#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
HNRNPR	10236	broad.mit.edu	37	1	23648100	23648100	+	Silent	SNP	T	T	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr1:23648100T>A	ENST00000374612.1	-	7	855	c.732A>T	c.(730-732)gcA>gcT	p.A244A	HNRNPR_ENST00000302271.6_Silent_p.A244A|HNRNPR_ENST00000478691.1_Silent_p.A143A|HNRNPR_ENST00000374616.3_Silent_p.A244A|HNRNPR_ENST00000606561.1_Silent_p.A105A|HNRNPR_ENST00000427764.2_Silent_p.A206A|HNRNPR_ENST00000426846.2_Silent_p.A84A	NM_001102398.1|NM_005826.3	NP_001095868.1|NP_005817.1	O43390	HNRPR_HUMAN	heterogeneous nuclear ribonucleoprotein R	244	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.A244A(2)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(8)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Breast(348;0.00394)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;6.83e-27)|Colorectal(126;6.01e-08)|COAD - Colon adenocarcinoma(152;3.32e-06)|GBM - Glioblastoma multiforme(114;6.69e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00101)|KIRC - Kidney renal clear cell carcinoma(1967;0.00357)|STAD - Stomach adenocarcinoma(196;0.0131)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0875)|LUSC - Lung squamous cell carcinoma(448;0.19)		GTCTGTTGTTTGCCACAGAAA	0.383																																							uc001bgr.3		NA																	2	Substitution - coding silent(2)		lung(2)	upper_aerodigestive_tract(1)|skin(1)	2						c.(730-732)GCA>GCT		heterogeneous nuclear ribonucleoprotein R							124.0	128.0	127.0					1																	23648100		2203	4300	6503	SO:0001819	synonymous_variant	10236					catalytic step 2 spliceosome|cytoplasm|heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	nucleotide binding|protein binding|RNA binding	g.chr1:23648100T>A	AF000364	CCDS232.1, CCDS44085.1, CCDS60020.1, CCDS72726.1, CCDS72727.1	1p36.12	2013-02-12		2007-08-16	ENSG00000125944	ENSG00000125944		"""RNA binding motif (RRM) containing"""	5047	protein-coding gene	gene with protein product		607201		HNRPR		9421497	Standard	XM_005245711		Approved	hnRNP-R	uc001bgp.4	O43390	OTTHUMG00000003224	ENST00000374612.1:c.732A>T	1.37:g.23648100T>A			Somatic				HNRNPR_uc001bgp.3_Silent_p.A244A|HNRNPR_uc009vqk.2_Silent_p.A143A|HNRNPR_uc001bgs.3_Silent_p.A143A|HNRNPR_uc010odw.1_Silent_p.A206A|HNRNPR_uc010odx.1_Silent_p.A84A|HNRNPR_uc009vql.2_Silent_p.A105A	p.A244A	NM_005826	NP_005817	WXS	Illumina HiSeq	Unspecified	O43390	HNRPR_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;6.83e-27)|Colorectal(126;6.01e-08)|COAD - Colon adenocarcinoma(152;3.32e-06)|GBM - Glioblastoma multiforme(114;6.69e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00101)|KIRC - Kidney renal clear cell carcinoma(1967;0.00357)|STAD - Stomach adenocarcinoma(196;0.0131)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0875)|LUSC - Lung squamous cell carcinoma(448;0.19)	7	891	-		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Breast(348;0.00394)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)	244			RRM 1.		Q2L7G6|Q5TEH1|Q9BV64|S4R3J4	Silent	SNP	ENST00000374612.1	37	c.732A>T	CCDS232.1																																																																																				0.383	HNRNPR-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000008889.1	NM_005826		46	195	0	0	0	0.00361	0	46	195				
TCEA3	6920	broad.mit.edu	37	1	23743829	23743829	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr1:23743829T>A	ENST00000450454.2	-	4	399	c.293A>T	c.(292-294)aAg>aTg	p.K98M	TCEA3_ENST00000461794.1_Missense_Mutation_p.K61M|TCEA3_ENST00000374601.3_Missense_Mutation_p.K98M	NM_003196.1	NP_003187.1	O75764	TCEA3_HUMAN	transcription elongation factor A (SII), 3	98					regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.K98M(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|urinary_tract(1)	7		Colorectal(325;3.46e-05)|Lung NSC(340;4.16e-05)|all_lung(284;6.68e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.0054)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;1.6e-25)|Colorectal(126;8.32e-08)|COAD - Colon adenocarcinoma(152;4.29e-06)|GBM - Glioblastoma multiforme(114;9e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00112)|KIRC - Kidney renal clear cell carcinoma(1967;0.00424)|STAD - Stomach adenocarcinoma(196;0.0145)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.0963)|LUSC - Lung squamous cell carcinoma(448;0.198)		tttttccttcttctttgcctt	0.468																																							uc001bgx.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(292-294)AAG>ATG		transcription elongation factor A (SII), 3							165.0	157.0	160.0					1																	23743829		1849	4096	5945	SO:0001583	missense	6920				regulation of transcription elongation, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription elongation, DNA-dependent	nucleus	DNA binding|translation elongation factor activity|zinc ion binding	g.chr1:23743829T>A	AJ223473	CCDS44086.1	1p36.11	2011-01-25			ENSG00000204219	ENSG00000204219			11615	protein-coding gene	gene with protein product		604128				9790746	Standard	NM_003196		Approved	TFIIS.H	uc021oig.1	O75764	OTTHUMG00000003233	ENST00000450454.2:c.293A>T	1.37:g.23743829T>A	ENSP00000406293:p.Lys98Met		Somatic				TCEA3_uc009vqn.1_Missense_Mutation_p.K77M|TCEA3_uc010ody.1_Missense_Mutation_p.K61M	p.K98M	NM_003196	NP_003187	WXS	Illumina HiSeq	Unspecified	O75764	TCEA3_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;1.6e-25)|Colorectal(126;8.32e-08)|COAD - Colon adenocarcinoma(152;4.29e-06)|GBM - Glioblastoma multiforme(114;9e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00112)|KIRC - Kidney renal clear cell carcinoma(1967;0.00424)|STAD - Stomach adenocarcinoma(196;0.0145)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.0963)|LUSC - Lung squamous cell carcinoma(448;0.198)	4	428	-		Colorectal(325;3.46e-05)|Lung NSC(340;4.16e-05)|all_lung(284;6.68e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.0054)|Myeloproliferative disorder(586;0.0255)	98					A8K2K7|Q5DR83	Missense_Mutation	SNP	ENST00000450454.2	37	c.293A>T	CCDS44086.1	.	.	.	.	.	.	.	.	.	.	T	18.09	3.547029	0.65198	.	.	ENSG00000204219	ENST00000450454;ENST00000374601	.	.	.	5.02	5.02	0.67125	.	1.560540	0.03619	N	0.236002	T	0.33352	0.0860	L	0.27053	0.805	0.25242	N	0.989742	P;P	0.46277	0.875;0.875	B;B	0.41510	0.359;0.359	T	0.31668	-0.9935	9	0.51188	T	0.08	-15.8875	11.3324	0.49484	0.0:0.0:0.0:1.0	.	98;98	A8K2K7;O75764	.;TCEA3_HUMAN	M	98	.	ENSP00000363729:K98M	K	-	2	0	TCEA3	23616416	1.000000	0.71417	1.000000	0.80357	0.618000	0.37518	3.315000	0.51951	2.244000	0.73946	0.533000	0.62120	AAG		0.468	TCEA3-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008911.2	NM_003196		12	119	0	0	0	0.000978	0	12	119				
CNR2	1269	broad.mit.edu	37	1	24201701	24201701	+	Missense_Mutation	SNP	C	C	T	rs199631465		TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr1:24201701C>T	ENST00000374472.4	-	2	568	c.407G>A	c.(406-408)cGc>cAc	p.R136H	CNR2_ENST00000536471.1_Missense_Mutation_p.R136H	NM_001841.2	NP_001832.1	P34972	CNR2_HUMAN	cannabinoid receptor 2 (macrophage)	136					G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|immune response (GO:0006955)|inflammatory response (GO:0006954)|negative regulation of action potential (GO:0045759)|negative regulation of inflammatory response (GO:0050728)|negative regulation of mast cell activation (GO:0033004)|negative regulation of nitric-oxide synthase activity (GO:0051001)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|response to amphetamine (GO:0001975)|response to lipopolysaccharide (GO:0032496)|sensory perception of pain (GO:0019233)	dendrite (GO:0030425)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	cannabinoid receptor activity (GO:0004949)	p.R136H(2)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|lung(9)|pancreas(1)|skin(2)|stomach(6)|upper_aerodigestive_tract(2)	26		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Ovarian(437;0.00348)|Breast(348;0.00957)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;1.32e-24)|Colorectal(126;6.09e-08)|COAD - Colon adenocarcinoma(152;3.33e-06)|GBM - Glioblastoma multiforme(114;2.9e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00101)|KIRC - Kidney renal clear cell carcinoma(1967;0.00359)|STAD - Stomach adenocarcinoma(196;0.0131)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.146)	Dronabinol(DB00470)|Nabilone(DB00486)	AGGTGGATAGCGCAGGCAGAG	0.582																																							uc001bif.2		NA																	2	Substitution - Missense(2)		lung(2)	skin(2)|central_nervous_system(1)	3						c.(406-408)CGC>CAC		cannabinoid receptor 2 (macrophage)	Nabilone(DB00486)						110.0	101.0	104.0					1																	24201701		2203	4300	6503	SO:0001583	missense	1269				behavior|G-protein signaling, coupled to cyclic nucleotide second messenger|immune response|inflammatory response	dendrite|integral to plasma membrane|perikaryon	cannabinoid receptor activity	g.chr1:24201701C>T	X74328	CCDS245.1	1p	2012-08-08			ENSG00000188822	ENSG00000188822		"""GPCR / Class A : Cannabinoid receptors"""	2160	protein-coding gene	gene with protein product		605051					Standard	NM_001841		Approved	CB2	uc001bif.3	P34972	OTTHUMG00000013892	ENST00000374472.4:c.407G>A	1.37:g.24201701C>T	ENSP00000363596:p.Arg136His		Somatic					p.R136H	NM_001841	NP_001832	WXS	Illumina HiSeq	Unspecified	P34972	CNR2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;1.32e-24)|Colorectal(126;6.09e-08)|COAD - Colon adenocarcinoma(152;3.33e-06)|GBM - Glioblastoma multiforme(114;2.9e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00101)|KIRC - Kidney renal clear cell carcinoma(1967;0.00359)|STAD - Stomach adenocarcinoma(196;0.0131)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.146)	2	534	-		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Ovarian(437;0.00348)|Breast(348;0.00957)|Myeloproliferative disorder(586;0.0255)	136			Cytoplasmic (Potential).		C6ES44|Q4VBK8|Q5JRH7|Q6B0G7|Q6NSY0	Missense_Mutation	SNP	ENST00000374472.4	37	c.407G>A	CCDS245.1	.	.	.	.	.	.	.	.	.	.	C	0.017	-1.505736	0.00992	.	.	ENSG00000188822	ENST00000374472;ENST00000536471	T;T	0.37752	1.18;1.18	5.78	0.623	0.17654	GPCR, rhodopsin-like superfamily (1);	0.666605	0.16768	N	0.200310	T	0.15046	0.0363	N	0.12527	0.23	0.23016	N	0.998427	B	0.06786	0.001	B	0.09377	0.004	T	0.26326	-1.0106	10	0.13108	T	0.6	.	4.4769	0.11748	0.2318:0.4633:0.0:0.3049	.	136	P34972	CNR2_HUMAN	H	136	ENSP00000363596:R136H;ENSP00000442830:R136H	ENSP00000363596:R136H	R	-	2	0	CNR2	24074288	0.956000	0.32656	0.808000	0.32385	0.036000	0.12997	0.899000	0.28417	-0.125000	0.11703	-0.266000	0.10368	CGC		0.582	CNR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038949.1	NM_001841		24	122	0	0	0	0.00632	0	24	122				
CEP85	64793	broad.mit.edu	37	1	26566285	26566285	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr1:26566285A>T	ENST00000252992.4	+	2	142	c.11A>T	c.(10-12)cAg>cTg	p.Q4L	CEP85_ENST00000451429.2_Missense_Mutation_p.Q4L	NM_001281517.1|NM_022778.2	NP_001268446.1|NP_073615.2	Q6P2H3	CEP85_HUMAN	centrosomal protein 85kDa	4						centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|spindle pole (GO:0000922)		p.Q4L(1)		breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(11)|skin(2)	25						ATGGCCATGCAGGAGAAATAT	0.408																																							uc001bls.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(10-12)CAG>CTG		coiled-coil domain containing 21							113.0	106.0	108.0					1																	26566285		2203	4300	6503	SO:0001583	missense	64793					centrosome|nucleolus|spindle pole		g.chr1:26566285A>T	AK024038	CCDS277.1, CCDS60038.1	1p36.11	2014-02-20	2011-05-06	2011-05-06	ENSG00000130695	ENSG00000130695			25309	protein-coding gene	gene with protein product			"""coiled-coil domain containing 21"""	CCDC21		12477932	Standard	NM_022778		Approved	DKFZP434L0117	uc001bls.1	Q6P2H3	OTTHUMG00000003380	ENST00000252992.4:c.11A>T	1.37:g.26566285A>T	ENSP00000252992:p.Gln4Leu		Somatic				CCDC21_uc001blr.2_Missense_Mutation_p.Q4L|CCDC21_uc010ofa.1_Missense_Mutation_p.Q4L	p.Q4L	NM_022778	NP_073615	WXS	Illumina HiSeq	Unspecified	Q6P2H3	CEP85_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;2.6e-26)|Colorectal(126;1.65e-08)|COAD - Colon adenocarcinoma(152;9.48e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|BRCA - Breast invasive adenocarcinoma(304;0.00105)|STAD - Stomach adenocarcinoma(196;0.00155)|GBM - Glioblastoma multiforme(114;0.00917)|READ - Rectum adenocarcinoma(331;0.0649)	2	142	+		all_cancers(24;7e-19)|Colorectal(325;0.000147)|all_lung(284;0.00122)|Lung NSC(340;0.00128)|Renal(390;0.00211)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.0589)|all_neural(195;0.0966)	4					B4DRL1|D3DPK4|F8W7K4|Q5VY68|Q5VY70|Q9H6Q1|Q9H828|Q9UF52	Missense_Mutation	SNP	ENST00000252992.4	37	c.11A>T	CCDS277.1	.	.	.	.	.	.	.	.	.	.	A	5.066	0.197829	0.09652	.	.	ENSG00000130695	ENST00000451429;ENST00000252992	T;T	0.30981	2.06;1.51	5.12	5.12	0.69794	.	0.327832	0.25771	N	0.028403	T	0.33059	0.0850	N	0.22421	0.69	0.31035	N	0.717006	D;B;B	0.57899	0.981;0.005;0.005	D;B;B	0.70487	0.969;0.007;0.011	T	0.07328	-1.0778	10	0.02654	T	1	-9.6431	11.2357	0.48940	1.0:0.0:0.0:0.0	.	4;4;4	F8W7K4;Q6P2H3;Q6P2H3-2	.;CEP85_HUMAN;.	L	4	ENSP00000417002:Q4L;ENSP00000252992:Q4L	ENSP00000252992:Q4L	Q	+	2	0	CEP85	26438872	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	3.871000	0.56077	2.136000	0.66102	0.477000	0.44152	CAG		0.408	CEP85-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009492.2	NM_022778		17	81	0	0	0	0.006122	0	17	81				
WDTC1	23038	broad.mit.edu	37	1	27627736	27627736	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr1:27627736G>T	ENST00000319394.3	+	13	1787	c.1252G>T	c.(1252-1254)Gcc>Tcc	p.A418S	WDTC1_ENST00000361771.3_Missense_Mutation_p.A417S	NM_001276252.1|NM_015023.3	NP_001263181.1|NP_055838.2	Q8N5D0	WDTC1_HUMAN	WD and tetratricopeptide repeats 1	418					cellular chemical homeostasis (GO:0055082)|cellular response to insulin stimulus (GO:0032869)|glucose metabolic process (GO:0006006)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein ubiquitination (GO:0016567)|regulation of cell size (GO:0008361)	cytosol (GO:0005829)|nucleus (GO:0005634)	enzyme inhibitor activity (GO:0004857)	p.A417S(1)		central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(5)|ovary(1)|skin(1)	21		all_cancers(24;3.12e-19)|all_epithelial(13;4.18e-18)|Colorectal(325;0.000147)|all_lung(284;0.000366)|Lung NSC(340;0.000548)|Renal(390;0.00211)|Breast(348;0.00257)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0443)|OV - Ovarian serous cystadenocarcinoma(117;1.09e-27)|Colorectal(126;8.83e-09)|COAD - Colon adenocarcinoma(152;1.02e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000544)|KIRC - Kidney renal clear cell carcinoma(1967;0.00201)|STAD - Stomach adenocarcinoma(196;0.00321)|READ - Rectum adenocarcinoma(331;0.0476)		CCACTATGATGCCCTGAGGGA	0.597											OREG0013280	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc009vst.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(1252-1254)GCC>TCC		WD and tetratricopeptide repeats 1							68.0	54.0	59.0					1																	27627736		2203	4300	6503	SO:0001583	missense	23038						protein binding	g.chr1:27627736G>T	AK023778	CCDS296.1, CCDS60044.1	1p35.3	2013-01-11			ENSG00000142784	ENSG00000142784		"""DDB1 and CUL4 associated factors"", ""WD repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29175	protein-coding gene	gene with protein product	"""adipose homolog (Drosophila)"", ""DDB1 and CUL4 associated factor 9"""					12717455, 19238144	Standard	NM_015023		Approved	KIAA1037, ADP, DCAF9	uc009vst.3	Q8N5D0	OTTHUMG00000004273	ENST00000319394.3:c.1252G>T	1.37:g.27627736G>T	ENSP00000317971:p.Ala418Ser		Somatic	OREG0013280	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	795	WDTC1_uc001bno.2_Missense_Mutation_p.A417S|WDTC1_uc001bnp.1_RNA|WDTC1_uc001bnq.2_Missense_Mutation_p.A96S	p.A418S	NM_015023	NP_055838	WXS	Illumina HiSeq	Unspecified	Q8N5D0	WDTC1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0443)|OV - Ovarian serous cystadenocarcinoma(117;1.09e-27)|Colorectal(126;8.83e-09)|COAD - Colon adenocarcinoma(152;1.02e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000544)|KIRC - Kidney renal clear cell carcinoma(1967;0.00201)|STAD - Stomach adenocarcinoma(196;0.00321)|READ - Rectum adenocarcinoma(331;0.0476)	13	1787	+		all_cancers(24;3.12e-19)|all_epithelial(13;4.18e-18)|Colorectal(325;0.000147)|all_lung(284;0.000366)|Lung NSC(340;0.000548)|Renal(390;0.00211)|Breast(348;0.00257)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)	418			TPR 2.		D3DPL5|Q5SSC5|Q9NV87|Q9UPW4	Missense_Mutation	SNP	ENST00000319394.3	37	c.1252G>T		.	.	.	.	.	.	.	.	.	.	G	24.4	4.527063	0.85706	.	.	ENSG00000142784	ENST00000319394;ENST00000361771	T;T	0.72394	-0.65;-0.65	5.13	5.13	0.70059	Tetratricopeptide-like helical (1);WD40 repeat-like-containing domain (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	D	0.83390	0.5244	M	0.73598	2.24	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.81243	-0.1021	10	0.31617	T	0.26	.	17.7531	0.88440	0.0:0.0:1.0:0.0	.	418;417	Q8N5D0;Q8N5D0-4	WDTC1_HUMAN;.	S	418;417	ENSP00000317971:A418S;ENSP00000355317:A417S	ENSP00000317971:A418S	A	+	1	0	WDTC1	27500323	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.263000	0.95617	2.668000	0.90789	0.561000	0.74099	GCC		0.597	WDTC1-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015023		7	54	1	0	5.18039e-06	0.00308	6.61496e-06	7	54				
RSPO1	284654	broad.mit.edu	37	1	38095323	38095323	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr1:38095323C>A	ENST00000401069.1	-	3	723	c.11G>T	c.(10-12)gGg>gTg	p.G4V	RSPO1_ENST00000356545.2_Missense_Mutation_p.G4V|RSPO1_ENST00000401071.2_Missense_Mutation_p.G4V|RSPO1_ENST00000401068.1_Missense_Mutation_p.G4V|RSPO1_ENST00000401070.1_Missense_Mutation_p.G4V|RSPO1_ENST00000373059.1_Intron	NM_001242908.1	NP_001229837.1	Q2MKA7	RSPO1_HUMAN	R-spondin 1	4					canonical Wnt signaling pathway (GO:0060070)|male meiosis (GO:0007140)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of non-canonical Wnt signaling pathway (GO:2000052)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of gene expression (GO:0010468)|regulation of male germ cell proliferation (GO:2000254)|regulation of receptor internalization (GO:0002090)	extracellular space (GO:0005615)|nucleus (GO:0005634)	G-protein coupled receptor binding (GO:0001664)|heparin binding (GO:0008201)|receptor binding (GO:0005102)	p.G4V(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(5)	12		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				CACACACAGCCCAAGCCGCAT	0.642																																					GBM(122;680 2230 27822 42821)	GBM(122;680 2230 27822 42821)	uc001cbl.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(10-12)GGG>GTG		R-spondin1 precursor							39.0	45.0	43.0					1																	38095323		2045	4180	6225	SO:0001583	missense	284654				positive regulation of canonical Wnt receptor signaling pathway|regulation of receptor internalization		heparin binding	g.chr1:38095323C>A	AK098225	CCDS41304.1, CCDS55590.1, CCDS55591.1	1p34.2	2014-01-30	2011-06-29		ENSG00000169218	ENSG00000169218		"""Endogenous ligands"""	21679	protein-coding gene	gene with protein product		609595	"""R-spondin homolog (Xenopus laevis)"""				Standard	NM_001038633		Approved	FLJ40906, RSPONDIN	uc001cbm.2	Q2MKA7	OTTHUMG00000004321	ENST00000401069.1:c.11G>T	1.37:g.38095323C>A	ENSP00000383847:p.Gly4Val		Somatic				RSPO1_uc001cbm.1_Missense_Mutation_p.G4V|RSPO1_uc009vvf.1_Intron|RSPO1_uc009vvg.1_Missense_Mutation_p.G4V	p.G4V	NM_001038633	NP_001033722	WXS	Illumina HiSeq	Unspecified	Q2MKA7	RSPO1_HUMAN			4	799	-		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)	4					A2A420|Q0H8S6|Q14C72|Q5T0F2|Q8N7L5	Missense_Mutation	SNP	ENST00000401069.1	37	c.11G>T	CCDS41304.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.015396	0.75161	.	.	ENSG00000169218	ENST00000401070;ENST00000356545;ENST00000401071;ENST00000401069;ENST00000401068	D;D;D;D;D	0.86030	-2.06;-1.55;-2.06;-1.55;-1.55	5.4	5.4	0.78164	.	0.465783	0.19195	U	0.120332	D	0.89469	0.6724	L	0.47716	1.5	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.88091	0.2813	10	0.40728	T	0.16	.	14.6799	0.69009	0.0:1.0:0.0:0.0	.	4;4	Q0H8S6;Q2MKA7	.;RSPO1_HUMAN	V	4	ENSP00000383848:G4V;ENSP00000348944:G4V;ENSP00000383849:G4V;ENSP00000383847:G4V;ENSP00000383846:G4V	ENSP00000348944:G4V	G	-	2	0	RSPO1	37867910	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.127000	0.57944	2.537000	0.85549	0.561000	0.74099	GGG		0.642	RSPO1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012477.2	NM_173640		7	28	1	0	0.000673444	0.008291	0.000757396	7	28				
LRRC41	10489	broad.mit.edu	37	1	46746874	46746874	+	Missense_Mutation	SNP	G	G	T	rs140475848		TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr1:46746874G>T	ENST00000343304.6	-	5	1964	c.1679C>A	c.(1678-1680)cCa>cAa	p.P560Q	LRRC41_ENST00000472710.1_5'UTR	NM_006369.4	NP_006360.3	Q15345	LRC41_HUMAN	leucine rich repeat containing 41	560					protein ubiquitination (GO:0016567)	membrane (GO:0016020)		p.P560Q(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(7)|ovary(3)|pancreas(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	28	Acute lymphoblastic leukemia(166;0.155)					CCGCTGGCTTGGGTGGTCAAC	0.582																																							uc001cpn.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|breast(1)|pancreas(1)	4						c.(1678-1680)CCA>CAA		MUF1 protein							81.0	69.0	73.0					1																	46746874		2203	4300	6503	SO:0001583	missense	10489							g.chr1:46746874G>T	AK024051	CCDS533.1	1p34.1	2008-02-05			ENSG00000132128	ENSG00000132128			16917	protein-coding gene	gene with protein product						11384984	Standard	XM_005270376		Approved	MUF1	uc001cpn.3	Q15345	OTTHUMG00000007810	ENST00000343304.6:c.1679C>A	1.37:g.46746874G>T	ENSP00000343298:p.Pro560Gln		Somatic				LRRC41_uc010omb.1_Missense_Mutation_p.P560Q	p.P560Q	NM_006369	NP_006360	WXS	Illumina HiSeq	Unspecified	Q15345	LRC41_HUMAN			5	1723	-	Acute lymphoblastic leukemia(166;0.155)		560					A8K5G8|Q3MJ96|Q5TDF5|Q71RA8|Q9BSM0	Missense_Mutation	SNP	ENST00000343304.6	37	c.1679C>A	CCDS533.1	.	.	.	.	.	.	.	.	.	.	G	12.55	1.972066	0.34754	.	.	ENSG00000132128	ENST00000343304;ENST00000371972	T	0.44083	0.93	5.75	4.65	0.58169	.	0.377344	0.25402	N	0.030928	T	0.20210	0.0486	N	0.14661	0.345	0.34778	D	0.734443	D;P	0.53745	0.962;0.926	B;B	0.39738	0.308;0.308	T	0.09314	-1.0680	10	0.12766	T	0.61	-10.1757	7.7125	0.28686	0.0916:0.0:0.701:0.2074	.	560;560	Q15345-3;Q15345	.;LRC41_HUMAN	Q	560;538	ENSP00000343298:P560Q	ENSP00000343298:P560Q	P	-	2	0	LRRC41	46519461	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	2.944000	0.49034	2.723000	0.93209	0.650000	0.86243	CCA		0.582	LRRC41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021438.1	NM_006369		6	73	1	0	5.4927e-09	0.004482	7.99815e-09	6	73				
SLC44A5	204962	broad.mit.edu	37	1	75708683	75708683	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr1:75708683T>A	ENST00000370855.5	-	8	472	c.359A>T	c.(358-360)aAg>aTg	p.K120M	SLC44A5_ENST00000469525.1_5'UTR|SLC44A5_ENST00000535611.1_De_novo_Start_InFrame|SLC44A5_ENST00000370859.3_Missense_Mutation_p.K120M	NM_152697.4	NP_689910.2	Q8NCS7	CTL5_HUMAN	solute carrier family 44, member 5	120					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.K120M(1)		kidney(1)|large_intestine(13)|lung(35)|ovary(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	61						TTCTGGGCACTTGGAGACACA	0.398																																							uc001dgu.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(2)	4						c.(358-360)AAG>ATG		solute carrier family 44, member 5 isoform A							83.0	86.0	85.0					1																	75708683		2203	4300	6503	SO:0001583	missense	204962					integral to membrane|plasma membrane	choline transmembrane transporter activity	g.chr1:75708683T>A	BC034580	CCDS667.1, CCDS44164.1	1p31.1	2013-05-22			ENSG00000137968	ENSG00000137968		"""Solute carriers"""	28524	protein-coding gene	gene with protein product						15715662	Standard	NM_152697		Approved	MGC34032, CTL5	uc001dgu.3	Q8NCS7	OTTHUMG00000009721	ENST00000370855.5:c.359A>T	1.37:g.75708683T>A	ENSP00000359892:p.Lys120Met		Somatic				SLC44A5_uc001dgt.2_Missense_Mutation_p.K120M|SLC44A5_uc001dgs.2_Missense_Mutation_p.K78M|SLC44A5_uc001dgr.2_Missense_Mutation_p.K78M|SLC44A5_uc010oqz.1_Missense_Mutation_p.K159M|SLC44A5_uc010ora.1_Missense_Mutation_p.K114M|SLC44A5_uc010orb.1_Translation_Start_Site	p.K120M	NM_152697	NP_689910	WXS	Illumina HiSeq	Unspecified	Q8NCS7	CTL5_HUMAN			8	503	-			120			Extracellular (Potential).		B5MCU3|Q4G0K0|Q8NA44|Q8NB86	Missense_Mutation	SNP	ENST00000370855.5	37	c.359A>T	CCDS667.1	.	.	.	.	.	.	.	.	.	.	T	19.76	3.886862	0.72410	.	.	ENSG00000137968	ENST00000370859;ENST00000536707;ENST00000370855;ENST00000535790	T;T	0.16897	2.31;2.31	5.07	-0.169	0.13339	.	0.253315	0.44902	D	0.000408	T	0.25382	0.0617	M	0.87180	2.865	0.80722	D	1	D;D;D;D;D	0.67145	0.992;0.993;0.981;0.995;0.996	P;P;P;D;D	0.67382	0.827;0.848;0.827;0.917;0.951	T	0.05716	-1.0868	10	0.62326	D	0.03	-0.4626	5.5974	0.17334	0.0:0.2425:0.1344:0.6231	.	114;159;120;120;159	B7Z5Y4;B7Z470;Q8NCS7;Q8NCS7-2;F5GYS0	.;.;CTL5_HUMAN;.;.	M	120;159;120;113	ENSP00000359896:K120M;ENSP00000359892:K120M	ENSP00000359892:K120M	K	-	2	0	SLC44A5	75481271	1.000000	0.71417	0.997000	0.53966	0.988000	0.76386	2.162000	0.42367	0.066000	0.16515	0.533000	0.62120	AAG		0.398	SLC44A5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000026921.1	NM_152697		24	86	0	0	0	0.002299	0	24	86				
COL24A1	255631	broad.mit.edu	37	1	86362043	86362043	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr1:86362043G>T	ENST00000370571.2	-	29	3194	c.2828C>A	c.(2827-2829)gCc>gAc	p.A943D	COL24A1_ENST00000436319.1_Missense_Mutation_p.A943D	NM_152890.5	NP_690850.2	Q17RW2	COOA1_HUMAN	collagen, type XXIV, alpha 1	943	Collagen-like 7.				extracellular matrix organization (GO:0030198)|hematopoietic progenitor cell differentiation (GO:0002244)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)	p.A943D(1)		NS(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(9)|liver(1)|lung(56)|ovary(4)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	101				all cancers(265;0.0627)|Epithelial(280;0.0689)		GATTACCTTGGCACCTTGTAT	0.313																																							uc001dlj.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|central_nervous_system(1)|skin(1)	5						c.(2827-2829)GCC>GAC		collagen, type XXIV, alpha 1 precursor							114.0	108.0	110.0					1																	86362043		1832	4087	5919	SO:0001583	missense	255631				cell adhesion	collagen	extracellular matrix structural constituent	g.chr1:86362043G>T	AF410793	CCDS41353.1	1p22.3-p22.2	2013-01-16			ENSG00000171502	ENSG00000171502		"""Collagens"""	20821	protein-coding gene	gene with protein product		610025					Standard	NM_152890		Approved		uc001dlj.3	Q17RW2	OTTHUMG00000010629	ENST00000370571.2:c.2828C>A	1.37:g.86362043G>T	ENSP00000359603:p.Ala943Asp		Somatic				COL24A1_uc001dli.2_Missense_Mutation_p.A79D|COL24A1_uc010osd.1_Missense_Mutation_p.A243D|COL24A1_uc001dlk.2_RNA|COL24A1_uc010ose.1_RNA|COL24A1_uc010osf.1_RNA	p.A943D	NM_152890	NP_690850	WXS	Illumina HiSeq	Unspecified	Q17RW2	COOA1_HUMAN		all cancers(265;0.0627)|Epithelial(280;0.0689)	29	2870	-			943			Collagen-like 7.		C9J1X6|Q14BD7|Q59EX5|Q5VY50|Q7Z5L5	Missense_Mutation	SNP	ENST00000370571.2	37	c.2828C>A	CCDS41353.1	.	.	.	.	.	.	.	.	.	.	G	14.96	2.691708	0.48097	.	.	ENSG00000171502	ENST00000370571;ENST00000436319	D;D	0.93488	-1.78;-3.23	5.46	-0.273	0.12915	.	0.000000	0.38492	N	0.001677	T	0.78387	0.4275	N	0.16066	0.365	0.25809	N	0.984419	P;P	0.46395	0.729;0.877	B;P	0.53224	0.222;0.721	T	0.76798	-0.2826	10	0.12103	T	0.63	.	4.6302	0.12498	0.4301:0.2859:0.284:0.0	.	943;943	Q17RW2;Q17RW2-2	COOA1_HUMAN;.	D	943	ENSP00000359603:A943D;ENSP00000392531:A943D	ENSP00000359603:A943D	A	-	2	0	COL24A1	86134631	0.535000	0.26370	0.996000	0.52242	0.996000	0.88848	-0.019000	0.12546	0.276000	0.22118	0.655000	0.94253	GCC		0.313	COL24A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029335.4	NM_152890		5	137	1	0	0.000602214	0.000602	0.000679128	5	137				
VAV3	10451	broad.mit.edu	37	1	108507486	108507486	+	Silent	SNP	C	C	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr1:108507486C>T	ENST00000370056.4	-	1	280	c.6G>A	c.(4-6)gaG>gaA	p.E2E	VAV3_ENST00000527011.1_Silent_p.E2E|VAV3-AS1_ENST00000438318.1_RNA|VAV3_ENST00000371846.4_5'Flank	NM_006113.4	NP_006104.4	Q9UKW4	VAV3_HUMAN	vav 3 guanine nucleotide exchange factor	2	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cellular response to DNA damage stimulus (GO:0006974)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell adhesion (GO:0045785)|positive regulation of GTPase activity (GO:0043547)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of signal transduction (GO:0009967)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to drug (GO:0042493)|small GTPase mediated signal transduction (GO:0007264)|vesicle fusion (GO:0006906)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|SH3/SH2 adaptor activity (GO:0005070)	p.E2E(1)		NS(2)|breast(5)|endometrium(4)|kidney(2)|large_intestine(14)|lung(20)|ovary(6)|prostate(3)|stomach(1)|urinary_tract(1)	58		all_epithelial(167;5.38e-05)|all_lung(203;0.000314)|Lung NSC(277;0.000594)		Colorectal(144;0.0331)|Lung(183;0.128)|Epithelial(280;0.204)		GCTTCCACGGCTCCATGCCCG	0.746																																							uc001dvk.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(5)|lung(2)|breast(2)	9						c.(4-6)GAG>GAA		vav 3 guanine nucleotide exchange factor isoform							31.0	26.0	28.0					1																	108507486		2203	4300	6503	SO:0001819	synonymous_variant	10451				angiogenesis|apoptosis|B cell receptor signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of B cell proliferation|regulation of Rho protein signal transduction|response to DNA damage stimulus|response to drug|small GTPase mediated signal transduction	cytosol	GTPase activator activity|metal ion binding|SH3/SH2 adaptor activity	g.chr1:108507486C>T	AF118886	CCDS785.1, CCDS44181.1	1p13.3	2013-02-14	2007-07-25		ENSG00000134215	ENSG00000134215		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12659	protein-coding gene	gene with protein product		605541	"""vav 3 oncogene"""				Standard	NM_001079874		Approved		uc001dvk.1	Q9UKW4	OTTHUMG00000010995	ENST00000370056.4:c.6G>A	1.37:g.108507486C>T			Somatic				VAV3_uc010ouw.1_Silent_p.E2E|VAV3_uc001dvl.1_5'Flank|VAV3_uc010oux.1_Silent_p.E2E	p.E2E	NM_006113	NP_006104	WXS	Illumina HiSeq	Unspecified	Q9UKW4	VAV3_HUMAN		Colorectal(144;0.0331)|Lung(183;0.128)|Epithelial(280;0.204)	1	60	-		all_epithelial(167;5.38e-05)|all_lung(203;0.000314)|Lung NSC(277;0.000594)	2			CH.		B1AMM0|B1APV5|B4E232|B7ZLR1|E9PQ97|O60498|O95230|Q9Y5X8	Silent	SNP	ENST00000370056.4	37	c.6G>A	CCDS785.1																																																																																				0.746	VAV3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030242.2	NM_006113		3	5	0	0	0	0.004672	0	3	5				
WARS2	10352	broad.mit.edu	37	1	119576771	119576771	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr1:119576771T>A	ENST00000235521.4	-	5	607	c.581A>T	c.(580-582)cAa>cTa	p.Q194L	WARS2_ENST00000537870.1_Missense_Mutation_p.Q100L|WARS2_ENST00000369426.5_Missense_Mutation_p.Q194L	NM_015836.3|NM_201263.2	NP_056651.1|NP_957715.1	Q9UGM6	SYWM_HUMAN	tryptophanyl tRNA synthetase 2, mitochondrial	194					gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)|tryptophanyl-tRNA aminoacylation (GO:0006436)|vasculogenesis (GO:0001570)	mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|tryptophan-tRNA ligase activity (GO:0004830)	p.Q194L(2)		breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(7)|prostate(2)	15	all_neural(166;0.187)	all_lung(203;2.48e-06)|Lung NSC(69;1.74e-05)|all_epithelial(167;0.000564)		Lung(183;0.0629)	L-Tryptophan(DB00150)	GTTGAAACCTTGTGCTAGATC	0.413																																							uc001ehn.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(580-582)CAA>CTA		mitochondrial tryptophanyl tRNA synthetase 2	L-Tryptophan(DB00150)						145.0	138.0	140.0					1																	119576771		2203	4300	6503	SO:0001583	missense	10352				tryptophanyl-tRNA aminoacylation	mitochondrial matrix	ATP binding|tryptophan-tRNA ligase activity	g.chr1:119576771T>A	BC021722	CCDS900.1, CCDS30817.1	1p12	2011-07-01	2007-02-23		ENSG00000116874	ENSG00000116874	6.1.1.2	"""Aminoacyl tRNA synthetases / Class I"""	12730	protein-coding gene	gene with protein product	"""tryptophan tRNA ligase 2, mitochondrial"""	604733				10072595, 10828066	Standard	NM_201263		Approved	TrpRS	uc001ehn.3	Q9UGM6	OTTHUMG00000012335	ENST00000235521.4:c.581A>T	1.37:g.119576771T>A	ENSP00000235521:p.Gln194Leu		Somatic				WARS2_uc010oxf.1_Missense_Mutation_p.Q100L|WARS2_uc001ehm.2_Missense_Mutation_p.Q194L|WARS2_uc010oxg.1_Missense_Mutation_p.Q137L|WARS2_uc010oxh.1_Silent_p.T165T|WARS2_uc010oxi.1_Silent_p.T71T	p.Q194L	NM_015836	NP_056651	WXS	Illumina HiSeq	Unspecified	Q9UGM6	SYWM_HUMAN		Lung(183;0.0629)	5	609	-	all_neural(166;0.187)	all_lung(203;2.48e-06)|Lung NSC(69;1.74e-05)|all_epithelial(167;0.000564)	194					B1ALR1|B2R9D4|Q53FT4|Q5VUD2|Q86TQ0	Missense_Mutation	SNP	ENST00000235521.4	37	c.581A>T	CCDS900.1	.	.	.	.	.	.	.	.	.	.	T	10.86	1.470528	0.26423	.	.	ENSG00000116874	ENST00000369426;ENST00000235521;ENST00000537870	T;T;T	0.32515	1.45;1.45;1.45	5.87	-2.06	0.07298	Rossmann-like alpha/beta/alpha sandwich fold (1);	0.546329	0.22141	N	0.064049	T	0.11153	0.0272	L	0.48642	1.525	0.09310	N	1	B;B;B	0.27625	0.024;0.095;0.183	B;B;B	0.29524	0.103;0.102;0.096	T	0.26643	-1.0097	10	0.42905	T	0.14	0.0014	12.9733	0.58525	0.0:0.5815:0.0:0.4185	.	137;194;194	B7Z6G7;Q9UGM6;B1ALR1	.;SYWM_HUMAN;.	L	194;194;100	ENSP00000358434:Q194L;ENSP00000235521:Q194L;ENSP00000438807:Q100L	ENSP00000235521:Q194L	Q	-	2	0	WARS2	119378294	0.941000	0.31946	0.041000	0.18516	0.394000	0.30568	1.307000	0.33516	-0.504000	0.06577	-0.250000	0.11733	CAA		0.413	WARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034362.1	NM_015836		16	121	0	0	0	0.00499	0	16	121				
FLG2	388698	broad.mit.edu	37	1	152326733	152326733	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr1:152326733T>C	ENST00000388718.5	-	3	3601	c.3529A>G	c.(3529-3531)Aca>Gca	p.T1177A	FLG-AS1_ENST00000445097.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	1177	Ser-rich.				establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.T1177A(1)		NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCAAAACTTGTGGTTGGACCT	0.483																																							uc001ezw.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17						c.(3529-3531)ACA>GCA		filaggrin family member 2							115.0	108.0	110.0					1																	152326733		2203	4300	6503	SO:0001583	missense	388698						calcium ion binding|structural molecule activity	g.chr1:152326733T>C	AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.3529A>G	1.37:g.152326733T>C	ENSP00000373370:p.Thr1177Ala		Somatic				uc001ezv.2_Intron	p.T1177A	NM_001014342	NP_001014364	WXS	Illumina HiSeq	Unspecified	Q5D862	FILA2_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	3602	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		1177			Ser-rich.		Q9H4U1	Missense_Mutation	SNP	ENST00000388718.5	37	c.3529A>G	CCDS30861.1	.	.	.	.	.	.	.	.	.	.	T	3.232	-0.157135	0.06544	.	.	ENSG00000143520	ENST00000388718	T	0.03635	3.86	3.2	-6.41	0.01938	.	.	.	.	.	T	0.00695	0.0023	L	0.50333	1.59	0.09310	N	1	B	0.19331	0.035	B	0.15484	0.013	T	0.49331	-0.8951	9	0.07644	T	0.81	.	1.7683	0.03007	0.1808:0.4089:0.119:0.2913	.	1177	Q5D862	FILA2_HUMAN	A	1177	ENSP00000373370:T1177A	ENSP00000373370:T1177A	T	-	1	0	FLG2	150593357	0.189000	0.23263	0.000000	0.03702	0.022000	0.10575	1.284000	0.33249	-1.058000	0.03197	0.254000	0.18369	ACA		0.483	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034018.5	NM_001014342		21	180	0	0	0	0.010504	0	21	180				
CD1C	911	broad.mit.edu	37	1	158261156	158261156	+	Silent	SNP	G	G	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr1:158261156G>A	ENST00000368170.3	+	2	573	c.294G>A	c.(292-294)gaG>gaA	p.E98E		NM_001765.2	NP_001756.2	P29017	CD1C_HUMAN	CD1c molecule	98					antigen processing and presentation (GO:0019882)|T cell activation involved in immune response (GO:0002286)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	endogenous lipid antigen binding (GO:0030883)|exogenous lipid antigen binding (GO:0030884)|glycolipid binding (GO:0051861)|lipopeptide binding (GO:0071723)	p.E98E(1)		NS(1)|endometrium(3)|large_intestine(4)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	39	all_hematologic(112;0.0378)					TAACTCGGGAGATTCAAGACC	0.368																																							uc001fru.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|skin(1)|pancreas(1)	4						c.(292-294)GAG>GAA		CD1C antigen precursor							98.0	96.0	97.0					1																	158261156		2203	4300	6503	SO:0001819	synonymous_variant	911				antigen processing and presentation|T cell activation involved in immune response	endosome membrane|integral to plasma membrane	endogenous lipid antigen binding|exogenous lipid antigen binding|glycolipid binding|lipopeptide binding	g.chr1:158261156G>A	M28827	CCDS1175.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158481	ENSG00000158481		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1636	protein-coding gene	gene with protein product		188340	"""CD1C antigen, c polypeptide"", ""CD1c antigen"""	CD1		2447586	Standard	NM_001765		Approved		uc001fru.3	P29017	OTTHUMG00000017514	ENST00000368170.3:c.294G>A	1.37:g.158261156G>A			Somatic				CD1C_uc001frv.2_5'Flank	p.E98E	NM_001765	NP_001756	WXS	Illumina HiSeq	Unspecified	P29017	CD1C_HUMAN			2	586	+	all_hematologic(112;0.0378)		98			Extracellular (Potential).		Q5TDJ7|Q6IAS4|Q9UMM0|Q9UN96	Silent	SNP	ENST00000368170.3	37	c.294G>A	CCDS1175.1	.	.	.	.	.	.	.	.	.	.	-	1.911	-0.450716	0.04572	.	.	ENSG00000158481	ENST00000443761	.	.	.	3.52	-0.692	0.11301	.	.	.	.	.	T	0.06735	0.0172	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.35798	-0.9774	4	.	.	.	.	0.7863	0.01049	0.2241:0.1869:0.3973:0.1917	.	.	.	.	N	33	.	.	D	+	1	0	CD1C	156527780	0.000000	0.05858	0.000000	0.03702	0.023000	0.10783	-3.074000	0.00617	-0.108000	0.12066	-0.182000	0.12963	GAT		0.368	CD1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046351.2	NM_001765		33	121	0	0	0	0.004289	0	33	121				
CD1E	913	broad.mit.edu	37	1	158325701	158325701	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr1:158325701C>A	ENST00000368167.3	+	4	949	c.710C>A	c.(709-711)cCa>cAa	p.P237Q	CD1E_ENST00000368165.3_Missense_Mutation_p.P147Q|CD1E_ENST00000452291.2_Missense_Mutation_p.P48Q|CD1E_ENST00000368155.3_Missense_Mutation_p.P147Q|CD1E_ENST00000368156.1_Missense_Mutation_p.P147Q|CD1E_ENST00000434258.1_Missense_Mutation_p.P235Q|CD1E_ENST00000368166.3_Missense_Mutation_p.P48Q|CD1E_ENST00000368161.3_Missense_Mutation_p.P237Q|CD1E_ENST00000444681.2_Missense_Mutation_p.P138Q|CD1E_ENST00000368164.3_Missense_Mutation_p.P48Q|CD1E_ENST00000368163.3_Missense_Mutation_p.P237Q|CD1E_ENST00000368154.1_Missense_Mutation_p.P48Q|CD1E_ENST00000368157.1_Missense_Mutation_p.P48Q|CD1E_ENST00000368160.3_Missense_Mutation_p.P237Q	NM_030893.3	NP_112155.2	P15812	CD1E_HUMAN	CD1e molecule	237	Ig-like.				antigen processing and presentation (GO:0019882)|immune response (GO:0006955)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	lipid binding (GO:0008289)	p.P237Q(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(27)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|urinary_tract(1)	49	all_hematologic(112;0.0378)					GGATTCTACCCAAAGCCCGTG	0.607																																							uc001fse.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)	3						c.(709-711)CCA>CAA		CD1E antigen isoform a precursor							75.0	74.0	74.0					1																	158325701		2203	4298	6501	SO:0001583	missense	913				antigen processing and presentation|immune response	early endosome|Golgi membrane|integral to plasma membrane|late endosome|lysosomal lumen		g.chr1:158325701C>A	AJ289111	CCDS41417.1, CCDS41418.1, CCDS41419.1, CCDS41420.1, CCDS41421.1, CCDS41422.1, CCDS53387.1, CCDS53388.1, CCDS53389.1, CCDS53390.1, CCDS53384.1, CCDS53385.1, CCDS53386.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158488	ENSG00000158488		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1638	protein-coding gene	gene with protein product		188411	"""CD1E antigen, e polypeptide"", ""CD1e antigen"""			10948205	Standard	NM_001042585		Approved		uc001fse.3	P15812	OTTHUMG00000017515	ENST00000368167.3:c.710C>A	1.37:g.158325701C>A	ENSP00000357149:p.Pro237Gln		Somatic				CD1E_uc010pid.1_Missense_Mutation_p.P235Q|CD1E_uc010pie.1_Missense_Mutation_p.P138Q|CD1E_uc010pif.1_Missense_Mutation_p.P48Q|CD1E_uc001fsd.2_Missense_Mutation_p.P237Q|CD1E_uc001fsk.2_Missense_Mutation_p.P147Q|CD1E_uc001fsj.2_Missense_Mutation_p.P147Q|CD1E_uc001fsc.2_Missense_Mutation_p.P48Q|CD1E_uc010pig.1_RNA|CD1E_uc001fsa.2_Missense_Mutation_p.P48Q|CD1E_uc001fsf.2_Missense_Mutation_p.P237Q|CD1E_uc001fry.2_Missense_Mutation_p.P237Q|CD1E_uc001fsg.2_Missense_Mutation_p.P48Q|CD1E_uc001fsh.2_Missense_Mutation_p.P48Q|CD1E_uc001fsi.2_Missense_Mutation_p.P237Q|CD1E_uc009wsv.2_Missense_Mutation_p.P138Q|CD1E_uc001frz.2_Missense_Mutation_p.P147Q|CD1E_uc009wsw.2_5'UTR	p.P237Q	NM_030893	NP_112155	WXS	Illumina HiSeq	Unspecified	P15812	CD1E_HUMAN			4	949	+	all_hematologic(112;0.0378)		237			Ig-like.		B4DZV3|E7EP01|Q5TDJ9|Q5TDK3|Q5TDK4|Q5TDK5|Q5TDK6|Q5TDK8|Q5TDL1|Q712E4|Q712E5|Q712E6|Q712E7|Q712E8|Q712E9|Q712F0|Q712F1|Q712F2|Q712F3|Q712F4|Q712F5|Q96TD0|Q96TD1|Q9UMM1|Q9Y5M3	Missense_Mutation	SNP	ENST00000368167.3	37	c.710C>A	CCDS41417.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.971016	0.74246	.	.	ENSG00000158488	ENST00000434258;ENST00000444681;ENST00000368167;ENST00000452291;ENST00000368165;ENST00000368166;ENST00000368163;ENST00000368164;ENST00000368157;ENST00000368160;ENST00000368161;ENST00000368156;ENST00000368155;ENST00000368154	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.70749	0.37;0.37;0.37;0.37;0.21;0.37;0.37;2.86;0.37;0.37;2.86;0.21;2.86;-0.51	4.83	4.83	0.62350	Immunoglobulin-like (1);MHC class I-like antigen recognition (1);Immunoglobulin C1-set (2);	0.000000	0.47093	D	0.000245	D	0.90021	0.6884	H	0.99668	4.69	0.36887	D	0.889718	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.998;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.97110	1.0;1.0;0.999;0.999;0.996;0.997;0.998;0.998;0.996;0.999;0.999;0.998;1.0;0.998;1.0	D	0.93767	0.7071	10	0.87932	D	0	-20.1559	13.2934	0.60284	0.0:1.0:0.0:0.0	.	48;138;235;138;147;147;48;48;237;237;237;48;48;147;237	B4E057;B4E042;E7ET31;E7EP01;P15812-5;P15812-7;P15812-9;P15812-10;P15812-2;P15812;P15812-3;P15812-8;P15812-11;P15812-6;P15812-4	.;.;.;.;.;.;.;.;.;CD1E_HUMAN;.;.;.;.;.	Q	235;138;237;48;147;48;237;48;48;237;237;147;147;48	ENSP00000401957:P235Q;ENSP00000402906:P138Q;ENSP00000357149:P237Q;ENSP00000416228:P48Q;ENSP00000357147:P147Q;ENSP00000357148:P48Q;ENSP00000357145:P237Q;ENSP00000357146:P48Q;ENSP00000357139:P48Q;ENSP00000357142:P237Q;ENSP00000357143:P237Q;ENSP00000357138:P147Q;ENSP00000357137:P147Q;ENSP00000357136:P48Q	ENSP00000357136:P48Q	P	+	2	0	CD1E	156592325	0.503000	0.26115	0.855000	0.33649	0.994000	0.84299	3.415000	0.52700	2.518000	0.84900	0.563000	0.77884	CCA		0.607	CD1E-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046353.3	NM_030893		27	90	1	0	1.55811e-20	0.008361	2.88668e-20	27	90				
OR10R2	343406	broad.mit.edu	37	1	158450421	158450421	+	Nonsense_Mutation	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr1:158450421G>T	ENST00000368152.1	+	1	754	c.754G>T	c.(754-756)Gag>Tag	p.E252*	RP11-144L1.4_ENST00000426251.1_RNA|RP11-144L1.4_ENST00000419738.1_RNA	NM_001004472.1	NP_001004472.1	Q8NGX6	O10R2_HUMAN	olfactory receptor, family 10, subfamily R, member 2	252						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.E252*(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(26)|pancreas(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	41	all_hematologic(112;0.0378)					TCCCTCAGCTGAGGGCAGACG	0.453																																							uc010pik.1		NA																	1	Substitution - Nonsense(1)		lung(1)	pancreas(2)|skin(1)	3						c.(754-756)GAG>TAG		olfactory receptor, family 10, subfamily R,							175.0	144.0	155.0					1																	158450421		2203	4300	6503	SO:0001587	stop_gained	343406				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:158450421G>T	AB065640	CCDS30898.1	1q23.1	2012-08-09			ENSG00000198965	ENSG00000198965		"""GPCR / Class A : Olfactory receptors"""	14820	protein-coding gene	gene with protein product							Standard	NM_001004472		Approved	OR10R2Q	uc010pik.2	Q8NGX6	OTTHUMG00000019632	ENST00000368152.1:c.754G>T	1.37:g.158450421G>T	ENSP00000357134:p.Glu252*		Somatic				uc001fso.1_RNA	p.E252*	NM_001004472	NP_001004472	WXS	Illumina HiSeq	Unspecified	Q8NGX6	O10R2_HUMAN			1	754	+	all_hematologic(112;0.0378)		252			Cytoplasmic (Potential).		Q5VWM8|Q6IFS1|Q96R61	Nonsense_Mutation	SNP	ENST00000368152.1	37	c.754G>T	CCDS30898.1	.	.	.	.	.	.	.	.	.	.	g	15.32	2.799967	0.50208	.	.	ENSG00000198965	ENST00000368152	.	.	.	4.2	4.2	0.49525	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.44086	T	0.13	.	12.0421	0.53458	0.0:0.1757:0.8243:0.0	.	.	.	.	X	252	.	ENSP00000357134:E252X	E	+	1	0	OR10R2	156717045	0.000000	0.05858	0.595000	0.28798	0.489000	0.33432	0.082000	0.14847	2.135000	0.66039	0.655000	0.94253	GAG		0.453	OR10R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051847.2	NM_001004472		21	99	1	0	1.28384e-07	0.001882	1.72425e-07	21	99				
RGS5	8490	broad.mit.edu	37	1	163138072	163138073	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr1:163138072_163138073GG>TT	ENST00000313961.5	-	2	407_408	c.130_131CC>AA	c.(130-132)CCa>AAa	p.P44K	RGS5_ENST00000527988.1_Intron|RGS5_ENST00000530507.1_Missense_Mutation_p.P44K|RGS5_ENST00000534288.1_5'UTR|RGS5_ENST00000367903.3_Missense_Mutation_p.P64K|RP11-267N12.1_ENST00000415437.1_RNA	NM_001254749.1|NM_003617.3	NP_001241678.1|NP_003608.1	O15539	RGS5_HUMAN	regulator of G-protein signaling 5	44					positive regulation of GTPase activity (GO:0043547)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)	p.P44K(1)		autonomic_ganglia(1)|breast(1)|endometrium(2)|large_intestine(1)|lung(12)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	20			LUSC - Lung squamous cell carcinoma(543;0.187)			TGGTTTCTCTGGCTTCTCATTG	0.455																																							uc001gcn.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(130-132)CCA>AAA		regulator of G-protein signalling 5																																				SO:0001583	missense	8490				negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|plasma membrane	GTPase activator activity|signal transducer activity	g.chr1:163138072_163138073GG>TT	AF030108	CCDS1244.1, CCDS55652.1, CCDS58041.1	1q23.1	2008-02-05	2007-08-14		ENSG00000143248	ENSG00000143248		"""Regulators of G-protein signaling"""	10001	protein-coding gene	gene with protein product		603276	"""regulator of G-protein signalling 5"""			9747037	Standard	NM_003617		Approved		uc021pdt.1	O15539	OTTHUMG00000034441	ENST00000313961.5:c.130_131delinsTT	1.37:g.163138072_163138073delinsTT	ENSP00000319308:p.Pro44Lys		Somatic				RGS5_uc009wvb.2_Intron	p.P44K	NM_003617	NP_003608	WXS	Illumina HiSeq	Unspecified	O15539	RGS5_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.187)		2	377_378	-			44					E9PMP5|Q53XA9|Q599J0	Missense_Mutation	DNP	ENST00000313961.5	37	c.130_131CC>AA	CCDS1244.1																																																																																				0.455	RGS5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083264.1	NM_003617		29	136	0	0	0	0.004672	0	29	136				
ILDR2	387597	broad.mit.edu	37	1	166905836	166905836	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr1:166905836G>T	ENST00000271417.3	-	5	750	c.695C>A	c.(694-696)cCt>cAt	p.P232H	ILDR2_ENST00000469934.2_Missense_Mutation_p.P232H|ILDR2_ENST00000528703.1_Missense_Mutation_p.P232H|ILDR2_ENST00000529387.1_Intron|ILDR2_ENST00000529071.1_Missense_Mutation_p.P213H|ILDR2_ENST00000525740.1_Intron|ILDR2_ENST00000526687.1_Intron	NM_199351.2	NP_955383.1	Q71H61	ILDR2_HUMAN	immunoglobulin-like domain containing receptor 2	232					cell differentiation (GO:0030154)|homeostasis of number of cells within a tissue (GO:0048873)|insulin secretion (GO:0030073)|pancreas development (GO:0031016)|response to glucose (GO:0009749)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)		p.P232H(1)		NS(3)|breast(1)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	22						ACAGGCTTGAGGGCAGCAGCA	0.602																																							uc001gdx.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(694-696)CCT>CAT		immunoglobulin-like domain containing receptor							60.0	56.0	57.0					1																	166905836		2203	4300	6503	SO:0001583	missense	387597					integral to membrane		g.chr1:166905836G>T	AF503509	CCDS1256.1	1q24.1	2008-12-18	2008-12-18	2008-12-18	ENSG00000143195	ENSG00000143195			18131	protein-coding gene	gene with protein product	"""LISCH-like"""		"""chromosome 1 open reading frame 32"""	C1orf32			Standard	NM_199351		Approved		uc001gdx.2	Q71H61	OTTHUMG00000034320	ENST00000271417.3:c.695C>A	1.37:g.166905836G>T	ENSP00000271417:p.Pro232His		Somatic					p.P232H	NM_199351	NP_955383	WXS	Illumina HiSeq	Unspecified	Q71H61	ILDR2_HUMAN			5	751	-			232			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000271417.3	37	c.695C>A	CCDS1256.1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.782823	0.90282	.	.	ENSG00000143195	ENST00000271417;ENST00000469934;ENST00000529071;ENST00000528703	T;T;T;T	0.64438	-0.1;-0.1;-0.1;-0.1	5.61	5.61	0.85477	LISCH7 (1);	0.058698	0.64402	D	0.000001	T	0.76513	0.3998	M	0.74647	2.275	0.41621	D	0.988964	D	0.89917	1.0	D	0.74348	0.983	T	0.78800	-0.2062	10	0.87932	D	0	.	19.2398	0.93877	0.0:0.0:1.0:0.0	.	232	Q71H61	ILDR2_HUMAN	H	232;232;213;232	ENSP00000271417:P232H;ENSP00000437008:P232H;ENSP00000436882:P213H;ENSP00000432750:P232H	ENSP00000271417:P232H	P	-	2	0	ILDR2	165172460	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.451000	0.97610	2.631000	0.89168	0.563000	0.77884	CCT		0.602	ILDR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082880.2	NM_199351		4	41	1	0	0.000442599	0.006214	0.000501854	4	41				
