000132681	ENST00000368081;ENST00000470705	D;D	0.95918	-3.85;-3.85	4.95	-9.89	0.00464	ATPase, P-type cation-transporter, C-terminal (1);ATPase, P-type,  transmembrane domain (1);	0.861378	0.10202	N	0.703242	D	0.85331	0.5672	L	0.41124	1.26	0.21627	N	0.99962	B	0.10296	0.003	B	0.19946	0.027	T	0.68663	-0.5349	10	0.87932	D	0	.	18.2758	0.90083	0.1332:0.1653:0.7014:0.0	.	1006	Q13733	AT1A4_HUMAN	F	1006;142	ENSP00000357060:V1006F;ENSP00000433094:V142F	ENSP00000357060:V1006F	V	+	1	0	ATP1A4	158422736	0.000000	0.05858	0.000000	0.03702	0.420000	0.31355	-0.659000	0.05323	-3.855000	0.00098	-1.893000	0.00533	GTC		0.557	ATP1A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077415.1	NM_144699		80	256	1	0	2.43828e-56	0.00361	6.72872e-56	80	256				
BLZF1	8548	broad.mit.edu	37	1	169346053	169346053	+	Silent	SNP	C	C	T	rs200267284		TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr1:169346053C>T	ENST00000367808.3	+	3	727	c.304C>T	c.(304-306)Ctg>Ttg	p.L102L	BLZF1_ENST00000367807.3_Silent_p.L102L|BLZF1_ENST00000329281.2_Silent_p.L102L			Q9H2G9	GO45_HUMAN	basic leucine zipper nuclear factor 1	102					cell proliferation (GO:0008283)|Golgi organization (GO:0007030)|Golgi to plasma membrane protein transport (GO:0043001)|mitotic cell cycle (GO:0000278)|regulation of cell growth (GO:0001558)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cytoplasm (GO:0005737)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)	p.L102L(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(4)|prostate(1)|skin(1)	14	all_hematologic(923;0.208)					GGTTAAGTCTCTGGGACATCA	0.373																																							uc001gfx.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(304-306)CTG>TTG		basic leucine zipper nuclear factor 1							92.0	101.0	98.0					1																	169346053		2202	4298	6500	SO:0001819	synonymous_variant	8548				cell proliferation|Golgi organization|Golgi to plasma membrane protein transport|regulation of cell growth|regulation of transcription from RNA polymerase II promoter	Golgi lumen|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|ubiquitin protein ligase binding	g.chr1:169346053C>T	U79751	CCDS1278.1	1q24	2008-08-01	2008-08-01		ENSG00000117475	ENSG00000117475			1065	protein-coding gene	gene with protein product		608692				9129147	Standard	NM_003666		Approved	JEM-1	uc001gfy.3	Q9H2G9	OTTHUMG00000035453	ENST00000367808.3:c.304C>T	1.37:g.169346053C>T			Somatic				BLZF1_uc001gfw.2_Silent_p.L102L|BLZF1_uc001gfy.2_Silent_p.L102L|BLZF1_uc009wvp.1_Silent_p.L79L	p.L102L	NM_003666	NP_003657	WXS	Illumina HiSeq	Unspecified	Q9H2G9	GO45_HUMAN			3	741	+	all_hematologic(923;0.208)		102					O15298|Q5T531|Q5T533|Q9GZX4	Silent	SNP	ENST00000367808.3	37	c.304C>T	CCDS1278.1																																																																																				0.373	BLZF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086109.1	NM_003666		31	90	0	0	0	0.002096	0	31	90				
TNN	63923	broad.mit.edu	37	1	175086266	175086266	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr1:175086266G>T	ENST00000239462.4	+	10	2424	c.2311G>T	c.(2311-2313)Gtg>Ttg	p.V771L		NM_022093.1	NP_071376.1	Q9UQP3	TENN_HUMAN	tenascin N	771	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)		p.V771L(1)		NS(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|liver(1)|lung(81)|ovary(5)|prostate(6)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	156		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		GAGGCCGGGTGTGGAGTACAC	0.612																																							uc001gkl.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(5)|ovary(3)|central_nervous_system(1)	9						c.(2311-2313)GTG>TTG		tenascin N precursor							89.0	83.0	85.0					1																	175086266		2203	4300	6503	SO:0001583	missense	63923				cell growth|cell migration|signal transduction	extracellular space|proteinaceous extracellular matrix		g.chr1:175086266G>T	AK127044	CCDS30943.1	1q23-q24	2013-02-11			ENSG00000120332	ENSG00000120332		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	22942	protein-coding gene	gene with protein product							Standard	NM_022093		Approved		uc001gkl.1	Q9UQP3	OTTHUMG00000034882	ENST00000239462.4:c.2311G>T	1.37:g.175086266G>T	ENSP00000239462:p.Val771Leu		Somatic					p.V771L	NM_022093	NP_071376	WXS	Illumina HiSeq	Unspecified	Q9UQP3	TENN_HUMAN		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)	10	2424	+		Breast(1374;0.000962)	771			Fibronectin type-III 6.		B9EGP3|Q5R360	Missense_Mutation	SNP	ENST00000239462.4	37	c.2311G>T	CCDS30943.1	.	.	.	.	.	.	.	.	.	.	G	9.699	1.154099	0.21371	.	.	ENSG00000120332	ENST00000239462;ENST00000539081	T	0.57436	0.4	5.37	3.51	0.40186	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.742997	0.12964	N	0.424729	T	0.64068	0.2565	M	0.82630	2.6	0.32041	N	0.598184	B	0.31859	0.343	P	0.44673	0.457	T	0.69591	-0.5104	10	0.72032	D	0.01	.	7.3266	0.26560	0.3081:0.0:0.6919:0.0	.	771	Q9UQP3	TENN_HUMAN	L	771;594	ENSP00000239462:V771L	ENSP00000239462:V771L	V	+	1	0	TNN	173352889	0.974000	0.33945	0.743000	0.31040	0.057000	0.15508	1.788000	0.38714	0.772000	0.33382	-0.136000	0.14681	GTG		0.612	TNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084422.1	XM_040527		30	79	1	0	1.39806e-14	0.008361	3.09839e-14	30	79				
RGS18	64407	broad.mit.edu	37	1	192153501	192153501	+	Silent	SNP	T	T	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr1:192153501T>A	ENST00000367460.3	+	5	706	c.525T>A	c.(523-525)gcT>gcA	p.A175A		NM_130782.2	NP_570138.1	Q9NS28	RGS18_HUMAN	regulator of G-protein signaling 18	175	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				G-protein coupled receptor signaling pathway (GO:0007186)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)	p.A175A(1)		kidney(1)|large_intestine(2)|lung(15)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						GTTTTGATGCTGCACAAAGCA	0.388																																							uc001gsg.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)	3						c.(523-525)GCT>GCA		regulator of G-protein signalling 18							138.0	130.0	132.0					1																	192153501		2203	4300	6503	SO:0001819	synonymous_variant	64407				negative regulation of signal transduction	cytoplasm|plasma membrane	GTPase activator activity|signal transducer activity	g.chr1:192153501T>A	AF268036	CCDS1374.1	1q31.2	2008-02-05	2007-08-14		ENSG00000150681	ENSG00000150681		"""Regulators of G-protein signaling"""	14261	protein-coding gene	gene with protein product		607192	"""regulator of G-protein signalling 18"""			11042171	Standard	NM_130782		Approved	RGS13	uc001gsg.3	Q9NS28	OTTHUMG00000035592	ENST00000367460.3:c.525T>A	1.37:g.192153501T>A			Somatic					p.A175A	NM_130782	NP_570138	WXS	Illumina HiSeq	Unspecified	Q9NS28	RGS18_HUMAN			5	701	+			175			RGS.		B2RD23	Silent	SNP	ENST00000367460.3	37	c.525T>A	CCDS1374.1																																																																																				0.388	RGS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086382.1	NM_130782		38	63	0	0	0	0.004878	0	38	63				
ASPM	259266	broad.mit.edu	37	1	197073015	197073015	+	Missense_Mutation	SNP	T	T	G			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr1:197073015T>G	ENST00000367409.4	-	18	5622	c.5366A>C	c.(5365-5367)aAa>aCa	p.K1789T	ASPM_ENST00000367408.1_Intron|ASPM_ENST00000294732.7_Intron	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	1789					developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)		p.K1789T(1)		breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						GACCTGTGCTTTGTATGCATG	0.363																																							uc001gtu.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|central_nervous_system(2)	6						c.(5365-5367)AAA>ACA		asp (abnormal spindle)-like, microcephaly							101.0	101.0	101.0					1																	197073015		2203	4299	6502	SO:0001583	missense	259266				mitosis	cytoplasm|nucleus	calmodulin binding	g.chr1:197073015T>G	AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.5366A>C	1.37:g.197073015T>G	ENSP00000356379:p.Lys1789Thr		Somatic				ASPM_uc001gtv.2_Intron|ASPM_uc001gtw.3_Intron	p.K1789T	NM_018136	NP_060606	WXS	Illumina HiSeq	Unspecified	Q8IZT6	ASPM_HUMAN			18	5623	-			1789					Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Missense_Mutation	SNP	ENST00000367409.4	37	c.5366A>C	CCDS1389.1	.	.	.	.	.	.	.	.	.	.	T	12.60	1.987561	0.35036	.	.	ENSG00000066279	ENST00000367409	T	0.72394	-0.65	5.83	-4.2	0.03823	.	0.628145	0.15460	N	0.261167	T	0.72518	0.3470	L	0.60455	1.87	0.19300	N	0.99998	D	0.55605	0.972	P	0.54759	0.76	T	0.68700	-0.5339	10	0.24483	T	0.36	.	16.4477	0.83947	0.0:0.6719:0.0:0.3281	.	1789	Q8IZT6	ASPM_HUMAN	T	1789	ENSP00000356379:K1789T	ENSP00000356379:K1789T	K	-	2	0	ASPM	195339638	0.045000	0.20229	0.671000	0.29857	0.811000	0.45836	-0.337000	0.07852	-0.812000	0.04363	0.477000	0.44152	AAA		0.363	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000088256.1	NM_018136		57	114	0	0	0	0.00361	0	57	114				
KCTD3	51133	broad.mit.edu	37	1	215747143	215747143	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr1:215747143G>T	ENST00000259154.4	+	2	392	c.98G>T	c.(97-99)aGa>aTa	p.R33I		NM_016121.3	NP_057205.2	Q9Y597	KCTD3_HUMAN	potassium channel tetramerization domain containing 3	33	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				protein homooligomerization (GO:0051260)			p.R33I(1)		breast(4)|endometrium(2)|kidney(1)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(1)	33				all cancers(67;0.0164)|OV - Ovarian serous cystadenocarcinoma(81;0.019)|GBM - Glioblastoma multiforme(131;0.0862)|Epithelial(68;0.13)		AGTACCTCAAGACAAACTCTT	0.254																																							uc001hks.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(97-99)AGA>ATA		potassium channel tetramerisation domain							68.0	78.0	75.0					1																	215747143		2197	4270	6467	SO:0001583	missense	51133					voltage-gated potassium channel complex	protein binding|voltage-gated potassium channel activity	g.chr1:215747143G>T	AK024547	CCDS1515.1	1q41	2013-06-20	2013-06-20		ENSG00000136636	ENSG00000136636			21305	protein-coding gene	gene with protein product		613272	"""potassium channel tetramerisation domain containing 3"""			10508479	Standard	NM_016121		Approved	NY-REN-45	uc001hks.3	Q9Y597	OTTHUMG00000037019	ENST00000259154.4:c.98G>T	1.37:g.215747143G>T	ENSP00000259154:p.Arg33Ile		Somatic				KCTD3_uc001hkt.2_Missense_Mutation_p.R33I|KCTD3_uc010pub.1_5'UTR	p.R33I	NM_016121	NP_057205	WXS	Illumina HiSeq	Unspecified	Q9Y597	KCTD3_HUMAN		all cancers(67;0.0164)|OV - Ovarian serous cystadenocarcinoma(81;0.019)|GBM - Glioblastoma multiforme(131;0.0862)|Epithelial(68;0.13)	2	392	+			33			BTB.		A0AV15|D3DTA6|Q49AG7|Q504Q9|Q6PJN6|Q8ND58|Q8NDJ0|Q8WX16	Missense_Mutation	SNP	ENST00000259154.4	37	c.98G>T	CCDS1515.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.3|23.3	4.400716|4.400716	0.83120|0.83120	.|.	.|.	ENSG00000136636|ENSG00000136636	ENST00000448333|ENST00000259154;ENST00000366945	.|T	.|0.76709	.|-1.04	5.17|5.17	4.26|4.26	0.50523|0.50523	.|BTB/POZ-like (2);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	.|0.039499	.|0.85682	.|D	.|0.000000	T|T	0.81346|0.81346	0.4803|0.4803	M|M	0.75884|0.75884	2.315|2.315	0.80722|0.80722	D|D	1|1	.|P;B	.|0.45212	.|0.853;0.111	.|P;B	.|0.47528	.|0.549;0.179	D|D	0.83507|0.83507	0.0078|0.0078	5|10	.|0.62326	.|D	.|0.03	-30.1511|-30.1511	13.8533|13.8533	0.63510|0.63510	0.0741:0.0:0.9259:0.0|0.0741:0.0:0.9259:0.0	.|.	.|33;33	.|Q9Y597-2;Q9Y597	.|.;KCTD3_HUMAN	N|I	5|33	.|ENSP00000259154:R33I	.|ENSP00000259154:R33I	K|R	+|+	3|2	2|0	KCTD3|KCTD3	213813766|213813766	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	7.002000|7.002000	0.76304|0.76304	1.320000|1.320000	0.45209|0.45209	0.484000|0.484000	0.47621|0.47621	AAG|AGA		0.254	KCTD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089871.2	NM_016121		46	146	1	0	4.1673e-28	0.00361	1.11257e-27	46	146				
USH2A	7399	broad.mit.edu	37	1	216373189	216373189	+	Silent	SNP	G	G	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr1:216373189G>T	ENST00000307340.3	-	17	3977	c.3591C>A	c.(3589-3591)tcC>tcA	p.S1197S	RP5-1099E6.3_ENST00000420867.1_RNA|USH2A_ENST00000366943.2_Silent_p.S1197S|USH2A_ENST00000366942.3_Silent_p.S1197S	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	1197	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.S1197S(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GACCTTCGTAGGAAACACATG	0.468										HNSCC(13;0.011)																													uc001hku.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26						c.(3589-3591)TCC>TCA		usherin isoform B							105.0	110.0	108.0					1																	216373189		2203	4300	6503	SO:0001819	synonymous_variant	7399				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding	g.chr1:216373189G>T	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.3591C>A	1.37:g.216373189G>T		HNSCC(13;0.011)	Somatic				USH2A_uc001hkv.2_Silent_p.S1197S	p.S1197S	NM_206933	NP_996816	WXS	Illumina HiSeq	Unspecified	O75445	USH2A_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)	17	3978	-			1197			Extracellular (Potential).|Fibronectin type-III 2.		Q5VVM9|Q6S362|Q9NS27	Silent	SNP	ENST00000307340.3	37	c.3591C>A	CCDS31025.1																																																																																				0.468	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123		29	116	1	0	9.80776e-20	0.00632	2.45836e-19	29	116				
SNAP47	116841	broad.mit.edu	37	1	227946813	227946813	+	Silent	SNP	G	G	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr1:227946813G>T	ENST00000366759.4	+	3	1164	c.750G>T	c.(748-750)ggG>ggT	p.G250G	SNAP47_ENST00000315781.5_Silent_p.G250G|SNAP47_ENST00000366760.1_Silent_p.G8G	NM_053052.3	NP_444280.2	Q5SQN1	SNP47_HUMAN	synaptosomal-associated protein, 47kDa	250					long-term synaptic potentiation (GO:0060291)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|membrane (GO:0016020)|neuronal cell body (GO:0043025)				endometrium(1)|large_intestine(5)|liver(2)|lung(6)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	17						AACCCTTTGGGAAAGAAGGGA	0.488																																							uc001hrf.2		NA																	0				ovary(1)	1						c.(748-750)GGG>GGT		synaptosomal-associated protein, 47kDa							112.0	123.0	119.0					1																	227946813		2203	4300	6503	SO:0001819	synonymous_variant	116841					endomembrane system|membrane|perinuclear region of cytoplasm		g.chr1:227946813G>T	AY090635	CCDS1562.1	1q42.13	2013-10-11	2008-10-27	2008-10-27	ENSG00000143740	ENSG00000143740			30669	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 142"""	C1orf142		16621800	Standard	NM_053052		Approved	SVAP1, SNAP-47	uc001hrf.2	Q5SQN1	OTTHUMG00000037697	ENST00000366759.4:c.750G>T	1.37:g.227946813G>T			Somatic				SNAP47_uc001hqz.2_Silent_p.G205G|SNAP47_uc001hra.2_Silent_p.G8G|SNAP47_uc001hrd.2_Silent_p.G250G|SNAP47_uc001hre.2_Silent_p.G8G|SNAP47_uc001hrg.1_Silent_p.G205G	p.G250G	NM_053052	NP_444280	WXS	Illumina HiSeq	Unspecified	Q5SQN1	SNP47_HUMAN			3	1164	+			250					B6EDE0|Q5HYB5|Q5TBZ3|Q8N558|Q8TB31|Q8TCW8|Q8WV46|Q96CQ3|Q96FE1|Q96I66|Q96NU3|Q9BT10|Q9BVB2	Silent	SNP	ENST00000366759.4	37	c.750G>T	CCDS1562.1	.	.	.	.	.	.	.	.	.	.	G	0.746	-0.774500	0.02951	.	.	ENSG00000143740	ENST00000418653;ENST00000426344	.	.	.	4.95	1.1	0.20463	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-8.8278	7.714	0.28694	0.521:0.0:0.479:0.0	.	.	.	.	X	63;242	.	.	E	+	1	0	SNAP47	226013436	0.506000	0.26139	0.999000	0.59377	0.124000	0.20399	-0.519000	0.06260	0.017000	0.15025	-0.367000	0.07326	GAA		0.488	SNAP47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091961.1	NM_053052		44	128	1	0	5.48756e-27	0.002852	1.45827e-26	44	128				
WNT3A	89780	broad.mit.edu	37	1	228238405	228238405	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr1:228238405C>A	ENST00000284523.1	+	3	440	c.362C>A	c.(361-363)gCc>gAc	p.A121D	WNT3A_ENST00000366753.2_Missense_Mutation_p.A121D	NM_033131.3	NP_149122.1	P56704	WNT3A_HUMAN	wingless-type MMTV integration site family, member 3A	121					axis elongation involved in somitogenesis (GO:0090245)|axon guidance (GO:0007411)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in cardiac muscle cell fate commitment (GO:0061317)|cell proliferation in forebrain (GO:0021846)|cellular protein localization (GO:0034613)|cellular response to retinoic acid (GO:0071300)|COP9 signalosome assembly (GO:0010387)|dorsal/ventral neural tube patterning (GO:0021904)|extracellular matrix organization (GO:0030198)|heart looping (GO:0001947)|hemopoiesis (GO:0030097)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|mammary gland development (GO:0030879)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron projection development (GO:0010977)|neuron differentiation (GO:0030182)|osteoblast differentiation (GO:0001649)|palate development (GO:0060021)|paraxial mesodermal cell fate commitment (GO:0048343)|platelet aggregation (GO:0070527)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of canonical Wnt signaling pathway involved in controlling type B pancreatic cell proliferation (GO:2000081)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of collateral sprouting in absence of injury (GO:0048697)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of dermatome development (GO:0061184)|positive regulation of mesodermal cell fate specification (GO:0048337)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of receptor internalization (GO:0002092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-anal tail morphogenesis (GO:0036342)|regulation of microtubule cytoskeleton organization (GO:0070507)|skeletal muscle cell differentiation (GO:0035914)|spinal cord association neuron differentiation (GO:0021527)|Wnt signaling pathway involved in forebrain neuroblast division (GO:0021874)	cell surface (GO:0009986)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)|transcription coactivator activity (GO:0003713)	p.A121D(1)		kidney(1)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)	12		Prostate(94;0.0405)				GCCGGTGTGGCCTTTGCAGTG	0.632																																							uc001hrq.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(361-363)GCC>GAC		wingless-type MMTV integration site family,							118.0	92.0	101.0					1																	228238405		2203	4300	6503	SO:0001583	missense	89780				axis specification|cell proliferation in forebrain|cell-cell signaling|cellular response to retinoic acid|convergent extension|dermatome development|dorsal/ventral neural tube patterning|embryonic pattern specification|extracellular matrix organization|hemopoietic stem cell proliferation|hippocampus development|inner ear morphogenesis|mammary gland development|midbrain-hindbrain boundary development|negative regulation of fat cell differentiation|negative regulation of heart induction by canonical Wnt receptor signaling pathway|negative regulation of neuron projection development|notochord development|palate development|paraxial mesodermal cell fate commitment|positive regulation of catenin import into nucleus|positive regulation of peptidyl-serine phosphorylation|positive regulation of protein binding|positive regulation of receptor internalization|positive regulation of transcription from RNA polymerase II promoter|signalosome assembly|tail morphogenesis|Wnt receptor signaling pathway involved in forebrain neuroblast division|Wnt receptor signaling pathway, calcium modulating pathway	cell surface|early endosome|extracellular space|late endosome|membrane raft|plasma membrane|proteinaceous extracellular matrix	extracellular matrix structural constituent|frizzled-2 binding|receptor agonist activity|signal transducer activity|transcription coactivator activity	g.chr1:228238405C>A	AB060284	CCDS1564.1	1q42	2013-02-28			ENSG00000154342	ENSG00000154342		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	15983	protein-coding gene	gene with protein product		606359				11414706	Standard	NM_033131		Approved		uc001hrq.2	P56704	OTTHUMG00000037593	ENST00000284523.1:c.362C>A	1.37:g.228238405C>A	ENSP00000284523:p.Ala121Asp		Somatic				WNT3A_uc001hrp.1_Missense_Mutation_p.A121D	p.A121D	NM_033131	NP_149122	WXS	Illumina HiSeq	Unspecified	P56704	WNT3A_HUMAN			3	440	+		Prostate(94;0.0405)	121					Q3SY79|Q3SY80|Q969P2	Missense_Mutation	SNP	ENST00000284523.1	37	c.362C>A	CCDS1564.1	.	.	.	.	.	.	.	.	.	.	C	19.32	3.804834	0.70682	.	.	ENSG00000154342	ENST00000284523;ENST00000366753	T;T	0.77098	-1.07;-1.07	4.68	4.68	0.58851	.	0.063242	0.64402	D	0.000006	D	0.90010	0.6881	M	0.89968	3.075	0.80722	D	1	D;D	0.61697	0.986;0.99	D;D	0.70227	0.968;0.936	D	0.92488	0.5998	10	0.87932	D	0	.	17.5957	0.88011	0.0:1.0:0.0:0.0	.	121;121	P56704;Q3SY79	WNT3A_HUMAN;.	D	121	ENSP00000284523:A121D;ENSP00000355715:A121D	ENSP00000284523:A121D	A	+	2	0	WNT3A	226305028	1.000000	0.71417	0.996000	0.52242	0.565000	0.35776	5.939000	0.70179	2.164000	0.68074	0.591000	0.81541	GCC		0.632	WNT3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091648.1	NM_033131		16	41	1	0	1.5739e-10	0.004007	3.11523e-10	16	41				
C1orf198	84886	broad.mit.edu	37	1	231004224	231004224	+	Missense_Mutation	SNP	C	C	A	rs374561053		TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr1:231004224C>A	ENST00000366663.5	-	1	175	c.35G>T	c.(34-36)cGc>cTc	p.R12L	C1orf198_ENST00000427697.2_Intron|C1orf198_ENST00000470540.1_Intron	NM_032800.2	NP_116189.1	Q9H425	CA198_HUMAN	chromosome 1 open reading frame 198	12						cytoplasm (GO:0005737)		p.R12L(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	17	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.178)				GACCGCCGAGCGCGAAGCCGC	0.741																																							uc001hub.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(34-36)CGC>CTC		hypothetical protein LOC84886 isoform 1			LEU/ARG,	1,4305		0,1,2152	7.0	11.0	10.0		35,	3.4	1.0	1		10	0,8486		0,0,4243	no	missense,intron	C1orf198	NM_032800.2,NM_001136494.1	102,	0,1,6395	AA,AC,CC		0.0,0.0232,0.0078	possibly-damaging,	12/328,	231004224	1,12791	2153	4243	6396	SO:0001583	missense	84886							g.chr1:231004224C>A	BC066649	CCDS1587.1, CCDS44330.1, CCDS44331.1	1q42.2	2008-02-05			ENSG00000119280	ENSG00000119280			25900	protein-coding gene	gene with protein product							Standard	NM_032800		Approved	FLJ14525, MGC10710, FLJ16283, DKFZp667D152, FLJ38847	uc001hub.3	Q9H425	OTTHUMG00000037790	ENST00000366663.5:c.35G>T	1.37:g.231004224C>A	ENSP00000355623:p.Arg12Leu		Somatic				C1orf198_uc001huc.1_Intron|C1orf198_uc001hud.1_Intron	p.R12L	NM_032800	NP_116189	WXS	Illumina HiSeq	Unspecified	Q9H425	CA198_HUMAN			1	79	-	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.178)	12					A8K8R8|B3KTW1|G5EA08	Missense_Mutation	SNP	ENST00000366663.5	37	c.35G>T	CCDS1587.1	.	.	.	.	.	.	.	.	.	.	c	20.8	4.046425	0.75846	2.32E-4	0.0	ENSG00000119280	ENST00000366663	T	0.46451	0.87	3.38	3.38	0.38709	.	0.337801	0.26470	U	0.024195	T	0.31199	0.0789	N	0.24115	0.695	0.80722	D	1	P	0.38455	0.632	B	0.38020	0.263	T	0.31861	-0.9928	10	0.56958	D	0.05	.	14.5276	0.67900	0.0:1.0:0.0:0.0	.	12	Q9H425	CA198_HUMAN	L	12	ENSP00000355623:R12L	ENSP00000355623:R12L	R	-	2	0	C1orf198	229070847	1.000000	0.71417	1.000000	0.80357	0.804000	0.45430	2.198000	0.42705	1.697000	0.51169	0.306000	0.20318	CGC		0.741	C1orf198-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000092236.2	NM_032800		3	12	1	0	0.004672	0.004672	0.00711334	3	12				
RYR2	6262	broad.mit.edu	37	1	237774250	237774250	+	Silent	SNP	T	T	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr1:237774250T>A	ENST00000366574.2	+	36	5189	c.4872T>A	c.(4870-4872)ccT>ccA	p.P1624P	RYR2_ENST00000360064.6_Silent_p.P1622P|RYR2_ENST00000542537.1_Silent_p.P1608P	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	1624	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.P1622P(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GTTTGGATCCTCTGCAGTTCA	0.517																																							uc001hyl.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(4870-4872)CCT>CCA		cardiac muscle ryanodine receptor							71.0	70.0	70.0					1																	237774250		1989	4170	6159	SO:0001819	synonymous_variant	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237774250T>A	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.4872T>A	1.37:g.237774250T>A			Somatic					p.P1624P	NM_001035	NP_001026	WXS	Illumina HiSeq	Unspecified	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		36	4992	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	1624			Cytoplasmic (By similarity).|4 X approximate repeats.		Q15411|Q546N8|Q5T3P2	Silent	SNP	ENST00000366574.2	37	c.4872T>A	CCDS55691.1																																																																																				0.517	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		6	21	0	0	0	0.001984	0	6	21				
OR2W5	441932	broad.mit.edu	37	1	247654685	247654685	+	RNA	SNP	G	G	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr1:247654685G>T	ENST00000522351.1	+	0	316							A6NFC9	OR2W5_HUMAN	olfactory receptor, family 2, subfamily W, member 5							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G86W(1)		breast(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(24)|ovary(1)|skin(4)	39	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.222)	OV - Ovarian serous cystadenocarcinoma(106;0.0188)			GTGGAACCTGGGGGGTCCAGA	0.537																																							uc001icz.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)|skin(1)	3						c.(256-258)GGG>TGG		olfactory receptor, family 2, subfamily W,							85.0	86.0	86.0					1																	247654685		2203	4300	6503			441932				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:247654685G>T			1q44	2013-03-27		2004-03-10	ENSG00000203664	ENSG00000203664		"""GPCR / Class A : Olfactory receptors"""	15424	other	unknown				OR2W5P		12213199	Standard	NM_001004698		Approved	OST722	uc001icz.2	A6NFC9	OTTHUMG00000040573		1.37:g.247654685G>T			Somatic					p.G86W	NM_001004698	NP_001004698	WXS	Illumina HiSeq	Unspecified	A6NFC9	OR2W5_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0188)		1	256	+	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.222)	86					B9EH85	Missense_Mutation	SNP	ENST00000522351.1	37	c.256G>T																																																																																					0.537	OR2W5-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000375789.1	NM_001004698		34	57	1	0	1.61788e-16	0.002445	3.80599e-16	34	57				
OR2T12	127064	broad.mit.edu	37	1	248458178	248458178	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr1:248458178C>A	ENST00000317996.1	-	1	702	c.703G>T	c.(703-705)Gcc>Tcc	p.A235S		NM_001004692.1	NP_001004692.1	Q8NG77	O2T12_HUMAN	olfactory receptor, family 2, subfamily T, member 12	235						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A235S(1)		endometrium(4)|kidney(3)|large_intestine(3)|lung(25)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	43	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0201)			GTGGCAAAGGCCTTCTTGCGG	0.517																																							uc010pzj.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)	3						c.(703-705)GCC>TCC		olfactory receptor, family 2, subfamily T,							92.0	89.0	90.0					1																	248458178		2203	4300	6503	SO:0001583	missense	127064				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248458178C>A	BK004485	CCDS31110.1	1q44	2012-08-09			ENSG00000177201	ENSG00000177201		"""GPCR / Class A : Olfactory receptors"""	19592	protein-coding gene	gene with protein product							Standard	NM_001004692		Approved		uc010pzj.2	Q8NG77	OTTHUMG00000040457	ENST00000317996.1:c.703G>T	1.37:g.248458178C>A	ENSP00000324583:p.Ala235Ser		Somatic					p.A235S	NM_001004692	NP_001004692	WXS	Illumina HiSeq	Unspecified	Q8NG77	O2T12_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0201)		1	703	-	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		235			Helical; Name=6; (Potential).			Missense_Mutation	SNP	ENST00000317996.1	37	c.703G>T	CCDS31110.1	.	.	.	.	.	.	.	.	.	.	c	19.65	3.867302	0.72065	.	.	ENSG00000177201	ENST00000317996	T	0.00359	7.87	1.55	1.55	0.23275	GPCR, rhodopsin-like superfamily (1);	0.000000	0.35096	U	0.003459	T	0.00754	0.0025	M	0.87827	2.91	0.36134	D	0.846331	D	0.55385	0.971	D	0.64506	0.926	T	0.62487	-0.6844	10	0.66056	D	0.02	.	10.5912	0.45310	0.0:1.0:0.0:0.0	.	235	Q8NG77	O2T12_HUMAN	S	235	ENSP00000324583:A235S	ENSP00000324583:A235S	A	-	1	0	OR2T12	246524801	0.648000	0.27313	0.672000	0.29872	0.725000	0.41563	1.138000	0.31491	0.645000	0.30675	0.175000	0.17021	GCC		0.517	OR2T12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097353.1	NM_001004692		34	99	1	0	8.4185e-14	0.002445	1.80307e-13	34	99				
OR2T3	343173	broad.mit.edu	37	1	248637213	248637213	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr1:248637213G>T	ENST00000359594.2	+	1	587	c.562G>T	c.(562-564)Gcc>Tcc	p.A188S		NM_001005495.1	NP_001005495.1	Q8NH03	OR2T3_HUMAN	olfactory receptor, family 2, subfamily T, member 3	188						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A188S(1)		breast(2)|endometrium(5)|lung(19)|ovary(1)|prostate(1)|skin(3)	31	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TGAGACTCCTGCCCTGCTGAA	0.512																																							uc001iel.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(562-564)GCC>TCC		olfactory receptor, family 2, subfamily T,							99.0	86.0	90.0					1																	248637213		2170	4268	6438	SO:0001583	missense	343173				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248637213G>T		CCDS31117.1	1q44	2012-08-09			ENSG00000196539	ENSG00000196539		"""GPCR / Class A : Olfactory receptors"""	14727	protein-coding gene	gene with protein product							Standard	NM_001005495		Approved		uc001iel.1	Q8NH03	OTTHUMG00000040452	ENST00000359594.2:c.562G>T	1.37:g.248637213G>T	ENSP00000352604:p.Ala188Ser		Somatic					p.A188S	NM_001005495	NP_001005495	WXS	Illumina HiSeq	Unspecified	Q8NH03	OR2T3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0265)		1	562	+	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		188			Extracellular (Potential).		B2RNJ1	Missense_Mutation	SNP	ENST00000359594.2	37	c.562G>T	CCDS31117.1	.	.	.	.	.	.	.	.	.	.	g	12.49	1.954574	0.34471	.	.	ENSG00000196539	ENST00000359594	T	0.00107	8.72	2.37	-0.141	0.13452	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00210	0.0006	L	0.31294	0.92	0.09310	N	1	D	0.63046	0.992	D	0.67900	0.954	T	0.53034	-0.8495	9	0.34782	T	0.22	.	5.2866	0.15704	0.1537:0.4611:0.3852:0.0	.	188	Q8NH03	OR2T3_HUMAN	S	188	ENSP00000352604:A188S	ENSP00000352604:A188S	A	+	1	0	OR2T3	246703836	0.000000	0.05858	0.003000	0.11579	0.282000	0.26991	0.238000	0.18004	0.106000	0.17784	0.186000	0.17326	GCC		0.512	OR2T3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097348.1	NM_001005495		79	75	1	0	7.09011e-46	0.00361	1.94724e-45	79	75				
KIN	22944	broad.mit.edu	37	10	7820806	7820806	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr10:7820806C>T	ENST00000379562.4	-	5	600	c.553G>A	c.(553-555)Gaa>Aaa	p.E185K	KIN_ENST00000543003.1_Missense_Mutation_p.E79K|KIN_ENST00000535925.1_Missense_Mutation_p.E185K	NM_012311.3	NP_036443.1			Kin17 DNA and RNA binding protein									p.E185K(1)		endometrium(1)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|pancreas(1)|skin(2)	19						CCCACCTGTTCCTTCCCTTCC	0.413																																							uc001ijt.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)|skin(1)	3						c.(553-555)GAA>AAA		HsKin17 protein							267.0	258.0	261.0					10																	7820806		2203	4300	6503	SO:0001583	missense	22944				DNA recombination|DNA repair|DNA replication|interspecies interaction between organisms|mRNA processing	cytoplasm|nuclear matrix	double-stranded DNA binding|RNA binding|zinc ion binding	g.chr10:7820806C>T	AJ005273	CCDS7080.1	10p15-p14	2014-07-15	2014-07-15		ENSG00000151657	ENSG00000151657			6327	protein-coding gene	gene with protein product		601720	"""antigenic determinant of recA protein (mouse) homolog"", ""KIN, antigenic determinant of recA protein homolog (mouse)"""			1923796, 24140279	Standard	NM_012311		Approved	KIN17, Rts2	uc001ijt.3	O60870	OTTHUMG00000017634	ENST00000379562.4:c.553G>A	10.37:g.7820806C>T	ENSP00000368881:p.Glu185Lys		Somatic				KIN_uc010qaz.1_RNA|KIN_uc009xip.2_Missense_Mutation_p.E185K|KIN_uc010qba.1_Missense_Mutation_p.E79K	p.E185K	NM_012311	NP_036443	WXS	Illumina HiSeq	Unspecified	O60870	KIN17_HUMAN			5	601	-			185						Missense_Mutation	SNP	ENST00000379562.4	37	c.553G>A	CCDS7080.1	.	.	.	.	.	.	.	.	.	.	C	18.15	3.559787	0.65538	.	.	ENSG00000151657	ENST00000535925;ENST00000379562;ENST00000543003	.	.	.	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.74183	0.3683	L	0.51422	1.61	0.80722	D	1	B;D;D	0.69078	0.041;0.993;0.997	B;D;D	0.73380	0.048;0.971;0.98	T	0.65121	-0.6245	9	0.14656	T	0.56	-29.5429	20.3932	0.98965	0.0:1.0:0.0:0.0	.	79;185;185	F5GXB3;B4DX32;O60870	.;.;KIN17_HUMAN	K	185;185;79	.	ENSP00000368881:E185K	E	-	1	0	KIN	7860812	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.770000	0.85390	2.824000	0.97209	0.655000	0.94253	GAA		0.413	KIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046683.2	NM_012311		84	220	0	0	0	0.00361	0	84	220				
ZNF37A	7587	broad.mit.edu	37	10	38403681	38403681	+	Splice_Site	SNP	A	A	G			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr10:38403681A>G	ENST00000361085.5	+	5	360		c.e5-1		ZNF37A_ENST00000351773.3_Splice_Site|ZNF37A_ENST00000479469.1_Splice_Site	NM_001178101.1|NM_003421.2	NP_001171572.1|NP_003412.1	P17032	ZN37A_HUMAN	zinc finger protein 37A						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.?(2)		NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(13)|prostate(1)	28						GTGATTTTCCAGGGATCAGTG	0.428																																							uc001izk.2		NA																	2	Unknown(2)		lung(2)	breast(1)	1						c.e6-2		zinc finger protein 37a							132.0	126.0	128.0					10																	38403681		2203	4300	6503	SO:0001630	splice_region_variant	7587					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr10:38403681A>G	X69115	CCDS31183.1	10p11.2	2013-01-08	2006-05-11		ENSG00000075407	ENSG00000075407		"""Zinc fingers, C2H2-type"", ""-"""	13102	protein-coding gene	gene with protein product			"""zinc finger protein 37a (KOX 21)"""			2014798, 8464732	Standard	NM_001178101		Approved	KOX21, ZNF37	uc001izl.3	P17032	OTTHUMG00000017990	ENST00000361085.5:c.16-1A>G	10.37:g.38403681A>G			Somatic				ZNF37A_uc001izl.2_Splice_Site_p.G6_splice|ZNF37A_uc001izm.2_Splice_Site_p.G6_splice	p.G6_splice	NM_001007094	NP_001007095	WXS	Illumina HiSeq	Unspecified	P17032	ZN37A_HUMAN			6	835	+								B3KRQ3|D3DRZ3|Q96B88	Splice_Site	SNP	ENST00000361085.5	37	c.16_splice	CCDS31183.1	.	.	.	.	.	.	.	.	.	.	A	12.08	1.831465	0.32329	.	.	ENSG00000075407	ENST00000351773;ENST00000361085	.	.	.	2.56	2.56	0.30785	.	.	.	.	.	.	.	.	.	.	.	0.52099	D	0.999948	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.6059	0.33773	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ZNF37A	38443687	1.000000	0.71417	0.017000	0.16124	0.362000	0.29581	3.759000	0.55227	1.173000	0.42796	0.383000	0.25322	.		0.428	ZNF37A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047624.2	NM_003421	Intron	29	133	0	0	0	0.001786	0	29	133				
GDF10	2662	broad.mit.edu	37	10	48429290	48429290	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr10:48429290C>A	ENST00000224605.2	-	2	861	c.596G>T	c.(595-597)gGc>gTc	p.G199V		NM_004962.3	NP_004953.1	P55107	BMP3B_HUMAN	growth differentiation factor 10	199					fat cell differentiation (GO:0045444)|growth (GO:0040007)|skeletal system development (GO:0001501)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular space (GO:0005615)	growth factor activity (GO:0008083)	p.G199V(1)		central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(20)|skin(1)	31						CTGCCACAGGCCGCGCGGTGG	0.721																																							uc001jfb.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)|central_nervous_system(1)	2						c.(595-597)GGC>GTC		growth differentiation factor 10 precursor							10.0	16.0	14.0					10																	48429290		2147	4218	6365	SO:0001583	missense	2662				growth|skeletal system development|transforming growth factor beta receptor signaling pathway	extracellular space	cytokine activity|growth factor activity	g.chr10:48429290C>A	L42113	CCDS73117.1	10q11.22	2014-04-10			ENSG00000107623	ENSG00000266524		"""Endogenous ligands"""	4215	protein-coding gene	gene with protein product		601361				8679252	Standard	NM_004962		Approved	BMP-3b	uc001jfb.3	P55107	OTTHUMG00000188319	ENST00000224605.2:c.596G>T	10.37:g.48429290C>A	ENSP00000224605:p.Gly199Val		Somatic				GDF10_uc009xnp.2_Missense_Mutation_p.G198V|GDF10_uc009xnq.1_Missense_Mutation_p.G199V	p.G199V	NM_004962	NP_004953	WXS	Illumina HiSeq	Unspecified	P55107	BMP3B_HUMAN			2	1052	-			199					Q5VSQ8|Q9UCX6	Missense_Mutation	SNP	ENST00000224605.2	37	c.596G>T	CCDS7220.1	.	.	.	.	.	.	.	.	.	.	C	16.11	3.030218	0.54790	.	.	ENSG00000107623	ENST00000374247;ENST00000224605	T	0.75050	-0.9	5.44	3.54	0.40534	.	0.050586	0.85682	D	0.000000	D	0.82761	0.5107	M	0.66939	2.045	0.80722	D	1	P;D	0.76494	0.949;0.999	P;D	0.75484	0.476;0.986	T	0.79598	-0.1737	10	0.26408	T	0.33	.	13.5721	0.61853	0.0:0.6772:0.3228:0.0	.	9;199	Q8N6T2;P55107	.;BMP3B_HUMAN	V	9;199	ENSP00000224605:G199V	ENSP00000224605:G199V	G	-	2	0	GDF10	48049296	0.998000	0.40836	0.969000	0.41365	0.724000	0.41520	3.500000	0.53318	0.631000	0.30412	-0.321000	0.08615	GGC		0.721	GDF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047884.1	NM_004962		4	25	1	0	3.59834e-05	0.001168	5.86774e-05	4	25				
NCOA4	8031	broad.mit.edu	37	10	51585241	51585241	+	Missense_Mutation	SNP	A	A	G	rs61754798	byFrequency	TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr10:51585241A>G	ENST00000443446.1	+	8	1569	c.1340A>G	c.(1339-1341)aAa>aGa	p.K447R	NCOA4_ENST00000438493.1_Missense_Mutation_p.K463R|NCOA4_ENST00000430396.2_Missense_Mutation_p.K347R|NCOA4_ENST00000452682.1_Missense_Mutation_p.K463R|NCOA4_ENST00000374087.4_Missense_Mutation_p.K447R|NCOA4_ENST00000344348.6_Missense_Mutation_p.K447R|NCOA4_ENST00000374082.1_Missense_Mutation_p.K447R|NCOA4_ENST00000414907.2_Missense_Mutation_p.K281R	NM_001145262.1	NP_001138734.1	Q13772	NCOA4_HUMAN	nuclear receptor coactivator 4	447					androgen receptor signaling pathway (GO:0030521)|male gonad development (GO:0008584)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|transcription coactivator activity (GO:0003713)	p.K463R(1)		NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|skin(1)	5						GTGGAACCCAAACCTGAGCCT	0.428			T	RET	papillary thyroid								.|||	2	0.000399361	0.0	0.0029	5008	,	,		20921	0.0		0.0	False		,,,				2504	0.0						uc001jis.3		NA		Dom	yes		10	10q11.2	8031	T	nuclear receptor coactivator 4 - PTC3 (ELE1)			E	RET		papillary thyroid 		1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)|kidney(1)	2						c.(1339-1341)AAA>AGA		nuclear receptor coactivator 4 isoform 3		A	ARG/LYS,ARG/LYS,ARG/LYS,ARG/LYS,ARG/LYS	3,4403	6.2+/-15.9	0,3,2200	104.0	116.0	112.0		1388,1388,1340,1340,1340	2.0	0.0	10	dbSNP_129	112	48,8552	29.6+/-80.5	0,48,4252	no	missense,missense,missense,missense,missense	NCOA4	NM_001145260.1,NM_001145261.1,NM_001145262.1,NM_001145263.1,NM_005437.3	26,26,26,26,26	0,51,6452	GG,GA,AA		0.5581,0.0681,0.3921	possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging	463/651,463/631,447/615,447/615,447/615	51585241	51,12955	2203	4300	6503	SO:0001583	missense	8031				androgen receptor signaling pathway|male gonad development|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	androgen receptor binding|transcription coactivator activity	g.chr10:51585241A>G	L49399	CCDS73092.1, CCDS73093.1, CCDS73094.1	10q11.2	2014-04-10			ENSG00000138293	ENSG00000266412			7671	protein-coding gene	gene with protein product	"""RET-activating gene ELE1"""	601984				8290261, 8643607, 24695223	Standard	NM_001145260		Approved	ARA70, RFG, ELE1, PTC3, DKFZp762E1112	uc009xon.3	Q13772	OTTHUMG00000188314	ENST00000443446.1:c.1340A>G	10.37:g.51585241A>G	ENSP00000390713:p.Lys447Arg		Somatic				PARG_uc001jih.2_Intron|uc010qha.1_Intron|uc001jin.2_Intron|uc010qhb.1_Intron|uc010qhc.1_Intron|NCOA4_uc009xon.2_Missense_Mutation_p.K463R|NCOA4_uc010qhd.1_Missense_Mutation_p.K463R|NCOA4_uc010qhe.1_Missense_Mutation_p.K347R|NCOA4_uc010qhf.1_Missense_Mutation_p.K281R|NCOA4_uc001jit.2_Missense_Mutation_p.K447R|NCOA4_uc009xoo.2_Missense_Mutation_p.K447R	p.K447R	NM_001145263	NP_001138735	WXS	Illumina HiSeq	Unspecified	Q13772	NCOA4_HUMAN			8	1543	+			447					A8K8W5|B4E260|E9PAV7|J3KQN8|Q14239	Missense_Mutation	SNP	ENST00000443446.1	37	c.1340A>G	CCDS7237.1	2	9.157509157509158E-4	0	0.0	2	0.0055248618784530384	0	0.0	0	0.0	A	9.667	1.145724	0.21288	6.81E-4	0.005581	ENSG00000138293	ENST00000438493;ENST00000452682;ENST00000430396;ENST00000374087;ENST00000414907;ENST00000344348;ENST00000374082;ENST00000443446	T;T;T;T;T;T;T;T	0.36520	1.25;1.25;1.25;1.25;1.25;1.25;1.25;1.25	5.6	1.96	0.26148	.	0.507788	0.22270	N	0.062271	T	0.20740	0.0499	M	0.64997	1.995	0.09310	N	1	B;B;B;B	0.21071	0.051;0.016;0.028;0.002	B;B;B;B	0.16722	0.016;0.011;0.011;0.005	T	0.17077	-1.0381	9	.	.	.	-3.3916	2.2831	0.04119	0.6011:0.1318:0.1404:0.1266	rs61754798	347;463;463;447	B4DF87;B4E260;E9PAV7;Q13772	.;.;.;NCOA4_HUMAN	R	463;463;347;447;281;447;447;447	ENSP00000405146:K463R;ENSP00000395465:K463R;ENSP00000393053:K347R;ENSP00000363200:K447R;ENSP00000411018:K281R;ENSP00000344552:K447R;ENSP00000363195:K447R;ENSP00000390713:K447R	.	K	+	2	0	NCOA4	51255247	0.923000	0.31300	0.049000	0.19019	0.873000	0.50193	3.054000	0.49908	0.388000	0.25054	0.528000	0.53228	AAA		0.428	NCOA4-204	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048052.1	NM_005437		3	198	0	0	0	0.004672	0	3	198				
SGMS1	259230	broad.mit.edu	37	10	52103484	52103484	+	Nonsense_Mutation	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr10:52103484C>A	ENST00000361781.2	-	7	1350	c.391G>T	c.(391-393)Gag>Tag	p.E131*	SGMS1_ENST00000429490.1_Intron|SGMS1_ENST00000361543.2_Nonsense_Mutation_p.E131*|SGMS1_ENST00000492601.2_5'Flank	NM_147156.3	NP_671512.1	Q86VZ5	SMS1_HUMAN	sphingomyelin synthase 1	137					apoptotic process (GO:0006915)|cell growth (GO:0016049)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingomyelin biosynthetic process (GO:0006686)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|Golgi trans cisterna (GO:0000138)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ceramide cholinephosphotransferase activity (GO:0047493)|kinase activity (GO:0016301)|sphingomyelin synthase activity (GO:0033188)	p.E131*(1)		endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(4)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	16						TTGCCCCACTCCATGGGGTAC	0.488																																							uc001jje.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)|kidney(1)	2						c.(391-393)GAG>TAG		sphingomyelin synthase 1							98.0	96.0	97.0					10																	52103484		2203	4300	6503	SO:0001587	stop_gained	259230				apoptosis|cell growth|sphingomyelin biosynthetic process	endoplasmic reticulum|Golgi trans cisterna|integral to Golgi membrane|nucleus|plasma membrane	ceramide cholinephosphotransferase activity|kinase activity|sphingomyelin synthase activity	g.chr10:52103484C>A	AY280959	CCDS7240.1	10q11.2	2013-01-10	2007-03-16	2007-03-16	ENSG00000198964	ENSG00000198964	2.7.8.27	"""Sterile alpha motif (SAM) domain containing"""	29799	protein-coding gene	gene with protein product		611573	"""transmembrane protein 23"""	TMEM23		11841947, 14976195	Standard	NM_147156		Approved	MOB, MGC17342, SMS1	uc001jje.3	Q86VZ5	OTTHUMG00000018231	ENST00000361781.2:c.391G>T	10.37:g.52103484C>A	ENSP00000354829:p.Glu131*		Somatic				SGMS1_uc010qhk.1_Intron|SGMS1_uc009xot.1_Intron|SGMS1_uc009xou.1_Nonsense_Mutation_p.E131*|SGMS1_uc010qhl.1_RNA	p.E131*	NM_147156	NP_671512	WXS	Illumina HiSeq	Unspecified	Q86VZ5	SMS1_HUMAN			7	1345	-			137					Q68U43|Q6EKK0|Q75SP1	Nonsense_Mutation	SNP	ENST00000361781.2	37	c.391G>T	CCDS7240.1	.	.	.	.	.	.	.	.	.	.	C	37	6.618651	0.97709	.	.	ENSG00000198964	ENST00000361781;ENST00000361543	.	.	.	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-17.863	17.1838	0.86861	0.0:1.0:0.0:0.0	.	.	.	.	X	131	.	ENSP00000355235:E131X	E	-	1	0	SGMS1	51773490	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.403000	0.79983	2.648000	0.89879	0.650000	0.86243	GAG		0.488	SGMS1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048074.2	NM_147156		36	78	1	0	5.71845e-15	0.005524	1.28218e-14	36	78				
A1CF	29974	broad.mit.edu	37	10	52595888	52595888	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr10:52595888C>A	ENST00000373993.1	-	4	594	c.550G>T	c.(550-552)Gtg>Ttg	p.V184L	A1CF_ENST00000282641.2_Missense_Mutation_p.V184L|A1CF_ENST00000373997.3_Missense_Mutation_p.V184L|A1CF_ENST00000374001.2_Missense_Mutation_p.V184L|A1CF_ENST00000373995.3_Missense_Mutation_p.V192L|A1CF_ENST00000395489.2_Missense_Mutation_p.V177L|A1CF_ENST00000395495.1_Missense_Mutation_p.V184L			Q9NQ94	A1CF_HUMAN	APOBEC1 complementation factor	184	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cytidine to uridine editing (GO:0016554)|gene expression (GO:0010467)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|protein stabilization (GO:0050821)	apolipoprotein B mRNA editing enzyme complex (GO:0030895)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|single-stranded RNA binding (GO:0003727)	p.V184L(1)|p.V192L(1)		NS(1)|breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(14)|prostate(2)|skin(3)	29						TCATACTCCACGAAGGCAAAG	0.488																																							uc001jjj.2		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(1)	1						c.(550-552)GTG>TTG		apobec-1 complementation factor isoform 2							129.0	120.0	123.0					10																	52595888		2203	4300	6503	SO:0001583	missense	29974				cytidine to uridine editing|mRNA modification|mRNA processing|protein stabilization	apolipoprotein B mRNA editing enzyme complex|endoplasmic reticulum|nucleoplasm	nucleotide binding|protein binding|single-stranded RNA binding	g.chr10:52595888C>A	AF271790	CCDS7241.1, CCDS7242.1, CCDS7243.1, CCDS73133.1	10q21.1	2013-02-12			ENSG00000148584	ENSG00000148584		"""RNA binding motif (RRM) containing"""	24086	protein-coding gene	gene with protein product						11815617, 11072063	Standard	NM_014576		Approved	ACF, ASP, ACF64, ACF65, APOBEC1CF	uc001jjj.3	Q9NQ94	OTTHUMG00000018240	ENST00000373993.1:c.550G>T	10.37:g.52595888C>A	ENSP00000363105:p.Val184Leu		Somatic				A1CF_uc010qhn.1_Missense_Mutation_p.V192L|A1CF_uc001jji.2_Missense_Mutation_p.V184L|A1CF_uc001jjh.2_Missense_Mutation_p.V192L|A1CF_uc010qho.1_Missense_Mutation_p.V192L|A1CF_uc009xov.2_Missense_Mutation_p.V184L	p.V184L	NM_138932	NP_620310	WXS	Illumina HiSeq	Unspecified	Q9NQ94	A1CF_HUMAN			6	738	-			184			RRM 2.		A1L4F2|A8K7G7|B7ZM14|Q5SZQ0|Q9NQ93|Q9NQX8|Q9NQX9|Q9NXC9|Q9NZD3	Missense_Mutation	SNP	ENST00000373993.1	37	c.550G>T	CCDS7242.1	.	.	.	.	.	.	.	.	.	.	C	15.81	2.944586	0.53079	.	.	ENSG00000148584	ENST00000374001;ENST00000373993;ENST00000373997;ENST00000373995;ENST00000282641;ENST00000395495;ENST00000395488;ENST00000395489;ENST00000414883	T;T;T;T;T;T;T;T	0.37411	1.2;1.2;1.2;1.2;1.2;1.2;1.2;1.2	6.04	6.04	0.98038	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.63307	0.2500	M	0.80982	2.52	0.80722	D	1	P;P;D;P	0.56035	0.901;0.832;0.974;0.899	P;P;D;P	0.75020	0.89;0.895;0.985;0.881	T	0.58896	-0.7555	10	0.35671	T	0.21	-8.0174	18.0887	0.89466	0.0:1.0:0.0:0.0	.	177;184;184;192	F8W9F8;Q9NQ94;Q9NQ94-2;Q9NQ94-4	.;A1CF_HUMAN;.;.	L	184;184;184;192;184;184;167;177;184	ENSP00000363113:V184L;ENSP00000363105:V184L;ENSP00000363109:V184L;ENSP00000363107:V192L;ENSP00000282641:V184L;ENSP00000378873:V184L;ENSP00000378868:V177L;ENSP00000397953:V184L	ENSP00000282641:V184L	V	-	1	0	A1CF	52265894	1.000000	0.71417	1.000000	0.80357	0.815000	0.46073	7.731000	0.84895	2.873000	0.98535	0.563000	0.77884	GTG		0.488	A1CF-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048086.2	NM_014576		11	124	1	0	2.27111e-07	0.001368	4.11236e-07	11	124				
MYPN	84665	broad.mit.edu	37	10	69909840	69909840	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr10:69909840C>G	ENST00000358913.5	+	6	1777	c.1289C>G	c.(1288-1290)cCt>cGt	p.P430R	MYPN_ENST00000373675.3_Missense_Mutation_p.P430R|MYPN_ENST00000354393.2_Missense_Mutation_p.P155R|MYPN_ENST00000540630.1_Missense_Mutation_p.P430R	NM_001256267.1|NM_032578.3	NP_001243196.1|NP_115967.2	Q86TC9	MYPN_HUMAN	myopalladin	430	Interaction with CARP.				sarcomere organization (GO:0045214)	I band (GO:0031674)|nucleus (GO:0005634)|Z disc (GO:0030018)	cytoskeletal protein binding (GO:0008092)|muscle alpha-actinin binding (GO:0051371)|SH3 domain binding (GO:0017124)	p.P430R(1)		breast(2)|central_nervous_system(1)|endometrium(13)|kidney(6)|large_intestine(13)|liver(1)|lung(43)|ovary(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(5)	94						GATGGAAAACCTATCATTGCA	0.368																																							uc001jnm.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(2)	5						c.(1288-1290)CCT>CGT		myopalladin							128.0	128.0	128.0					10																	69909840		2203	4300	6503	SO:0001583	missense	84665					nucleus|sarcomere	actin binding	g.chr10:69909840C>G	AL834247	CCDS7275.1, CCDS73142.1	10q22.1	2014-09-17			ENSG00000138347	ENSG00000138347		"""Immunoglobulin superfamily / I-set domain containing"""	23246	protein-coding gene	gene with protein product	"""sarcomeric protein myopalladin, 145 kDa"""	608517				11309420, 12482578	Standard	NM_032578		Approved	MYOP	uc001jnm.5	Q86TC9	OTTHUMG00000018344	ENST00000358913.5:c.1289C>G	10.37:g.69909840C>G	ENSP00000351790:p.Pro430Arg		Somatic				MYPN_uc001jnl.1_Missense_Mutation_p.P430R|MYPN_uc001jnn.3_Missense_Mutation_p.P155R|MYPN_uc001jno.3_Missense_Mutation_p.P430R|MYPN_uc001jnp.1_Missense_Mutation_p.P430R|MYPN_uc009xps.2_Missense_Mutation_p.P430R|MYPN_uc009xpt.2_Missense_Mutation_p.P430R|MYPN_uc010qit.1_Missense_Mutation_p.P136R|MYPN_uc010qiu.1_RNA	p.P430R	NM_032578	NP_115967	WXS	Illumina HiSeq	Unspecified	Q86TC9	MYPN_HUMAN			7	1474	+			430			Interaction with CARP.		Q5VV35|Q5VV36|Q86T37|Q8N3L4|Q96K90|Q96KF5	Missense_Mutation	SNP	ENST00000358913.5	37	c.1289C>G	CCDS7275.1	.	.	.	.	.	.	.	.	.	.	C	26.3	4.729142	0.89390	.	.	ENSG00000138347	ENST00000354393;ENST00000542332;ENST00000358913;ENST00000540630;ENST00000373675	T;T;T;T	0.63913	0.21;0.25;0.23;-0.07	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	T	0.77363	0.4119	L	0.58101	1.795	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.996;0.998	T	0.74556	-0.3626	9	.	.	.	.	19.8174	0.96576	0.0:1.0:0.0:0.0	.	430;430;155;430	F5GWA6;Q86TC9-3;Q86TC9-2;Q86TC9	.;.;.;MYPN_HUMAN	R	155;155;430;430;430	ENSP00000346369:P155R;ENSP00000351790:P430R;ENSP00000441668:P430R;ENSP00000362779:P430R	.	P	+	2	0	MYPN	69579846	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.989000	0.76219	2.757000	0.94681	0.591000	0.81541	CCT		0.368	MYPN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048307.1	NM_032578		22	60	0	0	0	0.004656	0	22	60				
PSAP	5660	broad.mit.edu	37	10	73579616	73579616	+	Silent	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr10:73579616C>A	ENST00000394936.3	-	10	1194	c.1047G>T	c.(1045-1047)ctG>ctT	p.L349L	PSAP_ENST00000394934.1_Silent_p.L351L			P07602	SAP_HUMAN	prosaposin	349	Saposin B-type 3. {ECO:0000255|PROSITE- ProRule:PRU00415}.		L -> P (in AGD). {ECO:0000269|PubMed:17919309}.		blood coagulation (GO:0007596)|cellular response to organic substance (GO:0071310)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|glycosphingolipid metabolic process (GO:0006687)|lipid transport (GO:0006869)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of catalytic activity (GO:0043085)|prostate gland growth (GO:0060736)|regulation of lipid metabolic process (GO:0019216)|regulation of MAPK cascade (GO:0043408)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)	enzyme activator activity (GO:0008047)|lipid binding (GO:0008289)	p.L349L(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	13						GGGACTTCGGCAGCTTCGAGC	0.572																																							uc001jsm.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(1045-1047)CTG>CTT		prosaposin isoform a preproprotein							40.0	41.0	40.0					10																	73579616		2203	4300	6503	SO:0001819	synonymous_variant	5660				glycosphingolipid metabolic process|lipid transport|platelet activation|platelet degranulation	extracellular space|Golgi apparatus|integral to membrane|lysosomal lumen	enzyme activator activity|lipid binding	g.chr10:73579616C>A	BC004275	CCDS7311.1	10q21-q22	2014-01-30	2008-07-31		ENSG00000197746	ENSG00000197746		"""Endogenous ligands"""	9498	protein-coding gene	gene with protein product	"""variant Gaucher disease and variant metachromatic leukodystrophy"""	176801	"""sphingolipid activator protein-1"""	SAP1, GLBA		2717620	Standard	NM_001042465		Approved		uc001jsm.3	P07602	OTTHUMG00000018429	ENST00000394936.3:c.1047G>T	10.37:g.73579616C>A			Somatic				PSAP_uc001jsl.2_Silent_p.L73L	p.L349L	NM_002778	NP_002769	WXS	Illumina HiSeq	Unspecified	P07602	SAP_HUMAN			10	1151	-			349		L -> P (in AGD).	Saposin B-type 3.		P07292|P15793|P78538|P78541|P78546|P78547|P78558|Q53Y86|Q6IBQ6|Q92739|Q92740|Q92741|Q92742	Silent	SNP	ENST00000394936.3	37	c.1047G>T	CCDS7311.1																																																																																				0.572	PSAP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000048553.1	NM_002778		10	21	1	0	1.58986e-06	0.008291	2.78226e-06	10	21				
BTAF1	9044	broad.mit.edu	37	10	93786944	93786944	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr10:93786944A>T	ENST00000265990.6	+	37	5601	c.5293A>T	c.(5293-5295)Atg>Ttg	p.M1765L	BTAF1_ENST00000544642.1_Missense_Mutation_p.M593L	NM_003972.2	NP_003963.1	O14981	BTAF1_HUMAN	BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa	1765	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				negative regulation of chromatin binding (GO:0035562)|negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.M1765L(1)		central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|lung(17)|ovary(1)|prostate(1)|skin(2)|urinary_tract(6)	59		Colorectal(252;0.0846)				AGAAAAAATAATGGGGTTGCA	0.378																																							uc001khr.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)|skin(1)	3						c.(5293-5295)ATG>TTG		BTAF1 RNA polymerase II, B-TFIID transcription							132.0	132.0	132.0					10																	93786944		2203	4300	6503	SO:0001583	missense	9044				negative regulation of transcription, DNA-dependent	nucleus	ATP binding|DNA binding|helicase activity|sequence-specific DNA binding transcription factor activity	g.chr10:93786944A>T	AJ001017	CCDS7419.1	10q22-q23	2013-05-01	2013-05-01		ENSG00000095564	ENSG00000095564			17307	protein-coding gene	gene with protein product	"""Mot1 homolog (S. cerevisiae)"""	605191	"""BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170 kD (Mot1 homolog, S. cerevisiae)"""			9342322, 9488487	Standard	NM_003972		Approved	TAFII170, TAF172, MOT1, TAF-172, TAF(II)170	uc001khr.3	O14981	OTTHUMG00000018752	ENST00000265990.6:c.5293A>T	10.37:g.93786944A>T	ENSP00000265990:p.Met1765Leu		Somatic					p.M1765L	NM_003972	NP_003963	WXS	Illumina HiSeq	Unspecified	O14981	BTAF1_HUMAN			37	5391	+		Colorectal(252;0.0846)	1765			Helicase C-terminal.		B4E0W6|O43578	Missense_Mutation	SNP	ENST00000265990.6	37	c.5293A>T	CCDS7419.1	.	.	.	.	.	.	.	.	.	.	A	21.7	4.189094	0.78789	.	.	ENSG00000095564	ENST00000265990;ENST00000544642;ENST00000538688	T;T	0.72167	-0.63;-0.63	5.52	5.52	0.82312	Helicase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.65312	0.2679	N	0.05050	-0.12	0.80722	D	1	D	0.56746	0.977	P	0.57283	0.817	T	0.71314	-0.4630	10	0.42905	T	0.14	-18.2892	15.9359	0.79707	1.0:0.0:0.0:0.0	.	1765	O14981	BTAF1_HUMAN	L	1765;593;615	ENSP00000265990:M1765L;ENSP00000439924:M593L	ENSP00000265990:M1765L	M	+	1	0	BTAF1	93776924	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.287000	0.95975	2.225000	0.72522	0.459000	0.35465	ATG		0.378	BTAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049380.4	NM_003972		20	91	0	0	0	0.007413	0	20	91				
GSTO2	119391	broad.mit.edu	37	10	106039228	106039228	+	Splice_Site	SNP	A	A	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr10:106039228A>T	ENST00000338595.2	+	5	787	c.467A>T	c.(466-468)gAg>gTg	p.E156V	GSTO2_ENST00000369707.2_Splice_Site_p.E128V|GSTO2_ENST00000401888.2_Splice_Site_p.E156V|GSTO2_ENST00000450629.2_Intron|GSTO2_ENST00000429569.2_Intron|GSTO2_ENST00000477078.2_3'UTR	NM_183239.1	NP_899062.1	Q9H4Y5	GSTO2_HUMAN	glutathione S-transferase omega 2	156	GST C-terminal.				cellular response to arsenic-containing substance (GO:0071243)|glutathione derivative biosynthetic process (GO:1901687)|L-ascorbic acid metabolic process (GO:0019852)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	glutathione dehydrogenase (ascorbate) activity (GO:0045174)|glutathione transferase activity (GO:0004364)|methylarsonate reductase activity (GO:0050610)|oxidoreductase activity (GO:0016491)	p.E156V(1)		NS(1)|breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(2)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	11		Colorectal(252;0.178)		Epithelial(162;1.14e-09)|all cancers(201;3.89e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0155)	Glutathione(DB00143)	AACCTGGAAGAGGTACAAAAA	0.527																																							uc001kyb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(466-468)GAG>GTG		glutathione S-transferase omega 2	Glutathione(DB00143)						104.0	91.0	95.0					10																	106039228		2203	4300	6503	SO:0001630	splice_region_variant	119391				water-soluble vitamin metabolic process|xenobiotic metabolic process	cytosol	glutathione transferase activity	g.chr10:106039228A>T	AY191318	CCDS7556.1, CCDS53574.1, CCDS53575.1	10q25.1	2012-06-21			ENSG00000065621	ENSG00000065621	2.5.1.18, 1.8.5.1, 1.20.4.2	"""Glutathione S-transferases / Soluble"""	23064	protein-coding gene	gene with protein product		612314				12618591	Standard	NM_001191013		Approved		uc001kyb.3	Q9H4Y5	OTTHUMG00000019006	ENST00000338595.2:c.468+1A>T	10.37:g.106039228A>T			Somatic				GSTO2_uc010qqw.1_Missense_Mutation_p.E156V|GSTO2_uc010qqx.1_Intron|GSTO2_uc001kyc.2_Missense_Mutation_p.E128V|GSTO2_uc010qqy.1_Intron	p.E156V	NM_183239	NP_899062	WXS	Illumina HiSeq	Unspecified	Q9H4Y5	GSTO2_HUMAN		Epithelial(162;1.14e-09)|all cancers(201;3.89e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0155)	5	1095	+		Colorectal(252;0.178)	156			GST C-terminal.		A8K771|B4DJW6|E7ESD6|Q49TW5|Q5GM70|Q5JU15|Q86WP3	Missense_Mutation	SNP	ENST00000338595.2	37	c.467A>T	CCDS7556.1	.	.	.	.	.	.	.	.	.	.	A	22.9	4.349777	0.82132	.	.	ENSG00000065621	ENST00000369708;ENST00000338595;ENST00000401888;ENST00000369707	D;T;D	0.93859	-3.3;2.97;-3.3	6.17	6.17	0.99709	Glutathione S-transferase, C-terminal-like (2);Glutathione S-transferase/chloride channel, C-terminal (1);	0.202998	0.51477	D	0.000081	D	0.95708	0.8604	M	0.80332	2.49	0.80722	D	1	D;P	0.55800	0.973;0.947	P;P	0.57009	0.811;0.694	D	0.95874	0.8893	10	0.72032	D	0.01	-21.8064	13.214	0.59844	1.0:0.0:0.0:0.0	.	156;156	B4DU59;Q9H4Y5	.;GSTO2_HUMAN	V	156;156;156;128	ENSP00000345023:E156V;ENSP00000386011:E156V;ENSP00000358721:E128V	ENSP00000345023:E156V	E	+	2	0	GSTO2	106029218	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	4.563000	0.60823	2.371000	0.80710	0.533000	0.62120	GAG		0.527	GSTO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050210.2	NM_183239	Missense_Mutation	6	53	0	0	0	0.001168	0	6	53				
MXI1	4601	broad.mit.edu	37	10	111987959	111987959	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr10:111987959G>T	ENST00000239007.7	+	2	304	c.86G>T	c.(85-87)gGc>gTc	p.G29V	MXI1_ENST00000369612.1_5'UTR|MXI1_ENST00000393134.1_Missense_Mutation_p.G29V|MXI1_ENST00000332674.5_Missense_Mutation_p.G96V|MXI1_ENST00000361248.4_5'UTR|MXI1_ENST00000485566.1_3'UTR	NM_005962.4	NP_005953.4	P50539	MXI1_HUMAN	MAX interactor 1, dimerization protein	29					cytoplasmic sequestering of transcription factor (GO:0042994)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription corepressor activity (GO:0003714)	p.G96V(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(3)|lung(1)	10		Breast(234;0.052)|Lung NSC(174;0.223)		Epithelial(162;1.33e-05)|all cancers(201;0.000277)|BRCA - Breast invasive adenocarcinoma(275;0.127)		TGTGAACATGGCTACGCCTCT	0.517																																							uc001kza.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(85-87)GGC>GTC		MAX interactor 1 isoform a							78.0	82.0	81.0					10																	111987959		2203	4300	6503	SO:0001583	missense	4601				cytoplasmic sequestering of transcription factor|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|transcription corepressor activity	g.chr10:111987959G>T	BC016678	CCDS7563.1, CCDS7564.2, CCDS31284.1	10q24-q25	2012-11-15	2012-11-15		ENSG00000119950	ENSG00000119950		"""MAX dimerization proteins"", ""Basic helix-loop-helix proteins"""	7534	protein-coding gene	gene with protein product		600020	"""MAX interacting protein 1"", ""MAX interactor 1"""			7959753	Standard	NM_130439		Approved	MXD2, MAD2, MXI, bHLHc11	uc001kyy.3	P50539	OTTHUMG00000019033	ENST00000239007.7:c.86G>T	10.37:g.111987959G>T	ENSP00000239007:p.Gly29Val		Somatic				MXI1_uc001kyy.2_Missense_Mutation_p.G96V|MXI1_uc001kyz.2_5'UTR|MXI1_uc010qrc.1_Missense_Mutation_p.G29V|MXI1_uc009xxu.2_Missense_Mutation_p.G26V|MXI1_uc009xxv.2_RNA	p.G29V	NM_005962	NP_005953	WXS	Illumina HiSeq	Unspecified	P50539	MXI1_HUMAN		Epithelial(162;1.33e-05)|all cancers(201;0.000277)|BRCA - Breast invasive adenocarcinoma(275;0.127)	2	293	+		Breast(234;0.052)|Lung NSC(174;0.223)	29					B1ANN7|D3DR25|D3DRA9|Q15887|Q6FHW2|Q96E53	Missense_Mutation	SNP	ENST00000239007.7	37	c.86G>T	CCDS7564.2	.	.	.	.	.	.	.	.	.	.	g	17.54	3.415231	0.62511	.	.	ENSG00000119950	ENST00000332674;ENST00000453116;ENST00000239007;ENST00000369619;ENST00000393134	T;T;T;T	0.69306	0.33;-0.08;0.42;-0.39	4.65	3.75	0.43078	.	0.101009	0.64402	D	0.000002	T	0.79499	0.4456	M	0.76170	2.325	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.998;1.0	T	0.80627	-0.1298	10	0.87932	D	0	-13.7692	10.9963	0.47578	0.0875:0.0:0.9125:0.0	.	29;29;96	B1ANN8;P50539;P50539-3	.;MXI1_HUMAN;.	V	96;96;29;29;29	ENSP00000331152:G96V;ENSP00000398981:G96V;ENSP00000239007:G29V;ENSP00000376842:G29V	ENSP00000239007:G29V	G	+	2	0	MXI1	111977949	1.000000	0.71417	1.000000	0.80357	0.888000	0.51559	6.015000	0.70791	0.938000	0.37419	0.443000	0.29094	GGC		0.517	MXI1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000050316.1	NM_130439		19	55	1	0	1.01871e-10	0.008871	2.03742e-10	19	55				
GRK5	2869	broad.mit.edu	37	10	121184541	121184541	+	Silent	SNP	C	C	T	rs189973518		TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr10:121184541C>T	ENST00000392870.2	+	6	806	c.477C>T	c.(475-477)caC>caT	p.H159H	GRK5_ENST00000369108.3_Silent_p.H54H	NM_005308.2	NP_005299.1	P34947	GRK5_HUMAN	G protein-coupled receptor kinase 5	159	N-terminal.|RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|protein autophosphorylation (GO:0046777)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|tachykinin receptor signaling pathway (GO:0007217)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|G-protein coupled receptor kinase activity (GO:0004703)|phospholipid binding (GO:0005543)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)	p.H159H(1)		endometrium(2)|large_intestine(5)|lung(15)|skin(3)|stomach(1)|urinary_tract(1)	27		Lung NSC(174;0.0971)|all_lung(145;0.127)|Ovarian(717;0.249)		all cancers(201;0.0227)		AACCATTCCACGAATATCTGG	0.502																																							uc001led.2		NA																	1	Substitution - coding silent(1)		lung(1)	lung(2)|stomach(1)	3						c.(475-477)CAC>CAT		G protein-coupled receptor kinase 5							204.0	160.0	175.0					10																	121184541		2203	4300	6503	SO:0001819	synonymous_variant	2869				G-protein signaling, coupled to cAMP nucleotide second messenger|regulation of G-protein coupled receptor protein signaling pathway|tachykinin receptor signaling pathway	cytoplasm|plasma membrane|soluble fraction	ATP binding|G-protein coupled receptor kinase activity|phospholipid binding|protein kinase C binding|signal transducer activity	g.chr10:121184541C>T	L15388	CCDS7612.1	10q26.11	2013-09-19	2004-02-04	2004-02-06	ENSG00000198873	ENSG00000198873			4544	protein-coding gene	gene with protein product		600870		GPRK5		7685906	Standard	NM_005308		Approved		uc001led.3	P34947	OTTHUMG00000019149	ENST00000392870.2:c.477C>T	10.37:g.121184541C>T			Somatic				GRK5_uc009xzh.2_Silent_p.H54H|GRK5_uc010qta.1_Silent_p.H54H	p.H159H	NM_005308	NP_005299	WXS	Illumina HiSeq	Unspecified	P34947	GRK5_HUMAN		all cancers(201;0.0227)	6	710	+		Lung NSC(174;0.0971)|all_lung(145;0.127)|Ovarian(717;0.249)	159			N-terminal.|RGS.		D3DRD0|Q5T059	Silent	SNP	ENST00000392870.2	37	c.477C>T	CCDS7612.1																																																																																				0.502	GRK5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050652.2	NM_005308		8	79	0	0	0	0.008291	0	8	79				
GRK5	2869	broad.mit.edu	37	10	121199253	121199253	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr10:121199253C>T	ENST00000392870.2	+	10	1269	c.940C>T	c.(940-942)Cct>Tct	p.P314S	GRK5_ENST00000369108.3_Missense_Mutation_p.P209S	NM_005308.2	NP_005299.1	P34947	GRK5_HUMAN	G protein-coupled receptor kinase 5	314	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|protein autophosphorylation (GO:0046777)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|tachykinin receptor signaling pathway (GO:0007217)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|G-protein coupled receptor kinase activity (GO:0004703)|phospholipid binding (GO:0005543)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)	p.P314S(1)		endometrium(2)|large_intestine(5)|lung(15)|skin(3)|stomach(1)|urinary_tract(1)	27		Lung NSC(174;0.0971)|all_lung(145;0.127)|Ovarian(717;0.249)		all cancers(201;0.0227)		AGATCTGAAACCTGAAAACAT	0.493																																							uc001led.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)|stomach(1)	3						c.(940-942)CCT>TCT		G protein-coupled receptor kinase 5							170.0	164.0	166.0					10																	121199253		2203	4300	6503	SO:0001583	missense	2869				G-protein signaling, coupled to cAMP nucleotide second messenger|regulation of G-protein coupled receptor protein signaling pathway|tachykinin receptor signaling pathway	cytoplasm|plasma membrane|soluble fraction	ATP binding|G-protein coupled receptor kinase activity|phospholipid binding|protein kinase C binding|signal transducer activity	g.chr10:121199253C>T	L15388	CCDS7612.1	10q26.11	2013-09-19	2004-02-04	2004-02-06	ENSG00000198873	ENSG00000198873			4544	protein-coding gene	gene with protein product		600870		GPRK5		7685906	Standard	NM_005308		Approved		uc001led.3	P34947	OTTHUMG00000019149	ENST00000392870.2:c.940C>T	10.37:g.121199253C>T	ENSP00000376609:p.Pro314Ser		Somatic				GRK5_uc009xzh.2_Missense_Mutation_p.P209S	p.P314S	NM_005308	NP_005299	WXS	Illumina HiSeq	Unspecified	P34947	GRK5_HUMAN		all cancers(201;0.0227)	10	1173	+		Lung NSC(174;0.0971)|all_lung(145;0.127)|Ovarian(717;0.249)	314			Protein kinase.		D3DRD0|Q5T059	Missense_Mutation	SNP	ENST00000392870.2	37	c.940C>T	CCDS7612.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.960433	0.74016	.	.	ENSG00000198873	ENST00000392870;ENST00000369108	T;T	0.40756	1.02;1.02	5.55	5.55	0.83447	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000015	T	0.72882	0.3516	M	0.89904	3.07	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.78398	-0.2219	10	0.72032	D	0.01	-9.2534	19.518	0.95171	0.0:1.0:0.0:0.0	.	314;314	B2R7K0;P34947	.;GRK5_HUMAN	S	314;209	ENSP00000376609:P314S;ENSP00000358104:P209S	ENSP00000358104:P209S	P	+	1	0	GRK5	121189243	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	7.758000	0.85224	2.615000	0.88500	0.650000	0.86243	CCT		0.493	GRK5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050652.2	NM_005308		9	54	0	0	0	0.004482	0	9	54				
TCERG1L	256536	broad.mit.edu	37	10	133058582	133058582	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr10:133058582G>T	ENST00000368642.4	-	4	881	c.796C>A	c.(796-798)Ccg>Acg	p.P266T		NM_174937.3	NP_777597.2	Q5VWI1	TCRGL_HUMAN	transcription elongation regulator 1-like	266								p.P225T(1)		cervix(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	31		all_cancers(35;1.22e-10)|all_epithelial(44;2.65e-09)|Lung NSC(174;0.00188)|all_lung(145;0.00307)|Melanoma(40;0.0179)|all_neural(114;0.0424)|Breast(234;0.0743)|Colorectal(57;0.09)		all cancers(32;0.000899)|OV - Ovarian serous cystadenocarcinoma(35;0.0021)|Epithelial(32;0.00276)		AAGTGGCGCGGCTGCACGCTG	0.701																																							uc001lkp.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(2)|ovary(2)	4						c.(796-798)CCG>ACG		transcription elongation regulator 1-like							22.0	26.0	25.0					10																	133058582		2203	4300	6503	SO:0001583	missense	256536							g.chr10:133058582G>T	AK096269	CCDS7662.2	10q26.3	2006-04-12			ENSG00000176769	ENSG00000176769			23533	protein-coding gene	gene with protein product							Standard	NM_174937		Approved	FLJ38950	uc001lkp.3	Q5VWI1	OTTHUMG00000019276	ENST00000368642.4:c.796C>A	10.37:g.133058582G>T	ENSP00000357631:p.Pro266Thr		Somatic				TCERG1L_uc009yax.1_RNA	p.P266T	NM_174937	NP_777597	WXS	Illumina HiSeq	Unspecified	Q5VWI1	TCRGL_HUMAN		all cancers(32;0.000899)|OV - Ovarian serous cystadenocarcinoma(35;0.0021)|Epithelial(32;0.00276)	4	882	-		all_cancers(35;1.22e-10)|all_epithelial(44;2.65e-09)|Lung NSC(174;0.00188)|all_lung(145;0.00307)|Melanoma(40;0.0179)|all_neural(114;0.0424)|Breast(234;0.0743)|Colorectal(57;0.09)	266					Q5VWI2|Q86XM8	Missense_Mutation	SNP	ENST00000368642.4	37	c.796C>A	CCDS7662.2	.	.	.	.	.	.	.	.	.	.	G	17.64	3.440236	0.63067	.	.	ENSG00000176769	ENST00000368642	T	0.29917	1.55	5.2	5.2	0.72013	.	0.092545	0.45867	D	0.000328	T	0.44850	0.1313	L	0.47716	1.5	0.43342	D	0.995396	D	0.69078	0.997	P	0.61397	0.888	T	0.16364	-1.0405	10	0.33940	T	0.23	-7.6038	15.4636	0.75381	0.0:0.0:1.0:0.0	.	266	Q5VWI1	TCRGL_HUMAN	T	266	ENSP00000357631:P266T	ENSP00000357631:P266T	P	-	1	0	TCERG1L	132948572	1.000000	0.71417	0.994000	0.49952	0.703000	0.40648	4.723000	0.61965	2.407000	0.81776	0.655000	0.94253	CCG		0.701	TCERG1L-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091619.2	NM_174937		4	16	1	0	1.23904e-05	0.000602	2.08566e-05	4	16				
Unknown	0	broad.mit.edu	37	10	135491108	135491108	+	IGR	SNP	C	C	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr10:135491108C>T								AL845259.1 (17929 upstream) : None (None downstream)																							TCGTGGGTCGCCTTCGCCCAC	0.776																																							uc010qvi.1		NA																	0					0						c.(718-720)GCC>GTC		double homeobox, 4-like							14.0	16.0	15.0					10																	135491108		1146	2187	3333	SO:0001628	intergenic_variant	653544					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr10:135491108C>T																													10.37:g.135491108C>T			Somatic					p.A240V	NM_001127389	NP_001120861	WXS	Illumina HiSeq	Unspecified	F5GZ66	F5GZ66_HUMAN			1	830	+			240						Missense_Mutation	SNP		37	c.719C>T																																																																																				0	0.776									4	21	0	0	0	0.000248	0	4	21				
MUC5B	727897	broad.mit.edu	37	11	1272644	1272644	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr11:1272644C>A	ENST00000529681.1	+	31	14592	c.14534C>A	c.(14533-14535)aCc>aAc	p.T4845N	RP11-532E4.2_ENST00000532061.2_RNA|MUC5B_ENST00000447027.1_Missense_Mutation_p.T4848N	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	4845	23 X approximate tandem repeats, Ser/Thr- rich.|Thr-rich.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)		p.T4800N(1)|p.T4845N(1)		cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CCAGGGACCACCTGGATCCTC	0.632																																							uc009ycr.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(15499-15501)ACC>AAC		SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;							123.0	145.0	138.0					11																	1272644		2149	4230	6379	SO:0001583	missense	727897				cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding	g.chr11:1272644C>A	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.14534C>A	11.37:g.1272644C>A	ENSP00000436812:p.Thr4845Asn		Somatic				MUC5B_uc001ltb.2_Missense_Mutation_p.T4848N	p.T5167N	NM_017511	NP_059981	WXS	Illumina HiSeq	Unspecified	Q9HC84	MUC5B_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)	52	15626	+		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)	4845			23 X approximate tandem repeats, Ser/Thr- rich.|Thr-rich.		O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	c.15500C>A	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	c	6.913	0.538142	0.13188	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.26810	1.71;1.9	2.32	-0.293	0.12835	.	.	.	.	.	T	0.21267	0.0512	L	0.29908	0.895	0.09310	N	1	D;D	0.54964	0.969;0.969	P;P	0.47827	0.558;0.558	T	0.16660	-1.0395	9	0.87932	D	0	.	6.7625	0.23548	0.1967:0.6105:0.1928:0.0	.	5167;4848	A7Y9J9;E9PBJ0	.;.	N	4845;4848;4789;4544	ENSP00000436812:T4845N;ENSP00000415793:T4848N	ENSP00000343037:T4789N	T	+	2	0	MUC5B	1229220	0.000000	0.05858	0.002000	0.10522	0.159000	0.22180	-0.859000	0.04277	0.261000	0.21753	0.134000	0.15878	ACC		0.632	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093		27	62	1	0	2.14196e-07	0.007291	3.90312e-07	27	62				
MUC5B	727897	broad.mit.edu	37	11	1272646	1272646	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr11:1272646T>C	ENST00000529681.1	+	31	14594	c.14536T>C	c.(14536-14538)Tgg>Cgg	p.W4846R	RP11-532E4.2_ENST00000532061.2_RNA|MUC5B_ENST00000447027.1_Missense_Mutation_p.W4849R	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	4846	23 X approximate tandem repeats, Ser/Thr- rich.|Thr-rich.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)		p.W4801R(1)|p.W4846R(1)		cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		AGGGACCACCTGGATCCTCAC	0.632																																							uc009ycr.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(15502-15504)TGG>CGG		SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;																																				SO:0001583	missense	727897				cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding	g.chr11:1272646T>C	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.14536T>C	11.37:g.1272646T>C	ENSP00000436812:p.Trp4846Arg		Somatic				MUC5B_uc001ltb.2_Missense_Mutation_p.W4849R	p.W5168R	NM_017511	NP_059981	WXS	Illumina HiSeq	Unspecified	Q9HC84	MUC5B_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)	52	15628	+		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)	4846			23 X approximate tandem repeats, Ser/Thr- rich.|Thr-rich.		O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	c.15502T>C	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	t	5.226	0.227191	0.09916	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.15952	2.38;2.56	2.32	-2.73	0.05950	.	.	.	.	.	T	0.11110	0.0271	L	0.29908	0.895	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.002	T	0.33266	-0.9875	9	0.87932	D	0	.	6.8704	0.24117	0.0:0.6153:0.1806:0.2041	.	5168;4849	A7Y9J9;E9PBJ0	.;.	R	4846;4849;4790;4545	ENSP00000436812:W4846R;ENSP00000415793:W4849R	ENSP00000343037:W4790R	W	+	1	0	MUC5B	1229222	0.000000	0.05858	0.000000	0.03702	0.168000	0.22595	-0.757000	0.04772	-0.441000	0.07201	0.113000	0.15668	TGG		0.632	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093		27	64	0	0	0	0.007291	0	27	64				
HBB	3043	broad.mit.edu	37	11	5248282	5248282	+	De_novo_Start_OutOfFrame	SNP	G	G	T	rs63750628		TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr11:5248282G>T	ENST00000335295.4	-	0	19				CoTC_ribozyme_ENST00000408104.1_RNA	NM_000518.4	NP_000509.1	P68871	HBB_HUMAN	hemoglobin, beta						bicarbonate transport (GO:0015701)|blood coagulation (GO:0007596)|hydrogen peroxide catabolic process (GO:0042744)|nitric oxide transport (GO:0030185)|oxidation-reduction process (GO:0055114)|oxygen transport (GO:0015671)|platelet aggregation (GO:0070527)|positive regulation of cell death (GO:0010942)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|protein heterooligomerization (GO:0051291)|regulation of blood pressure (GO:0008217)|regulation of blood vessel size (GO:0050880)|renal absorption (GO:0070293)|response to hydrogen peroxide (GO:0042542)|small molecule metabolic process (GO:0044281)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|haptoglobin-hemoglobin complex (GO:0031838)|hemoglobin complex (GO:0005833)	heme binding (GO:0020037)|hemoglobin binding (GO:0030492)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|oxygen transporter activity (GO:0005344)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(7)|skin(1)	15		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.76e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)	Iron Dextran(DB00893)	AGTGAACACAGTTGTGTCAGA	0.537									Sickle Cell Trait		OREG0003733	type=REGULATORY REGION|Gene=HBB|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																											uc001mae.1		NA																	0				central_nervous_system(1)	1						c.(-32--28)AACTG>AAATG		beta globin	Iron Dextran(DB00893)						112.0	87.0	95.0					11																	5248282		2201	4298	6499			3043	Sickle_Cell_Trait	Familial Cancer Database		blood coagulation|hydrogen peroxide catabolic process|nitric oxide transport|positive regulation of cell death|positive regulation of nitric oxide biosynthetic process|protein heterooligomerization|regulation of blood pressure|regulation of blood vessel size	haptoglobin-hemoglobin complex|hemoglobin complex	heme binding|hemoglobin binding|oxygen binding|oxygen transporter activity	g.chr11:5248282G>T	J00173	CCDS7753.1	11p15.5	2014-05-19			ENSG00000244734	ENSG00000244734			4827	protein-coding gene	gene with protein product		141900				2649166	Standard	NM_000518		Approved	CD113t-C, HBD, beta-globin	uc001mae.1	P68871	OTTHUMG00000066678	ENST00000335295.4:c.-31C>A	11.37:g.5248282G>T			Somatic	OREG0003733	type=REGULATORY REGION|Gene=HBB|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	625			NM_000518	NP_000509	WXS	Illumina HiSeq	Unspecified	P68871	HBB_HUMAN		Epithelial(150;2.76e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)	1	20	-		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)						A4GX73|B2ZUE0|P02023|Q13852|Q14481|Q14510|Q45KT0|Q549N7|Q6FI08|Q6R7N2|Q8IZI1|Q9BX96|Q9UCD6|Q9UCP8|Q9UCP9	Translation_Start_Site	SNP	ENST00000335295.4	37	c.-30C>A	CCDS7753.1																																																																																				0.537	HBB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142977.2	NM_000518		8	29	1	0	1.06961e-07	0.00308	1.98692e-07	8	29				
TPP1	1200	broad.mit.edu	37	11	6637657	6637657	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr11:6637657T>C	ENST00000299427.6	-	8	1024	c.964A>G	c.(964-966)Act>Gct	p.T322A	TPP1_ENST00000533371.1_Missense_Mutation_p.T79A|TPP1_ENST00000534644.1_5'Flank|RP11-732A19.9_ENST00000545572.1_RNA	NM_000391.3	NP_000382.3	P49638	TTPA_HUMAN	tripeptidyl peptidase I	0					embryonic placenta development (GO:0001892)|intermembrane transport (GO:0046909)|intracellular pH reduction (GO:0051452)|lipid metabolic process (GO:0006629)|negative regulation of cell death (GO:0060548)|negative regulation of establishment of blood-brain barrier (GO:0090212)|response to nutrient (GO:0007584)|response to pH (GO:0009268)|response to toxic substance (GO:0009636)|transport (GO:0006810)|vitamin E metabolic process (GO:0042360)|vitamin transport (GO:0051180)	cytosol (GO:0005829)|late endosome (GO:0005770)	phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|transporter activity (GO:0005215)|vitamin E binding (GO:0008431)	p.T322A(1)		breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(9)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;3.45e-09)|BRCA - Breast invasive adenocarcinoma(625;0.131)	Vitamin E(DB00163)	TAGCTCACAGTATGCACATGT	0.542																																							uc001mel.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(964-966)ACT>GCT		tripeptidyl-peptidase I preproprotein							62.0	57.0	59.0					11																	6637657		2201	4296	6497	SO:0001583	missense	1200				bone resorption|cell death|lipid metabolic process|lysosome organization|nervous system development|neuromuscular process controlling balance|peptide catabolic process|protein catabolic process|proteolysis	lysosome|melanosome|soluble fraction	metal ion binding|peptide binding|protein binding|serine-type endopeptidase activity|tripeptidyl-peptidase activity	g.chr11:6637657T>C	AF017456	CCDS7770.1	11p15.4	2014-09-17	2004-12-09	2004-12-10	ENSG00000166340	ENSG00000166340			2073	protein-coding gene	gene with protein product	"""TPP I"""	607998	"""ceroid-lipofuscinosis, neuronal 2, late infantile (Jansky-Bielschowsky disease)"", ""spinocerebellar ataxia, autosomal recessive 7"""	CLN2, SCAR7		9653647, 23418007	Standard	NM_000391		Approved		uc001mel.1	O14773	OTTHUMG00000133404	ENST00000299427.6:c.964A>G	11.37:g.6637657T>C	ENSP00000299427:p.Thr322Ala		Somatic				TPP1_uc001mek.1_Missense_Mutation_p.T79A	p.T322A	NM_000391	NP_000382	WXS	Illumina HiSeq	Unspecified	O14773	TPP1_HUMAN		Epithelial(150;3.45e-09)|BRCA - Breast invasive adenocarcinoma(625;0.131)	8	1025	-		Medulloblastoma(188;0.00263)|all_neural(188;0.026)	322					Q71V64	Missense_Mutation	SNP	ENST00000299427.6	37	c.964A>G	CCDS7770.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	7.785|7.785	0.710251|0.710251	0.15239|0.15239	.|.	.|.	ENSG00000166340|ENSG00000166340	ENST00000436873|ENST00000299427;ENST00000533371	T|D;D	0.73575|0.99136	-0.76|-5.47;-2.64	5.27|5.27	5.27|5.27	0.74061|0.74061	.|Peptidase S8/S53, subtilisin/kexin/sedolisin (3);	.|0.107742	.|0.64402	.|D	.|0.000005	D|D	0.98264|0.98264	0.9425|0.9425	M|M	0.74546|0.74546	2.27|2.27	0.80722|0.80722	D|D	1|1	.|P	.|0.48589	.|0.912	.|P	.|0.47645	.|0.553	D|D	0.98006|0.98006	1.0363|1.0363	7|10	0.87932|0.72032	D|D	0|0.01	-20.6431|-20.6431	8.7273|8.7273	0.34478|0.34478	0.1808:0.0:0.0:0.8192|0.1808:0.0:0.0:0.8192	.|.	.|322	.|O14773	.|TPP1_HUMAN	M|A	176|322;79	ENSP00000398136:I176M|ENSP00000299427:T322A;ENSP00000437066:T79A	ENSP00000398136:I176M|ENSP00000299427:T322A	I|T	-|-	3|1	3|0	TPP1|TPP1	6594233|6594233	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.712000|0.712000	0.41017|0.41017	4.795000|4.795000	0.62489|0.62489	2.007000|2.007000	0.58848|0.58848	0.454000|0.454000	0.30748|0.30748	ATA|ACT		0.542	TPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257261.2			12	29	0	0	0	0.000978	0	12	29				
DCHS1	8642	broad.mit.edu	37	11	6662431	6662431	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr11:6662431G>T	ENST00000299441.3	-	2	825	c.414C>A	c.(412-414)gaC>gaA	p.D138E		NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	138	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D138E(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CTGGAGCATGGTCGTTGATGT	0.602																																							uc001mem.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|large_intestine(1)|pancreas(1)	5						c.(412-414)GAC>GAA		dachsous 1 precursor							81.0	55.0	64.0					11																	6662431		2201	4296	6497	SO:0001583	missense	8642				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr11:6662431G>T	AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.414C>A	11.37:g.6662431G>T	ENSP00000299441:p.Asp138Glu		Somatic					p.D138E	NM_003737	NP_003728	WXS	Illumina HiSeq	Unspecified	Q96JQ0	PCD16_HUMAN		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)	2	824	-		Medulloblastoma(188;0.00263)|all_neural(188;0.026)	138			Cadherin 1.|Extracellular (Potential).		O15098	Missense_Mutation	SNP	ENST00000299441.3	37	c.414C>A	CCDS7771.1	.	.	.	.	.	.	.	.	.	.	G	19.51	3.840495	0.71488	.	.	ENSG00000166341	ENST00000299441	T	0.62788	0.0	5.41	5.41	0.78517	Cadherin (3);Cadherin conserved site (1);Cadherin-like (1);	0.000000	0.49305	D	0.000147	D	0.85539	0.5720	H	0.95328	3.655	0.49389	D	0.999785	D	0.63046	0.992	D	0.75484	0.986	D	0.88858	0.3324	10	0.52906	T	0.07	.	18.1884	0.89799	0.0:0.0:1.0:0.0	.	138	Q96JQ0	PCD16_HUMAN	E	138	ENSP00000299441:D138E	ENSP00000299441:D138E	D	-	3	2	DCHS1	6619007	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	5.725000	0.68507	2.536000	0.85505	0.643000	0.83706	GAC		0.602	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257258.1	NM_003737		12	21	1	0	6.40141e-05	0.000978	0.000104091	12	21				
NELL1	4745	broad.mit.edu	37	11	20948922	20948922	+	Silent	SNP	T	T	C			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr11:20948922T>C	ENST00000357134.5	+	8	980	c.828T>C	c.(826-828)agT>agC	p.S276S	NELL1_ENST00000325319.5_Silent_p.S219S|NELL1_ENST00000532434.1_Silent_p.S276S|NELL1_ENST00000298925.5_Silent_p.S304S	NM_006157.3|NM_201551.1	NP_006148.2|NP_963845.1	Q92832	NELL1_HUMAN	NEL-like 1 (chicken)	276	VWFC 1. {ECO:0000255|PROSITE- ProRule:PRU00220}.				cell differentiation (GO:0030154)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of osteoblast proliferation (GO:0033689)|nervous system development (GO:0007399)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of gene expression (GO:0010468)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)	p.S276S(1)		NS(1)|breast(3)|endometrium(5)|kidney(3)|large_intestine(15)|lung(36)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	70						GTCAAGTGAGTGGACTGCTCT	0.383																																							uc001mqe.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|large_intestine(1)	3						c.(826-828)AGT>AGC		nel-like 1 isoform 1 precursor							136.0	128.0	130.0					11																	20948922		2203	4300	6503	SO:0001819	synonymous_variant	4745				cell adhesion|nervous system development	extracellular region	calcium ion binding|structural molecule activity	g.chr11:20948922T>C	AK127805	CCDS7855.1, CCDS44555.1, CCDS73267.1, CCDS73268.1	11p15.1	2008-02-01	2001-11-28		ENSG00000165973	ENSG00000165973			7750	protein-coding gene	gene with protein product		602319	"""nel (chicken)-like 1"""			8975702	Standard	NM_006157		Approved	IDH3GL, FLJ45906	uc001mqe.3	Q92832	OTTHUMG00000166042	ENST00000357134.5:c.828T>C	11.37:g.20948922T>C			Somatic				NELL1_uc001mqf.2_Silent_p.S276S|NELL1_uc009yid.2_Silent_p.S304S|NELL1_uc010rdo.1_Silent_p.S219S|NELL1_uc010rdp.1_Silent_p.S36S	p.S276S	NM_006157	NP_006148	WXS	Illumina HiSeq	Unspecified	Q92832	NELL1_HUMAN			8	981	+			276			VWFC 1.		B2CKC1|Q4VB90|Q4VB91|Q6NSY8|Q9Y472	Silent	SNP	ENST00000357134.5	37	c.828T>C	CCDS7855.1																																																																																				0.383	NELL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387588.1	NM_006157		9	40	0	0	0	0.006214	0	9	40				
LUZP2	338645	broad.mit.edu	37	11	24759796	24759796	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr11:24759796T>C	ENST00000336930.6	+	4	347	c.281T>C	c.(280-282)cTg>cCg	p.L94P	LUZP2_ENST00000533227.1_Missense_Mutation_p.L8P|LUZP2_ENST00000531187.1_3'UTR			Q86TE4	LUZP2_HUMAN	leucine zipper protein 2	94						extracellular region (GO:0005576)		p.L94P(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(11)|lung(12)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	32						CAGGAGGCCCTGCAAAATCAG	0.363																																							uc001mqs.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(280-282)CTG>CCG		leucine zipper protein 2 precursor							73.0	76.0	75.0					11																	24759796		2203	4300	6503	SO:0001583	missense	338645					extracellular region		g.chr11:24759796T>C	AL832641	CCDS31446.1, CCDS58128.1	11p14.3	2005-09-18			ENSG00000187398	ENSG00000187398			23206	protein-coding gene	gene with protein product		608178				12856284	Standard	NM_001009909		Approved		uc001mqs.3	Q86TE4	OTTHUMG00000166109	ENST00000336930.6:c.281T>C	11.37:g.24759796T>C	ENSP00000336817:p.Leu94Pro		Somatic				LUZP2_uc009yif.2_Missense_Mutation_p.L8P|LUZP2_uc009yig.2_Missense_Mutation_p.L94P	p.L94P	NM_001009909	NP_001009909	WXS	Illumina HiSeq	Unspecified	Q86TE4	LUZP2_HUMAN			4	515	+			94			Potential.		A2RUB8|E9PN53|Q6UXE7|Q6ZS65	Missense_Mutation	SNP	ENST00000336930.6	37	c.281T>C	CCDS31446.1	.	.	.	.	.	.	.	.	.	.	T	19.48	3.835851	0.71373	.	.	ENSG00000187398	ENST00000336930;ENST00000529015;ENST00000533227	T;T;T	0.23950	1.88;1.88;1.88	5.77	5.77	0.91146	.	0.313351	0.30118	N	0.010366	T	0.44603	0.1301	L	0.50333	1.59	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.68943	0.961;0.961	T	0.37150	-0.9718	10	0.87932	D	0	-8.7217	14.0207	0.64553	0.0:0.0:0.0:1.0	.	8;94	E9PN53;Q86TE4	.;LUZP2_HUMAN	P	94;94;8	ENSP00000336817:L94P;ENSP00000437032:L94P;ENSP00000432952:L8P	ENSP00000336817:L94P	L	+	2	0	LUZP2	24716372	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.267000	0.72546	2.199000	0.70637	0.533000	0.62120	CTG		0.363	LUZP2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387861.1	NM_001009909		18	38	0	0	0	0.008871	0	18	38				
LRRC4C	57689	broad.mit.edu	37	11	40137252	40137252	+	Silent	SNP	G	G	C			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr11:40137252G>C	ENST00000278198.2	-	2	2554	c.591C>G	c.(589-591)tcC>tcG	p.S197S	LRRC4C_ENST00000528697.1_Silent_p.S197S|LRRC4C_ENST00000530763.1_Silent_p.S197S|LRRC4C_ENST00000527150.1_Silent_p.S197S			Q9HCJ2	LRC4C_HUMAN	leucine rich repeat containing 4C	197					regulation of axonogenesis (GO:0050770)	cell junction (GO:0030054)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|postsynaptic membrane (GO:0045211)		p.S197S(1)		NS(2)|central_nervous_system(3)|endometrium(1)|large_intestine(14)|lung(43)|ovary(5)|prostate(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	86		all_lung(304;0.0575)|Lung NSC(402;0.138)				ACCTCAAGTTGGACAGACCTT	0.428																																							uc001mxa.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|skin(3)|central_nervous_system(1)	8						c.(589-591)TCC>TCG		netrin-G1 ligand precursor							93.0	91.0	92.0					11																	40137252		2203	4300	6503	SO:0001819	synonymous_variant	57689				regulation of axonogenesis	integral to membrane	protein binding	g.chr11:40137252G>C	AB046800	CCDS31464.1	11p12	2013-01-14				ENSG00000148948		"""Immunoglobulin superfamily / I-set domain containing"""	29317	protein-coding gene	gene with protein product		608817				14595443	Standard	NM_020929		Approved	KIAA1580, NGL-1	uc031pzu.1	Q9HCJ2		ENST00000278198.2:c.591C>G	11.37:g.40137252G>C			Somatic				LRRC4C_uc001mxc.1_Silent_p.S193S|LRRC4C_uc001mxd.1_Silent_p.S193S|LRRC4C_uc001mxb.1_Silent_p.S193S	p.S197S	NM_020929	NP_065980	WXS	Illumina HiSeq	Unspecified	Q9HCJ2	LRC4C_HUMAN			2	2555	-		all_lung(304;0.0575)|Lung NSC(402;0.138)	197					A8K0T1|Q7L0N3	Silent	SNP	ENST00000278198.2	37	c.591C>G	CCDS31464.1																																																																																				0.428	LRRC4C-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389499.1	NM_020929		8	54	0	0	0	0.004482	0	8	54				
TTC17	55761	broad.mit.edu	37	11	43436154	43436154	+	Silent	SNP	G	G	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr11:43436154G>A	ENST00000039989.4	+	16	2093	c.2079G>A	c.(2077-2079)ttG>ttA	p.L693L	TTC17_ENST00000526774.1_3'UTR|TTC17_ENST00000299240.6_Silent_p.L693L	NM_018259.5	NP_060729.2	Q96AE7	TTC17_HUMAN	tetratricopeptide repeat domain 17	693					actin filament polymerization (GO:0030041)|cilium organization (GO:0044782)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)		p.L693L(1)		breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(27)|ovary(5)|prostate(3)|skin(3)	53						TGACCTTTTTGAGCCTGGGAA	0.393																																							uc001mxi.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(5)	5						c.(2077-2079)TTG>TTA		tetratricopeptide repeat domain 17							103.0	115.0	111.0					11																	43436154		2203	4300	6503	SO:0001819	synonymous_variant	55761						binding	g.chr11:43436154G>A	AK001540	CCDS31466.1	11p11.2	2013-01-10			ENSG00000052841	ENSG00000052841		"""Tetratricopeptide (TTC) repeat domain containing"""	25596	protein-coding gene	gene with protein product						12477932	Standard	NM_018259		Approved	FLJ10890	uc001mxi.3	Q96AE7	OTTHUMG00000166398	ENST00000039989.4:c.2079G>A	11.37:g.43436154G>A			Somatic				TTC17_uc001mxh.2_Silent_p.L693L|TTC17_uc010rfj.1_Silent_p.L636L|TTC17_uc001mxj.2_Silent_p.L463L	p.L693L	NM_018259	NP_060729	WXS	Illumina HiSeq	Unspecified	Q96AE7	TTC17_HUMAN			16	2093	+			693			TPR 3.		G3XAB3|Q8NEC0	Silent	SNP	ENST00000039989.4	37	c.2079G>A	CCDS31466.1																																																																																				0.393	TTC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389577.2	NM_018259		28	166	0	0	0	0.008361	0	28	166				
RAPSN	5913	broad.mit.edu	37	11	47464332	47464332	+	Missense_Mutation	SNP	G	G	A	rs121909257		TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr11:47464332G>A	ENST00000298854.2	-	3	779	c.566C>T	c.(565-567)gCg>gTg	p.A189V	RAPSN_ENST00000524487.1_Intron|RAPSN_ENST00000352508.3_Missense_Mutation_p.A189V|RAPSN_ENST00000529341.1_Missense_Mutation_p.A189V|RAPSN_ENST00000528356.1_5'Flank|RNU6-1302P_ENST00000516518.1_RNA	NM_005055.4	NP_005046.2	Q13702	RAPSN_HUMAN	receptor-associated protein of the synapse	189			A -> V (in FADS). {ECO:0000269|PubMed:18252226}.		positive regulation of neuron apoptotic process (GO:0043525)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|neuromuscular junction (GO:0031594)|postsynaptic membrane (GO:0045211)	acetylcholine receptor binding (GO:0033130)|zinc ion binding (GO:0008270)	p.A189V(1)		endometrium(1)|large_intestine(3)|lung(6)|ovary(2)	12						AAGCTCTGCCGCCTTGCAGGG	0.607																																							uc001nfi.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1	GRCh37	CM080516	RAPSN	M	rs121909257	c.(565-567)GCG>GTG		43 kD receptor-associated protein of the synapse							86.0	80.0	82.0					11																	47464332		2201	4298	6499	SO:0001583	missense	5913				synaptic transmission, cholinergic	cell junction|cytoskeleton|postsynaptic membrane	acetylcholine receptor binding|zinc ion binding	g.chr11:47464332G>A		CCDS7936.1, CCDS7937.1	11p11.2	2009-04-28	2007-02-23		ENSG00000165917	ENSG00000165917		"""RING-type (C3HC4) zinc fingers"""	9863	protein-coding gene	gene with protein product	"""rapsyn"""	601592	"""receptor-associated protein of the synapse, 43kD"""			8812503	Standard	NM_005055		Approved	RNF205, CMS1D, CMS1E	uc001nfi.2	Q13702	OTTHUMG00000166891	ENST00000298854.2:c.566C>T	11.37:g.47464332G>A	ENSP00000298854:p.Ala189Val		Somatic				RAPSN_uc001nfj.1_Missense_Mutation_p.A189V|RAPSN_uc009yls.1_Missense_Mutation_p.A189V	p.A189V	NM_005055	NP_005046	WXS	Illumina HiSeq	Unspecified	Q13702	RAPSN_HUMAN			3	780	-			189		A -> V (in FADS).	TPR 4.		Q8TDF3|Q9BTD9	Missense_Mutation	SNP	ENST00000298854.2	37	c.566C>T	CCDS7936.1	.	.	.	.	.	.	.	.	.	.	G	32	5.171603	0.94807	.	.	ENSG00000165917	ENST00000298854;ENST00000352508;ENST00000529341	D;T;T	0.82167	-1.58;0.64;0.64	5.09	5.09	0.68999	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	D	0.86611	0.5974	L	0.29908	0.895	0.80722	A	1	D;D;D	0.89917	0.997;0.998;1.0	P;D;D	0.76575	0.821;0.974;0.988	D	0.86615	0.1875	9	0.44086	T	0.13	-16.4929	18.8521	0.92237	0.0:0.0:1.0:0.0	.	189;189;189	E9PK11;Q13702-2;Q13702	.;.;RAPSN_HUMAN	V	189	ENSP00000298854:A189V;ENSP00000298853:A189V;ENSP00000431732:A189V	ENSP00000298854:A189V	A	-	2	0	RAPSN	47420908	1.000000	0.71417	0.965000	0.40720	0.887000	0.51463	9.420000	0.97426	2.538000	0.85594	0.655000	0.94253	GCG		0.607	RAPSN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391726.1			23	68	0	0	0	0.00333	0	23	68				
OR4C12	283093	broad.mit.edu	37	11	50003113	50003113	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr11:50003113C>A	ENST00000335238.4	-	1	958	c.925G>T	c.(925-927)Gat>Tat	p.D309Y		NM_001005270.2	NP_001005270.2	Q96R67	OR4CC_HUMAN	olfactory receptor, family 4, subfamily C, member 12	309						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.D309Y(1)		NS(1)|kidney(4)|large_intestine(3)|liver(1)|lung(19)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	36						CTTATTTAATCATTATCTGAA	0.378																																							uc010ria.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(925-927)GAT>TAT		olfactory receptor, family 4, subfamily C,							55.0	51.0	53.0					11																	50003113		2201	4296	6497	SO:0001583	missense	283093				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:50003113C>A	BK004413	CCDS31496.1	11p11.12	2012-08-09			ENSG00000221954	ENSG00000221954		"""GPCR / Class A : Olfactory receptors"""	15168	protein-coding gene	gene with protein product							Standard	NM_001005270		Approved		uc010ria.2	Q96R67	OTTHUMG00000166687	ENST00000335238.4:c.925G>T	11.37:g.50003113C>A	ENSP00000334418:p.Asp309Tyr		Somatic					p.D309Y	NM_001005270	NP_001005270	WXS	Illumina HiSeq	Unspecified	Q96R67	OR4CC_HUMAN			1	925	-			309			Cytoplasmic (Potential).		B2RNF0|Q6IF49	Missense_Mutation	SNP	ENST00000335238.4	37	c.925G>T	CCDS31496.1	.	.	.	.	.	.	.	.	.	.	.	10.26	1.299919	0.23650	.	.	ENSG00000221954	ENST00000335238	T	0.01119	5.31	2.98	-5.97	0.02227	.	.	.	.	.	T	0.00580	0.0019	N	0.08118	0	0.09310	N	1	P	0.43973	0.823	B	0.36766	0.232	T	0.45512	-0.9256	9	0.87932	D	0	.	3.7601	0.08601	0.125:0.1229:0.1252:0.6269	.	309	Q96R67	OR4CC_HUMAN	Y	309	ENSP00000334418:D309Y	ENSP00000334418:D309Y	D	-	1	0	OR4C12	49959689	0.000000	0.05858	0.000000	0.03702	0.493000	0.33554	-0.549000	0.06041	-1.744000	0.01338	0.398000	0.26397	GAT		0.378	OR4C12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391104.1	NM_001005270		16	50	1	0	3.57192e-18	0.006122	8.65099e-18	16	50				
OR4C46	119749	broad.mit.edu	37	11	51515616	51515616	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr11:51515616T>A	ENST00000328188.1	+	1	335	c.335T>A	c.(334-336)cTa>cAa	p.L112Q		NM_001004703.1	NP_001004703.1	A6NHA9	O4C46_HUMAN	olfactory receptor, family 4, subfamily C, member 46	112						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L112Q(1)		endometrium(5)|large_intestine(5)|lung(31)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	48						GAGGGCATCCTACTTACTGTG	0.473																																							uc010ric.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(334-336)CTA>CAA		olfactory receptor, family 4, subfamily C,							152.0	147.0	149.0					11																	51515616		2201	4296	6497	SO:0001583	missense	119749				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:51515616T>A		CCDS73288.1	11p11.12	2012-08-09			ENSG00000185926	ENSG00000185926		"""GPCR / Class A : Olfactory receptors"""	31271	protein-coding gene	gene with protein product		614273					Standard	NM_001004703		Approved		uc010ric.2	A6NHA9	OTTHUMG00000166705	ENST00000328188.1:c.335T>A	11.37:g.51515616T>A	ENSP00000329056:p.Leu112Gln		Somatic					p.L112Q	NM_001004703	NP_001004703	WXS	Illumina HiSeq	Unspecified	A6NHA9	O4C46_HUMAN			1	335	+			112			Helical; Name=3; (Potential).			Missense_Mutation	SNP	ENST00000328188.1	37	c.335T>A	CCDS31498.1	.	.	.	.	.	.	.	.	.	.	.	8.296	0.818871	0.16607	.	.	ENSG00000185926	ENST00000328188	T	0.07327	3.2	2.63	2.63	0.31362	GPCR, rhodopsin-like superfamily (1);	0.000000	0.35646	N	0.003064	T	0.42698	0.1214	H	0.99090	4.425	0.09310	N	1	D	0.89917	1.0	D	0.75484	0.986	T	0.48980	-0.8986	10	0.87932	D	0	.	8.8424	0.35151	0.0:0.0:0.0:1.0	.	112	A6NHA9	O4C46_HUMAN	Q	112	ENSP00000329056:L112Q	ENSP00000329056:L112Q	L	+	2	0	OR4C46	51372192	0.978000	0.34361	0.005000	0.12908	0.016000	0.09150	7.334000	0.79224	1.239000	0.43787	0.113000	0.15668	CTA		0.473	OR4C46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391155.1	NM_001004703		51	148	0	0	0	0.00361	0	51	148				
OR4P4	81300	broad.mit.edu	37	11	55406518	55406518	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr11:55406518G>A	ENST00000314612.2	+	1	685	c.685G>A	c.(685-687)Gag>Aag	p.E229K		NM_001004124.1	NP_001004124.1	Q8NGL7	OR4P4_HUMAN	olfactory receptor, family 4, subfamily P, member 4	229						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.E229K(1)		autonomic_ganglia(1)|central_nervous_system(1)|kidney(4)|large_intestine(4)|lung(28)|ovary(1)|upper_aerodigestive_tract(1)	40						ATACTCTGCAGAGAGACGCAG	0.388																																							uc010rij.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(685-687)GAG>AAG		olfactory receptor, family 4, subfamily P,							184.0	129.0	148.0					11																	55406518		2181	4027	6208	SO:0001583	missense	81300				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55406518G>A	AB065775	CCDS31504.1	11q11	2012-08-09			ENSG00000181927	ENSG00000181927		"""GPCR / Class A : Olfactory receptors"""	15180	protein-coding gene	gene with protein product				OR4P3P			Standard	NM_001004124		Approved		uc010rij.2	Q8NGL7	OTTHUMG00000165300	ENST00000314612.2:c.685G>A	11.37:g.55406518G>A	ENSP00000324831:p.Glu229Lys		Somatic					p.E229K	NM_001004124	NP_001004124	WXS	Illumina HiSeq	Unspecified	Q8NGL7	OR4P4_HUMAN			1	685	+			229			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000314612.2	37	c.685G>A	CCDS31504.1	.	.	.	.	.	.	.	.	.	.	G	8.135	0.783887	0.16189	.	.	ENSG00000181927	ENST00000314612	T	0.00174	8.62	5.51	1.51	0.23008	GPCR, rhodopsin-like superfamily (1);	0.367049	0.19835	N	0.104987	T	0.00178	0.0005	L	0.52364	1.645	0.09310	N	1	B	0.15141	0.012	B	0.26969	0.075	T	0.34527	-0.9825	10	0.59425	D	0.04	-4.8542	6.8288	0.23898	0.1547:0.2741:0.5712:0.0	.	229	Q8NGL7	OR4P4_HUMAN	K	229	ENSP00000324831:E229K	ENSP00000324831:E229K	E	+	1	0	OR4P4	55163094	0.000000	0.05858	0.051000	0.19133	0.022000	0.10575	-0.040000	0.12104	0.271000	0.22005	0.637000	0.83480	GAG		0.388	OR4P4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383356.1	NM_001004124		55	28	0	0	0	0.00361	0	55	28				
OR8J3	81168	broad.mit.edu	37	11	55904484	55904484	+	Silent	SNP	G	G	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr11:55904484G>T	ENST00000301529.1	-	1	710	c.711C>A	c.(709-711)gcC>gcA	p.A237A		NM_001004064.1	NP_001004064.1	Q8NGG0	OR8J3_HUMAN	olfactory receptor, family 8, subfamily J, member 3	237						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A237A(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(1)|lung(38)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	59	Esophageal squamous(21;0.00693)					AGGTGGAAAAGGCTTTTTTCC	0.388																																							uc010riz.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(2)	2						c.(709-711)GCC>GCA		olfactory receptor, family 8, subfamily J,							112.0	103.0	106.0					11																	55904484		2201	4296	6497	SO:0001819	synonymous_variant	81168				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55904484G>T		CCDS31520.1	11q12.2	2012-08-09			ENSG00000167822	ENSG00000167822		"""GPCR / Class A : Olfactory receptors"""	15312	protein-coding gene	gene with protein product							Standard	NM_001004064		Approved		uc010riz.2	Q8NGG0	OTTHUMG00000166834	ENST00000301529.1:c.711C>A	11.37:g.55904484G>T			Somatic					p.A237A	NM_001004064	NP_001004064	WXS	Illumina HiSeq	Unspecified	Q8NGG0	OR8J3_HUMAN			1	711	-	Esophageal squamous(21;0.00693)		237			Cytoplasmic (Potential).		Q6IFB6|Q96RC2	Silent	SNP	ENST00000301529.1	37	c.711C>A	CCDS31520.1																																																																																				0.388	OR8J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391542.1	NM_001004064		41	122	1	0	3.61848e-18	0.007835	8.72692e-18	41	122				
OR8J3	81168	broad.mit.edu	37	11	55904892	55904892	+	Silent	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr11:55904892C>A	ENST00000301529.1	-	1	302	c.303G>T	c.(301-303)ctG>ctT	p.L101L		NM_001004064.1	NP_001004064.1	Q8NGG0	OR8J3_HUMAN	olfactory receptor, family 8, subfamily J, member 3	101						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L101L(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(1)|lung(38)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	59	Esophageal squamous(21;0.00693)					AGAACCCTCCCAGTTGGGTGG	0.438																																							uc010riz.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(2)	2						c.(301-303)CTG>CTT		olfactory receptor, family 8, subfamily J,							151.0	142.0	145.0					11																	55904892		2201	4296	6497	SO:0001819	synonymous_variant	81168				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55904892C>A		CCDS31520.1	11q12.2	2012-08-09			ENSG00000167822	ENSG00000167822		"""GPCR / Class A : Olfactory receptors"""	15312	protein-coding gene	gene with protein product							Standard	NM_001004064		Approved		uc010riz.2	Q8NGG0	OTTHUMG00000166834	ENST00000301529.1:c.303G>T	11.37:g.55904892C>A			Somatic					p.L101L	NM_001004064	NP_001004064	WXS	Illumina HiSeq	Unspecified	Q8NGG0	OR8J3_HUMAN			1	303	-	Esophageal squamous(21;0.00693)		101			Helical; Name=3; (Potential).		Q6IFB6|Q96RC2	Silent	SNP	ENST00000301529.1	37	c.303G>T	CCDS31520.1																																																																																				0.438	OR8J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391542.1	NM_001004064		62	108	1	0	5.08636e-23	0.00361	1.32708e-22	62	108				
OR5M3	219482	broad.mit.edu	37	11	56237227	56237227	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr11:56237227G>T	ENST00000312240.2	-	1	787	c.747C>A	c.(745-747)ttC>ttA	p.F249L		NM_001004742.2	NP_001004742.2	Q8NGP4	OR5M3_HUMAN	olfactory receptor, family 5, subfamily M, member 3	249						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.F249L(1)		NS(1)|central_nervous_system(2)|endometrium(2)|large_intestine(7)|lung(15)|ovary(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	37	Esophageal squamous(21;0.00448)					GAGTACCATAGAATATAATGA	0.488																																							uc010rjk.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(745-747)TTC>TTA		olfactory receptor, family 5, subfamily M,							56.0	54.0	55.0					11																	56237227		2201	4295	6496	SO:0001583	missense	219482				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:56237227G>T	AB065746	CCDS31532.1	11q11	2012-08-09			ENSG00000174937	ENSG00000174937		"""GPCR / Class A : Olfactory receptors"""	14806	protein-coding gene	gene with protein product							Standard	NM_001004742		Approved		uc010rjk.2	Q8NGP4	OTTHUMG00000166875	ENST00000312240.2:c.747C>A	11.37:g.56237227G>T	ENSP00000312208:p.Phe249Leu		Somatic					p.F249L	NM_001004742	NP_001004742	WXS	Illumina HiSeq	Unspecified	Q8NGP4	OR5M3_HUMAN			1	747	-	Esophageal squamous(21;0.00448)		249			Helical; Name=6; (Potential).		B2RNM7|Q6IEW4|Q96RC0	Missense_Mutation	SNP	ENST00000312240.2	37	c.747C>A	CCDS31532.1	.	.	.	.	.	.	.	.	.	.	G	15.69	2.906660	0.52333	.	.	ENSG00000174937	ENST00000312240	T	0.00285	8.3	5.08	1.14	0.20703	GPCR, rhodopsin-like superfamily (1);	0.000000	0.43747	D	0.000524	T	0.00580	0.0019	M	0.86097	2.795	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.39035	-0.9633	10	0.56958	D	0.05	-20.8155	8.1452	0.31108	0.7421:0.0:0.2579:0.0	.	249	Q8NGP4	OR5M3_HUMAN	L	249	ENSP00000312208:F249L	ENSP00000312208:F249L	F	-	3	2	OR5M3	55993803	0.006000	0.16342	0.953000	0.39169	0.754000	0.42855	0.576000	0.23744	0.261000	0.21753	-0.490000	0.04691	TTC		0.488	OR5M3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391639.1	NM_001004742		15	41	1	0	2.31682e-05	0.003163	3.85466e-05	15	41				
INCENP	3619	broad.mit.edu	37	11	61913164	61913164	+	Nonsense_Mutation	SNP	G	G	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr11:61913164G>T	ENST00000394818.3	+	14	2102	c.1900G>T	c.(1900-1902)Gag>Tag	p.E634*	INCENP_ENST00000278849.4_Nonsense_Mutation_p.E630*	NM_001040694.1	NP_001035784.1	Q9NQS7	INCE_HUMAN	inner centromere protein antigens 135/155kDa	634					chromosome segregation (GO:0007059)|cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	central element (GO:0000801)|chromocenter (GO:0010369)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lateral element (GO:0000800)|microtubule (GO:0005874)|midbody (GO:0030496)|pericentric heterochromatin (GO:0005721)|protein complex (GO:0043234)|spindle (GO:0005819)		p.E634*(1)|p.E630*(1)		breast(1)|endometrium(1)|kidney(6)|large_intestine(2)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19						GAAGATGGAGGAGGTGGAAGC	0.652																																							uc001nsw.1		NA																	2	Substitution - Nonsense(2)		lung(2)	lung(1)	1						c.(1900-1902)GAG>TAG		inner centromere protein antigens 135/155kDa							86.0	57.0	67.0					11																	61913164		2194	4287	6481	SO:0001587	stop_gained	3619				chromosome segregation|cytokinesis|mitotic prometaphase	centromeric heterochromatin|condensed chromosome kinetochore|cytosol|microtubule|spindle	protein binding	g.chr11:61913164G>T	AF282265	CCDS31582.1, CCDS44624.1	11q12.3	2013-01-17	2002-08-29		ENSG00000149503	ENSG00000149503			6058	protein-coding gene	gene with protein product		604411	"""inner centromere protein antigens (135kD, 155kD)"""			1860899, 11453556	Standard	NM_001040694		Approved	FLJ31633	uc001nsw.1	Q9NQS7	OTTHUMG00000167470	ENST00000394818.3:c.1900G>T	11.37:g.61913164G>T	ENSP00000378295:p.Glu634*		Somatic				INCENP_uc009ynw.1_Nonsense_Mutation_p.E634*|INCENP_uc001nsx.1_Nonsense_Mutation_p.E630*|INCENP_uc001nsy.1_Nonsense_Mutation_p.E44*	p.E634*	NM_001040694	NP_001035784	WXS	Illumina HiSeq	Unspecified	Q9NQS7	INCE_HUMAN			14	2102	+			634			Potential.		A8MQD2|Q5Y192	Nonsense_Mutation	SNP	ENST00000394818.3	37	c.1900G>T	CCDS44624.1	.	.	.	.	.	.	.	.	.	.	G	41	8.764452	0.98945	.	.	ENSG00000149503	ENST00000394818;ENST00000278849	.	.	.	5.53	5.53	0.82687	.	0.000000	0.56097	D	0.000035	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.36615	T	0.2	.	16.9593	0.86268	0.0:0.0:1.0:0.0	.	.	.	.	X	634;630	.	ENSP00000278849:E630X	E	+	1	0	INCENP	61669740	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	8.299000	0.89946	2.580000	0.87095	0.561000	0.74099	GAG		0.652	INCENP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000394723.2	NM_020238		5	10	1	0	3.59834e-05	0.001168	5.86774e-05	5	10				
PLCB3	5331	broad.mit.edu	37	11	64026145	64026145	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr11:64026145C>G	ENST00000540288.1	+	11	1316	c.1213C>G	c.(1213-1215)Ccc>Gcc	p.P405A	PLCB3_ENST00000279230.6_Missense_Mutation_p.P405A|PLCB3_ENST00000325234.5_Missense_Mutation_p.P338A	NM_000932.2	NP_000923.1	Q01970	PLCB3_HUMAN	phospholipase C, beta 3 (phosphatidylinositol-specific)	405	PI-PLC X-box. {ECO:0000255|PROSITE- ProRule:PRU00270}.				inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|regulation of systemic arterial blood pressure (GO:0003073)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)	p.P405A(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|pancreas(1)|prostate(3)|urinary_tract(1)	33						CAAGACCTCGCCCTACCCCGT	0.602																																							uc001nzb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(1213-1215)CCC>GCC		phospholipase C beta 3							113.0	95.0	101.0					11																	64026145		2201	4297	6498	SO:0001583	missense	5331				intracellular signal transduction|lipid catabolic process|synaptic transmission	cytosol	calcium ion binding|calmodulin binding|phosphatidylinositol phospholipase C activity|signal transducer activity	g.chr11:64026145C>G	Z26649	CCDS8064.1, CCDS53654.1	11q13	2008-03-18			ENSG00000149782	ENSG00000149782	3.1.4.11		9056	protein-coding gene	gene with protein product		600230				7849701	Standard	NM_000932		Approved		uc009ypg.2	Q01970	OTTHUMG00000167816	ENST00000540288.1:c.1213C>G	11.37:g.64026145C>G	ENSP00000443631:p.Pro405Ala		Somatic				PLCB3_uc009ypg.1_Missense_Mutation_p.P405A|PLCB3_uc009yph.1_Missense_Mutation_p.P338A|PLCB3_uc009ypi.2_Missense_Mutation_p.P405A	p.P405A	NM_000932	NP_000923	WXS	Illumina HiSeq	Unspecified	Q01970	PLCB3_HUMAN			11	1213	+			405			PI-PLC X-box.		A5PKZ6|G5E960|Q8N1A4	Missense_Mutation	SNP	ENST00000540288.1	37	c.1213C>G	CCDS8064.1	.	.	.	.	.	.	.	.	.	.	C	18.64	3.666997	0.67814	.	.	ENSG00000149782	ENST00000279230;ENST00000540288;ENST00000325234	T;T;T	0.54479	0.57;0.57;0.57	4.72	4.72	0.59763	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific , X domain (3);	0.000000	0.85682	D	0.000000	T	0.70072	0.3182	M	0.66297	2.02	0.80722	D	1	D;D	0.89917	1.0;0.993	D;P	0.74023	0.982;0.905	T	0.72181	-0.4368	10	0.49607	T	0.09	.	16.4309	0.83841	0.0:1.0:0.0:0.0	.	338;405	G5E960;Q01970	.;PLCB3_HUMAN	A	405;405;338	ENSP00000279230:P405A;ENSP00000443631:P405A;ENSP00000324660:P338A	ENSP00000279230:P405A	P	+	1	0	PLCB3	63782721	0.999000	0.42202	1.000000	0.80357	0.213000	0.24496	5.845000	0.69437	2.182000	0.69389	0.305000	0.20034	CCC		0.602	PLCB3-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396405.1			20	73	0	0	0	0.001523	0	20	73				
SNX32	254122	broad.mit.edu	37	11	65620114	65620114	+	Missense_Mutation	SNP	G	G	A	rs377041103		TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr11:65620114G>A	ENST00000308342.6	+	11	1351	c.926G>A	c.(925-927)cGg>cAg	p.R309Q		NM_152760.2	NP_689973.2	Q86XE0	SNX32_HUMAN	sorting nexin 32	309					intracellular protein transport (GO:0006886)	endosome (GO:0005768)	phosphatidylinositol binding (GO:0035091)	p.R309Q(1)		endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20				READ - Rectum adenocarcinoma(159;0.171)		CTGCTGTACCGGCGGCTGCGG	0.697																																							uc001ofr.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(925-927)CGG>CAG		sorting nexin 6B		G	GLN/ARG	1,4397		0,1,2198	16.0	18.0	17.0		926	1.1	0.1	11		17	0,8580		0,0,4290	no	missense	SNX32	NM_152760.2	43	0,1,6488	AA,AG,GG		0.0,0.0227,0.0077	benign	309/404	65620114	1,12977	2199	4290	6489	SO:0001583	missense	254122				cell communication|protein transport		phosphatidylinositol binding	g.chr11:65620114G>A	AK055496	CCDS8113.2	11q13.1	2008-03-11	2008-03-11	2008-03-11	ENSG00000172803	ENSG00000172803		"""Sorting nexins"""	26423	protein-coding gene	gene with protein product			"""sorting nexin 6B"""	SNX6B		16782399	Standard	XM_005273871		Approved	FLJ30934	uc001ofr.3	Q86XE0	OTTHUMG00000128491	ENST00000308342.6:c.926G>A	11.37:g.65620114G>A	ENSP00000310620:p.Arg309Gln		Somatic					p.R309Q	NM_152760	NP_689973	WXS	Illumina HiSeq	Unspecified	Q86XE0	SNX32_HUMAN		READ - Rectum adenocarcinoma(159;0.171)	11	1053	+			309			Potential.		Q8IW53|Q96NG4	Missense_Mutation	SNP	ENST00000308342.6	37	c.926G>A	CCDS8113.2	.	.	.	.	.	.	.	.	.	.	G	25.0	4.590992	0.86851	2.27E-4	0.0	ENSG00000172803	ENST00000308342	T	0.26223	1.75	5.21	1.13	0.20643	Vps5 C-terminal (1);	0.615165	0.14581	N	0.310876	T	0.25419	0.0618	M	0.86178	2.8	0.24048	N	0.996059	B	0.34226	0.443	B	0.22601	0.04	T	0.23476	-1.0187	10	0.59425	D	0.04	-10.1678	4.3003	0.10922	0.0788:0.1349:0.5129:0.2733	.	309	Q86XE0	SNX32_HUMAN	Q	309	ENSP00000310620:R309Q	ENSP00000310620:R309Q	R	+	2	0	SNX32	65376690	1.000000	0.71417	0.052000	0.19188	0.951000	0.60555	4.286000	0.58995	0.057000	0.16193	0.561000	0.74099	CGG		0.697	SNX32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250295.3	NM_152760		4	12	0	0	0	0.000248	0	4	12				
DPP3	10072	broad.mit.edu	37	11	66258798	66258798	+	Silent	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr11:66258798C>A	ENST00000360510.2	+	7	807	c.742C>A	c.(742-744)Cgg>Agg	p.R248R	DPP3_ENST00000541961.1_Silent_p.R248R|DPP3_ENST00000453114.1_Silent_p.R248R|DPP3_ENST00000530165.1_Silent_p.R218R|DPP3_ENST00000532677.1_Silent_p.R267R|DPP3_ENST00000531863.1_Silent_p.R268R			Q9NY33	DPP3_HUMAN	dipeptidyl-peptidase 3	248					proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	dipeptidyl-peptidase activity (GO:0008239)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.R248R(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(2)|stomach(1)	23						CCAGGTGACCCGGGGGGACTA	0.607											OREG0021109	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001oig.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|skin(1)	2						c.(742-744)CGG>AGG		dipeptidyl peptidase III							52.0	58.0	56.0					11																	66258798		2200	4295	6495	SO:0001819	synonymous_variant	10072				proteolysis	cytoplasm	aminopeptidase activity|dipeptidyl-peptidase activity|metal ion binding|metallopeptidase activity	g.chr11:66258798C>A	AB017970	CCDS8141.1, CCDS58147.1	11q12-q13.1	2008-02-05	2006-01-12		ENSG00000254986	ENSG00000254986	3.4.14.4		3008	protein-coding gene	gene with protein product		606818	"""dipeptidylpeptidase III"", ""dipeptidylpeptidase 3"""			10773679	Standard	NM_005700		Approved		uc001oif.2	Q9NY33	OTTHUMG00000167143	ENST00000360510.2:c.742C>A	11.37:g.66258798C>A			Somatic	OREG0021109	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1090	DPP3_uc001oif.1_Silent_p.R248R|DPP3_uc010rpe.1_Silent_p.R237R	p.R248R	NM_005700	NP_005691	WXS	Illumina HiSeq	Unspecified	Q9NY33	DPP3_HUMAN			7	804	+			248					B2RDB5|B4DLX4|F5H8L6|O95748|Q969H2|Q9BV67|Q9HAL6	Silent	SNP	ENST00000360510.2	37	c.742C>A	CCDS8141.1																																																																																				0.607	DPP3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393424.2			30	89	1	0	1.16021e-09	0.007291	2.24229e-09	30	89				
B3GNT6	192134	broad.mit.edu	37	11	76750717	76750717	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr11:76750717G>T	ENST00000533140.1	+	2	260	c.122G>T	c.(121-123)aGg>aTg	p.R41M	B3GNT6_ENST00000421061.1_Intron|B3GNT6_ENST00000354301.5_Missense_Mutation_p.R41M			O43505	B3GN1_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6 (core 3 synthase)	0					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|poly-N-acetyllactosamine biosynthetic process (GO:0030311)|protein glycosylation (GO:0006486)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	N-acetyllactosaminide beta-1,3-N-acetylglucosaminyltransferase activity (GO:0008532)	p.R41M(2)		central_nervous_system(1)|kidney(2)|lung(4)|prostate(1)	8						CGGGAGGAGAGGTCCCCGCAG	0.711											OREG0021252	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001oxw.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(121-123)AGG>ATG		UDP-GlcNAc:betaGal							26.0	28.0	28.0					11																	76750717		1916	4102	6018	SO:0001583	missense	192134				O-glycan processing, core 3	Golgi membrane|integral to membrane	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,3-N-acetylglucosaminyltransferase activity|galactosyltransferase activity	g.chr11:76750717G>T	AB073740	CCDS53681.1	11q13.4	2013-02-19			ENSG00000198488	ENSG00000198488		"""Beta 3-glycosyltransferases"""	24141	protein-coding gene	gene with protein product		615315				11821425	Standard	NM_138706		Approved	B3Gn-T6	uc021qnp.1	Q6ZMB0		ENST00000533140.1:c.122G>T	11.37:g.76750717G>T	ENSP00000435352:p.Arg41Met		Somatic	OREG0021252	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1170		p.R41M	NM_138706	NP_619651	WXS	Illumina HiSeq	Unspecified	Q6ZMB0	B3GN6_HUMAN			2	210	+			41			Lumenal (Potential).		Q4TTN0	Missense_Mutation	SNP	ENST00000533140.1	37	c.122G>T	CCDS53681.1	.	.	.	.	.	.	.	.	.	.	G	11.03	1.518978	0.27211	.	.	ENSG00000198488	ENST00000533140;ENST00000354301;ENST00000528622	T;T	0.28255	1.62;1.62	0.235	0.235	0.15431	.	3.711250	0.00832	N	0.001663	T	0.20251	0.0487	N	0.24115	0.695	0.19775	N	0.999956	P	0.50156	0.932	B	0.38106	0.265	T	0.24154	-1.0168	9	0.48119	T	0.1	.	.	.	.	.	41	Q6ZMB0	B3GN6_HUMAN	M	41	ENSP00000435352:R41M;ENSP00000346256:R41M	ENSP00000346256:R41M	R	+	2	0	B3GNT6	76428365	0.001000	0.12720	0.013000	0.15412	0.023000	0.10783	-0.747000	0.04823	0.308000	0.22923	0.313000	0.20887	AGG		0.711	B3GNT6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000382740.2	NM_138706		25	14	1	0	7.87624e-14	0.00278	1.69961e-13	25	14				
ATM	472	broad.mit.edu	37	11	108218090	108218090	+	Missense_Mutation	SNP	T	T	G			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr11:108218090T>G	ENST00000452508.2	+	60	8858	c.8669T>G	c.(8668-8670)cTa>cGa	p.L2890R	ATM_ENST00000525178.1_3'UTR|C11orf65_ENST00000525729.1_Intron|ATM_ENST00000278616.4_Missense_Mutation_p.L2890R|C11orf65_ENST00000526725.1_Intron			Q13315	ATM_HUMAN	ATM serine/threonine kinase	2890	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.		L -> V (in T-prolymphocytic leukemia). {ECO:0000269|PubMed:9288106, ECO:0000269|PubMed:9488043}.		brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)	p.L2890R(2)		NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	CATATAGATCTAGGTAAGTAA	0.308			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																													uc001pkb.1		NA	yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	D|Mis|N|F|S	ataxia telangiectasia mutated			"""L, O"""		leukemia|lymphoma|medulloblastoma|glioma	T-PLL		2	Substitution - Missense(2)	p.L2890V(2)	lung(2)	haematopoietic_and_lymphoid_tissue(174)|lung(25)|breast(15)|large_intestine(9)|ovary(5)|kidney(5)|central_nervous_system(4)|upper_aerodigestive_tract(1)|stomach(1)|NS(1)	240						c.(8668-8670)CTA>CGA	Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	ataxia telangiectasia mutated isoform 1							76.0	81.0	79.0					11																	108218090		2201	4297	6498	SO:0001583	missense	472	Ataxia_Telangiectasia	Familial Cancer Database	AT, Louis-Bar syndrome	cell cycle arrest|cellular response to gamma radiation|DNA damage induced protein phosphorylation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|double-strand break repair via homologous recombination|G2/M transition DNA damage checkpoint|histone mRNA catabolic process|mitotic cell cycle spindle assembly checkpoint|negative regulation of B cell proliferation|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|pre-B cell allelic exclusion|protein autophosphorylation|reciprocal meiotic recombination|replicative senescence	cytoplasmic membrane-bounded vesicle|nucleoplasm	1-phosphatidylinositol-3-kinase activity|ATP binding|DNA binding|DNA-dependent protein kinase activity|identical protein binding|protein complex binding|protein dimerization activity|protein N-terminus binding	g.chr11:108218090T>G	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.8669T>G	11.37:g.108218090T>G	ENSP00000388058:p.Leu2890Arg	TSP Lung(14;0.12)	Somatic				ATM_uc009yxr.1_Missense_Mutation_p.L2890R|C11orf65_uc010rvx.1_Intron|C11orf65_uc009yxu.1_Intron|ATM_uc001pke.1_Missense_Mutation_p.L1542R	p.L2890R	NM_000051	NP_000042	WXS	Illumina HiSeq	Unspecified	Q13315	ATM_HUMAN		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	59	9054	+		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)	2890		L -> V (in T-prolymphocytic leukemia).	PI3K/PI4K.		B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Missense_Mutation	SNP	ENST00000452508.2	37	c.8669T>G	CCDS31669.1	.	.	.	.	.	.	.	.	.	.	T	17.70	3.454179	0.63290	.	.	ENSG00000149311	ENST00000278616;ENST00000452508	D;D	0.81821	-1.54;-1.54	5.52	5.52	0.82312	Protein kinase-like domain (1);Armadillo-type fold (1);Phosphatidylinositol 3-/4-kinase, catalytic (4);	0.000000	0.64402	D	0.000003	D	0.92224	0.7534	M	0.93150	3.385	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94174	0.7426	10	0.87932	D	0	.	15.6511	0.77095	0.0:0.0:0.0:1.0	.	2890	Q13315	ATM_HUMAN	R	2890	ENSP00000278616:L2890R;ENSP00000388058:L2890R	ENSP00000278616:L2890R	L	+	2	0	ATM	107723300	1.000000	0.71417	0.966000	0.40874	0.287000	0.27160	7.461000	0.80834	2.090000	0.63153	0.454000	0.30748	CTA		0.308	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389938.1	NM_000051		30	39	0	0	0	0.001786	0	30	39				
ARHGAP20	57569	broad.mit.edu	37	11	110454436	110454436	+	Missense_Mutation	SNP	T	T	G			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr11:110454436T>G	ENST00000260283.4	-	14	1725	c.1441A>C	c.(1441-1443)Aat>Cat	p.N481H	ARHGAP20_ENST00000357139.3_Missense_Mutation_p.N455H|ARHGAP20_ENST00000529591.1_Missense_Mutation_p.N24H|ARHGAP20_ENST00000528829.1_Missense_Mutation_p.N445H|ARHGAP20_ENST00000527598.1_Missense_Mutation_p.N445H|ARHGAP20_ENST00000533353.1_Missense_Mutation_p.N455H|ARHGAP20_ENST00000524756.1_Missense_Mutation_p.N458H	NM_020809.3	NP_065860.2	Q9P2F6	RHG20_HUMAN	Rho GTPase activating protein 20	481	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)	p.N481H(1)		breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(18)|lung(13)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	60		all_cancers(61;3.26e-12)|all_epithelial(67;6.09e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;0.000484)|Acute lymphoblastic leukemia(157;0.000967)|all_neural(223;0.0199)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;3.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|all cancers(92;0.000147)|OV - Ovarian serous cystadenocarcinoma(223;0.0475)		AGAACAACATTGGCTCTCGGA	0.383																																							uc001pkz.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|kidney(2)	5						c.(1441-1443)AAT>CAT		Rho GTPase activating protein 20							94.0	80.0	85.0					11																	110454436		2201	4298	6499	SO:0001583	missense	57569				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity	g.chr11:110454436T>G	AB037812	CCDS31673.1, CCDS58175.1, CCDS58176.1, CCDS58177.1	11q23.2	2011-06-29			ENSG00000137727	ENSG00000137727		"""Rho GTPase activating proteins"""	18357	protein-coding gene	gene with protein product		609568				14532992	Standard	NM_020809		Approved	KIAA1391	uc001pkz.2	Q9P2F6	OTTHUMG00000166590	ENST00000260283.4:c.1441A>C	11.37:g.110454436T>G	ENSP00000260283:p.Asn481His		Somatic				ARHGAP20_uc001pky.1_Missense_Mutation_p.N458H|ARHGAP20_uc009yyb.1_Missense_Mutation_p.N445H|ARHGAP20_uc001pla.1_Missense_Mutation_p.N445H|ARHGAP20_uc001plb.2_Missense_Mutation_p.N24H	p.N481H	NM_020809	NP_065860	WXS	Illumina HiSeq	Unspecified	Q9P2F6	RHG20_HUMAN		Epithelial(105;3.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|all cancers(92;0.000147)|OV - Ovarian serous cystadenocarcinoma(223;0.0475)	14	1726	-		all_cancers(61;3.26e-12)|all_epithelial(67;6.09e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;0.000484)|Acute lymphoblastic leukemia(157;0.000967)|all_neural(223;0.0199)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)	481			Rho-GAP.		A8K8C5|B0YIW7|B0YIW8|Q6RJU1|Q6RJU2|Q6RJU3|Q6RJU5|Q8IXS1	Missense_Mutation	SNP	ENST00000260283.4	37	c.1441A>C	CCDS31673.1	.	.	.	.	.	.	.	.	.	.	T	19.49	3.837621	0.71373	.	.	ENSG00000137727	ENST00000260283;ENST00000357139;ENST00000529591;ENST00000524756;ENST00000528829;ENST00000533353;ENST00000527598	T;T;T;T;T;T;T	0.51325	0.71;0.71;1.68;0.71;0.71;0.71;0.71	5.56	4.41	0.53225	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.000000	0.85682	D	0.000000	T	0.64516	0.2605	M	0.63843	1.955	0.41908	D	0.990459	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.66069	-0.6015	10	0.54805	T	0.06	.	12.8768	0.57994	0.0:0.0:0.1361:0.8639	.	455;481;458	Q9P2F6-2;Q9P2F6;Q9P2F6-3	.;RHG20_HUMAN;.	H	481;455;24;458;445;455;445	ENSP00000260283:N481H;ENSP00000349660:N455H;ENSP00000437905:N24H;ENSP00000432076:N458H;ENSP00000436319:N445H;ENSP00000436522:N455H;ENSP00000431399:N445H	ENSP00000260283:N481H	N	-	1	0	ARHGAP20	109959646	1.000000	0.71417	0.999000	0.59377	0.991000	0.79684	7.196000	0.77805	1.011000	0.39340	0.482000	0.46254	AAT		0.383	ARHGAP20-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390628.1	NM_020809		14	12	0	0	0	0.00245	0	14	12				
IGSF9B	22997	broad.mit.edu	37	11	133801993	133801993	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr11:133801993C>G	ENST00000321016.8	-	8	1313	c.1083G>C	c.(1081-1083)aaG>aaC	p.K361N	IGSF9B_ENST00000533871.2_Missense_Mutation_p.K361N			Q9UPX0	TUTLB_HUMAN	immunoglobulin superfamily, member 9B	361	Ig-like 4.				homophilic cell adhesion (GO:0007156)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)	dendrite (GO:0030425)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)		p.K361N(1)		breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(18)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	all_hematologic(175;0.127)	all_cancers(12;1.58e-21)|all_epithelial(12;5.17e-16)|all_lung(97;1.6e-05)|Lung NSC(97;3.86e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;7.19e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|all cancers(11;1.23e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00328)|Lung(977;0.221)		GACGGCCGTCCTTGTTCCACT	0.607																																							uc001qgx.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1081-1083)AAG>AAC		immunoglobulin superfamily, member 9B							72.0	88.0	83.0					11																	133801993		2141	4230	6371	SO:0001583	missense	22997					integral to membrane|plasma membrane		g.chr11:133801993C>G	AK097578	CCDS61010.1	11q25	2013-02-11	2005-10-12	2005-11-20				"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	32326	protein-coding gene	gene with protein product		613773					Standard	NM_001277285		Approved	KIAA1030	uc031qfh.1	Q9UPX0		ENST00000321016.8:c.1083G>C	11.37:g.133801993C>G	ENSP00000317980:p.Lys361Asn		Somatic				IGSF9B_uc001qgy.1_Missense_Mutation_p.K203N	p.K361N	NM_014987	NP_055802	WXS	Illumina HiSeq	Unspecified	Q9UPX0	TUTLB_HUMAN		Epithelial(10;7.19e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|all cancers(11;1.23e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00328)|Lung(977;0.221)	8	1314	-	all_hematologic(175;0.127)	all_cancers(12;1.58e-21)|all_epithelial(12;5.17e-16)|all_lung(97;1.6e-05)|Lung NSC(97;3.86e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)	361			Extracellular (Potential).|Ig-like 4.		G5EA26	Missense_Mutation	SNP	ENST00000321016.8	37	c.1083G>C		.	.	.	.	.	.	.	.	.	.	C	17.64	3.439261	0.63067	.	.	ENSG00000080854	ENST00000321016;ENST00000533871;ENST00000527648	T;T;T	0.18960	2.18;2.18;2.18	4.89	1.79	0.24919	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.51024	0.1650	M	0.92077	3.27	0.47308	D	0.999386	D	0.76494	0.999	D	0.81914	0.995	T	0.58787	-0.7575	9	0.87932	D	0	.	9.9976	0.41909	0.0:0.6912:0.0:0.3088	.	361	Q9UPX0	TUTLB_HUMAN	N	361;203;361	ENSP00000317980:K361N;ENSP00000436552:K203N;ENSP00000436576:K361N	ENSP00000317980:K361N	K	-	3	2	IGSF9B	133307203	1.000000	0.71417	1.000000	0.80357	0.741000	0.42261	1.309000	0.33539	0.663000	0.31027	-0.265000	0.10407	AAG		0.607	IGSF9B-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		XM_290502		13	12	0	0	0	0.003163	0	13	12				
NANOGP1	404635	broad.mit.edu	37	12	8048247	8048247	+	RNA	SNP	T	T	G			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr12:8048247T>G	ENST00000607111.1	+	0	175							Q8N7R0	NANG2_HUMAN	Nanog homeobox pseudogene 1						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.V52G(1)		kidney(1)|lung(4)|prostate(1)	6						CAGCTGTGTGTACTCAATGAT	0.458																																							uc001qtp.1		NA																	1	Substitution - Missense(1)		lung(1)		NA						c.(154-156)GTA>GGA		RecName: Full=Putative homeobox protein NANOG2;																																						0							g.chr12:8048247T>G	AY455283		12p13.31	2014-03-20			ENSG00000176654	ENSG00000176654		"""Homeoboxes / ANTP class : NKL subclass"""	23099	pseudogene	pseudogene						15108323, 15233988	Standard	NG_006522		Approved	NANOG2	uc001qtp.1	Q8N7R0	OTTHUMG00000166020		12.37:g.8048247T>G			Somatic					p.V52G			WXS	Illumina HiSeq	Unspecified					2	235	+									Missense_Mutation	SNP	ENST00000607111.1	37	c.155T>G		.	.	.	.	.	.	.	.	.	.	T	12.00	1.807323	0.31961	.	.	ENSG00000176654	ENST00000530989;ENST00000525030	.	.	.	1.77	0.611	0.17586	.	0.536822	0.17329	N	0.178219	T	0.53753	0.1816	.	.	.	0.36956	D	0.893125	P	0.46395	0.877	P	0.54856	0.762	T	0.55289	-0.8164	8	0.39692	T	0.17	-0.3193	3.3478	0.07141	0.0:0.2275:0.0:0.7725	.	52	E9PQ94	.	G	52;70	.	ENSP00000435164:V70G	V	+	2	0	NANOGP1	7939514	0.241000	0.23857	0.563000	0.28383	0.958000	0.62258	0.638000	0.24674	0.189000	0.20188	0.240000	0.17902	GTA		0.458	NANOGP1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000470953.1			3	57	0	0	0	0.004672	0	3	57				
SLCO1B1	10599	broad.mit.edu	37	12	21358830	21358830	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr12:21358830G>T	ENST00000256958.2	+	11	1456	c.1360G>T	c.(1360-1362)Gta>Tta	p.V454L		NM_006446.4	NP_006437.3	Q9Y6L6	SO1B1_HUMAN	solute carrier organic anion transporter family, member 1B1	454	Kazal-like. {ECO:0000255|PROSITE- ProRule:PRU00798}.				bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium-independent organic anion transmembrane transporter activity (GO:0015347)	p.V454L(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(33)|ovary(3)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)	70					Acetylcysteine(DB06151)|Aminohippurate(DB00345)|Atorvastatin(DB01076)|Axitinib(DB06626)|Benzylpenicillin(DB01053)|Bezafibrate(DB01393)|Cabazitaxel(DB06772)|Caspofungin(DB00520)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dabrafenib(DB08912)|Dextrothyroxine(DB00509)|Digoxin(DB00390)|Dinoprostone(DB00917)|Eltrombopag(DB06210)|Estradiol(DB00783)|Estrone(DB00655)|Ezetimibe(DB00973)|Fexofenadine(DB00950)|Fluvastatin(DB01095)|Gadoxetate(DB08884)|Gemfibrozil(DB01241)|Indinavir(DB00224)|Irinotecan(DB00762)|L-Carnitine(DB00583)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Lovastatin(DB00227)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Nelfinavir(DB00220)|Olmesartan(DB00275)|Ouabain(DB01092)|Pantoprazole(DB00213)|Pazopanib(DB06589)|Penicillamine(DB00859)|Pioglitazone(DB01132)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Quinidine(DB00908)|Repaglinide(DB00912)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Ritonavir(DB00503)|Rosiglitazone(DB00412)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|SIMEPREVIR(DB06290)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sumatriptan(DB00669)|Valsartan(DB00177)|Verapamil(DB00661)	TCATAGAGATGTACCACTTTC	0.383																																							uc001req.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(3)|pancreas(1)|central_nervous_system(1)	8						c.(1360-1362)GTA>TTA		solute carrier organic anion transporter family,	Digoxin(DB00390)|Gemfibrozil(DB01241)|Pravastatin(DB00175)						111.0	107.0	108.0					12																	21358830		2203	4300	6503	SO:0001583	missense	10599				bile acid metabolic process|sodium-independent organic anion transport	basolateral plasma membrane|integral to plasma membrane|membrane fraction	bile acid transmembrane transporter activity|sodium-independent organic anion transmembrane transporter activity|thyroid hormone transmembrane transporter activity	g.chr12:21358830G>T		CCDS8685.1	12p12	2013-05-22	2003-11-25	2003-11-26	ENSG00000134538	ENSG00000134538		"""Solute carriers"""	10959	protein-coding gene	gene with protein product		604843	"""solute carrier family 21 (organic anion transporter), member 6"""	SLC21A6		10358072	Standard	NM_006446		Approved	OATP-C, LST-1, OATP1B1	uc001req.4	Q9Y6L6	OTTHUMG00000169047	ENST00000256958.2:c.1360G>T	12.37:g.21358830G>T	ENSP00000256958:p.Val454Leu		Somatic					p.V454L	NM_006446	NP_006437	WXS	Illumina HiSeq	Unspecified	Q9Y6L6	SO1B1_HUMAN			11	1464	+			454			Extracellular (Potential).|Kazal-like.		B2R7G2|Q29R64|Q9NQ37|Q9UBF3|Q9UH89	Missense_Mutation	SNP	ENST00000256958.2	37	c.1360G>T	CCDS8685.1	.	.	.	.	.	.	.	.	.	.	G	6.541	0.468114	0.12461	.	.	ENSG00000134538	ENST00000256958	T	0.38887	1.11	4.06	1.79	0.24919	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.35495	N	0.003163	T	0.30103	0.0754	L	0.49455	1.56	0.25366	N	0.988742	B	0.06786	0.001	B	0.18263	0.021	T	0.12734	-1.0536	10	0.26408	T	0.33	.	4.1559	0.10260	0.4084:0.0:0.5916:0.0	.	454	Q9Y6L6	SO1B1_HUMAN	L	454	ENSP00000256958:V454L	ENSP00000256958:V454L	V	+	1	0	SLCO1B1	21250097	0.031000	0.19500	0.969000	0.41365	0.428000	0.31595	1.094000	0.30951	0.664000	0.31047	0.484000	0.47621	GTA		0.383	SLCO1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402070.1	NM_006446		12	114	1	0	0.000978159	0.000978	0.00153405	12	114				
SOX5	6660	broad.mit.edu	37	12	23757422	23757422	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr12:23757422C>G	ENST00000451604.2	-	9	1164	c.1063G>C	c.(1063-1065)Ggg>Cgg	p.G355R	SOX5_ENST00000541536.1_Missense_Mutation_p.G342R|SOX5_ENST00000537393.1_Missense_Mutation_p.G320R|SOX5_ENST00000546136.1_Missense_Mutation_p.G342R|SOX5_ENST00000545921.1_Missense_Mutation_p.G345R|SOX5_ENST00000309359.1_Missense_Mutation_p.G342R|SOX5_ENST00000381381.2_Missense_Mutation_p.G342R			P35711	SOX5_HUMAN	SRY (sex determining region Y)-box 5	355					cartilage development (GO:0051216)|cell fate commitment (GO:0045165)|cellular response to transforming growth factor beta stimulus (GO:0071560)|central nervous system neuron differentiation (GO:0021953)|in utero embryonic development (GO:0001701)|negative regulation of transcription, DNA-templated (GO:0045892)|oligodendrocyte differentiation (GO:0048709)|positive regulation of cartilage development (GO:0061036)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of timing of neuron differentiation (GO:0060164)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear transcription factor complex (GO:0044798)	sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.G355R(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(25)|ovary(5)|skin(2)|upper_aerodigestive_tract(3)	57						GGCAGCTTCCCTCCTGGAGAT	0.473																																							uc001rfw.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|lung(1)	6						c.(1063-1065)GGG>CGG		SRY (sex determining region Y)-box 5 isoform a							122.0	105.0	111.0					12																	23757422		2203	4300	6503	SO:0001583	missense	6660				transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity	g.chr12:23757422C>G	AB081589	CCDS8699.1, CCDS41761.1, CCDS44844.1, CCDS58216.1, CCDS58217.1	12p12.1	2010-04-20			ENSG00000134532	ENSG00000134532		"""SRY (sex determining region Y)-boxes"""	11201	protein-coding gene	gene with protein product		604975				8812465	Standard	NM_006940		Approved	L-SOX5, MGC35153	uc001rfw.3	P35711	OTTHUMG00000169026	ENST00000451604.2:c.1063G>C	12.37:g.23757422C>G	ENSP00000398273:p.Gly355Arg		Somatic				SOX5_uc001rfx.2_Missense_Mutation_p.G342R|SOX5_uc001rfy.2_Missense_Mutation_p.G342R|SOX5_uc010siv.1_Missense_Mutation_p.G342R|SOX5_uc010siw.1_RNA|SOX5_uc001rfz.1_Missense_Mutation_p.G307R	p.G355R	NM_006940	NP_008871	WXS	Illumina HiSeq	Unspecified	P35711	SOX5_HUMAN			9	1165	-			355					B7Z8V0|F5H5B0|Q86UK8|Q8J017|Q8J018|Q8J019|Q8J020|Q8N1D9|Q8N7E0|Q8TEA4	Missense_Mutation	SNP	ENST00000451604.2	37	c.1063G>C	CCDS8699.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.144405	0.77888	.	.	ENSG00000134532	ENST00000546136;ENST00000309359;ENST00000381381;ENST00000451604;ENST00000435266;ENST00000537393;ENST00000541536;ENST00000545921	D;D;D;D;D;D;D	0.96885	-4.08;-4.08;-4.16;-4.09;-4.08;-4.16;-4.09	6.16	6.16	0.99307	.	0.298327	0.36482	N	0.002578	D	0.95182	0.8438	N	0.22421	0.69	0.50313	D	0.999868	B;P;B	0.38455	0.409;0.632;0.286	B;P;B	0.46850	0.239;0.529;0.184	D	0.94226	0.7472	10	0.49607	T	0.09	.	20.8598	0.99761	0.0:1.0:0.0:0.0	.	320;342;355	F5H0I3;P35711-4;P35711	.;.;SOX5_HUMAN	R	342;342;342;355;307;320;342;345	ENSP00000437487:G342R;ENSP00000308927:G342R;ENSP00000370788:G342R;ENSP00000398273:G355R;ENSP00000439832:G320R;ENSP00000441973:G342R;ENSP00000443520:G345R	ENSP00000308927:G342R	G	-	1	0	SOX5	23648689	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.051000	0.64257	2.937000	0.99478	0.650000	0.86243	GGG		0.473	SOX5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000402006.2	NM_006940		3	103	0	0	0	0.004672	0	3	103				
KRAS	3845	broad.mit.edu	37	12	25398285	25398285	+	Missense_Mutation	SNP	C	C	A	rs121913530		TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr12:25398285C>A	ENST00000256078.4	-	2	97	c.34G>T	c.(34-36)Ggt>Tgt	p.G12C	KRAS_ENST00000311936.3_Missense_Mutation_p.G12C|KRAS_ENST00000557334.1_Missense_Mutation_p.G12C|KRAS_ENST00000556131.1_Missense_Mutation_p.G12C	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CCTACGCCACCAGCTCCAACT	0.348	G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	uc001rgp.1	G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12C(CALU1_LUNG)|G12C(NCIH2030_LUNG)|G12C(LU99_LUNG)|G12C(NCIH1792_LUNG)|G12R(KP2_PANCREAS)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(NCIH2122_LUNG)|G12C(NCIH358_LUNG)|G12R(PSN1_PANCREAS)|G12C(KYSE410_OESOPHAGUS)|G12S(A549_LUNG)|G12R(HUPT3_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12C(HCC44_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(SW1463_LARGE_INTESTINE)|G12C(NCIH23_LUNG)|G12C(LU65_LUNG)|G12C(NCIH1373_LUNG)|G12C(MIAPACA2_PANCREAS)|G12R(HS274T_BREAST)|G12S(LS123_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(OV56_OVARY)|G12C(IALM_LUNG)	119		Dom	yes		12	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog			"""L, E, M, O"""			pancreatic|colorectal|lung|thyroid|AML|others		5144	Substitution - Missense(5142)|Insertion - In frame(2)	p.G12D(7175)|p.G12V(4780)|p.G12C(2482)|p.G12A(1180)|p.G12S(1119)|p.G12R(691)|p.G12?(50)|p.G12F(34)|p.G12G(6)|p.G12N(6)|p.G12L(5)|p.G12I(4)|p.G12_G13insG(4)|p.G12E(3)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12fs*3(1)	large_intestine(2360)|lung(1649)|pancreas(656)|biliary_tract(125)|ovary(56)|endometrium(54)|haematopoietic_and_lymphoid_tissue(49)|thyroid(42)|stomach(21)|cervix(19)|upper_aerodigestive_tract(17)|urinary_tract(17)|soft_tissue(15)|small_intestine(13)|prostate(11)|breast(9)|skin(8)|testis(7)|liver(6)|oesophagus(3)|peritoneum(1)|autonomic_ganglia(1)|kidney(1)|central_nervous_system(1)|NS(1)|penis(1)|adrenal_gland(1)	large_intestine(12391)|pancreas(3285)|lung(2847)|biliary_tract(521)|ovary(443)|endometrium(339)|haematopoietic_and_lymphoid_tissue(318)|stomach(203)|thyroid(149)|prostate(85)|soft_tissue(77)|small_intestine(62)|upper_aerodigestive_tract(59)|cervix(49)|urinary_tract(48)|skin(38)|liver(31)|breast(28)|testis(17)|oesophagus(15)|central_nervous_system(9)|peritoneum(6)|salivary_gland(6)|kidney(5)|gastrointestinal_tract_(site_indeterminate)(5)|thymus(5)|eye(4)|autonomic_ganglia(2)|bone(2)|genital_tract(1)|penis(1)|adrenal_gland(1)	21052	GRCh37	CM076251	KRAS	M	rs121913530	c.(34-36)GGT>TGT		c-K-ras2 protein isoform a precursor							93.0	83.0	86.0					12																	25398285		2203	4300	6503	SO:0001583	missense	3845	Cardiofaciocutaneous_syndrome|Noonan_syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	activation of MAPKK activity|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	plasma membrane	GTP binding|GTPase activity|protein binding	g.chr12:25398285C>A	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.34G>T	12.37:g.25398285C>A	ENSP00000256078:p.Gly12Cys	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)	Somatic				KRAS_uc001rgq.1_Missense_Mutation_p.G12C|KRAS_uc001rgr.2_RNA	p.G12C	NM_033360	NP_203524	WXS	Illumina HiSeq	Unspecified	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)		2	215	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		12		G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation).|G -> R (in lung cancer and bladder cancer; somatic mutation).|G -> S (in lung carcinoma and GASC; somatic mutation).|G -> A (in a colorectal cancer sample; somatic mutation).|G -> C (in lung carcinoma; somatic mutation).|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation).	GTP.		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	c.34G>T	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.676185	0.88445	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.79141	-1.24;-1.24;-1.24;-1.24	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90466	0.7014	M	0.90650	3.135	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.993	D	0.91833	0.5477	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	C	12	ENSP00000308495:G12C;ENSP00000452512:G12C;ENSP00000256078:G12C;ENSP00000451856:G12C	ENSP00000256078:G12C	G	-	1	0	KRAS	25289552	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360		13	13	1	0	1.3612e-06	0.003163	2.39672e-06	13	13				
ADCY6	112	broad.mit.edu	37	12	49177055	49177055	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr12:49177055G>C	ENST00000307885.4	-	1	857	c.163C>G	c.(163-165)Ccc>Gcc	p.P55A	ADCY6_ENST00000550422.1_Missense_Mutation_p.P55A|ADCY6_ENST00000357869.3_Missense_Mutation_p.P55A	NM_015270.3	NP_056085.1	O43306	ADCY6_HUMAN	adenylate cyclase 6	55					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|dopamine receptor signaling pathway (GO:0007212)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|negative regulation of neuron projection development (GO:0010977)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cilium (GO:0005929)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)	p.P55A(1)		breast(1)|endometrium(6)|kidney(1)|large_intestine(2)|lung(16)|prostate(1)|skin(1)|urinary_tract(1)	29						GCAGGGGTGGGGCTGGGTGGC	0.721																																							uc001rsh.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(163-165)CCC>GCC		adenylate cyclase 6 isoform a							12.0	16.0	15.0					12																	49177055		2193	4282	6475	SO:0001583	missense	112				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane	ATP binding|metal ion binding	g.chr12:49177055G>C		CCDS8767.1, CCDS8768.1	12q12-q13	2013-02-04				ENSG00000174233	4.6.1.1	"""Adenylate cyclases"""	237	protein-coding gene	gene with protein product		600294					Standard	NM_015270		Approved	AC6	uc001rsh.4	O43306		ENST00000307885.4:c.163C>G	12.37:g.49177055G>C	ENSP00000311405:p.Pro55Ala		Somatic				ADCY6_uc001rsj.3_Missense_Mutation_p.P55A|ADCY6_uc001rsi.3_Missense_Mutation_p.P55A	p.P55A	NM_015270	NP_056085	WXS	Illumina HiSeq	Unspecified	O43306	ADCY6_HUMAN			1	823	-			55			Cytoplasmic (Potential).		Q9NR75|Q9UDB0	Missense_Mutation	SNP	ENST00000307885.4	37	c.163C>G	CCDS8767.1	.	.	.	.	.	.	.	.	.	.	G	12.51	1.959258	0.34565	.	.	ENSG00000174233	ENST00000357869;ENST00000550422;ENST00000307885	T;T;T	0.77229	-1.07;-1.07;-1.08	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	T	0.63236	0.2494	L	0.28740	0.885	0.46222	D	0.998934	P;P	0.40731	0.728;0.608	B;B	0.39339	0.297;0.156	T	0.62695	-0.6800	10	0.05959	T	0.93	.	12.5617	0.56286	0.0:0.0:0.8335:0.1665	.	55;55	O43306-2;O43306	.;ADCY6_HUMAN	A	55	ENSP00000350536:P55A;ENSP00000446730:P55A;ENSP00000311405:P55A	ENSP00000311405:P55A	P	-	1	0	ADCY6	47463322	1.000000	0.71417	1.000000	0.80357	0.878000	0.50629	4.895000	0.63214	2.667000	0.90743	0.561000	0.74099	CCC		0.721	ADCY6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408863.1	NM_020983		5	21	0	0	0	0.000602	0	5	21				
LARP4	113251	broad.mit.edu	37	12	50835427	50835427	+	Splice_Site	SNP	G	G	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr12:50835427G>T	ENST00000398473.2	+	8	916		c.e8+1		LARP4_ENST00000347328.5_Splice_Site|LARP4_ENST00000293618.8_Splice_Site|LARP4_ENST00000518561.1_Splice_Site|LARP4_ENST00000429001.3_Splice_Site|LARP4_ENST00000518444.1_Splice_Site|LARP4_ENST00000522085.1_Splice_Site	NM_052879.4|NM_199188.2	NP_443111.4|NP_954658.2	Q71RC2	LARP4_HUMAN	La ribonucleoprotein domain family, member 4						cytoskeleton organization (GO:0007010)|regulation of cell morphogenesis (GO:0022604)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)	p.?(1)		breast(3)|endometrium(3)|kidney(2)|large_intestine(2)|liver(2)|lung(7)|ovary(1)|skin(2)|urinary_tract(1)	23						GCCAATTATGGTAAGAAATAG	0.294																																							uc001rwp.1		NA																	1	Unknown(1)		lung(1)	ovary(1)	1						c.e8+1		c-Mpl binding protein isoform a							71.0	70.0	70.0					12																	50835427		1799	4066	5865	SO:0001630	splice_region_variant	113251						nucleotide binding|RNA binding	g.chr12:50835427G>T	AY004310	CCDS41782.1, CCDS44879.1, CCDS44880.1, CCDS44879.2, CCDS53789.1, CCDS53790.1	12q13.12	2005-08-09			ENSG00000161813	ENSG00000161813		"""La ribonucleoprotein domain containing"""	24320	protein-coding gene	gene with protein product						12477932	Standard	NM_052879		Approved	PP13296	uc001rwp.2	Q71RC2	OTTHUMG00000163724	ENST00000398473.2:c.804+1G>T	12.37:g.50835427G>T			Somatic				LARP4_uc001rwo.1_Splice_Site_p.M274_splice|LARP4_uc001rwq.1_Splice_Site_p.M268_splice|LARP4_uc001rwr.1_Splice_Site_p.M268_splice|LARP4_uc001rws.1_Splice_Site_p.M267_splice|LARP4_uc009zlr.1_Splice_Site_p.M87_splice|LARP4_uc001rwt.1_Splice_Site_p.M1_splice|LARP4_uc001rwm.2_Splice_Site_p.M268_splice|LARP4_uc001rwn.2_Splice_Site_p.M198_splice	p.M268_splice	NM_052879	NP_443111	WXS	Illumina HiSeq	Unspecified	Q71RC2	LARP4_HUMAN			8	948	+								A8K6T1|E9PDG5|G3XAA8|G5E976|Q5CZ97|Q6ZV14|Q96NF9	Splice_Site	SNP	ENST00000398473.2	37	c.804_splice	CCDS41782.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.215144	0.79352	.	.	ENSG00000161813	ENST00000293618;ENST00000429001;ENST00000398473;ENST00000522085;ENST00000398464;ENST00000518444;ENST00000518561;ENST00000520064;ENST00000347328	.	.	.	4.78	4.78	0.61160	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.1592	0.89703	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	LARP4	49121694	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	9.403000	0.97302	2.347000	0.79759	0.491000	0.48974	.		0.294	LARP4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000374981.1	NM_052879	Intron	16	78	1	0	1.99824e-07	0.00499	3.65283e-07	16	78				
CALCOCO1	57658	broad.mit.edu	37	12	54110043	54110043	+	Splice_Site	SNP	C	C	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr12:54110043C>T	ENST00000550804.1	-	8	1066		c.e8+1		CALCOCO1_ENST00000262059.4_Splice_Site|CALCOCO1_ENST00000430117.2_Intron|CALCOCO1_ENST00000548263.1_Splice_Site			Q9P1Z2	CACO1_HUMAN	calcium binding and coiled-coil domain 1						intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein C-terminus binding (GO:0008022)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|transcription regulatory region DNA binding (GO:0044212)	p.?(1)		NS(2)|breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(14)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	28						GCCTCACTCACCACCCGCTGC	0.572																																							uc001sef.2		NA																	1	Unknown(1)		lung(1)	ovary(1)	1						c.e8+1		coiled-coil transcriptional coactivator isoform							80.0	73.0	75.0					12																	54110043		2203	4300	6503	SO:0001630	splice_region_variant	57658				steroid hormone receptor signaling pathway|transcription, DNA-dependent|Wnt receptor signaling pathway	cytoplasm	armadillo repeat domain binding|beta-catenin binding|ligand-dependent nuclear receptor transcription coactivator activity|protein C-terminus binding|sequence-specific DNA binding|transcription regulatory region DNA binding	g.chr12:54110043C>T	AL136895	CCDS8864.1, CCDS44908.1	12q13.13	2014-01-02			ENSG00000012822	ENSG00000012822			29306	protein-coding gene	gene with protein product	"""coiled-coil leucine zipper coactivator 1"", ""inorganic pyrophosphatase activator"""					10819331, 11230166	Standard	NM_020898		Approved	KIAA1536, calphoglin, Cocoa	uc001sef.3	Q9P1Z2	OTTHUMG00000170095	ENST00000550804.1:c.1005+1G>A	12.37:g.54110043C>T			Somatic				CALCOCO1_uc001see.2_5'Flank|CALCOCO1_uc010som.1_Intron|CALCOCO1_uc010son.1_Splice_Site_p.V212_splice|CALCOCO1_uc001seh.2_Splice_Site_p.V335_splice|CALCOCO1_uc009znd.2_Splice_Site_p.V335_splice|CALCOCO1_uc001seg.2_Intron|CALCOCO1_uc010soo.1_Splice_Site_p.V328_splice	p.V335_splice	NM_020898	NP_065949	WXS	Illumina HiSeq	Unspecified	Q9P1Z2	CACO1_HUMAN			8	1149	-								B3KVA8|Q6FI59|Q71RC3|Q86WF8|Q96JU3|Q9H090	Splice_Site	SNP	ENST00000550804.1	37	c.1005_splice	CCDS8864.1	.	.	.	.	.	.	.	.	.	.	C	14.64	2.595612	0.46318	.	.	ENSG00000012822	ENST00000342760;ENST00000262059;ENST00000413257;ENST00000548263;ENST00000550804;ENST00000549935;ENST00000454332	.	.	.	4.78	4.78	0.61160	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.5463	0.61707	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CALCOCO1	52396310	1.000000	0.71417	1.000000	0.80357	0.762000	0.43233	2.418000	0.44662	2.652000	0.90054	0.655000	0.94253	.		0.572	CALCOCO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000407233.2	NM_020898	Intron	20	52	0	0	0	0.00278	0	20	52				
OR9K2	441639	broad.mit.edu	37	12	55524042	55524042	+	Missense_Mutation	SNP	C	C	G	rs143111490		TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr12:55524042C>G	ENST00000305377.5	+	1	578	c.490C>G	c.(490-492)Cgt>Ggt	p.R164G		NM_001005243.1	NP_001005243.1	Q8NGE7	OR9K2_HUMAN	olfactory receptor, family 9, subfamily K, member 2	164						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R164G(1)|p.R164C(1)		NS(2)|breast(3)|central_nervous_system(1)|kidney(3)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(2)	31						AATGTCCACACGTCTGTGTAC	0.468																																							uc010spe.1		NA																	2	Substitution - Missense(2)		lung(1)|breast(1)	central_nervous_system(1)|pancreas(1)	2						c.(490-492)CGT>GGT		olfactory receptor, family 9, subfamily K,							144.0	137.0	139.0					12																	55524042		2203	4300	6503	SO:0001583	missense	441639				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr12:55524042C>G	BK004326	CCDS31814.1	12q13.2	2012-08-09						"""GPCR / Class A : Olfactory receptors"""	15339	protein-coding gene	gene with protein product							Standard	NM_001005243		Approved		uc010spe.2	Q8NGE7	OTTHUMG00000169827	ENST00000305377.5:c.490C>G	12.37:g.55524042C>G	ENSP00000307598:p.Arg164Gly		Somatic					p.R164G	NM_001005243	NP_001005243	WXS	Illumina HiSeq	Unspecified	Q8NGE7	OR9K2_HUMAN			1	490	+			164			Cytoplasmic (Potential).		B9EH19|Q6IFD6	Missense_Mutation	SNP	ENST00000305377.5	37	c.490C>G	CCDS31814.1	.	.	.	.	.	.	.	.	.	.	C	3.604	-0.080979	0.07141	.	.	ENSG00000170605	ENST00000305377	T	0.00397	7.57	4.98	4.09	0.47781	GPCR, rhodopsin-like superfamily (1);	0.404876	0.21454	N	0.074295	T	0.00271	0.0008	L	0.35288	1.05	0.09310	N	1	B	0.10296	0.003	B	0.19391	0.025	T	0.33675	-0.9859	10	0.21014	T	0.42	0.0695	10.6597	0.45696	0.1486:0.7082:0.1432:0.0	.	164	Q8NGE7	OR9K2_HUMAN	G	164	ENSP00000307598:R164G	ENSP00000307598:R164G	R	+	1	0	OR9K2	53810309	0.000000	0.05858	0.327000	0.25402	0.558000	0.35554	-0.948000	0.03897	1.458000	0.47871	0.650000	0.86243	CGT		0.468	OR9K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406105.1			54	122	0	0	0	0.00361	0	54	122				
NAB2	4665	broad.mit.edu	37	12	57485446	57485446	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr12:57485446T>C	ENST00000300131.3	+	2	1000	c.622T>C	c.(622-624)Ttc>Ctc	p.F208L	NAB2_ENST00000554718.1_3'UTR|NAB2_ENST00000357680.4_Missense_Mutation_p.F208L|NAB2_ENST00000342556.6_Missense_Mutation_p.F208L	NM_005967.3	NP_005958.1	Q15742	NAB2_HUMAN	NGFI-A binding protein 2 (EGR1 binding protein 2)	208					cell proliferation (GO:0008283)|endochondral ossification (GO:0001958)|myelination (GO:0042552)|negative regulation of transcription from RNA polymerase III promoter (GO:0016480)|nervous system development (GO:0007399)|regulation of epidermis development (GO:0045682)|Schwann cell differentiation (GO:0014037)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)	p.F208L(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	20						CTCGCCCCCCTTCTCCCCCCC	0.716																																							uc001smz.2		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|ovary(1)	2						c.(622-624)TTC>CTC		NGFI-A binding protein 2							12.0	17.0	15.0					12																	57485446		2196	4277	6473	SO:0001583	missense	4665				cell proliferation|negative regulation of transcription from RNA polymerase III promoter|transcription, DNA-dependent	nucleus	transcription corepressor activity	g.chr12:57485446T>C	BC065931	CCDS8930.1	12q13.3	2008-05-14				ENSG00000166886			7627	protein-coding gene	gene with protein product		602381				8668170, 8649813	Standard	XM_005268894		Approved	MADER	uc001smz.3	Q15742		ENST00000300131.3:c.622T>C	12.37:g.57485446T>C	ENSP00000300131:p.Phe208Leu		Somatic					p.F208L	NM_005967	NP_005958	WXS	Illumina HiSeq	Unspecified	Q15742	NAB2_HUMAN			2	1000	+			208					B2RAK3|O76006|Q14797	Missense_Mutation	SNP	ENST00000300131.3	37	c.622T>C	CCDS8930.1	.	.	.	.	.	.	.	.	.	.	T	10.87	1.473597	0.26423	.	.	ENSG00000166886	ENST00000300131;ENST00000342556;ENST00000357680	.	.	.	4.15	4.15	0.48705	NAB co-repressor, domain (1);	0.441905	0.22768	N	0.055868	T	0.21801	0.0525	N	0.11427	0.14	0.33270	D	0.560932	P	0.43826	0.818	B	0.41466	0.358	T	0.14392	-1.0474	9	0.10902	T	0.67	-12.462	9.5058	0.39046	0.0:0.0:0.0:1.0	.	208	Q15742	NAB2_HUMAN	L	208	.	ENSP00000300131:F208L	F	+	1	0	NAB2	55771713	0.994000	0.37717	0.852000	0.33557	0.975000	0.68041	0.652000	0.24888	1.732000	0.51606	0.379000	0.24179	TTC		0.716	NAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412222.1	NM_005967		5	25	0	0	0	0.001168	0	5	25				
LGR5	8549	broad.mit.edu	37	12	71974057	71974057	+	Splice_Site	SNP	G	G	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr12:71974057G>T	ENST00000266674.5	+	16	1717		c.e16-1		RP11-186F10.2_ENST00000546601.1_RNA|LGR5_ENST00000536515.1_Splice_Site|LGR5_ENST00000540815.2_Splice_Site			O75473	LGR5_HUMAN	leucine-rich repeat containing G protein-coupled receptor 5						G-protein coupled receptor signaling pathway (GO:0007186)|inner ear development (GO:0048839)|positive regulation of canonical Wnt signaling pathway (GO:0090263)	integral component of plasma membrane (GO:0005887)|trans-Golgi network membrane (GO:0032588)	G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)	p.?(1)	NUP107/LGR5(2)	endometrium(2)|kidney(3)|large_intestine(2)|lung(24)|ovary(1)|pancreas(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(3)	48						TTCATTTAAAGGGTTATAGAA	0.333																																							uc001swl.2		NA																	1	Unknown(1)		lung(1)	lung(4)|skin(3)|ovary(1)|pancreas(1)	9						c.e16-1		leucine-rich repeat-containing G protein-coupled							157.0	158.0	158.0					12																	71974057		2203	4300	6503	SO:0001630	splice_region_variant	8549					integral to plasma membrane	protein-hormone receptor activity	g.chr12:71974057G>T	AF062006	CCDS9000.1, CCDS61194.1, CCDS61195.1	12q22-q23	2012-08-21	2011-01-25	2004-11-12				"""GPCR / Class A : Orphans"""	4504	protein-coding gene	gene with protein product		606667	"""G protein-coupled receptor 49"", ""leucine-rich repeat-containing G protein-coupled receptor 5"""	GPR67, GPR49		9642114	Standard	NM_003667		Approved	HG38, FEX	uc001swl.4	O75473	OTTHUMG00000169543	ENST00000266674.5:c.1407-1G>T	12.37:g.71974057G>T			Somatic				LGR5_uc001swm.2_Splice_Site_p.K445_splice|LGR5_uc001swn.1_Splice_Site	p.K469_splice	NM_003667	NP_003658	WXS	Illumina HiSeq	Unspecified	O75473	LGR5_HUMAN			16	1455	+								D8MCT0|Q4VAM0|Q4VAM2|Q9UP75	Splice_Site	SNP	ENST00000266674.5	37	c.1407_splice	CCDS9000.1	.	.	.	.	.	.	.	.	.	.	G	16.27	3.077321	0.55753	.	.	ENSG00000139292	ENST00000266674;ENST00000451585;ENST00000536515;ENST00000540815	.	.	.	5.41	5.41	0.78517	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.5627	0.95378	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	LGR5	70260324	1.000000	0.71417	0.996000	0.52242	0.341000	0.28922	9.497000	0.97970	2.691000	0.91804	0.650000	0.86243	.		0.333	LGR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404744.1	NM_003667	Intron	5	202	1	0	0.00198382	0.001984	0.00304468	5	202				
TRHDE	29953	broad.mit.edu	37	12	73012670	73012670	+	Splice_Site	SNP	G	G	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr12:73012670G>T	ENST00000261180.4	+	13	2282		c.e13-1		TRHDE_ENST00000549138.1_Splice_Site	NM_013381.2	NP_037513.1	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme						cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.?(1)		NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(8)|kidney(3)|large_intestine(13)|lung(38)|ovary(2)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	79						TTTAACTGTAGGGCTGGCTAT	0.368																																							uc001sxa.2		NA																	1	Unknown(1)		lung(1)	ovary(2)|skin(1)	3						c.e13-1		thyrotropin-releasing hormone degrading enzyme							48.0	54.0	52.0					12																	73012670		2202	4299	6501	SO:0001630	splice_region_variant	29953				cell-cell signaling|proteolysis|signal transduction	integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|zinc ion binding	g.chr12:73012670G>T	AF126372	CCDS9004.1	12q15-q21	2012-07-25		2005-08-09		ENSG00000072657	3.4.19.6		30748	protein-coding gene	gene with protein product	"""pyroglutamyl-peptidase II"", ""pyroglutamyl aminopeptidase II"", ""TRH-specific aminopeptidase"""	606950				10491199, 12975309	Standard	NM_013381		Approved	PGPEP2, TRH-DE, PAP-II	uc001sxa.3	Q9UKU6		ENST00000261180.4:c.2187-1G>T	12.37:g.73012670G>T			Somatic					p.R729_splice	NM_013381	NP_037513	WXS	Illumina HiSeq	Unspecified	Q9UKU6	TRHDE_HUMAN			13	2217	+								A5PL19|Q6UWJ4	Splice_Site	SNP	ENST00000261180.4	37	c.2187_splice	CCDS9004.1	.	.	.	.	.	.	.	.	.	.	G	15.18	2.756548	0.49362	.	.	ENSG00000072657	ENST00000261180	.	.	.	5.77	5.77	0.91146	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.3626	0.98863	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TRHDE	71298937	1.000000	0.71417	0.998000	0.56505	0.423000	0.31445	9.055000	0.93873	2.885000	0.99019	0.655000	0.94253	.		0.368	TRHDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405380.1	NM_013381	Intron	22	76	1	0	2.41591e-17	0.004656	5.75408e-17	22	76				
LRRIQ1	84125	broad.mit.edu	37	12	85531673	85531673	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr12:85531673C>A	ENST00000393217.2	+	19	4316	c.4255C>A	c.(4255-4257)Cta>Ata	p.L1419I		NM_001079910.1	NP_001073379.1	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	1419	IQ 3. {ECO:0000255|PROSITE- ProRule:PRU00116}.							p.L1419I(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|liver(1)|lung(28)|ovary(5)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	83				GBM - Glioblastoma multiforme(134;0.212)		GACAACAGCTCTAGAGGCTAT	0.308																																							uc001tac.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|central_nervous_system(1)|skin(1)	6						c.(4255-4257)CTA>ATA		leucine-rich repeats and IQ motif containing 1							124.0	116.0	118.0					12																	85531673		1796	4070	5866	SO:0001583	missense	84125							g.chr12:85531673C>A	AK022365	CCDS41816.1	12q21	2008-02-05			ENSG00000133640	ENSG00000133640			25708	protein-coding gene	gene with protein product						11347906	Standard	NM_001079910		Approved	FLJ12303, KIAA1801	uc001tac.3	Q96JM4	OTTHUMG00000166185	ENST00000393217.2:c.4255C>A	12.37:g.85531673C>A	ENSP00000376910:p.Leu1419Ile		Somatic					p.L1419I	NM_001079910	NP_001073379	WXS	Illumina HiSeq	Unspecified	Q96JM4	LRIQ1_HUMAN		GBM - Glioblastoma multiforme(134;0.212)	19	4366	+			1419			IQ 3.		Q567P4|Q9BS17|Q9HA36	Missense_Mutation	SNP	ENST00000393217.2	37	c.4255C>A	CCDS41816.1	.	.	.	.	.	.	.	.	.	.	C	13.04	2.118313	0.37339	.	.	ENSG00000133640	ENST00000393217	T	0.57107	0.42	5.56	2.72	0.32119	.	.	.	.	.	T	0.33556	0.0867	N	0.19112	0.55	0.21984	N	0.999434	P	0.52316	0.952	B	0.40636	0.335	T	0.12451	-1.0547	9	0.54805	T	0.06	.	5.5457	0.17063	0.1412:0.6456:0.0:0.2132	.	1419	Q96JM4	LRIQ1_HUMAN	I	1419	ENSP00000376910:L1419I	ENSP00000376910:L1419I	L	+	1	2	LRRIQ1	84055804	0.993000	0.37304	0.996000	0.52242	0.996000	0.88848	0.952000	0.29149	0.690000	0.31570	0.650000	0.86243	CTA		0.308	LRRIQ1-004	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388249.2	NM_032165		45	113	1	0	4.01344e-20	0.00361	1.01934e-19	45	113				
TDG	6996	broad.mit.edu	37	12	104379502	104379502	+	Silent	SNP	G	G	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr12:104379502G>A	ENST00000392872.3	+	9	1320	c.1086G>A	c.(1084-1086)ggG>ggA	p.G362G	AC078819.1_ENST00000401157.1_RNA|TDG_ENST00000542036.1_Silent_p.G158G|TDG_ENST00000266775.9_Silent_p.G358G|TDG_ENST00000544861.1_Silent_p.G219G	NM_003211.4	NP_003202.3	Q13569	TDG_HUMAN	thymine-DNA glycosylase	362					base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|chromatin modification (GO:0016568)|depyrimidination (GO:0045008)|DNA demethylation (GO:0080111)|DNA repair (GO:0006281)|embryo development (GO:0009790)|mismatch repair (GO:0006298)|negative regulation of chromatin binding (GO:0035562)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of gene expression, epigenetic (GO:0040029)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)	damaged DNA binding (GO:0003684)|DNA N-glycosylase activity (GO:0019104)|double-stranded DNA binding (GO:0003690)|mismatched DNA binding (GO:0030983)|protein homodimerization activity (GO:0042803)|pyrimidine-specific mismatch base pair DNA N-glycosylase activity (GO:0008263)|RNA polymerase II transcription cofactor activity (GO:0001104)|structure-specific DNA binding (GO:0043566)	p.G362G(1)		large_intestine(2)|lung(14)|ovary(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	24				BRCA - Breast invasive adenocarcinoma(302;0.00114)		CTTCAAATGGGCTAAGTATGG	0.408								Base excision repair (BER), DNA glycosylases																															uc001tkg.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|lung(3)	6						c.(1084-1086)GGG>GGA	BER_DNA_glycosylases	thymine-DNA glycosylase							144.0	135.0	138.0					12																	104379502		2203	4300	6503	SO:0001819	synonymous_variant	6996				depyrimidination|mismatch repair	nucleoplasm	damaged DNA binding|mismatched DNA binding|protein binding|pyrimidine-specific mismatch base pair DNA N-glycosylase activity	g.chr12:104379502G>A	U51166	CCDS9095.1	12q24.1	2014-05-14			ENSG00000139372	ENSG00000139372	3.2.2.29		11700	protein-coding gene	gene with protein product	"""G/T mismatch-specific thymine DNA glycosylase"""	601423				8662714, 9299239	Standard	NM_003211		Approved		uc001tkg.3	Q13569	OTTHUMG00000168418	ENST00000392872.3:c.1086G>A	12.37:g.104379502G>A			Somatic				TDG_uc009zuk.2_Silent_p.G358G|TDG_uc010swi.1_Silent_p.G219G|TDG_uc010swj.1_Silent_p.G150G	p.G362G	NM_003211	NP_003202	WXS	Illumina HiSeq	Unspecified	Q13569	TDG_HUMAN		BRCA - Breast invasive adenocarcinoma(302;0.00114)	9	1309	+			362					Q8IUZ6|Q8IZM3	Silent	SNP	ENST00000392872.3	37	c.1086G>A	CCDS9095.1																																																																																				0.408	TDG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399673.2			27	84	0	0	0	0.00632	0	27	84				
RPH3A	22895	broad.mit.edu	37	12	113313513	113313513	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr12:113313513G>A	ENST00000389385.4	+	12	1410	c.913G>A	c.(913-915)Ggg>Agg	p.G305R	RPH3A_ENST00000420983.2_Missense_Mutation_p.G305R|RPH3A_ENST00000549913.2_3'UTR|RPH3A_ENST00000548866.1_Missense_Mutation_p.G256R|RPH3A_ENST00000447659.2_Missense_Mutation_p.G256R|RPH3A_ENST00000543106.2_Missense_Mutation_p.G305R|RPH3A_ENST00000551052.1_Missense_Mutation_p.G301R|RPH3A_ENST00000415485.3_Missense_Mutation_p.G305R	NM_001143854.1|NM_014954.3	NP_001137326.1|NP_055769.2	Q9Y2J0	RP3A_HUMAN	rabphilin 3A	305	Pro-rich.				intracellular protein transport (GO:0006886)	cell junction (GO:0030054)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phosphatidylinositol phosphate binding (GO:1901981)|transporter activity (GO:0005215)	p.G301R(1)		breast(1)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(16)|ovary(3)|prostate(4)|skin(6)|urinary_tract(1)	47				BRCA - Breast invasive adenocarcinoma(302;0.00453)		ACCGGGTCCTGGGCCAGCAGG	0.597																																							uc010syl.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|central_nervous_system(2)|skin(2)	7						c.(913-915)GGG>AGG		rabphilin 3A homolog isoform 1							71.0	69.0	69.0					12																	113313513		2203	4300	6503	SO:0001583	missense	22895				intracellular protein transport	cell junction|synaptic vesicle	Rab GTPase binding|transporter activity|zinc ion binding	g.chr12:113313513G>A	AB023202	CCDS31904.1, CCDS44979.1	12q24.13	2014-07-02	2014-07-02		ENSG00000089169	ENSG00000089169		"""Synaptotagmins"""	17056	protein-coding gene	gene with protein product		612159	"""rabphilin 3A homolog (mouse)"""			10231032, 7822236	Standard	NM_014954		Approved	KIAA0985, rabphilin, exophilin-1	uc001ttz.3	Q9Y2J0	OTTHUMG00000169713	ENST00000389385.4:c.913G>A	12.37:g.113313513G>A	ENSP00000374036:p.Gly305Arg		Somatic				RPH3A_uc001ttz.2_Missense_Mutation_p.G305R|RPH3A_uc001tty.2_Missense_Mutation_p.G301R|RPH3A_uc009zwe.1_Missense_Mutation_p.G301R|RPH3A_uc010sym.1_Missense_Mutation_p.G256R|RPH3A_uc001tua.2_Missense_Mutation_p.G65R	p.G305R	NM_001143854	NP_001137326	WXS	Illumina HiSeq	Unspecified	Q9Y2J0	RP3A_HUMAN		BRCA - Breast invasive adenocarcinoma(302;0.00453)	12	1275	+			305			Pro-rich.		B7Z3C3|Q96AE0	Missense_Mutation	SNP	ENST00000389385.4	37	c.913G>A	CCDS44979.1	.	.	.	.	.	.	.	.	.	.	G	13.33	2.203559	0.38905	.	.	ENSG00000089169	ENST00000543106;ENST00000389385;ENST00000447659;ENST00000551052;ENST00000415485;ENST00000548866;ENST00000420983	T;T;T;T;T;T;T	0.61392	0.11;0.11;0.12;0.12;0.11;0.12;0.11	4.18	3.18	0.36537	.	0.555036	0.15308	N	0.269244	T	0.44767	0.1309	L	0.50333	1.59	0.20403	N	0.999903	P;B;B;P	0.43701	0.815;0.435;0.435;0.703	B;B;B;B	0.40228	0.323;0.077;0.077;0.323	T	0.22906	-1.0203	10	0.15066	T	0.55	.	6.1047	0.20067	0.1453:0.0:0.8547:0.0	.	256;305;305;301	F8VP47;B7Z9Z7;Q9Y2J0;Q9Y2J0-2	.;.;RP3A_HUMAN;.	R	305;305;256;301;305;256;305	ENSP00000440384:G305R;ENSP00000374036:G305R;ENSP00000413254:G256R;ENSP00000448297:G301R;ENSP00000405357:G305R;ENSP00000450347:G256R;ENSP00000408889:G305R	ENSP00000374036:G305R	G	+	1	0	RPH3A	111797896	0.884000	0.30299	0.832000	0.32986	0.830000	0.47004	3.020000	0.49643	2.147000	0.66899	0.655000	0.94253	GGG		0.597	RPH3A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405561.1	NM_014954		24	59	0	0	0	0.005443	0	24	59				
RBM19	9904	broad.mit.edu	37	12	114374917	114374917	+	Nonsense_Mutation	SNP	C	C	A	rs201183061		TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr12:114374917C>A	ENST00000545145.2	-	16	2041	c.1963G>T	c.(1963-1965)Gag>Tag	p.E655*	RBM19_ENST00000392561.3_Nonsense_Mutation_p.E655*|RBM19_ENST00000261741.5_Nonsense_Mutation_p.E655*|RP11-780K2.1_ENST00000550206.1_RNA	NM_001146699.1	NP_001140171.1	Q9Y4C8	RBM19_HUMAN	RNA binding motif protein 19	655	RRM 4. {ECO:0000255|PROSITE- ProRule:PRU00176}.				multicellular organismal development (GO:0007275)|positive regulation of embryonic development (GO:0040019)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.E655*(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|skin(3)|stomach(4)	55	Medulloblastoma(191;0.163)|all_neural(191;0.178)					GGAGCCCACTCCAGATAGAGG	0.547																																							uc009zwi.2		NA																	1	Substitution - Nonsense(1)		lung(1)	skin(3)|ovary(1)|liver(1)|central_nervous_system(1)	6						c.(1963-1965)GAG>TAG		RNA binding motif protein 19							103.0	103.0	103.0					12																	114374917		2203	4300	6503	SO:0001587	stop_gained	9904				multicellular organismal development|positive regulation of embryonic development	chromosome|cytoplasm|nucleolus|nucleoplasm	nucleotide binding|RNA binding	g.chr12:114374917C>A	AL117547	CCDS9172.1	12q24.21	2013-02-12				ENSG00000122965		"""RNA binding motif (RRM) containing"""	29098	protein-coding gene	gene with protein product						9734811, 11230166	Standard	NM_016196		Approved	DKFZp586F1023, KIAA0682	uc009zwi.2	Q9Y4C8	OTTHUMG00000169646	ENST00000545145.2:c.1963G>T	12.37:g.114374917C>A	ENSP00000442053:p.Glu655*		Somatic				RBM19_uc001tvn.3_Nonsense_Mutation_p.E655*|RBM19_uc001tvm.2_Nonsense_Mutation_p.E655*	p.E655*	NM_001146699	NP_001140171	WXS	Illumina HiSeq	Unspecified	Q9Y4C8	RBM19_HUMAN			16	2107	-	Medulloblastoma(191;0.163)|all_neural(191;0.178)		655			RRM 4.		A8K5X9|Q9BPY6|Q9UFN5	Nonsense_Mutation	SNP	ENST00000545145.2	37	c.1963G>T	CCDS9172.1	.	.	.	.	.	.	.	.	.	.	C	39	7.799618	0.98495	.	.	ENSG00000122965	ENST00000545145;ENST00000392561;ENST00000261741	.	.	.	4.8	4.8	0.61643	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-35.9315	16.8661	0.86029	0.0:1.0:0.0:0.0	.	.	.	.	X	655	.	ENSP00000261741:E655X	E	-	1	0	RBM19	112859300	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.869000	0.75521	2.222000	0.72286	0.655000	0.94253	GAG		0.547	RBM19-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405251.1	NM_016196		15	70	1	0	2.61681e-11	0.00245	5.27036e-11	15	70				
NCOR2	9612	broad.mit.edu	37	12	124826522	124826522	+	Silent	SNP	G	G	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr12:124826522G>A	ENST00000405201.1	-	34	5035	c.5035C>T	c.(5035-5037)Ctg>Ttg	p.L1679L	NCOR2_ENST00000397355.1_Silent_p.L1670L|NCOR2_ENST00000404621.1_Silent_p.L1669L|NCOR2_ENST00000429285.2_Silent_p.L1669L|NCOR2_ENST00000356219.3_Silent_p.L1686L|NCOR2_ENST00000404121.2_Silent_p.L1240L			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	1687					cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)	p.L1679L(1)|p.L1686L(1)		breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		CGGTTCTCCAGCGCCGCCGTG	0.657																																							uc010tba.1		NA																	2	Substitution - coding silent(2)		lung(2)	skin(3)|ovary(1)	4						c.(5059-5061)CTG>TTG		nuclear receptor co-repressor 2 isoform 2							56.0	73.0	67.0					12																	124826522		2147	4250	6397	SO:0001819	synonymous_variant	9612				cellular lipid metabolic process|negative regulation of transcription from RNA polymerase II promoter|regulation of cellular ketone metabolic process by negative regulation of transcription from an RNA polymerase II promoter|transcription, DNA-dependent	nuclear body|nucleus|transcriptional repressor complex	DNA binding|histone deacetylase binding|Notch binding|protein N-terminus binding|transcription corepressor activity	g.chr12:124826522G>A	U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.5035C>T	12.37:g.124826522G>A			Somatic				NCOR2_uc010tay.1_Silent_p.L1686L|NCOR2_uc010taz.1_Silent_p.L1670L|NCOR2_uc010tbb.1_Silent_p.L1679L|NCOR2_uc010tbc.1_Silent_p.L1669L|NCOR2_uc010tax.1_5'Flank	p.L1687L	NM_001077261	NP_001070729	WXS	Illumina HiSeq	Unspecified	Q9Y618	NCOR2_HUMAN		Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)	34	5176	-	all_neural(191;0.0804)|Medulloblastoma(191;0.163)		1687					O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	Silent	SNP	ENST00000405201.1	37	c.5059C>T	CCDS41858.2	.	.	.	.	.	.	.	.	.	.	G	10.35	1.326130	0.24080	.	.	ENSG00000196498	ENST00000453428	T	0.54279	0.58	4.23	3.23	0.37069	.	.	.	.	.	T	0.60843	0.2300	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.64761	-0.6331	6	0.87932	D	0	-20.8856	9.2519	0.37560	0.0:0.0:0.4729:0.5271	.	.	.	.	V	27	ENSP00000400687:A27V	ENSP00000400687:A27V	A	-	2	0	NCOR2	123392475	1.000000	0.71417	0.991000	0.47740	0.977000	0.68977	3.838000	0.55828	1.895000	0.54865	0.491000	0.48974	GCT		0.657	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318173.2	NM_006312		26	72	0	0	0	0.005443	0	26	72				
RNF17	56163	broad.mit.edu	37	13	25399823	25399823	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr13:25399823G>C	ENST00000255324.5	+	16	2210	c.2158G>C	c.(2158-2160)Gaa>Caa	p.E720Q	RNF17_ENST00000381921.1_Missense_Mutation_p.E720Q	NM_001184993.1|NM_031277.2	NP_001171922.1|NP_112567.2	Q9BXT8	RNF17_HUMAN	ring finger protein 17	720					multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.E720Q(1)		NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(15)|ovary(1)|prostate(3)|skin(6)	36		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)		TGAAGATGGAGAAAATCTGGA	0.363																																							uc001upr.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(2158-2160)GAA>CAA		ring finger protein 17							89.0	88.0	88.0					13																	25399823		2203	4300	6503	SO:0001583	missense	56163				multicellular organismal development	cytoplasm|nucleus	hydrolase activity, acting on ester bonds|nucleic acid binding|zinc ion binding	g.chr13:25399823G>C	AF285602, AK001907	CCDS9308.2	13q12.13	2013-01-23			ENSG00000132972	ENSG00000132972		"""RING-type (C3HC4) zinc fingers"", ""Tudor domain containing"""	10060	protein-coding gene	gene with protein product	"""spermatogenesis associated 23"""	605793	"""tudor domain containing 4"""	TDRD4		11279525	Standard	NM_001184993		Approved	Mmip-2, SPATA23, FLJ11045	uc001upr.3	Q9BXT8	OTTHUMG00000016589	ENST00000255324.5:c.2158G>C	13.37:g.25399823G>C	ENSP00000255324:p.Glu720Gln		Somatic				RNF17_uc010tdd.1_Missense_Mutation_p.E579Q|RNF17_uc010aab.2_RNA|RNF17_uc010tde.1_Missense_Mutation_p.E720Q|RNF17_uc001ups.2_Missense_Mutation_p.E659Q	p.E720Q	NM_031277	NP_112567	WXS	Illumina HiSeq	Unspecified	Q9BXT8	RNF17_HUMAN		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)	16	2199	+		Lung SC(185;0.0225)|Breast(139;0.077)	720					Q5T2J9|Q6P1W3|Q9BXT7|Q9NUY9	Missense_Mutation	SNP	ENST00000255324.5	37	c.2158G>C	CCDS9308.2	.	.	.	.	.	.	.	.	.	.	G	17.22	3.334291	0.60853	.	.	ENSG00000132972	ENST00000255324;ENST00000381921;ENST00000429047;ENST00000418120	T;T;T	0.12984	3.41;3.4;2.63	4.69	4.69	0.59074	Maternal tudor protein (1);	0.635200	0.16216	N	0.224230	T	0.14743	0.0356	L	0.35288	1.05	0.80722	D	1	P;P	0.45044	0.815;0.849	P;B	0.46049	0.502;0.419	T	0.09662	-1.0664	10	0.17369	T	0.5	.	14.9002	0.70672	0.0:0.0:1.0:0.0	.	720;720	B7Z7S1;Q9BXT8	.;RNF17_HUMAN	Q	720;720;579;44	ENSP00000255324:E720Q;ENSP00000371346:E720Q;ENSP00000388892:E44Q	ENSP00000255324:E720Q	E	+	1	0	RNF17	24297823	0.998000	0.40836	0.998000	0.56505	0.875000	0.50365	3.014000	0.49590	2.312000	0.78011	0.491000	0.48974	GAA		0.363	RNF17-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044217.1	NM_031994		15	78	0	0	0	0.00245	0	15	78				
POSTN	10631	broad.mit.edu	37	13	38164532	38164532	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr13:38164532C>G	ENST00000379747.4	-	4	535	c.418G>C	c.(418-420)Gag>Cag	p.E140Q	POSTN_ENST00000379742.4_Missense_Mutation_p.E140Q|POSTN_ENST00000379749.4_Missense_Mutation_p.E140Q|POSTN_ENST00000379743.4_Missense_Mutation_p.E140Q|POSTN_ENST00000541179.1_Missense_Mutation_p.E140Q|POSTN_ENST00000541481.1_Missense_Mutation_p.E140Q	NM_006475.2	NP_006466.2	Q15063	POSTN_HUMAN	periostin, osteoblast specific factor	140	FAS1 1. {ECO:0000255|PROSITE- ProRule:PRU00082, ECO:0000305}.				cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of Notch signaling pathway (GO:0008593)|skeletal system development (GO:0001501)|tissue development (GO:0009888)	proteinaceous extracellular matrix (GO:0005578)|trans-Golgi network (GO:0005802)	heparin binding (GO:0008201)	p.E140Q(1)		cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(16)|lung(22)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	59		Lung NSC(96;2.09e-05)|Prostate(109;0.0513)|Breast(139;0.0538)|Lung SC(185;0.0743)		all cancers(112;2.48e-08)|Epithelial(112;2.78e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000853)|BRCA - Breast invasive adenocarcinoma(63;0.013)|GBM - Glioblastoma multiforme(144;0.0154)		TCCCAAGCCTCATTACTCGGT	0.393																																							uc001uwo.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(418-420)GAG>CAG		periostin, osteoblast specific factor isoform 1							102.0	86.0	91.0					13																	38164532		2203	4300	6503	SO:0001583	missense	10631				cell adhesion|skeletal system development	proteinaceous extracellular matrix	heparin binding	g.chr13:38164532C>G	D13665	CCDS9364.1, CCDS45034.1, CCDS53864.1, CCDS66530.1, CCDS66531.1	13q13.3	2008-02-05			ENSG00000133110	ENSG00000133110			16953	protein-coding gene	gene with protein product		608777				8363580, 12235007	Standard	NM_006475		Approved	OSF-2, PN, periostin	uc001uwo.4	Q15063	OTTHUMG00000016751	ENST00000379747.4:c.418G>C	13.37:g.38164532C>G	ENSP00000369071:p.Glu140Gln		Somatic				POSTN_uc001uwp.3_Missense_Mutation_p.E140Q|POSTN_uc001uwr.2_Missense_Mutation_p.E140Q|POSTN_uc001uwq.2_Missense_Mutation_p.E140Q|POSTN_uc010teu.1_Missense_Mutation_p.E140Q|POSTN_uc010tev.1_Missense_Mutation_p.E140Q|POSTN_uc010tew.1_Missense_Mutation_p.E140Q|POSTN_uc010tex.1_Missense_Mutation_p.E55Q	p.E140Q	NM_006475	NP_006466	WXS	Illumina HiSeq	Unspecified	Q15063	POSTN_HUMAN		all cancers(112;2.48e-08)|Epithelial(112;2.78e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000853)|BRCA - Breast invasive adenocarcinoma(63;0.013)|GBM - Glioblastoma multiforme(144;0.0154)	4	536	-		Lung NSC(96;2.09e-05)|Prostate(109;0.0513)|Breast(139;0.0538)|Lung SC(185;0.0743)	140			FAS1 1.		B1ALD8|C0IMJ1|C0IMJ2|C0IMJ4|D2KRH7|F5H628|Q15064|Q29XZ0|Q3KPJ5|Q5VSY5|Q8IZF9	Missense_Mutation	SNP	ENST00000379747.4	37	c.418G>C	CCDS9364.1	.	.	.	.	.	.	.	.	.	.	C	26.4	4.731083	0.89390	.	.	ENSG00000133110	ENST00000541179;ENST00000379749;ENST00000379747;ENST00000379743;ENST00000379742;ENST00000541481;ENST00000538347	D;D;D;D;D;D	0.92348	-3.02;-3.02;-3.02;-3.02;-3.02;-3.02	5.36	5.36	0.76844	FAS1 domain (5);	0.261736	0.43579	D	0.000555	D	0.95300	0.8475	M	0.72894	2.215	0.58432	D	0.999993	D;P;D;P;D;P;D	0.62365	0.98;0.956;0.988;0.956;0.991;0.739;0.988	P;P;P;P;P;B;D	0.65323	0.815;0.718;0.89;0.718;0.817;0.372;0.934	D	0.94010	0.7283	10	0.33141	T	0.24	-4.8692	19.0894	0.93221	0.0:1.0:0.0:0.0	.	140;140;140;140;140;140;140	C0IMJ4;F5H628;B1ALD8;Q15063-3;Q15063-4;Q15063-2;Q15063	.;.;.;.;.;.;POSTN_HUMAN	Q	140;140;140;140;140;140;57	ENSP00000437959:E140Q;ENSP00000369073:E140Q;ENSP00000369071:E140Q;ENSP00000369067:E140Q;ENSP00000369066:E140Q;ENSP00000437953:E140Q	ENSP00000369066:E140Q	E	-	1	0	POSTN	37062532	1.000000	0.71417	0.991000	0.47740	0.972000	0.66771	7.487000	0.81328	2.515000	0.84797	0.650000	0.86243	GAG		0.393	POSTN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044566.2	NM_006475		2	6	0	0	0	0.004672	0	2	6				
TRPC4	7223	broad.mit.edu	37	13	38357466	38357466	+	Missense_Mutation	SNP	G	G	T	rs376206930		TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr13:38357466G>T	ENST00000379705.3	-	2	862	c.5C>A	c.(4-6)gCt>gAt	p.A2D	TRPC4_ENST00000426868.2_Missense_Mutation_p.A2D|TRPC4_ENST00000379679.1_Missense_Mutation_p.A2D|TRPC4_ENST00000447043.1_Missense_Mutation_p.A2D|TRPC4_ENST00000379673.2_Missense_Mutation_p.A2D|TRPC4_ENST00000358477.2_Missense_Mutation_p.A2D|TRPC4_ENST00000379681.3_Missense_Mutation_p.A2D|TRPC4_ENST00000338947.5_Missense_Mutation_p.A2D|TRPC4_ENST00000355779.2_Missense_Mutation_p.A2D			Q9UBN4	TRPC4_HUMAN	transient receptor potential cation channel, subfamily C, member 4	2					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|gamma-aminobutyric acid secretion (GO:0014051)|ion transmembrane transport (GO:0034220)|oligodendrocyte differentiation (GO:0048709)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|calcium channel complex (GO:0034704)|caveola (GO:0005901)|cell surface (GO:0009986)|cortical cytoskeleton (GO:0030863)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)	p.A2D(2)		NS(2)|breast(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(26)|lung(30)|ovary(4)|prostate(1)|skin(4)|urinary_tract(2)	83				all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)		ATAGAACTGAGCCATGTTTCA	0.358																																							uc001uws.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|skin(2)|breast(1)	6						c.(4-6)GCT>GAT		transient receptor potential cation channel,							73.0	70.0	71.0					13																	38357466		2203	4300	6503	SO:0001583	missense	7223				axon guidance|calcium ion import	basolateral plasma membrane|calcium channel complex|cell surface|cortical cytoskeleton	beta-catenin binding|cadherin binding|store-operated calcium channel activity	g.chr13:38357466G>T	U40983	CCDS9365.1, CCDS45035.1, CCDS45036.1, CCDS45038.1, CCDS45039.1	13q13.3	2013-01-10			ENSG00000133107	ENSG00000133107		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	12336	protein-coding gene	gene with protein product		603651				8646775, 16382100	Standard	NM_016179		Approved	HTRP4, TRP4	uc010abx.3	Q9UBN4	OTTHUMG00000016752	ENST00000379705.3:c.5C>A	13.37:g.38357466G>T	ENSP00000369027:p.Ala2Asp		Somatic				TRPC4_uc010abv.2_5'UTR|TRPC4_uc001uwt.2_Missense_Mutation_p.A2D|TRPC4_uc010tey.1_Missense_Mutation_p.A2D|TRPC4_uc010abw.2_Missense_Mutation_p.A2D|TRPC4_uc010abx.2_Missense_Mutation_p.A2D|TRPC4_uc010aby.2_Missense_Mutation_p.A2D	p.A2D	NM_016179	NP_057263	WXS	Illumina HiSeq	Unspecified	Q9UBN4	TRPC4_HUMAN		all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)	2	240	-			2			Cytoplasmic (Potential).		B1ALE0|B1ALE1|B1ALE2|Q15721|Q3SWS6|Q96P03|Q96P04|Q96P05|Q9UIB0|Q9UIB1|Q9UIB2	Missense_Mutation	SNP	ENST00000379705.3	37	c.5C>A	CCDS9365.1	.	.	.	.	.	.	.	.	.	.	G	33	5.255507	0.95336	.	.	ENSG00000133107	ENST00000379705;ENST00000379681;ENST00000338947;ENST00000379679;ENST00000426868;ENST00000355779;ENST00000358477;ENST00000379673;ENST00000447043	T;T;T;T;T;T;T;T;T	0.76186	-0.47;-0.47;-0.11;-0.11;-1.0;0.15;-0.32;-0.57;0.15	6.16	6.16	0.99307	.	0.050909	0.85682	D	0.000000	T	0.74068	0.3668	N	0.24115	0.695	0.58432	D	0.999998	P;P;P;P;P;P	0.51351	0.734;0.837;0.944;0.944;0.734;0.923	P;P;P;P;P;P	0.50617	0.642;0.642;0.646;0.646;0.642;0.641	T	0.76293	-0.3012	10	0.87932	D	0	-15.0912	20.8598	0.99761	0.0:0.0:1.0:0.0	.	2;2;2;2;2;2	Q9UBN4-3;Q9UBN4-4;Q9UBN4-5;Q9UBN4-6;Q9UBN4-2;Q9UBN4	.;.;.;.;.;TRPC4_HUMAN	D	2	ENSP00000369027:A2D;ENSP00000369003:A2D;ENSP00000342580:A2D;ENSP00000369001:A2D;ENSP00000410133:A2D;ENSP00000348025:A2D;ENSP00000351264:A2D;ENSP00000368995:A2D;ENSP00000414316:A2D	ENSP00000342580:A2D	A	-	2	0	TRPC4	37255466	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.869000	0.99810	2.937000	0.99478	0.650000	0.86243	GCT		0.358	TRPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044574.2	NM_003306		13	53	1	0	0.00010058	0.001368	0.000162171	13	53				
CCDC122	160857	broad.mit.edu	37	13	44443475	44443475	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr13:44443475G>A	ENST00000444614.3	-	3	296	c.38C>T	c.(37-39)cCt>cTt	p.P13L	CCDC122_ENST00000281508.3_Missense_Mutation_p.P13L|CCDC122_ENST00000476570.2_5'UTR	NM_144974.3	NP_659411.2	Q5T0U0	CC122_HUMAN	coiled-coil domain containing 122	13								p.P13L(1)		endometrium(1)|large_intestine(2)|lung(5)|stomach(1)	9		Lung NSC(96;7.5e-06)|Breast(139;0.00765)|Hepatocellular(98;0.00826)|Prostate(109;0.0143)|Lung SC(185;0.0262)		GBM - Glioblastoma multiforme(144;0.000767)|BRCA - Breast invasive adenocarcinoma(63;0.128)		ACCTTCTTTAGGAAATCCTTG	0.313																																							uc010acf.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(37-39)CCT>CTT		coiled-coil domain containing 122							158.0	133.0	142.0					13																	44443475		2202	4297	6499	SO:0001583	missense	160857							g.chr13:44443475G>A	AK056408	CCDS9390.2	13q14.11	2008-10-30			ENSG00000151773	ENSG00000151773			26478	protein-coding gene	gene with protein product		613408					Standard	NM_144974		Approved	FLJ31846	uc010acf.3	Q5T0U0	OTTHUMG00000017413	ENST00000444614.3:c.38C>T	13.37:g.44443475G>A	ENSP00000407763:p.Pro13Leu		Somatic				CCDC122_uc010tfn.1_Missense_Mutation_p.P13L	p.P13L	NM_144974	NP_659411	WXS	Illumina HiSeq	Unspecified	Q5T0U0	CC122_HUMAN		GBM - Glioblastoma multiforme(144;0.000767)|BRCA - Breast invasive adenocarcinoma(63;0.128)	3	297	-		Lung NSC(96;7.5e-06)|Breast(139;0.00765)|Hepatocellular(98;0.00826)|Prostate(109;0.0143)|Lung SC(185;0.0262)	13					B2RP70|B7ZMI9|Q96MV0	Missense_Mutation	SNP	ENST00000444614.3	37	c.38C>T	CCDS9390.2	.	.	.	.	.	.	.	.	.	.	g	11.04	1.520871	0.27211	.	.	ENSG00000151773	ENST00000444614;ENST00000281508	T;T	0.38887	1.11;1.11	4.91	-0.648	0.11464	.	0.877455	0.10023	N	0.725714	T	0.37100	0.0991	L	0.59436	1.845	0.09310	N	1	B;B	0.09022	0.002;0.0	B;B	0.08055	0.002;0.003	T	0.39354	-0.9618	10	0.87932	D	0	-0.2883	8.1147	0.30935	0.5877:0.0:0.4123:0.0	.	13;13	B7ZMJ0;Q5T0U0	.;CC122_HUMAN	L	13	ENSP00000407763:P13L;ENSP00000281508:P13L	ENSP00000281508:P13L	P	-	2	0	CCDC122	43341475	0.003000	0.15002	0.000000	0.03702	0.152000	0.21847	0.139000	0.16036	-0.264000	0.09365	0.454000	0.30748	CCT		0.313	CCDC122-004	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276172.4	NM_144974		6	68	0	0	0	0.001168	0	6	68				
KLHL1	57626	broad.mit.edu	37	13	70293636	70293636	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr13:70293636C>G	ENST00000377844.4	-	9	2639	c.1880G>C	c.(1879-1881)tGg>tCg	p.W627S	KLHL1_ENST00000545028.1_Missense_Mutation_p.W434S	NM_020866.2	NP_065917.1	Q9NR64	KLHL1_HUMAN	kelch-like family member 1	627					actin cytoskeleton organization (GO:0030036)|adult walking behavior (GO:0007628)|cerebellar Purkinje cell layer development (GO:0021680)|dendrite development (GO:0016358)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	actin binding (GO:0003779)	p.W627S(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(56)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	84		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)		ACACATGTTCCACTTATTTGT	0.433																																							uc001vip.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1879-1881)TGG>TCG		kelch-like 1 protein							114.0	100.0	105.0					13																	70293636		2203	4300	6503	SO:0001583	missense	57626				actin cytoskeleton organization	cytoplasm|cytoskeleton	actin binding	g.chr13:70293636C>G	AB040923	CCDS9445.1, CCDS73582.1	13q21	2013-01-30	2013-01-30		ENSG00000150361	ENSG00000150361		"""Kelch-like"", ""BTB/POZ domain containing"""	6352	protein-coding gene	gene with protein product	"""Kelch-like protein 1"", ""Mayven-related protein 2"""	605332	"""kelch (Drosophila)-like 1"", ""kelch-like 1 (Drosophila)"""			10888605	Standard	NM_020866		Approved	KIAA1490, MRP2, FLJ30047	uc001vip.3	Q9NR64	OTTHUMG00000017056	ENST00000377844.4:c.1880G>C	13.37:g.70293636C>G	ENSP00000367075:p.Trp627Ser		Somatic				KLHL1_uc010thm.1_Missense_Mutation_p.W566S	p.W627S	NM_020866	NP_065917	WXS	Illumina HiSeq	Unspecified	Q9NR64	KLHL1_HUMAN		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)	9	2674	-		Breast(118;0.000162)	627			Kelch 4.		A8K5X0|Q5VZ64|Q9H4X4|Q9NR65|Q9P238	Missense_Mutation	SNP	ENST00000377844.4	37	c.1880G>C	CCDS9445.1	.	.	.	.	.	.	.	.	.	.	C	25.1	4.607713	0.87157	.	.	ENSG00000150361	ENST00000377844;ENST00000545028	D;D	0.96967	-4.19;-4.19	5.82	5.82	0.92795	Galactose oxidase, beta-propeller (1);	0.000000	0.64402	D	0.000010	D	0.99345	0.9770	H	0.99979	5.18	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97955	1.0334	10	0.87932	D	0	.	20.088	0.97803	0.0:1.0:0.0:0.0	.	627;627	Q8TBJ7;Q9NR64	.;KLHL1_HUMAN	S	627;434	ENSP00000367075:W627S;ENSP00000439602:W434S	ENSP00000367075:W627S	W	-	2	0	KLHL1	69191637	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.739000	0.93911	0.655000	0.94253	TGG		0.433	KLHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045231.3	NM_020866		9	72	0	0	0	0.006214	0	9	72				
SLITRK1	114798	broad.mit.edu	37	13	84453902	84453902	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr13:84453902G>T	ENST00000377084.2	-	1	2626	c.1741C>A	c.(1741-1743)Ctg>Atg	p.L581M		NM_001281503.1|NM_052910.1	NP_001268432.1|NP_443142.1	Q96PX8	SLIK1_HUMAN	SLIT and NTRK-like family, member 1	581					adult behavior (GO:0030534)|axonogenesis (GO:0007409)|homeostatic process (GO:0042592)|multicellular organism growth (GO:0035264)	integral component of membrane (GO:0016021)		p.L581M(1)		NS(2)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(36)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	80	Medulloblastoma(90;0.18)	Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.07)		CTAGCGTACAGCTGAGGGCAG	0.542																																							uc001vlk.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5						c.(1741-1743)CTG>ATG		slit and trk like 1 protein precursor							90.0	77.0	81.0					13																	84453902		2203	4300	6503	SO:0001583	missense	114798					integral to membrane		g.chr13:84453902G>T	AB067497	CCDS9464.1	13q31.1	2004-01-08	2004-01-08		ENSG00000178235	ENSG00000178235			20297	protein-coding gene	gene with protein product		609678	"""leucine rich repeat containing 12"""	LRRC12		14557068, 12975309	Standard	NM_001281503		Approved	KIAA1910	uc001vlk.3	Q96PX8	OTTHUMG00000017149	ENST00000377084.2:c.1741C>A	13.37:g.84453902G>T	ENSP00000366288:p.Leu581Met		Somatic					p.L581M	NM_052910	NP_443142	WXS	Illumina HiSeq	Unspecified	Q96PX8	SLIK1_HUMAN		GBM - Glioblastoma multiforme(99;0.07)	1	2627	-	Medulloblastoma(90;0.18)	Breast(118;0.212)	581			Extracellular (Potential).		Q5U5I6|Q96SF9	Missense_Mutation	SNP	ENST00000377084.2	37	c.1741C>A	CCDS9464.1	.	.	.	.	.	.	.	.	.	.	G	15.80	2.940913	0.52972	.	.	ENSG00000178235	ENST00000377084	T	0.60424	0.19	5.22	5.22	0.72569	.	0.000000	0.64402	D	0.000002	T	0.65302	0.2678	M	0.81802	2.56	0.58432	D	0.999997	P	0.38420	0.63	B	0.41466	0.358	T	0.66578	-0.5888	10	0.35671	T	0.21	-6.2805	17.693	0.88273	0.0:0.0:1.0:0.0	.	581	Q96PX8	SLIK1_HUMAN	M	581	ENSP00000366288:L581M	ENSP00000366288:L581M	L	-	1	2	SLITRK1	83351903	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.532000	0.60608	2.603000	0.88011	0.655000	0.94253	CTG		0.542	SLITRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045396.1	NM_052910		9	17	1	0	3.09899e-07	0.004482	5.5588e-07	9	17				
SLITRK5	26050	broad.mit.edu	37	13	88330080	88330080	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr13:88330080C>A	ENST00000325089.6	+	2	2656	c.2437C>A	c.(2437-2439)Ctg>Atg	p.L813M	SLITRK5_ENST00000400028.3_Missense_Mutation_p.L572M	NM_015567.1	NP_056382.1	O94991	SLIK5_HUMAN	SLIT and NTRK-like family, member 5	813					adult behavior (GO:0030534)|axonogenesis (GO:0007409)|cardiovascular system development (GO:0072358)|dendrite morphogenesis (GO:0048813)|grooming behavior (GO:0007625)|response to xenobiotic stimulus (GO:0009410)|skin development (GO:0043588)|striatum development (GO:0021756)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)		p.L813M(1)		breast(1)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(14)|lung(40)|ovary(2)|pancreas(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(4)	81	all_neural(89;0.101)|Medulloblastoma(90;0.163)					cccgccgcagctgcagctgca	0.706																																							uc001vln.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|pancreas(2)|central_nervous_system(1)	5						c.(2437-2439)CTG>ATG		SLIT and NTRK-like family, member 5 precursor							8.0	11.0	10.0					13																	88330080		2047	4073	6120	SO:0001583	missense	26050					integral to membrane		g.chr13:88330080C>A	AB020725	CCDS9465.1	13q31.1	2004-04-16	2004-01-08		ENSG00000165300	ENSG00000165300			20295	protein-coding gene	gene with protein product		609680	"""leucine rich repeat containing 11"""	LRRC11		10048485, 14557068	Standard	NM_015567		Approved	bA364G4.2, KIAA0918	uc001vln.3	O94991	OTTHUMG00000017167	ENST00000325089.6:c.2437C>A	13.37:g.88330080C>A	ENSP00000366283:p.Leu813Met		Somatic				SLITRK5_uc010tic.1_Missense_Mutation_p.L572M	p.L813M	NM_015567	NP_056382	WXS	Illumina HiSeq	Unspecified	O94991	SLIK5_HUMAN			2	2656	+	all_neural(89;0.101)|Medulloblastoma(90;0.163)		813			Cytoplasmic (Potential).		B3KNB8|B4DSH5|Q5VT81	Missense_Mutation	SNP	ENST00000325089.6	37	c.2437C>A	CCDS9465.1	.	.	.	.	.	.	.	.	.	.	C	8.548	0.874894	0.17395	.	.	ENSG00000165300	ENST00000325089;ENST00000400028	T;T	0.60424	0.19;0.48	5.57	2.88	0.33553	.	0.248759	0.20146	N	0.098275	T	0.31949	0.0813	N	0.08118	0	0.23304	N	0.99794	B;B	0.34015	0.435;0.232	B;B	0.36289	0.221;0.147	T	0.13980	-1.0489	9	.	.	.	-4.6198	4.7292	0.12955	0.1545:0.6144:0.1491:0.082	.	572;813	B4DSH5;O94991	.;SLIK5_HUMAN	M	813;572	ENSP00000366283:L813M;ENSP00000442244:L572M	.	L	+	1	2	SLITRK5	87128081	0.969000	0.33509	0.998000	0.56505	0.992000	0.81027	0.878000	0.28126	0.286000	0.22352	0.561000	0.74099	CTG		0.706	SLITRK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045416.3			6	5	1	0	0.00198382	0.001984	0.00304468	6	5				
SLC15A1	6564	broad.mit.edu	37	13	99337125	99337125	+	Silent	SNP	A	A	G			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr13:99337125A>G	ENST00000376503.5	-	23	2035	c.1980T>C	c.(1978-1980)tgT>tgC	p.C660C		NM_005073.3	NP_005064.1	P46059	S15A1_HUMAN	solute carrier family 15 (oligopeptide transporter), member 1	660					digestion (GO:0007586)|ion transport (GO:0006811)|protein transport (GO:0015031)|proton transport (GO:0015992)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	peptide:proton symporter activity (GO:0015333)|proton-dependent oligopeptide secondary active transmembrane transporter activity (GO:0005427)	p.C660C(1)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	30	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Aminolevulinic acid(DB00855)|Amoxicillin(DB01060)|Ampicillin(DB00415)|Azidocillin(DB08795)|Benazepril(DB00542)|Benzylpenicillin(DB01053)|Captopril(DB01197)|Cefaclor(DB00833)|Cefadroxil(DB01140)|Cefalotin(DB00456)|Cefdinir(DB00535)|Cefepime(DB01413)|Cefixime(DB00671)|Cefmetazole(DB00274)|Cefotaxime(DB00493)|Cefradine(DB01333)|Ceftazidime(DB00438)|Ceftibuten(DB01415)|Ceftizoxime(DB01332)|Ceftriaxone(DB01212)|Cefuroxime(DB01112)|Cephalexin(DB00567)|Chlorpropamide(DB00672)|Cilazapril(DB01340)|Cloxacillin(DB01147)|Cyclacillin(DB01000)|Dicloxacillin(DB00485)|Enalapril(DB00584)|Fluvastatin(DB01095)|Fosinopril(DB00492)|Glyburide(DB01016)|L-DOPA(DB01235)|Lisinopril(DB00722)|Methyldopa(DB00968)|Midodrine(DB00211)|Moexipril(DB00691)|Nateglinide(DB00731)|Oseltamivir(DB00198)|Oxacillin(DB00713)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Spirapril(DB01348)|Tolbutamide(DB01124)|Trandolapril(DB00519)|Valaciclovir(DB00577)|Valganciclovir(DB01610)	CAAAAATTACACAGACGACCA	0.413																																							uc001vno.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(1978-1980)TGT>TGC		solute carrier family 15 (oligopeptide	Cefadroxil(DB01140)|Ceftibuten(DB01415)|Cyclacillin(DB01000)						76.0	68.0	71.0					13																	99337125		2203	4300	6503	SO:0001819	synonymous_variant	6564				digestion|protein transport	integral to plasma membrane|membrane fraction	peptide:hydrogen symporter activity	g.chr13:99337125A>G	U13173	CCDS9489.1	13q32.3	2013-05-22			ENSG00000088386	ENSG00000088386		"""Solute carriers"""	10920	protein-coding gene	gene with protein product	"""peptide transporter HPEPT1"", ""bA551M18.1.1 (solute carrier family 15 (oligopeptide transporter) member 1)"", ""solute carrier family 15 oligopeptide transporter member 1"""	600544				7896779	Standard	NM_005073		Approved	PEPT1, HPECT1, HPEPT1	uc001vno.3	P46059	OTTHUMG00000017255	ENST00000376503.5:c.1980T>C	13.37:g.99337125A>G			Somatic					p.C660C	NM_005073	NP_005064	WXS	Illumina HiSeq	Unspecified	P46059	S15A1_HUMAN			23	2057	-	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)		660			Helical; (Potential).		Q5VW82	Silent	SNP	ENST00000376503.5	37	c.1980T>C	CCDS9489.1																																																																																				0.413	SLC15A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045560.3	NM_005073		3	21	0	0	0	0.004672	0	3	21				
OR4N2	390429	broad.mit.edu	37	14	20295950	20295950	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr14:20295950C>T	ENST00000315947.1	+	1	343	c.343C>T	c.(343-345)Ctt>Ttt	p.L115F	OR4N2_ENST00000568211.1_Missense_Mutation_p.L115F	NM_001004723.1	NP_001004723.1	Q8NGD1	OR4N2_HUMAN	olfactory receptor, family 4, subfamily N, member 2	115						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L115F(1)		breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|liver(1)|lung(32)|ovary(2)|prostate(1)|skin(2)|stomach(2)	52	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		GGGATTACTCCTTGTTGTGAT	0.507																																							uc010tkv.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)|skin(1)	4						c.(343-345)CTT>TTT		olfactory receptor, family 4, subfamily N,							126.0	136.0	133.0					14																	20295950		2203	4297	6500	SO:0001583	missense	390429				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr14:20295950C>T		CCDS32022.1	14q11.2	2013-09-23				ENSG00000176294		"""GPCR / Class A : Olfactory receptors"""	14742	protein-coding gene	gene with protein product							Standard	NM_001004723		Approved		uc010tkv.2	Q8NGD1		ENST00000315947.1:c.343C>T	14.37:g.20295950C>T	ENSP00000319601:p.Leu115Phe		Somatic					p.L115F	NM_001004723	NP_001004723	WXS	Illumina HiSeq	Unspecified	Q8NGD1	OR4N2_HUMAN	Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)	1	343	+	all_cancers(95;0.00108)		115			Helical; Name=3; (Potential).		Q6IEY9|Q6IFA2	Missense_Mutation	SNP	ENST00000315947.1	37	c.343C>T	CCDS32022.1	.	.	.	.	.	.	.	.	.	.	.	21.2	4.108173	0.77096	.	.	ENSG00000176294	ENST00000557677;ENST00000315947	T;T	0.81415	-1.49;3.23	4.53	4.53	0.55603	GPCR, rhodopsin-like superfamily (1);	0.000000	0.43747	D	0.000529	D	0.90762	0.7100	M	0.88512	2.96	0.43351	D	0.995419	D	0.89917	1.0	D	0.97110	1.0	D	0.92425	0.5949	10	0.87932	D	0	-14.2194	15.1112	0.72359	0.0:1.0:0.0:0.0	.	115	Q8NGD1	OR4N2_HUMAN	F	115	ENSP00000452022:L115F;ENSP00000319601:L115F	ENSP00000319601:L115F	L	+	1	0	OR4N2	19365790	0.875000	0.30112	0.638000	0.29380	0.940000	0.58332	1.753000	0.38359	2.488000	0.83962	0.591000	0.81541	CTT		0.507	OR4N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409821.2			84	318	0	0	0	0.00361	0	84	318				
METTL3	56339	broad.mit.edu	37	14	21971722	21971722	+	Splice_Site	SNP	T	T	C			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr14:21971722T>C	ENST00000298717.4	-	3	470		c.e3-2		METTL3_ENST00000538267.1_Splice_Site	NM_019852.3	NP_062826.2	Q86U44	MTA70_HUMAN	methyltransferase like 3						circadian rhythm (GO:0007623)|gene expression (GO:0010467)|mRNA destabilization (GO:0061157)|mRNA methylation (GO:0080009)|mRNA processing (GO:0006397)|RNA methylation (GO:0001510)|stem cell maintenance (GO:0019827)	MIS complex (GO:0036396)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA (2'-O-methyladenosine-N6-)-methyltransferase activity (GO:0016422)|RNA binding (GO:0003723)	p.?(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(5)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	20	all_cancers(95;0.000628)		Epithelial(56;6.61e-06)	GBM - Glioblastoma multiforme(265;0.0146)		AGCATCTGGCTAGAGAACGAG	0.483																																							uc001wbc.2		NA																	1	Unknown(1)		lung(1)	pancreas(1)|skin(1)	2						c.e3-1		methyltransferase like 3							56.0	53.0	54.0					14																	21971722		2203	4300	6503	SO:0001630	splice_region_variant	56339				gene expression	nuclear speck	mRNA (2'-O-methyladenosine-N6-)-methyltransferase activity|RNA binding	g.chr14:21971722T>C	AF014837	CCDS32044.1	14q11.1	2012-06-12			ENSG00000165819	ENSG00000165819	2.1.1.62		17563	protein-coding gene	gene with protein product	"""N6-adenosine-methyltransferase 70 kDa subunit"""	612472					Standard	XM_006720206		Approved	Spo8, M6A, MT-A70	uc001wbc.3	Q86U44	OTTHUMG00000168825	ENST00000298717.4:c.319-2A>G	14.37:g.21971722T>C			Somatic				METTL3_uc001wbb.2_5'UTR|METTL3_uc010tlw.1_Splice_Site|METTL3_uc010tlx.1_Splice_Site_p.P107_splice|METTL3_uc001wbd.1_Intron	p.P107_splice	NM_019852	NP_062826	WXS	Illumina HiSeq	Unspecified	Q86U44	MTA70_HUMAN	Epithelial(56;6.61e-06)	GBM - Glioblastoma multiforme(265;0.0146)	3	411	-	all_cancers(95;0.000628)							O14736|Q86V05|Q9HB32	Splice_Site	SNP	ENST00000298717.4	37	c.319_splice	CCDS32044.1	.	.	.	.	.	.	.	.	.	.	T	16.85	3.237514	0.58886	.	.	ENSG00000165819	ENST00000298717;ENST00000538267;ENST00000440691	.	.	.	5.06	5.06	0.68205	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.226	0.65860	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	METTL3	21041562	1.000000	0.71417	0.996000	0.52242	0.813000	0.45954	6.218000	0.72224	2.257000	0.74773	0.460000	0.39030	.		0.483	METTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401227.1	NM_019852	Intron	3	93	0	0	0	0.000248	0	3	93				
RNF31	55072	broad.mit.edu	37	14	24619313	24619313	+	Silent	SNP	C	C	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr14:24619313C>T	ENST00000324103.6	+	7	1173	c.853C>T	c.(853-855)Ctg>Ttg	p.L285L	RNF31_ENST00000559275.1_Silent_p.L134L|PSME2_ENST00000216802.5_5'Flank|RP11-468E2.4_ENST00000558468.1_5'Flank|RNF31_ENST00000382687.3_Silent_p.L134L	NM_017999.4	NP_060469.4	Q96EP0	RNF31_HUMAN	ring finger protein 31	285	Polyubiquitin-binding.				CD40 signaling pathway (GO:0023035)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein linear polyubiquitination (GO:0097039)|protein polyubiquitination (GO:0000209)|T cell receptor signaling pathway (GO:0050852)	CD40 receptor complex (GO:0035631)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|LUBAC complex (GO:0071797)	ligase activity (GO:0016874)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.L285L(1)		breast(3)|endometrium(6)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|prostate(4)|skin(2)|soft_tissue(1)	39				GBM - Glioblastoma multiforme(265;0.00861)		GACCTCCCTGCTGGCCCTGGG	0.582																																							uc001wmn.1		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(1)|ovary(1)	2						c.(853-855)CTG>TTG		ring finger protein 31							81.0	84.0	83.0					14																	24619313		2006	4165	6171	SO:0001819	synonymous_variant	55072				CD40 signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|protein linear polyubiquitination|T cell receptor signaling pathway	CD40 receptor complex|internal side of plasma membrane|LUBAC complex	ubiquitin binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr14:24619313C>T	AK000973	CCDS41931.1	14q11.2	2012-09-20			ENSG00000092098	ENSG00000092098		"""RING-type (C3HC4) zinc fingers"""	16031	protein-coding gene	gene with protein product	"""HOIL-1-interacting protein"""	612487				10422847	Standard	NM_017999		Approved	ZIBRA, FLJ10111, FLJ23501, HOIP	uc001wmn.1	Q96EP0	OTTHUMG00000028798	ENST00000324103.6:c.853C>T	14.37:g.24619313C>T			Somatic				RNF31_uc001wml.1_Silent_p.L134L|RNF31_uc001wmm.1_Intron|RNF31_uc010alg.1_Silent_p.L100L|RNF31_uc001wmo.1_5'Flank|RNF31_uc001wmp.2_5'Flank	p.L285L	NM_017999	NP_060469	WXS	Illumina HiSeq	Unspecified	Q96EP0	RNF31_HUMAN		GBM - Glioblastoma multiforme(265;0.00861)	7	1102	+			285			Polyubiquitin-binding.		A0A962|Q86VI2|Q8TEI0|Q96GB4|Q96NF1|Q9H5F1|Q9NWD2	Silent	SNP	ENST00000324103.6	37	c.853C>T	CCDS41931.1																																																																																				0.582	RNF31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071921.3	NM_017999		19	76	0	0	0	0.001882	0	19	76				
CTSG	1511	broad.mit.edu	37	14	25044579	25044579	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr14:25044579C>A	ENST00000216336.2	-	2	131	c.95G>T	c.(94-96)cGc>cTc	p.R32L		NM_001911.2	NP_001902.1	P08311	CATG_HUMAN	cathepsin G	32	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				angiotensin maturation (GO:0002003)|cellular protein metabolic process (GO:0044267)|defense response to fungus (GO:0050832)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|immune response (GO:0006955)|negative regulation of growth of symbiont in host (GO:0044130)|neutrophil mediated killing of gram-positive bacterium (GO:0070946)|positive regulation of immune response (GO:0050778)|proteolysis (GO:0006508)|response to lipopolysaccharide (GO:0032496)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)	heparin binding (GO:0008201)|peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)	p.R32L(1)		autonomic_ganglia(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(1)|urinary_tract(1)	25				GBM - Glioblastoma multiforme(265;0.0269)		CATGTAGGGGCGGGAGTGGGG	0.567																																							uc001wpq.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(94-96)CGC>CTC		cathepsin G preproprotein							112.0	113.0	113.0					14																	25044579		2203	4300	6503	SO:0001583	missense	1511				immune response|proteolysis	cell surface|extracellular space|plasma membrane|stored secretory granule	heparin binding|serine-type endopeptidase activity	g.chr14:25044579C>A	M16117	CCDS9631.1	14q12	2013-02-25			ENSG00000100448	ENSG00000100448		"""Cathepsins"", ""Endogenous ligands"""	2532	protein-coding gene	gene with protein product		116830				2569462	Standard	NM_001911		Approved	CG	uc001wpq.3	P08311	OTTHUMG00000140182	ENST00000216336.2:c.95G>T	14.37:g.25044579C>A	ENSP00000216336:p.Arg32Leu		Somatic					p.R32L	NM_001911	NP_001902	WXS	Illumina HiSeq	Unspecified	P08311	CATG_HUMAN		GBM - Glioblastoma multiforme(265;0.0269)	2	132	-			32			Peptidase S1.		Q6IBJ6|Q9UCA5|Q9UCU6	Missense_Mutation	SNP	ENST00000216336.2	37	c.95G>T	CCDS9631.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.318416	0.81469	.	.	ENSG00000100448	ENST00000216336	D	0.92545	-3.06	5.38	-9.18	0.00688	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.842353	0.09878	N	0.744065	D	0.90957	0.7157	L	0.42529	1.33	0.26704	N	0.971101	D	0.63880	0.993	D	0.68621	0.959	D	0.85734	0.1333	10	0.59425	D	0.04	.	7.9123	0.29798	0.2166:0.5716:0.0:0.2118	.	32	P08311	CATG_HUMAN	L	32	ENSP00000216336:R32L	ENSP00000216336:R32L	R	-	2	0	CTSG	24114419	0.000000	0.05858	0.649000	0.29536	0.900000	0.52787	-1.367000	0.02583	-1.505000	0.01807	-0.140000	0.14226	CGC		0.567	CTSG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276536.2	NM_001911		39	117	1	0	2.59497e-14	0.007835	5.66355e-14	39	117				