GPA33	10223	broad.mit.edu	37	1	167025041	167025041	+	Nonsense_Mutation	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr1:167025041G>T	ENST00000367868.3	-	5	960	c.617C>A	c.(616-618)tCg>tAg	p.S206*	RP11-102C16.3_ENST00000417644.1_RNA|GPA33_ENST00000527955.1_5'UTR	NM_005814.1	NP_005805.1	Q99795	GPA33_HUMAN	glycoprotein A33 (transmembrane)	206	Ig-like C2-type.					extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)	p.S206*(1)		endometrium(4)|large_intestine(1)|lung(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	15						GTAGTAACCCGATGTGTCTGT	0.572																																							uc001gea.1		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(616-618)TCG>TAG		transmembrane glycoprotein A33 precursor							152.0	124.0	133.0					1																	167025041		2203	4300	6503	SO:0001587	stop_gained	10223					integral to plasma membrane	receptor activity	g.chr1:167025041G>T	U79725	CCDS1258.1	1q24.1	2013-01-29			ENSG00000143167	ENSG00000143167		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	4445	protein-coding gene	gene with protein product		602171				9012807, 9245713	Standard	NM_005814		Approved	A33	uc001gea.1	Q99795	OTTHUMG00000034435	ENST00000367868.3:c.617C>A	1.37:g.167025041G>T	ENSP00000356842:p.Ser206*		Somatic					p.S206*	NM_005814	NP_005805	WXS	Illumina HiSeq	Unspecified	Q99795	GPA33_HUMAN			5	961	-			206			Ig-like C2-type.|Extracellular (Potential).		Q5VZP6	Nonsense_Mutation	SNP	ENST00000367868.3	37	c.617C>A	CCDS1258.1	.	.	.	.	.	.	.	.	.	.	G	27.0	4.794146	0.90453	.	.	ENSG00000143167	ENST00000367868	.	.	.	4.91	4.91	0.64330	.	0.130170	0.53938	D	0.000056	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.5913	0.61961	0.0:0.0:1.0:0.0	.	.	.	.	X	206	.	ENSP00000356842:S206X	S	-	2	0	GPA33	165291665	0.935000	0.31712	0.012000	0.15200	0.024000	0.10985	3.851000	0.55926	2.262000	0.75019	0.650000	0.86243	TCG		0.572	GPA33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083245.1	NM_005814		34	107	1	0	3.11337e-16	0.002836	5.49809e-16	34	107				
PAPPA2	60676	broad.mit.edu	37	1	176668684	176668684	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr1:176668684G>T	ENST00000367662.3	+	8	4359	c.3195G>T	c.(3193-3195)ttG>ttT	p.L1065F		NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	1065					bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.L1065F(1)		NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						CCAGTGGTTTGCCCGTGGTGG	0.567																																							uc001gkz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						c.(3193-3195)TTG>TTT		pappalysin 2 isoform 1							125.0	126.0	125.0					1																	176668684		2036	4179	6215	SO:0001583	missense	60676				cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding	g.chr1:176668684G>T	BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.3195G>T	1.37:g.176668684G>T	ENSP00000356634:p.Leu1065Phe		Somatic				PAPPA2_uc009www.2_RNA	p.L1065F	NM_020318	NP_064714	WXS	Illumina HiSeq	Unspecified	Q9BXP8	PAPP2_HUMAN			8	4359	+			1065					A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Missense_Mutation	SNP	ENST00000367662.3	37	c.3195G>T	CCDS41438.1	.	.	.	.	.	.	.	.	.	.	G	0.032	-1.327739	0.01309	.	.	ENSG00000116183	ENST00000367662	T	0.42513	0.97	5.38	-2.4	0.06583	Fibronectin, type III (2);	1.549150	0.02999	N	0.147913	T	0.29914	0.0748	L	0.31664	0.95	0.09310	N	0.999996	B	0.19445	0.036	B	0.14578	0.011	T	0.16600	-1.0397	10	0.30078	T	0.28	0.4655	7.2516	0.26152	0.505:0.22:0.275:0.0	.	1065	Q9BXP8	PAPP2_HUMAN	F	1065	ENSP00000356634:L1065F	ENSP00000356634:L1065F	L	+	3	2	PAPPA2	174935307	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.157000	0.10085	-0.280000	0.09154	-0.140000	0.14226	TTG		0.567	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084763.1			75	236	1	0	4.41824e-40	0.00361	8.64891e-40	75	236				
CFHR2	3080	broad.mit.edu	37	1	196928066	196928066	+	Nonsense_Mutation	SNP	G	G	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr1:196928066G>A	ENST00000367415.5	+	5	769	c.669G>A	c.(667-669)tgG>tgA	p.W223*	CFHR2_ENST00000476712.2_Nonsense_Mutation_p.W207*|CFHR2_ENST00000367421.3_Nonsense_Mutation_p.W223*|CFHR2_ENST00000496448.1_3'UTR	NM_005666.2	NP_005657.1	P36980	FHR2_HUMAN	complement factor H-related 2	223	Sushi 4. {ECO:0000255|PROSITE- ProRule:PRU00302}.					extracellular region (GO:0005576)		p.W223*(1)		large_intestine(2)|ovary(1)|skin(3)	6						AATTAAAGTGGACAAACCAAC	0.279																																							uc001gtq.1		NA																	1	Substitution - Nonsense(1)		lung(1)	skin(2)|ovary(1)	3						c.(667-669)TGG>TGA		H factor (complement)-like 3 precursor							46.0	49.0	48.0					1																	196928066		2201	4292	6493	SO:0001587	stop_gained	3080					extracellular region		g.chr1:196928066G>A	X64877	CCDS30959.1	1q31.3	2008-02-05	2004-08-09	2006-02-28	ENSG00000080910	ENSG00000080910		"""Complement system"""	4890	protein-coding gene	gene with protein product		600889	"""H factor (complement)-like 3"""	HFL3, CFHL2		1533657, 7672821	Standard	NM_005666		Approved	FHR2	uc001gtq.1	P36980	OTTHUMG00000036518	ENST00000367415.5:c.669G>A	1.37:g.196928066G>A	ENSP00000356385:p.Trp223*		Somatic				CFHR2_uc001gtr.1_Nonsense_Mutation_p.W99*	p.W223*	NM_005666	NP_005657	WXS	Illumina HiSeq	Unspecified	P36980	FHR2_HUMAN			5	746	+			223			Sushi 4.		Q14310|Q5T9T1	Nonsense_Mutation	SNP	ENST00000367415.5	37	c.669G>A	CCDS30959.1	.	.	.	.	.	.	.	.	.	.	.	8.776	0.927090	0.18056	.	.	ENSG00000080910	ENST00000367421;ENST00000367415	.	.	.	3.52	2.53	0.30540	.	0.000000	0.31989	N	0.006747	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.25106	T	0.35	.	9.8296	0.40932	0.0:0.0:0.7953:0.2047	.	.	.	.	X	223	.	ENSP00000356385:W223X	W	+	3	0	CFHR2	195194689	0.998000	0.40836	0.004000	0.12327	0.001000	0.01503	4.561000	0.60809	1.782000	0.52362	0.543000	0.68304	TGG		0.279	CFHR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088815.2	NM_005666		3	37	0	0	0	0.000602	0	3	37				
USH2A	7399	broad.mit.edu	37	1	216019167	216019167	+	Splice_Site	SNP	C	C	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr1:216019167C>A	ENST00000307340.3	-	45	9440	c.9054G>T	c.(9052-9054)ggG>ggT	p.G3018G	USH2A_ENST00000366943.2_Splice_Site_p.G3018G	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	3018	Fibronectin type-III 16. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.G3018G(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TGGACTCACCCCCATCGCAAG	0.438										HNSCC(13;0.011)																													uc001hku.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26						c.(9052-9054)GGG>GGT		usherin isoform B							72.0	67.0	69.0					1																	216019167		2203	4300	6503	SO:0001630	splice_region_variant	7399				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding	g.chr1:216019167C>A	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.9055+1G>T	1.37:g.216019167C>A		HNSCC(13;0.011)	Somatic					p.G3018G	NM_206933	NP_996816	WXS	Illumina HiSeq	Unspecified	O75445	USH2A_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)	45	9441	-			3018			Extracellular (Potential).		Q5VVM9|Q6S362|Q9NS27	Silent	SNP	ENST00000307340.3	37	c.9054G>T	CCDS31025.1																																																																																				0.438	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	Silent	7	46	1	0	5.18039e-06	0.00308	6.61496e-06	7	46				
HHIPL2	79802	broad.mit.edu	37	1	222717100	222717100	+	Silent	SNP	C	C	G			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr1:222717100C>G	ENST00000343410.6	-	2	811	c.753G>C	c.(751-753)ctG>ctC	p.L251L		NM_024746.3	NP_079022.2	Q6UWX4	HIPL2_HUMAN	HHIP-like 2	251					carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor (GO:0016901)|quinone binding (GO:0048038)	p.L251L(1)		NS(2)|endometrium(8)|kidney(4)|large_intestine(7)|lung(28)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	59				GBM - Glioblastoma multiforme(131;0.0185)		AGGGTTGCTCCAGGCGACTCC	0.592																																							uc001hnh.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(751-753)CTG>CTC		HHIP-like 2 precursor							93.0	88.0	90.0					1																	222717100		2203	4300	6503	SO:0001819	synonymous_variant	79802				carbohydrate metabolic process	extracellular region	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor|quinone binding	g.chr1:222717100C>G	BC007638	CCDS1530.2	1q41	2008-02-05	2008-01-16	2008-01-16	ENSG00000143512	ENSG00000143512			25842	protein-coding gene	gene with protein product			"""KIAA1822-like"""	KIAA1822L		12975309	Standard	NM_024746		Approved	FLJ13840	uc001hnh.1	Q6UWX4	OTTHUMG00000037545	ENST00000343410.6:c.753G>C	1.37:g.222717100C>G			Somatic					p.L251L	NM_024746	NP_079022	WXS	Illumina HiSeq	Unspecified	Q6UWX4	HIPL2_HUMAN		GBM - Glioblastoma multiforme(131;0.0185)	2	811	-			251					Q6GU65|Q96BT4|Q96BU5|Q9H8A0	Silent	SNP	ENST00000343410.6	37	c.753G>C	CCDS1530.2																																																																																				0.592	HHIPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091499.2	NM_024746		30	158	0	0	0	0.007291	0	30	158				
ITPKB	3707	broad.mit.edu	37	1	226836376	226836376	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr1:226836376C>T	ENST00000272117.3	-	2	2028	c.2029G>A	c.(2029-2031)Gca>Aca	p.A677T	ITPKB_ENST00000429204.1_Missense_Mutation_p.A677T			P27987	IP3KB_HUMAN	inositol-trisphosphate 3-kinase B	677					cell surface receptor signaling pathway (GO:0007166)|inositol phosphate metabolic process (GO:0043647)|MAPK cascade (GO:0000165)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of Ras protein signal transduction (GO:0046579)|positive thymic T cell selection (GO:0045059)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)	p.A677T(1)|p.A203T(1)		central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(13)|ovary(4)|prostate(1)|skin(1)	30		Prostate(94;0.0773)				TGTCTACCTGCGTGTCCTGCC	0.547																																					Colon(84;110 1851 5306 33547)	Colon(84;110 1851 5306 33547)	uc010pvo.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|central_nervous_system(1)	5						c.(2029-2031)GCA>ACA		1D-myo-inositol-trisphosphate 3-kinase B							155.0	151.0	152.0					1																	226836376		2203	4300	6503	SO:0001583	missense	3707						ATP binding|calmodulin binding|inositol trisphosphate 3-kinase activity	g.chr1:226836376C>T	AJ242780	CCDS1555.1	1q42.12	2011-04-28	2011-04-28		ENSG00000143772	ENSG00000143772	2.7.1.127		6179	protein-coding gene	gene with protein product		147522	"""inositol 1,4,5-trisphosphate 3-kinase B"""			1654894, 1330886	Standard	NM_002221		Approved	IP3KB, IP3-3KB	uc010pvo.2	P27987	OTTHUMG00000037582	ENST00000272117.3:c.2029G>A	1.37:g.226836376C>T	ENSP00000272117:p.Ala677Thr		Somatic					p.A677T	NM_002221	NP_002212	WXS	Illumina HiSeq	Unspecified	P27987	IP3KB_HUMAN			3	2369	-		Prostate(94;0.0773)	677					Q5VWL9|Q5VWM0|Q96BZ2|Q96JS1|Q9UH47	Missense_Mutation	SNP	ENST00000272117.3	37	c.2029G>A	CCDS1555.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.185474	0.78677	.	.	ENSG00000143772	ENST00000272117;ENST00000429204	T;T	0.13538	2.58;2.58	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	T	0.14227	0.0344	L	0.43701	1.375	0.80722	D	1	P	0.35793	0.521	B	0.27170	0.077	T	0.02371	-1.1169	10	0.48119	T	0.1	.	19.8414	0.96690	0.0:1.0:0.0:0.0	.	677	P27987	IP3KB_HUMAN	T	677	ENSP00000272117:A677T;ENSP00000411152:A677T	ENSP00000272117:A677T	A	-	1	0	ITPKB	224902999	1.000000	0.71417	0.998000	0.56505	0.919000	0.55068	7.553000	0.82203	2.769000	0.95229	0.655000	0.94253	GCA		0.547	ITPKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091632.1	NM_002221		10	173	0	0	0	0.008291	0	10	173				
PRSS38	339501	broad.mit.edu	37	1	228033666	228033666	+	Silent	SNP	G	G	C			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr1:228033666G>C	ENST00000366757.3	+	5	762	c.738G>C	c.(736-738)ggG>ggC	p.G246G		NM_183062.2	NP_898885.1	A1L453	PRS38_HUMAN	protease, serine, 38	246	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)	p.G246G(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23						GCGACTCCGGGGGCCCACTTG	0.607																																							uc001hrh.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(736-738)GGG>GGC		marapsin 2 precursor							45.0	51.0	49.0					1																	228033666		2203	4300	6503	SO:0001819	synonymous_variant	339501				proteolysis	extracellular region	serine-type endopeptidase activity	g.chr1:228033666G>C		CCDS1563.1	1q42.13	2010-05-07			ENSG00000185888	ENSG00000185888		"""Serine peptidases / Serine peptidases"""	29625	protein-coding gene	gene with protein product	"""marapsin 2"""					12838346	Standard	NM_183062		Approved	MPN2	uc001hrh.3	A1L453	OTTHUMG00000037701	ENST00000366757.3:c.738G>C	1.37:g.228033666G>C			Somatic					p.G246G	NM_183062	NP_898885	WXS	Illumina HiSeq	Unspecified	A1L453	PRS38_HUMAN			5	738	+			246			Peptidase S1.		Q7RTY6	Silent	SNP	ENST00000366757.3	37	c.738G>C	CCDS1563.1																																																																																				0.607	PRSS38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091981.1	NM_183062		13	62	0	0	0	0.003163	0	13	62				
RYR2	6262	broad.mit.edu	37	1	237948095	237948095	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr1:237948095G>T	ENST00000366574.2	+	90	13400	c.13083G>T	c.(13081-13083)gaG>gaT	p.E4361D	RYR2_ENST00000542537.1_Missense_Mutation_p.E4345D|RYR2_ENST00000609119.1_3'UTR|RYR2_ENST00000360064.6_Missense_Mutation_p.E4367D	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	4361					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.E4359D(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TGCCCTCCGAGGATCTGACCG	0.537																																							uc001hyl.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(13081-13083)GAG>GAT		cardiac muscle ryanodine receptor							53.0	52.0	52.0					1																	237948095		1913	4126	6039	SO:0001583	missense	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237948095G>T	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.13083G>T	1.37:g.237948095G>T	ENSP00000355533:p.Glu4361Asp		Somatic				RYR2_uc010pya.1_Missense_Mutation_p.E776D	p.E4361D	NM_001035	NP_001026	WXS	Illumina HiSeq	Unspecified	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		90	13203	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	4361					Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	c.13083G>T	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	G	5.202	0.222833	0.09863	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537;ENST00000542288	D;D;D	0.93712	-3.27;-3.27;-3.27	5.32	0.33	0.15929	Ryanodine Receptor TM 4-6 (1);	0.078374	0.47852	D	0.000203	D	0.92195	0.7525	L	0.29908	0.895	0.80722	D	1	D;P	0.71674	0.998;0.737	D;B	0.83275	0.996;0.376	D	0.87516	0.2443	10	0.31617	T	0.26	-16.499	8.2161	0.31511	0.6537:0.0:0.3463:0.0	.	1335;4361	B4DGV4;Q92736	.;RYR2_HUMAN	D	4361;4367;4345;1335	ENSP00000355533:E4361D;ENSP00000353174:E4367D;ENSP00000443798:E4345D	ENSP00000353174:E4367D	E	+	3	2	RYR2	236014718	0.953000	0.32496	0.911000	0.35937	0.057000	0.15508	0.158000	0.16422	-0.096000	0.12329	-0.312000	0.09012	GAG		0.537	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		18	96	1	0	4.96729e-08	0.008871	6.84859e-08	18	96				
OR1C1	26188	broad.mit.edu	37	1	247921322	247921322	+	Silent	SNP	G	G	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr1:247921322G>A	ENST00000408896.2	-	1	660	c.387C>T	c.(385-387)ccC>ccT	p.P129P		NM_012353.2	NP_036485.2	Q15619	OR1C1_HUMAN	olfactory receptor, family 1, subfamily C, member 1	129					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P129P(1)		central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(32)|skin(2)|upper_aerodigestive_tract(1)	46	all_cancers(71;4.34e-05)|all_epithelial(71;1.13e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)	all_cancers(173;0.0247)	OV - Ovarian serous cystadenocarcinoma(106;0.0168)			TGTAATGTAAGGGGTGGCAAA	0.502																																							uc010pza.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(385-387)CCC>CCT		olfactory receptor, family 1, subfamily C,							74.0	70.0	71.0					1																	247921322		2010	4179	6189	SO:0001819	synonymous_variant	26188				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:247921322G>A	X89674	CCDS41481.1	1q44	2012-08-09			ENSG00000221888	ENSG00000221888		"""GPCR / Class A : Olfactory receptors"""	8182	protein-coding gene	gene with protein product						9119360	Standard	NM_012353		Approved	TPCR27, HSTPCR27	uc010pza.2	Q15619	OTTHUMG00000040198	ENST00000408896.2:c.387C>T	1.37:g.247921322G>A			Somatic					p.P129P	NM_012353	NP_036485	WXS	Illumina HiSeq	Unspecified	Q15619	OR1C1_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0168)		1	387	-	all_cancers(71;4.34e-05)|all_epithelial(71;1.13e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)	all_cancers(173;0.0247)	129			Cytoplasmic (Potential).		B9EIR9|Q5VVD2|Q6IF97|Q8NGZ1|Q96R83	Silent	SNP	ENST00000408896.2	37	c.387C>T	CCDS41481.1																																																																																				0.502	OR1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096855.1			11	65	0	0	0	0.000978	0	11	65				
OR2T8	343172	broad.mit.edu	37	1	248084558	248084558	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr1:248084558C>G	ENST00000319968.4	+	1	239	c.239C>G	c.(238-240)gCg>gGg	p.A80G		NM_001005522.1	NP_001005522.1	A6NH00	OR2T8_HUMAN	olfactory receptor, family 2, subfamily T, member 8	80						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A80G(1)|p.A80V(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(20)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	34	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0211)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			CCCAAAATGGCGGCTGACTAC	0.577																																							uc010pzc.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(238-240)GCG>GGG		olfactory receptor, family 2, subfamily T,							40.0	39.0	40.0					1																	248084558		2190	4289	6479	SO:0001583	missense	343172				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248084558C>G		CCDS31100.1	1q44	2012-08-09		2004-03-10	ENSG00000177462	ENSG00000177462		"""GPCR / Class A : Olfactory receptors"""	15020	protein-coding gene	gene with protein product				OR2T8P			Standard	XM_005273117		Approved		uc010pzc.2	A6NH00	OTTHUMG00000040205	ENST00000319968.4:c.239C>G	1.37:g.248084558C>G	ENSP00000326225:p.Ala80Gly		Somatic					p.A80G	NM_001005522	NP_001005522	WXS	Illumina HiSeq	Unspecified	A6NH00	OR2T8_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0319)		1	239	+	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0211)	80			Extracellular (Potential).			Missense_Mutation	SNP	ENST00000319968.4	37	c.239C>G	CCDS31100.1	.	.	.	.	.	.	.	.	.	.	c	11.83	1.756467	0.31137	.	.	ENSG00000177462	ENST00000319968	T	0.00438	7.42	3.81	1.87	0.25490	GPCR, rhodopsin-like superfamily (1);	0.224332	0.22373	U	0.060913	T	0.00754	0.0025	M	0.85197	2.74	0.09310	N	1	D	0.54397	0.966	P	0.53490	0.727	T	0.40308	-0.9570	10	0.72032	D	0.01	.	7.6056	0.28100	0.0:0.703:0.0:0.297	.	80	A6NH00	OR2T8_HUMAN	G	80	ENSP00000326225:A80G	ENSP00000326225:A80G	A	+	2	0	OR2T8	246151181	0.420000	0.25457	0.078000	0.20375	0.102000	0.19082	4.689000	0.61723	0.810000	0.34279	0.603000	0.83216	GCG		0.577	OR2T8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096862.1	NM_001005522		4	171	0	0	0	0.00308	0	4	171				
OR2M5	127059	broad.mit.edu	37	1	248309050	248309050	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr1:248309050A>T	ENST00000366476.1	+	1	601	c.601A>T	c.(601-603)Atc>Ttc	p.I201F		NM_001004690.1	NP_001004690.1	A3KFT3	OR2M5_HUMAN	olfactory receptor, family 2, subfamily M, member 5	201						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.I201F(1)		NS(1)|endometrium(5)|kidney(2)|large_intestine(7)|liver(1)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	49	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0388)			GGTTCTTTTCATCTGCTGTAT	0.433																																							uc010pze.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|kidney(1)	3						c.(601-603)ATC>TTC		olfactory receptor, family 2, subfamily M,							277.0	268.0	271.0					1																	248309050		2203	4300	6503	SO:0001583	missense	127059				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248309050A>T		CCDS31105.1	1q44	2012-08-09		2004-03-10	ENSG00000162727	ENSG00000162727		"""GPCR / Class A : Olfactory receptors"""	19576	protein-coding gene	gene with protein product				OR2M5P			Standard	NM_001004690		Approved		uc010pze.2	A3KFT3	OTTHUMG00000040447	ENST00000366476.1:c.601A>T	1.37:g.248309050A>T	ENSP00000355432:p.Ile201Phe		Somatic					p.I201F	NM_001004690	NP_001004690	WXS	Illumina HiSeq	Unspecified	A3KFT3	OR2M5_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0388)		1	601	+	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		201			Helical; Name=5; (Potential).			Missense_Mutation	SNP	ENST00000366476.1	37	c.601A>T	CCDS31105.1	.	.	.	.	.	.	.	.	.	.	a	13.64	2.298762	0.40694	.	.	ENSG00000162727	ENST00000366476	T	0.00084	8.75	3.52	2.33	0.28932	GPCR, rhodopsin-like superfamily (1);	1.259560	0.06382	U	0.715334	T	0.00144	0.0004	L	0.37507	1.11	0.09310	N	1	B	0.15719	0.014	B	0.23852	0.049	T	0.33189	-0.9878	10	0.46703	T	0.11	.	7.7754	0.29035	0.6675:0.0:0.0:0.3325	.	201	A3KFT3	OR2M5_HUMAN	F	201	ENSP00000355432:I201F	ENSP00000355432:I201F	I	+	1	0	OR2M5	246375673	0.000000	0.05858	0.000000	0.03702	0.868000	0.49771	-2.350000	0.01092	0.321000	0.23259	0.403000	0.27427	ATC		0.433	OR2M5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097343.1	NM_001004690		12	402	0	0	0	0.001368	0	12	402				
OR2G6	391211	broad.mit.edu	37	1	248685264	248685264	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr1:248685264G>T	ENST00000343414.4	+	1	349	c.317G>T	c.(316-318)gGg>gTg	p.G106V		NM_001013355.1	NP_001013373.1	Q5TZ20	OR2G6_HUMAN	olfactory receptor, family 2, subfamily G, member 6	106						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G106V(1)		NS(1)|cervix(1)|endometrium(2)|large_intestine(7)|lung(40)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	61	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0156)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GTGGCCATGGGGTTGGGCTCG	0.542																																							uc001ien.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(316-318)GGG>GTG		olfactory receptor, family 2, subfamily G,							107.0	106.0	106.0					1																	248685264		2203	4300	6503	SO:0001583	missense	391211				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248685264G>T		CCDS31119.1	1q44	2012-08-09			ENSG00000188558	ENSG00000188558		"""GPCR / Class A : Olfactory receptors"""	27019	protein-coding gene	gene with protein product							Standard	NM_001013355		Approved		uc001ien.1	Q5TZ20	OTTHUMG00000040462	ENST00000343414.4:c.317G>T	1.37:g.248685264G>T	ENSP00000341291:p.Gly106Val		Somatic					p.G106V	NM_001013355	NP_001013373	WXS	Illumina HiSeq	Unspecified	Q5TZ20	OR2G6_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0265)		1	317	+	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0156)	106			Helical; Name=3; (Potential).		B2RP33	Missense_Mutation	SNP	ENST00000343414.4	37	c.317G>T	CCDS31119.1	.	.	.	.	.	.	.	.	.	.	N	0.577	-0.838781	0.02692	.	.	ENSG00000188558	ENST00000343414	T	0.02682	4.2	3.35	1.31	0.21738	GPCR, rhodopsin-like superfamily (1);	0.161882	0.28724	U	0.014351	T	0.02119	0.0066	L	0.27053	0.805	0.09310	N	1	B	0.22146	0.065	B	0.14023	0.01	T	0.44329	-0.9335	10	0.41790	T	0.15	.	6.2976	0.21095	0.0:0.3234:0.3629:0.3138	.	106	Q5TZ20	OR2G6_HUMAN	V	106	ENSP00000341291:G106V	ENSP00000341291:G106V	G	+	2	0	OR2G6	246751887	0.000000	0.05858	0.000000	0.03702	0.044000	0.14063	-0.695000	0.05109	0.200000	0.20447	0.400000	0.26472	GGG		0.542	OR2G6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097358.1	XM_372842		8	140	1	0	5.18039e-06	0.00308	6.61496e-06	8	140				
SH3BP5L	80851	broad.mit.edu	37	1	249110823	249110823	+	Silent	SNP	C	C	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr1:249110823C>A	ENST00000366472.5	-	4	1514	c.285G>T	c.(283-285)tcG>tcT	p.S95S	SH3BP5L_ENST00000411742.2_Silent_p.S63S|SH3BP5L_ENST00000475978.1_5'UTR	NM_030645.1	NP_085148.1	Q7L8J4	3BP5L_HUMAN	SH3-binding domain protein 5-like	95								p.S95S(1)		endometrium(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	23	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.19)	OV - Ovarian serous cystadenocarcinoma(106;0.00805)			GTTTCCTCGCCGACTCCTGTA	0.582																																							uc001iew.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(283-285)TCG>TCT		SH3-binding domain protein 5-like							85.0	89.0	88.0					1																	249110823		2203	4300	6503	SO:0001819	synonymous_variant	80851							g.chr1:249110823C>A	AB051507	CCDS31126.1	1q44	2008-02-05			ENSG00000175137	ENSG00000175137			29360	protein-coding gene	gene with protein product							Standard	NM_030645		Approved	KIAA1720	uc001iew.1	Q7L8J4	OTTHUMG00000040389	ENST00000366472.5:c.285G>T	1.37:g.249110823C>A			Somatic				SH3BP5L_uc010pzp.1_5'Flank|SH3BP5L_uc010pzq.1_Silent_p.S63S|SH3BP5L_uc001iev.1_5'UTR	p.S95S	NM_030645	NP_085148	WXS	Illumina HiSeq	Unspecified	Q7L8J4	3BP5L_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00805)		4	837	-	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.19)	95			Potential.		B4DQ94|Q96FI5|Q9BQH8|Q9C0E3	Silent	SNP	ENST00000366472.5	37	c.285G>T	CCDS31126.1																																																																																				0.582	SH3BP5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097140.1	NM_030645		11	161	1	0	1.58986e-06	0.008291	2.08137e-06	11	161				
SKIDA1	387640	broad.mit.edu	37	10	21804176	21804176	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr10:21804176C>A	ENST00000449193.2	-	4	4828	c.2576G>T	c.(2575-2577)gGg>gTg	p.G859V	SKIDA1_ENST00000444772.3_Missense_Mutation_p.G780V	NM_207371.3	NP_997254.3	Q1XH10	SKDA1_HUMAN	SKI/DACH domain containing 1	778						nucleus (GO:0005634)		p.G859V(2)									CCCATCTCTCCCAATAATGAG	0.458																																							uc009xkd.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(2575-2577)GGG>GTG		hypothetical protein LOC387640							105.0	97.0	100.0					10																	21804176		1882	4111	5993	SO:0001583	missense	387640					nucleus	nucleotide binding	g.chr10:21804176C>A	AK131456	CCDS44363.1	10p12.31	2012-06-13	2012-06-13	2012-06-13	ENSG00000180592	ENSG00000180592			32697	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 140"""	C10orf140			Standard	NM_207371		Approved	FLJ45187	uc021pnx.1	Q1XH10	OTTHUMG00000017797	ENST00000449193.2:c.2576G>T	10.37:g.21804176C>A	ENSP00000410041:p.Gly859Val		Somatic				uc001iqp.1_Intron	p.G859V	NM_207371	NP_997254	WXS	Illumina HiSeq	Unspecified	Q1XH10	DLN1_HUMAN			4	4829	-			778					B1ANA5|Q6ZMX4|Q8N3C3	Missense_Mutation	SNP	ENST00000449193.2	37	c.2576G>T	CCDS44363.1	.	.	.	.	.	.	.	.	.	.	C	16.46	3.130006	0.56721	.	.	ENSG00000180592	ENST00000449193;ENST00000444772	.	.	.	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.76772	0.4034	L	0.52573	1.65	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.77275	-0.2648	9	0.87932	D	0	-3.1715	20.0534	0.97636	0.0:1.0:0.0:0.0	.	859	E9PAX1	.	V	859;780	.	ENSP00000442432:G780V	G	-	2	0	C10orf140	21844182	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.675000	0.68123	2.821000	0.97095	0.655000	0.94253	GGG		0.458	SKIDA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286950.2	NM_207371		15	43	1	0	0.000422831	0.004007	0.000484738	15	43				
FAM13C	220965	broad.mit.edu	37	10	61112108	61112108	+	Silent	SNP	G	G	C			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr10:61112108G>C	ENST00000373868.2	-	3	333	c.246C>G	c.(244-246)ccC>ccG	p.P82P	FAM13C_ENST00000422313.2_Silent_p.P82P|FAM13C_ENST00000435852.2_Silent_p.P82P|FAM13C_ENST00000468840.2_5'UTR|FAM13C_ENST00000373867.3_5'UTR|FAM13C_ENST00000442566.3_Silent_p.P82P|FAM13C_ENST00000277705.6_Silent_p.P82P|FAM13C_ENST00000419214.2_Silent_p.P82P	NM_198215.3	NP_937858.2	Q8NE31	FA13C_HUMAN	family with sequence similarity 13, member C	82			P -> H (in dbSNP:rs17853626). {ECO:0000269|PubMed:15489334}.					p.P82P(1)		NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(8)|lung(19)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						TGCCCATGCTGGGTCGCAATA	0.612																																							uc001jkn.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(244-246)CCC>CCG		hypothetical protein LOC220965 isoform 1							76.0	75.0	75.0					10																	61112108		2203	4300	6503	SO:0001819	synonymous_variant	220965							g.chr10:61112108G>C	U79304	CCDS31207.1, CCDS44406.1, CCDS7255.1, CCDS53538.1	10q21	2009-09-15	2009-01-20	2009-01-20	ENSG00000148541	ENSG00000148541			19371	protein-coding gene	gene with protein product			"""family with sequence similarity 13, member C1"""	FAM13C1			Standard	NM_001001971		Approved		uc001jkn.3	Q8NE31	OTTHUMG00000018277	ENST00000373868.2:c.246C>G	10.37:g.61112108G>C			Somatic				FAM13C_uc001jko.2_Silent_p.P82P|FAM13C_uc010qid.1_5'UTR|FAM13C_uc010qie.1_5'UTR|FAM13C_uc010qif.1_Silent_p.P104P|FAM13C_uc001jkp.2_5'UTR	p.P82P	NM_198215	NP_937858	WXS	Illumina HiSeq	Unspecified	Q8NE31	FA13C_HUMAN			4	380	-			82					B7ZB77|Q5T631|Q6P2M3|Q99787	Silent	SNP	ENST00000373868.2	37	c.246C>G	CCDS7255.1																																																																																				0.612	FAM13C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048162.2			10	78	0	0	0	0.008291	0	10	78				
TET1	80312	broad.mit.edu	37	10	70404986	70404986	+	Missense_Mutation	SNP	T	T	G			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr10:70404986T>G	ENST00000373644.4	+	4	2709	c.2500T>G	c.(2500-2502)Tcc>Gcc	p.S834A		NM_030625.2	NP_085128.2	Q8NFU7	TET1_HUMAN	tet methylcytosine dioxygenase 1	834					chromatin modification (GO:0016568)|DNA demethylation (GO:0080111)|inner cell mass cell differentiation (GO:0001826)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of DNA methylation (GO:0044030)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	iron ion binding (GO:0005506)|methylcytosine dioxygenase activity (GO:0070579)|structure-specific DNA binding (GO:0043566)|zinc ion binding (GO:0008270)	p.S834A(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(2)|ovary(5)|prostate(1)|upper_aerodigestive_tract(2)	21						TAACTGCAGTTCCATTCCACA	0.393																																							uc001jok.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|lung(2)|prostate(1)|breast(1)	9						c.(2500-2502)TCC>GCC		CXXC finger 6							145.0	135.0	138.0					10																	70404986		2203	4300	6503	SO:0001583	missense	80312				DNA demethylation|inner cell mass cell differentiation|negative regulation of methylation-dependent chromatin silencing|stem cell maintenance		iron ion binding|methylcytosine dioxygenase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|structure-specific DNA binding|zinc ion binding	g.chr10:70404986T>G	AF430147	CCDS7281.1	10q21	2014-02-18	2011-09-30	2008-03-12	ENSG00000138336	ENSG00000138336			29484	protein-coding gene	gene with protein product	"""leukemia-associated protein with a CXXC domain"", ""ten-eleven translocation-1"""	607790	"""CXXC zinc finger 6"", ""tet oncogene 1"""	CXXC6		12124344, 12646957	Standard	NM_030625		Approved	LCX, KIAA1676, bA119F7.1	uc001jok.4	Q8NFU7	OTTHUMG00000018359	ENST00000373644.4:c.2500T>G	10.37:g.70404986T>G	ENSP00000362748:p.Ser834Ala		Somatic					p.S834A	NM_030625	NP_085128	WXS	Illumina HiSeq	Unspecified	Q8NFU7	TET1_HUMAN			4	3005	+			834					Q5VUP7|Q7Z6B6|Q8TCR1|Q9C0I7	Missense_Mutation	SNP	ENST00000373644.4	37	c.2500T>G	CCDS7281.1	.	.	.	.	.	.	.	.	.	.	T	12.22	1.871440	0.33069	.	.	ENSG00000138336	ENST00000373644	T	0.07444	3.19	5.92	3.63	0.41609	.	0.907039	0.09442	N	0.801622	T	0.06325	0.0163	L	0.34521	1.04	0.09310	N	1	P	0.48089	0.905	B	0.44224	0.444	T	0.06481	-1.0824	10	0.06494	T	0.89	.	3.6729	0.08280	0.2033:0.1671:0.0:0.6296	.	834	Q8NFU7	TET1_HUMAN	A	834	ENSP00000362748:S834A	ENSP00000362748:S834A	S	+	1	0	TET1	70074992	0.000000	0.05858	0.011000	0.14972	0.411000	0.31082	0.354000	0.20146	1.083000	0.41159	0.528000	0.53228	TCC		0.393	TET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048354.1	NM_030625		20	299	0	0	0	0.001882	0	20	299				
TSPAN15	23555	broad.mit.edu	37	10	71265915	71265915	+	Silent	SNP	C	C	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr10:71265915C>A	ENST00000373290.2	+	7	776	c.654C>A	c.(652-654)ggC>ggA	p.G218G	TSPAN15_ENST00000459981.1_3'UTR	NM_012339.3	NP_036471.1	O95858	TSN15_HUMAN	tetraspanin 15	218					establishment of protein localization to plasma membrane (GO:0090002)|protein maturation (GO:0051604)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tetraspanin-enriched microdomain (GO:0097197)	enzyme binding (GO:0019899)	p.G218G(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(4)|pancreas(1)|prostate(1)	9						ACGTGCGGGGCTGCACCAACG	0.632																																							uc001jpo.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(652-654)GGC>GGA		transmembrane 4 superfamily member 15							137.0	108.0	118.0					10																	71265915		2203	4300	6503	SO:0001819	synonymous_variant	23555					integral to plasma membrane|membrane fraction		g.chr10:71265915C>A	AY358934	CCDS7294.1	10q22.1	2013-02-14	2005-03-21	2005-03-21	ENSG00000099282	ENSG00000099282		"""Tetraspanins"""	23298	protein-coding gene	gene with protein product		613140	"""transmembrane 4 superfamily member 15"""	TM4SF15		11739647, 10719184	Standard	NM_012339		Approved	NET-7	uc001jpo.1	O95858	OTTHUMG00000018381	ENST00000373290.2:c.654C>A	10.37:g.71265915C>A			Somatic					p.G218G	NM_012339	NP_036471	WXS	Illumina HiSeq	Unspecified	O95858	TSN15_HUMAN			7	779	+			218			Extracellular (Potential).		Q6UW79	Silent	SNP	ENST00000373290.2	37	c.654C>A	CCDS7294.1																																																																																				0.632	TSPAN15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048444.1	NM_012339		12	126	1	0	0.000151284	0.001855	0.00017938	12	126				
FUT11	170384	broad.mit.edu	37	10	75532609	75532609	+	Missense_Mutation	SNP	G	G	A	rs368590019		TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr10:75532609G>A	ENST00000372841.3	+	1	561	c.518G>A	c.(517-519)cGc>cAc	p.R173H	FUT11_ENST00000394790.1_Missense_Mutation_p.R173H|AC022400.2_ENST00000595757.1_5'Flank|RMRPP1_ENST00000517236.1_RNA|FUT11_ENST00000465695.1_3'UTR	NM_173540.2	NP_775811.2	Q495W5	FUT11_HUMAN	fucosyltransferase 11 (alpha (1,3) fucosyltransferase)	173					protein glycosylation (GO:0006486)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-(1->3)-fucosyltransferase activity (GO:0046920)	p.R173H(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(3)	7	Prostate(51;0.0112)					ACCTTCAGTCGCCACTCGGAT	0.687																																							uc001jva.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(517-519)CGC>CAC		fucosyltransferase 11 (alpha (1,3)		G	HIS/ARG	0,4076		0,0,2038	22.0	25.0	24.0		518	5.4	1.0	10		24	1,8095		0,1,4047	no	missense	FUT11	NM_173540.2	29	0,1,6085	AA,AG,GG		0.0124,0.0,0.0082	probably-damaging	173/493	75532609	1,12171	2038	4048	6086	SO:0001583	missense	170384				protein glycosylation	Golgi cisterna membrane|integral to membrane	alpha(1,3)-fucosyltransferase activity	g.chr10:75532609G>A	BC036037	CCDS7333.1, CCDS60558.1	10q22.3	2014-01-02			ENSG00000196968	ENSG00000196968		"""Fucosyltransferases"""	19233	protein-coding gene	gene with protein product						11698403, 24318988	Standard	NM_173540		Approved	MGC33202	uc001jva.3	Q495W5	OTTHUMG00000018483	ENST00000372841.3:c.518G>A	10.37:g.75532609G>A	ENSP00000361932:p.Arg173His		Somatic				FUT11_uc001juy.1_Missense_Mutation_p.R173H|FUT11_uc001juz.1_Missense_Mutation_p.R173H	p.R173H	NM_173540	NP_775811	WXS	Illumina HiSeq	Unspecified	Q495W5	FUT11_HUMAN			1	561	+	Prostate(51;0.0112)		173			Lumenal (Potential).		Q495W7|Q8IYE4	Missense_Mutation	SNP	ENST00000372841.3	37	c.518G>A	CCDS7333.1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.781899	0.90282	0.0	1.24E-4	ENSG00000196968	ENST00000372841;ENST00000394790	T;T	0.28666	1.6;1.6	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	T	0.62527	0.2435	M	0.85099	2.735	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.986;0.962;1.0	T	0.68036	-0.5515	10	0.66056	D	0.02	-28.4877	19.0801	0.93178	0.0:0.0:1.0:0.0	.	173;173;173	Q495W5;Q495W5-2;B2RC53	FUT11_HUMAN;.;.	H	173	ENSP00000361932:R173H;ENSP00000378270:R173H	ENSP00000361932:R173H	R	+	2	0	FUT11	75202615	1.000000	0.71417	1.000000	0.80357	0.417000	0.31264	9.757000	0.98924	2.523000	0.85059	0.462000	0.41574	CGC		0.687	FUT11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048689.1	NM_173540		15	35	0	0	0	0.007413	0	15	35				
KAT6B	23522	broad.mit.edu	37	10	76781967	76781967	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr10:76781967A>T	ENST00000287239.4	+	16	3839	c.3350A>T	c.(3349-3351)cAg>cTg	p.Q1117L	KAT6B_ENST00000372711.1_Missense_Mutation_p.Q934L|KAT6B_ENST00000490365.1_3'UTR|RP11-77G23.2_ENST00000413431.1_RNA|KAT6B_ENST00000372724.1_Missense_Mutation_p.Q825L|KAT6B_ENST00000372714.1_Missense_Mutation_p.Q825L|KAT6B_ENST00000372725.1_Missense_Mutation_p.Q825L|RP11-77G23.5_ENST00000436608.1_RNA	NM_001256468.1|NM_012330.3	NP_001243397.1|NP_036462.2	Q8WYB5	KAT6B_HUMAN	K(lysine) acetyltransferase 6B	1117					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	acetyltransferase activity (GO:0016407)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.Q1117L(1)									ACGAAACCACAGTCAGTTGCC	0.398											OREG0020273	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001jwn.1		NA								T					CREBBP		AML		1	Substitution - Missense(1)		lung(1)	central_nervous_system(5)|ovary(4)|lung(3)|breast(2)|skin(1)|prostate(1)	16						c.(3349-3351)CAG>CTG		MYST histone acetyltransferase (monocytic							92.0	83.0	86.0					10																	76781967		2153	4239	6392	SO:0001583	missense	23522				histone H3 acetylation|negative regulation of transcription, DNA-dependent|nucleosome assembly|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	MOZ/MORF histone acetyltransferase complex|nucleosome	DNA binding|histone acetyltransferase activity|transcription factor binding|zinc ion binding	g.chr10:76781967A>T	AF113514	CCDS7345.1, CCDS58084.1, CCDS58085.1	10q22.2	2013-01-28	2011-07-21	2011-07-21	ENSG00000156650	ENSG00000156650		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	17582	protein-coding gene	gene with protein product	"""MOZ-related factor"""	605880	"""MYST histone acetyltransferase (monocytic leukemia) 4"""	MYST4		9205841, 10497217	Standard	NM_012330		Approved	querkopf, qkf, Morf, MOZ2, ZC2HC6B	uc001jwn.2	Q8WYB5	OTTHUMG00000018509	ENST00000287239.4:c.3350A>T	10.37:g.76781967A>T	ENSP00000287239:p.Gln1117Leu		Somatic	OREG0020273	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1170	MYST4_uc001jwm.1_Missense_Mutation_p.Q825L|MYST4_uc001jwo.1_Missense_Mutation_p.Q825L|MYST4_uc001jwp.1_Missense_Mutation_p.Q934L	p.Q1117L	NM_012330	NP_036462	WXS	Illumina HiSeq	Unspecified	Q8WYB5	MYST4_HUMAN			16	3843	+	all_cancers(46;0.0347)|all_epithelial(25;0.00236)|Prostate(51;0.0112)|Ovarian(15;0.0964)		1117					O15087|Q86Y05|Q8WU81|Q9UKW2|Q9UKW3|Q9UKX0	Missense_Mutation	SNP	ENST00000287239.4	37	c.3350A>T	CCDS7345.1	.	.	.	.	.	.	.	.	.	.	A	11.54	1.670370	0.29693	.	.	ENSG00000156650	ENST00000372725;ENST00000372724;ENST00000287239;ENST00000372714;ENST00000372711	T;T;T;T;T	0.76968	2.21;2.21;1.97;2.21;-1.06	5.95	5.95	0.96441	.	0.000000	0.47455	D	0.000230	D	0.82545	0.5060	L	0.46157	1.445	0.47276	D	0.999376	D;P;P	0.62365	0.991;0.879;0.936	P;P;P	0.61201	0.725;0.503;0.885	T	0.81680	-0.0823	10	0.38643	T	0.18	-9.9754	14.9803	0.71306	1.0:0.0:0.0:0.0	.	934;825;1117	Q8WYB5-2;Q8WYB5-3;Q8WYB5	.;.;KAT6B_HUMAN	L	825;825;1117;825;934	ENSP00000361810:Q825L;ENSP00000361809:Q825L;ENSP00000287239:Q1117L;ENSP00000361799:Q825L;ENSP00000361796:Q934L	ENSP00000287239:Q1117L	Q	+	2	0	KAT6B	76451973	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	6.481000	0.73608	2.276000	0.75962	0.460000	0.39030	CAG		0.398	KAT6B-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048771.1	NM_012330		35	188	0	0	0	0.00874	0	35	188				
CDHR1	92211	broad.mit.edu	37	10	85973997	85973997	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr10:85973997C>A	ENST00000372117.3	+	17	2303	c.2200C>A	c.(2200-2202)Ctg>Atg	p.L734M	CDHR1_ENST00000440770.2_Missense_Mutation_p.L438M|CDHR1_ENST00000332904.3_Intron	NM_033100.2	NP_149091.1	Q96JP9	CDHR1_HUMAN	cadherin-related family member 1	734					cellular process (GO:0009987)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)	calcium ion binding (GO:0005509)	p.L734M(1)		breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(21)|ovary(1)|prostate(1)|skin(1)	36						TAACAAGGTCCTGCCAATGCG	0.642																																							uc001kcv.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(2200-2202)CTG>ATG		protocadherin 21 precursor							55.0	60.0	58.0					10																	85973997		2203	4299	6502	SO:0001583	missense	92211				homophilic cell adhesion		calcium ion binding|receptor activity	g.chr10:85973997C>A	AB053448	CCDS7372.1, CCDS53548.1	10q23.1	2014-01-28	2010-01-25	2010-01-25	ENSG00000148600	ENSG00000148600		"""Cadherins / Cadherin-related"""	14550	protein-coding gene	gene with protein product		609502	"""protocadherin 21"""	PCDH21		11597768	Standard	NM_001171971		Approved	KIAA1775, CORD15, RP65	uc001kcv.3	Q96JP9	OTTHUMG00000018634	ENST00000372117.3:c.2200C>A	10.37:g.85973997C>A	ENSP00000361189:p.Leu734Met		Somatic				CDHR1_uc001kcw.2_Intron|CDHR1_uc009xst.2_Missense_Mutation_p.L438M|CDHR1_uc001kcx.2_Missense_Mutation_p.L48M	p.L734M	NM_033100	NP_149091	WXS	Illumina HiSeq	Unspecified	Q96JP9	CDHR1_HUMAN			17	2200	+			734			Cytoplasmic (Potential).		Q69YZ8|Q8IXY5	Missense_Mutation	SNP	ENST00000372117.3	37	c.2200C>A	CCDS7372.1	.	.	.	.	.	.	.	.	.	.	C	4.307	0.056302	0.08291	.	.	ENSG00000148600	ENST00000372117;ENST00000440770	T;T	0.58358	0.51;0.34	5.53	3.58	0.41010	.	0.720518	0.13612	N	0.375081	T	0.37625	0.1010	L	0.37750	1.13	0.09310	N	1	B;B	0.24483	0.104;0.068	B;B	0.19666	0.022;0.026	T	0.18967	-1.0320	10	0.33141	T	0.24	-9.4007	4.6888	0.12771	0.2613:0.5577:0.0:0.181	.	438;734	E7EN47;Q96JP9	.;CDHR1_HUMAN	M	734;438	ENSP00000361189:L734M;ENSP00000415980:L438M	ENSP00000361189:L734M	L	+	1	2	CDHR1	85963977	0.946000	0.32159	0.992000	0.48379	0.582000	0.36321	0.508000	0.22692	1.250000	0.43966	0.561000	0.74099	CTG		0.642	CDHR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049111.1	NM_033100		12	63	1	0	5.03518e-11	0.007413	7.97558e-11	12	63				
GRID1	2894	broad.mit.edu	37	10	87373323	87373323	+	Silent	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr10:87373323G>T	ENST00000327946.7	-	15	2527	c.2442C>A	c.(2440-2442)acC>acA	p.T814T	GRID1_ENST00000552278.2_5'Flank|GRID1_ENST00000536331.1_Silent_p.T385T	NM_017551.2	NP_060021.1	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	814					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|social behavior (GO:0035176)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|ionotropic glutamate receptor complex (GO:0008328)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)	p.T814T(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(46)|ovary(5)|prostate(4)|skin(5)|stomach(4)|upper_aerodigestive_tract(5)	106						TGGCATGGCTGGTGAGGTCAC	0.632										Multiple Myeloma(13;0.14)																													uc001kdl.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(5)|upper_aerodigestive_tract(2)|large_intestine(2)|central_nervous_system(1)	10						c.(2440-2442)ACC>ACA		glutamate receptor, ionotropic, delta 1	L-Glutamic Acid(DB00142)						67.0	73.0	71.0					10																	87373323		2203	4300	6503	SO:0001819	synonymous_variant	2894					cell junction|integral to membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity	g.chr10:87373323G>T	AB033046	CCDS31236.1	10q22	2012-08-29			ENSG00000182771	ENSG00000182771		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4575	protein-coding gene	gene with protein product		610659					Standard	NM_017551		Approved	GluD1, KIAA1220	uc001kdl.1	Q9ULK0	OTTHUMG00000018650	ENST00000327946.7:c.2442C>A	10.37:g.87373323G>T		Multiple Myeloma(13;0.14)	Somatic				GRID1_uc009xsu.1_RNA|GRID1_uc010qmf.1_Silent_p.T385T	p.T814T	NM_017551	NP_060021	WXS	Illumina HiSeq	Unspecified	Q9ULK0	GRID1_HUMAN			15	2543	-			814			Extracellular (Potential).		B3KXD5|B7Z7L0|Q8IXT3	Silent	SNP	ENST00000327946.7	37	c.2442C>A	CCDS31236.1																																																																																				0.632	GRID1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049148.3	XM_043613		16	58	1	0	6.33239e-15	0.010504	1.09498e-14	16	58				
BTAF1	9044	broad.mit.edu	37	10	93749274	93749274	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr10:93749274C>G	ENST00000265990.6	+	20	3099	c.2791C>G	c.(2791-2793)Cca>Gca	p.P931A		NM_003972.2	NP_003963.1	O14981	BTAF1_HUMAN	BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa	931					negative regulation of chromatin binding (GO:0035562)|negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P931A(1)		central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|lung(17)|ovary(1)|prostate(1)|skin(2)|urinary_tract(6)	59		Colorectal(252;0.0846)				TTGTGTGGACCCATATCTAAC	0.403																																							uc001khr.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)|skin(1)	3						c.(2791-2793)CCA>GCA		BTAF1 RNA polymerase II, B-TFIID transcription							76.0	82.0	80.0					10																	93749274		2203	4300	6503	SO:0001583	missense	9044				negative regulation of transcription, DNA-dependent	nucleus	ATP binding|DNA binding|helicase activity|sequence-specific DNA binding transcription factor activity	g.chr10:93749274C>G	AJ001017	CCDS7419.1	10q22-q23	2013-05-01	2013-05-01		ENSG00000095564	ENSG00000095564			17307	protein-coding gene	gene with protein product	"""Mot1 homolog (S. cerevisiae)"""	605191	"""BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170 kD (Mot1 homolog, S. cerevisiae)"""			9342322, 9488487	Standard	NM_003972		Approved	TAFII170, TAF172, MOT1, TAF-172, TAF(II)170	uc001khr.3	O14981	OTTHUMG00000018752	ENST00000265990.6:c.2791C>G	10.37:g.93749274C>G	ENSP00000265990:p.Pro931Ala		Somatic				BTAF1_uc001khs.1_Missense_Mutation_p.P601A|BTAF1_uc001kht.1_Missense_Mutation_p.P369A	p.P931A	NM_003972	NP_003963	WXS	Illumina HiSeq	Unspecified	O14981	BTAF1_HUMAN			20	2889	+		Colorectal(252;0.0846)	931					B4E0W6|O43578	Missense_Mutation	SNP	ENST00000265990.6	37	c.2791C>G	CCDS7419.1	.	.	.	.	.	.	.	.	.	.	C	10.81	1.456643	0.26161	.	.	ENSG00000095564	ENST00000265990	D	0.89552	-2.53	5.42	4.5	0.54988	Domain of unknown function DUF3535 (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.114136	0.64402	N	0.000008	D	0.83403	0.5247	L	0.37507	1.11	0.80722	D	1	B;B	0.14012	0.009;0.009	B;B	0.20955	0.032;0.032	T	0.77109	-0.2709	10	0.12103	T	0.63	-19.3604	16.0557	0.80801	0.0:0.8655:0.1345:0.0	.	931;931	Q2M1V9;O14981	.;BTAF1_HUMAN	A	931	ENSP00000265990:P931A	ENSP00000265990:P931A	P	+	1	0	BTAF1	93739254	1.000000	0.71417	0.992000	0.48379	0.998000	0.95712	3.229000	0.51278	1.247000	0.43917	0.591000	0.81541	CCA		0.403	BTAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049380.4	NM_003972		9	98	0	0	0	0.006214	0	9	98				