HECTD1	25831	broad.mit.edu	37	14	31626111	31626111	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr14:31626111T>C	ENST00000399332.1	-	12	2355	c.1867A>G	c.(1867-1869)Aaa>Gaa	p.K623E	HECTD1_ENST00000553700.1_Missense_Mutation_p.K623E	NM_015382.2	NP_056197.2	Q9ULT8	HECD1_HUMAN	HECT domain containing E3 ubiquitin protein ligase 1	623					neural tube closure (GO:0001843)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|metal ion binding (GO:0046872)|ubiquitin-protein transferase activity (GO:0004842)	p.K623E(1)		breast(10)|endometrium(7)|kidney(5)|large_intestine(12)|lung(23)|ovary(4)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	70	Hepatocellular(127;0.0877)|Breast(36;0.176)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.111)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00617)		GTTGACACTTTGCTAATTACA	0.408																																							uc001wrc.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|large_intestine(1)|lung(1)	5						c.(1867-1869)AAA>GAA		HECT domain containing 1							110.0	98.0	101.0					14																	31626111		1865	4111	5976	SO:0001583	missense	25831				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	intracellular	metal ion binding|protein binding|ubiquitin-protein ligase activity	g.chr14:31626111T>C	AB032957	CCDS41939.1	14q12	2013-01-10	2012-02-23		ENSG00000092148	ENSG00000092148		"""Ankyrin repeat domain containing"""	20157	protein-coding gene	gene with protein product			"""HECT domain containing 1"""			10574461	Standard	XM_005267502		Approved	KIAA1131	uc001wrc.1	Q9ULT8	OTTHUMG00000170670	ENST00000399332.1:c.1867A>G	14.37:g.31626111T>C	ENSP00000382269:p.Lys623Glu		Somatic				HECTD1_uc001wrd.1_Missense_Mutation_p.K138E	p.K623E	NM_015382	NP_056197	WXS	Illumina HiSeq	Unspecified	Q9ULT8	HECD1_HUMAN	LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.111)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00617)	12	2356	-	Hepatocellular(127;0.0877)|Breast(36;0.176)		623					D3DS86|Q6P445|Q86VJ1|Q96F34|Q9UFZ7	Missense_Mutation	SNP	ENST00000399332.1	37	c.1867A>G	CCDS41939.1	.	.	.	.	.	.	.	.	.	.	T	29.0	4.972054	0.92919	.	.	ENSG00000092148	ENST00000553700;ENST00000261312;ENST00000399332;ENST00000553957;ENST00000556224	T;T;T;T	0.64618	-0.11;-0.11;1.08;-0.11	5.62	5.62	0.85841	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.76919	0.4055	M	0.70595	2.14	0.80722	D	1	D;P	0.67145	0.996;0.956	D;P	0.65140	0.932;0.899	T	0.78398	-0.2219	10	0.52906	T	0.07	-23.1826	16.1172	0.81314	0.0:0.0:0.0:1.0	.	623;623	D3DS86;Q9ULT8	.;HECD1_HUMAN	E	623;623;623;97;623	ENSP00000450697:K623E;ENSP00000382269:K623E;ENSP00000451860:K97E;ENSP00000452015:K623E	ENSP00000261312:K623E	K	-	1	0	HECTD1	30695862	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.951000	0.87819	2.266000	0.75297	0.533000	0.62120	AAA		0.408	HECTD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409942.1			11	87	0	0	0	0.001368	0	11	87				
ADCK1	57143	broad.mit.edu	37	14	78399674	78399674	+	Silent	SNP	G	G	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr14:78399674G>T	ENST00000238561.5	+	11	1611	c.1512G>T	c.(1510-1512)ggG>ggT	p.G504G	ADCK1_ENST00000556560.1_3'UTR|ADCK1_ENST00000341211.5_Silent_p.G436G	NM_020421.3	NP_065154.2	Q86TW2	ADCK1_HUMAN	aarF domain containing kinase 1	511						extracellular region (GO:0005576)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.G436G(1)|p.G504G(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(2)|skin(2)|stomach(2)	25			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0376)		GTGTGAAGGGGTTGAAGCTGG	0.527																																							uc001xui.2		NA																	2	Substitution - coding silent(2)		lung(2)	stomach(2)|ovary(1)	3						c.(1510-1512)GGG>GGT		aarF domain containing kinase 1 isoform a							140.0	131.0	134.0					14																	78399674		2203	4300	6503	SO:0001819	synonymous_variant	57143					extracellular region	ATP binding|protein serine/threonine kinase activity	g.chr14:78399674G>T	AK096919	CCDS9869.1, CCDS45144.1	14q24	2005-10-30							19038	protein-coding gene	gene with protein product						12471243	Standard	NM_020421		Approved	FLJ39600	uc001xui.3	Q86TW2		ENST00000238561.5:c.1512G>T	14.37:g.78399674G>T			Somatic				ADCK1_uc001xuj.2_Silent_p.G436G|ADCK1_uc001xul.2_Silent_p.G211G	p.G504G	NM_020421	NP_065154	WXS	Illumina HiSeq	Unspecified	Q86TW2	ADCK1_HUMAN	Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0376)	11	1611	+			511					B3KUD5|Q6PD65|Q9UIE6	Silent	SNP	ENST00000238561.5	37	c.1512G>T	CCDS9869.1																																																																																				0.527	ADCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413864.1	NM_020421		40	87	1	0	5.44703e-19	0.002222	1.34189e-18	40	87				
NRXN3	9369	broad.mit.edu	37	14	80164043	80164043	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr14:80164043C>A	ENST00000557594.1	+	4	1625	c.672C>A	c.(670-672)ttC>ttA	p.F224L	NRXN3_ENST00000554719.1_Missense_Mutation_p.F856L|NRXN3_ENST00000281127.7_Missense_Mutation_p.F224L|NRXN3_ENST00000556003.1_Intron|NRXN3_ENST00000428277.2_Missense_Mutation_p.F254L|NRXN3_ENST00000335750.5_Missense_Mutation_p.F856L|RP11-242P2.1_ENST00000553322.1_RNA	NM_001272020.1	NP_001258949.1	Q9HDB5	NRX3B_HUMAN	neurexin 3	224	Laminin G-like. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|angiogenesis (GO:0001525)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)	p.F254L(1)|p.F856L(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(23)|lung(40)|ovary(3)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(9)|urinary_tract(1)	104		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		GACGCCTCTTCCAAGGCCAAC	0.473																																							uc001xun.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|upper_aerodigestive_tract(2)|pancreas(2)|central_nervous_system(1)|breast(1)|skin(1)	10						c.(2566-2568)TTC>TTA		neurexin 3 isoform 1 precursor							81.0	77.0	79.0					14																	80164043		2203	4300	6503	SO:0001583	missense	9369				axon guidance|cell adhesion	integral to plasma membrane	metal ion binding|receptor activity	g.chr14:80164043C>A	AB018286	CCDS9870.1, CCDS9871.1, CCDS45145.1, CCDS61515.1	14q31	2010-01-19				ENSG00000021645			8010	protein-coding gene	gene with protein product		600567	"""chromosome 14 open reading frame 60"""	C14orf60		11944992, 12379233	Standard	NM_004796		Approved	KIAA0743	uc001xun.4	Q9HDB5		ENST00000557594.1:c.672C>A	14.37:g.80164043C>A	ENSP00000451672:p.Phe224Leu		Somatic				NRXN3_uc001xum.1_RNA|NRXN3_uc001xup.2_RNA|NRXN3_uc001xuq.2_Missense_Mutation_p.F224L|NRXN3_uc010asw.2_Missense_Mutation_p.F254L|NRXN3_uc001xur.3_Missense_Mutation_p.F224L	p.F856L	NM_004796	NP_004787	WXS	Illumina HiSeq	Unspecified	Q9Y4C0	NRX3A_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)	15	3059	+		Renal(4;0.00876)	1229			Extracellular (Potential).|Laminin G-like 6.		A5PKW8|A8MPU5|B3KPM7|Q6NUR0|Q8IUD8	Missense_Mutation	SNP	ENST00000557594.1	37	c.2568C>A		.	.	.	.	.	.	.	.	.	.	C	16.73	3.205232	0.58234	.	.	ENSG00000021645	ENST00000330071;ENST00000332068;ENST00000554719;ENST00000335750;ENST00000557594;ENST00000281127;ENST00000428277	D;D;T;T;T	0.89196	-2.48;-2.48;-0.4;-0.4;-0.4	5.76	4.87	0.63330	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.120772	0.56097	D	0.000023	D	0.93657	0.7974	M	0.89904	3.07	0.58432	D	0.999995	D;P;P;P	0.58970	0.984;0.777;0.955;0.614	P;B;P;B	0.54060	0.741;0.427;0.563;0.305	D	0.94356	0.7583	9	.	.	.	.	14.5227	0.67863	0.0:0.9296:0.0:0.0704	.	254;224;224;856	Q9HDB5-4;Q9HDB5-2;Q9HDB5;Q9Y4C0-3	.;.;NRX3B_HUMAN;.	L	1229;1248;856;856;224;224;254	ENSP00000451648:F856L;ENSP00000338349:F856L;ENSP00000451672:F224L;ENSP00000281127:F224L;ENSP00000394426:F254L	.	F	+	3	2	NRXN3	79233796	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.432000	0.44784	1.428000	0.47296	0.557000	0.71058	TTC		0.473	NRXN3-004	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000413790.1	NM_001105250		23	67	1	0	1.64293e-13	0.00333	3.49275e-13	23	67				
RPS6KA5	9252	broad.mit.edu	37	14	91356896	91356896	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr14:91356896G>A	ENST00000261991.3	-	14	1944	c.1771C>T	c.(1771-1773)Cca>Tca	p.P591S	RPS6KA5_ENST00000536315.2_Missense_Mutation_p.P512S	NM_004755.2	NP_004746.2	O75582	KS6A5_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 5	591	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|epidermal growth factor receptor signaling pathway (GO:0007173)|histone H2A-S1 phosphorylation (GO:0043990)|histone H3-S10 phosphorylation (GO:0043987)|histone H3-S28 phosphorylation (GO:0043988)|histone phosphorylation (GO:0016572)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1-mediated signaling pathway (GO:0070498)|intracellular signal transduction (GO:0035556)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cytokine production (GO:0001818)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone phosphorylation (GO:0033129)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.P591S(2)		endometrium(2)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|skin(2)|urinary_tract(2)	24		all_cancers(154;0.0148)|Melanoma(154;0.099)|all_epithelial(191;0.146)		Epithelial(152;0.182)|BRCA - Breast invasive adenocarcinoma(234;0.201)		AAGAGCTCTGGGGCGGCATAA	0.448																																							uc001xys.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(1771-1773)CCA>TCA		ribosomal protein S6 kinase, polypeptide 5							70.0	67.0	68.0					14																	91356896		2203	4300	6503	SO:0001583	missense	9252				axon guidance|epidermal growth factor receptor signaling pathway|histone phosphorylation|innate immune response|interleukin-1-mediated signaling pathway|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|positive regulation of histone acetylation|positive regulation of histone phosphorylation|positive regulation of transcription from RNA polymerase II promoter|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytoplasm|nucleoplasm	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity	g.chr14:91356896G>A	AF074393	CCDS9893.1, CCDS45149.1	14q31-q32.1	2011-04-05	2002-08-29			ENSG00000100784			10434	protein-coding gene	gene with protein product		603607	"""ribosomal protein S6 kinase, 90kD, polypeptide 5"""			9687510, 10702687	Standard	NM_004755		Approved	MSK1, RLPK	uc001xys.2	O75582		ENST00000261991.3:c.1771C>T	14.37:g.91356896G>A	ENSP00000261991:p.Pro591Ser		Somatic				RPS6KA5_uc010twi.1_Missense_Mutation_p.P512S	p.P591S	NM_004755	NP_004746	WXS	Illumina HiSeq	Unspecified	O75582	KS6A5_HUMAN		Epithelial(152;0.182)|BRCA - Breast invasive adenocarcinoma(234;0.201)	14	1986	-		all_cancers(154;0.0148)|Melanoma(154;0.099)|all_epithelial(191;0.146)	591			Protein kinase 2.		O95316|Q96AF7	Missense_Mutation	SNP	ENST00000261991.3	37	c.1771C>T	CCDS9893.1	.	.	.	.	.	.	.	.	.	.	G	18.86	3.712726	0.68730	.	.	ENSG00000100784	ENST00000261991;ENST00000536315	D;D	0.85556	-2.0;-2.0	5.45	5.45	0.79879	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.95912	0.8669	H	0.98314	4.2	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97567	1.0102	10	0.87932	D	0	.	19.2841	0.94063	0.0:0.0:1.0:0.0	.	591	O75582	KS6A5_HUMAN	S	591;512	ENSP00000261991:P591S;ENSP00000442803:P512S	ENSP00000261991:P591S	P	-	1	0	RPS6KA5	90426649	1.000000	0.71417	0.995000	0.50966	0.098000	0.18820	9.809000	0.99208	2.535000	0.85469	0.655000	0.94253	CCA		0.448	RPS6KA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411442.2	NM_004755		8	47	0	0	0	0.006214	0	8	47				
RTL1	388015	broad.mit.edu	37	14	101348403	101348403	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr14:101348403C>A	ENST00000534062.1	-	1	2781	c.2723G>T	c.(2722-2724)cGc>cTc	p.R908L	MIR136_ENST00000385207.1_RNA|MIR433_ENST00000384837.1_RNA|MIR431_ENST00000385266.1_RNA|MIR432_ENST00000606207.1_RNA|MIR127_ENST00000384876.1_RNA	NM_001134888.2	NP_001128360.1	A6NKG5	RTL1_HUMAN	retrotransposon-like 1	908					multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)		p.R908L(1)		breast(1)|endometrium(5)|kidney(4)|large_intestine(1)|lung(5)|pancreas(1)|prostate(2)|skin(2)	21						GGAGATGTTGCGGGAGTAGAA	0.572																																							uc010txj.1		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)	1						c.(2722-2724)CGC>CTC		retrotransposon-like 1							27.0	25.0	26.0					14																	101348403		692	1591	2283	SO:0001583	missense	388015							g.chr14:101348403C>A		CCDS53910.1	14q32.2	2012-04-18			ENSG00000254656	ENSG00000254656			14665	protein-coding gene	gene with protein product		611896				16155747, 15854907, 12796779	Standard	NM_001134888		Approved	PEG11, MART1, Mar1	uc010txj.1	A6NKG5	OTTHUMG00000167573	ENST00000534062.1:c.2723G>T	14.37:g.101348403C>A	ENSP00000435342:p.Arg908Leu		Somatic				uc001yig.3_5'Flank|MIR127_hsa-mir-127|MI0000472_5'Flank|MIR432_hsa-mir-432|MI0003133_5'Flank|uc010txk.1_5'Flank|MIR136_hsa-mir-136|MI0000475_5'Flank	p.R908L	NM_001134888	NP_001128360	WXS	Illumina HiSeq	Unspecified	A6NKG5	RTL1_HUMAN			1	2782	-			908					E9PKS8	Missense_Mutation	SNP	ENST00000534062.1	37	c.2723G>T	CCDS53910.1	.	.	.	.	.	.	.	.	.	.	C	11.73	1.727015	0.30593	.	.	ENSG00000254656	ENST00000534062	T	0.46451	0.87	3.15	3.15	0.36227	.	0.000000	0.32578	N	0.005901	T	0.46229	0.1382	L	0.29908	0.895	0.25682	N	0.985788	D	0.89917	1.0	D	0.85130	0.997	T	0.15292	-1.0442	10	0.87932	D	0	.	6.3335	0.21282	0.0:0.8672:0.0:0.1328	.	908	E9PKS8	.	L	908	ENSP00000435342:R908L	ENSP00000435342:R908L	R	-	2	0	RTL1	100418156	0.920000	0.31207	0.335000	0.25508	0.061000	0.15899	3.093000	0.50217	2.091000	0.63221	0.555000	0.69702	CGC		0.572	RTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395127.1	NM_001134888		4	7	1	0	0.00024832	0.000248	0.000393745	4	7				
NPAP1	23742	broad.mit.edu	37	15	24921606	24921606	+	Missense_Mutation	SNP	G	G	T	rs150016698		TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr15:24921606G>T	ENST00000329468.2	+	1	1066	c.592G>T	c.(592-594)Gtg>Ttg	p.V198L		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	198					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)		p.V198L(1)									CCAGGGAGACGTGGCCTCCTT	0.597																																							uc001ywo.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|large_intestine(2)|skin(2)|kidney(1)|central_nervous_system(1)	8						c.(592-594)GTG>TTG		hypothetical protein LOC23742							44.0	38.0	40.0					15																	24921606		2203	4300	6503	SO:0001583	missense	23742				cell differentiation|multicellular organismal development|spermatogenesis			g.chr15:24921606G>T	AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.592G>T	15.37:g.24921606G>T	ENSP00000333735:p.Val198Leu		Somatic					p.V198L	NM_018958	NP_061831	WXS	Illumina HiSeq	Unspecified	Q9NZP6	CO002_HUMAN		all cancers(64;3.19e-24)|Epithelial(43;2.67e-17)|GBM - Glioblastoma multiforme(186;7.36e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000273)|Lung(196;0.229)	1	1066	+		all_cancers(20;2.14e-21)|all_epithelial(15;4.77e-19)|Lung NSC(15;1.43e-14)|all_lung(15;9.57e-14)|Breast(32;0.00086)	198						Missense_Mutation	SNP	ENST00000329468.2	37	c.592G>T	CCDS10015.1	.	.	.	.	.	.	.	.	.	.	.	0.008	-1.903641	0.00512	.	.	ENSG00000185823	ENST00000329468	T	0.09630	2.96	2.06	-1.42	0.08913	.	1.692080	0.04046	N	0.303925	T	0.02888	0.0086	N	0.00554	-1.385	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.37126	-0.9719	10	0.23302	T	0.38	.	5.0853	0.14678	0.2197:0.3377:0.4426:0.0	.	198	Q9NZP6	CO002_HUMAN	L	198	ENSP00000333735:V198L	ENSP00000333735:V198L	V	+	1	0	C15orf2	22472699	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.333000	0.07894	-0.329000	0.08527	-0.511000	0.04467	GTG		0.597	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251253.1	NM_018958		6	18	1	0	3.59834e-05	0.001168	5.86774e-05	6	18				
ARHGAP11B	89839	broad.mit.edu	37	15	30938316	30938316	+	lincRNA	SNP	G	G	A	rs112615235		TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr15:30938316G>A	ENST00000602684.1	+	0	0																											TTCCTTGGCAGTGGATAAGTT	0.393																																							uc010azv.1		NA																	0					0						c.e11-1		Homo sapiens cDNA, FLJ17072.																																						89839				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity	g.chr15:30938316G>A																													15.37:g.30938316G>A			Somatic				ARHGAP11B_uc001zeu.2_Splice_Site				WXS	Illumina HiSeq	Unspecified	Q3KRB8	RHGBB_HUMAN		all cancers(64;1.9e-15)|Epithelial(43;3.59e-12)|GBM - Glioblastoma multiforme(186;9e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)|Lung(196;0.153)	11		+		all_lung(180;2.71e-09)|Breast(32;0.00116)							Splice_Site	SNP	ENST00000602684.1	37	c.1127_splice																																																																																					0.393	RP11-932O9.10-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000467507.1			4	29	0	0	0	0.000248	0	4	29				
CILP	8483	broad.mit.edu	37	15	65499179	65499179	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr15:65499179C>G	ENST00000261883.4	-	4	531	c.365G>C	c.(364-366)aGg>aCg	p.R122T		NM_003613.3	NP_003604	O75339	CILP1_HUMAN	cartilage intermediate layer protein, nucleotide pyrophosphohydrolase	122					negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)		p.R122T(1)		breast(5)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(17)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(1)	55						CCGCTGCTCCCTGTTGAGGCA	0.642																																							uc002aon.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|pancreas(2)|skin(1)	7						c.(364-366)AGG>ACG		cartilage intermediate layer protein							54.0	56.0	55.0					15																	65499179		2201	4299	6500	SO:0001583	missense	8483				negative regulation of insulin-like growth factor receptor signaling pathway	extracellular matrix part|extracellular space|proteinaceous extracellular matrix		g.chr15:65499179C>G	AY358904	CCDS10203.1	15q22	2013-01-14			ENSG00000138615	ENSG00000138615		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1980	protein-coding gene	gene with protein product		603489				9722584, 9722583	Standard	NM_003613		Approved	HsT18872	uc002aon.2	O75339	OTTHUMG00000133140	ENST00000261883.4:c.365G>C	15.37:g.65499179C>G	ENSP00000261883:p.Arg122Thr		Somatic					p.R122T	NM_003613	NP_003604	WXS	Illumina HiSeq	Unspecified	O75339	CILP1_HUMAN			4	546	-			122					B2R8F7|Q6UW99|Q8IYI5	Missense_Mutation	SNP	ENST00000261883.4	37	c.365G>C	CCDS10203.1	.	.	.	.	.	.	.	.	.	.	C	13.09	2.132666	0.37630	.	.	ENSG00000138615	ENST00000261883	T	0.16743	2.32	5.3	1.03	0.20045	.	0.785389	0.12428	N	0.469801	T	0.12347	0.0300	L	0.35487	1.065	0.27502	N	0.951942	B	0.06786	0.001	B	0.08055	0.003	T	0.21348	-1.0248	10	0.72032	D	0.01	-0.6616	6.8056	0.23777	0.0:0.5285:0.0:0.4715	.	122	O75339	CILP1_HUMAN	T	122	ENSP00000261883:R122T	ENSP00000261883:R122T	R	-	2	0	CILP	63286232	0.905000	0.30787	0.965000	0.40720	0.666000	0.39218	1.156000	0.31712	0.367000	0.24454	0.561000	0.74099	AGG		0.642	CILP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256829.1	NM_003613		15	26	0	0	0	0.00245	0	15	26				
C15orf59	388135	broad.mit.edu	37	15	74032550	74032550	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr15:74032550A>G	ENST00000569673.1	-	3	1794	c.590T>C	c.(589-591)cTg>cCg	p.L197P	C15orf59_ENST00000558834.1_5'UTR|C15orf59_ENST00000379822.4_Missense_Mutation_p.L197P			Q2T9L4	CO059_HUMAN	chromosome 15 open reading frame 59	197								p.L197P(1)		breast(1)|endometrium(2)|large_intestine(2)|lung(6)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						gtcACAGCACAGAGCATGGTA	0.652																																							uc002avy.2		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)	1						c.(589-591)CTG>CCG		hypothetical protein LOC388135							87.0	63.0	71.0					15																	74032550		2198	4297	6495	SO:0001583	missense	388135							g.chr15:74032550A>G		CCDS32289.1	15q24.1	2012-09-27			ENSG00000205363	ENSG00000205363			33753	protein-coding gene	gene with protein product							Standard	XM_005254369		Approved	MGC131524, LOC388135	uc002avy.3	Q2T9L4	OTTHUMG00000172556	ENST00000569673.1:c.590T>C	15.37:g.74032550A>G	ENSP00000457205:p.Leu197Pro		Somatic					p.L197P	NM_001039614	NP_001034703	WXS	Illumina HiSeq	Unspecified	Q2T9L4	CO059_HUMAN			2	935	-			197						Missense_Mutation	SNP	ENST00000569673.1	37	c.590T>C	CCDS32289.1	.	.	.	.	.	.	.	.	.	.	A	19.47	3.833753	0.71258	.	.	ENSG00000205363	ENST00000379822	T	0.57273	0.41	5.15	5.15	0.70609	.	0.000000	0.64402	D	0.000003	T	0.67951	0.2948	L	0.55481	1.735	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.71144	-0.4678	10	0.72032	D	0.01	.	14.6149	0.68541	1.0:0.0:0.0:0.0	.	197	Q2T9L4	CO059_HUMAN	P	197	ENSP00000369150:L197P	ENSP00000369150:L197P	L	-	2	0	C15orf59	71819603	1.000000	0.71417	0.993000	0.49108	0.763000	0.43281	8.573000	0.90759	1.933000	0.56026	0.459000	0.35465	CTG		0.652	C15orf59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419077.2	NM_001039614		9	25	0	0	0	0.006214	0	9	25				
AGBL1	123624	broad.mit.edu	37	15	86813215	86813215	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr15:86813215T>C	ENST00000441037.2	+	13	1861	c.1766T>C	c.(1765-1767)tTc>tCc	p.F589S	AGBL1_ENST00000421325.2_Missense_Mutation_p.F589S|AGBL1_ENST00000389298.3_Missense_Mutation_p.F320S	NM_152336.2	NP_689549.2	Q96MI9	CBPC4_HUMAN	ATP/GTP binding protein-like 1	589					C-terminal protein deglutamylation (GO:0035609)|protein side chain deglutamylation (GO:0035610)	cytoplasm (GO:0005737)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)	p.F589S(1)		NS(3)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|liver(2)|lung(28)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	62						TGGTTCTATTTCAAAGTGAGC	0.493																																							uc002blz.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1765-1767)TTC>TCC		ATP/GTP binding protein-like 1							62.0	61.0	61.0					15																	86813215		1928	4152	6080	SO:0001583	missense	123624				C-terminal protein deglutamylation|protein side chain deglutamylation|proteolysis	cytosol	metallocarboxypeptidase activity|tubulin binding|zinc ion binding	g.chr15:86813215T>C	AK056872	CCDS58398.1	15q25.3	2014-06-23			ENSG00000166748	ENSG00000166748			26504	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 4"""	615496				21074048, 24094747	Standard	NM_152336		Approved	FLJ32310, CCP4	uc002blz.1	Q96MI9	OTTHUMG00000149978	ENST00000441037.2:c.1766T>C	15.37:g.86813215T>C	ENSP00000413001:p.Phe589Ser		Somatic				AGBL1_uc002bma.1_Missense_Mutation_p.F320S|AGBL1_uc002bmb.1_Missense_Mutation_p.F283S	p.F589S	NM_152336	NP_689549	WXS	Illumina HiSeq	Unspecified	Q96MI9	CBPC4_HUMAN			13	1846	+			589					A1A4X5|A6NJH6|C9JHL5	Missense_Mutation	SNP	ENST00000441037.2	37	c.1766T>C	CCDS58398.1	.	.	.	.	.	.	.	.	.	.	T	17.57	3.423117	0.62733	.	.	ENSG00000166748	ENST00000441037;ENST00000421325;ENST00000389298	T;T	0.36157	1.27;1.27	5.65	5.65	0.86999	.	0.107759	0.64402	D	0.000006	T	0.73697	0.3620	H	0.97415	4	0.51482	D	0.999928	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.997	D	0.83825	0.0249	10	0.87932	D	0	-32.1986	15.0613	0.71955	0.0:0.0:0.0:1.0	.	288;320;589	Q96MI9-2;Q96MI9-3;Q96MI9	.;.;CBPC4_HUMAN	S	618;589;320	ENSP00000397173:F589S;ENSP00000373949:F320S	ENSP00000373949:F320S	F	+	2	0	AGBL1	84614219	1.000000	0.71417	0.972000	0.41901	0.134000	0.20937	7.877000	0.87225	2.152000	0.67230	0.459000	0.35465	TTC		0.493	AGBL1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000314929.5	NM_152336		15	14	0	0	0	0.00245	0	15	14				
LUC7L	55692	broad.mit.edu	37	16	239997	239997	+	Missense_Mutation	SNP	C	C	A	rs146490197		TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr16:239997C>A	ENST00000293872.8	-	9	1054	c.944G>T	c.(943-945)cGg>cTg	p.R315L	LUC7L_ENST00000337351.4_Missense_Mutation_p.R315L|LUC7L_ENST00000397783.1_Missense_Mutation_p.R315L|LUC7L_ENST00000397780.1_Missense_Mutation_p.R262L	NM_201412.1	NP_958815.1	Q9NQ29	LUC7L_HUMAN	LUC7-like (S. cerevisiae)	315	Arg/Ser-rich.				mRNA splice site selection (GO:0006376)|negative regulation of striated muscle tissue development (GO:0045843)	U1 snRNP (GO:0005685)	identical protein binding (GO:0042802)|mRNA binding (GO:0003729)	p.R315L(2)|p.R315Q(1)		NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(1)	11		all_cancers(16;1.1e-06)|all_epithelial(16;2.71e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.0138)|all_lung(18;0.0306)				CCGGGAAGCCCGACGATGTCC	0.617																																							uc002cgc.1		NA																	3	Substitution - Missense(3)		lung(2)|ovary(1)	central_nervous_system(1)	1						c.(943-945)CGG>CTG		LUC7-like isoform b							231.0	228.0	229.0					16																	239997		2203	4300	6503	SO:0001583	missense	55692						metal ion binding	g.chr16:239997C>A	AY005111	CCDS10401.1, CCDS32348.1	16p13.3	2010-01-25	2001-11-28		ENSG00000007392	ENSG00000007392			6723	protein-coding gene	gene with protein product		607782	"""LUC7 (S. cerevisiae)-like"""				Standard	NM_201412		Approved	LUC7B1, hLuc7B1, Luc7	uc002cgc.1	Q9NQ29	OTTHUMG00000060730	ENST00000293872.8:c.944G>T	16.37:g.239997C>A	ENSP00000293872:p.Arg315Leu		Somatic				LUC7L_uc002cga.1_Missense_Mutation_p.R315L|LUC7L_uc002cgd.1_RNA|LUC7L_uc002cge.1_Missense_Mutation_p.R315L|LUC7L_uc002cgb.1_Missense_Mutation_p.R229L	p.R315L	NM_201412	NP_958815	WXS	Illumina HiSeq	Unspecified	Q9NQ29	LUC7L_HUMAN			9	1055	-		all_cancers(16;1.1e-06)|all_epithelial(16;2.71e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.0138)|all_lung(18;0.0306)	315			Arg/Ser-rich.		B8ZZ13|Q96S32|Q9NPH4	Missense_Mutation	SNP	ENST00000293872.8	37	c.944G>T	CCDS32348.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.960216	0.74016	.	.	ENSG00000007392	ENST00000337351;ENST00000293872;ENST00000397783;ENST00000429378;ENST00000397780	T;T;T;T	0.54279	1.01;1.01;0.58;3.4	5.15	5.15	0.70609	.	0.268963	0.41938	D	0.000791	T	0.52917	0.1764	M	0.64404	1.975	0.80722	D	1	P	0.38827	0.649	B	0.37550	0.253	T	0.56335	-0.7996	10	0.41790	T	0.15	.	17.6237	0.88089	0.0:1.0:0.0:0.0	.	315	Q9NQ29	LUC7L_HUMAN	L	315;315;315;114;262	ENSP00000337507:R315L;ENSP00000380885:R315L;ENSP00000413033:R114L;ENSP00000380882:R262L	ENSP00000293872:R315L	R	-	2	0	LUC7L	179998	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.789000	0.55454	2.404000	0.81709	0.655000	0.94253	CGG		0.617	LUC7L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000134239.1			29	128	1	0	1.06801e-11	0.001786	2.18163e-11	29	128				
PTX4	390667	broad.mit.edu	37	16	1537689	1537689	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr16:1537689C>A	ENST00000447419.2	-	2	449	c.424G>T	c.(424-426)Gca>Tca	p.A142S	PTX4_ENST00000440447.2_Intron|PTX4_ENST00000293922.1_Missense_Mutation_p.A137S			Q96A99	PTX4_HUMAN	pentraxin 4, long	142						extracellular region (GO:0005576)	metal ion binding (GO:0046872)	p.A137S(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	17						GCCTTGTGTGCCTTCCTTTCC	0.711																																							uc010uvf.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(409-411)GCA>TCA		neuronal pentraxin II-like							26.0	32.0	30.0					16																	1537689		2195	4289	6484	SO:0001583	missense	390667					extracellular region	metal ion binding	g.chr16:1537689C>A		CCDS32362.1	16p13.3	2011-01-06	2010-03-30	2010-03-30	ENSG00000251692	ENSG00000251692			14171	protein-coding gene	gene with protein product		613442	"""chromosome 16 open reading frame 38"""	C16orf38			Standard	NM_001013658		Approved		uc010uvf.2	Q96A99		ENST00000447419.2:c.424G>T	16.37:g.1537689C>A	ENSP00000445277:p.Ala142Ser		Somatic					p.A137S	NM_001013658	NP_001013680	WXS	Illumina HiSeq	Unspecified	Q96A99	PTX4_HUMAN			2	409	-			142						Missense_Mutation	SNP	ENST00000447419.2	37	c.409G>T		.	.	.	.	.	.	.	.	.	.	C	5.415	0.261708	0.10239	.	.	ENSG00000251692	ENST00000447419;ENST00000293922	T;T	0.05319	3.59;3.46	5.21	2.09	0.27110	.	4.607070	0.00357	N	0.000020	T	0.04634	0.0126	N	0.22421	0.69	0.09310	N	1	B	0.32467	0.372	B	0.24394	0.053	T	0.38394	-0.9663	10	0.09843	T	0.71	.	6.9712	0.24650	0.0:0.6905:0.1429:0.1665	.	137	Q96A99-2	.	S	142;137	ENSP00000445277:A142S;ENSP00000293922:A137S	ENSP00000293922:A137S	A	-	1	0	PTX4	1477690	0.004000	0.15560	0.021000	0.16686	0.001000	0.01503	0.542000	0.23222	0.583000	0.29574	0.561000	0.74099	GCA		0.711	PTX4-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000432526.1	NM_001013658		3	28	1	0	0.004672	0.004672	0.00711334	3	28				
ECI1	1632	broad.mit.edu	37	16	2296886	2296886	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr16:2296886T>A	ENST00000301729.4	-	3	315	c.268A>T	c.(268-270)Agc>Tgc	p.S90C	ECI1_ENST00000562238.1_Missense_Mutation_p.S90C|ECI1_ENST00000570258.1_Missense_Mutation_p.S31C	NM_001919.3	NP_001910.2	P42126	ECI1_HUMAN	enoyl-CoA delta isomerase 1	90					cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	dodecenoyl-CoA delta-isomerase activity (GO:0004165)|intramolecular oxidoreductase activity (GO:0016860)	p.S90C(1)		endometrium(1)|large_intestine(2)|lung(6)	9						CCGCGGAAGCTCTTGTCATTC	0.562																																							uc002cpr.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(268-270)AGC>TGC		dodecenoyl-Coenzyme A delta isomerase precursor							70.0	66.0	67.0					16																	2296886		2198	4300	6498	SO:0001583	missense	1632				fatty acid beta-oxidation	mitochondrial matrix	dodecenoyl-CoA delta-isomerase activity	g.chr16:2296886T>A		CCDS10464.1, CCDS58410.1	16p13.3	2011-03-15	2011-03-15	2011-03-15	ENSG00000167969	ENSG00000167969	5.3.3.8		2703	protein-coding gene	gene with protein product	"""3,2 trans-enoyl-CoA isomerase"""	600305	"""dodecenoyl-Coenzyme A delta isomerase (3,2 trans-enoyl-Coenzyme A isomerase)"", ""dodecenoyl-CoA isomerase"""	DCI		7829074	Standard	NM_001178029		Approved		uc002cpr.3	P42126	OTTHUMG00000128830	ENST00000301729.4:c.268A>T	16.37:g.2296886T>A	ENSP00000301729:p.Ser90Cys		Somatic				DCI_uc002cps.2_Missense_Mutation_p.S90C	p.S90C	NM_001919	NP_001910	WXS	Illumina HiSeq	Unspecified	P42126	ECI1_HUMAN			3	304	-			90					A8K512|Q13290|Q7Z2L6|Q7Z2L7|Q9BUB8|Q9BW05|Q9UDG6	Missense_Mutation	SNP	ENST00000301729.4	37	c.268A>T	CCDS10464.1	.	.	.	.	.	.	.	.	.	.	T	18.16	3.563205	0.65538	.	.	ENSG00000167969	ENST00000301729	D	0.87029	-2.2	5.21	-5.38	0.02673	Crotonase, core (1);	0.821572	0.11457	N	0.562192	D	0.86785	0.6016	M	0.62154	1.92	0.33027	D	0.52961	D;D	0.63880	0.993;0.988	P;P	0.57911	0.681;0.829	D	0.83966	0.0324	10	0.72032	D	0.01	-13.6507	4.7702	0.13151	0.1217:0.5026:0.1245:0.2511	.	90;90	P42126-2;P42126	.;ECI1_HUMAN	C	90	ENSP00000301729:S90C	ENSP00000301729:S90C	S	-	1	0	ECI1	2236887	0.232000	0.23762	0.027000	0.17364	0.128000	0.20619	-0.268000	0.08607	-0.716000	0.04962	-0.408000	0.06270	AGC		0.562	ECI1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250768.1			5	59	0	0	0	0.000602	0	5	59				
MMP25	64386	broad.mit.edu	37	16	3107056	3107056	+	Missense_Mutation	SNP	T	T	G			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr16:3107056T>G	ENST00000336577.4	+	5	921	c.684T>G	c.(682-684)ttT>ttG	p.F228L	RP11-473M20.7_ENST00000573953.1_RNA|RP11-473M20.7_ENST00000573130.1_RNA|RP11-473M20.7_ENST00000597579.1_RNA|RP11-473M20.7_ENST00000572222.1_RNA|RP11-473M20.7_ENST00000573878.1_RNA|RP11-473M20.7_ENST00000570949.1_RNA|RP11-473M20.7_ENST00000572427.1_RNA|RP11-473M20.7_ENST00000572930.1_RNA|RP11-473M20.7_ENST00000572574.1_RNA|RP11-473M20.7_ENST00000576250.1_RNA	NM_022468.4	NP_071913.1	Q9H239	MMP28_HUMAN	matrix metallopeptidase 25	235					negative regulation of macrophage chemotaxis (GO:0010760)	cytoplasm (GO:0005737)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.F228L(1)		endometrium(1)|kidney(2)|large_intestine(2)|lung(7)|prostate(1)|skin(1)	14					Marimastat(DB00786)	CCGACCTGTTTGCCGTGGCTG	0.672																																					NSCLC(147;665 1067 3888 6863 19894 30469 40247 45633 51336)	NSCLC(147;665 1067 3888 6863 19894 30469 40247 45633 51336)	uc002cth.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(682-684)TTT>TTG		matrix metalloproteinase 25 preproprotein							66.0	67.0	67.0					16																	3107056		2197	4300	6497	SO:0001583	missense	64386				inflammatory response|proteolysis	anchored to membrane|cell surface|plasma membrane|proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding	g.chr16:3107056T>G	AF145442	CCDS10492.1	16p13.3	2008-02-05	2005-08-08			ENSG00000008516			14246	protein-coding gene	gene with protein product		608482	"""matrix metalloproteinase 25"", ""matrix metallopeptidase-like 1"""	MMPL1, MMP20		10628838, 10706098	Standard	NM_022468		Approved	MT6-MMP	uc002cth.3	Q9NPA2		ENST00000336577.4:c.684T>G	16.37:g.3107056T>G	ENSP00000337816:p.Phe228Leu		Somatic				uc002ctj.1_Intron	p.F228L	NM_022468	NP_071913	WXS	Illumina HiSeq	Unspecified	Q9NPA2	MMP25_HUMAN			5	921	+			228					Q96F04|Q96TE2	Missense_Mutation	SNP	ENST00000336577.4	37	c.684T>G	CCDS10492.1	.	.	.	.	.	.	.	.	.	.	t	16.67	3.187554	0.57909	.	.	ENSG00000008516	ENST00000336577	T	0.21734	1.99	4.48	0.846	0.18955	Peptidase M10, metallopeptidase (1);Peptidase, metallopeptidase (1);Metallopeptidase, catalytic domain (1);	0.000000	0.49305	D	0.000148	T	0.31670	0.0804	L	0.52823	1.66	0.42535	D	0.993057	P	0.49447	0.924	P	0.60415	0.874	T	0.02026	-1.1227	10	0.54805	T	0.06	.	7.443	0.27194	0.0:0.2823:0.0:0.7177	.	228	Q9NPA2	MMP25_HUMAN	L	228	ENSP00000337816:F228L	ENSP00000337816:F228L	F	+	3	2	MMP25	3047057	0.001000	0.12720	0.960000	0.40013	0.427000	0.31564	-0.763000	0.04740	-0.136000	0.11475	0.255000	0.18592	TTT		0.672	MMP25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437116.1	NM_022468		13	69	0	0	0	0.001855	0	13	69				
GRIN2A	2903	broad.mit.edu	37	16	9934526	9934526	+	Silent	SNP	G	G	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr16:9934526G>A	ENST00000396573.2	-	8	1938	c.1629C>T	c.(1627-1629)acC>acT	p.T543T	GRIN2A_ENST00000396575.2_Silent_p.T543T|GRIN2A_ENST00000330684.3_Silent_p.T543T|GRIN2A_ENST00000562109.1_Silent_p.T543T|GRIN2A_ENST00000535259.1_Silent_p.T386T|GRIN2A_ENST00000404927.2_Silent_p.T543T	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	543					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)	p.T543T(1)		NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	AAGGTGAGACGGTGCCATTAC	0.453																																							uc002czo.3		NA																	1	Substitution - coding silent(1)		lung(1)	skin(32)|NS(5)|ovary(4)|large_intestine(1)|lung(1)|breast(1)|kidney(1)	45						c.(1627-1629)ACC>ACT		N-methyl-D-aspartate receptor subunit 2A isoform	Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)						133.0	108.0	116.0					16																	9934526		2197	4300	6497	SO:0001819	synonymous_variant	2903				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding	g.chr16:9934526G>A		CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.1629C>T	16.37:g.9934526G>A			Somatic				GRIN2A_uc010uym.1_Silent_p.T543T|GRIN2A_uc010uyn.1_Silent_p.T386T|GRIN2A_uc002czr.3_Silent_p.T543T	p.T543T	NM_001134407	NP_001127879	WXS	Illumina HiSeq	Unspecified	Q12879	NMDE1_HUMAN			7	2177	-			543			Extracellular (Potential).		O00669|Q17RZ6	Silent	SNP	ENST00000396573.2	37	c.1629C>T	CCDS10539.1																																																																																				0.453	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251930.3			10	58	0	0	0	0.008291	0	10	58				
PDILT	204474	broad.mit.edu	37	16	20410442	20410442	+	Missense_Mutation	SNP	G	G	T	rs368369154		TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr16:20410442G>T	ENST00000302451.4	-	2	429	c.181C>A	c.(181-183)Cgc>Agc	p.R61S		NM_174924.1	NP_777584.1	Q8N807	PDILT_HUMAN	protein disulfide isomerase-like, testis expressed	61					cell migration (GO:0016477)|cell redox homeostasis (GO:0045454)|multicellular organismal development (GO:0007275)|protein folding (GO:0006457)|spermatid development (GO:0007286)	endoplasmic reticulum (GO:0005783)	protein disulfide isomerase activity (GO:0003756)	p.R61S(1)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(33)|prostate(3)|skin(1)|urinary_tract(1)	61						ATGAGGAAGCGGGTCTGGTTC	0.562																																							uc002dhc.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)	1						c.(181-183)CGC>AGC		protein disulfide isomerase-like, testis							100.0	91.0	94.0					16																	20410442		2203	4300	6503	SO:0001583	missense	204474				cell differentiation|cell redox homeostasis|multicellular organismal development|spermatogenesis	endoplasmic reticulum	isomerase activity	g.chr16:20410442G>T		CCDS10584.1	16p12.3	2011-11-10	2009-02-23		ENSG00000169340	ENSG00000169340		"""Protein disulfide isomerases"""	27338	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 7"", ""protein disulfide isomerase-like protein of the testis"""					15475357	Standard	NM_174924		Approved	PDIA7	uc002dhc.1	Q8N807	OTTHUMG00000131487	ENST00000302451.4:c.181C>A	16.37:g.20410442G>T	ENSP00000305465:p.Arg61Ser		Somatic					p.R61S	NM_174924	NP_777584	WXS	Illumina HiSeq	Unspecified	Q8N807	PDILT_HUMAN			2	404	-			61					Q8IVQ5	Missense_Mutation	SNP	ENST00000302451.4	37	c.181C>A	CCDS10584.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.027180	0.75390	.	.	ENSG00000169340	ENST00000302451	T	0.03212	4.01	4.21	4.21	0.49690	Thioredoxin domain (1);Thioredoxin-like fold (2);	0.357715	0.30134	N	0.010336	T	0.05135	0.0137	L	0.34521	1.04	0.33941	D	0.643194	P	0.48834	0.916	P	0.48454	0.578	T	0.46034	-0.9220	10	0.21014	T	0.42	.	12.3542	0.55165	0.0:0.0:1.0:0.0	.	61	Q8N807	PDILT_HUMAN	S	61	ENSP00000305465:R61S	ENSP00000305465:R61S	R	-	1	0	PDILT	20317943	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	3.640000	0.54350	2.623000	0.88846	0.591000	0.81541	CGC		0.562	PDILT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254332.1	NM_174924		17	41	1	0	4.7546e-09	0.004007	9.09714e-09	17	41				
THUMPD1	55623	broad.mit.edu	37	16	20748497	20748497	+	Missense_Mutation	SNP	T	T	G	rs369253312		TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr16:20748497T>G	ENST00000381337.2	-	4	1111	c.767A>C	c.(766-768)tAc>tCc	p.Y256S	THUMPD1_ENST00000431224.2_Missense_Mutation_p.Y342S|THUMPD1_ENST00000396083.2_Missense_Mutation_p.Y256S	NM_017736.3	NP_060206.2	Q9NXG2	THUM1_HUMAN	THUMP domain containing 1	256							poly(A) RNA binding (GO:0044822)	p.Y256S(1)		NS(2)|large_intestine(2)|lung(6)|pancreas(1)|urinary_tract(1)	12						AAACAACATGTAATCTTTCAC	0.418																																							uc002dho.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(766-768)TAC>TCC		THUMP domain containing 1							138.0	123.0	128.0					16																	20748497		2201	4300	6501	SO:0001583	missense	55623							g.chr16:20748497T>G	BC000448	CCDS10588.1	16p13.11	2010-06-17			ENSG00000066654	ENSG00000066654			23807	protein-coding gene	gene with protein product							Standard	XM_005255422		Approved	FLJ20274	uc002dho.3	Q9NXG2	OTTHUMG00000131558	ENST00000381337.2:c.767A>C	16.37:g.20748497T>G	ENSP00000370741:p.Tyr256Ser		Somatic				THUMPD1_uc010vaz.1_Missense_Mutation_p.Y109S|THUMPD1_uc002dhp.2_Missense_Mutation_p.Y256S	p.Y256S	NM_017736	NP_060206	WXS	Illumina HiSeq	Unspecified	Q9NXG2	THUM1_HUMAN			4	905	-			256					Q9BWC3	Missense_Mutation	SNP	ENST00000381337.2	37	c.767A>C	CCDS10588.1	.	.	.	.	.	.	.	.	.	.	T	28.0	4.880389	0.91740	.	.	ENSG00000066654	ENST00000381337;ENST00000431224;ENST00000396083	T;T;T	0.68331	-0.29;-0.32;-0.29	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.79896	0.4525	M	0.63843	1.955	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.80723	-0.1255	10	0.54805	T	0.06	.	16.183	0.81925	0.0:0.0:0.0:1.0	.	256	Q9NXG2	THUM1_HUMAN	S	256;342;256	ENSP00000370741:Y256S;ENSP00000392282:Y342S;ENSP00000379392:Y256S	ENSP00000370741:Y256S	Y	-	2	0	THUMPD1	20655998	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.615000	0.83006	2.231000	0.72958	0.402000	0.26972	TAC		0.418	THUMPD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254420.1	NM_017736		15	91	0	0	0	0.006122	0	15	91				
HS3ST4	9951	broad.mit.edu	37	16	26147079	26147079	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr16:26147079C>A	ENST00000331351.5	+	2	1273	c.881C>A	c.(880-882)gCc>gAc	p.A294D	HS3ST4_ENST00000475436.1_3'UTR	NM_006040.2	NP_006031.2	Q9Y661	HS3S4_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 4	294					heparan sulfate proteoglycan metabolic process (GO:0030201)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity (GO:0008467)	p.A294D(2)		breast(2)|endometrium(3)|large_intestine(1)|lung(9)	15				GBM - Glioblastoma multiforme(48;0.0988)		GTGACCAGGGCCATCTCTGAC	0.532																																							uc002dof.2		NA																	2	Substitution - Missense(2)		lung(2)	large_intestine(1)|breast(1)	2						c.(880-882)GCC>GAC		heparan sulfate D-glucosaminyl							149.0	137.0	141.0					16																	26147079		1568	3582	5150	SO:0001583	missense	9951				heparan sulfate proteoglycan metabolic process	extracellular region|Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity	g.chr16:26147079C>A	AF105378	CCDS53995.1	16p11.2	2008-03-12			ENSG00000182601	ENSG00000182601	2.8.2.23	"""Sulfotransferases, membrane-bound"""	5200	protein-coding gene	gene with protein product		604059				9988767	Standard	NM_006040		Approved	3OST4	uc002dof.3	Q9Y661	OTTHUMG00000059978	ENST00000331351.5:c.881C>A	16.37:g.26147079C>A	ENSP00000330606:p.Ala294Asp		Somatic					p.A294D	NM_006040	NP_006031	WXS	Illumina HiSeq	Unspecified	Q9Y661	HS3S4_HUMAN		GBM - Glioblastoma multiforme(48;0.0988)	2	1273	+			294			Lumenal (Potential).|PAPS and substrate (By similarity).		Q5QI42|Q8NDC2	Missense_Mutation	SNP	ENST00000331351.5	37	c.881C>A	CCDS53995.1	.	.	.	.	.	.	.	.	.	.	C	27.1	4.798129	0.90538	.	.	ENSG00000182601	ENST00000331351	D	0.85013	-1.93	5.11	5.11	0.69529	Sulfotransferase domain (1);	0.000000	0.64402	U	0.000002	D	0.94837	0.8332	H	0.95151	3.63	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96359	0.9264	10	0.87932	D	0	.	17.5178	0.87779	0.0:1.0:0.0:0.0	.	294	Q9Y661	HS3S4_HUMAN	D	294	ENSP00000330606:A294D	ENSP00000330606:A294D	A	+	2	0	HS3ST4	26054580	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.756000	0.85195	2.375000	0.81037	0.655000	0.94253	GCC		0.532	HS3ST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133286.2	NM_006040		30	127	1	0	3.1745e-13	0.008361	6.69912e-13	30	127				
AHSP	51327	broad.mit.edu	37	16	31539817	31539817	+	Silent	SNP	G	G	C			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr16:31539817G>C	ENST00000302312.4	+	3	217	c.114G>C	c.(112-114)gtG>gtC	p.V38V	AHSP_ENST00000569954.1_3'UTR	NM_016633.2	NP_057717.1	Q9NZD4	AHSP_HUMAN	alpha hemoglobin stabilizing protein	38					hemoglobin metabolic process (GO:0020027)|hemopoiesis (GO:0030097)|protein folding (GO:0006457)|protein stabilization (GO:0050821)	hemoglobin complex (GO:0005833)	hemoglobin binding (GO:0030492)|unfolded protein binding (GO:0051082)	p.V38V(1)		lung(2)	2						AAGACATGGTGACTGTGGTGG	0.547																																							uc002ecj.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(112-114)GTG>GTC		erythroid associated factor							69.0	66.0	67.0					16																	31539817		2197	4300	6497	SO:0001819	synonymous_variant	51327				hemoglobin metabolic process|hemopoiesis|protein folding|protein stabilization	hemoglobin complex	hemoglobin binding|unfolded protein binding	g.chr16:31539817G>C	AF208865	CCDS10716.1	16p11.1	2009-10-07	2009-10-07	2009-10-07	ENSG00000169877	ENSG00000169877			18075	protein-coding gene	gene with protein product	"""alpha hemoglobin stabilising protein"""	605821	"""erythroid associated factor"""	ERAF		11231637, 12066189	Standard	XM_005255352		Approved	EDRF	uc002ecj.3	Q9NZD4	OTTHUMG00000132461	ENST00000302312.4:c.114G>C	16.37:g.31539817G>C			Somatic					p.V38V	NM_016633	NP_057717	WXS	Illumina HiSeq	Unspecified	Q9NZD4	AHSP_HUMAN			3	199	+			38					Q8TD01	Silent	SNP	ENST00000302312.4	37	c.114G>C	CCDS10716.1																																																																																				0.547	AHSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255624.1	NM_016633		19	85	0	0	0	0.007413	0	19	85				
ADCY7	113	broad.mit.edu	37	16	50349373	50349373	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr16:50349373T>C	ENST00000394697.2	+	26	3540	c.3200T>C	c.(3199-3201)gTc>gCc	p.V1067A	ADCY7_ENST00000254235.3_Missense_Mutation_p.V1067A			P51828	ADCY7_HUMAN	adenylate cyclase 7	1067					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to ethanol (GO:0071361)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|maternal process involved in female pregnancy (GO:0060135)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cAMP biosynthetic process (GO:0030819)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)	p.V1067A(1)		breast(1)|cervix(1)|endometrium(5)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(3)	35		all_cancers(37;0.0127)		GBM - Glioblastoma multiforme(240;0.195)		ACTTACTTTGTCTGTACGGAC	0.582																																							uc002egd.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(3199-3201)GTC>GCC		adenylate cyclase 7	Bromocriptine(DB01200)						103.0	98.0	100.0					16																	50349373		2198	4300	6498	SO:0001583	missense	113				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to ethanol|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|positive regulation of cAMP biosynthetic process|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding	g.chr16:50349373T>C	D25538	CCDS10741.1, CCDS73882.1	16q12.1	2013-02-04			ENSG00000121281	ENSG00000121281	4.6.1.1	"""Adenylate cyclases"""	238	protein-coding gene	gene with protein product		600385				7860067	Standard	NM_001286057		Approved	KIAA0037, AC7	uc002egd.1	P51828	OTTHUMG00000133172	ENST00000394697.2:c.3200T>C	16.37:g.50349373T>C	ENSP00000378187:p.Val1067Ala		Somatic					p.V1067A	NM_001114	NP_001105	WXS	Illumina HiSeq	Unspecified	P51828	ADCY7_HUMAN		GBM - Glioblastoma multiforme(240;0.195)	25	3468	+		all_cancers(37;0.0127)	1067			Cytoplasmic (Potential).		A0AVA6	Missense_Mutation	SNP	ENST00000394697.2	37	c.3200T>C	CCDS10741.1	.	.	.	.	.	.	.	.	.	.	T	27.6	4.850218	0.91277	.	.	ENSG00000121281	ENST00000394697;ENST00000254235	D;D	0.81659	-1.52;-1.52	5.46	5.46	0.80206	Adenylyl cyclase class-3/4/guanylyl cyclase (3);	0.000000	0.38778	U	0.001564	D	0.91938	0.7447	M	0.92604	3.325	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.93844	0.7139	10	0.87932	D	0	.	15.5407	0.76043	0.0:0.0:0.0:1.0	.	1067	P51828	ADCY7_HUMAN	A	1067	ENSP00000378187:V1067A;ENSP00000254235:V1067A	ENSP00000254235:V1067A	V	+	2	0	ADCY7	48906874	1.000000	0.71417	1.000000	0.80357	0.794000	0.44872	8.040000	0.89188	2.065000	0.61736	0.379000	0.24179	GTC		0.582	ADCY7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256877.3			6	96	0	0	0	0.001984	0	6	96				
GNAO1	2775	broad.mit.edu	37	16	56374870	56374870	+	Intron	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr16:56374870C>A	ENST00000262493.6	+	6	1569				GNAO1_ENST00000262494.7_Missense_Mutation_p.P283Q	NM_020988.2	NP_066268.1	P09471	GNAO_HUMAN	guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O						adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|aging (GO:0007568)|dopamine receptor signaling pathway (GO:0007212)|forebrain development (GO:0030900)|locomotory behavior (GO:0007626)|muscle contraction (GO:0006936)|negative regulation of calcium ion transport (GO:0051926)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|regulation of heart contraction (GO:0008016)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to morphine (GO:0043278)	heterotrimeric G-protein complex (GO:0005834)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	corticotropin-releasing hormone receptor 1 binding (GO:0051430)|G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled serotonin receptor binding (GO:0031821)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|mu-type opioid receptor binding (GO:0031852)|signal transducer activity (GO:0004871)	p.P283Q(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(4)|prostate(1)	17		all_neural(199;0.159)				AAGAAGTCCCCGCTCACCATC	0.517																																							uc002eit.3		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)|breast(1)	2						c.(847-849)CCG>CAG		guanine nucleotide binding protein, alpha							257.0	268.0	265.0					16																	56374870		2198	4300	6498	SO:0001627	intron_variant	2775				dopamine receptor signaling pathway|G-protein signaling, coupled to cAMP nucleotide second messenger|muscle contraction	heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|GTP binding|GTPase activity|metabotropic serotonin receptor binding|signal transducer activity	g.chr16:56374870C>A		CCDS10756.1, CCDS10757.1	16q13	2008-08-01			ENSG00000087258	ENSG00000087258			4389	protein-coding gene	gene with protein product		139311				1899283, 11395521	Standard	NM_020988		Approved	G-ALPHA-o	uc002eit.4	P09471	OTTHUMG00000133241	ENST00000262493.6:c.723+4098C>A	16.37:g.56374870C>A			Somatic				GNAO1_uc002eiu.3_Intron	p.P283Q	NM_138736	NP_620073	WXS	Illumina HiSeq	Unspecified	P09471	GNAO_HUMAN			7	1745	+		all_neural(199;0.159)	283					P29777|Q8TD72|Q9UMV4	Missense_Mutation	SNP	ENST00000262493.6	37	c.848C>A	CCDS10756.1	.	.	.	.	.	.	.	.	.	.	C	25.0	4.589681	0.86851	.	.	ENSG00000087258	ENST00000262494	D	0.81659	-1.52	4.95	4.95	0.65309	.	.	.	.	.	D	0.91233	0.7237	M	0.90705	3.14	0.80722	D	1	D	0.63880	0.993	D	0.66084	0.941	D	0.93212	0.6601	9	0.87932	D	0	.	18.178	0.89767	0.0:1.0:0.0:0.0	.	283	P09471-2	.	Q	283	ENSP00000262494:P283Q	ENSP00000262494:P283Q	P	+	2	0	GNAO1	54932371	1.000000	0.71417	0.998000	0.56505	0.971000	0.66376	7.770000	0.85390	2.307000	0.77673	0.462000	0.41574	CCG		0.517	GNAO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256981.2	NM_020988		60	372	1	0	1.40621e-15	0.00361	3.20304e-15	60	372				
ZFP90	146198	broad.mit.edu	37	16	68598006	68598006	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr16:68598006A>T	ENST00000570495.1	+	5	1608	c.1316A>T	c.(1315-1317)cAa>cTa	p.Q439L	ZFP90_ENST00000563169.2_Missense_Mutation_p.Q439L|ZFP90_ENST00000398253.2_Missense_Mutation_p.Q439L			Q8TF47	ZFP90_HUMAN	ZFP90 zinc finger protein	439					negative regulation of DNA binding (GO:0043392)|positive regulation of transcription, DNA-templated (GO:0045893)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)	p.Q439L(1)		breast(2)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	27		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.00233)|Epithelial(162;0.0184)|all cancers(182;0.0946)		TCTCTCACTCAAGATGAAAGC	0.408																																							uc010cff.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1315-1317)CAA>CTA		zinc finger protein 90							93.0	90.0	91.0					16																	68598006		2001	4185	6186	SO:0001583	missense	146198				positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr16:68598006A>T	AK074332	CCDS42183.1	16q22.1	2013-01-08	2012-11-27			ENSG00000184939		"""Zinc fingers, C2H2-type"", ""-"""	23329	protein-coding gene	gene with protein product		609451	"""zinc finger protein 90 homolog (mouse)"""			7576184	Standard	NM_133458		Approved	KIAA1954, NK10, ZNF756	uc002ewc.3	Q8TF47		ENST00000570495.1:c.1316A>T	16.37:g.68598006A>T	ENSP00000460547:p.Gln439Leu		Somatic				ZFP90_uc002ewb.2_3'UTR|ZFP90_uc002ewc.2_3'UTR|ZFP90_uc002ewd.2_Missense_Mutation_p.Q439L|ZFP90_uc002ewe.2_Missense_Mutation_p.Q439L	p.Q439L	NM_133458	NP_597715	WXS	Illumina HiSeq	Unspecified	Q8TF47	ZFP90_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.00233)|Epithelial(162;0.0184)|all cancers(182;0.0946)	5	1608	+		Ovarian(137;0.192)	439					B2RU00|B3KVE7|Q49AD1|Q96MQ6	Missense_Mutation	SNP	ENST00000570495.1	37	c.1316A>T	CCDS42183.1	.	.	.	.	.	.	.	.	.	.	A	1.512	-0.549243	0.04024	.	.	ENSG00000184939	ENST00000398253	T	0.14516	2.5	5.66	1.82	0.25136	.	.	.	.	.	T	0.09598	0.0236	N	0.25789	0.76	0.09310	N	1	B	0.23442	0.085	B	0.19666	0.026	T	0.35822	-0.9773	9	0.17832	T	0.49	-2.0282	11.7335	0.51752	0.5734:0.4266:0.0:0.0	.	439	Q8TF47	ZFP90_HUMAN	L	439	ENSP00000381304:Q439L	ENSP00000381304:Q439L	Q	+	2	0	ZFP90	67155507	0.000000	0.05858	0.085000	0.20634	0.028000	0.11728	-0.270000	0.08584	0.461000	0.27071	-0.313000	0.08912	CAA		0.408	ZFP90-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436217.3	XM_085375		6	95	0	0	0	0.001984	0	6	95				
ZFHX3	463	broad.mit.edu	37	16	72984794	72984794	+	Silent	SNP	C	C	G			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr16:72984794C>G	ENST00000268489.5	-	3	3462	c.2790G>C	c.(2788-2790)ctG>ctC	p.L930L	ZFHX3_ENST00000397992.5_Silent_p.L16L	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	930					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.L930L(1)		NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				AGCTCTCGCCCAGGTTCATCA	0.622																																							uc002fck.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|skin(2)	4						c.(2788-2790)CTG>CTC		zinc finger homeobox 3 isoform A							71.0	62.0	65.0					16																	72984794		2198	4300	6498	SO:0001819	synonymous_variant	463				muscle organ development|negative regulation of myoblast differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|positive regulation of myoblast differentiation	transcription factor complex	enzyme binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription regulatory region DNA binding|zinc ion binding	g.chr16:72984794C>G	D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.2790G>C	16.37:g.72984794C>G			Somatic				ZFHX3_uc002fcl.2_Silent_p.L16L	p.L930L	NM_006885	NP_008816	WXS	Illumina HiSeq	Unspecified	Q15911	ZFHX3_HUMAN			3	3463	-		Ovarian(137;0.13)	930					D3DWS8|O15101|Q13719	Silent	SNP	ENST00000268489.5	37	c.2790G>C	CCDS10908.1																																																																																				0.622	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269008.1	NM_006885		22	55	0	0	0	0.00278	0	22	55				
ZMYND15	84225	broad.mit.edu	37	17	4642104	4642104	+	5'Flank	SNP	G	G	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr17:4642104G>A	ENST00000433935.1	+	0	0				CXCL16_ENST00000576153.1_5'Flank|ZMYND15_ENST00000573751.2_5'Flank|ZMYND15_ENST00000592813.1_5'Flank|CXCL16_ENST00000574412.1_Missense_Mutation_p.A83V|CXCL16_ENST00000293778.6_Missense_Mutation_p.A83V|ZMYND15_ENST00000269289.6_5'Flank	NM_001136046.2|NM_001267822.1	NP_001129518.1|NP_001254751.1	Q9H091	ZMY15_HUMAN	zinc finger, MYND-type containing 15						negative regulation of transcription, DNA-templated (GO:0045892)|spermatid development (GO:0007286)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)	p.A83V(2)		endometrium(5)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|skin(2)	18						CCGATGGTAAGCTCTCAGGTG	0.552																																							uc002fyr.3		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(247-249)GCT>GTT		chemokine (C-X-C motif) ligand 16							63.0	59.0	60.0					17																	4642104		2203	4300	6503	SO:0001631	upstream_gene_variant	58191				lymphocyte chemotaxis|positive regulation of cell growth|positive regulation of cell migration|receptor-mediated endocytosis|response to interferon-gamma|response to tumor necrosis factor	extracellular space|integral to membrane|plasma membrane	chemokine activity|low-density lipoprotein receptor activity|scavenger receptor activity	g.chr17:4642104G>A	AL136893	CCDS11053.1, CCDS45584.1, CCDS58506.1	17p13.3	2008-05-02			ENSG00000141497	ENSG00000141497		"""Zinc fingers, MYND-type"""	20997	protein-coding gene	gene with protein product		614312				11230166	Standard	NM_001136046		Approved	DKFZp434N127	uc002fyu.3	Q9H091	OTTHUMG00000090760		17.37:g.4642104G>A	Exception_encountered		Somatic				CXCL16_uc002fyq.3_5'Flank|CXCL16_uc002fys.3_Missense_Mutation_p.A83V|ZMYND15_uc002fyv.2_5'Flank|ZMYND15_uc002fyt.2_5'Flank|ZMYND15_uc002fyu.2_5'Flank	p.A83V	NM_022059	NP_071342	WXS	Illumina HiSeq	Unspecified	Q9H2A7	CXL16_HUMAN			2	780	-			64			Extracellular (Potential).|Chemokine.		B4DXY5|I3L296	Missense_Mutation	SNP	ENST00000433935.1	37	c.248C>T	CCDS45584.1	.	.	.	.	.	.	.	.	.	.	G	13.62	2.292142	0.40594	.	.	ENSG00000161921	ENST00000293778	T	0.32515	1.45	4.96	-9.92	0.00455	.	1.465370	0.04425	N	0.368289	T	0.15652	0.0377	L	0.27053	0.805	0.09310	N	1	B	0.16396	0.017	B	0.18561	0.022	T	0.13335	-1.0513	10	0.37606	T	0.19	2.7424	3.2728	0.06888	0.0929:0.4045:0.2916:0.211	.	64	Q9H2A7	CXL16_HUMAN	V	83	ENSP00000293778:A83V	ENSP00000293778:A83V	A	-	2	0	CXCL16	4588853	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-4.405000	0.00239	-2.443000	0.00548	-0.176000	0.13171	GCT		0.552	ZMYND15-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439580.1	NM_032265		10	39	0	0	0	0.008291	0	10	39				
KIAA0753	9851	broad.mit.edu	37	17	6526310	6526310	+	Silent	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr17:6526310C>A	ENST00000361413.3	-	6	1354	c.996G>T	c.(994-996)cgG>cgT	p.R332R	KIAA0753_ENST00000542606.1_Silent_p.R33R|KIAA0753_ENST00000589033.1_5'Flank|KIAA0753_ENST00000572370.1_Silent_p.R33R	NM_014804.2	NP_055619.2	Q2KHM9	K0753_HUMAN	KIAA0753	332						centrosome (GO:0005813)|cytoplasm (GO:0005737)		p.R332R(1)		endometrium(4)|large_intestine(11)|lung(5)|prostate(4)	24				COAD - Colon adenocarcinoma(228;0.157)		GTTCCTTACACCGAGCAGGAA	0.512																																							uc002gde.3		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(994-996)CGG>CGT		hypothetical protein LOC9851							77.0	75.0	76.0					17																	6526310		1927	4133	6060	SO:0001819	synonymous_variant	9851					centrosome		g.chr17:6526310C>A		CCDS42247.1	17p13.1	2014-04-04			ENSG00000198920	ENSG00000198920			29110	protein-coding gene	gene with protein product						24613305	Standard	NM_014804		Approved		uc002gde.4	Q2KHM9	OTTHUMG00000177928	ENST00000361413.3:c.996G>T	17.37:g.6526310C>A			Somatic				KIAA0753_uc010vtd.1_5'Flank|KIAA0753_uc010clo.2_Silent_p.R33R|KIAA0753_uc010vte.1_Silent_p.R33R	p.R332R	NM_014804	NP_055619	WXS	Illumina HiSeq	Unspecified	Q2KHM9	K0753_HUMAN		COAD - Colon adenocarcinoma(228;0.157)	6	1355	-			332					A8KA11|B7Z479|O94853|Q05D97|Q2KHN0|Q9UG45	Silent	SNP	ENST00000361413.3	37	c.996G>T	CCDS42247.1																																																																																				0.512	KIAA0753-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439769.3	NM_014804		16	32	1	0	1.15088e-07	0.004007	2.12413e-07	16	32				
TRAF4	9618	broad.mit.edu	37	17	27076266	27076266	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr17:27076266C>G	ENST00000262395.5	+	7	1213	c.1084C>G	c.(1084-1086)Cac>Gac	p.H362D	AC010761.9_ENST00000577325.1_RNA|TRAF4_ENST00000262396.6_Intron|AC010761.10_ENST00000579468.1_RNA|TRAF4_ENST00000444415.3_Missense_Mutation_p.H362D	NM_004295.3	NP_004286.2	Q9BUZ4	TRAF4_HUMAN	TNF receptor-associated factor 4	362	MATH. {ECO:0000255|PROSITE- ProRule:PRU00129}.				activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of protein kinase activity (GO:0045860)|regulation of apoptotic process (GO:0042981)|respiratory gaseous exchange (GO:0007585)|respiratory tube development (GO:0030323)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	DNA binding (GO:0003677)|thioesterase binding (GO:0031996)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|WW domain binding (GO:0050699)|zinc ion binding (GO:0008270)	p.H362D(1)		endometrium(2)|large_intestine(2)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	10	Lung NSC(42;0.01)		Epithelial(11;3.26e-05)|all cancers(11;0.000272)|OV - Ovarian serous cystadenocarcinoma(11;0.235)			TGAGGGCACACACCTCTCACT	0.542																																							uc002hcs.2		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|lung(1)	2						c.(1084-1086)CAC>GAC		TNF receptor-associated factor 4							97.0	85.0	89.0					17																	27076266		2203	4300	6503	SO:0001583	missense	9618				apoptosis|positive regulation of JNK cascade|positive regulation of protein homodimerization activity|positive regulation of protein kinase activity|regulation of apoptosis|signal transduction	cytoskeleton|nucleus|perinuclear region of cytoplasm|tight junction	DNA binding|ubiquitin-protein ligase activity|WW domain binding|zinc ion binding	g.chr17:27076266C>G	X80200	CCDS11243.1	17q11-q21.3	2013-01-09			ENSG00000076604	ENSG00000076604		"""RING-type (C3HC4) zinc fingers"""	12034	protein-coding gene	gene with protein product		602464				7592751, 7490069	Standard	NM_004295		Approved	CART1, MLN62, RNF83	uc002hcs.3	Q9BUZ4	OTTHUMG00000132677	ENST00000262395.5:c.1084C>G	17.37:g.27076266C>G	ENSP00000262395:p.His362Asp		Somatic				TRAF4_uc002hcq.1_Intron	p.H362D	NM_004295	NP_004286	WXS	Illumina HiSeq	Unspecified	Q9BUZ4	TRAF4_HUMAN	Epithelial(11;3.26e-05)|all cancers(11;0.000272)|OV - Ovarian serous cystadenocarcinoma(11;0.235)		7	1192	+	Lung NSC(42;0.01)		362			MATH.		O75615|Q14848|Q2KJU4|Q2PJN8	Missense_Mutation	SNP	ENST00000262395.5	37	c.1084C>G	CCDS11243.1	.	.	.	.	.	.	.	.	.	.	C	17.37	3.371977	0.61624	.	.	ENSG00000076604	ENST00000262395;ENST00000444415;ENST00000394924	T;T	0.33216	1.42;1.42	5.69	5.69	0.88448	TRAF-type (1);TRAF-like (1);MATH (3);	0.047995	0.85682	D	0.000000	T	0.56232	0.1971	M	0.88704	2.975	0.80722	D	1	D	0.59767	0.986	P	0.59288	0.855	T	0.63963	-0.6518	10	0.87932	D	0	.	12.1562	0.54079	0.0:0.9225:0.0:0.0775	.	362	Q9BUZ4	TRAF4_HUMAN	D	362;362;59	ENSP00000262395:H362D;ENSP00000438154:H362D	ENSP00000262395:H362D	H	+	1	0	TRAF4	24100393	1.000000	0.71417	0.980000	0.43619	0.928000	0.56348	5.562000	0.67346	2.674000	0.91012	0.655000	0.94253	CAC		0.542	TRAF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255944.2	NM_145751		3	72	0	0	0	0.000248	0	3	72				
TIAF1	9220	broad.mit.edu	37	17	27401083	27401083	+	Silent	SNP	C	C	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr17:27401083C>T	ENST00000359450.6	-	1	4792	c.135G>A	c.(133-135)gaG>gaA	p.E45E	MYO18A_ENST00000529578.1_5'UTR|TIAF1_ENST00000408971.2_Silent_p.E45E|MYO18A_ENST00000527372.1_3'UTR|MYO18A_ENST00000533112.1_3'UTR|MYO18A_ENST00000354329.4_3'UTR|MYO18A_ENST00000531253.1_3'UTR	NM_004740.3	NP_004731.2	O95411	TIAF1_HUMAN	TGFB1-induced anti-apoptotic factor 1	45					apoptotic process (GO:0006915)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of apoptotic process (GO:0043066)	nucleus (GO:0005634)		p.E45E(1)		kidney(1)|lung(1)|urinary_tract(1)	3	Lung NSC(42;0.015)		Epithelial(11;1.19e-05)|all cancers(11;6.57e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000153)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)			CGTAGGCTTGCTCAACCCAGC	0.587																																							uc002hdv.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(133-135)GAG>GAA		TGFB1-induced anti-apoptotic factor 1							82.0	72.0	75.0					17																	27401083		2203	4300	6503	SO:0001819	synonymous_variant	9220				anti-apoptosis|apoptosis|I-kappaB kinase/NF-kappaB cascade	nucleus		g.chr17:27401083C>T	AF105277	CCDS32599.1	17q11.2	2006-08-07				ENSG00000221995			11803	protein-coding gene	gene with protein product		609517				9918798	Standard	NM_004740		Approved		uc002hdv.1	O95411		ENST00000359450.6:c.135G>A	17.37:g.27401083C>T			Somatic				MYO18A_uc010wbc.1_3'UTR|MYO18A_uc002hds.2_3'UTR|MYO18A_uc010csa.1_3'UTR|MYO18A_uc002hdt.1_3'UTR|MYO18A_uc002hdu.1_3'UTR	p.E45E	NM_004740	NP_004731	WXS	Illumina HiSeq	Unspecified	O95411	TIAF1_HUMAN	Epithelial(11;1.19e-05)|all cancers(11;6.57e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000153)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)		1	1545	-	Lung NSC(42;0.015)		45					A2RRE2|Q6PEG2	Silent	SNP	ENST00000359450.6	37	c.135G>A	CCDS32599.1																																																																																				0.587	TIAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372394.2	NM_004740		17	60	0	0	0	0.004007	0	17	60				
NF1	4763	broad.mit.edu	37	17	29663769	29663769	+	Silent	SNP	G	G	C			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr17:29663769G>C	ENST00000358273.4	+	42	6647	c.6264G>C	c.(6262-6264)ctG>ctC	p.L2088L	NF1_ENST00000356175.3_Silent_p.L2067L|NF1_ENST00000417592.2_5'Flank|NF1_ENST00000444181.2_5'Flank	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	2088			L -> P (in FSNF; null mutation; 50% reduction of protein level; no cafe-au- lait macules; dbSNP:rs137854561). {ECO:0000269|PubMed:11704931}.		actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.L2088L(4)|p.?(3)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		TGCTGATGCTGTCCTTCAACA	0.433			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																													uc002hgg.2		NA	yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	D|Mis|N|F|S|O	neurofibromatosis type 1 gene			O		neurofibroma|glioma	neurofibroma|glioma		15	Whole gene deletion(8)|Substitution - coding silent(4)|Unknown(3)		soft_tissue(7)|lung(3)|haematopoietic_and_lymphoid_tissue(2)|autonomic_ganglia(2)|central_nervous_system(1)	soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330						c.(6262-6264)CTG>CTC		neurofibromin isoform 1							218.0	186.0	197.0					17																	29663769		2203	4300	6503	SO:0001819	synonymous_variant	4763	Neurofibromatosis_type_1	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome	actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity	g.chr17:29663769G>C		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.6264G>C	17.37:g.29663769G>C		TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)	Somatic				NF1_uc002hgh.2_Silent_p.L2067L|NF1_uc010cso.2_Silent_p.L276L|NF1_uc010wbt.1_5'Flank|NF1_uc010wbu.1_5'Flank	p.L2088L	NM_001042492	NP_001035957	WXS	Illumina HiSeq	Unspecified	P21359	NF1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)	42	6597	+		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)	2088		L -> P (in FSNF; null mutation; 50% reduction of protein level; no cafe-au- lait macules).			O00662|Q14284|Q14930|Q14931|Q9UMK3	Silent	SNP	ENST00000358273.4	37	c.6264G>C	CCDS42292.1																																																																																				0.433	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256351.2	NM_000267		25	120	0	0	0	0.004656	0	25	120				
MYO19	80179	broad.mit.edu	37	17	34864956	34864956	+	Silent	SNP	T	T	C			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr17:34864956T>C	ENST00000431794.3	-	14	1698	c.1176A>G	c.(1174-1176)gtA>gtG	p.V392V	MYO19_ENST00000268852.9_Silent_p.V392V	NM_001163735.1	NP_001157207.1	Q96H55	MYO19_HUMAN	myosin XIX	392	Myosin motor.					cytoplasm (GO:0005737)|mitochondrial outer membrane (GO:0005741)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.V392V(2)		endometrium(6)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|urinary_tract(1)	20		Breast(25;0.00957)|Ovarian(249;0.17)	Kidney(155;0.104)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)		TGATCACTGATACCAGCCAGT	0.532																																							uc010wcy.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(1174-1176)GTA>GTG		myosin XIX isoform 2							52.0	57.0	56.0					17																	34864956		2018	4192	6210	SO:0001819	synonymous_variant	80179					mitochondrial outer membrane|myosin complex	actin binding|ATP binding|motor activity	g.chr17:34864956T>C	BC008900	CCDS45654.1, CCDS54112.1, CCDS59283.1	17q12	2014-08-12	2007-09-26	2007-09-26	ENSG00000278259	ENSG00000278259		"""Myosins / Myosin superfamily : Class XIX"""	26234	protein-coding gene	gene with protein product			"""myosin head domain containing 1"""	MYOHD1		17877792, 19932026	Standard	NM_001033580		Approved	FLJ22865	uc010wcy.2	Q96H55	OTTHUMG00000188437	ENST00000431794.3:c.1176A>G	17.37:g.34864956T>C			Somatic				MYO19_uc002hmw.2_Silent_p.V392V|MYO19_uc010cuu.2_RNA|MYO19_uc010wcz.1_RNA	p.V392V	NM_001163735	NP_001157207	WXS	Illumina HiSeq	Unspecified	Q96H55	MYO19_HUMAN	Kidney(155;0.104)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)	15	2168	-		Breast(25;0.00957)|Ovarian(249;0.17)	392			Myosin head-like.		Q59GS4|Q9H5X2	Silent	SNP	ENST00000431794.3	37	c.1176A>G	CCDS54112.1																																																																																				0.532	MYO19-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451074.1	NM_025109		7	19	0	0	0	0.004482	0	7	19				
HOXB2	3212	broad.mit.edu	37	17	46620496	46620496	+	Silent	SNP	A	A	G			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr17:46620496A>G	ENST00000330070.4	-	2	2172	c.1005T>C	c.(1003-1005)ccT>ccC	p.P335P	HOXB-AS1_ENST00000508688.1_RNA|HOXB2_ENST00000504772.3_5'UTR|HOXB-AS1_ENST00000435312.1_RNA|HOXB-AS1_ENST00000504972.3_RNA	NM_002145.3	NP_002136.1	P14652	HXB2_HUMAN	homeobox B2	335					anterior/posterior pattern specification (GO:0009952)|blood circulation (GO:0008015)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|facial nerve structural organization (GO:0021612)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|neural nucleus development (GO:0048857)|rhombomere 3 development (GO:0021569)|rhombomere 4 development (GO:0021570)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P335P(2)		NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|prostate(1)|skin(1)	11						CCTCGGAAAAAGGGACCGGGC	0.587																																							uc002inm.2		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(1003-1005)CCT>CCC		homeobox B2							80.0	83.0	82.0					17																	46620496		2203	4300	6503	SO:0001819	synonymous_variant	3212				blood circulation	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr17:46620496A>G		CCDS11527.1	17q21.32	2012-02-22	2005-12-22		ENSG00000173917	ENSG00000173917		"""Homeoboxes / ANTP class : HOXL subclass"""	5113	protein-coding gene	gene with protein product		142967	"""homeo box B2"""	HOX2, HOX2H		1973146, 1358459	Standard	XM_005257276		Approved		uc002inm.3	P14652	OTTHUMG00000159930	ENST00000330070.4:c.1005T>C	17.37:g.46620496A>G			Somatic					p.P335P	NM_002145	NP_002136	WXS	Illumina HiSeq	Unspecified	P14652	HXB2_HUMAN			2	1125	-			335					P10913|P17485	Silent	SNP	ENST00000330070.4	37	c.1005T>C	CCDS11527.1																																																																																				0.587	HOXB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358384.2			3	95	0	0	0	0.000248	0	3	95				
CACNA1G	8913	broad.mit.edu	37	17	48680482	48680482	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr17:48680482C>T	ENST00000359106.5	+	21	4091	c.4091C>T	c.(4090-4092)tCc>tTc	p.S1364F	CACNA1G_ENST00000515165.1_Missense_Mutation_p.S1364F|CACNA1G_ENST00000514717.1_Missense_Mutation_p.S1341F|CACNA1G_ENST00000354983.4_Missense_Mutation_p.S1341F|CACNA1G_ENST00000514079.1_Missense_Mutation_p.S1364F|CACNA1G_ENST00000512389.1_Missense_Mutation_p.S1364F|CACNA1G_ENST00000513964.1_Missense_Mutation_p.S1364F|CACNA1G_ENST00000507609.1_Missense_Mutation_p.S1364F|CACNA1G_ENST00000503485.1_Missense_Mutation_p.S1364F|CACNA1G_ENST00000513689.2_Missense_Mutation_p.S1364F|CACNA1G_ENST00000515765.1_Missense_Mutation_p.S1364F|CACNA1G_ENST00000360761.4_Missense_Mutation_p.S1341F|CACNA1G_ENST00000352832.5_Missense_Mutation_p.S1341F|CACNA1G_ENST00000358244.5_Missense_Mutation_p.S1341F|CACNA1G_ENST00000510366.1_Missense_Mutation_p.S1364F|CACNA1G_ENST00000416767.4_Missense_Mutation_p.S1364F|CACNA1G_ENST00000507336.1_Missense_Mutation_p.S1364F|CACNA1G_ENST00000507510.2_Missense_Mutation_p.S1364F|CACNA1G_ENST00000514181.1_Missense_Mutation_p.S1364F|CACNA1G_ENST00000429973.2_Missense_Mutation_p.S1364F|CACNA1G_ENST00000505165.1_Missense_Mutation_p.S1364F|CACNA1G_ENST00000507896.1_Missense_Mutation_p.S1364F|CACNA1G_ENST00000515411.1_Missense_Mutation_p.S1364F|CACNA1G_ENST00000510115.1_Missense_Mutation_p.S1341F|CACNA1G_ENST00000442258.2_Missense_Mutation_p.S1341F|CACNA1G_ENST00000502264.1_Missense_Mutation_p.S1341F	NM_018896.4	NP_061496.2	O43497	CAC1G_HUMAN	calcium channel, voltage-dependent, T type, alpha 1G subunit	1364					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|response to nickel cation (GO:0010045)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|scaffold protein binding (GO:0097110)	p.S1364F(3)|p.S1341F(1)		breast(5)|cervix(1)|endometrium(13)|kidney(5)|lung(23)	47	Breast(11;6.7e-17)		BRCA - Breast invasive adenocarcinoma(22;7.52e-09)		Cinnarizine(DB00568)|Ethosuximide(DB00593)|Flunarizine(DB04841)|Methsuximide(DB05246)|Spironolactone(DB00421)|Trimethadione(DB00347)|Verapamil(DB00661)|Zonisamide(DB00909)	ATTCTGGTGTCCATGGTCTCT	0.652																																							uc002irk.1		NA																	4	Substitution - Missense(4)		lung(4)	breast(1)	1						c.(4090-4092)TCC>TTC		voltage-dependent calcium channel alpha 1G	Ethosuximide(DB00593)|Flunarizine(DB04841)|Levetiracetam(DB01202)|Mibefradil(DB01388)|Pimozide(DB01100)|Trimethadione(DB00347)|Verapamil(DB00661)|Zonisamide(DB00909)						115.0	129.0	124.0					17																	48680482		2200	4287	6487	SO:0001583	missense	8913				axon guidance	voltage-gated calcium channel complex	low voltage-gated calcium channel activity	g.chr17:48680482C>T	AC004590	CCDS45730.1, CCDS45731.1, CCDS45732.1, CCDS45733.1, CCDS45734.1, CCDS45735.1, CCDS45736.1, CCDS45737.1, CCDS54142.1, CCDS54143.1, CCDS54144.1, CCDS54145.1, CCDS54146.1, CCDS58565.1, CCDS58566.1, CCDS58567.1, CCDS58568.1, CCDS58569.1, CCDS58570.1, CCDS58571.1, CCDS58572.1, CCDS58573.1, CCDS58574.1, CCDS58575.1, CCDS58576.1	17q22	2012-03-07	2007-02-16		ENSG00000006283	ENSG00000006283		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1394	protein-coding gene	gene with protein product		604065				9495342, 16382099	Standard	NM_001256334		Approved	Cav3.1, NBR13	uc002irk.2	O43497	OTTHUMG00000162180	ENST00000359106.5:c.4091C>T	17.37:g.48680482C>T	ENSP00000352011:p.Ser1364Phe		Somatic				CACNA1G_uc002iri.1_Missense_Mutation_p.S1364F|CACNA1G_uc002irj.1_Missense_Mutation_p.S1341F|CACNA1G_uc002irl.1_Missense_Mutation_p.S1341F|CACNA1G_uc002irm.1_Missense_Mutation_p.S1341F|CACNA1G_uc002irn.1_Missense_Mutation_p.S1341F|CACNA1G_uc002iro.1_Missense_Mutation_p.S1341F|CACNA1G_uc002irp.1_Missense_Mutation_p.S1364F|CACNA1G_uc002irq.1_Missense_Mutation_p.S1341F|CACNA1G_uc002irr.1_Missense_Mutation_p.S1364F|CACNA1G_uc002irs.1_Missense_Mutation_p.S1364F|CACNA1G_uc002irt.1_Missense_Mutation_p.S1364F|CACNA1G_uc002irv.1_Missense_Mutation_p.S1364F|CACNA1G_uc002irw.1_Missense_Mutation_p.S1341F|CACNA1G_uc002iru.1_Missense_Mutation_p.S1341F|CACNA1G_uc002irx.1_Missense_Mutation_p.S1277F|CACNA1G_uc002iry.1_Missense_Mutation_p.S1277F|CACNA1G_uc002irz.1_Missense_Mutation_p.S1277F|CACNA1G_uc002isa.1_Missense_Mutation_p.S1277F|CACNA1G_uc002isb.1_Missense_Mutation_p.S1277F|CACNA1G_uc002isc.1_Missense_Mutation_p.S1277F|CACNA1G_uc002isd.1_Missense_Mutation_p.S1277F|CACNA1G_uc002ise.1_Missense_Mutation_p.S1277F|CACNA1G_uc002isf.1_Missense_Mutation_p.S1277F|CACNA1G_uc002isg.1_Missense_Mutation_p.S1277F|CACNA1G_uc002ish.1_Missense_Mutation_p.S1277F|CACNA1G_uc002isi.1_Missense_Mutation_p.S1254F|CACNA1G_uc002isj.2_Missense_Mutation_p.S88F	p.S1364F	NM_018896	NP_061496	WXS	Illumina HiSeq	Unspecified	O43497	CAC1G_HUMAN	BRCA - Breast invasive adenocarcinoma(22;7.52e-09)		21	4463	+	Breast(11;6.7e-17)		1364			III.|Helical; Name=S3 of repeat III; (Potential).		D6RA64|E7EPR0|O43498|O94770|Q19QY8|Q19QY9|Q19QZ0|Q19QZ1|Q19QZ2|Q19QZ3|Q19QZ4|Q19QZ5|Q19QZ6|Q19QZ7|Q19QZ8|Q19QZ9|Q19R00|Q19R01|Q19R02|Q19R03|Q19R04|Q19R05|Q19R06|Q19R07|Q19R08|Q19R09|Q19R10|Q19R11|Q19R12|Q19R13|Q19R15|Q19R16|Q19R17|Q19R18|Q2TAC4|Q9NYU4|Q9NYU5|Q9NYU6|Q9NYU7|Q9NYU8|Q9NYU9|Q9NYV0|Q9NYV1|Q9UHN9|Q9UHP0|Q9ULU6|Q9UNG7|Q9Y5T2|Q9Y5T3	Missense_Mutation	SNP	ENST00000359106.5	37	c.4091C>T	CCDS45730.1	.	.	.	.	.	.	.	.	.	.	c	19.91	3.913894	0.72983	.	.	ENSG00000006283	ENST00000360761;ENST00000352832;ENST00000416767;ENST00000354983;ENST00000442258;ENST00000502264;ENST00000512389;ENST00000513964;ENST00000514717;ENST00000510366;ENST00000503485;ENST00000507510;ENST00000507336;ENST00000513689;ENST00000507609;ENST00000510115;ENST00000515165;ENST00000514181;ENST00000515765;ENST00000514079;ENST00000358244;ENST00000359106;ENST00000429973;ENST00000515411;ENST00000505165;ENST00000507896;ENST00000506520	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.98567	-5.0;-5.0;-5.0;-5.0;-5.0;-5.0;-5.0;-5.0;-5.0;-5.0;-5.0;-5.0;-5.0;-5.0;-5.0;-5.0;-5.0;-5.0;-5.0;-5.0;-5.0;-5.0;-5.0;-5.0;-5.0;-5.0;-5.0	4.82	4.82	0.62117	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98950	0.9643	M	0.82517	2.595	0.80722	D	1	B;D;B;D;D;B;D;D;B;D;B;B;B;B;P;D;P;D;D;B;P;D;P;B;P;D;D	0.76494	0.421;0.999;0.357;0.999;0.999;0.337;0.999;0.998;0.337;0.998;0.357;0.337;0.193;0.421;0.506;0.998;0.669;0.985;0.993;0.337;0.538;0.999;0.595;0.337;0.939;0.996;0.982	B;D;P;D;D;B;D;D;B;D;P;B;B;B;B;D;P;D;D;B;P;D;B;B;P;D;D	0.91635	0.412;0.996;0.464;0.999;0.998;0.261;0.987;0.998;0.261;0.998;0.464;0.261;0.112;0.25;0.398;0.99;0.502;0.961;0.991;0.261;0.464;0.998;0.383;0.261;0.873;0.986;0.934	D	0.99797	1.1034	10	0.62326	D	0.03	.	17.9041	0.88913	0.0:1.0:0.0:0.0	.	394;1341;1364;1364;1364;1364;1364;1364;1364;1364;1364;1364;1341;1364;1364;1364;1364;1364;1341;1364;1341;1341;1341;1341;1364;1341;1364	B4DKD3;Q19QZ5;Q19QZ1;Q19QZ4;Q19R07;Q19QY8;Q19R10;Q19QZ6;Q19QZ3;Q19R06;Q19R00;Q19R04;O43497-10;Q19QZ9;Q19QZ7;Q19R08;Q19QZ8;Q19R03;O43497-4;Q19R02;Q19R12;Q19R17;Q19R11;Q2TAC4;O43497;Q19R13;O43497-11	.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;CAC1G_HUMAN;.;.	F	1341;1341;1364;1341;1341;1341;1364;1364;1341;1364;1364;1364;1364;1364;1364;1341;1364;1364;1364;1364;1341;1364;1364;1364;1364;1364;179	ENSP00000353990:S1341F;ENSP00000339302:S1341F;ENSP00000392390:S1364F;ENSP00000347078:S1341F;ENSP00000409759:S1341F;ENSP00000425522:S1341F;ENSP00000426261:S1364F;ENSP00000425451:S1364F;ENSP00000422407:S1341F;ENSP00000426814:S1364F;ENSP00000427238:S1364F;ENSP00000423112:S1364F;ENSP00000420918:S1364F;ENSP00000426172:S1364F;ENSP00000423045:S1364F;ENSP00000427173:S1341F;ENSP00000426098:S1364F;ENSP00000425698:S1364F;ENSP00000426232:S1364F;ENSP00000423317:S1364F;ENSP00000350979:S1341F;ENSP00000352011:S1364F;ENSP00000414388:S1364F;ENSP00000423155:S1364F;ENSP00000422268:S1364F;ENSP00000421518:S1364F;ENSP00000427697:S179F	ENSP00000339302:S1341F	S	+	2	0	CACNA1G	46035481	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.802000	0.85969	2.234000	0.73211	0.491000	0.48974	TCC		0.652	CACNA1G-013	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367895.1	NM_018896		14	62	0	0	0	0.00245	0	14	62				
CD79B	974	broad.mit.edu	37	17	62006601	62006601	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr17:62006601G>T	ENST00000006750.3	-	6	767	c.675C>A	c.(673-675)caC>caA	p.H225Q	CD79B_ENST00000392795.3_Missense_Mutation_p.H226Q|CD79B_ENST00000349817.2_Missense_Mutation_p.H121Q	NM_000626.2|NM_021602.2	NP_000617.1|NP_067613.1	P40259	CD79B_HUMAN	CD79b molecule, immunoglobulin-associated beta	225					B cell receptor signaling pathway (GO:0050853)|immune response (GO:0006955)|signal transduction (GO:0007165)	B cell receptor complex (GO:0019815)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	transmembrane signaling receptor activity (GO:0004888)	p.H225Q(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(6)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|stomach(1)	15						CCTGGCCTGGGTGCTCACCTA	0.612			"""Mis, O"""		DLBCL																																		uc002jdq.1		NA		Dom	yes		17	17q23	974	Mis|O	"""CD79b molecule, immunoglobulin-associated beta"""			L			DLBCL		1	Substitution - Missense(1)		lung(1)		0						c.(673-675)CAC>CAA		CD79B antigen isoform 1 precursor							145.0	128.0	134.0					17																	62006601		2203	4300	6503	SO:0001583	missense	974				cell surface receptor linked signaling pathway|immune response	Golgi apparatus|integral to plasma membrane|nucleus	transmembrane receptor activity	g.chr17:62006601G>T	L27587	CCDS11655.1, CCDS11656.1, CCDS42372.1	17q23	2014-09-17	2006-03-28			ENSG00000007312		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1699	protein-coding gene	gene with protein product		147245	"""CD79B antigen (immunoglobulin-associated beta)"""	IGB		9545642	Standard	XM_005257858		Approved	B29	uc002jdp.1	P40259		ENST00000006750.3:c.675C>A	17.37:g.62006601G>T	ENSP00000006750:p.His225Gln		Somatic				CD79B_uc002jdo.1_Missense_Mutation_p.H199Q|CD79B_uc002jdp.1_Missense_Mutation_p.H226Q|CD79B_uc002jdr.1_Missense_Mutation_p.H121Q	p.H225Q	NM_000626	NP_000617	WXS	Illumina HiSeq	Unspecified	P40259	CD79B_HUMAN			6	758	-			225			Cytoplasmic (Potential).		Q53FS2|Q9BU06	Missense_Mutation	SNP	ENST00000006750.3	37	c.675C>A	CCDS11655.1	.	.	.	.	.	.	.	.	.	.	G	16.57	3.159538	0.57368	.	.	ENSG00000007312	ENST00000349817;ENST00000392795;ENST00000006750	T;T	0.79653	-1.29;-1.28	4.09	2.04	0.26737	.	0.329234	0.28815	N	0.014043	T	0.78767	0.4335	N	0.19112	0.55	0.40376	D	0.979398	D;D	0.71674	0.997;0.998	D;D	0.80764	0.986;0.994	T	0.77056	-0.2729	10	0.72032	D	0.01	-32.8719	6.7772	0.23626	0.2095:0.0:0.7904:0.0	.	121;225	P40259-2;P40259	.;CD79B_HUMAN	Q	121;226;225	ENSP00000376544:H226Q;ENSP00000006750:H225Q	ENSP00000006750:H225Q	H	-	3	2	CD79B	59360333	1.000000	0.71417	1.000000	0.80357	0.883000	0.51084	1.146000	0.31589	0.379000	0.24794	0.436000	0.28706	CAC		0.612	CD79B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417711.1			26	56	1	0	2.48779e-11	0.005443	5.02815e-11	26	56				
ABCA9	10350	broad.mit.edu	37	17	66982325	66982325	+	Silent	SNP	G	G	A	rs552343216		TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr17:66982325G>A	ENST00000340001.4	-	32	4399	c.4188C>T	c.(4186-4188)gaC>gaT	p.D1396D	ABCA9_ENST00000370732.2_Silent_p.D1396D|ABCA9_ENST00000482072.1_5'Flank|ABCA9_ENST00000453985.2_Silent_p.D1358D	NM_080283.3	NP_525022.2	Q8IUA7	ABCA9_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 9	1396	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.D1396D(1)		NS(2)|breast(4)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(21)|lung(35)|ovary(4)|prostate(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	91	Breast(10;1.47e-12)					CGATCATTGCGTCCCCTTTCC	0.562													G|||	1	0.000199681	0.0	0.0	5008	,	,		17885	0.001		0.0	False		,,,				2504	0.0						uc002jhu.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|upper_aerodigestive_tract(1)|central_nervous_system(1)	6						c.(4186-4188)GAC>GAT		ATP-binding cassette, sub-family A, member 9							170.0	137.0	148.0					17																	66982325		2203	4300	6503	SO:0001819	synonymous_variant	10350				transport	integral to membrane	ATP binding|ATPase activity	g.chr17:66982325G>A	AF423307	CCDS11681.1	17q24	2012-03-14			ENSG00000154258	ENSG00000154258		"""ATP binding cassette transporters / subfamily A"""	39	protein-coding gene	gene with protein product		612507					Standard	XM_005256934		Approved	EST640918	uc002jhu.3	Q8IUA7	OTTHUMG00000140371	ENST00000340001.4:c.4188C>T	17.37:g.66982325G>A			Somatic				ABCA9_uc010dez.2_Silent_p.D1358D	p.D1396D	NM_080283	NP_525022	WXS	Illumina HiSeq	Unspecified	Q8IUA7	ABCA9_HUMAN			32	4331	-	Breast(10;1.47e-12)		1396			ABC transporter 2.		Q6P655|Q8N2S4|Q8WWZ5|Q96MD8	Silent	SNP	ENST00000340001.4	37	c.4188C>T	CCDS11681.1																																																																																				0.562	ABCA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277072.2	NM_172386		15	85	0	0	0	0.003163	0	15	85				
DNAI2	64446	broad.mit.edu	37	17	72310295	72310295	+	Missense_Mutation	SNP	G	G	T	rs375973900		TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr17:72310295G>T	ENST00000311014.6	+	13	1825	c.1758G>T	c.(1756-1758)gaG>gaT	p.E586D	DNAI2_ENST00000446837.2_Missense_Mutation_p.E586D|DNAI2_ENST00000307504.5_Nonsense_Mutation_p.G392*|DNAI2_ENST00000579490.1_Missense_Mutation_p.E643D|DNAI2_ENST00000582036.1_Missense_Mutation_p.E574D			Q9GZS0	DNAI2_HUMAN	dynein, axonemal, intermediate chain 2	586					cilium assembly (GO:0042384)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	microtubule motor activity (GO:0003777)	p.E586D(1)		breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|liver(2)|lung(19)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	39						aggtggtggaggagggagagg	0.582									Kartagener syndrome																														uc002jkf.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(1756-1758)GAG>GAT		dynein, axonemal, intermediate polypeptide 2							184.0	137.0	153.0					17																	72310295		2203	4300	6503	SO:0001583	missense	64446	Kartagener_syndrome	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	cilium assembly	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	microtubule motor activity	g.chr17:72310295G>T	AF250288	CCDS11697.1, CCDS58589.1	17q25	2013-02-19	2006-09-04			ENSG00000171595		"""Axonemal dyneins"", ""WD repeat domain containing"""	18744	protein-coding gene	gene with protein product	"""dynein intermediate chain 2"""	605483	"""dynein, axonemal, intermediate polypeptide 2"""			11153919, 21953912	Standard	NM_023036		Approved	CILD9, DIC2	uc002jkf.3	Q9GZS0		ENST00000311014.6:c.1758G>T	17.37:g.72310295G>T	ENSP00000308312:p.Glu586Asp		Somatic				DNAI2_uc002jkg.2_RNA|DNAI2_uc010dfp.2_RNA|DNAI2_uc002jki.2_RNA	p.E586D	NM_023036	NP_075462	WXS	Illumina HiSeq	Unspecified	Q9GZS0	DNAI2_HUMAN			13	1857	+			586					C9J0S6|Q8IUW4|Q9H179|Q9NT53	Missense_Mutation	SNP	ENST00000311014.6	37	c.1758G>T	CCDS11697.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	36|36	5.946673|5.946673	0.97134|0.97134	.|.	.|.	ENSG00000171595|ENSG00000171595	ENST00000311014;ENST00000446837|ENST00000307504	T;T|.	0.65916|.	-0.18;-0.18|.	3.48|3.48	-0.5|-0.5	0.12012|0.12012	.|.	0.805990|.	0.10284|.	N|.	0.693219|.	T|.	0.29288|.	0.0729|.	L|L	0.36672|0.36672	1.1|1.1	0.09310|0.09310	N|N	1|1	B|.	0.16166|.	0.016|.	B|.	0.14578|.	0.011|.	T|.	0.30179|.	-0.9987|.	10|.	0.36615|0.18276	T|T	0.2|0.48	0.0096|0.0096	5.7812|5.7812	0.18308|0.18308	0.5564:0.0:0.4436:0.0|0.5564:0.0:0.4436:0.0	.|.	586|.	Q9GZS0|.	DNAI2_HUMAN|.	D|X	586|392	ENSP00000308312:E586D;ENSP00000400252:E586D|.	ENSP00000308312:E586D|ENSP00000302929:G392X	E|G	+|+	3|1	2|0	DNAI2|DNAI2	69821890|69821890	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.014000|0.014000	0.08584|0.08584	-0.396000|-0.396000	0.07278|0.07278	-0.050000|-0.050000	0.13356|0.13356	0.556000|0.556000	0.70494|0.70494	GAG|GGA		0.582	DNAI2-001	KNOWN	NMD_exception|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000442537.1	NM_023036		8	35	1	0	0.000157383	0.00308	0.000252341	8	35				
CDR2L	30850	broad.mit.edu	37	17	72999924	72999924	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr17:72999924G>C	ENST00000337231.5	+	5	1565	c.1153G>C	c.(1153-1155)Ggc>Cgc	p.G385R		NM_014603.2	NP_055418.2	Q86X02	CDR2L_HUMAN	cerebellar degeneration-related protein 2-like	385								p.G379R(1)				all_lung(278;0.226)					GCGGCACGCCGGCGTGCAGAC	0.697																																							uc002jml.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1153-1155)GGC>CGC		cerebellar degeneration-related protein 2-like							19.0	18.0	18.0					17																	72999924		2180	4249	6429	SO:0001583	missense	30850							g.chr17:72999924G>C		CCDS11710.2	17q25.1	2006-03-28			ENSG00000109089	ENSG00000109089			29999	protein-coding gene	gene with protein product	"""paraneoplastic antigen"""						Standard	NM_014603		Approved	HUMPPA	uc002jml.4	Q86X02	OTTHUMG00000150435	ENST00000337231.5:c.1153G>C	17.37:g.72999924G>C	ENSP00000336587:p.Gly385Arg		Somatic					p.G385R	NM_014603	NP_055418	WXS	Illumina HiSeq	Unspecified	Q86X02	CDR2L_HUMAN			5	1565	+	all_lung(278;0.226)		385					B4DFA7|Q15175	Missense_Mutation	SNP	ENST00000337231.5	37	c.1153G>C	CCDS11710.2	.	.	.	.	.	.	.	.	.	.	G	22.0	4.227950	0.79576	.	.	ENSG00000109089	ENST00000337231	T	0.43294	0.95	5.45	5.45	0.79879	.	0.051058	0.85682	D	0.000000	T	0.65123	0.2661	M	0.73962	2.25	0.53005	D	0.999969	D	0.89917	1.0	D	0.73708	0.981	T	0.61013	-0.7148	10	0.28530	T	0.3	-20.5427	19.2802	0.94050	0.0:0.0:1.0:0.0	.	385	Q86X02	CDR2L_HUMAN	R	385	ENSP00000336587:G385R	ENSP00000336587:G385R	G	+	1	0	CDR2L	70511519	1.000000	0.71417	0.347000	0.25668	0.475000	0.33008	9.860000	0.99555	2.547000	0.85894	0.563000	0.77884	GGC		0.697	CDR2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318080.1	NM_014603		5	1	0	0	0	0.000602	0	5	1				
PIAS2	9063	broad.mit.edu	37	18	44424712	44424712	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr18:44424712G>A	ENST00000585916.1	-	7	951	c.952C>T	c.(952-954)Cat>Tat	p.H318Y	PIAS2_ENST00000545673.1_Missense_Mutation_p.H28Y|PIAS2_ENST00000324794.7_Missense_Mutation_p.H318Y	NM_004671.3	NP_004662.2	O75928	PIAS2_HUMAN	protein inhibitor of activated STAT, 2	318					androgen receptor signaling pathway (GO:0030521)|negative regulation of androgen receptor signaling pathway (GO:0060766)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein sumoylation (GO:0016925)|regulation of osteoblast differentiation (GO:0045667)|transcription, DNA-templated (GO:0006351)	nuclear body (GO:0016604)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|SUMO ligase activity (GO:0019789)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)	p.H318Y(2)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	22						GCTCTGGAATGATCAGGGTTT	0.294																																							uc002lck.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|breast(1)|skin(1)	4						c.(952-954)CAT>TAT		protein inhibitor of activated STAT X isoform							88.0	92.0	91.0					18																	44424712		2203	4298	6501	SO:0001583	missense	9063				androgen receptor signaling pathway|negative regulation of androgen receptor signaling pathway|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear speck|PML body	androgen receptor binding|DNA binding|protein binding|SUMO ligase activity|transcription coactivator activity|zinc ion binding	g.chr18:44424712G>A	AF077953	CCDS32824.1, CCDS32825.1	18q12.1-q12.3	2011-10-11				ENSG00000078043		"""Zinc fingers, MIZ-type"""	17311	protein-coding gene	gene with protein product	"""zinc finger, MIZ-type containing 4"""	603567				9724754, 9256341	Standard	NM_004671		Approved	PIASX-BETA, miz, PIASX-ALPHA, ZMIZ4	uc002lck.3	O75928		ENST00000585916.1:c.952C>T	18.37:g.44424712G>A	ENSP00000465676:p.His318Tyr		Somatic				PIAS2_uc010dnp.2_Missense_Mutation_p.H16Y|PIAS2_uc002lcl.2_Missense_Mutation_p.H318Y|PIAS2_uc010xda.1_Missense_Mutation_p.H16Y|PIAS2_uc002lcm.2_Missense_Mutation_p.H318Y|PIAS2_uc002lcn.1_Missense_Mutation_p.H322Y	p.H318Y	NM_004671	NP_004662	WXS	Illumina HiSeq	Unspecified	O75928	PIAS2_HUMAN			7	1110	-			318					O75927|Q96BT5|Q96KE3	Missense_Mutation	SNP	ENST00000585916.1	37	c.952C>T	CCDS32824.1	.	.	.	.	.	.	.	.	.	.	G	14.22	2.471382	0.43942	.	.	ENSG00000078043	ENST00000398654;ENST00000262161;ENST00000398651;ENST00000545673;ENST00000324794	T;T	0.46451	0.87;1.47	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.46889	0.1416	L	0.34521	1.04	0.80722	D	1	B;P;B;B;B	0.45126	0.066;0.851;0.047;0.198;0.243	B;P;B;B;B	0.50570	0.028;0.644;0.074;0.108;0.109	T	0.07158	-1.0787	10	0.25106	T	0.35	-15.6675	20.6593	0.99626	0.0:0.0:1.0:0.0	.	28;322;318;318;318	B4DGW0;O75928-3;Q2TA77;O75928-2;O75928	.;.;.;.;PIAS2_HUMAN	Y	318;318;314;28;318	ENSP00000443238:H28Y;ENSP00000317163:H318Y	ENSP00000262161:H318Y	H	-	1	0	PIAS2	42678710	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.476000	0.97823	2.885000	0.99019	0.655000	0.94253	CAT		0.294	PIAS2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445656.2	NM_004671		6	65	0	0	0	0.001168	0	6	65				
SERPINB13	5275	broad.mit.edu	37	18	61260167	61260167	+	Missense_Mutation	SNP	G	G	T	rs187247060		TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr18:61260167G>T	ENST00000344731.5	+	5	536	c.434G>T	c.(433-435)cGa>cTa	p.R145L	SERPINB13_ENST00000269489.5_Missense_Mutation_p.R145L	NM_012397.3	NP_036529.1	Q9UIV8	SPB13_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 13	145					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)|response to UV (GO:0009411)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.R145L(1)|p.R145Q(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|prostate(2)|urinary_tract(1)	25						GATGAAAGTCGAAAGAAGATT	0.328																																							uc002ljc.2		NA																	2	Substitution - Missense(2)		large_intestine(1)|lung(1)	ovary(1)	1						c.(433-435)CGA>CTA		serine (or cysteine) proteinase inhibitor, clade							105.0	115.0	111.0					18																	61260167		2203	4300	6503	SO:0001583	missense	5275				regulation of proteolysis|response to UV	cytoplasm|extracellular region	serine-type endopeptidase inhibitor activity	g.chr18:61260167G>T	AF169949, BC101821	CCDS11985.1	18q21.33	2014-02-18	2005-08-18		ENSG00000197641	ENSG00000197641		"""Serine (or cysteine) peptidase inhibitors"""	8944	protein-coding gene	gene with protein product		604445	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 13"""	PI13		9297979, 10512713, 24172014	Standard	NM_012397		Approved	HUR7, hurpin, headpin	uc002ljc.3	Q9UIV8	OTTHUMG00000060406	ENST00000344731.5:c.434G>T	18.37:g.61260167G>T	ENSP00000341584:p.Arg145Leu		Somatic				SERPINB13_uc002ljd.2_5'UTR|SERPINB13_uc010xep.1_Missense_Mutation_p.R154L|SERPINB13_uc010xeq.1_Intron|SERPINB13_uc010xer.1_Intron	p.R145L	NM_012397	NP_036529	WXS	Illumina HiSeq	Unspecified	Q9UIV8	SPB13_HUMAN			5	602	+			145					A8K2Q8|Q3MII2|Q9HCX1|Q9UBW1|Q9UKG0	Missense_Mutation	SNP	ENST00000344731.5	37	c.434G>T	CCDS11985.1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.777950	0.90195	.	.	ENSG00000197641	ENST00000269489;ENST00000344731	D;D	0.85556	-2.0;-2.0	5.57	4.69	0.59074	Serpin domain (3);	0.153174	0.30168	N	0.010242	D	0.91994	0.7464	M	0.80422	2.495	0.54753	D	0.999983	D;D	0.89917	1.0;1.0	D;D	0.91635	0.996;0.999	D	0.92273	0.5827	9	.	.	.	.	14.038	0.64658	0.0731:0.0:0.9269:0.0	.	154;145	B7ZKV6;Q9UIV8	.;SPB13_HUMAN	L	145	ENSP00000269489:R145L;ENSP00000341584:R145L	.	R	+	2	0	SERPINB13	59411147	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.891000	0.75639	1.485000	0.48380	0.555000	0.69702	CGA		0.328	SERPINB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133798.1	NM_012397		15	72	1	0	6.31663e-08	0.003163	1.18102e-07	15	72				
SERPINB4	6318	broad.mit.edu	37	18	61305167	61305167	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr18:61305167C>T	ENST00000341074.5	-	8	1074	c.959G>A	c.(958-960)aGc>aAc	p.S320N	SERPINB4_ENST00000356424.6_Missense_Mutation_p.S268N	NM_002974.2	NP_002965.1	P48594	SPB4_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 4	320					negative regulation of endopeptidase activity (GO:0010951)|negative regulation of peptidase activity (GO:0010466)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	enzyme binding (GO:0019899)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.S320N(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(22)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	42						GAGACCGTGGCTCCAGGTCAT	0.507																																							uc002ljf.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|lung(1)	3						c.(958-960)AGC>AAC		serine (or cysteine) proteinase inhibitor, clade							152.0	135.0	141.0					18																	61305167		2203	4300	6503	SO:0001583	missense	6318				immune response|regulation of proteolysis	cytoplasm|extracellular region	protein binding|serine-type endopeptidase inhibitor activity	g.chr18:61305167C>T	X89015	CCDS11986.1	18q21.33	2014-02-18	2005-08-18		ENSG00000206073	ENSG00000206073		"""Serine (or cysteine) peptidase inhibitors"""	10570	protein-coding gene	gene with protein product	"""squamous cell carcinoma antigen 2"""	600518	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 4"""	SCCA2		7724531, 14630915, 24172014	Standard	NM_175041		Approved	PI11, LEUPIN, SCCA-2, SCCA1		P48594	OTTHUMG00000060405	ENST00000341074.5:c.959G>A	18.37:g.61305167C>T	ENSP00000343445:p.Ser320Asn		Somatic				SERPINB4_uc002lje.2_Missense_Mutation_p.S299N|SERPINB4_uc002ljg.2_Missense_Mutation_p.S320N	p.S320N	NM_002974	NP_002965	WXS	Illumina HiSeq	Unspecified	P48594	SPB4_HUMAN			8	1045	-			320					A8K847	Missense_Mutation	SNP	ENST00000341074.5	37	c.959G>A	CCDS11986.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.816|8.816	0.936351|0.936351	0.18206|0.18206	.|.	.|.	ENSG00000206073|ENSG00000206073	ENST00000413673|ENST00000341074;ENST00000356424	.|D;D	.|0.82619	.|-1.63;-1.63	4.4|4.4	-4.38|-4.38	0.03622|0.03622	.|Serpin domain (3);	.|1.584460	.|0.04122	.|N	.|0.316434	T|T	0.78805|0.78805	0.4341|0.4341	L|L	0.58354|0.58354	1.805|1.805	0.09310|0.09310	N|N	1|1	.|B;B;P	.|0.34699	.|0.057;0.057;0.464	.|B;B;B	.|0.36335	.|0.024;0.038;0.222	T|T	0.65479|0.65479	-0.6158|-0.6158	5|10	.|0.30078	.|T	.|0.28	.|.	9.249|9.249	0.37543|0.37543	0.0:0.1493:0.5203:0.3305|0.0:0.1493:0.5203:0.3305	.|.	.|320;320;299	.|Q5K684;P48594;Q9BYF7	.|.;SPB4_HUMAN;.	T|N	301|320;268	.|ENSP00000343445:S320N;ENSP00000348795:S268N	.|ENSP00000343445:S320N	A|S	-|-	1|2	0|0	SERPINB4|SERPINB4	59456147|59456147	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.019000|0.019000	0.09904|0.09904	-3.682000|-3.682000	0.00394|0.00394	-0.786000|-0.786000	0.04516|0.04516	0.609000|0.609000	0.83330|0.83330	GCC|AGC		0.507	SERPINB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133794.2	NM_175041		10	65	0	0	0	0.000978	0	10	65				
STK11	6794	broad.mit.edu	37	19	1220410	1220410	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr19:1220410A>G	ENST00000326873.7	+	4	1676	c.503A>G	c.(502-504)cAt>cGt	p.H168R		NM_000455.4	NP_000446.1	Q15831	STK11_HUMAN	serine/threonine kinase 11	168	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of protein kinase activity (GO:0032147)|anoikis (GO:0043276)|autophagy (GO:0006914)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|energy reserve metabolic process (GO:0006112)|establishment of cell polarity (GO:0030010)|glucose homeostasis (GO:0042593)|Golgi localization (GO:0051645)|insulin receptor signaling pathway (GO:0008286)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|positive regulation of axonogenesis (GO:0050772)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive thymic T cell selection (GO:0045059)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of protein kinase B signaling (GO:0051896)|regulation of Wnt signaling pathway (GO:0030111)|response to glucagon (GO:0033762)|response to ionizing radiation (GO:0010212)|response to lipid (GO:0033993)|small molecule metabolic process (GO:0044281)|spermatid development (GO:0007286)|T cell receptor signaling pathway (GO:0050852)|TCR signalosome assembly (GO:0036399)|tissue homeostasis (GO:0001894)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|TCR signalosome (GO:0036398)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|p53 binding (GO:0002039)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.0?(20)|p.Y156fs*87(4)|p.?(4)|p.H168R(1)		biliary_tract(1)|breast(3)|cervix(35)|gastrointestinal_tract_(site_indeterminate)(5)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|liver(1)|lung(219)|oesophagus(1)|ovary(4)|pancreas(6)|prostate(2)|skin(15)|small_intestine(1)|stomach(9)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	328		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)		GAGTACCTGCATAGCCAGGGC	0.647		14	"""D, Mis, N, F, S"""		"""NSCLC, pancreatic"""	"""jejunal harmartoma, ovarian, testicular, pancreatic"""			Peutz-Jeghers syndrome	TSP Lung(3;<1E-08)																													uc002lrl.1		14	yes	Rec	yes	Peutz-Jeghers syndrome	19	19p13.3	6794	D|Mis|N|F|S	serine/threonine kinase 11 gene (LKB1)			"""E, M, O"""		jejunal harmartoma|ovarian|testicular|pancreatic	NSCLC|pancreatic		29	Whole gene deletion(20)|Unknown(4)|Deletion - Frameshift(4)|Substitution - Missense(1)	p.0?(19)|p.Y156fs*87(4)|p.?(4)|p.G52_P179del(1)	cervix(15)|lung(10)|oesophagus(1)|ovary(1)|kidney(1)|pancreas(1)	lung(174)|cervix(35)|skin(15)|large_intestine(12)|pancreas(6)|gastrointestinal_tract_(site_indeterminate)(5)|stomach(4)|ovary(4)|breast(2)|upper_aerodigestive_tract(1)|testis(1)|liver(1)|biliary_tract(1)|small_intestine(1)|urinary_tract(1)|oesophagus(1)|prostate(1)|kidney(1)	266						c.(502-504)CAT>CGT		serine/threonine protein kinase 11							41.0	47.0	45.0					19																	1220410		2093	4240	6333	SO:0001583	missense	6794	Peutz-Jeghers_syndrome	Familial Cancer Database	PJS, Hamartous Intestinal Polyposis	anoikis|cell cycle arrest|energy reserve metabolic process|insulin receptor signaling pathway|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of fatty acid biosynthetic process|regulation of fatty acid oxidation	cytosol|nucleus	ATP binding|magnesium ion binding|protein serine/threonine kinase activity	g.chr19:1220410A>G	U63333	CCDS45896.1	19p13.3	2014-09-17	2005-12-13			ENSG00000118046			11389	protein-coding gene	gene with protein product	"""polarization-related protein LKB1"""	602216	"""serine/threonine kinase 11 (Peutz-Jeghers syndrome)"""			9425897	Standard	XM_005259617		Approved	PJS, LKB1	uc002lrl.1	Q15831		ENST00000326873.7:c.503A>G	19.37:g.1220410A>G	ENSP00000324856:p.His168Arg	TSP Lung(3;<1E-08)	Somatic					p.H168R	NM_000455	NP_000446	WXS	Illumina HiSeq	Unspecified	Q15831	STK11_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)	4	1618	+		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)	168			Protein kinase.		B2RBX7|E7EW76	Missense_Mutation	SNP	ENST00000326873.7	37	c.503A>G	CCDS45896.1	.	.	.	.	.	.	.	.	.	.	A	27.4	4.827129	0.90955	.	.	ENSG00000118046	ENST00000326873;ENST00000405031	D	0.84516	-1.86	5.6	5.6	0.85130	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.94417	0.8204	H	0.94542	3.55	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95778	0.8814	10	0.87932	D	0	-59.7055	14.9586	0.71138	1.0:0.0:0.0:0.0	.	168	Q15831	STK11_HUMAN	R	168	ENSP00000324856:H168R	ENSP00000324856:H168R	H	+	2	0	STK11	1171410	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	9.209000	0.95087	2.135000	0.66039	0.459000	0.35465	CAT		0.647	STK11-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449839.3	NM_000455		3	5	0	0	0	0.004672	0	3	5				
MUC16	94025	broad.mit.edu	37	19	8996403	8996403	+	Silent	SNP	C	C	A	rs564839682	byFrequency	TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr19:8996403C>A	ENST00000397910.4	-	61	41372	c.41169G>T	c.(41167-41169)ctG>ctT	p.L13723L	MUC16_ENST00000380951.5_Silent_p.L364L	NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	13725	SEA 11. {ECO:0000255|PROSITE- ProRule:PRU00188}.			Missing (in Ref. 3; AAK74120). {ECO:0000305}.	cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.L408L(1)|p.L13723L(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GCTCCCAATACAGCTGCTCTC	0.572																																							uc002mkp.2		NA																	2	Substitution - coding silent(2)		lung(2)	lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(41167-41169)CTG>CTT		mucin 16							128.0	118.0	121.0					19																	8996403		1976	4160	6136	SO:0001819	synonymous_variant	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:8996403C>A	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.41169G>T	19.37:g.8996403C>A			Somatic				MUC16_uc010dwi.2_RNA|MUC16_uc010dwj.2_Silent_p.L540L|MUC16_uc010xki.1_RNA	p.L13723L	NM_024690	NP_078966	WXS	Illumina HiSeq	Unspecified	Q8WXI7	MUC16_HUMAN			61	41373	-			13725	Missing (in Ref. 3; AAK74120).		Extracellular (Potential).|SEA 11.		Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	37	c.41169G>T	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	.	3.797	-0.042437	0.07452	.	.	ENSG00000181143	ENST00000542240	.	.	.	3.4	-5.83	0.02325	.	.	.	.	.	T	0.15132	0.0365	.	.	.	.	.	.	.	.	.	.	.	.	T	0.23404	-1.0189	3	.	.	.	-8.9475	0.4581	0.00512	0.3046:0.2169:0.2735:0.205	.	.	.	.	F	563	.	.	C	-	2	0	MUC16	8857403	0.080000	0.21391	0.001000	0.08648	0.073000	0.16967	-0.844000	0.04345	-1.235000	0.02545	0.455000	0.32223	TGT		0.572	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		28	106	1	0	1.77063e-15	0.005443	4.00135e-15	28	106				
MUC16	94025	broad.mit.edu	37	19	9070212	9070212	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr19:9070212G>T	ENST00000397910.4	-	3	17437	c.17234C>A	c.(17233-17235)gCc>gAc	p.A5745D		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	5747	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.A5745D(2)|p.A1378D(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TGGAGATGTGGCTTTGGATGT	0.473																																							uc002mkp.2		NA																	3	Substitution - Missense(3)		lung(3)	lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(17233-17235)GCC>GAC		mucin 16							154.0	148.0	150.0					19																	9070212		2074	4207	6281	SO:0001583	missense	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9070212G>T	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.17234C>A	19.37:g.9070212G>T	ENSP00000381008:p.Ala5745Asp		Somatic					p.A5745D	NM_024690	NP_078966	WXS	Illumina HiSeq	Unspecified	Q8WXI7	MUC16_HUMAN			3	17438	-			5747			Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	c.17234C>A	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	4.137	0.023731	0.08006	.	.	ENSG00000181143	ENST00000397910	T	0.27104	1.69	1.73	-1.33	0.09172	.	.	.	.	.	T	0.18841	0.0452	N	0.19112	0.55	.	.	.	P	0.51537	0.946	P	0.50934	0.654	T	0.20306	-1.0279	8	0.87932	D	0	.	2.7463	0.05268	0.2758:0.3165:0.4077:0.0	.	5745	B5ME49	.	D	5745	ENSP00000381008:A5745D	ENSP00000381008:A5745D	A	-	2	0	MUC16	8931212	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-2.943000	0.00682	-0.249000	0.09569	0.462000	0.41574	GCC		0.473	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		9	100	1	0	1.33834e-09	0.007413	2.57787e-09	9	100				
MUC16	94025	broad.mit.edu	37	19	9090058	9090058	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr19:9090058G>T	ENST00000397910.4	-	1	1960	c.1757C>A	c.(1756-1758)tCt>tAt	p.S586Y		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	586	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.S586Y(2)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TGTGTCTGCAGATGTTTCTTC	0.542																																							uc002mkp.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(1756-1758)TCT>TAT		mucin 16							51.0	52.0	52.0					19																	9090058		2103	4242	6345	SO:0001583	missense	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9090058G>T	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.1757C>A	19.37:g.9090058G>T	ENSP00000381008:p.Ser586Tyr		Somatic					p.S586Y	NM_024690	NP_078966	WXS	Illumina HiSeq	Unspecified	Q8WXI7	MUC16_HUMAN			1	1961	-			586			Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	c.1757C>A	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	4.236	0.042795	0.08196	.	.	ENSG00000181143	ENST00000397910	T	0.02737	4.18	1.28	1.28	0.21552	.	.	.	.	.	T	0.03477	0.0100	N	0.08118	0	.	.	.	D	0.62365	0.991	P	0.59012	0.85	T	0.44019	-0.9355	8	0.87932	D	0	.	5.9493	0.19237	0.0:0.0:1.0:0.0	.	586	B5ME49	.	Y	586	ENSP00000381008:S586Y	ENSP00000381008:S586Y	S	-	2	0	MUC16	8951058	0.001000	0.12720	0.066000	0.19879	0.320000	0.28249	0.785000	0.26830	1.024000	0.39682	0.205000	0.17691	TCT		0.542	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		14	20	1	0	9.31168e-06	0.001855	1.58602e-05	14	20				
ZNF177	7730	broad.mit.edu	37	19	9490795	9490795	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr19:9490795A>T	ENST00000589262.1	+	5	382	c.316A>T	c.(316-318)Aca>Tca	p.T106S	ZNF177_ENST00000434737.2_Missense_Mutation_p.T106S|ZNF177_ENST00000602856.1_Missense_Mutation_p.T106S|ZNF177_ENST00000590616.1_Missense_Mutation_p.T106S|ZNF177_ENST00000446085.4_Missense_Mutation_p.T106S|ZNF177_ENST00000602738.1_Missense_Mutation_p.T106S|ZNF177_ENST00000605471.1_3'UTR|ZNF177_ENST00000541595.2_Missense_Mutation_p.T106S|ZNF177_ENST00000343499.4_Missense_Mutation_p.T106S	NM_001172651.1	NP_001166122.1	Q13360	ZN177_HUMAN	zinc finger protein 177	106					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	blood microparticle (GO:0072562)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T106S(2)		breast(1)|endometrium(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)|stomach(2)	13						TGGGGGAAAAACATCCAATGG	0.373																																							uc002mli.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(316-318)ACA>TCA		zinc finger protein 177							85.0	82.0	83.0					19																	9490795		2203	4300	6503	SO:0001583	missense	7730				negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:9490795A>T	U37263, BC012012	CCDS12212.1, CCDS54214.1	19p13.2	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	12966	protein-coding gene	gene with protein product		601276					Standard	NM_003451		Approved		uc021uon.1	Q13360		ENST00000589262.1:c.316A>T	19.37:g.9490795A>T	ENSP00000468531:p.Thr106Ser		Somatic				ZNF177_uc002mlj.2_5'UTR|ZNF177_uc002mlk.2_Missense_Mutation_p.T106S	p.T106S	NM_003451	NP_003442	WXS	Illumina HiSeq	Unspecified	Q13360	ZN177_HUMAN			11	979	+			106					B4DY57|E9PDG0|I3L0I4|Q96ER2	Missense_Mutation	SNP	ENST00000589262.1	37	c.316A>T	CCDS54214.1	.	.	.	.	.	.	.	.	.	.	A	0.537	-0.855223	0.02630	.	.	ENSG00000188629	ENST00000541595;ENST00000446085;ENST00000343499;ENST00000434737	T;T;T;T	0.05717	3.59;5.72;3.59;3.4	2.79	1.78	0.24846	.	.	.	.	.	T	0.02494	0.0076	N	0.03999	-0.3	0.22620	N	0.998922	B	0.30793	0.295	B	0.29176	0.099	T	0.42447	-0.9451	8	0.16420	T	0.52	.	4.6356	0.12523	0.8496:0.0:0.1504:0.0	.	106	Q13360	ZN177_HUMAN	S	106	ENSP00000445323:T106S;ENSP00000413568:T106S;ENSP00000341497:T106S;ENSP00000415070:T106S	ENSP00000341497:T106S	T	+	1	0	ZNF177	9351795	0.002000	0.14202	0.002000	0.10522	0.004000	0.04260	1.305000	0.33493	0.498000	0.27948	-0.376000	0.06991	ACA		0.373	ZNF177-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449028.1	NM_003451		7	25	0	0	0	0.006214	0	7	25				
ABHD8	79575	broad.mit.edu	37	19	17405099	17405099	+	Nonsense_Mutation	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr19:17405099C>A	ENST00000247706.3	-	4	1386	c.1147G>T	c.(1147-1149)Gag>Tag	p.E383*	MRPL34_ENST00000600434.1_Intron|MRPL34_ENST00000595444.1_Intron|CTD-2278I10.4_ENST00000594077.1_RNA	NM_024527.4	NP_078803.4	Q96I13	ABHD8_HUMAN	abhydrolase domain containing 8	383							hydrolase activity (GO:0016787)	p.E383*(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|lung(5)|urinary_tract(1)	9						GCCTCTACCTCGGCCATGCGC	0.692																																					Ovarian(156;1368 2543 15275 41187)	Ovarian(156;1368 2543 15275 41187)	uc002ngb.3		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(1147-1149)GAG>TAG		abhydrolase domain containing 8							33.0	31.0	32.0					19																	17405099		2203	4299	6502	SO:0001587	stop_gained	79575						hydrolase activity	g.chr19:17405099C>A	AK021805	CCDS12355.1	19p13.12	2010-12-09			ENSG00000127220	ENSG00000127220		"""Abhydrolase domain containing"""	23759	protein-coding gene	gene with protein product						12477932	Standard	NM_024527		Approved	FLJ11743, MGC14280, MGC2512	uc002ngb.4	Q96I13		ENST00000247706.3:c.1147G>T	19.37:g.17405099C>A	ENSP00000247706:p.Glu383*		Somatic					p.E383*	NM_024527	NP_078803	WXS	Illumina HiSeq	Unspecified	Q96I13	ABHD8_HUMAN			4	1387	-			383					Q9HAE9	Nonsense_Mutation	SNP	ENST00000247706.3	37	c.1147G>T	CCDS12355.1	.	.	.	.	.	.	.	.	.	.	C	38	6.846917	0.97881	.	.	ENSG00000127220	ENST00000247706;ENST00000544788	.	.	.	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.21014	T	0.42	-40.1754	16.4003	0.83639	0.0:1.0:0.0:0.0	.	.	.	.	X	383;329	.	ENSP00000247706:E383X	E	-	1	0	ABHD8	17266099	1.000000	0.71417	0.948000	0.38648	0.329000	0.28539	7.426000	0.80270	2.470000	0.83445	0.655000	0.94253	GAG		0.692	ABHD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462937.1	NM_024527		5	27	1	0	3.59834e-05	0.001168	5.86774e-05	5	27				
ZNF676	163223	broad.mit.edu	37	19	22362761	22362761	+	Missense_Mutation	SNP	C	C	A	rs543467184		TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr19:22362761C>A	ENST00000397121.2	-	3	2075	c.1758G>T	c.(1756-1758)gaG>gaT	p.E586D		NM_001001411.2	NP_001001411.2	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676	586					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E586D(1)		NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(49)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	67		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)				TTTAGGGATTCTCTCCAGTAT	0.343																																							uc002nqs.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1756-1758)GAG>GAT		zinc finger protein 676							44.0	46.0	46.0					19																	22362761		2034	4216	6250	SO:0001583	missense	163223				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:22362761C>A	AK097798	CCDS42539.1	19p12	2013-01-08				ENSG00000196109		"""Zinc fingers, C2H2-type"""	20429	protein-coding gene	gene with protein product							Standard	NM_001001411		Approved		uc002nqs.1	Q8N7Q3		ENST00000397121.2:c.1758G>T	19.37:g.22362761C>A	ENSP00000380310:p.Glu586Asp		Somatic					p.E586D	NM_001001411	NP_001001411	WXS	Illumina HiSeq	Unspecified	Q8N7Q3	ZN676_HUMAN			3	2076	-		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)	586					A8MVX5	Missense_Mutation	SNP	ENST00000397121.2	37	c.1758G>T	CCDS42539.1	.	.	.	.	.	.	.	.	.	.	.	5.771	0.326614	0.10900	.	.	ENSG00000196109	ENST00000397121	T	0.09163	3.01	0.109	0.109	0.14578	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.12220	0.0297	M	0.69523	2.12	0.21984	N	0.999435	B	0.24483	0.104	B	0.20955	0.032	T	0.27536	-1.0071	9	0.87932	D	0	.	5.312	0.15835	0.0:0.6366:0.3634:1.0E-4	.	586	Q8N7Q3	ZN676_HUMAN	D	586	ENSP00000380310:E586D	ENSP00000380310:E586D	E	-	3	2	ZNF676	22154601	0.017000	0.18338	0.070000	0.20053	0.070000	0.16714	0.473000	0.22132	0.181000	0.19994	0.184000	0.17185	GAG		0.343	ZNF676-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464392.1	NM_001001411		10	38	1	0	4.68919e-08	0.008291	8.85393e-08	10	38				
ZNF99	7652	broad.mit.edu	37	19	22939511	22939511	+	IGR	SNP	G	G	T	rs375203401|rs74170737		TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr19:22939511G>T	ENST00000596209.1	-	0	2686				CTC-451A6.4_ENST00000442497.2_lincRNA|ZNF99_ENST00000397104.3_Missense_Mutation_p.P887Q	NM_001080409.2	NP_001073878.2	A8MXY4	ZNF99_HUMAN	zinc finger protein 99						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.P887Q(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(20)|lung(55)|ovary(2)|prostate(10)|skin(5)|stomach(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	124		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				ACATTTGTACGGTTTCTCCCC	0.353																																							uc010xrh.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(2659-2661)CCG>CAG		zinc finger protein 99							36.0	48.0	44.0					19																	22939511		1874	4215	6089	SO:0001628	intergenic_variant	7652							g.chr19:22939511G>T	BC021822	CCDS59369.1	19p12	2013-01-08	2006-01-17		ENSG00000213973	ENSG00000213973		"""Zinc fingers, C2H2-type"", ""-"""	13175	protein-coding gene	gene with protein product		603981	"""zinc finger protein 99 (F8281)"", ""chromosome 19 open reading frame 9"""	C19orf9			Standard	NM_001080409		Approved	MGC24986	uc021urt.1	A8MXY4			19.37:g.22939511G>T			Somatic					p.P887Q	NM_001080409	NP_001073878	WXS	Illumina HiSeq	Unspecified					7	2660	-		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)						M0R335	Missense_Mutation	SNP	ENST00000596209.1	37	c.2660C>A	CCDS59369.1	.	.	.	.	.	.	.	.	.	.	N	11.71	1.719551	0.30503	.	.	ENSG00000213973	ENST00000397104	T	0.28454	1.61	1.32	-0.0083	0.14005	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.48295	0.1492	.	.	.	0.28661	N	0.906149	D	0.76494	0.999	D	0.76071	0.987	T	0.38887	-0.9640	8	0.87932	D	0	.	6.5989	0.22689	0.1803:0.0:0.8197:0.0	.	887	A8MXY4	ZNF99_HUMAN	Q	887	ENSP00000380293:P887Q	ENSP00000380293:P887Q	P	-	2	0	ZNF99	22731351	0.023000	0.18921	0.001000	0.08648	0.007000	0.05969	0.946000	0.29069	-0.105000	0.12132	0.164000	0.16699	CCG		0.353	ZNF99-001	NOVEL	not_best_in_genome_evidence|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000464591.1	XM_065124		12	59	1	0	2.27111e-07	0.001368	4.11236e-07	12	59				
ZNF91	7644	broad.mit.edu	37	19	23557440	23557440	+	Splice_Site	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr19:23557440C>A	ENST00000300619.7	-	2	362	c.157G>T	c.(157-159)Ggt>Tgt	p.G53C	ZNF91_ENST00000397082.2_Splice_Site_p.G53C|ZNF91_ENST00000599743.1_Splice_Site_p.G53C	NM_003430.2	NP_003421.2	Q05481	ZNF91_HUMAN	zinc finger protein 91	53	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.G53C(1)					all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)				TTTTCCTTACCCAGGAAGGCC	0.348																																							uc002nre.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(157-159)GGT>TGT		zinc finger protein 91							66.0	74.0	71.0					19																	23557440		2200	4300	6500	SO:0001630	splice_region_variant	7644					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:23557440C>A	M61871	CCDS42541.1, CCDS74322.1	19p12	2014-02-04	2006-05-12		ENSG00000167232	ENSG00000167232		"""Zinc fingers, C2H2-type"", ""-"""	13166	protein-coding gene	gene with protein product		603971	"""zinc finger protein 91 (HPF7, HTF10)"""			2023909, 2505992	Standard	XR_430154		Approved	HPF7, HTF10	uc002nre.3	Q05481	OTTHUMG00000183268	ENST00000300619.7:c.157+1G>T	19.37:g.23557440C>A			Somatic				ZNF91_uc010xrj.1_Missense_Mutation_p.G53C	p.G53C	NM_003430	NP_003421	WXS	Illumina HiSeq	Unspecified	Q05481	ZNF91_HUMAN			2	270	-		all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)	53			KRAB.		A8K5E1|B7Z6G6	Missense_Mutation	SNP	ENST00000300619.7	37	c.157G>T	CCDS42541.1	.	.	.	.	.	.	.	.	.	.	C	11.71	1.720011	0.30503	.	.	ENSG00000167232	ENST00000300619;ENST00000397082	T;T	0.03004	4.08;4.08	0.149	0.149	0.14863	Krueppel-associated box (4);	.	.	.	.	T	0.21468	0.0517	H	0.94847	3.59	0.18873	N	0.999982	D;D	0.89917	0.986;1.0	P;D	0.75484	0.699;0.986	T	0.02553	-1.1142	7	.	.	.	.	.	.	.	.	53;53	Q05481-2;Q05481	.;ZNF91_HUMAN	C	53	ENSP00000300619:G53C;ENSP00000380272:G53C	.	G	-	1	0	ZNF91	23349280	0.738000	0.28186	0.484000	0.27391	0.485000	0.33311	0.786000	0.26844	0.192000	0.20272	0.195000	0.17529	GGT		0.348	ZNF91-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465891.1	NM_003430	Missense_Mutation	12	98	1	0	7.03913e-09	0.001368	1.34235e-08	12	98				
ZNF536	9745	broad.mit.edu	37	19	30934718	30934718	+	Silent	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr19:30934718C>A	ENST00000355537.3	+	2	396	c.249C>A	c.(247-249)ctC>ctA	p.L83L		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	83					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)	p.L83L(1)		NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					AGATGGCGCTCCTGGCCAACC	0.672																																							uc002nsu.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(7)|large_intestine(2)|skin(2)	11						c.(247-249)CTC>CTA		zinc finger protein 536							26.0	27.0	27.0					19																	30934718		2202	4300	6502	SO:0001819	synonymous_variant	9745				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding	g.chr19:30934718C>A		CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.249C>A	19.37:g.30934718C>A			Somatic				ZNF536_uc010edd.1_Silent_p.L83L	p.L83L	NM_014717	NP_055532	WXS	Illumina HiSeq	Unspecified	O15090	ZN536_HUMAN			2	387	+	Esophageal squamous(110;0.0834)		83					A2RU18	Silent	SNP	ENST00000355537.3	37	c.249C>A	CCDS32984.1																																																																																				0.672	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459667.2	NM_014717		7	17	1	0	0.00198382	0.001984	0.00304468	7	17				
TSHZ3	57616	broad.mit.edu	37	19	31768669	31768669	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr19:31768669C>A	ENST00000240587.4	-	2	2357	c.2030G>T	c.(2029-2031)gGg>gTg	p.G677V		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	677					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G677V(1)|p.G494V(1)		breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					ATCCTTGCACCCATCCCGCGG	0.647																																							uc002nsy.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|skin(2)|pancreas(1)|lung(1)	8						c.(2029-2031)GGG>GTG		zinc finger protein 537							30.0	32.0	31.0					19																	31768669		2203	4300	6503	SO:0001583	missense	57616				negative regulation of transcription, DNA-dependent|regulation of respiratory gaseous exchange by neurological system process	growth cone|nucleus	chromatin binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:31768669C>A	AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.2030G>T	19.37:g.31768669C>A	ENSP00000240587:p.Gly677Val		Somatic					p.G677V	NM_020856	NP_065907	WXS	Illumina HiSeq	Unspecified	Q63HK5	TSH3_HUMAN			2	2095	-	Esophageal squamous(110;0.226)		677					Q9H0G6|Q9P254	Missense_Mutation	SNP	ENST00000240587.4	37	c.2030G>T	CCDS12421.2	.	.	.	.	.	.	.	.	.	.	C	0.701	-0.790878	0.02884	.	.	ENSG00000121297	ENST00000240587	T	0.37058	1.22	5.5	2.13	0.27403	.	0.540655	0.21236	N	0.077882	T	0.25044	0.0608	L	0.36672	1.1	0.19300	N	0.999979	B	0.20052	0.041	B	0.19391	0.025	T	0.16453	-1.0402	10	0.39692	T	0.17	-11.1441	6.4523	0.21910	0.1266:0.5619:0.2444:0.0671	.	677	Q63HK5	TSH3_HUMAN	V	677	ENSP00000240587:G677V	ENSP00000240587:G677V	G	-	2	0	TSHZ3	36460509	0.002000	0.14202	0.003000	0.11579	0.125000	0.20455	1.020000	0.30027	0.256000	0.21614	0.650000	0.86243	GGG		0.647	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316743.2	NM_020856		10	46	1	0	1.33987e-11	0.008291	2.72725e-11	10	46				
FFAR3	2865	broad.mit.edu	37	19	35850660	35850660	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr19:35850660C>A	ENST00000327809.4	+	2	1069	c.868C>A	c.(868-870)Ctg>Atg	p.L290M	FFAR3_ENST00000594310.1_Missense_Mutation_p.L290M	NM_005304.3	NP_005295.1	O14843	FFAR3_HUMAN	free fatty acid receptor 3	290					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to fatty acid (GO:0071398)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|mucosal immune response (GO:0002385)|negative regulation of blood pressure (GO:0045776)|positive regulation of acute inflammatory response to non-antigenic stimulus (GO:0002879)|positive regulation of chemokine production (GO:0032722)|positive regulation of cytokine production involved in immune response (GO:0002720)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|regulation of hormone biosynthetic process (GO:0046885)|regulation of norepinephrine secretion (GO:0014061)|regulation of peptide hormone secretion (GO:0090276)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lipid binding (GO:0008289)	p.L290M(1)		endometrium(3)|large_intestine(2)|lung(9)|ovary(1)|skin(1)|stomach(1)	17	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		Epithelial(14;1.29e-19)|OV - Ovarian serous cystadenocarcinoma(14;4.63e-18)|all cancers(14;5.19e-17)|LUSC - Lung squamous cell carcinoma(66;0.0221)			CTTTCATGAGCTGCTGAGGAG	0.602																																					Esophageal Squamous(185;1742 2042 21963 24215 27871)	Esophageal Squamous(185;1742 2042 21963 24215 27871)	uc002nzd.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(868-870)CTG>ATG		free fatty acid receptor 3							42.0	32.0	36.0					19																	35850660		2200	4274	6474	SO:0001583	missense	2865					integral to plasma membrane	G-protein coupled receptor activity|lipid binding	g.chr19:35850660C>A	AF024688	CCDS12459.1	19q13.1	2012-08-08	2006-02-15	2006-02-15	ENSG00000185897	ENSG00000185897		"""GPCR / Class A : Fatty acid receptors"""	4499	protein-coding gene	gene with protein product		603821	"""G protein-coupled receptor 41"""	GPR41		9344866, 22493486	Standard	NM_005304		Approved	FFA3R	uc002nzd.3	O14843	OTTHUMG00000172514	ENST00000327809.4:c.868C>A	19.37:g.35850660C>A	ENSP00000328230:p.Leu290Met		Somatic				FFAR3_uc010xsu.1_Intron	p.L290M	NM_005304	NP_005295	WXS	Illumina HiSeq	Unspecified	O14843	FFAR3_HUMAN	Epithelial(14;1.29e-19)|OV - Ovarian serous cystadenocarcinoma(14;4.63e-18)|all cancers(14;5.19e-17)|LUSC - Lung squamous cell carcinoma(66;0.0221)		2	943	+	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		290			Cytoplasmic (Potential).		B2RWM8|Q14CM7	Missense_Mutation	SNP	ENST00000327809.4	37	c.868C>A	CCDS12459.1	.	.	.	.	.	.	.	.	.	.	C	11.44	1.639181	0.29157	.	.	ENSG00000185897	ENST00000327809	T	0.42900	0.96	4.65	2.5	0.30297	.	0.681397	0.13036	U	0.418884	T	0.31071	0.0785	L	0.34521	1.04	0.09310	N	1	P	0.45428	0.858	B	0.42422	0.387	T	0.07328	-1.0778	10	0.33940	T	0.23	-13.8371	7.1764	0.25747	0.0:0.7888:0.0:0.2112	.	290	O14843	FFAR3_HUMAN	M	290	ENSP00000328230:L290M	ENSP00000328230:L290M	L	+	1	2	FFAR3	40542500	0.000000	0.05858	0.009000	0.14445	0.088000	0.18126	-0.221000	0.09202	0.491000	0.27793	0.455000	0.32223	CTG		0.602	FFAR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418873.2	NM_005304		6	32	1	0	2.17888e-05	0.006214	3.64628e-05	6	32				
CYP2A7	1549	broad.mit.edu	37	19	41383145	41383145	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr19:41383145C>A	ENST00000301146.4	-	7	1652	c.1111G>T	c.(1111-1113)Gcc>Tcc	p.A371S	CTC-490E21.12_ENST00000601627.1_Intron|CYP2A7_ENST00000291764.3_Missense_Mutation_p.A320S	NM_000764.2	NP_000755.2	P20853	CP2A7_HUMAN	cytochrome P450, family 2, subfamily A, polypeptide 7	371						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)	p.A371S(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(7)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			ACCCTGCGGGCCAAACTCATG	0.547																																							uc002opm.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	3						c.(1111-1113)GCC>TCC		cytochrome P450, family 2, subfamily A,							103.0	91.0	95.0					19																	41383145		2203	4299	6502	SO:0001583	missense	1549					endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding	g.chr19:41383145C>A	NM_000764	CCDS12569.1, CCDS42570.1	19q13.2	2013-07-25	2003-01-14		ENSG00000198077	ENSG00000198077		"""Cytochrome P450s"""	2611	protein-coding gene	gene with protein product		608054	"""cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 7"""			7668294, 15128046	Standard	NM_030589		Approved	CYP2A	uc002opm.3	P20853	OTTHUMG00000182715	ENST00000301146.4:c.1111G>T	19.37:g.41383145C>A	ENSP00000301146:p.Ala371Ser		Somatic				CYP2A7_uc002opo.2_Missense_Mutation_p.A371S|CYP2A7_uc002opn.2_Missense_Mutation_p.A320S	p.A371S	NM_000764	NP_000755	WXS	Illumina HiSeq	Unspecified	P20853	CP2A7_HUMAN	LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)		7	1653	-			371					Q13121	Missense_Mutation	SNP	ENST00000301146.4	37	c.1111G>T	CCDS12569.1	.	.	.	.	.	.	.	.	.	.	C	11.53	1.667412	0.29604	.	.	ENSG00000198077	ENST00000301146;ENST00000291764	T;T	0.67698	-0.28;-0.28	2.29	-4.57	0.03421	.	0.066563	0.64402	U	0.000012	T	0.49949	0.1587	N	0.25201	0.72	0.09310	N	1	B;B;B	0.25955	0.075;0.138;0.038	B;B;B	0.36030	0.216;0.073;0.184	T	0.47328	-0.9126	10	0.72032	D	0.01	.	9.4235	0.38565	0.1456:0.2822:0.5722:0.0	.	371;320;371	B7ZKR0;F8W816;P20853	.;.;CP2A7_HUMAN	S	371;320	ENSP00000301146:A371S;ENSP00000291764:A320S	ENSP00000291764:A320S	A	-	1	0	CYP2A7	46074985	0.006000	0.16342	0.000000	0.03702	0.229000	0.25112	-0.035000	0.12205	-1.498000	0.01824	0.184000	0.17185	GCC		0.547	CYP2A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463269.2	NM_030589		20	49	1	0	4.96729e-08	0.008871	9.31773e-08	20	49				
PSG1	5669	broad.mit.edu	37	19	43382204	43382204	+	Silent	SNP	T	T	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr19:43382204T>A	ENST00000436291.2	-	2	407	c.291A>T	c.(289-291)ggA>ggT	p.G97G	PSG1_ENST00000595124.1_Silent_p.G97G|PSG1_ENST00000403380.3_Silent_p.G97G|PSG1_ENST00000244296.2_Silent_p.G97G|PSG1_ENST00000595356.1_Silent_p.G97G|PSG1_ENST00000312439.6_Silent_p.G97G|PSG1_ENST00000601073.1_5'UTR	NM_001184825.1|NM_001184826.1	NP_001171754.1|NP_001171755.1	P11464	PSG1_HUMAN	pregnancy specific beta-1-glycoprotein 1	97	Ig-like V-type.				female pregnancy (GO:0007565)	extracellular region (GO:0005576)		p.G97G(2)		breast(2)|endometrium(4)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	30		Prostate(69;0.00682)				CTGTTTCTCGTCCACTATATG	0.448																																							uc002ovb.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)	2						c.(289-291)GGA>GGT		pregnancy specific beta-1-glycoprotein 1							305.0	290.0	295.0					19																	43382204		2202	4299	6501	SO:0001819	synonymous_variant	5669				female pregnancy	extracellular region		g.chr19:43382204T>A		CCDS12612.1, CCDS54275.1, CCDS59392.1, CCDS74380.1	19q13.2	2013-01-29			ENSG00000231924	ENSG00000231924		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9514	protein-coding gene	gene with protein product		176390		PSBG1			Standard	NM_006905		Approved	PSGGA, CD66f, PBG1		P11464	OTTHUMG00000151123	ENST00000436291.2:c.291A>T	19.37:g.43382204T>A			Somatic				PSG3_uc002ouf.2_Intron|PSG1_uc002oug.1_Silent_p.G97G|PSG11_uc002ouw.2_Intron|PSG7_uc002ous.1_Intron|PSG7_uc002out.1_Intron|PSG10_uc002ouv.1_Intron|PSG1_uc002oun.2_RNA|PSG1_uc002our.1_Silent_p.G97G|PSG1_uc010eio.1_Silent_p.G97G|PSG1_uc002oux.1_Silent_p.G26G|PSG1_uc002ouy.1_Silent_p.G97G|PSG1_uc002ouz.1_Silent_p.G97G|PSG1_uc002ova.1_Silent_p.G97G|PSG1_uc002ovc.2_Silent_p.G97G|PSG1_uc002ovd.1_Silent_p.G97G	p.G97G	NM_006905	NP_008836	WXS	Illumina HiSeq	Unspecified	P11464	PSG1_HUMAN			2	429	-		Prostate(69;0.00682)	97			Ig-like V-type.		O75236|P11462|P11463|Q15231|Q15241|Q15243|Q16660|Q6ICR4|Q9P1W5|Q9UQ79	Silent	SNP	ENST00000436291.2	37	c.291A>T	CCDS54275.1																																																																																				0.448	PSG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000321426.1			76	445	0	0	0	0.00361	0	76	445				
ZNF114	163071	broad.mit.edu	37	19	48789178	48789178	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr19:48789178C>A	ENST00000595607.1	+	6	791	c.297C>A	c.(295-297)caC>caA	p.H99Q	ZNF114_ENST00000315849.1_Missense_Mutation_p.H99Q|ZNF114_ENST00000600687.1_Missense_Mutation_p.H99Q|ZNF114_ENST00000597695.1_Missense_Mutation_p.H65Q			Q8NC26	ZN114_HUMAN	zinc finger protein 114	99			H -> N (in dbSNP:rs35802964).		regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.H99Q(1)		endometrium(1)|large_intestine(6)|lung(11)	18		all_epithelial(76;8.01e-05)|all_lung(116;0.000112)|Lung NSC(112;0.000192)|Prostate(7;0.0187)|all_neural(266;0.0228)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;7.56e-05)|all cancers(93;0.000113)|Epithelial(262;0.00962)|GBM - Glioblastoma multiforme(486;0.0153)		AGGAACCACACAGGCAGGGGG	0.478																																							uc002pil.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(295-297)CAC>CAA		zinc finger protein 114							76.0	68.0	71.0					19																	48789178		2203	4300	6503	SO:0001583	missense	163071				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:48789178C>A	BC014935	CCDS12713.1, CCDS74412.1	19q13.32	2013-01-08			ENSG00000178150	ENSG00000178150		"""Zinc fingers, C2H2-type"", ""-"""	12894	protein-coding gene	gene with protein product		603996					Standard	XM_005258580		Approved	MGC17986	uc002pim.1	Q8NC26		ENST00000595607.1:c.297C>A	19.37:g.48789178C>A	ENSP00000469998:p.His99Gln		Somatic				ZNF114_uc010elv.1_Missense_Mutation_p.H99Q|ZNF114_uc002pim.1_Missense_Mutation_p.H99Q|ZNF114_uc002pin.2_Missense_Mutation_p.H65Q	p.H99Q	NM_153608	NP_705836	WXS	Illumina HiSeq	Unspecified	Q8NC26	ZN114_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;7.56e-05)|all cancers(93;0.000113)|Epithelial(262;0.00962)|GBM - Glioblastoma multiforme(486;0.0153)	6	794	+		all_epithelial(76;8.01e-05)|all_lung(116;0.000112)|Lung NSC(112;0.000192)|Prostate(7;0.0187)|all_neural(266;0.0228)|Ovarian(192;0.113)	99					A8K6B0|Q08AQ6	Missense_Mutation	SNP	ENST00000595607.1	37	c.297C>A	CCDS12713.1	.	.	.	.	.	.	.	.	.	.	C	1.581	-0.531559	0.04112	.	.	ENSG00000178150	ENST00000315849	T	0.04706	3.57	1.94	-0.448	0.12230	.	.	.	.	.	T	0.02156	0.0067	N	0.08118	0	0.09310	N	1	B	0.26195	0.144	B	0.18263	0.021	T	0.48703	-0.9012	9	0.21014	T	0.42	.	5.1389	0.14948	0.2233:0.3358:0.4409:0.0	.	99	Q8NC26	ZN114_HUMAN	Q	99	ENSP00000318898:H99Q	ENSP00000318898:H99Q	H	+	3	2	ZNF114	53480990	0.000000	0.05858	0.000000	0.03702	0.026000	0.11368	-0.237000	0.08990	-0.022000	0.13986	0.411000	0.27672	CAC		0.478	ZNF114-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465601.1	NM_153608		15	50	1	0	0.000566183	0.00499	0.000895287	15	50				
NLRP12	91662	broad.mit.edu	37	19	54314284	54314284	+	Missense_Mutation	SNP	G	G	C	rs377594629	byFrequency	TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr19:54314284G>C	ENST00000324134.6	-	3	797	c.629C>G	c.(628-630)cCg>cGg	p.P210R	NLRP12_ENST00000354278.3_Missense_Mutation_p.P210R|NLRP12_ENST00000351894.4_Missense_Mutation_p.P210R|NLRP12_ENST00000391773.1_Missense_Mutation_p.P210R|NLRP12_ENST00000345770.5_Missense_Mutation_p.P210R|NLRP12_ENST00000391772.1_Missense_Mutation_p.P210R|NLRP12_ENST00000391775.3_Missense_Mutation_p.P210R|NLRP12_ENST00000535162.1_Missense_Mutation_p.P210R	NM_001277126.1|NM_144687.2	NP_001264055.1|NP_653288.1	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12	210					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to cytokine stimulus (GO:0071345)|dendritic cell migration (GO:0036336)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 secretion (GO:0050711)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of signal transduction (GO:0009968)|negative regulation of Toll signaling pathway (GO:0045751)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of MHC class I biosynthetic process (GO:0045345)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of interleukin-18 biosynthetic process (GO:0045381)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)	p.P210R(1)		NS(1)|breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(36)|ovary(5)|pancreas(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	80	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		CACGGTGCGCGGTGGCTCGGG	0.647																																							uc002qch.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|upper_aerodigestive_tract(2)|lung(1)	7						c.(628-630)CCG>CGG		NLR family, pyrin domain containing 12 isoform							96.0	79.0	85.0					19																	54314284		2203	4300	6503	SO:0001583	missense	91662				negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of interleukin-1 secretion|negative regulation of interleukin-6 biosynthetic process|negative regulation of protein autophosphorylation|negative regulation of Toll signaling pathway|positive regulation of inflammatory response|positive regulation of interleukin-1 beta secretion|regulation of interleukin-18 biosynthetic process|release of cytoplasmic sequestered NF-kappaB	cytoplasm	ATP binding|caspase activator activity|protein binding	g.chr19:54314284G>C	AY095146	CCDS12864.1, CCDS62784.1, CCDS62785.1	19q13.42	2014-09-17	2006-12-08	2006-12-08	ENSG00000142405	ENSG00000142405		"""Nucleotide-binding domain and leucine rich repeat containing"""	22938	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 12"""	609648	"""NACHT, leucine rich repeat and PYD containing 12"""	NALP12		12563287, 12019269	Standard	NM_001277129		Approved	RNO2, PYPAF7, Monarch1, PAN6, CLR19.3	uc002qcj.5	P59046	OTTHUMG00000060776	ENST00000324134.6:c.629C>G	19.37:g.54314284G>C	ENSP00000319377:p.Pro210Arg		Somatic				NLRP12_uc010eqw.2_5'Flank|NLRP12_uc002qci.3_Missense_Mutation_p.P210R|NLRP12_uc002qcj.3_Missense_Mutation_p.P210R|NLRP12_uc002qck.3_RNA|NLRP12_uc010eqx.2_Missense_Mutation_p.P210R	p.P210R	NM_144687	NP_653288	WXS	Illumina HiSeq	Unspecified	P59046	NAL12_HUMAN		GBM - Glioblastoma multiforme(134;0.026)	3	849	-	Ovarian(34;0.19)		210					A8MTQ2|B3KTE7|Q8NEU4|Q9BY26	Missense_Mutation	SNP	ENST00000324134.6	37	c.629C>G	CCDS12864.1	.	.	.	.	.	.	.	.	.	.	G	12.61	1.989402	0.35131	.	.	ENSG00000142405	ENST00000324134;ENST00000535162;ENST00000351894;ENST00000354278;ENST00000391775;ENST00000391773;ENST00000345770;ENST00000391772	D;D;D;D;D;D;D	0.81499	-1.5;-1.5;-1.5;-1.5;-1.5;-1.5;-1.5	4.25	4.25	0.50352	.	0.000000	0.42821	D	0.000643	D	0.89047	0.6604	M	0.78049	2.395	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	D	0.90551	0.4509	10	0.72032	D	0.01	.	14.5812	0.68292	0.0:0.0:1.0:0.0	.	210;210;210;210	F2Z321;A8K407;A8MTQ2;P59046	.;.;.;NAL12_HUMAN	R	210	ENSP00000319377:P210R;ENSP00000438030:P210R;ENSP00000340473:P210R;ENSP00000346231:P210R;ENSP00000375655:P210R;ENSP00000375653:P210R;ENSP00000375652:P210R	ENSP00000319377:P210R	P	-	2	0	NLRP12	59006096	1.000000	0.71417	0.990000	0.47175	0.107000	0.19398	4.193000	0.58385	2.113000	0.64589	0.306000	0.20318	CCG		0.647	NLRP12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000134340.1	NM_144687		21	62	0	0	0	0.001882	0	21	62				
LILRB2	10288	broad.mit.edu	37	19	54782199	54782199	+	Silent	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr19:54782199C>A	ENST00000391749.4	-	7	1444	c.1173G>T	c.(1171-1173)gcG>gcT	p.A391A	LILRB2_ENST00000471216.1_5'Flank|LILRB2_ENST00000391748.1_Silent_p.A391A|LILRB2_ENST00000391746.1_Silent_p.A391A|LILRB2_ENST00000314446.5_Silent_p.A391A|LILRB2_ENST00000434421.1_Silent_p.A275A	NM_001278406.1	NP_001265335.1	Q8N423	LIRB2_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 2	391	Ig-like C2-type 4.				cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular defense response (GO:0006968)|cellular response to lipopolysaccharide (GO:0071222)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|heterotypic cell-cell adhesion (GO:0034113)|immune response (GO:0006955)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|negative regulation of antigen processing and presentation (GO:0002578)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T cell tolerance induction (GO:0002666)|regulation of dendritic cell differentiation (GO:2001198)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|inhibitory MHC class I receptor activity (GO:0032396)|MHC class I protein binding (GO:0042288)|MHC class Ib protein binding (GO:0023029)|protein phosphatase 1 binding (GO:0008157)|receptor activity (GO:0004872)	p.A391A(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(30)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	44	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		TGTAGGTCCCCGCGTGGGCTG	0.602																																							uc002qfb.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(1171-1173)GCG>GCT		leukocyte immunoglobulin-like receptor,							126.0	123.0	124.0					19																	54782199		2203	4300	6503	SO:0001819	synonymous_variant	10288				cell surface receptor linked signaling pathway|cell-cell signaling|cellular defense response|immune response|regulation of immune response	integral to plasma membrane|membrane fraction	receptor activity	g.chr19:54782199C>A	AF000574	CCDS12886.1, CCDS42612.1, CCDS62791.1, CCDS62792.1	19q13.4	2013-01-11			ENSG00000131042	ENSG00000131042		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6606	protein-coding gene	gene with protein product		604815				9151699, 9079806	Standard	XM_006722966		Approved	LIR-2, ILT4, MIR-10, LIR2, CD85d, MIR10	uc002qfb.3	Q8N423	OTTHUMG00000064896	ENST00000391749.4:c.1173G>T	19.37:g.54782199C>A			Somatic				LILRA6_uc002qew.1_Intron|LILRB2_uc010eri.2_Silent_p.A391A|LILRB2_uc010erj.2_RNA|LILRB2_uc002qfc.2_Silent_p.A391A|LILRB2_uc010yet.1_Silent_p.A275A|LILRB2_uc010yeu.1_RNA	p.A391A	NM_005874	NP_005865	WXS	Illumina HiSeq	Unspecified	Q8N423	LIRB2_HUMAN		GBM - Glioblastoma multiforme(193;0.105)	7	1439	-	Ovarian(34;0.19)		391			Extracellular (Potential).|Ig-like C2-type 4.		A8MU67|C9JF29|O75017|Q8NHJ7|Q8NHJ8	Silent	SNP	ENST00000391749.4	37	c.1173G>T	CCDS12886.1																																																																																				0.602	LILRB2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139510.1			36	141	1	0	3.76114e-14	0.004289	8.14676e-14	36	141				
DNAAF3	352909	broad.mit.edu	37	19	55672123	55672123	+	Silent	SNP	T	T	C			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr19:55672123T>C	ENST00000524407.2	-	9	966	c.933A>G	c.(931-933)caA>caG	p.Q311Q	CTD-2587H24.5_ENST00000591665.1_RNA|CTD-2587H24.4_ENST00000587871.1_5'Flank|DNAAF3_ENST00000455045.1_Silent_p.Q257Q|DNAAF3_ENST00000391720.4_Silent_p.Q358Q|DNAAF3_ENST00000587789.2_5'Flank|DNAAF3_ENST00000527223.2_Silent_p.Q379Q			Q8N9W5	DAAF3_HUMAN	dynein, axonemal, assembly factor 3	311					axonemal dynein complex assembly (GO:0070286)|motile cilium assembly (GO:0044458)	cytoplasm (GO:0005737)		p.Q358Q(1)									TCACGTTGTGTTGAGTGATCT	0.711																																							uc002qji.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(931-933)CAA>CAG		RecName: Full=UPF0470 protein C19orf51;							33.0	35.0	35.0					19																	55672123		1918	4101	6019	SO:0001819	synonymous_variant	352909							g.chr19:55672123T>C	AK097388	CCDS12918.2, CCDS58679.1, CCDS58680.1, CCDS59422.1	19q13.42	2012-10-05	2012-03-09	2012-03-09	ENSG00000167646	ENSG00000167646			30492	protein-coding gene	gene with protein product		614566	"""chromosome 19 open reading frame 51"", ""ciliary dyskinesia, primary 2"""	C19orf51, CILD2		22387996	Standard	NM_001256714		Approved	FLJ40069, FLJ36139, PF22, PCD	uc002qjl.2	Q8N9W5	OTTHUMG00000128547	ENST00000524407.2:c.933A>G	19.37:g.55672123T>C			Somatic				C19orf51_uc002qjh.1_Silent_p.Q126Q|C19orf51_uc002qjj.1_Silent_p.Q358Q|C19orf51_uc002qjk.1_Silent_p.Q257Q|C19orf51_uc002qjl.1_Silent_p.Q379Q	p.Q311Q			WXS	Illumina HiSeq	Unspecified	Q8N9W5	CS051_HUMAN	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.044)	9	967	-			311					A8MUY0|E3W9A1|E9PAX5|Q6P4F6|Q8N9W0|Q96AR2	Silent	SNP	ENST00000524407.2	37	c.933A>G	CCDS59422.1																																																																																				0.711	DNAAF3-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000250388.5	NM_178837		3	33	0	0	0	0.004672	0	3	33				
ZNF835	90485	broad.mit.edu	37	19	57175225	57175225	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr19:57175225A>T	ENST00000537055.2	-	2	1573	c.1342T>A	c.(1342-1344)Tgc>Agc	p.C448S		NM_001005850.2	NP_001005850.2	Q9Y2P0	ZN835_HUMAN	zinc finger protein 835	448					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.C470S(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(22)|pancreas(3)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	47						CACTCGGGGCAGGTGTAGGGC	0.677																																							uc010ygo.1		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(3)|skin(1)	4						c.(1408-1410)TGC>AGC		zinc finger protein 835							51.0	56.0	54.0					19																	57175225		2201	4299	6500	SO:0001583	missense	90485							g.chr19:57175225A>T	AK023017	CCDS56105.1	19q13.43	2013-01-08			ENSG00000127903	ENSG00000127903		"""Zinc fingers, C2H2-type"""	34332	protein-coding gene	gene with protein product							Standard	NM_001005850		Approved	BC37295_3	uc010ygn.2	Q9Y2P0		ENST00000537055.2:c.1342T>A	19.37:g.57175225A>T	ENSP00000444747:p.Cys448Ser		Somatic				ZNF835_uc010ygn.1_Missense_Mutation_p.C448S	p.C470S	NM_001005850	NP_001005850	WXS	Illumina HiSeq	Unspecified					2	1408	-								B7Z5Y0|G3V1S0	Missense_Mutation	SNP	ENST00000537055.2	37	c.1408T>A	CCDS56105.1	.	.	.	.	.	.	.	.	.	.	A	19.71	3.878009	0.72294	.	.	ENSG00000127903	ENST00000342088;ENST00000537055	D	0.85171	-1.95	2.32	2.32	0.28847	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.93923	0.8055	H	0.95884	3.735	0.30820	N	0.737847	D	0.89917	1.0	D	0.87578	0.998	D	0.89999	0.4113	9	0.87932	D	0	.	9.8231	0.40894	1.0:0.0:0.0:0.0	.	470	Q9Y2P0	ZN835_HUMAN	S	470;448	ENSP00000444747:C448S	ENSP00000341756:C470S	C	-	1	0	ZNF835	61867037	0.973000	0.33851	0.049000	0.19019	0.440000	0.31957	3.686000	0.54685	1.305000	0.44909	0.459000	0.35465	TGC		0.677	ZNF835-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459800.1	NM_001005850		39	47	0	0	0	0.004878	0	39	47				
ZNF135	7694	broad.mit.edu	37	19	58574842	58574842	+	Silent	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr19:58574842C>A	ENST00000313434.5	+	4	290	c.189C>A	c.(187-189)atC>atA	p.I63I	ZNF135_ENST00000439855.2_Silent_p.I63I|ZNF135_ENST00000401053.4_Silent_p.I75I|ZNF135_ENST00000359978.6_Silent_p.I75I|ZNF135_ENST00000511556.1_Silent_p.I63I|ZNF135_ENST00000506786.1_Silent_p.I21I	NM_003436.3	NP_003427.3	P52742	ZN135_HUMAN	zinc finger protein 135	63	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				cytoskeleton organization (GO:0007010)|regulation of cell morphogenesis (GO:0022604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.I75I(1)|p.I63I(1)		breast(1)|endometrium(3)|large_intestine(6)|liver(2)|lung(26)|ovary(1)|skin(1)|urinary_tract(1)	41		Colorectal(82;0.000256)|all_neural(62;0.0412)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0161)		CGAATGTCATCTCCCTGCTGG	0.587																																							uc010yhq.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(187-189)ATC>ATA		zinc finger protein 135 isoform 2							110.0	95.0	100.0					19																	58574842		2203	4300	6503	SO:0001819	synonymous_variant	7694				regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding	g.chr19:58574842C>A	U09413	CCDS12970.1, CCDS12970.2, CCDS54329.1, CCDS54330.1, CCDS74471.1, CCDS74472.1	19q13.4	2013-01-08	2006-05-12			ENSG00000176293		"""Zinc fingers, C2H2-type"", ""-"""	12919	protein-coding gene	gene with protein product		604077	"""zinc finger protein 61"", ""zinc finger protein 135 (clone pHZ-17)"""	ZNF61, ZNF78L1		7557990, 1505991	Standard	NM_003436		Approved	pHZ-17	uc002qrg.3	P52742		ENST00000313434.5:c.189C>A	19.37:g.58574842C>A			Somatic				ZNF135_uc002qre.2_Silent_p.I63I|ZNF135_uc002qrd.1_Silent_p.I21I|ZNF135_uc002qrf.2_Silent_p.I21I|ZNF135_uc002qrg.2_Silent_p.I21I|ZNF135_uc010yhr.1_5'UTR	p.I63I	NM_003436	NP_003427	WXS	Illumina HiSeq	Unspecified	B4DHH9	B4DHH9_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0161)	4	285	+		Colorectal(82;0.000256)|all_neural(62;0.0412)|Breast(46;0.147)|Ovarian(87;0.156)	63					B4DHH9|E9PEV2|F5GYY9|I3L0B3|Q5U5L3|Q8N1I7	Silent	SNP	ENST00000313434.5	37	c.189C>A		.	.	.	.	.	.	.	.	.	.	C	4.323	0.059390	0.08339	.	.	ENSG00000176293	ENST00000391699	.	.	.	2.51	1.45	0.22620	.	.	.	.	.	T	0.25344	0.0616	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.21621	-1.0240	4	.	.	.	.	5.1997	0.15256	0.0:0.8331:0.0:0.1669	.	.	.	.	Y	69	.	.	S	+	2	0	ZNF135	63266654	0.120000	0.22244	0.002000	0.10522	0.128000	0.20619	0.327000	0.19663	0.629000	0.30376	0.563000	0.77884	TCT		0.587	ZNF135-003	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000361899.2	NM_003436		23	38	1	0	2.48779e-11	0.005443	5.02815e-11	23	38				
TPO	7173	broad.mit.edu	37	2	1497701	1497701	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr2:1497701C>G	ENST00000345913.4	+	11	1987	c.1896C>G	c.(1894-1896)atC>atG	p.I632M	TPO_ENST00000337415.3_Missense_Mutation_p.I632M|TPO_ENST00000382198.1_Missense_Mutation_p.I459M|TPO_ENST00000349624.3_Missense_Mutation_p.I459M|TPO_ENST00000346956.3_Missense_Mutation_p.I632M|TPO_ENST00000329066.4_Missense_Mutation_p.I632M|TPO_ENST00000382201.3_Missense_Mutation_p.I575M|TPO_ENST00000497517.2_3'UTR	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase	632					cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)	p.I632M(1)		breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	CTGACAACATCGATGTCTGGC	0.612																																							uc002qww.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(7)|pancreas(6)|skin(5)|lung(1)|kidney(1)	20						c.(1894-1896)ATC>ATG		thyroid peroxidase isoform a	Carbimazole(DB00389)|Methimazole(DB00763)|Propylthiouracil(DB00550)						85.0	82.0	83.0					2																	1497701		2203	4300	6503	SO:0001583	missense	7173				cellular nitrogen compound metabolic process|hormone biosynthetic process|hydrogen peroxide catabolic process	cell surface|cytoplasm|integral to plasma membrane	calcium ion binding|heme binding|iodide peroxidase activity	g.chr2:1497701C>G		CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.1896C>G	2.37:g.1497701C>G	ENSP00000318820:p.Ile632Met		Somatic				TPO_uc010ewj.2_RNA|TPO_uc002qwu.2_Missense_Mutation_p.I575M|TPO_uc002qwr.2_Missense_Mutation_p.I632M|TPO_uc002qwx.2_Missense_Mutation_p.I575M|TPO_uc010yio.1_Missense_Mutation_p.I459M|TPO_uc010yip.1_Missense_Mutation_p.I632M|TPO_uc002qwy.1_Translation_Start_Site|TPO_uc002qwz.2_RNA	p.I632M	NM_000547	NP_000538	WXS	Illumina HiSeq	Unspecified	P07202	PERT_HUMAN		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	11	1987	+	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)	632			Extracellular (Potential).		P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Missense_Mutation	SNP	ENST00000345913.4	37	c.1896C>G	CCDS1643.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.81|10.81	1.454705|1.454705	0.26161|0.26161	.|.	.|.	ENSG00000115705|ENSG00000115705	ENST00000337415;ENST00000345913;ENST00000346956;ENST00000349624;ENST00000329066;ENST00000382201;ENST00000382198;ENST00000422464;ENST00000469607|ENST00000446278	T;T;T;T;T;T;T;T;T|.	0.74526|.	-0.85;-0.85;-0.85;-0.85;-0.85;-0.85;-0.85;-0.85;-0.85|.	4.84|4.84	-7.05|-7.05	0.01573|0.01573	.|.	0.302385|.	0.37530|.	N|.	0.002058|.	T|T	0.75975|0.75975	0.3923|0.3923	H|H	0.94183|0.94183	3.505|3.505	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.76494|.	0.999;0.999;0.999;0.999|.	D;D;D;D|.	0.80764|.	0.986;0.994;0.986;0.992|.	T|T	0.78961|0.78961	-0.1997|-0.1997	10|5	0.87932|.	D|.	0|.	-7.7439|-7.7439	7.6025|7.6025	0.28083|0.28083	0.0:0.1884:0.3156:0.496|0.0:0.1884:0.3156:0.496	.|.	632;459;575;632|.	P07202-4;P07202-5;P07202-2;P07202|.	.;.;.;PERT_HUMAN|.	M|W	632;632;632;459;632;575;459;561;106|107	ENSP00000337263:I632M;ENSP00000318820:I632M;ENSP00000263886:I632M;ENSP00000332044:I459M;ENSP00000329869:I632M;ENSP00000371636:I575M;ENSP00000371633:I459M;ENSP00000405788:I561M;ENSP00000419461:I106M|.	ENSP00000329869:I632M|.	I|S	+|+	3|2	3|0	TPO|TPO	1476708|1476708	0.118000|0.118000	0.22208|0.22208	0.093000|0.093000	0.20910|0.20910	0.014000|0.014000	0.08584|0.08584	-0.695000|-0.695000	0.05109|0.05109	-1.411000|-1.411000	0.02032|0.02032	-0.311000|-0.311000	0.09066|0.09066	ATC|TCG		0.612	TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206594.2	NM_000547		27	34	0	0	0	0.005443	0	27	34				
APOB	338	broad.mit.edu	37	2	21226018	21226018	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr2:21226018G>T	ENST00000233242.1	-	29	12403	c.12276C>A	c.(12274-12276)caC>caA	p.H4092Q	RP11-116D2.1_ENST00000567376.2_lincRNA	NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	4092					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)	p.H4092Q(1)		NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGAGCCCTGTGTGTTCCCAGT	0.473																																							uc002red.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27						c.(12274-12276)CAC>CAA		apolipoprotein B precursor	Atorvastatin(DB01076)						162.0	161.0	162.0					2																	21226018		2203	4300	6503	SO:0001583	missense	338				cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity	g.chr2:21226018G>T	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.12276C>A	2.37:g.21226018G>T	ENSP00000233242:p.His4092Gln		Somatic					p.H4092Q	NM_000384	NP_000375	WXS	Illumina HiSeq	Unspecified	P04114	APOB_HUMAN			29	12404	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		4092					O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	ENST00000233242.1	37	c.12276C>A	CCDS1703.1	.	.	.	.	.	.	.	.	.	.	G	14.75	2.628173	0.46944	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.31247	1.5	5.62	4.7	0.59300	.	0.803958	0.10977	N	0.613068	T	0.22781	0.0550	L	0.43923	1.385	0.80722	D	1	B	0.34372	0.451	B	0.26517	0.07	T	0.15521	-1.0434	10	0.52906	T	0.07	.	5.8097	0.18460	0.1814:0.2016:0.6169:0.0	.	4092	P04114	APOB_HUMAN	Q	4092	ENSP00000233242:H4092Q	ENSP00000233242:H4092Q	H	-	3	2	APOB	21079523	1.000000	0.71417	0.939000	0.37840	0.880000	0.50808	1.130000	0.31393	2.643000	0.89663	0.655000	0.94253	CAC		0.473	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1			36	219	1	0	3.11337e-16	0.002836	7.29419e-16	36	219				
EHD3	30845	broad.mit.edu	37	2	31489306	31489306	+	Silent	SNP	C	C	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr2:31489306C>T	ENST00000322054.5	+	6	1629	c.1344C>T	c.(1342-1344)taC>taT	p.Y448Y	EHD3_ENST00000541626.1_3'UTR	NM_014600.2	NP_055415.1	Q9NZN3	EHD3_HUMAN	EH-domain containing 3	448	EH. {ECO:0000255|PROSITE- ProRule:PRU00077}.				blood coagulation (GO:0007596)|endocytic recycling (GO:0032456)|protein homooligomerization (GO:0051260)|protein targeting to plasma membrane (GO:0072661)|regulation of cardiac muscle cell membrane potential (GO:0086036)	cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endosome membrane (GO:0010008)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|nucleic acid binding (GO:0003676)	p.Y448Y(1)		NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(11)|lung(12)|ovary(1)|skin(3)	33	Acute lymphoblastic leukemia(172;0.155)					AGCCCATGTACGACGAGATCT	0.602																																							uc002rnu.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(2)	2						c.(1342-1344)TAC>TAT		EH-domain containing 3							107.0	91.0	97.0					2																	31489306		2203	4300	6503	SO:0001819	synonymous_variant	30845				blood coagulation|endocytic recycling|protein homooligomerization	nucleus|plasma membrane|recycling endosome membrane	ATP binding|calcium ion binding|GTP binding|GTPase activity|nucleic acid binding|protein binding	g.chr2:31489306C>T	AF181264	CCDS1774.1	2p21	2013-01-10			ENSG00000013016	ENSG00000013016		"""EF-hand domain containing"""	3244	protein-coding gene	gene with protein product		605891		PAST3		10673336	Standard	NM_014600		Approved		uc002rnu.3	Q9NZN3	OTTHUMG00000099365	ENST00000322054.5:c.1344C>T	2.37:g.31489306C>T			Somatic				EHD3_uc010ymt.1_3'UTR	p.Y448Y	NM_014600	NP_055415	WXS	Illumina HiSeq	Unspecified	Q9NZN3	EHD3_HUMAN			6	1952	+	Acute lymphoblastic leukemia(172;0.155)		448			EH.		B4DFR5|D6W574|Q8N514|Q9NZB3	Silent	SNP	ENST00000322054.5	37	c.1344C>T	CCDS1774.1																																																																																				0.602	EHD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216810.1	NM_014600		4	32	0	0	0	0.000248	0	4	32				
DHX57	90957	broad.mit.edu	37	2	39088243	39088243	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr2:39088243C>A	ENST00000295373.6	-	5	1435	c.1309G>T	c.(1309-1311)Gtg>Ttg	p.V437L	DHX57_ENST00000479345.2_5'UTR|AC018693.6_ENST00000442829.1_RNA	NM_198963.1	NP_945314.1	Q6P158	DHX57_HUMAN	DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57	437							ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.V437L(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(20)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	62		all_hematologic(82;0.248)				AGAAAGTTCACAGGAGGGTCA	0.383																																					Melanoma(191;1090 2095 4375 23729 47341)	Melanoma(191;1090 2095 4375 23729 47341)	uc002rrf.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|lung(1)|skin(1)	3						c.(1309-1311)GTG>TTG		DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57							133.0	139.0	137.0					2																	39088243		2203	4300	6503	SO:0001583	missense	90957						ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding|zinc ion binding	g.chr2:39088243C>A	AF070590	CCDS1800.1	2p22.3	2008-02-05			ENSG00000163214	ENSG00000163214		"""DEAH-boxes"""	20086	protein-coding gene	gene with protein product							Standard	NM_198963		Approved	DDX57	uc002rrf.3	Q6P158	OTTHUMG00000102103	ENST00000295373.6:c.1309G>T	2.37:g.39088243C>A	ENSP00000295373:p.Val437Leu		Somatic				DHX57_uc002rre.2_5'UTR|DHX57_uc002rrg.2_Missense_Mutation_p.V437L	p.V437L	NM_198963	NP_945314	WXS	Illumina HiSeq	Unspecified	Q6P158	DHX57_HUMAN			5	1408	-		all_hematologic(82;0.248)	437					A2RRC7|Q53SI4|Q6P9G1|Q7Z6H3|Q8NG17|Q96M33	Missense_Mutation	SNP	ENST00000295373.6	37	c.1309G>T	CCDS1800.1	.	.	.	.	.	.	.	.	.	.	C	4.144	0.025106	0.08054	.	.	ENSG00000163214	ENST00000295373;ENST00000355320	T	0.02709	4.19	5.67	1.72	0.24424	.	1.074330	0.07280	N	0.870547	T	0.01870	0.0059	N	0.19112	0.55	0.09310	N	1	B;B	0.17852	0.024;0.0	B;B	0.16722	0.016;0.003	T	0.49890	-0.8891	10	0.09590	T	0.72	.	1.8724	0.03211	0.2324:0.4582:0.1131:0.1962	.	437;437	Q6P158-2;Q6P158	.;DHX57_HUMAN	L	437;335	ENSP00000295373:V437L	ENSP00000295373:V437L	V	-	1	0	DHX57	38941747	0.000000	0.05858	0.180000	0.23079	0.333000	0.28666	-0.242000	0.08928	0.304000	0.22809	-0.122000	0.15005	GTG		0.383	DHX57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219940.2	NM_145646		46	90	1	0	2.81731e-22	0.00361	7.21935e-22	46	90				
ABCG5	64240	broad.mit.edu	37	2	44051104	44051104	+	Nonsense_Mutation	SNP	G	G	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr2:44051104G>T	ENST00000260645.1	-	9	1411	c.1272C>A	c.(1270-1272)taC>taA	p.Y424*	ABCG5_ENST00000405322.1_Nonsense_Mutation_p.Y253*|ABCG5_ENST00000543989.1_Nonsense_Mutation_p.Y29*	NM_022436.2	NP_071881.1	Q9H222	ABCG5_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 5	424	ABC transmembrane type-2.				ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|excretion (GO:0007588)|intestinal cholesterol absorption (GO:0030299)|negative regulation of intestinal cholesterol absorption (GO:0045796)|negative regulation of intestinal phytosterol absorption (GO:0010949)|response to drug (GO:0042493)|response to ionizing radiation (GO:0010212)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|cholesterol transporter activity (GO:0017127)|protein heterodimerization activity (GO:0046982)	p.Y424*(1)		breast(1)|kidney(2)|large_intestine(4)|liver(1)|lung(19)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	33		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)			Ezetimibe(DB00973)	CCACAAACTGGTAAAGGAGAC	0.527																																							uc002rtn.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)|skin(1)	2						c.(1270-1272)TAC>TAA		ATP-binding cassette sub-family G member 5							101.0	82.0	88.0					2																	44051104		2203	4300	6503	SO:0001587	stop_gained	64240				cholesterol efflux|cholesterol homeostasis|excretion|lipid metabolic process|negative regulation of intestinal cholesterol absorption|negative regulation of intestinal phytosterol absorption	apical plasma membrane|integral to membrane	ATP binding|ATPase activity|protein heterodimerization activity	g.chr2:44051104G>T	T93792	CCDS1814.1	2p21	2012-03-14	2008-07-31		ENSG00000138075	ENSG00000138075		"""ATP binding cassette transporters / subfamily G"""	13886	protein-coding gene	gene with protein product	"""sterolin 1"""	605459				11099417, 11452359	Standard	NM_022436		Approved	STSL	uc002rtn.3	Q9H222	OTTHUMG00000128758	ENST00000260645.1:c.1272C>A	2.37:g.44051104G>T	ENSP00000260645:p.Tyr424*		Somatic				ABCG5_uc002rtm.2_Nonsense_Mutation_p.Y29*|ABCG5_uc002rto.2_Nonsense_Mutation_p.Y253*|ABCG5_uc002rtp.2_Nonsense_Mutation_p.Y29*	p.Y424*	NM_022436	NP_071881	WXS	Illumina HiSeq	Unspecified	Q9H222	ABCG5_HUMAN			9	1412	-		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	424			Helical; Name=2; (Potential).|ABC transmembrane type-2.		Q2T9G2|Q96QZ2|Q96QZ3	Nonsense_Mutation	SNP	ENST00000260645.1	37	c.1272C>A	CCDS1814.1	.	.	.	.	.	.	.	.	.	.	g	43	9.861866	0.99281	.	.	ENSG00000138075	ENST00000260645;ENST00000405322;ENST00000543989	.	.	.	5.9	4.06	0.47325	.	2.871980	0.01752	N	0.029981	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.20046	T	0.44	.	13.041	0.58899	0.1349:0.0:0.8651:0.0	.	.	.	.	X	424;253;29	.	ENSP00000260645:Y424X	Y	-	3	2	ABCG5	43904608	1.000000	0.71417	1.000000	0.80357	0.075000	0.17131	2.540000	0.45727	1.466000	0.48025	0.651000	0.88453	TAC		0.527	ABCG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250675.1	NM_022436		22	37	1	0	2.98393e-07	0.00278	5.38609e-07	22	37				
MSH2	4436	broad.mit.edu	37	2	47690292	47690292	+	Splice_Site	SNP	T	T	C			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr2:47690292T>C	ENST00000233146.2	+	9	1732	c.1509T>C	c.(1507-1509)ctT>ctC	p.L503L	MSH2_ENST00000406134.1_Splice_Site_p.L503L|MSH2_ENST00000543555.1_Splice_Site_p.L437L	NM_000251.2	NP_000242.1	P43246	MSH2_HUMAN	mutS homolog 2	503					ATP catabolic process (GO:0006200)|B cell differentiation (GO:0030183)|B cell mediated immunity (GO:0019724)|cell cycle arrest (GO:0007050)|determination of adult lifespan (GO:0008340)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|germ cell development (GO:0007281)|in utero embryonic development (GO:0001701)|intra-S DNA damage checkpoint (GO:0031573)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|isotype switching (GO:0045190)|maintenance of DNA repeat elements (GO:0043570)|male gonad development (GO:0008584)|meiotic gene conversion (GO:0006311)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of reciprocal meiotic recombination (GO:0045128)|oxidative phosphorylation (GO:0006119)|positive regulation of helicase activity (GO:0051096)|postreplication repair (GO:0006301)|response to UV-B (GO:0010224)|response to X-ray (GO:0010165)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	membrane (GO:0016020)|MutSalpha complex (GO:0032301)|MutSbeta complex (GO:0032302)|nuclear chromosome (GO:0000228)	ATP binding (GO:0005524)|centromeric DNA binding (GO:0019237)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|double-strand/single-strand DNA junction binding (GO:0000406)|enzyme binding (GO:0019899)|guanine/thymine mispair binding (GO:0032137)|heteroduplex DNA loop binding (GO:0000404)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|Y-form DNA binding (GO:0000403)	p.0?(2)|p.?(2)|p.L503L(1)		NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(9)|kidney(5)|large_intestine(50)|lung(18)|ovary(5)|prostate(2)|skin(3)|small_intestine(1)|stomach(2)|urinary_tract(1)	112		all_hematologic(82;0.0359)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			CCAGAGATCTTGGTAAGAATG	0.338			"""D, Mis, N, F, S"""		"""colorectal, endometrial, ovarian"""	"""colorectal, endometrial, ovarian"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																														uc002rvy.1		NA	yes	Rec	yes	Hereditary non-polyposis colorectal cancer	2	2p22-p21	4436	D|Mis|N|F|S	mutS homolog 2 (E. coli)			E		colorectal|endometrial|ovarian	colorectal|endometrial|ovarian		5	Whole gene deletion(2)|Unknown(2)|Substitution - coding silent(1)	p.?(2)	haematopoietic_and_lymphoid_tissue(3)|lung(1)|prostate(1)	large_intestine(33)|haematopoietic_and_lymphoid_tissue(6)|endometrium(4)|ovary(3)|cervix(2)|central_nervous_system(2)|stomach(1)|small_intestine(1)|breast(1)|skin(1)|prostate(1)	55						c.(1507-1509)CTT>CTC	MMR	mutS homolog 2							91.0	95.0	94.0					2																	47690292		2203	4299	6502	SO:0001630	splice_region_variant	4436	Lynch_syndrome|Muir-Torre_syndrome|Turcot_syndrome|Constitutional_Mismatch_Repair_Deficiency_Syndrome	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	B cell differentiation|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|double-strand break repair|intra-S DNA damage checkpoint|isotype switching|maintenance of DNA repeat elements|male gonad development|meiotic gene conversion|meiotic mismatch repair|negative regulation of neuron apoptosis|negative regulation of reciprocal meiotic recombination|positive regulation of helicase activity|postreplication repair|response to UV-B|response to X-ray|somatic hypermutation of immunoglobulin genes	MutSalpha complex|MutSbeta complex|nuclear chromosome	ATP binding|DNA-dependent ATPase activity|double-strand/single-strand DNA junction binding|guanine/thymine mispair binding|loop DNA binding|protein C-terminus binding|protein homodimerization activity|protein kinase binding|Y-form DNA binding	g.chr2:47690292T>C	U03911	CCDS1834.1, CCDS58709.1	2p21	2014-09-17	2013-09-12		ENSG00000095002	ENSG00000095002			7325	protein-coding gene	gene with protein product		609309	"""mutS (E. coli) homolog 2 (colon cancer, nonpolyposis type 1)"", ""mutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli)"""	COCA1		8484120, 9843200	Standard	NM_000251		Approved	HNPCC, HNPCC1	uc002rvy.2	P43246	OTTHUMG00000128861	ENST00000233146.2:c.1510+1T>C	2.37:g.47690292T>C			Somatic				MSH2_uc010yoh.1_Silent_p.L437L|MSH2_uc002rvz.2_Silent_p.L503L|MSH2_uc010fbg.2_Silent_p.L313L|MSH2_uc010fbh.1_RNA|MSH2_uc010fbi.1_RNA	p.L503L	NM_000251	NP_000242	WXS	Illumina HiSeq	Unspecified	P43246	MSH2_HUMAN	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		9	1577	+		all_hematologic(82;0.0359)|Acute lymphoblastic leukemia(82;0.175)	503					B4E2Z2|O75488	Silent	SNP	ENST00000233146.2	37	c.1509T>C	CCDS1834.1																																																																																				0.338	MSH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250805.3		Silent	23	81	0	0	0	0.005443	0	23	81				
WDPCP	51057	broad.mit.edu	37	2	63380691	63380691	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr2:63380691C>G	ENST00000272321.7	-	16	2624	c.2097G>C	c.(2095-2097)agG>agC	p.R699S	WDPCP_ENST00000398544.3_Missense_Mutation_p.R540S|WDPCP_ENST00000409199.1_Missense_Mutation_p.R507S|WDPCP_ENST00000409120.1_Missense_Mutation_p.R507S	NM_015910.5	NP_056994.3	O95876	FRITZ_HUMAN	WD repeat containing planar cell polarity effector	699					auditory receptor cell morphogenesis (GO:0002093)|camera-type eye development (GO:0043010)|cardiovascular system development (GO:0072358)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|digestive system development (GO:0055123)|embryonic digit morphogenesis (GO:0042733)|establishment of protein localization (GO:0045184)|glomerular visceral epithelial cell migration (GO:0090521)|kidney development (GO:0001822)|palate development (GO:0060021)|regulation of embryonic cell shape (GO:0016476)|regulation of establishment of cell polarity (GO:2000114)|regulation of fibroblast migration (GO:0010762)|regulation of focal adhesion assembly (GO:0051893)|regulation of protein localization (GO:0032880)|regulation of ruffle assembly (GO:1900027)|respiratory system development (GO:0060541)|septin cytoskeleton organization (GO:0032185)|smoothened signaling pathway (GO:0007224)	axonemal basal plate (GO:0097541)|axoneme (GO:0005930)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)		p.R699S(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(19)|ovary(1)|skin(1)	35						CAAGTTCATTCCTTCTGTCAA	0.294																																							uc002sch.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2095-2097)AGG>AGC		hypothetical protein LOC51057 isoform 2							86.0	80.0	82.0					2																	63380691		1798	4058	5856	SO:0001583	missense	51057				cilium morphogenesis|regulation of embryonic cell shape|regulation of protein localization|septin cytoskeleton organization	cilium axoneme|cytoplasm|cytoskeleton|plasma membrane		g.chr2:63380691C>G		CCDS42688.1, CCDS46301.1	2p15	2014-04-24	2011-02-01	2011-02-01	ENSG00000143951	ENSG00000143951			28027	protein-coding gene	gene with protein product		613580	"""chromosome 2 open reading frame 86"""	C2orf86		15654087, 20671153	Standard	NM_015910		Approved	hFrtz, fritz, BBS15	uc002sch.3	O95876	OTTHUMG00000152566	ENST00000272321.7:c.2097G>C	2.37:g.63380691C>G	ENSP00000272321:p.Arg699Ser		Somatic				C2orf86_uc002sce.2_RNA|C2orf86_uc002scf.2_Missense_Mutation_p.R540S|C2orf86_uc010ypu.1_RNA|C2orf86_uc002scg.2_Missense_Mutation_p.R507S	p.R699S	NM_015910	NP_056994	WXS	Illumina HiSeq	Unspecified	O95876	FRITZ_HUMAN			16	2543	-			699					Q53RW4|Q7Z2Z3	Missense_Mutation	SNP	ENST00000272321.7	37	c.2097G>C	CCDS42688.1	.	.	.	.	.	.	.	.	.	.	C	0.015	-1.562941	0.00903	.	.	ENSG00000143951	ENST00000272321;ENST00000409199;ENST00000409120;ENST00000398544	T;T;T;T	0.72505	-0.66;-0.08;-0.08;-0.08	4.57	-3.39	0.04868	.	.	.	.	.	T	0.49115	0.1538	N	0.14661	0.345	0.09310	N	1	B;B	0.30281	0.18;0.275	B;B	0.25405	0.017;0.06	T	0.26744	-1.0094	9	0.62326	D	0.03	-0.5444	10.4749	0.44659	0.0:0.3924:0.0:0.6076	.	699;540	O95876;O95876-3	FRITZ_HUMAN;.	S	699;507;507;540	ENSP00000272321:R699S;ENSP00000386592:R507S;ENSP00000386769:R507S;ENSP00000381552:R540S	ENSP00000272321:R699S	R	-	3	2	WDPCP	63234195	0.007000	0.16637	0.001000	0.08648	0.161000	0.22273	-0.042000	0.12063	-1.185000	0.02716	-1.124000	0.02001	AGG		0.294	WDPCP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326820.1	NM_015910		27	47	0	0	0	0.002836	0	27	47				
APLF	200558	broad.mit.edu	37	2	68765342	68765343	+	Nonsense_Mutation	DNP	TG	TG	AT	rs572217330		TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	TG	TG	-	-	TG	TG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr2:68765342_68765343TG>AT	ENST00000303795.4	+	7	1314_1315	c.1143_1144TG>AT	c.(1141-1146)taTGgg>taATgg	p.381_382YG>*W	APLF_ENST00000471727.1_3'UTR	NM_173545.2	NP_775816.1	Q8IW19	APLF_HUMAN	aprataxin and PNKP like factor	381					cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|double-strand break repair (GO:0006302)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of DNA ligation (GO:0051106)|regulation of isotype switching (GO:0045191)|single strand break repair (GO:0000012)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	3'-5' exonuclease activity (GO:0008408)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|endodeoxyribonuclease activity (GO:0004520)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)	p.Y381_G382>*(1)		autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(2)|lung(9)|ovary(3)|prostate(1)|skin(1)	25						CCTGCATGTATGGGGCAAACTG	0.371																																							uc002sep.2		NA																	1	Complex - deletion inframe(1)		lung(1)	ovary(2)	2						c.(1141-1146)TATGGG>TAATGG		aprataxin and PNKP like factor																																				SO:0001587	stop_gained	200558				double-strand break repair|single strand break repair	cytosol|nucleus	3'-5' exonuclease activity|DNA-(apurinic or apyrimidinic site) lyase activity|endodeoxyribonuclease activity|metal ion binding|nucleotide binding|protein binding	g.chr2:68765342_68765343TG>AT	BC030711	CCDS1888.1	2p14	2014-02-20	2008-10-01	2008-10-01	ENSG00000169621	ENSG00000169621			28724	protein-coding gene	gene with protein product	"""XRCC1-interacting protein 1"", ""zinc finger, CX5CX6HX5H motif containing 1"""	611035	"""chromosome 2 open reading frame 13"""	C2orf13		18474613, 18077224, 17353262	Standard	NM_173545		Approved	MGC47799, Xip1, ZCCHH1	uc002sep.3	Q8IW19	OTTHUMG00000129566	Exception_encountered	2.37:g.68765342_68765343delinsAT	ENSP00000307004:p.Y381_G382delins*W		Somatic				APLF_uc002seq.1_RNA|APLF_uc010fdf.2_Nonsense_Mutation_p.357_358YG>*W|APLF_uc002ser.1_Nonsense_Mutation_p.112_113YG>*W	p.381_382YG>*W	NM_173545	NP_775816	WXS	Illumina HiSeq	Unspecified	Q8IW19	APLF_HUMAN			7	1316_1317	+			381_382			PBZ-type 1.		A8K476|Q53P47|Q53PB9|Q53QU0	Nonsense_Mutation	DNP	ENST00000303795.4	37	c.1143_1144TG>AT	CCDS1888.1																																																																																				0.371	APLF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251759.1	NM_173545		22	39	0	0	0	0.004672	0	22	39				
DYSF	8291	broad.mit.edu	37	2	71801487	71801487	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr2:71801487C>T	ENST00000258104.3	+	30	3611	c.3334C>T	c.(3334-3336)Ctt>Ttt	p.L1112F	DYSF_ENST00000429174.2_Missense_Mutation_p.L1112F|DYSF_ENST00000409651.1_Missense_Mutation_p.L1144F|DYSF_ENST00000394120.2_Missense_Mutation_p.L1113F|DYSF_ENST00000409366.1_Missense_Mutation_p.L1113F|DYSF_ENST00000410041.1_Missense_Mutation_p.L1130F|DYSF_ENST00000413539.2_Missense_Mutation_p.L1143F|DYSF_ENST00000409744.1_Missense_Mutation_p.L1099F|DYSF_ENST00000409582.3_Missense_Mutation_p.L1129F|DYSF_ENST00000409762.1_Missense_Mutation_p.L1129F|DYSF_ENST00000410020.3_Missense_Mutation_p.L1130F	NM_001130976.1|NM_003494.3	NP_001124448.1|NP_003485.1	O75923	DYSF_HUMAN	dysferlin	1112					plasma membrane repair (GO:0001778)|vesicle fusion (GO:0006906)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phospholipid binding (GO:0005543)	p.L1112F(1)|p.L1130F(1)		autonomic_ganglia(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(57)|ovary(3)|pancreas(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	111						TGTGTTTGCCCTTGAGGGGGC	0.637																																							uc002sie.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|breast(2)|pancreas(1)|skin(1)	7						c.(3334-3336)CTT>TTT		dysferlin isoform 8							71.0	78.0	75.0					2																	71801487		2203	4300	6503	SO:0001583	missense	8291					cytoplasmic vesicle membrane|integral to membrane|sarcolemma	calcium-dependent phospholipid binding	g.chr2:71801487C>T	AF075575	CCDS1918.1, CCDS46323.1, CCDS46324.1, CCDS46325.1, CCDS46326.1, CCDS46327.1, CCDS46328.1, CCDS46329.1, CCDS46330.1, CCDS46331.1, CCDS46332.1	2p13.3	2014-09-17	2013-09-12		ENSG00000135636	ENSG00000135636			3097	protein-coding gene	gene with protein product	"""fer-1-like family member 1"""	603009	"""limb girdle muscular dystrophy 2B (autosomal recessive)"""	LGMD2B		8320700	Standard	NM_003494		Approved	FER1L1	uc010fen.3	O75923	OTTHUMG00000129757	ENST00000258104.3:c.3334C>T	2.37:g.71801487C>T	ENSP00000258104:p.Leu1112Phe		Somatic				DYSF_uc010feg.2_Missense_Mutation_p.L1143F|DYSF_uc010feh.2_Missense_Mutation_p.L1098F|DYSF_uc002sig.3_Missense_Mutation_p.L1098F|DYSF_uc010yqx.1_RNA|DYSF_uc010fee.2_Missense_Mutation_p.L1112F|DYSF_uc010fef.2_Missense_Mutation_p.L1129F|DYSF_uc010fei.2_Missense_Mutation_p.L1129F|DYSF_uc010fek.2_Missense_Mutation_p.L1130F|DYSF_uc010fej.2_Missense_Mutation_p.L1099F|DYSF_uc010fel.2_Missense_Mutation_p.L1099F|DYSF_uc010feo.2_Missense_Mutation_p.L1144F|DYSF_uc010fem.2_Missense_Mutation_p.L1113F|DYSF_uc010fen.2_Missense_Mutation_p.L1130F|DYSF_uc002sif.2_Missense_Mutation_p.L1113F|DYSF_uc010yqy.1_5'Flank	p.L1112F	NM_003494	NP_003485	WXS	Illumina HiSeq	Unspecified	O75923	DYSF_HUMAN			30	3710	+			1112			Cytoplasmic (Potential).		A0FK00|B1PZ70|B1PZ71|B1PZ72|B1PZ73|B1PZ74|B1PZ75|B1PZ76|B1PZ77|B1PZ78|B1PZ79|B1PZ80|B1PZ81|B3KQB9|O75696|Q09EX5|Q0H395|Q53QY3|Q53TD2|Q8TEL8|Q9UEN7	Missense_Mutation	SNP	ENST00000258104.3	37	c.3334C>T	CCDS1918.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.059424	0.76074	.	.	ENSG00000135636	ENST00000413539;ENST00000409762;ENST00000409582;ENST00000429174;ENST00000258104;ENST00000409651;ENST00000394120;ENST00000409744;ENST00000409366;ENST00000410020;ENST00000410041	D;D;D;D;D;D;D;D;D;D;D	0.85861	-2.03;-2.04;-2.03;-2.02;-2.03;-2.03;-2.03;-2.03;-2.02;-2.03;-2.04	5.6	5.6	0.85130	.	0.000000	0.64402	D	0.000001	D	0.91533	0.7326	M	0.82056	2.57	0.41074	D	0.985478	D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;0.999;0.998;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.97110	1.0;0.999;0.999;0.999;1.0;1.0;1.0;0.997;0.999;0.991;0.983;0.986;1.0;0.998	D	0.91888	0.5521	10	0.62326	D	0.03	-32.542	10.5268	0.44954	0.0:0.9123:0.0:0.0877	.	1144;1130;1113;1099;1130;1099;1129;1098;1143;1129;1112;1098;1113;1112	O75923-8;O75923-13;O75923-10;O75923-9;O75923-11;O75923-12;O75923-5;O75923-6;O75923-2;O75923-7;O75923-4;O75923-3;O75923-14;O75923	.;.;.;.;.;.;.;.;.;.;.;.;.;DYSF_HUMAN	F	1143;1129;1129;1112;1112;1144;1113;1099;1113;1130;1130	ENSP00000407046:L1143F;ENSP00000387137:L1129F;ENSP00000386547:L1129F;ENSP00000398305:L1112F;ENSP00000258104:L1112F;ENSP00000386683:L1144F;ENSP00000377678:L1113F;ENSP00000386285:L1099F;ENSP00000386512:L1113F;ENSP00000386881:L1130F;ENSP00000386617:L1130F	ENSP00000258104:L1112F	L	+	1	0	DYSF	71654995	0.997000	0.39634	1.000000	0.80357	0.970000	0.65996	2.481000	0.45215	2.627000	0.88993	0.650000	0.86243	CTT		0.637	DYSF-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251970.3	NM_003494		19	104	0	0	0	0.001523	0	19	104				
ALMS1	7840	broad.mit.edu	37	2	73677380	73677380	+	Silent	SNP	A	A	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr2:73677380A>T	ENST00000264448.6	+	8	3834	c.3723A>T	c.(3721-3723)acA>acT	p.T1241T	ALMS1_ENST00000409009.1_Silent_p.T1199T|ALMS1_ENST00000377715.1_Silent_p.T1241T	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	1241	34 X 47 AA approximate tandem repeat.				endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)		p.T1241T(1)		breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						ACTCACACACAGAGAAGCCTG	0.468																																							uc002sje.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(3)|ovary(2)|breast(2)|pancreas(1)|lung(1)	9						c.(3727-3729)ACA>ACT		Alstrom syndrome 1							84.0	86.0	85.0					2																	73677380		1863	4103	5966	SO:0001819	synonymous_variant	7840				G2/M transition of mitotic cell cycle	centrosome|cilium|cytosol|microtubule basal body|spindle pole		g.chr2:73677380A>T	AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.3723A>T	2.37:g.73677380A>T			Somatic				ALMS1_uc002sjf.1_Silent_p.T1199T|ALMS1_uc002sjg.2_Silent_p.T629T|ALMS1_uc002sjh.1_Silent_p.T629T	p.T1243T	NM_015120	NP_055935	WXS	Illumina HiSeq	Unspecified	Q8TCU4	ALMS1_HUMAN			10	3840	+			1241			15.|34 X 47 AA approximate tandem repeat.		Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Silent	SNP	ENST00000264448.6	37	c.3729A>T	CCDS42697.1																																																																																				0.468	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327776.1	NM_015120		58	110	0	0	0	0.00361	0	58	110				
REG1B	5968	broad.mit.edu	37	2	79313600	79313600	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr2:79313600G>T	ENST00000305089.3	-	4	294	c.214C>A	c.(214-216)Ctg>Atg	p.L72M		NM_006507.3	NP_006498.1	P48304	REG1B_HUMAN	regenerating islet-derived 1 beta	72	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cell proliferation (GO:0008283)	extracellular vesicular exosome (GO:0070062)	carbohydrate binding (GO:0030246)	p.L72M(1)		central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(40)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	51						ACAGACACCAGGTTGCCTGAA	0.522																																							uc002sny.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)|skin(1)	2						c.(214-216)CTG>ATG		regenerating islet-derived 1 beta precursor							120.0	111.0	114.0					2																	79313600		2203	4300	6503	SO:0001583	missense	5968				cell proliferation	extracellular region	sugar binding	g.chr2:79313600G>T		CCDS1963.1	2p12	2008-06-04	2008-06-04		ENSG00000172023	ENSG00000172023			9952	protein-coding gene	gene with protein product	"""lithostathine 1 beta"", ""secretory pancreatic stone protein 2"""	167771	"""regenerating islet-derived 1 beta (pancreatic stone protein, pancreatic thread protein)"""			8110835	Standard	NM_006507		Approved	REGL, PSPS2, REGH, REGI-BETA	uc002sny.2	P48304	OTTHUMG00000130019	ENST00000305089.3:c.214C>A	2.37:g.79313600G>T	ENSP00000303206:p.Leu72Met		Somatic				REG1B_uc010ffv.1_Missense_Mutation_p.L72M|REG1B_uc010ffw.2_3'UTR	p.L72M	NM_006507	NP_006498	WXS	Illumina HiSeq	Unspecified	P48304	REG1B_HUMAN			4	326	-			72			C-type lectin.			Missense_Mutation	SNP	ENST00000305089.3	37	c.214C>A	CCDS1963.1	.	.	.	.	.	.	.	.	.	.	g	18.42	3.619767	0.66787	.	.	ENSG00000172023	ENST00000454188;ENST00000305089	T;T	0.38887	1.11;1.11	3.51	0.747	0.18371	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.000000	0.30210	N	0.010143	T	0.68897	0.3051	H	0.96430	3.82	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	T	0.59516	-0.7440	10	0.87932	D	0	.	6.124	0.20170	0.3199:0.0:0.6801:0.0	.	72;72	Q6ICS1;P48304	.;REG1B_HUMAN	M	23;72	ENSP00000387410:L23M;ENSP00000303206:L72M	ENSP00000303206:L72M	L	-	1	2	REG1B	79167108	0.000000	0.05858	0.004000	0.12327	0.985000	0.73830	-0.308000	0.08156	0.017000	0.15025	0.491000	0.48974	CTG		0.522	REG1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252292.2	NM_006507		32	94	1	0	1.22384e-17	0.002836	2.93925e-17	32	94				
SMYD1	150572	broad.mit.edu	37	2	88407897	88407897	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr2:88407897T>A	ENST00000419482.2	+	9	1238	c.1153T>A	c.(1153-1155)Tac>Aac	p.Y385N	SMYD1_ENST00000444564.2_Missense_Mutation_p.Y372N|SMYD1_ENST00000438570.1_Intron	NM_198274.3	NP_938015.1	Q8NB12	SMYD1_HUMAN	SET and MYND domain containing 1	385					chromatin remodeling (GO:0006338)|heart development (GO:0007507)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of myotube differentiation (GO:0010831)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)	p.Y385N(1)		NS(1)|breast(4)|central_nervous_system(1)|large_intestine(6)|lung(19)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	41						CAGGAAGCTCTACCACCCCAA	0.473																																							uc002ssr.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|lung(1)|skin(1)	4						c.(1153-1155)TAC>AAC		SET and MYND domain containing 1							92.0	82.0	85.0					2																	88407897		2203	4300	6503	SO:0001583	missense	150572				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|zinc ion binding	g.chr2:88407897T>A	AF086123	CCDS33240.1	2p11.1	2011-07-01			ENSG00000115593	ENSG00000115593		"""Zinc fingers, MYND-type"", ""Chromatin-modifying enzymes / K-methyltransferases"""	20986	protein-coding gene	gene with protein product		606846				11923873	Standard	NM_198274		Approved	BOP, ZMYND22, KMT3D	uc002ssr.3	Q8NB12	OTTHUMG00000155045	ENST00000419482.2:c.1153T>A	2.37:g.88407897T>A	ENSP00000393453:p.Tyr385Asn		Somatic				SMYD1_uc002ssq.1_Intron|SMYD1_uc002sss.2_Missense_Mutation_p.Y81N	p.Y385N	NM_198274	NP_938015	WXS	Illumina HiSeq	Unspecified	Q8NB12	SMYD1_HUMAN			9	1155	+			385					A0AV30|A6NE13	Missense_Mutation	SNP	ENST00000419482.2	37	c.1153T>A	CCDS33240.1	.	.	.	.	.	.	.	.	.	.	t	18.99	3.740051	0.69304	.	.	ENSG00000115593	ENST00000419482;ENST00000444564;ENST00000295833	T;T	0.38240	1.15;1.23	4.89	4.89	0.63831	.	0.000000	0.85682	D	0.000000	T	0.59797	0.2220	M	0.76574	2.34	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.65055	-0.6261	10	0.87932	D	0	-24.7107	13.6969	0.62585	0.0:0.0:0.0:1.0	.	385	Q8NB12	SMYD1_HUMAN	N	385;372;206	ENSP00000393453:Y385N;ENSP00000407888:Y372N	ENSP00000295833:Y206N	Y	+	1	0	SMYD1	88189012	1.000000	0.71417	0.999000	0.59377	0.693000	0.40251	5.949000	0.70257	1.835000	0.53391	0.473000	0.43528	TAC		0.473	SMYD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338229.2	XM_097915		5	40	0	0	0	0.001168	0	5	40				
DPP10	57628	broad.mit.edu	37	2	116525943	116525943	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr2:116525943G>T	ENST00000410059.1	+	13	1664	c.1184G>T	c.(1183-1185)cGt>cTt	p.R395L	DPP10_ENST00000393147.2_Missense_Mutation_p.R399L|DPP10_ENST00000310323.8_Missense_Mutation_p.R388L|DPP10_ENST00000409163.1_Missense_Mutation_p.R345L	NM_001178037.1|NM_020868.3	NP_001171508.1|NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl-peptidase 10 (non-functional)	395						integral component of membrane (GO:0016021)|membrane (GO:0016020)	serine-type peptidase activity (GO:0008236)	p.R388L(1)|p.R395L(1)		breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(24)|liver(2)|lung(48)|ovary(6)|prostate(1)|skin(5)|soft_tissue(1)	101						CAAGGGGGACGTGGAGAATTT	0.458																																							uc002tla.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(5)|large_intestine(2)|skin(2)|breast(1)	10						c.(1183-1185)CGT>CTT		dipeptidyl peptidase 10 isoform long							147.0	141.0	143.0					2																	116525943		2203	4300	6503	SO:0001583	missense	57628				proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity	g.chr2:116525943G>T	AY172661	CCDS33278.1, CCDS46400.1, CCDS54388.1, CCDS54389.1	2q14.1	2010-05-04	2010-05-04		ENSG00000175497	ENSG00000175497			20823	protein-coding gene	gene with protein product		608209	"""dipeptidylpeptidase 10"", ""dipeptidyl-peptidase 10"""			10819331, 12662155	Standard	NM_020868		Approved	DPRP3	uc002tle.3	Q8N608	OTTHUMG00000153294	ENST00000410059.1:c.1184G>T	2.37:g.116525943G>T	ENSP00000386565:p.Arg395Leu		Somatic				DPP10_uc002tlb.1_Missense_Mutation_p.R345L|DPP10_uc002tlc.1_Missense_Mutation_p.R391L|DPP10_uc002tle.2_Missense_Mutation_p.R399L|DPP10_uc002tlf.1_Missense_Mutation_p.R388L	p.R395L	NM_020868	NP_065919	WXS	Illumina HiSeq	Unspecified	Q8N608	DPP10_HUMAN			13	1641	+			395			Extracellular (Potential).		A8K1Q2|J3KPP2|J3KQ46|Q0GLB8|Q53QT3|Q53S86|Q53SL8|Q53SS4|Q6TTV4|Q86YR9|Q9P236	Missense_Mutation	SNP	ENST00000410059.1	37	c.1184G>T	CCDS46400.1	.	.	.	.	.	.	.	.	.	.	G	28.2	4.901494	0.92035	.	.	ENSG00000175497	ENST00000410059;ENST00000409163;ENST00000393147;ENST00000310323;ENST00000476155	T;T;T;T	0.29917	1.55;1.55;1.55;1.55	5.25	5.25	0.73442	Peptidase S9B, dipeptidylpeptidase IV N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.55800	0.1943	M	0.76002	2.32	0.80722	D	1	D;D;D;D	0.67145	0.995;0.962;0.996;0.996	P;P;D;D	0.65987	0.87;0.562;0.92;0.94	T	0.58713	-0.7588	10	0.72032	D	0.01	-14.1906	17.5891	0.87991	0.0:0.0:1.0:0.0	.	388;399;391;395	Q8N608-2;Q0GLB8;Q0GLB9;Q8N608	.;.;.;DPP10_HUMAN	L	395;345;399;388;345	ENSP00000386565:R395L;ENSP00000387038:R345L;ENSP00000376855:R399L;ENSP00000309066:R388L	ENSP00000309066:R388L	R	+	2	0	DPP10	116242413	1.000000	0.71417	0.996000	0.52242	0.980000	0.70556	8.473000	0.90410	2.724000	0.93272	0.655000	0.94253	CGT		0.458	DPP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330580.4	NM_020868		12	93	1	0	2.62699e-14	0.003163	5.71171e-14	12	93				
CNTNAP5	129684	broad.mit.edu	37	2	125555740	125555740	+	Silent	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr2:125555740C>A	ENST00000431078.1	+	19	3421	c.3057C>A	c.(3055-3057)acC>acA	p.T1019T		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	1019	Laminin G-like 4. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)		p.T1019T(1)		NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		ATCCTGTGACCAAGAATATAA	0.443																																							uc002tno.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(10)	10						c.(3055-3057)ACC>ACA		contactin associated protein-like 5 precursor							141.0	130.0	134.0					2																	125555740		1923	4118	6041	SO:0001819	synonymous_variant	129684				cell adhesion|signal transduction	integral to membrane	receptor binding	g.chr2:125555740C>A	AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.3057C>A	2.37:g.125555740C>A			Somatic				CNTNAP5_uc010flu.2_Silent_p.T1020T	p.T1019T	NM_130773	NP_570129	WXS	Illumina HiSeq	Unspecified	Q8WYK1	CNTP5_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.248)	19	3421	+			1019			Extracellular (Potential).|Laminin G-like 4.		Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Silent	SNP	ENST00000431078.1	37	c.3057C>A	CCDS46401.1																																																																																				0.443	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330864.3			16	38	1	0	2.23348e-06	0.004007	3.88491e-06	16	38				
LCT	3938	broad.mit.edu	37	2	136570154	136570154	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr2:136570154C>A	ENST00000264162.2	-	7	2090	c.2080G>T	c.(2080-2082)Gcc>Tcc	p.A694S	Y_RNA_ENST00000363794.1_RNA	NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	694	4 X approximate repeats.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)	p.A694S(1)		breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	TTTTGTGGGGCGTTGCTGATG	0.547																																							uc002tuu.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(7)|central_nervous_system(2)|skin(2)|pancreas(1)|lung(1)	13						c.(2080-2082)GCC>TCC		lactase-phlorizin hydrolase preproprotein							98.0	91.0	93.0					2																	136570154		2203	4300	6503	SO:0001583	missense	3938				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|integral to plasma membrane|membrane fraction	cation binding|glycosylceramidase activity|lactase activity	g.chr2:136570154C>A	X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.2080G>T	2.37:g.136570154C>A	ENSP00000264162:p.Ala694Ser		Somatic					p.A694S	NM_002299	NP_002290	WXS	Illumina HiSeq	Unspecified	P09848	LPH_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.169)	7	2091	-			694			Extracellular (Potential).|4 X approximate repeats.|2.		Q4ZG58	Missense_Mutation	SNP	ENST00000264162.2	37	c.2080G>T	CCDS2178.1	.	.	.	.	.	.	.	.	.	.	C	0.012	-1.660835	0.00772	.	.	ENSG00000115850	ENST00000264162;ENST00000455227	T	0.32272	1.46	5.49	2.76	0.32466	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.425083	0.22470	N	0.059640	T	0.15132	0.0365	N	0.20881	0.62	0.09310	N	1	B	0.18310	0.027	B	0.18561	0.022	T	0.30475	-0.9977	10	0.10111	T	0.7	-8.392	4.4279	0.11513	0.2341:0.4885:0.0:0.2774	.	694	P09848	LPH_HUMAN	S	694;126	ENSP00000264162:A694S	ENSP00000264162:A694S	A	-	1	0	LCT	136286624	0.000000	0.05858	0.001000	0.08648	0.065000	0.16274	-0.175000	0.09825	0.303000	0.22785	0.655000	0.94253	GCC		0.547	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254657.1	NM_002299		16	66	1	0	8.28177e-16	0.007413	1.90913e-15	16	66				
GALNT13	114805	broad.mit.edu	37	2	155265538	155265538	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr2:155265538C>A	ENST00000392825.3	+	11	1906	c.1339C>A	c.(1339-1341)Cgc>Agc	p.R447S	GALNT13_ENST00000409237.1_Missense_Mutation_p.R447S|GALNT13_ENST00000487047.1_3'UTR	NM_052917.2	NP_443149.2	Q8IUC8	GLT13_HUMAN	polypeptide N-acetylgalactosaminyltransferase 13	447	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.R447S(1)		NS(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(6)|lung(37)|ovary(3)|pancreas(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	65						CAACATGGGCCGCAAGGAAAA	0.368																																							uc002tyr.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|pancreas(2)|central_nervous_system(1)|skin(1)	6						c.(1339-1341)CGC>AGC		UDP-N-acetyl-alpha-D-galactosamine:polypeptide							122.0	121.0	121.0					2																	155265538		2203	4300	6503	SO:0001583	missense	114805					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding	g.chr2:155265538C>A	AB067505	CCDS2199.1	2q24.1	2014-03-13	2014-03-13		ENSG00000144278	ENSG00000144278	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	23242	protein-coding gene	gene with protein product	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13"", ""polypeptide GalNAc transferase 13"""	608369	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13 (GalNAc-T13)"""			11572484, 12407114	Standard	XM_005246267		Approved	KIAA1918, GalNAc-T13	uc002tyr.4	Q8IUC8	OTTHUMG00000131917	ENST00000392825.3:c.1339C>A	2.37:g.155265538C>A	ENSP00000376570:p.Arg447Ser		Somatic				GALNT13_uc002tyt.3_Missense_Mutation_p.R447S|GALNT13_uc010foc.1_Missense_Mutation_p.R266S|GALNT13_uc010fod.2_Missense_Mutation_p.R200S	p.R447S	NM_052917	NP_443149	WXS	Illumina HiSeq	Unspecified	Q8IUC8	GLT13_HUMAN			11	1906	+			447			Ricin B-type lectin.|Lumenal (Potential).		Q08ER7|Q68VI8|Q6ZWG1|Q96PX0|Q9UIE5	Missense_Mutation	SNP	ENST00000392825.3	37	c.1339C>A	CCDS2199.1	.	.	.	.	.	.	.	.	.	.	C	18.63	3.665175	0.67700	.	.	ENSG00000144278	ENST00000392825;ENST00000409237;ENST00000422126	T;T	0.76709	-1.04;-1.04	5.18	5.18	0.71444	Ricin B-related lectin (1);Ricin B lectin (3);	0.105263	0.64402	D	0.000005	T	0.77883	0.4197	L	0.58510	1.815	0.80722	D	1	P;P;P;P	0.51791	0.937;0.948;0.808;0.948	P;B;B;B	0.49047	0.599;0.384;0.443;0.384	T	0.76732	-0.2851	10	0.36615	T	0.2	.	11.617	0.51096	0.1778:0.8222:0.0:0.0	.	447;447;447;447	Q8IUC8-2;B3KY85;Q08ER7;Q8IUC8	.;.;.;GLT13_HUMAN	S	447;447;6	ENSP00000376570:R447S;ENSP00000387239:R447S	ENSP00000376570:R447S	R	+	1	0	GALNT13	154973784	0.998000	0.40836	1.000000	0.80357	0.999000	0.98932	1.925000	0.40074	2.564000	0.86499	0.650000	0.86243	CGC		0.368	GALNT13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254870.2	NM_052917		31	72	1	0	1.42033e-22	0.004289	3.67239e-22	31	72				
KCNJ3	3760	broad.mit.edu	37	2	155711609	155711609	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr2:155711609G>T	ENST00000295101.2	+	3	1767	c.1290G>T	c.(1288-1290)ttG>ttT	p.L430F		NM_001260509.1|NM_002239.3	NP_001247438.1|NP_002230.1	P48549	KCNJ3_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 3	430					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|response to electrical stimulus (GO:0051602)|synaptic transmission (GO:0007268)	external side of plasma membrane (GO:0009897)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated potassium channel complex (GO:0008076)	G-protein activated inward rectifier potassium channel activity (GO:0015467)	p.L430F(1)		breast(2)|endometrium(2)|kidney(3)|large_intestine(9)|lung(30)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	54					Halothane(DB01159)	CCTACAGCTTGGGAGACTTGC	0.403																																							uc002tyv.1		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|pancreas(1)	2						c.(1288-1290)TTG>TTT		potassium inwardly-rectifying channel J3	Halothane(DB01159)						66.0	74.0	71.0					2																	155711609		2201	4298	6499	SO:0001583	missense	3760				synaptic transmission	voltage-gated potassium channel complex	G-protein activated inward rectifier potassium channel activity|protein binding	g.chr2:155711609G>T	U50964	CCDS2200.1, CCDS58733.1	2q24.1	2011-07-05			ENSG00000162989	ENSG00000162989		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6264	protein-coding gene	gene with protein product		601534				8088798, 16382105	Standard	NM_002239		Approved	Kir3.1, GIRK1, KGA	uc002tyv.2	P48549	OTTHUMG00000131937	ENST00000295101.2:c.1290G>T	2.37:g.155711609G>T	ENSP00000295101:p.Leu430Phe		Somatic				KCNJ3_uc010zce.1_3'UTR	p.L430F	NM_002239	NP_002230	WXS	Illumina HiSeq	Unspecified	P48549	IRK3_HUMAN			3	1485	+			430			Cytoplasmic (By similarity).		B4DEW7|Q8TBI0	Missense_Mutation	SNP	ENST00000295101.2	37	c.1290G>T	CCDS2200.1	.	.	.	.	.	.	.	.	.	.	G	9.695	1.152839	0.21371	.	.	ENSG00000162989	ENST00000295101	D	0.89485	-2.52	5.95	4.17	0.49024	.	0.195558	0.45126	D	0.000393	T	0.80513	0.4637	N	0.19112	0.55	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.73046	-0.4106	10	0.39692	T	0.17	.	11.7768	0.51991	0.1408:0.0:0.8592:0.0	.	430	P48549	IRK3_HUMAN	F	430	ENSP00000295101:L430F	ENSP00000295101:L430F	L	+	3	2	KCNJ3	155419855	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	0.694000	0.25512	0.861000	0.35504	-0.142000	0.14014	TTG		0.403	KCNJ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254890.2	NM_002239		28	121	1	0	5.61819e-17	0.005443	1.33258e-16	28	121				
ABCB11	8647	broad.mit.edu	37	2	169792745	169792745	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr2:169792745C>G	ENST00000263817.6	-	22	2933	c.2809G>C	c.(2809-2811)Gga>Cga	p.G937R		NM_003742.2	NP_003733.2	O95342	ABCBB_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 11	937	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				bile acid and bile salt transport (GO:0015721)|bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|canalicular bile acid transport (GO:0015722)|small molecule metabolic process (GO:0044281)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|bile acid-exporting ATPase activity (GO:0015432)|canalicular bile acid transmembrane transporter activity (GO:0015126)|sodium-exporting ATPase activity, phosphorylative mechanism (GO:0008554)|transporter activity (GO:0005215)	p.G937R(1)		breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(16)|lung(26)|ovary(3)|stomach(1)	57					Adenosine triphosphate(DB00171)|Bosentan(DB00559)|Chlorpromazine(DB00477)|Cimetidine(DB00501)|Clofazimine(DB00845)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Digoxin(DB00390)|Doxorubicin(DB00997)|Ethinyl Estradiol(DB00977)|Fluorescein(DB00693)|Fusidic Acid(DB02703)|Glyburide(DB01016)|Ketoconazole(DB01026)|Novobiocin(DB01051)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Ponatinib(DB08901)|Pravastatin(DB00175)|Progesterone(DB00396)|Quinidine(DB00908)|Reserpine(DB00206)|Rifampicin(DB01045)|Rosuvastatin(DB01098)|Tamoxifen(DB00675)|Ursodeoxycholic acid(DB01586)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)	ATTACCTGTCCCACCATCTCC	0.473																																							uc002ueo.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|large_intestine(2)|breast(1)	5						c.(2809-2811)GGA>CGA		ATP-binding cassette, sub-family B (MDR/TAP),	Adenosine triphosphate(DB00171)|Bosentan(DB00559)|Glibenclamide(DB01016)						102.0	104.0	103.0					2																	169792745		2016	4197	6213	SO:0001583	missense	8647				bile acid biosynthetic process	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus|membrane fraction	ATP binding|bile acid-exporting ATPase activity|canalicular bile acid transmembrane transporter activity|sodium-exporting ATPase activity, phosphorylative mechanism	g.chr2:169792745C>G	AF091582	CCDS46444.1	2q24	2012-03-14			ENSG00000073734	ENSG00000073734		"""ATP binding cassette transporters / subfamily B"""	42	protein-coding gene	gene with protein product	"""ABC member 16, MDR/TAP subfamily"""	603201	"""progressive familial intrahepatic cholestasis 2"", ""bile salt export pump"""	BSEP, PFIC2		9806540	Standard	NM_003742		Approved	ABC16, SPGP, PFIC-2, PGY4	uc002ueo.1	O95342	OTTHUMG00000154039	ENST00000263817.6:c.2809G>C	2.37:g.169792745C>G	ENSP00000263817:p.Gly937Arg		Somatic				ABCB11_uc010zda.1_Missense_Mutation_p.G379R|ABCB11_uc010zdb.1_Missense_Mutation_p.G413R	p.G937R	NM_003742	NP_003733	WXS	Illumina HiSeq	Unspecified	O95342	ABCBB_HUMAN			22	2935	-			937			Cytoplasmic (Potential).|ABC transmembrane type-1 2.		Q53TL2|Q9UNB2	Missense_Mutation	SNP	ENST00000263817.6	37	c.2809G>C	CCDS46444.1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.455168	0.84209	.	.	ENSG00000073734	ENST00000263817	D	0.90900	-2.75	5.37	5.37	0.77165	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.96433	0.8836	M	0.91406	3.205	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.72338	0.977;0.977	D	0.97120	0.9810	10	0.87932	D	0	.	19.0962	0.93253	0.0:1.0:0.0:0.0	.	379;937	B4DZQ8;O95342	.;ABCBB_HUMAN	R	937	ENSP00000263817:G937R	ENSP00000263817:G937R	G	-	1	0	ABCB11	169500991	1.000000	0.71417	0.949000	0.38748	0.594000	0.36715	7.487000	0.81328	2.513000	0.84729	0.561000	0.74099	GGA		0.473	ABCB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333616.2	NM_003742		6	37	0	0	0	0.001168	0	6	37				
TTN	7273	broad.mit.edu	37	2	179397295	179397295	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr2:179397295G>T	ENST00000591111.1	-	308	99348	c.99124C>A	c.(99124-99126)Ctt>Att	p.L33042I	TTN_ENST00000342992.6_Missense_Mutation_p.L32115I|TTN_ENST00000359218.5_Missense_Mutation_p.L25743I|TTN_ENST00000460472.2_Missense_Mutation_p.L25618I|TTN-AS1_ENST00000589842.1_RNA|TTN-AS1_ENST00000587568.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.L25810I|TTN-AS1_ENST00000592836.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000585625.1_RNA|TTN-AS1_ENST00000591867.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000604571.1_RNA|TTN-AS1_ENST00000589355.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000587944.1_RNA|TTN-AS1_ENST00000450692.2_RNA|TTN-AS1_ENST00000589434.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000588244.1_RNA|TTN-AS1_ENST00000590040.1_RNA|TTN-AS1_ENST00000592182.1_RNA|TTN-AS1_ENST00000588716.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000588257.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.L34683I|TTN-AS1_ENST00000442329.2_RNA|TTN-AS1_ENST00000589391.1_RNA|TTN-AS1_ENST00000588804.1_RNA|TTN-AS1_ENST00000585358.1_RNA|TTN-AS1_ENST00000585487.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000591466.1_RNA|TTN-AS1_ENST00000431259.2_RNA			Q8WZ42	TITIN_HUMAN	titin	33042					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.L32115I(1)|p.L25618I(1)|p.L25810I(1)|p.L32113I(1)|p.L25743I(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCTTCTTCAAGACGCAGCCTC	0.463																																							uc010zfg.1		NA																	5	Substitution - Missense(5)		lung(5)	ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(96343-96345)CTT>ATT		titin isoform N2-A							111.0	107.0	109.0					2																	179397295		1892	4133	6025	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179397295G>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.99124C>A	2.37:g.179397295G>T	ENSP00000465570:p.Leu33042Ile		Somatic				uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.L25810I|TTN_uc010zfi.1_Missense_Mutation_p.L25743I|TTN_uc010zfj.1_Missense_Mutation_p.L25618I	p.L32115I	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		307	96567	-			33042					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.96343C>A		.	.	.	.	.	.	.	.	.	.	G	16.25	3.070228	0.55539	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.66638	-0.22;0.04;0.01;-0.0	6.08	6.08	0.98989	Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);	.	.	.	.	T	0.69958	0.3169	N	0.19112	0.55	0.47862	D	0.999534	D;D;D;D	0.67145	0.991;0.991;0.991;0.996	P;P;P;P	0.58266	0.732;0.732;0.732;0.836	T	0.73100	-0.4089	9	0.87932	D	0	.	20.2585	0.98435	0.0:0.0:1.0:0.0	.	25618;25743;25810;33042	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	I	32115;25618;25810;25743;25615	ENSP00000343764:L32115I;ENSP00000434586:L25618I;ENSP00000340554:L25810I;ENSP00000352154:L25743I	ENSP00000340554:L25810I	L	-	1	0	TTN	179105541	1.000000	0.71417	0.999000	0.59377	0.999000	0.98932	4.713000	0.61895	2.894000	0.99253	0.655000	0.94253	CTT		0.463	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		25	167	1	0	2.44723e-14	0.004656	5.36149e-14	25	167				
TTN	7273	broad.mit.edu	37	2	179482722	179482722	+	Nonsense_Mutation	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr2:179482722C>A	ENST00000591111.1	-	203	42657	c.42433G>T	c.(42433-42435)Gga>Tga	p.G14145*	TTN_ENST00000342992.6_Nonsense_Mutation_p.G13218*|TTN_ENST00000359218.5_Nonsense_Mutation_p.G6846*|TTN_ENST00000460472.2_Nonsense_Mutation_p.G6721*|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Nonsense_Mutation_p.G6913*|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000604956.1_RNA|RP11-171I2.4_ENST00000605334.1_lincRNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN_ENST00000589042.1_Nonsense_Mutation_p.G15786*|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin	14145	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.G13218*(2)|p.G6913*(1)|p.G6721*(1)|p.G6846*(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCAGCACCTCCATCATACTCT	0.463																																							uc010zfg.1		NA																	5	Substitution - Nonsense(5)		lung(5)	ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(39652-39654)GGA>TGA		titin isoform N2-A							106.0	104.0	105.0					2																	179482722		1976	4149	6125	SO:0001587	stop_gained	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179482722C>A	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.42433G>T	2.37:g.179482722C>A	ENSP00000465570:p.Gly14145*		Somatic				TTN_uc010zfh.1_Nonsense_Mutation_p.G6913*|TTN_uc010zfi.1_Nonsense_Mutation_p.G6846*|TTN_uc010zfj.1_Nonsense_Mutation_p.G6721*	p.G13218*	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		202	39876	-			14145					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Nonsense_Mutation	SNP	ENST00000591111.1	37	c.39652G>T		.	.	.	.	.	.	.	.	.	.	C	59	34.341142	0.99982	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	.	.	.	5.73	5.73	0.89815	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	20.2602	0.98440	0.0:1.0:0.0:0.0	.	.	.	.	X	13218;6721;6913;6846;6721	.	ENSP00000340554:G6913X	G	-	1	0	TTN	179190967	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.729000	0.84864	2.861000	0.98227	0.655000	0.94253	GGA		0.463	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		12	114	1	0	3.07112e-06	0.000978	5.32574e-06	12	114				
TTN	7273	broad.mit.edu	37	2	179567381	179567381	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr2:179567381A>G	ENST00000591111.1	-	105	29506	c.29282T>C	c.(29281-29283)aTt>aCt	p.I9761T	TTN_ENST00000342992.6_Missense_Mutation_p.I8834T|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.I10078T|TTN-AS1_ENST00000431752.1_RNA|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin	13839	Ig-like 79.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.I8834T(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGTAAACTGAATTGGTTCAGC	0.383																																							uc010zfg.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(26500-26502)ATT>ACT		titin isoform N2-A							105.0	98.0	100.0					2																	179567381		1934	4133	6067	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179567381A>G	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.29282T>C	2.37:g.179567381A>G	ENSP00000465570:p.Ile9761Thr		Somatic				TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.I5495T|TTN_uc010fre.1_5'UTR	p.I8834T	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		104	26725	-			9761					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.26501T>C		.	.	.	.	.	.	.	.	.	.	A	15.80	2.940533	0.52972	.	.	ENSG00000155657	ENST00000342992	T	0.04758	3.56	5.84	5.84	0.93424	Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.24353	0.0590	M	0.84326	2.69	0.80722	D	1	D	0.71674	0.998	D	0.69824	0.966	T	0.00878	-1.1530	9	0.87932	D	0	.	16.2167	0.82231	1.0:0.0:0.0:0.0	.	9761	Q8WZ42	TITIN_HUMAN	T	8834	ENSP00000343764:I8834T	ENSP00000343764:I8834T	I	-	2	0	TTN	179275626	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.310000	0.96267	2.231000	0.72958	0.533000	0.62120	ATT		0.383	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		13	65	0	0	0	0.001368	0	13	65				
TTN	7273	broad.mit.edu	37	2	179648941	179648942	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr2:179648941_179648942GG>TT	ENST00000591111.1	-	16	2854_2855	c.2630_2631CC>AA	c.(2629-2631)cCC>cAA	p.P877Q	TTN_ENST00000342992.6_Missense_Mutation_p.P877Q|TTN_ENST00000359218.5_Missense_Mutation_p.P831Q|TTN_ENST00000460472.2_Missense_Mutation_p.P831Q|TTN_ENST00000342175.6_Missense_Mutation_p.P831Q|TTN_ENST00000360870.5_Missense_Mutation_p.P877Q|TTN_ENST00000589042.1_Missense_Mutation_p.P877Q			Q8WZ42	TITIN_HUMAN	titin	33699					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.P831Q(3)|p.P877Q(3)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACTGTGGCAAGGGTGTGGGCTC	0.525																																							uc010zfg.1		NA																	6	Substitution - Missense(6)		lung(6)	ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(2629-2631)CCC>CAA		titin isoform N2-A																																				SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179648941_179648942GG>TT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.2630_2631delinsTT	2.37:g.179648941_179648942delinsTT	ENSP00000465570:p.Pro877Gln		Somatic				TTN_uc010zfh.1_Missense_Mutation_p.P831Q|TTN_uc010zfi.1_Missense_Mutation_p.P831Q|TTN_uc010zfj.1_Missense_Mutation_p.P831Q|TTN_uc002unb.2_Missense_Mutation_p.P877Q	p.P877Q	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		16	2854_2855	-			877					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	DNP	ENST00000591111.1	37	c.2630_2631CC>AA																																																																																					0.525	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		9	88	0	0	0	0.004672	0	9	88				
ITGAV	3685	broad.mit.edu	37	2	187529244	187529244	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr2:187529244G>T	ENST00000261023.3	+	20	2223	c.1949G>T	c.(1948-1950)gGg>gTg	p.G650V	ITGAV_ENST00000433736.2_Missense_Mutation_p.G604V|ITGAV_ENST00000374907.3_Missense_Mutation_p.G614V|AC017101.10_ENST00000453665.1_RNA	NM_002210.3	NP_002201	P06756	ITAV_HUMAN	integrin, alpha V	650					angiogenesis (GO:0001525)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|apoptotic cell clearance (GO:0043277)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell adhesion (GO:0007155)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|endodermal cell differentiation (GO:0035987)|entry of symbiont into host cell by promotion of host phagocytosis (GO:0052066)|ERK1 and ERK2 cascade (GO:0070371)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|negative chemotaxis (GO:0050919)|negative regulation of entry of bacterium into host cell (GO:2000536)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of lipid storage (GO:0010888)|negative regulation of lipid transport (GO:0032369)|negative regulation of lipoprotein metabolic process (GO:0050748)|negative regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045715)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of osteoblast proliferation (GO:0033690)|regulation of apoptotic cell clearance (GO:2000425)|regulation of phagocytosis (GO:0050764)|substrate adhesion-dependent cell spreading (GO:0034446)|viral entry into host cell (GO:0046718)	alphav-beta3 integrin-IGF-1-IGF1R complex (GO:0035867)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|integrin alphav-beta3 complex (GO:0034683)|integrin alphav-beta5 complex (GO:0034684)|integrin alphav-beta8 complex (GO:0034686)|integrin complex (GO:0008305)|lamellipodium membrane (GO:0031258)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	extracellular matrix binding (GO:0050840)|extracellular matrix protein binding (GO:1990430)|fibronectin binding (GO:0001968)|metal ion binding (GO:0046872)|protease binding (GO:0002020)|transforming growth factor beta binding (GO:0050431)|virus receptor activity (GO:0001618)|voltage-gated calcium channel activity (GO:0005245)	p.G650V(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(19)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	47			OV - Ovarian serous cystadenocarcinoma(117;0.0185)|Epithelial(96;0.072)|all cancers(119;0.189)	STAD - Stomach adenocarcinoma(3;0.106)|COAD - Colon adenocarcinoma(31;0.108)	Antithymocyte globulin(DB00098)	ATCTATATTGGGGATGACAAC	0.403																																					Melanoma(58;108 1995 6081)	Melanoma(58;108 1995 6081)	uc002upq.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|kidney(1)|skin(1)	4						c.(1948-1950)GGG>GTG		integrin alpha-V isoform 1 precursor							143.0	138.0	139.0					2																	187529244		2203	4300	6503	SO:0001583	missense	3685				angiogenesis|axon guidance|blood coagulation|cell-matrix adhesion|entry of bacterium into host cell|entry of symbiont into host cell by promotion of host phagocytosis|entry of virus into host cell|ERK1 and ERK2 cascade|integrin-mediated signaling pathway|leukocyte migration|negative regulation of apoptosis|negative regulation of lipid storage|negative regulation of lipid transport|negative regulation of lipoprotein metabolic process|negative regulation of low-density lipoprotein particle receptor biosynthetic process|negative regulation of macrophage derived foam cell differentiation|positive regulation of cell adhesion|positive regulation of cell proliferation|regulation of apoptotic cell clearance	integrin complex	receptor activity|transforming growth factor beta binding	g.chr2:187529244G>T		CCDS2292.1, CCDS46470.1, CCDS46471.1	2q31-q32	2012-04-20	2012-04-20		ENSG00000138448	ENSG00000138448		"""CD molecules"", ""Integrins"""	6150	protein-coding gene	gene with protein product		193210	"""antigen identified by monoclonal antibody L230"", ""vitronectin receptor"", ""integrin, alpha V (vitronectin receptor, alpha polypeptide, antigen CD51)"""	VNRA, MSK8, VTNR		2454952	Standard	NM_001144999		Approved	CD51	uc002upq.4	P06756	OTTHUMG00000132635	ENST00000261023.3:c.1949G>T	2.37:g.187529244G>T	ENSP00000261023:p.Gly650Val		Somatic				ITGAV_uc010frs.2_Missense_Mutation_p.G614V|ITGAV_uc010zfv.1_Missense_Mutation_p.G604V	p.G650V	NM_002210	NP_002201	WXS	Illumina HiSeq	Unspecified	P06756	ITAV_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0185)|Epithelial(96;0.072)|all cancers(119;0.189)	STAD - Stomach adenocarcinoma(3;0.106)|COAD - Colon adenocarcinoma(31;0.108)	20	2225	+			650			Extracellular (Potential).		A0AV67|B0LPF4|B7Z883|B7ZLX0|D3DPG8|E7EWZ6|Q53SK4|Q59EB7|Q6LD15	Missense_Mutation	SNP	ENST00000261023.3	37	c.1949G>T	CCDS2292.1	.	.	.	.	.	.	.	.	.	.	G	34	5.304931	0.95601	.	.	ENSG00000138448	ENST00000261023;ENST00000374907;ENST00000433736	T;T;T	0.60920	0.15;0.15;0.15	6.17	6.17	0.99709	Integrin alpha-2 (1);	0.000000	0.85682	D	0.000000	T	0.81351	0.4804	M	0.86502	2.82	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.82486	-0.0433	10	0.87932	D	0	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	604;614;650	E7EWZ6;P06756-2;P06756	.;.;ITAV_HUMAN	V	650;614;604	ENSP00000261023:G650V;ENSP00000364042:G614V;ENSP00000404291:G604V	ENSP00000261023:G650V	G	+	2	0	ITGAV	187237489	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.941000	0.99782	0.655000	0.94253	GGG		0.403	ITGAV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255882.2	NM_002210		33	215	1	0	1.04352e-10	0.003755	2.07979e-10	33	215				