CYP2C19	1557	broad.mit.edu	37	10	96534881	96534881	+	Nonsense_Mutation	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr10:96534881G>T	ENST00000371321.3	+	2	317	c.235G>T	c.(235-237)Gga>Tga	p.G79*	CYP2C19_ENST00000464755.1_3'UTR	NM_000769.1	NP_000760	P33261	CP2CJ_HUMAN	cytochrome P450, family 2, subfamily C, polypeptide 19	79					arachidonic acid metabolic process (GO:0019369)|drug metabolic process (GO:0017144)|epoxygenase P450 pathway (GO:0019373)|exogenous drug catabolic process (GO:0042738)|heterocycle metabolic process (GO:0046483)|monoterpenoid metabolic process (GO:0016098)|omega-hydroxylase P450 pathway (GO:0097267)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	(R)-limonene 6-monooxygenase activity (GO:0052741)|(S)-limonene 6-monooxygenase activity (GO:0018675)|(S)-limonene 7-monooxygenase activity (GO:0018676)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity (GO:0016491)|oxygen binding (GO:0019825)|steroid hydroxylase activity (GO:0008395)	p.G79*(1)		central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(4)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	43		Colorectal(252;0.09)		all cancers(201;6.02e-07)|KIRC - Kidney renal clear cell carcinoma(50;0.0672)|Kidney(138;0.0838)	Acenocoumarol(DB01418)|Acetylsalicylic acid(DB00945)|Adinazolam(DB00546)|Almotriptan(DB00918)|Aminoglutethimide(DB00357)|Aminophenazone(DB01424)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amoxicillin(DB01060)|Amprenavir(DB00701)|Antipyrine(DB01435)|Apixaban(DB06605)|Aprepitant(DB00673)|Arformoterol(DB01274)|Artemether(DB06697)|Atomoxetine(DB00289)|Atorvastatin(DB01076)|Axitinib(DB06626)|Azelastine(DB00972)|Benzatropine(DB00245)|Bicalutamide(DB01128)|Bifonazole(DB04794)|Bortezomib(DB00188)|Bromazepam(DB01558)|Brompheniramine(DB00835)|Bupivacaine(DB00297)|Buprenorphine(DB00921)|Carbamazepine(DB00564)|Carbinoxamine(DB00748)|Carisoprodol(DB00395)|Chloramphenicol(DB00446)|Chlorpropamide(DB00672)|Cholecalciferol(DB00169)|Cilostazol(DB01166)|Cimetidine(DB00501)|Cisapride(DB00604)|Citalopram(DB00215)|Clarithromycin(DB01211)|Clevidipine(DB04920)|Clobazam(DB00349)|Clomipramine(DB01242)|Clopidogrel(DB00758)|Clotiazepam(DB01559)|Clotrimazole(DB00257)|Clozapine(DB00363)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dapsone(DB00250)|Delavirdine(DB00705)|Desipramine(DB01151)|Desloratadine(DB00967)|Dexamethasone(DB01234)|Dexfenfluramine(DB01191)|Dextromethorphan(DB00514)|Diazepam(DB00829)|Diclofenac(DB00586)|Diltiazem(DB00343)|Dimethyl sulfoxide(DB01093)|Diphenhydramine(DB01075)|Dopamine(DB00988)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronabinol(DB00470)|Efavirenz(DB00625)|Eletriptan(DB00216)|Enfuvirtide(DB00109)|Enzalutamide(DB08899)|Escitalopram(DB01175)|Esomeprazole(DB00736)|Estradiol(DB00783)|Ethanol(DB00898)|Ethotoin(DB00754)|Etoricoxib(DB01628)|Etravirine(DB06414)|Famotidine(DB00927)|Felbamate(DB00949)|Fluconazole(DB00196)|Flunitrazepam(DB01544)|Fluoxetine(DB00472)|Flutamide(DB00499)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Formoterol(DB00983)|Fosphenytoin(DB01320)|Gefitinib(DB00317)|Gemfibrozil(DB01241)|Gliclazide(DB01120)|Glucosamine(DB01296)|Glyburide(DB01016)|Guanfacine(DB01018)|Haloperidol(DB00502)|Hexobarbital(DB01355)|Ibuprofen(DB01050)|Ifosfamide(DB01181)|Imatinib(DB00619)|Imipramine(DB00458)|Indinavir(DB00224)|Indomethacin(DB00328)|Isoniazid(DB00951)|Ketobemidone(DB06738)|Ketoconazole(DB01026)|Lansoprazole(DB00448)|Lapatinib(DB01259)|Levomilnacipran(DB08918)|Lopinavir(DB01601)|Loratadine(DB00455)|Lorcaserin(DB04871)|Losartan(DB00678)|Lovastatin(DB00227)|LULICONAZOLE(DB08933)|Lumiracoxib(DB01283)|MACITENTAN(DB08932)|Melatonin(DB01065)|Memantine(DB01043)|Meprobamate(DB00371)|Methadone(DB00333)|Methazolamide(DB00703)|Methimazole(DB00763)|Methsuximide(DB05246)|Methylphenobarbital(DB00849)|Metoprolol(DB00264)|Miconazole(DB01110)|Moclobemide(DB01171)|Modafinil(DB00745)|Nelfinavir(DB00220)|Nicardipine(DB00622)|Nicotine(DB00184)|Nilutamide(DB00665)|Nilvadipine(DB06712)|Norethindrone(DB00717)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Omeprazole(DB00338)|Ospemifene(DB04938)|Oxcarbazepine(DB00776)|Oxiconazole(DB00239)|Pantoprazole(DB00213)|Pegvisomant(DB00082)|Pentamidine(DB00738)|Pentobarbital(DB00312)|Perphenazine(DB00850)|Pethidine(DB00454)|Phenelzine(DB00780)|Phenobarbital(DB01174)|Phensuximide(DB00832)|Phenytoin(DB00252)|Pimozide(DB01100)|Pioglitazone(DB01132)|Pipotiazine(DB01621)|Podofilox(DB01179)|Prasugrel(DB06209)|Praziquantel(DB01058)|Prednisone(DB00635)|Primidone(DB00794)|Probenecid(DB01032)|Progesterone(DB00396)|Proguanil(DB01131)|Promazine(DB00420)|Propofol(DB00818)|Propranolol(DB00571)|Quazepam(DB01589)|Quetiapine(DB01224)|Quinine(DB00468)|Rabeprazole(DB01129)|Ramelteon(DB00980)|Ranitidine(DB00863)|Regorafenib(DB08896)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Ritonavir(DB00503)|Rosiglitazone(DB00412)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Selegiline(DB01037)|Sertraline(DB01104)|Sildenafil(DB00203)|Simvastatin(DB00641)|Sitaxentan(DB06268)|Sorafenib(DB00398)|Sulfanilamide(DB00259)|Tamoxifen(DB00675)|Tapentadol(DB06204)|Telmisartan(DB00966)|Temazepam(DB00231)|Teniposide(DB00444)|Terbinafine(DB00857)|Testosterone(DB00624)|Thalidomide(DB01041)|Thioridazine(DB00679)|Ticlopidine(DB00208)|Timolol(DB00373)|Tioconazole(DB01007)|Tipranavir(DB00932)|Tofacitinib(DB08895)|Tolbutamide(DB01124)|Tolterodine(DB01036)|Topiramate(DB00273)|Torasemide(DB00214)|Trabectedin(DB05109)|Tranylcypromine(DB00752)|Trimethadione(DB00347)|Trimipramine(DB00726)|Troleandomycin(DB01361)|Valproic Acid(DB00313)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vismodegib(DB08828)|Voriconazole(DB00582)|Warfarin(DB00682)|Zafirlukast(DB00549)|Zidovudine(DB00495)|Zolpidem(DB00425)|Zonisamide(DB00909)	GGTGCTGCATGGATATGAAGT	0.458																																							uc010qnz.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(4)|central_nervous_system(1)|skin(1)	6						c.(235-237)GGA>TGA		cytochrome P450, family 2, subfamily C,	Adinazolam(DB00546)|Aminophenazone(DB01424)|Amitriptyline(DB00321)|Amoxicillin(DB01060)|Arformoterol(DB01274)|Bortezomib(DB00188)|Carisoprodol(DB00395)|Chlorzoxazone(DB00356)|Cilostazol(DB01166)|Citalopram(DB00215)|Clarithromycin(DB01211)|Clobazam(DB00349)|Desipramine(DB01151)|Desloratadine(DB00967)|Diclofenac(DB00586)|Diltiazem(DB00343)|Efavirenz(DB00625)|Esomeprazole(DB00736)|Famotidine(DB00927)|Felbamate(DB00949)|Finasteride(DB01216)|Flunitrazepam(DB01544)|Fluvoxamine(DB00176)|Formoterol(DB00983)|Fosphenytoin(DB01320)|Guanfacine(DB01018)|Imipramine(DB00458)|Indomethacin(DB00328)|Ketoconazole(DB01026)|Lansoprazole(DB00448)|Lapatinib(DB01259)|Loratadine(DB00455)|Melatonin(DB01065)|Mephenytoin(DB00532)|Methadone(DB00333)|Methylphenobarbital(DB00849)|Moclobemide(DB01171)|Modafinil(DB00745)|Nelfinavir(DB00220)|Nicardipine(DB00622)|Nilutamide(DB00665)|Norgestrel(DB00506)|Omeprazole(DB00338)|Oxcarbazepine(DB00776)|Pantoprazole(DB00213)|Pentamidine(DB00738)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Primidone(DB00794)|Progesterone(DB00396)|Proguanil(DB01131)|Promazine(DB00420)|Quinidine(DB00908)|Rabeprazole(DB01129)|Ranitidine(DB00863)|Ritonavir(DB00503)|Selegiline(DB01037)|Sertraline(DB01104)|Temazepam(DB00231)|Teniposide(DB00444)|Terfenadine(DB00342)|Thalidomide(DB01041)|Thioridazine(DB00679)|Ticlopidine(DB00208)|Tolbutamide(DB01124)|Topiramate(DB00273)|Tranylcypromine(DB00752)|Troglitazone(DB00197)|Troleandomycin(DB01361)|Voriconazole(DB00582)						229.0	207.0	214.0					10																	96534881		2203	4300	6503	SO:0001587	stop_gained	1557				exogenous drug catabolic process|heterocycle metabolic process|monoterpenoid metabolic process|steroid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	(S)-limonene 6-monooxygenase activity|(S)-limonene 7-monooxygenase activity|4-hydroxyacetophenone monooxygenase activity|electron carrier activity|enzyme binding|heme binding|oxygen binding|steroid hydroxylase activity	g.chr10:96534881G>T	M61854	CCDS7436.1	10q24	2007-12-14	2003-01-14		ENSG00000165841	ENSG00000165841		"""Cytochrome P450s"""	2621	protein-coding gene	gene with protein product		124020	"""cytochrome P450, subfamily IIC (mephenytoin 4-hydroxylase), polypeptide 19"""	CYP2C		2009263, 8530044	Standard	NM_000769		Approved	P450IIC19, CPCJ	uc010qnz.2	P33261	OTTHUMG00000018799	ENST00000371321.3:c.235G>T	10.37:g.96534881G>T	ENSP00000360372:p.Gly79*		Somatic				CYP2C19_uc009xus.1_Intron|CYP2C19_uc010qny.1_Nonsense_Mutation_p.G57*	p.G79*	NM_000769	NP_000760	WXS	Illumina HiSeq	Unspecified	P33261	CP2CJ_HUMAN		all cancers(201;6.02e-07)|KIRC - Kidney renal clear cell carcinoma(50;0.0672)|Kidney(138;0.0838)	2	235	+		Colorectal(252;0.09)	79					P33259|Q8WZB1|Q8WZB2|Q9UCD4	Nonsense_Mutation	SNP	ENST00000371321.3	37	c.235G>T	CCDS7436.1	.	.	.	.	.	.	.	.	.	.	G	15.42	2.829257	0.50845	.	.	ENSG00000165841	ENST00000371321	.	.	.	3.74	3.74	0.42951	.	0.000000	0.64402	U	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	13.4377	0.61094	0.0:0.0:1.0:0.0	.	.	.	.	X	79	.	ENSP00000360372:G79X	G	+	1	0	CYP2C19	96524871	1.000000	0.71417	0.928000	0.36995	0.155000	0.21991	6.450000	0.73477	1.807000	0.52817	0.405000	0.27470	GGA		0.458	CYP2C19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049490.1	NM_000769		29	123	1	0	3.80469e-20	0.009535	7.01755e-20	29	123				
OR51F2	119694	broad.mit.edu	37	11	4843600	4843600	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr11:4843600A>T	ENST00000322110.5	+	1	1050	c.985A>T	c.(985-987)Aat>Tat	p.N329Y	MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron	NM_001004753.1	NP_001004753.1	Q8NH61	O51F2_HUMAN	olfactory receptor, family 51, subfamily F, member 2	329						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.N329Y(1)		breast(2)|endometrium(4)|large_intestine(3)|lung(16)|ovary(1)|pancreas(1)|prostate(4)|skin(2)	33		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.0778)		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)		CTCCAAATCTAATCATCAGCT	0.383																																							uc010qyn.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(985-987)AAT>TAT		olfactory receptor, family 51, subfamily F,							82.0	85.0	84.0					11																	4843600		2201	4298	6499	SO:0001583	missense	119694				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:4843600A>T	BK004281	CCDS31361.1	11p15.4	2012-08-09			ENSG00000176925	ENSG00000176925		"""GPCR / Class A : Olfactory receptors"""	15197	protein-coding gene	gene with protein product							Standard	NM_001004753		Approved		uc010qyn.2	Q8NH61	OTTHUMG00000066508	ENST00000322110.5:c.985A>T	11.37:g.4843600A>T	ENSP00000323952:p.Asn329Tyr		Somatic					p.N329Y	NM_001004753	NP_001004753	WXS	Illumina HiSeq	Unspecified	Q8NH61	O51F2_HUMAN		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)	1	985	+		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.0778)	329			Cytoplasmic (Potential).		Q6IFI1	Missense_Mutation	SNP	ENST00000322110.5	37	c.985A>T	CCDS31361.1	.	.	.	.	.	.	.	.	.	.	A	15.13	2.741195	0.49151	.	.	ENSG00000176925	ENST00000322110	T	0.37584	1.19	5.01	3.85	0.44370	.	.	.	.	.	T	0.20333	0.0489	N	0.08118	0	0.09310	N	1	B	0.24483	0.104	B	0.22386	0.039	T	0.19031	-1.0318	9	0.72032	D	0.01	.	9.1386	0.36890	0.9118:0.0:0.0882:0.0	.	329	Q8NH61	O51F2_HUMAN	Y	329	ENSP00000323952:N329Y	ENSP00000323952:N329Y	N	+	1	0	OR51F2	4800176	0.832000	0.29368	0.099000	0.21106	0.134000	0.20937	1.315000	0.33608	0.887000	0.36136	0.459000	0.35465	AAT		0.383	OR51F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142181.1	NM_001004753		13	56	0	0	0	0.001368	0	13	56				
OR51L1	119682	broad.mit.edu	37	11	5020470	5020470	+	Silent	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr11:5020470G>T	ENST00000321543.1	+	1	258	c.258G>T	c.(256-258)gtG>gtT	p.V86V		NM_001004755.1	NP_001004755.1	Q8NGJ5	O51L1_HUMAN	olfactory receptor, family 51, subfamily L, member 1	86						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V86V(1)		central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(19)|skin(2)|stomach(1)	31		Medulloblastoma(188;0.0061)|all_neural(188;0.0479)|Breast(177;0.086)		Epithelial(150;1.75e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0285)|LUSC - Lung squamous cell carcinoma(625;0.19)		TGCTTGCTGTGTTATGGTTGG	0.483																																							uc010qyu.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(256-258)GTG>GTT		olfactory receptor, family 51, subfamily L,							215.0	169.0	185.0					11																	5020470		2201	4298	6499	SO:0001819	synonymous_variant	119682				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:5020470G>T	AB065799	CCDS31369.1	11p15.4	2012-08-09			ENSG00000176798	ENSG00000176798		"""GPCR / Class A : Olfactory receptors"""	14759	protein-coding gene	gene with protein product							Standard	NM_001004755		Approved		uc010qyu.2	Q8NGJ5	OTTHUMG00000066605	ENST00000321543.1:c.258G>T	11.37:g.5020470G>T			Somatic					p.V86V	NM_001004755	NP_001004755	WXS	Illumina HiSeq	Unspecified	Q8NGJ5	O51L1_HUMAN		Epithelial(150;1.75e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0285)|LUSC - Lung squamous cell carcinoma(625;0.19)	1	258	+		Medulloblastoma(188;0.0061)|all_neural(188;0.0479)|Breast(177;0.086)	86			Extracellular (Potential).		Q6IFE5	Silent	SNP	ENST00000321543.1	37	c.258G>T	CCDS31369.1																																																																																				0.483	OR51L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142812.1	NM_001004755		8	175	1	0	0.000442599	0.006214	0.000501854	8	175				
OR51V1	283111	broad.mit.edu	37	11	5221508	5221508	+	Silent	SNP	A	A	G			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr11:5221508A>G	ENST00000321255.1	-	1	422	c.423T>C	c.(421-423)taT>taC	p.Y141Y		NM_001004760.2	NP_001004760.2	Q9H2C8	O51V1_HUMAN	olfactory receptor, family 51, subfamily V, member 1	141					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Y141Y(1)		endometrium(1)|kidney(2)|large_intestine(13)|lung(19)|skin(2)|upper_aerodigestive_tract(2)	39		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.83e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GGATGGAGGAATAACGTAGTG	0.418																																							uc010qyz.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(421-423)TAT>TAC		olfactory receptor, family 51, subfamily V,							58.0	59.0	59.0					11																	5221508		2201	4298	6499	SO:0001819	synonymous_variant	283111				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:5221508A>G	BK004432	CCDS31375.1	11p15.4	2012-08-09			ENSG00000176742	ENSG00000176742		"""GPCR / Class A : Olfactory receptors"""	19597	protein-coding gene	gene with protein product				OR51A12			Standard	NM_001004760		Approved		uc010qyz.2	Q9H2C8	OTTHUMG00000066671	ENST00000321255.1:c.423T>C	11.37:g.5221508A>G			Somatic					p.Y141Y	NM_001004760	NP_001004760	WXS	Illumina HiSeq	Unspecified	Q9H2C8	O51V1_HUMAN		Epithelial(150;2.83e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)	1	423	-		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)	141			Cytoplasmic (Potential).			Silent	SNP	ENST00000321255.1	37	c.423T>C	CCDS31375.1																																																																																				0.418	OR51V1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142965.1	NM_001004760		7	76	0	0	0	0.004482	0	7	76				
TUB	7275	broad.mit.edu	37	11	8118969	8118969	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr11:8118969G>T	ENST00000299506.2	+	7	1031	c.882G>T	c.(880-882)aaG>aaT	p.K294N	TUB_ENST00000305253.4_Missense_Mutation_p.K349N|TUB_ENST00000534099.1_Missense_Mutation_p.K300N	NM_177972.2	NP_813977.1	P50607	TUB_HUMAN	tubby bipartite transcription factor	294					multicellular organismal macromolecule metabolic process (GO:0044259)|phagocytosis (GO:0006909)|phototransduction (GO:0007602)|positive regulation of phagocytosis (GO:0050766)|response to hormone (GO:0009725)|retina development in camera-type eye (GO:0060041)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein coupled photoreceptor activity (GO:0008020)|protein complex binding (GO:0032403)	p.K349N(1)		breast(1)|cervix(1)|endometrium(9)|large_intestine(7)|lung(5)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	26		all_lung(207;6.91e-20)|Lung NSC(207;3.36e-17)		Epithelial(150;1.69e-62)|BRCA - Breast invasive adenocarcinoma(625;8.54e-06)|LUSC - Lung squamous cell carcinoma(625;0.000184)		AGGATGGGAAGAAGGTAAGGT	0.512																																							uc001mga.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(880-882)AAG>AAT		tubby isoform b							80.0	72.0	75.0					11																	8118969		2201	4296	6497	SO:0001583	missense	7275				phagocytosis|positive regulation of phagocytosis|response to stimulus	cytoplasm|extracellular region|nucleus|plasma membrane		g.chr11:8118969G>T	U54644	CCDS7786.1, CCDS7787.1	11p15.5	2013-08-06	2013-08-06		ENSG00000166402	ENSG00000166402			12406	protein-coding gene	gene with protein product		601197	"""tubby (mouse) homolog"", ""tubby homolog (mouse)"""			8612280	Standard	NM_003320		Approved	rd5	uc001mfy.3	P50607	OTTHUMG00000165690	ENST00000299506.2:c.882G>T	11.37:g.8118969G>T	ENSP00000299506:p.Lys294Asn		Somatic				TUB_uc010rbk.1_Missense_Mutation_p.K300N|TUB_uc001mfy.2_Missense_Mutation_p.K349N	p.K294N	NM_177972	NP_813977	WXS	Illumina HiSeq	Unspecified	P50607	TUB_HUMAN		Epithelial(150;1.69e-62)|BRCA - Breast invasive adenocarcinoma(625;8.54e-06)|LUSC - Lung squamous cell carcinoma(625;0.000184)	7	1031	+		all_lung(207;6.91e-20)|Lung NSC(207;3.36e-17)	294					D3DQU4|O00293|Q6B007	Missense_Mutation	SNP	ENST00000299506.2	37	c.882G>T	CCDS7787.1	.	.	.	.	.	.	.	.	.	.	G	18.54	3.646556	0.67358	.	.	ENSG00000166402	ENST00000534099;ENST00000305253;ENST00000299506	D;D;D	0.86164	-2.08;-2.08;-2.08	4.57	3.65	0.41850	Tubby, C-terminal (3);	0.088059	0.85682	D	0.000000	D	0.92364	0.7577	M	0.92077	3.27	0.80722	D	1	D;D;P	0.58268	0.966;0.982;0.916	P;P;P	0.61940	0.775;0.896;0.751	D	0.91550	0.5256	10	0.56958	D	0.05	-11.989	4.2191	0.10549	0.3114:0.0:0.6886:0.0	.	300;294;349	E9PQR4;P50607;P50607-2	.;TUB_HUMAN;.	N	300;349;294	ENSP00000434400:K300N;ENSP00000305426:K349N;ENSP00000299506:K294N	ENSP00000299506:K294N	K	+	3	2	TUB	8075545	1.000000	0.71417	1.000000	0.80357	0.796000	0.44982	2.153000	0.42282	2.538000	0.85594	0.585000	0.79938	AAG		0.512	TUB-003	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385823.1	NM_003320		13	106	1	0	4.93089e-13	0.00245	8.21815e-13	13	106				
ABCC8	6833	broad.mit.edu	37	11	17419905	17419905	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr11:17419905C>G	ENST00000389817.3	-	30	3802	c.3734G>C	c.(3733-3735)aGa>aCa	p.R1245T	ABCC8_ENST00000302539.4_Missense_Mutation_p.R1246T			Q09428	ABCC8_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 8	1245	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium ion transmembrane transporter activity (GO:0015079)|sulfonylurea receptor activity (GO:0008281)	p.R1245T(1)		NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(38)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	67				READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	Adenosine triphosphate(DB00171)|Chlorpropamide(DB00672)|Gliclazide(DB01120)|Glimepiride(DB00222)|Glipizide(DB01067)|Gliquidone(DB01251)|Glyburide(DB01016)|Glycodiazine(DB01382)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)|Tolbutamide(DB01124)	TTCCAGCCATCTGTTGGCAGC	0.552																																							uc001mnc.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(3733-3735)AGA>ACA		ATP-binding cassette, sub-family C, member 8	Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)|Gliclazide(DB01120)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)						211.0	184.0	193.0					11																	17419905		2200	4293	6493	SO:0001583	missense	6833				carbohydrate metabolic process|energy reserve metabolic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium ion transmembrane transporter activity|sulfonylurea receptor activity	g.chr11:17419905C>G	L78207	CCDS31437.1, CCDS73264.1	11p15.1	2014-09-17			ENSG00000006071	ENSG00000006071		"""ATP binding cassette transporters / subfamily C"""	59	protein-coding gene	gene with protein product	"""sulfonylurea receptor (hyperinsulinemia)"""	600509		SUR, HRINS		7920639, 7716548	Standard	NM_000352		Approved	HI, PHHI, SUR1, MRP8, ABC36, HHF1, TNDM2	uc001mnc.3	Q09428	OTTHUMG00000166316	ENST00000389817.3:c.3734G>C	11.37:g.17419905C>G	ENSP00000374467:p.Arg1245Thr		Somatic					p.R1245T	NM_000352	NP_000343	WXS	Illumina HiSeq	Unspecified	Q09428	ABCC8_HUMAN		READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	30	3860	-			1245			ABC transmembrane type-1 2.|Cytoplasmic (By similarity).		A6NMX8|E3UYX6|O75948|Q16583	Missense_Mutation	SNP	ENST00000389817.3	37	c.3734G>C	CCDS31437.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	27.2|27.2	4.814023|4.814023	0.90790|0.90790	.|.	.|.	ENSG00000006071|ENSG00000006071	ENST00000528374|ENST00000389817;ENST00000302539	.|D;D	.|0.90004	.|-2.6;-2.6	5.46|5.46	5.46|5.46	0.80206|0.80206	.|ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.96024|0.96024	0.8705|0.8705	H|H	0.94582|0.94582	3.555|3.555	0.80722|0.80722	D|D	1|1	.|D	.|0.57571	.|0.98	.|D	.|0.64321	.|0.924	D|D	0.96904|0.96904	0.9662|0.9662	5|10	.|0.87932	.|D	.|0	.|.	19.3005|19.3005	0.94143|0.94143	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|1245	.|Q09428	.|ABCC8_HUMAN	H|T	68|1245;1246	.|ENSP00000374467:R1245T;ENSP00000303960:R1246T	.|ENSP00000303960:R1246T	Q|R	-|-	3|2	2|0	ABCC8|ABCC8	17376481|17376481	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.993000|0.993000	0.82548|0.82548	7.818000|7.818000	0.86416|0.86416	2.576000|2.576000	0.86940|0.86940	0.555000|0.555000	0.69702|0.69702	CAG|AGA		0.552	ABCC8-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000389093.1	NM_000352		7	56	0	0	0	0.006214	0	7	56				
OR4C15	81309	broad.mit.edu	37	11	55322475	55322475	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr11:55322475G>C	ENST00000314644.2	+	1	693	c.693G>C	c.(691-693)atG>atC	p.M231I		NM_001001920.1	NP_001001920.1	Q8NGM1	OR4CF_HUMAN	olfactory receptor, family 4, subfamily C, member 15	177						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.M231I(1)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(31)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(5)	56						ATCACTTTATGTGTGACTTGT	0.463										HNSCC(20;0.049)																													uc010rig.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(691-693)ATG>ATC		olfactory receptor, family 4, subfamily C,							110.0	81.0	91.0					11																	55322475		2201	4296	6497	SO:0001583	missense	81309				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55322475G>C	BK004319	CCDS31501.1	11q11	2012-08-09			ENSG00000181939	ENSG00000181939		"""GPCR / Class A : Olfactory receptors"""	15171	protein-coding gene	gene with protein product							Standard	NM_001001920		Approved		uc010rig.2	Q8NGM1	OTTHUMG00000166714	ENST00000314644.2:c.693G>C	11.37:g.55322475G>C	ENSP00000324958:p.Met231Ile	HNSCC(20;0.049)	Somatic					p.M231I	NM_001001920	NP_001001920	WXS	Illumina HiSeq	Unspecified	Q8NGM1	OR4CF_HUMAN			1	693	+			177			Extracellular (Potential).		Q6IFE2	Missense_Mutation	SNP	ENST00000314644.2	37	c.693G>C	CCDS31501.1	.	.	.	.	.	.	.	.	.	.	G	0.715	-0.785657	0.02907	.	.	ENSG00000181939	ENST00000314644	T	0.00039	8.85	5.02	-4.32	0.03688	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00109	0.0003	L	0.28504	0.86	0.09310	N	0.999999	B	0.06786	0.001	B	0.17979	0.02	T	0.02698	-1.1122	9	0.27082	T	0.32	.	3.4726	0.07573	0.2156:0.4232:0.2528:0.1084	.	177	Q8NGM1	OR4CF_HUMAN	I	231	ENSP00000324958:M231I	ENSP00000324958:M231I	M	+	3	0	OR4C15	55079051	0.000000	0.05858	0.031000	0.17742	0.018000	0.09664	-0.414000	0.07114	-0.560000	0.06102	-0.815000	0.03128	ATG		0.463	OR4C15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391164.1	NM_001001920		14	61	0	0	0	0.00245	0	14	61				
OR8I2	120586	broad.mit.edu	37	11	55860901	55860901	+	Silent	SNP	T	T	C			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr11:55860901T>C	ENST00000302124.2	+	1	149	c.118T>C	c.(118-120)Ttg>Ctg	p.L40L		NM_001003750.1	NP_001003750.1	Q8N0Y5	OR8I2_HUMAN	olfactory receptor, family 8, subfamily I, member 2	40						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L40L(1)		NS(1)|breast(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(24)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	53	Esophageal squamous(21;0.00693)					ATTCACTGTTTTGGGAAACCT	0.378																																							uc010rix.1		NA																	1	Substitution - coding silent(1)		lung(1)	breast(1)	1						c.(118-120)TTG>CTG		olfactory receptor, family 8, subfamily I,							219.0	211.0	214.0					11																	55860901		2201	4296	6497	SO:0001819	synonymous_variant	120586				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55860901T>C	AB065656	CCDS31517.1	11q11	2012-08-09			ENSG00000172154	ENSG00000172154		"""GPCR / Class A : Olfactory receptors"""	15310	protein-coding gene	gene with protein product							Standard	NM_001003750		Approved		uc010rix.2	Q8N0Y5	OTTHUMG00000166831	ENST00000302124.2:c.118T>C	11.37:g.55860901T>C			Somatic					p.L40L	NM_001003750	NP_001003750	WXS	Illumina HiSeq	Unspecified	Q8N0Y5	OR8I2_HUMAN			1	118	+	Esophageal squamous(21;0.00693)		40			Helical; Name=1; (Potential).		B2RNN4|Q6IFC0|Q96RC5	Silent	SNP	ENST00000302124.2	37	c.118T>C	CCDS31517.1																																																																																				0.378	OR8I2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001003750		34	201	0	0	0	0.004289	0	34	201				
CTNND1	1500	broad.mit.edu	37	11	57563083	57563083	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr11:57563083G>C	ENST00000399050.4	+	5	838	c.302G>C	c.(301-303)aGg>aCg	p.R101T	CTNND1_ENST00000529986.1_5'UTR|CTNND1_ENST00000524630.1_Missense_Mutation_p.R101T|CTNND1_ENST00000361332.4_Missense_Mutation_p.R101T|CTNND1_ENST00000525902.1_Intron|CTNND1_ENST00000532463.1_5'UTR|CTNND1_ENST00000426142.2_5'UTR|CTNND1_ENST00000526357.1_Missense_Mutation_p.R47T|CTNND1_ENST00000526772.1_Intron|CTNND1_ENST00000528232.1_5'UTR|CTNND1_ENST00000361796.4_Missense_Mutation_p.R101T|CTNND1_ENST00000534579.1_Missense_Mutation_p.R47T|CTNND1_ENST00000532844.1_Missense_Mutation_p.R47T|CTNND1_ENST00000530094.1_5'UTR|CTNND1_ENST00000527467.1_Intron|CTNND1_ENST00000529526.1_Missense_Mutation_p.R47T|CTNND1_ENST00000532649.1_Missense_Mutation_p.R47T|CTNND1_ENST00000532245.1_5'UTR|CTNND1_ENST00000531014.1_Intron|CTNND1_ENST00000358694.6_Missense_Mutation_p.R101T|CTNND1_ENST00000528621.1_Missense_Mutation_p.R47T|CTNND1_ENST00000526938.1_Missense_Mutation_p.R101T|CTNND1_ENST00000529873.1_Missense_Mutation_p.R47T|CTNND1_ENST00000399039.4_Missense_Mutation_p.R101T|CTNND1_ENST00000415361.2_5'UTR|CTNND1_ENST00000361391.6_Missense_Mutation_p.R101T|CTNND1_ENST00000360682.6_Missense_Mutation_p.R101T|CTNND1_ENST00000529919.1_Missense_Mutation_p.R101T|CTNND1_ENST00000532787.1_5'UTR|CTNND1_ENST00000533667.1_Intron|CTNND1_ENST00000530748.1_Missense_Mutation_p.R47T|CTNND1_ENST00000428599.2_Missense_Mutation_p.R101T	NM_001085458.1	NP_001078927.1	O60716	CTND1_HUMAN	catenin (cadherin-associated protein), delta 1	101					adherens junction organization (GO:0034332)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|regulation of transcription, DNA-templated (GO:0006355)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|midbody (GO:0030496)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synapse (GO:0045202)|zonula adherens (GO:0005915)	cadherin binding (GO:0045296)|receptor binding (GO:0005102)	p.R101T(2)		breast(5)|endometrium(8)|kidney(4)|large_intestine(7)|liver(2)|lung(16)|ovary(1)|upper_aerodigestive_tract(2)	45		all_epithelial(135;0.155)				ACCATCCCCAGGATGCAGGAG	0.473																																							uc001nmc.3		NA																	2	Substitution - Missense(2)		lung(2)	breast(4)|ovary(1)|kidney(1)	6						c.(301-303)AGG>ACG		catenin, delta 1 isoform 1ABC							49.0	54.0	52.0					11																	57563083		1932	4121	6053	SO:0001583	missense	1500				adherens junction organization|cell junction assembly|negative regulation of canonical Wnt receptor signaling pathway|regulation of transcription, DNA-dependent|transcription, DNA-dependent|Wnt receptor signaling pathway	cytosol|midbody|nucleus	cadherin binding|protein binding|receptor binding	g.chr11:57563083G>C	AB002382	CCDS44604.1, CCDS44605.1, CCDS44606.1, CCDS44607.1, CCDS44608.1, CCDS44609.1, CCDS53632.1, CCDS53633.1, CCDS53634.1, CCDS55763.1, CCDS55764.1, CCDS55765.1, CCDS55766.1, CCDS55767.1, CCDS73290.1	11q12.1	2013-02-14				ENSG00000198561		"""Armadillo repeat containing"""	2515	protein-coding gene	gene with protein product		601045		CTNND		8808291	Standard	NM_001085460		Approved	KIAA0384, p120, p120cas, p120ctn	uc001nmc.4	O60716		ENST00000399050.4:c.302G>C	11.37:g.57563083G>C	ENSP00000382004:p.Arg101Thr		Somatic				CTNND1_uc001nlf.1_Missense_Mutation_p.R101T|CTNND1_uc001nlh.1_Missense_Mutation_p.R101T|CTNND1_uc001nlu.3_5'UTR|CTNND1_uc001nlt.3_5'UTR|CTNND1_uc001nls.3_5'UTR|CTNND1_uc001nlw.3_5'UTR|CTNND1_uc001nmf.3_Missense_Mutation_p.R101T|CTNND1_uc001nmd.3_Missense_Mutation_p.R47T|CTNND1_uc001nlk.3_Missense_Mutation_p.R47T|CTNND1_uc001nme.3_Missense_Mutation_p.R101T|CTNND1_uc001nll.3_Missense_Mutation_p.R47T|CTNND1_uc001nmg.3_Missense_Mutation_p.R47T|CTNND1_uc001nlj.3_Missense_Mutation_p.R47T|CTNND1_uc001nlr.3_Missense_Mutation_p.R47T|CTNND1_uc001nlp.3_Missense_Mutation_p.R47T|CTNND1_uc001nlx.3_Intron|CTNND1_uc001nlz.3_Intron|CTNND1_uc009ymn.2_Intron|CTNND1_uc001nlm.3_Missense_Mutation_p.R101T|CTNND1_uc001nly.3_Intron|CTNND1_uc001nmb.3_Intron|CTNND1_uc001nma.3_Intron|CTNND1_uc001nmi.3_5'UTR|CTNND1_uc001nmh.3_Missense_Mutation_p.R101T|CTNND1_uc001nlq.3_5'UTR|CTNND1_uc001nln.3_Missense_Mutation_p.R101T|CTNND1_uc001nli.3_Missense_Mutation_p.R101T|CTNND1_uc001nlo.3_5'UTR|CTNND1_uc001nlv.3_5'UTR	p.R101T	NM_001085458	NP_001078927	WXS	Illumina HiSeq	Unspecified	O60716	CTND1_HUMAN			5	873	+		all_epithelial(135;0.155)	101					A8K939|O15088|O60713|O60714|O60715|O60935|Q6DHZ7|Q6RBX8|Q9UP71|Q9UP72|Q9UP73	Missense_Mutation	SNP	ENST00000399050.4	37	c.302G>C	CCDS44604.1	.	.	.	.	.	.	.	.	.	.	G	14.97	2.695364	0.48202	.	.	ENSG00000198561	ENST00000524630;ENST00000529919;ENST00000399039;ENST00000360682;ENST00000361796;ENST00000529526;ENST00000399050;ENST00000361391;ENST00000361332;ENST00000358694;ENST00000532649;ENST00000528621;ENST00000530748;ENST00000428599;ENST00000529873;ENST00000532844;ENST00000526357;ENST00000534579;ENST00000526938;ENST00000530068;ENST00000534647	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.71817	1.58;1.58;1.58;1.58;1.58;-0.23;1.58;1.58;1.58;1.58;-0.23;-0.23;-0.24;1.58;-0.6;-0.25;-0.25;-0.23;1.58;1.58;2.21	5.8	5.8	0.92144	.	0.126892	0.56097	D	0.000030	T	0.63094	0.2482	L	0.29908	0.895	0.44635	D	0.997611	B;B;B;P;B;B;B	0.51933	0.003;0.005;0.003;0.949;0.001;0.003;0.002	B;B;B;P;B;B;B	0.45881	0.004;0.004;0.002;0.496;0.004;0.004;0.002	T	0.60131	-0.7323	10	0.25751	T	0.34	-13.079	14.4927	0.67663	0.0:0.0:0.853:0.1469	.	101;101;101;47;101;101;101	O60716-3;O60716-2;O60716;O60716-10;O60716-5;F8WA43;C9JZR2	.;.;CTND1_HUMAN;.;.;.;.	T	101;101;101;101;101;47;101;101;101;101;47;47;47;101;47;47;47;47;101;47;23	ENSP00000436543:R101T;ENSP00000434808:R101T;ENSP00000381996:R101T;ENSP00000353902:R101T;ENSP00000354907:R101T;ENSP00000436323:R47T;ENSP00000382004:R101T;ENSP00000354785:R101T;ENSP00000354823:R101T;ENSP00000351527:R101T;ENSP00000435379:R47T;ENSP00000432243:R47T;ENSP00000436744:R47T;ENSP00000413586:R101T;ENSP00000435494:R47T;ENSP00000433276:R47T;ENSP00000433334:R47T;ENSP00000435789:R47T;ENSP00000432041:R101T;ENSP00000431600:R47T;ENSP00000434202:R23T	ENSP00000351527:R101T	R	+	2	0	CTNND1	57319659	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.255000	0.58804	2.750000	0.94351	0.467000	0.42956	AGG		0.473	CTNND1-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000393944.1	NM_001331		3	40	0	0	0	0.004672	0	3	40				
OR5AN1	390195	broad.mit.edu	37	11	59132051	59132051	+	Silent	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr11:59132051G>T	ENST00000313940.2	+	1	167	c.120G>T	c.(118-120)ctG>ctT	p.L40L		NM_001004729.1	NP_001004729.1	Q8NGI8	O5AN1_HUMAN	olfactory receptor, family 5, subfamily AN, member 1	40						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L40L(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	21						TTACATCTCTGGCCTGGAACC	0.418																																							uc010rks.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(118-120)CTG>CTT		olfactory receptor, family 5, subfamily AN,							182.0	166.0	171.0					11																	59132051		2201	4295	6496	SO:0001819	synonymous_variant	390195				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:59132051G>T	AB065806	CCDS31559.1	11q12.1	2012-08-09			ENSG00000176495	ENSG00000176495		"""GPCR / Class A : Olfactory receptors"""	15255	protein-coding gene	gene with protein product		615702					Standard	NM_001004729		Approved		uc010rks.2	Q8NGI8	OTTHUMG00000167337	ENST00000313940.2:c.120G>T	11.37:g.59132051G>T			Somatic					p.L40L	NM_001004729	NP_001004729	WXS	Illumina HiSeq	Unspecified	Q8NGI8	O5AN1_HUMAN			1	120	+			40			Helical; Name=1; (Potential).		B9EIS2|Q6IEV4	Silent	SNP	ENST00000313940.2	37	c.120G>T	CCDS31559.1																																																																																				0.418	OR5AN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394231.1	NM_001004729		19	270	1	0	5.35267e-07	0.007413	7.09699e-07	19	270				
OR4D10	390197	broad.mit.edu	37	11	59245669	59245669	+	Missense_Mutation	SNP	A	A	G	rs374135249		TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr11:59245669A>G	ENST00000530162.1	+	1	824	c.767A>G	c.(766-768)tAt>tGt	p.Y256C		NM_001004705.1	NP_001004705.1	Q8NGI6	OR4DA_HUMAN	olfactory receptor, family 4, subfamily D, member 10	256						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Y256C(1)|p.Y254C(1)		NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						CCCTGCATCTATGTCTATGCC	0.562																																							uc001nnz.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|skin(1)	3						c.(766-768)TAT>TGT		olfactory receptor, family 4, subfamily D,		A	CYS/TYR	0,4402		0,0,2201	204.0	181.0	189.0		767	2.4	1.0	11		189	1,8589	1.2+/-3.3	0,1,4294	no	missense	OR4D10	NM_001004705.1	194	0,1,6495	GG,GA,AA		0.0116,0.0,0.0077	benign	256/312	59245669	1,12991	2201	4295	6496	SO:0001583	missense	390197				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:59245669A>G	AB065808	CCDS53636.1	11q12.1	2012-10-03		2004-03-10	ENSG00000254466	ENSG00000254466		"""GPCR / Class A : Olfactory receptors"""	15173	protein-coding gene	gene with protein product				OR4D10P			Standard	NM_001004705		Approved	OST711	uc001nnz.1	Q8NGI6	OTTHUMG00000167341	ENST00000530162.1:c.767A>G	11.37:g.59245669A>G	ENSP00000436424:p.Tyr256Cys		Somatic					p.Y256C	NM_001004705	NP_001004705	WXS	Illumina HiSeq	Unspecified	Q8NGI6	OR4DA_HUMAN			1	767	+			256			Helical; Name=6; (Potential).		B2RNH6	Missense_Mutation	SNP	ENST00000530162.1	37	c.767A>G	CCDS53636.1	.	.	.	.	.	.	.	.	.	.	A	15.71	2.914686	0.52546	0.0	1.16E-4	ENSG00000254466	ENST00000530162	T	0.00115	8.71	4.7	2.38	0.29361	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00271	0.0008	L	0.35793	1.09	0.28739	N	0.902071	D	0.89917	1.0	D	0.79108	0.992	T	0.55095	-0.8194	9	0.72032	D	0.01	.	7.1178	0.25427	0.6354:0.0:0.3646:0.0	.	256	Q8NGI6	OR4DA_HUMAN	C	256	ENSP00000436424:Y256C	ENSP00000436424:Y256C	Y	+	2	0	OR4D10	59002245	0.003000	0.15002	0.996000	0.52242	0.905000	0.53344	0.858000	0.27845	0.267000	0.21916	-0.256000	0.11100	TAT		0.562	OR4D10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394235.1	NM_001004705		26	225	0	0	0	0.007291	0	26	225				
AHNAK	79026	broad.mit.edu	37	11	62290909	62290909	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr11:62290909C>A	ENST00000378024.4	-	5	11254	c.10980G>T	c.(10978-10980)aaG>aaT	p.K3660N	AHNAK_ENST00000530124.1_Intron|AHNAK_ENST00000257247.7_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	3660					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				TCTCAGGCATCTTGAACTTGG	0.468																																							uc001ntl.2		NA																	0				ovary(10)|pancreas(4)|skin(4)|upper_aerodigestive_tract(1)	19						c.(10978-10980)AAG>AAT		AHNAK nucleoprotein isoform 1							224.0	230.0	228.0					11																	62290909		2202	4299	6501	SO:0001583	missense	79026				nervous system development	nucleus	protein binding	g.chr11:62290909C>A	M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.10980G>T	11.37:g.62290909C>A	ENSP00000367263:p.Lys3660Asn		Somatic				AHNAK_uc001ntk.1_Intron	p.K3660N	NM_001620	NP_001611	WXS	Illumina HiSeq	Unspecified	Q09666	AHNK_HUMAN			5	11280	-		Melanoma(852;0.155)	3660					A1A586	Missense_Mutation	SNP	ENST00000378024.4	37	c.10980G>T	CCDS31584.1	.	.	.	.	.	.	.	.	.	.	-	16.86	3.239008	0.58995	.	.	ENSG00000124942	ENST00000378024	T	0.01379	4.96	5.32	3.43	0.39272	.	0.000000	0.43260	D	0.000592	T	0.07458	0.0188	M	0.82193	2.58	0.44562	D	0.997529	D	0.89917	1.0	D	0.79108	0.992	T	0.02477	-1.1153	10	0.41790	T	0.15	-12.036	10.4647	0.44600	0.0:0.8604:0.0:0.1396	.	3660	Q09666	AHNK_HUMAN	N	3660	ENSP00000367263:K3660N	ENSP00000367263:K3660N	K	-	3	2	AHNAK	62047485	0.190000	0.23276	1.000000	0.80357	0.947000	0.59692	-0.149000	0.10204	2.492000	0.84095	0.579000	0.79373	AAG		0.468	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	NM_024060		41	418	1	0	2.54651e-27	0.006999	4.91535e-27	41	418				
MYEOV	26579	broad.mit.edu	37	11	69062910	69062910	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr11:69062910C>T	ENST00000308946.3	+	2	539	c.89C>T	c.(88-90)tCc>tTc	p.S30F	MYEOV_ENST00000441339.2_Missense_Mutation_p.S30F|MYEOV_ENST00000535407.1_5'UTR	NM_138768.2	NP_620123.2	Q96EZ4	MYEOV_HUMAN	myeloma overexpressed	30								p.S30F(2)		endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(1)|lung(12)|prostate(2)|skin(1)|urinary_tract(1)	24	all_lung(4;2.21e-19)|Lung NSC(4;6.13e-19)|Melanoma(5;0.00128)		LUSC - Lung squamous cell carcinoma(11;3.33e-11)|STAD - Stomach adenocarcinoma(18;0.00654)|LUAD - Lung adenocarcinoma(13;0.0713)	Kidney(183;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(183;3.23e-08)|Lung(977;0.00361)|LUSC - Lung squamous cell carcinoma(976;0.0153)		cagtctccctcctggtgtcAT	0.587																																							uc001oov.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(88-90)TCC>TTC		myeloma overexpressed							240.0	171.0	194.0					11																	69062910		2200	4294	6494	SO:0001583	missense	26579							g.chr11:69062910C>T	AJ223366	CCDS8190.1, CCDS73340.1	11q13.2	2013-03-27	2013-03-27			ENSG00000172927			7563	protein-coding gene	gene with protein product		605625	"""myeloma overexpressed (in a subset of t(11;14) positive multiple myelomas)"""			10753852	Standard	XM_005273908		Approved	OCIM	uc001oov.3	Q96EZ4		ENST00000308946.3:c.89C>T	11.37:g.69062910C>T	ENSP00000308330:p.Ser30Phe		Somatic				MYEOV_uc001oox.2_Intron|MYEOV_uc009ysl.2_Missense_Mutation_p.S30F|MYEOV_uc001oow.2_5'UTR	p.S30F	NM_138768	NP_620123	WXS	Illumina HiSeq	Unspecified	Q96EZ4	MYEOV_HUMAN	LUSC - Lung squamous cell carcinoma(11;3.33e-11)|STAD - Stomach adenocarcinoma(18;0.00654)|LUAD - Lung adenocarcinoma(13;0.0713)	Kidney(183;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(183;3.23e-08)|Lung(977;0.00361)|LUSC - Lung squamous cell carcinoma(976;0.0153)	2	539	+	all_lung(4;2.21e-19)|Lung NSC(4;6.13e-19)|Melanoma(5;0.00128)		30					Q9UGN6|Q9UGN7	Missense_Mutation	SNP	ENST00000308946.3	37	c.89C>T	CCDS8190.1	.	.	.	.	.	.	.	.	.	.	C	9.072	0.997231	0.19043	.	.	ENSG00000172927	ENST00000441339;ENST00000308946	T;T	0.24350	1.86;1.86	1.34	-0.873	0.10635	.	.	.	.	.	T	0.09379	0.0231	N	0.08118	0	0.19300	N	0.999973	P	0.47910	0.902	B	0.32465	0.146	T	0.20672	-1.0268	9	0.87932	D	0	.	6.8908	0.24228	0.0:0.4224:0.5776:0.0	.	30	Q96EZ4	MYEOV_HUMAN	F	30	ENSP00000412482:S30F;ENSP00000308330:S30F	ENSP00000308330:S30F	S	+	2	0	MYEOV	68819486	0.000000	0.05858	0.000000	0.03702	0.068000	0.16541	-1.934000	0.01552	-0.247000	0.09597	-0.666000	0.03841	TCC		0.587	MYEOV-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396548.1			20	84	0	0	0	0.010504	0	20	84				
FAT3	120114	broad.mit.edu	37	11	92525961	92525961	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr11:92525961G>T	ENST00000298047.6	+	8	4657	c.4640G>T	c.(4639-4641)aGa>aTa	p.R1547I	FAT3_ENST00000525166.1_Missense_Mutation_p.R1397I|FAT3_ENST00000409404.2_Missense_Mutation_p.R1547I			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	1547	Cadherin 14. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R1547I(2)		NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				CCTTATCGAAGAAACTTGGCC	0.418										TCGA Ovarian(4;0.039)																													uc001pdj.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|pancreas(1)	5						c.(4639-4641)AGA>ATA		FAT tumor suppressor homolog 3							183.0	181.0	182.0					11																	92525961		1928	4135	6063	SO:0001583	missense	120114				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding	g.chr11:92525961G>T	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.4640G>T	11.37:g.92525961G>T	ENSP00000298047:p.Arg1547Ile	TCGA Ovarian(4;0.039)	Somatic					p.R1547I	NM_001008781	NP_001008781	WXS	Illumina HiSeq	Unspecified	Q8TDW7	FAT3_HUMAN			8	4657	+		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)	1547			Cadherin 14.|Extracellular (Potential).		B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	37	c.4640G>T		.	.	.	.	.	.	.	.	.	.	G	25.5	4.649760	0.87958	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	T;T;T	0.01685	4.69;4.69;4.69	5.94	5.94	0.96194	.	.	.	.	.	T	0.10294	0.0252	M	0.68593	2.085	0.80722	D	1	D	0.69078	0.997	D	0.67382	0.951	T	0.00085	-1.2098	9	0.87932	D	0	.	20.3591	0.98849	0.0:0.0:1.0:0.0	.	1547	Q8TDW7-3	.	I	1547;1547;1397	ENSP00000298047:R1547I;ENSP00000387040:R1547I;ENSP00000432586:R1397I	ENSP00000298047:R1547I	R	+	2	0	FAT3	92165609	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.145000	0.71769	2.816000	0.96949	0.561000	0.74099	AGA		0.418	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781		9	149	1	0	1.58986e-06	0.008291	2.08137e-06	9	149				
FAT3	120114	broad.mit.edu	37	11	92535011	92535011	+	Silent	SNP	C	C	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr11:92535011C>A	ENST00000298047.6	+	9	8849	c.8832C>A	c.(8830-8832)gcC>gcA	p.A2944A	FAT3_ENST00000525166.1_Silent_p.A2794A|FAT3_ENST00000409404.2_Silent_p.A2944A			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	2944	Cadherin 27. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A2944A(2)		NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				AGGTGGTAGCCGTCCTCAGCA	0.517										TCGA Ovarian(4;0.039)																													uc001pdj.3		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(4)|pancreas(1)	5						c.(8830-8832)GCC>GCA		FAT tumor suppressor homolog 3							73.0	76.0	75.0					11																	92535011		1989	4159	6148	SO:0001819	synonymous_variant	120114				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding	g.chr11:92535011C>A	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.8832C>A	11.37:g.92535011C>A		TCGA Ovarian(4;0.039)	Somatic					p.A2944A	NM_001008781	NP_001008781	WXS	Illumina HiSeq	Unspecified	Q8TDW7	FAT3_HUMAN			9	8849	+		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)	2944			Cadherin 27.|Extracellular (Potential).		B5MDB0|Q96AU6	Silent	SNP	ENST00000298047.6	37	c.8832C>A																																																																																					0.517	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781		12	112	1	0	7.03913e-09	0.001368	1.01432e-08	12	112				
NPAT	4863	broad.mit.edu	37	11	108057265	108057265	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr11:108057265C>T	ENST00000278612.8	-	8	775	c.670G>A	c.(670-672)Ggc>Agc	p.G224S	NPAT_ENST00000610253.1_5'UTR	NM_002519.2	NP_002510.2	Q14207	NPAT_HUMAN	nuclear protein, ataxia-telangiectasia locus	224	Interaction with MIZF.				positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression (GO:0010468)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription, DNA-templated (GO:0006351)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|Gemini of coiled bodies (GO:0097504)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.G224S(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(21)|ovary(2)|prostate(2)|skin(5)	46		all_cancers(61;2.31e-10)|all_epithelial(67;1.11e-06)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;1.05e-05)|Epithelial(105;3.01e-05)|all cancers(92;0.000816)|Colorectal(284;0.116)		GAATGAGGGCCAGACAAAGTG	0.323																																							uc001pjz.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(670-672)GGC>AGC		nuclear protein,  ataxia-telangiectasia locus							113.0	107.0	109.0					11																	108057265		1806	4077	5883	SO:0001583	missense	4863				positive regulation of transcription, DNA-dependent|regulation of transcription involved in G1/S phase of mitotic cell cycle	Cajal body	protein C-terminus binding|protein N-terminus binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity	g.chr11:108057265C>T	X97186	CCDS41710.1	11q22-q23	2008-02-01			ENSG00000149308	ENSG00000149308			7896	protein-coding gene	gene with protein product		601448				9205109	Standard	NM_002519		Approved	E14	uc001pjz.4	Q14207	OTTHUMG00000166385	ENST00000278612.8:c.670G>A	11.37:g.108057265C>T	ENSP00000278612:p.Gly224Ser		Somatic				NPAT_uc001pka.2_Missense_Mutation_p.G19S	p.G224S	NM_002519	NP_002510	WXS	Illumina HiSeq	Unspecified	Q14207	NPAT_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.05e-05)|Epithelial(105;3.01e-05)|all cancers(92;0.000816)|Colorectal(284;0.116)	8	772	-		all_cancers(61;2.31e-10)|all_epithelial(67;1.11e-06)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)	224			Interaction with MIZF.		A8K1V5|A8K6M2|Q13632|Q14967|Q16580|Q86W55|Q8IWE9	Missense_Mutation	SNP	ENST00000278612.8	37	c.670G>A	CCDS41710.1	.	.	.	.	.	.	.	.	.	.	C	25.9	4.686812	0.88639	.	.	ENSG00000149308	ENST00000278612	T	0.03920	3.76	5.76	5.76	0.90799	.	0.229474	0.44097	D	0.000492	T	0.17066	0.0410	L	0.60455	1.87	0.42902	D	0.994238	D;D	0.63880	0.993;0.993	D;D	0.66497	0.944;0.944	T	0.00276	-1.1855	10	0.34782	T	0.22	-4.9638	16.6764	0.85280	0.0:1.0:0.0:0.0	.	224;224	B9EG70;Q14207	.;NPAT_HUMAN	S	224	ENSP00000278612:G224S	ENSP00000278612:G224S	G	-	1	0	NPAT	107562475	1.000000	0.71417	0.996000	0.52242	0.993000	0.82548	4.238000	0.58688	2.721000	0.93114	0.655000	0.94253	GGC		0.323	NPAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389506.2	NM_002519		8	92	0	0	0	0.008291	0	8	92				
DSCAML1	57453	broad.mit.edu	37	11	117395626	117395626	+	Silent	SNP	T	T	C			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr11:117395626T>C	ENST00000321322.6	-	5	1012	c.1011A>G	c.(1009-1011)acA>acG	p.T337T	DSCAML1_ENST00000527706.1_Silent_p.T67T	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	277	Ig-like C2-type 4.				axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)	p.T337T(1)		breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		TGGTCAGCCCTGTGATGCGCT	0.657																																							uc001prh.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|large_intestine(2)|skin(2)|upper_aerodigestive_tract(1)	8						c.(1009-1011)ACA>ACG		Down syndrome cell adhesion molecule like 1							45.0	38.0	40.0					11																	117395626		2200	4296	6496	SO:0001819	synonymous_variant	57453				axonogenesis|brain development|cell fate determination|dorsal/ventral pattern formation|embryonic skeletal system morphogenesis|homophilic cell adhesion	cell surface|integral to membrane|plasma membrane	protein homodimerization activity	g.chr11:117395626T>C		CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.1011A>G	11.37:g.117395626T>C			Somatic				DSCAML1_uc001pri.1_Silent_p.T141T	p.T337T	NM_020693	NP_065744	WXS	Illumina HiSeq	Unspecified	Q8TD84	DSCL1_HUMAN		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)	5	1013	-	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)	277			Ig-like C2-type 3.|Extracellular (Potential).		Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Silent	SNP	ENST00000321322.6	37	c.1011A>G	CCDS8384.1																																																																																				0.657	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392907.2	NM_020693		3	22	0	0	0	0.000602	0	3	22				
OR8D1	283159	broad.mit.edu	37	11	124180365	124180365	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr11:124180365G>T	ENST00000357821.2	-	1	368	c.298C>A	c.(298-300)Cag>Aag	p.Q100K		NM_001002917.1	NP_001002917.1	Q8WZ84	OR8D1_HUMAN	olfactory receptor, family 8, subfamily D, member 1	100						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Q100K(1)		kidney(1)|large_intestine(1)|lung(7)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0528)		AAAAAGAGCTGGACCATGCAC	0.453																																							uc010sag.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(298-300)CAG>AAG		olfactory receptor, family 8, subfamily D,							70.0	67.0	68.0					11																	124180365		2201	4299	6500	SO:0001583	missense	283159				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:124180365G>T	AF238489	CCDS31706.1	11q25	2012-08-09			ENSG00000196341	ENSG00000196341		"""GPCR / Class A : Olfactory receptors"""	8481	protein-coding gene	gene with protein product				OR8D3			Standard	NM_001002917		Approved	OST004	uc010sag.2	Q8WZ84	OTTHUMG00000165977	ENST00000357821.2:c.298C>A	11.37:g.124180365G>T	ENSP00000350474:p.Gln100Lys		Somatic					p.Q100K	NM_001002917	NP_001002917	WXS	Illumina HiSeq	Unspecified	Q8WZ84	OR8D1_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0528)	1	298	-		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)	100			Helical; Name=3; (Potential).		B2RNL4|Q6IEW1|Q8NGH0	Missense_Mutation	SNP	ENST00000357821.2	37	c.298C>A	CCDS31706.1	.	.	.	.	.	.	.	.	.	.	g	16.44	3.123329	0.56613	.	.	ENSG00000196341	ENST00000357821	T	0.00462	7.26	4.29	4.29	0.51040	GPCR, rhodopsin-like superfamily (1);	0.000000	0.35207	U	0.003375	T	0.03348	0.0097	H	0.98577	4.27	0.46499	D	0.999078	D	0.89917	1.0	D	0.91635	0.999	T	0.06534	-1.0821	10	0.87932	D	0	.	16.5818	0.84717	0.0:0.0:1.0:0.0	.	100	Q8WZ84	OR8D1_HUMAN	K	100	ENSP00000350474:Q100K	ENSP00000350474:Q100K	Q	-	1	0	OR8D1	123685575	1.000000	0.71417	0.957000	0.39632	0.064000	0.16182	6.603000	0.74145	2.236000	0.73375	0.508000	0.49915	CAG		0.453	OR8D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387285.1	NM_001002917		3	27	1	0	2.56e-06	0.009096	3.33041e-06	3	27				
PRDM10	56980	broad.mit.edu	37	11	129801996	129801996	+	Splice_Site	SNP	C	C	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr11:129801996C>A	ENST00000360871.3	-	10	1519		c.e10+1		PRDM10_ENST00000526082.1_Splice_Site|PRDM10_ENST00000358825.5_Splice_Site|PRDM10_ENST00000423662.2_Splice_Site|PRDM10_ENST00000304538.6_Splice_Site|PRDM10_ENST00000528746.1_Splice_Site	NM_199437.1	NP_955469.1	Q9NQV6	PRD10_HUMAN	PR domain containing 10						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)	p.?(1)		breast(2)|endometrium(6)|kidney(3)|large_intestine(14)|lung(15)|pancreas(2)|skin(1)|stomach(3)|urinary_tract(2)	48	all_hematologic(175;0.0537)	Breast(109;0.000496)|Lung NSC(97;0.000693)|all_lung(97;0.00151)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0174)|Lung(977;0.176)|LUSC - Lung squamous cell carcinoma(976;0.185)		TCCCCCCGTACCTGTGTCCCA	0.562																																							uc001qfm.2		NA																	1	Unknown(1)		lung(1)	pancreas(1)	1						c.e10+1		PR domain containing 10 isoform 1							144.0	113.0	124.0					11																	129801996		2201	4297	6498	SO:0001630	splice_region_variant	56980				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr11:129801996C>A	AF275817	CCDS8484.1, CCDS8485.1, CCDS44771.1, CCDS44772.1	11q24.3	2013-01-08			ENSG00000170325	ENSG00000170325		"""Zinc fingers, C2H2-type"""	13995	protein-coding gene	gene with protein product	"""PRDM zinc finger transcription factor"", ""PR-domain family member 7"", ""tristanin"""					12175877	Standard	NM_020228		Approved	KIAA1231, PFM7, MGC131802	uc001qfm.3	Q9NQV6	OTTHUMG00000165762	ENST00000360871.3:c.1287+1G>T	11.37:g.129801996C>A			Somatic				PRDM10_uc001qfj.2_Splice_Site_p.Q343_splice|PRDM10_uc001qfk.2_Splice_Site_p.Q343_splice|PRDM10_uc001qfl.2_Splice_Site_p.Q343_splice|PRDM10_uc010sbx.1_Splice_Site_p.Q343_splice|PRDM10_uc001qfn.2_Splice_Site_p.Q429_splice|PRDM10_uc009zct.1_Splice_Site_p.Q461_splice	p.Q429_splice	NM_020228	NP_064613	WXS	Illumina HiSeq	Unspecified	Q9NQV6	PRD10_HUMAN		OV - Ovarian serous cystadenocarcinoma(99;0.0174)|Lung(977;0.176)|LUSC - Lung squamous cell carcinoma(976;0.185)	10	1519	-	all_hematologic(175;0.0537)	Breast(109;0.000496)|Lung NSC(97;0.000693)|all_lung(97;0.00151)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)						B7ZL71|G3XAE5|J3KP23|Q17R90|Q2KHR4|Q863Z2|Q9NXI4|Q9ULI9	Splice_Site	SNP	ENST00000360871.3	37	c.1287_splice	CCDS8484.1	.	.	.	.	.	.	.	.	.	.	c	22.5	4.304298	0.81136	.	.	ENSG00000170325	ENST00000358825;ENST00000304538;ENST00000360871;ENST00000423662;ENST00000528746;ENST00000526082;ENST00000533431	.	.	.	5.17	5.17	0.71159	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.6205	0.91319	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PRDM10	129307206	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	6.478000	0.73596	2.577000	0.86979	0.586000	0.80456	.		0.562	PRDM10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386076.1	NM_199437	Intron	17	100	1	0	1.33834e-09	0.007413	1.99788e-09	17	100				
ERC1	23085	broad.mit.edu	37	12	1299084	1299084	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr12:1299084C>A	ENST00000397203.2	+	12	2623	c.2217C>A	c.(2215-2217)caC>caA	p.H739Q	ERC1_ENST00000543086.3_Missense_Mutation_p.H711Q|ERC1_ENST00000546231.2_Missense_Mutation_p.H739Q|ERC1_ENST00000589028.1_Missense_Mutation_p.H739Q|ERC1_ENST00000536573.2_3'UTR|ERC1_ENST00000360905.4_Missense_Mutation_p.H739Q|ERC1_ENST00000355446.5_Missense_Mutation_p.H739Q			Q8IUD2	RB6I2_HUMAN	ELKS/RAB6-interacting/CAST family member 1	739					I-kappaB phosphorylation (GO:0007252)|multicellular organismal development (GO:0007275)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein transport (GO:0015031)|regulation of transcription, DNA-templated (GO:0006355)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|IkappaB kinase complex (GO:0008385)|presynaptic membrane (GO:0042734)	leucine zipper domain binding (GO:0043522)	p.H739Q(1)		NS(1)|breast(2)|cervix(2)|endometrium(2)|large_intestine(8)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	38	all_epithelial(11;0.0698)|Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00239)|BRCA - Breast invasive adenocarcinoma(9;0.0567)			GAATACAGCACTTGGAGAGAG	0.458																																							uc001qjb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|lung(2)|breast(1)	5						c.(2215-2217)CAC>CAA		RAB6-interacting protein 2 isoform epsilon							113.0	103.0	106.0					12																	1299084		2203	4300	6503	SO:0001583	missense	23085				I-kappaB phosphorylation|multicellular organismal development|positive regulation of anti-apoptosis|positive regulation of NF-kappaB transcription factor activity|protein transport	Golgi membrane|IkappaB kinase complex|presynaptic membrane	leucine zipper domain binding	g.chr12:1299084C>A	AB015617	CCDS8508.1, CCDS53732.1	12p13.3	2008-02-05	2006-08-14	2006-08-14	ENSG00000082805	ENSG00000082805			17072	protein-coding gene	gene with protein product		607127	"""RAB6 interacting protein 2"""	RAB6IP2		10697956, 11929610	Standard	NM_178040		Approved	ELKS, KIAA1081, CAST2, MGC12974	uc001qjb.2	Q8IUD2	OTTHUMG00000130138	ENST00000397203.2:c.2217C>A	12.37:g.1299084C>A	ENSP00000380386:p.His739Gln		Somatic				ERC1_uc001qiz.2_RNA|ERC1_uc001qjc.2_Missense_Mutation_p.H711Q|ERC1_uc001qja.2_RNA|ERC1_uc001qjd.2_RNA|ERC1_uc001qjf.2_Missense_Mutation_p.H739Q|ERC1_uc010sdv.1_Missense_Mutation_p.H487Q|ERC1_uc009zdp.2_Missense_Mutation_p.H379Q|ERC1_uc001qje.2_RNA	p.H739Q	NM_178040	NP_829884	WXS	Illumina HiSeq	Unspecified	Q8IUD2	RB6I2_HUMAN	OV - Ovarian serous cystadenocarcinoma(31;0.00239)|BRCA - Breast invasive adenocarcinoma(9;0.0567)		12	2458	+	all_epithelial(11;0.0698)|Ovarian(42;0.107)		739			Potential.		A2RU77|A7E295|D3DUP7|D3DUP8|Q6NVK2|Q8IUD3|Q8IUD4|Q8IUD5|Q8NAS1|Q9NXN5|Q9UIK7|Q9UPS1	Missense_Mutation	SNP	ENST00000397203.2	37	c.2217C>A	CCDS8508.1	.	.	.	.	.	.	.	.	.	.	C	8.648	0.897644	0.17686	.	.	ENSG00000082805	ENST00000347735;ENST00000397203;ENST00000454194;ENST00000537890;ENST00000299183;ENST00000543086;ENST00000542302;ENST00000545948;ENST00000546231;ENST00000355446;ENST00000360905;ENST00000440394;ENST00000538971;ENST00000536573	T;T;T;T;T;T;T;T	0.38887	1.11;1.11;1.11;1.11;1.11;1.11;1.11;1.11	5.88	-9.02	0.00741	.	0.360115	0.32459	N	0.006077	T	0.10680	0.0261	N	0.00413	-1.525	0.09310	N	1	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.04013	0.001;0.0;0.0;0.0;0.0	T	0.21895	-1.0232	10	0.20519	T	0.43	-12.1462	19.0006	0.92832	0.119:0.1032:0.7778:0.0	.	487;379;711;711;739	F5H327;F5GZU8;Q8IUD2-2;Q8IUD2-3;Q8IUD2	.;.;.;.;RB6I2_HUMAN	Q	711;739;711;711;439;711;711;439;739;739;739;711;487;379	ENSP00000340054:H711Q;ENSP00000380386:H739Q;ENSP00000438546:H711Q;ENSP00000442976:H439Q;ENSP00000442739:H739Q;ENSP00000347621:H739Q;ENSP00000354158:H739Q;ENSP00000410064:H711Q	ENSP00000299183:H439Q	H	+	3	2	ERC1	1169345	0.170000	0.23016	0.037000	0.18230	0.712000	0.41017	-0.353000	0.07691	-1.820000	0.01215	-0.262000	0.10625	CAC		0.458	ERC1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398380.2	NM_015064		12	62	1	0	2.61681e-11	0.00245	4.17684e-11	12	62				
ANO2	57101	broad.mit.edu	37	12	5687595	5687595	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr12:5687595G>T	ENST00000356134.5	-	23	2397	c.2326C>A	c.(2326-2328)Ctc>Atc	p.L776I	ANO2_ENST00000546188.1_Missense_Mutation_p.L776I|ANO2_ENST00000327087.8_Missense_Mutation_p.L775I	NM_001278596.1	NP_001265525.1	Q9NQ90	ANO2_HUMAN	anoctamin 2, calcium activated chloride channel	780					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	chloride channel complex (GO:0034707)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)	p.L775I(1)|p.L776I(1)		central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(3)|upper_aerodigestive_tract(1)	58						TTTGCATCGAGCCGCACTTCA	0.547																																							uc001qnm.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|large_intestine(2)|central_nervous_system(1)	7						c.(2323-2325)CTC>ATC		anoctamin 2							76.0	81.0	80.0					12																	5687595		2022	4172	6194	SO:0001583	missense	57101					chloride channel complex|plasma membrane	intracellular calcium activated chloride channel activity	g.chr12:5687595G>T	AJ272204	CCDS44807.1, CCDS44807.2	12p13.3	2014-04-09	2014-04-09	2008-08-28		ENSG00000047617		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	1183	protein-coding gene	gene with protein product	"""transmembrane protein 16B (eight membrane-spanning domains)"""	610109	"""chromosome 12 open reading frame 3"", ""transmembrane protein 16B"", ""anoctamin 2"""	C12orf3, TMEM16B		12739008, 15067359, 24692353	Standard	NM_001278596		Approved		uc001qnm.2	Q9NQ90		ENST00000356134.5:c.2326C>A	12.37:g.5687595G>T	ENSP00000348453:p.Leu776Ile		Somatic					p.L775I	NM_020373	NP_065106	WXS	Illumina HiSeq	Unspecified	Q9NQ90	ANO2_HUMAN			22	2395	-			780			Cytoplasmic (Potential).		C4N787|Q9H847	Missense_Mutation	SNP	ENST00000356134.5	37	c.2323C>A		.	.	.	.	.	.	.	.	.	.	G	14.13	2.443195	0.43429	.	.	ENSG00000047617	ENST00000327087;ENST00000356134;ENST00000546188;ENST00000541277	T;T;T	0.63913	-0.07;-0.07;-0.07	4.78	3.88	0.44766	.	0.000000	0.64402	D	0.000002	T	0.76969	0.4062	M	0.78916	2.43	0.54753	D	0.999985	D	0.89917	1.0	D	0.85130	0.997	T	0.77096	-0.2714	10	0.41790	T	0.15	.	11.8997	0.52675	0.0839:0.0:0.9161:0.0	.	775	Q9NQ90-3	.	I	775;776;776;780	ENSP00000314048:L775I;ENSP00000348453:L776I;ENSP00000440981:L776I	ENSP00000314048:L775I	L	-	1	0	ANO2	5557856	1.000000	0.71417	0.022000	0.16811	0.066000	0.16364	3.378000	0.52432	1.239000	0.43787	0.655000	0.94253	CTC		0.547	ANO2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000399019.4	NM_020373		5	52	1	0	1.26484e-09	0.00308	1.89498e-09	5	52				
TMTC1	83857	broad.mit.edu	37	12	29911688	29911688	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr12:29911688G>T	ENST00000539277.1	-	3	561	c.503C>A	c.(502-504)gCg>gAg	p.A168E	TMTC1_ENST00000551659.1_Missense_Mutation_p.A168E|TMTC1_ENST00000381224.2_Missense_Mutation_p.A60E|TMTC1_ENST00000256062.5_Missense_Mutation_p.A60E|TMTC1_ENST00000552618.1_Missense_Mutation_p.A168E	NM_001193451.1	NP_001180380.1	Q8IUR5	TMTC1_HUMAN	transmembrane and tetratricopeptide repeat containing 1	168						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)		p.A60E(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(17)|lung(45)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	75	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)					TAACACGTCCGCTCTGCCAAC	0.413																																							uc001rjb.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(178-180)GCG>GAG		transmembrane and tetratricopeptide repeat							105.0	78.0	87.0					12																	29911688		2203	4300	6503	SO:0001583	missense	83857					integral to membrane	binding	g.chr12:29911688G>T		CCDS8718.1, CCDS53772.1	12p11.22	2014-06-09	2006-01-06			ENSG00000133687		"""Tetratricopeptide (TTC) repeat domain containing"""	24099	protein-coding gene	gene with protein product		615855				24764305	Standard	NM_001193451		Approved	ARG99, OLF, FLJ31400, FLJ41625	uc021qwi.1	Q8IUR5	OTTHUMG00000169324	ENST00000539277.1:c.503C>A	12.37:g.29911688G>T	ENSP00000442046:p.Ala168Glu		Somatic				TMTC1_uc001rjc.1_Missense_Mutation_p.A60E	p.A60E	NM_175861	NP_787057	WXS	Illumina HiSeq	Unspecified	Q8IUR5	TMTC1_HUMAN			3	653	-	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)		168			Helical; (Potential).		D0EP37|F5H8B5|Q6PIU4|Q6ZSM5|Q96N52|Q9BXM2	Missense_Mutation	SNP	ENST00000539277.1	37	c.179C>A	CCDS53772.1	.	.	.	.	.	.	.	.	.	.	G	31	5.069233	0.93950	.	.	ENSG00000133687	ENST00000256062;ENST00000551659;ENST00000552618;ENST00000539277;ENST00000381224	T;D;D;D;T	0.95377	-0.91;-3.69;-3.69;-3.69;0.97	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	D	0.97508	0.9184	M	0.74467	2.265	0.54753	D	0.999986	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.997	D	0.97306	0.9934	9	.	.	.	-14.0566	18.1463	0.89656	0.0:0.0:1.0:0.0	.	60;168	Q8IUR5-3;Q8IUR5	.;TMTC1_HUMAN	E	60;168;168;168;60	ENSP00000256062:A60E;ENSP00000448112:A168E;ENSP00000449043:A168E;ENSP00000442046:A168E;ENSP00000370622:A60E	.	A	-	2	0	TMTC1	29802955	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.382000	0.90154	2.624000	0.88883	0.655000	0.94253	GCG		0.413	TMTC1-002	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000403509.1	NM_031920		4	17	1	0	0.000602214	0.000602	0.000679128	4	17				
KMT2D	8085	broad.mit.edu	37	12	49435239	49435239	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr12:49435239C>T	ENST00000301067.7	-	31	6313	c.6314G>A	c.(6313-6315)cGc>cAc	p.R2105H		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	2105					chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.R1835H(2)|p.R2105H(2)									CGGGGGAATGCGGAGATGTAG	0.652																																							uc001rta.3		NA								N|F|Mis							medulloblastoma|renal		4	Substitution - Missense(4)		lung(4)	kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						c.(6313-6315)CGC>CAC		myeloid/lymphoid or mixed-lineage leukemia 2							39.0	44.0	42.0					12																	49435239		1973	4148	6121	SO:0001583	missense	8085				chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding	g.chr12:49435239C>T	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.6314G>A	12.37:g.49435239C>T	ENSP00000301067:p.Arg2105His	HNSCC(34;0.089)	Somatic					p.R2105H	NM_003482	NP_003473	WXS	Illumina HiSeq	Unspecified	O14686	MLL2_HUMAN			31	6314	-			2105					O14687	Missense_Mutation	SNP	ENST00000301067.7	37	c.6314G>A	CCDS44873.1	.	.	.	.	.	.	.	.	.	.	C	10.51	1.371352	0.24771	.	.	ENSG00000167548	ENST00000301067	T	0.80033	-1.33	4.14	4.14	0.48551	.	0.000000	0.33364	N	0.004996	T	0.71796	0.3382	N	0.08118	0	0.33483	D	0.587692	D	0.71674	0.998	P	0.54270	0.747	T	0.79448	-0.1799	10	0.87932	D	0	.	9.9782	0.41797	0.0:0.9031:0.0:0.0969	.	2105	O14686	MLL2_HUMAN	H	2105	ENSP00000301067:R2105H	ENSP00000301067:R2105H	R	-	2	0	MLL2	47721506	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.316000	0.59178	2.599000	0.87857	0.561000	0.74099	CGC		0.652	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2			5	61	0	0	0	0.000602	0	5	61				
KRT7	3855	broad.mit.edu	37	12	52639362	52639362	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr12:52639362C>T	ENST00000331817.5	+	7	1334	c.1151C>T	c.(1150-1152)gCc>gTc	p.A384V	RP3-416H24.1_ENST00000546686.1_RNA|KRT7_ENST00000552322.1_3'UTR	NM_005556.3	NP_005547.3	P08729	K2C7_HUMAN	keratin 7	384	Coil 2.|Rod.				viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)	p.A384V(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|prostate(2)|stomach(1)|urinary_tract(1)	14				BRCA - Breast invasive adenocarcinoma(357;0.105)	Primaquine(DB01087)	GTGAAGCTGGCCCTGGACATC	0.637																																							uc001saa.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1150-1152)GCC>GTC		keratin 7							78.0	75.0	76.0					12																	52639362		2203	4300	6503	SO:0001583	missense	3855				cytoskeleton organization|DNA replication|interphase|interspecies interaction between organisms|regulation of translation	Golgi apparatus|keratin filament|nucleus	protein binding|structural molecule activity	g.chr12:52639362C>T		CCDS8822.1	12q13.13	2013-01-16			ENSG00000135480	ENSG00000135480		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6445	protein-coding gene	gene with protein product	"""keratin, type II cytoskeletal 7"", ""cytokeratin 7"", ""sarcolectin"", ""keratin, 55K type II cytoskeletal"""	148059				1713141, 16831889	Standard	XR_245927		Approved	K7, CK7, K2C7, SCL	uc001saa.1	P08729	OTTHUMG00000169580	ENST00000331817.5:c.1151C>T	12.37:g.52639362C>T	ENSP00000329243:p.Ala384Val		Somatic				KRT7_uc009zmf.1_Intron	p.A384V	NM_005556	NP_005547	WXS	Illumina HiSeq	Unspecified	P08729	K2C7_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.105)	7	1278	+			384			Rod.|Coil 2.		Q92676|Q9BUD8|Q9Y3R7	Missense_Mutation	SNP	ENST00000331817.5	37	c.1151C>T	CCDS8822.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.260084	0.80246	.	.	ENSG00000135480	ENST00000331817;ENST00000422319	D	0.90900	-2.75	4.4	3.5	0.40072	Filament (1);	0.210963	0.24046	N	0.042053	D	0.96380	0.8819	H	0.94345	3.525	0.80722	D	1	D	0.76494	0.999	D	0.74674	0.984	D	0.97448	1.0026	10	0.87932	D	0	.	14.8996	0.70670	0.0:0.8564:0.1436:0.0	.	384	P08729	K2C7_HUMAN	V	384;360	ENSP00000329243:A384V	ENSP00000329243:A384V	A	+	2	0	KRT7	50925629	0.994000	0.37717	1.000000	0.80357	0.552000	0.35366	3.106000	0.50322	1.190000	0.43042	0.561000	0.74099	GCC		0.637	KRT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404897.1	NM_005556		4	90	0	0	0	0.001168	0	4	90				
PPP1R1A	5502	broad.mit.edu	37	12	54975870	54975870	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr12:54975870C>A	ENST00000257905.8	-	5	463	c.293G>T	c.(292-294)gGa>gTa	p.G98V	PPP1R1A_ENST00000547431.1_Intron	NM_006741.3	NP_006732	Q13522	PPR1A_HUMAN	protein phosphatase 1, regulatory (inhibitor) subunit 1A	98					glycogen metabolic process (GO:0005977)|negative regulation of catalytic activity (GO:0043086)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	protein serine/threonine phosphatase inhibitor activity (GO:0004865)	p.G98V(2)		lung(2)	2						AGGTTCCTCTCCTTGCTGCTG	0.602																																							uc001sgg.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(292-294)GGA>GTA		protein phosphatase 1, regulatory (inhibitor)							49.0	51.0	50.0					12																	54975870		1911	4129	6040	SO:0001583	missense	5502				glycogen metabolic process|signal transduction		protein binding|protein serine/threonine phosphatase inhibitor activity	g.chr12:54975870C>A	U48707	CCDS44912.1	12q13.2	2012-04-17			ENSG00000135447	ENSG00000135447	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9286	protein-coding gene	gene with protein product		613246				8611507	Standard	NM_006741		Approved		uc001sgg.2	Q13522	OTTHUMG00000169934	ENST00000257905.8:c.293G>T	12.37:g.54975870C>A	ENSP00000257905:p.Gly98Val		Somatic					p.G98V	NM_006741	NP_006732	WXS	Illumina HiSeq	Unspecified	Q13522	PPR1A_HUMAN			5	464	-			98					Q6IB01|Q8TBJ2|Q8WWV2	Missense_Mutation	SNP	ENST00000257905.8	37	c.293G>T	CCDS44912.1	.	.	.	.	.	.	.	.	.	.	C	17.49	3.402478	0.62288	.	.	ENSG00000135447	ENST00000257905	T	0.30182	1.54	5.07	2.23	0.28157	.	0.499266	0.19507	N	0.112599	T	0.42426	0.1202	L	0.55481	1.735	0.58432	D	0.999997	D	0.63046	0.992	D	0.67548	0.952	T	0.17806	-1.0357	10	0.42905	T	0.14	.	6.3039	0.21127	0.0:0.6962:0.0:0.3038	.	98	Q13522	PPR1A_HUMAN	V	98	ENSP00000257905:G98V	ENSP00000257905:G98V	G	-	2	0	PPP1R1A	53262137	0.992000	0.36948	1.000000	0.80357	0.939000	0.58152	0.558000	0.23469	0.657000	0.30906	0.655000	0.94253	GGA		0.602	PPP1R1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406604.1	NM_006741		20	57	1	0	2.94398e-08	0.007413	4.15562e-08	20	57				
SLC39A5	283375	broad.mit.edu	37	12	56629470	56629470	+	Nonsense_Mutation	SNP	C	C	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr12:56629470C>T	ENST00000266980.4	+	6	1224	c.931C>T	c.(931-933)Cga>Tga	p.R311*	SLC39A5_ENST00000454355.2_Nonsense_Mutation_p.R311*|ANKRD52_ENST00000548241.1_5'Flank	NM_001135195.1	NP_001128667.1	Q6ZMH5	S39A5_HUMAN	solute carrier family 39 (zinc transporter), member 5	311					cellular response to zinc ion starvation (GO:0034224)|G1 to G0 transition involved in cell differentiation (GO:0070315)|neural precursor cell proliferation (GO:0061351)|transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	metal ion transmembrane transporter activity (GO:0046873)	p.R310*(1)		NS(1)|cervix(6)|endometrium(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						TTTGCGGCACCGAGGGCTCAG	0.632																																							uc010sqj.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)|skin(1)	2						c.(931-933)CGA>TGA		solute carrier family 39 (metal ion							148.0	148.0	148.0					12																	56629470		2203	4300	6503	SO:0001587	stop_gained	283375				zinc ion transport	basolateral plasma membrane|integral to membrane	metal ion transmembrane transporter activity	g.chr12:56629470C>T		CCDS8912.2	12q13.3	2013-07-17	2013-07-17		ENSG00000139540	ENSG00000139540		"""Solute carriers"""	20502	protein-coding gene	gene with protein product		608730	"""solute carrier family 39 (metal ion transporter), member 5"""				Standard	NM_173596		Approved		uc010sqj.2	Q6ZMH5	OTTHUMG00000156962	ENST00000266980.4:c.931C>T	12.37:g.56629470C>T	ENSP00000266980:p.Arg311*		Somatic				SLC39A5_uc010sqi.1_Nonsense_Mutation_p.R202*|SLC39A5_uc010sqk.1_Nonsense_Mutation_p.R311*	p.R311*	NM_173596	NP_775867	WXS	Illumina HiSeq	Unspecified	Q6ZMH5	S39A5_HUMAN			8	1188	+			311			Cytoplasmic (Potential).		B2R808|Q8N6Y3	Nonsense_Mutation	SNP	ENST00000266980.4	37	c.931C>T	CCDS8912.2	.	.	.	.	.	.	.	.	.	.	C	32	5.115131	0.94339	.	.	ENSG00000139540	ENST00000454355;ENST00000266980	.	.	.	3.7	0.491	0.16867	.	1.501380	0.04792	N	0.431796	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.14656	T	0.56	-8.019	9.4654	0.38809	0.6437:0.3563:0.0:0.0	.	.	.	.	X	311	.	ENSP00000266980:R311X	R	+	1	2	SLC39A5	54915737	0.268000	0.24133	0.289000	0.24876	0.974000	0.67602	-0.006000	0.12833	0.088000	0.17205	0.655000	0.94253	CGA		0.632	SLC39A5-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346834.1	NM_173596		28	372	0	0	0	0.00632	0	28	372				
OTOGL	283310	broad.mit.edu	37	12	80771682	80771682	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr12:80771682A>G	ENST00000547103.1	+	58	6859	c.6853A>G	c.(6853-6855)Aat>Gat	p.N2285D	OTOGL_ENST00000458043.2_Missense_Mutation_p.N2297D|OTOGL_ENST00000546620.1_Missense_Mutation_p.N316D			Q3ZCN5	OTOGL_HUMAN	otogelin-like	2285	CTCK. {ECO:0000255|PROSITE- ProRule:PRU00039}.				L-arabinose metabolic process (GO:0046373)	extracellular region (GO:0005576)	alpha-L-arabinofuranosidase activity (GO:0046556)	p.N2297D(1)|p.N662D(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(14)|prostate(1)	23						ATATAACATCAATATTGAAAG	0.358																																							uc009zsg.1		NA																	2	Substitution - Missense(2)		lung(2)		NA						c.(529-531)AAT>GAT		RecName: Full=Uncharacterized protein C12orf64;							79.0	71.0	73.0					12																	80771682		2203	4300	6503	SO:0001583	missense	0							g.chr12:80771682A>G	AK096852		12q21.31	2011-02-11	2011-02-11	2011-02-11	ENSG00000165899	ENSG00000165899			26901	protein-coding gene	gene with protein product		614925	"""chromosome 12 open reading frame 64"""	C12orf64			Standard	NM_173591		Approved	FLJ90579	uc001szd.3	Q3ZCN5	OTTHUMG00000150509	ENST00000547103.1:c.6853A>G	12.37:g.80771682A>G	ENSP00000447211:p.Asn2285Asp		Somatic				uc001szd.2_Missense_Mutation_p.N316D	p.N177D			WXS	Illumina HiSeq	Unspecified					13	1130	+								F8W0C3|Q495U8|Q8N8G5|Q8NC28	Missense_Mutation	SNP	ENST00000547103.1	37	c.529A>G		.	.	.	.	.	.	.	.	.	.	A	29.3	4.996969	0.93167	.	.	ENSG00000165899	ENST00000547103;ENST00000458043;ENST00000546620	T;T;T	0.17213	2.41;2.41;2.29	5.87	5.87	0.94306	Cystine knot, C-terminal (2);	0.000000	0.85682	D	0.000000	T	0.35128	0.0921	L	0.46614	1.455	0.38956	D	0.958443	D	0.89917	1.0	D	0.85130	0.997	T	0.05257	-1.0896	10	0.27785	T	0.31	.	16.2628	0.82557	1.0:0.0:0.0:0.0	.	662	Q3ZCN5	OTOGL_HUMAN	D	2285;2297;316	ENSP00000447211:N2285D;ENSP00000400895:N2297D;ENSP00000449094:N316D	ENSP00000400895:N2297D	N	+	1	0	OTOGL	79295813	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.957000	0.93082	2.233000	0.73108	0.482000	0.46254	AAT		0.358	OTOGL-001	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000407438.1	NM_173591		4	11	0	0	0	0.001168	0	4	11				
TMTC2	160335	broad.mit.edu	37	12	83358817	83358817	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr12:83358817A>T	ENST00000321196.3	+	5	2320	c.1613A>T	c.(1612-1614)cAg>cTg	p.Q538L	TMTC2_ENST00000548305.1_Missense_Mutation_p.Q538L|TMTC2_ENST00000549919.1_Missense_Mutation_p.Q532L	NM_152588.1	NP_689801.1	Q8N394	TMTC2_HUMAN	transmembrane and tetratricopeptide repeat containing 2	538					calcium ion homeostasis (GO:0055074)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)		p.Q538L(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(7)|lung(13)|ovary(2)|skin(1)|urinary_tract(1)	39						CTACTTCTCCAGGAGAACAGC	0.333																																							uc001szt.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1612-1614)CAG>CTG		transmembrane and tetratricopeptide repeat							84.0	89.0	88.0					12																	83358817		2203	4299	6502	SO:0001583	missense	160335					endoplasmic reticulum|integral to membrane	binding	g.chr12:83358817A>T	AK074634	CCDS9025.1	12q21.31	2014-06-09			ENSG00000179104	ENSG00000179104		"""Tetratricopeptide (TTC) repeat domain containing"""	25440	protein-coding gene	gene with protein product		615856				24764305	Standard	NM_152588		Approved	DKFZp762A217	uc001szt.3	Q8N394	OTTHUMG00000169736	ENST00000321196.3:c.1613A>T	12.37:g.83358817A>T	ENSP00000322300:p.Gln538Leu		Somatic				TMTC2_uc001szr.1_Missense_Mutation_p.Q538L|TMTC2_uc001szs.1_Missense_Mutation_p.Q538L|TMTC2_uc010suk.1_Missense_Mutation_p.Q293L	p.Q538L	NM_152588	NP_689801	WXS	Illumina HiSeq	Unspecified	Q8N394	TMTC2_HUMAN			5	2045	+			538			TPR 3.		B2RCU7|Q8N2K8	Missense_Mutation	SNP	ENST00000321196.3	37	c.1613A>T	CCDS9025.1	.	.	.	.	.	.	.	.	.	.	A	25.9	4.680484	0.88542	.	.	ENSG00000179104	ENST00000321196;ENST00000548305;ENST00000549919;ENST00000546590	T;T;T	0.54479	0.57;0.57;0.57	5.92	5.92	0.95590	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	T	0.54046	0.1834	N	0.11064	0.09	0.80722	D	1	D;B;D	0.76494	0.999;0.34;0.996	D;B;D	0.70935	0.971;0.171;0.923	T	0.58109	-0.7694	10	0.33141	T	0.24	-17.6868	16.3782	0.83418	1.0:0.0:0.0:0.0	.	538;293;538	Q8N394;F8VRQ2;F8VSH2	TMTC2_HUMAN;.;.	L	538;538;532;293	ENSP00000322300:Q538L;ENSP00000448292:Q538L;ENSP00000447609:Q532L	ENSP00000322300:Q538L	Q	+	2	0	TMTC2	81882948	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.100000	0.76989	2.277000	0.76020	0.528000	0.53228	CAG		0.333	TMTC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405663.1	NM_152588		26	57	0	0	0	0.00632	0	26	57				
ALX1	8092	broad.mit.edu	37	12	85695135	85695135	+	Missense_Mutation	SNP	G	G	T	rs531910111		TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr12:85695135G>T	ENST00000316824.3	+	4	1018	c.863G>T	c.(862-864)gGg>gTg	p.G288V		NM_006982.2	NP_008913.2	Q15699	ALX1_HUMAN	ALX homeobox 1	288					anterior/posterior pattern specification (GO:0009952)|brain development (GO:0007420)|cartilage condensation (GO:0001502)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|mesenchymal cell development (GO:0014031)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.G288V(1)		breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(16)|ovary(1)	26				GBM - Glioblastoma multiforme(134;0.134)		CTTCTTACTGGGGCAACCAAT	0.483																																							uc001tae.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(862-864)GGG>GTG		cartilage paired-class homeoprotein 1							101.0	98.0	99.0					12																	85695135		2203	4299	6502	SO:0001583	missense	8092				brain development|cartilage condensation|negative regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter		sequence-specific DNA binding transcription factor activity|transcription corepressor activity	g.chr12:85695135G>T	U31986	CCDS9028.1	12q21.31	2011-06-20	2007-07-26	2007-07-26		ENSG00000180318		"""Homeoboxes / PRD class"""	1494	protein-coding gene	gene with protein product		601527	"""cartilage paired-class homeoprotein 1"""	CART1		8756334, 7592751	Standard	NM_006982		Approved		uc001tae.4	Q15699	OTTHUMG00000169820	ENST00000316824.3:c.863G>T	12.37:g.85695135G>T	ENSP00000315417:p.Gly288Val		Somatic					p.G288V	NM_006982	NP_008913	WXS	Illumina HiSeq	Unspecified	Q15699	ALX1_HUMAN		GBM - Glioblastoma multiforme(134;0.134)	4	867	+			288					Q546C8|Q96FH4	Missense_Mutation	SNP	ENST00000316824.3	37	c.863G>T	CCDS9028.1	.	.	.	.	.	.	.	.	.	.	G	12.62	1.991286	0.35131	.	.	ENSG00000180318	ENST00000316824	D	0.93488	-3.23	5.99	5.99	0.97316	.	0.151372	0.64402	D	0.000011	D	0.94298	0.8168	L	0.38175	1.15	0.80722	D	1	D	0.71674	0.998	D	0.64410	0.925	D	0.91052	0.4879	10	0.15499	T	0.54	.	20.4777	0.99188	0.0:0.0:1.0:0.0	.	288	Q15699	ALX1_HUMAN	V	288	ENSP00000315417:G288V	ENSP00000315417:G288V	G	+	2	0	ALX1	84219266	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.815000	0.69215	2.840000	0.97914	0.655000	0.94253	GGG		0.483	ALX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406072.1	NM_006982		11	106	1	0	2.80697e-09	0.000978	4.17525e-09	11	106				
TCHP	84260	broad.mit.edu	37	12	110348913	110348913	+	Nonsense_Mutation	SNP	G	G	T	rs538057194		TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr12:110348913G>T	ENST00000312777.5	+	9	1139	c.925G>T	c.(925-927)Gag>Tag	p.E309*	TCHP_ENST00000405876.4_Nonsense_Mutation_p.E309*	NM_032300.4	NP_115676.1			trichoplein, keratin filament binding									p.E309*(1)		NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|ovary(1)|skin(2)	22						GAAGGAGGACGAGAGCCAGCG	0.667																																							uc001tpn.2		NA																	1	Substitution - Nonsense(1)		lung(1)	skin(1)	1						c.(925-927)GAG>TAG		trichoplein							14.0	16.0	15.0					12																	110348913		2196	4294	6490	SO:0001587	stop_gained	84260				apoptosis|negative regulation of cell growth	apical cortex|centrosome|keratin filament|mitochondrion|plasma membrane	protein binding	g.chr12:110348913G>T	AK092736	CCDS9137.1	12q24.11	2011-08-25	2006-01-27			ENSG00000139437			28135	protein-coding gene	gene with protein product	"""mitostatin"""	612654				15731013, 20930847	Standard	NM_032300		Approved	MGC10854, TpMs	uc001tpn.3	Q9BT92		ENST00000312777.5:c.925G>T	12.37:g.110348913G>T	ENSP00000324404:p.Glu309*		Somatic				TCHP_uc001tpo.1_RNA|TCHP_uc001tpp.2_Nonsense_Mutation_p.E309*	p.E309*	NM_001143852	NP_001137324	WXS	Illumina HiSeq	Unspecified	Q9BT92	TCHP_HUMAN			9	1078	+			309			Trichohyalin/plectin homology domain.|Glu-rich.|Interaction with keratin proteins.|Potential.			Nonsense_Mutation	SNP	ENST00000312777.5	37	c.925G>T	CCDS9137.1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.408546	0.83340	.	.	ENSG00000139437	ENST00000405876;ENST00000312777	.	.	.	5.27	5.27	0.74061	.	0.055408	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.23891	T	0.37	-22.749	16.4092	0.83701	0.0:0.0:1.0:0.0	.	.	.	.	X	309	.	ENSP00000324404:E309X	E	+	1	0	TCHP	108833296	1.000000	0.71417	0.481000	0.27354	0.012000	0.07955	9.068000	0.93961	2.466000	0.83321	0.561000	0.74099	GAG		0.667	TCHP-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403289.1	NM_032300		3	13	1	0	0.004672	0.004672	0.0050756	3	13				
P2RX7	5027	broad.mit.edu	37	12	121600296	121600296	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr12:121600296C>G	ENST00000546057.1	+	5	649	c.506C>G	c.(505-507)cCc>cGc	p.P169R	P2RX7_ENST00000535250.1_Missense_Mutation_p.P79R|P2RX7_ENST00000541446.1_5'UTR|P2RX7_ENST00000443520.3_3'UTR|P2RX7_ENST00000328963.5_Intron|P2RX7_ENST00000377162.2_Missense_Mutation_p.P169R	NM_002562.5	NP_002553	Q99572	P2RX7_HUMAN	purinergic receptor P2X, ligand-gated ion channel, 7	169					apoptotic signaling pathway (GO:0097190)|bleb assembly (GO:0032060)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|membrane depolarization (GO:0051899)|negative regulation of bone resorption (GO:0045779)|negative regulation of MAPK cascade (GO:0043409)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|pore complex assembly (GO:0046931)|positive regulation of bone mineralization (GO:0030501)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of cytolysis (GO:0045919)|positive regulation of cytoskeleton organization (GO:0051495)|positive regulation of interleukin-1 beta secretion (GO:0050718)|purinergic nucleotide receptor signaling pathway (GO:0035590)|regulation of killing of cells of other organism (GO:0051709)|regulation of sodium ion transport (GO:0002028)|response to ATP (GO:0033198)|sensory perception of pain (GO:0019233)	bleb (GO:0032059)|cytoplasm (GO:0005737)|integral component of nuclear inner membrane (GO:0005639)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|extracellular ATP-gated cation channel activity (GO:0004931)|lipopolysaccharide binding (GO:0001530)|protein homodimerization activity (GO:0042803)|purinergic nucleotide receptor activity (GO:0001614)|receptor binding (GO:0005102)	p.P169R(1)		NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(9)|skin(1)|stomach(1)	19	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					GCCTGGTGCCCCATCGAGGCA	0.592																																							uc001tzm.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(2)|lung(1)|breast(1)|skin(1)	5						c.(505-507)CCC>CGC		purinergic receptor P2X7							70.0	69.0	69.0					12																	121600296		2203	4300	6503	SO:0001583	missense	5027					integral to membrane	ATP binding|ion channel activity|receptor activity	g.chr12:121600296C>G	Y09561	CCDS9213.1	12q24	2012-01-17			ENSG00000089041	ENSG00000089041		"""Purinergic receptors"", ""Ligand-gated ion channels / Purinergic receptors, ionotropic"""	8537	protein-coding gene	gene with protein product		602566				9038151, 9826911	Standard	NM_002562		Approved	P2X7, MGC20089	uc001tzm.3	Q99572	OTTHUMG00000169153	ENST00000546057.1:c.506C>G	12.37:g.121600296C>G	ENSP00000442349:p.Pro169Arg		Somatic				P2RX7_uc001tzn.2_Missense_Mutation_p.P79R|P2RX7_uc001tzo.2_RNA|P2RX7_uc001tzp.2_5'UTR|P2RX7_uc001tzq.2_Intron	p.P169R	NM_002562	NP_002553	WXS	Illumina HiSeq	Unspecified	Q99572	P2RX7_HUMAN			5	602	+	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)		169					A8K2Z0|E7EMK6|F5H6P2|F5H7E8|F8W951|O14991|Q4VKH8|Q4VKH9|Q4VKI0|Q4VKI1|Q4VKI2|Q4VKI3|Q4VKI4|Q7Z771|Q96EV7	Missense_Mutation	SNP	ENST00000546057.1	37	c.506C>G	CCDS9213.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.411719	0.83340	.	.	ENSG00000089041	ENST00000546057;ENST00000377162;ENST00000535250	T;T;T	0.19938	2.11;2.11;2.11	5.58	5.58	0.84498	.	0.172687	0.41823	D	0.000817	T	0.60676	0.2287	H	0.95470	3.675	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.73046	-0.4106	10	0.87932	D	0	.	17.0516	0.86520	0.0:1.0:0.0:0.0	.	79;169	F5H7E8;Q99572	.;P2RX7_HUMAN	R	169;169;79	ENSP00000442349:P169R;ENSP00000366367:P169R;ENSP00000442572:P79R	ENSP00000366367:P169R	P	+	2	0	P2RX7	120084679	1.000000	0.71417	0.930000	0.37139	0.946000	0.59487	6.260000	0.72502	2.625000	0.88918	0.655000	0.94253	CCC		0.592	P2RX7-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402532.1	NM_002562		4	60	0	0	0	0.000602	0	4	60				
TMEM132B	114795	broad.mit.edu	37	12	126137173	126137173	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr12:126137173C>A	ENST00000299308.3	+	8	2094	c.2086C>A	c.(2086-2088)Cag>Aag	p.Q696K	TMEM132B_ENST00000535886.1_Missense_Mutation_p.Q208K	NM_052907.2	NP_443139.2	Q14DG7	T132B_HUMAN	transmembrane protein 132B	696						integral component of membrane (GO:0016021)		p.Q696K(1)		NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(11)|liver(1)|lung(45)|ovary(5)|pancreas(1)|prostate(4)|skin(15)|upper_aerodigestive_tract(3)|urinary_tract(1)	107	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)		TCAGTCCCCACAGCAGGTGAG	0.607																																							uc001uhe.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(11)|ovary(5)|large_intestine(1)|pancreas(1)|breast(1)	19						c.(2086-2088)CAG>AAG		transmembrane protein 132B							54.0	54.0	54.0					12																	126137173		2111	4236	6347	SO:0001583	missense	114795					integral to membrane		g.chr12:126137173C>A	AB067493	CCDS41859.1, CCDS66501.1	12q24.31	2006-03-02							29397	protein-coding gene	gene with protein product						11572484	Standard	NM_001286219		Approved	KIAA1906, KIAA1786	uc001uhe.1	Q14DG7		ENST00000299308.3:c.2086C>A	12.37:g.126137173C>A	ENSP00000299308:p.Gln696Lys		Somatic				TMEM132B_uc001uhf.1_Missense_Mutation_p.Q208K	p.Q696K	NM_052907	NP_443139	WXS	Illumina HiSeq	Unspecified	Q14DG7	T132B_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)	8	2094	+	all_neural(191;0.101)|Medulloblastoma(191;0.163)		696			Extracellular (Potential).		A2RRG8|Q8NA73|Q96JN9|Q96PY1	Missense_Mutation	SNP	ENST00000299308.3	37	c.2086C>A	CCDS41859.1	.	.	.	.	.	.	.	.	.	.	C	5.458	0.269552	0.10349	.	.	ENSG00000139364	ENST00000299308;ENST00000535886	T;T	0.06142	3.34;3.34	5.53	4.63	0.57726	.	0.195954	0.36303	N	0.002677	T	0.02156	0.0067	N	0.01257	-0.925	0.36857	D	0.888182	B	0.10296	0.003	B	0.10450	0.005	T	0.33803	-0.9854	10	0.02654	T	1	.	12.7506	0.57306	0.4517:0.5483:0.0:0.0	.	696	Q14DG7	T132B_HUMAN	K	696;208	ENSP00000299308:Q696K;ENSP00000440436:Q208K	ENSP00000299308:Q696K	Q	+	1	0	TMEM132B	124703126	1.000000	0.71417	0.963000	0.40424	0.865000	0.49528	6.469000	0.73555	1.289000	0.44618	0.655000	0.94253	CAG		0.607	TMEM132B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400043.1	NM_052907		6	84	1	0	0.00198382	0.001984	0.00218378	6	84				
RIMBP2	23504	broad.mit.edu	37	12	130912844	130912844	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr12:130912844G>T	ENST00000261655.4	-	12	2404	c.2241C>A	c.(2239-2241)agC>agA	p.S747R		NM_015347.4	NP_056162.4	O15034	RIMB2_HUMAN	RIMS binding protein 2	747					negative regulation of phosphatase activity (GO:0010923)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|synapse (GO:0045202)		p.S747R(1)		NS(2)|breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(33)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	96	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		ACCCCCGGCTGCTCTCTGTGT	0.617																																							uc001uil.2		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(3)|ovary(3)|large_intestine(2)|central_nervous_system(2)|pancreas(1)	11						c.(2239-2241)AGC>AGA		RIM-binding protein 2							78.0	68.0	71.0					12																	130912844		2203	4300	6503	SO:0001583	missense	23504					cell junction|synapse		g.chr12:130912844G>T	AB002316	CCDS31925.1	12q24.33	2014-06-13				ENSG00000060709			30339	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 133"""	611602				10748113	Standard	NM_015347		Approved	KIAA0318, RBP2, MGC15831, RIM-BP2, PPP1R133	uc001uil.2	O15034		ENST00000261655.4:c.2241C>A	12.37:g.130912844G>T	ENSP00000261655:p.Ser747Arg		Somatic					p.S747R	NM_015347	NP_056162	WXS	Illumina HiSeq	Unspecified	O15034	RIMB2_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)	12	2405	-	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)	747					Q96ID2	Missense_Mutation	SNP	ENST00000261655.4	37	c.2241C>A	CCDS31925.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.167955	0.78339	.	.	ENSG00000060709	ENST00000261655	T	0.21191	2.02	4.96	3.12	0.35913	.	0.000000	0.85682	D	0.000000	T	0.37517	0.1006	M	0.66939	2.045	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.32079	-0.9920	10	0.08381	T	0.77	-35.9741	11.5618	0.50780	0.1469:0.0:0.8531:0.0	.	747	O15034	RIMB2_HUMAN	R	747	ENSP00000261655:S747R	ENSP00000261655:S747R	S	-	3	2	RIMBP2	129478797	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	4.176000	0.58269	0.499000	0.27970	0.561000	0.74099	AGC		0.617	RIMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399520.1	NM_015347		14	96	1	0	3.41278e-10	0.00499	5.22622e-10	14	96				
FLT3	2322	broad.mit.edu	37	13	28589815	28589815	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr13:28589815C>A	ENST00000241453.7	-	21	2646	c.2565G>T	c.(2563-2565)atG>atT	p.M855I	FLT3_ENST00000537084.1_Missense_Mutation_p.M814I|FLT3_ENST00000380982.4_Missense_Mutation_p.M858I|FLT3_ENST00000469894.1_5'Flank	NM_004119.2	NP_004110.2	P36888	FLT3_HUMAN	fms-related tyrosine kinase 3	855	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				B cell differentiation (GO:0030183)|cellular response to cytokine stimulus (GO:0071345)|common myeloid progenitor cell proliferation (GO:0035726)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell differentiation (GO:0097028)|hemopoiesis (GO:0030097)|leukocyte homeostasis (GO:0001776)|lymphocyte proliferation (GO:0046651)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)|pro-B cell differentiation (GO:0002328)|pro-T cell differentiation (GO:0002572)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor signaling pathway (GO:0038084)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|cytokine receptor activity (GO:0004896)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)	p.M855I(1)		NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(12329)|kidney(2)|large_intestine(8)|lung(30)|ovary(4)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	12390	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0156)|Ovarian(182;0.0392)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.00154)|all cancers(112;0.00459)|GBM - Glioblastoma multiforme(144;0.00562)|Epithelial(112;0.0959)|Lung(94;0.212)	Ponatinib(DB08901)|Sorafenib(DB00398)|Sunitinib(DB01268)	TTTCGGGGGCCATCCATTTTA	0.428			"""Mis, O"""		"""AML, ALL"""																																		uc001urw.2		NA		Dom	yes		13	13q12	2322	Mis|O	fms-related tyrosine kinase 3			L			AML|ALL		1	Substitution - Missense(1)		lung(1)	haematopoietic_and_lymphoid_tissue(8536)|lung(7)|ovary(3)|stomach(1)|central_nervous_system(1)|skin(1)	8549						c.(2563-2565)ATG>ATT		fms-related tyrosine kinase 3 precursor	Sorafenib(DB00398)|Sunitinib(DB01268)						74.0	76.0	76.0					13																	28589815		2203	4300	6503	SO:0001583	missense	2322				positive regulation of cell proliferation	integral to plasma membrane	ATP binding|vascular endothelial growth factor receptor activity	g.chr13:28589815C>A	U02687	CCDS31953.1	13q12	2014-09-17			ENSG00000122025	ENSG00000122025	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3765	protein-coding gene	gene with protein product		136351				8394751	Standard	NM_004119		Approved	STK1, FLK2, CD135	uc001urw.3	P36888	OTTHUMG00000016646	ENST00000241453.7:c.2565G>T	13.37:g.28589815C>A	ENSP00000241453:p.Met855Ile		Somatic				FLT3_uc010aao.2_RNA|FLT3_uc010tdn.1_Missense_Mutation_p.M814I	p.M855I	NM_004119	NP_004110	WXS	Illumina HiSeq	Unspecified	P36888	FLT3_HUMAN	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.00154)|all cancers(112;0.00459)|GBM - Glioblastoma multiforme(144;0.00562)|Epithelial(112;0.0959)|Lung(94;0.212)	21	2647	-	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0156)|Ovarian(182;0.0392)	855			Protein kinase.|Cytoplasmic (Potential).		A0AVG9|B7ZLT7|B7ZLT8|F5H0A0|Q13414	Missense_Mutation	SNP	ENST00000241453.7	37	c.2565G>T	CCDS31953.1	.	.	.	.	.	.	.	.	.	.	C	28.7	4.939678	0.92526	.	.	ENSG00000122025	ENST00000241453;ENST00000380982;ENST00000537084	D;D;D	0.90197	-2.63;-2.63;-2.63	5.73	5.73	0.89815	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.94673	0.8282	L	0.58810	1.83	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.91635	0.98;0.999	D	0.94521	0.7727	10	0.87932	D	0	.	19.8736	0.96861	0.0:1.0:0.0:0.0	.	814;855	P36888-2;P36888	.;FLT3_HUMAN	I	855;858;814	ENSP00000241453:M855I;ENSP00000370369:M858I;ENSP00000438139:M814I	ENSP00000241453:M855I	M	-	3	0	FLT3	27487815	1.000000	0.71417	1.000000	0.80357	0.819000	0.46315	7.511000	0.81718	2.868000	0.98415	0.557000	0.71058	ATG		0.428	FLT3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000044319.2			16	85	1	0	4.35082e-09	0.010504	6.42558e-09	16	85				
POTEG	404785	broad.mit.edu	37	14	19553724	19553724	+	Missense_Mutation	SNP	G	G	T	rs373172594		TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr14:19553724G>T	ENST00000409832.3	+	1	360	c.308G>T	c.(307-309)tGc>tTc	p.C103F		NM_001005356.2	NP_001005356.1	Q6S5H5	POTEG_HUMAN	POTE ankyrin domain family, member G	103								p.C103F(1)		cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(31)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	47						AAGTGGTGCTGCCACTGCTTC	0.617																																							uc001vuz.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(307-309)TGC>TTC		POTE ankyrin domain family, member G							114.0	129.0	124.0					14																	19553724		2175	4228	6403	SO:0001583	missense	404785							g.chr14:19553724G>T		CCDS73610.1	14q11.2	2013-01-10	2008-11-26	2008-11-26	ENSG00000222036	ENSG00000222036		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33896	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 4"""	608916	"""ANKRD26-like family C, member 2"""	A26C2			Standard	NR_027480		Approved	POTE14, POTE-14, POTE14alpha, CT104.4	uc001vuz.1	Q6S5H5	OTTHUMG00000170340	ENST00000409832.3:c.308G>T	14.37:g.19553724G>T	ENSP00000386971:p.Cys103Phe		Somatic				POTEG_uc001vva.1_RNA|POTEG_uc010ahc.1_RNA	p.C103F	NM_001005356	NP_001005356	WXS	Illumina HiSeq	Unspecified	Q6S5H5	POTEG_HUMAN			1	360	+			103					A1L153|A6NMI9|Q6S5H6|Q6S8J2	Missense_Mutation	SNP	ENST00000409832.3	37	c.308G>T	CCDS32018.1	.	.	.	.	.	.	.	.	.	.	g	0.353	-0.943976	0.02322	.	.	ENSG00000222036	ENST00000409832	T	0.28666	1.6	0.535	-1.07	0.09968	.	.	.	.	.	T	0.22475	0.0542	L	0.46157	1.445	0.09310	N	1	P	0.35821	0.523	B	0.37387	0.248	T	0.15235	-1.0444	8	0.44086	T	0.13	.	.	.	.	.	103	Q6S5H5	POTEG_HUMAN	F	103	ENSP00000386971:C103F	ENSP00000386971:C103F	C	+	2	0	POTEG	18623724	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.484000	0.02316	-1.309000	0.02315	-0.814000	0.03130	TGC		0.617	POTEG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408579.1	NM_001005356		37	435	1	0	2.29192e-23	0.00361	4.34313e-23	37	435				
IL25	64806	broad.mit.edu	37	14	23842381	23842381	+	Silent	SNP	A	A	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr14:23842381A>T	ENST00000329715.2	+	1	312	c.54A>T	c.(52-54)ctA>ctT	p.L18L	IL25_ENST00000397242.2_Intron	NM_022789.3	NP_073626.1	Q9H293	IL25_HUMAN	interleukin 25	18					eosinophil differentiation (GO:0030222)|inflammatory response to antigenic stimulus (GO:0002437)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to fungus (GO:0009620)|response to nematode (GO:0009624)	extracellular space (GO:0005615)	interleukin-17E receptor binding (GO:0030380)	p.L18L(1)		NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)	9	all_cancers(95;2e-05)			GBM - Glioblastoma multiforme(265;0.00665)|READ - Rectum adenocarcinoma(4;0.0276)|Colorectal(4;0.0396)		GCCTTTTCCTACAGGTGGTTG	0.587																																							uc001wjr.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(52-54)CTA>CTT		interleukin 25 isoform 1 precursor							193.0	151.0	165.0					14																	23842381		2203	4300	6503	SO:0001819	synonymous_variant	64806				inflammatory response	extracellular space|membrane	cytokine activity|interleukin-17E receptor binding	g.chr14:23842381A>T	AF305200	CCDS9597.1, CCDS45086.1	14q11.2	2008-01-07	2006-05-17	2006-05-17	ENSG00000166090	ENSG00000166090		"""Interleukins and interleukin receptors"""	13765	protein-coding gene	gene with protein product		605658	"""interleukin 17E"""	IL17E		11058597, 11754819	Standard	NM_172314		Approved	IL-25, IL-17E	uc001wjq.3	Q9H293	OTTHUMG00000028749	ENST00000329715.2:c.54A>T	14.37:g.23842381A>T			Somatic				IL25_uc001wjq.2_Intron	p.L18L	NM_022789	NP_073626	WXS	Illumina HiSeq	Unspecified	Q9H293	IL25_HUMAN		GBM - Glioblastoma multiforme(265;0.00665)|READ - Rectum adenocarcinoma(4;0.0276)|Colorectal(4;0.0396)	1	364	+	all_cancers(95;2e-05)		18					Q2M3F0|Q8IZV3|Q8WXB0	Silent	SNP	ENST00000329715.2	37	c.54A>T	CCDS9597.1																																																																																				0.587	IL25-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000071789.2			34	107	0	0	0	0.003271	0	34	107				