DYTN	391475	broad.mit.edu	37	2	207516601	207516601	+	Nonsense_Mutation	SNP	G	G	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr2:207516601G>A	ENST00000452335.2	-	12	1794	c.1678C>T	c.(1678-1680)Cga>Tga	p.R560*	AC010731.4_ENST00000543490.1_lincRNA	NM_001093730.1	NP_001087199.1	A2CJ06	DYTN_HUMAN	dystrotelin	560						plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)	p.R560*(2)		breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(24)|ovary(1)|upper_aerodigestive_tract(1)	36				LUSC - Lung squamous cell carcinoma(261;0.082)|Epithelial(149;0.129)|Lung(261;0.153)		CTGCACACTCGCTGAGCTCCA	0.473																																							uc002vbr.1		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(1)|central_nervous_system(1)	2						c.(1678-1680)CGA>TGA		dystrotelin							67.0	71.0	70.0					2																	207516601		2019	4198	6217	SO:0001587	stop_gained	391475					plasma membrane	zinc ion binding	g.chr2:207516601G>A	ABF55377	CCDS46502.1	2q33.3	2007-01-22			ENSG00000232125	ENSG00000232125			23279	protein-coding gene	gene with protein product						17233888	Standard	NM_001093730		Approved		uc002vbr.1	A2CJ06	OTTHUMG00000154729	ENST00000452335.2:c.1678C>T	2.37:g.207516601G>A	ENSP00000396593:p.Arg560*		Somatic					p.R560*	NM_001093730	NP_001087199	WXS	Illumina HiSeq	Unspecified	A2CJ06	DYTN_HUMAN		LUSC - Lung squamous cell carcinoma(261;0.082)|Epithelial(149;0.129)|Lung(261;0.153)	12	1795	-			560						Nonsense_Mutation	SNP	ENST00000452335.2	37	c.1678C>T	CCDS46502.1	.	.	.	.	.	.	.	.	.	.	G	16.44	3.125003	0.56721	.	.	ENSG00000232125	ENST00000452335	.	.	.	5.33	1.23	0.21249	.	.	.	.	.	.	.	.	.	.	.	0.42393	D	0.992533	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.1954	5.2775	0.15657	0.0807:0.2771:0.5139:0.1283	.	.	.	.	X	560	.	ENSP00000396593:R560X	R	-	1	2	DYTN	207224846	0.006000	0.16342	0.380000	0.26093	0.186000	0.23388	0.300000	0.19156	0.367000	0.24454	-0.136000	0.14681	CGA		0.473	DYTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336799.1			11	63	0	0	0	0.001368	0	11	63				
CPS1	1373	broad.mit.edu	37	2	211515108	211515108	+	Silent	SNP	A	A	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr2:211515108A>T	ENST00000233072.5	+	28	3622	c.3426A>T	c.(3424-3426)gtA>gtT	p.V1142V	CPS1_ENST00000451903.2_Silent_p.V691V|CPS1_ENST00000430249.2_Silent_p.V1148V	NM_001875.4	NP_001866.2	P31327	CPSM_HUMAN	carbamoyl-phosphate synthase 1, mitochondrial	1142	ATP-grasp 2.				anion homeostasis (GO:0055081)|carbamoyl phosphate biosynthetic process (GO:0070409)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to glucagon stimulus (GO:0071377)|cellular response to oleic acid (GO:0071400)|citrulline biosynthetic process (GO:0019240)|glutamine catabolic process (GO:0006543)|glycogen catabolic process (GO:0005980)|hepatocyte differentiation (GO:0070365)|homocysteine metabolic process (GO:0050667)|midgut development (GO:0007494)|nitric oxide metabolic process (GO:0046209)|positive regulation of vasodilation (GO:0045909)|response to amine (GO:0014075)|response to amino acid (GO:0043200)|response to dexamethasone (GO:0071548)|response to drug (GO:0042493)|response to food (GO:0032094)|response to growth hormone (GO:0060416)|response to lipopolysaccharide (GO:0032496)|response to starvation (GO:0042594)|response to toxic substance (GO:0009636)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)|urea cycle (GO:0000050)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|carbamoyl-phosphate synthase (ammonia) activity (GO:0004087)|endopeptidase activity (GO:0004175)|glutamate binding (GO:0016595)|modified amino acid binding (GO:0072341)|phospholipid binding (GO:0005543)	p.V1148V(1)|p.V1142V(1)		breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(85)|ovary(8)|pancreas(1)|prostate(6)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	142				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)	Carglumic Acid(DB06775)	TGAATGTGGTATTCTCTGAGG	0.398																																							uc002vee.3		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(8)|central_nervous_system(3)|breast(1)|skin(1)	13						c.(3424-3426)GTA>GTT		carbamoyl-phosphate synthetase 1 isoform b							141.0	141.0	141.0					2																	211515108		2203	4300	6503	SO:0001819	synonymous_variant	1373				carbamoyl phosphate biosynthetic process|citrulline biosynthetic process|glutamine metabolic process|glycogen catabolic process|nitric oxide metabolic process|positive regulation of vasodilation|response to lipopolysaccharide|triglyceride catabolic process|urea cycle	mitochondrial nucleoid	ATP binding|carbamoyl-phosphate synthase (ammonia) activity	g.chr2:211515108A>T	AF154830	CCDS2393.1, CCDS46505.1, CCDS46506.1	2p	2014-09-17	2010-05-11		ENSG00000021826	ENSG00000021826	6.3.4.16		2323	protein-coding gene	gene with protein product		608307	"""carbamoyl-phosphate synthetase 1, mitochondrial"""				Standard	NM_001122633		Approved		uc002vee.4	P31327	OTTHUMG00000132994	ENST00000233072.5:c.3426A>T	2.37:g.211515108A>T			Somatic				CPS1_uc010fur.2_Silent_p.V1148V|CPS1_uc010fus.2_Silent_p.V691V	p.V1142V	NM_001875	NP_001866	WXS	Illumina HiSeq	Unspecified	P31327	CPSM_HUMAN		Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)	28	3558	+			1142			ATP-grasp 2.		B7Z818|J3KQL0|O43774|Q53TL5|Q59HF8|Q7Z5I5	Silent	SNP	ENST00000233072.5	37	c.3426A>T	CCDS2393.1																																																																																				0.398	CPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256569.5			10	75	0	0	0	0.008291	0	10	75				
ABCA12	26154	broad.mit.edu	37	2	215798856	215798856	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr2:215798856G>T	ENST00000272895.7	-	52	7845	c.7626C>A	c.(7624-7626)aaC>aaA	p.N2542K	ABCA12_ENST00000389661.4_Missense_Mutation_p.N2224K|AC072062.1_ENST00000607412.1_RNA	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	2542					cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)	p.N2542K(1)		NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		AAGCAGTCTTGTTGGTTTCCA	0.418																																					Ovarian(66;664 1488 5121 34295)	Ovarian(66;664 1488 5121 34295)	uc002vew.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	11						c.(7624-7626)AAC>AAA		ATP-binding cassette, sub-family A, member 12							126.0	119.0	121.0					2																	215798856		2203	4300	6503	SO:0001583	missense	26154				cellular homeostasis|lipid transport	integral to membrane	ATP binding|ATPase activity	g.chr2:215798856G>T	AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.7626C>A	2.37:g.215798856G>T	ENSP00000272895:p.Asn2542Lys		Somatic				ABCA12_uc002vev.2_Missense_Mutation_p.N2224K|ABCA12_uc010zjn.1_Missense_Mutation_p.N1469K	p.N2542K	NM_173076	NP_775099	WXS	Illumina HiSeq	Unspecified	Q86UK0	ABCAC_HUMAN		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)	52	7846	-		Renal(323;0.127)	2542					Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Missense_Mutation	SNP	ENST00000272895.7	37	c.7626C>A	CCDS33372.1	.	.	.	.	.	.	.	.	.	.	G	17.62	3.433895	0.62955	.	.	ENSG00000144452	ENST00000272895;ENST00000389661	D;D	0.83250	-1.7;-1.7	5.59	2.87	0.33458	.	0.152340	0.46758	D	0.000279	T	0.79610	0.4475	M	0.62016	1.91	0.80722	D	1	B;P	0.45768	0.451;0.866	B;B	0.41236	0.351;0.343	T	0.77600	-0.2527	10	0.56958	D	0.05	.	10.7795	0.46369	0.2108:0.0:0.7892:0.0	.	2542;2224	Q86UK0;Q86UK0-2	ABCAC_HUMAN;.	K	2542;2224	ENSP00000272895:N2542K;ENSP00000374312:N2224K	ENSP00000272895:N2542K	N	-	3	2	ABCA12	215507101	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	2.925000	0.48884	0.428000	0.26173	-1.008000	0.02478	AAC		0.418	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337111.1	NM_173076		19	76	1	0	3.32936e-07	0.006122	5.95343e-07	19	76				
ABCA12	26154	broad.mit.edu	37	2	215865469	215865469	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr2:215865469G>T	ENST00000272895.7	-	22	3358	c.3139C>A	c.(3139-3141)Cag>Aag	p.Q1047K	ABCA12_ENST00000389661.4_Missense_Mutation_p.Q729K	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	1047					cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)			NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		GCTTGAACCTGGACTGCTATT	0.393																																					Ovarian(66;664 1488 5121 34295)	Ovarian(66;664 1488 5121 34295)	uc002vew.2		NA																	0				ovary(6)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	11						c.(3139-3141)CAG>AAG		ATP-binding cassette, sub-family A, member 12							114.0	119.0	118.0					2																	215865469		2203	4300	6503	SO:0001583	missense	26154				cellular homeostasis|lipid transport	integral to membrane	ATP binding|ATPase activity	g.chr2:215865469G>T	AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.3139C>A	2.37:g.215865469G>T	ENSP00000272895:p.Gln1047Lys		Somatic				ABCA12_uc002vev.2_Missense_Mutation_p.Q729K|ABCA12_uc010zjn.1_5'UTR	p.Q1047K	NM_173076	NP_775099	WXS	Illumina HiSeq	Unspecified	Q86UK0	ABCAC_HUMAN		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)	22	3359	-		Renal(323;0.127)	1047					Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Missense_Mutation	SNP	ENST00000272895.7	37	c.3139C>A	CCDS33372.1	.	.	.	.	.	.	.	.	.	.	G	23.3	4.404512	0.83230	.	.	ENSG00000144452	ENST00000272895;ENST00000389661	D;D	0.94330	-2.21;-3.4	5.73	5.73	0.89815	.	0.000000	0.64402	D	0.000003	D	0.96617	0.8896	M	0.82056	2.57	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.94571	0.7771	10	0.18710	T	0.47	.	19.9082	0.97015	0.0:0.0:1.0:0.0	.	1047;729	Q86UK0;Q86UK0-2	ABCAC_HUMAN;.	K	1047;729	ENSP00000272895:Q1047K;ENSP00000374312:Q729K	ENSP00000272895:Q1047K	Q	-	1	0	ABCA12	215573714	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	9.582000	0.98214	2.705000	0.92388	0.555000	0.69702	CAG		0.393	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337111.1	NM_173076		16	151	1	0	4.75885e-15	0.00499	1.07121e-14	16	151				
TRPM8	79054	broad.mit.edu	37	2	234916722	234916722	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr2:234916722A>T	ENST00000324695.4	+	24	3279	c.3239A>T	c.(3238-3240)cAt>cTt	p.H1080L	TRPM8_ENST00000433712.2_Missense_Mutation_p.H658L	NM_024080.4	NP_076985.4	Q7Z2W7	TRPM8_HUMAN	transient receptor potential cation channel, subfamily M, member 8	1080					calcium ion transmembrane transport (GO:0070588)|cellular calcium ion homeostasis (GO:0006874)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|protein homotetramerization (GO:0051289)|protein homotrimerization (GO:0070207)|response to cold (GO:0009409)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)	p.H1080L(1)		breast(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(2)|lung(27)|prostate(2)|skin(7)|stomach(2)	66		Breast(86;0.00205)|Renal(207;0.00694)|all_lung(227;0.0129)|Lung NSC(271;0.0408)|all_hematologic(139;0.0753)|Acute lymphoblastic leukemia(138;0.224)		Epithelial(121;1.19e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000139)|Lung(119;0.00758)|LUSC - Lung squamous cell carcinoma(224;0.0108)	Menthol(DB00825)	AGAATGAGGCATCGATTTAGA	0.338																																							uc002vvh.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(4)	4						c.(3238-3240)CAT>CTT		transient receptor potential cation channel,	Menthol(DB00825)						234.0	225.0	228.0					2																	234916722		2203	4300	6503	SO:0001583	missense	79054					integral to membrane		g.chr2:234916722A>T	AC005538	CCDS33407.1	2q37	2011-12-14			ENSG00000144481	ENSG00000144481		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17961	protein-coding gene	gene with protein product		606678				16382100	Standard	NM_024080		Approved		uc002vvh.3	Q7Z2W7	OTTHUMG00000059129	ENST00000324695.4:c.3239A>T	2.37:g.234916722A>T	ENSP00000323926:p.His1080Leu		Somatic				TRPM8_uc010fyj.2_Missense_Mutation_p.H658L|TRPM8_uc010fyk.2_RNA	p.H1080L	NM_024080	NP_076985	WXS	Illumina HiSeq	Unspecified	Q7Z2W7	TRPM8_HUMAN		Epithelial(121;1.19e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000139)|Lung(119;0.00758)|LUSC - Lung squamous cell carcinoma(224;0.0108)	24	3279	+		Breast(86;0.00205)|Renal(207;0.00694)|all_lung(227;0.0129)|Lung NSC(271;0.0408)|all_hematologic(139;0.0753)|Acute lymphoblastic leukemia(138;0.224)	1080			Cytoplasmic (Potential).		A0AVG2|Q3YFM7|Q6QNH9|Q8TAC3|Q8TDX8|Q9BVK1	Missense_Mutation	SNP	ENST00000324695.4	37	c.3239A>T	CCDS33407.1	.	.	.	.	.	.	.	.	.	.	A	14.84	2.656014	0.47467	.	.	ENSG00000144481	ENST00000324695;ENST00000433712;ENST00000456930	T;T;T	0.58506	0.33;0.39;0.51	5.45	5.45	0.79879	.	0.229503	0.31031	N	0.008399	T	0.48059	0.1479	L	0.36672	1.1	0.27760	N	0.943874	B;B	0.17667	0.023;0.0	B;B	0.12156	0.007;0.0	T	0.50065	-0.8871	10	0.72032	D	0.01	-17.6018	11.9189	0.52781	1.0:0.0:0.0:0.0	.	658;1080	A0AVG2;Q7Z2W7	.;TRPM8_HUMAN	L	1080;658;341	ENSP00000323926:H1080L;ENSP00000404423:H658L;ENSP00000414198:H341L	ENSP00000323926:H1080L	H	+	2	0	TRPM8	234581461	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.653000	0.54446	2.086000	0.62901	0.533000	0.62120	CAT		0.338	TRPM8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131005.4	NM_024080		16	155	0	0	0	0.004007	0	16	155				
RTP5	285093	broad.mit.edu	37	2	242815319	242815319	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr2:242815319G>T	ENST00000343216.3	+	2	1640	c.1612G>T	c.(1612-1614)Gcc>Tcc	p.A538S		NM_173821.2	NP_776182.2												p.A538S(2)									TAGGCCGCACGCCGAGCCCTA	0.652																																							uc010fzu.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(1612-1614)GCC>TCC		hypothetical protein LOC285093							81.0	92.0	88.0					2																	242815319		2078	4182	6260	SO:0001583	missense	285093					integral to membrane		g.chr2:242815319G>T																												ENST00000343216.3:c.1612G>T	2.37:g.242815319G>T	ENSP00000345374:p.Ala538Ser		Somatic					p.A538S	NM_173821	NP_776182	WXS	Illumina HiSeq	Unspecified	Q14D33	CB085_HUMAN			2	1635	+			538						Missense_Mutation	SNP	ENST00000343216.3	37	c.1612G>T	CCDS42843.1	.	.	.	.	.	.	.	.	.	.	.	7.165	0.586452	0.13749	.	.	ENSG00000188011	ENST00000343216	T	0.23950	1.88	2.08	-0.231	0.13086	.	.	.	.	.	T	0.10937	0.0267	N	0.08118	0	0.09310	N	1	B	0.14438	0.01	B	0.12837	0.008	T	0.35500	-0.9786	9	0.22109	T	0.4	-9.9244	6.2805	0.21005	0.0:0.0:0.3585:0.6415	.	538	Q14D33	CB085_HUMAN	S	538	ENSP00000345374:A538S	ENSP00000345374:A538S	A	+	1	0	C2orf85	242463992	0.000000	0.05858	0.000000	0.03702	0.582000	0.36321	-0.595000	0.05727	-0.050000	0.13356	0.196000	0.17591	GCC		0.652	CXXC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322310.1			25	121	1	0	5.45727e-16	0.008361	1.26821e-15	25	121				
TGM6	343641	broad.mit.edu	37	20	2413145	2413145	+	Silent	SNP	C	C	G			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr20:2413145C>G	ENST00000202625.2	+	13	2038	c.1977C>G	c.(1975-1977)acC>acG	p.T659T	TGM6_ENST00000381423.1_Missense_Mutation_p.P615A	NM_198994.2	NP_945345.2	O95932	TGM3L_HUMAN	transglutaminase 6	659					cell death (GO:0008219)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)	p.T659T(1)		breast(1)|endometrium(6)|kidney(2)|large_intestine(2)|lung(32)|ovary(4)|prostate(1)|skin(4)	52					L-Glutamine(DB00130)	GCGTGCCTACCCTGGAGCCTC	0.617																																							uc002wfy.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|skin(1)	4						c.(1975-1977)ACC>ACG		transglutaminase 6	L-Glutamine(DB00130)						90.0	77.0	81.0					20																	2413145		2203	4300	6503	SO:0001819	synonymous_variant	343641				cell death|peptide cross-linking		acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity	g.chr20:2413145C>G	AF540970	CCDS13025.1, CCDS58761.1	20p13	2010-12-19	2004-07-05	2004-07-07	ENSG00000166948	ENSG00000166948		"""Transglutaminases"""	16255	protein-coding gene	gene with protein product	"""spinocerebellar ataxia 35"""	613900	"""transglutaminase 3-like"""	TGM3L		11390390, 21106500	Standard	NM_198994		Approved	dJ734P14.3, TGY, SCA35	uc002wfy.1	O95932	OTTHUMG00000031692	ENST00000202625.2:c.1977C>G	20.37:g.2413145C>G			Somatic				TGM6_uc010gal.1_Missense_Mutation_p.P615A	p.T659T	NM_198994	NP_945345	WXS	Illumina HiSeq	Unspecified	O95932	TGM3L_HUMAN			13	2038	+			659					Q5JXU4|Q5JXU5|Q719M2|Q719M3|Q9Y4U8	Silent	SNP	ENST00000202625.2	37	c.1977C>G	CCDS13025.1	.	.	.	.	.	.	.	.	.	.	C	15.47	2.842238	0.51057	.	.	ENSG00000166948	ENST00000381423	T	0.79554	-1.28	4.87	2.93	0.34026	.	.	.	.	.	D	0.82783	0.5112	.	.	.	0.25817	N	0.984326	D	0.89917	1.0	D	0.87578	0.998	T	0.70142	-0.4953	8	0.12430	T	0.62	-6.8219	8.6367	0.33953	0.0:0.8581:0.0:0.1419	.	615	O95932-2	.	A	615	ENSP00000370831:P615A	ENSP00000370831:P615A	P	+	1	0	TGM6	2361145	0.012000	0.17670	0.882000	0.34594	0.821000	0.46438	0.038000	0.13862	0.754000	0.32968	0.655000	0.94253	CCT		0.617	TGM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077581.2	NM_198994		14	47	0	0	0	0.003163	0	14	47				
SMOX	54498	broad.mit.edu	37	20	4167988	4167988	+	Silent	SNP	G	G	C			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr20:4167988G>C	ENST00000305958.4	+	7	1827	c.1602G>C	c.(1600-1602)ctG>ctC	p.L534L	SMOX_ENST00000379460.2_Silent_p.L534L|SMOX_ENST00000339123.6_Silent_p.L481L|SMOX_ENST00000346595.2_Silent_p.L169L|SMOX_ENST00000278795.3_Silent_p.L511L	NM_175839.2	NP_787033.1	Q9NWM0	SMOX_HUMAN	spermine oxidase	534					cellular nitrogen compound metabolic process (GO:0034641)|oxidation-reduction process (GO:0055114)|polyamine biosynthetic process (GO:0006596)|polyamine catabolic process (GO:0006598)|polyamine metabolic process (GO:0006595)|small molecule metabolic process (GO:0044281)|spermine catabolic process (GO:0046208)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	N1-acetylspermine:oxygen oxidoreductase (N1-acetylspermidine-forming) activity (GO:0052895)|norspermine:oxygen oxidoreductase activity (GO:0052894)|polyamine oxidase activity (GO:0046592)|spermine:oxygen oxidoreductase (spermidine-forming) activity (GO:0052901)	p.L534L(1)|p.L511L(1)		breast(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(7)|lung(5)|skin(2)|urinary_tract(1)	26					Spermine(DB00127)	GTGCTCTGCTGTCCGGCCAGC	0.637																																							uc002wkm.1		NA																	2	Substitution - coding silent(2)		lung(2)	breast(1)	1						c.(1600-1602)CTG>CTC		spermine oxidase isoform 1	Spermine(DB00127)						66.0	54.0	58.0					20																	4167988		2203	4300	6503	SO:0001819	synonymous_variant	54498				polyamine biosynthetic process|xenobiotic metabolic process	cytosol|nucleus	polyamine oxidase activity	g.chr20:4167988G>C	AK000753	CCDS13075.1, CCDS13076.1, CCDS13077.1, CCDS13078.1, CCDS74702.1	20p13	2003-10-15	2003-10-15	2003-10-15	ENSG00000088826	ENSG00000088826			15862	protein-coding gene	gene with protein product		615854	"""chromosome 20 open reading frame 16"""	C20orf16		11454677, 12398765	Standard	NM_175839		Approved	FLJ20746, dJ779E11.1, PAO, PAOh1, MGC1010, SMO	uc002wkp.3	Q9NWM0	OTTHUMG00000031777	ENST00000305958.4:c.1602G>C	20.37:g.4167988G>C			Somatic				SMOX_uc002wkk.1_Silent_p.L511L|SMOX_uc002wkl.1_Silent_p.L481L|SMOX_uc002wkn.1_Silent_p.L169L|SMOX_uc002wkp.2_Silent_p.L564L|SMOX_uc010zqo.1_Silent_p.L458L|SMOX_uc002wko.1_Silent_p.L534L	p.L534L	NM_175839	NP_787033	WXS	Illumina HiSeq	Unspecified	Q9NWM0	SMOX_HUMAN			7	1803	+			534					A2A2P5|A2A2P6|A8BE87|D3DVZ4|Q5TE26|Q5TE27|Q6UY28|Q8IX00|Q96LC3|Q96LC4|Q96QT3|Q9BW38|Q9H6H1|Q9NP51|Q9NPY1|Q9NPY2	Silent	SNP	ENST00000305958.4	37	c.1602G>C	CCDS13075.1																																																																																				0.637	SMOX-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077806.1	NM_175842		10	36	0	0	0	0.000978	0	10	36				
PLCB1	23236	broad.mit.edu	37	20	8722135	8722135	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr20:8722135C>G	ENST00000338037.6	+	23	2465	c.2438C>G	c.(2437-2439)cCa>cGa	p.P813R	PLCB1_ENST00000378641.3_Missense_Mutation_p.P813R|PLCB1_ENST00000378637.2_Missense_Mutation_p.P813R|PLCB1_ENST00000494924.1_3'UTR	NM_015192.2	NP_056007.1	Q9NQ66	PLCB1_HUMAN	phospholipase C, beta 1 (phosphoinositide-specific)	813					activation of meiosis involved in egg activation (GO:0060466)|cerebral cortex development (GO:0021987)|fat cell differentiation (GO:0045444)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G2/M transition of mitotic cell cycle (GO:0000086)|glutamate receptor signaling pathway (GO:0007215)|inositol phosphate metabolic process (GO:0043647)|insulin-like growth factor receptor signaling pathway (GO:0048009)|interleukin-1-mediated signaling pathway (GO:0070498)|interleukin-12-mediated signaling pathway (GO:0035722)|interleukin-15-mediated signaling pathway (GO:0035723)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|memory (GO:0007613)|negative regulation of monocyte extravasation (GO:2000438)|negative regulation of transcription, DNA-templated (GO:0045892)|phosphatidylinositol metabolic process (GO:0046488)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of CD24 biosynthetic process (GO:2000560)|positive regulation of developmental growth (GO:0048639)|positive regulation of embryonic development (GO:0040019)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of GTPase activity (GO:0043547)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of JNK cascade (GO:0046330)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fertilization (GO:0080154)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|phosphatidylinositol phospholipase C activity (GO:0004435)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein homodimerization activity (GO:0042803)|signal transducer activity (GO:0004871)	p.P813R(2)		NS(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(11)|liver(2)|lung(41)|ovary(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	95						TTATCAAACCCAATCCGATAT	0.383																																							uc002wnb.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|breast(3)|upper_aerodigestive_tract(2)|skin(2)|lung(1)	12						c.(2437-2439)CCA>CGA		phosphoinositide-specific phospholipase C beta 1							130.0	117.0	122.0					20																	8722135		2203	4300	6503	SO:0001583	missense	23236				activation of meiosis involved in egg activation|CD24 biosynthetic process|cerebral cortex development|G1 phase|G2/M transition of mitotic cell cycle|glutamate signaling pathway|insulin-like growth factor receptor signaling pathway|interleukin-1-mediated signaling pathway|interleukin-12-mediated signaling pathway|interleukin-15-mediated signaling pathway|intracellular signal transduction|lipid catabolic process|memory|muscarinic acetylcholine receptor signaling pathway|negative regulation of monocyte extravasation|negative regulation of transcription, DNA-dependent|phosphatidylinositol metabolic process|positive regulation of acrosome reaction|positive regulation of developmental growth|positive regulation of embryonic development|positive regulation of interleukin-12 production|positive regulation of JNK cascade|positive regulation of myoblast differentiation|positive regulation of transcription, DNA-dependent|regulation of fertilization|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	cytosol|nuclear chromatin|nuclear speck	calcium ion binding|calmodulin binding|enzyme binding|GTPase activator activity|phosphatidylinositol phospholipase C activity|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity|signal transducer activity	g.chr20:8722135C>G	AB011153	CCDS13102.1, CCDS13103.1	20p12	2008-03-18			ENSG00000182621	ENSG00000182621	3.1.4.11		15917	protein-coding gene	gene with protein product		607120				10760467, 11118617	Standard	NM_015192		Approved	KIAA0581, PLC-I, PLC154	uc002wnb.4	Q9NQ66	OTTHUMG00000031849	ENST00000338037.6:c.2438C>G	20.37:g.8722135C>G	ENSP00000338185:p.Pro813Arg		Somatic				PLCB1_uc010zrb.1_Missense_Mutation_p.P712R|PLCB1_uc002wna.2_Missense_Mutation_p.P813R|PLCB1_uc002wnc.1_Missense_Mutation_p.P712R|PLCB1_uc002wnd.1_Missense_Mutation_p.P390R	p.P813R	NM_015192	NP_056007	WXS	Illumina HiSeq	Unspecified	Q9NQ66	PLCB1_HUMAN			23	2441	+			813					D3DW12|D3DW13|O60325|Q17RQ6|Q5TFF7|Q5TGC9|Q8IV93|Q9BQW2|Q9H4H2|Q9H8H5|Q9NQ65|Q9NQH9|Q9NTH4|Q9UJP6|Q9UM26	Missense_Mutation	SNP	ENST00000338037.6	37	c.2438C>G	CCDS13102.1	.	.	.	.	.	.	.	.	.	.	C	26.6	4.757205	0.89843	.	.	ENSG00000182621	ENST00000378641;ENST00000338037;ENST00000378637;ENST00000441163;ENST00000535719;ENST00000338061;ENST00000439627	T;T;T;T	0.49139	0.87;0.79;0.87;1.76	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.74374	0.3708	M	0.86502	2.82	0.80722	D	1	P;D	0.58970	0.918;0.984	P;D	0.72625	0.653;0.978	T	0.78945	-0.2004	10	0.87932	D	0	.	19.3094	0.94179	0.0:1.0:0.0:0.0	.	813;813	Q9NQ66;Q9NQ66-2	PLCB1_HUMAN;.	R	813;813;813;733;733;159;132	ENSP00000367908:P813R;ENSP00000338185:P813R;ENSP00000367904:P813R;ENSP00000391162:P132R	ENSP00000338185:P813R	P	+	2	0	PLCB1	8670135	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	7.818000	0.86416	2.561000	0.86390	0.460000	0.39030	CCA		0.383	PLCB1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077938.3			7	34	0	0	0	0.001984	0	7	34				
SNAP25	6616	broad.mit.edu	37	20	10286783	10286783	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr20:10286783T>A	ENST00000254976.2	+	8	770	c.559T>A	c.(559-561)Tcc>Acc	p.S187T	SNAP25-AS1_ENST00000453544.1_RNA|SNAP25_ENST00000304886.2_Missense_Mutation_p.S187T|SNAP25_ENST00000495883.1_3'UTR|SNAP25-AS1_ENST00000421143.2_RNA	NM_130811.2	NP_570824.1	P60880	SNP25_HUMAN	synaptosomal-associated protein, 25kDa	187	t-SNARE coiled-coil homology 2. {ECO:0000255|PROSITE-ProRule:PRU00202}.				energy reserve metabolic process (GO:0006112)|glutamate secretion (GO:0014047)|long-term synaptic potentiation (GO:0060291)|neurotransmitter secretion (GO:0007269)|neurotransmitter uptake (GO:0001504)|regulation of establishment of protein localization (GO:0070201)|regulation of insulin secretion (GO:0050796)|regulation of neuron projection development (GO:0010975)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|growth cone (GO:0030426)|membrane (GO:0016020)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|SNARE complex (GO:0031201)|synaptobrevin 2-SNAP-25-syntaxin-1a-complexin I complex (GO:0070032)|trans-Golgi network (GO:0005802)	calcium-dependent protein binding (GO:0048306)	p.S187T(2)		endometrium(1)|large_intestine(2)|lung(8)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	18					Botulinum Toxin Type A(DB00083)	CTAGGCTGATTCCAACAAAAC	0.493																																							uc002wnq.1		NA																	2	Substitution - Missense(2)		lung(2)	skin(2)	2						c.(559-561)TCC>ACC		synaptosomal-associated protein 25 isoform	Botulinum Toxin Type A(DB00083)						124.0	102.0	109.0					20																	10286783		2203	4300	6503	SO:0001583	missense	6616				energy reserve metabolic process|glutamate secretion|neurotransmitter uptake|synaptic vesicle docking involved in exocytosis	cell junction|growth cone|perinuclear region of cytoplasm|synapse|synaptosome		g.chr20:10286783T>A		CCDS13109.1, CCDS13110.1	20p12-p11.2	2008-08-01	2002-08-29		ENSG00000132639	ENSG00000132639			11132	protein-coding gene	gene with protein product	"""resistance to inhibitors of cholinesterase 4 homolog"""	600322	"""synaptosomal-associated protein, 25kD"""	SNAP		8661740, 10692432	Standard	NM_003081		Approved	SNAP-25, RIC-4, RIC4, SEC9, bA416N4.2, dJ1068F16.2	uc002wnr.2	P60880	OTTHUMG00000031863	ENST00000254976.2:c.559T>A	20.37:g.10286783T>A	ENSP00000254976:p.Ser187Thr		Somatic				SNAP25_uc002wnr.1_Missense_Mutation_p.S187T|SNAP25_uc002wns.1_Missense_Mutation_p.S124T|SNAP25_uc010gca.1_Missense_Mutation_p.S187T|SNAP25_uc010gcb.1_Missense_Mutation_p.S124T|SNAP25_uc010gcc.1_Missense_Mutation_p.S81T	p.S187T	NM_130811	NP_570824	WXS	Illumina HiSeq	Unspecified	P60880	SNP25_HUMAN			8	771	+			187			t-SNARE coiled-coil homology 2.		B2RAU4|D3DW16|D3DW17|P13795|P36974|P70557|P70558|Q53EM2|Q5U0B5|Q8IXK3|Q96FM2|Q9BR45	Missense_Mutation	SNP	ENST00000254976.2	37	c.559T>A	CCDS13110.1	.	.	.	.	.	.	.	.	.	.	T	12.21	1.869121	0.32977	.	.	ENSG00000132639	ENST00000254976;ENST00000304886	.	.	.	6.08	6.08	0.98989	Target SNARE coiled-coil domain (3);	0.096628	0.85682	D	0.000000	T	0.36441	0.0967	N	0.16130	0.375	0.80722	D	1	B;B	0.33883	0.43;0.425	B;B	0.32762	0.152;0.131	T	0.22626	-1.0211	9	0.17369	T	0.5	-7.8069	16.6512	0.85203	0.0:0.0:0.0:1.0	.	187;187	P60880-2;P60880	.;SNP25_HUMAN	T	187	.	ENSP00000254976:S187T	S	+	1	0	SNAP25	10234783	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.040000	0.89188	2.333000	0.79357	0.482000	0.46254	TCC		0.493	SNAP25-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000077976.3	NM_130811		24	57	0	0	0	0.002299	0	24	57				
SSTR4	6754	broad.mit.edu	37	20	23017003	23017003	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr20:23017003G>T	ENST00000255008.3	+	1	947	c.883G>T	c.(883-885)Gtg>Ttg	p.V295L	RP4-753D10.3_ENST00000440921.1_RNA	NM_001052.2	NP_001043.2	P31391	SSR4_HUMAN	somatostatin receptor 4	295					arachidonic acid metabolic process (GO:0019369)|cell migration (GO:0016477)|cellular response to glucocorticoid stimulus (GO:0071385)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cAMP metabolic process (GO:0030815)|negative regulation of cell proliferation (GO:0008285)|positive regulation of MAPK cascade (GO:0043410)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	somatostatin receptor activity (GO:0004994)	p.V295L(2)		breast(1)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|upper_aerodigestive_tract(1)	32	Colorectal(13;0.0518)|Lung NSC(19;0.0542)|all_lung(19;0.118)					CGTCAACCACGTGTCCCTTAT	0.562																																					Esophageal Squamous(15;850 1104 16640)	Esophageal Squamous(15;850 1104 16640)	uc002wsr.2		NA																	2	Substitution - Missense(2)		upper_aerodigestive_tract(1)|lung(1)	ovary(1)	1						c.(883-885)GTG>TTG		somatostatin receptor 4							205.0	205.0	205.0					20																	23017003		2203	4300	6503	SO:0001583	missense	6754				G-protein signaling, coupled to cyclic nucleotide second messenger|negative regulation of cell proliferation	integral to plasma membrane	somatostatin receptor activity	g.chr20:23017003G>T		CCDS42856.1	20p11.21	2014-07-11			ENSG00000132671	ENSG00000132671		"""GPCR / Class A : Somatostatin receptors"""	11333	protein-coding gene	gene with protein product		182454				8483934	Standard	NM_001052		Approved		uc002wsr.2	P31391	OTTHUMG00000032054	ENST00000255008.3:c.883G>T	20.37:g.23017003G>T	ENSP00000255008:p.Val295Leu		Somatic					p.V295L	NM_001052	NP_001043	WXS	Illumina HiSeq	Unspecified	P31391	SSR4_HUMAN			1	947	+	Colorectal(13;0.0518)|Lung NSC(19;0.0542)|all_lung(19;0.118)		295			Helical; Name=7; (Potential).		Q17RM1|Q17RM3|Q9UIY1	Missense_Mutation	SNP	ENST00000255008.3	37	c.883G>T	CCDS42856.1	.	.	.	.	.	.	.	.	.	.	G	0.635	-0.815556	0.02776	.	.	ENSG00000132671	ENST00000255008	T	0.37235	1.21	3.36	2.4	0.29515	GPCR, rhodopsin-like superfamily (1);	0.228496	0.21195	U	0.078570	T	0.11324	0.0276	N	0.01624	-0.795	0.26787	N	0.969489	B	0.06786	0.001	B	0.14023	0.01	T	0.29397	-1.0013	10	0.13853	T	0.58	.	6.3952	0.21609	0.2355:0.0:0.7645:0.0	.	295	P31391	SSR4_HUMAN	L	295	ENSP00000255008:V295L	ENSP00000255008:V295L	V	+	1	0	SSTR4	22965003	0.212000	0.23540	0.991000	0.47740	0.975000	0.68041	1.530000	0.36007	0.608000	0.30000	0.655000	0.94253	GTG		0.562	SSTR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078308.1			51	107	1	0	6.3237e-29	0.00361	1.69617e-28	51	107				
PTPRT	11122	broad.mit.edu	37	20	40770554	40770554	+	Splice_Site	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr20:40770554C>A	ENST00000373187.1	-	18	2770		c.e18+1		PTPRT_ENST00000356100.2_Splice_Site|PTPRT_ENST00000373201.1_Splice_Site|PTPRT_ENST00000373190.1_Splice_Site|PTPRT_ENST00000373184.1_Splice_Site|PTPRT_ENST00000373198.4_Splice_Site|PTPRT_ENST00000373193.3_Splice_Site			O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T						cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|protein tyrosine phosphatase activity (GO:0004725)	p.?(1)		NS(2)|breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(12)|large_intestine(26)|liver(1)|lung(63)|ovary(8)|pancreas(2)|prostate(5)|skin(35)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	176		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				AGGGCACCTACAGGATATGAT	0.448																																							uc002xkg.2		NA																	1	Unknown(1)		lung(1)	skin(8)|ovary(7)|lung(5)	20						c.e18+1		protein tyrosine phosphatase, receptor type, T							208.0	208.0	208.0					20																	40770554		1915	4123	6038	SO:0001630	splice_region_variant	11122				homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity	g.chr20:40770554C>A	AF043644	CCDS42874.1, CCDS68127.1	20q12-q13	2013-02-11			ENSG00000196090	ENSG00000196090		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9682	protein-coding gene	gene with protein product		608712				9486824, 9602027	Standard	NM_133170		Approved	RPTPrho, KIAA0283	uc010ggj.3	O14522	OTTHUMG00000033040	ENST00000373187.1:c.2770+1G>T	20.37:g.40770554C>A			Somatic				PTPRT_uc010ggj.2_Splice_Site_p.Y943_splice|PTPRT_uc010ggi.2_Splice_Site_p.Y127_splice	p.Y924_splice	NM_007050	NP_008981	WXS	Illumina HiSeq	Unspecified	O14522	PTPRT_HUMAN			18	2954	-		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)						A8E4R6|O43655|O75664|Q5W0X9|Q5W0Y1|Q9BR24|Q9BR28|Q9H0Y8|Q9NTL1|Q9NU72|Q9UBD2|Q9UJL7	Splice_Site	SNP	ENST00000373187.1	37	c.2770_splice	CCDS42874.1	.	.	.	.	.	.	.	.	.	.	C	27.3	4.817466	0.90790	.	.	ENSG00000196090	ENST00000373190;ENST00000373187;ENST00000373193;ENST00000356100;ENST00000373198;ENST00000373184;ENST00000373201	.	.	.	5.28	5.28	0.74379	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.05	0.89344	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PTPRT	40203968	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.874000	0.75546	2.613000	0.88420	0.650000	0.86243	.		0.448	PTPRT-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000080315.1		Intron	34	137	1	0	1.836e-18	0.003755	4.46553e-18	34	137				
CDH22	64405	broad.mit.edu	37	20	44815504	44815504	+	Silent	SNP	G	G	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr20:44815504G>A	ENST00000372262.3	-	8	1906	c.1506C>T	c.(1504-1506)ccC>ccT	p.P502P	CDH22_ENST00000537909.1_Silent_p.P502P	NM_021248.1	NP_067071.1	Q9UJ99	CAD22_HUMAN	cadherin 22, type 2	502	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				brain development (GO:0007420)|calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P502P(1)		endometrium(3)|kidney(1)|large_intestine(9)|lung(16)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|urinary_tract(3)	44		Myeloproliferative disorder(115;0.0122)				CTGCCTCGTAGGGTGTGGCCA	0.592																																							uc002xrm.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|skin(1)	5						c.(1504-1506)CCC>CCT		cadherin 22 precursor							207.0	185.0	192.0					20																	44815504		2203	4300	6503	SO:0001819	synonymous_variant	64405				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr20:44815504G>A	AF035300	CCDS13395.1	20q13.1	2010-01-26	2009-11-20		ENSG00000149654	ENSG00000149654		"""Cadherins / Major cadherins"""	13251	protein-coding gene	gene with protein product		609920	"""cadherin-like 22"""	C20orf25		8626716	Standard	NM_021248		Approved	dJ998H6.1	uc010ghk.2	Q9UJ99	OTTHUMG00000033073	ENST00000372262.3:c.1506C>T	20.37:g.44815504G>A			Somatic				CDH22_uc010ghk.1_Silent_p.P502P	p.P502P	NM_021248	NP_067071	WXS	Illumina HiSeq	Unspecified	Q9UJ99	CAD22_HUMAN			8	1907	-		Myeloproliferative disorder(115;0.0122)	502			Cadherin 5.|Extracellular (Potential).		B9EGK7|O43205	Silent	SNP	ENST00000372262.3	37	c.1506C>T	CCDS13395.1																																																																																				0.592	CDH22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080491.1	NM_021248		22	110	0	0	0	0.00333	0	22	110				
TUBB1	81027	broad.mit.edu	37	20	57599371	57599371	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr20:57599371C>A	ENST00000217133.1	+	4	1158	c.889C>A	c.(889-891)Cgc>Agc	p.R297S		NM_030773.3	NP_110400.1	Q9H4B7	TBB1_HUMAN	tubulin, beta 1 class VI	297					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)|protein polymerization (GO:0051258)|spindle assembly (GO:0051225)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)	p.R297S(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(2)|skin(2)	16	all_lung(29;0.00711)		Colorectal(105;0.109)		Cabazitaxel(DB06772)|Colchicine(DB01394)|Docetaxel(DB01248)|Paclitaxel(DB01229)|Vindesine(DB00309)	GTTCGATGCCCGCAATACCAT	0.627																																							uc002yak.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(889-891)CGC>AGC		beta tubulin 1, class VI	Colchicine(DB01394)|Docetaxel(DB01248)|Paclitaxel(DB01229)|Vindesine(DB00309)						55.0	47.0	50.0					20																	57599371		2203	4300	6503	SO:0001583	missense	81027				'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity	g.chr20:57599371C>A	AJ292757	CCDS13475.1	20q13.32	2014-09-17	2011-10-10		ENSG00000101162	ENSG00000101162		"""Tubulins"""	16257	protein-coding gene	gene with protein product	"""class VI beta-tubulin"""	612901	"""tubulin, beta 1"""				Standard	NM_030773		Approved	dJ543J19.4	uc002yak.3	Q9H4B7	OTTHUMG00000032860	ENST00000217133.1:c.889C>A	20.37:g.57599371C>A	ENSP00000217133:p.Arg297Ser		Somatic					p.R297S	NM_030773	NP_110400	WXS	Illumina HiSeq	Unspecified	Q9H4B7	TBB1_HUMAN	Colorectal(105;0.109)		4	1158	+	all_lung(29;0.00711)		297						Missense_Mutation	SNP	ENST00000217133.1	37	c.889C>A	CCDS13475.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.050062	0.75846	.	.	ENSG00000101162	ENST00000217133	T	0.80738	-1.41	5.34	5.34	0.76211	Tubulin/FtsZ, 2-layer sandwich domain (3);Tubulin/FtsZ, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.79364	0.4433	L	0.45422	1.42	0.51233	D	0.999917	P	0.52842	0.956	P	0.48704	0.587	T	0.81818	-0.0758	10	0.87932	D	0	.	13.0358	0.58870	0.161:0.839:0.0:0.0	.	297	Q9H4B7	TBB1_HUMAN	S	297	ENSP00000217133:R297S	ENSP00000217133:R297S	R	+	1	0	TUBB1	57032766	0.996000	0.38824	0.999000	0.59377	0.891000	0.51852	3.295000	0.51794	2.509000	0.84616	0.561000	0.74099	CGC		0.627	TUBB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079903.1	NM_030773		6	33	1	0	5.9392e-07	0.001168	1.05873e-06	6	33				
ZNF831	128611	broad.mit.edu	37	20	57768614	57768614	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr20:57768614C>A	ENST00000371030.2	+	1	2540	c.2540C>A	c.(2539-2541)cCc>cAc	p.P847H		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	847							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)	p.P847H(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					CCAGGTGGGCCCACGCAGCCT	0.642																																							uc002yan.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(13)|ovary(1)	14						c.(2539-2541)CCC>CAC		zinc finger protein 831							26.0	34.0	32.0					20																	57768614		2015	4190	6205	SO:0001583	missense	128611					intracellular	nucleic acid binding|zinc ion binding	g.chr20:57768614C>A	AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.2540C>A	20.37:g.57768614C>A	ENSP00000360069:p.Pro847His		Somatic					p.P847H	NM_178457	NP_848552	WXS	Illumina HiSeq	Unspecified	Q5JPB2	ZN831_HUMAN			1	2540	+	all_lung(29;0.0085)		847					Q5TDR4|Q8TCP0	Missense_Mutation	SNP	ENST00000371030.2	37	c.2540C>A	CCDS42894.1	.	.	.	.	.	.	.	.	.	.	C	14.62	2.590464	0.46214	.	.	ENSG00000124203	ENST00000371030	T	0.04970	3.52	4.91	2.82	0.32997	.	0.933883	0.08907	N	0.876427	T	0.10423	0.0255	L	0.27053	0.805	0.09310	N	1	D	0.65815	0.995	P	0.58660	0.843	T	0.34204	-0.9838	10	0.62326	D	0.03	-5.0378	5.6191	0.17448	0.194:0.7048:0.0:0.1012	.	847	Q5JPB2	ZN831_HUMAN	H	847	ENSP00000360069:P847H	ENSP00000360069:P847H	P	+	2	0	ZNF831	57202009	0.000000	0.05858	0.001000	0.08648	0.000000	0.00434	-0.290000	0.08354	1.196000	0.43129	-0.136000	0.14681	CCC		0.642	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000079916.2	NM_178457		15	26	1	0	1.52009e-12	0.003163	3.14994e-12	15	26				
PHACTR3	116154	broad.mit.edu	37	20	58349509	58349509	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr20:58349509C>A	ENST00000371015.1	+	7	1605	c.1138C>A	c.(1138-1140)Cag>Aag	p.Q380K	PHACTR3_ENST00000355648.4_Missense_Mutation_p.Q339K|PHACTR3_ENST00000395639.4_Missense_Mutation_p.Q269K|PHACTR3_ENST00000541461.1_Missense_Mutation_p.Q339K|PHACTR3_ENST00000361300.4_Missense_Mutation_p.Q269K|PHACTR3_ENST00000359926.3_Missense_Mutation_p.Q377K|PHACTR3_ENST00000395636.2_Missense_Mutation_p.Q339K	NM_001281507.1|NM_080672.3	NP_001268436.1|NP_542403.1	Q96KR7	PHAR3_HUMAN	phosphatase and actin regulator 3	380						nucleus (GO:0005634)	protein phosphatase inhibitor activity (GO:0004864)	p.Q380K(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|liver(2)|lung(32)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	59	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;2.76e-09)			GCTTTTGTATCAGGACGAGGA	0.507																																							uc002yau.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|pancreas(1)	3						c.(1138-1140)CAG>AAG		phosphatase and actin regulator 3 isoform 1							133.0	136.0	135.0					20																	58349509		2203	4300	6503	SO:0001583	missense	116154					nuclear matrix	actin binding|protein phosphatase inhibitor activity	g.chr20:58349509C>A	AJ311122	CCDS13480.1, CCDS13481.1, CCDS42895.1, CCDS56202.1	20q13.32-q13.33	2014-06-13	2004-05-20	2004-05-20	ENSG00000087495	ENSG00000087495		"""Phosphatase and actin regulators"""	15833	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 123"""	608725	"""chromosome 20 open reading frame 101"""	C20orf101		15107502	Standard	NM_001199505		Approved	PPP1R123	uc002yau.3	Q96KR7	OTTHUMG00000032869	ENST00000371015.1:c.1138C>A	20.37:g.58349509C>A	ENSP00000360054:p.Gln380Lys		Somatic				PHACTR3_uc002yat.2_Missense_Mutation_p.Q377K|PHACTR3_uc010zzw.1_Missense_Mutation_p.Q339K|PHACTR3_uc002yav.2_Missense_Mutation_p.Q339K|PHACTR3_uc002yaw.2_Missense_Mutation_p.Q339K|PHACTR3_uc002yax.2_Missense_Mutation_p.Q269K	p.Q380K	NM_080672	NP_542403	WXS	Illumina HiSeq	Unspecified	Q96KR7	PHAR3_HUMAN	BRCA - Breast invasive adenocarcinoma(7;2.76e-09)		7	1605	+	all_lung(29;0.00344)		380					B1AKX0|B1AN68|B1AN69|B2RB46|Q32P33|Q707P6|Q9H4T4	Missense_Mutation	SNP	ENST00000371015.1	37	c.1138C>A	CCDS13480.1	.	.	.	.	.	.	.	.	.	.	C	13.09	2.132477	0.37630	.	.	ENSG00000087495	ENST00000359926;ENST00000371015;ENST00000395639;ENST00000541461;ENST00000355648;ENST00000395636;ENST00000361300	T;T;T;T;T;T;T	0.27256	2.08;2.09;1.68;2.09;2.09;2.09;1.68	5.06	5.06	0.68205	.	0.167044	0.44285	D	0.000471	T	0.34019	0.0883	M	0.67953	2.075	0.53005	D	0.999966	P;P;P	0.47604	0.898;0.65;0.65	P;B;B	0.46718	0.525;0.244;0.244	T	0.12528	-1.0544	10	0.11794	T	0.64	-24.0679	17.4155	0.87498	0.0:1.0:0.0:0.0	.	269;380;377	Q96KR7-3;Q96KR7;B1AKX0	.;PHAR3_HUMAN;.	K	377;380;269;339;339;339;269	ENSP00000353002:Q377K;ENSP00000360054:Q380K;ENSP00000379001:Q269K;ENSP00000442483:Q339K;ENSP00000347866:Q339K;ENSP00000378998:Q339K;ENSP00000354555:Q269K	ENSP00000347866:Q339K	Q	+	1	0	PHACTR3	57782904	1.000000	0.71417	0.981000	0.43875	0.559000	0.35586	5.356000	0.66052	2.335000	0.79485	0.655000	0.94253	CAG		0.507	PHACTR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079923.3	NM_080672		25	94	1	0	1.17739e-12	0.005443	2.44864e-12	25	94				
MYT1	4661	broad.mit.edu	37	20	62839282	62839282	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr20:62839282A>G	ENST00000328439.1	+	7	1097	c.733A>G	c.(733-735)Agt>Ggt	p.S245G	MYT1_ENST00000360149.4_Intron|MYT1_ENST00000536311.1_Missense_Mutation_p.S245G	NM_004535.2	NP_004526.1	Q99640	PMYT1_HUMAN	myelin transcription factor 1	0	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|regulation of cell cycle (GO:0051726)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitosis (GO:0007088)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.S245G(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(12)|liver(1)|lung(17)|ovary(5)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55	all_cancers(38;1.82e-11)|all_epithelial(29;3.3e-13)|Lung NSC(23;5.21e-10)|all_lung(23;1.92e-09)					GGATGCAGCCAGTGAGGAGTC	0.602																																					GBM(59;481 1041 20555 21139 33705)	GBM(59;481 1041 20555 21139 33705)	uc002yii.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(733-735)AGT>GGT		myelin transcription factor 1							31.0	32.0	31.0					20																	62839282		2203	4300	6503	SO:0001583	missense	4661				cell differentiation|nervous system development	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr20:62839282A>G	M96980	CCDS13558.1	20q13.33	2014-03-24			ENSG00000196132	ENSG00000196132		"""Zinc fingers, C2HC-type containing"""	7622	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 2"""	600379		PLPB1		1280325, 9268380	Standard	NM_004535		Approved	MTF1, MYTI, ZC2HC4A, NZF2	uc002yii.3	Q01538	OTTHUMG00000149988	ENST00000328439.1:c.733A>G	20.37:g.62839282A>G	ENSP00000327465:p.Ser245Gly		Somatic				MYT1_uc002yih.2_Intron|MYT1_uc002yij.2_5'UTR	p.S245G	NM_004535	NP_004526	WXS	Illumina HiSeq	Unspecified	Q01538	MYT1_HUMAN			7	1097	+	all_cancers(38;1.82e-11)|all_epithelial(29;3.3e-13)|Lung NSC(23;5.21e-10)|all_lung(23;1.92e-09)		245			Glu-rich.		B3KUN8|B4DXD4|D3DUA4|F8W164|I3L1V2|O14731|Q7LE24|Q8TCM9	Missense_Mutation	SNP	ENST00000328439.1	37	c.733A>G	CCDS13558.1	.	.	.	.	.	.	.	.	.	.	a	7.015	0.557515	0.13436	.	.	ENSG00000196132	ENST00000328439;ENST00000536311	T;T	0.70986	2.38;-0.53	4.46	2.03	0.26663	.	0.850231	0.10713	N	0.642664	T	0.54854	0.1884	L	0.36672	1.1	0.09310	N	1	B	0.12013	0.005	B	0.06405	0.002	T	0.37244	-0.9714	10	0.23302	T	0.38	0.401	4.7329	0.12974	0.7435:0.0:0.0908:0.1657	.	245	Q01538	MYT1_HUMAN	G	245	ENSP00000327465:S245G;ENSP00000442412:S245G	ENSP00000327465:S245G	S	+	1	0	MYT1	62309726	0.003000	0.15002	0.003000	0.11579	0.950000	0.60333	1.390000	0.34464	0.601000	0.29879	0.451000	0.29950	AGT		0.602	MYT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080297.1	NM_004535		3	14	0	0	0	0.004672	0	3	14				
LIPI	149998	broad.mit.edu	37	21	15561682	15561682	+	Silent	SNP	A	A	G			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr21:15561682A>G	ENST00000536861.1	-	2	104	c.105T>C	c.(103-105)gaT>gaC	p.D35D	LIPI_ENST00000344577.2_Silent_p.D56D			Q6XZB0	LIPI_HUMAN	lipase, member I	35					lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|phospholipase activity (GO:0004620)	p.D56D(1)		endometrium(1)|kidney(13)|large_intestine(9)|liver(3)|lung(24)|ovary(3)|urinary_tract(1)	54				Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.0015)|Colorectal(24;0.00693)|Lung(58;0.166)		GAATAAATAAATCTCTGAAGG	0.353																																							uc002yjm.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(166-168)GAT>GAC		lipase, member I							90.0	93.0	92.0					21																	15561682		2203	4300	6503	SO:0001819	synonymous_variant	149998				lipid catabolic process	extracellular region|extracellular space|membrane|plasma membrane	heparin binding|phospholipase activity	g.chr21:15561682A>G	BC028732	CCDS13564.1	21q11.2	2012-07-31			ENSG00000188992	ENSG00000188992			18821	protein-coding gene	gene with protein product	"""membrane-associated phospholipase A1 beta"", ""cancer/testis antigen 17"""	609252				12719377	Standard	XM_005260924		Approved	PRED5, LPDL, CT17, mPA-PLA1beta, PLA1C	uc002yjm.3	Q6XZB0	OTTHUMG00000074258	ENST00000536861.1:c.105T>C	21.37:g.15561682A>G			Somatic				LIPI_uc010gkw.1_5'UTR	p.D56D	NM_198996	NP_945347	WXS	Illumina HiSeq	Unspecified	Q6XZB0	LIPI_HUMAN		Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.0015)|Colorectal(24;0.00693)|Lung(58;0.166)	2	178	-			35					G1JSG3|G1JSG4|G1JSG5|G1JSG6|G1JSG7|G1JSG8|G1JSG9	Silent	SNP	ENST00000536861.1	37	c.168T>C																																																																																					0.353	LIPI-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_198996		39	59	0	0	0	0.005524	0	39	59				
PCNT	5116	broad.mit.edu	37	21	47783483	47783483	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr21:47783483A>T	ENST00000359568.5	+	14	2350	c.2243A>T	c.(2242-2244)aAa>aTa	p.K748I	PCNT_ENST00000480896.1_3'UTR	NM_006031.5	NP_006022.3	O95613	PCNT_HUMAN	pericentrin	748	Glu-rich.				brain morphogenesis (GO:0048854)|cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of intracellular protein transport (GO:0090316)|spindle organization (GO:0007051)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|microtubule (GO:0005874)|motile cilium (GO:0031514)|pericentriolar material (GO:0000242)		p.K748I(1)		NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(15)|liver(2)|lung(41)|ovary(5)|pancreas(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	104	Breast(49;0.112)					TTCCAAAGAAAAGAAACGGAC	0.408																																							uc002zji.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|breast(2)|pancreas(2)	8						c.(2242-2244)AAA>ATA		pericentrin							130.0	133.0	132.0					21																	47783483		2203	4300	6503	SO:0001583	missense	5116				cilium assembly|G2/M transition of mitotic cell cycle	cytosol|microtubule	calmodulin binding	g.chr21:47783483A>T	AB007862	CCDS33592.1	21q22.3	2014-02-20	2008-01-30	2005-11-03	ENSG00000160299	ENSG00000160299			16068	protein-coding gene	gene with protein product	"""kendrin"", ""Seckel syndrome 4"""	605925	"""pericentrin 2 (kendrin)"""	PCNT2		8812505, 9455477	Standard	NM_006031		Approved	KEN, KIAA0402, PCN, PCNTB, SCKL4	uc002zji.4	O95613	OTTHUMG00000090665	ENST00000359568.5:c.2243A>T	21.37:g.47783483A>T	ENSP00000352572:p.Lys748Ile		Somatic				PCNT_uc002zjj.2_Missense_Mutation_p.K630I	p.K748I	NM_006031	NP_006022	WXS	Illumina HiSeq	Unspecified	O95613	PCNT_HUMAN			14	2350	+	Breast(49;0.112)		748			Glu-rich.|Potential.		O43152|Q7Z7C9	Missense_Mutation	SNP	ENST00000359568.5	37	c.2243A>T	CCDS33592.1	.	.	.	.	.	.	.	.	.	.	A	16.57	3.159552	0.57368	.	.	ENSG00000160299	ENST00000359568;ENST00000337772	T	0.24908	1.83	5.11	-0.351	0.12602	.	0.450247	0.16510	N	0.211299	T	0.36663	0.0975	L	0.46157	1.445	0.09310	N	0.999992	D;D	0.76494	0.999;0.998	D;P	0.63877	0.919;0.897	T	0.20338	-1.0278	10	0.72032	D	0.01	.	10.4244	0.44369	0.8179:0.0:0.1821:0.0	.	630;748	O95613-2;O95613	.;PCNT_HUMAN	I	748;735	ENSP00000352572:K748I	ENSP00000338675:K735I	K	+	2	0	PCNT	46607911	0.907000	0.30839	0.005000	0.12908	0.011000	0.07611	0.962000	0.29280	-0.034000	0.13713	0.528000	0.53228	AAA		0.408	PCNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207336.1	NM_006031		20	67	0	0	0	0.007413	0	20	67				
POTEH	23784	broad.mit.edu	37	22	16279214	16279214	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr22:16279214C>A	ENST00000343518.6	-	4	1060	c.1009G>T	c.(1009-1011)Gca>Tca	p.A337S	RNU6-816P_ENST00000390914.1_RNA|POTEH-AS1_ENST00000422014.1_RNA	NM_001136213.1	NP_001129685.1	Q6S545	POTEH_HUMAN	POTE ankyrin domain family, member H	337								p.A337S(1)		NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(20)|ovary(1)|skin(7)|urinary_tract(2)	37						CTATCCAGTGCATTTAAATTT	0.313																																							uc010gqp.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(1009-1011)GCA>TCA		ANKRD26-like family C, member 3																																				SO:0001583	missense	23784							g.chr22:16279214C>A	AY462874	CCDS74808.1	22q11.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000198062	ENSG00000198062		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	133	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 7"""	608913	"""actin, beta-like 1"", ""ANKRD26-like family C, member 3"""	ACTBL1, A26C3		10591208, 15276201, 21439273	Standard	NM_001136213		Approved	POTE22, CT104.7	uc010gqp.2	Q6S545	OTTHUMG00000140314	ENST00000343518.6:c.1009G>T	22.37:g.16279214C>A	ENSP00000340610:p.Ala337Ser		Somatic				POTEH_uc002zlg.1_RNA|POTEH_uc002zlh.1_Missense_Mutation_p.A56S|POTEH_uc002zlj.1_Missense_Mutation_p.A172S	p.A337S	NM_001136213	NP_001129685	WXS	Illumina HiSeq	Unspecified	Q6S545	POTEH_HUMAN			4	1061	-			337			ANK 5.		A2CEK4|A6NCI1|A9Z1W0	Missense_Mutation	SNP	ENST00000343518.6	37	c.1009G>T	CCDS46658.1	.	.	.	.	.	.	.	.	.	.	.	9.851	1.193548	0.22037	.	.	ENSG00000198062	ENST00000359587;ENST00000343518	T	0.56103	0.48	1.38	-1.16	0.09678	Ankyrin repeat-containing domain (4);	0.000000	0.35805	U	0.002961	T	0.48429	0.1499	L	0.59967	1.855	0.09310	N	1	B;P	0.45283	0.416;0.855	B;P	0.50231	0.347;0.635	T	0.42865	-0.9426	10	0.56958	D	0.05	.	1.8902	0.03246	0.3209:0.4527:0.0:0.2264	.	337;300	Q6S545;A6NKF6	POTEH_HUMAN;.	S	300;337	ENSP00000340610:A337S	ENSP00000340610:A337S	A	-	1	0	POTEH	14659214	0.000000	0.05858	0.000000	0.03702	0.056000	0.15407	0.044000	0.13992	-0.262000	0.09392	0.175000	0.17021	GCA		0.313	POTEH-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000276918.4	NM_001136213		29	550	1	0	9.39395e-14	0.00632	2.00451e-13	29	550				
POTEH	23784	broad.mit.edu	37	22	16287480	16287480	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr22:16287480C>A	ENST00000343518.6	-	1	457	c.406G>T	c.(406-408)Ggc>Tgc	p.G136C		NM_001136213.1	NP_001129685.1	Q6S545	POTEH_HUMAN	POTE ankyrin domain family, member H	136								p.G136C(1)		NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(20)|ovary(1)|skin(7)|urinary_tract(2)	37						CACCACTTGCCCATCTTGCTC	0.617																																							uc010gqp.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(406-408)GGC>TGC		ANKRD26-like family C, member 3							43.0	55.0	51.0					22																	16287480		1760	3402	5162	SO:0001583	missense	23784							g.chr22:16287480C>A	AY462874	CCDS74808.1	22q11.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000198062	ENSG00000198062		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	133	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 7"""	608913	"""actin, beta-like 1"", ""ANKRD26-like family C, member 3"""	ACTBL1, A26C3		10591208, 15276201, 21439273	Standard	NM_001136213		Approved	POTE22, CT104.7	uc010gqp.2	Q6S545	OTTHUMG00000140314	ENST00000343518.6:c.406G>T	22.37:g.16287480C>A	ENSP00000340610:p.Gly136Cys		Somatic				POTEH_uc002zlg.1_5'Flank|POTEH_uc002zlh.1_5'Flank|POTEH_uc002zlj.1_Intron	p.G136C	NM_001136213	NP_001129685	WXS	Illumina HiSeq	Unspecified	Q6S545	POTEH_HUMAN			1	458	-			136					A2CEK4|A6NCI1|A9Z1W0	Missense_Mutation	SNP	ENST00000343518.6	37	c.406G>T	CCDS46658.1	.	.	.	.	.	.	.	.	.	.	.	3.017	-0.202618	0.06219	.	.	ENSG00000198062	ENST00000359587;ENST00000343518;ENST00000355872	T	0.30714	1.52	.	.	.	.	.	.	.	.	T	0.22666	0.0547	L	0.38175	1.15	0.09310	N	1	B	0.21225	0.053	B	0.22753	0.041	T	0.27400	-1.0075	7	0.66056	D	0.02	.	.	.	.	.	136	Q6S545	POTEH_HUMAN	C	99;136;136	ENSP00000340610:G136C	ENSP00000340610:G136C	G	-	1	0	POTEH	14667480	0.008000	0.16893	0.024000	0.17045	0.108000	0.19459	1.154000	0.31688	0.422000	0.26005	0.000000	0.15137	GGC		0.617	POTEH-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000276918.4	NM_001136213		71	476	1	0	9.47431e-33	0.00361	2.55317e-32	71	476				
CECR1	51816	broad.mit.edu	37	22	17662792	17662792	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr22:17662792C>A	ENST00000399839.1	-	9	1630	c.1360G>T	c.(1360-1362)Gat>Tat	p.D454Y	CECR1_ENST00000262607.3_Missense_Mutation_p.D454Y|CECR1_ENST00000449907.2_Missense_Mutation_p.D412Y|CECR1_ENST00000330232.4_Missense_Mutation_p.D213Y|CECR1_ENST00000399837.2_Missense_Mutation_p.D454Y	NM_001282227.1|NM_001282228.1	NP_001269156.1|NP_001269157.1	Q9NZK5	CECR1_HUMAN	cat eye syndrome chromosome region, candidate 1	454					adenosine catabolic process (GO:0006154)|hypoxanthine salvage (GO:0043103)|inosine biosynthetic process (GO:0046103)|multicellular organismal development (GO:0007275)	extracellular space (GO:0005615)	adenosine deaminase activity (GO:0004000)|adenosine receptor binding (GO:0031685)|growth factor activity (GO:0008083)|heparin binding (GO:0008201)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|zinc ion binding (GO:0008270)	p.D454Y(1)|p.D213Y(1)		endometrium(1)|kidney(2)|large_intestine(6)|liver(1)|lung(10)|ovary(2)|prostate(2)|stomach(1)	25		all_epithelial(15;0.0152)|Lung NSC(13;0.0875)|all_lung(157;0.106)				TCATAGAAATCATAGGACAAG	0.532																																							uc002zmk.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(1360-1362)GAT>TAT		cat eye syndrome critical region protein 1							97.0	82.0	88.0					22																	17662792		2203	4300	6503	SO:0001583	missense	51816				adenosine catabolic process|hypoxanthine salvage|inosine biosynthetic process|multicellular organismal development|purine ribonucleoside monophosphate biosynthetic process	extracellular space|Golgi apparatus	adenosine deaminase activity|adenosine receptor binding|growth factor activity|heparin binding|protein homodimerization activity|proteoglycan binding|zinc ion binding	g.chr22:17662792C>A	AF190746	CCDS13742.1, CCDS13743.1, CCDS63395.1, CCDS74809.1	22q11.2	2008-02-22			ENSG00000093072	ENSG00000093072			1839	protein-coding gene	gene with protein product		607575		IDGFL		10756095	Standard	NM_001282225		Approved	ADGF	uc002zmk.1	Q9NZK5	OTTHUMG00000030726	ENST00000399839.1:c.1360G>T	22.37:g.17662792C>A	ENSP00000382733:p.Asp454Tyr		Somatic				CECR1_uc010gqu.1_Missense_Mutation_p.D454Y|CECR1_uc011agi.1_Missense_Mutation_p.D412Y|CECR1_uc002zmj.1_Missense_Mutation_p.D213Y	p.D454Y	NM_017424	NP_059120	WXS	Illumina HiSeq	Unspecified	Q9NZK5	CECR1_HUMAN			8	1572	-		all_epithelial(15;0.0152)|Lung NSC(13;0.0875)|all_lung(157;0.106)	454					A8K9H4|Q6ICF1|Q86UB6|Q8NCJ2|Q96K41	Missense_Mutation	SNP	ENST00000399839.1	37	c.1360G>T	CCDS13742.1	.	.	.	.	.	.	.	.	.	.	C	14.43	2.532496	0.45073	.	.	ENSG00000093072	ENST00000399839;ENST00000330232;ENST00000262607;ENST00000449907;ENST00000399837	D;D;D;D;D	0.83837	-1.77;-1.77;-1.77;-1.77;-1.77	3.78	3.78	0.43462	Adenosine/AMP deaminase (1);	0.000000	0.85682	D	0.000000	D	0.93719	0.7993	H	0.96080	3.765	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.95912	0.8924	10	0.87932	D	0	.	15.6405	0.76997	0.0:1.0:0.0:0.0	.	454;213	Q9NZK5;Q9NZK5-2	CECR1_HUMAN;.	Y	454;213;454;412;454	ENSP00000382733:D454Y;ENSP00000332871:D213Y;ENSP00000262607:D454Y;ENSP00000406443:D412Y;ENSP00000382731:D454Y	ENSP00000262607:D454Y	D	-	1	0	CECR1	16042792	1.000000	0.71417	0.846000	0.33378	0.040000	0.13550	4.843000	0.62838	1.645000	0.50612	0.561000	0.74099	GAT		0.532	CECR1-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316079.1			18	48	1	0	1.56452e-12	0.007413	3.23035e-12	18	48				
CABIN1	23523	broad.mit.edu	37	22	24487629	24487629	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr22:24487629G>T	ENST00000398319.2	+	24	4003	c.3618G>T	c.(3616-3618)tgG>tgT	p.W1206C	CABIN1_ENST00000405822.2_Missense_Mutation_p.W1156C|CABIN1_ENST00000263119.5_Missense_Mutation_p.W1206C	NM_001199281.1	NP_001186210.1	Q9Y6J0	CABIN_HUMAN	calcineurin binding protein 1	1206					cell surface receptor signaling pathway (GO:0007166)|chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|negative regulation of catalytic activity (GO:0043086)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase inhibitor activity (GO:0004864)	p.W1206C(1)		breast(2)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(13)|liver(1)|lung(18)|ovary(5)|pancreas(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						AGGAGGAGTGGCTCATCCACT	0.602																																							uc002zzi.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5						c.(3616-3618)TGG>TGT		calcineurin binding protein 1							97.0	77.0	84.0					22																	24487629		2203	4300	6503	SO:0001583	missense	23523				cell surface receptor linked signaling pathway|chromatin modification	nucleus	protein phosphatase inhibitor activity	g.chr22:24487629G>T	AF072441	CCDS13823.1, CCDS74830.1	22q11.23	2008-09-16			ENSG00000099991	ENSG00000099991			24187	protein-coding gene	gene with protein product		604251				9655484, 9205841	Standard	NM_001199281		Approved	KIAA0330, PPP3IN	uc002zzi.1	Q9Y6J0	OTTHUMG00000150797	ENST00000398319.2:c.3618G>T	22.37:g.24487629G>T	ENSP00000381364:p.Trp1206Cys		Somatic				CABIN1_uc002zzj.1_Missense_Mutation_p.W1156C|CABIN1_uc002zzl.1_Missense_Mutation_p.W1206C	p.W1206C	NM_012295	NP_036427	WXS	Illumina HiSeq	Unspecified	Q9Y6J0	CABIN_HUMAN			24	3745	+			1206					G5E9F3|Q6PHY0|Q9Y460	Missense_Mutation	SNP	ENST00000398319.2	37	c.3618G>T	CCDS13823.1	.	.	.	.	.	.	.	.	.	.	G	15.74	2.922865	0.52653	.	.	ENSG00000099991	ENST00000263119;ENST00000405822;ENST00000398319	T;T;T	0.32023	1.47;1.47;1.47	4.46	3.43	0.39272	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	T	0.54598	0.1868	M	0.78456	2.415	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.996	T	0.60677	-0.7216	10	0.87932	D	0	.	12.4432	0.55637	0.0835:0.0:0.9165:0.0	.	1156;1206	G5E9F3;Q9Y6J0	.;CABIN_HUMAN	C	1206;1156;1206	ENSP00000263119:W1206C;ENSP00000384694:W1156C;ENSP00000381364:W1206C	ENSP00000263119:W1206C	W	+	3	0	CABIN1	22817629	1.000000	0.71417	1.000000	0.80357	0.385000	0.30292	9.695000	0.98691	1.204000	0.43247	-0.156000	0.13503	TGG		0.602	CABIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320161.2	NM_012295		13	56	1	0	1.61879e-10	0.001368	3.18215e-10	13	56				
SF3A1	10291	broad.mit.edu	37	22	30735151	30735151	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr22:30735151C>A	ENST00000215793.8	-	10	1619	c.1465G>T	c.(1465-1467)Ggt>Tgt	p.G489C	SF3A1_ENST00000439242.1_Missense_Mutation_p.G424C	NM_005877.4	NP_005868.1	Q15459	SF3A1_HUMAN	splicing factor 3a, subunit 1, 120kDa	489					gene expression (GO:0010467)|mRNA 3'-splice site recognition (GO:0000389)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U2-type spliceosomal complex (GO:0005684)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.G489C(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(9)|ovary(4)|pancreas(1)|prostate(1)|urinary_tract(1)	29						TCCTCCTCACCGATCTTCTTA	0.512																																							uc003ahl.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|large_intestine(1)|pancreas(1)	5						c.(1465-1467)GGT>TGT		splicing factor 3a, subunit 1, 120kDa isoform 1							262.0	205.0	224.0					22																	30735151		2203	4300	6503	SO:0001583	missense	10291				nuclear mRNA 3'-splice site recognition	catalytic step 2 spliceosome|nucleoplasm|U2-type spliceosomal complex	protein binding|RNA binding	g.chr22:30735151C>A	X85237	CCDS13875.1	22q12.2	2014-09-17	2002-08-29		ENSG00000099995	ENSG00000099995			10765	protein-coding gene	gene with protein product		605595	"""splicing factor 3a, subunit 1, 120kD"""			7489498	Standard	NM_005877		Approved	SF3a120, SAP114, PRPF21, Prp21	uc003ahl.3	Q15459	OTTHUMG00000151005	ENST00000215793.8:c.1465G>T	22.37:g.30735151C>A	ENSP00000215793:p.Gly489Cys		Somatic					p.G489C	NM_005877	NP_005868	WXS	Illumina HiSeq	Unspecified	Q15459	SF3A1_HUMAN			10	1597	-			489					E9PAW1	Missense_Mutation	SNP	ENST00000215793.8	37	c.1465G>T	CCDS13875.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.032311	0.75504	.	.	ENSG00000099995	ENST00000439242;ENST00000215793;ENST00000536049	T;T	0.35236	1.32;1.34	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	T	0.65852	0.2731	M	0.79693	2.465	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.67719	-0.5598	10	0.87932	D	0	-15.6256	20.3248	0.98698	0.0:1.0:0.0:0.0	.	489	Q15459	SF3A1_HUMAN	C	424;489;386	ENSP00000390336:G424C;ENSP00000215793:G489C	ENSP00000215793:G489C	G	-	1	0	SF3A1	29065151	1.000000	0.71417	0.892000	0.35008	0.982000	0.71751	7.601000	0.82783	2.818000	0.97014	0.655000	0.94253	GGT		0.512	SF3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320916.2	NM_005877		45	104	1	0	2.215e-12	0.002852	4.55703e-12	45	104				
CACNA1I	8911	broad.mit.edu	37	22	40066959	40066959	+	Splice_Site	SNP	G	G	C			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr22:40066959G>C	ENST00000402142.3	+	26	4539	c.4539G>C	c.(4537-4539)acG>acC	p.T1513T	CACNA1I_ENST00000407673.1_Splice_Site_p.T1478T|CACNA1I_ENST00000401624.1_Splice_Site_p.T1513T|CACNA1I_ENST00000400164.3_Splice_Site_p.T1478T|CACNA1I_ENST00000336649.4_Splice_Site_p.T1519T|CACNA1I_ENST00000404898.1_Splice_Site_p.T1478T	NM_021096.3	NP_066919.2	Q9P0X4	CAC1I_HUMAN	calcium channel, voltage-dependent, T type, alpha 1I subunit	1513			T -> M (in dbSNP:rs8141262).		axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|signal transduction (GO:0007165)|sleep (GO:0030431)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)	p.T1513T(1)|p.T1478T(1)		breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|liver(2)|lung(27)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Melanoma(58;0.0749)				Cinnarizine(DB00568)|Flunarizine(DB04841)|Paramethadione(DB00617)|Spironolactone(DB00421)|Verapamil(DB00661)|Zonisamide(DB00909)	ATCAGCCCACGGTGAGCCCTG	0.587																																							uc003ayc.2		NA																	2	Substitution - coding silent(2)		lung(2)	breast(1)|central_nervous_system(1)	2						c.(4537-4539)ACG>ACC		calcium channel, voltage-dependent, T type,	Flunarizine(DB04841)|Paramethadione(DB00617)|Verapamil(DB00661)						75.0	77.0	76.0					22																	40066959		2118	4236	6354	SO:0001630	splice_region_variant	8911				axon guidance|signal transduction	voltage-gated calcium channel complex	low voltage-gated calcium channel activity|protein binding	g.chr22:40066959G>C	AF129133	CCDS46710.1, CCDS46711.1	22q13.1	2012-03-07	2007-02-16		ENSG00000100346	ENSG00000100346		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1396	protein-coding gene	gene with protein product		608230				10454147, 16382099	Standard	NM_021096		Approved	Cav3.3	uc003ayd.3	Q9P0X4	OTTHUMG00000151096	ENST00000402142.3:c.4539+1G>C	22.37:g.40066959G>C			Somatic				CACNA1I_uc003ayd.2_Silent_p.T1478T|CACNA1I_uc003aye.2_Silent_p.T1428T|CACNA1I_uc003ayf.2_Silent_p.T1393T	p.T1513T	NM_021096	NP_066919	WXS	Illumina HiSeq	Unspecified	Q9P0X4	CAC1I_HUMAN			26	4539	+	Melanoma(58;0.0749)		1513			Extracellular (Potential).|IV.		B0QY12|B0QY13|B0QY14|O95504|Q5JZ88|Q7Z6S9|Q8NFX6|Q9NZC8|Q9UH15|Q9UH30|Q9ULU9|Q9UNE6	Silent	SNP	ENST00000402142.3	37	c.4539G>C	CCDS46710.1																																																																																				0.587	CACNA1I-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321290.1	NM_001003406	Silent	11	34	0	0	0	0.008291	0	11	34				
ATP2B2	491	broad.mit.edu	37	3	10387773	10387773	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr3:10387773G>A	ENST00000352432.4	-	16	2522	c.2453C>T	c.(2452-2454)aCg>aTg	p.T818M	ATP2B2_ENST00000383800.4_Missense_Mutation_p.T773M|ATP2B2_ENST00000360273.2_Missense_Mutation_p.T818M|ATP2B2_ENST00000343816.4_Missense_Mutation_p.T804M|ATP2B2_ENST00000397077.1_Missense_Mutation_p.T773M			Q01814	AT2B2_HUMAN	ATPase, Ca++ transporting, plasma membrane 2	818					auditory receptor cell stereocilium organization (GO:0060088)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cerebellar granule cell differentiation (GO:0021707)|cerebellar Purkinje cell differentiation (GO:0021702)|cGMP metabolic process (GO:0046068)|cochlea development (GO:0090102)|cytosolic calcium ion homeostasis (GO:0051480)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotion (GO:0040011)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|organelle organization (GO:0006996)|otolith mineralization (GO:0045299)|positive regulation of calcium ion transport (GO:0051928)|regulation of cell size (GO:0008361)|regulation of synaptic plasticity (GO:0048167)|sensory perception of sound (GO:0007605)|serotonin metabolic process (GO:0042428)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cilium (GO:0005929)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-dependent ATPase activity (GO:0030899)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein C-terminus binding (GO:0008022)	p.T773M(1)|p.T818M(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|large_intestine(19)|lung(29)|ovary(5)|prostate(2)|skin(4)|stomach(2)|urinary_tract(2)	74						CCCGTCCCCCGTCACGGCCAC	0.687																																					Ovarian(125;1619 1709 15675 19819 38835)	Ovarian(125;1619 1709 15675 19819 38835)	uc003bvt.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|skin(2)|central_nervous_system(1)	6						c.(2452-2454)ACG>ATG		plasma membrane calcium ATPase 2 isoform 1							65.0	59.0	61.0					3																	10387773		2203	4300	6503	SO:0001583	missense	491				ATP biosynthetic process|cytosolic calcium ion homeostasis|platelet activation	cytosol|integral to membrane|plasma membrane	ATP binding|ATP binding|calcium ion binding|calcium-transporting ATPase activity|calcium-transporting ATPase activity|calmodulin binding|calmodulin binding|metal ion binding|PDZ domain binding|protein C-terminus binding	g.chr3:10387773G>A	X63575	CCDS2601.1, CCDS33701.1	3p25.3	2010-04-20	2001-12-04		ENSG00000157087	ENSG00000157087	3.6.3.8	"""ATPases / P-type"""	815	protein-coding gene	gene with protein product	"""plasma membrane Ca2+ pump 2"", ""plasma membrane calcium-transporting ATPase 2"""	108733				1313367	Standard	NM_001001331		Approved	PMCA2	uc003bvt.3	Q01814	OTTHUMG00000128679	ENST00000352432.4:c.2453C>T	3.37:g.10387773G>A	ENSP00000324172:p.Thr818Met		Somatic				ATP2B2_uc003bvv.2_Missense_Mutation_p.T773M|ATP2B2_uc003bvw.2_Missense_Mutation_p.T773M|ATP2B2_uc010hdo.2_Missense_Mutation_p.T523M	p.T818M	NM_001001331	NP_001001331	WXS	Illumina HiSeq	Unspecified	Q01814	AT2B2_HUMAN			17	2892	-			818			Cytoplasmic (Potential).		O00766|Q12994|Q16818	Missense_Mutation	SNP	ENST00000352432.4	37	c.2453C>T	CCDS33701.1	.	.	.	.	.	.	.	.	.	.	G	29.7	5.032296	0.93575	.	.	ENSG00000157087	ENST00000352432;ENST00000383800;ENST00000397077;ENST00000360273;ENST00000343816;ENST00000535386;ENST00000452124;ENST00000342354	D;D;D;D;D;D	0.96365	-3.99;-3.99;-3.99;-3.99;-3.99;-3.99	4.36	4.36	0.52297	HAD-like domain (1);ATPase, P-type,  transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.99158	0.9709	H	0.99820	4.81	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.85130	0.997;0.932;0.994	D	0.98530	1.0627	10	0.87932	D	0	-12.9661	17.2324	0.86988	0.0:0.0:1.0:0.0	.	753;785;818	F5H7F7;Q4LE63;Q01814	.;.;AT2B2_HUMAN	M	818;773;773;818;804;753;674;818	ENSP00000324172:T818M;ENSP00000373311:T773M;ENSP00000380267:T773M;ENSP00000353414:T818M;ENSP00000344677:T804M;ENSP00000414854:T674M	ENSP00000342954:T818M	T	-	2	0	ATP2B2	10362773	1.000000	0.71417	0.940000	0.37924	0.985000	0.73830	9.733000	0.98818	2.147000	0.66899	0.484000	0.47621	ACG		0.687	ATP2B2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250576.2	NM_001683		4	25	0	0	0	0.000602	0	4	25				
LSM3	27258	broad.mit.edu	37	3	14220343	14220343	+	5'UTR	SNP	G	G	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr3:14220343G>T	ENST00000306024.3	+	0	486				XPC_ENST00000449060.2_5'Flank|XPC_ENST00000285021.7_5'Flank	NM_014463.2	NP_055278.1	P62310	LSM3_HUMAN	LSM3 homolog, U6 small nuclear RNA associated (S. cerevisiae)						exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|large_intestine(2)|ovary(1)	4						AGGCGGGAAAGGGCGCAGGGT	0.502																																							uc003byn.2		NA																	0				ovary(1)	1						c.(-19--15)AAGGG>AATGG		Lsm3 protein							93.0	91.0	92.0					3																	14220343		2203	4300	6503	SO:0001623	5_prime_UTR_variant	27258				exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay	catalytic step 2 spliceosome|cytosol	protein binding|RNA binding	g.chr3:14220343G>T	AF182289	CCDS2619.1	3p25.1	2012-08-15			ENSG00000170860	ENSG00000170860			17874	protein-coding gene	gene with protein product		607283				10369684	Standard	NM_014463		Approved	YLR438C, SMX4, USS2	uc003byn.3	P62310	OTTHUMG00000129838	ENST00000306024.3:c.-18G>T	3.37:g.14220343G>T			Somatic				XPC_uc011ave.1_5'Flank|XPC_uc011avf.1_5'Flank|XPC_uc011avg.1_5'Flank		NM_014463	NP_055278	WXS	Illumina HiSeq	Unspecified	P62310	LSM3_HUMAN			1	12	+								Q6IAH0|Q9Y4Z1	Translation_Start_Site	SNP	ENST00000306024.3	37	c.-17G>T	CCDS2619.1																																																																																				0.502	LSM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252078.3	NM_014463		11	46	1	0	1.61879e-10	0.001368	3.18215e-10	11	46				
TOP2B	7155	broad.mit.edu	37	3	25654005	25654005	+	Splice_Site	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr3:25654005C>A	ENST00000264331.4	-	28	3786		c.e28+1		TOP2B_ENST00000542520.1_Splice_Site|TOP2B_ENST00000540199.1_Splice_Site|TOP2B_ENST00000435706.2_Splice_Site|TOP2B_ENST00000475717.1_5'Flank	NM_001068.2	NP_001059.2	Q02880	TOP2B_HUMAN	topoisomerase (DNA) II beta 180kDa						ATP catabolic process (GO:0006200)|axonogenesis (GO:0007409)|DNA topological change (GO:0006265)|DNA unwinding involved in DNA replication (GO:0006268)|forebrain development (GO:0030900)|mitotic DNA integrity checkpoint (GO:0044774)|mitotic recombination (GO:0006312)|neuron migration (GO:0001764)|resolution of meiotic recombination intermediates (GO:0000712)|sister chromatid segregation (GO:0000819)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|DNA topoisomerase complex (ATP-hydrolyzing) (GO:0009330)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|protein kinase C binding (GO:0005080)	p.?(1)		breast(2)|endometrium(5)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|skin(2)|stomach(1)	36					Dactinomycin(DB00970)|Daunorubicin(DB00694)|Dexrazoxane(DB00380)|Etoposide(DB00773)	GTATGTCATACCTTCTTCTTC	0.323																																							uc003cdj.2		NA																	1	Unknown(1)		lung(1)	breast(2)|ovary(1)|lung(1)|skin(1)	5						c.e28+1		DNA topoisomerase II, beta isozyme							126.0	120.0	122.0					3																	25654005		1847	4079	5926	SO:0001630	splice_region_variant	7155				DNA topological change|DNA-dependent DNA replication|mitotic cell cycle G2/M transition decatenation checkpoint|mitotic recombination|resolution of meiotic recombination intermediates|sister chromatid segregation	cytosol|DNA topoisomerase complex (ATP-hydrolyzing)|nucleolus|nucleoplasm|synaptonemal complex|WINAC complex	ATP binding|chromatin binding|DNA topoisomerase (ATP-hydrolyzing) activity|DNA-dependent ATPase activity|histone deacetylase binding|protein C-terminus binding|protein heterodimerization activity|protein kinase C binding|sequence-specific DNA binding transcription factor activity	g.chr3:25654005C>A	X68060	CCDS46776.1	3p24.2	2012-08-30	2002-08-29		ENSG00000077097	ENSG00000077097	5.99.1.3		11990	protein-coding gene	gene with protein product		126431	"""topoisomerase (DNA) II beta (180kD)"""			1309226, 1333583	Standard	NM_001068		Approved		uc003cdj.3	Q02880	OTTHUMG00000155596	ENST00000264331.4:c.3786+1G>T	3.37:g.25654005C>A			Somatic				TOP2B_uc011awm.1_Splice_Site_p.K114_splice|TOP2B_uc010hff.1_Splice_Site_p.K123_splice	p.K1257_splice	NM_001068	NP_001059	WXS	Illumina HiSeq	Unspecified	Q02880	TOP2B_HUMAN			28	3771	-								Q13600|Q9UMG8|Q9UQP8	Splice_Site	SNP	ENST00000264331.4	37	c.3771_splice		.	.	.	.	.	.	.	.	.	.	C	25.4	4.634722	0.87660	.	.	ENSG00000077097	ENST00000542520;ENST00000435706;ENST00000264331;ENST00000540199	.	.	.	6.16	6.16	0.99307	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.8598	0.99761	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TOP2B	25629009	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	7.368000	0.79567	2.937000	0.99478	0.650000	0.86243	.		0.323	TOP2B-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding			Intron	26	103	1	0	7.26314e-15	0.007291	1.6222e-14	26	103				
ZNF621	285268	broad.mit.edu	37	3	40573561	40573561	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr3:40573561G>T	ENST00000339296.5	+	5	752	c.300G>T	c.(298-300)aaG>aaT	p.K100N	ZNF621_ENST00000431278.1_5'UTR|ZNF621_ENST00000403205.2_Missense_Mutation_p.K100N|ZNF621_ENST00000490457.1_Intron|ZNF621_ENST00000310898.1_Missense_Mutation_p.K100N	NM_198484.3	NP_940886.1	Q6ZSS3	ZN621_HUMAN	zinc finger protein 621	100					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.K100N(1)		endometrium(1)|kidney(2)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	21				KIRC - Kidney renal clear cell carcinoma(284;0.0515)|Kidney(284;0.0648)		TAGTTATAAAGCAGGAAGCCT	0.433																																							uc003ckm.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(298-300)AAG>AAT		zinc finger protein 621							72.0	79.0	77.0					3																	40573561		2203	4300	6503	SO:0001583	missense	285268				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr3:40573561G>T	AK127181	CCDS2693.1, CCDS74920.1	3p21.33	2013-01-08			ENSG00000172888	ENSG00000172888		"""Zinc fingers, C2H2-type"", ""-"""	24787	protein-coding gene	gene with protein product							Standard	XM_005265079		Approved	FLJ45246	uc003ckm.2	Q6ZSS3	OTTHUMG00000131389	ENST00000339296.5:c.300G>T	3.37:g.40573561G>T	ENSP00000340841:p.Lys100Asn		Somatic				ZNF621_uc003ckn.2_Missense_Mutation_p.K100N|ZNF621_uc003cko.2_Missense_Mutation_p.K65N|ZNF621_uc011aze.1_Missense_Mutation_p.K92N	p.K100N	NM_001098414	NP_001091884	WXS	Illumina HiSeq	Unspecified	Q6ZSS3	ZN621_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.0515)|Kidney(284;0.0648)	5	516	+			100					Q14DC7|Q8TE91	Missense_Mutation	SNP	ENST00000339296.5	37	c.300G>T	CCDS2693.1	.	.	.	.	.	.	.	.	.	.	g	26.0	4.699911	0.88924	.	.	ENSG00000172888	ENST00000403205;ENST00000310898;ENST00000339296;ENST00000453351	T;T;T;T	0.08102	3.13;5.23;3.13;5.25	4.17	3.26	0.37387	.	0.685817	0.12752	N	0.442133	T	0.10852	0.0265	L	0.47190	1.495	0.25377	N	0.988647	D;B	0.54397	0.966;0.281	P;B	0.44860	0.462;0.147	T	0.14337	-1.0476	10	0.49607	T	0.09	.	11.2724	0.49147	0.0:0.0:0.8159:0.1841	.	100;100	C9JM43;Q6ZSS3	.;ZN621_HUMAN	N	100	ENSP00000386051:K100N;ENSP00000312144:K100N;ENSP00000340841:K100N;ENSP00000408779:K100N	ENSP00000312144:K100N	K	+	3	2	ZNF621	40548565	0.746000	0.28272	0.815000	0.32552	0.952000	0.60782	1.194000	0.32174	1.283000	0.44513	0.655000	0.94253	AAG		0.433	ZNF621-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254178.2	NM_198484		23	72	1	0	1.10513e-12	0.002299	2.30671e-12	23	72				
COL7A1	1294	broad.mit.edu	37	3	48603991	48603991	+	Silent	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr3:48603991C>A	ENST00000328333.8	-	112	8417	c.8310G>T	c.(8308-8310)cgG>cgT	p.R2770R	COL7A1_ENST00000470076.1_5'Flank|UCN2_ENST00000273610.3_5'Flank|COL7A1_ENST00000454817.1_Silent_p.R2738R	NM_000094.3	NP_000085.1	Q02388	CO7A1_HUMAN	collagen, type VII, alpha 1	2770	Triple-helical region.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen type VII trimer (GO:0005590)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.R2770R(1)		NS(3)|breast(8)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(57)|ovary(7)|prostate(5)|skin(9)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	137				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		CAGGCCCTGGCCGCCCCTATG	0.647																																							uc003ctz.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|breast(3)|skin(3)|central_nervous_system(1)	11						c.(8308-8310)CGG>CGT		alpha 1 type VII collagen precursor							89.0	97.0	94.0					3																	48603991		2203	4299	6502	SO:0001819	synonymous_variant	1294				cell adhesion|epidermis development	basement membrane|collagen type VII	protein binding|serine-type endopeptidase inhibitor activity	g.chr3:48603991C>A	L02870	CCDS2773.1	3p21.1	2014-09-17	2008-08-01		ENSG00000114270	ENSG00000114270		"""Collagens"", ""Fibronectin type III domain containing"""	2214	protein-coding gene	gene with protein product	"""collagen VII, alpha-1 polypeptide"", ""LC collagen"""	120120	"""epidermolysis bullosa, dystrophic, dominant and recessive"""	EBDCT, EBD1, EBR1		1871109	Standard	NM_000094		Approved		uc003ctz.2	Q02388	OTTHUMG00000133541	ENST00000328333.8:c.8310G>T	3.37:g.48603991C>A			Somatic				UCN2_uc003cty.1_5'Flank	p.R2770R	NM_000094	NP_000085	WXS	Illumina HiSeq	Unspecified	Q02388	CO7A1_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)	112	8311	-			2770			Triple-helical region.		Q14054|Q16507	Silent	SNP	ENST00000328333.8	37	c.8310G>T	CCDS2773.1																																																																																				0.647	COL7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257519.1	NM_000094		13	74	1	0	2.31682e-05	0.003163	3.85466e-05	13	74				
DUSP7	1849	broad.mit.edu	37	3	52088145	52088145	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr3:52088145C>A	ENST00000495880.1	-	2	946	c.763G>T	c.(763-765)Ggc>Tgc	p.G255C	DUSP7_ENST00000296483.6_Missense_Mutation_p.G204C			Q16829	DUS7_HUMAN	dual specificity phosphatase 7	255					inactivation of MAPK activity (GO:0000188)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of MAP kinase activity (GO:0043407)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|protein tyrosine phosphatase activity (GO:0004725)	p.G204C(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(1)	17				BRCA - Breast invasive adenocarcinoma(193;5.14e-05)|Kidney(197;0.000534)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		TTGGCGCAGCCGAGGTAGAGG	0.612																																							uc003dct.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(763-765)GGC>TGC		dual specificity phosphatase 7							228.0	206.0	213.0					3																	52088145		2203	4300	6503	SO:0001583	missense	1849				inactivation of MAPK activity|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	MAP kinase tyrosine/serine/threonine phosphatase activity|protein binding|protein tyrosine phosphatase activity	g.chr3:52088145C>A	X93921	CCDS33766.1, CCDS33766.2	3p21	2011-06-09			ENSG00000164086	ENSG00000164086		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3073	protein-coding gene	gene with protein product		602749				8626780, 9205128	Standard	NM_001947		Approved	MKP-X, PYST2	uc003dct.3	Q16829	OTTHUMG00000157819	ENST00000495880.1:c.763G>T	3.37:g.52088145C>A	ENSP00000417183:p.Gly255Cys		Somatic				DUSP7_uc010hma.2_Missense_Mutation_p.G255C	p.G255C	NM_001947	NP_001938	WXS	Illumina HiSeq	Unspecified	Q16829	DUS7_HUMAN		BRCA - Breast invasive adenocarcinoma(193;5.14e-05)|Kidney(197;0.000534)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	2	842	-			255					Q2M3J7|Q8NFJ0	Missense_Mutation	SNP	ENST00000495880.1	37	c.763G>T	CCDS33766.2	.	.	.	.	.	.	.	.	.	.	C	31	5.083919	0.94050	.	.	ENSG00000164086	ENST00000495880;ENST00000296483;ENST00000469623	T;T;T	0.68331	-0.32;-0.32;-0.32	5.42	5.42	0.78866	Dual specificity phosphatase, catalytic domain (1);Dual specificity phosphatase, subgroup, catalytic domain (2);	0.000000	0.85682	D	0.000000	D	0.86611	0.5974	M	0.92880	3.355	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.89682	0.3891	10	0.87932	D	0	.	18.8199	0.92092	0.0:1.0:0.0:0.0	.	204;255	Q16829-2;Q16829	.;DUS7_HUMAN	C	255;204;188	ENSP00000417183:G255C;ENSP00000296483:G204C;ENSP00000418566:G188C	ENSP00000296483:G204C	G	-	1	0	DUSP7	52063185	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.753000	0.85153	2.527000	0.85204	0.549000	0.68633	GGC		0.612	DUSP7-001	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000349697.1	NM_001947		22	113	1	0	9.95505e-16	0.002299	2.28568e-15	22	113				
CACNA2D3	55799	broad.mit.edu	37	3	54603989	54603989	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr3:54603989A>T	ENST00000474759.1	+	8	794	c.746A>T	c.(745-747)cAg>cTg	p.Q249L	CACNA2D3_ENST00000490478.1_Missense_Mutation_p.Q155L|CACNA2D3_ENST00000288197.5_Missense_Mutation_p.Q249L|CACNA2D3_ENST00000415676.2_Missense_Mutation_p.Q249L	NM_018398.2	NP_060868.2	Q8IZS8	CA2D3_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 3	249						integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.Q249L(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(17)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(3)	59				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)	Amlodipine(DB00381)|Nilvadipine(DB06712)|Spironolactone(DB00421)	AGGTACATCCAGGCAGCAACT	0.423																																							uc003dhf.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7						c.(745-747)CAG>CTG		calcium channel, voltage-dependent, alpha							115.0	108.0	110.0					3																	54603989		1937	4158	6095	SO:0001583	missense	55799					integral to membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity	g.chr3:54603989A>T	AJ272268	CCDS54598.1	3p21.1	2010-10-05	2008-02-26		ENSG00000157445	ENSG00000157445		"""Calcium channel subunits"""	15460	protein-coding gene	gene with protein product		606399				11245980	Standard	XM_005265318		Approved	HSA272268	uc003dhf.3	Q8IZS8	OTTHUMG00000158580	ENST00000474759.1:c.746A>T	3.37:g.54603989A>T	ENSP00000419101:p.Gln249Leu		Somatic				CACNA2D3_uc011beu.1_RNA|CACNA2D3_uc003dhg.1_Missense_Mutation_p.Q155L|CACNA2D3_uc003dhh.1_RNA|CACNA2D3_uc010hmv.1_5'UTR	p.Q249L	NM_018398	NP_060868	WXS	Illumina HiSeq	Unspecified	Q8IZS8	CA2D3_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)	8	794	+			249			Extracellular (Potential).		B2RPL6|Q9NY16|Q9NY18	Missense_Mutation	SNP	ENST00000474759.1	37	c.746A>T	CCDS54598.1	.	.	.	.	.	.	.	.	.	.	A	25.1	4.607096	0.87157	.	.	ENSG00000157445	ENST00000415676;ENST00000474759;ENST00000288197;ENST00000490478;ENST00000398624;ENST00000438476	T;T;T;T	0.10192	2.9;2.9;2.9;2.91	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	T	0.29914	0.0748	M	0.73372	2.23	0.58432	D	0.999997	D	0.55605	0.972	P	0.60173	0.87	T	0.01771	-1.1277	10	0.72032	D	0.01	.	15.7338	0.77827	1.0:0.0:0.0:0.0	.	249	Q8IZS8	CA2D3_HUMAN	L	249;249;249;155;155;154	ENSP00000389506:Q249L;ENSP00000419101:Q249L;ENSP00000288197:Q249L;ENSP00000417279:Q155L	ENSP00000288197:Q249L	Q	+	2	0	CACNA2D3	54579029	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.229000	0.95273	2.185000	0.69588	0.528000	0.53228	CAG		0.423	CACNA2D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351402.1			12	65	0	0	0	0.001368	0	12	65				
OR5H6	79295	broad.mit.edu	37	3	97983970	97983970	+	Missense_Mutation	SNP	C	C	T	rs200721570		TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr3:97983970C>T	ENST00000383696.2	+	1	883	c.842C>T	c.(841-843)cCg>cTg	p.P281L	RP11-325B23.2_ENST00000508616.1_lincRNA	NM_001005479.1	NP_001005479.1	Q8NGV6	OR5H6_HUMAN	olfactory receptor, family 5, subfamily H, member 6 (gene/pseudogene)	281						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P281L(1)		cervix(2)|endometrium(1)|large_intestine(4)|lung(20)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	34						TCTGCATCTCCGCAAGCAGAT	0.423													C|||	1	0.000199681	0.0	0.0	5008	,	,		16464	0.001		0.0	False		,,,				2504	0.0						uc003dsi.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|large_intestine(1)	3						c.(841-843)CCG>CTG		olfactory receptor, family 5, subfamily H,							62.0	60.0	60.0					3																	97983970		2203	4299	6502	SO:0001583	missense	79295				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr3:97983970C>T	BK004374	CCDS33800.1	3q12.1	2013-10-10	2013-10-10		ENSG00000230301	ENSG00000230301		"""GPCR / Class A : Olfactory receptors"""	14767	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily H, member 6"""				Standard	NM_001005479		Approved		uc003dsi.1	Q8NGV6	OTTHUMG00000160078	ENST00000383696.2:c.842C>T	3.37:g.97983970C>T	ENSP00000373196:p.Pro281Leu		Somatic					p.P281L	NM_001005479	NP_001005479	WXS	Illumina HiSeq	Unspecified	Q8NGV6	OR5H6_HUMAN			1	842	+			281			Extracellular (Potential).		Q6IF88	Missense_Mutation	SNP	ENST00000383696.2	37	c.842C>T	CCDS33800.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	-	1.315	-0.601151	0.03744	.	.	ENSG00000230301	ENST00000383696	T	0.00069	8.77	2.19	0.102	0.14522	GPCR, rhodopsin-like superfamily (1);	1.334550	0.05193	N	0.503515	T	0.00073	0.0002	N	0.11313	0.125	0.09310	N	1	B	0.18166	0.026	B	0.13407	0.009	T	0.08827	-1.0703	10	0.44086	T	0.13	.	3.8787	0.09068	0.2392:0.6014:0.0:0.1594	.	281	Q8NGV6	OR5H6_HUMAN	L	281	ENSP00000373196:P281L	ENSP00000373196:P281L	P	+	2	0	OR5H6	99466660	0.000000	0.05858	0.001000	0.08648	0.006000	0.05464	-1.029000	0.03585	0.209000	0.20645	0.194000	0.17425	CCG		0.423	OR5H6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359111.2			18	60	0	0	0	0.006122	0	18	60				
MYH15	22989	broad.mit.edu	37	3	108107873	108107873	+	Nonsense_Mutation	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr3:108107873C>A	ENST00000273353.3	-	39	5595	c.5539G>T	c.(5539-5541)Gag>Tag	p.E1847*		NM_014981.1	NP_055796.1	Q9Y2K3	MYH15_HUMAN	myosin, heavy chain 15	1847						cytoplasm (GO:0005737)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.E1847*(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(4)|endometrium(10)|kidney(4)|large_intestine(14)|lung(47)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	105						CTCTGGGCCTCTGCACTGCGA	0.562																																							uc003dxa.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(5)|central_nervous_system(2)	7						c.(5539-5541)GAG>TAG		myosin, heavy polypeptide 15							117.0	121.0	120.0					3																	108107873		2030	4203	6233	SO:0001587	stop_gained	22989					myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity	g.chr3:108107873C>A	AB023217	CCDS43127.1	3q13	2011-09-27	2006-09-29		ENSG00000144821	ENSG00000144821		"""Myosins / Myosin superfamily : Class II"""	31073	protein-coding gene	gene with protein product		609929	"""myosin, heavy polypeptide 15"""			15014174, 15042088	Standard	NM_014981		Approved	KIAA1000	uc003dxa.1	Q9Y2K3	OTTHUMG00000159226	ENST00000273353.3:c.5539G>T	3.37:g.108107873C>A	ENSP00000273353:p.Glu1847*		Somatic					p.E1847*	NM_014981	NP_055796	WXS	Illumina HiSeq	Unspecified	Q9Y2K3	MYH15_HUMAN			39	5596	-			1847			Potential.			Nonsense_Mutation	SNP	ENST00000273353.3	37	c.5539G>T	CCDS43127.1	.	.	.	.	.	.	.	.	.	.	C	46	12.637393	0.99684	.	.	ENSG00000144821	ENST00000273353	.	.	.	5.98	5.98	0.97165	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	20.0384	0.97572	0.0:1.0:0.0:0.0	.	.	.	.	X	1847	.	ENSP00000273353:E1847X	E	-	1	0	MYH15	109590563	1.000000	0.71417	0.341000	0.25589	0.364000	0.29643	4.729000	0.62008	2.838000	0.97847	0.655000	0.94253	GAG		0.562	MYH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353935.1	XM_036988		42	110	1	0	3.77016e-25	0.003214	9.97268e-25	42	110				
BOC	91653	broad.mit.edu	37	3	112969439	112969439	+	Silent	SNP	C	C	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr3:112969439C>T	ENST00000495514.1	+	4	839	c.135C>T	c.(133-135)acC>acT	p.T45T	BOC_ENST00000355385.3_Silent_p.T45T|BOC_ENST00000484034.1_Silent_p.T45T|BOC_ENST00000273395.4_Silent_p.T45T|BOC_ENST00000485230.1_Silent_p.T45T			Q9BWV1	BOC_HUMAN	BOC cell adhesion associated, oncogene regulated	45	Ig-like C2-type 1.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|smoothened signaling pathway (GO:0007224)	axonal growth cone (GO:0044295)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)		p.T45T(1)		NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	68			Epithelial(53;0.227)			CTGCGTCCACCGTCCAGAAGC	0.562																																							uc003dzx.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|breast(1)|central_nervous_system(1)|pancreas(1)	6						c.(133-135)ACC>ACT		brother of CDO precursor							113.0	108.0	110.0					3																	112969439		2203	4300	6503	SO:0001819	synonymous_variant	91653				cell adhesion|muscle cell differentiation|positive regulation of myoblast differentiation	integral to membrane|plasma membrane	protein binding	g.chr3:112969439C>T	AY027658	CCDS2971.1	3q13.2	2013-02-11	2012-12-07		ENSG00000144857	ENSG00000144857		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	17173	protein-coding gene	gene with protein product	"""brother of CDO"", ""brother of CDON"", ""cell adhesion associated, oncogene regulated 2"""	608708	"""Boc homolog (mouse)"""			11782431	Standard	NM_033254		Approved	CDON2	uc003dzy.3	Q9BWV1	OTTHUMG00000159305	ENST00000495514.1:c.135C>T	3.37:g.112969439C>T			Somatic				BOC_uc010hqi.2_Silent_p.T45T|BOC_uc003dzy.2_Silent_p.T45T|BOC_uc003dzz.2_Silent_p.T45T|BOC_uc003dzw.1_Silent_p.T45T|BOC_uc003eaa.1_Silent_p.T45T	p.T45T	NM_033254	NP_150279	WXS	Illumina HiSeq	Unspecified	Q9BWV1	BOC_HUMAN	Epithelial(53;0.227)		4	756	+			45			Extracellular (Potential).|Ig-like C2-type 1.		A6NJ30|B2RMS8|D3DN70|Q6UXJ5|Q8N2P7|Q8NF26	Silent	SNP	ENST00000495514.1	37	c.135C>T	CCDS2971.1																																																																																				0.562	BOC-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000354485.3	NM_033254		8	59	0	0	0	0.00308	0	8	59				
PLCH1	23007	broad.mit.edu	37	3	155199127	155199127	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr3:155199127G>T	ENST00000340059.7	-	23	4711	c.4712C>A	c.(4711-4713)cCc>cAc	p.P1571H	PLCH1_ENST00000494598.1_Intron|PLCH1_ENST00000460012.1_Missense_Mutation_p.P1533H|PLCH1_ENST00000414191.1_Missense_Mutation_p.P1533H|PLCH1_ENST00000447496.2_3'UTR|PLCH1_ENST00000334686.6_Missense_Mutation_p.P1533H	NM_001130960.1	NP_001124432.1	Q4KWH8	PLCH1_HUMAN	phospholipase C, eta 1	1571					inositol phosphate metabolic process (GO:0043647)|lipid catabolic process (GO:0016042)|phosphatidylinositol-mediated signaling (GO:0048015)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase C activity (GO:0050429)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)	p.P1571H(1)|p.P1533H(1)		NS(3)|breast(3)|endometrium(9)|kidney(4)|large_intestine(20)|lung(45)|ovary(2)|prostate(5)|skin(8)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	107			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			CAGTGCCCGGGGGAGCTGATT	0.512																																							uc011bok.1		NA																	2	Substitution - Missense(2)		lung(2)	skin(3)|ovary(1)	4						c.(4711-4713)CCC>CAC		phospholipase C eta 1 isoform a							90.0	93.0	92.0					3																	155199127		2203	4300	6503	SO:0001583	missense	23007				lipid catabolic process|phosphatidylinositol-mediated signaling	membrane	calcium ion binding|calcium-dependent phospholipase C activity|phosphatidylinositol phospholipase C activity|signal transducer activity	g.chr3:155199127G>T	AB028992	CCDS33881.1, CCDS46939.1, CCDS46940.1	3q25	2013-01-10	2006-03-16	2006-03-16	ENSG00000114805	ENSG00000114805	3.1.4.11	"""EF-hand domain containing"""	29185	protein-coding gene	gene with protein product		612835	"""phospholipase C-like 3"""	PLCL3		15702972	Standard	NM_014996		Approved	KIAA1069, MGC117152, DKFZp434C1372, PLCeta1	uc021xge.1	Q4KWH8	OTTHUMG00000158477	ENST00000340059.7:c.4712C>A	3.37:g.155199127G>T	ENSP00000345988:p.Pro1571His		Somatic				PLCH1_uc011boj.1_3'UTR|PLCH1_uc011bol.1_Missense_Mutation_p.P1533H	p.P1571H	NM_001130960	NP_001124432	WXS	Illumina HiSeq	Unspecified	Q4KWH8	PLCH1_HUMAN	Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)		23	4989	-			1571					Q29RV9|Q4KWH9|Q68CN0|Q86XK4|Q9H9U2|Q9UPT3	Missense_Mutation	SNP	ENST00000340059.7	37	c.4712C>A	CCDS46939.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.312081	0.81358	.	.	ENSG00000114805	ENST00000460012;ENST00000340059;ENST00000334686;ENST00000414191	T;T;T;T	0.26810	1.71;1.71;1.71;1.71	5.26	5.26	0.73747	.	0.114273	0.64402	D	0.000010	T	0.52741	0.1753	M	0.69823	2.125	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.55842	-0.8077	10	0.72032	D	0.01	.	18.4579	0.90728	0.0:0.0:1.0:0.0	.	1533;1571	Q4KWH8-2;Q4KWH8	.;PLCH1_HUMAN	H	1533;1571;1533;1533	ENSP00000417502:P1533H;ENSP00000345988:P1571H;ENSP00000335469:P1533H;ENSP00000412977:P1533H	ENSP00000335469:P1533H	P	-	2	0	PLCH1	156681821	1.000000	0.71417	0.992000	0.48379	0.983000	0.72400	7.412000	0.80091	2.428000	0.82296	0.650000	0.86243	CCC		0.512	PLCH1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000351125.1	NM_014996		26	75	1	0	6.32553e-13	0.004656	1.32998e-12	26	75				
SI	6476	broad.mit.edu	37	3	164710112	164710112	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr3:164710112C>A	ENST00000264382.3	-	42	4977	c.4915G>T	c.(4915-4917)Gta>Tta	p.V1639L		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	1639	Sucrase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)	p.V1639L(1)		NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	GGTTCCAGTACTGGGGTAACC	0.328										HNSCC(35;0.089)																													uc003fei.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(7)|upper_aerodigestive_tract(4)|skin(2)|pancreas(1)	14						c.(4915-4917)GTA>TTA		sucrase-isomaltase	Acarbose(DB00284)						67.0	69.0	68.0					3																	164710112		2203	4300	6503	SO:0001583	missense	6476				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|brush border|Golgi apparatus|integral to membrane	carbohydrate binding|oligo-1,6-glucosidase activity|sucrose alpha-glucosidase activity	g.chr3:164710112C>A	X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.4915G>T	3.37:g.164710112C>A	ENSP00000264382:p.Val1639Leu	HNSCC(35;0.089)	Somatic					p.V1639L	NM_001041	NP_001032	WXS	Illumina HiSeq	Unspecified	P14410	SUIS_HUMAN			42	4977	-		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)	1639			Sucrase.|Lumenal.		A2RUC3|Q1JQ80|Q1RMC2	Missense_Mutation	SNP	ENST00000264382.3	37	c.4915G>T	CCDS3196.1	.	.	.	.	.	.	.	.	.	.	C	24.4	4.532755	0.85812	.	.	ENSG00000090402	ENST00000264382	D	0.95588	-3.75	4.82	4.82	0.62117	.	0.204831	0.43260	D	0.000599	D	0.97949	0.9325	M	0.92412	3.305	0.46823	D	0.999218	D	0.60160	0.987	P	0.59889	0.865	D	0.98922	1.0784	10	0.87932	D	0	.	18.0443	0.89327	0.0:1.0:0.0:0.0	.	1639	P14410	SUIS_HUMAN	L	1639	ENSP00000264382:V1639L	ENSP00000264382:V1639L	V	-	1	0	SI	166192806	1.000000	0.71417	0.913000	0.36048	0.643000	0.38383	7.120000	0.77153	2.654000	0.90174	0.655000	0.94253	GTA		0.328	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350116.1	NM_001041		28	63	1	0	7.41945e-09	0.005443	1.41019e-08	28	63				
PRKCI	5584	broad.mit.edu	37	3	169953139	169953139	+	Splice_Site	SNP	G	G	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr3:169953139G>T	ENST00000295797.4	+	2	528	c.223G>T	c.(223-225)Gga>Tga	p.G75*		NM_002740.5	NP_002731.4	P41743	KPCI_HUMAN	protein kinase C, iota	75	Interaction with PARD6A.|OPR.|Regulatory domain.				actin filament organization (GO:0007015)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell-cell junction organization (GO:0045216)|cellular response to insulin stimulus (GO:0032869)|cytoskeleton organization (GO:0007010)|establishment of apical/basal cell polarity (GO:0035089)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|eye photoreceptor cell development (GO:0042462)|Golgi vesicle budding (GO:0048194)|intracellular signal transduction (GO:0035556)|membrane organization (GO:0061024)|negative regulation of apoptotic process (GO:0043066)|negative regulation of glial cell apoptotic process (GO:0034351)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of glucose import (GO:0046326)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein phosphorylation (GO:0006468)|protein targeting to membrane (GO:0006612)|response to interleukin-1 (GO:0070555)|secretion (GO:0046903)|tight junction assembly (GO:0070830)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|Schmidt-Lanterman incisure (GO:0043220)	ATP binding (GO:0005524)|phospholipid binding (GO:0005543)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)	p.G66*(1)		breast(2)|endometrium(5)|kidney(1)|large_intestine(4)|lung(16)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	36	all_cancers(22;6.45e-23)|all_epithelial(15;8.52e-28)|all_lung(20;6.31e-17)|Lung NSC(18;2.61e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.197)		Tamoxifen(DB00675)	AGATGAGGAAGGTGAGTGGTA	0.388																																							uc003fgs.2		NA																	1	Substitution - Nonsense(1)		lung(1)	lung(2)|ovary(1)|breast(1)|skin(1)	5						c.(223-225)GGA>TGA		protein kinase C, iota							91.0	86.0	88.0					3																	169953139		2203	4300	6503	SO:0001630	splice_region_variant	5584				anti-apoptosis|cellular membrane organization|cellular response to insulin stimulus|establishment or maintenance of epithelial cell apical/basal polarity|intracellular signal transduction|nerve growth factor receptor signaling pathway|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|protein targeting to membrane|secretion|tight junction assembly|vesicle-mediated transport	cytosol|endosome|nucleus|polarisome	ATP binding|phospholipid binding|protein binding|protein kinase C activity|zinc ion binding	g.chr3:169953139G>T		CCDS3212.2	3q26.3	2008-07-18			ENSG00000163558	ENSG00000163558	2.7.11.13		9404	protein-coding gene	gene with protein product		600539		DXS1179E		7607695, 11978974	Standard	NM_002740		Approved	PKCI	uc003fgs.2	P41743	OTTHUMG00000150214	ENST00000295797.4:c.223+1G>T	3.37:g.169953139G>T			Somatic					p.G75*	NM_002740	NP_002731	WXS	Illumina HiSeq	Unspecified	P41743	KPCI_HUMAN	Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.197)		2	461	+	all_cancers(22;6.45e-23)|all_epithelial(15;8.52e-28)|all_lung(20;6.31e-17)|Lung NSC(18;2.61e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		75			Interaction with PARD6A.|Regulatory domain.|OPR.		D3DNQ4|Q8WW06	Nonsense_Mutation	SNP	ENST00000295797.4	37	c.223G>T	CCDS3212.2	.	.	.	.	.	.	.	.	.	.	G	39	7.629038	0.98399	.	.	ENSG00000163558	ENST00000295797	.	.	.	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.247	0.93906	0.0:0.0:1.0:0.0	.	.	.	.	X	75	.	.	G	+	1	0	PRKCI	171435833	1.000000	0.71417	1.000000	0.80357	0.704000	0.40688	9.067000	0.93955	2.516000	0.84829	0.655000	0.94253	GGA		0.388	PRKCI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316866.3	NM_002740	Nonsense_Mutation	16	47	1	0	2.48551e-13	0.00499	5.2645e-13	16	47				
GHSR	2693	broad.mit.edu	37	3	172165766	172165766	+	Silent	SNP	G	G	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr3:172165766G>A	ENST00000241256.2	-	1	480	c.438C>T	c.(436-438)tgC>tgT	p.C146C	GHSR_ENST00000427970.1_Silent_p.C146C	NM_198407.2	NP_940799.1	Q92847	GHSR_HUMAN	growth hormone secretagogue receptor	146					actin polymerization or depolymerization (GO:0008154)|adult feeding behavior (GO:0008343)|cellular response to insulin stimulus (GO:0032869)|decidualization (GO:0046697)|G-protein coupled receptor signaling pathway (GO:0007186)|growth hormone secretion (GO:0030252)|hormone-mediated signaling pathway (GO:0009755)|negative regulation of inflammatory response (GO:0050728)|negative regulation of insulin secretion (GO:0046676)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of appetite (GO:0032100)|positive regulation of fatty acid metabolic process (GO:0045923)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of multicellular organism growth (GO:0040018)|regulation of hindgut contraction (GO:0043134)|regulation of synapse assembly (GO:0051963)|response to food (GO:0032094)|response to hormone (GO:0009725)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|growth hormone secretagogue receptor activity (GO:0001616)|growth hormone-releasing hormone receptor activity (GO:0016520)|peptide hormone binding (GO:0017046)	p.C146C(2)		biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(16)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	33	Ovarian(172;0.00143)|Breast(254;0.197)		Lung(28;3.93e-15)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)|STAD - Stomach adenocarcinoma(35;0.235)			GGAGTGGGAAGCAGATGGCGA	0.622																																					Esophageal Squamous(93;641 1401 20883 29581 34638)	Esophageal Squamous(93;641 1401 20883 29581 34638)	uc003fib.1		NA																	2	Substitution - coding silent(2)		lung(2)	lung(3)|ovary(1)|central_nervous_system(1)	5						c.(436-438)TGC>TGT		growth hormone secretagogue receptor isoform 1a							61.0	58.0	59.0					3																	172165766		2203	4300	6503	SO:0001819	synonymous_variant	2693				actin polymerization or depolymerization|adult feeding behavior|decidualization|growth hormone secretion|hormone-mediated signaling pathway|negative regulation of inflammatory response|negative regulation of interleukin-1 beta production|negative regulation of interleukin-6 biosynthetic process|negative regulation of tumor necrosis factor biosynthetic process|positive regulation of appetite|positive regulation of multicellular organism growth	cell surface|integral to membrane|membrane raft|neuron projection|plasma membrane	growth hormone secretagogue receptor activity|growth hormone-releasing hormone receptor activity	g.chr3:172165766G>A	AY429112	CCDS3218.1, CCDS46959.1	3q26.31	2012-08-08			ENSG00000121853	ENSG00000121853		"""GPCR / Class A : Ghrelin receptors"""	4267	protein-coding gene	gene with protein product		601898				8688086	Standard	NM_198407		Approved		uc003fib.2	Q92847	OTTHUMG00000156946	ENST00000241256.2:c.438C>T	3.37:g.172165766G>A			Somatic				GHSR_uc011bpv.1_Silent_p.C146C	p.C146C	NM_198407	NP_940799	WXS	Illumina HiSeq	Unspecified	Q92847	GHSR_HUMAN	Lung(28;3.93e-15)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)|STAD - Stomach adenocarcinoma(35;0.235)		1	438	-	Ovarian(172;0.00143)|Breast(254;0.197)		146			Cytoplasmic (Potential).		Q14D12|Q6ISR8|Q92848|Q96RJ7	Silent	SNP	ENST00000241256.2	37	c.438C>T	CCDS3218.1																																																																																				0.622	GHSR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346728.1	NM_004122		3	26	0	0	0	0.004672	0	3	26				