ARHGAP5	394	broad.mit.edu	37	14	32563233	32563233	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr14:32563233A>G	ENST00000345122.3	+	2	3673	c.3358A>G	c.(3358-3360)Aaa>Gaa	p.K1120E	ARHGAP5_ENST00000433497.1_Intron|ARHGAP5_ENST00000396582.2_Intron|ARHGAP5_ENST00000539826.2_Missense_Mutation_p.K1120E|ARHGAP5_ENST00000432921.1_Missense_Mutation_p.K1120E|ARHGAP5_ENST00000556611.1_Missense_Mutation_p.K1120E	NM_001030055.1	NP_001025226.1	Q13017	RHG05_HUMAN	Rho GTPase activating protein 5	1120					cell adhesion (GO:0007155)|GTP catabolic process (GO:0006184)|mammary gland development (GO:0030879)|positive regulation of cell migration (GO:0030335)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell size (GO:0008361)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)	p.K1120E(1)		NS(2)|breast(10)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(12)|ovary(4)|skin(1)|stomach(1)|urinary_tract(4)	55	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.186)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0952)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00566)		AAATCGTATTAAAATTCGAAA	0.363																																					NSCLC(9;77 350 3443 29227 41353)	NSCLC(9;77 350 3443 29227 41353)	uc001wrl.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|central_nervous_system(1)	5						c.(3358-3360)AAA>GAA		Rho GTPase activating protein 5 isoform b							50.0	53.0	52.0					14																	32563233		2203	4299	6502	SO:0001583	missense	394				cell adhesion|Rho protein signal transduction	cytosol|membrane	GTP binding|GTPase activity|Rho GTPase activator activity|SH2 domain binding	g.chr14:32563233A>G	U17032	CCDS32062.1, CCDS45095.1	14q12	2010-02-05						"""Rho GTPase activating proteins"""	675	protein-coding gene	gene with protein product		602680	"""growth factor independent 2"""	GFI2		8537347	Standard	XM_005267635		Approved	RhoGAP5, p190-B, p190BRhoGAP	uc001wrn.3	Q13017		ENST00000345122.3:c.3358A>G	14.37:g.32563233A>G	ENSP00000371897:p.Lys1120Glu		Somatic				ARHGAP5_uc001wrm.2_Missense_Mutation_p.K1120E|ARHGAP5_uc001wrn.2_Missense_Mutation_p.K1120E|ARHGAP5_uc001wro.2_Intron|ARHGAP5_uc001wrp.2_Intron	p.K1120E	NM_001173	NP_001025226	WXS	Illumina HiSeq	Unspecified	Q13017	RHG05_HUMAN	LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0952)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00566)	2	3597	+	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.186)		1120					A1L375|A1L376|A8KAA1|D3DS89|D3DS90|Q05BE8|Q05BU8|Q59ER0|Q6DHZ3	Missense_Mutation	SNP	ENST00000345122.3	37	c.3358A>G	CCDS32062.1	.	.	.	.	.	.	.	.	.	.	A	13.74	2.327589	0.41197	.	.	ENSG00000100852	ENST00000556611;ENST00000539826;ENST00000345122;ENST00000432921	T;T;T;T	0.09630	2.96;2.96;2.96;2.96	5.27	5.27	0.74061	.	0.042536	0.85682	D	0.000000	T	0.11324	0.0276	L	0.44542	1.39	0.58432	D	0.999994	P;P	0.40970	0.734;0.615	B;B	0.38755	0.281;0.146	T	0.18241	-1.0343	10	0.21014	T	0.42	.	15.4744	0.75465	1.0:0.0:0.0:0.0	.	1120;1120	Q13017-2;Q13017	.;RHG05_HUMAN	E	1120	ENSP00000452222:K1120E;ENSP00000441692:K1120E;ENSP00000371897:K1120E;ENSP00000393307:K1120E	ENSP00000371897:K1120E	K	+	1	0	ARHGAP5	31632984	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	9.108000	0.94275	2.123000	0.65237	0.383000	0.25322	AAA		0.363	ARHGAP5-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000409735.1	NM_001030055		3	84	0	0	0	0.004672	0	3	84				
SYT16	83851	broad.mit.edu	37	14	62462844	62462844	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr14:62462844C>A	ENST00000430451.2	+	1	304	c.107C>A	c.(106-108)tCt>tAt	p.S36Y	SYT16_ENST00000446982.2_Missense_Mutation_p.S36Y	NM_031914.2	NP_114120.2	Q17RD7	SYT16_HUMAN	synaptotagmin XVI	36					exocytosis (GO:0006887)			p.S36Y(2)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(12)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	35				OV - Ovarian serous cystadenocarcinoma(108;0.0438)|BRCA - Breast invasive adenocarcinoma(234;0.118)		GATATGTTATCTGCTTCGCTG	0.413																																							uc001xfu.1		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(1)	1						c.(106-108)TCT>TAT		synaptotagmin XIV-like							112.0	107.0	108.0					14																	62462844		1870	4113	5983	SO:0001583	missense	83851							g.chr14:62462844C>A	BC040924	CCDS45121.1	14q23.2	2014-07-02	2005-07-15	2005-07-15	ENSG00000139973	ENSG00000139973		"""Synaptotagmins"""	23142	protein-coding gene	gene with protein product	"""synaptotagmin XIV-related"", "" chr14 synaptotagmin"""	610950	"""synaptotagmin XIV-like"""	SYT14L		11543631	Standard	NM_031914		Approved	yt14r, CHR14SYT, Strep14	uc001xfu.1	Q17RD7	OTTHUMG00000171106	ENST00000430451.2:c.107C>A	14.37:g.62462844C>A	ENSP00000394700:p.Ser36Tyr		Somatic				SYT16_uc010tsd.1_Missense_Mutation_p.S36Y	p.S36Y	NM_031914	NP_114120	WXS	Illumina HiSeq	Unspecified	Q17RD7	SYT16_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.0438)|BRCA - Breast invasive adenocarcinoma(234;0.118)	1	304	+			36					B4DZH2|B7ZL60|C9J8I3|Q707N2|Q7Z441|Q8IUU0|Q9BQR8	Missense_Mutation	SNP	ENST00000430451.2	37	c.107C>A	CCDS45121.1	.	.	.	.	.	.	.	.	.	.	C	17.81	3.480432	0.63849	.	.	ENSG00000139973	ENST00000446982;ENST00000430451	T;T	0.52057	0.68;3.18	5.31	5.31	0.75309	.	0.171258	0.41001	D	0.000977	T	0.65637	0.2710	L	0.51422	1.61	0.36569	D	0.872871	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.71318	-0.4629	10	0.87932	D	0	-15.1966	19.1584	0.93520	0.0:1.0:0.0:0.0	.	36;36	B4DZH2;Q17RD7	.;SYT16_HUMAN	Y	36	ENSP00000388023:S36Y;ENSP00000394700:S36Y	ENSP00000394700:S36Y	S	+	2	0	SYT16	61532597	1.000000	0.71417	0.999000	0.59377	0.949000	0.60115	4.820000	0.62671	2.765000	0.95021	0.555000	0.69702	TCT		0.413	SYT16-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000411700.1	NM_031914		19	62	1	0	3.51602e-12	0.008871	5.72214e-12	19	62				
MOAP1	64112	broad.mit.edu	37	14	93649642	93649642	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr14:93649642C>G	ENST00000556883.1	-	2	1430	c.946G>C	c.(946-948)Gat>Cat	p.D316H	MOAP1_ENST00000298894.4_Missense_Mutation_p.D316H|TMEM251_ENST00000415050.2_5'Flank|RP11-371E8.4_ENST00000557574.1_5'Flank|TMEM251_ENST00000283534.4_5'Flank			Q96BY2	MOAP1_HUMAN	modulator of apoptosis 1	316					apoptotic signaling pathway (GO:0097190)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|positive regulation of apoptotic process (GO:0043065)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:0001844)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	ubiquitin protein ligase binding (GO:0031625)	p.D316H(1)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(4)|ovary(1)|skin(2)	13		all_cancers(154;0.00528)|Acute lymphoblastic leukemia(33;0.0497)|all_epithelial(191;0.125)|all_neural(303;0.13)		Epithelial(152;0.178)|all cancers(159;0.2)|COAD - Colon adenocarcinoma(157;0.204)		gctgggccatcctctggcaga	0.502																																							uc001ybj.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)	3						c.(946-948)GAT>CAT		modulator of apoptosis 1							94.0	94.0	94.0					14																	93649642		2203	4300	6503	SO:0001583	missense	64112				activation of caspase activity|apoptotic nuclear change	cytoplasm	protein homodimerization activity	g.chr14:93649642C>G	BC015044	CCDS9908.1	14q32.12	2012-02-09			ENSG00000165943	ENSG00000165943		"""Paraneoplastic Ma antigens"""	16658	protein-coding gene	gene with protein product	"""paraneoplastic Ma antigen family member 4"""	609485				11060313	Standard	NM_022151		Approved	MAP-1, PNMA4	uc001ybj.3	Q96BY2	OTTHUMG00000169184	ENST00000556883.1:c.946G>C	14.37:g.93649642C>G	ENSP00000451594:p.Asp316His		Somatic				C14orf109_uc001ybk.3_5'Flank|C14orf109_uc010auo.2_5'Flank	p.D316H	NM_022151	NP_071434	WXS	Illumina HiSeq	Unspecified	Q96BY2	MOAP1_HUMAN		Epithelial(152;0.178)|all cancers(159;0.2)|COAD - Colon adenocarcinoma(157;0.204)	3	1316	-		all_cancers(154;0.00528)|Acute lymphoblastic leukemia(33;0.0497)|all_epithelial(191;0.125)|all_neural(303;0.13)	316					B2RDF6|Q9H833|Q9HAS1	Missense_Mutation	SNP	ENST00000556883.1	37	c.946G>C	CCDS9908.1	.	.	.	.	.	.	.	.	.	.	C	13.44	2.237725	0.39598	.	.	ENSG00000165943	ENST00000298894;ENST00000556883	T;T	0.09817	2.94;2.94	3.45	3.45	0.39498	.	.	.	.	.	T	0.12305	0.0299	L	0.29908	0.895	0.09310	N	1	P	0.49447	0.924	P	0.47941	0.562	T	0.10730	-1.0617	9	0.72032	D	0.01	-7.1274	10.7802	0.46374	0.0:1.0:0.0:0.0	.	316	Q96BY2	MOAP1_HUMAN	H	316	ENSP00000298894:D316H;ENSP00000451594:D316H	ENSP00000298894:D316H	D	-	1	0	MOAP1	92719395	0.001000	0.12720	0.042000	0.18584	0.722000	0.41435	0.624000	0.24462	2.237000	0.73441	0.650000	0.86243	GAT		0.502	MOAP1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412685.1			56	133	0	0	0	0.00361	0	56	133				
ADSSL1	122622	broad.mit.edu	37	14	105201358	105201358	+	Splice_Site	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr14:105201358G>T	ENST00000330877.2	+	2	279	c.194G>T	c.(193-195)gGg>gTg	p.G65V	ADSSL1_ENST00000332972.5_Splice_Site_p.G108V	NM_152328.3	NP_689541.1			adenylosuccinate synthase like 1									p.G108V(1)		central_nervous_system(1)|cervix(1)|kidney(1)|lung(5)|ovary(2)|prostate(1)	11		all_cancers(154;0.0896)|Melanoma(154;0.155)|all_epithelial(191;0.172)	all cancers(16;0.00153)|OV - Ovarian serous cystadenocarcinoma(23;0.0148)|Epithelial(46;0.0396)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.18)		CTGTTCCAGGGGGGCAACAAC	0.617																																							uc001ypd.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(193-195)GGG>GTG		adenylosuccinate synthase like 1 isoform 2	L-Aspartic Acid(DB00128)						50.0	44.0	46.0					14																	105201358		2203	4300	6503	SO:0001630	splice_region_variant	122622				AMP biosynthetic process|immune system process|purine base metabolic process	cytosol	adenylosuccinate synthase activity|GTP binding|magnesium ion binding|phosphate binding	g.chr14:105201358G>T	AK095921	CCDS9990.1, CCDS9991.1	14q32.33	2010-08-05			ENSG00000185100	ENSG00000185100			20093	protein-coding gene	gene with protein product		612498					Standard	NM_199165		Approved	FLJ38602	uc001ype.3	Q8N142		ENST00000330877.2:c.193-1G>T	14.37:g.105201358G>T			Somatic				INF2_uc010tyi.1_Intron|ADSSL1_uc001ype.2_Missense_Mutation_p.G108V|ADSSL1_uc001ypf.2_RNA	p.G65V	NM_152328	NP_689541	WXS	Illumina HiSeq	Unspecified	Q8N142	PURA1_HUMAN	all cancers(16;0.00153)|OV - Ovarian serous cystadenocarcinoma(23;0.0148)|Epithelial(46;0.0396)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.18)	2	268	+		all_cancers(154;0.0896)|Melanoma(154;0.155)|all_epithelial(191;0.172)	65						Missense_Mutation	SNP	ENST00000330877.2	37	c.194G>T	CCDS9990.1	.	.	.	.	.	.	.	.	.	.	G	18.50	3.637898	0.67130	.	.	ENSG00000185100	ENST00000330877;ENST00000332972	T;T	0.67345	-0.26;-0.26	3.72	3.72	0.42706	.	0.000000	0.85682	D	0.000000	T	0.81442	0.4823	M	0.79614	2.46	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.85130	0.0974	10	0.87932	D	0	-13.855	15.6745	0.77303	0.0:0.0:1.0:0.0	.	108;65	Q8N142-2;Q8N142	.;PURA1_HUMAN	V	65;108	ENSP00000331260:G65V;ENSP00000333019:G108V	ENSP00000331260:G65V	G	+	2	0	ADSSL1	104272403	1.000000	0.71417	0.987000	0.45799	0.746000	0.42486	9.447000	0.97595	1.914000	0.55421	0.561000	0.74099	GGG		0.617	ADSSL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410529.1		Missense_Mutation	6	30	1	0	1.06961e-07	0.00308	1.45062e-07	6	30				
TRPM1	4308	broad.mit.edu	37	15	31360169	31360169	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr15:31360169G>T	ENST00000256552.6	-	5	553	c.406C>A	c.(406-408)Ccc>Acc	p.P136T	TRPM1_ENST00000397795.2_Missense_Mutation_p.P114T|TRPM1_ENST00000542188.1_Missense_Mutation_p.P153T|MIR211_ENST00000384969.1_RNA	NM_001252024.1	NP_001238953.1			transient receptor potential cation channel, subfamily M, member 1									p.P114T(1)		NS(2)|breast(3)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(15)|lung(48)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(3)	99		all_lung(180;1.92e-11)		all cancers(64;3.52e-16)|Epithelial(43;1.65e-11)|GBM - Glioblastoma multiforme(186;3.57e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00533)|COAD - Colon adenocarcinoma(236;0.0609)|Lung(196;0.199)		TTCAGCTTGGGCTGCATCTCA	0.547																																							uc001zfm.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|pancreas(1)|skin(1)	4						c.(340-342)CCC>ACC		transient receptor potential cation channel,							120.0	119.0	119.0					15																	31360169		1903	4130	6033	SO:0001583	missense	4308				cellular response to light stimulus|visual perception	integral to plasma membrane	calcium channel activity|receptor activity	g.chr15:31360169G>T	AF071787	CCDS10024.2, CCDS58345.1, CCDS58346.1, CCDS58347.1	15q13.3	2014-01-28		2002-01-18	ENSG00000134160	ENSG00000134160		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	7146	protein-coding gene	gene with protein product		603576	"""melastatin 1"""	MLSN1		9806836, 9537257, 16382100	Standard	NM_001252020		Approved	LTRPC1, CSNB1C	uc021sia.1	Q7Z4N2	OTTHUMG00000129267	ENST00000256552.6:c.406C>A	15.37:g.31360169G>T	ENSP00000256552:p.Pro136Thr		Somatic				TRPM1_uc010azy.2_Missense_Mutation_p.P27T|TRPM1_uc001zfl.2_RNA|uc010ubm.1_5'Flank|MIR211_hsa-mir-211|MI0000287_5'Flank|uc010ubn.1_5'Flank	p.P114T	NM_002420	NP_002411	WXS	Illumina HiSeq	Unspecified	Q7Z4N2	TRPM1_HUMAN		all cancers(64;3.52e-16)|Epithelial(43;1.65e-11)|GBM - Glioblastoma multiforme(186;3.57e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00533)|COAD - Colon adenocarcinoma(236;0.0609)|Lung(196;0.199)	4	468	-		all_lung(180;1.92e-11)	114			Extracellular (Potential).			Missense_Mutation	SNP	ENST00000256552.6	37	c.340C>A	CCDS58346.1	.	.	.	.	.	.	.	.	.	.	G	32	5.122824	0.94429	.	.	ENSG00000134160	ENST00000397795;ENST00000542188;ENST00000256552;ENST00000397793	T;T;T	0.65916	-0.18;-0.18;-0.18	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.71600	0.3359	M	0.68317	2.08	0.80722	D	1	P;P	0.41929	0.765;0.474	P;B	0.47299	0.543;0.341	T	0.73369	-0.4004	10	0.87932	D	0	-28.8108	20.3397	0.98756	0.0:0.0:1.0:0.0	.	114;114	Q7Z4N2-3;Q7Z4N2	.;TRPM1_HUMAN	T	114;153;136;114	ENSP00000380897:P114T;ENSP00000437849:P153T;ENSP00000256552:P136T	ENSP00000256552:P136T	P	-	1	0	TRPM1	29147461	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.729000	0.74775	2.803000	0.96430	0.585000	0.79938	CCC		0.547	TRPM1-004	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417166.2	NM_002420		22	214	1	0	5.26018e-13	0.001882	8.7319e-13	22	214				
NUTM1	256646	broad.mit.edu	37	15	34640216	34640216	+	Silent	SNP	C	C	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr15:34640216C>T	ENST00000333756.4	+	2	218	c.63C>T	c.(61-63)gcC>gcT	p.A21A	NUTM1_ENST00000438749.3_Silent_p.A39A|NUTM1_ENST00000537011.1_Silent_p.A49A	NM_175741.1	NP_786883	Q86Y26	NUTM1_HUMAN	NUT midline carcinoma, family member 1	21	Pro-rich.					cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.A21A(1)									CTAGTGCCGCCCCGTCTCCAT	0.532																																							uc001zif.2		NA								T					BRD3|BRD4		lethal midline carcinoma	BRD4_ENST00000263377/C15orf55(24)|BRD3/C15orf55(3)	1	Substitution - coding silent(1)		lung(1)	midline_organs(25)|ovary(2)|lung(2)|skin(1)	30						c.(61-63)GCC>GCT		nuclear protein in testis							122.0	110.0	114.0					15																	34640216		2201	4298	6499	SO:0001819	synonymous_variant	256646					cytoplasm|nucleus		g.chr15:34640216C>T	AF482429	CCDS32190.1, CCDS61584.1, CCDS61585.1	15q14	2014-01-28	2013-03-14	2013-03-14	ENSG00000184507	ENSG00000184507			29919	protein-coding gene	gene with protein product	"""nuclear protein in testis"""	608963	"""chromosome 15 open reading frame 55"""	C15orf55		12543779	Standard	NM_175741		Approved	NUT, DKFZp434O192, FAM22H	uc001zif.3	Q86Y26	OTTHUMG00000172348	ENST00000333756.4:c.63C>T	15.37:g.34640216C>T			Somatic				C15orf55_uc010ucc.1_Silent_p.A49A|C15orf55_uc010ucd.1_Silent_p.A39A	p.A21A	NM_175741	NP_786883	WXS	Illumina HiSeq	Unspecified	Q86Y26	NUT_HUMAN		all cancers(64;4.53e-18)|GBM - Glioblastoma multiforme(113;8.29e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0249)	2	218	+		all_lung(180;2.78e-08)	21			Pro-rich.		B4DZ00|B7Z7Y4|E7EVE8|F5H4I6|Q86YS8|Q8N7F2|Q9NTB3	Silent	SNP	ENST00000333756.4	37	c.63C>T	CCDS32190.1																																																																																				0.532	NUTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418026.1	NM_175741		11	90	0	0	0	0.001368	0	11	90				
CASC5	57082	broad.mit.edu	37	15	40912855	40912855	+	Silent	SNP	T	T	C			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr15:40912855T>C	ENST00000346991.5	+	11	861	c.471T>C	c.(469-471)caT>caC	p.H157H	CASC5_ENST00000399668.2_Silent_p.H131H|CASC5_ENST00000527044.1_Missense_Mutation_p.Y112H			Q8NG31	CASC5_HUMAN	cancer susceptibility candidate 5	157	Interaction with BUB1 and BUB1B.				acrosome assembly (GO:0001675)|attachment of spindle microtubules to kinetochore (GO:0008608)|CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|nucleosome assembly (GO:0006334)|protein localization to kinetochore (GO:0034501)|spindle assembly checkpoint (GO:0071173)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.H157H(2)		NS(1)|breast(7)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(13)|lung(16)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	57		all_cancers(109;2.03e-18)|all_epithelial(112;4.26e-15)|Lung NSC(122;1.12e-10)|all_lung(180;2.59e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;4.99e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0861)|COAD - Colon adenocarcinoma(120;0.211)		TTATAGAACATACCCGTGAAA	0.313																																							uc010bbs.1		NA																	2	Substitution - coding silent(2)		lung(2)	breast(3)|central_nervous_system(1)|skin(1)	5						c.(469-471)CAT>CAC		cancer susceptibility candidate 5 isoform 1							40.0	38.0	38.0					15																	40912855		1811	4080	5891	SO:0001819	synonymous_variant	57082				acrosome assembly|attachment of spindle microtubules to kinetochore|cell division|CenH3-containing nucleosome assembly at centromere|mitotic prometaphase|spindle assembly checkpoint	acrosomal vesicle|condensed chromosome kinetochore|cytosol|nucleoplasm	protein binding	g.chr15:40912855T>C	AF173994	CCDS42023.1, CCDS42024.1	15q14	2013-07-03			ENSG00000137812	ENSG00000137812		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	24054	protein-coding gene	gene with protein product	"""cancer/testis antigen 29"", ""kinetochore null 1 homolog (C. elegans)"", ""blinkin, bub-linking kinetochore protein"", ""protein phosphatase 1, regulatory subunit 55"""	609173				10980622, 10780384, 18045986	Standard	NM_170589		Approved	D40, AF15Q14, CT29, hKNL-1, KNL1, hSpc105, PPP1R55, Spc7	uc010bbt.1	Q8NG31	OTTHUMG00000166532	ENST00000346991.5:c.471T>C	15.37:g.40912855T>C			Somatic				CASC5_uc010ucq.1_5'UTR|CASC5_uc001zme.2_Silent_p.H131H|CASC5_uc010bbt.1_Silent_p.H131H	p.H157H	NM_170589	NP_733468	WXS	Illumina HiSeq	Unspecified	Q8NG31	CASC5_HUMAN		GBM - Glioblastoma multiforme(113;4.99e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0861)|COAD - Colon adenocarcinoma(120;0.211)	11	632	+		all_cancers(109;2.03e-18)|all_epithelial(112;4.26e-15)|Lung NSC(122;1.12e-10)|all_lung(180;2.59e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)	157			Interaction with BUB1 and BUB1B.		Q8NHE1|Q8WXA6|Q9HCK2|Q9NR92	Silent	SNP	ENST00000346991.5	37	c.471T>C	CCDS42023.1	.	.	.	.	.	.	.	.	.	.	T	3.726	-0.056481	0.07362	.	.	ENSG00000137812	ENST00000527044	T	0.25749	1.78	6.04	2.18	0.27775	.	.	.	.	.	T	0.19765	0.0475	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.22452	-1.0216	5	.	.	.	.	6.3231	0.21229	0.0:0.4854:0.1312:0.3835	.	.	.	.	H	112	ENSP00000432654:Y112H	.	Y	+	1	0	CASC5	38700147	0.000000	0.05858	0.047000	0.18901	0.825000	0.46686	-0.547000	0.06055	0.619000	0.30197	0.460000	0.39030	TAC		0.313	CASC5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390224.2	NM_144508		7	56	0	0	0	0.001984	0	7	56				
MAP1A	4130	broad.mit.edu	37	15	43819588	43819588	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr15:43819588C>A	ENST00000300231.5	+	4	6367	c.5917C>A	c.(5917-5919)Cag>Aag	p.Q1973K	MAP1A_ENST00000399453.1_Missense_Mutation_p.Q1973K|MAP1A_ENST00000382031.1_Missense_Mutation_p.Q2211K			P78559	MAP1A_HUMAN	microtubule-associated protein 1A	1973					microtubule cytoskeleton organization (GO:0000226)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	structural molecule activity (GO:0005198)	p.Q1973K(1)		breast(5)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(5)|pancreas(3)|prostate(2)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	66		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.05e-06)	Estramustine(DB01196)	CATCTATGAGCAGATGATGCT	0.582																																							uc001zrt.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|breast(3)|pancreas(2)|skin(1)	9						c.(5917-5919)CAG>AAG		microtubule-associated protein 1A	Estramustine(DB01196)						72.0	76.0	75.0					15																	43819588		2146	4264	6410	SO:0001583	missense	4130					cytoplasm|microtubule|microtubule associated complex	protein binding|structural molecule activity	g.chr15:43819588C>A	U38292	CCDS42031.1	15q15.3	2006-06-15			ENSG00000166963	ENSG00000166963			6835	protein-coding gene	gene with protein product		600178		MAP1L		7806212, 7629894	Standard	XM_005254385		Approved		uc001zrt.3	P78559	OTTHUMG00000059756	ENST00000300231.5:c.5917C>A	15.37:g.43819588C>A	ENSP00000300231:p.Gln1973Lys		Somatic					p.Q1973K	NM_002373	NP_002364	WXS	Illumina HiSeq	Unspecified	P78559	MAP1A_HUMAN		GBM - Glioblastoma multiforme(94;3.05e-06)	4	6384	+		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)	1973					O95643|Q12973|Q15882|Q9UJT4	Missense_Mutation	SNP	ENST00000300231.5	37	c.5917C>A	CCDS42031.1	.	.	.	.	.	.	.	.	.	.	C	12.77	2.037033	0.35893	.	.	ENSG00000166963	ENST00000382031;ENST00000399453;ENST00000300231	T;T;T	0.01252	5.1;5.1;5.1	4.88	4.88	0.63580	.	0.000000	0.32343	N	0.006231	T	0.01489	0.0048	L	0.36672	1.1	0.29353	N	0.865234	B	0.24576	0.106	B	0.25614	0.062	T	0.37619	-0.9698	10	0.24483	T	0.36	-16.2007	8.1489	0.31128	0.2814:0.5809:0.1377:0.0	.	1973	P78559	MAP1A_HUMAN	K	2211;1973;1973	ENSP00000371462:Q2211K;ENSP00000382380:Q1973K;ENSP00000300231:Q1973K	ENSP00000300231:Q1973K	Q	+	1	0	MAP1A	41606880	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.615000	0.36922	2.537000	0.85549	0.563000	0.77884	CAG		0.582	MAP1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000132894.5	NM_002373		5	111	1	0	0.000157383	0.00308	0.000184503	5	111				
CPLX3	594855	broad.mit.edu	37	15	75119191	75119191	+	Silent	SNP	G	G	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr15:75119191G>A	ENST00000395018.4	+	1	304	c.147G>A	c.(145-147)aaG>aaA	p.K49K	RP11-414J4.2_ENST00000564823.1_RNA	NM_001030005.2	NP_001025176.1	Q8WVH0	CPLX3_HUMAN	complexin 3	49					insulin secretion (GO:0030073)|regulation of neurotransmitter secretion (GO:0046928)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|synapse (GO:0045202)	neurotransmitter transporter activity (GO:0005326)	p.K49K(1)		large_intestine(2)|lung(2)	4						AGTATCAGAAGCAACTCGTGG	0.637																																							uc002ayu.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(145-147)AAG>AAA		complexin 3 precursor							113.0	107.0	109.0					15																	75119191		2196	4295	6491	SO:0001819	synonymous_variant	594855					cell junction|synapse	syntaxin binding	g.chr15:75119191G>A	BC018026	CCDS32294.1	15q24.1	2005-08-09			ENSG00000213578	ENSG00000213578			27652	protein-coding gene	gene with protein product		609585				15911881	Standard	NM_001030005		Approved	CPX-III	uc002ayu.1	Q8WVH0	OTTHUMG00000142816	ENST00000395018.4:c.147G>A	15.37:g.75119191G>A			Somatic				LMAN1L_uc010bke.1_3'UTR	p.K49K	NM_001030005	NP_001025176	WXS	Illumina HiSeq	Unspecified	Q8WVH0	CPLX3_HUMAN			1	241	+			49			Potential.		D3DW66|Q8TEM6|Q9H818	Silent	SNP	ENST00000395018.4	37	c.147G>A	CCDS32294.1																																																																																				0.637	CPLX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286402.2	NM_001030005		6	44	0	0	0	0.001984	0	6	44				
ULK3	25989	broad.mit.edu	37	15	75134424	75134424	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr15:75134424T>A	ENST00000440863.2	-	3	447	c.356A>T	c.(355-357)cAg>cTg	p.Q119L	ULK3_ENST00000569437.1_Missense_Mutation_p.Q119L|ULK3_ENST00000568667.1_Missense_Mutation_p.Q130L	NM_001099436.1	NP_001092906	Q6PHR2	ULK3_HUMAN	unc-51 like kinase 3	119	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				autophagic vacuole assembly (GO:0000045)|autophagy (GO:0006914)|cellular senescence (GO:0090398)|negative regulation of smoothened signaling pathway (GO:0045879)|positive regulation of smoothened signaling pathway (GO:0045880)|protein autophosphorylation (GO:0046777)|regulation of autophagy (GO:0010506)	ATG1/UKL1 signaling complex (GO:0034273)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|pre-autophagosomal structure (GO:0000407)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.Q119L(1)		breast(2)	2						ACCTAATTGCTGCATGAAGAC	0.577																																							uc010bkf.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(2)	2						c.(355-357)CAG>CTG		unc-51-like kinase 3							113.0	120.0	118.0					15																	75134424		2105	4221	6326	SO:0001583	missense	25989					cytoplasm	ATP binding|protein serine/threonine kinase activity	g.chr15:75134424T>A	BC048289		15q24.1	2013-07-02	2013-07-02			ENSG00000140474			19703	protein-coding gene	gene with protein product		613472	"""unc-51-like kinase 3 (C. elegans)"""				Standard	XM_005254289		Approved	DKFZP434C131, FLJ90566	uc010bkf.1	Q6PHR2		ENST00000440863.2:c.356A>T	15.37:g.75134424T>A	ENSP00000400312:p.Gln119Leu		Somatic				ULK3_uc010ulp.1_Missense_Mutation_p.Q29L|ULK3_uc010ulq.1_Missense_Mutation_p.Q130L|ULK3_uc010ulr.1_Missense_Mutation_p.Q2L|ULK3_uc002ayv.2_Missense_Mutation_p.Q119L|ULK3_uc010uls.1_Missense_Mutation_p.Q2L|ULK3_uc010ult.1_Missense_Mutation_p.Q29L|ULK3_uc010ulu.1_Missense_Mutation_p.Q29L	p.Q119L	NM_001099436	NP_001092906	WXS	Illumina HiSeq	Unspecified	Q6PHR2	ULK3_HUMAN			3	462	-			119			Protein kinase.		B2RXK3|B4DRQ7|D3DW68|Q9NPN5|Q9UFS4	Missense_Mutation	SNP	ENST00000440863.2	37	c.356A>T	CCDS45305.1	.	.	.	.	.	.	.	.	.	.	T	25.6	4.659353	0.88154	.	.	ENSG00000140474	ENST00000440863;ENST00000418051	T	0.21932	1.98	5.53	5.53	0.82687	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.131674	0.53938	D	0.000047	T	0.33206	0.0855	N	0.25825	0.765	0.58432	D	0.999998	B;D;D;B;D	0.71674	0.018;0.993;0.998;0.236;0.988	B;D;D;B;P	0.70935	0.055;0.96;0.971;0.374;0.796	T	0.10474	-1.0628	10	0.72032	D	0.01	-15.6241	14.5265	0.67892	0.0:0.0:0.0:1.0	.	29;130;29;119;119	B4DEJ1;B4DFT0;B4DFS6;Q6PHR2;Q6PHR2-3	.;.;.;ULK3_HUMAN;.	L	119;130	ENSP00000400312:Q119L	ENSP00000393658:Q130L	Q	-	2	0	ULK3	72921477	1.000000	0.71417	1.000000	0.80357	0.683000	0.39861	7.636000	0.83301	2.107000	0.64212	0.533000	0.62120	CAG		0.577	ULK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000421734.4	NM_015518		17	192	0	0	0	0.008871	0	17	192				
LOC645752	645752	broad.mit.edu	37	15	78211193	78211193	+	lincRNA	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr15:78211193G>T	ENST00000565869.1	+	0	111				RN7SL214P_ENST00000487317.2_RNA|RP11-114H24.2_ENST00000567226.1_RNA																							TCCTGCTTTTGTAGCCTGTCC	0.592																																							uc010bky.2		NA																	0					0						c.(574-576)CAA>AAA		SubName: Full=GOLGA6 protein; Flags: Fragment;																																						645752							g.chr15:78211193G>T																													15.37:g.78211193G>T			Somatic					p.Q192K	NR_027024		WXS	Illumina HiSeq	Unspecified					11	1338	-									Missense_Mutation	SNP	ENST00000565869.1	37	c.574C>A																																																																																					0.592	RP11-114H24.7-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000421587.1			11	166	1	0	1.15919e-05	0.008871	1.45776e-05	11	166				
ZNF597	146434	broad.mit.edu	37	16	3490906	3490906	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr16:3490906C>G	ENST00000301744.4	-	3	296	c.61G>C	c.(61-63)Gtg>Ctg	p.V21L	NAA60_ENST00000407558.4_5'Flank|NAA60_ENST00000608722.1_5'Flank|NAA60_ENST00000573580.1_5'Flank|NAA60_ENST00000424546.2_5'Flank	NM_152457.1	NP_689670.1	Q96LX8	ZN597_HUMAN	zinc finger protein 597	21	KRAB.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.V21L(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)|urinary_tract(1)	13						GAAAAATACACAGCCAGATCC	0.512																																							uc002cvd.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(61-63)GTG>CTG		zinc finger protein 597							77.0	72.0	73.0					16																	3490906		2197	4300	6497	SO:0001583	missense	146434				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr16:3490906C>G	AK057633	CCDS10505.1	16p13.3	2013-01-08			ENSG00000167981	ENSG00000167981		"""Zinc fingers, C2H2-type"", ""-"""	26573	protein-coding gene	gene with protein product		614685				12477932	Standard	NM_152457		Approved	FLJ33071	uc002cvd.3	Q96LX8	OTTHUMG00000129359	ENST00000301744.4:c.61G>C	16.37:g.3490906C>G	ENSP00000301744:p.Val21Leu		Somatic				NAT15_uc002cvh.3_5'Flank|NAT15_uc010uxb.1_5'Flank	p.V21L	NM_152457	NP_689670	WXS	Illumina HiSeq	Unspecified	Q96LX8	ZN597_HUMAN			3	245	-			21			KRAB.			Missense_Mutation	SNP	ENST00000301744.4	37	c.61G>C	CCDS10505.1	.	.	.	.	.	.	.	.	.	.	C	16.74	3.207265	0.58343	.	.	ENSG00000167981	ENST00000301744	T	0.04156	3.69	3.99	3.03	0.35002	Krueppel-associated box (3);	0.260614	0.21112	N	0.079971	T	0.13586	0.0329	M	0.84156	2.68	0.30411	N	0.779078	D	0.53312	0.959	P	0.52909	0.713	T	0.03364	-1.1044	10	0.66056	D	0.02	-4.6646	7.4553	0.27264	0.0:0.8813:0.0:0.1187	.	21	Q96LX8	ZN597_HUMAN	L	21	ENSP00000301744:V21L	ENSP00000301744:V21L	V	-	1	0	ZNF597	3430907	0.906000	0.30813	0.847000	0.33407	0.949000	0.60115	1.075000	0.30716	1.020000	0.39573	0.563000	0.77884	GTG		0.512	ZNF597-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251511.2	NM_152457		12	86	0	0	0	0.001855	0	12	86				
GRIN2A	2903	broad.mit.edu	37	16	9857275	9857275	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr16:9857275G>T	ENST00000396573.2	-	14	4435	c.4126C>A	c.(4126-4128)Cgc>Agc	p.R1376S	GRIN2A_ENST00000330684.3_Missense_Mutation_p.R1376S|GRIN2A_ENST00000404927.2_Missense_Mutation_p.N1261K|GRIN2A_ENST00000562109.1_Missense_Mutation_p.N1261K|GRIN2A_ENST00000396575.2_Missense_Mutation_p.R1376S|GRIN2A_ENST00000535259.1_Missense_Mutation_p.N1104K	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	1376					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)	p.R1376S(1)		NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	ATAACCAAGCGTTGGTCATCC	0.562																																							uc002czo.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(32)|NS(5)|ovary(4)|large_intestine(1)|lung(1)|breast(1)|kidney(1)	45						c.(4126-4128)CGC>AGC		N-methyl-D-aspartate receptor subunit 2A isoform	Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)						93.0	85.0	87.0					16																	9857275		2197	4300	6497	SO:0001583	missense	2903				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding	g.chr16:9857275G>T		CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.4126C>A	16.37:g.9857275G>T	ENSP00000379818:p.Arg1376Ser		Somatic				GRIN2A_uc010uym.1_Missense_Mutation_p.R1376S|GRIN2A_uc010uyn.1_Missense_Mutation_p.N1104K|GRIN2A_uc002czr.3_Missense_Mutation_p.N1261K	p.R1376S	NM_001134407	NP_001127879	WXS	Illumina HiSeq	Unspecified	Q12879	NMDE1_HUMAN			13	4674	-			1376			Cytoplasmic (Potential).		O00669|Q17RZ6	Missense_Mutation	SNP	ENST00000396573.2	37	c.4126C>A	CCDS10539.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.059|9.059	0.994032|0.994032	0.19043|0.19043	.|.	.|.	ENSG00000183454|ENSG00000183454	ENST00000404927;ENST00000535259|ENST00000396573;ENST00000330684;ENST00000396575	T;T|T;T;T	0.10860|0.10860	2.83;2.83|2.83;2.83;2.83	5.61|5.61	5.61|5.61	0.85477|0.85477	.|Glutamate [NMDA] receptor, epsilon subunit, C-terminal (1);	.|0.171581	.|0.51477	.|D	.|0.000094	T|T	0.13628|0.13628	0.0330|0.0330	L|L	0.59436|0.59436	1.845|1.845	0.22468|0.22468	N|N	0.999074|0.999074	B;B|B	0.02656|0.13594	0.0;0.0|0.008	B;B|B	0.04013|0.20184	0.001;0.001|0.028	T|T	0.09862|0.09862	-1.0655|-1.0655	8|9	.|.	.|.	.|.	.|.	13.8992|13.8992	0.63792|0.63792	0.0:0.0:0.848:0.152|0.0:0.0:0.848:0.152	.|.	1104;1261|1376	F5GZ52;Q17RZ6|Q12879	.;.|NMDE1_HUMAN	K|S	1261;1104|1376	ENSP00000385872:N1261K;ENSP00000441572:N1104K|ENSP00000379818:R1376S;ENSP00000332549:R1376S;ENSP00000379820:R1376S	.|.	N|R	-|-	3|1	2|0	GRIN2A|GRIN2A	9764776|9764776	1.000000|1.000000	0.71417|0.71417	0.588000|0.588000	0.28705|0.28705	0.984000|0.984000	0.73092|0.73092	3.971000|3.971000	0.56831|0.56831	2.793000|2.793000	0.96121|0.96121	0.655000|0.655000	0.94253|0.94253	AAC|CGC		0.562	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251930.3			17	87	1	0	1.00905e-13	0.008871	1.71621e-13	17	87				
MYH11	4629	broad.mit.edu	37	16	15839064	15839064	+	Silent	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr16:15839064G>T	ENST00000300036.5	-	20	2551	c.2442C>A	c.(2440-2442)acC>acA	p.T814T	MYH11_ENST00000576790.2_Silent_p.T814T|MYH11_ENST00000396324.3_Silent_p.T821T|MYH11_ENST00000452625.2_Silent_p.T821T	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle	814	IQ. {ECO:0000255|PROSITE- ProRule:PRU00116}.				axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)	p.T814T(1)|p.T821T(1)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						CCTTCATGGCGGTCAGCTGCT	0.617			T	CBFB	AML																																		uc002ddy.2		NA		Dom	yes		16	16p13.13-p13.12	4629	T	"""myosin, heavy polypeptide 11, smooth muscle"""			L	CBFB		AML		2	Substitution - coding silent(2)		lung(2)	ovary(6)|skin(3)|lung(2)|breast(2)|upper_aerodigestive_tract(1)|pancreas(1)	15						c.(2440-2442)ACC>ACA		smooth muscle myosin heavy chain 11 isoform							66.0	62.0	64.0					16																	15839064		2197	4300	6497	SO:0001819	synonymous_variant	4629				axon guidance|cardiac muscle fiber development|elastic fiber assembly|skeletal muscle myosin thick filament assembly|smooth muscle contraction	cytosol|melanosome|muscle myosin complex|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle	g.chr16:15839064G>T	X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.2442C>A	16.37:g.15839064G>T			Somatic				MYH11_uc002ddv.2_Silent_p.T821T|MYH11_uc002ddw.2_Silent_p.T814T|MYH11_uc002ddx.2_Silent_p.T821T|MYH11_uc010bvg.2_Silent_p.T646T	p.T814T	NM_002474	NP_002465	WXS	Illumina HiSeq	Unspecified	P35749	MYH11_HUMAN			20	2549	-			814			IQ.		D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Silent	SNP	ENST00000300036.5	37	c.2442C>A	CCDS10565.1																																																																																				0.617	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252192.2	NM_001040113		15	64	1	0	3.45872e-05	0.004007	4.28468e-05	15	64				
ACSM2B	348158	broad.mit.edu	37	16	20554536	20554536	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr16:20554536G>T	ENST00000329697.6	-	11	1498	c.1330C>A	c.(1330-1332)Ctt>Att	p.L444I	ACSM2B_ENST00000565322.1_Missense_Mutation_p.L365I|ACSM2B_ENST00000567288.1_5'Flank|ACSM2B_ENST00000567001.1_Missense_Mutation_p.L444I|ACSM2B_ENST00000565232.1_Missense_Mutation_p.L444I	NM_001105069.1	NP_001098539.1	Q68CK6	ACS2B_HUMAN	acyl-CoA synthetase medium-chain family member 2B	444					fatty acid metabolic process (GO:0006631)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|metal ion binding (GO:0046872)			breast(4)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(4)|lung(33)|ovary(1)|prostate(1)|skin(5)	57						CGGTCTCCAAGGAGCCAAAAG	0.493																																							uc002dhj.3		NA																	0				skin(3)|ovary(1)|central_nervous_system(1)	5						c.(1330-1332)CTT>ATT		acyl-CoA synthetase medium-chain family member							145.0	174.0	165.0					16																	20554536		2200	4297	6497	SO:0001583	missense	348158				fatty acid metabolic process|xenobiotic metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|CoA-ligase activity|metal ion binding	g.chr16:20554536G>T	AY160217	CCDS10586.1	16p12.3	2014-08-08	2007-06-20	2007-06-20	ENSG00000066813	ENSG00000066813		"""Acyl-CoA synthetase family"""	30931	protein-coding gene	gene with protein product	"""xenobiotic/medium chain fatty acid:CoA ligase"""	614359	"""acyl-CoA synthetase medium-chain family member 2"""	ACSM2		12616642	Standard	NM_182617		Approved	HXMA, HYST1046	uc002dhk.4	Q68CK6	OTTHUMG00000131555	ENST00000329697.6:c.1330C>A	16.37:g.20554536G>T	ENSP00000327453:p.Leu444Ile		Somatic				ACSM2B_uc002dhk.3_Missense_Mutation_p.L444I|ACSM2B_uc010bwf.1_Missense_Mutation_p.L444I	p.L444I	NM_182617	NP_872423	WXS	Illumina HiSeq	Unspecified	Q68CK6	ACS2B_HUMAN			12	1540	-			444					Q86YT1	Missense_Mutation	SNP	ENST00000329697.6	37	c.1330C>A	CCDS10586.1	.	.	.	.	.	.	.	.	.	.	G	7.942	0.742943	0.15642	.	.	ENSG00000066813	ENST00000329697	T	0.48836	0.8	3.26	-4.46	0.03536	AMP-dependent synthetase/ligase (1);	3.502710	0.01035	N	0.004207	T	0.42585	0.1209	N	0.14661	0.345	0.19300	N	0.999976	B;B	0.22746	0.074;0.074	B;B	0.38562	0.276;0.276	T	0.54984	-0.8211	10	0.87932	D	0	0.0533	14.6215	0.68588	0.0:0.0:0.177:0.823	.	444;444	A8K051;Q68CK6	.;ACS2B_HUMAN	I	444	ENSP00000327453:L444I	ENSP00000327453:L444I	L	-	1	0	ACSM2B	20462037	0.000000	0.05858	0.057000	0.19452	0.076000	0.17211	0.148000	0.16224	-0.520000	0.06435	-0.241000	0.12123	CTT		0.493	ACSM2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254417.2	NM_182617		28	264	1	0	3.73988e-18	0.00632	6.74805e-18	28	264				
USP31	57478	broad.mit.edu	37	16	23080502	23080502	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr16:23080502C>T	ENST00000219689.7	-	16	2923	c.2924G>A	c.(2923-2925)cGc>cAc	p.R975H	USP31_ENST00000567975.1_Missense_Mutation_p.R268H	NM_020718.3	NP_065769.3	Q86UV5	UBP48_HUMAN	ubiquitin specific peptidase 31	0	Ubiquitin-like. {ECO:0000255|PROSITE- ProRule:PRU00214}.				ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)	p.R975H(1)		breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(17)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	57				GBM - Glioblastoma multiforme(48;0.0187)		CGGGGGCAGGCGGTCCCCTTG	0.517																																							uc002dll.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|lung(3)|breast(2)|pancreas(1)|skin(1)	10						c.(2923-2925)CGC>CAC		ubiquitin specific peptidase 31							75.0	80.0	78.0					16																	23080502		2197	4300	6497	SO:0001583	missense	57478				ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity	g.chr16:23080502C>T	AB033029	CCDS10607.1	16p12.3	2008-02-05	2005-08-08		ENSG00000103404	ENSG00000103404		"""Ubiquitin-specific peptidases"""	20060	protein-coding gene	gene with protein product			"""ubiquitin specific protease 31"""			12838346	Standard	NM_020718		Approved	KIAA1203	uc002dll.3	Q70CQ4	OTTHUMG00000094793	ENST00000219689.7:c.2924G>A	16.37:g.23080502C>T	ENSP00000219689:p.Arg975His		Somatic				USP31_uc002dlk.2_Missense_Mutation_p.R247H|USP31_uc010vca.1_Missense_Mutation_p.R278H|USP31_uc010bxm.2_Missense_Mutation_p.R263H	p.R975H	NM_020718	NP_065769	WXS	Illumina HiSeq	Unspecified	Q70CQ4	UBP31_HUMAN		GBM - Glioblastoma multiforme(48;0.0187)	16	2924	-			975			Ser-rich.		B7ZKS7|Q2M3I4|Q5SZI4|Q5T3T5|Q6NX53|Q8N3F6|Q96F64|Q96IQ3|Q9H5N3|Q9H5T7|Q9NUJ6|Q9NXR0	Missense_Mutation	SNP	ENST00000219689.7	37	c.2924G>A	CCDS10607.1	.	.	.	.	.	.	.	.	.	.	C	2.410	-0.335620	0.05278	.	.	ENSG00000103404	ENST00000219689;ENST00000381162	T	0.08102	3.13	6.06	-1.47	0.08772	.	.	.	.	.	T	0.04907	0.0132	N	0.19112	0.55	0.09310	N	1	B;B;B	0.18013	0.025;0.001;0.001	B;B;B	0.08055	0.003;0.0;0.002	T	0.40720	-0.9548	9	0.33141	T	0.24	0.1173	7.1687	0.25706	0.0:0.5708:0.1076:0.3215	.	278;975;268	Q70CQ4-2;Q70CQ4;B3KS48	.;UBP31_HUMAN;.	H	975;278	ENSP00000219689:R975H	ENSP00000219689:R975H	R	-	2	0	USP31	22988003	0.000000	0.05858	0.000000	0.03702	0.100000	0.18952	-0.223000	0.09177	-0.508000	0.06540	-1.000000	0.02509	CGC		0.517	USP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211607.1	NM_020718		20	142	0	0	0	0.008871	0	20	142				
ITGAX	3687	broad.mit.edu	37	16	31391640	31391640	+	Missense_Mutation	SNP	C	C	G	rs373900500		TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr16:31391640C>G	ENST00000268296.4	+	27	3235	c.3114C>G	c.(3112-3114)agC>agG	p.S1038R	ITGAX_ENST00000562522.1_Missense_Mutation_p.S1038R	NM_000887.3	NP_000878.2	P20702	ITAX_HUMAN	integrin, alpha X (complement component 3 receptor 4 subunit)	1038					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|organ morphogenesis (GO:0009887)	cell surface (GO:0009986)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|receptor activity (GO:0004872)	p.S1038R(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(42)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	77						CCTCCTTCAGCGTCCAGGAGG	0.607																																							uc002ebu.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)|pancreas(1)	4						c.(3112-3114)AGC>AGG		integrin alpha X precursor							56.0	44.0	48.0					16																	31391640		2197	4300	6497	SO:0001583	missense	3687				blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration|organ morphogenesis	integrin complex	protein binding|receptor activity	g.chr16:31391640C>G	BC038237	CCDS10711.1, CCDS67014.1	16p11.2	2010-03-23	2006-02-10		ENSG00000140678	ENSG00000140678		"""CD molecules"", ""Complement system"", ""Integrins"""	6152	protein-coding gene	gene with protein product		151510	"""integrin, alpha X (antigen CD11C (p150), alpha polypeptide)"""	CD11C		3284962, 2303426	Standard	NM_001286375		Approved	CD11c	uc002ebu.1	P20702	OTTHUMG00000132465	ENST00000268296.4:c.3114C>G	16.37:g.31391640C>G	ENSP00000268296:p.Ser1038Arg		Somatic				ITGAX_uc002ebt.2_Missense_Mutation_p.S1038R	p.S1038R	NM_000887	NP_000878	WXS	Illumina HiSeq	Unspecified	P20702	ITAX_HUMAN			27	3181	+			1038			Extracellular (Potential).		Q8IVA6	Missense_Mutation	SNP	ENST00000268296.4	37	c.3114C>G	CCDS10711.1	.	.	.	.	.	.	.	.	.	.	C	6.517	0.463678	0.12402	.	.	ENSG00000140678	ENST00000268296	T	0.47528	0.84	4.69	1.64	0.23874	.	.	.	.	.	T	0.42426	0.1202	L	0.36672	1.1	0.09310	N	1	D;P	0.76494	0.999;0.953	P;B	0.54312	0.748;0.207	T	0.23048	-1.0199	9	0.16896	T	0.51	.	4.9837	0.14180	0.0:0.6372:0.173:0.1898	.	1038;223	P20702;Q8TES5	ITAX_HUMAN;.	R	1038	ENSP00000268296:S1038R	ENSP00000268296:S1038R	S	+	3	2	ITGAX	31299141	0.001000	0.12720	0.123000	0.21794	0.028000	0.11728	-0.066000	0.11598	0.291000	0.22468	-1.132000	0.01976	AGC		0.607	ITGAX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255628.2	NM_000887		4	34	0	0	0	0.009096	0	4	34				
CBLN1	869	broad.mit.edu	37	16	49313499	49313499	+	Missense_Mutation	SNP	A	A	C			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr16:49313499A>C	ENST00000219197.6	-	3	763	c.398T>G	c.(397-399)cTa>cGa	p.L133R	CBLN1_ENST00000536749.1_Missense_Mutation_p.L133R	NM_004352.3	NP_004343.1	P23435	CBLN1_HUMAN	cerebellin 1 precursor	133	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.|Necessary for interaction with CBLN3, and homotrimerization. {ECO:0000250}.				cerebellar granule cell differentiation (GO:0021707)|heterophilic cell-cell adhesion (GO:0007157)|nervous system development (GO:0007399)|positive regulation of synapse assembly (GO:0051965)|protein secretion (GO:0009306)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|extracellular region (GO:0005576)|postsynaptic membrane (GO:0045211)		p.L133R(1)		breast(1)|kidney(3)|large_intestine(2)|lung(3)	9		all_cancers(37;0.0766)|all_lung(18;0.24)				CCACCCGTTTAGCATGAGGCT	0.607																																							uc002efq.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(397-399)CTA>CGA		cerebellin 1 precursor							42.0	43.0	43.0					16																	49313499		2200	4300	6500	SO:0001583	missense	869				nervous system development|synaptic transmission	cell junction|extracellular region|synapse		g.chr16:49313499A>C	M58583	CCDS10736.1	16q12.1	2008-02-05			ENSG00000102924	ENSG00000102924			1543	protein-coding gene	gene with protein product		600432				7877445, 1704129	Standard	NM_004352		Approved		uc002efq.3	P23435	OTTHUMG00000133148	ENST00000219197.6:c.398T>G	16.37:g.49313499A>C	ENSP00000219197:p.Leu133Arg		Somatic					p.L133R	NM_004352	NP_004343	WXS	Illumina HiSeq	Unspecified	P23435	CBLN1_HUMAN			3	737	-		all_cancers(37;0.0766)|all_lung(18;0.24)	133			C1q.|Necessary for interaction with CBLN3, and homotrimerization (By similarity).		B2RAN9|P02682|Q52M09	Missense_Mutation	SNP	ENST00000219197.6	37	c.398T>G	CCDS10736.1	.	.	.	.	.	.	.	.	.	.	A	11.98	1.801354	0.31869	.	.	ENSG00000102924	ENST00000219197;ENST00000536749	T;T	0.36878	1.23;1.23	5.68	4.55	0.56014	Tumour necrosis factor-like (2);Complement C1q protein (3);	0.079948	0.48767	D	0.000164	T	0.32164	0.0820	L	0.31578	0.945	0.41984	D	0.990816	P	0.35307	0.494	P	0.45794	0.493	T	0.04840	-1.0923	10	0.08381	T	0.77	-7.3392	12.1789	0.54202	0.8724:0.0:0.0:0.1276	.	133	P23435	CBLN1_HUMAN	R	133	ENSP00000219197:L133R;ENSP00000444651:L133R	ENSP00000219197:L133R	L	-	2	0	CBLN1	47871000	0.982000	0.34865	1.000000	0.80357	0.993000	0.82548	1.904000	0.39868	2.156000	0.67533	0.533000	0.62120	CTA		0.607	CBLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256845.4	NM_004352		8	56	0	0	0	0.006214	0	8	56				
SALL1	6299	broad.mit.edu	37	16	51173271	51173271	+	Silent	SNP	G	G	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr16:51173271G>A	ENST00000251020.4	-	2	2895	c.2862C>T	c.(2860-2862)agC>agT	p.S954S	SALL1_ENST00000566102.1_Intron|SALL1_ENST00000440970.1_Silent_p.S857S|SALL1_ENST00000541611.1_Intron	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	954					adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S954S(1)		NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			TGGCAAACTCGCTTGGGACCG	0.517																																					GBM(103;1352 1446 1855 4775 8890)	GBM(103;1352 1446 1855 4775 8890)	uc010vgs.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(5)|ovary(3)	8						c.(2860-2862)AGC>AGT		sal-like 1 isoform a							71.0	55.0	61.0					16																	51173271		2198	4300	6498	SO:0001819	synonymous_variant	6299				adrenal gland development|branching involved in ureteric bud morphogenesis|embryonic digestive tract development|embryonic digit morphogenesis|gonad development|histone deacetylation|inductive cell-cell signaling|mesenchymal to epithelial transition involved in metanephros morphogenesis|negative regulation of transcription from RNA polymerase II promoter|olfactory bulb interneuron differentiation|olfactory bulb mitral cell layer development|olfactory nerve development|outer ear morphogenesis|pituitary gland development|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway|ureteric bud invasion|ventricular septum development	chromocenter|cytoplasm|heterochromatin|nucleus	beta-catenin binding|DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr16:51173271G>A	X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.2862C>T	16.37:g.51173271G>A			Somatic				SALL1_uc010vgr.1_Silent_p.S857S|SALL1_uc010cbv.2_Intron	p.S954S	NM_002968	NP_002959	WXS	Illumina HiSeq	Unspecified	Q9NSC2	SALL1_HUMAN	COAD - Colon adenocarcinoma(2;0.24)		2	2893	-		all_cancers(37;0.0322)	954					Q99881|Q9NSC3|Q9P1R0	Silent	SNP	ENST00000251020.4	37	c.2862C>T	CCDS10747.1																																																																																				0.517	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256883.2	NM_002968		9	60	0	0	0	0.008291	0	9	60				
SLC6A2	6530	broad.mit.edu	37	16	55728015	55728015	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr16:55728015A>T	ENST00000379906.2	+	6	1267	c.1012A>T	c.(1012-1014)Aac>Tac	p.N338Y	SLC6A2_ENST00000561820.1_Missense_Mutation_p.N338Y|SLC6A2_ENST00000414754.3_Missense_Mutation_p.N338Y|SLC6A2_ENST00000219833.8_Missense_Mutation_p.N338Y|SLC6A2_ENST00000566163.1_Missense_Mutation_p.N293Y|SLC6A2_ENST00000567238.1_Missense_Mutation_p.N233Y|SLC6A2_ENST00000568943.1_Missense_Mutation_p.N338Y	NM_001043.3	NP_001034.1	P23975	SC6A2_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 2	338					monoamine transport (GO:0015844)|norepinephrine transport (GO:0015874)|response to drug (GO:0042493)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	monoamine transmembrane transporter activity (GO:0008504)|norepinephrine:sodium symporter activity (GO:0005334)	p.N338Y(2)		breast(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(20)|ovary(3)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(1)	41				BRCA - Breast invasive adenocarcinoma(181;0.01)|Kidney(780;0.0267)	Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Atomoxetine(DB00289)|Bupropion(DB01156)|Chlorphenamine(DB01114)|Citalopram(DB00215)|Clomipramine(DB01242)|Cocaine(DB00907)|Debrisoquin(DB04840)|Desipramine(DB01151)|Desvenlafaxine(DB06700)|Dexmethylphenidate(DB06701)|Dextroamphetamine(DB01576)|Dextromethorphan(DB00514)|Diethylpropion(DB00937)|Dopamine(DB00988)|Doxepin(DB01142)|Droxidopa(DB06262)|Duloxetine(DB00476)|Ephedra(DB01363)|Ephedrine(DB01364)|Ergotamine(DB00696)|Escitalopram(DB01175)|Ginkgo biloba(DB01381)|Guanadrel(DB00226)|Guanethidine(DB01170)|Imipramine(DB00458)|Iobenguane(DB06704)|Ketamine(DB01221)|Levomilnacipran(DB08918)|Levonordefrin(DB06707)|Loxapine(DB00408)|Maprotiline(DB00934)|Mazindol(DB00579)|Methamphetamine(DB01577)|Methylphenidate(DB00422)|Mianserin(DB06148)|Milnacipran(DB04896)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Orphenadrine(DB01173)|Paroxetine(DB00715)|Pethidine(DB00454)|Phendimetrazine(DB01579)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Protriptyline(DB00344)|Pseudoephedrine(DB00852)|Reboxetine(DB00234)|Sibutramine(DB01105)|Tapentadol(DB06204)|Tramadol(DB00193)|Trimipramine(DB00726)|Venlafaxine(DB00285)	ATTTGACAACAACTGTTACAG	0.438																																							uc002eif.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(4)|ovary(2)|pancreas(2)	8						c.(1012-1014)AAC>TAC		solute carrier family 6 member 2	Amineptine(DB04836)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Atomoxetine(DB00289)|Bethanidine(DB00217)|Bupropion(DB01156)|Clomipramine(DB01242)|Cocaine(DB00907)|Debrisoquin(DB04840)|Desipramine(DB01151)|Diethylpropion(DB00937)|Doxepin(DB01142)|Duloxetine(DB00476)|Ergotamine(DB00696)|Guanadrel Sulfate(DB00226)|Guanethidine(DB01170)|Imipramine(DB00458)|Maprotiline(DB00934)|Mazindol(DB00579)|Methylphenidate(DB00422)|Milnacipran(DB04896)|Nefazodone(DB01149)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Paroxetine(DB00715)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Protriptyline(DB00344)|Reboxetine(DB00234)|Sibutramine(DB01105)|Tramadol(DB00193)|Trazodone(DB00656)|Trimipramine(DB00726)|Venlafaxine(DB00285)						115.0	110.0	112.0					16																	55728015		2198	4300	6498	SO:0001583	missense	6530				synaptic transmission	integral to plasma membrane|membrane fraction	norepinephrine:sodium symporter activity	g.chr16:55728015A>T		CCDS10754.1, CCDS54011.1, CCDS58463.1	16q12.2	2013-07-19	2013-07-19		ENSG00000103546	ENSG00000103546		"""Solute carriers"""	11048	protein-coding gene	gene with protein product	"""norepinephrine transporter"""	163970	"""solute carrier family 6 (neurotransmitter transporter, noradrenalin), member 2"""	NET1, NAT1, SLC6A5		2008212	Standard	NM_001043		Approved	NET	uc021tio.1	P23975	OTTHUMG00000133208	ENST00000379906.2:c.1012A>T	16.37:g.55728015A>T	ENSP00000369237:p.Asn338Tyr		Somatic				SLC6A2_uc010ccd.2_Missense_Mutation_p.N338Y|SLC6A2_uc002eig.2_Missense_Mutation_p.N338Y|SLC6A2_uc002eih.2_Missense_Mutation_p.N338Y|SLC6A2_uc002eii.2_Missense_Mutation_p.N233Y|SLC6A2_uc002eij.2_Missense_Mutation_p.N52Y	p.N338Y	NM_001043	NP_001034	WXS	Illumina HiSeq	Unspecified	P23975	SC6A2_HUMAN		BRCA - Breast invasive adenocarcinoma(181;0.01)|Kidney(780;0.0267)	7	1123	+			338					B2R707|B4DX48|Q96KH8	Missense_Mutation	SNP	ENST00000379906.2	37	c.1012A>T	CCDS10754.1	.	.	.	.	.	.	.	.	.	.	A	11.37	1.618562	0.28801	.	.	ENSG00000103546	ENST00000414754;ENST00000537705;ENST00000379906;ENST00000219833	T;T;T	0.80033	-1.33;-1.33;-1.33	4.87	3.76	0.43208	.	0.000000	0.85682	D	0.000000	D	0.93086	0.7799	H	0.98612	4.28	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.997;0.998;0.998	D	0.93589	0.6919	10	0.87932	D	0	.	11.3835	0.49771	0.8478:0.1522:0.0:0.0	.	338;52;233;338	Q96KH8;F5H0T4;B4DX48;P23975	.;.;.;SC6A2_HUMAN	Y	338;52;338;338	ENSP00000394956:N338Y;ENSP00000369237:N338Y;ENSP00000219833:N338Y	ENSP00000219833:N338Y	N	+	1	0	SLC6A2	54285516	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	7.190000	0.77755	0.705000	0.31890	-0.313000	0.08912	AAC		0.438	SLC6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256922.2			32	161	0	0	0	0.003271	0	32	161				
GNAO1	2775	broad.mit.edu	37	16	56377812	56377812	+	Intron	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr16:56377812G>T	ENST00000262493.6	+	6	1569				GNAO1_ENST00000262494.7_Missense_Mutation_p.V339L	NM_020988.2	NP_066268.1	P09471	GNAO_HUMAN	guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O						adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|aging (GO:0007568)|dopamine receptor signaling pathway (GO:0007212)|forebrain development (GO:0030900)|locomotory behavior (GO:0007626)|muscle contraction (GO:0006936)|negative regulation of calcium ion transport (GO:0051926)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|regulation of heart contraction (GO:0008016)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to morphine (GO:0043278)	heterotrimeric G-protein complex (GO:0005834)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	corticotropin-releasing hormone receptor 1 binding (GO:0051430)|G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled serotonin receptor binding (GO:0031821)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|mu-type opioid receptor binding (GO:0031852)|signal transducer activity (GO:0004871)	p.V339L(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(4)|prostate(1)	17		all_neural(199;0.159)				CTTTGATGCTGTGACGGACGT	0.617																																							uc002eit.3		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)|breast(1)	2						c.(1015-1017)GTG>TTG		guanine nucleotide binding protein, alpha							184.0	124.0	144.0					16																	56377812		2198	4300	6498	SO:0001627	intron_variant	2775				dopamine receptor signaling pathway|G-protein signaling, coupled to cAMP nucleotide second messenger|muscle contraction	heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|GTP binding|GTPase activity|metabotropic serotonin receptor binding|signal transducer activity	g.chr16:56377812G>T		CCDS10756.1, CCDS10757.1	16q13	2008-08-01			ENSG00000087258	ENSG00000087258			4389	protein-coding gene	gene with protein product		139311				1899283, 11395521	Standard	NM_020988		Approved	G-ALPHA-o	uc002eit.4	P09471	OTTHUMG00000133241	ENST00000262493.6:c.723+7040G>T	16.37:g.56377812G>T			Somatic				GNAO1_uc002eiu.3_Intron	p.V339L	NM_138736	NP_620073	WXS	Illumina HiSeq	Unspecified	P09471	GNAO_HUMAN			8	1912	+		all_neural(199;0.159)	339					P29777|Q8TD72|Q9UMV4	Missense_Mutation	SNP	ENST00000262493.6	37	c.1015G>T	CCDS10756.1	.	.	.	.	.	.	.	.	.	.	G	31	5.070223	0.93950	.	.	ENSG00000087258	ENST00000262494	T	0.80123	-1.34	4.58	4.58	0.56647	.	.	.	.	.	D	0.92280	0.7551	M	0.93720	3.45	0.80722	D	1	D	0.69078	0.997	D	0.79108	0.992	D	0.94505	0.7713	9	0.87932	D	0	.	17.7684	0.88485	0.0:0.0:1.0:0.0	.	339	P09471-2	.	L	339	ENSP00000262494:V339L	ENSP00000262494:V339L	V	+	1	0	GNAO1	54935313	1.000000	0.71417	0.958000	0.39756	0.861000	0.49209	9.731000	0.98807	2.278000	0.76064	0.561000	0.74099	GTG		0.617	GNAO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256981.2	NM_020988		11	74	1	0	6.40141e-05	0.000978	7.74515e-05	11	74				
TANGO6	79613	broad.mit.edu	37	16	68894053	68894053	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr16:68894053C>T	ENST00000261778.1	+	2	373	c.361C>T	c.(361-363)Ccc>Tcc	p.P121S		NM_024562.1	NP_078838.1	Q9C0B7	TNG6_HUMAN	transport and golgi organization 6 homolog (Drosophila)	121						integral component of membrane (GO:0016021)		p.P121S(1)									TCCAGGTAAACCCAACCCTAG	0.468																																							uc002ewi.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(361-363)CCC>TCC		transmembrane and coiled-coil domains 7							197.0	191.0	193.0					16																	68894053		1964	4161	6125	SO:0001583	missense	79613					integral to membrane	binding	g.chr16:68894053C>T		CCDS45516.1	16q22.1	2012-12-13	2012-12-13	2012-12-13	ENSG00000103047	ENSG00000103047			25749	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 7"""	TMCO7		11214970	Standard	NM_024562		Approved	FLJ12688, KIAA1746	uc002ewi.4	Q9C0B7	OTTHUMG00000176743	ENST00000261778.1:c.361C>T	16.37:g.68894053C>T	ENSP00000261778:p.Pro121Ser		Somatic				TMCO7_uc002ewh.2_Missense_Mutation_p.P121S	p.P121S	NM_024562	NP_078838	WXS	Illumina HiSeq	Unspecified	Q9C0B7	TMCO7_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.0446)|Epithelial(162;0.198)	2	373	+		Ovarian(137;0.0568)	121					Q569F9|Q9H9K1	Missense_Mutation	SNP	ENST00000261778.1	37	c.361C>T	CCDS45516.1	.	.	.	.	.	.	.	.	.	.	C	13.30	2.194985	0.38806	.	.	ENSG00000103047	ENST00000261778	.	.	.	5.41	4.47	0.54385	.	.	.	.	.	T	0.52853	0.1760	L	0.45581	1.43	0.42141	D	0.991517	B	0.16396	0.017	B	0.20577	0.03	T	0.46693	-0.9173	8	0.17832	T	0.49	-2.2809	11.9756	0.53089	0.0:0.9158:0.0:0.0842	.	121	Q9C0B7	TMCO7_HUMAN	S	121	.	ENSP00000261778:P121S	P	+	1	0	TMCO7	67451554	0.978000	0.34361	0.955000	0.39395	0.836000	0.47400	1.456000	0.35201	1.303000	0.44873	0.561000	0.74099	CCC		0.468	TANGO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433471.2	XM_928235.2		46	280	0	0	0	0.00361	0	46	280				
HYDIN	54768	broad.mit.edu	37	16	71019123	71019123	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr16:71019123G>T	ENST00000393567.2	-	28	4447	c.4297C>A	c.(4297-4299)Ctt>Att	p.L1433I		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	1433					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)		p.L1384I(1)|p.L1432I(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				CCAGGGAGAAGGTTGTCTGGA	0.517																																							uc002ezr.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|skin(1)	2						c.(4294-4296)CTT>ATT		hydrocephalus inducing isoform a							16.0	18.0	17.0					16																	71019123		1819	4065	5884	SO:0001583	missense	54768							g.chr16:71019123G>T	AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.4297C>A	16.37:g.71019123G>T	ENSP00000377197:p.Leu1433Ile		Somatic					p.L1432I	NM_032821	NP_116210	WXS	Illumina HiSeq	Unspecified	Q4G0P3	HYDIN_HUMAN			28	4422	-		Ovarian(137;0.0654)	1433					A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	ENST00000393567.2	37	c.4294C>A	CCDS59269.1	.	.	.	.	.	.	.	.	.	.	G	10.97	1.502683	0.26949	.	.	ENSG00000157423	ENST00000393567;ENST00000316490	T	0.00986	5.47	4.75	2.72	0.32119	.	0.000000	0.30347	U	0.009830	T	0.01156	0.0038	L	0.53249	1.67	0.09310	N	0.999995	B	0.29432	0.244	B	0.28638	0.092	T	0.46898	-0.9158	10	0.22109	T	0.4	.	8.0031	0.30308	0.0837:0.0:0.7582:0.1581	.	1432	F8WD23	.	I	1433;1432	ENSP00000377197:L1433I	ENSP00000313052:L1432I	L	-	1	0	HYDIN	69576624	0.995000	0.38212	0.028000	0.17463	0.023000	0.10783	3.075000	0.50073	0.650000	0.30769	0.609000	0.83330	CTT		0.517	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000398624.3			7	30	1	0	0.00621372	0.006214	0.0066979	7	30				
CNTNAP4	85445	broad.mit.edu	37	16	76461392	76461392	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr16:76461392G>T	ENST00000476707.1	+	3	582	c.443G>T	c.(442-444)aGa>aTa	p.R148I	CNTNAP4_ENST00000307431.8_Missense_Mutation_p.R144I|CNTNAP4_ENST00000469589.1_3'UTR|CNTNAP4_ENST00000377504.4_Missense_Mutation_p.R144I|CNTNAP4_ENST00000478060.1_Missense_Mutation_p.R120I			Q9C0A0	CNTP4_HUMAN	contactin associated protein-like 4	145	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.				cell adhesion (GO:0007155)|regulation of grooming behavior (GO:2000821)|regulation of synaptic transmission, dopaminergic (GO:0032225)|regulation of synaptic transmission, GABAergic (GO:0032228)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|presynaptic membrane (GO:0042734)		p.R120I(2)|p.R144I(1)		breast(4)|central_nervous_system(1)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(33)|ovary(2)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	64						GTGTACTATAGACTCCAGCCT	0.433																																							uc002feu.1		NA																	3	Substitution - Missense(3)		lung(3)	ovary(1)|pancreas(1)	2						c.(433-435)AGA>ATA		cell recognition protein CASPR4 isoform 1							196.0	193.0	194.0					16																	76461392		2198	4300	6498	SO:0001583	missense	85445				cell adhesion|signal transduction	integral to membrane	receptor binding	g.chr16:76461392G>T	AB051550	CCDS10924.1, CCDS10924.2, CCDS73915.1	16q23.1	2008-02-05			ENSG00000152910	ENSG00000152910			18747	protein-coding gene	gene with protein product		610518				12093160	Standard	NM_033401		Approved	CASPR4, KIAA1763	uc010chb.1	Q9C0A0	OTTHUMG00000137617	ENST00000476707.1:c.443G>T	16.37:g.76461392G>T	ENSP00000417628:p.Arg148Ile		Somatic				CNTNAP4_uc002fev.1_Missense_Mutation_p.R57I|CNTNAP4_uc010chb.1_Missense_Mutation_p.R120I|CNTNAP4_uc002fex.1_Missense_Mutation_p.R148I|CNTNAP4_uc002few.2_Missense_Mutation_p.R120I	p.R145I	NM_033401	NP_207837	WXS	Illumina HiSeq	Unspecified	Q9C0A0	CNTP4_HUMAN			6	819	+			145			Extracellular (Potential).|F5/8 type C.		E9PFZ6|Q86YZ7	Missense_Mutation	SNP	ENST00000476707.1	37	c.434G>T		.	.	.	.	.	.	.	.	.	.	G	22.4	4.289370	0.80914	.	.	ENSG00000152910	ENST00000307431;ENST00000377504;ENST00000478060;ENST00000476707	D;D;D;D	0.98178	-4.77;-4.77;-4.77;-4.77	4.98	3.03	0.35002	Coagulation factor 5/8 C-terminal type domain (3);Galactose-binding domain-like (1);	0.173349	0.27759	N	0.017979	D	0.98232	0.9415	.	.	.	0.50813	D	0.999896	P;D;P;D	0.57899	0.907;0.979;0.534;0.981	P;D;P;D	0.67725	0.864;0.936;0.545;0.953	D	0.97859	1.0279	9	0.72032	D	0.01	.	4.9481	0.14000	0.381:0.0:0.619:0.0	.	120;148;120;145	E9PFZ6;E9PDN6;Q96M80;Q9C0A0	.;.;.;CNTP4_HUMAN	I	144;144;120;148	ENSP00000306893:R144I;ENSP00000439733:R144I;ENSP00000418741:R120I;ENSP00000417628:R148I	ENSP00000306893:R144I	R	+	2	0	CNTNAP4	75018893	1.000000	0.71417	0.966000	0.40874	0.988000	0.76386	5.052000	0.64263	1.470000	0.48102	0.655000	0.94253	AGA		0.433	CNTNAP4-005	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000348216.1	NM_033401		30	143	1	0	2.80507e-11	0.002445	4.46017e-11	30	143				
ADAMTS18	170692	broad.mit.edu	37	16	77317955	77317955	+	Nonsense_Mutation	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr16:77317955G>T	ENST00000282849.5	-	23	3982	c.3564C>A	c.(3562-3564)tgC>tgA	p.C1188*	RP11-538I12.3_ENST00000561672.1_RNA	NM_199355.2	NP_955387.1	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 18	1188	PLAC. {ECO:0000255|PROSITE- ProRule:PRU00233}.				eye development (GO:0001654)|negative regulation of platelet aggregation (GO:0090331)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.C1188*(1)		NS(1)|breast(5)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(26)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(19)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	118						AGAAATCTACGCAGGATGGAT	0.388																																							uc002ffc.3		NA																	1	Substitution - Nonsense(1)		lung(1)	large_intestine(4)|lung(4)|kidney(4)|skin(3)|breast(1)|ovary(1)|pancreas(1)	18						c.(3562-3564)TGC>TGA		ADAM metallopeptidase with thrombospondin type 1							137.0	124.0	129.0					16																	77317955		2198	4300	6498	SO:0001587	stop_gained	170692				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr16:77317955G>T	AJ311903	CCDS10926.1	16q23	2008-07-29	2005-08-19		ENSG00000140873	ENSG00000140873		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17110	protein-coding gene	gene with protein product		607512	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 18"""	ADAMTS21		11867212, 17546048	Standard	NM_199355		Approved		uc002ffc.4	Q8TE60	OTTHUMG00000137619	ENST00000282849.5:c.3564C>A	16.37:g.77317955G>T	ENSP00000282849:p.Cys1188*		Somatic					p.C1188*	NM_199355	NP_955387	WXS	Illumina HiSeq	Unspecified	Q8TE60	ATS18_HUMAN			23	3983	-			1188			PLAC.		Q6P4R5|Q6ZWJ9	Nonsense_Mutation	SNP	ENST00000282849.5	37	c.3564C>A	CCDS10926.1	.	.	.	.	.	.	.	.	.	.	g	44	10.647634	0.99444	.	.	ENSG00000140873	ENST00000282849	.	.	.	5.93	-0.725	0.11174	.	0.049773	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.9291	0.47207	0.5816:0.0:0.4184:0.0	.	.	.	.	X	1188	.	ENSP00000282849:C1188X	C	-	3	2	ADAMTS18	75875456	0.994000	0.37717	0.514000	0.27761	0.606000	0.37113	1.021000	0.30040	-0.404000	0.07610	-1.057000	0.02308	TGC		0.388	ADAMTS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269037.1			6	98	1	0	0.00198382	0.001984	0.00218378	6	98				
COTL1	23406	broad.mit.edu	37	16	84623755	84623755	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr16:84623755C>T	ENST00000262428.4	-	3	436	c.274G>A	c.(274-276)Gcc>Acc	p.A92T	COTL1_ENST00000564057.1_Missense_Mutation_p.A23T	NM_021149.2	NP_066972.1	Q14019	COTL1_HUMAN	coactosin-like F-actin binding protein 1	92	ADF-H. {ECO:0000255|PROSITE- ProRule:PRU00599}.				defense response to fungus (GO:0050832)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	actin binding (GO:0003779)|enzyme binding (GO:0019899)	p.A92T(1)		endometrium(1)|large_intestine(1)|liver(1)|lung(2)|skin(1)	6						CCGGTTTTGGCGCGCTGCAGC	0.597																																							uc002fid.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(274-276)GCC>ACC		coactosin-like 1							101.0	76.0	84.0					16																	84623755		2199	4300	6499	SO:0001583	missense	23406					cytoplasm|cytoskeleton	actin binding|enzyme binding	g.chr16:84623755C>T	L54057	CCDS10947.1	16q24.1	2014-03-05	2014-03-05	2002-08-01	ENSG00000103187	ENSG00000103187			18304	protein-coding gene	gene with protein product		606748	"""coactosin-like 1 (Dictyostelium)"""			10051563, 9326934, 16924104	Standard	NM_021149		Approved	CLP	uc002fid.3	Q14019	OTTHUMG00000137634	ENST00000262428.4:c.274G>A	16.37:g.84623755C>T	ENSP00000262428:p.Ala92Thr		Somatic				COTL1_uc002fie.2_Intron|COTL1_uc010chk.2_RNA	p.A92T	NM_021149	NP_066972	WXS	Illumina HiSeq	Unspecified	Q14019	COTL1_HUMAN			3	423	-			92			ADF-H.		B2RDU3|D3DUL9|Q86XM5	Missense_Mutation	SNP	ENST00000262428.4	37	c.274G>A	CCDS10947.1	.	.	.	.	.	.	.	.	.	.	C	36	5.711196	0.96821	.	.	ENSG00000103187	ENST00000262428	T	0.37752	1.18	5.34	5.34	0.76211	Actin-binding, cofilin/tropomyosin type (3);	0.000000	0.85682	D	0.000000	T	0.61515	0.2353	M	0.70903	2.155	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.64935	-0.6290	10	0.87932	D	0	.	18.0463	0.89334	0.0:1.0:0.0:0.0	.	92	Q14019	COTL1_HUMAN	T	92	ENSP00000262428:A92T	ENSP00000262428:A92T	A	-	1	0	COTL1	83181256	1.000000	0.71417	0.996000	0.52242	0.983000	0.72400	7.300000	0.78841	2.494000	0.84150	0.561000	0.74099	GCC		0.597	COTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269075.1	NM_021149		4	81	0	0	0	0.009096	0	4	81				
CENPBD1	92806	broad.mit.edu	37	16	90038268	90038268	+	Silent	SNP	C	C	G			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr16:90038268C>G	ENST00000314994.3	-	1	674	c.63G>C	c.(61-63)gcG>gcC	p.A21A	CENPBD1_ENST00000567035.1_Intron|AFG3L1P_ENST00000437774.1_RNA|RP11-566K11.5_ENST00000565150.1_RNA	NM_145039.3	NP_659476.2	B2RD01	CENP1_HUMAN	CENPB DNA-binding domains containing 1	21	HTH psq-type. {ECO:0000255|PROSITE- ProRule:PRU00320}.					nucleus (GO:0005634)	DNA binding (GO:0003677)	p.A21A(2)		endometrium(1)|lung(2)	3						CAAGGGTAATCGCTTTCCGTT	0.488																																							uc002fpr.2		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(61-63)GCG>GCC		CENPB DNA-binding domains containing 1							47.0	53.0	51.0					16																	90038268		2128	4236	6364	SO:0001819	synonymous_variant	92806				regulation of transcription, DNA-dependent	chromosome, centromeric region|nucleus	DNA binding	g.chr16:90038268C>G	AK056131	CCDS45556.1	16q24.3	2009-08-26			ENSG00000177946	ENSG00000177946			28272	protein-coding gene	gene with protein product							Standard	NM_145039		Approved	MGC16385	uc002fpr.3	B2RD01		ENST00000314994.3:c.63G>C	16.37:g.90038268C>G			Somatic				AFG3L1_uc002fps.1_5'Flank|AFG3L1_uc002fpt.1_5'Flank|AFG3L1_uc002fpu.1_5'Flank|AFG3L1_uc002fpv.1_5'Flank|AFG3L1_uc002fpw.1_5'Flank|AFG3L1_uc002fpx.1_5'Flank	p.A21A	NM_145039	NP_659476	WXS	Illumina HiSeq	Unspecified	B2RD01	CENP1_HUMAN			1	675	-			21			HTH psq-type.			Silent	SNP	ENST00000314994.3	37	c.63G>C	CCDS45556.1																																																																																				0.488	CENPBD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421897.1	NM_145039		9	50	0	0	0	0.000978	0	9	50				
CHRNE	1145	broad.mit.edu	37	17	4804399	4804399	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr17:4804399C>A	ENST00000293780.4	-	7	698	c.688G>T	c.(688-690)Gtc>Ttc	p.V230F	CHRNE_ENST00000575637.1_5'UTR|C17orf107_ENST00000381365.3_3'UTR	NM_000080.3	NP_000071.1	Q04844	ACHE_HUMAN	cholinergic receptor, nicotinic, epsilon (muscle)	230					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|muscle contraction (GO:0006936)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|cation transmembrane transporter activity (GO:0008324)	p.V230F(1)		central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(5)|lung(3)|prostate(1)	12					Galantamine(DB00674)	GAGTAGATGACGTCAGTCTCC	0.652																																							uc002fzk.1		NA																	1	Substitution - Missense(1)		lung(1)		0	GRCh37	CI991991	CHRNE	I		c.(688-690)GTC>TTC		nicotinic acetylcholine receptor epsilon							82.0	89.0	87.0					17																	4804399		2203	4300	6503	SO:0001583	missense	1145				muscle contraction|synaptic transmission, cholinergic	cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity	g.chr17:4804399C>A	X66403	CCDS11058.1	17p13.2	2012-02-11	2012-02-07		ENSG00000108556	ENSG00000108556		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1966	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, epsilon (muscle)"""	100725	"""cholinergic receptor, nicotinic, epsilon"""			7688301	Standard	NM_000080		Approved	ACHRE	uc002fzk.1	Q04844	OTTHUMG00000090778	ENST00000293780.4:c.688G>T	17.37:g.4804399C>A	ENSP00000293780:p.Val230Phe		Somatic				C17orf107_uc002fzl.3_3'UTR	p.V230F	NM_000080	NP_000071	WXS	Illumina HiSeq	Unspecified	Q04844	ACHE_HUMAN			7	699	-			230			Extracellular (Potential).		D3DTK6	Missense_Mutation	SNP	ENST00000293780.4	37	c.688G>T	CCDS11058.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.076177	0.76415	.	.	ENSG00000108556	ENST00000293780	D	0.83506	-1.73	4.86	0.51	0.16983	Neurotransmitter-gated ion-channel ligand-binding (3);	0.257039	0.37530	N	0.002045	D	0.88492	0.6451	M	0.91406	3.205	0.80722	D	1	P	0.52316	0.952	P	0.58970	0.849	D	0.84896	0.0839	10	0.87932	D	0	.	3.3657	0.07202	0.3062:0.4339:0.0:0.26	.	230	Q04844	ACHE_HUMAN	F	230	ENSP00000293780:V230F	ENSP00000293780:V230F	V	-	1	0	CHRNE	4745178	0.003000	0.15002	0.707000	0.30419	0.835000	0.47333	0.005000	0.13129	0.248000	0.21435	0.655000	0.94253	GTC		0.652	CHRNE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207560.3			14	112	1	0	1.5739e-10	0.004007	2.45552e-10	14	112				
TP53	7157	broad.mit.edu	37	17	7577535	7577535	+	Missense_Mutation	SNP	C	C	A	rs587782329		TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr17:7577535C>A	ENST00000269305.4	-	7	935	c.746G>T	c.(745-747)aGg>aTg	p.R249M	TP53_ENST00000413465.2_Missense_Mutation_p.R249M|TP53_ENST00000445888.2_Missense_Mutation_p.R249M|TP53_ENST00000359597.4_Missense_Mutation_p.R249M|TP53_ENST00000455263.2_Missense_Mutation_p.R249M|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Missense_Mutation_p.R249M	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	249	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		R -> G (in sporadic cancers; somatic mutation).|R -> I (in a sporadic cancer; somatic mutation).|R -> K (in sporadic cancers; somatic mutation).|R -> M (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:17224074}.|R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> S (in sporadic cancers; somatic mutation; does not induce SNAI1 degradation; dbSNP:rs28934571). {ECO:0000269|PubMed:1694291, ECO:0000269|PubMed:16959974}.|R -> T (in sporadic cancers; somatic mutation).|R -> W (in sporadic cancers; somatic mutation).|RP -> SA (in a sporadic cancer; somatic mutation).|RP -> SS (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R249M(38)|p.R249K(20)|p.R249T(16)|p.0?(8)|p.?(5)|p.R249fs*96(4)|p.M246_P250delMNRRP(2)|p.R248_P250delRRP(1)|p.R249_P250delRP(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R249fs*14(1)|p.R249_T256delRPILTIIT(1)|p.R249_I251delRPI(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GAGGATGGGCCTCCGGTTCAT	0.567		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	Pancreas(47;798 1329 9957 10801)	uc002gim.2		111	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	Mis|N|F	tumor protein p53			"""L, E, M, O"""		breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types	breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types		100	Substitution - Missense(74)|Whole gene deletion(8)|Deletion - In frame(8)|Deletion - Frameshift(5)|Unknown(5)	p.R249S(303)|p.R249M(25)|p.R249G(24)|p.R249W(23)|p.R249T(16)|p.R249K(14)|p.0?(7)|p.R249R(6)|p.R249fs*96(6)|p.M246_P250delMNRRP(2)|p.R249fs*14(2)|p.R248_P250delRRP(1)|p.R249_P250delRP(1)|p.R249_P250insR(1)|p.R249_P250>SS(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R249fs*19(1)|p.R249_T256delRPILTIIT(1)|p.R249fs*15(1)|p.R249_I251delRPI(1)	lung(22)|upper_aerodigestive_tract(12)|breast(8)|large_intestine(7)|liver(7)|stomach(6)|haematopoietic_and_lymphoid_tissue(5)|biliary_tract(5)|oesophagus(5)|skin(4)|bone(4)|central_nervous_system(3)|ovary(3)|adrenal_gland(2)|urinary_tract(2)|pancreas(2)|peritoneum(1)|soft_tissue(1)|prostate(1)	large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245						c.(745-747)AGG>ATG	Other_conserved_DNA_damage_response_genes	tumor protein p53 isoform a							154.0	113.0	127.0					17																	7577535		2203	4300	6503	SO:0001583	missense	7157	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumensyndrome|Osteosarcoma_Familial_Clustering_of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	g.chr17:7577535C>A	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.746G>T	17.37:g.7577535C>A	ENSP00000269305:p.Arg249Met	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)	Somatic				TP53_uc002gig.1_Missense_Mutation_p.R249M|TP53_uc002gih.2_Missense_Mutation_p.R249M|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R117M|TP53_uc010cng.1_Missense_Mutation_p.R117M|TP53_uc002gii.1_Missense_Mutation_p.R117M|TP53_uc010cnh.1_Missense_Mutation_p.R249M|TP53_uc010cni.1_Missense_Mutation_p.R249M|TP53_uc002gij.2_Missense_Mutation_p.R249M|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.R156M|TP53_uc002gio.2_Missense_Mutation_p.R117M	p.R249M	NM_001126112	NP_001119584	WXS	Illumina HiSeq	Unspecified	P04637	P53_HUMAN		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	7	940	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	249		R -> W (in sporadic cancers; somatic mutation).|RP -> SA (in a sporadic cancer; somatic mutation).|RP -> SS (in sporadic cancers; somatic mutation).|R -> T (in sporadic cancers; somatic mutation).|R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> I (in a sporadic cancer; somatic mutation).|R -> M (in sporadic cancers; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> K (in sporadic cancers; somatic mutation).	|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	c.746G>T	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.284101	0.80803	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D;D	0.99869	-7.33;-7.33;-7.33;-7.33;-7.33;-7.33;-7.33	4.62	3.64	0.41730	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99871	0.9939	M	0.92367	3.3	0.52501	D	0.999959	P;D;P;P;D	0.89917	0.932;1.0;0.945;0.86;1.0	P;D;P;P;D	0.87578	0.622;0.998;0.795;0.453;0.991	D	0.96551	0.9408	10	0.87932	D	0	-3.0658	12.8645	0.57932	0.0:0.8349:0.1651:0.0	.	249;249;249;249;249	P04637-2;P04637-3;P04637;Q1MSW8;E7EQX7	.;.;P53_HUMAN;.;.	M	249;249;249;249;249;249;238;117	ENSP00000410739:R249M;ENSP00000352610:R249M;ENSP00000269305:R249M;ENSP00000398846:R249M;ENSP00000391127:R249M;ENSP00000391478:R249M;ENSP00000425104:R117M	ENSP00000269305:R249M	R	-	2	0	TP53	7518260	0.835000	0.29415	0.998000	0.56505	0.801000	0.45260	7.609000	0.82925	1.295000	0.44724	0.462000	0.41574	AGG		0.567	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		17	55	1	0	1.40151e-16	0.010504	2.50701e-16	17	55				
MYH8	4626	broad.mit.edu	37	17	10298575	10298575	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr17:10298575C>G	ENST00000403437.2	-	34	4931	c.4837G>C	c.(4837-4839)Gat>Cat	p.D1613H	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_002472.2	NP_002463.2	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle, perinatal	1613					ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|skeletal muscle contraction (GO:0003009)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|myosin light chain binding (GO:0032027)|structural constituent of muscle (GO:0008307)	p.D1613H(1)		NS(3)|breast(8)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(61)|ovary(3)|prostate(3)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	134						CTCAGAGCATCATTTCTGCTT	0.448									Trismus-Pseudocamptodactyly Syndrome with Cardiac Myxoma and Freckling																														uc002gmm.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(6)|ovary(3)|breast(2)	11						c.(4837-4839)GAT>CAT		myosin, heavy chain 8, skeletal muscle,							262.0	222.0	235.0					17																	10298575		2203	4300	6503	SO:0001583	missense	4626	Trismus-Pseudocamptodactyly_Syndrome_with_Cardiac_Myxoma_and_Freckling	Familial Cancer Database	Carney Complex Variant	muscle filament sliding	cytosol|muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle	g.chr17:10298575C>G		CCDS11153.1	17p13.1	2013-09-19	2006-09-29		ENSG00000133020	ENSG00000133020		"""Myosins / Myosin superfamily : Class II"""	7578	protein-coding gene	gene with protein product		160741	"""myosin, heavy polypeptide 8, skeletal muscle, perinatal"""			2373371	Standard	NM_002472		Approved	MyHC-peri, MyHC-pn	uc002gmm.2	P13535	OTTHUMG00000130361	ENST00000403437.2:c.4837G>C	17.37:g.10298575C>G	ENSP00000384330:p.Asp1613His		Somatic				uc002gml.1_Intron	p.D1613H	NM_002472	NP_002463	WXS	Illumina HiSeq	Unspecified	P13535	MYH8_HUMAN			34	4932	-			1613			Potential.		Q14910	Missense_Mutation	SNP	ENST00000403437.2	37	c.4837G>C	CCDS11153.1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.398182	0.83120	.	.	ENSG00000133020	ENST00000252173;ENST00000403437	T	0.79653	-1.29	4.85	4.85	0.62838	Myosin tail (1);	0.160572	0.28671	U	0.014525	D	0.86142	0.5862	L	0.47190	1.495	0.58432	D	0.999996	D	0.56746	0.977	D	0.63793	0.918	D	0.87601	0.2497	10	0.87932	D	0	.	18.168	0.89734	0.0:1.0:0.0:0.0	.	1613	P13535	MYH8_HUMAN	H	1613	ENSP00000384330:D1613H	ENSP00000252173:D1613H	D	-	1	0	MYH8	10239300	1.000000	0.71417	0.997000	0.53966	0.929000	0.56500	5.815000	0.69215	2.521000	0.84997	0.650000	0.86243	GAT		0.448	MYH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252724.2	NM_002472		17	143	0	0	0	0.00499	0	17	143				
MYH8	4626	broad.mit.edu	37	17	10301785	10301785	+	Missense_Mutation	SNP	C	C	A	rs147143044		TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr17:10301785C>A	ENST00000403437.2	-	30	4248	c.4154G>T	c.(4153-4155)cGc>cTc	p.R1385L	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_002472.2	NP_002463.2	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle, perinatal	1385					ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|skeletal muscle contraction (GO:0003009)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|myosin light chain binding (GO:0032027)|structural constituent of muscle (GO:0008307)	p.R1385L(1)		NS(3)|breast(8)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(61)|ovary(3)|prostate(3)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	134						CTCCTCTGTGCGCTGGATGGC	0.512									Trismus-Pseudocamptodactyly Syndrome with Cardiac Myxoma and Freckling																														uc002gmm.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(6)|ovary(3)|breast(2)	11						c.(4153-4155)CGC>CTC		myosin, heavy chain 8, skeletal muscle,							178.0	170.0	173.0					17																	10301785		2203	4300	6503	SO:0001583	missense	4626	Trismus-Pseudocamptodactyly_Syndrome_with_Cardiac_Myxoma_and_Freckling	Familial Cancer Database	Carney Complex Variant	muscle filament sliding	cytosol|muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle	g.chr17:10301785C>A		CCDS11153.1	17p13.1	2013-09-19	2006-09-29		ENSG00000133020	ENSG00000133020		"""Myosins / Myosin superfamily : Class II"""	7578	protein-coding gene	gene with protein product		160741	"""myosin, heavy polypeptide 8, skeletal muscle, perinatal"""			2373371	Standard	NM_002472		Approved	MyHC-peri, MyHC-pn	uc002gmm.2	P13535	OTTHUMG00000130361	ENST00000403437.2:c.4154G>T	17.37:g.10301785C>A	ENSP00000384330:p.Arg1385Leu		Somatic				uc002gml.1_Intron	p.R1385L	NM_002472	NP_002463	WXS	Illumina HiSeq	Unspecified	P13535	MYH8_HUMAN			30	4249	-			1385			Potential.		Q14910	Missense_Mutation	SNP	ENST00000403437.2	37	c.4154G>T	CCDS11153.1	.	.	.	.	.	.	.	.	.	.	C	34	5.339306	0.95783	.	.	ENSG00000133020	ENST00000252173;ENST00000403437	T	0.80824	-1.42	5.21	5.21	0.72293	Myosin tail (1);	0.000000	0.42682	U	0.000680	D	0.90772	0.7103	M	0.86268	2.805	0.58432	D	0.999995	D	0.64830	0.994	D	0.71870	0.975	D	0.91872	0.5508	10	0.87932	D	0	.	18.9402	0.92602	0.0:1.0:0.0:0.0	.	1385	P13535	MYH8_HUMAN	L	1385	ENSP00000384330:R1385L	ENSP00000252173:R1385L	R	-	2	0	MYH8	10242510	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.525000	0.81892	2.698000	0.92095	0.655000	0.94253	CGC		0.512	MYH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252724.2	NM_002472		47	227	1	0	1.38658e-30	0.00361	2.70155e-30	47	227				
DNAH9	1770	broad.mit.edu	37	17	11757701	11757701	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr17:11757701A>T	ENST00000262442.4	+	50	9957	c.9889A>T	c.(9889-9891)Aca>Tca	p.T3297S	DNAH9_ENST00000454412.2_Missense_Mutation_p.T3297S	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	3297	Stalk. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)	p.T3297S(1)		NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		CGCGGACCTCACAGCTGCCCA	0.557																																							uc002gne.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20						c.(9889-9891)ACA>TCA		dynein, axonemal, heavy chain 9 isoform 2							48.0	50.0	49.0					17																	11757701		2203	4300	6503	SO:0001583	missense	1770				cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr17:11757701A>T	U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.9889A>T	17.37:g.11757701A>T	ENSP00000262442:p.Thr3297Ser		Somatic				DNAH9_uc010coo.2_Missense_Mutation_p.T2591S	p.T3297S	NM_001372	NP_001363	WXS	Illumina HiSeq	Unspecified	Q9NYC9	DYH9_HUMAN		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)	50	9957	+		Breast(5;0.0122)|all_epithelial(5;0.131)	3297			Stalk (By similarity).|Potential.		A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	ENST00000262442.4	37	c.9889A>T	CCDS11160.1	.	.	.	.	.	.	.	.	.	.	A	12.08	1.830255	0.32329	.	.	ENSG00000007174	ENST00000262442;ENST00000454412;ENST00000413703	T;T	0.74526	-0.85;-0.85	5.44	1.94	0.25998	Dynein heavy chain, coiled coil stalk (1);	0.382752	0.26328	N	0.025018	T	0.47967	0.1474	N	0.10916	0.065	0.80722	D	1	B	0.06786	0.001	B	0.16722	0.016	T	0.26326	-1.0106	10	0.26408	T	0.33	.	3.2832	0.06922	0.4181:0.2244:0.3574:0.0	.	3297	Q9NYC9	DYH9_HUMAN	S	3297;3297;1879	ENSP00000262442:T3297S;ENSP00000414874:T3297S	ENSP00000262442:T3297S	T	+	1	0	DNAH9	11698426	0.225000	0.23685	0.981000	0.43875	0.912000	0.54170	1.395000	0.34520	1.077000	0.40990	0.533000	0.62120	ACA		0.557	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	NM_001372		13	58	0	0	0	0.00245	0	13	58				
MAPK7	5598	broad.mit.edu	37	17	19285382	19285382	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr17:19285382C>G	ENST00000308406.5	+	5	2152	c.1766C>G	c.(1765-1767)cCt>cGt	p.P589R	MAPK7_ENST00000299612.7_Missense_Mutation_p.P450R|MFAP4_ENST00000574313.2_5'Flank|MAPK7_ENST00000571657.1_Intron|MAPK7_ENST00000395602.4_Missense_Mutation_p.P589R|MAPK7_ENST00000395604.3_Missense_Mutation_p.P589R	NM_139033.2	NP_620602.2	Q13164	MK07_HUMAN	mitogen-activated protein kinase 7	589	May not be required for kinase activity; required to stimulate MEF2C activity. {ECO:0000250}.|Pro-rich.				cAMP-mediated signaling (GO:0019933)|cell cycle (GO:0007049)|cell differentiation (GO:0030154)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to transforming growth factor beta stimulus (GO:0071560)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cAMP catabolic process (GO:0030821)|negative regulation of cyclic-nucleotide phosphodiesterase activity (GO:0051344)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of inflammatory response (GO:0050728)|negative regulation of NFAT protein import into nucleus (GO:0051534)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|negative regulation of response to cytokine stimulus (GO:0060761)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of protein metabolic process (GO:0051247)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|regulation of angiogenesis (GO:0045765)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|mitogen-activated protein kinase binding (GO:0051019)	p.P589R(1)		autonomic_ganglia(1)|central_nervous_system(4)|endometrium(5)|kidney(2)|large_intestine(4)|lung(9)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	30	all_cancers(12;2.87e-05)|all_epithelial(12;0.00114)|Hepatocellular(7;0.00345)|Breast(13;0.206)					gtgccggcccctgccccagcg	0.662																																							uc002gvn.2		NA																	1	Substitution - Missense(1)	p.P589S(1)	lung(1)	central_nervous_system(4)|lung(3)|stomach(1)|skin(1)	9						c.(1765-1767)CCT>CGT		mitogen-activated protein kinase 7 isoform 1							12.0	12.0	12.0					17																	19285382		2192	4282	6474	SO:0001583	missense	5598				cell cycle|cell differentiation|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase activity|protein binding	g.chr17:19285382C>G	U25278	CCDS11206.1, CCDS11207.1	17p11.2	2011-06-09			ENSG00000166484	ENSG00000166484	2.7.11.24	"""Mitogen-activated protein kinase cascade / Kinases"""	6880	protein-coding gene	gene with protein product	"""BMK1 kinase"", ""extracellular-signal-regulated kinase 5"""	602521		PRKM7		10072598, 7759517	Standard	NM_139032		Approved	BMK1, ERK5	uc002gvp.3	Q13164	OTTHUMG00000059587	ENST00000308406.5:c.1766C>G	17.37:g.19285382C>G	ENSP00000311005:p.Pro589Arg		Somatic				MAPK7_uc002gvo.2_Missense_Mutation_p.P450R|MAPK7_uc002gvq.2_Missense_Mutation_p.P589R|MAPK7_uc002gvp.2_Missense_Mutation_p.P589R|uc010vyt.1_5'Flank	p.P589R	NM_139033	NP_620602	WXS	Illumina HiSeq	Unspecified	Q13164	MK07_HUMAN			5	2152	+	all_cancers(12;2.87e-05)|all_epithelial(12;0.00114)|Hepatocellular(7;0.00345)|Breast(13;0.206)		589			May not be required for kinase activity; required to stimulate MEF2C activity (By similarity).|Pro-rich.		Q16634|Q59F50|Q6QLU7|Q7L4P4|Q969G1|Q96G51	Missense_Mutation	SNP	ENST00000308406.5	37	c.1766C>G	CCDS11206.1	.	.	.	.	.	.	.	.	.	.	C	0.452	-0.893262	0.02491	.	.	ENSG00000166484	ENST00000308406;ENST00000299612;ENST00000395604;ENST00000395602	T;T;T;T	0.73047	-0.44;-0.71;-0.44;-0.44	3.19	-6.37	0.01963	.	1.460970	0.04383	N	0.361188	T	0.50497	0.1619	L	0.29908	0.895	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.34750	-0.9816	10	0.66056	D	0.02	.	0.6113	0.00762	0.3473:0.2879:0.1278:0.237	.	589	Q13164	MK07_HUMAN	R	589;450;589;589	ENSP00000311005:P589R;ENSP00000299612:P450R;ENSP00000378968:P589R;ENSP00000378966:P589R	ENSP00000299612:P450R	P	+	2	0	MAPK7	19225975	0.032000	0.19561	0.000000	0.03702	0.055000	0.15305	2.950000	0.49081	-0.878000	0.04007	-0.479000	0.04858	CCT		0.662	MAPK7-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132506.1	NM_139033		5	12	0	0	0	0.001984	0	5	12				
CPD	1362	broad.mit.edu	37	17	28754530	28754530	+	Silent	SNP	C	C	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr17:28754530C>T	ENST00000225719.4	+	7	2047	c.1971C>T	c.(1969-1971)agC>agT	p.S657S	CPD_ENST00000543464.2_Silent_p.S410S	NM_001304.4	NP_001295.2	O75976	CBPD_HUMAN	carboxypeptidase D	657	Carboxypeptidase-like 2.					extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	metallocarboxypeptidase activity (GO:0004181)|serine-type carboxypeptidase activity (GO:0004185)|zinc ion binding (GO:0008270)	p.S657S(1)		central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(13)|skin(5)|stomach(1)|urinary_tract(1)	36						CTGTAATGAGCTGGATGAAGT	0.408																																							uc002hfb.1		NA																	1	Substitution - coding silent(1)		lung(1)	liver(1)|skin(1)	2						c.(1969-1971)AGC>AGT		carboxypeptidase D precursor							156.0	138.0	144.0					17																	28754530		2203	4300	6503	SO:0001819	synonymous_variant	1362				proteolysis	integral to membrane	metallocarboxypeptidase activity|serine-type carboxypeptidase activity|zinc ion binding	g.chr17:28754530C>T	U65090	CCDS11257.1, CCDS56025.1	17q11.2	2012-02-10			ENSG00000108582	ENSG00000108582	3.4.17.22		2301	protein-coding gene	gene with protein product	"""metallocarboxypeptidase D"""	603102				9628828, 9355738	Standard	NM_001304		Approved	GP180	uc002hfb.2	O75976	OTTHUMG00000132797	ENST00000225719.4:c.1971C>T	17.37:g.28754530C>T			Somatic				CPD_uc010wbo.1_Silent_p.S410S|CPD_uc010wbp.1_RNA	p.S657S	NM_001304	NP_001295	WXS	Illumina HiSeq	Unspecified	O75976	CBPD_HUMAN			7	1986	+			657			Extracellular (Potential).|Carboxypeptidase-like 2.		B7Z7T9|B7ZAU4|F5GZH6|O15377|Q86SH9|Q86XE6	Silent	SNP	ENST00000225719.4	37	c.1971C>T	CCDS11257.1																																																																																				0.408	CPD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256214.3	NM_001304		24	179	0	0	0	0.00333	0	24	179				
MYO1D	4642	broad.mit.edu	37	17	31075963	31075963	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr17:31075963C>A	ENST00000318217.5	-	12	1833	c.1529G>T	c.(1528-1530)gGc>gTc	p.G510V	MYO1D_ENST00000584232.1_5'UTR|MYO1D_ENST00000394649.4_Missense_Mutation_p.G422V|MYO1D_ENST00000579584.1_Missense_Mutation_p.G510V	NM_015194.1	NP_056009.1	O94832	MYO1D_HUMAN	myosin ID	510	Myosin motor.				early endosome to recycling endosome transport (GO:0061502)|negative regulation of phosphatase activity (GO:0010923)	axolemma (GO:0030673)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|smooth endoplasmic reticulum (GO:0005790)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)	p.G510V(1)		breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(14)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39			BRCA - Breast invasive adenocarcinoma(9;0.0362)			CACTACATCGCCTGCATAATG	0.368																																							uc002hho.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|ovary(1)|central_nervous_system(1)	3						c.(1528-1530)GGC>GTC		myosin ID							154.0	138.0	143.0					17																	31075963		2203	4300	6503	SO:0001583	missense	4642					myosin complex	actin binding|ATP binding|calmodulin binding	g.chr17:31075963C>A	AB018270	CCDS32615.1	17q11-q12	2014-06-12				ENSG00000176658		"""Myosins / Myosin superfamily : Class I"""	7598	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 108"""	606539				8884266	Standard	NM_015194		Approved	KIAA0727, myr4, PPP1R108	uc002hho.1	O94832		ENST00000318217.5:c.1529G>T	17.37:g.31075963C>A	ENSP00000324527:p.Gly510Val		Somatic				MYO1D_uc002hhp.1_Missense_Mutation_p.G510V	p.G510V	NM_015194	NP_056009	WXS	Illumina HiSeq	Unspecified	O94832	MYO1D_HUMAN	BRCA - Breast invasive adenocarcinoma(9;0.0362)		12	1541	-			510			Myosin head-like.		A6H8V3|Q8NHP9	Missense_Mutation	SNP	ENST00000318217.5	37	c.1529G>T	CCDS32615.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.309953	0.81247	.	.	ENSG00000176658	ENST00000318217	T	0.79940	-1.32	5.97	5.97	0.96955	Myosin head, motor domain (2);	0.000000	0.39475	U	0.001342	D	0.93311	0.7868	H	0.96208	3.785	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.94738	0.7916	10	0.87932	D	0	.	17.9263	0.88985	0.0:1.0:0.0:0.0	.	421;510	Q7Z3N6;O94832	.;MYO1D_HUMAN	V	510	ENSP00000324527:G510V	ENSP00000324527:G510V	G	-	2	0	MYO1D	28100076	1.000000	0.71417	0.533000	0.28001	0.626000	0.37791	7.270000	0.78493	2.833000	0.97629	0.585000	0.79938	GGC		0.368	MYO1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447457.1			21	142	1	0	3.08376e-08	0.00333	4.32352e-08	21	142				
MYO1D	4642	broad.mit.edu	37	17	31075976	31075976	+	Nonsense_Mutation	SNP	G	G	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr17:31075976G>A	ENST00000318217.5	-	12	1820	c.1516C>T	c.(1516-1518)Cga>Tga	p.R506*	MYO1D_ENST00000584232.1_5'UTR|MYO1D_ENST00000394649.4_Nonsense_Mutation_p.R418*|MYO1D_ENST00000579584.1_Nonsense_Mutation_p.R506*	NM_015194.1	NP_056009.1	O94832	MYO1D_HUMAN	myosin ID	506	Myosin motor.				early endosome to recycling endosome transport (GO:0061502)|negative regulation of phosphatase activity (GO:0010923)	axolemma (GO:0030673)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|smooth endoplasmic reticulum (GO:0005790)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)	p.R506*(2)		breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(14)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39			BRCA - Breast invasive adenocarcinoma(9;0.0362)			GCATAATGTCGAATTCGAAAA	0.373																																							uc002hho.1		NA																	2	Substitution - Nonsense(2)		lung(1)|skin(1)	large_intestine(1)|ovary(1)|central_nervous_system(1)	3						c.(1516-1518)CGA>TGA		myosin ID							146.0	133.0	137.0					17																	31075976		2203	4300	6503	SO:0001587	stop_gained	4642					myosin complex	actin binding|ATP binding|calmodulin binding	g.chr17:31075976G>A	AB018270	CCDS32615.1	17q11-q12	2014-06-12				ENSG00000176658		"""Myosins / Myosin superfamily : Class I"""	7598	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 108"""	606539				8884266	Standard	NM_015194		Approved	KIAA0727, myr4, PPP1R108	uc002hho.1	O94832		ENST00000318217.5:c.1516C>T	17.37:g.31075976G>A	ENSP00000324527:p.Arg506*		Somatic				MYO1D_uc002hhp.1_Nonsense_Mutation_p.R506*	p.R506*	NM_015194	NP_056009	WXS	Illumina HiSeq	Unspecified	O94832	MYO1D_HUMAN	BRCA - Breast invasive adenocarcinoma(9;0.0362)		12	1528	-			506			Myosin head-like.		A6H8V3|Q8NHP9	Nonsense_Mutation	SNP	ENST00000318217.5	37	c.1516C>T	CCDS32615.1	.	.	.	.	.	.	.	.	.	.	G	43	9.953257	0.99303	.	.	ENSG00000176658	ENST00000318217	.	.	.	5.97	3.84	0.44239	.	0.212168	0.21935	U	0.066965	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.08599	T	0.76	.	12.8118	0.57643	0.0:0.0:0.6619:0.338	.	.	.	.	X	506	.	ENSP00000324527:R506X	R	-	1	2	MYO1D	28100089	0.905000	0.30787	0.982000	0.44146	0.979000	0.70002	1.092000	0.30927	1.490000	0.48466	0.585000	0.79938	CGA		0.373	MYO1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447457.1			22	147	0	0	0	0.00333	0	22	147				
CNTD1	124817	broad.mit.edu	37	17	40958759	40958759	+	Silent	SNP	C	C	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr17:40958759C>T	ENST00000588408.1	+	5	924	c.648C>T	c.(646-648)gtC>gtT	p.V216V	CNTD1_ENST00000588527.1_Silent_p.V133V|CNTD1_ENST00000315066.5_3'UTR	NM_173478.2	NP_775749.2	Q8N815	CNTD1_HUMAN	cyclin N-terminal domain containing 1	216								p.V216V(1)		central_nervous_system(2)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	10		Breast(137;0.00104)		BRCA - Breast invasive adenocarcinoma(366;0.0749)		TCGACCTGGTCTATCTTCTGC	0.488																																							uc002ibm.3		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)	1						c.(646-648)GTC>GTT		cyclin N-terminal domain containing 1							162.0	143.0	150.0					17																	40958759		2203	4300	6503	SO:0001819	synonymous_variant	124817							g.chr17:40958759C>T	AK097456	CCDS11440.1	17q21.31	2014-07-03	2006-03-31	2006-03-31	ENSG00000176563	ENSG00000176563			26847	protein-coding gene	gene with protein product			"""cyclin N-terminal domain containing"""	CNTD		24891606	Standard	NM_173478		Approved	FLJ40137	uc002ibm.4	Q8N815		ENST00000588408.1:c.648C>T	17.37:g.40958759C>T			Somatic				CNTD1_uc010wha.1_Silent_p.V133V	p.V216V	NM_173478	NP_775749	WXS	Illumina HiSeq	Unspecified	Q8N815	CNTD1_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.0749)	5	880	+		Breast(137;0.00104)	216					Q658Q6|Q8NEP1	Silent	SNP	ENST00000588408.1	37	c.648C>T	CCDS11440.1																																																																																				0.488	CNTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452398.1	NM_173478		17	164	0	0	0	0.007413	0	17	164				
SPATA32	124783	broad.mit.edu	37	17	43332762	43332762	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr17:43332762G>A	ENST00000331780.4	-	4	882	c.787C>T	c.(787-789)Cac>Tac	p.H263Y	MAP3K14-AS1_ENST00000590100.1_RNA|MAP3K14-AS1_ENST00000592422.1_RNA|MAP3K14-AS1_ENST00000591263.1_RNA|SPATA32_ENST00000543122.1_Missense_Mutation_p.H242Y|MAP3K14-AS1_ENST00000588160.1_RNA|MAP3K14-AS1_ENST00000588698.1_RNA|MAP3K14-AS1_ENST00000585346.1_RNA|MAP3K14-AS1_ENST00000588504.1_RNA	NM_152343.2	NP_689556.2	Q96LK8	SPT32_HUMAN	spermatogenesis associated 32	263					spermatogenesis (GO:0007283)	perinuclear region of cytoplasm (GO:0048471)		p.H263Y(1)									TTCATCATGTGTTCCAAACTG	0.582																																							uc002iis.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|ovary(1)	2						c.(787-789)CAC>TAC		hypothetical protein LOC124783							64.0	59.0	61.0					17																	43332762		2203	4300	6503	SO:0001583	missense	124783							g.chr17:43332762G>A	AK058143	CCDS32669.1	17q21.31	2013-10-11	2012-10-08	2012-10-08	ENSG00000184361	ENSG00000184361			26349	protein-coding gene	gene with protein product	"""acrosome expressed 2"""		"""chromosome 17 open reading frame 46"", ""testis expressed 34"""	C17orf46, TEX34		18621766	Standard	NM_152343		Approved	FLJ25414, AEP2, VAD1.2	uc002iis.1	Q96LK8	OTTHUMG00000180363	ENST00000331780.4:c.787C>T	17.37:g.43332762G>A	ENSP00000331532:p.His263Tyr		Somatic				LOC100133991_uc010dah.2_Intron|C17orf46_uc010wjk.1_Missense_Mutation_p.H242Y	p.H263Y	NM_152343	NP_689556	WXS	Illumina HiSeq	Unspecified	Q96LK8	CQ046_HUMAN			4	883	-			263					Q7Z4U1|Q8N6V6	Missense_Mutation	SNP	ENST00000331780.4	37	c.787C>T	CCDS32669.1	.	.	.	.	.	.	.	.	.	.	G	9.460	1.092973	0.20471	.	.	ENSG00000184361	ENST00000331780;ENST00000543122	T;T	0.47177	0.85;0.85	3.37	0.944	0.19537	.	1.209610	0.05974	N	0.642895	T	0.53126	0.1777	L	0.50333	1.59	0.09310	N	1	D	0.64830	0.994	P	0.53912	0.737	T	0.43278	-0.9401	10	0.38643	T	0.18	-21.3321	8.2549	0.31748	0.0:0.0:0.4423:0.5577	.	263	Q96LK8	CQ046_HUMAN	Y	263;242	ENSP00000331532:H263Y;ENSP00000442724:H242Y	ENSP00000331532:H263Y	H	-	1	0	C17orf46	40688545	0.001000	0.12720	0.001000	0.08648	0.051000	0.14879	0.576000	0.23744	0.249000	0.21456	0.561000	0.74099	CAC		0.582	SPATA32-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000450946.1	NM_152343		6	97	0	0	0	0.001168	0	6	97				