MFN1	55669	broad.mit.edu	37	3	179069732	179069732	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr3:179069732G>T	ENST00000471841.1	+	3	283	c.157G>T	c.(157-159)Gat>Tat	p.D53Y	MFN1_ENST00000280653.7_Missense_Mutation_p.D53Y|MFN1_ENST00000263969.5_Missense_Mutation_p.D53Y	NM_033540.2	NP_284941	Q8IWA4	MFN1_HUMAN	mitofusin 1	53					mitochondrial fusion (GO:0008053)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.D53Y(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(14)|ovary(3)|prostate(1)|urinary_tract(1)	31	all_cancers(143;1.67e-16)|Ovarian(172;0.0172)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;5.78e-26)|GBM - Glioblastoma multiforme(14;0.00225)|BRCA - Breast invasive adenocarcinoma(182;0.0923)			CACTGAAGATGATCTGGTAGA	0.353																																							uc003fjs.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|large_intestine(1)	3						c.(157-159)GAT>TAT		mitofusin 1							135.0	132.0	133.0					3																	179069732		2203	4300	6503	SO:0001583	missense	55669				mitochondrial fusion	integral to membrane|mitochondrial outer membrane	GTP binding|GTPase activity	g.chr3:179069732G>T	AF054986	CCDS3228.1	3q26.32	2006-12-13			ENSG00000171109	ENSG00000171109			18262	protein-coding gene	gene with protein product		608506				8358434, 11181170	Standard	NM_033540		Approved	FLJ20693	uc003fjs.3	Q8IWA4	OTTHUMG00000157385	ENST00000471841.1:c.157G>T	3.37:g.179069732G>T	ENSP00000420617:p.Asp53Tyr		Somatic				MFN1_uc010hxb.2_RNA|MFN1_uc003fjt.2_Missense_Mutation_p.D81Y	p.D53Y	NM_033540	NP_284941	WXS	Illumina HiSeq	Unspecified	Q8IWA4	MFN1_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;5.78e-26)|GBM - Glioblastoma multiforme(14;0.00225)|BRCA - Breast invasive adenocarcinoma(182;0.0923)		3	283	+	all_cancers(143;1.67e-16)|Ovarian(172;0.0172)|Breast(254;0.155)		53			Cytoplasmic (Potential).		B2RAR1|D3DNR6|O15323|O60639|Q9BZB5|Q9NWQ2	Missense_Mutation	SNP	ENST00000471841.1	37	c.157G>T	CCDS3228.1	.	.	.	.	.	.	.	.	.	.	G	11.96	1.794458	0.31777	.	.	ENSG00000171109	ENST00000471841;ENST00000280653;ENST00000539169;ENST00000467174;ENST00000263969	D;D;D;D	0.99766	-5.73;-6.69;-4.99;-5.73	5.16	5.16	0.70880	.	0.205916	0.51477	D	0.000086	D	0.99190	0.9719	L	0.48642	1.525	0.52501	D	0.999959	D;D	0.57571	0.98;0.964	P;P	0.50617	0.543;0.646	D	0.99979	1.2399	10	0.02654	T	1	-15.7859	19.0061	0.92851	0.0:0.0:1.0:0.0	.	81;53	Q4AEJ4;Q8IWA4	.;MFN1_HUMAN	Y	53	ENSP00000420617:D53Y;ENSP00000280653:D53Y;ENSP00000419134:D53Y;ENSP00000263969:D53Y	ENSP00000263969:D53Y	D	+	1	0	MFN1	180552426	1.000000	0.71417	1.000000	0.80357	0.301000	0.27625	3.714000	0.54889	2.571000	0.86741	0.467000	0.42956	GAT		0.353	MFN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348654.2	NM_017927		30	70	1	0	1.99505e-19	0.002445	4.9574e-19	30	70				
PCYT1A	5130	broad.mit.edu	37	3	195997349	195997349	+	Silent	SNP	C	C	G	rs200496999	byFrequency	TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr3:195997349C>G	ENST00000292823.2	-	3	226	c.54G>C	c.(52-54)gcG>gcC	p.A18A	PCYT1A_ENST00000419333.1_Silent_p.A18A|PCYT1A_ENST00000431016.1_Silent_p.A18A|PCYT1A_ENST00000491544.1_5'UTR|RP11-447L10.1_ENST00000431391.1_3'UTR	NM_005017.2	NP_005008.2	P49585	PCY1A_HUMAN	phosphate cytidylyltransferase 1, choline, alpha	18					CDP-choline pathway (GO:0006657)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|glycogen granule (GO:0042587)	choline-phosphate cytidylyltransferase activity (GO:0004105)|lipid binding (GO:0008289)	p.A18A(2)		cervix(1)|endometrium(3)|large_intestine(8)|lung(5)|ovary(1)	18	all_cancers(143;1.19e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;1.28e-24)|all cancers(36;1.01e-22)|OV - Ovarian serous cystadenocarcinoma(49;3.88e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00259)	Choline(DB00122)|Lamivudine(DB00709)	TGGGTCCGGGCGCCTCTTTTC	0.483																																							uc003fwg.2		NA																	2	Substitution - coding silent(2)		large_intestine(1)|lung(1)		0						c.(52-54)GCG>GCC		choline phosphate cytidylyltransferase 1 alpha	Choline(DB00122)						232.0	231.0	232.0					3																	195997349		2203	4300	6503	SO:0001819	synonymous_variant	5130					cytosol|soluble fraction	choline-phosphate cytidylyltransferase activity	g.chr3:195997349C>G	L28957	CCDS3315.1	3q29	2010-07-19	2005-09-05		ENSG00000161217	ENSG00000161217	2.7.7.15		8754	protein-coding gene	gene with protein product	"""phosphate cytidylyltransferase 1, choline, alpha isoform"""	123695	"""phosphate cytidylyltransferase 1, choline, alpha isoform"""	PCYT1		7918629	Standard	NM_005017		Approved	CT, CTPCT	uc003fwg.3	P49585	OTTHUMG00000155670	ENST00000292823.2:c.54G>C	3.37:g.195997349C>G			Somatic				PCYT1A_uc003fwh.2_Silent_p.A18A	p.A18A	NM_005017	NP_005008	WXS	Illumina HiSeq	Unspecified	P49585	PCY1A_HUMAN	Epithelial(36;1.28e-24)|all cancers(36;1.01e-22)|OV - Ovarian serous cystadenocarcinoma(49;3.88e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00259)	3	227	-	all_cancers(143;1.19e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		18					A9LYK9|D3DXB1|Q86Y88	Silent	SNP	ENST00000292823.2	37	c.54G>C	CCDS3315.1																																																																																				0.483	PCYT1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341147.1	NM_005017		94	180	0	0	0	0.00361	0	94	180				
LDB2	9079	broad.mit.edu	37	4	16900063	16900063	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr4:16900063G>C	ENST00000304523.5	-	1	369	c.46C>G	c.(46-48)Cca>Gca	p.P16A	LDB2_ENST00000502640.1_Missense_Mutation_p.P16A|LDB2_ENST00000515064.1_Missense_Mutation_p.P16A|LDB2_ENST00000441778.2_Missense_Mutation_p.P16A	NM_001290.3	NP_001281.1	O43679	LDB2_HUMAN	LIM domain binding 2	16					epithelial structure maintenance (GO:0010669)|hair follicle development (GO:0001942)|positive regulation of cellular component biogenesis (GO:0044089)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|somatic stem cell maintenance (GO:0035019)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	LIM domain binding (GO:0030274)|transcription cofactor activity (GO:0003712)	p.P16A(2)		breast(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(23)|urinary_tract(1)	33						CTATAAAATGGGCCGAAAGGA	0.453																																							uc003goz.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(46-48)CCA>GCA		LIM domain binding 2 isoform a							196.0	172.0	180.0					4																	16900063		2203	4300	6503	SO:0001583	missense	9079						LIM domain binding|transcription cofactor activity	g.chr4:16900063G>C	AF068651	CCDS3420.1, CCDS47031.1	4p16	2008-08-01			ENSG00000169744	ENSG00000169744			6533	protein-coding gene	gene with protein product		603450				9853615, 9880598, 10861853	Standard	NM_001290		Approved	CLIM1, LDB1	uc003goz.3	O43679	OTTHUMG00000048212	ENST00000304523.5:c.46C>G	4.37:g.16900063G>C	ENSP00000306772:p.Pro16Ala		Somatic				LDB2_uc003gpa.2_Missense_Mutation_p.P16A|LDB2_uc003gpb.2_Missense_Mutation_p.P16A|LDB2_uc011bxh.1_Missense_Mutation_p.P16A|LDB2_uc010iee.2_Missense_Mutation_p.P16A	p.P16A	NM_001290	NP_001281	WXS	Illumina HiSeq	Unspecified	O43679	LDB2_HUMAN			1	362	-			16					O60619|O75480	Missense_Mutation	SNP	ENST00000304523.5	37	c.46C>G	CCDS3420.1	.	.	.	.	.	.	.	.	.	.	G	20.5	4.005340	0.74932	.	.	ENSG00000169744	ENST00000515064;ENST00000441778;ENST00000304523;ENST00000502640	.	.	.	5.05	5.05	0.67936	.	0.000000	0.64402	D	0.000001	T	0.71443	0.3340	L	0.48642	1.525	0.80722	D	1	B;D;P;P	0.60575	0.01;0.988;0.612;0.752	B;P;B;B	0.62885	0.011;0.908;0.222;0.338	T	0.68750	-0.5326	9	0.31617	T	0.26	-6.5577	17.3951	0.87443	0.0:0.0:1.0:0.0	.	16;16;16;16	E9PFI4;G5E9Y7;O43679-2;O43679	.;.;.;LDB2_HUMAN	A	16	.	ENSP00000306772:P16A	P	-	1	0	LDB2	16509161	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.292000	0.96076	2.325000	0.78763	0.460000	0.39030	CCA		0.453	LDB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250321.2			4	57	0	0	0	0.000248	0	4	57				
GABRG1	2565	broad.mit.edu	37	4	46099357	46099357	+	Missense_Mutation	SNP	C	C	A	rs190029157		TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr4:46099357C>A	ENST00000295452.4	-	2	281	c.114G>T	c.(112-114)aaG>aaT	p.K38N		NM_173536.3	NP_775807.2	Q8N1C3	GBRG1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 1	38					gamma-aminobutyric acid signaling pathway (GO:0007214)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.K38N(1)		breast(2)|central_nervous_system(5)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(2)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	76				Lung(65;0.106)|LUSC - Lung squamous cell carcinoma(721;0.23)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	CATCATCTGCCTTATCAACAC	0.323																																							uc003gxb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(112-114)AAG>AAT		gamma-aminobutyric acid A receptor, gamma 1							137.0	143.0	141.0					4																	46099357		2203	4299	6502	SO:0001583	missense	2565				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity	g.chr4:46099357C>A	BC031087	CCDS3470.1	4p12	2012-06-22			ENSG00000163285	ENSG00000163285		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4086	protein-coding gene	gene with protein product	"""GABA(A) receptor, gamma"""	137166				1321425	Standard	NM_173536		Approved		uc003gxb.3	Q8N1C3	OTTHUMG00000128609	ENST00000295452.4:c.114G>T	4.37:g.46099357C>A	ENSP00000295452:p.Lys38Asn		Somatic					p.K38N	NM_173536	NP_775807	WXS	Illumina HiSeq	Unspecified	Q8N1C3	GBRG1_HUMAN		Lung(65;0.106)|LUSC - Lung squamous cell carcinoma(721;0.23)	2	266	-			38			Extracellular (Probable).		Q5H9T8	Missense_Mutation	SNP	ENST00000295452.4	37	c.114G>T	CCDS3470.1	.	.	.	.	.	.	.	.	.	.	C	12.47	1.947409	0.34377	.	.	ENSG00000163285	ENST00000295452;ENST00000540030	T	0.67698	-0.28	4.96	3.79	0.43588	.	0.259996	0.27223	N	0.020358	T	0.61937	0.2387	L	0.54323	1.7	0.44018	D	0.996731	P	0.48162	0.906	B	0.44224	0.444	T	0.62205	-0.6903	10	0.52906	T	0.07	.	9.2673	0.37650	0.0:0.0866:0.0:0.9134	.	38	Q8N1C3	GBRG1_HUMAN	N	38	ENSP00000295452:K38N	ENSP00000295452:K38N	K	-	3	2	GABRG1	45794114	1.000000	0.71417	1.000000	0.80357	0.605000	0.37080	2.227000	0.42972	0.922000	0.37019	-0.302000	0.09304	AAG		0.323	GABRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250470.1	NM_173536		32	122	1	0	1.84765e-07	0.003755	3.38834e-07	32	122				
EPHA5	2044	broad.mit.edu	37	4	66356169	66356169	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr4:66356169G>T	ENST00000273854.3	-	5	1928	c.1328C>A	c.(1327-1329)gCa>gAa	p.A443E	EPHA5_ENST00000432638.2_Intron|EPHA5_ENST00000354839.4_Missense_Mutation_p.A443E|EPHA5_ENST00000511294.1_Missense_Mutation_p.A443E	NM_001281765.1|NM_004439.5	NP_001268694.1|NP_004430.4	P54756	EPHA5_HUMAN	EPH receptor A5	443	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cAMP-mediated signaling (GO:0019933)|ephrin receptor signaling pathway (GO:0048013)|hippocampus development (GO:0021766)|negative regulation of synapse assembly (GO:0051964)|neuron development (GO:0048666)|positive regulation of CREB transcription factor activity (GO:0032793)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of Rac GTPase activity (GO:0032314)	dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|GPI-linked ephrin receptor activity (GO:0005004)|transmembrane-ephrin receptor activity (GO:0005005)	p.A443E(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(25)|liver(1)|lung(76)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	142						TCCATTCACTGCCTCAATCTC	0.502										TSP Lung(17;0.13)																													uc003hcy.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(19)|stomach(2)|ovary(2)|central_nervous_system(1)	24						c.(1327-1329)GCA>GAA		ephrin receptor EphA5 isoform a precursor							114.0	93.0	100.0					4																	66356169		2203	4300	6503	SO:0001583	missense	2044				cAMP-mediated signaling|neuron development	dendrite|external side of plasma membrane|integral to plasma membrane|neuronal cell body|perinuclear region of cytoplasm|rough endoplasmic reticulum	ATP binding|transmembrane-ephrin receptor activity	g.chr4:66356169G>T	L36644	CCDS3513.1, CCDS3514.1, CCDS75131.1, CCDS75132.1, CCDS75133.1	4q13.1	2013-02-11	2004-10-28		ENSG00000145242	ENSG00000145242		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3389	protein-coding gene	gene with protein product		600004	"""EphA5"""			9267020, 7528718	Standard	NM_004439		Approved	Hek7, TYRO4, CEK7, EHK1	uc003hcy.3	P54756	OTTHUMG00000129273	ENST00000273854.3:c.1328C>A	4.37:g.66356169G>T	ENSP00000273854:p.Ala443Glu	TSP Lung(17;0.13)	Somatic				EPHA5_uc003hcx.2_Missense_Mutation_p.A374E|EPHA5_uc003hcz.2_Missense_Mutation_p.A443E|EPHA5_uc011cah.1_Missense_Mutation_p.A443E|EPHA5_uc011cai.1_Missense_Mutation_p.A443E|EPHA5_uc003hda.2_Missense_Mutation_p.A443E	p.A443E	NM_004439	NP_004430	WXS	Illumina HiSeq	Unspecified	P54756	EPHA5_HUMAN			5	1521	-			443			Fibronectin type-III 1.|Extracellular (Potential).		Q7Z3F2	Missense_Mutation	SNP	ENST00000273854.3	37	c.1328C>A	CCDS3513.1	.	.	.	.	.	.	.	.	.	.	G	33	5.210857	0.95069	.	.	ENSG00000145242	ENST00000273854;ENST00000354839;ENST00000511294	T;T;T	0.69685	-0.42;-0.42;-0.42	6.08	6.08	0.98989	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000012	D	0.87908	0.6296	H	0.94542	3.55	0.80722	D	1	D;D;D;D	0.76494	0.997;0.997;0.997;0.999	D;D;D;D	0.78314	0.974;0.991;0.956;0.975	D	0.89885	0.4033	10	0.87932	D	0	.	20.6721	0.99693	0.0:0.0:1.0:0.0	.	443;443;443;443	B7ZKW7;B7ZKJ3;P54756-2;P54756	.;.;.;EPHA5_HUMAN	E	443	ENSP00000273854:A443E;ENSP00000346899:A443E;ENSP00000427638:A443E	ENSP00000273854:A443E	A	-	2	0	EPHA5	66038764	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.912000	0.87465	2.894000	0.99253	0.591000	0.81541	GCA		0.502	EPHA5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251388.2	NM_004439		16	64	1	0	0.00498961	0.00499	0.00757681	16	64				
ADAMTS3	9508	broad.mit.edu	37	4	73149142	73149142	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr4:73149142C>A	ENST00000286657.4	-	22	3365	c.3329G>T	c.(3328-3330)gGa>gTa	p.G1110V		NM_014243.2	NP_055058.2	O15072	ATS3_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 3	1110					collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix organization (GO:0030198)|positive regulation of vascular endothelial growth factor signaling pathway (GO:1900748)|protein processing (GO:0016485)|vascular endothelial growth factor production (GO:0010573)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	endopeptidase activity (GO:0004175)|heparin binding (GO:0008201)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.G1110V(1)		NS(1)|breast(2)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(33)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	76			Epithelial(6;4.97e-05)|OV - Ovarian serous cystadenocarcinoma(6;5.66e-05)|all cancers(17;0.000486)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			ATTTGGACCTCCCACTGAAGA	0.463																																					NSCLC(168;1941 2048 2918 13048 43078)	NSCLC(168;1941 2048 2918 13048 43078)	uc003hgk.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|lung(1)	2						c.(3328-3330)GGA>GTA		ADAM metallopeptidase with thrombospondin type 1							105.0	97.0	100.0					4																	73149142		2203	4300	6503	SO:0001583	missense	9508				collagen catabolic process|collagen fibril organization|proteolysis	proteinaceous extracellular matrix	heparin binding|metalloendopeptidase activity|zinc ion binding	g.chr4:73149142C>A	AB002364	CCDS3553.1	4q21	2008-07-29	2005-08-19		ENSG00000156140	ENSG00000156140	3.4.24.-	"""ADAM metallopeptidases with thrombospondin type 1 motif"""	219	protein-coding gene	gene with protein product		605011	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 3"""			10094461	Standard	NM_014243		Approved	KIAA0366, ADAMTS-4	uc003hgk.2	O15072	OTTHUMG00000129912	ENST00000286657.4:c.3329G>T	4.37:g.73149142C>A	ENSP00000286657:p.Gly1110Val		Somatic					p.G1110V	NM_014243	NP_055058	WXS	Illumina HiSeq	Unspecified	O15072	ATS3_HUMAN	Epithelial(6;4.97e-05)|OV - Ovarian serous cystadenocarcinoma(6;5.66e-05)|all cancers(17;0.000486)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)		22	3366	-			1110					A1L3U9|Q9BXZ8	Missense_Mutation	SNP	ENST00000286657.4	37	c.3329G>T	CCDS3553.1	.	.	.	.	.	.	.	.	.	.	C	0.100	-1.153095	0.01700	.	.	ENSG00000156140	ENST00000286657	T	0.60920	0.15	5.35	2.14	0.27477	.	0.722910	0.12329	N	0.478585	T	0.43590	0.1254	L	0.40543	1.245	0.32298	N	0.565435	B	0.15473	0.013	B	0.16289	0.015	T	0.42361	-0.9456	10	0.26408	T	0.33	.	5.8126	0.18475	0.0:0.1481:0.5796:0.2722	.	1110	O15072	ATS3_HUMAN	V	1110	ENSP00000286657:G1110V	ENSP00000286657:G1110V	G	-	2	0	ADAMTS3	73368006	0.603000	0.26924	0.008000	0.14137	0.034000	0.12701	1.647000	0.37260	0.140000	0.18849	0.591000	0.81541	GGA		0.463	ADAMTS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252164.2			15	78	1	0	1.15088e-07	0.004007	2.12413e-07	15	78				
THAP6	152815	broad.mit.edu	37	4	76452177	76452177	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr4:76452177G>T	ENST00000311638.3	+	5	490	c.422G>T	c.(421-423)aGc>aTc	p.S141I	THAP6_ENST00000514480.1_Missense_Mutation_p.S141I|THAP6_ENST00000507556.1_Intron|THAP6_ENST00000507885.1_Intron|THAP6_ENST00000502620.1_Intron|THAP6_ENST00000504190.1_Intron|THAP6_ENST00000380837.3_Missense_Mutation_p.S99I|THAP6_ENST00000507557.1_Intron	NM_144721.4	NP_653322.1	Q8TBB0	THAP6_HUMAN	THAP domain containing 6	141						microtubule cytoskeleton (GO:0015630)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S141I(1)		lung(5)	5			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)			TAGGAACATAGCTACAGTGTA	0.343																																							uc003him.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(421-423)AGC>ATC		THAP domain containing 6							45.0	45.0	45.0					4																	76452177		2203	4300	6503	SO:0001583	missense	152815					microtubule cytoskeleton	DNA binding|metal ion binding	g.chr4:76452177G>T	BC022989	CCDS3568.1	4q21.21	2013-01-25			ENSG00000174796	ENSG00000174796		"""THAP (C2CH-type zinc finger) domain containing"""	23189	protein-coding gene	gene with protein product		612535				12575992	Standard	NM_144721		Approved	MGC30052	uc003him.3	Q8TBB0	OTTHUMG00000130108	ENST00000311638.3:c.422G>T	4.37:g.76452177G>T	ENSP00000309007:p.Ser141Ile		Somatic				THAP6_uc003hin.2_Missense_Mutation_p.S99I|THAP6_uc011cbm.1_Intron|THAP6_uc010iiu.1_Intron|THAP6_uc003hio.1_Intron|THAP6_uc010iiv.2_Missense_Mutation_p.S141I	p.S141I	NM_144721	NP_653322	WXS	Illumina HiSeq	Unspecified	Q8TBB0	THAP6_HUMAN	Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)		5	519	+			141					B4E146|Q5HYJ7|Q5JPC6	Missense_Mutation	SNP	ENST00000311638.3	37	c.422G>T	CCDS3568.1	.	.	.	.	.	.	.	.	.	.	G	19.37	3.814165	0.70912	.	.	ENSG00000174796	ENST00000311638;ENST00000380837;ENST00000514480	D;D;D	0.98649	-4.66;-5.05;-4.66	4.46	4.46	0.54185	.	0.000000	0.64402	D	0.000010	D	0.97291	0.9114	N	0.08118	0	0.36534	D	0.870909	D;D	0.65815	0.994;0.995	D;D	0.75484	0.975;0.986	D	0.97371	0.9976	10	0.45353	T	0.12	-15.5192	12.9323	0.58294	0.0:0.0:1.0:0.0	.	99;141	Q8TBB0-2;Q8TBB0	.;THAP6_HUMAN	I	141;99;141	ENSP00000309007:S141I;ENSP00000370217:S99I;ENSP00000423720:S141I	ENSP00000309007:S141I	S	+	2	0	THAP6	76671201	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.403000	0.59729	2.773000	0.95371	0.655000	0.94253	AGC		0.343	THAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252414.1	NM_144721		15	29	1	0	2.23348e-06	0.004007	3.88491e-06	15	29				
SOWAHB	345079	broad.mit.edu	37	4	77818208	77818208	+	Silent	SNP	A	A	G			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr4:77818208A>G	ENST00000334306.2	-	1	794	c.795T>C	c.(793-795)gcT>gcC	p.A265A		NM_001029870.1	NP_001025041.1	A6NEL2	SWAHB_HUMAN	sosondowah ankyrin repeat domain family member B	265	Ala-rich.							p.A265A(1)									TGCTTGTCGCAGCCTCGACGG	0.721																																							uc003hki.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(793-795)GCT>GCC		ankyrin repeat domain 56							3.0	5.0	4.0					4																	77818208		1950	3877	5827	SO:0001819	synonymous_variant	345079							g.chr4:77818208A>G		CCDS34017.1	4q21.1	2013-01-10	2012-01-12	2012-01-12	ENSG00000186212	ENSG00000186212		"""Ankyrin repeat domain containing"""	32958	protein-coding gene	gene with protein product			"""ankyrin repeat domain 56"""	ANKRD56		22234889	Standard	NM_001029870		Approved		uc003hki.3	A6NEL2	OTTHUMG00000160876	ENST00000334306.2:c.795T>C	4.37:g.77818208A>G			Somatic					p.A265A	NM_001029870	NP_001025041	WXS	Illumina HiSeq	Unspecified	A6NEL2	ANR56_HUMAN			1	795	-			265			Ala-rich.		B2RP29	Silent	SNP	ENST00000334306.2	37	c.795T>C	CCDS34017.1																																																																																				0.721	SOWAHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362762.1	NM_001029870		2	4	0	0	0	0.004672	0	2	4				
FGF5	2250	broad.mit.edu	37	4	81188269	81188269	+	Silent	SNP	C	C	A	rs148557449		TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr4:81188269C>A	ENST00000312465.7	+	1	517	c.291C>A	c.(289-291)atC>atA	p.I97I	FGF5_ENST00000456523.3_Silent_p.I97I	NM_004464.3	NP_004455.2	P12034	FGF5_HUMAN	fibroblast growth factor 5	97					cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell differentiation (GO:0010001)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|signal transduction involved in regulation of gene expression (GO:0023019)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	fibroblast growth factor receptor binding (GO:0005104)	p.I97I(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	22						GAGTGGGCATCGGTTTCCATC	0.567																																							uc003hmd.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|breast(1)	2						c.(289-291)ATC>ATA		fibroblast growth factor 5 isoform 1 precursor							49.0	54.0	52.0					4																	81188269		2202	4296	6498	SO:0001819	synonymous_variant	2250				cell proliferation|cell-cell signaling|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|positive regulation of cell division|positive regulation of cell proliferation	extracellular space	fibroblast growth factor receptor binding|growth factor activity	g.chr4:81188269C>A	M23534	CCDS3586.1, CCDS34021.1	4q21	2014-01-30			ENSG00000138675	ENSG00000138675		"""Endogenous ligands"""	3683	protein-coding gene	gene with protein product		165190				3211147, 2577873	Standard	NM_001291812		Approved		uc003hmd.3	P12034	OTTHUMG00000130288	ENST00000312465.7:c.291C>A	4.37:g.81188269C>A			Somatic				FGF5_uc003hme.2_Silent_p.I97I	p.I97I	NM_004464	NP_004455	WXS	Illumina HiSeq	Unspecified	P12034	FGF5_HUMAN			1	528	+			97					B2R554|O75846|Q3Y8M3|Q8NF90	Silent	SNP	ENST00000312465.7	37	c.291C>A	CCDS34021.1																																																																																				0.567	FGF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252627.2			25	68	1	0	1.5548e-18	0.005443	3.79768e-18	25	68				
PKD2	5311	broad.mit.edu	37	4	88996742	88996742	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr4:88996742C>A	ENST00000508588.1	+	10	1452	c.1057C>A	c.(1057-1059)Cta>Ata	p.L353I	PKD2_ENST00000511337.1_3'UTR|PKD2_ENST00000502363.1_Missense_Mutation_p.L353I|PKD2_ENST00000237596.2_Missense_Mutation_p.L935I			Q9BZL6	KPCD2_HUMAN	polycystic kidney disease 2 (autosomal dominant)	0					angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial tube morphogenesis (GO:0061154)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell receptor signaling pathway (GO:0050862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)	p.L935I(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|liver(2)|lung(15)|skin(4)|upper_aerodigestive_tract(1)	36		Hepatocellular(203;0.114)|Acute lymphoblastic leukemia(40;0.221)		OV - Ovarian serous cystadenocarcinoma(123;9.98e-10)|COAD - Colon adenocarcinoma(81;0.0237)		GCCAGTGGGACTAAATGGTCA	0.532																																							uc003hre.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(2803-2805)CTA>ATA		polycystin 2							163.0	143.0	149.0					4																	88996742		2203	4300	6503	SO:0001583	missense	5311					basal cortex|basal plasma membrane|endoplasmic reticulum|integral to membrane|lamellipodium|microtubule basal body	calcium ion binding|cytoskeletal protein binding|voltage-gated chloride channel activity|voltage-gated sodium channel activity	g.chr4:88996742C>A	U50928	CCDS3627.1	4q22.1	2014-01-28			ENSG00000118762	ENSG00000118762		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""EF-hand domain containing"""	9009	protein-coding gene	gene with protein product	"""transient receptor potential cation channel, subfamily P, member 2"""	173910				8298643	Standard	NM_000297		Approved	PKD4, PC2, Pc-2, TRPP2	uc003hre.3	Q13563	OTTHUMG00000160982	ENST00000508588.1:c.1057C>A	4.37:g.88996742C>A	ENSP00000427131:p.Leu353Ile		Somatic				PKD2_uc011cdf.1_Missense_Mutation_p.L353I|PKD2_uc011cdg.1_Missense_Mutation_p.L261I|PKD2_uc011cdh.1_Missense_Mutation_p.L158I	p.L935I	NM_000297	NP_000288	WXS	Illumina HiSeq	Unspecified	Q13563	PKD2_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;9.98e-10)|COAD - Colon adenocarcinoma(81;0.0237)	15	2869	+		Hepatocellular(203;0.114)|Acute lymphoblastic leukemia(40;0.221)	935			C-terminal coiled coil domain.|Cytoplasmic (Potential).		Q8TB08|Q9P0T6|Q9Y3X8	Missense_Mutation	SNP	ENST00000508588.1	37	c.2803C>A		.	.	.	.	.	.	.	.	.	.	C	9.462	1.093427	0.20471	.	.	ENSG00000118762	ENST00000237596;ENST00000508588;ENST00000502363	T;D;D	0.91577	-0.15;-2.87;-2.87	5.3	5.3	0.74995	.	0.460622	0.19012	N	0.125042	D	0.86104	0.5853	L	0.44542	1.39	0.09310	N	1	P	0.41673	0.759	B	0.37833	0.259	T	0.78658	-0.2118	10	0.27082	T	0.32	-5.7895	13.8775	0.63662	0.1525:0.8475:0.0:0.0	.	935	Q13563	PKD2_HUMAN	I	935;353;353	ENSP00000237596:L935I;ENSP00000427131:L353I;ENSP00000425289:L353I	ENSP00000237596:L935I	L	+	1	2	PKD2	89215766	0.049000	0.20398	0.036000	0.18154	0.194000	0.23727	2.190000	0.42630	2.467000	0.83353	0.585000	0.79938	CTA		0.532	PKD2-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000363253.2	NM_000297		6	149	1	0	0.00307968	0.00308	0.00471396	6	149				
SLC9B2	133308	broad.mit.edu	37	4	103964603	103964603	+	Splice_Site	SNP	C	C	T	rs189641708		TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr4:103964603C>T	ENST00000394785.3	-	9	1628		c.e9-1		SLC9B2_ENST00000503103.1_Splice_Site|SLC9B2_ENST00000339611.4_Splice_Site|SLC9B2_ENST00000362026.3_Splice_Site|SLC9B2_ENST00000503230.1_Splice_Site	NM_178833.4	NP_849155.2	Q86UD5	SL9B2_HUMAN	solute carrier family 9, subfamily B (NHA2, cation proton antiporter 2), member 2						ion transmembrane transport (GO:0034220)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	solute:proton antiporter activity (GO:0015299)	p.?(2)									CAAGTTTGTCCTTTAGGAGAA	0.343																																							uc003hwx.3		NA																	2	Unknown(2)		lung(2)		0						c.e9-1		Na+/H+ exchanger domain containing 2							104.0	87.0	93.0					4																	103964603		2203	4300	6503	SO:0001630	splice_region_variant	133308				sodium ion transport	integral to membrane|mitochondrial membrane	solute:hydrogen antiporter activity	g.chr4:103964603C>T	AK172823	CCDS3662.1, CCDS75173.1, CCDS75174.1	4q24	2013-05-22	2012-03-22	2011-08-03	ENSG00000164038	ENSG00000164038		"""Solute carriers"""	25143	protein-coding gene	gene with protein product		611789	"""Na+/H+ exchanger domain containing 2"", ""solute carrier family 9, subfamily B (cation proton antiporter 2), member 2"""	NHEDC2		18600791	Standard	XM_005262758		Approved	FLJ23984, NHA2	uc003hwy.3	Q86UD5	OTTHUMG00000131125	ENST00000394785.3:c.997-1G>A	4.37:g.103964603C>T			Somatic				NHEDC2_uc010iln.1_Splice_Site_p.D185_splice|NHEDC2_uc003hwy.2_Splice_Site_p.D333_splice|NHEDC2_uc011cew.1_Splice_Site_p.D276_splice|NHEDC2_uc011cex.1_Splice_Site_p.D276_splice	p.D333_splice	NM_178833	NP_849155	WXS	Illumina HiSeq	Unspecified	Q86UD5	NHDC2_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;2.3e-08)	9	1869	-								B5ME52|Q6ZMD8|Q96D95	Splice_Site	SNP	ENST00000394785.3	37	c.997_splice	CCDS3662.1	.	.	.	.	.	.	.	.	.	.	C	34	5.312503	0.95655	.	.	ENSG00000164038	ENST00000362026;ENST00000506288;ENST00000339611;ENST00000394785;ENST00000503103;ENST00000503230	.	.	.	5.53	5.53	0.82687	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.072	0.93143	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SLC9B2	104184052	1.000000	0.71417	0.834000	0.33040	0.875000	0.50365	4.992000	0.63889	2.595000	0.87683	0.591000	0.81541	.		0.343	SLC9B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253805.1	NM_178833	Intron	3	19	0	0	0	0.000248	0	3	19				
SYNPO2	171024	broad.mit.edu	37	4	119951485	119951485	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr4:119951485A>T	ENST00000429713.2	+	4	1737	c.1555A>T	c.(1555-1557)Agc>Tgc	p.S519C	SYNPO2_ENST00000448416.2_Intron|SYNPO2_ENST00000434046.2_Missense_Mutation_p.S519C|SYNPO2_ENST00000307142.4_Missense_Mutation_p.S519C	NM_001128933.1	NP_001122405.1	Q9UMS6	SYNP2_HUMAN	synaptopodin 2	519						actin cytoskeleton (GO:0015629)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|Z disc (GO:0030018)	14-3-3 protein binding (GO:0071889)|muscle alpha-actinin binding (GO:0051371)	p.S519C(2)		breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(18)|ovary(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						TGGAACGCCAAGCAGAGAACA	0.522																																							uc003icm.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(1555-1557)AGC>TGC		synaptopodin 2 isoform b							75.0	61.0	66.0					4																	119951485		2203	4300	6503	SO:0001583	missense	171024					nucleus|Z disc	14-3-3 protein binding|actin binding|muscle alpha-actinin binding	g.chr4:119951485A>T	AJ010482	CCDS34054.1, CCDS47128.1, CCDS47129.1, CCDS75185.1, CCDS75186.1	4q26	2008-08-29			ENSG00000172403	ENSG00000172403			17732	protein-coding gene	gene with protein product						11673475, 17828378	Standard	NM_133477		Approved	MYOPODIN	uc010inb.3	Q9UMS6	OTTHUMG00000161165	ENST00000429713.2:c.1555A>T	4.37:g.119951485A>T	ENSP00000395143:p.Ser519Cys		Somatic				SYNPO2_uc010ina.2_Missense_Mutation_p.S519C|SYNPO2_uc010inb.2_Missense_Mutation_p.S519C|SYNPO2_uc011cgh.1_Intron|SYNPO2_uc010inc.2_Missense_Mutation_p.S447C	p.S519C	NM_001128933	NP_001122405	WXS	Illumina HiSeq	Unspecified	Q9UMS6	SYNP2_HUMAN			4	1751	+			519					B2RWP6|B2Y8J9|Q9UK89|S5XAM4	Missense_Mutation	SNP	ENST00000429713.2	37	c.1555A>T	CCDS47129.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	8.902|8.902	0.956574|0.956574	0.18507|0.18507	.|.	.|.	ENSG00000172403|ENSG00000172403	ENST00000504178|ENST00000307142;ENST00000429713;ENST00000434046	.|T;T;T	.|0.47528	.|0.84;0.84;0.84	4.73|4.73	-5.79|-5.79	0.02354|0.02354	.|.	.|1.347760	.|0.04595	.|N	.|0.397399	T|T	0.42200|0.42200	0.1192|0.1192	L|L	0.44542|0.44542	1.39|1.39	0.09310|0.09310	N|N	0.999999|0.999999	.|P;P;P;P	.|0.48016	.|0.845;0.904;0.845;0.845	.|B;P;B;B	.|0.46339	.|0.315;0.513;0.43;0.315	T|T	0.52366|0.52366	-0.8585|-0.8585	5|9	.|.	.|.	.|.	2.4357|2.4357	9.3569|9.3569	0.38173|0.38173	0.239:0.1952:0.5658:0.0|0.239:0.1952:0.5658:0.0	.|.	.|519;519;519;519	.|B9EG60;Q9UMS6-2;E9PEM2;Q9UMS6	.|.;.;.;SYNP2_HUMAN	M|C	470|519	.|ENSP00000306015:S519C;ENSP00000395143:S519C;ENSP00000390965:S519C	.|.	K|S	+|+	2|1	0|0	SYNPO2|SYNPO2	120170933|120170933	0.002000|0.002000	0.14202|0.14202	0.000000|0.000000	0.03702|0.03702	0.028000|0.028000	0.11728|0.11728	-0.092000|-0.092000	0.11129|0.11129	-0.733000|-0.733000	0.04850|0.04850	0.383000|0.383000	0.25322|0.25322	AAG|AGC		0.522	SYNPO2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364020.1			5	33	0	0	0	0.001168	0	5	33				
QRFPR	84109	broad.mit.edu	37	4	122250567	122250567	+	Silent	SNP	A	A	G			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr4:122250567A>G	ENST00000394427.2	-	6	1609	c.1198T>C	c.(1198-1200)Ttg>Ctg	p.L400L	Y_RNA_ENST00000384419.1_RNA|QRFPR_ENST00000334383.5_3'UTR	NM_198179.2	NP_937822.2	Q96P65	QRFPR_HUMAN	pyroglutamylated RFamide peptide receptor	400					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide Y receptor activity (GO:0004983)	p.L400L(1)		endometrium(1)|kidney(2)|large_intestine(9)|lung(10)|prostate(2)|skin(3)|stomach(1)	28						TGTTCACACAATTTGACTTCA	0.413																																							uc010inj.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1198-1200)TTG>CTG		G protein-coupled receptor 103							229.0	222.0	224.0					4																	122250567		2203	4300	6503	SO:0001819	synonymous_variant	84109					plasma membrane	neuropeptide Y receptor activity	g.chr4:122250567A>G	AF411117	CCDS3719.1	4q27	2012-08-10	2008-12-18	2008-12-18	ENSG00000186867	ENSG00000186867		"""GPCR / Class A : RF amide peptide receptors"""	15565	protein-coding gene	gene with protein product		606925	"""G protein-coupled receptor 103"""	GPR103		11574155	Standard	NM_198179		Approved		uc010inj.1	Q96P65	OTTHUMG00000133036	ENST00000394427.2:c.1198T>C	4.37:g.122250567A>G			Somatic				QRFPR_uc010ink.1_RNA|QRFPR_uc003ids.2_3'UTR	p.L400L	NM_198179	NP_937822	WXS	Illumina HiSeq	Unspecified	Q96P65	QRFPR_HUMAN			6	1577	-			400			Cytoplasmic (Potential).			Silent	SNP	ENST00000394427.2	37	c.1198T>C	CCDS3719.1																																																																																				0.413	QRFPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256641.2	NM_198179		41	177	0	0	0	0.00874	0	41	177				
UCP1	7350	broad.mit.edu	37	4	141483349	141483349	+	Silent	SNP	C	C	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr4:141483349C>T	ENST00000262999.3	-	5	882	c.807G>A	c.(805-807)aaG>aaA	p.K269K		NM_021833.4	NP_068605.1	P25874	UCP1_HUMAN	uncoupling protein 1 (mitochondrial, proton carrier)	269					brown fat cell differentiation (GO:0050873)|cellular metabolic process (GO:0044237)|mitochondrial transport (GO:0006839)|proton transport (GO:0015992)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	oxidative phosphorylation uncoupler activity (GO:0017077)	p.K269K(1)		NS(1)|breast(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|skin(1)|stomach(1)	16	all_hematologic(180;0.162)					TATCTTACCCCTTGAAGAAAG	0.418																																							uc011chj.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(805-807)AAG>AAA		uncoupling protein 1							198.0	182.0	188.0					4																	141483349		2203	4300	6503	SO:0001819	synonymous_variant	7350				brown fat cell differentiation|cellular lipid metabolic process|respiratory electron transport chain	integral to membrane|mitochondrial inner membrane	binding	g.chr4:141483349C>T	X51955	CCDS3753.1	4q28-q31	2013-05-22			ENSG00000109424	ENSG00000109424		"""Solute carriers"""	12517	protein-coding gene	gene with protein product		113730		UCP		2380264	Standard	NM_021833		Approved	SLC25A7	uc011chj.2	P25874	OTTHUMG00000133415	ENST00000262999.3:c.807G>A	4.37:g.141483349C>T			Somatic				UCP1_uc011chk.1_Silent_p.K268K	p.K269K	NM_021833	NP_068605	WXS	Illumina HiSeq	Unspecified	P25874	UCP1_HUMAN			5	883	-	all_hematologic(180;0.162)		269			Helical; Name=6; (Potential).|Solcar 3.		Q13218|Q4KMZ3|Q68G66	Silent	SNP	ENST00000262999.3	37	c.807G>A	CCDS3753.1																																																																																				0.418	UCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257273.1			18	66	0	0	0	0.007413	0	18	66				
IL15	3600	broad.mit.edu	37	4	142653921	142653921	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr4:142653921G>C	ENST00000296545.7	+	8	1253	c.409G>C	c.(409-411)Gag>Cag	p.E137Q	IL15_ENST00000320650.4_Missense_Mutation_p.E137Q|IL15_ENST00000514653.1_Missense_Mutation_p.E110Q|IL15_ENST00000529613.1_Missense_Mutation_p.E137Q|IL15_ENST00000477265.1_Missense_Mutation_p.E110Q|IL15_ENST00000394159.1_Missense_Mutation_p.E110Q			P40933	IL15_HUMAN	interleukin 15	137					aging (GO:0007568)|cell maturation (GO:0048469)|cell-cell signaling (GO:0007267)|cellular response to vitamin D (GO:0071305)|extrathymic T cell selection (GO:0045062)|hyaluronan metabolic process (GO:0030212)|immune response (GO:0006955)|inflammatory response (GO:0006954)|lymph node development (GO:0048535)|natural killer cell differentiation (GO:0001779)|negative regulation of smooth muscle cell proliferation (GO:0048662)|NK T cell proliferation (GO:0001866)|positive regulation of cell proliferation (GO:0008284)|positive regulation of immune response (GO:0050778)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of natural killer cell proliferation (GO:0032819)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of tissue remodeling (GO:0034105)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|regulation of defense response to virus by host (GO:0050691)|regulation of T cell differentiation (GO:0045580)|signal transduction (GO:0007165)|skeletal muscle atrophy (GO:0014732)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleus (GO:0005634)		p.E137Q(1)		kidney(1)|large_intestine(1)|lung(2)|stomach(1)	5	all_hematologic(180;0.158)					CAAAGAATGTGAGGAACTGGA	0.284																																					Pancreas(10;184 986 25902)	Pancreas(10;184 986 25902)	uc003iis.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(409-411)GAG>CAG		interleukin 15 preproprotein							78.0	90.0	86.0					4																	142653921		2203	4298	6501	SO:0001583	missense	3600				cell-cell signaling|immune response|positive regulation of interleukin-17 production	endosome|extracellular space|Golgi apparatus|integral to plasma membrane|membrane fraction|nucleus	cytokine activity|cytokine receptor binding|signal transducer activity	g.chr4:142653921G>C	U14407	CCDS3755.1, CCDS3756.1	4q31	2011-07-14			ENSG00000164136	ENSG00000164136		"""Interleukins and interleukin receptors"""	5977	protein-coding gene	gene with protein product		600554				8178155	Standard	NM_000585		Approved	IL-15, MGC9721	uc003iis.3	P40933	OTTHUMG00000133418	ENST00000296545.7:c.409G>C	4.37:g.142653921G>C	ENSP00000296545:p.Glu137Gln		Somatic				IL15_uc003iit.2_Missense_Mutation_p.E137Q|IL15_uc010iol.2_RNA|IL15_uc003iiu.2_RNA	p.E137Q	NM_000585	NP_000576	WXS	Illumina HiSeq	Unspecified	P40933	IL15_HUMAN			8	778	+	all_hematologic(180;0.158)		137					D3DNZ2|O00440|O43512|Q495Z8|Q6FGX7|Q93058|Q9UBA3	Missense_Mutation	SNP	ENST00000296545.7	37	c.409G>C	CCDS3755.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.988741	0.74589	.	.	ENSG00000164136	ENST00000320650;ENST00000296545;ENST00000514653;ENST00000529613;ENST00000477265;ENST00000394159	.	.	.	5.77	4.92	0.64577	.	0.000000	0.64402	D	0.000003	T	0.78991	0.4371	M	0.82923	2.615	0.36505	D	0.869252	D	0.76494	0.999	D	0.70016	0.967	D	0.85507	0.1195	9	0.87932	D	0	-5.0284	12.4457	0.55649	0.0:0.0:0.8321:0.1679	.	137	P40933	IL15_HUMAN	Q	137;137;110;137;110;110	.	ENSP00000296545:E137Q	E	+	1	0	IL15	142873371	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.742000	0.62103	1.557000	0.49525	0.650000	0.86243	GAG		0.284	IL15-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257278.2	NM_172175		45	99	0	0	0	0.00361	0	45	99				
TDO2	6999	broad.mit.edu	37	4	156831356	156831356	+	Nonsense_Mutation	SNP	T	T	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr4:156831356T>A	ENST00000536354.2	+	6	675	c.611T>A	c.(610-612)tTa>tAa	p.L204*		NM_005651.3	NP_005642.1			tryptophan 2,3-dioxygenase									p.L204*(1)		breast(3)|endometrium(1)|large_intestine(4)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	18	all_hematologic(180;0.24)	Renal(120;0.0854)		KIRC - Kidney renal clear cell carcinoma(143;0.0455)|Kidney(143;0.0568)|COAD - Colon adenocarcinoma(41;0.141)		CTTCTGGAATTAGTGGAGGTA	0.308																																					Colon(57;928 1036 2595 6946 26094)	Colon(57;928 1036 2595 6946 26094)	uc003ipf.1		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(610-612)TTA>TAA		tryptophan 2,3-dioxygenase	L-Tryptophan(DB00150)						51.0	55.0	54.0					4																	156831356		2201	4297	6498	SO:0001587	stop_gained	6999				tryptophan catabolic process to kynurenine	cytosol	tryptophan 2,3-dioxygenase activity	g.chr4:156831356T>A		CCDS34086.1	4q31-q32	2008-02-05				ENSG00000151790	1.13.11.11		11708	protein-coding gene	gene with protein product		191070					Standard	NM_005651		Approved	TDO, TPH2	uc003ipf.2	P48775		ENST00000536354.2:c.611T>A	4.37:g.156831356T>A	ENSP00000444788:p.Leu204*		Somatic					p.L204*	NM_005651	NP_005642	WXS	Illumina HiSeq	Unspecified	P48775	T23O_HUMAN		KIRC - Kidney renal clear cell carcinoma(143;0.0455)|Kidney(143;0.0568)|COAD - Colon adenocarcinoma(41;0.141)	6	675	+	all_hematologic(180;0.24)	Renal(120;0.0854)	204						Nonsense_Mutation	SNP	ENST00000536354.2	37	c.611T>A	CCDS34086.1	.	.	.	.	.	.	.	.	.	.	T	16.29	3.082235	0.55861	.	.	ENSG00000151790	ENST00000536354	.	.	.	4.92	4.92	0.64577	.	0.067174	0.64402	D	0.000010	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.8765	14.8918	0.70614	0.0:0.0:0.0:1.0	.	.	.	.	X	204	.	ENSP00000281525:L204X	L	+	2	0	TDO2	157050806	1.000000	0.71417	0.545000	0.28153	0.113000	0.19764	7.993000	0.88291	1.978000	0.57642	0.524000	0.50904	TTA		0.308	TDO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366209.3	NM_005651		12	67	0	0	0	0.001368	0	12	67				
NPY5R	4889	broad.mit.edu	37	4	164271731	164271731	+	Silent	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr4:164271731C>A	ENST00000515560.1	+	4	1828	c.306C>A	c.(304-306)gtC>gtA	p.V102V	NPY5R_ENST00000338566.3_Silent_p.V102V|NPY5R_ENST00000506953.1_Silent_p.V102V			Q15761	NPY5R_HUMAN	neuropeptide Y receptor Y5	102					cardiac left ventricle morphogenesis (GO:0003214)|eating behavior (GO:0042755)|G-protein coupled receptor signaling pathway (GO:0007186)|generation of ovulation cycle rhythm (GO:0060112)|negative regulation of apoptotic process (GO:0043066)|negative regulation of glutamate secretion (GO:0014050)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|neuropeptide signaling pathway (GO:0007218)|outflow tract morphogenesis (GO:0003151)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of smooth muscle cell proliferation (GO:0048661)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neuropeptide Y receptor activity (GO:0004983)|pancreatic polypeptide receptor activity (GO:0001602)|peptide YY receptor activity (GO:0001601)	p.V102V(1)		NS(2)|biliary_tract(1)|breast(1)|endometrium(3)|large_intestine(4)|lung(26)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	42	all_hematologic(180;0.166)	Prostate(90;0.109)				TGACGTCTGTCTTGCTGGATC	0.393																																					Melanoma(139;1287 1774 9781 19750 25599)	Melanoma(139;1287 1774 9781 19750 25599)	uc003iqn.2		NA																	1	Substitution - coding silent(1)		lung(1)	lung(6)|skin(1)	7						c.(304-306)GTC>GTA		neuropeptide Y receptor Y5							307.0	298.0	301.0					4																	164271731		2203	4300	6503	SO:0001819	synonymous_variant	4889				cardiac left ventricle morphogenesis|outflow tract morphogenesis	integral to plasma membrane		g.chr4:164271731C>A	BC042416	CCDS3804.1	4q31-q32	2012-08-08				ENSG00000164129		"""GPCR / Class A : Neuropeptide receptors : Y"""	7958	protein-coding gene	gene with protein product		602001				8700207, 9417917	Standard	NM_006174		Approved	NPYR5	uc003iqn.3	Q15761		ENST00000515560.1:c.306C>A	4.37:g.164271731C>A			Somatic					p.V102V	NM_006174	NP_006165	WXS	Illumina HiSeq	Unspecified	Q15761	NPY5R_HUMAN			4	488	+	all_hematologic(180;0.166)	Prostate(90;0.109)	102			Extracellular (Potential).		Q6GTR7|Q92916	Silent	SNP	ENST00000515560.1	37	c.306C>A	CCDS3804.1																																																																																				0.393	NPY5R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364633.1	NM_006174		83	169	1	0	2.47556e-37	0.00361	6.73447e-37	83	169				
MTNR1A	4543	broad.mit.edu	37	4	187455689	187455689	+	Missense_Mutation	SNP	T	T	G			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr4:187455689T>G	ENST00000307161.5	-	2	408	c.207A>C	c.(205-207)ttA>ttC	p.L69F	RP11-215A19.2_ENST00000509111.1_Intron	NM_005958.3	NP_005949.1	P48039	MTR1A_HUMAN	melatonin receptor 1A	69					circadian rhythm (GO:0007623)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|mating behavior (GO:0007617)|positive regulation of cGMP biosynthetic process (GO:0030828)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	hormone binding (GO:0042562)|melatonin receptor activity (GO:0008502)|organic cyclic compound binding (GO:0097159)	p.L69F(1)		breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	14		all_cancers(14;6.39e-56)|all_epithelial(14;1.48e-41)|all_lung(41;2.45e-15)|Lung NSC(41;7.26e-15)|Melanoma(20;1.91e-06)|Hepatocellular(41;0.00335)|Prostate(90;0.00996)|all_hematologic(60;0.014)|Colorectal(36;0.0161)|Renal(120;0.0183)|all_neural(102;0.202)		OV - Ovarian serous cystadenocarcinoma(60;7.63e-12)|BRCA - Breast invasive adenocarcinoma(30;6.68e-07)|GBM - Glioblastoma multiforme(59;3.44e-05)|LUSC - Lung squamous cell carcinoma(40;0.000106)|STAD - Stomach adenocarcinoma(60;0.000279)|READ - Rectum adenocarcinoma(43;0.159)	Agomelatine(DB06594)|Melatonin(DB01065)|Ramelteon(DB00980)	CTGCCACCGCTAAGCTCACCA	0.458																																							uc003izd.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)|breast(1)|central_nervous_system(1)|pancreas(1)	5						c.(205-207)TTA>TTC		melatonin receptor 1A	Melatonin(DB01065)|Ramelteon(DB00980)						51.0	54.0	53.0					4																	187455689		2203	4300	6503	SO:0001583	missense	4543				circadian rhythm|G-protein signaling, coupled to cyclic nucleotide second messenger|mating behavior	integral to plasma membrane	melatonin receptor activity	g.chr4:187455689T>G		CCDS3848.1	4q35	2012-08-08				ENSG00000168412		"""GPCR / Class A : Melatonin receptors"""	7463	protein-coding gene	gene with protein product		600665				7558006	Standard	NM_005958		Approved	MEL-1A-R	uc003izd.1	P48039		ENST00000307161.5:c.207A>C	4.37:g.187455689T>G	ENSP00000302811:p.Leu69Phe		Somatic					p.L69F	NM_005958	NP_005949	WXS	Illumina HiSeq	Unspecified	P48039	MTR1A_HUMAN		OV - Ovarian serous cystadenocarcinoma(60;7.63e-12)|BRCA - Breast invasive adenocarcinoma(30;6.68e-07)|GBM - Glioblastoma multiforme(59;3.44e-05)|LUSC - Lung squamous cell carcinoma(40;0.000106)|STAD - Stomach adenocarcinoma(60;0.000279)|READ - Rectum adenocarcinoma(43;0.159)	2	225	-		all_cancers(14;6.39e-56)|all_epithelial(14;1.48e-41)|all_lung(41;2.45e-15)|Lung NSC(41;7.26e-15)|Melanoma(20;1.91e-06)|Hepatocellular(41;0.00335)|Prostate(90;0.00996)|all_hematologic(60;0.014)|Colorectal(36;0.0161)|Renal(120;0.0183)|all_neural(102;0.202)	69			Helical; Name=2; (Potential).		A0AVC5|B0M0L2	Missense_Mutation	SNP	ENST00000307161.5	37	c.207A>C	CCDS3848.1	.	.	.	.	.	.	.	.	.	.	T	18.21	3.574381	0.65878	.	.	ENSG00000168412	ENST00000307161	D	0.91351	-2.83	5.16	-7.64	0.01286	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000001	D	0.96122	0.8736	H	0.99444	4.57	0.53005	D	0.999962	D	0.89917	1.0	D	0.97110	1.0	D	0.93041	0.6457	10	0.87932	D	0	-3.4704	9.3141	0.37924	0.2005:0.5326:0.0:0.2669	.	69	P48039	MTR1A_HUMAN	F	69	ENSP00000302811:L69F	ENSP00000302811:L69F	L	-	3	2	MTNR1A	187692683	0.010000	0.17322	0.598000	0.28837	0.732000	0.41865	-0.909000	0.04058	-0.969000	0.03573	-0.899000	0.02877	TTA		0.458	MTNR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360189.1			12	28	0	0	0	0.00245	0	12	28				
PRDM9	56979	broad.mit.edu	37	5	23522959	23522959	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr5:23522959G>T	ENST00000296682.3	+	8	1029	c.847G>T	c.(847-849)Gac>Tac	p.D283Y		NM_020227.2	NP_064612.2	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	283	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				meiotic gene conversion (GO:0006311)|positive regulation of meiosis I (GO:0060903)|positive regulation of reciprocal meiotic recombination (GO:0010845)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|metal ion binding (GO:0046872)|recombination hotspot binding (GO:0010844)|sequence-specific DNA binding (GO:0043565)	p.D283Y(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(27)|lung(87)|ovary(6)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(11)	172						AATTACAGAAGACGAAGAGGC	0.557										HNSCC(3;0.000094)																													uc003jgo.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|large_intestine(2)|pancreas(1)	6						c.(847-849)GAC>TAC		PR domain containing 9							76.0	77.0	77.0					5																	23522959		2203	4300	6503	SO:0001583	missense	56979				meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleoplasm	histone-lysine N-methyltransferase activity|nucleic acid binding|zinc ion binding	g.chr5:23522959G>T	AF275816	CCDS43307.1	5p14.2	2014-06-03			ENSG00000164256	ENSG00000164256		"""-"", ""Zinc fingers, C2H2-type"""	13994	protein-coding gene	gene with protein product	"""PR-domain containing protein 9"""	609760	"""minisatellite binding protein 3, 115kDa"", ""minisatellite binding protein 3 (115kD)"""	MSBP3		10668202, 2062643, 24634223	Standard	NM_020227		Approved	PFM6, ZNF899	uc003jgo.3	Q9NQV7	OTTHUMG00000161918	ENST00000296682.3:c.847G>T	5.37:g.23522959G>T	ENSP00000296682:p.Asp283Tyr	HNSCC(3;0.000094)	Somatic					p.D283Y	NM_020227	NP_064612	WXS	Illumina HiSeq	Unspecified	Q9NQV7	PRDM9_HUMAN			8	1029	+			283			SET.		B4DX22|Q27Q50	Missense_Mutation	SNP	ENST00000296682.3	37	c.847G>T	CCDS43307.1	.	.	.	.	.	.	.	.	.	.	G	10.48	1.363388	0.24684	.	.	ENSG00000164256	ENST00000296682;ENST00000253473	T	0.72505	-0.66	4.14	2.28	0.28536	SET domain (2);	0.199321	0.24688	N	0.036407	T	0.75361	0.3839	M	0.62723	1.935	0.22541	N	0.999009	D	0.76494	0.999	P	0.61397	0.888	T	0.64054	-0.6497	10	0.72032	D	0.01	-15.8086	6.0761	0.19915	0.2436:0.0:0.7563:0.0	.	283	Q9NQV7	PRDM9_HUMAN	Y	283;77	ENSP00000296682:D283Y	ENSP00000253473:D77Y	D	+	1	0	PRDM9	23558716	0.851000	0.29673	0.419000	0.26584	0.011000	0.07611	1.226000	0.32563	0.851000	0.35264	-0.206000	0.12725	GAC		0.557	PRDM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366375.1	NM_020227		21	76	1	0	1.28384e-07	0.001882	2.36193e-07	21	76				
C5orf42	65250	broad.mit.edu	37	5	37183193	37183193	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr5:37183193A>G	ENST00000508244.1	-	25	5183	c.5090T>C	c.(5089-5091)cTa>cCa	p.L1697P	C5orf42_ENST00000274258.7_Missense_Mutation_p.L578P|C5orf42_ENST00000425232.2_Missense_Mutation_p.L1697P			Q9H799	CE042_HUMAN	chromosome 5 open reading frame 42	1697						integral component of membrane (GO:0016021)		p.L1697P(1)|p.L578P(1)		breast(5)|endometrium(3)|kidney(8)|large_intestine(24)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	79	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			TCTCTGGATTAGACATTTCTC	0.328																																							uc011cpa.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|breast(2)|skin(1)	7						c.(5089-5091)CTA>CCA		hypothetical protein LOC65250							84.0	82.0	83.0					5																	37183193		2203	4300	6503	SO:0001583	missense	65250							g.chr5:37183193A>G		CCDS34146.1, CCDS34146.2	5p13.2	2014-01-28			ENSG00000197603	ENSG00000197603			25801	protein-coding gene	gene with protein product		614571				22264561	Standard	NM_023073		Approved	FLJ13231, JBTS17	uc011cpa.1	Q9H799	OTTHUMG00000160492	ENST00000508244.1:c.5090T>C	5.37:g.37183193A>G	ENSP00000421690:p.Leu1697Pro		Somatic				C5orf42_uc011coy.1_Missense_Mutation_p.L198P|C5orf42_uc003jks.2_RNA|C5orf42_uc011coz.1_Missense_Mutation_p.L772P|C5orf42_uc011cpb.1_Missense_Mutation_p.L578P	p.L1697P	NM_023073	NP_075561	WXS	Illumina HiSeq	Unspecified	E9PH94	E9PH94_HUMAN	COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)		26	5321	-	all_lung(31;0.000616)		1697					A8MUB7|B7ZLV7|Q4G174|Q6DK46|Q8N8L4|Q9H5T1|Q9H8T9	Missense_Mutation	SNP	ENST00000508244.1	37	c.5090T>C	CCDS34146.2	.	.	.	.	.	.	.	.	.	.	A	17.15	3.316248	0.60524	.	.	ENSG00000197603	ENST00000508244;ENST00000425232;ENST00000274258;ENST00000514429;ENST00000388739	T;T;T;T	0.19806	2.12;2.12;2.12;2.12	5.19	-0.254	0.12992	.	1.368830	0.05118	N	0.490092	T	0.09905	0.0243	N	0.08118	0	0.09310	N	0.999999	B;B	0.23806	0.091;0.091	B;B	0.19666	0.026;0.026	T	0.32241	-0.9914	10	0.72032	D	0.01	.	1.068	0.01615	0.3948:0.2403:0.2324:0.1326	.	1697;578	E9PH94;Q9H799	.;CE042_HUMAN	P	1697;1697;578;745;578	ENSP00000421690:L1697P;ENSP00000389014:L1697P;ENSP00000274258:L578P;ENSP00000424223:L745P	ENSP00000274258:L578P	L	-	2	0	C5orf42	37218950	0.000000	0.05858	0.000000	0.03702	0.269000	0.26545	0.587000	0.23909	-0.015000	0.14150	0.533000	0.62120	CTA		0.328	C5orf42-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360806.1	NM_023073		24	54	0	0	0	0.00278	0	24	54				
MROH2B	133558	broad.mit.edu	37	5	41009403	41009403	+	Missense_Mutation	SNP	G	G	C	rs531636398		TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr5:41009403G>C	ENST00000399564.4	-	32	3849	c.3399C>G	c.(3397-3399)atC>atG	p.I1133M	MROH2B_ENST00000506092.2_Missense_Mutation_p.I688M	NM_173489.4	NP_775760.3	Q7Z745	MRO2B_HUMAN	maestro heat-like repeat family member 2B	1133								p.I1133M(1)									CAACCCTGGCGATGTCATCTT	0.507																																							uc003jmj.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|central_nervous_system(2)	8						c.(3397-3399)ATC>ATG		HEAT repeat family member 7B2							128.0	134.0	132.0					5																	41009403		2011	4170	6181	SO:0001583	missense	133558						binding	g.chr5:41009403G>C		CCDS47202.1	5p13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000171495	ENSG00000171495		"""maestro heat-like repeat containing"""	26857	protein-coding gene	gene with protein product			"""HEAT repeat family member 7B2"""	HEATR7B2		12477932	Standard	NM_173489		Approved	DKFZp781F0822, FLJ40243	uc003jmj.4	Q7Z745	OTTHUMG00000162151	ENST00000399564.4:c.3399C>G	5.37:g.41009403G>C	ENSP00000382476:p.Ile1133Met		Somatic				HEATR7B2_uc003jmi.3_Missense_Mutation_p.I688M	p.I1133M	NM_173489	NP_775760	WXS	Illumina HiSeq	Unspecified	Q7Z745	HTRB2_HUMAN			32	3889	-			1133			HEAT 12.		Q68DM1|Q7Z4U4|Q8N7X3	Missense_Mutation	SNP	ENST00000399564.4	37	c.3399C>G	CCDS47202.1	.	.	.	.	.	.	.	.	.	.	G	15.08	2.726648	0.48833	.	.	ENSG00000171495	ENST00000506092;ENST00000296803;ENST00000399564	T;T	0.01495	4.83;5.07	5.99	-2.93	0.05598	Armadillo-like helical (1);Armadillo-type fold (1);	0.871836	0.09993	N	0.729465	T	0.00967	0.0032	N	0.14661	0.345	0.09310	N	1	P	0.42941	0.794	B	0.38264	0.269	T	0.45804	-0.9236	10	0.26408	T	0.33	.	2.4267	0.04461	0.0946:0.2608:0.2943:0.3504	.	1133	Q7Z745	HTRB2_HUMAN	M	688;838;1133	ENSP00000441504:I688M;ENSP00000382476:I1133M	ENSP00000296803:I838M	I	-	3	3	HEATR7B2	41045160	0.000000	0.05858	0.001000	0.08648	0.460000	0.32559	-2.143000	0.01297	-0.529000	0.06358	0.655000	0.94253	ATC		0.507	MROH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367558.2	NM_173489		34	85	0	0	0	0.002836	0	34	85				
MROH2B	133558	broad.mit.edu	37	5	41019088	41019088	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr5:41019088T>A	ENST00000399564.4	-	25	2924	c.2474A>T	c.(2473-2475)cAc>cTc	p.H825L	MROH2B_ENST00000506092.2_Missense_Mutation_p.H380L	NM_173489.4	NP_775760.3	Q7Z745	MRO2B_HUMAN	maestro heat-like repeat family member 2B	825								p.H825L(1)									AATGTTAAGGTGGTCTTGTAG	0.463																																							uc003jmj.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|central_nervous_system(2)	8						c.(2473-2475)CAC>CTC		HEAT repeat family member 7B2							82.0	79.0	80.0					5																	41019088		1935	4128	6063	SO:0001583	missense	133558						binding	g.chr5:41019088T>A		CCDS47202.1	5p13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000171495	ENSG00000171495		"""maestro heat-like repeat containing"""	26857	protein-coding gene	gene with protein product			"""HEAT repeat family member 7B2"""	HEATR7B2		12477932	Standard	NM_173489		Approved	DKFZp781F0822, FLJ40243	uc003jmj.4	Q7Z745	OTTHUMG00000162151	ENST00000399564.4:c.2474A>T	5.37:g.41019088T>A	ENSP00000382476:p.His825Leu		Somatic				HEATR7B2_uc003jmi.3_Missense_Mutation_p.H380L	p.H825L	NM_173489	NP_775760	WXS	Illumina HiSeq	Unspecified	Q7Z745	HTRB2_HUMAN			25	2964	-			825					Q68DM1|Q7Z4U4|Q8N7X3	Missense_Mutation	SNP	ENST00000399564.4	37	c.2474A>T	CCDS47202.1	.	.	.	.	.	.	.	.	.	.	T	9.150	1.015924	0.19355	.	.	ENSG00000171495	ENST00000506092;ENST00000296803;ENST00000399564	T;T	0.62788	3.47;-0.0	6.02	6.02	0.97574	Armadillo-type fold (1);	0.919320	0.09293	N	0.822074	T	0.57577	0.2063	L	0.44542	1.39	0.09310	N	1	B	0.23249	0.082	B	0.21708	0.036	T	0.48055	-0.9068	10	0.34782	T	0.22	.	12.9364	0.58316	0.0:0.0:0.0:1.0	.	825	Q7Z745	HTRB2_HUMAN	L	380;530;825	ENSP00000441504:H380L;ENSP00000382476:H825L	ENSP00000296803:H530L	H	-	2	0	HEATR7B2	41054845	0.998000	0.40836	0.078000	0.20375	0.070000	0.16714	3.916000	0.56416	2.311000	0.77944	0.533000	0.62120	CAC		0.463	MROH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367558.2	NM_173489		13	30	0	0	0	0.001855	0	13	30				
ZNF608	57507	broad.mit.edu	37	5	123980214	123980214	+	Silent	SNP	G	G	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr5:123980214G>A	ENST00000306315.5	-	5	4281	c.3846C>T	c.(3844-3846)ccC>ccT	p.P1282P	ZNF608_ENST00000504926.1_Silent_p.P855P|ZNF608_ENST00000513985.1_5'Flank	NM_020747.2	NP_065798.2	Q9ULD9	ZN608_HUMAN	zinc finger protein 608	1282							metal ion binding (GO:0046872)	p.P1282P(1)		breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(12)|ovary(3)|skin(6)|urinary_tract(1)	46		all_cancers(142;0.186)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.00126)|Epithelial(69;0.00238)|all cancers(49;0.00783)		CAGGAAGGCTGGGCACACCAC	0.418																																							uc003ktq.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(3)|ovary(2)|lung(1)	6						c.(3844-3846)CCC>CCT		zinc finger protein 608							199.0	195.0	196.0					5																	123980214		2203	4300	6503	SO:0001819	synonymous_variant	57507					intracellular	zinc ion binding	g.chr5:123980214G>A	AB033107	CCDS34219.1	5q23.2	2008-05-02			ENSG00000168916	ENSG00000168916		"""Zinc fingers, C2H2-type"""	29238	protein-coding gene	gene with protein product						10574462, 10508479	Standard	NM_020747		Approved	KIAA1281, DKFZp434M098, NY-REN-36	uc003ktq.1	Q9ULD9	OTTHUMG00000162999	ENST00000306315.5:c.3846C>T	5.37:g.123980214G>A			Somatic				ZNF608_uc003ktr.1_RNA|ZNF608_uc003ktp.1_5'UTR	p.P1282P	NM_020747	NP_065798	WXS	Illumina HiSeq	Unspecified	Q9ULD9	ZN608_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.00126)|Epithelial(69;0.00238)|all cancers(49;0.00783)	5	3969	-		all_cancers(142;0.186)|Prostate(80;0.081)	1282					A7E2W9|Q3SYM6|Q68D12|Q8IY05|Q9Y5A1	Silent	SNP	ENST00000306315.5	37	c.3846C>T	CCDS34219.1																																																																																				0.418	ZNF608-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371300.1	XM_114432		36	203	0	0	0	0.006999	0	36	203				
ACSL6	23305	broad.mit.edu	37	5	131302125	131302125	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr5:131302125A>T	ENST00000379240.1	-	17	1775	c.1622T>A	c.(1621-1623)aTc>aAc	p.I541N	ACSL6_ENST00000544770.1_Missense_Mutation_p.I450N|ACSL6_ENST00000379255.1_Missense_Mutation_p.I466N|AC034228.4_ENST00000446275.1_RNA|ACSL6_ENST00000379272.2_Missense_Mutation_p.I556N|ACSL6_ENST00000379249.3_Missense_Mutation_p.I541N|ACSL6_ENST00000296869.4_Missense_Mutation_p.I566N|ACSL6_ENST00000431707.1_Missense_Mutation_p.I521N|ACSL6_ENST00000379244.1_Missense_Mutation_p.I541N|ACSL6_ENST00000543479.1_Missense_Mutation_p.I541N|ACSL6_ENST00000379246.1_Missense_Mutation_p.I552N|ACSL6_ENST00000379264.2_Missense_Mutation_p.I566N|ACSL6_ENST00000357096.1_Missense_Mutation_p.I466N			Q9UKU0	ACSL6_HUMAN	acyl-CoA synthetase long-chain family member 6	541					acyl-CoA metabolic process (GO:0006637)|cellular lipid metabolic process (GO:0044255)|cellular response to insulin stimulus (GO:0032869)|fatty acid transport (GO:0015908)|long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|neuroblast proliferation (GO:0007405)|neuron development (GO:0048666)|phospholipid biosynthetic process (GO:0008654)|positive regulation of neuron projection development (GO:0010976)|positive regulation of plasma membrane long-chain fatty acid transport (GO:0010747)|positive regulation of triglyceride biosynthetic process (GO:0010867)|response to gravity (GO:0009629)|response to hypoxia (GO:0001666)|response to nutrient (GO:0007584)|response to steroid hormone (GO:0048545)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|long-chain fatty acid-CoA ligase activity (GO:0004467)|protein homodimerization activity (GO:0042803)	p.I566N(2)		NS(1)|breast(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	35		all_cancers(142;0.107)|Breast(839;0.198)|Lung NSC(810;0.216)|all_lung(232;0.248)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			CCATTTTCCGATGTCTCCAGT	0.537																																							uc010jdo.1		NA																	2	Substitution - Missense(2)		lung(2)	upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3						c.(1621-1623)ATC>AAC		acyl-CoA synthetase long-chain family member 6							132.0	120.0	124.0					5																	131302125		2203	4300	6503	SO:0001583	missense	23305				fatty acid metabolic process|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial outer membrane|peroxisomal membrane|plasma membrane	ATP binding|long-chain fatty acid-CoA ligase activity	g.chr5:131302125A>T	AB020644	CCDS34228.1, CCDS34229.1, CCDS56381.1, CCDS56382.1, CCDS56383.1	5q31	2008-02-05	2004-02-19	2004-02-20	ENSG00000164398	ENSG00000164398		"""Acyl-CoA synthetase family"""	16496	protein-coding gene	gene with protein product		604443	"""fatty-acid-Coenzyme A ligase, long-chain 6"""	FACL6		10502316, 10548543	Standard	NM_015256		Approved	KIAA0837, ACS2, LACS5, LACS2	uc003kvy.2	Q9UKU0	OTTHUMG00000150692	ENST00000379240.1:c.1622T>A	5.37:g.131302125A>T	ENSP00000368542:p.Ile541Asn		Somatic				ACSL6_uc003kvv.1_RNA|ACSL6_uc003kvx.1_Missense_Mutation_p.I566N|ACSL6_uc003kvy.1_Missense_Mutation_p.I566N|ACSL6_uc003kwb.2_Missense_Mutation_p.I531N|ACSL6_uc003kvz.1_Missense_Mutation_p.I466N|ACSL6_uc003kwa.1_Missense_Mutation_p.I552N|ACSL6_uc003kvw.1_Missense_Mutation_p.I187N|ACSL6_uc010jdn.1_Missense_Mutation_p.I556N	p.I541N	NM_015256	NP_056071	WXS	Illumina HiSeq	Unspecified	Q9UKU0	ACSL6_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		17	1705	-		all_cancers(142;0.107)|Breast(839;0.198)|Lung NSC(810;0.216)|all_lung(232;0.248)	541			Cytoplasmic (Potential).		J3KPG3|O94924|O95829|Q108M9|Q108N0|Q4G191|Q86TN7	Missense_Mutation	SNP	ENST00000379240.1	37	c.1622T>A		.	.	.	.	.	.	.	.	.	.	A	25.1	4.607246	0.87157	.	.	ENSG00000164398	ENST00000379249;ENST00000379264;ENST00000379272;ENST00000357096;ENST00000379255;ENST00000296869;ENST00000379246;ENST00000379244;ENST00000544770;ENST00000379240;ENST00000431707;ENST00000543479	T;T;T;T;T;T;T;T;T;T;T;T	0.50277	0.75;0.75;0.75;0.75;0.75;0.75;0.75;0.75;0.75;0.75;0.75;0.75	5.58	5.58	0.84498	AMP-dependent synthetase/ligase (1);	0.091342	0.85682	D	0.000000	D	0.82609	0.5074	H	0.99415	4.555	0.80722	D	1	D;D;D;D;D;D;D	0.89917	0.998;1.0;1.0;0.999;1.0;1.0;1.0	D;D;D;D;D;D;D	0.81914	0.985;0.991;0.995;0.991;0.991;0.991;0.991	D	0.90458	0.4444	10	0.87932	D	0	.	16.0334	0.80603	1.0:0.0:0.0:0.0	.	541;556;531;541;466;566;566	Q9UKU0-3;Q9UKU0-6;B4DFW3;Q9UKU0;Q9UKU0-7;Q9UKU0-1;Q9UKU0-8	.;.;.;ACSL6_HUMAN;.;.;.	N	541;566;556;466;466;566;552;541;450;541;521;541	ENSP00000368551:I541N;ENSP00000368566:I566N;ENSP00000368574:I556N;ENSP00000349608:I466N;ENSP00000368557:I466N;ENSP00000296869:I566N;ENSP00000368548:I552N;ENSP00000368546:I541N;ENSP00000445154:I450N;ENSP00000368542:I541N;ENSP00000413329:I521N;ENSP00000442124:I541N	ENSP00000296869:I566N	I	-	2	0	ACSL6	131330024	1.000000	0.71417	0.987000	0.45799	0.923000	0.55619	9.237000	0.95368	2.243000	0.73865	0.533000	0.62120	ATC		0.537	ACSL6-004	NOVEL	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000132622.1	NM_015256		20	64	0	0	0	0.001882	0	20	64				
PCDHA5	56143	broad.mit.edu	37	5	140203112	140203112	+	Silent	SNP	G	G	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr5:140203112G>A	ENST00000529859.1	+	1	1752	c.1752G>A	c.(1750-1752)gtG>gtA	p.V584V	PCDHA5_ENST00000529619.1_Silent_p.V584V|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000378126.3_Silent_p.V584V|PCDHA1_ENST00000504120.2_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA4_ENST00000512229.2_Intron	NM_018908.2	NP_061731.1	Q9Y5H7	PCDA5_HUMAN	protocadherin alpha 5	584	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.V584V(2)		NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(6)|large_intestine(8)|liver(1)|lung(22)|ovary(2)|prostate(6)|skin(4)|upper_aerodigestive_tract(3)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGAGGTCAGTGGGTGCGGGCC	0.682																																							uc003lhl.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)|breast(1)|skin(1)	3						c.(1750-1752)GTG>GTA		protocadherin alpha 5 isoform 1 precursor							59.0	65.0	63.0					5																	140203112		2202	4299	6501	SO:0001819	synonymous_variant	56143				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding	g.chr5:140203112G>A	AF152483	CCDS54917.1	5q31	2010-11-26				ENSG00000204965		"""Cadherins / Protocadherins : Clustered"""	8671	other	complex locus constituent	"""ortholog of mouse CNR6"", ""KIAA0345-like 9"""	606311		CNRS6		10380929, 10662547	Standard	NM_018908		Approved	CNR6, CRNR6, CNRN6, PCDH-ALPHA5		Q9Y5H7		ENST00000529859.1:c.1752G>A	5.37:g.140203112G>A			Somatic				PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Silent_p.V584V|PCDHA5_uc003lhj.1_Silent_p.V584V	p.V584V	NM_018908	NP_061731	WXS	Illumina HiSeq	Unspecified	Q9Y5H7	PCDA5_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1752	+			584			Extracellular (Potential).|Cadherin 6.		O75284|Q8N4R3	Silent	SNP	ENST00000529859.1	37	c.1752G>A	CCDS54917.1																																																																																				0.682	PCDHA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372883.2	NM_018908		9	61	0	0	0	0.004482	0	9	61				
PCDHA9	9752	broad.mit.edu	37	5	140228509	140228509	+	Silent	SNP	G	G	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr5:140228509G>A	ENST00000532602.1	+	1	1462	c.429G>A	c.(427-429)gcG>gcA	p.A143A	PCDHA5_ENST00000529619.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA9_ENST00000378122.3_Silent_p.A143A|PCDHA1_ENST00000504120.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA6_ENST00000529310.1_Intron	NM_031857.1	NP_114063.1	Q9Y5H5	PCDA9_HUMAN	protocadherin alpha 9	143	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A143A(2)		breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(18)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	59			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGTTCATCGCGGAATCCAGGC	0.552																																					Melanoma(55;1800 1972 14909)	Melanoma(55;1800 1972 14909)	uc003lhu.2		NA																	2	Substitution - coding silent(2)		lung(2)	large_intestine(2)|ovary(2)|skin(1)	5						c.(427-429)GCG>GCA		protocadherin alpha 9 isoform 1 precursor							90.0	83.0	86.0					5																	140228509		2203	4298	6501	SO:0001819	synonymous_variant	9752				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding	g.chr5:140228509G>A	AF152487	CCDS54920.1	5q31	2010-11-26				ENSG00000204961		"""Cadherins / Protocadherins : Clustered"""	8675	other	complex locus constituent	"""KIAA0345-like 5"""	606315				10380929	Standard	NM_031857		Approved	KIAA0345, PCDH-ALPHA9		Q9Y5H5		ENST00000532602.1:c.429G>A	5.37:g.140228509G>A			Somatic				PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lht.1_Silent_p.A143A	p.A143A	NM_031857	NP_114063	WXS	Illumina HiSeq	Unspecified	Q9Y5H5	PCDA9_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1153	+			143			Extracellular (Potential).|Cadherin 2.		O15053|Q2M3S5	Silent	SNP	ENST00000532602.1	37	c.429G>A	CCDS54920.1																																																																																				0.552	PCDHA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372896.2	NM_031857		6	146	0	0	0	0.001168	0	6	146				
PCDHB4	56131	broad.mit.edu	37	5	140503357	140503357	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr5:140503357G>T	ENST00000194152.1	+	1	1777	c.1777G>T	c.(1777-1779)Ggc>Tgc	p.G593C		NM_018938.2	NP_061761.1	Q9Y5E5	PCDB4_HUMAN	protocadherin beta 4	593	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G593C(1)		autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(12)|lung(35)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	67			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGCGGTGGACGGCGACTCGGG	0.716																																							uc003lip.1		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3						c.(1777-1779)GGC>TGC		protocadherin beta 4 precursor							11.0	11.0	11.0					5																	140503357		1610	3331	4941	SO:0001583	missense	56131				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	cytoplasm|integral to plasma membrane|intermediate filament cytoskeleton	calcium ion binding	g.chr5:140503357G>T	AF152497	CCDS4246.1	5q31	2010-01-26			ENSG00000081818	ENSG00000081818		"""Cadherins / Protocadherins : Clustered"""	8689	other	protocadherin		606330				10380929	Standard	NM_018938		Approved	PCDH-BETA4	uc003lip.1	Q9Y5E5	OTTHUMG00000129617	ENST00000194152.1:c.1777G>T	5.37:g.140503357G>T	ENSP00000194152:p.Gly593Cys		Somatic					p.G593C	NM_018938	NP_061761	WXS	Illumina HiSeq	Unspecified	Q9Y5E5	PCDB4_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	1777	+			593			Cadherin 6.|Extracellular (Potential).		Q4V761	Missense_Mutation	SNP	ENST00000194152.1	37	c.1777G>T	CCDS4246.1	.	.	.	.	.	.	.	.	.	.	G	11.38	1.623037	0.28889	.	.	ENSG00000081818	ENST00000194152	T	0.51817	0.69	4.01	-1.3	0.09259	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.39279	0.1072	M	0.64170	1.965	0.09310	N	1	B	0.16166	0.016	B	0.21917	0.037	T	0.44726	-0.9309	9	0.62326	D	0.03	.	2.6417	0.04973	0.2268:0.2056:0.4545:0.113	.	593	Q9Y5E5	PCDB4_HUMAN	C	593	ENSP00000194152:G593C	ENSP00000194152:G593C	G	+	1	0	PCDHB4	140483541	0.225000	0.23685	0.578000	0.28575	0.992000	0.81027	2.017000	0.40981	-0.144000	0.11314	0.485000	0.47835	GGC		0.716	PCDHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251812.2	NM_018938		28	63	1	0	2.2171e-23	0.001786	5.81103e-23	28	63				
PCDHB16	57717	broad.mit.edu	37	5	140567370	140567370	+	IGR	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr5:140567370C>A	ENST00000361016.2	+	0	4814					NM_020957.1	NP_066008.1	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16						calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|endometrium(10)|kidney(3)|large_intestine(14)|lung(29)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|urinary_tract(1)	69			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AGCACAGGATCCAGATGAAGG	0.388																																							uc003liw.1		NA																	0					0						c.(478-480)CCA>ACA		protocadherin beta 9 precursor							111.0	124.0	120.0					5																	140567370		2195	4296	6491	SO:0001628	intergenic_variant	56127				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140567370C>A	AF217757	CCDS4251.1	5q31	2014-04-11			ENSG00000196963			"""Cadherins / Protocadherins : Clustered"""	14546	other	protocadherin	"""cadherin ME1"", ""protocadherin-3x"", ""PCDHbeta 16"""	606345				11230163, 11322959	Standard	NM_020957		Approved	PCDHB8a, PCDH3X, KIAA1621, PCDH-BETA16, ME1	uc003liv.3	Q9NRJ7	OTTHUMG00000188325		5.37:g.140567370C>A			Somatic					p.P160T	NM_019119	NP_061992	WXS	Illumina HiSeq	Unspecified	Q9Y5E1	PCDB9_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	478	+			160			Extracellular (Potential).|Cadherin 2.		B3KPK5|Q8IYD5|Q96SE9|Q9HCF1	Missense_Mutation	SNP	ENST00000361016.2	37	c.478C>A	CCDS4251.1																																																																																				0.388	PCDHB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251800.1	NM_020957		37	141	1	0	9.62906e-15	0.00623	2.14228e-14	37	141				
PCDHB13	56123	broad.mit.edu	37	5	140594394	140594394	+	Silent	SNP	C	C	A	rs3822336		TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr5:140594394C>A	ENST00000341948.4	+	1	886	c.699C>A	c.(697-699)gtC>gtA	p.V233V		NM_018933.2	NP_061756.1	Q9Y5F0	PCDBD_HUMAN	protocadherin beta 13	233	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V233V(1)		NS(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(4)|lung(24)|ovary(5)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	66			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ACATCGAAGTCCTGGATGTCA	0.537																																							uc003lja.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(2)|ovary(1)	3						c.(697-699)GTC>GTA		protocadherin beta 13 precursor							163.0	171.0	168.0					5																	140594394		2203	4300	6503	SO:0001819	synonymous_variant	56123				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140594394C>A	AF152492	CCDS4255.1	5q31	2010-01-26			ENSG00000187372	ENSG00000187372		"""Cadherins / Protocadherins : Clustered"""	8684	other	protocadherin		606339				10380929	Standard	NM_018933		Approved	PCDH-BETA13	uc003lja.1	Q9Y5F0	OTTHUMG00000129615	ENST00000341948.4:c.699C>A	5.37:g.140594394C>A			Somatic					p.V233V	NM_018933	NP_061756	WXS	Illumina HiSeq	Unspecified	Q9Y5F0	PCDBD_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	886	+			233			Cadherin 2.|Extracellular (Potential).		A8K9V6	Silent	SNP	ENST00000341948.4	37	c.699C>A	CCDS4255.1																																																																																				0.537	PCDHB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251810.1	NM_018933		32	149	1	0	5.91797e-21	0.002445	1.50974e-20	32	149				
PCDHGB1	56104	broad.mit.edu	37	5	140730539	140730539	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr5:140730539G>A	ENST00000523390.1	+	1	712	c.712G>A	c.(712-714)Gtg>Atg	p.V238M	PCDHGA2_ENST00000394576.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron	NM_018922.2|NM_032095.1	NP_061745.1|NP_115266.1	Q9Y5G3	PCDGD_HUMAN	protocadherin gamma subfamily B, 1	238	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V238M(1)		central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|prostate(1)	16			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TAATGCTCCCGTGTTTAGCCA	0.557																																							uc003ljo.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(712-714)GTG>ATG		protocadherin gamma subfamily B, 1 isoform 1							80.0	83.0	82.0					5																	140730539		1966	4159	6125	SO:0001583	missense	56104				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140730539G>A	AF152517	CCDS54923.1, CCDS75330.1	5q31	2010-01-26				ENSG00000254221		"""Cadherins / Protocadherins : Clustered"""	8708	other	protocadherin	"""protocadherin gamma subfamily B, 1, isoform 2"""	606299				10380929	Standard	NM_018922		Approved	PCDH-GAMMA-B1		Q9Y5G3		ENST00000523390.1:c.712G>A	5.37:g.140730539G>A	ENSP00000429273:p.Val238Met		Somatic				PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc011daq.1_Missense_Mutation_p.V238M	p.V238M	NM_018922	NP_061745	WXS	Illumina HiSeq	Unspecified	Q9Y5G3	PCDGD_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	712	+			238			Extracellular (Potential).|Cadherin 2.		Q3SY75|Q9Y5C8	Missense_Mutation	SNP	ENST00000523390.1	37	c.712G>A	CCDS54923.1	.	.	.	.	.	.	.	.	.	.	.	2.940	-0.219160	0.06101	.	.	ENSG00000254221	ENST00000523390	T	0.03242	4.0	5.36	1.43	0.22495	Cadherin (2);Cadherin-like (1);	.	.	.	.	T	0.07503	0.0189	M	0.82517	2.595	0.09310	N	0.999992	P;D	0.55172	0.873;0.97	B;B	0.42771	0.397;0.298	T	0.22347	-1.0219	9	0.54805	T	0.06	.	7.7368	0.28819	0.1248:0.1:0.6724:0.1027	.	238;238	Q9Y5G3-2;Q9Y5G3	.;PCDGD_HUMAN	M	238	ENSP00000429273:V238M	ENSP00000429273:V238M	V	+	1	0	PCDHGB1	140710723	0.015000	0.18098	0.131000	0.22000	0.013000	0.08279	0.364000	0.20325	0.061000	0.16311	-2.589000	0.00165	GTG		0.557	PCDHGB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374740.1	NM_018922		17	55	0	0	0	0.004007	0	17	55				
PCDHGA6	56109	broad.mit.edu	37	5	140755906	140755906	+	Silent	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr5:140755906C>A	ENST00000517434.1	+	1	2256	c.2256C>A	c.(2254-2256)acC>acA	p.T752T	PCDHGB2_ENST00000522605.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron	NM_018919.2|NM_032086.1	NP_061742.1|NP_114475.1	Q9Y5G7	PCDG6_HUMAN	protocadherin gamma subfamily A, 6	752					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.T752T(1)		breast(1)|large_intestine(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCCTGCAGACCTATTCCCACG	0.587																																							uc003ljy.1		NA																	1	Substitution - coding silent(1)		lung(1)	breast(1)	1						c.(2254-2256)ACC>ACA		protocadherin gamma subfamily A, 6 isoform 1							86.0	90.0	88.0					5																	140755906		2203	4300	6503	SO:0001819	synonymous_variant	56109				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140755906C>A	AF152513	CCDS54926.1, CCDS75335.1	5q31	2010-01-26				ENSG00000253731		"""Cadherins / Protocadherins : Clustered"""	8704	other	protocadherin		606293				10380929	Standard	NM_018919		Approved	PCDH-GAMMA-A6		Q9Y5G7		ENST00000517434.1:c.2256C>A	5.37:g.140755906C>A			Somatic				PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc011dau.1_Silent_p.T752T	p.T752T	NM_018919	NP_061742	WXS	Illumina HiSeq	Unspecified	Q9Y5G7	PCDG6_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	2256	+			752			Cytoplasmic (Potential).		A6H8K7|B2RN55|Q9Y5D1	Silent	SNP	ENST00000517434.1	37	c.2256C>A	CCDS54926.1																																																																																				0.587	PCDHGA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374743.1	NM_018919		11	69	1	0	0.000673444	0.008291	0.00105906	11	69				
PCDH1	5097	broad.mit.edu	37	5	141248409	141248409	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr5:141248409C>A	ENST00000394536.3	-	2	767	c.628G>T	c.(628-630)Ggg>Tgg	p.G210W	PCDH1_ENST00000511044.1_5'Flank|PCDH1_ENST00000456271.1_Intron|PCDH1_ENST00000503492.1_Missense_Mutation_p.G210W|PCDH1_ENST00000536585.1_Missense_Mutation_p.G188W|PCDH1_ENST00000287008.3_Missense_Mutation_p.G210W	NM_001278613.1|NM_001278615.1	NP_001265542.1|NP_001265544.1	Q08174	PCDH1_HUMAN	protocadherin 1	210	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell-cell signaling (GO:0007267)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G210W(1)		breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(4)|lung(20)|ovary(5)|skin(3)|upper_aerodigestive_tract(1)	51		Lung NSC(810;0.027)|all_lung(500;0.0321)|all_hematologic(541;0.0433)|Prostate(461;0.0453)|Breast(839;0.128)|Lung SC(612;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;1.06e-05)		GCCTCAGGCCCAGCCTGCAGC	0.607																																					Ovarian(132;1609 1739 4190 14731 45037)	Ovarian(132;1609 1739 4190 14731 45037)	uc003llq.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)	5						c.(628-630)GGG>TGG		protocadherin 1 isoform 1 precursor							120.0	120.0	120.0					5																	141248409		2203	4300	6503	SO:0001583	missense	5097				cell-cell signaling|homophilic cell adhesion|nervous system development	cell-cell junction|integral to plasma membrane	calcium ion binding	g.chr5:141248409C>A	AK075233	CCDS4267.1, CCDS43375.1	5q31.3	2010-01-26	2007-02-12		ENSG00000156453	ENSG00000156453		"""Cadherins / Protocadherins : Non-clustered"""	8655	protein-coding gene	gene with protein product		603626	"""protocadherin 1 (cadherin-like 1)"""			8508762	Standard	NM_032420		Approved	pc42	uc003llp.3	Q08174	OTTHUMG00000129661	ENST00000394536.3:c.628G>T	5.37:g.141248409C>A	ENSP00000378043:p.Gly210Trp		Somatic				PCDH1_uc003llp.2_Missense_Mutation_p.G210W|PCDH1_uc011dbf.1_Missense_Mutation_p.G188W	p.G210W	NM_002587	NP_002578	WXS	Illumina HiSeq	Unspecified	Q08174	PCDH1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;1.06e-05)	2	745	-		Lung NSC(810;0.027)|all_lung(500;0.0321)|all_hematologic(541;0.0433)|Prostate(461;0.0453)|Breast(839;0.128)|Lung SC(612;0.238)	210			Extracellular (Potential).|Cadherin 2.		Q8IUP2	Missense_Mutation	SNP	ENST00000394536.3	37	c.628G>T	CCDS43375.1	.	.	.	.	.	.	.	.	.	.	c	17.49	3.403322	0.62288	.	.	ENSG00000156453	ENST00000503492;ENST00000287008;ENST00000394536;ENST00000357517;ENST00000536585	T;T;T;T;T	0.64260	-0.09;0.38;0.38;0.38;0.38	4.39	3.52	0.40303	Cadherin (4);Cadherin-like (1);	0.242690	0.28821	N	0.014021	T	0.78748	0.4332	M	0.85630	2.765	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.80861	-0.1193	10	0.87932	D	0	.	10.1699	0.42904	0.0:0.9013:0.0:0.0987	.	210;210	Q08174;Q08174-2	PCDH1_HUMAN;.	W	210;210;210;221;188	ENSP00000424667:G210W;ENSP00000287008:G210W;ENSP00000378043:G210W;ENSP00000350122:G221W;ENSP00000438825:G188W	ENSP00000287008:G210W	G	-	1	0	PCDH1	141228593	0.982000	0.34865	0.987000	0.45799	0.962000	0.63368	4.278000	0.58946	1.207000	0.43291	0.550000	0.68814	GGG		0.607	PCDH1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251862.1	NM_032420		13	93	1	0	0.00010058	0.001368	0.000162171	13	93				
FAT2	2196	broad.mit.edu	37	5	150922135	150922135	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr5:150922135G>T	ENST00000261800.5	-	9	8565	c.8553C>A	c.(8551-8553)gaC>gaA	p.D2851E		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	2851	Cadherin 25. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D2851E(1)		NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CACTCTCACTGTCAATGGCAA	0.522																																							uc003lue.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|upper_aerodigestive_tract(1)|skin(1)	6						c.(8551-8553)GAC>GAA		FAT tumor suppressor 2 precursor							127.0	114.0	118.0					5																	150922135		2203	4300	6503	SO:0001583	missense	2196				epithelial cell migration|homophilic cell adhesion	cell-cell adherens junction|integral to membrane|nucleus	calcium ion binding	g.chr5:150922135G>T	AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.8553C>A	5.37:g.150922135G>T	ENSP00000261800:p.Asp2851Glu		Somatic				GM2A_uc011dcs.1_Intron	p.D2851E	NM_001447	NP_001438	WXS	Illumina HiSeq	Unspecified	Q9NYQ8	FAT2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		9	8566	-		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	2851			Extracellular (Potential).|Cadherin 25.		O75091|Q9NSR7	Missense_Mutation	SNP	ENST00000261800.5	37	c.8553C>A	CCDS4317.1	.	.	.	.	.	.	.	.	.	.	G	15.85	2.954264	0.53293	.	.	ENSG00000086570	ENST00000261800	T	0.01705	4.68	6.05	3.34	0.38264	Cadherin (4);Cadherin-like (1);	0.085018	0.49916	D	0.000134	T	0.06690	0.0171	M	0.73372	2.23	0.49299	D	0.999779	D	0.58268	0.982	P	0.60286	0.872	T	0.06391	-1.0829	10	0.54805	T	0.06	.	9.5338	0.39209	0.3311:0.0:0.6689:0.0	.	2851	Q9NYQ8	FAT2_HUMAN	E	2851	ENSP00000261800:D2851E	ENSP00000261800:D2851E	D	-	3	2	FAT2	150902328	0.986000	0.35501	0.999000	0.59377	0.989000	0.77384	1.486000	0.35530	0.458000	0.26988	-0.142000	0.14014	GAC		0.522	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252434.1	NM_001447		22	61	1	0	1.55795e-14	0.001882	3.43946e-14	22	61				
NPM1	4869	broad.mit.edu	37	5	170819773	170819773	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr5:170819773A>G	ENST00000296930.5	+	5	713	c.412A>G	c.(412-414)Ata>Gta	p.I138V	NPM1_ENST00000393820.2_Missense_Mutation_p.I138V|NPM1_ENST00000517671.1_Missense_Mutation_p.I138V|NPM1_ENST00000351986.6_Missense_Mutation_p.I138V	NM_002520.6	NP_002511.1	P06748	NPM_HUMAN	nucleophosmin (nucleolar phosphoprotein B23, numatrin)	138	Required for interaction with SENP3.				cell aging (GO:0007569)|CENP-A containing nucleosome assembly (GO:0034080)|centrosome cycle (GO:0007098)|DNA repair (GO:0006281)|intracellular protein transport (GO:0006886)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of centrosome duplication (GO:0010826)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|nucleocytoplasmic transport (GO:0006913)|nucleosome assembly (GO:0006334)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of translation (GO:0045727)|protein localization (GO:0008104)|protein oligomerization (GO:0051259)|regulation of centriole replication (GO:0046599)|regulation of eIF2 alpha phosphorylation by dsRNA (GO:0060735)|regulation of endodeoxyribonuclease activity (GO:0032071)|regulation of endoribonuclease activity (GO:0060699)|response to stress (GO:0006950)|ribosome assembly (GO:0042255)|signal transduction (GO:0007165)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spindle pole centrosome (GO:0031616)	histone binding (GO:0042393)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein kinase inhibitor activity (GO:0004860)|ribosomal large subunit binding (GO:0043023)|ribosomal small subunit binding (GO:0043024)|RNA binding (GO:0003723)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|unfolded protein binding (GO:0051082)	p.I138V(2)	NPM1/ALK(632)	central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(4261)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	4269	Renal(175;0.000159)|Lung NSC(126;0.00576)|all_lung(126;0.00963)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			ACTCTTAAGTATATCTGGAAA	0.393			"""T, F """	"""ALK, RARA, MLF1"""	"""NHL, APL, AML"""																																		uc011dex.1		NA		Dom	yes		5	5q35	4869	T|F 	"""nucleophosmin (nucleolar phosphoprotein B23, numatrin)"""			L	ALK|RARA|MLF1		NHL|APL|AML	NPM1/ALK(632)	2	Substitution - Missense(2)		lung(2)	haematopoietic_and_lymphoid_tissue(3109)|skin(1)	3110						c.(412-414)ATA>GTA		nucleophosmin 1 isoform 1							98.0	113.0	108.0					5																	170819773		2202	4298	6500	SO:0001583	missense	4869				anti-apoptosis|cell aging|CenH3-containing nucleosome assembly at centromere|centrosome cycle|DNA repair|interspecies interaction between organisms|intracellular protein transport|negative regulation of cell proliferation|negative regulation of centrosome duplication|nucleocytoplasmic transport|positive regulation of NF-kappaB transcription factor activity|protein oligomerization|regulation of endodeoxyribonuclease activity|regulation of endoribonuclease activity|ribosome assembly|signal transduction	nucleolus|nucleoplasm|ribonucleoprotein complex|spindle pole centrosome	histone binding|NF-kappaB binding|protein binding|protein heterodimerization activity|protein homodimerization activity|ribosomal large subunit binding|ribosomal small subunit binding|RNA binding|Tat protein binding|transcription coactivator activity|unfolded protein binding	g.chr5:170819773A>G	M26697	CCDS4376.1, CCDS4377.1, CCDS43399.1	5q35.1	2014-09-17			ENSG00000181163	ENSG00000181163			7910	protein-coding gene	gene with protein product	"""nucleolar phosphoprotein B23"", ""numatrin"", ""nucleophosmin/nucleoplasmin family, member 1"""	164040				8471164, 8122112	Standard	NM_002520		Approved	B23, NPM	uc003mbi.3	P06748	OTTHUMG00000130465	ENST00000296930.5:c.412A>G	5.37:g.170819773A>G	ENSP00000296930:p.Ile138Val		Somatic				NPM1_uc003mbh.2_Missense_Mutation_p.I138V|NPM1_uc003mbi.2_Missense_Mutation_p.I138V|NPM1_uc003mbj.2_Missense_Mutation_p.I138V	p.I138V	NM_002520	NP_002511	WXS	Illumina HiSeq	Unspecified	P06748	NPM_HUMAN	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)		6	547	+	Renal(175;0.000159)|Lung NSC(126;0.00576)|all_lung(126;0.00963)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	138			Required for interaction with SENP3.		A8K3N7|B5BU00|D3DQL6|P08693|Q12826|Q13440|Q13441|Q14115|Q5EU94|Q5EU95|Q5EU96|Q5EU97|Q5EU98|Q5EU99|Q6V962|Q8WTW5|Q96AT6|Q96DC4|Q96EA5|Q9BYG9|Q9UDJ7	Missense_Mutation	SNP	ENST00000296930.5	37	c.412A>G	CCDS4376.1	.	.	.	.	.	.	.	.	.	.	A	8.050	0.765828	0.15983	.	.	ENSG00000181163	ENST00000517671;ENST00000296930;ENST00000521672;ENST00000351986;ENST00000393820	T;T;T;T	0.41065	1.07;1.07;1.01;1.04	3.73	0.986	0.19784	.	1.377010	0.04588	N	0.396266	T	0.40015	0.1100	M	0.66378	2.025	0.09310	N	1	B;B;B	0.12630	0.0;0.006;0.0	B;B;B	0.17722	0.004;0.019;0.005	T	0.21690	-1.0238	10	0.25751	T	0.34	.	4.7832	0.13213	0.648:0.1619:0.1901:0.0	.	138;138;138	P06748-2;P06748;Q9BYG9	.;NPM_HUMAN;.	V	138;138;74;138;138	ENSP00000428755:I138V;ENSP00000296930:I138V;ENSP00000341168:I138V;ENSP00000377408:I138V	ENSP00000296930:I138V	I	+	1	0	NPM1	170752378	0.710000	0.27896	0.347000	0.25668	0.960000	0.62799	1.212000	0.32394	0.440000	0.26502	0.397000	0.26171	ATA		0.393	NPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252858.2	NM_002520		31	110	0	0	0	0.002096	0	31	110				
LMAN2	10960	broad.mit.edu	37	5	176765495	176765495	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr5:176765495C>A	ENST00000303127.7	-	3	631	c.427G>T	c.(427-429)Gtg>Ttg	p.V143L	LMAN2_ENST00000506310.1_5'UTR|LMAN2_ENST00000515209.1_Missense_Mutation_p.V143L|RN7SL562P_ENST00000582768.1_RNA	NM_006816.2	NP_006807.1	Q12907	LMAN2_HUMAN	lectin, mannose-binding 2	143	L-type lectin-like. {ECO:0000255|PROSITE- ProRule:PRU00658}.				positive regulation of phagocytosis (GO:0050766)|protein transport (GO:0015031)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|glycoprotein binding (GO:0001948)|heat shock protein binding (GO:0031072)|mannose binding (GO:0005537)|metal ion binding (GO:0046872)	p.V143L(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|upper_aerodigestive_tract(1)	16	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CCACCTGGCACGAGGCGGTCC	0.657																																							uc003mge.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(427-429)GTG>TTG		lectin, mannose-binding 2 precursor							164.0	128.0	140.0					5																	176765495		2203	4300	6503	SO:0001583	missense	10960				protein transport	endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|Golgi membrane|integral to membrane	metal ion binding|sugar binding	g.chr5:176765495C>A	U10362	CCDS4417.1	5q35	2008-02-05		2003-07-04	ENSG00000169223	ENSG00000169223			16986	protein-coding gene	gene with protein product		609551	"""chromosome 5 open reading frame 8"""	C5orf8		12609988	Standard	NM_006816		Approved	GP36B, VIP36	uc003mge.3	Q12907	OTTHUMG00000130860	ENST00000303127.7:c.427G>T	5.37:g.176765495C>A	ENSP00000303366:p.Val143Leu		Somatic				LMAN2_uc003mgd.2_Missense_Mutation_p.V143L	p.V143L	NM_006816	NP_006807	WXS	Illumina HiSeq	Unspecified	Q12907	LMAN2_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		3	664	-	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	143			Lumenal (Potential).|L-type lectin-like.		Q53HH1	Missense_Mutation	SNP	ENST00000303127.7	37	c.427G>T	CCDS4417.1	.	.	.	.	.	.	.	.	.	.	C	11.21	1.572336	0.28092	.	.	ENSG00000169223	ENST00000303127;ENST00000539488;ENST00000515209;ENST00000514458;ENST00000502560;ENST00000513877	T;T;T;T;T	0.63417	-0.04;-0.04;-0.04;-0.04;-0.04	5.03	2.26	0.28386	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.311034	0.34879	N	0.003613	T	0.27594	0.0678	N	0.02697	-0.525	0.29844	N	0.828993	B;B	0.12630	0.004;0.006	B;B	0.10450	0.003;0.005	T	0.16748	-1.0392	10	0.09084	T	0.74	-18.117	4.141	0.10193	0.0:0.3847:0.3716:0.2438	.	143;143	Q12907;D6RBV2	LMAN2_HUMAN;.	L	143;72;143;143;143;72	ENSP00000303366:V143L;ENSP00000423998:V143L;ENSP00000424132:V143L;ENSP00000425229:V143L;ENSP00000427377:V72L	ENSP00000303366:V143L	V	-	1	0	LMAN2	176698101	0.922000	0.31269	0.588000	0.28705	0.570000	0.35934	1.775000	0.38584	0.818000	0.34468	-0.229000	0.12294	GTG		0.657	LMAN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253434.1	NM_006816		16	67	1	0	3.52763e-06	0.00499	6.09898e-06	16	67				
TFAP2A	7020	broad.mit.edu	37	6	10415182	10415183	+	Missense_Mutation	DNP	CC	CC	AG			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr6:10415182_10415183CC>AG	ENST00000482890.1	-	2	388_389	c.36_37GG>CT	c.(34-39)gaGGac>gaCTac	p.12_13ED>DY	TFAP2A_ENST00000379613.3_Missense_Mutation_p.14_15ED>DY|TFAP2A-AS1_ENST00000443546.1_RNA|TFAP2A_ENST00000379608.3_5'Flank|TFAP2A_ENST00000379604.2_Missense_Mutation_p.12_13ED>DY|TFAP2A-AS1_ENST00000420777.1_RNA|TFAP2A_ENST00000319516.4_Intron			P05549	AP2A_HUMAN	transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha)	12					anterior neuropore closure (GO:0021506)|basement membrane organization (GO:0071711)|bone morphogenesis (GO:0060349)|cellular response to iron ion (GO:0071281)|cornea development in camera-type eye (GO:0061303)|embryonic body morphogenesis (GO:0010172)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic forelimb morphogenesis (GO:0035115)|embryonic pattern specification (GO:0009880)|epidermis morphogenesis (GO:0048730)|eyelid development in camera-type eye (GO:0061029)|face morphogenesis (GO:0060325)|forebrain neuron development (GO:0021884)|inner ear morphogenesis (GO:0042472)|keratinocyte development (GO:0003334)|kidney development (GO:0001822)|lens induction in camera-type eye (GO:0060235)|metanephric nephron development (GO:0072210)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription by competitive promoter binding (GO:0010944)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell development (GO:0014032)|oculomotor nerve formation (GO:0021623)|optic cup structural organization (GO:0003409)|optic vesicle morphogenesis (GO:0003404)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cell migration (GO:0030335)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of tooth mineralization (GO:0070172)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell differentiation (GO:0045595)|regulation of neuron differentiation (GO:0045664)|retina layer formation (GO:0010842)|sensory perception of sound (GO:0007605)|sympathetic nervous system development (GO:0048485)|transcription from RNA polymerase II promoter (GO:0006366)|trigeminal nerve development (GO:0021559)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|protein dimerization activity (GO:0046983)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)	p.E12_D13>DY(1)		breast(1)|endometrium(1)|large_intestine(5)|lung(5)|ovary(1)	13	Breast(50;0.0427)|Ovarian(93;0.0991)	all_hematologic(90;0.107)				ACCTCGCAGTCCTCGTACTTGA	0.569											OREG0017182	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc003myr.2		NA																	1	Complex - compound substitution(1)		lung(1)	ovary(1)	1						c.(34-39)GAGGAC>GACTAC		transcription factor AP-2 alpha isoform a																																				SO:0001583	missense	7020				ectoderm development|positive regulation of bone mineralization|positive regulation of tooth mineralization|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter	centrosome|Golgi apparatus|nucleus	chromatin binding|protein dimerization activity|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription regulatory region DNA binding	g.chr6:10415182_10415183CC>AG	X52611	CCDS4510.1, CCDS34337.1, CCDS43422.1	6p24.3	2013-09-19	2001-11-28		ENSG00000137203	ENSG00000137203			11742	protein-coding gene	gene with protein product		107580	"""transcription factor AP-2 alpha (activating enhancer-binding protein 2 alpha)"""	TFAP2, AP2TF		1916817, 3063603	Standard	NM_001032280		Approved	AP-2	uc003myr.3	P05549	OTTHUMG00000014235	ENST00000482890.1:c.36_37delinsAG	6.37:g.10415182_10415183delinsAG	ENSP00000418541:p.E12_D13delinsDY		Somatic	OREG0017182	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	664	TFAP2A_uc003myq.2_5'Flank|TFAP2A_uc003mys.2_RNA|TFAP2A_uc011dih.1_Missense_Mutation_p.12_13ED>DY|TFAP2A_uc003myt.2_Intron|TFAP2A_uc003myu.1_Missense_Mutation_p.12_13ED>DY|TFAP2A_uc003myv.1_5'Flank|TFAP2A_uc011dii.1_Intron|uc003myw.2_RNA|uc003myx.2_RNA|uc003myy.1_RNA	p.12_13ED>DY	NM_003220	NP_003211	WXS	Illumina HiSeq	Unspecified	P05549	AP2A_HUMAN			1	288_289	-	Breast(50;0.0427)|Ovarian(93;0.0991)	all_hematologic(90;0.107)	12_13					Q13777|Q5TAV5|Q8N1C6	Missense_Mutation	DNP	ENST00000482890.1	37	c.36_37GG>CT	CCDS4510.1																																																																																				0.569	TFAP2A-007	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000353619.2	NM_003220		10	85	0	0	0	0.004672	0	10	85				
PPT2	9374	broad.mit.edu	37	6	32130370	32130370	+	Nonsense_Mutation	SNP	G	G	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr6:32130370G>T	ENST00000324816.6	+	8	1304	c.736G>T	c.(736-738)Gag>Tag	p.E246*	PPT2_ENST00000375143.2_Nonsense_Mutation_p.E246*|PPT2_ENST00000445576.2_Nonsense_Mutation_p.E246*|PPT2_ENST00000493548.1_3'UTR|PPT2_ENST00000437001.2_Nonsense_Mutation_p.E123*|EGFL8_ENST00000333845.6_5'Flank|PPT2_ENST00000395523.1_Nonsense_Mutation_p.E246*|PPT2_ENST00000361568.2_Nonsense_Mutation_p.E252*|PPT2-EGFL8_ENST00000453656.2_3'UTR|PPT2_ENST00000375137.2_Nonsense_Mutation_p.E246*|PPT2-EGFL8_ENST00000422437.1_Nonsense_Mutation_p.E246*|EGFL8_ENST00000395512.1_5'Flank			Q9UMR5	PPT2_HUMAN	palmitoyl-protein thioesterase 2	246					cellular protein modification process (GO:0006464)|macromolecule depalmitoylation (GO:0098734)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	palmitoyl hydrolase activity (GO:0098599)|palmitoyl-(protein) hydrolase activity (GO:0008474)|thiolester hydrolase activity (GO:0016790)	p.E252*(1)		NS(1)|endometrium(2)|large_intestine(2)|lung(10)|prostate(1)|urinary_tract(1)	17						TGATGCAAATGAGACCGTCCT	0.542																																							uc003nzx.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(736-738)GAG>TAG		palmitoyl-protein thioesterase 2 isoform a							157.0	176.0	169.0					6																	32130370		2203	4300	6503	SO:0001587	stop_gained	9374				protein modification process	lysosome	palmitoyl-(protein) hydrolase activity	g.chr6:32130370G>T	AF020543	CCDS4740.1, CCDS4742.1	6p21.3	2012-07-02			ENSG00000221988	ENSG00000221988	3.1.2.22		9326	protein-coding gene	gene with protein product		603298				9341199, 10051407	Standard	NM_138717		Approved		uc003nzw.3	Q9UMR5	OTTHUMG00000031257	ENST00000324816.6:c.736G>T	6.37:g.32130370G>T	ENSP00000320528:p.Glu246*		Somatic				PPT2_uc003nzw.2_Nonsense_Mutation_p.E252*|PPT2_uc011dpi.1_RNA|PPT2_uc003nzy.1_RNA|PPT2_uc003nzz.2_Nonsense_Mutation_p.E246*|PPT2_uc003oaa.2_Nonsense_Mutation_p.E246*|PPT2_uc010jtu.1_Nonsense_Mutation_p.E246*|EGFL8_uc003oac.1_5'Flank|EGFL8_uc003oab.1_5'Flank	p.E246*	NM_005155	NP_005146	WXS	Illumina HiSeq	Unspecified	Q9UMR5	PPT2_HUMAN			8	1304	+			246					A2ABC9|A2ABD1|A2ARM7|A2BFH7|A2BFH9|A2BFI2|A8K9L4|B0S868|G8JLE1|O14799|Q0P6K0|Q5JP13|Q5JP14|Q5JQF0|Q5SSX4|Q5SSX5|Q5SSX6|Q5STJ4|Q5STJ5|Q5STJ6|Q6FI80|Q99945	Nonsense_Mutation	SNP	ENST00000324816.6	37	c.736G>T	CCDS4742.1	.	.	.	.	.	.	.	.	.	.	G	39	7.858619	0.98528	.	.	ENSG00000221988	ENST00000361568;ENST00000395523;ENST00000445576;ENST00000324816;ENST00000437001;ENST00000375137;ENST00000375143	.	.	.	4.98	4.98	0.66077	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.12430	T	0.62	-3.6977	13.9418	0.64059	0.0:0.0:1.0:0.0	.	.	.	.	X	252;246;246;246;123;246;246	.	ENSP00000320528:E246X	E	+	1	0	PPT2	32238348	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	6.851000	0.75425	2.744000	0.94065	0.655000	0.94253	GAG		0.542	PPT2-207	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076552.4	NM_138717		33	218	1	0	1.57351e-24	0.003755	4.14311e-24	33	218				
PPARD	5467	broad.mit.edu	37	6	35393636	35393636	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr6:35393636G>T	ENST00000311565.4	+	9	1455	c.1106G>T	c.(1105-1107)cGg>cTg	p.R369L	PPARD_ENST00000448077.2_Missense_Mutation_p.R330L|PPARD_ENST00000418635.2_Missense_Mutation_p.R271L|PPARD_ENST00000360694.3_Missense_Mutation_p.R369L|PPARD_ENST00000540939.1_Missense_Mutation_p.R266L	NM_001171818.1	NP_001165289.1	Q03181	PPARD_HUMAN	peroxisome proliferator-activated receptor delta	369	Ligand-binding.				adipose tissue development (GO:0060612)|anagen (GO:0042640)|apoptotic signaling pathway (GO:0097190)|axon ensheathment (GO:0008366)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cell-substrate adhesion (GO:0031589)|cellular response to hypoxia (GO:0071456)|cholesterol metabolic process (GO:0008203)|decidualization (GO:0046697)|embryo implantation (GO:0007566)|fatty acid beta-oxidation (GO:0006635)|fatty acid catabolic process (GO:0009062)|fatty acid transport (GO:0015908)|gene expression (GO:0010467)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glucose transport (GO:0015758)|heart development (GO:0007507)|intracellular receptor signaling pathway (GO:0030522)|keratinocyte migration (GO:0051546)|keratinocyte proliferation (GO:0043616)|lipid metabolic process (GO:0006629)|mRNA transcription (GO:0009299)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of collagen biosynthetic process (GO:0032966)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of inflammatory response (GO:0050728)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|phospholipid biosynthetic process (GO:0008654)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epidermis development (GO:0045684)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of insulin secretion (GO:0032024)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vasodilation (GO:0045909)|proteoglycan metabolic process (GO:0006029)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to activity (GO:0014823)|response to glucose (GO:0009749)|response to vitamin A (GO:0033189)|transcription initiation from RNA polymerase II promoter (GO:0006367)|vitamin A metabolic process (GO:0006776)|wound healing (GO:0042060)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|drug binding (GO:0008144)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|linoleic acid binding (GO:0070539)|lipid binding (GO:0008289)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)	p.R369L(1)		autonomic_ganglia(1)|breast(1)|endometrium(1)|large_intestine(4)|liver(2)|lung(9)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	23					Bezafibrate(DB01393)|Icosapent(DB00159)|Sulindac(DB00605)|Treprostinil(DB00374)	AACGTTCCACGGGTGGAGGCT	0.622																																							uc003okm.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1105-1107)CGG>CTG		peroxisome proliferative activated receptor,	Icosapent(DB00159)|Sulindac(DB00605)|Treprostinil(DB00374)						101.0	90.0	94.0					6																	35393636		2203	4300	6503	SO:0001583	missense	5467				apoptosis|axon ensheathment|cholesterol metabolic process|decidualization|embryo implantation|fatty acid beta-oxidation|fatty acid transport|generation of precursor metabolites and energy|glucose metabolic process|glucose transport|negative regulation of transcription from RNA polymerase II promoter|positive regulation of fat cell differentiation|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	drug binding|linoleic acid binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding	g.chr6:35393636G>T	L07592	CCDS4803.1, CCDS4804.1, CCDS54994.1, CCDS54995.1	6p21.2	2013-01-16	2006-10-17		ENSG00000112033	ENSG00000112033		"""Nuclear hormone receptors"""	9235	protein-coding gene	gene with protein product		600409	"""peroxisome proliferative activated receptor, delta"""			1333051	Standard	NM_177435		Approved	NUC1, NUCII, FAAR, NR1C2	uc003okm.3	Q03181	OTTHUMG00000014567	ENST00000311565.4:c.1106G>T	6.37:g.35393636G>T	ENSP00000310928:p.Arg369Leu		Somatic				PPARD_uc003okn.2_Missense_Mutation_p.R369L|PPARD_uc011dtb.1_Missense_Mutation_p.R330L|PPARD_uc011dtc.1_Missense_Mutation_p.R271L	p.R369L	NM_006238	NP_006229	WXS	Illumina HiSeq	Unspecified	Q03181	PPARD_HUMAN			8	1415	+			369			Ligand-binding.		A8K6J6|B4E3V3|B6ZGS1|B7Z3W1|E9PE18|Q5D1P0|Q7Z5K0|Q9BUD4	Missense_Mutation	SNP	ENST00000311565.4	37	c.1106G>T	CCDS4803.1	.	.	.	.	.	.	.	.	.	.	A	10.62	1.400994	0.25291	.	.	ENSG00000112033	ENST00000448077;ENST00000360694;ENST00000418635;ENST00000311565;ENST00000540939	D;D;D;D;D	0.96830	-4.14;-4.14;-4.14;-4.14;-4.14	5.01	5.01	0.66863	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.122334	0.64402	D	0.000017	T	0.72334	0.3447	N	0.01277	-0.915	0.25876	N	0.983655	B;B;B	0.06786	0.001;0.0;0.001	B;B;B	0.08055	0.003;0.0;0.0	T	0.61257	-0.7099	10	0.07175	T	0.84	.	10.8083	0.46531	0.9255:0.0:0.0745:0.0	.	271;330;369	E9PE18;B7Z3W1;Q03181	.;.;PPARD_HUMAN	L	330;369;271;369;266	ENSP00000414372:R330L;ENSP00000353916:R369L;ENSP00000413314:R271L;ENSP00000310928:R369L;ENSP00000443759:R266L	ENSP00000310928:R369L	R	+	2	0	PPARD	35501614	1.000000	0.71417	0.979000	0.43373	0.990000	0.78478	4.567000	0.60850	0.771000	0.33359	-0.369000	0.07265	CGG		0.622	PPARD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040288.1	NM_006238		6	54	1	0	3.59834e-05	0.001168	5.86774e-05	6	54				