NXPH3	11248	broad.mit.edu	37	17	47656499	47656499	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr17:47656499G>T	ENST00000328741.5	+	2	958	c.596G>T	c.(595-597)tGc>tTc	p.C199F	NXPH3_ENST00000513748.1_Missense_Mutation_p.C199F|RP5-1029K10.4_ENST00000503624.1_RNA	NM_007225.2	NP_009156.2	O95157	NXPH3_HUMAN	neurexophilin 3	199	V (Cys-rich).				neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)		p.C199F(1)		endometrium(2)|large_intestine(3)|lung(4)|pancreas(1)|skin(2)	12	all_cancers(4;7.45e-14)|Breast(4;1.08e-27)|all_epithelial(4;2.27e-17)					GCCAAGATCTGCTCCCGAGAC	0.602																																							uc002ipa.2		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)|skin(1)	2						c.(595-597)TGC>TTC		neurexophilin 3 precursor							85.0	83.0	84.0					17																	47656499		2203	4300	6503	SO:0001583	missense	11248				neuropeptide signaling pathway	extracellular region		g.chr17:47656499G>T	AF043468	CCDS11550.1	17q	2008-07-03				ENSG00000182575			8077	protein-coding gene	gene with protein product		604636				9570794	Standard	NM_007225		Approved	NPH3	uc002ipa.3	O95157		ENST00000328741.5:c.596G>T	17.37:g.47656499G>T	ENSP00000329295:p.Cys199Phe		Somatic				NXPH3_uc010wlw.1_Missense_Mutation_p.C199F	p.C199F	NM_007225	NP_009156	WXS	Illumina HiSeq	Unspecified	O95157	NXPH3_HUMAN			2	880	+	all_cancers(4;7.45e-14)|Breast(4;1.08e-27)|all_epithelial(4;2.27e-17)		199			V (Cys-rich).		Q8NDC3|Q8TBF6|Q9ULR1	Missense_Mutation	SNP	ENST00000328741.5	37	c.596G>T	CCDS11550.1	.	.	.	.	.	.	.	.	.	.	g	22.7	4.329308	0.81690	.	.	ENSG00000182575	ENST00000328741;ENST00000513748	.	.	.	4.44	4.44	0.53790	.	0.099482	0.64402	D	0.000001	D	0.83954	0.5366	M	0.87269	2.87	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.91635	0.999;0.994	D	0.87530	0.2452	9	0.87932	D	0	-24.2869	16.8808	0.86062	0.0:0.0:1.0:0.0	.	199;199	D6RGW2;O95157	.;NXPH3_HUMAN	F	199	.	ENSP00000329295:C199F	C	+	2	0	NXPH3	45011498	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	9.643000	0.98464	2.310000	0.77875	0.556000	0.70494	TGC		0.602	NXPH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365143.1			24	132	1	0	2.79863e-10	0.004656	4.31759e-10	24	132				
LRRC59	55379	broad.mit.edu	37	17	48462617	48462617	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr17:48462617T>C	ENST00000225972.7	-	6	773	c.538A>G	c.(538-540)Aag>Gag	p.K180E	Y_RNA_ENST00000384097.1_RNA	NM_018509.3	NP_060979.2	Q96AG4	LRC59_HUMAN	leucine rich repeat containing 59	180						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial nucleoid (GO:0042645)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.K180E(1)		NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|urinary_tract(1)	13	Breast(11;5.62e-19)		BRCA - Breast invasive adenocarcinoma(22;2.43e-08)			TGAGCTTCCTTAGCTCGCTGC	0.527																																							uc002iqt.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(538-540)AAG>GAG		leucine rich repeat containing 59							110.0	110.0	110.0					17																	48462617		2203	4300	6503	SO:0001583	missense	55379					endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial nucleoid	protein binding	g.chr17:48462617T>C	AK025328	CCDS11566.1	17q21.33	2014-02-12	2006-01-12		ENSG00000108829	ENSG00000108829			28817	protein-coding gene	gene with protein product		614854				12477932	Standard	NM_018509		Approved	PRO1855, FLJ21675	uc002iqt.3	Q96AG4	OTTHUMG00000162079	ENST00000225972.7:c.538A>G	17.37:g.48462617T>C	ENSP00000225972:p.Lys180Glu		Somatic					p.K180E	NM_018509	NP_060979	WXS	Illumina HiSeq	Unspecified	Q96AG4	LRC59_HUMAN	BRCA - Breast invasive adenocarcinoma(22;2.43e-08)		6	692	-	Breast(11;5.62e-19)		180			Potential.|Cytoplasmic (Potential).		B2RE83|D3DTX8|Q9P189	Missense_Mutation	SNP	ENST00000225972.7	37	c.538A>G	CCDS11566.1	.	.	.	.	.	.	.	.	.	.	T	17.95	3.514348	0.64522	.	.	ENSG00000108829	ENST00000225972	T	0.06068	3.35	5.87	4.73	0.59995	.	0.206543	0.47093	D	0.000244	T	0.04588	0.0125	L	0.27053	0.805	0.80722	D	1	P	0.37781	0.608	B	0.32090	0.14	T	0.54200	-0.8329	10	0.19147	T	0.46	.	13.0564	0.58982	0.0:0.0:0.1338:0.8661	.	180	Q96AG4	LRC59_HUMAN	E	180	ENSP00000225972:K180E	ENSP00000225972:K180E	K	-	1	0	LRRC59	45817616	0.994000	0.37717	0.985000	0.45067	0.993000	0.82548	2.417000	0.44653	2.371000	0.80710	0.533000	0.62120	AAG		0.527	LRRC59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367117.2	NM_018509		35	224	0	0	0	0.006999	0	35	224				
CA10	56934	broad.mit.edu	37	17	49710858	49710858	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr17:49710858C>A	ENST00000285273.4	-	9	2054	c.943G>T	c.(943-945)Gcc>Tcc	p.A315S	CA10_ENST00000570565.1_Missense_Mutation_p.A240S|CA10_ENST00000451037.2_Missense_Mutation_p.A315S|CA10_ENST00000442502.2_Missense_Mutation_p.A315S|CA10_ENST00000340813.6_Missense_Mutation_p.A321S|CA10_ENST00000571918.1_5'Flank	NM_001082533.1	NP_001076002.1	Q9NS85	CAH10_HUMAN	carbonic anhydrase X	315					brain development (GO:0007420)			p.A315S(1)		cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(21)|ovary(1)|skin(3)|stomach(2)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(22;4.74e-06)		Zonisamide(DB00909)	AGCTTCTGGGCTCGGTTGTTT	0.512																																							uc002itw.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(943-945)GCC>TCC		carbonic anhydrase X							129.0	116.0	121.0					17																	49710858		2203	4300	6503	SO:0001583	missense	56934				brain development			g.chr17:49710858C>A	AF288385	CCDS32684.1	17q21	2012-08-21			ENSG00000154975	ENSG00000154975		"""Carbonic anhydrases"""	1369	protein-coding gene	gene with protein product		604642				8673298, 9921901	Standard	NM_020178		Approved	CARPX, CA-RPX, HUCEP-15	uc002itx.4	Q9NS85	OTTHUMG00000177544	ENST00000285273.4:c.943G>T	17.37:g.49710858C>A	ENSP00000285273:p.Ala315Ser		Somatic				CA10_uc002itu.3_Missense_Mutation_p.A244S|CA10_uc002itv.3_Missense_Mutation_p.A321S|CA10_uc002itx.3_Missense_Mutation_p.A315S|CA10_uc002ity.3_Missense_Mutation_p.A315S|CA10_uc002itz.2_Missense_Mutation_p.A315S	p.A315S	NM_020178	NP_064563	WXS	Illumina HiSeq	Unspecified	Q9NS85	CAH10_HUMAN	BRCA - Breast invasive adenocarcinoma(22;4.74e-06)		8	1929	-			315					B2R7J0|B4DGL6	Missense_Mutation	SNP	ENST00000285273.4	37	c.943G>T	CCDS32684.1	.	.	.	.	.	.	.	.	.	.	C	14.88	2.668066	0.47677	.	.	ENSG00000154975	ENST00000442502;ENST00000285273;ENST00000451037;ENST00000340813	T;T;T;T	0.69306	-0.37;-0.37;-0.37;-0.39	5.44	4.41	0.53225	.	0.059688	0.64402	D	0.000003	T	0.52948	0.1766	L	0.29908	0.895	0.51482	D	0.999922	B;P;B	0.37914	0.418;0.611;0.001	B;B;B	0.36378	0.169;0.223;0.002	T	0.51276	-0.8726	10	0.22109	T	0.4	.	14.775	0.69724	0.0:0.8553:0.1447:0.0	.	315;321;240	Q9NS85;Q68D28;B4DGL6	CAH10_HUMAN;.;.	S	315;315;315;321	ENSP00000390666:A315S;ENSP00000285273:A315S;ENSP00000405388:A315S;ENSP00000340363:A321S	ENSP00000285273:A315S	A	-	1	0	CA10	47065857	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.715000	0.61909	2.558000	0.86282	0.655000	0.94253	GCC		0.512	CA10-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000437480.1	NM_020178		6	100	1	0	5.4927e-09	0.004482	7.99815e-09	6	100				
TANC2	26115	broad.mit.edu	37	17	61498459	61498459	+	Nonsense_Mutation	SNP	C	C	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr17:61498459C>T	ENST00000424789.2	+	25	5120	c.5116C>T	c.(5116-5118)Cga>Tga	p.R1706*	RP11-269G24.3_ENST00000583552.1_RNA|TANC2_ENST00000389520.4_Nonsense_Mutation_p.R1716*	NM_025185.3	NP_079461.2	Q9HCD6	TANC2_HUMAN	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2	1706					in utero embryonic development (GO:0001701)			p.R1716*(2)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|upper_aerodigestive_tract(3)	44						CTCAGCATACCGAGGTGGCGT	0.567																																							uc002jal.3		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(2)	2						c.(5116-5118)CGA>TGA		tetratricopeptide repeat, ankyrin repeat and							170.0	172.0	171.0					17																	61498459		2186	4266	6452	SO:0001587	stop_gained	26115						binding	g.chr17:61498459C>T	AB032974	CCDS45754.1	17q23.3	2013-01-11				ENSG00000170921		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30212	protein-coding gene	gene with protein product	"""rolling pebbles homolog B (Drosophila)"""	615047					Standard	NM_025185		Approved	DKFZP564D166, FLJ10215, FLJ11824, KIAA1148, KIAA1636, rols, ROLSA	uc002jal.4	Q9HCD6		ENST00000424789.2:c.5116C>T	17.37:g.61498459C>T	ENSP00000387593:p.Arg1706*		Somatic				TANC2_uc010wpe.1_3'UTR|TANC2_uc002jao.3_Nonsense_Mutation_p.R817*	p.R1706*	NM_025185	NP_079461	WXS	Illumina HiSeq	Unspecified	Q9HCD6	TANC2_HUMAN			25	5139	+			1706					Q9HAC3|Q9NW88|Q9NXY9|Q9ULS2	Nonsense_Mutation	SNP	ENST00000424789.2	37	c.5116C>T	CCDS45754.1	.	.	.	.	.	.	.	.	.	.	C	41	8.641087	0.98897	.	.	ENSG00000170921	ENST00000389520;ENST00000424789	.	.	.	5.06	5.06	0.68205	.	0.074862	0.53938	D	0.000048	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.1352	0.59405	0.17:0.83:0.0:0.0	.	.	.	.	X	1716;1706	.	ENSP00000374171:R1716X	R	+	1	2	TANC2	58852191	0.987000	0.35691	1.000000	0.80357	0.788000	0.44548	1.158000	0.31737	2.797000	0.96272	0.561000	0.74099	CGA		0.567	TANC2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444765.1			19	279	0	0	0	0.007413	0	19	279				
ABCA9	10350	broad.mit.edu	37	17	66986013	66986013	+	Missense_Mutation	SNP	C	C	A	rs149991432		TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr17:66986013C>A	ENST00000340001.4	-	30	4107	c.3896G>T	c.(3895-3897)tGc>tTc	p.C1299F	ABCA9_ENST00000482072.1_5'Flank|ABCA9_ENST00000370732.2_Missense_Mutation_p.C1299F|ABCA9_ENST00000453985.2_Missense_Mutation_p.C1261F	NM_080283.3	NP_525022.2	Q8IUA7	ABCA9_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 9	1299	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.C1299F(1)		NS(2)|breast(4)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(21)|lung(35)|ovary(4)|prostate(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	91	Breast(10;1.47e-12)					TTTAGAAAAGCAATTTTTCTT	0.358																																							uc002jhu.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|upper_aerodigestive_tract(1)|central_nervous_system(1)	6						c.(3895-3897)TGC>TTC		ATP-binding cassette, sub-family A, member 9							80.0	81.0	81.0					17																	66986013		2203	4300	6503	SO:0001583	missense	10350				transport	integral to membrane	ATP binding|ATPase activity	g.chr17:66986013C>A	AF423307	CCDS11681.1	17q24	2012-03-14			ENSG00000154258	ENSG00000154258		"""ATP binding cassette transporters / subfamily A"""	39	protein-coding gene	gene with protein product		612507					Standard	XM_005256934		Approved	EST640918	uc002jhu.3	Q8IUA7	OTTHUMG00000140371	ENST00000340001.4:c.3896G>T	17.37:g.66986013C>A	ENSP00000342216:p.Cys1299Phe		Somatic				ABCA9_uc010dez.2_Missense_Mutation_p.C1261F	p.C1299F	NM_080283	NP_525022	WXS	Illumina HiSeq	Unspecified	Q8IUA7	ABCA9_HUMAN			30	4039	-	Breast(10;1.47e-12)		1299			ABC transporter 2.		Q6P655|Q8N2S4|Q8WWZ5|Q96MD8	Missense_Mutation	SNP	ENST00000340001.4	37	c.3896G>T	CCDS11681.1	.	.	.	.	.	.	.	.	.	.	C	11.78	1.739528	0.30774	.	.	ENSG00000154258	ENST00000340001;ENST00000453985;ENST00000370732	T;T	0.12255	2.7;2.7	4.99	4.99	0.66335	ABC transporter-like (1);	0.000000	0.46758	D	0.000267	T	0.10423	0.0255	N	0.11201	0.11	0.32674	N	0.516382	P;B	0.40534	0.72;0.059	P;B	0.44359	0.447;0.067	T	0.12293	-1.0553	10	0.35671	T	0.21	.	12.9615	0.58462	0.1729:0.8271:0.0:0.0	.	1299;1299	Q8IUA7-3;Q8IUA7	.;ABCA9_HUMAN	F	1299;1244;1299	ENSP00000342216:C1299F;ENSP00000359767:C1299F	ENSP00000342216:C1299F	C	-	2	0	ABCA9	64497608	0.924000	0.31332	0.896000	0.35187	0.986000	0.74619	2.652000	0.46682	2.330000	0.79161	0.511000	0.50034	TGC		0.358	ABCA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277072.2	NM_172386		13	106	1	0	7.03913e-09	0.001368	1.01432e-08	13	106				
ABCA5	23461	broad.mit.edu	37	17	67243691	67243691	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr17:67243691C>T	ENST00000392676.3	-	39	4980	c.4916G>A	c.(4915-4917)aGa>aAa	p.R1639K	ABCA10_ENST00000432313.2_5'Flank|ABCA5_ENST00000588877.1_Missense_Mutation_p.R1639K|ABCA10_ENST00000416101.2_5'Flank|ABCA5_ENST00000392677.2_Missense_Mutation_p.R1640K|ABCA10_ENST00000269081.4_5'Flank			Q8WWZ7	ABCA5_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 5	1639					cholesterol efflux (GO:0033344)|high-density lipoprotein particle remodeling (GO:0034375)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|reverse cholesterol transport (GO:0043691)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.R1639K(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(18)|lung(19)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	54	Breast(10;3.72e-11)				Tacrolimus(DB00864)	AAATACTACTCTATCTTCTTG	0.333																																							uc002jif.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)|skin(1)	4						c.(4915-4917)AGA>AAA		ATP-binding cassette, sub-family A , member 5							194.0	184.0	187.0					17																	67243691		2202	4298	6500	SO:0001583	missense	23461				cholesterol efflux|high-density lipoprotein particle remodeling|negative regulation of macrophage derived foam cell differentiation	Golgi membrane|integral to membrane|late endosome membrane|lysosomal membrane	ATP binding|ATPase activity	g.chr17:67243691C>T	U66672	CCDS11685.1	17q24.3	2012-03-14			ENSG00000154265	ENSG00000154265		"""ATP binding cassette transporters / subfamily A"""	35	protein-coding gene	gene with protein product		612503				8894702	Standard	NM_172232		Approved	EST90625	uc002jig.2	Q8WWZ7		ENST00000392676.3:c.4916G>A	17.37:g.67243691C>T	ENSP00000376443:p.Arg1639Lys		Somatic				ABCA10_uc010dfa.1_5'Flank|ABCA5_uc002jib.2_Missense_Mutation_p.R605K|ABCA5_uc002jic.2_Missense_Mutation_p.R862K|ABCA5_uc002jid.2_Missense_Mutation_p.R556K|ABCA5_uc002jie.2_RNA|ABCA5_uc002jig.2_Missense_Mutation_p.R1639K	p.R1639K	NM_018672	NP_061142	WXS	Illumina HiSeq	Unspecified	Q8WWZ7	ABCA5_HUMAN			38	6134	-	Breast(10;3.72e-11)		1639					Q8IVJ2|Q96LJ1|Q96MS4|Q96PZ9|Q9NY14	Missense_Mutation	SNP	ENST00000392676.3	37	c.4916G>A	CCDS11685.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.214964	0.79352	.	.	ENSG00000154265	ENST00000392677;ENST00000392676	D;D	0.87491	-2.25;-2.26	5.6	5.6	0.85130	.	0.089981	0.47852	D	0.000211	D	0.89167	0.6638	L	0.44542	1.39	0.41343	D	0.987317	D	0.62365	0.991	P	0.54499	0.754	D	0.88976	0.3404	10	0.48119	T	0.1	.	19.6239	0.95670	0.0:1.0:0.0:0.0	.	1639	Q8WWZ7	ABCA5_HUMAN	K	1640;1639	ENSP00000376444:R1640K;ENSP00000376443:R1639K	ENSP00000376443:R1639K	R	-	2	0	ABCA5	64755286	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	5.494000	0.66905	2.649000	0.89929	0.655000	0.94253	AGA		0.333	ABCA5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000450654.1	NM_018672		8	108	0	0	0	0.004482	0	8	108				
ABCA5	23461	broad.mit.edu	37	17	67309240	67309240	+	Silent	SNP	T	T	C	rs146635038		TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr17:67309240T>C	ENST00000392676.3	-	3	364	c.300A>G	c.(298-300)ctA>ctG	p.L100L	ABCA5_ENST00000588877.1_Silent_p.L100L|ABCA5_ENST00000392677.2_Silent_p.L100L			Q8WWZ7	ABCA5_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 5	100					cholesterol efflux (GO:0033344)|high-density lipoprotein particle remodeling (GO:0034375)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|reverse cholesterol transport (GO:0043691)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.L100L(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(18)|lung(19)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	54	Breast(10;3.72e-11)				Tacrolimus(DB00864)	TACCATCAGGTAGATGATCAG	0.313													T|||	1	0.000199681	0.0	0.0	5008	,	,		13932	0.0		0.001	False		,,,				2504	0.0						uc002jif.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|central_nervous_system(1)|skin(1)	4						c.(298-300)CTA>CTG		ATP-binding cassette, sub-family A , member 5		T	,	1,4405	2.1+/-5.4	0,1,2202	76.0	78.0	77.0		300,300	2.8	0.3	17	dbSNP_134	77	0,8588		0,0,4294	no	coding-synonymous,coding-synonymous	ABCA5	NM_018672.3,NM_172232.2	,	0,1,6496	CC,CT,TT		0.0,0.0227,0.0077	,	100/1643,100/1643	67309240	1,12993	2203	4294	6497	SO:0001819	synonymous_variant	23461				cholesterol efflux|high-density lipoprotein particle remodeling|negative regulation of macrophage derived foam cell differentiation	Golgi membrane|integral to membrane|late endosome membrane|lysosomal membrane	ATP binding|ATPase activity	g.chr17:67309240T>C	U66672	CCDS11685.1	17q24.3	2012-03-14			ENSG00000154265	ENSG00000154265		"""ATP binding cassette transporters / subfamily A"""	35	protein-coding gene	gene with protein product		612503				8894702	Standard	NM_172232		Approved	EST90625	uc002jig.2	Q8WWZ7		ENST00000392676.3:c.300A>G	17.37:g.67309240T>C			Somatic				ABCA5_uc002jig.2_Silent_p.L100L|ABCA5_uc002jih.2_Silent_p.L100L|ABCA5_uc010dfe.2_Silent_p.L100L	p.L100L	NM_018672	NP_061142	WXS	Illumina HiSeq	Unspecified	Q8WWZ7	ABCA5_HUMAN			2	1518	-	Breast(10;3.72e-11)		100					Q8IVJ2|Q96LJ1|Q96MS4|Q96PZ9|Q9NY14	Silent	SNP	ENST00000392676.3	37	c.300A>G	CCDS11685.1																																																																																				0.313	ABCA5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000450654.1	NM_018672		5	66	0	0	0	0.000602	0	5	66				
P4HB	5034	broad.mit.edu	37	17	79813036	79813036	+	Silent	SNP	C	C	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr17:79813036C>A	ENST00000331483.4	-	4	828	c.606G>T	c.(604-606)ggG>ggT	p.G202G	P4HB_ENST00000576390.1_Intron|P4HB_ENST00000472244.1_5'UTR|P4HB_ENST00000439918.2_Silent_p.G158G	NM_000918.3	NP_000909.2	P07237	PDIA1_HUMAN	prolyl 4-hydroxylase, beta polypeptide	202					cell redox homeostasis (GO:0045454)|cellular response to hypoxia (GO:0071456)|extracellular matrix organization (GO:0030198)|lipoprotein metabolic process (GO:0042157)|peptidyl-proline hydroxylation to 4-hydroxy-L-proline (GO:0018401)|protein folding (GO:0006457)|regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902175)|response to endoplasmic reticulum stress (GO:0034976)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|procollagen-proline 4-dioxygenase complex (GO:0016222)	poly(A) RNA binding (GO:0044822)|procollagen-proline 4-dioxygenase activity (GO:0004656)|protein disulfide isomerase activity (GO:0003756)	p.G202G(1)		NS(1)|breast(1)|large_intestine(2)|lung(17)|urinary_tract(1)	22	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.013)|OV - Ovarian serous cystadenocarcinoma(97;0.0509)			AGAGGACAACCCCATCTTTGT	0.527																																					Colon(49;444 983 1296 7887 42561)	Colon(49;444 983 1296 7887 42561)	uc002kbn.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(604-606)GGG>GGT		prolyl 4-hydroxylase, beta subunit precursor							253.0	228.0	237.0					17																	79813036		2203	4300	6503	SO:0001819	synonymous_variant	5034				cell redox homeostasis|glycerol ether metabolic process|lipid metabolic process|lipoprotein metabolic process|peptidyl-proline hydroxylation to 4-hydroxy-L-proline	cell surface|endoplasmic reticulum lumen|ER-Golgi intermediate compartment|extracellular region|melanosome|plasma membrane	electron carrier activity|procollagen-proline 4-dioxygenase activity|protein disulfide isomerase activity|protein disulfide oxidoreductase activity	g.chr17:79813036C>A	J02783	CCDS11787.1	17q25	2011-10-19	2008-12-09		ENSG00000185624	ENSG00000185624	1.14.11.2, 5.3.4.1	"""Protein disulfide isomerases"""	8548	protein-coding gene	gene with protein product	"""protein disulfide isomerase-associated 1"", ""protein disulfide isomerase family A, member 1"", ""collagen prolyl 4-hydroxylase beta"""	176790	"""procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), beta polypeptide (protein disulfide isomerase; thyroid hormone binding protein p55)"", ""procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), beta polypeptide (protein disulfide isomerase-associated 1)"", ""procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), beta polypeptide"""	PO4DB, ERBA2L		8111381	Standard	NM_000918		Approved	PDIA1, PROHB, DSI, GIT, PDI, PO4HB, P4Hbeta	uc002kbn.1	P07237	OTTHUMG00000150269	ENST00000331483.4:c.606G>T	17.37:g.79813036C>A			Somatic				P4HB_uc002kbm.1_5'UTR	p.G202G	NM_000918	NP_000909	WXS	Illumina HiSeq	Unspecified	P07237	PDIA1_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.013)|OV - Ovarian serous cystadenocarcinoma(97;0.0509)		4	803	-	all_neural(118;0.0878)|Ovarian(332;0.12)		202					B2RDQ2|P30037|P32079|Q15205|Q6LDE5	Silent	SNP	ENST00000331483.4	37	c.606G>T	CCDS11787.1																																																																																				0.527	P4HB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317250.3	NM_000918		49	287	1	0	2.81731e-22	0.00361	5.29042e-22	49	287				
PIEZO2	63895	broad.mit.edu	37	18	10680359	10680359	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr18:10680359G>T	ENST00000503781.3	-	48	7449	c.7450C>A	c.(7450-7452)Caa>Aaa	p.Q2484K	PIEZO2_ENST00000581680.1_5'UTR|PIEZO2_ENST00000285141.4_Missense_Mutation_p.Q276K|PIEZO2_ENST00000302079.6_Missense_Mutation_p.Q2421K|PIEZO2_ENST00000580640.1_Missense_Mutation_p.Q2509K|PIEZO2_ENST00000538948.1_Missense_Mutation_p.Q441K	NM_022068.2	NP_071351.2	Q9H5I5	PIEZ2_HUMAN	piezo-type mechanosensitive ion channel component 2	2484					cation transport (GO:0006812)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|regulation of membrane potential (GO:0042391)|response to mechanical stimulus (GO:0009612)	integral component of membrane (GO:0016021)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)	p.Q276K(1)|p.Q2484K(1)									TCCAGAAATTGCATAGCACCC	0.378																																							uc002kor.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(1321-1323)CAA>AAA		family with sequence similarity 38, member B							126.0	121.0	123.0					18																	10680359		2203	4300	6503	SO:0001583	missense	63895					integral to membrane	ion channel activity	g.chr18:10680359G>T	AK027056		18p11.21	2012-11-19	2011-08-31	2011-08-31	ENSG00000154864	ENSG00000154864			26270	protein-coding gene	gene with protein product		613629	"""chromosome 18 open reading frame 30"", ""chromosome 18 open reading frame 58"", ""family with sequence similarity 38, member B"""	FAM38B2, C18orf30, C18orf58, FAM38B		20813920, 21056836, 21299953	Standard	NM_022068		Approved	FLJ23403, FLJ23144, HsT748, HsT771, FLJ34907	uc002kos.2	Q9H5I5	OTTHUMG00000178507	ENST00000503781.3:c.7450C>A	18.37:g.10680359G>T	ENSP00000421377:p.Gln2484Lys		Somatic				FAM38B_uc002koq.2_Missense_Mutation_p.Q276K	p.Q441K	NM_022068	NP_071351	WXS	Illumina HiSeq	Unspecified	Q9H5I5	PIEZ2_HUMAN			10	1461	-			2484					B7Z812|M4GPJ9|Q6ZS91|Q8N787|Q8NAR6|Q9H5R4	Missense_Mutation	SNP	ENST00000503781.3	37	c.1321C>A		.	.	.	.	.	.	.	.	.	.	G	24.5	4.539260	0.85917	.	.	ENSG00000154864	ENST00000503781;ENST00000302079;ENST00000538948;ENST00000285141	T;T	0.71817	-0.6;-0.6	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	T	0.81964	0.4934	M	0.76838	2.35	0.41753	D	0.98967	D	0.69078	0.997	P	0.62014	0.897	T	0.76418	-0.2966	10	0.08381	T	0.77	.	20.3214	0.98679	0.0:0.0:1.0:0.0	.	378	D6RFZ0	.	K	378;2484;441;276	ENSP00000443129:Q441K;ENSP00000285141:Q276K	ENSP00000285141:Q276K	Q	-	1	0	FAM38B	10670359	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.189000	0.72051	2.804000	0.96469	0.655000	0.94253	CAA		0.378	PIEZO2-003	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000442385.4	NM_022068		6	91	1	0	0.00307968	0.00308	0.00337221	6	91				
CEP192	55125	broad.mit.edu	37	18	13095519	13095519	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr18:13095519G>T	ENST00000325971.8	+	33	6077	c.4484G>T	c.(4483-4485)gGg>gTg	p.G1495V	CEP192_ENST00000506447.1_Missense_Mutation_p.G2091V|CEP192_ENST00000540847.2_3'UTR|CEP192_ENST00000430049.2_Missense_Mutation_p.G1616V			Q8TEP8	CE192_HUMAN	centrosomal protein 192kDa	1495					centrosome duplication (GO:0051298)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of phosphatase activity (GO:0010923)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	phosphatase binding (GO:0019902)	p.G2091V(1)|p.G1495V(1)		NS(1)|breast(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(36)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						GGAGCTTCTGGGAAACATGGT	0.438																																							uc010xac.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|pancreas(1)	5						c.(6271-6273)GGG>GTG		centrosomal protein 192kDa							93.0	96.0	95.0					18																	13095519		2203	4300	6503	SO:0001583	missense	55125							g.chr18:13095519G>T	AK074074	CCDS32792.1, CCDS32792.2	18p11.21	2014-02-20				ENSG00000101639		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	25515	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 62"""					11230166, 14654843	Standard	NM_032142		Approved	KIAA1569, FLJ10352, PPP1R62	uc010xac.2	Q8TEP8		ENST00000325971.8:c.4484G>T	18.37:g.13095519G>T	ENSP00000317156:p.Gly1495Val		Somatic				CEP192_uc010dlf.1_RNA|CEP192_uc010xad.1_Missense_Mutation_p.G1616V|CEP192_uc002kru.2_RNA|CEP192_uc002krv.2_Missense_Mutation_p.G513V|CEP192_uc002krw.2_Missense_Mutation_p.G240V|CEP192_uc002krx.2_Missense_Mutation_p.G95V|CEP192_uc002kry.2_RNA	p.G2091V	NM_032142	NP_115518	WXS	Illumina HiSeq	Unspecified	E9PF99	E9PF99_HUMAN			35	6352	+			2091					A0A060A9S4|E9PF99|Q8WYT8|Q9H0F4|Q9NW27	Missense_Mutation	SNP	ENST00000325971.8	37	c.6272G>T		.	.	.	.	.	.	.	.	.	.	G	1.982	-0.433797	0.04669	.	.	ENSG00000101639	ENST00000506447;ENST00000325971;ENST00000399863;ENST00000430049;ENST00000540847	T;T;T	0.33865	1.39;1.39;1.39	5.91	2.79	0.32731	.	0.369609	0.30151	N	0.010294	T	0.25158	0.0611	L	0.59436	1.845	0.09310	N	0.999993	B;B;B;B	0.32365	0.073;0.141;0.367;0.225	B;B;B;B	0.29716	0.049;0.073;0.106;0.078	T	0.12578	-1.0542	10	0.26408	T	0.33	-7.6413	0.6949	0.00897	0.382:0.1635:0.2875:0.167	.	1616;2091;95;693	C9JT09;E9PF99;F5GZ47;Q9HCK3	.;.;.;.	V	2091;1495;1495;1616;95	ENSP00000427550:G2091V;ENSP00000317156:G1495V;ENSP00000389190:G1616V	ENSP00000317156:G1495V	G	+	2	0	CEP192	13085519	0.848000	0.29623	0.003000	0.11579	0.003000	0.03518	1.400000	0.34577	0.845000	0.35118	0.650000	0.86243	GGG		0.438	CEP192-201	KNOWN	basic	protein_coding	protein_coding		NM_032142		93	224	1	0	4.98208e-43	0.00361	9.79887e-43	93	224				
DSG3	1830	broad.mit.edu	37	18	29054280	29054280	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr18:29054280G>T	ENST00000257189.4	+	15	2381	c.2298G>T	c.(2296-2298)atG>atT	p.M766I		NM_001944.2	NP_001935.2	P32926	DSG3_HUMAN	desmoglein 3	766					apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|homophilic cell adhesion (GO:0007156)	cell junction (GO:0030054)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.M766I(1)		breast(1)|central_nervous_system(2)|cervix(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(28)|ovary(4)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)	62			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			CTGGAACCATGAGAACAAGGC	0.507																																							uc002kws.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(4)|ovary(3)|lung(1)|central_nervous_system(1)	9						c.(2296-2298)ATG>ATT		desmoglein 3 preproprotein							122.0	117.0	119.0					18																	29054280		2203	4300	6503	SO:0001583	missense	1830				cellular component disassembly involved in apoptosis|homophilic cell adhesion	cytosol|desmosome|integral to membrane	calcium ion binding	g.chr18:29054280G>T	M76482	CCDS11898.1	18q12.1	2010-06-24	2010-06-24		ENSG00000134757	ENSG00000134757		"""Cadherins / Major cadherins"""	3050	protein-coding gene	gene with protein product	"""pemphigus vulgaris antigen"""	169615	"""desmoglein 3 (pemphigus vulgaris antigen)"""			1601426	Standard	NM_001944		Approved	CDHF6	uc002kws.3	P32926	OTTHUMG00000131985	ENST00000257189.4:c.2298G>T	18.37:g.29054280G>T	ENSP00000257189:p.Met766Ile		Somatic				DSG3_uc002kwt.2_Missense_Mutation_p.M48I	p.M766I	NM_001944	NP_001935	WXS	Illumina HiSeq	Unspecified	P32926	DSG3_HUMAN	OV - Ovarian serous cystadenocarcinoma(10;0.00504)		15	2407	+			766			Cytoplasmic (Potential).		A8K2V2	Missense_Mutation	SNP	ENST00000257189.4	37	c.2298G>T	CCDS11898.1	.	.	.	.	.	.	.	.	.	.	G	4.802	0.149207	0.09185	.	.	ENSG00000134757	ENST00000257189	T	0.58797	0.31	5.53	2.74	0.32292	.	0.251256	0.28630	N	0.014668	T	0.46464	0.1394	L	0.56769	1.78	0.26553	N	0.973871	B	0.25850	0.136	B	0.24006	0.05	T	0.37753	-0.9692	10	0.36615	T	0.2	.	3.9982	0.09568	0.1095:0.2605:0.4953:0.1346	.	766	P32926	DSG3_HUMAN	I	766	ENSP00000257189:M766I	ENSP00000257189:M766I	M	+	3	0	DSG3	27308278	0.999000	0.42202	0.945000	0.38365	0.187000	0.23431	0.905000	0.28504	0.428000	0.26173	0.650000	0.86243	ATG		0.507	DSG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254949.1	NM_001944		20	112	1	0	4.96729e-08	0.008871	6.84859e-08	20	112				
ZCCHC2	54877	broad.mit.edu	37	18	60243765	60243765	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr18:60243765G>C	ENST00000269499.5	+	14	3908	c.3490G>C	c.(3490-3492)Gca>Cca	p.A1164P	ZCCHC2_ENST00000586834.1_Missense_Mutation_p.A843P	NM_017742.4	NP_060212.4	Q9C0B9	ZCHC2_HUMAN	zinc finger, CCHC domain containing 2	1164						cytoplasm (GO:0005737)	nucleic acid binding (GO:0003676)|phosphatidylinositol binding (GO:0035091)|zinc ion binding (GO:0008270)	p.A1164P(1)		breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(10)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	25						ACTGAGATACGCACCTCCCCT	0.473																																							uc002lip.3		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)|prostate(1)	2						c.(3490-3492)GCA>CCA		zinc finger, CCHC domain containing 2							176.0	169.0	171.0					18																	60243765		2030	4193	6223	SO:0001583	missense	54877				cell communication	cytoplasm	nucleic acid binding|phosphatidylinositol binding|zinc ion binding	g.chr18:60243765G>C	AB051531	CCDS45880.1	18q21.33	2012-04-19			ENSG00000141664	ENSG00000141664		"""Zinc fingers, CCHC domain containing"""	22916	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 49"""	C18orf49		11214970	Standard	NM_017742		Approved	FLJ20281, KIAA1744, FLJ20222	uc002lip.4	Q9C0B9		ENST00000269499.5:c.3490G>C	18.37:g.60243765G>C	ENSP00000269499:p.Ala1164Pro		Somatic				ZCCHC2_uc002lio.2_RNA|ZCCHC2_uc002liq.2_Missense_Mutation_p.A634P	p.A1164P	NM_017742	NP_060212	WXS	Illumina HiSeq	Unspecified	Q9C0B9	ZCHC2_HUMAN			14	3490	+			1164					B2RPG6|Q8N3S1|Q9NXF6	Missense_Mutation	SNP	ENST00000269499.5	37	c.3490G>C	CCDS45880.1	.	.	.	.	.	.	.	.	.	.	G	27.2	4.810384	0.90707	.	.	ENSG00000141664	ENST00000269499	T	0.34667	1.35	5.61	5.61	0.85477	.	0.143577	0.48286	D	0.000198	T	0.43964	0.1271	N	0.08118	0	0.51012	D	0.999907	D	0.89917	1.0	D	0.91635	0.999	T	0.55823	-0.8080	10	0.72032	D	0.01	-17.5406	20.0018	0.97417	0.0:0.0:1.0:0.0	.	1164	Q9C0B9	ZCHC2_HUMAN	P	1164	ENSP00000269499:A1164P	ENSP00000269499:A1164P	A	+	1	0	ZCCHC2	58394745	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.028000	0.64115	2.793000	0.96121	0.655000	0.94253	GCA		0.473	ZCCHC2-005	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000450083.1	NM_017742		3	30	0	0	0	0.009096	0	3	30				
TSHZ1	10194	broad.mit.edu	37	18	72998565	72998565	+	Silent	SNP	C	C	G			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr18:72998565C>G	ENST00000580243.1	+	2	1551	c.1203C>G	c.(1201-1203)ggC>ggG	p.G401G	TSHZ1_ENST00000322038.5_Silent_p.G356G			Q6ZSZ6	TSH1_HUMAN	teashirt zinc finger homeobox 1	401					anterior/posterior pattern specification (GO:0009952)|middle ear morphogenesis (GO:0042474)|regulation of transcription, DNA-templated (GO:0006355)|soft palate development (GO:0060023)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G356G(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(11)|liver(1)|lung(14)|ovary(1)|skin(6)|upper_aerodigestive_tract(2)	42		Esophageal squamous(42;0.129)|Prostate(75;0.142)|Melanoma(33;0.211)		Colorectal(1;0.000501)|READ - Rectum adenocarcinoma(2;0.00226)|BRCA - Breast invasive adenocarcinoma(31;0.246)		ACCAGAATGGCGCCAGCTACA	0.612																																							uc002lly.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1066-1068)GGC>GGG		teashirt family zinc finger 1							76.0	80.0	79.0					18																	72998565		2203	4300	6503	SO:0001819	synonymous_variant	10194					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr18:72998565C>G	AF039698	CCDS12009.1	18q22.3	2013-11-20	2007-07-16	2006-03-14	ENSG00000179981	ENSG00000179981		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	10669	protein-coding gene	gene with protein product		614427	"""serologically defined colon cancer antigen 33"", ""teashirt zinc finger 1"", ""teashirt family zinc finger 1"""	SDCCAG33		17586487	Standard	NM_005786		Approved	NY-CO-33, TSH1	uc002lly.4	Q6ZSZ6	OTTHUMG00000132859	ENST00000580243.1:c.1203C>G	18.37:g.72998565C>G			Somatic					p.G356G	NM_005786	NP_005777	WXS	Illumina HiSeq	Unspecified	Q6ZSZ6	TSH1_HUMAN		Colorectal(1;0.000501)|READ - Rectum adenocarcinoma(2;0.00226)|BRCA - Breast invasive adenocarcinoma(31;0.246)	2	1631	+		Esophageal squamous(42;0.129)|Prostate(75;0.142)|Melanoma(33;0.211)	401					O60534|Q4LE29|Q53EU4	Silent	SNP	ENST00000580243.1	37	c.1068C>G																																																																																					0.612	TSHZ1-005	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000444913.1	NM_005786		5	53	0	0	0	0.001984	0	5	53				
MIER2	54531	broad.mit.edu	37	19	313534	313534	+	Silent	SNP	C	C	G			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr19:313534C>G	ENST00000264819.4	-	8	775	c.765G>C	c.(763-765)ggG>ggC	p.G255G		NM_017550.1	NP_060020.1	Q8N344	MIER2_HUMAN	mesoderm induction early response 1, family member 2	255	ELM2. {ECO:0000255|PROSITE- ProRule:PRU00512}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.G255G(1)		endometrium(4)|kidney(1)|large_intestine(5)|lung(8)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	22		all_cancers(10;1.05e-30)|all_epithelial(18;3.04e-19)|Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;2.49e-05)|all_lung(49;4.36e-05)|Breast(49;0.000304)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGAGCTGAGGCCCGGCCATCT	0.677																																							uc002lok.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(763-765)GGG>GGC		mesoderm induction early response 1, family							67.0	70.0	69.0					19																	313534		2203	4300	6503	SO:0001819	synonymous_variant	54531				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding	g.chr19:313534C>G	AB033019	CCDS32855.1	19p13.3	2008-02-05	2006-04-20	2006-04-20		ENSG00000105556			29210	protein-coding gene	gene with protein product			"""KIAA1193"""	KIAA1193		10574462	Standard	NM_017550		Approved		uc002lok.1	Q8N344		ENST00000264819.4:c.765G>C	19.37:g.313534C>G			Somatic					p.G255G	NM_017550	NP_060020	WXS	Illumina HiSeq	Unspecified	Q8N344	MIER2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	8	774	-		all_cancers(10;1.05e-30)|all_epithelial(18;3.04e-19)|Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;2.49e-05)|all_lung(49;4.36e-05)|Breast(49;0.000304)	255			ELM2.		Q9ULM7	Silent	SNP	ENST00000264819.4	37	c.765G>C	CCDS32855.1																																																																																				0.677	MIER2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451784.1	XM_041843		7	110	0	0	0	0.00308	0	7	110				
TLE6	79816	broad.mit.edu	37	19	2989238	2989238	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr19:2989238G>T	ENST00000246112.4	+	12	1121	c.920G>T	c.(919-921)aGa>aTa	p.R307I	TLE6_ENST00000452088.1_Missense_Mutation_p.R184I|TLE6_ENST00000478073.2_3'UTR	NM_001143986.1	NP_001137458.1	Q9H808	TLE6_HUMAN	transducin-like enhancer of split 6	307					regulation of transcription, DNA-templated (GO:0006355)	cell cortex (GO:0005938)|nucleus (GO:0005634)|protein complex (GO:0043234)		p.R184I(1)|p.R307I(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|urinary_tract(1)	10				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGTGGCAGAAGAGGCATCAAG	0.602																																							uc002lwu.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(550-552)AGA>ATA		transducin-like enhancer of split 6 isoform 2							60.0	45.0	50.0					19																	2989238		2203	4300	6503	SO:0001583	missense	79816				regulation of transcription, DNA-dependent	nucleus		g.chr19:2989238G>T	AK024071	CCDS12100.1, CCDS45910.1	19p13.3	2014-03-07	2014-03-07		ENSG00000104953	ENSG00000104953		"""WD repeat domain containing"""	30788	protein-coding gene	gene with protein product		612399	"""transducin-like enhancer of split 6 (E(sp1) homolog, Drosophila)"""			11486032	Standard	NM_024760		Approved	FLJ14009, GRG6	uc002lwt.2	Q9H808	OTTHUMG00000156793	ENST00000246112.4:c.920G>T	19.37:g.2989238G>T	ENSP00000246112:p.Arg307Ile		Somatic				TLE6_uc002lwt.2_Missense_Mutation_p.R307I|TLE6_uc010dtg.2_Missense_Mutation_p.R307I|TLE6_uc002lwv.2_Missense_Mutation_p.R88I	p.R184I	NM_024760	NP_079036	WXS	Illumina HiSeq	Unspecified	Q9H808	TLE6_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	11	951	+			184			WD 1.		J3KMZ1	Missense_Mutation	SNP	ENST00000246112.4	37	c.551G>T	CCDS45910.1	.	.	.	.	.	.	.	.	.	.	G	12.29	1.894501	0.33442	.	.	ENSG00000104953	ENST00000447920;ENST00000246112;ENST00000452088;ENST00000441927	T;T	0.12147	2.71;2.71	3.53	0.019	0.14119	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	.	.	.	.	T	0.16896	0.0406	L	0.36672	1.1	0.36050	D	0.840694	D;D;P;P	0.64830	0.986;0.994;0.764;0.764	P;P;B;B	0.56751	0.736;0.805;0.259;0.38	T	0.27971	-1.0058	9	0.87932	D	0	.	5.2892	0.15717	0.12:0.4146:0.4653:0.0	.	307;165;184;184	C9JGZ7;Q9Y6S1;Q9H808;Q6PJM9	.;.;TLE6_HUMAN;.	I	307;307;184;184	ENSP00000246112:R307I;ENSP00000406893:R184I	ENSP00000246112:R307I	R	+	2	0	TLE6	2940238	0.998000	0.40836	0.000000	0.03702	0.002000	0.02628	2.429000	0.44758	0.106000	0.17784	-0.314000	0.08810	AGA		0.602	TLE6-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000345996.3	NM_024760		4	46	1	0	0.00909568	0.009096	0.00975377	4	46				
XAB2	56949	broad.mit.edu	37	19	7684528	7684528	+	Silent	SNP	G	G	T	rs574958927		TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr19:7684528G>T	ENST00000358368.4	-	19	2549	c.2512C>A	c.(2512-2514)Cgg>Agg	p.R838R	XAB2_ENST00000534844.1_Silent_p.R835R	NM_020196.2	NP_064581.2	Q9HCS7	SYF1_HUMAN	XPA binding protein 2	838					blastocyst development (GO:0001824)|DNA repair (GO:0006281)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|transcription, DNA-templated (GO:0006351)|transcription-coupled nucleotide-excision repair (GO:0006283)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.R835R(1)		breast(1)|central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(11)|prostate(1)|skin(2)|urinary_tract(1)	26						TGCTCCAGCCGAACCTCTGTG	0.701								Direct reversal of damage;Nucleotide excision repair (NER)																															uc002mgx.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(2)|breast(1)|skin(1)	4						c.(2512-2514)CGG>AGG	Direct_reversal_of_damage|NER	XPA binding protein 2							32.0	31.0	31.0					19																	7684528		2202	4296	6498	SO:0001819	synonymous_variant	56949				transcription, DNA-dependent|transcription-coupled nucleotide-excision repair	catalytic step 2 spliceosome|nucleoplasm	protein binding	g.chr19:7684528G>T	AB026111	CCDS32892.1	19p13.3	2013-08-21				ENSG00000076924			14089	protein-coding gene	gene with protein product	"""SYF1 homolog, RNA splicing factor (S. cerevisiae)"", ""SYF1 pre-mRNA-splicing factor"""	610850				10944529	Standard	NM_020196		Approved	HCNP, HCRN, SYF1, NTC90	uc002mgx.3	Q9HCS7		ENST00000358368.4:c.2512C>A	19.37:g.7684528G>T			Somatic					p.R838R	NM_020196	NP_064581	WXS	Illumina HiSeq	Unspecified	Q9HCS7	SYF1_HUMAN			19	2538	-			838					Q8TET6|Q96HB0|Q96IW0|Q9NRG6|Q9ULP3	Silent	SNP	ENST00000358368.4	37	c.2512C>A	CCDS32892.1																																																																																				0.701	XAB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000461021.1	NM_020196		4	35	1	0	1.23904e-05	0.000602	1.5488e-05	4	35				
MUC16	94025	broad.mit.edu	37	19	9064438	9064438	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr19:9064438G>T	ENST00000397910.4	-	3	23211	c.23008C>A	c.(23008-23010)Cct>Act	p.P7670T		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	7672	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.P7670T(2)|p.P3303T(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						ACACCTCCAGGACCTCTGCCC	0.527																																							uc002mkp.2		NA																	3	Substitution - Missense(3)		lung(3)	lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(23008-23010)CCT>ACT		mucin 16							83.0	87.0	86.0					19																	9064438		1966	4152	6118	SO:0001583	missense	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9064438G>T	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.23008C>A	19.37:g.9064438G>T	ENSP00000381008:p.Pro7670Thr		Somatic					p.P7670T	NM_024690	NP_078966	WXS	Illumina HiSeq	Unspecified	Q8WXI7	MUC16_HUMAN			3	23212	-			7672			Ser-rich.|Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	c.23008C>A	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	N	2.715	-0.267953	0.05754	.	.	ENSG00000181143	ENST00000397910	T	0.34859	1.34	2.11	-1.62	0.08372	.	.	.	.	.	T	0.28067	0.0692	L	0.27053	0.805	.	.	.	P	0.44659	0.84	P	0.47744	0.556	T	0.34650	-0.9820	8	0.87932	D	0	.	5.2109	0.15316	0.5643:0.0:0.4357:0.0	.	7670	B5ME49	.	T	7670	ENSP00000381008:P7670T	ENSP00000381008:P7670T	P	-	1	0	MUC16	8925438	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.600000	0.05693	-0.339000	0.08401	0.400000	0.26472	CCT		0.527	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		6	62	1	0	0.00198382	0.001984	0.00218378	6	62				
MUC16	94025	broad.mit.edu	37	19	9064463	9064463	+	Silent	SNP	C	C	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr19:9064463C>T	ENST00000397910.4	-	3	23186	c.22983G>A	c.(22981-22983)gaG>gaA	p.E7661E		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	7663	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AAGTGGTCATCTCTGGGTGTG	0.517																																							uc002mkp.2		NA																	0				lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(22981-22983)GAG>GAA		mucin 16							80.0	82.0	82.0					19																	9064463		1928	4125	6053	SO:0001819	synonymous_variant	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9064463C>T	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.22983G>A	19.37:g.9064463C>T			Somatic					p.E7661E	NM_024690	NP_078966	WXS	Illumina HiSeq	Unspecified	Q8WXI7	MUC16_HUMAN			3	23187	-			7663			Ser-rich.|Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	37	c.22983G>A	CCDS54212.1																																																																																				0.517	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		6	59	0	0	0	0.001984	0	6	59				
MUC16	94025	broad.mit.edu	37	19	9073402	9073402	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr19:9073402G>T	ENST00000397910.4	-	3	14247	c.14044C>A	c.(14044-14046)Cag>Aag	p.Q4682K		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	4684	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.Q4682K(2)|p.Q315K(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GACCCTGTCTGGGTGGTGGTC	0.483																																							uc002mkp.2		NA																	3	Substitution - Missense(3)		lung(3)	lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(14044-14046)CAG>AAG		mucin 16							166.0	155.0	159.0					19																	9073402		1909	4133	6042	SO:0001583	missense	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9073402G>T	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.14044C>A	19.37:g.9073402G>T	ENSP00000381008:p.Gln4682Lys		Somatic					p.Q4682K	NM_024690	NP_078966	WXS	Illumina HiSeq	Unspecified	Q8WXI7	MUC16_HUMAN			3	14248	-			4684			Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	c.14044C>A	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	7.092	0.572278	0.13623	.	.	ENSG00000181143	ENST00000397910	T	0.02258	4.37	1.32	-1.76	0.08006	.	.	.	.	.	T	0.01627	0.0052	L	0.27053	0.805	.	.	.	B	0.26975	0.165	B	0.16722	0.016	T	0.44436	-0.9328	8	0.87932	D	0	.	3.0819	0.06265	0.0:0.3005:0.3966:0.303	.	4682	B5ME49	.	K	4682	ENSP00000381008:Q4682K	ENSP00000381008:Q4682K	Q	-	1	0	MUC16	8934402	0.000000	0.05858	0.000000	0.03702	0.554000	0.35429	0.133000	0.15912	-0.419000	0.07439	0.313000	0.20887	CAG		0.483	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		37	191	1	0	1.49673e-21	0.00623	2.7854e-21	37	191				
TRMT1	55621	broad.mit.edu	37	19	13223573	13223573	+	Silent	SNP	C	C	A	rs147062421	byFrequency	TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr19:13223573C>A	ENST00000592062.1	-	8	1386	c.816G>T	c.(814-816)acG>acT	p.T272T	TRMT1_ENST00000437766.1_Silent_p.T272T|TRMT1_ENST00000221504.8_Silent_p.T272T|TRMT1_ENST00000357720.4_Silent_p.T272T|TRMT1_ENST00000592892.1_5'Flank			Q9NXH9	TRM1_HUMAN	tRNA methyltransferase 1 homolog (S. cerevisiae)	272	Trm1 methyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00958}.						metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|tRNA (guanine-N2-)-methyltransferase activity (GO:0004809)|tRNA binding (GO:0000049)	p.T272T(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	14			OV - Ovarian serous cystadenocarcinoma(19;6.08e-22)	GBM - Glioblastoma multiforme(1328;0.0356)		TGCTGTAGCACGTCTCCCCGC	0.667																																							uc002mwj.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(814-816)ACG>ACT		tRNA methyltransferase 1 isoform 1							64.0	61.0	62.0					19																	13223573		2203	4300	6503	SO:0001819	synonymous_variant	55621						RNA binding|tRNA (guanine-N2-)-methyltransferase activity|zinc ion binding	g.chr19:13223573C>A	AF196479	CCDS12293.1, CCDS45997.1	19p13.13	2012-06-12	2012-06-12						25980	protein-coding gene	gene with protein product		611669				10982862	Standard	NM_001142554		Approved	FLJ20244, TRM1	uc002mwl.3	Q9NXH9		ENST00000592062.1:c.816G>T	19.37:g.13223573C>A			Somatic				TRMT1_uc002mwk.2_Silent_p.T272T|TRMT1_uc002mwl.3_Silent_p.T272T|TRMT1_uc010xmz.1_Silent_p.T58T	p.T272T	NM_017722	NP_060192	WXS	Illumina HiSeq	Unspecified	Q9NXH9	TRM1_HUMAN	OV - Ovarian serous cystadenocarcinoma(19;6.08e-22)	GBM - Glioblastoma multiforme(1328;0.0356)	6	1066	-			272					O76103|Q548Y5|Q8WVA6	Silent	SNP	ENST00000592062.1	37	c.816G>T	CCDS12293.1																																																																																				0.667	TRMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452780.2	NM_017722		8	53	1	0	1.12685e-05	0.004482	1.42141e-05	8	53				
SLC27A1	376497	broad.mit.edu	37	19	17599848	17599848	+	Silent	SNP	C	C	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr19:17599848C>T	ENST00000252595.7	+	6	1015	c.918C>T	c.(916-918)atC>atT	p.I306I	CTD-3131K8.2_ENST00000596643.1_lincRNA|SLC27A1_ENST00000598424.1_Silent_p.I127I|SLC27A1_ENST00000442725.1_Silent_p.I306I	NM_198580.1	NP_940982.1	Q6PCB7	S27A1_HUMAN	solute carrier family 27 (fatty acid transporter), member 1	306	Sufficient for oligomerization. {ECO:0000250}.				adiponectin-activated signaling pathway (GO:0033211)|cardiolipin biosynthetic process (GO:0032049)|cellular lipid metabolic process (GO:0044255)|fatty acid metabolic process (GO:0006631)|long-chain fatty acid transport (GO:0015909)|medium-chain fatty acid transport (GO:0001579)|negative regulation of phospholipid biosynthetic process (GO:0071072)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phosphatidylglycerol biosynthetic process (GO:0006655)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylserine biosynthetic process (GO:0006659)|positive regulation of heat generation (GO:0031652)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|response to cold (GO:0009409)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	fatty acid transporter activity (GO:0015245)|nucleotide binding (GO:0000166)|very long-chain fatty acid-CoA ligase activity (GO:0031957)	p.I306I(2)		breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	23						AGTGTCTCATCTATGGGCTGA	0.612																																							uc002ngu.1		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(916-918)ATC>ATT		solute carrier family 27, member 1							88.0	84.0	85.0					19																	17599848		2203	4300	6503	SO:0001819	synonymous_variant	376497				cardiolipin biosynthetic process|fatty acid metabolic process|long-chain fatty acid transport|negative regulation of phospholipid biosynthetic process|phosphatidic acid biosynthetic process|phosphatidylcholine biosynthetic process|phosphatidylethanolamine biosynthetic process|phosphatidylinositol biosynthetic process|phosphatidylserine biosynthetic process|transmembrane transport	endomembrane system|integral to membrane	fatty acid transporter activity|nucleotide binding	g.chr19:17599848C>T	BC059399	CCDS32953.1	19p13.11	2013-07-15			ENSG00000130304	ENSG00000130304		"""Acyl-CoA synthetase family"", ""Solute carriers"""	10995	protein-coding gene	gene with protein product		600691				10873384	Standard	NM_198580		Approved	FATP1, FATP, MGC71751, FLJ00336, ACSVL5	uc002ngu.1	Q6PCB7	OTTHUMG00000182878	ENST00000252595.7:c.918C>T	19.37:g.17599848C>T			Somatic				SLC27A1_uc002ngt.1_Silent_p.I38I|SLC27A1_uc010xpp.1_Silent_p.I127I	p.I306I	NM_198580	NP_940982	WXS	Illumina HiSeq	Unspecified	Q6PCB7	S27A1_HUMAN			6	968	+			306			Sufficient for oligomerization (By similarity).|Cytoplasmic (Potential).		A6NIH2|B7Z662	Silent	SNP	ENST00000252595.7	37	c.918C>T	CCDS32953.1																																																																																				0.612	SLC27A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464145.1	NM_198580		8	53	0	0	0	0.004482	0	8	53				
ZNF492	57615	broad.mit.edu	37	19	22847799	22847799	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr19:22847799A>G	ENST00000456783.2	+	4	1572	c.1328A>G	c.(1327-1329)cAt>cGt	p.H443R	CTC-457E21.9_ENST00000601860.1_RNA	NM_020855.2	NP_065906.1	Q9P255	ZN492_HUMAN	zinc finger protein 492	443					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.H443R(1)		endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		all_cancers(12;0.0266)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00203)|Hepatocellular(1079;0.244)				AAGGTAATTCATACTGGAGAG	0.378																																							uc002nqw.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1327-1329)CAT>CGT		zinc finger protein 492							30.0	42.0	38.0					19																	22847799		2022	4211	6233	SO:0001583	missense	57615				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:22847799A>G	AB040906	CCDS46032.1	19p13.11	2013-01-08				ENSG00000229676		"""Zinc fingers, C2H2-type"""	23707	protein-coding gene	gene with protein product			"""zinc finger protein 115 (Y20)"""	ZNF115		10819331	Standard	NM_020855		Approved	KIAA1473	uc002nqw.3	Q9P255		ENST00000456783.2:c.1328A>G	19.37:g.22847799A>G	ENSP00000413660:p.His443Arg		Somatic					p.H443R	NM_020855	NP_065906	WXS	Illumina HiSeq	Unspecified	Q9P255	ZN492_HUMAN			4	1572	+		all_cancers(12;0.0266)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00203)|Hepatocellular(1079;0.244)	443			C2H2-type 11.		Q08EI7|Q08EI8	Missense_Mutation	SNP	ENST00000456783.2	37	c.1328A>G	CCDS46032.1	.	.	.	.	.	.	.	.	.	.	.	11.86	1.764862	0.31228	.	.	ENSG00000229676	ENST00000456783	T	0.67523	-0.27	1.12	1.12	0.20585	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.81039	0.4740	M	0.93898	3.47	0.26432	N	0.975915	D	0.63880	0.993	P	0.60286	0.872	T	0.69379	-0.5161	9	0.87932	D	0	.	5.8144	0.18484	1.0:0.0:0.0:0.0	.	443	Q9P255	ZN492_HUMAN	R	443	ENSP00000413660:H443R	ENSP00000413660:H443R	H	+	2	0	ZNF492	22639639	0.989000	0.36119	0.024000	0.17045	0.024000	0.10985	4.511000	0.60462	0.231000	0.21079	0.228000	0.17796	CAT		0.378	ZNF492-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464581.1	NM_020855		7	38	0	0	0	0.001984	0	7	38				
TSHZ3	57616	broad.mit.edu	37	19	31768256	31768256	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr19:31768256G>T	ENST00000240587.4	-	2	2770	c.2443C>A	c.(2443-2445)Ccg>Acg	p.P815T		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	815					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.P632T(1)|p.P815T(1)		breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					GAGGTTGCCGGGGCTGTGGAC	0.532																																							uc002nsy.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|skin(2)|pancreas(1)|lung(1)	8						c.(2443-2445)CCG>ACG		zinc finger protein 537							113.0	98.0	103.0					19																	31768256		2203	4300	6503	SO:0001583	missense	57616				negative regulation of transcription, DNA-dependent|regulation of respiratory gaseous exchange by neurological system process	growth cone|nucleus	chromatin binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:31768256G>T	AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.2443C>A	19.37:g.31768256G>T	ENSP00000240587:p.Pro815Thr		Somatic					p.P815T	NM_020856	NP_065907	WXS	Illumina HiSeq	Unspecified	Q63HK5	TSH3_HUMAN			2	2508	-	Esophageal squamous(110;0.226)		815					Q9H0G6|Q9P254	Missense_Mutation	SNP	ENST00000240587.4	37	c.2443C>A	CCDS12421.2	.	.	.	.	.	.	.	.	.	.	G	7.043	0.562943	0.13498	.	.	ENSG00000121297	ENST00000240587	T	0.11277	2.79	5.37	5.37	0.77165	.	0.164249	0.56097	D	0.000036	T	0.04048	0.0113	N	0.08118	0	0.52501	D	0.999954	B	0.23377	0.084	B	0.15870	0.014	T	0.30650	-0.9971	10	0.02654	T	1	-26.0887	7.0021	0.24815	0.2115:0.0:0.7885:0.0	.	815	Q63HK5	TSH3_HUMAN	T	815	ENSP00000240587:P815T	ENSP00000240587:P815T	P	-	1	0	TSHZ3	36460096	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.483000	0.66838	2.501000	0.84356	0.655000	0.94253	CCG		0.532	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316743.2	NM_020856		20	82	1	0	1.10513e-12	0.002299	1.81996e-12	20	82				
GPI	2821	broad.mit.edu	37	19	34859562	34859562	+	Missense_Mutation	SNP	G	G	T	rs11548996		TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr19:34859562G>T	ENST00000356487.5	+	4	598	c.357G>T	c.(355-357)atG>atT	p.M119I	GPI_ENST00000415930.3_Missense_Mutation_p.M158I|GPI_ENST00000586425.1_Missense_Mutation_p.M119I	NM_000175.3	NP_000166.2	P06744	G6PI_HUMAN	glucose-6-phosphate isomerase	119					aldehyde catabolic process (GO:0046185)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose 6-phosphate metabolic process (GO:0051156)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|hemostasis (GO:0007599)|humoral immune response (GO:0006959)|learning or memory (GO:0007611)|methylglyoxal biosynthetic process (GO:0019242)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of neuron apoptotic process (GO:0043524)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	glucose-6-phosphate isomerase activity (GO:0004347)|intramolecular transferase activity (GO:0016866)|monosaccharide binding (GO:0048029)	p.M119I(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	25	Esophageal squamous(110;0.162)					AGGATGTGATGCCAGAGGTCA	0.552																																							uc002nvg.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|kidney(1)	2						c.(355-357)ATG>ATT		glucose phosphate isomerase							151.0	118.0	129.0					19																	34859562		2203	4300	6503	SO:0001583	missense	2821				angiogenesis|gluconeogenesis|glycolysis|hemostasis|humoral immune response	cytosol|extracellular space|nucleus|plasma membrane	cytokine activity|glucose-6-phosphate isomerase activity|growth factor activity	g.chr19:34859562G>T	M61214	CCDS12437.1, CCDS54246.1	19q13.1	2012-10-02	2010-05-11			ENSG00000105220	5.3.1.9		4458	protein-coding gene	gene with protein product		172400	"""glucose phosphate isomerase"""			2387591, 8575767	Standard	NM_001184722		Approved	AMF, NLK	uc002nvg.2	P06744		ENST00000356487.5:c.357G>T	19.37:g.34859562G>T	ENSP00000348877:p.Met119Ile		Somatic				GPI_uc002nvf.2_Missense_Mutation_p.M158I|GPI_uc010xrv.1_Missense_Mutation_p.M158I|GPI_uc010xrw.1_Missense_Mutation_p.M119I|GPI_uc010edl.1_Missense_Mutation_p.M119I|GPI_uc002nvh.1_3'UTR	p.M119I	NM_000175	NP_000166	WXS	Illumina HiSeq	Unspecified	P06744	G6PI_HUMAN			4	460	+	Esophageal squamous(110;0.162)		119					B4DG39|Q9BRD3|Q9BSK5|Q9UHE6	Missense_Mutation	SNP	ENST00000356487.5	37	c.357G>T	CCDS12437.1	.	.	.	.	.	.	.	.	.	.	G	16.91	3.254076	0.59212	.	.	ENSG00000105220	ENST00000415930;ENST00000356487	D;D	0.92595	-3.07;-3.07	5.88	4.79	0.61399	.	0.078821	0.85682	D	0.000000	D	0.90584	0.7048	M	0.71581	2.175	0.58432	D	0.999997	B;B;B;B	0.15719	0.014;0.001;0.014;0.005	B;B;B;B	0.30716	0.098;0.015;0.098;0.119	D	0.87413	0.2377	10	0.87932	D	0	-14.0949	6.7933	0.23711	0.1106:0.0:0.6599:0.2295	.	119;158;102;119	B4DE36;B4DG39;B4DVJ0;P06744	.;.;.;G6PI_HUMAN	I	158;119	ENSP00000405573:M158I;ENSP00000348877:M119I	ENSP00000348877:M119I	M	+	3	0	GPI	39551402	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.369000	0.59511	2.792000	0.96026	0.555000	0.69702	ATG		0.552	GPI-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451693.3			13	81	1	0	9.05144e-12	0.001855	1.45595e-11	13	81				
ATP1A3	478	broad.mit.edu	37	19	42480646	42480646	+	Silent	SNP	C	C	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr19:42480646C>T	ENST00000302102.5	-	15	2166	c.2016G>A	c.(2014-2016)ctG>ctA	p.L672L	ATP1A3_ENST00000545399.1_Silent_p.L685L|ATP1A3_ENST00000602133.1_Silent_p.L642L|ATP1A3_ENST00000543770.1_Silent_p.L683L	NM_152296.4	NP_689509.1	P13637	AT1A3_HUMAN	ATPase, Na+/K+ transporting, alpha 3 polypeptide	672					adult locomotory behavior (GO:0008344)|ATP biosynthetic process (GO:0006754)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|memory (GO:0007613)|potassium ion import (GO:0010107)|response to drug (GO:0042493)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)|visual learning (GO:0008542)	axon (GO:0030424)|dendritic spine head (GO:0044327)|dendritic spine neck (GO:0044326)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|myelin sheath (GO:0043209)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)|synapse (GO:0045202)|vesicle (GO:0031982)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)	p.L672L(1)		NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(11)|liver(1)|lung(19)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	52						TGTGATTCTGCAGGATCTCGT	0.612																																							uc002osg.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(2014-2016)CTG>CTA		Na+/K+ -ATPase alpha 3 subunit							198.0	146.0	164.0					19																	42480646		2203	4300	6503	SO:0001819	synonymous_variant	478				ATP biosynthetic process	endoplasmic reticulum|Golgi apparatus	ATP binding|metal ion binding|sodium:potassium-exchanging ATPase activity	g.chr19:42480646C>T		CCDS12594.1, CCDS58663.1, CCDS58664.1	19q13.2	2012-10-22			ENSG00000105409	ENSG00000105409	3.6.3.9	"""ATPases / P-type"""	801	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-3"", ""sodium pump subunit alpha-3"", ""sodium-potassium ATPase catalytic subunit alpha-3"""	182350	"""dystonia 12"""	DYT12		17282997	Standard	NM_152296		Approved		uc002osh.4	P13637	OTTHUMG00000137384	ENST00000302102.5:c.2016G>A	19.37:g.42480646C>T			Somatic				ATP1A3_uc010xwf.1_Silent_p.L683L|ATP1A3_uc010xwg.1_Silent_p.L642L|ATP1A3_uc010xwh.1_Silent_p.L685L|ATP1A3_uc002osh.2_Silent_p.L672L	p.L672L	NM_152296	NP_689509	WXS	Illumina HiSeq	Unspecified	P13637	AT1A3_HUMAN			15	2170	-			672			Cytoplasmic (Potential).		B7Z2T0|B7Z401|F5H6J6|Q16732|Q16735|Q969K5	Silent	SNP	ENST00000302102.5	37	c.2016G>A	CCDS12594.1																																																																																				0.612	ATP1A3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268107.1	NM_152296		14	77	0	0	0	0.004007	0	14	77				
SHANK1	50944	broad.mit.edu	37	19	51220030	51220030	+	Silent	SNP	A	A	G			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr19:51220030A>G	ENST00000293441.1	-	1	165	c.147T>C	c.(145-147)ggT>ggC	p.G49G	SHANK1_ENST00000391814.1_Silent_p.G49G|SHANK1_ENST00000359082.3_Silent_p.G49G	NM_016148.2	NP_057232.2	Q9Y566	SHAN1_HUMAN	SH3 and multiple ankyrin repeat domains 1	49					adult behavior (GO:0030534)|associative learning (GO:0008306)|cytoskeletal anchoring at plasma membrane (GO:0007016)|dendritic spine morphogenesis (GO:0060997)|determination of affect (GO:0050894)|habituation (GO:0046959)|long-term memory (GO:0007616)|negative regulation of actin filament bundle assembly (GO:0032232)|neuromuscular process controlling balance (GO:0050885)|olfactory behavior (GO:0042048)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|protein complex assembly (GO:0006461)|protein localization to synapse (GO:0035418)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|righting reflex (GO:0060013)|social behavior (GO:0035176)|synapse maturation (GO:0060074)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|excitatory synapse (GO:0060076)|intracellular (GO:0005622)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ankyrin repeat binding (GO:0071532)|GKAP/Homer scaffold activity (GO:0030160)|identical protein binding (GO:0042802)|ionotropic glutamate receptor binding (GO:0035255)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|scaffold protein binding (GO:0097110)|SH3 domain binding (GO:0017124)|somatostatin receptor binding (GO:0031877)	p.G49G(1)		breast(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	64		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(134;0.0199)		AGGCCAGGCTACCAGGTGCCC	0.692																																							uc002psx.1		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(2)	2						c.(145-147)GGT>GGC		SH3 and multiple ankyrin repeat domains 1							37.0	35.0	36.0					19																	51220030		2203	4300	6503	SO:0001819	synonymous_variant	50944				cytoskeletal anchoring at plasma membrane	cell junction|cytoplasm|dendrite|membrane fraction|postsynaptic density|postsynaptic membrane	ionotropic glutamate receptor binding	g.chr19:51220030A>G	AF163302	CCDS12799.1	19q13.3	2013-01-10			ENSG00000161681	ENSG00000161681		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	15474	protein-coding gene	gene with protein product	"""somatostatin receptor-interacting protein"""	604999				10551867	Standard	NM_016148		Approved	SSTRIP, SPANK-1, synamon	uc002psx.1	Q9Y566	OTTHUMG00000137380	ENST00000293441.1:c.147T>C	19.37:g.51220030A>G			Somatic					p.G49G	NM_016148	NP_057232	WXS	Illumina HiSeq	Unspecified	Q9Y566	SHAN1_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(134;0.0199)	1	166	-		all_neural(266;0.057)	49					A8MXP5|B7WNY6|Q9NYW9	Silent	SNP	ENST00000293441.1	37	c.147T>C	CCDS12799.1																																																																																				0.692	SHANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268071.1	NM_016148		14	37	0	0	0	0.004007	0	14	37				
ZNF813	126017	broad.mit.edu	37	19	53994225	53994225	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr19:53994225G>T	ENST00000396403.4	+	4	867	c.739G>T	c.(739-741)Gta>Tta	p.V247L	ZNF813_ENST00000396421.4_Intron	NM_001004301.3	NP_001004301.2	Q6ZN06	ZN813_HUMAN	zinc finger protein 813	247					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.V247L(1)		large_intestine(1)	1				GBM - Glioblastoma multiforme(134;0.00619)		TAAATGTGATGTATGTGGCAA	0.393																																							uc002qbu.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)	1						c.(739-741)GTA>TTA		zinc finger protein 813							76.0	78.0	77.0					19																	53994225		2201	4298	6499	SO:0001583	missense	126017				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:53994225G>T	AK091460	CCDS46172.1	19q13.41	2013-01-08			ENSG00000198346	ENSG00000198346		"""Zinc fingers, C2H2-type"", ""-"""	33257	protein-coding gene	gene with protein product							Standard	NM_001004301		Approved	FLJ16542	uc002qbu.2	Q6ZN06	OTTHUMG00000158309	ENST00000396403.4:c.739G>T	19.37:g.53994225G>T	ENSP00000379684:p.Val247Leu		Somatic				ZNF813_uc010eqq.1_Intron	p.V247L	NM_001004301	NP_001004301	WXS	Illumina HiSeq	Unspecified	Q6ZN06	ZN813_HUMAN		GBM - Glioblastoma multiforme(134;0.00619)	4	867	+			247			C2H2-type 2.			Missense_Mutation	SNP	ENST00000396403.4	37	c.739G>T	CCDS46172.1	.	.	.	.	.	.	.	.	.	.	G	0.139	-1.104134	0.01828	.	.	ENSG00000198346	ENST00000396403	T	0.15952	2.38	1.16	-0.764	0.11027	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.12347	0.0300	N	0.10685	0.025	0.09310	N	1	D	0.55385	0.971	P	0.53102	0.718	T	0.21008	-1.0258	9	0.66056	D	0.02	.	5.1929	0.15218	0.1817:0.2137:0.6046:0.0	.	247	Q6ZN06	ZN813_HUMAN	L	247	ENSP00000379684:V247L	ENSP00000379684:V247L	V	+	1	0	ZNF813	58686037	0.000000	0.05858	0.284000	0.24805	0.293000	0.27360	-0.000000	0.12993	-1.029000	0.03317	-1.021000	0.02439	GTA		0.393	ZNF813-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350638.1	NM_001004301		15	75	1	0	0.00498961	0.00499	0.00540649	15	75				
PRKCG	5582	broad.mit.edu	37	19	54396639	54396639	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr19:54396639G>T	ENST00000263431.3	+	9	1215	c.933G>T	c.(931-933)ttG>ttT	p.L311F	PRKCG_ENST00000540413.1_Missense_Mutation_p.L311F|PRKCG_ENST00000536044.1_Missense_Mutation_p.C282F|PRKCG_ENST00000542049.1_Missense_Mutation_p.L198F	NM_002739.3	NP_002730.1	P05129	KPCG_HUMAN	protein kinase C, gamma	311					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cell death (GO:0008219)|chemosensory behavior (GO:0007635)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein ubiquitination (GO:0031397)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphorylation (GO:0016310)|platelet activation (GO:0030168)|positive regulation of mismatch repair (GO:0032425)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|response to morphine (GO:0043278)|response to pain (GO:0048265)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|synaptic membrane (GO:0097060)	ATP binding (GO:0005524)|calcium-dependent protein kinase C activity (GO:0004698)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|zinc ion binding (GO:0008270)	p.L311F(1)		large_intestine(1)|lung(4)|ovary(2)|pancreas(2)|skin(1)	10	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0521)	Tamoxifen(DB00675)	CCCTGGAATTGTATGAGGTGA	0.507																																							uc002qcq.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(4)|ovary(2)|pancreas(2)|large_intestine(1)	9						c.(931-933)TTG>TTT		protein kinase C, gamma							133.0	118.0	123.0					19																	54396639		2203	4300	6503	SO:0001583	missense	5582				activation of phospholipase C activity|cell death|intracellular signal transduction|negative regulation of protein catabolic process|negative regulation of protein ubiquitination|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of mismatch repair|synaptic transmission	cytosol	ATP binding|protein kinase C activity|zinc ion binding	g.chr19:54396639G>T	M13977	CCDS12867.1	19q13.4	2014-09-17			ENSG00000126583	ENSG00000126583	2.7.11.1		9402	protein-coding gene	gene with protein product	"""PKC-gamma"""	176980		PKCG, SCA14		8432525, 3755548	Standard	NM_002739		Approved	PKCC, MGC57564	uc002qcq.1	P05129	OTTHUMG00000064846	ENST00000263431.3:c.933G>T	19.37:g.54396639G>T	ENSP00000263431:p.Leu311Phe		Somatic				PRKCG_uc010eqz.1_Missense_Mutation_p.L311F|PRKCG_uc010yef.1_Missense_Mutation_p.C282F|PRKCG_uc010yeg.1_Missense_Mutation_p.L311F|PRKCG_uc010yeh.1_Missense_Mutation_p.L198F	p.L311F	NM_002739	NP_002730	WXS	Illumina HiSeq	Unspecified	P05129	KPCG_HUMAN		GBM - Glioblastoma multiforme(134;0.0521)	9	1215	+	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)		311					B7Z8Q0	Missense_Mutation	SNP	ENST00000263431.3	37	c.933G>T	CCDS12867.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.67|12.67	2.006638|2.006638	0.35415|0.35415	.|.	.|.	ENSG00000126583|ENSG00000126583	ENST00000536044|ENST00000540413;ENST00000263431;ENST00000542049	T|T;T;T	0.77098|0.70516	-1.07|-0.49;-0.49;-0.47	4.02|4.02	1.81|1.81	0.25067|0.25067	.|.	.|.	.|.	.|.	.|.	T|T	0.65544|0.65544	0.2701|0.2701	N|N	0.08118|0.08118	0|0	0.40955|0.40955	D|D	0.98457|0.98457	B|D;D;D;P	0.24186|0.69078	0.099|0.984;0.997;0.978;0.531	B|P;D;P;B	0.16722|0.80764	0.016|0.86;0.994;0.601;0.108	T|T	0.65952|0.65952	-0.6043|-0.6043	8|9	.|0.56958	.|D	.|0.05	.|.	8.6063|8.6063	0.33775|0.33775	0.2032:0.0:0.7968:0.0|0.2032:0.0:0.7968:0.0	.|.	282|198;311;311;311	B7Z870|B7Z8Q0;F5H5C4;B7Z3W6;P05129	.|.;.;.;KPCG_HUMAN	F|F	282|311;311;198	ENSP00000440541:C282F|ENSP00000443493:L311F;ENSP00000263431:L311F;ENSP00000438090:L198F	.|ENSP00000263431:L311F	C|L	+|+	2|3	0|2	PRKCG|PRKCG	59088451|59088451	0.997000|0.997000	0.39634|0.39634	1.000000|1.000000	0.80357|0.80357	0.945000|0.945000	0.59286|0.59286	0.051000|0.051000	0.14141|0.14141	0.441000|0.441000	0.26529|0.26529	0.561000|0.561000	0.74099|0.74099	TGT|TTG		0.507	PRKCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139233.3	NM_002739		13	63	1	0	1.36491e-13	0.001855	2.31199e-13	13	63				
LILRB5	10990	broad.mit.edu	37	19	54760185	54760185	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr19:54760185G>T	ENST00000316219.5	-	4	483	c.376C>A	c.(376-378)Ctt>Att	p.L126I	LILRB5_ENST00000449561.2_Missense_Mutation_p.L126I|LILRB5_ENST00000450632.1_Intron|LILRB5_ENST00000345866.6_Intron	NM_001081442.1|NM_006840.3	NP_001074911.1|NP_006831.1	O75023	LIRB5_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 5	126	Ig-like C2-type 2.				cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)	integral component of membrane (GO:0016021)	transmembrane signaling receptor activity (GO:0004888)	p.L126I(1)|p.?(1)		NS(1)|breast(1)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	all_cancers(19;0.00681)|all_epithelial(19;0.00368)|all_lung(19;0.016)|Lung NSC(19;0.0296)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		AGGGCTAAAAGAGTGGGTTCT	0.552																																							uc002qex.2		NA																	2	Substitution - Missense(1)|Unknown(1)		lung(2)	ovary(1)|pancreas(1)	2						c.(376-378)CTT>ATT		leukocyte immunoglobulin-like receptor,							64.0	69.0	68.0					19																	54760185		2203	4300	6503	SO:0001583	missense	10990				cell surface receptor linked signaling pathway|defense response	integral to membrane	transmembrane receptor activity	g.chr19:54760185G>T	AF025534	CCDS12885.1, CCDS42611.1, CCDS46176.1	19q13.4	2013-01-11			ENSG00000105609	ENSG00000105609		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6609	protein-coding gene	gene with protein product		604814				9548455	Standard	NM_006840		Approved	LIR-8, LIR8, CD85c	uc002qey.3	O75023	OTTHUMG00000066636	ENST00000316219.5:c.376C>A	19.37:g.54760185G>T	ENSP00000320390:p.Leu126Ile		Somatic				LILRA6_uc002qew.1_Intron|LILRB5_uc010yer.1_Intron|LILRB5_uc002qey.2_Missense_Mutation_p.L126I|LILRB5_uc002qez.2_Intron|LILRB5_uc002qfa.1_Intron|LILRB5_uc010yes.1_Intron	p.L126I	NM_006840	NP_006831	WXS	Illumina HiSeq	Unspecified	O75023	LIRB5_HUMAN		GBM - Glioblastoma multiforme(193;0.105)	4	487	-	all_cancers(19;0.00681)|all_epithelial(19;0.00368)|all_lung(19;0.016)|Lung NSC(19;0.0296)|Ovarian(34;0.19)		126			Extracellular (Potential).|Ig-like C2-type 2.		Q8N760	Missense_Mutation	SNP	ENST00000316219.5	37	c.376C>A	CCDS12885.1	.	.	.	.	.	.	.	.	.	.	G	13.89	2.372617	0.42003	.	.	ENSG00000105609	ENST00000316219;ENST00000449561	T;T	0.01068	5.38;5.38	3.44	1.17	0.20885	Immunoglobulin-like fold (1);	0.293219	0.24539	N	0.037653	T	0.04952	0.0133	M	0.84156	2.68	0.09310	N	0.999995	D;D	0.76494	0.999;0.998	D;D	0.81914	0.995;0.985	T	0.19811	-1.0294	10	0.87932	D	0	.	4.194	0.10435	0.1265:0.0:0.6476:0.226	.	126;126	O75023-3;O75023	.;LIRB5_HUMAN	I	126	ENSP00000320390:L126I;ENSP00000406478:L126I	ENSP00000320390:L126I	L	-	1	0	LILRB5	59451997	0.009000	0.17119	0.002000	0.10522	0.006000	0.05464	0.451000	0.21779	0.250000	0.21479	0.585000	0.79938	CTT		0.552	LILRB5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000142877.2			21	88	1	0	1.22574e-08	0.002299	1.75407e-08	21	88				
LILRA3	11026	broad.mit.edu	37	19	54801976	54801976	+	Silent	SNP	G	G	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr19:54801976G>A	ENST00000251390.3	-	6	1303	c.1212C>T	c.(1210-1212)aaC>aaT	p.N404N	LILRA3_ENST00000391744.3_Silent_p.N340N|LILRA3_ENST00000391745.1_Silent_p.N421N	NM_006865.3	NP_006856.3	Q8N6C8	LIRA3_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (without TM domain), member 3	404	Ig-like C2-type 4.				defense response (GO:0006952)|immune system process (GO:0002376)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|receptor activity (GO:0004872)	p.N404N(1)		NS(3)|breast(1)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	28	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		GCAGGTAGGGGTTGGAGCTGA	0.617																																							uc002qfd.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(1210-1212)AAC>AAT		leukocyte immunoglobulin-like receptor,							106.0	93.0	98.0					19																	54801976		2194	4184	6378	SO:0001819	synonymous_variant	11026				defense response	extracellular region|plasma membrane	antigen binding|receptor activity	g.chr19:54801976G>A	U91926		19q13.4	2013-01-11						"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6604	protein-coding gene	gene with protein product		604818				9278324, 9548455	Standard	XM_006710242		Approved	LIR-4, HM43, ILT6, HM31, LIR4, CD85e		Q8N6C8		ENST00000251390.3:c.1212C>T	19.37:g.54801976G>A			Somatic				LILRA6_uc002qew.1_Intron|LILRA3_uc010erk.2_Silent_p.N340N	p.N404N	NM_006865	NP_006856	WXS	Illumina HiSeq	Unspecified	Q8N6C8	LIRA3_HUMAN		GBM - Glioblastoma multiforme(193;0.105)	6	1277	-	Ovarian(34;0.19)		404			Ig-like C2-type 4.		J3KPM2|O15469|O15470|O75016|Q8N151|Q8N154|Q8NHJ1|Q8NHJ2|Q8NHJ3|Q8NHJ4	Silent	SNP	ENST00000251390.3	37	c.1212C>T	CCDS12887.1																																																																																				0.617	LILRA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140236.1			19	186	0	0	0	0.001882	0	19	186				
NLRP2	55655	broad.mit.edu	37	19	55501959	55501959	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr19:55501959C>A	ENST00000543010.1	+	10	2770	c.2627C>A	c.(2626-2628)gCc>gAc	p.A876D	NLRP2_ENST00000263437.6_Missense_Mutation_p.A873D|NLRP2_ENST00000427260.2_Missense_Mutation_p.A853D|NLRP2_ENST00000339757.7_Missense_Mutation_p.A854D|NLRP2_ENST00000391721.4_Missense_Mutation_p.A852D|NLRP2_ENST00000448584.2_Missense_Mutation_p.A876D|NLRP2_ENST00000537859.1_Missense_Mutation_p.A854D|NLRP2_ENST00000538819.1_Missense_Mutation_p.A852D	NM_001174081.1	NP_001167552.1	Q9NX02	NALP2_HUMAN	NLR family, pyrin domain containing 2	876					positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|Pyrin domain binding (GO:0032090)	p.A876D(1)		large_intestine(4)|liver(1)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	11			BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)		CTGTGCTTGGCCAAGAACCCC	0.522																																							uc002qij.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(2626-2628)GCC>GAC		NLR family, pyrin domain containing 2							130.0	127.0	128.0					19																	55501959		2203	4300	6503	SO:0001583	missense	55655				apoptosis|positive regulation of caspase activity|positive regulation of interleukin-1 beta secretion	cytoplasm	ATP binding|Pyrin domain binding	g.chr19:55501959C>A	AK000517	CCDS12913.1, CCDS54318.1, CCDS54319.1	19q13.42	2008-02-05	2006-12-08	2006-12-08	ENSG00000022556	ENSG00000022556		"""Nucleotide-binding domain and leucine rich repeat containing"""	22948	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 2"""	609364	"""NACHT, leucine rich repeat and PYD containing 2"""	NALP2		12563287, 11270363	Standard	NM_001174081		Approved	FLJ20510, PYPAF2, NBS1, PAN1, CLR19.9	uc021vbq.1	Q9NX02	OTTHUMG00000167763	ENST00000543010.1:c.2627C>A	19.37:g.55501959C>A	ENSP00000445135:p.Ala876Asp		Somatic				NLRP2_uc010yfp.1_Missense_Mutation_p.A853D|NLRP2_uc010esn.2_Missense_Mutation_p.A852D|NLRP2_uc010eso.2_Missense_Mutation_p.A873D|NLRP2_uc010esp.2_Missense_Mutation_p.A854D	p.A876D	NM_017852	NP_060322	WXS	Illumina HiSeq	Unspecified	Q9NX02	NALP2_HUMAN	BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)	10	2713	+			876			LRR 3.		B4DZL7|I3L0G4|Q53FL5|Q59G09|Q8IXT0|Q9BVN5|Q9H6G6|Q9HAV9|Q9NWK3	Missense_Mutation	SNP	ENST00000543010.1	37	c.2627C>A	CCDS12913.1	.	.	.	.	.	.	.	.	.	.	C	9.723	1.160233	0.21454	.	.	ENSG00000022556	ENST00000543010;ENST00000391721;ENST00000339757;ENST00000448584;ENST00000537859;ENST00000427260;ENST00000538819;ENST00000263437	T;T;T;T;T;T;T;T	0.52983	0.64;0.64;0.64;0.64;0.64;0.64;0.64;0.64	2.31	2.31	0.28768	.	.	.	.	.	T	0.57548	0.2061	L	0.50993	1.605	0.22796	N	0.998722	D;D;D;D;D	0.89917	0.996;0.999;0.999;1.0;0.998	D;D;D;D;D	0.81914	0.978;0.991;0.995;0.991;0.978	T	0.38090	-0.9677	9	0.38643	T	0.18	.	8.2242	0.31560	0.0:1.0:0.0:0.0	.	853;854;873;852;876	B4DZL7;Q9NX02-2;A8K9G6;Q9NX02-4;Q9NX02	.;.;.;.;NALP2_HUMAN	D	876;852;854;876;854;853;852;873	ENSP00000445135:A876D;ENSP00000375601:A852D;ENSP00000344074:A854D;ENSP00000409370:A876D;ENSP00000440601:A854D;ENSP00000402474:A853D;ENSP00000441133:A852D;ENSP00000263437:A873D	ENSP00000263437:A873D	A	+	2	0	NLRP2	60193771	0.002000	0.14202	0.657000	0.29651	0.043000	0.13939	-0.083000	0.11286	1.593000	0.50029	0.561000	0.74099	GCC		0.522	NLRP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396152.1	NM_017852		8	123	1	0	5.4927e-09	0.004482	7.99815e-09	8	123				
APOB	338	broad.mit.edu	37	2	21235206	21235206	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr2:21235206C>A	ENST00000233242.1	-	26	4661	c.4534G>T	c.(4534-4536)Ggc>Tgc	p.G1512C		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	1512					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)	p.G1512C(1)		NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTGAGCCGGCCAGTGTTAGGA	0.478																																							uc002red.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27						c.(4534-4536)GGC>TGC		apolipoprotein B precursor	Atorvastatin(DB01076)						131.0	127.0	128.0					2																	21235206		2203	4300	6503	SO:0001583	missense	338				cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity	g.chr2:21235206C>A	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.4534G>T	2.37:g.21235206C>A	ENSP00000233242:p.Gly1512Cys		Somatic					p.G1512C	NM_000384	NP_000375	WXS	Illumina HiSeq	Unspecified	P04114	APOB_HUMAN			26	4662	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		1512					O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	ENST00000233242.1	37	c.4534G>T	CCDS1703.1	.	.	.	.	.	.	.	.	.	.	C	12.17	1.858097	0.32791	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.00737	5.76	5.88	4.96	0.65561	.	0.104769	0.42821	D	0.000648	T	0.02533	0.0077	L	0.51422	1.61	0.23984	N	0.996262	D	0.89917	1.0	D	0.73380	0.98	T	0.42032	-0.9475	10	0.54805	T	0.06	.	10.2265	0.43229	0.0:0.704:0.2209:0.0751	.	1512	P04114	APOB_HUMAN	C	1512	ENSP00000233242:G1512C	ENSP00000233242:G1512C	G	-	1	0	APOB	21088711	0.001000	0.12720	0.958000	0.39756	0.116000	0.19942	0.562000	0.23531	2.782000	0.95742	0.655000	0.94253	GGC		0.478	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1			12	79	1	0	5.50884e-06	0.001368	7.01278e-06	12	79				
ASXL2	55252	broad.mit.edu	37	2	25967101	25967101	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr2:25967101C>T	ENST00000435504.4	-	13	2398	c.2105G>A	c.(2104-2106)gGa>gAa	p.G702E	ASXL2_ENST00000404843.1_Missense_Mutation_p.G442E|ASXL2_ENST00000336112.4_Missense_Mutation_p.G674E|ASXL2_ENST00000272341.4_Missense_Mutation_p.G442E			Q76L83	ASXL2_HUMAN	additional sex combs like transcriptional regulator 2	702	Gly-rich.				adult heart development (GO:0007512)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of bone mineralization involved in bone maturation (GO:1900159)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of histone H3-K27 trimethylation (GO:1902466)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)	p.G702E(1)|p.G442E(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(7)|pancreas(1)|prostate(4)|skin(3)|urinary_tract(3)	33	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ACCACCCTCTCCTGGACCTTG	0.642																																							uc002rgs.2		NA																	2	Substitution - Missense(2)		lung(2)	pancreas(1)	1						c.(2104-2106)GGA>GAA		additional sex combs like 2							93.0	92.0	92.0					2																	25967101		1956	4155	6111	SO:0001583	missense	55252				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|protein binding	g.chr2:25967101C>T			2p24.1	2014-06-17	2014-06-17		ENSG00000143970	ENSG00000143970			23805	protein-coding gene	gene with protein product		612991	"""additional sex combs like 2 (Drosophila)"""			12888926	Standard	NM_018263		Approved	ASXH2, FLJ10898, KIAA1685	uc002rgs.2	Q76L83	OTTHUMG00000152176	ENST00000435504.4:c.2105G>A	2.37:g.25967101C>T	ENSP00000391447:p.Gly702Glu		Somatic				ASXL2_uc002rgt.1_Missense_Mutation_p.G442E	p.G702E	NM_018263	NP_060733	WXS	Illumina HiSeq	Unspecified	Q76L83	ASXL2_HUMAN			12	2326	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		702			Gly-rich.		Q53TC9|Q5H9U4|Q76L81|Q86XM1|Q9C0H8|Q9NV67	Missense_Mutation	SNP	ENST00000435504.4	37	c.2105G>A		.	.	.	.	.	.	.	.	.	.	C	13.88	2.370239	0.42003	.	.	ENSG00000143970	ENST00000435504;ENST00000336112;ENST00000404843;ENST00000272341	T;T;T;T	0.17054	2.3;2.3;2.31;2.31	5.94	5.94	0.96194	.	0.071819	0.56097	D	0.000021	T	0.23410	0.0566	L	0.47716	1.5	0.45541	D	0.998496	D;D	0.63046	0.992;0.974	P;B	0.48030	0.564;0.36	T	0.00400	-1.1763	10	0.27082	T	0.32	-7.0256	17.8532	0.88754	0.0:1.0:0.0:0.0	.	442;702	Q76L83-2;Q76L83	.;ASXL2_HUMAN	E	702;674;442;442	ENSP00000391447:G702E;ENSP00000337250:G674E;ENSP00000383920:G442E;ENSP00000272341:G442E	ENSP00000272341:G442E	G	-	2	0	ASXL2	25820605	0.949000	0.32298	1.000000	0.80357	0.927000	0.56198	1.339000	0.33885	2.816000	0.96949	0.563000	0.77884	GGA		0.642	ASXL2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000325593.3	NM_018263		13	178	0	0	0	0.003163	0	13	178				
RASGRP3	25780	broad.mit.edu	37	2	33747045	33747045	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr2:33747045G>A	ENST00000403687.3	+	7	1132	c.392G>A	c.(391-393)aGa>aAa	p.R131K	RASGRP3_ENST00000407811.1_Missense_Mutation_p.R131K|RASGRP3_ENST00000402538.3_Missense_Mutation_p.R131K	NM_001139488.1	NP_001132960.1	Q8IV61	GRP3_HUMAN	RAS guanyl releasing protein 3 (calcium and DAG-regulated)	131					MAPK cascade (GO:0000165)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rap GTPase activity (GO:0032854)|Ras protein signal transduction (GO:0007265)|small GTPase mediated signal transduction (GO:0007264)	guanyl-nucleotide exchange factor complex (GO:0032045)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|diacylglycerol binding (GO:0019992)|guanyl-nucleotide exchange factor activity (GO:0005085)|Rap GTPase activator activity (GO:0046582)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|signal transducer activity (GO:0004871)	p.R131K(1)		large_intestine(3)|lung(3)|ovary(2)|pancreas(1)|stomach(2)	11	all_hematologic(175;0.115)					TGGATGAGAAGAGTCACACAG	0.438																																							uc002rox.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(3)|ovary(1)|pancreas(1)	5						c.(391-393)AGA>AAA		RAS guanyl releasing protein 3 (calcium and							124.0	120.0	121.0					2																	33747045		1887	4107	5994	SO:0001583	missense	25780				MAPKKK cascade|small GTPase mediated signal transduction	integral to plasma membrane|intracellular	calcium ion binding|diacylglycerol binding|guanyl-nucleotide exchange factor activity|protein binding|Rap GTPase activator activity|signal transducer activity	g.chr2:33747045G>A	AB020653	CCDS46256.1, CCDS54346.1	2p25.1-p24.1	2013-01-10			ENSG00000152689	ENSG00000152689		"""EF-hand domain containing"""	14545	protein-coding gene	gene with protein product		609531				10048485, 10934204	Standard	NM_170672		Approved	KIAA0846, GRP3	uc002roy.3	Q8IV61	OTTHUMG00000152124	ENST00000403687.3:c.392G>A	2.37:g.33747045G>A	ENSP00000384192:p.Arg131Lys		Somatic				RASGRP3_uc010ync.1_Missense_Mutation_p.R131K|RASGRP3_uc002roy.2_Missense_Mutation_p.R131K	p.R131K	NM_170672	NP_733772	WXS	Illumina HiSeq	Unspecified	Q8IV61	GRP3_HUMAN			8	1019	+	all_hematologic(175;0.115)		131					D6W583|O94931|Q53SD7	Missense_Mutation	SNP	ENST00000403687.3	37	c.392G>A	CCDS46256.1	.	.	.	.	.	.	.	.	.	.	G	9.447	1.089494	0.20390	.	.	ENSG00000152689	ENST00000402538;ENST00000437184;ENST00000403687;ENST00000407811	T;T;T;T	0.27557	1.66;1.66;1.66;1.66	6.03	6.03	0.97812	Ras guanine nucleotide exchange factor, domain (1);	0.049983	0.85682	D	0.000000	T	0.16727	0.0402	N	0.04959	-0.14	0.39119	D	0.961629	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.002	T	0.15549	-1.0433	10	0.02654	T	1	-20.8731	20.5752	0.99366	0.0:0.0:1.0:0.0	.	131;131	D6W583;Q8IV61	.;GRP3_HUMAN	K	131	ENSP00000385886:R131K;ENSP00000393866:R131K;ENSP00000384192:R131K;ENSP00000383917:R131K	ENSP00000385886:R131K	R	+	2	0	RASGRP3	33600549	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.339000	0.72969	2.868000	0.98415	0.557000	0.71058	AGA		0.438	RASGRP3-006	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325462.2	NM_015376		15	124	0	0	0	0.00245	0	15	124				
LRPPRC	10128	broad.mit.edu	37	2	44204192	44204192	+	Splice_Site	SNP	C	C	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr2:44204192C>T	ENST00000260665.7	-	5	649		c.e5-1		LRPPRC_ENST00000409659.1_Splice_Site|LRPPRC_ENST00000409946.1_Splice_Site	NM_133259.3	NP_573566.2	P42704	LPPRC_HUMAN	leucine-rich pentatricopeptide repeat containing						mitochondrion transport along microtubule (GO:0047497)|mRNA transport (GO:0051028)|negative regulation of mitochondrial RNA catabolic process (GO:0000961)|regulation of mitochondrial translation (GO:0070129)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome (GO:0000794)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|microtubule (GO:0005874)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ribonucleoprotein complex (GO:0030529)	beta-tubulin binding (GO:0048487)|microtubule binding (GO:0008017)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)	p.?(1)		breast(3)|endometrium(3)|kidney(5)|large_intestine(9)|lung(15)|ovary(2)|prostate(2)|skin(2)	41		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				GGTATGTCACCTGTCAATGAA	0.313																																							uc002rtr.2		NA																	1	Unknown(1)		lung(1)	ovary(2)|skin(1)	3						c.e5-1		leucine-rich PPR motif-containing protein							86.0	85.0	86.0					2																	44204192		2203	4300	6503	SO:0001630	splice_region_variant	10128				mitochondrion transport along microtubule|mRNA transport|regulation of transcription, DNA-dependent|transcription, DNA-dependent	condensed nuclear chromosome|cytoskeleton|mitochondrial nucleoid|nuclear inner membrane|nuclear outer membrane|nucleoplasm|perinuclear region of cytoplasm	beta-tubulin binding|microtubule binding|RNA binding	g.chr2:44204192C>T	M92439	CCDS33189.1	2p21	2012-02-24	2012-02-24		ENSG00000138095	ENSG00000138095			15714	protein-coding gene	gene with protein product		607544	"""Leigh syndrome, French-Canadian type (cytochrome oxidase deficiency)"""	LSFC		8012652, 8619474, 22045337	Standard	NM_133259		Approved	GP130, LRP130	uc002rtr.2	P42704	OTTHUMG00000152782	ENST00000260665.7:c.592-1G>A	2.37:g.44204192C>T			Somatic				LRPPRC_uc010yob.1_Splice_Site_p.V98_splice|LRPPRC_uc010faw.1_Splice_Site_p.V172_splice	p.V198_splice	NM_133259	NP_573566	WXS	Illumina HiSeq	Unspecified	P42704	LPPRC_HUMAN			5	650	-		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)						A0PJE3|A8K1V1|Q53PC0|Q53QN7|Q6ZUD8|Q7Z7A6|Q96D84	Splice_Site	SNP	ENST00000260665.7	37	c.592_splice	CCDS33189.1	.	.	.	.	.	.	.	.	.	.	C	18.68	3.676285	0.67928	.	.	ENSG00000138095	ENST00000465633;ENST00000260665;ENST00000409946;ENST00000409659;ENST00000447246	.	.	.	5.73	4.85	0.62838	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.2354	0.73427	0.0:0.9323:0.0:0.0677	.	.	.	.	.	-1	.	.	.	-	.	.	LRPPRC	44057696	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	7.772000	0.85439	1.566000	0.49654	-0.300000	0.09419	.		0.313	LRPPRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327823.1	NM_133259	Intron	5	39	0	0	0	0.001984	0	5	39				
AFTPH	54812	broad.mit.edu	37	2	64779295	64779295	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr2:64779295G>T	ENST00000422803.1	+	2	1001	c.687G>T	c.(685-687)gaG>gaT	p.E229D	AFTPH_ENST00000238855.7_Missense_Mutation_p.E229D|AFTPH_ENST00000238856.4_Missense_Mutation_p.E229D|AFTPH_ENST00000409183.1_5'Flank|AFTPH_ENST00000409933.1_Missense_Mutation_p.E229D			Q6ULP2	AFTIN_HUMAN	aftiphilin	229					protein transport (GO:0015031)	AP-1 adaptor complex (GO:0030121)|cytosol (GO:0005829)	clathrin binding (GO:0030276)	p.E229D(2)		breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	35						GTCCTGCTGAGGAATTTGCAG	0.393																																							uc002sdc.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(685-687)GAG>GAT		aftiphilin protein isoform a							65.0	65.0	65.0					2																	64779295		2203	4300	6503	SO:0001583	missense	54812				protein transport	AP-1 adaptor complex|cytosol|nucleus	clathrin binding	g.chr2:64779295G>T	AB073356	CCDS1878.1, CCDS46303.1	2p14	2008-02-05			ENSG00000119844	ENSG00000119844			25951	protein-coding gene	gene with protein product						14665628, 15758025, 15811338	Standard	NM_017657		Approved	MGC33965, FLJ20080, FLJ23793, Nbla10388	uc002scz.3	Q6ULP2	OTTHUMG00000129539	ENST00000422803.1:c.687G>T	2.37:g.64779295G>T	ENSP00000397726:p.Glu229Asp		Somatic				AFTPH_uc002scz.2_Missense_Mutation_p.E229D|AFTPH_uc002sda.2_Missense_Mutation_p.E229D|AFTPH_uc002sdb.2_Missense_Mutation_p.E229D	p.E229D	NM_203437	NP_982261	WXS	Illumina HiSeq	Unspecified	Q6ULP2	AFTIN_HUMAN			1	719	+			229					D6W5E9|Q6ZM66|Q86VW3|Q8TCF3|Q9H7E3|Q9HAB9|Q9NXS4	Missense_Mutation	SNP	ENST00000422803.1	37	c.687G>T		.	.	.	.	.	.	.	.	.	.	G	6.274	0.418658	0.11870	.	.	ENSG00000119844	ENST00000238856;ENST00000422803;ENST00000238855;ENST00000409933	T;T;T;T	0.26518	1.73;1.73;1.73;1.73	5.78	2.97	0.34412	.	0.243821	0.40818	N	0.001013	T	0.17152	0.0412	L	0.38175	1.15	0.31184	N	0.701728	B;B;B;B	0.19583	0.037;0.037;0.037;0.0	B;B;B;B	0.19946	0.027;0.027;0.027;0.002	T	0.17167	-1.0378	10	0.22109	T	0.4	-1.9821	6.9233	0.24401	0.1397:0.0:0.6116:0.2487	.	229;229;229;229	Q6ULP2;Q6ULP2-2;Q6ULP2-5;Q6ULP2-4	AFTIN_HUMAN;.;.;.	D	229	ENSP00000238856:E229D;ENSP00000397726:E229D;ENSP00000238855:E229D;ENSP00000387071:E229D	ENSP00000238855:E229D	E	+	3	2	AFTPH	64632799	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	1.643000	0.37217	0.437000	0.26423	-0.230000	0.12252	GAG		0.393	AFTPH-202	KNOWN	basic	protein_coding	protein_coding		NM_017657		20	68	1	0	1.22574e-08	0.002299	1.75407e-08	20	68				
MOGS	7841	broad.mit.edu	37	2	74688860	74688860	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr2:74688860C>T	ENST00000233616.4	-	4	2218	c.2056G>A	c.(2056-2058)Gta>Ata	p.V686I	MOGS_ENST00000462443.1_5'Flank|MOGS_ENST00000452063.2_Missense_Mutation_p.V580I|MOGS_ENST00000409065.1_3'UTR	NM_006302.2	NP_006293.2	Q13724	MOGS_HUMAN	mannosyl-oligosaccharide glucosidase	686					cellular protein metabolic process (GO:0044267)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucosidase activity (GO:0015926)|mannosyl-oligosaccharide glucosidase activity (GO:0004573)	p.V686I(1)		cervix(1)|endometrium(6)|large_intestine(3)|lung(10)|prostate(1)|urinary_tract(2)	23						AGAGCATCTACATACTGCAGT	0.592																																							uc010ffj.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2056-2058)GTA>ATA		mannosyl-oligosaccharide glucosidase isoform 1							76.0	90.0	85.0					2																	74688860		2018	4176	6194	SO:0001583	missense	7841				oligosaccharide metabolic process|post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|integral to membrane|membrane fraction	mannosyl-oligosaccharide glucosidase activity	g.chr2:74688860C>T	X87237	CCDS42700.1, CCDS54370.1	2p13.1	2012-01-31			ENSG00000115275	ENSG00000115275	3.2.1.106		24862	protein-coding gene	gene with protein product	"""glucosidase I"", ""processing A-glucosidase I"""	601336				7635146, 8786151	Standard	NM_006302		Approved	GCS1, CWH41, DER7	uc010ffj.3	Q13724	OTTHUMG00000152886	ENST00000233616.4:c.2056G>A	2.37:g.74688860C>T	ENSP00000233616:p.Val686Ile		Somatic				MOGS_uc010ffh.2_Missense_Mutation_p.V411I|MOGS_uc010yrt.1_Missense_Mutation_p.V567I|MOGS_uc010ffi.2_Missense_Mutation_p.V580I	p.V686I	NM_006302	NP_006293	WXS	Illumina HiSeq	Unspecified	Q13724	MOGS_HUMAN			4	2219	-			686			Lumenal (Potential).		A8K938|F5H6D0|Q17RN9|Q8TCT5	Missense_Mutation	SNP	ENST00000233616.4	37	c.2056G>A	CCDS42700.1	.	.	.	.	.	.	.	.	.	.	C	15.63	2.890113	0.52014	.	.	ENSG00000115275	ENST00000233616;ENST00000452063	T;T	0.47528	0.84;0.84	5.01	5.01	0.66863	Six-hairpin glycosidase-like (1);	0.000000	0.85682	D	0.000000	T	0.68220	0.2977	M	0.76002	2.32	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	T	0.68769	-0.5321	10	0.46703	T	0.11	-14.7246	15.8593	0.79009	0.0:1.0:0.0:0.0	.	686	Q13724	MOGS_HUMAN	I	686;580	ENSP00000233616:V686I;ENSP00000388201:V580I	ENSP00000233616:V686I	V	-	1	0	MOGS	74542368	1.000000	0.71417	1.000000	0.80357	0.160000	0.22226	5.198000	0.65147	2.618000	0.88619	0.462000	0.41574	GTA		0.592	MOGS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328382.1	NM_006302		16	131	0	0	0	0.006122	0	16	131				
LRRTM1	347730	broad.mit.edu	37	2	80530299	80530299	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr2:80530299G>T	ENST00000295057.3	-	2	1302	c.646C>A	c.(646-648)Ctc>Atc	p.L216I	CTNNA2_ENST00000361291.4_Intron|CTNNA2_ENST00000402739.4_Intron|CTNNA2_ENST00000466387.1_Intron|CTNNA2_ENST00000496558.1_Intron|CTNNA2_ENST00000541047.1_Intron|LRRTM1_ENST00000409148.1_Missense_Mutation_p.L216I|CTNNA2_ENST00000540488.1_Intron	NM_178839.4	NP_849161.2	Q86UE6	LRRT1_HUMAN	leucine rich repeat transmembrane neuronal 1	216					exploration behavior (GO:0035640)|locomotory behavior (GO:0007626)|long-term synaptic potentiation (GO:0060291)|negative regulation of receptor internalization (GO:0002091)|protein localization to synapse (GO:0035418)|synapse organization (GO:0050808)	axon (GO:0030424)|cell junction (GO:0030054)|endoplasmic reticulum (GO:0005783)|excitatory synapse (GO:0060076)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)		p.L216I(2)		NS(1)|breast(1)|endometrium(5)|large_intestine(7)|liver(1)|lung(33)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	63						TTGTGCTCGAGGTGCAGCTCG	0.582										HNSCC(69;0.2)																													uc002sok.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|upper_aerodigestive_tract(1)|skin(1)	5						c.(646-648)CTC>ATC		leucine rich repeat transmembrane neuronal 1							109.0	106.0	107.0					2																	80530299		2203	4300	6503	SO:0001583	missense	347730					axon|endoplasmic reticulum membrane|growth cone|integral to membrane		g.chr2:80530299G>T	AY358310	CCDS1966.1	2p12	2004-06-22			ENSG00000162951	ENSG00000162951			19408	protein-coding gene	gene with protein product		610867				12676565	Standard	XR_244930		Approved	FLJ32082	uc002sok.1	Q86UE6	OTTHUMG00000130021	ENST00000295057.3:c.646C>A	2.37:g.80530299G>T	ENSP00000295057:p.Leu216Ile	HNSCC(69;0.2)	Somatic				CTNNA2_uc010yse.1_Intron|CTNNA2_uc010ysf.1_Intron|CTNNA2_uc010ysg.1_Intron|CTNNA2_uc010ysh.1_Intron|CTNNA2_uc010ysi.1_5'Flank|LRRTM1_uc002soj.3_RNA	p.L216I	NM_178839	NP_849161	WXS	Illumina HiSeq	Unspecified	Q86UE6	LRRT1_HUMAN			2	916	-			216			LRR 6.|Lumenal (Potential).		A8K397|D6W5K1|Q96DN1	Missense_Mutation	SNP	ENST00000295057.3	37	c.646C>A	CCDS1966.1	.	.	.	.	.	.	.	.	.	.	G	16.38	3.107915	0.56291	.	.	ENSG00000162951	ENST00000295057;ENST00000409148;ENST00000416268	D;D;T	0.87809	-2.3;-2.3;3.29	5.26	3.4	0.38934	.	0.000000	0.64402	U	0.000002	D	0.91586	0.7342	M	0.73217	2.22	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	D	0.89905	0.4047	9	.	.	.	.	10.5984	0.45352	0.0726:0.1331:0.7944:0.0	.	216	Q86UE6	LRRT1_HUMAN	I	216	ENSP00000295057:L216I;ENSP00000386646:L216I;ENSP00000415368:L216I	.	L	-	1	0	LRRTM1	80383810	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.038000	0.57318	0.544000	0.28883	0.655000	0.94253	CTC		0.582	LRRTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313614.1	NM_178839		31	164	1	0	4.31634e-10	0.002445	6.56146e-10	31	164				
WASH2P	375260	broad.mit.edu	37	2	114357557	114357557	+	RNA	SNP	A	A	G	rs377652994		TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr2:114357557A>G	ENST00000538033.2	+	0	2800							Q6VEQ5	WASH2_HUMAN	WAS protein family homolog 2 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)										GCCTACTTCTAGTGAAACTGG	0.567																																							uc010yxx.1		NA																	0					0						c.(382-384)TAG>CAG		SubName: Full=DEAD/H box polypeptide 11 like 2;																																						84771							g.chr2:114357557A>G			2q13	2010-07-08	2008-01-16	2008-01-16	ENSG00000146556	ENSG00000146556		"""WAS protein homologs"""	33145	pseudogene	pseudogene			"""family with sequence similarity 39, member B"""	FAM39B		18159949	Standard	NR_024077		Approved	MGC52000	uc002tkh.3	Q6VEQ5	OTTHUMG00000047822		2.37:g.114357557A>G			Somatic					p.*128Q			WXS	Illumina HiSeq	Unspecified					3	709	-									Nonstop_Mutation	SNP	ENST00000538033.2	37	c.382T>C																																																																																					0.567	WASH2P-002	KNOWN	mRNA_end_NF|basic	retained_intron	pseudogene	OTTHUMT00000467782.1	NM_198943		3	23	0	0	0	0.004672	0	3	23				
LRP1B	53353	broad.mit.edu	37	2	140992421	140992421	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr2:140992421G>T	ENST00000389484.3	-	90	14564	c.13593C>A	c.(13591-13593)ttC>ttA	p.F4531L		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	4531					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.F4531L(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		gtggaagcttgaaagcactgg	0.408										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	Colon(99;50 2074 2507 20106)	uc002tvj.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50						c.(13591-13593)TTC>TTA		low density lipoprotein-related protein 1B							115.0	113.0	114.0					2																	140992421		2203	4300	6503	SO:0001583	missense	53353				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding	g.chr2:140992421G>T	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.13593C>A	2.37:g.140992421G>T	ENSP00000374135:p.Phe4531Leu	TSP Lung(27;0.18)	Somatic					p.F4531L	NM_018557	NP_061027	WXS	Illumina HiSeq	Unspecified	Q9NZR2	LRP1B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)	90	14565	-		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)	4531			Cytoplasmic (Potential).		