CLPS	1208	broad.mit.edu	37	6	35762936	35762936	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr6:35762936C>T	ENST00000259938.2	-	3	348	c.326G>A	c.(325-327)cGc>cAc	p.R109H		NM_001832.3	NP_001823.1	P04118	COL_HUMAN	colipase, pancreatic	109			R -> C (in dbSNP:rs41270082). {ECO:0000269|PubMed:16189801}.		lipid catabolic process (GO:0016042)|lipid digestion (GO:0044241)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	enzyme activator activity (GO:0008047)	p.R109H(1)		large_intestine(2)|lung(2)|prostate(1)	5						CTGCTTGGAGCGTCCAGCGTC	0.607																																					Melanoma(167;2962 3494 37796)	Melanoma(167;2962 3494 37796)	uc003ole.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(325-327)CGC>CAC		colipase preproprotein							249.0	161.0	191.0					6																	35762936		2203	4300	6503	SO:0001583	missense	1208				lipid catabolic process|lipid digestion|retinoid metabolic process|steroid metabolic process	extracellular region		g.chr6:35762936C>T		CCDS4811.1, CCDS75437.1, CCDS75438.1	6p21.31	2012-02-06			ENSG00000137392	ENSG00000137392			2085	protein-coding gene	gene with protein product		120105				2045105	Standard	NM_001832		Approved		uc003ole.2	P04118	OTTHUMG00000014578	ENST00000259938.2:c.326G>A	6.37:g.35762936C>T	ENSP00000259938:p.Arg109His		Somatic				CLPS_uc003olf.1_Missense_Mutation_p.R68H	p.R109H	NM_001832	NP_001823	WXS	Illumina HiSeq	Unspecified	P04118	COL_HUMAN			3	363	-			109					Q5T9G7|Q5U809	Missense_Mutation	SNP	ENST00000259938.2	37	c.326G>A	CCDS4811.1	.	.	.	.	.	.	.	.	.	.	C	16.70	3.194959	0.58017	.	.	ENSG00000137392	ENST00000259938;ENST00000541088	T	0.42131	0.98	4.7	2.87	0.33458	.	0.265863	0.22600	N	0.057972	T	0.23370	0.0565	M	0.62723	1.935	0.09310	N	1	D;P	0.59767	0.986;0.824	P;B	0.45474	0.482;0.14	T	0.10154	-1.0642	10	0.72032	D	0.01	-12.1046	6.176	0.20444	0.0:0.68:0.213:0.107	.	68;109	G3V1M8;P04118	.;COL_HUMAN	H	109;68	ENSP00000259938:R109H	ENSP00000259938:R109H	R	-	2	0	CLPS	35870914	0.000000	0.05858	0.001000	0.08648	0.131000	0.20780	0.094000	0.15107	0.376000	0.24707	0.655000	0.94253	CGC		0.607	CLPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040312.1	NM_001832		5	87	0	0	0	0.001984	0	5	87				
KIF6	221458	broad.mit.edu	37	6	39580974	39580974	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr6:39580974C>T	ENST00000287152.7	-	6	724	c.630G>A	c.(628-630)atG>atA	p.M210I	KIF6_ENST00000538893.1_Missense_Mutation_p.M210I|KIF6_ENST00000373215.3_Missense_Mutation_p.M210I|KIF6_ENST00000373213.4_Missense_Mutation_p.M49I|KIF6_ENST00000373216.3_Missense_Mutation_p.M210I	NM_145027.4	NP_659464.3	Q6ZMV9	KIF6_HUMAN	kinesin family member 6	210	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|male germ cell nucleus (GO:0001673)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.M210I(2)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(16)|large_intestine(8)|lung(15)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	52						CCTCTGCAATCATTCGGTTGG	0.373																																							uc003oot.2		NA																	2	Substitution - Missense(2)		lung(2)	breast(2)|central_nervous_system(1)	3						c.(628-630)ATG>ATA		kinesin family member 6							100.0	93.0	95.0					6																	39580974		2203	4300	6503	SO:0001583	missense	221458				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity|protein binding	g.chr6:39580974C>T	AL832634	CCDS4844.1, CCDS75449.1	6p21.2	2010-03-30			ENSG00000164627	ENSG00000164627		"""Kinesins"""	21202	protein-coding gene	gene with protein product		613919	"""chromosome 6 open reading frame 102"""	C6orf102			Standard	NM_145027		Approved	dJ1043E3.1, MGC33317, dJ137F1.4, dJ188D3.1, DKFZp451I2418	uc003oot.2	Q6ZMV9	OTTHUMG00000014648	ENST00000287152.7:c.630G>A	6.37:g.39580974C>T	ENSP00000287152:p.Met210Ile		Somatic				KIF6_uc010jxa.1_Missense_Mutation_p.M1I|KIF6_uc011dua.1_Missense_Mutation_p.M210I|KIF6_uc010jxb.1_Missense_Mutation_p.M210I	p.M210I	NM_145027	NP_659464	WXS	Illumina HiSeq	Unspecified	Q6ZMV9	KIF6_HUMAN			6	725	-			210			Kinesin-motor.		Q2MDE3|Q2MDE4|Q5T8J6|Q6ZWE3|Q86T87|Q8WTV4	Missense_Mutation	SNP	ENST00000287152.7	37	c.630G>A	CCDS4844.1	.	.	.	.	.	.	.	.	.	.	C	16.14	3.038721	0.55003	.	.	ENSG00000164627	ENST00000287152;ENST00000373216;ENST00000373213;ENST00000373215;ENST00000538893;ENST00000373211	T;T;T;T;T	0.74421	-0.84;-0.84;-0.84;-0.84;-0.84	5.59	4.67	0.58626	Kinesin, motor domain (4);	.	.	.	.	T	0.47154	0.1430	N	0.12746	0.255	0.80722	D	1	P;B;B;P	0.42827	0.63;0.151;0.169;0.791	B;B;B;B	0.43155	0.287;0.07;0.056;0.41	T	0.49670	-0.8915	9	0.17369	T	0.5	.	15.6092	0.76699	0.0:0.8623:0.1377:0.0	.	210;210;210;210	E7EUN7;F6VGH2;Q6ZMV9-3;Q6ZMV9	.;.;.;KIF6_HUMAN	I	210;210;49;210;210;1	ENSP00000287152:M210I;ENSP00000362312:M210I;ENSP00000362309:M49I;ENSP00000362311:M210I;ENSP00000441435:M210I	ENSP00000287152:M210I	M	-	3	0	KIF6	39688952	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.759000	0.62227	2.640000	0.89533	0.650000	0.86243	ATG		0.373	KIF6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040455.2	NM_145027		9	46	0	0	0	0.006214	0	9	46				
GFRAL	389400	broad.mit.edu	37	6	55196632	55196632	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr6:55196632G>T	ENST00000340465.2	+	2	228	c.142G>T	c.(142-144)Gcc>Tcc	p.A48S		NM_207410.2	NP_997293.2	Q6UXV0	GFRAL_HUMAN	GDNF family receptor alpha like	48					negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of neuron apoptotic process (GO:0043524)|stress-activated protein kinase signaling cascade (GO:0031098)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.A48S(1)		NS(1)|breast(1)|endometrium(2)|kidney(5)|large_intestine(2)|liver(1)|lung(31)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	48	Lung NSC(77;0.0875)|Renal(3;0.122)		LUSC - Lung squamous cell carcinoma(124;0.23)			AATGGAAGATGCCTGCAATGA	0.313																																							uc003pcm.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)	2						c.(142-144)GCC>TCC		GDNF family receptor alpha like precursor							107.0	95.0	99.0					6																	55196632		2202	4300	6502	SO:0001583	missense	389400					integral to membrane	receptor activity	g.chr6:55196632G>T	AY358198	CCDS4957.1	6p12.1	2007-06-22			ENSG00000187871	ENSG00000187871			32789	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 144"""	C6orf144		16086688	Standard	NM_207410		Approved	GRAL, UNQ9356, bA360D14.1	uc003pcm.1	Q6UXV0	OTTHUMG00000014900	ENST00000340465.2:c.142G>T	6.37:g.55196632G>T	ENSP00000343636:p.Ala48Ser		Somatic					p.A48S	NM_207410	NP_997293	WXS	Illumina HiSeq	Unspecified	Q6UXV0	GFRAL_HUMAN	LUSC - Lung squamous cell carcinoma(124;0.23)		2	228	+	Lung NSC(77;0.0875)|Renal(3;0.122)		48			Extracellular (Potential).		Q5VTF6	Missense_Mutation	SNP	ENST00000340465.2	37	c.142G>T	CCDS4957.1	.	.	.	.	.	.	.	.	.	.	G	4.697	0.129564	0.08981	.	.	ENSG00000187871	ENST00000340465	T	0.31769	1.48	4.92	3.06	0.35304	GDNF/GAS1 (1);	0.416306	0.22115	N	0.064435	T	0.06781	0.0173	L	0.29908	0.895	0.20764	N	0.999857	B	0.22983	0.078	B	0.18871	0.023	T	0.33979	-0.9847	10	0.26408	T	0.33	-1.3122	6.3548	0.21395	0.0965:0.0:0.7121:0.1915	.	48	Q6UXV0	GFRAL_HUMAN	S	48	ENSP00000343636:A48S	ENSP00000343636:A48S	A	+	1	0	GFRAL	55304591	1.000000	0.71417	0.993000	0.49108	0.112000	0.19704	1.950000	0.40323	0.432000	0.26286	0.467000	0.42956	GCC		0.313	GFRAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040995.2	NM_207410		15	18	1	0	1.05317e-09	0.00245	2.0423e-09	15	18				
COL9A1	1297	broad.mit.edu	37	6	70991127	70991127	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr6:70991127C>A	ENST00000357250.6	-	8	1000	c.842G>T	c.(841-843)gGc>gTc	p.G281V	COL9A1_ENST00000370499.4_Missense_Mutation_p.G38V|COL9A1_ENST00000370496.3_Missense_Mutation_p.G281V|COL9A1_ENST00000489611.1_5'Flank|COL9A1_ENST00000320755.7_Missense_Mutation_p.G38V	NM_001851.4	NP_001842.3	P20849	CO9A1_HUMAN	collagen, type IX, alpha 1	281	Collagen-like 1.|Triple-helical region (COL3).				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|organ morphogenesis (GO:0009887)|tissue homeostasis (GO:0001894)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)	p.G38V(1)|p.G281V(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(44)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)	80						TCCAGGGGGGCCCGGAGGCCC	0.597																																							uc003pfg.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)	4						c.(841-843)GGC>GTC		alpha 1 type IX collagen isoform 1 precursor							23.0	27.0	25.0					6																	70991127		2203	4300	6503	SO:0001583	missense	1297				axon guidance|cell adhesion|organ morphogenesis	collagen type IX	metal ion binding	g.chr6:70991127C>A		CCDS4971.1, CCDS47447.1	6q13	2013-05-07			ENSG00000112280	ENSG00000112280		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2217	protein-coding gene	gene with protein product		120210				1429648	Standard	NM_001851		Approved		uc003pfg.4	P20849	OTTHUMG00000014988	ENST00000357250.6:c.842G>T	6.37:g.70991127C>A	ENSP00000349790:p.Gly281Val		Somatic				COL9A1_uc003pfe.3_5'Flank|COL9A1_uc003pff.3_Missense_Mutation_p.G38V	p.G281V	NM_001851	NP_001842	WXS	Illumina HiSeq	Unspecified	P20849	CO9A1_HUMAN			8	1001	-			281			Triple-helical region (COL3).		Q13699|Q13700|Q5TF52|Q6P467|Q96BM8|Q99225|Q9H151|Q9H152|Q9Y6P2|Q9Y6P3	Missense_Mutation	SNP	ENST00000357250.6	37	c.842G>T	CCDS4971.1	.	.	.	.	.	.	.	.	.	.	C	12.37	1.916928	0.33815	.	.	ENSG00000112280	ENST00000357250;ENST00000320755;ENST00000370499;ENST00000370496	D;D;D;D	0.99353	-5.77;-5.77;-5.77;-5.77	5.74	5.74	0.90152	.	0.095514	0.64402	D	0.000001	D	0.99802	0.9915	H	0.99464	4.58	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.96865	0.9635	10	0.87932	D	0	.	18.8993	0.92435	0.0:1.0:0.0:0.0	.	281;38	P20849;P20849-2	CO9A1_HUMAN;.	V	281;38;38;281	ENSP00000349790:G281V;ENSP00000315252:G38V;ENSP00000359530:G38V;ENSP00000359527:G281V	ENSP00000315252:G38V	G	-	2	0	COL9A1	71047848	0.997000	0.39634	0.198000	0.23420	0.018000	0.09664	5.631000	0.67812	2.722000	0.93159	0.591000	0.81541	GGC		0.597	COL9A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041131.2			8	21	1	0	1.12685e-05	0.004482	1.908e-05	8	21				
SLC17A5	26503	broad.mit.edu	37	6	74351499	74351499	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr6:74351499G>A	ENST00000355773.5	-	3	708	c.440C>T	c.(439-441)gCt>gTt	p.A147V	SLC17A5_ENST00000393019.3_Missense_Mutation_p.A147V|SLC17A5_ENST00000481996.1_5'UTR	NM_012434.4	NP_036566.1	Q9NRA2	S17A5_HUMAN	solute carrier family 17 (acidic sugar transporter), member 5	147					amino acid transport (GO:0006865)|anion transport (GO:0006820)|ion transport (GO:0006811)|proton transport (GO:0015992)|sialic acid transport (GO:0015739)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)|synapse (GO:0045202)	sialic acid transmembrane transporter activity (GO:0015136)|sugar:proton symporter activity (GO:0005351)	p.A147V(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						GGTGAGGACAGCAGTGCCAAG	0.453																																							uc003phn.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(5)|central_nervous_system(1)	6						c.(439-441)GCT>GTT		sialin							161.0	160.0	161.0					6																	74351499		2203	4300	6503	SO:0001583	missense	26503				anion transport	integral to plasma membrane|lysosomal membrane|membrane fraction	sialic acid:hydrogen symporter activity	g.chr6:74351499G>A	AJ387747	CCDS4981.1	6q13	2013-07-18	2013-07-18		ENSG00000119899	ENSG00000119899		"""Solute carriers"""	10933	protein-coding gene	gene with protein product		604322	"""sialic acid storage disease"", ""solute carrier family 17 (anion/sugar transporter), member 5"""	SIASD		10581036, 8198127	Standard	NM_012434		Approved	AST, SD, ISSD, NSD, SIALIN, SLD	uc003phn.4	Q9NRA2	OTTHUMG00000015039	ENST00000355773.5:c.440C>T	6.37:g.74351499G>A	ENSP00000348019:p.Ala147Val		Somatic				SLC17A5_uc010kay.2_RNA|SLC17A5_uc011dyo.1_Silent_p.C45C	p.A147V	NM_012434	NP_036566	WXS	Illumina HiSeq	Unspecified	Q9NRA2	S17A5_HUMAN			3	568	-			147			Helical; (Potential).		Q5SZ76|Q8NBR5|Q9UGH0	Missense_Mutation	SNP	ENST00000355773.5	37	c.440C>T	CCDS4981.1	.	.	.	.	.	.	.	.	.	.	G	15.21	2.764941	0.49574	.	.	ENSG00000119899	ENST00000355773;ENST00000393019	T;T	0.60797	0.16;0.16	5.26	5.26	0.73747	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.395573	0.27861	N	0.017547	T	0.39462	0.1079	L	0.41961	1.31	0.09310	N	1	B	0.24823	0.112	B	0.29077	0.098	T	0.30327	-0.9982	10	0.39692	T	0.17	.	18.8507	0.92227	0.0:0.0:1.0:0.0	.	147	Q9NRA2	S17A5_HUMAN	V	147	ENSP00000348019:A147V;ENSP00000376742:A147V	ENSP00000348019:A147V	A	-	2	0	SLC17A5	74408220	0.895000	0.30542	0.937000	0.37676	0.899000	0.52679	5.410000	0.66381	2.452000	0.82932	0.591000	0.81541	GCT		0.453	SLC17A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041228.1			50	121	0	0	0	0.00361	0	50	121				
ELOVL4	6785	broad.mit.edu	37	6	80626442	80626442	+	Silent	SNP	T	T	C			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr6:80626442T>C	ENST00000369816.4	-	6	1128	c.828A>G	c.(826-828)ccA>ccG	p.P276P		NM_022726.3	NP_073563.1	Q9GZR5	ELOV4_HUMAN	ELOVL fatty acid elongase 4	276					cellular lipid metabolic process (GO:0044255)|detection of visible light (GO:0009584)|fatty acid biosynthetic process (GO:0006633)|fatty acid elongation, saturated fatty acid (GO:0019367)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|very long-chain fatty acid biosynthetic process (GO:0042761)	endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)	G-protein coupled photoreceptor activity (GO:0008020)|transferase activity (GO:0016740)	p.P276P(1)		central_nervous_system(2)|cervix(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22		all_cancers(76;1.83e-05)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.011)		BRCA - Breast invasive adenocarcinoma(397;0.0168)	Alpha-Linolenic Acid(DB00132)	TTCCAGCTTTTGGTTTCTTAG	0.373																																							uc003pja.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|skin(1)	2						c.(826-828)CCA>CCG		elongation of very long chain fatty acids-like	Alpha-Linolenic Acid(DB00132)						108.0	96.0	100.0					6																	80626442		2203	4300	6503	SO:0001819	synonymous_variant	6785				fatty acid elongation, saturated fatty acid|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process|very long-chain fatty acid biosynthetic process	integral to endoplasmic reticulum membrane	G-protein coupled photoreceptor activity|protein binding|transferase activity, transferring acyl groups other than amino-acyl groups	g.chr6:80626442T>C	AF277094	CCDS4992.1	6q14	2013-01-08	2011-05-25		ENSG00000118402	ENSG00000118402			14415	protein-coding gene	gene with protein product	"""cancer/testis antigen 118"""	605512	"""elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 4"""	STGD2, STGD3		11138005	Standard	NM_022726		Approved	CT118	uc003pja.4	Q9GZR5	OTTHUMG00000015087	ENST00000369816.4:c.828A>G	6.37:g.80626442T>C			Somatic				ELOVL4_uc011dyt.1_RNA	p.P276P	NM_022726	NP_073563	WXS	Illumina HiSeq	Unspecified	Q9GZR5	ELOV4_HUMAN		BRCA - Breast invasive adenocarcinoma(397;0.0168)	6	1147	-		all_cancers(76;1.83e-05)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.011)	276					B2R6B5|Q5TCS2|Q86YJ1|Q9H139	Silent	SNP	ENST00000369816.4	37	c.828A>G	CCDS4992.1																																																																																				0.373	ELOVL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041315.1			20	81	0	0	0	0.002299	0	20	81				
GPRC6A	222545	broad.mit.edu	37	6	117149993	117149993	+	Nonsense_Mutation	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr6:117149993C>A	ENST00000310357.3	-	1	205	c.184G>T	c.(184-186)Gag>Tag	p.E62*	GPRC6A_ENST00000530250.1_Nonsense_Mutation_p.E62*|GPRC6A_ENST00000368549.3_Nonsense_Mutation_p.E62*	NM_148963.2	NP_683766.2	Q5T6X5	GPC6A_HUMAN	G protein-coupled receptor, class C, group 6, member A	62					calcium-mediated signaling (GO:0019722)|response to amino acid (GO:0043200)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.E62*(1)		autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|liver(1)|lung(24)|ovary(5)|pancreas(1)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)	65		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0265)|all cancers(137;0.0554)|OV - Ovarian serous cystadenocarcinoma(136;0.07)		CCAACACACTCCTGGATTTGT	0.383																																							uc003pxj.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(4)|skin(2)	6						c.(184-186)GAG>TAG		G protein-coupled receptor, family C, group 6,							79.0	78.0	78.0					6																	117149993		2203	4300	6503	SO:0001587	stop_gained	222545				response to amino acid stimulus		G-protein coupled receptor activity	g.chr6:117149993C>A	AF502962	CCDS5112.1, CCDS69184.1, CCDS69185.1	6q22.31	2014-01-30	2014-01-30		ENSG00000173612	ENSG00000173612		"""GPCR / Class C : Calcium-sensing receptors"""	18510	protein-coding gene	gene with protein product			"""G protein-coupled receptor, family C, group 6, member A"""				Standard	NM_001286354		Approved	bA86F4.3	uc003pxj.1	Q5T6X5	OTTHUMG00000015447	ENST00000310357.3:c.184G>T	6.37:g.117149993C>A	ENSP00000309493:p.Glu62*		Somatic				GPRC6A_uc003pxk.1_Nonsense_Mutation_p.E62*|GPRC6A_uc003pxl.1_Nonsense_Mutation_p.E62*	p.E62*	NM_148963	NP_683766	WXS	Illumina HiSeq	Unspecified	Q5T6X5	GPC6A_HUMAN		GBM - Glioblastoma multiforme(226;0.0265)|all cancers(137;0.0554)|OV - Ovarian serous cystadenocarcinoma(136;0.07)	1	206	-		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)	62			Extracellular (Potential).		Q6JK43|Q6JK44|Q8NGU8|Q8NHZ9|Q8TDT6	Nonsense_Mutation	SNP	ENST00000310357.3	37	c.184G>T	CCDS5112.1	.	.	.	.	.	.	.	.	.	.	C	35	5.506230	0.96386	.	.	ENSG00000173612	ENST00000310357;ENST00000368549;ENST00000530250	.	.	.	5.05	3.89	0.44902	.	0.292444	0.30068	N	0.010496	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05436	T	0.98	.	6.5717	0.22543	0.0:0.0793:0.1539:0.7668	.	.	.	.	X	62	.	ENSP00000309493:E62X	E	-	1	0	GPRC6A	117256686	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.127000	0.42035	0.949000	0.37715	-0.414000	0.06135	GAG		0.383	GPRC6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041966.2			19	59	1	0	4.96729e-08	0.008871	9.31773e-08	19	59				
LAMA2	3908	broad.mit.edu	37	6	129371197	129371197	+	Missense_Mutation	SNP	T	T	G			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr6:129371197T>G	ENST00000421865.2	+	2	296	c.247T>G	c.(247-249)Tgt>Ggt	p.C83G		NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2	83	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)	p.C83G(1)		NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		GAACCCGCAGTGTCGAATCTG	0.463																																							uc003qbn.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(8)|breast(1)|skin(1)	10						c.(247-249)TGT>GGT		laminin alpha 2 subunit isoform a precursor							161.0	137.0	145.0					6																	129371197		2203	4300	6503	SO:0001583	missense	3908				cell adhesion|muscle organ development|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity	g.chr6:129371197T>G	Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.247T>G	6.37:g.129371197T>G	ENSP00000400365:p.Cys83Gly		Somatic				LAMA2_uc003qbo.2_Missense_Mutation_p.C83G	p.C83G	NM_000426	NP_000417	WXS	Illumina HiSeq	Unspecified	P24043	LAMA2_HUMAN		OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)	2	352	+			83			Laminin N-terminal.		Q14736|Q5VUM2|Q93022	Missense_Mutation	SNP	ENST00000421865.2	37	c.247T>G	CCDS5138.1	.	.	.	.	.	.	.	.	.	.	T	20.4	3.990145	0.74589	.	.	ENSG00000196569	ENST00000358023;ENST00000354729;ENST00000421865	D	0.86030	-2.06	5.44	5.44	0.79542	Laminin, N-terminal (3);	0.000000	0.85682	D	0.000000	D	0.94696	0.8289	H	0.97214	3.96	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.96579	0.9429	10	0.87932	D	0	.	15.4879	0.75582	0.0:0.0:0.0:1.0	.	83;83	A6NF00;P24043	.;LAMA2_HUMAN	G	83	ENSP00000400365:C83G	ENSP00000346769:C83G	C	+	1	0	LAMA2	129412890	1.000000	0.71417	0.945000	0.38365	0.613000	0.37349	7.649000	0.83500	2.064000	0.61679	0.459000	0.35465	TGT		0.463	LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042180.1			12	40	0	0	0	0.001855	0	12	40				
SAMD3	154075	broad.mit.edu	37	6	130530639	130530640	+	Splice_Site	DNP	CC	CC	AA			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr6:130530639_130530640CC>AA	ENST00000368134.2	-	7	991_992	c.383_384GG>TT	c.(382-384)aGG>aTT	p.R128I	SAMD3_ENST00000437477.2_Splice_Site_p.R128I|SAMD3_ENST00000532763.1_Splice_Site_p.R126I|SAMD3_ENST00000533296.1_5'UTR|SAMD3_ENST00000324172.6_Splice_Site_p.R128I|SAMD3_ENST00000457563.2_Splice_Site_p.R152I|SAMD3_ENST00000439090.2_Splice_Site_p.R128I	NM_001258275.1	NP_001245204.1	Q8N6K7	SAMD3_HUMAN	sterile alpha motif domain containing 3	128								p.?(1)		breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(3)|lung(15)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	29				GBM - Glioblastoma multiforme(226;0.00594)|OV - Ovarian serous cystadenocarcinoma(155;0.128)		GGTACCCCCACCTCTGTTTCAA	0.381																																							uc003qbv.2		NA																	1	Unknown(1)		lung(1)	ovary(1)	1						c.e6+1		sterile alpha motif domain containing 3 isoform																																				SO:0001630	splice_region_variant	154075							g.chr6:130530639_130530640CC>AA	AK091351	CCDS34539.1, CCDS64525.1	6q23.1	2013-01-10			ENSG00000164483	ENSG00000164483		"""Sterile alpha motif (SAM) domain containing"""	21574	protein-coding gene	gene with protein product							Standard	NM_001017373		Approved	bA73O6.2, FLJ34032	uc031spp.1	Q8N6K7	OTTHUMG00000015556	ENST00000368134.2:c.383_384delinsAA	6.37:g.130530639_130530640delinsAA			Somatic				SAMD3_uc003qbx.2_Splice_Site_p.R128_splice|SAMD3_uc003qbw.2_Splice_Site_p.R128_splice|SAMD3_uc010kfg.1_Splice_Site_p.R128_splice|SAMD3_uc003qby.2_Splice_Site_p.R128_splice|SAMD3_uc003qbz.1_Splice_Site_p.R87_splice	p.R128_splice	NM_001017373	NP_001017373	WXS	Illumina HiSeq	Unspecified	Q8N6K7	SAMD3_HUMAN		GBM - Glioblastoma multiforme(226;0.00594)|OV - Ovarian serous cystadenocarcinoma(155;0.128)	6	709	-								B4DY20|E1P576|J3KQK4|Q4VXD8|Q8NAY1|Q8NB96	Splice_Site	DNP	ENST00000368134.2	37	c.383_splice	CCDS34539.1																																																																																				0.381	SAMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042197.3	NM_152552	Missense_Mutation	10	31	0	0	0	0.004672	0	10	31				
TAAR8	83551	broad.mit.edu	37	6	132874344	132874344	+	Silent	SNP	C	C	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr6:132874344C>T	ENST00000275200.1	+	1	513	c.513C>T	c.(511-513)gtC>gtT	p.V171V		NM_053278.1	NP_444508.1	Q969N4	TAAR8_HUMAN	trace amine associated receptor 8	171					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|trace-amine receptor activity (GO:0001594)	p.V171V(1)		endometrium(3)|large_intestine(2)|lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	22	Breast(56;0.112)			OV - Ovarian serous cystadenocarcinoma(155;0.00412)|GBM - Glioblastoma multiforme(226;0.00792)		ACACAGGTGTCAATGATGATG	0.468																																							uc011ecj.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(511-513)GTC>GTT		trace amine associated receptor 8							299.0	291.0	294.0					6																	132874344		2203	4300	6503	SO:0001819	synonymous_variant	83551					plasma membrane	G-protein coupled receptor activity	g.chr6:132874344C>T	AF380193	CCDS5154.1	6q23.2	2014-05-14	2005-02-23	2005-02-24	ENSG00000146385	ENSG00000146385		"""GPCR / Class A : Trace amine associated receptors"""	14964	protein-coding gene	gene with protein product		606927	"""trace amine receptor 5"""	GPR102, TRAR5		11574155, 15718104	Standard	NM_053278		Approved	TA5, TAR5	uc011ecj.2	Q969N4	OTTHUMG00000015586	ENST00000275200.1:c.513C>T	6.37:g.132874344C>T			Somatic					p.V171V	NM_053278	NP_444508	WXS	Illumina HiSeq	Unspecified	Q969N4	TAAR8_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;0.00412)|GBM - Glioblastoma multiforme(226;0.00792)	1	513	+	Breast(56;0.112)		171			Extracellular (Potential).		Q5VUQ0	Silent	SNP	ENST00000275200.1	37	c.513C>T	CCDS5154.1																																																																																				0.468	TAAR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042262.1	NM_053278		30	223	0	0	0	0.002445	0	30	223				
IL20RA	53832	broad.mit.edu	37	6	137323275	137323275	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr6:137323275C>T	ENST00000316649.5	-	7	1317	c.1082G>A	c.(1081-1083)gGg>gAg	p.G361E	IL20RA_ENST00000367748.1_Missense_Mutation_p.G250E|IL20RA_ENST00000541547.1_Missense_Mutation_p.G312E|IL20RA_ENST00000468393.1_5'Flank|RP11-204P2.3_ENST00000458017.1_RNA	NM_001278722.1|NM_014432.2	NP_001265651.1|NP_055247	Q9UHF4	I20RA_HUMAN	interleukin 20 receptor, alpha	361					cytokine-mediated signaling pathway (GO:0019221)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|regulation of bone resorption (GO:0045124)	integral component of membrane (GO:0016021)		p.G361E(1)		NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	27	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000351)|OV - Ovarian serous cystadenocarcinoma(155;0.00459)		CGAAGCATACCCTAAATGTTT	0.488																																							uc003qhj.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(2)	4						c.(1081-1083)GGG>GAG		interleukin 20 receptor, alpha precursor							61.0	60.0	60.0					6																	137323275		2203	4300	6503	SO:0001583	missense	53832					integral to membrane	receptor activity	g.chr6:137323275C>T	AF184971	CCDS5181.1, CCDS64535.1, CCDS64536.1	6q23.3	2008-02-05			ENSG00000016402	ENSG00000016402		"""Interleukins and interleukin receptors"""	6003	protein-coding gene	gene with protein product		605620				10875937, 11163236	Standard	NM_001278724		Approved	ZCYTOR7, IL-20R1	uc003qhj.3	Q9UHF4	OTTHUMG00000015654	ENST00000316649.5:c.1082G>A	6.37:g.137323275C>T	ENSP00000314976:p.Gly361Glu		Somatic				IL20RA_uc011edl.1_Missense_Mutation_p.G312E|IL20RA_uc003qhk.2_Missense_Mutation_p.G250E|IL20RA_uc003qhi.2_Missense_Mutation_p.G93E	p.G361E	NM_014432	NP_055247	WXS	Illumina HiSeq	Unspecified	Q9UHF4	I20RA_HUMAN		GBM - Glioblastoma multiforme(68;0.000351)|OV - Ovarian serous cystadenocarcinoma(155;0.00459)	7	1515	-	Colorectal(23;0.24)		361			Cytoplasmic (Potential).		B4DLR5|F5H675|Q14CW2|Q6UWA9|Q96SH8	Missense_Mutation	SNP	ENST00000316649.5	37	c.1082G>A	CCDS5181.1	.	.	.	.	.	.	.	.	.	.	C	16.05	3.014082	0.54468	.	.	ENSG00000016402	ENST00000316649;ENST00000367748;ENST00000541547	T;T;T	0.62941	0.24;1.74;-0.01	5.76	5.76	0.90799	.	4.561590	0.00760	N	0.001138	T	0.68778	0.3038	M	0.61703	1.905	0.45567	D	0.998515	D;P	0.89917	1.0;0.89	D;B	0.97110	1.0;0.425	T	0.66488	-0.5911	10	0.02654	T	1	-26.3642	16.6794	0.85288	0.0:1.0:0.0:0.0	.	250;361	Q9UHF4-2;Q9UHF4	.;I20RA_HUMAN	E	361;250;312	ENSP00000314976:G361E;ENSP00000356722:G250E;ENSP00000437843:G312E	ENSP00000314976:G361E	G	-	2	0	IL20RA	137364968	0.010000	0.17322	0.393000	0.26258	0.131000	0.20780	0.571000	0.23669	2.720000	0.93068	0.655000	0.94253	GGG		0.488	IL20RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042393.1	NM_014432		19	45	0	0	0	0.008871	0	19	45				
SYNE1	23345	broad.mit.edu	37	6	152647561	152647561	+	Silent	SNP	G	G	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr6:152647561G>A	ENST00000367255.5	-	79	15764	c.15163C>T	c.(15163-15165)Ctg>Ttg	p.L5055L	SYNE1_ENST00000448038.1_Silent_p.L4984L|SYNE1_ENST00000265368.4_Silent_p.L5055L|SYNE1_ENST00000423061.1_Silent_p.L4984L|SYNE1_ENST00000341594.5_Silent_p.L4802L	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	5055					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.L5055L(2)|p.L4984L(1)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GTGGCTACCAGGCTGTGGAGC	0.527										HNSCC(10;0.0054)																													uc010kiw.2		NA																	3	Substitution - coding silent(3)		lung(3)	central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45						c.(15163-15165)CTG>TTG		spectrin repeat containing, nuclear envelope 1							97.0	99.0	99.0					6																	152647561		2203	4300	6503	SO:0001819	synonymous_variant	23345				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding	g.chr6:152647561G>A	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.15163C>T	6.37:g.152647561G>A		HNSCC(10;0.0054)	Somatic				SYNE1_uc003qot.3_Silent_p.L4984L|SYNE1_uc003qou.3_Silent_p.L5055L|SYNE1_uc010kiz.2_Silent_p.L810L	p.L5055L	NM_182961	NP_892006	WXS	Illumina HiSeq	Unspecified	Q8NF91	SYNE1_HUMAN	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)	79	15765	-		Ovarian(120;0.0955)	5055			Cytoplasmic (Potential).		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Silent	SNP	ENST00000367255.5	37	c.15163C>T	CCDS5236.2																																																																																				0.527	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961		24	52	0	0	0	0.00278	0	24	52				
LPA	4018	broad.mit.edu	37	6	160978463	160978463	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr6:160978463G>A	ENST00000316300.5	-	29	4816	c.4772C>T	c.(4771-4773)aCt>aTt	p.T1591I	LPA_ENST00000447678.1_Missense_Mutation_p.T1591I			P08519	APOA_HUMAN	lipoprotein, Lp(a)	4099	Kringle 14. {ECO:0000255|PROSITE- ProRule:PRU00121}.				blood circulation (GO:0008015)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|negative regulation of endopeptidase activity (GO:0010951)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|plasma lipoprotein particle (GO:0034358)	apolipoprotein binding (GO:0034185)|endopeptidase inhibitor activity (GO:0004866)|fibronectin binding (GO:0001968)|heparin binding (GO:0008201)|serine-type endopeptidase activity (GO:0004252)	p.T1591I(1)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|lung(54)|ovary(4)|pancreas(1)|prostate(2)|skin(10)|stomach(1)|urinary_tract(1)	107		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	TGGAACAACAGTGGGAGTCTC	0.463																																							uc003qtl.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(2)|pancreas(1)	6						c.(4771-4773)ACT>ATT		lipoprotein Lp(a) precursor	Aminocaproic Acid(DB00513)						129.0	123.0	125.0					6																	160978463		1960	4188	6148	SO:0001583	missense	4018				blood circulation|lipid metabolic process|lipid transport|lipoprotein metabolic process|proteolysis|receptor-mediated endocytosis	plasma lipoprotein particle	apolipoprotein binding|endopeptidase inhibitor activity|fibronectin binding|heparin binding|serine-type endopeptidase activity	g.chr6:160978463G>A	X06290	CCDS43523.1	6q25-q26	2012-10-02			ENSG00000198670	ENSG00000198670			6667	protein-coding gene	gene with protein product		152200		LP		3670400	Standard	NM_005577		Approved		uc003qtl.3	P08519	OTTHUMG00000015956	ENST00000316300.5:c.4772C>T	6.37:g.160978463G>A	ENSP00000321334:p.Thr1591Ile		Somatic					p.T1591I	NM_005577	NP_005568	WXS	Illumina HiSeq	Unspecified	P08519	APOA_HUMAN		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	30	4892	-		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)	4099			Kringle 36.		Q5VTD7|Q9UD88	Missense_Mutation	SNP	ENST00000316300.5	37	c.4772C>T	CCDS43523.1	.	.	.	.	.	.	.	.	.	.	g	11.66	1.704941	0.30232	.	.	ENSG00000198670	ENST00000316300;ENST00000447678	T;T	0.62639	0.01;0.01	2.04	1.09	0.20402	Kringle-like fold (1);	.	.	.	.	T	0.49592	0.1566	L	0.42581	1.335	0.09310	N	1	P	0.41188	0.741	P	0.56960	0.81	T	0.46762	-0.9168	9	0.66056	D	0.02	.	4.9622	0.14072	0.2014:0.0:0.7986:0.0	.	4099	P08519	APOA_HUMAN	I	1591	ENSP00000321334:T1591I;ENSP00000395608:T1591I	ENSP00000321334:T1591I	T	-	2	0	LPA	160898453	0.000000	0.05858	0.000000	0.03702	0.249000	0.25844	0.173000	0.16724	0.148000	0.19059	0.205000	0.17691	ACT		0.463	LPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042957.1	NM_005577		12	97	0	0	0	0.00245	0	12	97				
CARD11	84433	broad.mit.edu	37	7	2959089	2959089	+	Silent	SNP	C	C	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr7:2959089C>T	ENST00000396946.4	-	18	2830	c.2427G>A	c.(2425-2427)caG>caA	p.Q809Q		NM_032415.4	NP_115791.3	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11	809					Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|nucleotide phosphorylation (GO:0046939)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cytokine production (GO:0001819)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell proliferation (GO:0042102)|regulation of apoptotic process (GO:0042981)|regulation of B cell differentiation (GO:0045577)|regulation of T cell differentiation (GO:0045580)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|thymic T cell selection (GO:0045061)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)|guanylate kinase activity (GO:0004385)	p.Q802Q(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(62)|kidney(11)|large_intestine(13)|lung(31)|ovary(4)|prostate(5)|skin(7)|upper_aerodigestive_tract(2)	150		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)		CGTGCCTGTCCTGGTACATGG	0.592			Mis		DLBCL																																		uc003smv.2		NA		Dom	yes		7	7p22	84433	Mis	"""caspase recruitment domain family, member 11"""			L			DLBCL		1	Substitution - coding silent(1)		lung(1)	haematopoietic_and_lymphoid_tissue(43)|ovary(2)|kidney(2)|skin(2)|central_nervous_system(1)	50						c.(2425-2427)CAG>CAA		caspase recruitment domain family, member 11							105.0	76.0	86.0					7																	2959089		2203	4300	6503	SO:0001819	synonymous_variant	84433				positive regulation of cytokine production|positive regulation of NF-kappaB transcription factor activity|regulation of apoptosis|T cell costimulation|T cell receptor signaling pathway	cytosol|membrane raft|plasma membrane	CARD domain binding|guanylate kinase activity	g.chr7:2959089C>T	AF322641	CCDS5336.2	7p22	2014-09-17			ENSG00000198286	ENSG00000198286			16393	protein-coding gene	gene with protein product	"""card-maguk protein 1"", ""bcl10-interacting maguk protein 3"""	607210				11278692, 11356195	Standard	NM_032415		Approved	CARMA1, BIMP3	uc003smv.3	Q9BXL7	OTTHUMG00000023023	ENST00000396946.4:c.2427G>A	7.37:g.2959089C>T			Somatic					p.Q809Q	NM_032415	NP_115791	WXS	Illumina HiSeq	Unspecified	Q9BXL7	CAR11_HUMAN		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)	18	2831	-		Ovarian(82;0.0115)	809					A4D1Z7|Q2NKN7|Q548H3	Silent	SNP	ENST00000396946.4	37	c.2427G>A	CCDS5336.2																																																																																				0.592	CARD11-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059344.4	NM_032415		11	26	0	0	0	0.008291	0	11	26				
CLK2P1	1197	broad.mit.edu	37	7	23625371	23625371	+	IGR	SNP	C	C	G			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr7:23625371C>G								TRA2A (53711 upstream) : CCDC126 (11626 downstream)																							GCTGGGAGGCCATGTGGTGCA	0.498																																							uc003swk.2		NA																	0					0						c.(124-126)ATG>ATC		SubName: Full=cDNA FLJ61616, highly similar to Dual specificity protein kinase CLK2 (EC 2.7.12.1); SubName: Full=CDC-like kinase 2, isoform CRA_c; SubName: Full=Putative uncharacterized protein CLK2;																																				SO:0001628	intergenic_variant	1197							g.chr7:23625371C>G																													7.37:g.23625371C>G			Somatic					p.M42I	NR_002711		WXS	Illumina HiSeq	Unspecified					1	776	-									Missense_Mutation	SNP		37	c.126G>C																																																																																				0	0.498									19	60	0	0	0	0.007413	0	19	60				
AOAH	313	broad.mit.edu	37	7	36655990	36655990	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr7:36655990G>A	ENST00000258749.5	-	11	1241	c.842C>T	c.(841-843)tCt>tTt	p.S281F	AOAH_ENST00000431169.1_Missense_Mutation_p.S281F|AOAH_ENST00000535891.1_Missense_Mutation_p.S249F	NM_001637.3	NP_001628.1	P28039	AOAH_HUMAN	acyloxyacyl hydrolase (neutrophil)	281					inflammatory response (GO:0006954)|lipid metabolic process (GO:0006629)|lipopolysaccharide metabolic process (GO:0008653)|negative regulation of inflammatory response (GO:0050728)	extracellular region (GO:0005576)	acyloxyacyl hydrolase activity (GO:0050528)|catalytic activity (GO:0003824)|lipoprotein lipase activity (GO:0004465)	p.S281F(1)		NS(1)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(2)|large_intestine(3)|lung(21)|prostate(5)|skin(1)|stomach(1)|urinary_tract(3)	41						ACTTACCAAAGACATCTGCGA	0.483																																							uc003tfh.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(841-843)TCT>TTT		acyloxyacyl hydrolase precursor							76.0	65.0	69.0					7																	36655990		2203	4300	6503	SO:0001583	missense	313				inflammatory response|lipid metabolic process	extracellular region	acyloxyacyl hydrolase activity|lipoprotein lipase activity	g.chr7:36655990G>A	BC025698	CCDS5448.1, CCDS55102.1, CCDS75584.1	7p14-p12	2014-03-14			ENSG00000136250	ENSG00000136250	3.1.1.77		548	protein-coding gene	gene with protein product		102593				1883828	Standard	NM_001637		Approved		uc022abu.1	P28039	OTTHUMG00000023566	ENST00000258749.5:c.842C>T	7.37:g.36655990G>A	ENSP00000258749:p.Ser281Phe		Somatic				AOAH_uc010kxf.2_Missense_Mutation_p.S281F|AOAH_uc011kba.1_Missense_Mutation_p.S249F	p.S281F	NM_001637	NP_001628	WXS	Illumina HiSeq	Unspecified	P28039	AOAH_HUMAN			11	1243	-			281					A4D1Y5|B7Z490|Q53F13	Missense_Mutation	SNP	ENST00000258749.5	37	c.842C>T	CCDS5448.1	.	.	.	.	.	.	.	.	.	.	G	19.09	3.759544	0.69763	.	.	ENSG00000136250	ENST00000535891;ENST00000258749;ENST00000431169;ENST00000544647	T;T;T	0.15952	2.38;2.38;2.38	4.83	4.83	0.62350	Esterase, SGNH hydrolase-type (1);Lipase, GDSL (1);	0.000000	0.64402	D	0.000003	T	0.43211	0.1237	.	.	.	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.79108	0.977;0.992;0.979	T	0.41980	-0.9478	9	0.87932	D	0	.	14.9585	0.71138	0.0:0.0:1.0:0.0	.	249;281;281	B7Z490;C9J8T1;P28039	.;.;AOAH_HUMAN	F	249;281;281;281	ENSP00000441101:S249F;ENSP00000258749:S281F;ENSP00000405683:S281F	ENSP00000258749:S281F	S	-	2	0	AOAH	36622515	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	5.280000	0.65603	2.486000	0.83907	0.655000	0.94253	TCT		0.483	AOAH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000219829.2	NM_001637		5	18	0	0	0	0.000602	0	5	18				
GLI3	2737	broad.mit.edu	37	7	42088216	42088216	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr7:42088216C>A	ENST00000395925.3	-	5	637	c.553G>T	c.(553-555)Gct>Tct	p.A185S	GLI3_ENST00000479210.1_5'UTR	NM_000168.5	NP_000159.3	P10071	GLI3_HUMAN	GLI family zinc finger 3	185					anterior semicircular canal development (GO:0060873)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye morphogenesis (GO:0048593)|cell differentiation involved in kidney development (GO:0061005)|cerebral cortex radial glia guided migration (GO:0021801)|developmental growth (GO:0048589)|embryonic digestive tract development (GO:0048566)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain radial glial cell differentiation (GO:0021861)|frontal suture morphogenesis (GO:0060364)|heart development (GO:0007507)|hindgut morphogenesis (GO:0007442)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|lambdoid suture morphogenesis (GO:0060366)|lateral ganglionic eminence cell proliferation (GO:0022018)|lateral semicircular canal development (GO:0060875)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|mammary gland specification (GO:0060594)|melanocyte differentiation (GO:0030318)|metanephros development (GO:0001656)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative thymic T cell selection (GO:0045060)|nose morphogenesis (GO:0043585)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte differentiation (GO:0048709)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein processing (GO:0016485)|proximal/distal pattern formation (GO:0009954)|response to estrogen (GO:0043627)|sagittal suture morphogenesis (GO:0060367)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|smoothened signaling pathway involved in spinal cord motor neuron cell fate specification (GO:0021776)|smoothened signaling pathway involved in ventral spinal cord interneuron specification (GO:0021775)|T cell differentiation in thymus (GO:0033077)|thymocyte apoptotic process (GO:0070242)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|primary cilium (GO:0072372)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A185S(1)		NS(2)|biliary_tract(1)|breast(4)|central_nervous_system(2)|endometrium(12)|kidney(7)|large_intestine(25)|lung(49)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	112						GACTCGGAAGCAGCAGTGGGG	0.542									Pallister-Hall syndrome;Greig Cephalopolysyndactyly																														uc011kbh.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(11)|ovary(3)|large_intestine(2)|central_nervous_system(1)|kidney(1)|pancreas(1)	19						c.(553-555)GCT>TCT		GLI-Kruppel family member GLI3							129.0	133.0	132.0					7																	42088216		2203	4300	6503	SO:0001583	missense	2737	Greig_Cephalopolysyndactyly|Pallister-Hall_syndrome	Familial Cancer Database	;	negative regulation of alpha-beta T cell differentiation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of smoothened signaling pathway|negative regulation of transcription from RNA polymerase II promoter|negative thymic T cell selection|positive regulation of alpha-beta T cell differentiation|positive regulation of transcription from RNA polymerase II promoter|thymocyte apoptosis	cilium|cytosol|nucleolus	beta-catenin binding|histone acetyltransferase binding|histone deacetylase binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr7:42088216C>A		CCDS5465.1	7p13	2013-01-25	2009-03-05		ENSG00000106571	ENSG00000106571		"""Zinc fingers, C2H2-type"""	4319	protein-coding gene	gene with protein product	"""zinc finger protein GLI3"", ""oncogene GLI3"", ""DNA-binding protein"""	165240	"""Greig cephalopolysyndactyly syndrome"", ""GLI-Kruppel family member GLI3"", ""glioma-associated oncogene family zinc finger 3"""	GCPS, PHS		2118997	Standard	NM_000168		Approved	PAP-A, PAPA, PAPA1, PAPB, ACLS, PPDIV	uc011kbh.2	P10071	OTTHUMG00000023630	ENST00000395925.3:c.553G>T	7.37:g.42088216C>A	ENSP00000379258:p.Ala185Ser		Somatic				GLI3_uc011kbg.1_Missense_Mutation_p.A126S	p.A185S	NM_000168	NP_000159	WXS	Illumina HiSeq	Unspecified	P10071	GLI3_HUMAN			5	644	-			185					A4D1W1|O75219|Q17RW4|Q75MT0|Q75MU9|Q9UDT5|Q9UJ39	Missense_Mutation	SNP	ENST00000395925.3	37	c.553G>T	CCDS5465.1	.	.	.	.	.	.	.	.	.	.	C	12.42	1.931612	0.34096	.	.	ENSG00000106571	ENST00000395925	T	0.37584	1.19	5.55	3.37	0.38596	.	0.099386	0.64402	D	0.000002	T	0.21227	0.0511	N	0.19112	0.55	0.80722	D	1	B	0.24483	0.104	B	0.23275	0.045	T	0.05582	-1.0876	10	0.23302	T	0.38	.	9.7623	0.40539	0.0:0.7364:0.1327:0.1309	.	185	P10071	GLI3_HUMAN	S	185	ENSP00000379258:A185S	ENSP00000379258:A185S	A	-	1	0	GLI3	42054741	0.546000	0.26457	0.410000	0.26471	0.828000	0.46876	1.198000	0.32223	1.489000	0.48450	0.591000	0.81541	GCT		0.542	GLI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250806.3	NM_000168		32	78	1	0	1.08312e-15	0.001786	2.47694e-15	32	78				
PCLO	27445	broad.mit.edu	37	7	82585225	82585225	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr7:82585225C>A	ENST00000333891.9	-	5	5381	c.5044G>T	c.(5044-5046)Gca>Tca	p.A1682S	PCLO_ENST00000423517.2_Missense_Mutation_p.A1682S	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein									p.A1682S(2)|p.A1613S(1)		breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						GATGACTCTGCAGAATATTTA	0.403																																							uc003uhx.2		NA																	3	Substitution - Missense(3)		lung(3)	ovary(7)	7						c.(5044-5046)GCA>TCA		piccolo isoform 1							90.0	83.0	85.0					7																	82585225		1852	4092	5944	SO:0001583	missense	27445				cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity	g.chr7:82585225C>A	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.5044G>T	7.37:g.82585225C>A	ENSP00000334319:p.Ala1682Ser		Somatic				PCLO_uc003uhv.2_Missense_Mutation_p.A1682S	p.A1682S	NM_033026	NP_149015	WXS	Illumina HiSeq	Unspecified	Q9Y6V0	PCLO_HUMAN			5	5333	-			1613						Missense_Mutation	SNP	ENST00000333891.9	37	c.5044G>T	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	C	3.667	-0.068331	0.07228	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	T;T	0.15952	2.38;2.38	5.45	1.56	0.23342	.	.	.	.	.	T	0.11665	0.0284	L	0.29908	0.895	0.09310	N	0.999998	B;B	0.14012	0.005;0.009	B;B	0.15052	0.005;0.012	T	0.29671	-1.0004	9	0.87932	D	0	.	4.8209	0.13390	0.1249:0.6208:0.1206:0.1337	.	1682;1682	Q9Y6V0-5;Q9Y6V0-6	.;.	S	1613;1682;1682	ENSP00000334319:A1682S;ENSP00000388393:A1682S	ENSP00000334319:A1682S	A	-	1	0	PCLO	82423161	0.040000	0.19996	0.000000	0.03702	0.635000	0.38103	1.117000	0.31234	0.007000	0.14760	0.650000	0.86243	GCA		0.403	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510		13	53	1	0	5.50884e-06	0.001368	9.46728e-06	13	53				
SEMA3D	223117	broad.mit.edu	37	7	84697506	84697506	+	Splice_Site	SNP	C	C	G			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr7:84697506C>G	ENST00000284136.6	-	5	633		c.e5+1		SEMA3D_ENST00000444867.1_Splice_Site	NM_152754.2	NP_689967.2	O95025	SEM3D_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3D						cell differentiation (GO:0030154)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|membrane (GO:0016020)	receptor activity (GO:0004872)	p.?(1)		NS(1)|breast(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(19)|lung(29)|ovary(3)|pancreas(1)|prostate(4)|skin(2)	73						ATTGATCTTACCTGTCATTAC	0.348																																					Ovarian(63;442 1191 17318 29975 31528)	Ovarian(63;442 1191 17318 29975 31528)	uc003uic.2		NA																	1	Unknown(1)		lung(1)	ovary(3)|large_intestine(2)	5						c.e5+1		semaphorin 3D precursor							91.0	88.0	89.0					7																	84697506		2203	4300	6503	SO:0001630	splice_region_variant	223117				cell differentiation|nervous system development	extracellular region|membrane	receptor activity	g.chr7:84697506C>G	BC029590	CCDS34676.1	7q21.11	2013-01-11			ENSG00000153993	ENSG00000153993		"""Semaphorins"", ""Immunoglobulin superfamily / V-set domain containing"""	10726	protein-coding gene	gene with protein product		609907					Standard	NM_152754		Approved	coll-2, Sema-Z2	uc003uic.3	O95025	OTTHUMG00000154569	ENST00000284136.6:c.589+1G>C	7.37:g.84697506C>G			Somatic				SEMA3D_uc010led.2_Splice_Site_p.D197_splice|SEMA3D_uc010lee.1_Splice_Site_p.D197_splice	p.D197_splice	NM_152754	NP_689967	WXS	Illumina HiSeq	Unspecified	O95025	SEM3D_HUMAN			5	629	-								A6NK46|Q6UW77|Q8NCQ1	Splice_Site	SNP	ENST00000284136.6	37	c.589_splice	CCDS34676.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.676484	0.88445	.	.	ENSG00000153993	ENST00000284136;ENST00000444867	.	.	.	5.63	5.63	0.86233	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.0499	0.97621	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SEMA3D	84535442	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	7.438000	0.80431	2.798000	0.96311	0.655000	0.94253	.		0.348	SEMA3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336084.2	NM_152754	Intron	6	49	0	0	0	0.00308	0	6	49				
DYNC1I1	1780	broad.mit.edu	37	7	95499231	95499231	+	Silent	SNP	C	C	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr7:95499231C>T	ENST00000324972.6	+	6	655	c.462C>T	c.(460-462)acC>acT	p.T154T	DYNC1I1_ENST00000359388.4_Silent_p.T117T|DYNC1I1_ENST00000437599.1_Silent_p.T134T|DYNC1I1_ENST00000537881.1_Silent_p.T117T|DYNC1I1_ENST00000447467.2_Silent_p.T137T|DYNC1I1_ENST00000457059.1_Silent_p.T137T	NM_004411.4	NP_004402.1	O14576	DC1I1_HUMAN	dynein, cytoplasmic 1, intermediate chain 1	154					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|metabolic process (GO:0008152)|vesicle transport along microtubule (GO:0047496)	cytoplasmic dynein complex (GO:0005868)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|kinetochore (GO:0000776)|microtubule (GO:0005874)|perinuclear region of cytoplasm (GO:0048471)|spindle pole (GO:0000922)|vesicle (GO:0031982)	microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)|spectrin binding (GO:0030507)	p.T154T(1)		NS(2)|autonomic_ganglia(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(27)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	54	all_cancers(62;9.39e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.165)|all_lung(186;0.191)		STAD - Stomach adenocarcinoma(171;0.0957)			CAAAGGTCACCCAAGTGGATT	0.458																																							uc003uoc.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|kidney(1)	4						c.(460-462)ACC>ACT		dynein, cytoplasmic 1, intermediate chain 1							142.0	128.0	133.0					7																	95499231		2203	4300	6503	SO:0001819	synonymous_variant	1780				vesicle transport along microtubule	condensed chromosome kinetochore|cytoplasmic dynein complex|microtubule|perinuclear region of cytoplasm|spindle pole|vesicle	microtubule binding|microtubule motor activity	g.chr7:95499231C>T	AF063228	CCDS5644.1, CCDS47645.1, CCDS47646.1, CCDS64718.1	7q21.3-q22.1	2013-01-18	2005-11-24	2005-11-24	ENSG00000158560	ENSG00000158560		"""Cytoplasmic dyneins"", ""WD repeat domain containing"""	2963	protein-coding gene	gene with protein product		603772	"""dynein, cytoplasmic, intermediate polypeptide 1"""	DNCI1		10049579, 16260502	Standard	NM_004411		Approved	DNCIC1	uc003uoc.4	O14576	OTTHUMG00000153983	ENST00000324972.6:c.462C>T	7.37:g.95499231C>T			Somatic				DYNC1I1_uc003uod.3_Silent_p.T137T|DYNC1I1_uc003uob.2_Silent_p.T117T|DYNC1I1_uc003uoe.3_Silent_p.T134T|DYNC1I1_uc010lfl.2_Silent_p.T143T	p.T154T	NM_004411	NP_004402	WXS	Illumina HiSeq	Unspecified	O14576	DC1I1_HUMAN	STAD - Stomach adenocarcinoma(171;0.0957)		6	739	+	all_cancers(62;9.39e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.165)|all_lung(186;0.191)		154					B4DME3|F5H050|G5E9K1|Q8TBF7|Q9Y2X1	Silent	SNP	ENST00000324972.6	37	c.462C>T	CCDS5644.1																																																																																				0.458	DYNC1I1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333432.1	NM_004411		28	92	0	0	0	0.007291	0	28	92				
MUC17	140453	broad.mit.edu	37	7	100680280	100680280	+	Silent	SNP	G	G	T	rs141016213	byFrequency	TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr7:100680280G>T	ENST00000306151.4	+	3	5647	c.5583G>T	c.(5581-5583)acG>acT	p.T1861T		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	1861	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)	p.T1861T(1)		NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CAACCTCAACGCCTAGTGAAG	0.483													-|||	435	0.086861	0.0764	0.0101	5008	,	,		24208	0.1657		0.003	False		,,,				2504	0.1605						uc003uxp.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(14)|skin(8)|breast(3)|lung(2)	27						c.(5581-5583)ACG>ACT		mucin 17 precursor		T		14,4392		3,8,2192	222.0	231.0	228.0		5583	-1.6	0.0	7	dbSNP_134	228	1,8599		0,1,4299	no	coding-synonymous	MUC17	NM_001040105.1		3,9,6491	TT,TG,GG		0.0116,0.3177,0.1153		1861/4494	100680280	15,12991	2203	4300	6503	SO:0001819	synonymous_variant	140453					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity	g.chr7:100680280G>T	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.5583G>T	7.37:g.100680280G>T			Somatic				MUC17_uc010lho.1_RNA	p.T1861T	NM_001040105	NP_001035194	WXS	Illumina HiSeq	Unspecified	Q685J3	MUC17_HUMAN			3	5636	+	Lung NSC(181;0.136)|all_lung(186;0.182)		1861			Extracellular (Potential).|Ser-rich.|29.|59 X approximate tandem repeats.		O14761|Q685J2|Q8TDH7	Silent	SNP	ENST00000306151.4	37	c.5583G>T	CCDS34711.1																																																																																				0.483	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105		69	282	1	0	5.22007e-41	0.00361	1.42682e-40	69	282				
ZNHIT1	10467	broad.mit.edu	37	7	100866000	100866000	+	Silent	SNP	G	G	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr7:100866000G>T	ENST00000305105.2	+	2	666	c.138G>T	c.(136-138)gcG>gcT	p.A46A	ZNHIT1_ENST00000492315.1_3'UTR	NM_006349.2	NP_006340.1	O43257	ZNHI1_HUMAN	zinc finger, HIT-type containing 1	46					negative regulation of G0 to G1 transition (GO:0070317)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of histone deacetylation (GO:0031063)|regulation of T cell proliferation (GO:0042129)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)	p.A46A(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(2)	11	Lung NSC(181;0.168)|all_lung(186;0.215)					ACCCCCACGCGGGACTCCCTC	0.667																																							uc003uye.2		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(1)	1						c.(136-138)GCG>GCT		zinc finger, HIT domain containing 1							56.0	54.0	55.0					7																	100866000		2203	4300	6503	SO:0001819	synonymous_variant	10467						metal ion binding|protein binding	g.chr7:100866000G>T	AF093571	CCDS5716.1	7q22.1	2010-09-15	2010-09-15	2003-08-08	ENSG00000106400	ENSG00000106400		"""Zinc fingers, HIT-type"""	21688	protein-coding gene	gene with protein product	"""putative cyclin G1 interacting protein"""		"""zinc finger protein, subfamily 4A (HIT domain containing), member 1"", ""zinc finger, HIT domain containing 1"""	ZNFN4A1			Standard	NM_006349		Approved	CG1I, H_DJ0747G18.14	uc003uye.3	O43257	OTTHUMG00000157113	ENST00000305105.2:c.138G>T	7.37:g.100866000G>T			Somatic				ZNHIT1_uc003uyf.2_RNA	p.A46A	NM_006349	NP_006340	WXS	Illumina HiSeq	Unspecified	O43257	ZNHI1_HUMAN			2	630	+	Lung NSC(181;0.168)|all_lung(186;0.215)		46					Q6IB12	Silent	SNP	ENST00000305105.2	37	c.138G>T	CCDS5716.1																																																																																				0.667	ZNHIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347488.1	NM_006349		11	40	1	0	9.70103e-10	0.008291	1.88759e-09	11	40				
PIK3CG	5294	broad.mit.edu	37	7	106513371	106513371	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr7:106513371G>A	ENST00000359195.3	+	4	2585	c.2275G>A	c.(2275-2277)Gtc>Atc	p.V759I	PIK3CG_ENST00000496166.1_Missense_Mutation_p.V759I|PIK3CG_ENST00000440650.2_Missense_Mutation_p.V759I	NM_001282427.1|NM_002649.2	NP_001269356.1|NP_002640.2	P48736	PK3CG_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit gamma	759					adaptive immune response (GO:0002250)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cytokine production (GO:0001816)|dendritic cell chemotaxis (GO:0002407)|endocytosis (GO:0006897)|G-protein coupled receptor signaling pathway (GO:0007186)|hepatocyte apoptotic process (GO:0097284)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|mast cell degranulation (GO:0043303)|natural killer cell chemotaxis (GO:0035747)|negative regulation of cardiac muscle contraction (GO:0055118)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of triglyceride catabolic process (GO:0010897)|neutrophil chemotaxis (GO:0030593)|neutrophil extravasation (GO:0072672)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of cell adhesion mediated by integrin (GO:0033628)|respiratory burst involved in defense response (GO:0002679)|secretory granule localization (GO:0032252)|small molecule metabolic process (GO:0044281)|T cell activation (GO:0042110)|T cell chemotaxis (GO:0010818)|T cell proliferation (GO:0042098)	1-phosphatidylinositol-4-phosphate 3-kinase, class IB complex (GO:0005944)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mast cell granule (GO:0042629)|membrane (GO:0016020)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|ephrin receptor binding (GO:0046875)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.V759I(1)		breast(7)|central_nervous_system(9)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(16)|liver(4)|lung(59)|ovary(4)|pancreas(4)|prostate(3)|skin(6)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	132						AAAGTATGACGTCAGTTCCCA	0.408																																							uc003vdv.3		NA																	1	Substitution - Missense(1)		lung(1)	lung(16)|central_nervous_system(8)|breast(5)|pancreas(3)|stomach(2)|ovary(2)|upper_aerodigestive_tract(1)|skin(1)	38						c.(2275-2277)GTC>ATC		phosphoinositide-3-kinase, catalytic, gamma							94.0	91.0	92.0					7																	106513371		2203	4300	6503	SO:0001583	missense	5294				G-protein coupled receptor protein signaling pathway|phosphatidylinositol-mediated signaling|platelet activation	phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity|protein binding	g.chr7:106513371G>A		CCDS5739.1	7q22	2012-07-13	2012-07-13		ENSG00000105851	ENSG00000105851	2.7.1.153		8978	protein-coding gene	gene with protein product		601232	"""phosphoinositide-3-kinase, catalytic, gamma polypeptide"""				Standard	XM_005250443		Approved		uc003vdw.3	P48736	OTTHUMG00000157641	ENST00000359195.3:c.2275G>A	7.37:g.106513371G>A	ENSP00000352121:p.Val759Ile		Somatic				PIK3CG_uc003vdu.2_Missense_Mutation_p.V759I|PIK3CG_uc003vdw.2_Missense_Mutation_p.V759I	p.V759I	NM_002649	NP_002640	WXS	Illumina HiSeq	Unspecified	P48736	PK3CG_HUMAN			4	2360	+			759					A4D0Q6|Q8IV23|Q9BZC8	Missense_Mutation	SNP	ENST00000359195.3	37	c.2275G>A	CCDS5739.1	.	.	.	.	.	.	.	.	.	.	G	13.33	2.205478	0.39003	.	.	ENSG00000105851	ENST00000440650;ENST00000496166;ENST00000473541;ENST00000359195	T;T;T;T	0.80824	-1.42;-1.42;-1.42;-1.42	5.92	5.92	0.95590	Protein kinase-like domain (1);	6.795300	0.00748	N	0.001053	T	0.77745	0.4176	N	0.20685	0.6	0.46823	D	0.999214	B	0.12630	0.006	B	0.09377	0.004	T	0.31833	-0.9929	10	0.37606	T	0.19	-42.9428	20.3206	0.98668	0.0:0.0:1.0:0.0	.	759	P48736	PK3CG_HUMAN	I	759;759;32;759	ENSP00000392258:V759I;ENSP00000419260:V759I;ENSP00000417623:V32I;ENSP00000352121:V759I	ENSP00000352121:V759I	V	+	1	0	PIK3CG	106300607	1.000000	0.71417	0.987000	0.45799	0.635000	0.38103	5.636000	0.67848	2.809000	0.96659	0.655000	0.94253	GTC		0.408	PIK3CG-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349294.1			13	47	0	0	0	0.001855	0	13	47				
CLCN1	1180	broad.mit.edu	37	7	143043264	143043264	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr7:143043264C>A	ENST00000343257.2	+	18	2291	c.2204C>A	c.(2203-2205)aCt>aAt	p.T735N		NM_000083.2	NP_000074	P35523	CLCN1_HUMAN	chloride channel, voltage-sensitive 1	735					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|neuronal action potential propagation (GO:0019227)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	adenyl nucleotide binding (GO:0030554)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)	p.T735N(1)		breast(4)|central_nervous_system(1)|endometrium(1)|large_intestine(11)|lung(26)|ovary(3)|prostate(2)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	58	Melanoma(164;0.205)					CACCCCTCTACTACTGCCCCT	0.592																																							uc003wcr.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5						c.(2203-2205)ACT>AAT		chloride channel 1, skeletal muscle							97.0	92.0	94.0					7																	143043264		2203	4300	6503	SO:0001583	missense	1180				muscle contraction	chloride channel complex|integral to plasma membrane	voltage-gated chloride channel activity	g.chr7:143043264C>A	Z25884	CCDS5881.1	7q12	2012-09-26	2012-02-23		ENSG00000188037	ENSG00000188037		"""Ion channels / Chloride channels : Voltage-sensitive"""	2019	protein-coding gene	gene with protein product	"""Thomsen disease, autosomal dominant"""	118425	"""chloride channel 1, skeletal muscle"""			1379744	Standard	NM_000083		Approved	CLC1, ClC-1	uc003wcr.1	P35523	OTTHUMG00000152695	ENST00000343257.2:c.2204C>A	7.37:g.143043264C>A	ENSP00000339867:p.Thr735Asn		Somatic				CLCN1_uc011ktc.1_Missense_Mutation_p.T347N	p.T735N	NM_000083	NP_000074	WXS	Illumina HiSeq	Unspecified	P35523	CLCN1_HUMAN			18	2291	+	Melanoma(164;0.205)		735			Cytoplasmic (By similarity).		A4D2H5|Q2M202	Missense_Mutation	SNP	ENST00000343257.2	37	c.2204C>A	CCDS5881.1	.	.	.	.	.	.	.	.	.	.	C	0.031	-1.331829	0.01298	.	.	ENSG00000188037	ENST00000343257	D	0.84442	-1.85	3.81	2.82	0.32997	.	.	.	.	.	T	0.70789	0.3264	N	0.14661	0.345	0.09310	N	1	B	0.15930	0.015	B	0.15870	0.014	T	0.54814	-0.8237	9	0.17369	T	0.5	.	9.5844	0.39508	0.0:0.8789:0.0:0.1211	.	735	P35523	CLCN1_HUMAN	N	735	ENSP00000339867:T735N	ENSP00000339867:T735N	T	+	2	0	CLCN1	142753386	0.004000	0.15560	0.005000	0.12908	0.007000	0.05969	1.788000	0.38714	1.979000	0.57680	0.561000	0.74099	ACT		0.592	CLCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327420.1	NM_000083		12	33	1	0	0.00136819	0.001368	0.00211683	12	33				
PTPRN2	5799	broad.mit.edu	37	7	157926489	157926490	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr7:157926489_157926490CC>AA	ENST00000389418.4	-	9	1444_1445	c.1435_1436GG>TT	c.(1435-1437)GGg>TTg	p.G479L	PTPRN2_ENST00000404321.2_Missense_Mutation_p.G502L|PTPRN2_ENST00000389413.3_Missense_Mutation_p.G479L|PTPRN2_ENST00000389416.4_Missense_Mutation_p.G462L|PTPRN2_ENST00000409483.1_Missense_Mutation_p.G441L	NM_002847.3	NP_002838.2	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N polypeptide 2	479					negative regulation of GTPase activity (GO:0034260)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	endoplasmic reticulum lumen (GO:0005788)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)|secretory granule (GO:0030141)|terminal bouton (GO:0043195)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.G479L(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(1)|lung(42)|ovary(4)|pleura(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	86	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		CTTCGAGGGCCCAGGCATCTGG	0.653																																							uc003wno.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7						c.(1435-1437)GGG>TTG		protein tyrosine phosphatase, receptor type, N																																				SO:0001583	missense	5799					integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity	g.chr7:157926489_157926490CC>AA	AB002385	CCDS5947.1, CCDS5948.1, CCDS5949.1	7q36	2011-06-09			ENSG00000155093	ENSG00000155093		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9677	protein-coding gene	gene with protein product	"""IAR PTPRP"""	601698				8954911, 9220540	Standard	NM_130842		Approved	KIAA0387, phogrin, ICAAR, IA-2beta	uc003wno.3	Q92932	OTTHUMG00000152646	ENST00000389418.4:c.1435_1436delinsAA	7.37:g.157926489_157926490delinsAA	ENSP00000374069:p.Gly479Leu		Somatic				PTPRN2_uc003wnp.2_Missense_Mutation_p.G462L|PTPRN2_uc003wnq.2_Missense_Mutation_p.G479L|PTPRN2_uc003wnr.2_Missense_Mutation_p.G441L|PTPRN2_uc011kwa.1_Missense_Mutation_p.G502L	p.G479L	NM_002847	NP_002838	WXS	Illumina HiSeq	Unspecified	Q92932	PTPR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)	9	1556_1557	-	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	479			Extracellular (Potential).		E9PC57|Q8N4I5|Q92662|Q9Y4F8|Q9Y4I6	Missense_Mutation	DNP	ENST00000389418.4	37	c.1435_1436GG>TT	CCDS5947.1																																																																																				0.653	PTPRN2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000353214.1			14	54	0	0	0	0.004672	0	14	54				
ADAM32	203102	broad.mit.edu	37	8	39009054	39009054	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr8:39009054T>C	ENST00000379907.4	+	6	639	c.512T>C	c.(511-513)tTt>tCt	p.F171S	ADAM32_ENST00000519315.1_Missense_Mutation_p.F171S|ADAM32_ENST00000437682.2_Missense_Mutation_p.F178S	NM_145004.5	NP_659441	Q8TC27	ADA32_HUMAN	ADAM metallopeptidase domain 32	171						integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.F171S(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|skin(2)	31		all_cancers(7;3e-05)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00771)|Breast(189;0.0503)	LUSC - Lung squamous cell carcinoma(45;6.2e-07)|Colorectal(1;0.00699)|READ - Rectum adenocarcinoma(1;0.146)			GACAACATTTTTATAAGTGAA	0.254																																							uc003xmt.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|lung(1)|kidney(1)	3						c.(511-513)TTT>TCT		a disintegrin and metalloprotease domain 32							53.0	51.0	51.0					8																	39009054		1795	4051	5846	SO:0001583	missense	203102				proteolysis	integral to membrane	metalloendopeptidase activity|zinc ion binding	g.chr8:39009054T>C	BC026085	CCDS47846.1	8p11.22	2005-08-18	2005-08-18		ENSG00000197140	ENSG00000197140		"""ADAM metallopeptidase domain containing"""	15479	protein-coding gene	gene with protein product			"""a disintegrin and metalloproteinase domain 32"""			12568724	Standard	NM_145004		Approved		uc003xmt.4	Q8TC27	OTTHUMG00000164071	ENST00000379907.4:c.512T>C	8.37:g.39009054T>C	ENSP00000369238:p.Phe171Ser		Somatic				ADAM32_uc011lch.1_Missense_Mutation_p.F178S|ADAM32_uc003xmu.3_Missense_Mutation_p.F171S	p.F171S	NM_145004	NP_659441	WXS	Illumina HiSeq	Unspecified	Q8TC27	ADA32_HUMAN	LUSC - Lung squamous cell carcinoma(45;6.2e-07)|Colorectal(1;0.00699)|READ - Rectum adenocarcinoma(1;0.146)		6	757	+		all_cancers(7;3e-05)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00771)|Breast(189;0.0503)	171					Q8TC42	Missense_Mutation	SNP	ENST00000379907.4	37	c.512T>C	CCDS47846.1	.	.	.	.	.	.	.	.	.	.	T	3.411	-0.120292	0.06838	.	.	ENSG00000197140	ENST00000399831;ENST00000437682;ENST00000519315;ENST00000379907;ENST00000522506;ENST00000399826	T;T;T;T;T	0.20881	2.74;4.09;4.14;4.47;2.04	5.12	2.64	0.31445	.	1.139460	0.06903	N	0.806388	T	0.10035	0.0246	N	0.08118	0	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.002;0.001;0.002	T	0.39800	-0.9596	10	0.09843	T	0.71	.	6.2564	0.20876	0.153:0.0866:0.0:0.7603	.	178;171;171	E7EPX8;E7ER82;Q8TC27	.;.;ADA32_HUMAN	S	130;178;171;171;171;172	ENSP00000382727:F130S;ENSP00000405978:F178S;ENSP00000429422:F171S;ENSP00000369238:F171S;ENSP00000429066:F171S	ENSP00000369238:F171S	F	+	2	0	ADAM32	39128211	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	0.125000	0.15749	0.018000	0.15052	-1.773000	0.00660	TTT		0.254	ADAM32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377089.1	NM_145004		20	61	0	0	0	0.001523	0	20	61				
PXDNL	137902	broad.mit.edu	37	8	52232511	52232511	+	Silent	SNP	T	T	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr8:52232511T>A	ENST00000356297.4	-	23	4432	c.4332A>T	c.(4330-4332)ggA>ggT	p.G1444G	PXDNL_ENST00000543296.1_3'UTR|RP11-401H2.1_ENST00000521294.1_RNA	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	1444	VWFC. {ECO:0000255|PROSITE- ProRule:PRU00220}.				hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)	p.G1444G(1)		NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				GACAGCAGGTTCCTTTCACCA	0.517																																							uc003xqu.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(4330-4332)GGA>GGT		peroxidasin homolog-like precursor							51.0	52.0	52.0					8																	52232511		1897	4109	6006	SO:0001819	synonymous_variant	137902				hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity	g.chr8:52232511T>A		CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.4332A>T	8.37:g.52232511T>A			Somatic				PXDNL_uc003xqt.3_RNA	p.G1444G	NM_144651	NP_653252	WXS	Illumina HiSeq	Unspecified	A1KZ92	PXDNL_HUMAN			23	4433	-		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)	1444			VWFC.		B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Silent	SNP	ENST00000356297.4	37	c.4332A>T	CCDS47855.1	.	.	.	.	.	.	.	.	.	.	T	4.783	0.145635	0.09134	.	.	ENSG00000147485	ENST00000522933	.	.	.	4.51	0.36	0.16097	.	.	.	.	.	T	0.23171	0.0560	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.24512	-1.0158	4	.	.	.	.	3.5746	0.07930	0.3365:0.0994:0.0:0.5641	.	.	.	.	V	518	.	.	E	-	2	0	PXDNL	52395064	0.108000	0.22018	0.000000	0.03702	0.002000	0.02628	1.097000	0.30988	-0.208000	0.10171	0.533000	0.62120	GAA		0.517	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377905.1	NM_144651		4	24	0	0	0	0.000602	0	4	24				
ARMC1	55156	broad.mit.edu	37	8	66539450	66539450	+	Splice_Site	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr8:66539450C>A	ENST00000276569.3	-	2	428		c.e2+1		ARMC1_ENST00000458464.2_Splice_Site|ARMC1_ENST00000523384.1_Splice_Site	NM_018120.4	NP_060590.1	Q9NVT9	ARMC1_HUMAN	armadillo repeat containing 1						metal ion transport (GO:0030001)	mitochondrion (GO:0005739)	metal ion binding (GO:0046872)	p.?(1)		cervix(1)|endometrium(3)|large_intestine(1)|lung(8)|skin(1)	14			Epithelial(68;0.103)|OV - Ovarian serous cystadenocarcinoma(28;0.235)			AGGCAACTTACAAGCAAAGCG	0.418																																							uc003xvl.2		NA																	1	Unknown(1)		lung(1)	skin(1)	1						c.e2+1		armadillo repeat-containing protein							91.0	93.0	93.0					8																	66539450		2203	4300	6503	SO:0001630	splice_region_variant	55156				metal ion transport		metal ion binding	g.chr8:66539450C>A	BC011607	CCDS6181.1, CCDS69490.1	8q12.3	2013-02-14			ENSG00000104442	ENSG00000104442		"""Armadillo repeat containing"""	17684	protein-coding gene	gene with protein product							Standard	XM_005251264		Approved	FLJ10511, Arcp	uc003xvl.3	Q9NVT9	OTTHUMG00000164374	ENST00000276569.3:c.183+1G>T	8.37:g.66539450C>A			Somatic				ARMC1_uc011leo.1_Splice_Site_p.C23_splice	p.L61_splice	NM_018120	NP_060590	WXS	Illumina HiSeq	Unspecified	Q9NVT9	ARMC1_HUMAN	Epithelial(68;0.103)|OV - Ovarian serous cystadenocarcinoma(28;0.235)		2	418	-								B4E2W7|Q9H018|Q9H820	Splice_Site	SNP	ENST00000276569.3	37	c.183_splice	CCDS6181.1	.	.	.	.	.	.	.	.	.	.	C	16.19	3.052016	0.55218	.	.	ENSG00000104442	ENST00000276569;ENST00000458464;ENST00000518908;ENST00000519352	.	.	.	5.59	5.59	0.84812	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.5833	0.95478	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ARMC1	66702004	1.000000	0.71417	0.969000	0.41365	0.415000	0.31203	7.474000	0.81024	2.612000	0.88384	0.655000	0.94253	.		0.418	ARMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378480.1	NM_018120	Intron	24	89	1	0	5.35356e-11	0.00278	1.07446e-10	24	89				
MMP16	4325	broad.mit.edu	37	8	89053741	89053741	+	Missense_Mutation	SNP	C	C	A	rs577048107		TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr8:89053741C>A	ENST00000286614.6	-	10	2053	c.1772G>T	c.(1771-1773)gGa>gTa	p.G591V		NM_005941.4	NP_005932.2	P51512	MMP16_HUMAN	matrix metallopeptidase 16 (membrane-inserted)	591					chondrocyte proliferation (GO:0035988)|collagen catabolic process (GO:0030574)|craniofacial suture morphogenesis (GO:0097094)|embryonic cranial skeleton morphogenesis (GO:0048701)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of catalytic activity (GO:0043085)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|enzyme activator activity (GO:0008047)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.G591V(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|liver(1)|lung(51)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	81					Marimastat(DB00786)	GCGGGGTGTTCCTTTCCTCTT	0.448																																							uc003yeb.3		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(2)|ovary(2)|central_nervous_system(1)|urinary_tract(1)|skin(1)|kidney(1)	8						c.(1771-1773)GGA>GTA		matrix metalloproteinase 16 isoform 1							122.0	115.0	118.0					8																	89053741		2203	4300	6503	SO:0001583	missense	4325				collagen catabolic process|proteolysis	cell surface|integral to plasma membrane|proteinaceous extracellular matrix	calcium ion binding|enzyme activator activity|metalloendopeptidase activity|zinc ion binding	g.chr8:89053741C>A	D85511	CCDS6246.1	8q21	2009-01-09	2005-08-08		ENSG00000156103	ENSG00000156103			7162	protein-coding gene	gene with protein product		602262	"""matrix metalloproteinase 16 (membrane-inserted)"", ""chromosome 8 open reading frame 57"""	C8orf57		7559440	Standard	NM_005941		Approved	MT3-MMP, DKFZp761D112	uc003yeb.4	P51512	OTTHUMG00000163769	ENST00000286614.6:c.1772G>T	8.37:g.89053741C>A	ENSP00000286614:p.Gly591Val		Somatic					p.G591V	NM_005941	NP_005932	WXS	Illumina HiSeq	Unspecified	P51512	MMP16_HUMAN			10	2054	-			591			Cytoplasmic (Potential).		B2RAN7|Q14824|Q52H48	Missense_Mutation	SNP	ENST00000286614.6	37	c.1772G>T	CCDS6246.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.974831	0.74360	.	.	ENSG00000156103	ENST00000286614	T	0.51071	0.72	5.62	5.62	0.85841	Peptidase M10A, matrix metallopeptidase, C-terminal (1);	0.159687	0.56097	D	0.000036	T	0.67822	0.2934	L	0.61036	1.89	0.80722	D	1	D	0.58620	0.983	D	0.68483	0.958	T	0.69273	-0.5188	10	0.87932	D	0	.	19.6577	0.95849	0.0:1.0:0.0:0.0	.	591	P51512	MMP16_HUMAN	V	591	ENSP00000286614:G591V	ENSP00000286614:G591V	G	-	2	0	MMP16	89122857	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.533000	0.67160	2.638000	0.89438	0.591000	0.81541	GGA		0.448	MMP16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375304.2	NM_005941		30	117	1	0	8.4185e-14	0.002445	1.80307e-13	30	117				
RUNX1T1	862	broad.mit.edu	37	8	92988184	92988184	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr8:92988184G>T	ENST00000523629.1	-	10	1751	c.1297C>A	c.(1297-1299)Ctt>Att	p.L433I	RUNX1T1_ENST00000396218.1_Missense_Mutation_p.L406I|RUNX1T1_ENST00000360348.2_Missense_Mutation_p.L396I|GS1-5L10.1_ENST00000522980.1_RNA|RUNX1T1_ENST00000520724.1_Missense_Mutation_p.L396I|RUNX1T1_ENST00000436581.2_Missense_Mutation_p.L444I|RUNX1T1_ENST00000265814.3_Missense_Mutation_p.L433I|RUNX1T1_ENST00000518844.1_Missense_Mutation_p.L406I|RUNX1T1_ENST00000422361.2_Missense_Mutation_p.L396I	NM_001198626.1|NM_001198630.1|NM_001198633.1|NM_175634.2	NP_001185555.1|NP_001185559.1|NP_001185562.1|NP_783552.1	Q06455	MTG8_HUMAN	runt-related transcription factor 1; translocated to, 1 (cyclin D-related)	433					fat cell differentiation (GO:0045444)|generation of precursor metabolites and energy (GO:0006091)|regulation of DNA binding (GO:0051101)|transcription, DNA-templated (GO:0006351)	nuclear matrix (GO:0016363)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L444I(1)|p.L433I(1)|p.L396I(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(54)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	86			BRCA - Breast invasive adenocarcinoma(11;0.0141)			GGCCTGTGAAGGAATTCCCGA	0.493																																							uc003yfd.2		NA																	3	Substitution - Missense(3)		lung(3)	lung(9)|large_intestine(3)|breast(2)|central_nervous_system(1)|pancreas(1)	16						c.(1297-1299)CTT>ATT		acute myelogenous leukemia 1 translocation 1							111.0	112.0	111.0					8																	92988184		2203	4300	6503	SO:0001583	missense	862				generation of precursor metabolites and energy	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:92988184G>T	D43638	CCDS6256.1, CCDS6257.1, CCDS47891.1, CCDS56544.1, CCDS75766.1, CCDS75767.1	8q22	2007-01-29	2005-01-20	2005-01-22	ENSG00000079102	ENSG00000079102		"""Zinc fingers, MYND-type"""	1535	protein-coding gene	gene with protein product		133435	"""core-binding factor, runt domain, alpha subunit 2; translocated to, 1; cyclin D-related"""	AML1T1, CBFA2T1		1391946, 9790752	Standard	NM_004349		Approved	CDR, ETO, MTG8, ZMYND2	uc011lgi.2	Q06455	OTTHUMG00000164066	ENST00000523629.1:c.1297C>A	8.37:g.92988184G>T	ENSP00000428543:p.Leu433Ile		Somatic				RUNX1T1_uc003yfc.1_Missense_Mutation_p.L406I|RUNX1T1_uc003yfe.1_Missense_Mutation_p.L396I|RUNX1T1_uc010mao.2_Missense_Mutation_p.L406I|RUNX1T1_uc011lgi.1_Missense_Mutation_p.L444I|RUNX1T1_uc010man.1_Missense_Mutation_p.L58I|RUNX1T1_uc003yfb.1_Missense_Mutation_p.L396I	p.L433I	NM_175634	NP_783552	WXS	Illumina HiSeq	Unspecified	Q06455	MTG8_HUMAN	BRCA - Breast invasive adenocarcinoma(11;0.0141)		9	1381	-			433					B7Z4P4|E7EPN4|O14784|Q06456|Q14873|Q16239|Q16346|Q16347|Q6IBL1|Q6NXH1|Q7Z4J5|Q92479|Q9BRZ0	Missense_Mutation	SNP	ENST00000523629.1	37	c.1297C>A	CCDS6256.1	.	.	.	.	.	.	.	.	.	.	G	15.38	2.816349	0.50527	.	.	ENSG00000079102	ENST00000523629;ENST00000396218;ENST00000265814;ENST00000360348;ENST00000422361;ENST00000520724;ENST00000436581;ENST00000518844	T;T;T;T;T;T;T;T	0.34072	1.39;1.4;1.39;1.4;1.4;1.4;1.38;1.4	5.71	4.8	0.61643	.	0.000000	0.85682	D	0.000000	T	0.38746	0.1052	L	0.51422	1.61	0.53688	D	0.999977	B;B;P;B	0.39376	0.071;0.128;0.67;0.202	B;B;B;B	0.41860	0.04;0.062;0.368;0.187	T	0.13764	-1.0497	10	0.35671	T	0.21	-12.0845	16.8013	0.85615	0.0:0.1282:0.8718:0.0	.	444;396;433;406	E7EPN4;Q7Z4J5;Q06455;Q06455-2	.;.;MTG8_HUMAN;.	I	433;406;433;396;396;396;444;406	ENSP00000428543:L433I;ENSP00000379520:L406I;ENSP00000265814:L433I;ENSP00000353504:L396I;ENSP00000390137:L396I;ENSP00000428742:L396I;ENSP00000402257:L444I;ENSP00000430728:L406I	ENSP00000265814:L433I	L	-	1	0	RUNX1T1	93057360	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.886000	0.87288	2.687000	0.91594	0.655000	0.94253	CTT		0.493	RUNX1T1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377045.3	NM_004349, NM_175635		41	153	1	0	5.78141e-17	0.003214	1.36565e-16	41	153				
RGS22	26166	broad.mit.edu	37	8	101011627	101011627	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr8:101011627A>G	ENST00000360863.6	-	19	3006	c.2812T>C	c.(2812-2814)Tgg>Cgg	p.W938R	RGS22_ENST00000523287.1_Missense_Mutation_p.W757R|RGS22_ENST00000523437.1_Missense_Mutation_p.W926R|RGS22_ENST00000519421.1_5'Flank	NM_015668.3	NP_056483.3	Q8NE09	RGS22_HUMAN	regulator of G-protein signaling 22	938	RGS 1. {ECO:0000255|PROSITE- ProRule:PRU00171}.				positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)	p.W938R(2)	RGS22/SYCP1(2)	breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(33)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	68			Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)			ATCTTCCCCCAGCCACCACTT	0.363																																							uc003yjb.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|skin(2)|breast(1)|central_nervous_system(1)	7						c.(2812-2814)TGG>CGG		regulator of G-protein signaling 22							86.0	78.0	80.0					8																	101011627		1842	4123	5965	SO:0001583	missense	26166				negative regulation of signal transduction	cytoplasm|plasma membrane	GTPase activator activity|signal transducer activity	g.chr8:101011627A>G	AY009106	CCDS43758.1, CCDS69521.1, CCDS75775.1	8q22.2	2014-01-21	2007-08-14		ENSG00000132554	ENSG00000132554		"""Regulators of G-protein signaling"""	24499	protein-coding gene	gene with protein product		615650	"""regulator of G-protein signalling 22"""				Standard	XM_005250856		Approved	DKFZP434I092, PRTD-NY2, CT145	uc003yjb.1	Q8NE09	OTTHUMG00000164802	ENST00000360863.6:c.2812T>C	8.37:g.101011627A>G	ENSP00000354109:p.Trp938Arg		Somatic				RGS22_uc003yja.1_Missense_Mutation_p.W757R|RGS22_uc003yjc.1_Missense_Mutation_p.W926R	p.W938R	NM_015668	NP_056483	WXS	Illumina HiSeq	Unspecified	Q8NE09	RGS22_HUMAN	Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)		19	3007	-			938			RGS 1.		A8K944|Q569L2|Q86Y71|Q9BYZ4|Q9UFN6	Missense_Mutation	SNP	ENST00000360863.6	37	c.2812T>C	CCDS43758.1	.	.	.	.	.	.	.	.	.	.	A	17.23	3.336423	0.60963	.	.	ENSG00000132554	ENST00000360863;ENST00000427793;ENST00000523287;ENST00000523437;ENST00000517828	T;T;T;T	0.54479	2.17;2.17;2.17;0.57	4.6	4.6	0.57074	Regulator of G protein signalling (3);Regulator of G protein signalling superfamily (1);	0.091635	0.47455	D	0.000238	T	0.67449	0.2894	M	0.72118	2.19	0.33076	D	0.536041	P;P;D	0.71674	0.863;0.863;0.998	P;P;D	0.71656	0.496;0.496;0.974	T	0.75673	-0.3236	10	0.42905	T	0.14	.	10.5094	0.44853	0.8552:0.0:0.0:0.1448	.	926;938;757	A8K944;Q8NE09;G3V112	.;RGS22_HUMAN;.	R	938;925;757;926;253	ENSP00000354109:W938R;ENSP00000429382:W757R;ENSP00000428212:W926R;ENSP00000427754:W253R	ENSP00000354109:W938R	W	-	1	0	RGS22	101080803	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.014000	0.64029	1.696000	0.51158	0.533000	0.62120	TGG		0.363	RGS22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000380365.1	NM_015668		17	57	0	0	0	0.00499	0	17	57				
RGS22	26166	broad.mit.edu	37	8	101065029	101065030	+	Splice_Site	DNP	CC	CC	AA			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr8:101065029_101065030CC>AA	ENST00000360863.6	-	10	1883_1884	c.1689_1690GG>TT	c.(1687-1692)caGGaa>caTTaa	p.563_564QE>H*	RGS22_ENST00000523287.1_Splice_Site_p.382_383QE>H*|RGS22_ENST00000523437.1_Splice_Site_p.551_552QE>H*	NM_015668.3	NP_056483.3	Q8NE09	RGS22_HUMAN	regulator of G-protein signaling 22	563					positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)	p.?(2)	RGS22/SYCP1(2)	breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(33)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	68			Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)			GTACACCCTACCTGGATCTCAG	0.396																																							uc003yjb.1		NA																	2	Unknown(2)		lung(2)	ovary(3)|skin(2)|breast(1)|central_nervous_system(1)	7						c.e10+1		regulator of G-protein signaling 22																																				SO:0001630	splice_region_variant	26166				negative regulation of signal transduction	cytoplasm|plasma membrane	GTPase activator activity|signal transducer activity	g.chr8:101065029_101065030CC>AA	AY009106	CCDS43758.1, CCDS69521.1, CCDS75775.1	8q22.2	2014-01-21	2007-08-14		ENSG00000132554	ENSG00000132554		"""Regulators of G-protein signaling"""	24499	protein-coding gene	gene with protein product		615650	"""regulator of G-protein signalling 22"""				Standard	XM_005250856		Approved	DKFZP434I092, PRTD-NY2, CT145	uc003yjb.1	Q8NE09	OTTHUMG00000164802	ENST00000360863.6:c.1689_1690delinsAA	8.37:g.101065029_101065030delinsAA			Somatic				RGS22_uc003yja.1_Splice_Site_p.Q382_splice|RGS22_uc003yjc.1_Splice_Site_p.Q551_splice|RGS22_uc011lgz.1_Splice_Site|RGS22_uc010mbo.1_Splice_Site	p.Q563_splice	NM_015668	NP_056483	WXS	Illumina HiSeq	Unspecified	Q8NE09	RGS22_HUMAN	Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)		10	1884	-								A8K944|Q569L2|Q86Y71|Q9BYZ4|Q9UFN6	Splice_Site	DNP	ENST00000360863.6	37	c.1689_splice	CCDS43758.1																																																																																				0.396	RGS22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000380365.1	NM_015668	Nonsense_Mutation	73	123	0	0	0	0.004672	0	73	123				
CSMD3	114788	broad.mit.edu	37	8	113518953	113518953	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr8:113518953T>C	ENST00000297405.5	-	29	5106	c.4862A>G	c.(4861-4863)aAt>aGt	p.N1621S	CSMD3_ENST00000455883.2_Missense_Mutation_p.N1517S|CSMD3_ENST00000352409.3_Missense_Mutation_p.N1621S|CSMD3_ENST00000343508.3_Missense_Mutation_p.N1581S	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	1621	CUB 9. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.N1581S(1)|p.N1621S(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						ATAGTCTGCATTGACGGTGAT	0.383										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																													uc003ynu.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						c.(4861-4863)AAT>AGT		CUB and Sushi multiple domains 3 isoform 1							149.0	138.0	142.0					8																	113518953		2203	4300	6503	SO:0001583	missense	114788					integral to membrane|plasma membrane		g.chr8:113518953T>C	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.4862A>G	8.37:g.113518953T>C	ENSP00000297405:p.Asn1621Ser	HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)	Somatic				CSMD3_uc003yns.2_Missense_Mutation_p.N893S|CSMD3_uc003ynt.2_Missense_Mutation_p.N1581S|CSMD3_uc011lhx.1_Missense_Mutation_p.N1517S	p.N1621S	NM_198123	NP_937756	WXS	Illumina HiSeq	Unspecified	Q7Z407	CSMD3_HUMAN			29	5021	-			1621			Extracellular (Potential).|CUB 9.		Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	c.4862A>G	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	T	7.366	0.625753	0.14257	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.19394	2.15;2.15;2.15;2.15;2.15	4.99	3.82	0.43975	CUB (5);	0.137728	0.47852	D	0.000211	T	0.12390	0.0301	N	0.05158	-0.105	0.25998	N	0.982151	P;P;B	0.36183	0.486;0.542;0.104	B;P;B	0.44921	0.268;0.464;0.042	T	0.28618	-1.0038	10	0.07030	T	0.85	.	11.2585	0.49069	0.1368:0.0:0.0:0.8631	.	1517;1621;1581	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	S	1581;1621;961;1517;1621	ENSP00000345799:N1581S;ENSP00000297405:N1621S;ENSP00000341558:N961S;ENSP00000412263:N1517S;ENSP00000343124:N1621S	ENSP00000297405:N1621S	N	-	2	0	CSMD3	113588129	1.000000	0.71417	0.098000	0.21074	0.735000	0.41995	6.023000	0.70848	0.903000	0.36546	0.455000	0.32223	AAT		0.383	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900		28	63	0	0	0	0.001786	0	28	63				
COL14A1	7373	broad.mit.edu	37	8	121262899	121262899	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr8:121262899C>A	ENST00000297848.3	+	22	2916	c.2646C>A	c.(2644-2646)aaC>aaA	p.N882K	COL14A1_ENST00000309791.4_Missense_Mutation_p.N882K|COL14A1_ENST00000432943.2_3'UTR|COL14A1_ENST00000247781.3_Missense_Mutation_p.N787K	NM_021110.1	NP_066933.1			collagen, type XIV, alpha 1									p.N882K(1)		NS(1)|autonomic_ganglia(1)|breast(11)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(9)|large_intestine(31)|lung(42)|ovary(5)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	119	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			CTGACATTAACACCATCCTTA	0.448																																							uc003yox.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|kidney(4)|skin(2)|pancreas(1)|central_nervous_system(1)	12						c.(2644-2646)AAC>AAA		collagen, type XIV, alpha 1 precursor							123.0	110.0	114.0					8																	121262899		2203	4300	6503	SO:0001583	missense	7373				cell-cell adhesion|collagen fibril organization	collagen type XIV|extracellular space	collagen binding|extracellular matrix structural constituent|protein binding, bridging	g.chr8:121262899C>A		CCDS34938.1	8q23	2013-02-11	2008-02-04		ENSG00000187955	ENSG00000187955		"""Collagens"", ""Fibronectin type III domain containing"""	2191	protein-coding gene	gene with protein product		120324	"""undulin"""	UND		1716629, 9427527	Standard	NM_021110		Approved		uc003yox.4	Q05707	OTTHUMG00000149877	ENST00000297848.3:c.2646C>A	8.37:g.121262899C>A	ENSP00000297848:p.Asn882Lys		Somatic				COL14A1_uc003yoy.2_Missense_Mutation_p.N560K	p.N882K	NM_021110	NP_066933	WXS	Illumina HiSeq	Unspecified	Q05707	COEA1_HUMAN	OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)		22	2911	+	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		882			Fibronectin type-III 7.			Missense_Mutation	SNP	ENST00000297848.3	37	c.2646C>A	CCDS34938.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.112886	0.77210	.	.	ENSG00000187955	ENST00000309791;ENST00000297848;ENST00000247781;ENST00000434620	T;T;T;T	0.57436	0.4;0.4;0.4;0.4	5.73	4.86	0.63082	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.090168	0.85682	D	0.000000	T	0.56819	0.2011	M	0.78456	2.415	0.80722	D	1	P;P	0.45176	0.852;0.822	B;B	0.43536	0.281;0.423	T	0.62714	-0.6796	10	0.54805	T	0.06	.	11.7529	0.51859	0.0:0.8479:0.0:0.1521	.	882;882	Q05707-2;Q05707	.;COEA1_HUMAN	K	882;882;787;695	ENSP00000311809:N882K;ENSP00000297848:N882K;ENSP00000247781:N787K;ENSP00000409461:N695K	ENSP00000247781:N787K	N	+	3	2	COL14A1	121332080	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	1.858000	0.39408	1.584000	0.49913	0.655000	0.94253	AAC		0.448	COL14A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313657.2	NM_021110		32	46	1	0	6.53348e-20	0.003755	1.65208e-19	32	46				
HAS2	3037	broad.mit.edu	37	8	122627237	122627237	+	Missense_Mutation	SNP	A	A	C			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr8:122627237A>C	ENST00000303924.4	-	4	1308	c.771T>G	c.(769-771)agT>agG	p.S257R		NM_005328.2	NP_005319.1	Q92819	HYAS2_HUMAN	hyaluronan synthase 2	257					atrioventricular canal development (GO:0036302)|bone morphogenesis (GO:0060349)|cellular response to fluid shear stress (GO:0071498)|cellular response to interleukin-1 (GO:0071347)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|cellular response to tumor necrosis factor (GO:0071356)|endocardial cushion to mesenchymal transition (GO:0090500)|extracellular matrix assembly (GO:0085029)|extracellular polysaccharide biosynthetic process (GO:0045226)|hyaluronan biosynthetic process (GO:0030213)|kidney development (GO:0001822)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of monocyte aggregation (GO:1900625)|positive regulation of urine volume (GO:0035810)|renal water absorption (GO:0070295)|vasculogenesis (GO:0001570)	integral component of plasma membrane (GO:0005887)	hyaluronan synthase activity (GO:0050501)	p.S257R(1)	HAS2/PLAG1(10)	breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(19)|ovary(5)|skin(1)	38	Lung NSC(37;3.12e-08)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)|all_neural(195;0.142)		STAD - Stomach adenocarcinoma(47;0.00503)			AATATCTTACACTGCTGAGGA	0.378																																							uc003yph.2		NA																HAS2/PLAG1(10)	1	Substitution - Missense(1)		lung(1)	soft_tissue(10)|ovary(5)	15						c.(769-771)AGT>AGG		hyaluronan synthase 2							73.0	71.0	72.0					8																	122627237		2203	4300	6503	SO:0001583	missense	3037					integral to plasma membrane	hyaluronan synthase activity	g.chr8:122627237A>C	U54804	CCDS6335.1	8q24.12	2013-02-22			ENSG00000170961	ENSG00000170961	2.4.1.212	"""Glycosyltransferase family 2 domain containing"""	4819	protein-coding gene	gene with protein product		601636				9169154	Standard	NM_005328		Approved		uc003yph.2	Q92819	OTTHUMG00000164953	ENST00000303924.4:c.771T>G	8.37:g.122627237A>C	ENSP00000306991:p.Ser257Arg		Somatic					p.S257R	NM_005328	NP_005319	WXS	Illumina HiSeq	Unspecified	Q92819	HAS2_HUMAN	STAD - Stomach adenocarcinoma(47;0.00503)		4	1309	-	Lung NSC(37;3.12e-08)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)|all_neural(195;0.142)		257			Cytoplasmic (Potential).		Q32MM3	Missense_Mutation	SNP	ENST00000303924.4	37	c.771T>G	CCDS6335.1	.	.	.	.	.	.	.	.	.	.	A	15.01	2.705088	0.48412	.	.	ENSG00000170961	ENST00000303924;ENST00000443194	T	0.61040	0.14	6.03	2.39	0.29439	.	0.000000	0.85682	D	0.000000	T	0.74869	0.3773	M	0.87547	2.89	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.76945	-0.2771	10	0.87932	D	0	-16.5622	8.799	0.34896	0.6872:0.0:0.3128:0.0	.	257	Q92819	HAS2_HUMAN	R	257	ENSP00000306991:S257R	ENSP00000306991:S257R	S	-	3	2	HAS2	122696418	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	0.843000	0.27640	1.059000	0.40554	0.454000	0.30748	AGT		0.378	HAS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381150.2	NM_005328		17	64	0	0	0	0.004007	0	17	64				
ADCY8	114	broad.mit.edu	37	8	131955633	131955633	+	Silent	SNP	G	G	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr8:131955633G>T	ENST00000286355.5	-	4	3409	c.1317C>A	c.(1315-1317)ctC>ctA	p.L439L	RP11-737F9.1_ENST00000523318.1_RNA|ADCY8_ENST00000377928.3_Silent_p.L439L	NM_001115.2	NP_001106.1	P40145	ADCY8_HUMAN	adenylate cyclase 8 (brain)	439					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)	p.L439L(2)		NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(21)|lung(67)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(5)|urinary_tract(2)	134	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			AGAGCTCGTTGAGCATCCTGA	0.473										HNSCC(32;0.087)																													uc003ytd.3		NA																	2	Substitution - coding silent(2)		lung(2)	skin(4)|large_intestine(1)|central_nervous_system(1)	6						c.(1315-1317)CTC>CTA		adenylate cyclase 8							60.0	56.0	58.0					8																	131955633		2203	4300	6503	SO:0001819	synonymous_variant	114				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|membrane fraction|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|metal ion binding	g.chr8:131955633G>T	Z35309	CCDS6363.1	8q24	2013-02-04			ENSG00000155897	ENSG00000155897	4.6.1.1	"""Adenylate cyclases"""	239	protein-coding gene	gene with protein product		103070		ADCY3		8076676	Standard	NM_001115		Approved	HBAC1, AC8	uc003ytd.4	P40145	OTTHUMG00000164756	ENST00000286355.5:c.1317C>A	8.37:g.131955633G>T		HNSCC(32;0.087)	Somatic				ADCY8_uc010mds.2_Silent_p.L439L	p.L439L	NM_001115	NP_001106	WXS	Illumina HiSeq	Unspecified	P40145	ADCY8_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.000538)		4	1573	-	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		439			Cytoplasmic (Potential).			Silent	SNP	ENST00000286355.5	37	c.1317C>A	CCDS6363.1																																																																																				0.473	ADCY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380080.1			16	46	1	0	1.37657e-19	0.001882	3.43543e-19	16	46				
LRRC6	23639	broad.mit.edu	37	8	133584708	133584708	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr8:133584708A>G	ENST00000519595.1	-	12	1345	c.1247T>C	c.(1246-1248)cTa>cCa	p.L416P	LRRC6_ENST00000518642.1_3'UTR|LRRC6_ENST00000250173.1_Missense_Mutation_p.L416P			Q86X45	TILB_HUMAN	leucine rich repeat containing 6	416					cilium movement (GO:0003341)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|inner dynein arm assembly (GO:0036159)|male gonad development (GO:0008584)|motile cilium assembly (GO:0044458)|outer dynein arm assembly (GO:0036158)|reproductive system development (GO:0061458)|sperm motility (GO:0030317)	cilium (GO:0005929)|cytoplasm (GO:0005737)		p.L416P(1)		breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(18)|ovary(1)|prostate(1)|urinary_tract(2)	34	Ovarian(258;0.00352)|Esophageal squamous(12;0.00507)|all_neural(3;0.0052)|Medulloblastoma(3;0.0922)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)			GTCTACTTCTAGTTTCTCCAT	0.368																																							uc003ytk.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|kidney(1)	2						c.(1246-1248)CTA>CCA		leucine rich repeat containing 6							205.0	190.0	195.0					8																	133584708		2203	4300	6503	SO:0001583	missense	23639					cytoplasm		g.chr8:133584708A>G	U60666	CCDS6365.1	8q24	2013-02-22			ENSG00000129295	ENSG00000129295			16725	protein-coding gene	gene with protein product	"""leucine rich testes protein"""	614930				10775177, 23122586	Standard	NM_012472		Approved	TSLRP, LRTP, CILD19	uc003ytk.4	Q86X45	OTTHUMG00000164646	ENST00000519595.1:c.1247T>C	8.37:g.133584708A>G	ENSP00000429791:p.Leu416Pro		Somatic				LRRC6_uc003ytl.2_RNA	p.L416P	NM_012472	NP_036604	WXS	Illumina HiSeq	Unspecified	Q86X45	LRRC6_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.000311)		12	1321	-	Ovarian(258;0.00352)|Esophageal squamous(12;0.00507)|all_neural(3;0.0052)|Medulloblastoma(3;0.0922)|Acute lymphoblastic leukemia(118;0.155)		416					Q13648|Q4G183	Missense_Mutation	SNP	ENST00000519595.1	37	c.1247T>C		.	.	.	.	.	.	.	.	.	.	A	15.53	2.862156	0.51482	.	.	ENSG00000129295	ENST00000519595;ENST00000522789;ENST00000250173	T;T;T	0.71461	-0.46;-0.57;-0.46	5.5	5.5	0.81552	.	0.000000	0.64402	D	0.000001	D	0.82577	0.5067	M	0.75264	2.295	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.84634	0.0691	10	0.87932	D	0	-9.4423	12.2854	0.54789	1.0:0.0:0.0:0.0	.	416	Q86X45	LRRC6_HUMAN	P	416;156;416	ENSP00000429791:L416P;ENSP00000428015:L156P;ENSP00000250173:L416P	ENSP00000250173:L416P	L	-	2	0	LRRC6	133653890	0.983000	0.35010	0.027000	0.17364	0.564000	0.35744	5.416000	0.66417	2.224000	0.72417	0.533000	0.62120	CTA		0.368	LRRC6-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000379578.1	NM_012472		55	115	0	0	0	0.00361	0	55	115				
FAM135B	51059	broad.mit.edu	37	8	139163840	139163840	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr8:139163840G>A	ENST00000395297.1	-	13	3048	c.2878C>T	c.(2878-2880)Cct>Tct	p.P960S		NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B	960								p.P960S(2)		NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			ATAATGCAAGGTGAACCGCTT	0.507										HNSCC(54;0.14)																													uc003yuy.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(7)|skin(2)	9						c.(2878-2880)CCT>TCT		hypothetical protein LOC51059							159.0	126.0	137.0					8																	139163840		2203	4300	6503	SO:0001583	missense	51059							g.chr8:139163840G>A	AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.2878C>T	8.37:g.139163840G>A	ENSP00000378710:p.Pro960Ser	HNSCC(54;0.14)	Somatic				FAM135B_uc003yux.2_Missense_Mutation_p.P861S|FAM135B_uc003yuz.2_RNA|FAM135B_uc003yva.2_Missense_Mutation_p.P522S|FAM135B_uc003yvb.2_Missense_Mutation_p.P522S	p.P960S	NM_015912	NP_056996	WXS	Illumina HiSeq	Unspecified	Q49AJ0	F135B_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.0805)		13	3049	-	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		960					B5MDB3|O95879|Q2WGJ7|Q3KP46	Missense_Mutation	SNP	ENST00000395297.1	37	c.2878C>T	CCDS6375.2	.	.	.	.	.	.	.	.	.	.	G	8.800	0.932675	0.18131	.	.	ENSG00000147724	ENST00000395297	T	0.13089	2.62	5.12	1.71	0.24356	.	1.077110	0.07016	N	0.825869	T	0.07548	0.0190	L	0.29908	0.895	0.09310	N	1	B;B;B	0.28419	0.211;0.211;0.013	B;B;B	0.22601	0.04;0.04;0.006	T	0.36432	-0.9748	10	0.07030	T	0.85	-3.9993	2.6021	0.04868	0.3674:0.2633:0.3693:0.0	.	960;960;960	Q49AJ0-3;Q49AJ0-4;Q49AJ0	.;.;F135B_HUMAN	S	960	ENSP00000378710:P960S	ENSP00000276737:P960S	P	-	1	0	FAM135B	139233022	0.001000	0.12720	0.001000	0.08648	0.006000	0.05464	0.483000	0.22292	0.489000	0.27749	0.655000	0.94253	CCT		0.507	FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313590.3	NM_015912		40	147	0	0	0	0.002522	0	40	147				
FAM135B	51059	broad.mit.edu	37	8	139255226	139255226	+	Silent	SNP	A	A	G			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr8:139255226A>G	ENST00000395297.1	-	7	798	c.628T>C	c.(628-630)Ttg>Ctg	p.L210L		NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B	210								p.L210L(2)		NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			CCAAAGACCAAGTTTTCCAGA	0.463										HNSCC(54;0.14)																													uc003yuy.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(7)|skin(2)	9						c.(628-630)TTG>CTG		hypothetical protein LOC51059							80.0	81.0	80.0					8																	139255226		1878	4105	5983	SO:0001819	synonymous_variant	51059							g.chr8:139255226A>G	AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.628T>C	8.37:g.139255226A>G		HNSCC(54;0.14)	Somatic				FAM135B_uc003yux.2_Silent_p.L111L|FAM135B_uc003yuz.2_RNA	p.L210L	NM_015912	NP_056996	WXS	Illumina HiSeq	Unspecified	Q49AJ0	F135B_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.0805)		7	799	-	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		210					B5MDB3|O95879|Q2WGJ7|Q3KP46	Silent	SNP	ENST00000395297.1	37	c.628T>C	CCDS6375.2																																																																																				0.463	FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313590.3	NM_015912		6	47	0	0	0	0.001984	0	6	47				
COL22A1	169044	broad.mit.edu	37	8	139691879	139691879	+	Missense_Mutation	SNP	A	A	T	rs144461812	byFrequency	TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr8:139691879A>T	ENST00000303045.6	-	40	3499	c.3053T>A	c.(3052-3054)cTg>cAg	p.L1018Q	COL22A1_ENST00000341807.4_Intron|COL22A1_ENST00000435777.1_Intron	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	1018	Gly-rich.|Pro-rich.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)		p.L1018Q(1)		breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			TTGCCCTCCCAGTGCACAGTT	0.403										HNSCC(7;0.00092)																													uc003yvd.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(11)|pancreas(1)|skin(1)	13						c.(3052-3054)CTG>CAG		collagen, type XXII, alpha 1							173.0	153.0	160.0					8																	139691879		2203	4300	6503	SO:0001583	missense	169044				cell adhesion	collagen|cytoplasm	structural molecule activity	g.chr8:139691879A>T	AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.3053T>A	8.37:g.139691879A>T	ENSP00000303153:p.Leu1018Gln	HNSCC(7;0.00092)	Somatic				COL22A1_uc011ljo.1_Intron	p.L1018Q	NM_152888	NP_690848	WXS	Illumina HiSeq	Unspecified	Q8NFW1	COMA1_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.0517)		40	3500	-	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		1018			Pro-rich.|Gly-rich.		B7ZMH0|C9K0G4|Q8IVT9	Missense_Mutation	SNP	ENST00000303045.6	37	c.3053T>A	CCDS6376.1	.	.	.	.	.	.	.	.	.	.	A	3.867	-0.028674	0.07589	.	.	ENSG00000169436	ENST00000303045	D	0.93307	-3.2	2.01	-2.29	0.06805	.	19.341300	0.00397	U	0.000041	D	0.84120	0.5402	N	0.14661	0.345	0.09310	N	1	B	0.15473	0.013	B	0.11329	0.006	T	0.73033	-0.4110	10	0.21014	T	0.42	.	2.1471	0.03790	0.4059:0.0:0.3424:0.2517	.	1018	Q8NFW1	COMA1_HUMAN	Q	1018	ENSP00000303153:L1018Q	ENSP00000303153:L1018Q	L	-	2	0	COL22A1	139761061	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-1.432000	0.02430	-0.583000	0.05921	-0.464000	0.05259	CTG		0.403	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000315905.2	XM_291257		35	82	0	0	0	0.007835	0	35	82				
MROH1	727957	broad.mit.edu	37	8	145318037	145318037	+	IGR	SNP	G	G	A	rs547157741		TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr8:145318037G>A	ENST00000528919.1	+	0	5234				KM-PA-2_ENST00000377412.4_Missense_Mutation_p.T426M	NM_032450.2	NP_115826	Q8NDA8	MROH1_HUMAN	maestro heat-like repeat family member 1									p.T426M(1)									GGTCACCTGCGTCACTGGCTG	0.701													G|||	1	0.000199681	0.0008	0.0	5008	,	,		6513	0.0		0.0	False		,,,				2504	0.0						uc003zbm.3		NA																	1	Substitution - Missense(1)		lung(1)		NA						c.(1276-1278)ACG>ATG		block of proliferation 1																																				SO:0001628	intergenic_variant	0							g.chr8:145318037G>A		CCDS47938.1, CCDS47939.1, CCDS75803.1	8q24.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000179832	ENSG00000179832		"""maestro heat-like repeat containing"""	26958	protein-coding gene	gene with protein product			"""HEAT repeat containing 7A"""	HEATR7A		11347906	Standard	NM_032450		Approved	KIAA1833	uc003zbk.4	Q8NDA8	OTTHUMG00000165781		8.37:g.145318037G>A			Somatic					p.T426M	NM_015201	NP_056016	WXS	Illumina HiSeq	Unspecified					11	1304	-								C9JWM5|D3DWL5|Q0P612|Q569G6|Q6NVW4|Q8N230|Q8NAD1|Q8ND95|Q96JJ4	Missense_Mutation	SNP	ENST00000528919.1	37	c.1277C>T	CCDS47938.1	.	.	.	.	.	.	.	.	.	.	g	10.54	1.378607	0.24944	.	.	ENSG00000204775	ENST00000377412	T	0.01516	4.81	3.14	2.13	0.27403	.	0.378674	0.26130	N	0.026167	T	0.02848	0.0085	.	.	.	0.26576	N	0.973469	.	.	.	.	.	.	T	0.07790	-1.0754	6	0.56958	D	0.05	-3.9669	5.2753	0.15645	0.0:0.2235:0.5472:0.2293	.	.	.	.	M	426	ENSP00000366629:T426M	ENSP00000366629:T426M	T	-	2	0	AC145291.1	145390025	0.351000	0.24887	0.947000	0.38551	0.267000	0.26476	0.984000	0.29565	1.793000	0.52555	0.175000	0.17021	ACG		0.701	MROH1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386183.1	NM_032450		5	15	0	0	0	0.001168	0	5	15				
GLDC	2731	broad.mit.edu	37	9	6587241	6587241	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr9:6587241G>T	ENST00000321612.6	-	15	1900	c.1750C>A	c.(1750-1752)Cct>Act	p.P584T		NM_000170.2	NP_000161.2	P23378	GCSP_HUMAN	glycine dehydrogenase (decarboxylating)	584					glycine catabolic process (GO:0006546)	mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|glycine dehydrogenase (decarboxylating) activity (GO:0004375)|lyase activity (GO:0016829)|pyridoxal phosphate binding (GO:0030170)	p.P584T(1)		cervix(1)|endometrium(2)|large_intestine(5)|lung(23)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		Acute lymphoblastic leukemia(23;0.161)		GBM - Glioblastoma multiforme(50;0.0421)|Lung(218;0.134)	Glycine(DB00145)	TGATCCAGAGGCACAAAGGGG	0.388																																							uc003zkc.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1750-1752)CCT>ACT		glycine dehydrogenase (decarboxylating)	Glycine(DB00145)|Pyridoxal Phosphate(DB00114)						99.0	92.0	94.0					9																	6587241		2203	4300	6503	SO:0001583	missense	2731				glycine catabolic process	mitochondrion	electron carrier activity|glycine dehydrogenase (decarboxylating) activity|lyase activity|pyridoxal phosphate binding	g.chr9:6587241G>T	D90239	CCDS34987.1	9p22	2014-09-17	2006-05-22		ENSG00000178445	ENSG00000178445	1.4.4.2		4313	protein-coding gene	gene with protein product	"""glycine cleavage system protein P"", ""glycine decarboxylase"""	238300	"""glycine dehydrogenase (decarboxylating; glycine decarboxylase, glycine cleavage system protein P)"""			1993704, 1996985	Standard	NM_000170		Approved	GCSP, NKH	uc003zkc.3	P23378	OTTHUMG00000019524	ENST00000321612.6:c.1750C>A	9.37:g.6587241G>T	ENSP00000370737:p.Pro584Thr		Somatic					p.P584T	NM_000170	NP_000161	WXS	Illumina HiSeq	Unspecified	P23378	GCSP_HUMAN		GBM - Glioblastoma multiforme(50;0.0421)|Lung(218;0.134)	15	1943	-		Acute lymphoblastic leukemia(23;0.161)	584					Q2M2F8	Missense_Mutation	SNP	ENST00000321612.6	37	c.1750C>A	CCDS34987.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.019223	0.75275	.	.	ENSG00000178445	ENST00000321612	D	0.98192	-4.78	5.26	4.35	0.52113	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	D	0.99306	0.9757	H	0.96916	3.905	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98667	1.0686	10	0.72032	D	0.01	-5.9349	15.1548	0.72733	0.0:0.0:0.8576:0.1424	.	584	P23378	GCSP_HUMAN	T	584	ENSP00000370737:P584T	ENSP00000370737:P584T	P	-	1	0	GLDC	6577241	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.476000	0.97823	1.181000	0.42912	0.557000	0.71058	CCT		0.388	GLDC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051674.2	NM_000170		26	47	1	0	3.73148e-12	0.007291	7.64953e-12	26	47				
PTPRD	5789	broad.mit.edu	37	9	8504367	8504367	+	Silent	SNP	C	C	G			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr9:8504367C>G	ENST00000381196.4	-	20	2259	c.1716G>C	c.(1714-1716)ctG>ctC	p.L572L	PTPRD_ENST00000486161.1_Silent_p.L572L|PTPRD_ENST00000397617.3_Silent_p.L562L|PTPRD_ENST00000540109.1_Silent_p.L572L|PTPRD_ENST00000355233.5_Silent_p.L572L|PTPRD_ENST00000358503.5_Silent_p.L559L|PTPRD_ENST00000356435.5_Silent_p.L572L|PTPRD_ENST00000360074.4_Silent_p.L559L|PTPRD_ENST00000537002.1_Silent_p.L569L|PTPRD_ENST00000397606.3_Silent_p.L562L|PTPRD_ENST00000397611.3_Silent_p.L569L	NM_002839.3	NP_002830.1	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	572	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				heterophilic cell-cell adhesion (GO:0007157)|neuron differentiation (GO:0030182)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|protein dephosphorylation (GO:0006470)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cell adhesion molecule binding (GO:0050839)|receptor binding (GO:0005102)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.L572L(4)		NS(1)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(83)|ovary(4)|pancreas(1)|prostate(7)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	168		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		TCAGTCCTTGCAGCCTATATG	0.438										TSP Lung(15;0.13)																													uc003zkk.2		NA																	4	Substitution - coding silent(4)		lung(4)	lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22						c.(1714-1716)CTG>CTC		protein tyrosine phosphatase, receptor type, D							292.0	247.0	263.0					9																	8504367		2203	4300	6503	SO:0001819	synonymous_variant	5789				transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity	g.chr9:8504367C>G	X54133	CCDS6472.1, CCDS43786.1, CCDS6472.2, CCDS55288.1, CCDS55289.1, CCDS55290.1, CCDS75813.1	9p24.1-p23	2013-02-11			ENSG00000153707	ENSG00000153707		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9668	protein-coding gene	gene with protein product		601598				7896816, 8355697	Standard	NM_002839		Approved	PTPD, HPTP	uc003zkk.3	P23468	OTTHUMG00000021005	ENST00000381196.4:c.1716G>C	9.37:g.8504367C>G		TSP Lung(15;0.13)	Somatic				PTPRD_uc003zkp.2_Silent_p.L572L|PTPRD_uc003zkq.2_Silent_p.L572L|PTPRD_uc003zkr.2_Silent_p.L566L|PTPRD_uc003zks.2_Silent_p.L562L|PTPRD_uc003zkl.2_Silent_p.L572L|PTPRD_uc003zkm.2_Silent_p.L559L|PTPRD_uc003zkn.2_Silent_p.L572L|PTPRD_uc003zko.2_Silent_p.L569L	p.L572L	NM_002839	NP_002830	WXS	Illumina HiSeq	Unspecified	P23468	PTPRD_HUMAN		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)	22	2427	-		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)	572			Fibronectin type-III 3.|Extracellular (Potential).		B1ALA0|F5GWT7|Q3KPJ0|Q3KPJ1|Q3KPJ2	Silent	SNP	ENST00000381196.4	37	c.1716G>C	CCDS43786.1																																																																																				0.438	PTPRD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055395.3			29	84	0	0	0	0.008361	0	29	84				
IFNB1	3456	broad.mit.edu	37	9	21077501	21077501	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr9:21077501A>G	ENST00000380232.2	-	1	442	c.368T>C	c.(367-369)cTg>cCg	p.L123P		NM_002176.2	NP_002167.1	P01574	IFNB_HUMAN	interferon, beta 1, fibroblast	123					adaptive immune response (GO:0002250)|B cell activation involved in immune response (GO:0002312)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cell surface receptor signaling pathway (GO:0007166)|cellular response to exogenous dsRNA (GO:0071360)|cellular response to interferon-beta (GO:0035458)|cytokine-mediated signaling pathway (GO:0019221)|defense response to bacterium (GO:0042742)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation (GO:0030101)|natural killer cell activation involved in immune response (GO:0002323)|negative regulation of T cell differentiation (GO:0045581)|negative regulation of T-helper 2 cell cytokine production (GO:2000552)|negative regulation of viral genome replication (GO:0045071)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of innate immune response (GO:0045089)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|T cell activation involved in immune response (GO:0002286)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|type I interferon receptor binding (GO:0005132)	p.L123P(1)		breast(3)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)	12				GBM - Glioblastoma multiforme(5;7.45e-142)|Lung(24;2.42e-17)|LUSC - Lung squamous cell carcinoma(38;7.17e-11)		TTTTTCTTCCAGGACTGTCTT	0.423																																							uc003zok.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)|kidney(1)	3						c.(367-369)CTG>CCG		interferon, beta 1, fibroblast precursor	Interferon beta-1a(DB00060)|Interferon beta-1b(DB00068)						181.0	186.0	184.0					9																	21077501		2203	4300	6503	SO:0001583	missense	3456				activation of caspase activity|B cell proliferation|blood coagulation|cellular response to exogenous dsRNA|defense response to virus|induction of apoptosis|natural killer cell activation|negative regulation of cell proliferation|negative regulation of T cell differentiation|negative regulation of T-helper 2 cell cytokine production|negative regulation of viral genome replication|negative regulation of viral transcription|negative regulation of virion penetration into host cell|positive regulation of innate immune response|positive regulation of transcription from RNA polymerase II promoter|regulation of MHC class I biosynthetic process|regulation of type I interferon-mediated signaling pathway|type I interferon-mediated signaling pathway	extracellular space	cytokine activity|interferon-alpha/beta receptor binding|transcription corepressor activity	g.chr9:21077501A>G		CCDS6495.1	9p22	2008-07-21			ENSG00000171855	ENSG00000171855		"""Interferons"""	5434	protein-coding gene	gene with protein product		147640		IFNB			Standard	NM_002176		Approved	IFB, IFF	uc003zok.3	P01574	OTTHUMG00000019652	ENST00000380232.2:c.368T>C	9.37:g.21077501A>G	ENSP00000369581:p.Leu123Pro		Somatic					p.L123P	NM_002176	NP_002167	WXS	Illumina HiSeq	Unspecified	P01574	IFNB_HUMAN		GBM - Glioblastoma multiforme(5;7.45e-142)|Lung(24;2.42e-17)|LUSC - Lung squamous cell carcinoma(38;7.17e-11)	1	443	-			123					Q5VWC9	Missense_Mutation	SNP	ENST00000380232.2	37	c.368T>C	CCDS6495.1	.	.	.	.	.	.	.	.	.	.	A	14.08	2.429368	0.43122	.	.	ENSG00000171855	ENST00000380232	T	0.05513	3.43	5.09	3.93	0.45458	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	1.089820	0.07053	N	0.832264	T	0.30070	0.0753	M	0.87269	2.87	0.23969	N	0.99632	D	0.89917	1.0	D	0.87578	0.998	T	0.03993	-1.0986	10	0.56958	D	0.05	0.0103	9.4112	0.38494	0.8411:0.0:0.0:0.1589	.	123	P01574	IFNB_HUMAN	P	123	ENSP00000369581:L123P	ENSP00000369581:L123P	L	-	2	0	IFNB1	21067501	0.001000	0.12720	0.001000	0.08648	0.002000	0.02628	1.417000	0.34770	1.053000	0.40415	0.528000	0.53228	CTG		0.423	IFNB1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051881.1	NM_002176		54	127	0	0	0	0.00361	0	54	127				
FRMPD1	22844	broad.mit.edu	37	9	37711392	37711392	+	Splice_Site	SNP	G	G	C			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr9:37711392G>C	ENST00000539465.1	+	5	1001	c.408G>C	c.(406-408)tcG>tcC	p.S136S	FRMPD1_ENST00000377765.3_Splice_Site_p.S136S|RP11-613M10.9_ENST00000540557.1_Intron			Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1	136						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)		p.S136S(1)		NS(3)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(34)|ovary(5)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	93				GBM - Glioblastoma multiforme(29;0.00655)		GCTGCACGTCGGTAAATCTCT	0.438																																							uc004aag.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|central_nervous_system(2)|skin(2)|breast(1)	9						c.(406-408)TCG>TCC		FERM and PDZ domain containing 1							281.0	268.0	272.0					9																	37711392		2203	4300	6503	SO:0001630	splice_region_variant	22844					cytoskeleton|cytosol|plasma membrane		g.chr9:37711392G>C	AB023184	CCDS6612.1	9p13.1	2008-02-05			ENSG00000070601	ENSG00000070601			29159	protein-coding gene	gene with protein product						10231032	Standard	NM_014907		Approved	KIAA0967, FRMD2	uc004aag.1	Q5SYB0	OTTHUMG00000019927	ENST00000539465.1:c.408+1G>C	9.37:g.37711392G>C			Somatic				FRMPD1_uc004aah.1_Silent_p.S136S	p.S136S	NM_014907	NP_055722	WXS	Illumina HiSeq	Unspecified	Q5SYB0	FRPD1_HUMAN		GBM - Glioblastoma multiforme(29;0.00655)	5	452	+			136					B4DZC8|B7Z807|D3DRQ3|Q14C73|Q5HY96|Q9Y2H3	Silent	SNP	ENST00000539465.1	37	c.408G>C	CCDS6612.1																																																																																				0.438	FRMPD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402969.1	NM_014907	Silent	52	136	0	0	0	0.00361	0	52	136				
AGTPBP1	23287	broad.mit.edu	37	9	88292350	88292350	+	Splice_Site	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr9:88292350C>A	ENST00000357081.3	-	6	581		c.e6+1		AGTPBP1_ENST00000376081.4_Splice_Site|AGTPBP1_ENST00000376083.3_Splice_Site|AGTPBP1_ENST00000432218.1_Splice_Site|AGTPBP1_ENST00000376109.3_Splice_Site|AGTPBP1_ENST00000491784.1_Splice_Site|AGTPBP1_ENST00000376080.1_Splice_Site|AGTPBP1_ENST00000337006.4_Splice_Site			Q9UPW5	CBPC1_HUMAN	ATP/GTP binding protein 1						adult walking behavior (GO:0007628)|C-terminal protein deglutamylation (GO:0035609)|cerebellar Purkinje cell differentiation (GO:0021702)|eye photoreceptor cell differentiation (GO:0001754)|mitochondrion organization (GO:0007005)|neuromuscular process (GO:0050905)|neurotransmitter metabolic process (GO:0042133)|olfactory bulb development (GO:0021772)|protein side chain deglutamylation (GO:0035610)|retina development in camera-type eye (GO:0060041)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)	p.?(1)		NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(12)|lung(12)|ovary(5)|skin(2)|urinary_tract(3)	44						AAATCCCTTACCTTTTGGTCC	0.318																																							uc011ltd.1		NA																	1	Unknown(1)		lung(1)	ovary(4)|large_intestine(2)|skin(1)	7						c.e5+1		ATP/GTP binding protein 1							107.0	106.0	106.0					9																	88292350		2203	4300	6503	SO:0001630	splice_region_variant	23287				C-terminal protein deglutamylation|cerebellar Purkinje cell differentiation|eye photoreceptor cell differentiation|mitochondrion organization|neuromuscular process|olfactory bulb development|protein side chain deglutamylation|proteolysis	cytosol|mitochondrion|nucleus	metallocarboxypeptidase activity|tubulin binding|zinc ion binding	g.chr9:88292350C>A	AB028958	CCDS6672.1, CCDS75854.1	9q21.33	2014-06-23			ENSG00000135049	ENSG00000135049			17258	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 1"", ""tubulinyl-Tyr carboxypeptidase"", ""carboxypeptidase-tubulin"", ""tyrosine carboxypeptidase"", ""soluble carboxypeptidase"""	606830				11083920	Standard	NM_015239		Approved	KIAA1035, Nna1, CCP1	uc010mqc.3	Q9UPW5	OTTHUMG00000020124	ENST00000357081.3:c.436+1G>T	9.37:g.88292350C>A			Somatic				AGTPBP1_uc011ltc.1_Splice_Site_p.A88_splice|AGTPBP1_uc010mqc.2_Splice_Site_p.D146_splice|AGTPBP1_uc011lte.1_Splice_Site_p.D198_splice	p.D146_splice	NM_015239	NP_056054	WXS	Illumina HiSeq	Unspecified	Q9UPW5	CBPC1_HUMAN			5	469	-								B4DIT6|B4DRZ8|Q5VV80|Q63HM7|Q658P5|Q6P9D6|Q9H8U6|Q9H9W8|Q9NVK1	Splice_Site	SNP	ENST00000357081.3	37	c.436_splice		.	.	.	.	.	.	.	.	.	.	C	21.8	4.205671	0.79127	.	.	ENSG00000135049	ENST00000337006;ENST00000357081;ENST00000376083;ENST00000376109;ENST00000432218;ENST00000376081;ENST00000376080	.	.	.	4.74	4.74	0.60224	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.2845	0.90110	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	AGTPBP1	87482170	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.043000	0.76572	2.602000	0.87976	0.655000	0.94253	.		0.318	AGTPBP1-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000052893.1	NM_015239	Intron	23	65	1	0	1.77063e-15	0.005443	4.00135e-15	23	65				
AKAP2	11217	broad.mit.edu	37	9	112900028	112900028	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr9:112900028G>C	ENST00000259318.7	+	2	1718	c.1511G>C	c.(1510-1512)gGg>gCg	p.G504A	AKAP2_ENST00000374525.1_Missense_Mutation_p.G593A|AKAP2_ENST00000555236.1_Missense_Mutation_p.G735A|AKAP2_ENST00000510514.5_Missense_Mutation_p.G735A|PALM2-AKAP2_ENST00000302798.7_Missense_Mutation_p.G735A|AKAP2_ENST00000434623.2_Missense_Mutation_p.G593A|PALM2-AKAP2_ENST00000374530.3_Missense_Mutation_p.G735A	NM_001136562.2	NP_001130034.1	Q9Y2D5	AKAP2_HUMAN	A kinase (PRKA) anchor protein 2	504								p.G735A(1)|p.G593A(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	33						AGTGACAGCGGGGCATCCAAT	0.522																																							uc004bei.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|central_nervous_system(2)|skin(1)	6						c.(2899-2901)GGG>GCG		A kinase (PRKA) anchor protein 2 isoform 2							107.0	99.0	102.0					9																	112900028		2203	4300	6503	SO:0001583	missense	445815						enzyme binding	g.chr9:112900028G>C	AB023137	CCDS43861.1, CCDS48003.1, CCDS56581.1	9q31.3	2009-10-16			ENSG00000241978	ENSG00000241978		"""A-kinase anchor proteins"""	372	protein-coding gene	gene with protein product	"""protein kinase A2"""	604582		PRKA2		10231032	Standard	NM_001136562		Approved	AKAP-KL, KIAA0920, DKFZp564L0716		Q9Y2D5	OTTHUMG00000156811	ENST00000259318.7:c.1511G>C	9.37:g.112900028G>C	ENSP00000259318:p.Gly504Ala		Somatic				PALM2-AKAP2_uc004bek.3_Missense_Mutation_p.G735A|PALM2-AKAP2_uc004bej.3_Missense_Mutation_p.G735A|PALM2-AKAP2_uc004bel.1_Missense_Mutation_p.G545A|AKAP2_uc011lwi.1_Missense_Mutation_p.G593A|AKAP2_uc004bem.2_Missense_Mutation_p.G593A|PALM2-AKAP2_uc010mtw.1_Missense_Mutation_p.G553A|AKAP2_uc011lwj.1_Missense_Mutation_p.G504A|PALM2-AKAP2_uc004ben.2_Missense_Mutation_p.G504A	p.G967A	NM_001136562	NP_001130034	WXS	Illumina HiSeq	Unspecified	Q9Y2D5	AKAP2_HUMAN			9	3092	+			504					B1ALX9|B2RTU4|B3KQ00|B4DTZ2|B7ZW07|B9EJB5|Q9UG26	Missense_Mutation	SNP	ENST00000259318.7	37	c.2900G>C	CCDS48003.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.329131	0.81690	.	.	ENSG00000157654;ENSG00000157654;ENSG00000241978;ENSG00000241978;ENSG00000241978;ENSG00000241978;ENSG00000241978;ENSG00000241978	ENST00000374530;ENST00000302798;ENST00000555236;ENST00000510514;ENST00000434623;ENST00000374525;ENST00000480388;ENST00000259318	T;T;T;T;T;T;T;T	0.59906	1.58;1.6;1.58;1.6;0.85;0.26;0.23;0.9	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	T	0.69360	0.3102	L	0.32530	0.975	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	0.997;0.999;1.0;0.999;0.999;1.0;1.0;1.0	P;D;D;D;P;D;D;D	0.91635	0.861;0.934;0.998;0.934;0.861;0.999;0.999;0.998	T	0.70414	-0.4878	10	0.72032	D	0.01	-37.7729	19.3963	0.94608	0.0:0.0:1.0:0.0	.	504;593;587;593;594;735;735;553	Q9Y2D5;Q9Y2D5-7;B4E2K2;Q9Y2D5-5;B1ALY1;Q9Y2D5-6;Q9Y2D5-4;C9JVY5	AKAP2_HUMAN;.;.;.;.;.;.;.	A	735;735;735;735;593;593;553;504	ENSP00000363654:G735A;ENSP00000305861:G735A;ENSP00000451476:G735A;ENSP00000421522:G735A;ENSP00000404782:G593A;ENSP00000363649:G593A;ENSP00000419268:G553A;ENSP00000259318:G504A	ENSP00000259318:G504A	G	+	2	0	PALM2-AKAP2;AKAP2	111939849	1.000000	0.71417	0.994000	0.49952	0.927000	0.56198	9.201000	0.95017	2.814000	0.96858	0.655000	0.94253	GGG		0.522	AKAP2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000346067.3	NM_001004065		12	72	0	0	0	0.001855	0	12	72				
SVEP1	79987	broad.mit.edu	37	9	113173903	113173903	+	Missense_Mutation	SNP	C	C	G	rs369665876		TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr9:113173903C>G	ENST00000401783.2	-	37	6424	c.6088G>C	c.(6088-6090)Gcc>Ccc	p.A2030P	SVEP1_ENST00000297826.5_5'UTR|SVEP1_ENST00000374469.1_Missense_Mutation_p.A2007P	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	2030	Sushi 11. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)	p.A2033P(1)		NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						TCTGGAGAGGCGTGGTCCACA	0.542																																							uc010mtz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(7)	7						c.(6088-6090)GCC>CCC		polydom							41.0	45.0	43.0					9																	113173903		1991	4160	6151	SO:0001583	missense	79987				cell adhesion	cytoplasm|extracellular region|membrane	calcium ion binding	g.chr9:113173903C>G	AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.6088G>C	9.37:g.113173903C>G	ENSP00000384917:p.Ala2030Pro		Somatic				SVEP1_uc010mty.2_5'UTR	p.A2030P	NM_153366	NP_699197	WXS	Illumina HiSeq	Unspecified	Q4LDE5	SVEP1_HUMAN			37	6425	-			2030			Sushi 11.		Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Missense_Mutation	SNP	ENST00000401783.2	37	c.6088G>C	CCDS48004.1	.	.	.	.	.	.	.	.	.	.	C	26.9	4.780737	0.90195	.	.	ENSG00000165124	ENST00000401783;ENST00000374469	T;T	0.67865	-0.29;-0.29	5.78	5.78	0.91487	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.85682	D	0.000000	T	0.81894	0.4919	M	0.68317	2.08	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.82341	-0.0505	10	0.72032	D	0.01	.	19.9987	0.97401	0.0:1.0:0.0:0.0	.	2030	Q4LDE5	SVEP1_HUMAN	P	2030;2007	ENSP00000384917:A2030P;ENSP00000363593:A2007P	ENSP00000363593:A2007P	A	-	1	0	SVEP1	112213724	1.000000	0.71417	0.995000	0.50966	0.807000	0.45602	7.624000	0.83124	2.738000	0.93877	0.591000	0.81541	GCC		0.542	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				6	16	0	0	0	0.001168	0	6	16				
PTGS1	5742	broad.mit.edu	37	9	125148974	125148974	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr9:125148974C>A	ENST00000362012.2	+	9	1264	c.1259C>A	c.(1258-1260)gCc>gAc	p.A420D	PTGS1_ENST00000223423.4_Intron|AL162424.1_ENST00000600713.1_5'Flank|PTGS1_ENST00000373698.5_Missense_Mutation_p.A311D|PTGS1_ENST00000540753.1_Intron	NM_000962.3|NM_001271164.1|NM_001271367.1|NM_080591.2	NP_000953.2|NP_001258093.1|NP_001258296.1|NP_542158.1	P23219	PGH1_HUMAN	prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase)	420					arachidonic acid metabolic process (GO:0019369)|cyclooxygenase pathway (GO:0019371)|inflammatory response (GO:0006954)|lipid metabolic process (GO:0006629)|prostaglandin biosynthetic process (GO:0001516)|regulation of blood pressure (GO:0008217)|regulation of cell proliferation (GO:0042127)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|photoreceptor outer segment (GO:0001750)	dioxygenase activity (GO:0051213)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)|prostaglandin-endoperoxide synthase activity (GO:0004666)	p.A420D(1)		large_intestine(3)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	8					Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Antipyrine(DB01435)|Antrafenine(DB01419)|Balsalazide(DB01014)|Bortezomib(DB00188)|Bromfenac(DB00963)|Candesartan(DB00796)|Carprofen(DB00821)|Carvedilol(DB01136)|Chlorpropamide(DB00672)|Dapsone(DB00250)|Desmopressin(DB00035)|Diazepam(DB00829)|Diclofenac(DB00586)|Diethylcarbamazine(DB00711)|Diflunisal(DB00861)|Dihomo-gamma-linolenic acid(DB00154)|Diphenhydramine(DB01075)|Dronabinol(DB00470)|Eletriptan(DB00216)|Eszopiclone(DB00402)|Etodolac(DB00749)|Etoposide(DB00773)|Fenoprofen(DB00573)|Flurbiprofen(DB00712)|Hexobarbital(DB01355)|Hydromorphone(DB00327)|Ibuprofen(DB01050)|Icosapent(DB00159)|Ifosfamide(DB01181)|Imatinib(DB00619)|Indomethacin(DB00328)|Irbesartan(DB01029)|Ketamine(DB01221)|Ketobemidone(DB06738)|Ketoprofen(DB01009)|Ketorolac(DB00465)|Lornoxicam(DB06725)|Lumiracoxib(DB01283)|Magnesium salicylate(DB01397)|Meclofenamic acid(DB00939)|Mefenamic acid(DB00784)|Meloxicam(DB00814)|Mesalazine(DB00244)|Minoxidil(DB00350)|Montelukast(DB00471)|Nabumetone(DB00461)|Naproxen(DB00788)|Nateglinide(DB00731)|Nepafenac(DB06802)|Niflumic Acid(DB04552)|Nortriptyline(DB00540)|Oxaprozin(DB00991)|Phenylbutazone(DB00812)|Pioglitazone(DB01132)|Piroxicam(DB00554)|Rosiglitazone(DB00412)|Salicylate-sodium(DB01398)|Salicylic acid(DB00936)|Salsalate(DB01399)|Sulfamethoxazole(DB01015)|Sulfasalazine(DB00795)|Sulindac(DB00605)|Suprofen(DB00870)|Tenoxicam(DB00469)|Terbinafine(DB00857)|Thalidomide(DB01041)|Tiaprofenic acid(DB01600)|Tolmetin(DB00500)|Torasemide(DB00214)|Trabectedin(DB05109)|Triflusal(DB08814)|Trisalicylate-choline(DB01401)|Valproic Acid(DB00313)|Voriconazole(DB00582)|Zafirlukast(DB00549)|Zileuton(DB00744)|Zolpidem(DB00425)|Zopiclone(DB01198)	GGGGTTGAGGCCCTGGTGGAT	0.607																																							uc004bmg.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(1258-1260)GCC>GAC		prostaglandin-endoperoxide synthase 1 isoform 1	Acetaminophen(DB00316)|Aspirin(DB00945)|Balsalazide(DB01014)|Bromfenac(DB00963)|Ciclopirox(DB01188)|Diclofenac(DB00586)|Diflunisal(DB00861)|Dipyrone(DB04817)|Etodolac(DB00749)|Fenoprofen(DB00573)|Flurbiprofen(DB00712)|gamma-Homolinolenic acid(DB00154)|Ibuprofen(DB01050)|Icosapent(DB00159)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Ketorolac(DB00465)|Lumiracoxib(DB01283)|Meclofenamic acid(DB00939)|Mefenamic acid(DB00784)|Mesalazine(DB00244)|Minoxidil(DB00350)|Nabumetone(DB00461)|Naproxen(DB00788)|Phenacetin(DB03783)|Piroxicam(DB00554)|Rofecoxib(DB00533)|Salicyclic acid(DB00936)|Salsalate(DB01399)|Sulindac(DB00605)|Suprofen(DB00870)|Tenoxicam(DB00469)|Tolmetin(DB00500)						107.0	89.0	95.0					9																	125148974		2203	4300	6503	SO:0001583	missense	5742				cyclooxygenase pathway|hormone biosynthetic process|regulation of blood pressure|response to oxidative stress|xenobiotic metabolic process	endoplasmic reticulum membrane|Golgi apparatus|microsome|plasma membrane	heme binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|peroxidase activity|prostaglandin-endoperoxide synthase activity	g.chr9:125148974C>A	M59979	CCDS6842.1, CCDS6843.1, CCDS59520.1, CCDS59521.1, CCDS75895.1	9q32-q33.3	2008-02-05			ENSG00000095303	ENSG00000095303	1.14.99.1		9604	protein-coding gene	gene with protein product		176805				2512924, 1907252	Standard	NM_000962		Approved	COX1, PGHS-1, PTGHS	uc004bmg.2	P23219	OTTHUMG00000020605	ENST00000362012.2:c.1259C>A	9.37:g.125148974C>A	ENSP00000354612:p.Ala420Asp		Somatic				PTGS1_uc011lys.1_Intron|PTGS1_uc010mwb.1_Intron|PTGS1_uc004bmf.1_Intron|PTGS1_uc004bmh.1_Missense_Mutation_p.A311D|PTGS1_uc011lyt.1_Missense_Mutation_p.A311D	p.A420D	NM_000962	NP_000953	WXS	Illumina HiSeq	Unspecified	P23219	PGH1_HUMAN			9	1394	+			420					A8K1V7|B4DHQ2|B4E2S5|Q15122|Q3HY28|Q3HY29|Q5T7T6|Q5T7T7|Q5T7T8	Missense_Mutation	SNP	ENST00000362012.2	37	c.1259C>A	CCDS6842.1	.	.	.	.	.	.	.	.	.	.	C	12.22	1.872781	0.33069	.	.	ENSG00000095303	ENST00000362012;ENST00000373698	T;T	0.09163	3.01;3.01	5.17	5.17	0.71159	.	0.159263	0.56097	D	0.000029	T	0.14485	0.0350	L	0.56769	1.78	0.48185	D	0.999607	B	0.18863	0.031	B	0.23275	0.045	T	0.06789	-1.0807	10	0.20046	T	0.44	-24.0069	17.6819	0.88246	0.0:1.0:0.0:0.0	.	420	P23219	PGH1_HUMAN	D	420;311	ENSP00000354612:A420D;ENSP00000362802:A311D	ENSP00000354612:A420D	A	+	2	0	PTGS1	124188795	0.844000	0.29557	1.000000	0.80357	0.936000	0.57629	1.685000	0.37659	2.403000	0.81681	0.655000	0.94253	GCC		0.607	PTGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053933.1			28	42	1	0	8.24728e-16	0.004656	1.90885e-15	28	42				
DENND1A	57706	broad.mit.edu	37	9	126214567	126214567	+	Silent	SNP	A	A	C			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr9:126214567A>C	ENST00000373624.2	-	17	1488	c.1287T>G	c.(1285-1287)acT>acG	p.T429T	DENND1A_ENST00000473039.1_5'UTR|DENND1A_ENST00000373618.1_Silent_p.T397T|DENND1A_ENST00000394215.2_Silent_p.T399T|DENND1A_ENST00000394219.3_Silent_p.T397T|DENND1A_ENST00000373620.3_Silent_p.T429T|DENND1A_ENST00000542603.1_Silent_p.T171T	NM_020946.1	NP_065997.1	Q8TEH3	DEN1A_HUMAN	DENN/MADD domain containing 1A	429					endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)|regulation of Rab protein signal transduction (GO:0032483)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|clathrin-coated vesicle (GO:0030136)|clathrin-coated vesicle membrane (GO:0030665)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.T429T(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|liver(2)|lung(18)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43						ACTTGTAGACAGTCTTCATGG	0.378																																							uc004bnz.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(1285-1287)ACT>ACG		DENN/MADD domain containing 1A isoform 1							178.0	151.0	160.0					9																	126214567		2203	4300	6503	SO:0001819	synonymous_variant	57706					cell junction|clathrin coated vesicle membrane|presynaptic membrane	guanyl-nucleotide exchange factor activity	g.chr9:126214567A>C	AB046828	CCDS35133.1, CCDS35134.1	9q34.11	2012-10-03	2005-08-17	2005-08-17	ENSG00000119522	ENSG00000119522		"""DENN/MADD domain containing"""	29324	protein-coding gene	gene with protein product		613633	"""KIAA1608"""	KIAA1608		10997877	Standard	XM_005252109		Approved	FLJ21129, FAM31A	uc004bnz.1	Q8TEH3	OTTHUMG00000020643	ENST00000373624.2:c.1287T>G	9.37:g.126214567A>C			Somatic				DENND1A_uc011lzl.1_Silent_p.T204T|DENND1A_uc004bny.1_Silent_p.T168T|DENND1A_uc011lzm.1_Silent_p.T397T|DENND1A_uc004boa.1_Silent_p.T429T|DENND1A_uc004bob.1_Silent_p.T399T|DENND1A_uc004boc.2_Silent_p.T397T	p.T429T	NM_020946	NP_065997	WXS	Illumina HiSeq	Unspecified	Q8TEH3	DEN1A_HUMAN			17	1520	-			429					A8MZA3|B1AM80|B7Z3C8|B7Z669|D3PFD3|Q05C88|Q5VWF0|Q6PJZ5|Q8IVD6|Q9H796	Silent	SNP	ENST00000373624.2	37	c.1287T>G	CCDS35133.1																																																																																				0.378	DENND1A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053997.1	NM_024820		6	58	0	0	0	0.001984	0	6	58				
MXRA5	25878	broad.mit.edu	37	X	3228256	3228256	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chrX:3228256C>G	ENST00000217939.6	-	7	8142	c.7988G>C	c.(7987-7989)gGg>gCg	p.G2663A		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	2663	Ig-like C2-type 11.					extracellular vesicular exosome (GO:0070062)		p.G2663A(2)		NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				CTGCCCAGCCCCGGGAGGGGT	0.592																																							uc004crg.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(5)|lung(1)|central_nervous_system(1)|skin(1)	8						c.(7987-7989)GGG>GCG		adlican precursor							57.0	56.0	56.0					X																	3228256		2203	4300	6503	SO:0001583	missense	25878					extracellular region		g.chrX:3228256C>G	AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.7988G>C	X.37:g.3228256C>G	ENSP00000217939:p.Gly2663Ala		Somatic					p.G2663A	NM_015419	NP_056234	WXS	Illumina HiSeq	Unspecified	Q9NR99	MXRA5_HUMAN			7	8145	-		all_lung(23;0.00031)|Lung NSC(23;0.000946)	2663			Ig-like C2-type 11.		Q6P1M7|Q9Y3Y8	Missense_Mutation	SNP	ENST00000217939.6	37	c.7988G>C	CCDS14124.1	.	.	.	.	.	.	.	.	.	.	C	0.041	-1.284865	0.01398	.	.	ENSG00000101825	ENST00000381114;ENST00000217939	T	0.35973	1.28	4.47	3.59	0.41128	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.40818	U	0.001009	T	0.39384	0.1076	M	0.72624	2.21	0.09310	N	1	B	0.15930	0.015	B	0.18561	0.022	T	0.35475	-0.9787	10	0.51188	T	0.08	.	13.6992	0.62597	0.0:0.5927:0.4073:0.0	.	2663	Q9NR99	MXRA5_HUMAN	A	2663	ENSP00000217939:G2663A	ENSP00000217939:G2663A	G	-	2	0	MXRA5	3238256	0.001000	0.12720	0.002000	0.10522	0.011000	0.07611	1.355000	0.34068	0.672000	0.31204	0.597000	0.82753	GGG		0.592	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055655.2	NM_015419		30	76	0	0	0	0.003271	0	30	76				
MXRA5	25878	broad.mit.edu	37	X	3242605	3242605	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chrX:3242605T>C	ENST00000217939.6	-	5	1275	c.1121A>G	c.(1120-1122)tAt>tGt	p.Y374C		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	374						extracellular vesicular exosome (GO:0070062)		p.Y374C(2)		NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				TAGCTTTTCATAGTTTTCTCG	0.438																																							uc004crg.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(5)|lung(1)|central_nervous_system(1)|skin(1)	8						c.(1120-1122)TAT>TGT		adlican precursor							78.0	64.0	69.0					X																	3242605		2203	4300	6503	SO:0001583	missense	25878					extracellular region		g.chrX:3242605T>C	AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.1121A>G	X.37:g.3242605T>C	ENSP00000217939:p.Tyr374Cys		Somatic					p.Y374C	NM_015419	NP_056234	WXS	Illumina HiSeq	Unspecified	Q9NR99	MXRA5_HUMAN			5	1278	-		all_lung(23;0.00031)|Lung NSC(23;0.000946)	374					Q6P1M7|Q9Y3Y8	Missense_Mutation	SNP	ENST00000217939.6	37	c.1121A>G	CCDS14124.1	.	.	.	.	.	.	.	.	.	.	T	10.79	1.448745	0.26074	.	.	ENSG00000101825	ENST00000381114;ENST00000217939	T	0.70516	-0.49	3.47	3.47	0.39725	.	0.000000	0.34932	U	0.003572	T	0.79736	0.4497	M	0.76574	2.34	0.28144	N	0.929684	D	0.89917	1.0	D	0.74023	0.982	T	0.70407	-0.4880	10	0.40728	T	0.16	.	7.5749	0.27931	0.1931:0.0:0.0:0.8069	.	374	Q9NR99	MXRA5_HUMAN	C	374	ENSP00000217939:Y374C	ENSP00000217939:Y374C	Y	-	2	0	MXRA5	3252605	1.000000	0.71417	0.021000	0.16686	0.176000	0.22953	4.861000	0.62969	1.109000	0.41680	0.347000	0.21830	TAT		0.438	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055655.2	NM_015419		16	21	0	0	0	0.004007	0	16	21				
KDM5C	8242	broad.mit.edu	37	X	53245284	53245284	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chrX:53245284C>G	ENST00000375401.3	-	6	1285	c.753G>C	c.(751-753)atG>atC	p.M251I	KDM5C_ENST00000452825.3_Missense_Mutation_p.M184I|KDM5C_ENST00000375379.3_Missense_Mutation_p.M251I|KDM5C_ENST00000375383.3_Missense_Mutation_p.M210I|KDM5C_ENST00000404049.3_Missense_Mutation_p.M250I|KDM5C-IT1_ENST00000412242.1_RNA	NM_001282622.1|NM_004187.3	NP_001269551.1|NP_004178.2	P41229	KDM5C_HUMAN	lysine (K)-specific demethylase 5C	251					histone H3-K4 demethylation (GO:0034720)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-K4 specific) (GO:0032453)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)	p.M251I(1)|p.M184I(1)		autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(30)|large_intestine(9)|lung(17)|oesophagus(1)|ovary(6)|prostate(1)|salivary_gland(1)|skin(1)|upper_aerodigestive_tract(2)	82						TGTCTTTGGCCATGAGGCCCA	0.552			"""N, F, S"""		clear cell renal carcinoma																																		uc004drz.2		NA		Rec	yes		X	Xp11.22-p11.21	8242	N|F|S	lysine (K)-specific demethylase 5C (JARID1C)			E			clear cell renal carcinoma		2	Substitution - Missense(2)		lung(2)	kidney(9)|ovary(5)|salivary_gland(1)|autonomic_ganglia(1)|haematopoietic_and_lymphoid_tissue(1)|oesophagus(1)	18						c.(751-753)ATG>ATC		jumonji, AT rich interactive domain 1C isoform							121.0	108.0	112.0					X																	53245284		2203	4300	6503	SO:0001583	missense	8242				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|zinc ion binding	g.chrX:53245284C>G	Z29650	CCDS14351.1, CCDS55417.1, CCDS65269.1	Xp11.22-p11.21	2014-01-31	2009-04-06	2009-04-06	ENSG00000126012	ENSG00000126012		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	11114	protein-coding gene	gene with protein product		314690	"""Jumonji, AT rich interactive domain 1C (RBP2-like)"", ""Smcy homolog, X-linked (mouse)"", ""jumonji, AT rich interactive domain 1C"", ""mental retardation, X-linked 13"""	SMCX, JARID1C, MRX13		7951230, 8162017, 19826449	Standard	NM_004187		Approved	DXS1272E, XE169	uc004drz.3	P41229	OTTHUMG00000021606	ENST00000375401.3:c.753G>C	X.37:g.53245284C>G	ENSP00000364550:p.Met251Ile		Somatic				KDM5C_uc011moc.1_RNA|KDM5C_uc011mod.1_Missense_Mutation_p.M184I|KDM5C_uc004dsa.2_Missense_Mutation_p.M250I	p.M251I	NM_004187	NP_004178	WXS	Illumina HiSeq	Unspecified	P41229	KDM5C_HUMAN			6	1286	-			251					B0QZ44|B4E3I2|F5H3T1|Q5JUX3|Q5JUX4|Q5JUX5|Q7Z5S5	Missense_Mutation	SNP	ENST00000375401.3	37	c.753G>C	CCDS14351.1	.	.	.	.	.	.	.	.	.	.	C	5.890	0.348264	0.11126	.	.	ENSG00000126012	ENST00000452825;ENST00000375401;ENST00000404049;ENST00000375379;ENST00000375383	D;D;D;D;D	0.85773	-2.03;-1.74;-1.74;-1.75;-1.88	5.25	5.25	0.73442	.	0.096626	0.64402	D	0.000001	D	0.83450	0.5257	M	0.69823	2.125	0.33837	D	0.630972	B;B;B	0.28552	0.203;0.128;0.215	B;B;B	0.28784	0.094;0.04;0.062	D	0.84173	0.0435	10	0.17832	T	0.49	-16.3234	15.2151	0.73258	0.0:1.0:0.0:0.0	.	184;250;251	F5H3T1;B0QZ44;P41229	.;.;KDM5C_HUMAN	I	184;251;250;251;210	ENSP00000445176:M184I;ENSP00000364550:M251I;ENSP00000385394:M250I;ENSP00000364528:M251I;ENSP00000364532:M210I	ENSP00000364528:M251I	M	-	3	0	KDM5C	53262009	0.987000	0.35691	1.000000	0.80357	0.980000	0.70556	0.286000	0.18902	2.182000	0.69389	0.529000	0.55759	ATG		0.552	KDM5C-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056737.2	NM_004187		3	97	0	0	0	0.004672	0	3	97				
ITIH6	347365	broad.mit.edu	37	X	54817333	54817333	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chrX:54817333C>A	ENST00000218436.6	-	4	582	c.553G>T	c.(553-555)Ggc>Tgc	p.G185C	ITIH6_ENST00000498398.1_5'Flank	NM_198510.2	NP_940912.1	Q6UXX5	ITIH6_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 6	185					hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.G185C(1)									TAGGAGATGCCTGTCCTTTCT	0.587																																							uc004dtj.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)|skin(2)|ovary(1)|breast(1)	6						c.(553-555)GGC>TGC		inter-alpha (globulin) inhibitor H5-like							139.0	100.0	114.0					X																	54817333		2203	4300	6503	SO:0001583	missense	347365				hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity	g.chrX:54817333C>A	AY358170	CCDS14361.1	Xp11.22-p11.21	2011-10-26	2011-10-26	2011-10-26	ENSG00000102313	ENSG00000102313			28907	protein-coding gene	gene with protein product			"""inter-alpha (globulin) inhibitor H5-like"""	ITIH5L		12975309	Standard	NM_198510		Approved	UNQ6369	uc004dtj.2	Q6UXX5	OTTHUMG00000021634	ENST00000218436.6:c.553G>T	X.37:g.54817333C>A	ENSP00000218436:p.Gly185Cys		Somatic					p.G185C	NM_198510	NP_940912	WXS	Illumina HiSeq	Unspecified	Q6UXX5	ITH5L_HUMAN			4	583	-			185					A6NN03	Missense_Mutation	SNP	ENST00000218436.6	37	c.553G>T	CCDS14361.1	.	.	.	.	.	.	.	.	.	.	C	16.86	3.240063	0.58995	.	.	ENSG00000102313	ENST00000218436	T	0.03386	3.95	4.97	4.1	0.47936	.	0.000000	0.64402	U	0.000001	T	0.06917	0.0176	M	0.77486	2.375	0.40794	D	0.983289	P	0.38863	0.65	B	0.34590	0.186	T	0.07462	-1.0771	10	0.87932	D	0	.	11.6478	0.51271	0.0:0.9089:0.0:0.0911	.	185	Q6UXX5	ITH5L_HUMAN	C	185	ENSP00000218436:G185C	ENSP00000218436:G185C	G	-	1	0	ITIH5L	54834058	1.000000	0.71417	0.674000	0.29902	0.540000	0.34992	4.774000	0.62339	0.895000	0.36342	0.476000	0.43555	GGC		0.587	ITIH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056814.2	NM_198510		28	37	1	0	4.59853e-10	0.005443	8.97808e-10	28	37				
MTMR8	55613	broad.mit.edu	37	X	63490911	63490911	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chrX:63490911C>A	ENST00000374852.3	-	13	1591	c.1524G>T	c.(1522-1524)caG>caT	p.Q508H	MTMR8_ENST00000453546.1_Intron	NM_017677.3	NP_060147.2	Q96EF0	MTMR8_HUMAN	myotubularin related protein 8	508						nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)	p.0?(2)|p.Q508H(1)		breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(2)|skin(3)	37						TCTGCTTGGGCTGCAGCCCTT	0.448																																							uc004dvs.2		NA																	3	Whole gene deletion(2)|Substitution - Missense(1)		ovary(1)|lung(1)|large_intestine(1)	ovary(2)|breast(2)	4						c.(1522-1524)CAG>CAT		myotubularin related protein 8							67.0	56.0	60.0					X																	63490911		2203	4300	6503	SO:0001583	missense	55613					nuclear envelope	protein tyrosine phosphatase activity	g.chrX:63490911C>A	AK000133	CCDS14379.1	Xq11.2-q12	2013-01-11			ENSG00000102043	ENSG00000102043		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	16825	protein-coding gene	gene with protein product						11275328	Standard	NM_017677		Approved	FLJ20126	uc004dvs.3	Q96EF0	OTTHUMG00000021707	ENST00000374852.3:c.1524G>T	X.37:g.63490911C>A	ENSP00000363985:p.Gln508His		Somatic				MTMR8_uc011mou.1_Intron	p.Q508H	NM_017677	NP_060147	WXS	Illumina HiSeq	Unspecified	Q96EF0	MTMR8_HUMAN			13	1592	-			508					Q5JT99|Q9NXP6	Missense_Mutation	SNP	ENST00000374852.3	37	c.1524G>T	CCDS14379.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	0.035|0.035	-1.313103|-1.313103	0.01331|0.01331	.|.	.|.	ENSG00000102043|ENSG00000102043	ENST00000442913|ENST00000374852;ENST00000247400	.|D	.|0.94184	.|-3.37	3.75|3.75	-4.23|-4.23	0.03789|0.03789	.|.	.|0.140687	.|0.28354	.|U	.|0.015647	T|T	0.73690|0.73690	0.3619|0.3619	N|N	0.02539|0.02539	-0.55|-0.55	0.54753|0.54753	D|D	0.999986|0.999986	.|B	.|0.02656	.|0.0	.|B	.|0.04013	.|0.001	T|T	0.64170|0.64170	-0.6470|-0.6470	5|10	.|0.02654	.|T	.|1	.|.	7.6459|7.6459	0.28321|0.28321	0.0:0.1718:0.5747:0.2536|0.0:0.1718:0.5747:0.2536	.|.	.|508	.|Q96EF0	.|MTMR8_HUMAN	S|H	312|508;394	.|ENSP00000363985:Q508H	.|ENSP00000247400:Q394H	A|Q	-|-	1|3	0|2	MTMR8|MTMR8	63407636|63407636	0.630000|0.630000	0.27155|0.27155	0.021000|0.021000	0.16686|0.16686	0.023000|0.023000	0.10783|0.10783	-1.036000|-1.036000	0.03560|0.03560	-0.702000|-0.702000	0.05056|0.05056	-0.390000|-0.390000	0.06520|0.06520	GCC|CAG		0.448	MTMR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056949.2	NM_017677		13	24	1	0	9.31168e-06	0.001855	1.58602e-05	13	24				
TEX11	56159	broad.mit.edu	37	X	70080747	70080747	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chrX:70080747G>T	ENST00000395889.2	-	6	484	c.329C>A	c.(328-330)gCc>gAc	p.A110D	TEX11_ENST00000344304.3_Missense_Mutation_p.A110D|TEX11_ENST00000374333.2_Missense_Mutation_p.A95D	NM_001003811.1	NP_001003811.1	Q8IYF3	TEX11_HUMAN	testis expressed 11	110					chiasma assembly (GO:0051026)|fertilization (GO:0009566)|male gonad development (GO:0008584)|male meiosis chromosome segregation (GO:0007060)|meiotic gene conversion (GO:0006311)|negative regulation of apoptotic process (GO:0043066)|reciprocal meiotic recombination (GO:0007131)|resolution of meiotic recombination intermediates (GO:0000712)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)		p.A95D(1)		breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(12)|lung(13)|ovary(3)|prostate(3)|skin(3)	48	Renal(35;0.156)					GGCAAATGAGGCTTCACACAT	0.338																																							uc004dyl.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|breast(1)|skin(1)	5						c.(328-330)GCC>GAC		testis expressed sequence 11 isoform 1							120.0	90.0	100.0					X																	70080747		2203	4300	6503	SO:0001583	missense	56159						protein binding	g.chrX:70080747G>T	AF285594	CCDS35323.1, CCDS43968.1	Xp11	2008-02-05	2007-03-13		ENSG00000120498	ENSG00000120498			11733	protein-coding gene	gene with protein product		300311	"""testis expressed sequence 11"""			11279525	Standard	NM_001003811		Approved	TSGA3, TGC1	uc004dyl.3	Q8IYF3	OTTHUMG00000021782	ENST00000395889.2:c.329C>A	X.37:g.70080747G>T	ENSP00000379226:p.Ala110Asp		Somatic				TEX11_uc004dym.2_Missense_Mutation_p.A95D	p.A110D	NM_001003811	NP_001003811	WXS	Illumina HiSeq	Unspecified	Q8IYF3	TEX11_HUMAN			6	491	-	Renal(35;0.156)		110					A8K8V6|Q5JQQ8|Q96LZ4|Q96M47|Q9BXU6	Missense_Mutation	SNP	ENST00000395889.2	37	c.329C>A	CCDS35323.1	.	.	.	.	.	.	.	.	.	.	G	1.540	-0.542062	0.04053	.	.	ENSG00000120498	ENST00000374333;ENST00000395889;ENST00000344304	T;T;T	0.32753	1.44;1.44;1.44	4.83	-5.68	0.02436	.	1.636830	0.03341	N	0.194746	T	0.11707	0.0285	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.12993	-1.0526	9	.	.	.	12.6307	0.4574	0.00511	0.3041:0.1553:0.2903:0.2504	.	95;110	Q8IYF3-3;Q8IYF3	.;TEX11_HUMAN	D	95;110;110	ENSP00000363453:A95D;ENSP00000379226:A110D;ENSP00000340995:A110D	.	A	-	2	0	TEX11	69997472	0.000000	0.05858	0.000000	0.03702	0.102000	0.19082	-0.543000	0.06084	-2.203000	0.00744	-0.397000	0.06425	GCC		0.338	TEX11-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359072.1			9	32	1	0	1.12685e-05	0.004482	1.908e-05	9	32				
CDX4	1046	broad.mit.edu	37	X	72667475	72667475	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chrX:72667475C>T	ENST00000373514.2	+	1	386	c.386C>T	c.(385-387)cCa>cTa	p.P129L		NM_005193.1	NP_005184.1	O14627	CDX4_HUMAN	caudal type homeobox 4	129					anterior/posterior pattern specification (GO:0009952)|blood vessel development (GO:0001568)|labyrinthine layer development (GO:0060711)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.P129L(1)		endometrium(4)|kidney(1)|large_intestine(1)|lung(11)|skin(1)	18	Renal(35;0.156)					AGCAGCCTACCAGGCCAGGCT	0.682																																							uc011mqk.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(385-387)CCA>CTA		caudal type homeobox 4							16.0	17.0	17.0					X																	72667475		2203	4294	6497	SO:0001583	missense	1046					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chrX:72667475C>T	AF029879	CCDS14424.1	Xq13.2	2012-03-09	2007-07-09		ENSG00000131264	ENSG00000131264		"""Homeoboxes / ANTP class : HOXL subclass"""	1808	protein-coding gene	gene with protein product		300025	"""caudal type homeo box transcription factor 4"""			7655457	Standard	NM_005193		Approved		uc011mqk.2	O14627	OTTHUMG00000021831	ENST00000373514.2:c.386C>T	X.37:g.72667475C>T	ENSP00000362613:p.Pro129Leu		Somatic					p.P129L	NM_005193	NP_005184	WXS	Illumina HiSeq	Unspecified	O14627	CDX4_HUMAN			1	386	+	Renal(35;0.156)		129					A1A513|Q5JS20	Missense_Mutation	SNP	ENST00000373514.2	37	c.386C>T	CCDS14424.1	.	.	.	.	.	.	.	.	.	.	.	5.207	0.223709	0.09863	.	.	ENSG00000131264	ENST00000373514	T	0.44482	0.92	2.32	1.39	0.22231	Caudal-like activation domain (1);	0.364082	0.25762	N	0.028467	T	0.26593	0.0650	N	0.08118	0	0.46849	D	0.999224	P	0.52577	0.954	P	0.51701	0.677	T	0.04029	-1.0983	10	0.30854	T	0.27	-1.8064	5.4575	0.16598	0.3293:0.6707:0.0:0.0	.	129	O14627	CDX4_HUMAN	L	129	ENSP00000362613:P129L	ENSP00000362613:P129L	P	+	2	0	CDX4	72584200	0.994000	0.37717	0.011000	0.14972	0.069000	0.16628	2.632000	0.46511	0.379000	0.24794	0.432000	0.28606	CCA		0.682	CDX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057229.2	NM_005193		12	13	0	0	0	0.000978	0	12	13				
ZDHHC15	158866	broad.mit.edu	37	X	74742811	74742811	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chrX:74742811G>A	ENST00000373367.3	-	1	279	c.49C>T	c.(49-51)Cgc>Tgc	p.R17C	ZDHHC15_ENST00000482827.1_5'UTR|ZDHHC15_ENST00000373361.3_Missense_Mutation_p.R17C|ZDHHC15_ENST00000541184.1_Missense_Mutation_p.R17C	NM_144969.2	NP_659406.1	Q96MV8	ZDH15_HUMAN	zinc finger, DHHC-type containing 15	17					establishment of protein localization (GO:0045184)|protein palmitoylation (GO:0018345)|synaptic vesicle maturation (GO:0016188)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)	p.R17C(1)		central_nervous_system(2)|endometrium(3)|large_intestine(5)|liver(1)|lung(11)|ovary(2)|skin(2)	26						AGTACCCGGCGGCAGCACCGC	0.632																																							uc004ecg.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(49-51)CGC>TGC		zinc finger, DHHC-type containing 15 isoform 1							73.0	59.0	64.0					X																	74742811		2203	4300	6503	SO:0001583	missense	158866					integral to membrane	zinc ion binding	g.chrX:74742811G>A	AK056374	CCDS14430.1, CCDS55454.1	Xq13.3	2008-05-02			ENSG00000102383	ENSG00000102383		"""Zinc fingers, DHHC-type"""	20342	protein-coding gene	gene with protein product		300576					Standard	NM_144969		Approved	FLJ31812, MRX91	uc004ecg.3	Q96MV8	OTTHUMG00000021866	ENST00000373367.3:c.49C>T	X.37:g.74742811G>A	ENSP00000362465:p.Arg17Cys		Somatic				ZDHHC15_uc004ech.2_Missense_Mutation_p.R17C|ZDHHC15_uc011mqo.1_RNA|ZDHHC15_uc004eci.2_Missense_Mutation_p.R17C	p.R17C	NM_144969	NP_659406	WXS	Illumina HiSeq	Unspecified	Q96MV8	ZDH15_HUMAN			1	527	-			17					B3KVG7|Q3SY30|Q6UWH3	Missense_Mutation	SNP	ENST00000373367.3	37	c.49C>T	CCDS14430.1	.	.	.	.	.	.	.	.	.	.	G	23.6	4.440549	0.83993	.	.	ENSG00000102383	ENST00000373367;ENST00000541184;ENST00000373361	T;T;T	0.76968	0.89;1.14;-1.06	5.5	5.5	0.81552	.	0.055105	0.85682	D	0.000000	T	0.82001	0.4942	L	0.34521	1.04	0.54753	D	0.999985	D;D;D	0.89917	1.0;0.981;0.989	D;P;P	0.72338	0.977;0.608;0.676	T	0.81885	-0.0727	10	0.41790	T	0.15	-2.5176	15.6857	0.77409	0.0:0.0:1.0:0.0	.	17;17;17	Q96MV8-2;B3KVG7;Q96MV8	.;.;ZDH15_HUMAN	C	17	ENSP00000362465:R17C;ENSP00000445420:R17C;ENSP00000362459:R17C	ENSP00000362459:R17C	R	-	1	0	ZDHHC15	74659536	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	8.045000	0.89436	2.300000	0.77407	0.529000	0.55759	CGC		0.632	ZDHHC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057283.1	NM_144969		7	23	0	0	0	0.00308	0	7	23				
PABPC5	140886	broad.mit.edu	37	X	90691248	90691248	+	Silent	SNP	A	A	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chrX:90691248A>T	ENST00000312600.3	+	2	886	c.672A>T	c.(670-672)ccA>ccT	p.P224P	PABPC5-AS1_ENST00000456187.1_RNA|PABPC5_ENST00000373105.1_Silent_p.P60P	NM_080832.2	NP_543022.1	Q96DU9	PABP5_HUMAN	poly(A) binding protein, cytoplasmic 5	224	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.					mitochondrion (GO:0005739)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.P224P(1)		central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(20)|ovary(1)|pancreas(1)	42						AATATGGGCCAACTGAGAGTG	0.418																																							uc004efg.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|lung(1)|pancreas(1)	3						c.(670-672)CCA>CCT		poly(A) binding protein, cytoplasmic 5							57.0	59.0	58.0					X																	90691248		2203	4300	6503	SO:0001819	synonymous_variant	140886					cytoplasm	nucleotide binding|RNA binding	g.chrX:90691248A>T	AJ278963	CCDS14460.1	Xq21.3	2013-02-12	2001-11-28		ENSG00000174740	ENSG00000174740		"""RNA binding motif (RRM) containing"""	13629	protein-coding gene	gene with protein product		300407	"""poly(A)-binding protein, cytoplasmic 5"""			11374897	Standard	NM_080832		Approved	PABP5	uc004efg.3	Q96DU9	OTTHUMG00000021959	ENST00000312600.3:c.672A>T	X.37:g.90691248A>T			Somatic				PABPC5_uc004eff.1_Silent_p.P60P	p.P224P	NM_080832	NP_543022	WXS	Illumina HiSeq	Unspecified	Q96DU9	PABP5_HUMAN			2	1112	+			224			RRM 3.		A8K240|Q5JQF4|Q6P529|Q9UFE5	Silent	SNP	ENST00000312600.3	37	c.672A>T	CCDS14460.1																																																																																				0.418	PABPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057429.1	NM_080832		25	40	0	0	0	0.005443	0	25	40				
COL4A6	1288	broad.mit.edu	37	X	107457416	107457416	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chrX:107457416C>A	ENST00000372216.4	-	6	470	c.370G>T	c.(370-372)Gat>Tat	p.D124Y	COL4A6_ENST00000394872.2_Missense_Mutation_p.D122Y|COL4A6_ENST00000545689.1_Missense_Mutation_p.D123Y|COL4A6_ENST00000334504.7_Missense_Mutation_p.D123Y|COL4A6_ENST00000538570.1_Missense_Mutation_p.D123Y	NM_001847.2	NP_001838.2	Q14031	CO4A6_HUMAN	collagen, type IV, alpha 6	124	Triple-helical region.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)	p.D123Y(1)		breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(41)|ovary(7)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	92						TTACAGCCATCCAGACCAGGT	0.512									Alport syndrome with Diffuse Leiomyomatosis																												Melanoma(87;1895 1945 2589 7165)	Melanoma(87;1895 1945 2589 7165)	uc004enw.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|urinary_tract(1)|large_intestine(1)	8						c.(370-372)GAT>TAT		type IV alpha 6 collagen isoform A precursor							97.0	85.0	89.0					X																	107457416		2203	4300	6503	SO:0001583	missense	1288	Alport_syndrome_with_Diffuse_Leiomyomatosis	Familial Cancer Database		cell adhesion|extracellular matrix organization	collagen type IV	extracellular matrix structural constituent|protein binding	g.chrX:107457416C>A	U04845	CCDS14541.1, CCDS14542.1, CCDS76008.1, CCDS76009.1, CCDS76010.1	Xq22	2014-09-17			ENSG00000197565	ENSG00000197565		"""Collagens"""	2208	protein-coding gene	gene with protein product		303631				8356449	Standard	NM_033641		Approved		uc004env.4	Q14031	OTTHUMG00000022179	ENST00000372216.4:c.370G>T	X.37:g.107457416C>A	ENSP00000361290:p.Asp124Tyr		Somatic				COL4A6_uc004env.3_Missense_Mutation_p.D123Y|COL4A6_uc011msn.1_Missense_Mutation_p.D123Y|COL4A6_uc010npk.2_Missense_Mutation_p.D123Y	p.D124Y	NM_001847	NP_001838	WXS	Illumina HiSeq	Unspecified	Q14031	CO4A6_HUMAN			6	473	-			124			Triple-helical region.		Q12823|Q14053|Q5JYH6|Q5JYH8|Q9NQM5|Q9NTX3|Q9UJ76|Q9UMG6|Q9Y4L4	Missense_Mutation	SNP	ENST00000372216.4	37	c.370G>T	CCDS14541.1	.	.	.	.	.	.	.	.	.	.	C	13.45	2.240889	0.39598	.	.	ENSG00000197565	ENST00000372216;ENST00000334504;ENST00000394872;ENST00000541389;ENST00000545689;ENST00000538570	D;D;D;D;D	0.94330	-3.4;-3.4;-3.26;-3.4;-3.4	4.92	4.92	0.64577	.	0.000000	0.41938	D	0.000786	D	0.97309	0.9120	M	0.93016	3.37	0.44611	D	0.997583	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	D	0.98081	1.0404	10	0.72032	D	0.01	.	14.6254	0.68616	0.0:1.0:0.0:0.0	.	123;123;124;123	F5H851;F5H3Q5;Q14031;Q14031-2	.;.;CO4A6_HUMAN;.	Y	124;123;122;123;123;123	ENSP00000361290:D124Y;ENSP00000334733:D123Y;ENSP00000378340:D122Y;ENSP00000443707:D123Y;ENSP00000445236:D123Y	ENSP00000334733:D123Y	D	-	1	0	COL4A6	107344072	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	5.196000	0.65136	2.360000	0.80028	0.506000	0.49869	GAT		0.512	COL4A6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057875.2			21	67	1	0	1.96292e-10	0.001523	3.84545e-10	21	67				
RGAG1	57529	broad.mit.edu	37	X	109695218	109695218	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chrX:109695218C>A	ENST00000465301.2	+	3	1619	c.1373C>A	c.(1372-1374)aCa>aAa	p.T458K	RGAG1_ENST00000540313.1_Missense_Mutation_p.T458K	NM_020769.2	NP_065820.1	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1	458								p.T458K(1)		NS(1)|autonomic_ganglia(1)|breast(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	73						ATGTCAGCCACAGCCTCTAGA	0.498																																							uc004eor.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)|upper_aerodigestive_tract(1)|ovary(1)	4						c.(1372-1374)ACA>AAA		retrotransposon gag domain containing 1							151.0	133.0	139.0					X																	109695218		2203	4300	6503	SO:0001583	missense	57529							g.chrX:109695218C>A	AY121804	CCDS14552.1	Xq23	2008-02-05			ENSG00000243978	ENSG00000243978			29245	protein-coding gene	gene with protein product						10718198, 15716091, 16093683	Standard	NM_020769		Approved	KIAA1318, Mart9, Mar9	uc004eor.2	Q8NET4	OTTHUMG00000022196	ENST00000465301.2:c.1373C>A	X.37:g.109695218C>A	ENSP00000419786:p.Thr458Lys		Somatic				RGAG1_uc011msr.1_Missense_Mutation_p.T458K	p.T458K	NM_020769	NP_065820	WXS	Illumina HiSeq	Unspecified	Q8NET4	RGAG1_HUMAN			3	1619	+			458					Q9P2M8	Missense_Mutation	SNP	ENST00000465301.2	37	c.1373C>A	CCDS14552.1	.	.	.	.	.	.	.	.	.	.	C	14.72	2.620085	0.46736	.	.	ENSG00000243978	ENST00000465301;ENST00000540313;ENST00000540483	T;T	0.52057	0.68;0.68	3.97	3.1	0.35709	.	0.237399	0.21880	N	0.067751	T	0.50769	0.1635	L	0.58101	1.795	0.09310	N	1	D	0.56746	0.977	P	0.53593	0.73	T	0.37911	-0.9685	9	.	.	.	-2.4085	6.7182	0.23314	0.0:0.8693:0.0:0.1307	.	458	Q8NET4	RGAG1_HUMAN	K	458	ENSP00000419786:T458K;ENSP00000441452:T458K	.	T	+	2	0	RGAG1	109581874	0.000000	0.05858	0.001000	0.08648	0.055000	0.15305	0.823000	0.27366	1.019000	0.39547	0.544000	0.68410	ACA		0.498	RGAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057906.2	NM_020769		26	171	1	0	2.44723e-14	0.004656	5.36149e-14	26	171				
RGAG1	57529	broad.mit.edu	37	X	109696443	109696443	+	Silent	SNP	A	A	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chrX:109696443A>T	ENST00000465301.2	+	3	2844	c.2598A>T	c.(2596-2598)ccA>ccT	p.P866P	RGAG1_ENST00000540313.1_Silent_p.P866P	NM_020769.2	NP_065820.1	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1	866								p.P866P(1)		NS(1)|autonomic_ganglia(1)|breast(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	73						TGAGAGCCCCAGACTCTAGAG	0.557																																							uc004eor.1		NA																	1	Substitution - coding silent(1)		lung(1)	lung(2)|upper_aerodigestive_tract(1)|ovary(1)	4						c.(2596-2598)CCA>CCT		retrotransposon gag domain containing 1							159.0	147.0	151.0					X																	109696443		2203	4300	6503	SO:0001819	synonymous_variant	57529							g.chrX:109696443A>T	AY121804	CCDS14552.1	Xq23	2008-02-05			ENSG00000243978	ENSG00000243978			29245	protein-coding gene	gene with protein product						10718198, 15716091, 16093683	Standard	NM_020769		Approved	KIAA1318, Mart9, Mar9	uc004eor.2	Q8NET4	OTTHUMG00000022196	ENST00000465301.2:c.2598A>T	X.37:g.109696443A>T			Somatic				RGAG1_uc011msr.1_Silent_p.P866P	p.P866P	NM_020769	NP_065820	WXS	Illumina HiSeq	Unspecified	Q8NET4	RGAG1_HUMAN			3	2844	+			866					Q9P2M8	Silent	SNP	ENST00000465301.2	37	c.2598A>T	CCDS14552.1																																																																																				0.557	RGAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057906.2	NM_020769		69	175	0	0	0	0.00361	0	69	175				
CAPN6	827	broad.mit.edu	37	X	110489966	110489966	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chrX:110489966A>T	ENST00000324068.1	-	13	1932	c.1765T>A	c.(1765-1767)Tgt>Agt	p.C589S	CAPN6_ENST00000541758.1_Missense_Mutation_p.C334S	NM_014289.3	NP_055104.2	Q9Y6Q1	CAN6_HUMAN	calpain 6	589	C2.				microtubule bundle formation (GO:0001578)|proteolysis (GO:0006508)|regulation of cytoskeleton organization (GO:0051493)	perinuclear region of cytoplasm (GO:0048471)|spindle microtubule (GO:0005876)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|microtubule binding (GO:0008017)	p.C589S(1)		cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(25)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	47						AACTGATCACAGAATTTTCGG	0.512																																							uc004epc.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|lung(1)|skin(1)	6						c.(1765-1767)TGT>AGT		calpain 6							71.0	57.0	62.0					X																	110489966		2203	4300	6503	SO:0001583	missense	827				microtubule bundle formation|proteolysis|regulation of cytoskeleton organization	perinuclear region of cytoplasm|spindle microtubule	calcium-dependent cysteine-type endopeptidase activity|microtubule binding	g.chrX:110489966A>T	AF029232	CCDS14555.1	Xq23	2008-07-29			ENSG00000077274	ENSG00000077274			1483	protein-coding gene	gene with protein product		300146				9503024, 9339374	Standard	NM_014289		Approved	CAPNX, CalpM, CANPX	uc004epc.2	Q9Y6Q1	OTTHUMG00000022203	ENST00000324068.1:c.1765T>A	X.37:g.110489966A>T	ENSP00000317214:p.Cys589Ser		Somatic				CAPN6_uc011msu.1_Missense_Mutation_p.C334S	p.C589S	NM_014289	NP_055104	WXS	Illumina HiSeq	Unspecified	Q9Y6Q1	CAN6_HUMAN			13	1933	-			589			C2.		D3DUY7|Q9UEQ1|Q9UJA8	Missense_Mutation	SNP	ENST00000324068.1	37	c.1765T>A	CCDS14555.1	.	.	.	.	.	.	.	.	.	.	A	7.714	0.695679	0.15106	.	.	ENSG00000077274	ENST00000324068;ENST00000541758	T;T	0.66280	-0.2;-0.2	5.24	4.08	0.47627	C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.910788	0.09573	N	0.783972	T	0.50667	0.1629	L	0.27053	0.805	0.41763	D	0.989725	B	0.17852	0.024	B	0.24701	0.055	T	0.30851	-0.9964	10	0.37606	T	0.19	.	9.1656	0.37050	0.9119:0.0:0.0881:0.0	.	589	Q9Y6Q1	CAN6_HUMAN	S	589;334	ENSP00000317214:C589S;ENSP00000441736:C334S	ENSP00000317214:C589S	C	-	1	0	CAPN6	110376622	0.770000	0.28543	1.000000	0.80357	0.995000	0.86356	0.817000	0.27281	0.803000	0.34113	0.407000	0.27541	TGT		0.512	CAPN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057922.1			17	41	0	0	0	0.006122	0	17	41				
LONRF3	79836	broad.mit.edu	37	X	118123383	118123383	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chrX:118123383C>A	ENST00000371628.3	+	4	1103	c.1072C>A	c.(1072-1074)Ctc>Atc	p.L358I	LONRF3_ENST00000422289.2_Missense_Mutation_p.L102I|LONRF3_ENST00000304778.7_Missense_Mutation_p.L317I|LONRF3_ENST00000472173.1_3'UTR	NM_001031855.1	NP_001027026.1	Q496Y0	LONF3_HUMAN	LON peptidase N-terminal domain and ring finger 3	358							ATP-dependent peptidase activity (GO:0004176)|zinc ion binding (GO:0008270)	p.L358I(1)|p.L317I(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	36						CAATCTGGAGCTCCCACATTG	0.493																																							uc004eqw.2		NA																	2	Substitution - Missense(2)		lung(2)	breast(1)|central_nervous_system(1)	2						c.(1072-1074)CTC>ATC		LON peptidase N-terminal domain and ring finger							67.0	60.0	62.0					X																	118123383		2203	4300	6503	SO:0001583	missense	79836				proteolysis		ATP-dependent peptidase activity|protein binding|zinc ion binding	g.chrX:118123383C>A	AK026265	CCDS14575.1, CCDS35374.1, CCDS76014.1	Xq24	2013-01-09	2005-08-19	2005-08-19	ENSG00000175556	ENSG00000175556		"""RING-type (C3HC4) zinc fingers"""	21152	protein-coding gene	gene with protein product			"""ring finger protein 127"""	RNF127			Standard	XM_005262476		Approved	FLJ22612	uc004eqw.3	Q496Y0	OTTHUMG00000022262	ENST00000371628.3:c.1072C>A	X.37:g.118123383C>A	ENSP00000360690:p.Leu358Ile		Somatic				LONRF3_uc004eqx.2_Missense_Mutation_p.L317I|LONRF3_uc004eqy.2_RNA|LONRF3_uc004eqz.2_Missense_Mutation_p.L102I	p.L358I	NM_001031855	NP_001027026	WXS	Illumina HiSeq	Unspecified	Q496Y0	LONF3_HUMAN			4	1103	+			358					Q5JPN6|Q8NB00|Q9H647	Missense_Mutation	SNP	ENST00000371628.3	37	c.1072C>A	CCDS35374.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.04|12.04	1.818644|1.818644	0.32145|0.32145	.|.	.|.	ENSG00000175556|ENSG00000175556	ENST00000439603|ENST00000365713;ENST00000304778;ENST00000371628;ENST00000422289	.|D;D;T;D	.|0.83992	.|-1.55;-1.55;-1.28;-1.79	4.68|4.68	4.68|4.68	0.58851|0.58851	.|.	.|0.326086	.|0.25416	.|N	.|0.030821	T|T	0.72070|0.72070	0.3415|0.3415	N|N	0.24115|0.24115	0.695|0.695	0.25043|0.25043	N|N	0.991181|0.991181	.|B;B;B	.|0.15930	.|0.012;0.009;0.015	.|B;B;B	.|0.17722	.|0.013;0.009;0.019	T|T	0.59931|0.59931	-0.7361|-0.7361	5|10	.|0.30854	.|T	.|0.27	-3.8763|-3.8763	12.516|12.516	0.56032|0.56032	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|102;317;358	.|B3KUN7;Q496Y0-2;Q496Y0	.|.;.;LONF3_HUMAN	D|I	123|317;317;358;102	.|ENSP00000360691:L317I;ENSP00000307732:L317I;ENSP00000360690:L358I;ENSP00000408894:L102I	.|ENSP00000307732:L317I	A|L	+|+	2|1	0|0	LONRF3|LONRF3	118007411|118007411	0.921000|0.921000	0.31238|0.31238	0.863000|0.863000	0.33907|0.33907	0.642000|0.642000	0.38348|0.38348	1.363000|1.363000	0.34159|0.34159	2.249000|2.249000	0.74217|0.74217	0.513000|0.513000	0.50165|0.50165	GCT|CTC		0.493	LONRF3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355124.2	NM_024778		9	63	1	0	3.09899e-07	0.004482	5.5588e-07	9	63				
BCORL1	63035	broad.mit.edu	37	X	129149209	129149209	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chrX:129149209G>T	ENST00000218147.7	+	4	2658	c.2461G>T	c.(2461-2463)Ggg>Tgg	p.G821W	BCORL1_ENST00000303743.5_Missense_Mutation_p.G821W|BCORL1_ENST00000540052.1_Missense_Mutation_p.G821W|BCORL1_ENST00000359304.2_Missense_Mutation_p.G821W			Q5H9F3	BCORL_HUMAN	BCL6 corepressor-like 1	821					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|liver(3)|lung(30)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	75						TTCAGTCAATGGGAAACCTAC	0.602																																							uc004evb.1		NA																	0				ovary(4)|breast(2)|lung(1)	7						c.(2461-2463)GGG>TGG		BCL6 co-repressor-like 1							50.0	55.0	53.0					X																	129149209		2200	4300	6500	SO:0001583	missense	63035				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus		g.chrX:129149209G>T	AL136450	CCDS14616.1	Xq25-q26.1	2014-09-17	2010-06-10		ENSG00000085185	ENSG00000085185		"""Ankyrin repeat domain containing"""	25657	protein-coding gene	gene with protein product		300688	"""chromosome X open reading frame 10"", ""BCL6 co-repressor-like 1"""	CXorf10			Standard	NM_021946		Approved	FLJ11362	uc022cdu.1	Q5H9F3	OTTHUMG00000022379	ENST00000218147.7:c.2461G>T	X.37:g.129149209G>T	ENSP00000218147:p.Gly821Trp		Somatic				BCORL1_uc010nrd.1_Missense_Mutation_p.G723W	p.G821W	NM_021946	NP_068765	WXS	Illumina HiSeq	Unspecified	Q5H9F3	BCORL_HUMAN			4	2575	+			821					B5MDQ8|Q5H9F2|Q5H9F4|Q6ZVE0|Q8TEN3|Q9Y528	Missense_Mutation	SNP	ENST00000218147.7	37	c.2461G>T	CCDS14616.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.69|15.69	2.907765|2.907765	0.52333|0.52333	.|.	.|.	ENSG00000085185|ENSG00000085185	ENST00000218147;ENST00000303743;ENST00000359304;ENST00000540052;ENST00000456822|ENST00000441294	T;T;T;T;T|.	0.75589|.	-0.87;-0.38;-0.95;-0.87;-0.27|.	5.09|5.09	5.09|5.09	0.68999|0.68999	.|.	0.000000|.	0.37348|.	N|.	0.002128|.	T|T	0.57169|0.57169	0.2035|0.2035	L|L	0.29908|0.29908	0.895|0.895	0.51233|0.51233	D|D	0.999917|0.999917	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	1.0;1.0|.	T|T	0.53830|0.53830	-0.8383|-0.8383	10|5	0.87932|.	D|.	0|.	-13.6834|-13.6834	17.6562|17.6562	0.88178|0.88178	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	821;821|.	Q5H9F3-2;Q5H9F3|.	.;BCORL_HUMAN|.	W|L	821;821;821;821;421|256	ENSP00000218147:G821W;ENSP00000307541:G821W;ENSP00000352253:G821W;ENSP00000437775:G821W;ENSP00000399483:G421W|.	ENSP00000218147:G821W|.	G|W	+|+	1|2	0|0	BCORL1|BCORL1	128976890|128976890	1.000000|1.000000	0.71417|0.71417	0.991000|0.991000	0.47740|0.47740	0.992000|0.992000	0.81027|0.81027	4.001000|4.001000	0.57046|0.57046	2.099000|2.099000	0.63709|0.63709	0.529000|0.529000	0.55759|0.55759	GGG|TGG		0.602	BCORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058223.1	NM_021946		12	69	1	0	0.00136819	0.001368	0.00211683	12	69				
FAM127C	441518	broad.mit.edu	37	X	134156366	134156366	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chrX:134156366C>G	ENST00000391440.1	-	1	193	c.124G>C	c.(124-126)Gag>Cag	p.E42Q		NM_001078173.1	NP_001071641.1	Q17RB0	F127C_HUMAN	family with sequence similarity 127, member C	42								p.E42Q(1)		breast(1)|endometrium(2)|large_intestine(1)|lung(2)	6	Acute lymphoblastic leukemia(192;0.000127)					ACGATGAACTCCGGGAGCCGG	0.652																																							uc004eyc.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(124-126)GAG>CAG		family with sequence similarity 127, member C							71.0	80.0	77.0					X																	134156366		2112	4210	6322	SO:0001583	missense	441518							g.chrX:134156366C>G	BC048268	CCDS43996.1	Xq26.3	2014-05-16			ENSG00000212747	ENSG00000212747			33156	protein-coding gene	gene with protein product						9403077, 15716091	Standard	NM_001078173		Approved	MAR8B, CXX1c	uc004eyc.1	Q17RB0	OTTHUMG00000022464	ENST00000391440.1:c.124G>C	X.37:g.134156366C>G	ENSP00000375268:p.Glu42Gln		Somatic					p.E42Q	NM_001078173	NP_001071641	WXS	Illumina HiSeq	Unspecified	Q17RB0	F127C_HUMAN			1	201	-	Acute lymphoblastic leukemia(192;0.000127)		42						Missense_Mutation	SNP	ENST00000391440.1	37	c.124G>C	CCDS43996.1	.	.	.	.	.	.	.	.	.	.	c	17.57	3.421561	0.62622	.	.	ENSG00000212747	ENST00000391440	T	0.32515	1.45	2.35	2.35	0.29111	.	0.248639	0.20197	U	0.097170	T	0.48874	0.1524	M	0.80422	2.495	0.26505	N	0.974692	D	0.89917	1.0	D	0.79108	0.992	T	0.34551	-0.9824	10	0.19147	T	0.46	.	7.4608	0.27294	0.0:1.0:0.0:0.0	.	42	Q17RB0	F127C_HUMAN	Q	42	ENSP00000375268:E42Q	ENSP00000375268:E42Q	E	-	1	0	FAM127C	133984032	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	1.884000	0.39668	1.455000	0.47813	0.436000	0.28706	GAG		0.652	FAM127C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058389.2	NM_001078173		21	87	0	0	0	0.008871	0	21	87				
GPR101	83550	broad.mit.edu	37	X	136112793	136112793	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chrX:136112793G>T	ENST00000298110.1	-	1	1040	c.1041C>A	c.(1039-1041)gaC>gaA	p.D347E		NM_054021.1	NP_473362.1	Q96P66	GP101_HUMAN	G protein-coupled receptor 101	347						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)	p.D347E(1)		autonomic_ganglia(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(18)|ovary(3)|skin(1)|urinary_tract(1)	42	Acute lymphoblastic leukemia(192;0.000127)					CTTCACCCAAGTCAATGCTGC	0.547																																							uc011mwh.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|lung(1)|skin(1)	5						c.(1039-1041)GAC>GAA		G protein-coupled receptor 101							353.0	251.0	285.0					X																	136112793		2203	4300	6503	SO:0001583	missense	83550					integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chrX:136112793G>T	AF411115	CCDS14662.1	Xq26.3	2014-01-30			ENSG00000165370	ENSG00000165370		"""GPCR / Class A : Orphans"""	14963	protein-coding gene	gene with protein product		300393				11574155	Standard	NM_054021		Approved		uc011mwh.2	Q96P66	OTTHUMG00000022521	ENST00000298110.1:c.1041C>A	X.37:g.136112793G>T	ENSP00000298110:p.Asp347Glu		Somatic					p.D347E	NM_054021	NP_473362	WXS	Illumina HiSeq	Unspecified	Q96P66	GP101_HUMAN			1	1041	-	Acute lymphoblastic leukemia(192;0.000127)		347			Cytoplasmic (Potential).		Q5JSM8|Q8NG93	Missense_Mutation	SNP	ENST00000298110.1	37	c.1041C>A	CCDS14662.1	.	.	.	.	.	.	.	.	.	.	G	11.35	1.611534	0.28712	.	.	ENSG00000165370	ENST00000298110	T	0.62788	0.0	4.42	4.42	0.53409	GPCR, rhodopsin-like superfamily (1);	0.230011	0.22392	N	0.060669	T	0.46151	0.1378	L	0.36672	1.1	0.30230	N	0.795963	B	0.27791	0.189	B	0.27887	0.084	T	0.37979	-0.9682	10	0.05959	T	0.93	-15.8529	11.3475	0.49569	0.0:0.0:1.0:0.0	.	347	Q96P66	GP101_HUMAN	E	347	ENSP00000298110:D347E	ENSP00000298110:D347E	D	-	3	2	GPR101	135940459	0.759000	0.28416	0.993000	0.49108	0.674000	0.39518	1.947000	0.40293	2.448000	0.82819	0.600000	0.82982	GAC		0.547	GPR101-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058519.1			43	248	1	0	1.41504e-22	0.002852	3.67239e-22	43	248				
F9	2158	broad.mit.edu	37	X	138612946	138612946	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chrX:138612946T>C	ENST00000218099.2	+	1	30	c.23T>C	c.(22-24)aTg>aCg	p.M8T	F9_ENST00000479617.2_3'UTR|F9_ENST00000394090.2_Missense_Mutation_p.M8T	NM_000133.3	NP_000124.1	P00740	FA9_HUMAN	coagulation factor IX	8					blood coagulation (GO:0007596)|blood coagulation, extrinsic pathway (GO:0007598)|blood coagulation, intrinsic pathway (GO:0007597)|cellular protein metabolic process (GO:0044267)|peptidyl-glutamic acid carboxylation (GO:0017187)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)	p.M8T(1)		breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(7)|lung(19)|ovary(1)|skin(1)	35	Acute lymphoblastic leukemia(192;0.000127)				Antihemophilic Factor(DB00025)|Menadione(DB00170)	AACATGATCATGGCAGAATCA	0.408																																							uc004fas.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)|ovary(1)	3						c.(22-24)ATG>ACG		coagulation factor IX preproprotein	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Heparin(DB01109)|Menadione(DB00170)						269.0	215.0	233.0					X																	138612946		2203	4300	6503	SO:0001583	missense	2158				blood coagulation, extrinsic pathway|blood coagulation, intrinsic pathway|peptidyl-glutamic acid carboxylation|post-translational protein modification|proteolysis	endoplasmic reticulum lumen|extracellular region|Golgi lumen|plasma membrane	calcium ion binding|serine-type endopeptidase activity	g.chrX:138612946T>C	M11309	CCDS14666.1	Xq26.3-q27.1	2014-09-17	2008-08-01		ENSG00000101981	ENSG00000101981	3.4.21.22		3551	protein-coding gene	gene with protein product	"""Factor IX"", ""plasma thromboplastic component"", ""Christmas disease"", ""hemophilia B"""	300746					Standard	NM_000133		Approved	FIX	uc004fas.1	P00740	OTTHUMG00000022536	ENST00000218099.2:c.23T>C	X.37:g.138612946T>C	ENSP00000218099:p.Met8Thr		Somatic				F9_uc004fat.1_Missense_Mutation_p.M8T	p.M8T	NM_000133	NP_000124	WXS	Illumina HiSeq	Unspecified	P00740	FA9_HUMAN			1	52	+	Acute lymphoblastic leukemia(192;0.000127)		8					A8K9N4|F2RM36|Q5FBE1|Q5JYJ8	Missense_Mutation	SNP	ENST00000218099.2	37	c.23T>C	CCDS14666.1	.	.	.	.	.	.	.	.	.	.	t	13.27	2.187699	0.38609	.	.	ENSG00000101981	ENST00000218099;ENST00000394090	D;D	0.92099	-2.92;-2.97	5.08	5.08	0.68730	.	0.264569	0.42053	D	0.000763	D	0.89966	0.6868	M	0.75777	2.31	0.35961	D	0.834587	P;P	0.49961	0.651;0.93	B;B	0.38842	0.115;0.283	D	0.92612	0.6100	10	0.72032	D	0.01	.	10.2391	0.43301	0.0:0.0:0.0:1.0	.	8;8	Q5FBE1;P00740	.;FA9_HUMAN	T	8	ENSP00000218099:M8T;ENSP00000377650:M8T	ENSP00000218099:M8T	M	+	2	0	F9	138440612	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	4.324000	0.59228	1.683000	0.51011	0.478000	0.44815	ATG		0.408	F9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058557.1			22	89	0	0	0	0.005443	0	22	89				
SLITRK2	84631	broad.mit.edu	37	X	144904084	144904084	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chrX:144904084G>T	ENST00000370490.1	+	1	4396	c.141G>T	c.(139-141)gaG>gaT	p.E47D	SLITRK2_ENST00000447897.2_Missense_Mutation_p.E47D|SLITRK2_ENST00000434188.2_Missense_Mutation_p.E47D|SLITRK2_ENST00000413937.2_Missense_Mutation_p.E47D|SLITRK2_ENST00000428560.2_Missense_Mutation_p.E47D			Q9H156	SLIK2_HUMAN	SLIT and NTRK-like family, member 2	47					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)		p.E47D(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(17)|lung(40)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	86	Acute lymphoblastic leukemia(192;6.56e-05)					TCAACTGTGAGAACAAAGGAT	0.448																																							uc004fcd.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|central_nervous_system(1)|pancreas(1)	7						c.(139-141)GAG>GAT		SLIT and NTRK-like family, member 2 precursor							102.0	86.0	91.0					X																	144904084		2203	4300	6503	SO:0001583	missense	84631					integral to membrane		g.chrX:144904084G>T	Y19205	CCDS14680.1	Xq27.3	2008-02-05	2004-03-11		ENSG00000185985	ENSG00000185985			13449	protein-coding gene	gene with protein product		300561	"""slit-like 1 (Drosophila)"""	SLITL1		11347906, 14557068	Standard	NM_032539		Approved	KIAA1854, CXorf2	uc011mwr.2	Q9H156	OTTHUMG00000022595	ENST00000370490.1:c.141G>T	X.37:g.144904084G>T	ENSP00000359521:p.Glu47Asp		Somatic				SLITRK2_uc010nsp.2_Missense_Mutation_p.E47D|SLITRK2_uc010nso.2_Missense_Mutation_p.E47D|SLITRK2_uc011mwq.1_Missense_Mutation_p.E47D|SLITRK2_uc011mwr.1_Missense_Mutation_p.E47D|SLITRK2_uc011mws.1_Missense_Mutation_p.E47D|SLITRK2_uc004fcg.2_Missense_Mutation_p.E47D|SLITRK2_uc011mwt.1_Missense_Mutation_p.E47D	p.E47D	NM_032539	NP_115928	WXS	Illumina HiSeq	Unspecified	Q9H156	SLIK2_HUMAN			5	1131	+	Acute lymphoblastic leukemia(192;6.56e-05)		47			Extracellular (Potential).		A8K117|Q2KHN3|Q5JXB1|Q8NBC7|Q96JH3	Missense_Mutation	SNP	ENST00000370490.1	37	c.141G>T	CCDS14680.1	.	.	.	.	.	.	.	.	.	.	G	11.11	1.542906	0.27563	.	.	ENSG00000185985	ENST00000335565;ENST00000447897;ENST00000370490;ENST00000434188;ENST00000413937;ENST00000428560	T;T;T;T;T;T	0.51071	0.72;0.72;0.72;0.72;0.72;0.72	5.01	3.75	0.43078	Leucine-rich repeat-containing N-terminal (1);	0.000000	0.85682	U	0.000000	T	0.53916	0.1826	L	0.45228	1.405	0.45261	D	0.998263	D	0.89917	1.0	D	0.83275	0.996	T	0.48736	-0.9009	10	0.31617	T	0.26	-8.8351	6.0326	0.19688	0.7893:0.0:0.2107:0.0	.	47	Q9H156	SLIK2_HUMAN	D	47	ENSP00000334374:E47D;ENSP00000411681:E47D;ENSP00000359521:E47D;ENSP00000397015:E47D;ENSP00000407347:E47D;ENSP00000412010:E47D	ENSP00000334374:E47D	E	+	3	2	SLITRK2	144711776	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	1.577000	0.36515	0.573000	0.29400	-0.513000	0.04457	GAG		0.448	SLITRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058633.1	NM_032539		15	48	1	0	1.5739e-10	0.004007	3.11523e-10	15	48				
MAGEA8	4107	broad.mit.edu	37	X	149013595	149013595	+	Silent	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chrX:149013595C>A	ENST00000542674.1	+	3	1070	c.549C>A	c.(547-549)acC>acA	p.T183T	MAGEA8_ENST00000286482.1_Silent_p.T183T|MAGEA8_ENST00000535454.1_Silent_p.T183T	NM_001166401.1	NP_001159873.1	P43361	MAGA8_HUMAN	melanoma antigen family A, 8	183	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.							p.T183T(1)		NS(1)|breast(2)|endometrium(2)|large_intestine(2)|lung(12)|upper_aerodigestive_tract(1)	20	Acute lymphoblastic leukemia(192;6.56e-05)					TCCTTGTCACCTGCCTGGGCC	0.542																																							uc004fdw.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(547-549)ACC>ACA		melanoma antigen family A, 8							72.0	64.0	67.0					X																	149013595		2203	4298	6501	SO:0001819	synonymous_variant	4107							g.chrX:149013595C>A		CCDS14692.1	Xq28	2009-03-13			ENSG00000156009	ENSG00000156009			6806	protein-coding gene	gene with protein product	"""MAGE-8 antigen"", ""cancer/testis antigen family 1, member 8"""	300341		MAGE8		8575766	Standard	NM_005364		Approved	MGC2182, CT1.8	uc004fdw.2	P43361	OTTHUMG00000022635	ENST00000542674.1:c.549C>A	X.37:g.149013595C>A			Somatic					p.T183T	NM_005364	NP_005355	WXS	Illumina HiSeq	Unspecified	P43361	MAGA8_HUMAN			3	764	+	Acute lymphoblastic leukemia(192;6.56e-05)		183			MAGE.		Q9BUN9	Silent	SNP	ENST00000542674.1	37	c.549C>A	CCDS14692.1																																																																																				0.542	MAGEA8-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058728.1	NM_005364		13	94	1	0	9.31168e-06	0.001855	1.58602e-05	13	94				
CLIC2	1193	broad.mit.edu	37	X	154508497	154508497	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chrX:154508497C>A	ENST00000369449.2	-	5	741	c.523G>T	c.(523-525)Gat>Tat	p.D175Y	CLIC2_ENST00000465553.1_5'UTR	NM_001289.4	NP_001280.3	O15247	CLIC2_HUMAN	chloride intracellular channel 2	175	C-terminal.|GST C-terminal.				chloride transmembrane transport (GO:1902476)|negative regulation of ryanodine-sensitive calcium-release channel activity (GO:0060315)|oxidation-reduction process (GO:0055114)|positive regulation of binding (GO:0051099)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|signal transduction (GO:0007165)|transport (GO:0006810)	chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)	chloride channel activity (GO:0005254)|glutathione peroxidase activity (GO:0004602)|voltage-gated chloride channel activity (GO:0005247)	p.D175Y(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(1)	18	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					TGGTCCCCATCCAAGAATAGT	0.453																																					Melanoma(108;581 1592 2289 21669 28822)	Melanoma(108;581 1592 2289 21669 28822)	uc004fnf.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|ovary(1)|skin(1)	3						c.(523-525)GAT>TAT		chloride intracellular channel 2							90.0	83.0	85.0					X																	154508497		2203	4300	6503	SO:0001583	missense	1193				signal transduction	chloride channel complex|cytoplasm|nucleus	voltage-gated chloride channel activity	g.chrX:154508497C>A	AJ000217	CCDS14767.1	Xq28	2012-09-26			ENSG00000155962	ENSG00000155962		"""Ion channels / Chloride channels : Intracellular"""	2063	protein-coding gene	gene with protein product		300138				9339381	Standard	NM_001289		Approved	XAP121	uc004fnf.3	O15247	OTTHUMG00000022660	ENST00000369449.2:c.523G>T	X.37:g.154508497C>A	ENSP00000358460:p.Asp175Tyr		Somatic				CLIC2_uc010nvj.1_Missense_Mutation_p.D193Y	p.D175Y	NM_001289	NP_001280	WXS	Illumina HiSeq	Unspecified	O15247	CLIC2_HUMAN			5	773	-	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)		175			GST C-terminal.|C-terminal.		A8K9S0|O15174|Q5JT80|Q8TCE3	Missense_Mutation	SNP	ENST00000369449.2	37	c.523G>T	CCDS14767.1	.	.	.	.	.	.	.	.	.	.	c	20.7	4.040939	0.75732	.	.	ENSG00000155962	ENST00000369449;ENST00000321926	D;T	0.93307	-3.2;0.82	4.68	4.68	0.58851	Glutathione S-transferase, C-terminal-like (2);Glutathione S-transferase/chloride channel, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.97192	0.9082	M	0.90870	3.155	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98107	1.0418	10	0.87932	D	0	-15.1423	14.4807	0.67579	0.0:1.0:0.0:0.0	.	175	O15247	CLIC2_HUMAN	Y	175;133	ENSP00000358460:D175Y;ENSP00000318558:D133Y	ENSP00000318558:D133Y	D	-	1	0	CLIC2	154161691	1.000000	0.71417	1.000000	0.80357	0.831000	0.47069	7.055000	0.76656	2.085000	0.62840	0.284000	0.19432	GAT		0.453	CLIC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058793.1	NM_001289		11	96	1	0	1.58986e-06	0.008291	2.78226e-06	11	96				
SPRY3	10251	broad.mit.edu	37	X	155003662	155003662	+	Silent	SNP	C	C	G			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chrX:155003662C>G	ENST00000302805.2	+	2	560	c.129C>G	c.(127-129)tcC>tcG	p.S43S		NM_005840.1	NP_005831.1	O43610	SPY3_HUMAN	sprouty homolog 3 (Drosophila)	43					multicellular organismal development (GO:0007275)|regulation of signal transduction (GO:0009966)	cytoplasm (GO:0005737)|membrane (GO:0016020)		p.S43S(1)				all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					CCAGCCCTTCCCTTATTGTGC	0.547																																							uc004fnq.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(127-129)TCC>TCG		sprouty homolog 3							266.0	248.0	254.0					X																	155003662		2203	4296	6499	SO:0001819	synonymous_variant	10251				multicellular organismal development|regulation of signal transduction	cytoplasm|membrane		g.chrX:155003662C>G	AF041038	CCDS14769.4	Xq28 and Yq12	2008-02-05	2001-11-28		ENSG00000168939	ENSG00000168939		"""Pseudoautosomal regions / PAR2"""	11271	protein-coding gene	gene with protein product	"""antagonist of FGF signaling"""	300531	"""sprouty (Drosophila) homolog 2"""			9458049	Standard	NM_005840		Approved	HSPRY3	uc004fnq.1	O43610	OTTHUMG00000022675	ENST00000302805.2:c.129C>G	X.37:g.155003662C>G			Somatic				SPRY3_uc010nvl.1_Silent_p.S43S	p.S43S	NM_005840	NP_005831	WXS	Illumina HiSeq	Unspecified	O43610	SPY3_HUMAN			2	583	+	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)		43					A8K0H8	Silent	SNP	ENST00000302805.2	37	c.129C>G	CCDS14769.4																																																																																				0.547	SPRY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058823.2	NM_005840		25	97	0	0	0	0.00632	0	25	97				
PAPPA2	60676	broad.mit.edu	37	1	176811562	176811562	+	Frame_Shift_Del	DEL	G	G	-	rs552985138		TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr1:176811562delG	ENST00000367662.3	+	23	6512	c.5348delG	c.(5347-5349)cggfs	p.R1783fs		NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	1783					bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.R1783L(1)		NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						TGCACCTGCCGGGACCCCAAG	0.512																																							uc001gkz.2		NA																	1	Substitution - Missense(1)	p.R1783L(1)	breast(1)	ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						c.(5347-5349)CGGfs		pappalysin 2 isoform 1							88.0	87.0	87.0					1																	176811562		1899	4125	6024	SO:0001589	frameshift_variant	60676				cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding	g.chr1:176811562delG	BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.5348delG	1.37:g.176811562delG	ENSP00000356634:p.Arg1783fs		Somatic				PAPPA2_uc009www.2_RNA|uc001gla.1_5'Flank	p.R1783fs	NM_020318	NP_064714	WXS	Illumina HiSeq	Unspecified	Q9BXP8	PAPP2_HUMAN			23	6512	+			1783					A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Frame_Shift_Del	DEL	ENST00000367662.3	37	c.5348delG	CCDS41438.1																																																																																				0.512	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084763.1			10	57	NA	NA	NA	NA	NA	10	57	---	---	---	---
MTPAP	55149	broad.mit.edu	37	10	30604933	30604934	+	Frame_Shift_Ins	INS	-	-	A			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr10:30604933_30604934insA	ENST00000263063.4	-	8	1387_1388	c.1344_1345insT	c.(1342-1347)tttggcfs	p.G449fs	MTPAP_ENST00000488290.1_5'UTR|MTPAP_ENST00000358107.4_Frame_Shift_Ins_p.G579fs	NM_018109.3	NP_060579.3	Q9NVV4	PAPD1_HUMAN	mitochondrial poly(A) polymerase	449	PAP-associated.				cell death (GO:0008219)|histone mRNA catabolic process (GO:0071044)|mRNA polyadenylation (GO:0006378)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|poly(A) RNA binding (GO:0044822)|polynucleotide adenylyltransferase activity (GO:0004652)|protein homodimerization activity (GO:0042803)|UTP binding (GO:0002134)	p.G449fs*7(1)|p.G579fs*7(1)		breast(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	33						GCAAAATTGCCAAAATACTCAA	0.292																																							uc001iva.3		NA																	2	Insertion - Frameshift(2)		large_intestine(2)	ovary(1)	1						c.(1342-1347)TTTGGCfs		PAP associated domain containing 1 precursor																																				SO:0001589	frameshift_variant	55149				cell death|histone mRNA catabolic process|mRNA polyadenylation|transcription, DNA-dependent	mitochondrion	ATP binding|magnesium ion binding|manganese ion binding|polynucleotide adenylyltransferase activity|protein homodimerization activity|RNA binding|UTP binding	g.chr10:30604933_30604934insA	AL122121	CCDS7165.1	10p12.1	2014-01-30	2009-01-12	2009-01-12	ENSG00000107951	ENSG00000107951			25532	protein-coding gene	gene with protein product	"""TUTase1"""	613669	"""PAP associated domain containing 1"""	PAPD1		12239557, 15769737, 15547249	Standard	NM_018109		Approved	FLJ10486, mtPAP, SPAX4	uc001iva.4	Q9NVV4	OTTHUMG00000017895	ENST00000263063.4:c.1345dupT	10.37:g.30604937_30604937dupA	ENSP00000263063:p.Gly449fs		Somatic				MTPAP_uc001ivb.3_Frame_Shift_Ins_p.F578fs	p.F448fs	NM_018109	NP_060579	WXS	Illumina HiSeq	Unspecified	Q9NVV4	PAPD1_HUMAN			8	1407_1408	-			448_449			PAP-associated.		D3DRX0|Q659E3|Q6P7E5|Q9HA74	Frame_Shift_Ins	INS	ENST00000263063.4	37	c.1344_1345insT	CCDS7165.1																																																																																				0.292	MTPAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047426.2	NM_018109		15	26	NA	NA	NA	NA	NA	15	26	---	---	---	---
CNNM2	54805	broad.mit.edu	37	10	104816716	104816716	+	Frame_Shift_Del	DEL	C	C	-			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr10:104816716delC	ENST00000369878.4	+	4	2256	c.2068delC	c.(2068-2070)ctgfs	p.L690fs	CNNM2_ENST00000433628.2_Frame_Shift_Del_p.L690fs	NM_017649.4	NP_060119.3	Q9H8M5	CNNM2_HUMAN	cyclin and CBS domain divalent metal cation transport mediator 2	690					magnesium ion homeostasis (GO:0010960)|magnesium ion transport (GO:0015693)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	adenyl nucleotide binding (GO:0030554)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|urinary_tract(1)	19		Colorectal(252;0.103)|all_hematologic(284;0.152)|Breast(234;0.198)		Epithelial(162;7.89e-09)|all cancers(201;1.82e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		CGTTCTCATTCTGCAGGTCAG	0.433																																							uc001kwm.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(2068-2070)CTGfs		cyclin M2 isoform 1							125.0	134.0	131.0					10																	104816716		2078	4238	6316	SO:0001589	frameshift_variant	54805				ion transport	integral to membrane		g.chr10:104816716delC	AF216962	CCDS7543.1, CCDS44474.1, CCDS44475.1	10q24.32	2014-08-08	2014-08-07		ENSG00000148842	ENSG00000148842			103	protein-coding gene	gene with protein product		607803	"""cyclin M2"""	ACDP2		21393841, 24699222	Standard	NM_017649		Approved		uc001kwm.3	Q9H8M5	OTTHUMG00000018976	ENST00000369878.4:c.2068delC	10.37:g.104816716delC	ENSP00000358894:p.Leu690fs		Somatic				CNNM2_uc001kwn.2_Frame_Shift_Del_p.L690fs	p.L690fs	NM_017649	NP_060119	WXS	Illumina HiSeq	Unspecified	Q9H8M5	CNNM2_HUMAN		Epithelial(162;7.89e-09)|all cancers(201;1.82e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)	4	2192	+		Colorectal(252;0.103)|all_hematologic(284;0.152)|Breast(234;0.198)	690					Q5T569|Q5T570|Q8WU59|Q9H952|Q9NRK5|Q9NXT4	Frame_Shift_Del	DEL	ENST00000369878.4	37	c.2068delC	CCDS44474.1																																																																																				0.433	CNNM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050113.3	NM_017649		56	123	NA	NA	NA	NA	NA	56	123	---	---	---	---
KL	9365	broad.mit.edu	37	13	33635564	33635565	+	Frame_Shift_Ins	INS	-	-	T			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr13:33635564_33635565insT	ENST00000380099.3	+	4	2356_2357	c.2348_2349insT	c.(2347-2352)aattttfs	p.NF783fs	KL_ENST00000426690.2_3'UTR|KL_ENST00000487852.1_3'UTR	NM_004795.3	NP_004786.2	Q9UEF7	KLOT_HUMAN	klotho	783	Glycosyl hydrolase-1 2.				acute inflammatory response (GO:0002526)|aging (GO:0007568)|calcium ion homeostasis (GO:0055074)|carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of bone mineralization (GO:0030501)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-glucosidase activity (GO:0008422)|beta-glucuronidase activity (GO:0004566)|fibroblast growth factor binding (GO:0017134)|signal transducer activity (GO:0004871)|vitamin D binding (GO:0005499)			breast(2)|endometrium(5)|kidney(3)|large_intestine(10)|lung(14)|ovary(2)|skin(5)	41	all_epithelial(80;0.133)	Ovarian(182;1.78e-06)|Breast(139;4.08e-05)|Hepatocellular(188;0.00886)|Lung SC(185;0.0262)		GBM - Glioblastoma multiforme(144;7.13e-230)|all cancers(112;1.33e-165)|OV - Ovarian serous cystadenocarcinoma(117;1.09e-113)|Epithelial(112;3.79e-112)|Lung(94;8.52e-27)|LUSC - Lung squamous cell carcinoma(192;1.4e-13)|Kidney(163;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(186;5.63e-08)|BRCA - Breast invasive adenocarcinoma(63;1.41e-05)		CAAAGAAACAATTTTCTTCTTC	0.426																																							uc001uus.2		NA																	0				large_intestine(1)|ovary(1)|skin(1)	3						c.(2347-2349)AATfs		klotho precursor																																				SO:0001589	frameshift_variant	9365				aging|carbohydrate metabolic process|insulin receptor signaling pathway|positive regulation of bone mineralization	extracellular space|extracellular space|integral to membrane|integral to plasma membrane|membrane fraction|soluble fraction	beta-glucosidase activity|beta-glucuronidase activity|cation binding|fibroblast growth factor binding|hormone activity|signal transducer activity|vitamin D binding	g.chr13:33635564_33635565insT	AB005142	CCDS9347.1	13q12	2008-02-05			ENSG00000133116	ENSG00000133116			6344	protein-coding gene	gene with protein product		604824				9464267	Standard	NM_004795		Approved		uc001uus.3	Q9UEF7	OTTHUMG00000017408	ENST00000380099.3:c.2352dupT	13.37:g.33635568_33635568dupT	ENSP00000369442:p.Asn783fs		Somatic				KL_uc001uur.1_3'UTR	p.N783fs	NM_004795	NP_004786	WXS	Illumina HiSeq	Unspecified	Q9UEF7	KLOT_HUMAN		GBM - Glioblastoma multiforme(144;7.13e-230)|all cancers(112;1.33e-165)|OV - Ovarian serous cystadenocarcinoma(117;1.09e-113)|Epithelial(112;3.79e-112)|Lung(94;8.52e-27)|LUSC - Lung squamous cell carcinoma(192;1.4e-13)|Kidney(163;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(186;5.63e-08)|BRCA - Breast invasive adenocarcinoma(63;1.41e-05)	4	2356_2357	+	all_epithelial(80;0.133)	Ovarian(182;1.78e-06)|Breast(139;4.08e-05)|Hepatocellular(188;0.00886)|Lung SC(185;0.0262)	783			Glycosyl hydrolase-1 2.|Extracellular (Potential).		Q5VZ95|Q96KV5|Q96KW5|Q9UEI9|Q9Y4F0	Frame_Shift_Ins	INS	ENST00000380099.3	37	c.2348_2349insT	CCDS9347.1																																																																																				0.426	KL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045987.1			25	47	NA	NA	NA	NA	NA	25	47	---	---	---	---
Unknown	0	broad.mit.edu	37	16	33784704	33784705	+	IGR	INS	-	-	A	rs577700174		TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr16:33784704_33784705insA								RP11-812E19.3 (6960 upstream) : AC136932.2 (161243 downstream)																							TCTACAACAACACCAACGTGTA	0.629																																							uc010vgb.1		NA																	0					NA						c.(91-96)AACACCfs		RecName: Full=Transporter;																																				SO:0001628	intergenic_variant	0							g.chr16:33784704_33784705insA																													16.37:g.33784705_33784705dupA			Somatic					p.N31fs			WXS	Illumina HiSeq	Unspecified					2	113_114	+									Frame_Shift_Ins	INS		37	c.93_94insA																																																																																				0	0.629									7	59	NA	NA	NA	NA	NA	7	59	---	---	---	---
GAST	2520	broad.mit.edu	37	17	39871829	39871829	+	Frame_Shift_Del	DEL	G	G	-			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr17:39871829delG	ENST00000329402.3	+	2	208	c.141delG	c.(139-141)ctgfs	p.L47fs	RNA5SP442_ENST00000365050.1_RNA|JUP_ENST00000540235.1_Intron	NM_000805.4	NP_000796.1	P01350	GAST_HUMAN	gastrin	47					G-protein coupled receptor signaling pathway (GO:0007186)|signal transduction (GO:0007165)	extracellular region (GO:0005576)	hormone activity (GO:0005179)			endometrium(1)|kidney(1)|large_intestine(2)|lung(3)	7		Breast(137;0.000307)	BRCA - Breast invasive adenocarcinoma(4;0.0677)			TACCCTGGCTGGAGCAGCAGG	0.652																																							uc002hxl.2		NA																	0					0						c.(139-141)CTGfs		gastrin preproprotein							53.0	56.0	55.0					17																	39871829		2203	4300	6503	SO:0001589	frameshift_variant	2520					extracellular region	hormone activity	g.chr17:39871829delG		CCDS11404.1	17q21.2	2013-02-26	2005-06-14	2005-06-14	ENSG00000184502	ENSG00000184502		"""Endogenous ligands"""	4164	protein-coding gene	gene with protein product	"""preprogastrin"""	137250		GAS			Standard	NM_000805		Approved		uc002hxl.3	P01350	OTTHUMG00000133496	ENST00000329402.3:c.141delG	17.37:g.39871829delG	ENSP00000331358:p.Leu47fs		Somatic				JUP_uc010wfs.1_Intron	p.L47fs	NM_000805	NP_000796	WXS	Illumina HiSeq	Unspecified	P01350	GAST_HUMAN	BRCA - Breast invasive adenocarcinoma(4;0.0677)		2	173	+		Breast(137;0.000307)	47					P78463|P78464	Frame_Shift_Del	DEL	ENST00000329402.3	37	c.141delG	CCDS11404.1																																																																																				0.652	GAST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257409.1			38	78	NA	NA	NA	NA	NA	38	78	---	---	---	---
ITGB4	3691	broad.mit.edu	37	17	73747115	73747122	+	Frame_Shift_Del	DEL	GCTGGGCT	GCTGGGCT	-			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	GCTGGGCT	GCTGGGCT	-	-	GCTGGGCT	GCTGGGCT	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr17:73747115_73747122delGCTGGGCT	ENST00000200181.3	+	30	3903_3910	c.3716_3723delGCTGGGCT	c.(3715-3723)agctgggctfs	p.SWA1239fs	ITGB4_ENST00000450894.3_Frame_Shift_Del_p.SWA1239fs|ITGB4_ENST00000339591.3_Frame_Shift_Del_p.SWA1239fs|ITGB4_ENST00000579662.1_Frame_Shift_Del_p.SWA1239fs|ITGB4_ENST00000449880.2_Frame_Shift_Del_p.SWA1239fs	NM_000213.3	NP_000204.3	P16144	ITB4_HUMAN	integrin, beta 4	1239	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				amelogenesis (GO:0097186)|autophagy (GO:0006914)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell motility (GO:0048870)|cell-matrix adhesion (GO:0007160)|digestive tract development (GO:0048565)|extracellular matrix organization (GO:0030198)|filopodium assembly (GO:0046847)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|mesodermal cell differentiation (GO:0048333)|nail development (GO:0035878)|renal system development (GO:0072001)|response to wounding (GO:0009611)|skin development (GO:0043588)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|hemidesmosome (GO:0030056)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor binding (GO:0001664)|receptor activity (GO:0004872)	p.A1241V(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|liver(1)|lung(25)|skin(1)|urinary_tract(1)	43	all_cancers(13;1.5e-07)		all cancers(21;8.32e-07)|Epithelial(20;1.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)			ACCCAGCTGAGCTGGGCTGAGCCGGCTG	0.596																																							uc002jpg.2		NA																	1	Substitution - Missense(1)		liver(1)	lung(4)	4	GRCh37	CM086837	ITGB4	M		c.(3715-3723)AGCTGGGCTfs		integrin beta 4 isoform 1 precursor																																				SO:0001589	frameshift_variant	3691				cell communication|cell motility|cell-matrix adhesion|hemidesmosome assembly|integrin-mediated signaling pathway|multicellular organismal development|response to wounding	cell leading edge|cell surface|hemidesmosome|integrin complex	protein binding|receptor activity	g.chr17:73747115_73747122delGCTGGGCT		CCDS11727.1, CCDS32736.1, CCDS58599.1	17q25.1	2013-09-19			ENSG00000132470	ENSG00000132470		"""CD molecules"", ""Integrins"", ""Fibronectin type III domain containing"""	6158	protein-coding gene	gene with protein product		147557				2070796	Standard	XM_005257309		Approved	CD104	uc002jpg.3	P16144	OTTHUMG00000179814	ENST00000200181.3:c.3716_3723delGCTGGGCT	17.37:g.73747115_73747122delGCTGGGCT	ENSP00000200181:p.Ser1239fs		Somatic				ITGB4_uc002jph.2_Frame_Shift_Del_p.S1239fs|ITGB4_uc002jpi.3_Frame_Shift_Del_p.S1239fs|ITGB4_uc002jpj.2_Frame_Shift_Del_p.S1239fs	p.S1239fs	NM_000213	NP_000204	WXS	Illumina HiSeq	Unspecified	P16144	ITB4_HUMAN	all cancers(21;8.32e-07)|Epithelial(20;1.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)		30	3903_3910	+	all_cancers(13;1.5e-07)		1239_1241			Fibronectin type-III 2.|Cytoplasmic (Potential).		A0AVL6|O14690|O14691|O15339|O15340|O15341|Q0VF97|Q9UIQ4	Frame_Shift_Del	DEL	ENST00000200181.3	37	c.3716_3723delGCTGGGCT	CCDS11727.1																																																																																				0.596	ITGB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000448334.1			11	78	NA	NA	NA	NA	NA	11	78	---	---	---	---
FAM98C	147965	broad.mit.edu	37	19	38899502	38899504	+	In_Frame_Del	DEL	AAG	AAG	-	rs372349446		TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	AAG	AAG	-	-	AAG	AAG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr19:38899502_38899504delAAG	ENST00000252530.5	+	8	1049_1051	c.1030_1032delAAG	c.(1030-1032)aagdel	p.K349del	FAM98C_ENST00000343358.7_In_Frame_Del_p.K267del|FAM98C_ENST00000588262.1_3'UTR	NM_174905.3	NP_777565.3	Q17RN3	FA98C_HUMAN	family with sequence similarity 98, member C	349										endometrium(2)|large_intestine(3)|lung(6)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	15	all_cancers(60;3.95e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			TTGGGGTCGCAAGAAGAAGAAGA	0.606																																							uc002oin.1		NA																	0				skin(1)	1						c.(1030-1032)AAGdel		hypothetical protein LOC147965				414,186,2888		21,2,370,1,182,1168						-2.6	0.1		dbSNP_134	37	186,506,7042		7,0,172,3,500,3185	no	codingComplex	FAM98C	NM_174905.3		28,2,542,4,682,4353	A1A1,A1A2,A1R,A2A2,A2R,RR		8.9475,17.2018,11.5131				600,692,9930				SO:0001651	inframe_deletion	147965							g.chr19:38899502_38899504delAAG		CCDS42562.1	19q13.2	2008-02-05				ENSG00000130244			27119	protein-coding gene	gene with protein product						12477932	Standard	NM_174905		Approved	FLJ44669	uc002oin.1	Q17RN3		ENST00000252530.5:c.1030_1032delAAG	19.37:g.38899511_38899513delAAG	ENSP00000252530:p.Lys349del		Somatic				FAM98C_uc002oio.1_In_Frame_Del_p.K267del|FAM98C_uc010xtz.1_3'UTR	p.K349del	NM_174905	NP_777565	WXS	Illumina HiSeq	Unspecified	Q17RN3	FA98C_HUMAN	Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		8	1049_1051	+	all_cancers(60;3.95e-06)		349					A6NMW3|Q66K45	In_Frame_Del	DEL	ENST00000252530.5	37	c.1030_1032delAAG	CCDS42562.1																																																																																				0.606	FAM98C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000459222.1	NM_174905		8	91	NA	NA	NA	NA	NA	8	91	---	---	---	---
SCN7A	6332	broad.mit.edu	37	2	167322380	167322380	+	Frame_Shift_Del	DEL	C	C	-			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr2:167322380delC	ENST00000409855.1	-	7	908	c.782delG	c.(781-783)ggcfs	p.G261fs		NM_002976.3	NP_002967.2	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha subunit	261					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	glial cell projection (GO:0097386)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(30)|prostate(4)|soft_tissue(1)|urinary_tract(1)	44					Valproic Acid(DB00313)	TTTCAAGTTGCCCATGAAGAG	0.413																																							uc002udu.1		NA																	0				large_intestine(1)	1						c.(781-783)GGCfs		sodium channel, voltage-gated, type VII, alpha							94.0	89.0	91.0					2																	167322380		1816	4075	5891	SO:0001589	frameshift_variant	6332				muscle contraction	voltage-gated sodium channel complex	voltage-gated sodium channel activity	g.chr2:167322380delC	M91556	CCDS46442.1	2q21-q23	2012-03-05	2012-02-28	2002-06-14	ENSG00000136546	ENSG00000136546		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10594	protein-coding gene	gene with protein product		182392	"""sodium channel, voltage-gated, type VI, alpha"", ""sodium channel, voltage-gated, type VII, alpha"""	SCN6A		10198179	Standard	NM_002976		Approved	Nav2.1, Nav2.2, NaG	uc002udu.2	Q01118	OTTHUMG00000154078	ENST00000409855.1:c.782delG	2.37:g.167322380delC	ENSP00000386796:p.Gly261fs		Somatic				SCN7A_uc010fpm.1_RNA	p.G261fs	NM_002976	NP_002967	WXS	Illumina HiSeq	Unspecified	Q01118	SCN7A_HUMAN			7	909	-			261			Helical; Name=S5 of repeat I; (By similarity).			Frame_Shift_Del	DEL	ENST00000409855.1	37	c.782delG	CCDS46442.1																																																																																				0.413	SCN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333745.1			15	115	NA	NA	NA	NA	NA	15	115	---	---	---	---
DYTN	391475	broad.mit.edu	37	2	207528023	207528023	+	Frame_Shift_Del	DEL	C	C	-			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr2:207528023delC	ENST00000452335.2	-	11	1353	c.1237delG	c.(1237-1239)gatfs	p.D413fs		NM_001093730.1	NP_001087199.1	A2CJ06	DYTN_HUMAN	dystrotelin	413						plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(24)|ovary(1)|upper_aerodigestive_tract(1)	36				LUSC - Lung squamous cell carcinoma(261;0.082)|Epithelial(149;0.129)|Lung(261;0.153)		TGCAAATAATCCCCTCCCTTT	0.468																																							uc002vbr.1		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(1237-1239)GATfs		dystrotelin							110.0	104.0	106.0					2																	207528023		1905	4116	6021	SO:0001589	frameshift_variant	391475					plasma membrane	zinc ion binding	g.chr2:207528023delC	ABF55377	CCDS46502.1	2q33.3	2007-01-22			ENSG00000232125	ENSG00000232125			23279	protein-coding gene	gene with protein product						17233888	Standard	NM_001093730		Approved		uc002vbr.1	A2CJ06	OTTHUMG00000154729	ENST00000452335.2:c.1237delG	2.37:g.207528023delC	ENSP00000396593:p.Asp413fs		Somatic					p.D413fs	NM_001093730	NP_001087199	WXS	Illumina HiSeq	Unspecified	A2CJ06	DYTN_HUMAN		LUSC - Lung squamous cell carcinoma(261;0.082)|Epithelial(149;0.129)|Lung(261;0.153)	11	1354	-			413						Frame_Shift_Del	DEL	ENST00000452335.2	37	c.1237delG	CCDS46502.1																																																																																				0.468	DYTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336799.1			17	123	NA	NA	NA	NA	NA	17	123	---	---	---	---
SFMBT1	51460	broad.mit.edu	37	3	52945171	52945172	+	Frame_Shift_Ins	INS	-	-	C			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr3:52945171_52945172insC	ENST00000394752.3	-	17	2135_2136	c.1753_1754insG	c.(1753-1755)gctfs	p.A585fs	SFMBT1_ENST00000394750.1_Frame_Shift_Ins_p.A585fs|SFMBT1_ENST00000358080.2_Frame_Shift_Ins_p.A585fs|SFMBT1_ENST00000296295.6_Frame_Shift_Ins_p.A585fs	NM_016329.3	NP_057413.2	Q9UHJ3	SMBT1_HUMAN	Scm-like with four mbt domains 1	585					cell differentiation (GO:0030154)|chromatin modification (GO:0016568)|negative regulation of muscle organ development (GO:0048635)|negative regulation of transcription, DNA-templated (GO:0045892)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone binding (GO:0042393)|transcription corepressor activity (GO:0003714)			breast(2)|endometrium(3)|kidney(3)|large_intestine(8)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	24				BRCA - Breast invasive adenocarcinoma(193;9.91e-05)|Kidney(197;0.000644)|KIRC - Kidney renal clear cell carcinoma(197;0.000792)|OV - Ovarian serous cystadenocarcinoma(275;0.113)		CTCAACAGTAGCCCGATAACTC	0.421																																							uc003dgf.2		NA																	0				ovary(1)	1						c.(1753-1755)GCTfs		Scm-like with four mbt domains 1																																				SO:0001589	frameshift_variant	51460				regulation of transcription, DNA-dependent	nucleus		g.chr3:52945171_52945172insC	AF168132	CCDS2867.1	3p21.31	2013-01-10			ENSG00000163935	ENSG00000163935		"""Sterile alpha motif (SAM) domain containing"""	20255	protein-coding gene	gene with protein product		607319				10661410	Standard	NM_016329		Approved	RU1, DKFZp434L243, SFMBT	uc003dgh.3	Q9UHJ3	OTTHUMG00000159052	ENST00000394752.3:c.1754dupG	3.37:g.52945174_52945174dupC	ENSP00000378235:p.Ala585fs		Somatic				SFMBT1_uc010hmr.2_Frame_Shift_Ins_p.A532fs|SFMBT1_uc003dgg.2_Frame_Shift_Ins_p.A585fs|SFMBT1_uc003dgh.2_Frame_Shift_Ins_p.A585fs	p.A585fs	NM_001005159	NP_001005159	WXS	Illumina HiSeq	Unspecified	Q9UHJ3	SMBT1_HUMAN		BRCA - Breast invasive adenocarcinoma(193;9.91e-05)|Kidney(197;0.000644)|KIRC - Kidney renal clear cell carcinoma(197;0.000792)|OV - Ovarian serous cystadenocarcinoma(275;0.113)	18	2322_2323	-			585					Q402F7|Q96C73|Q9Y4Q9	Frame_Shift_Ins	INS	ENST00000394752.3	37	c.1753_1754insG	CCDS2867.1																																																																																				0.421	SFMBT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353040.3	NM_016329		16	76	NA	NA	NA	NA	NA	16	76	---	---	---	---
GMCL1P1	64396	broad.mit.edu	37	5	177613745	177613745	+	IGR	DEL	C	C	-			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chr5:177613745delC								NHP2 (32777 upstream) : HNRNPAB (17762 downstream)																							CAAGCTGCTGCCAAAATGGCA	0.433																																							uc003mit.1		NA																	0					0						c.(556-558)GCAfs		SubName: Full=Germ cell-less homolog 1 (Drosophila); SubName: Full=Putative uncharacterized protein FLJ13057;																																				SO:0001628	intergenic_variant	64396							g.chr5:177613745delC																													5.37:g.177613745delC			Somatic					p.A186fs	NR_003281		WXS	Illumina HiSeq	Unspecified					1	689	-									Frame_Shift_Del	DEL		37	c.556delG																																																																																				0	0.433									21	63	NA	NA	NA	NA	NA	21	63	---	---	---	---
PCDH19	57526	broad.mit.edu	37	X	99551618	99551618	+	Frame_Shift_Del	DEL	C	C	-			TCGA-05-4417-01A-22D-1855-08	TCGA-05-4417-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	57e3657d-7a3c-4d80-a2c2-2de0293f5f05	f54f5b4b-f15b-4f65-9c0b-c0656d57413b	g.chrX:99551618delC	ENST00000373034.4	-	6	4779	c.3104delG	c.(3103-3105)ggcfs	p.G1035fs	PCDH19_ENST00000420881.2_Frame_Shift_Del_p.G987fs|PCDH19_ENST00000255531.7_Frame_Shift_Del_p.G988fs|PCDH19_ENST00000464981.1_5'Flank	NM_001184880.1	NP_001171809.1	Q8TAB3	PCD19_HUMAN	protocadherin 19	1035					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(5)|endometrium(11)|kidney(1)|large_intestine(14)|liver(1)|lung(23)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	68						AGTCCTCTTGCCTTTCAGGGT	0.597																																							uc010nmz.2		NA																	0				ovary(2)|breast(2)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	7						c.(3103-3105)GGCfs		protocadherin 19 isoform b							70.0	70.0	70.0					X																	99551618		2145	4220	6365	SO:0001589	frameshift_variant	57526				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chrX:99551618delC	AB037734	CCDS43976.1, CCDS48141.1, CCDS55462.1	Xq22.1	2014-06-28			ENSG00000165194	ENSG00000165194		"""Cadherins / Protocadherins : Non-clustered"""	14270	protein-coding gene	gene with protein product		300460	"""epilepsy, female restricted, with mental retardation (Juberg-Hellman syndrome)"""	EFMR		11549318, 18469813, 19752159	Standard	NM_020766		Approved	KIAA1313, EIEE9	uc010nmz.3	Q8TAB3	OTTHUMG00000022000	ENST00000373034.4:c.3104delG	X.37:g.99551618delC	ENSP00000362125:p.Gly1035fs		Somatic				PCDH19_uc004efw.3_Frame_Shift_Del_p.G987fs|PCDH19_uc004efx.3_Frame_Shift_Del_p.G988fs	p.G1035fs	NM_020766	NP_001098713	WXS	Illumina HiSeq	Unspecified	Q8TAB3	PCD19_HUMAN			6	4780	-			1035			Cytoplasmic (Potential).		B0LDS4|E9PAM6|Q5JTG1|Q5JTG2|Q68DT7|Q9P2N3	Frame_Shift_Del	DEL	ENST00000373034.4	37	c.3104delG	CCDS55462.1																																																																																				0.597	PCDH19-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057479.2	NM_020766		14	29	NA	NA	NA	NA	NA	14	29	---	---	---	---
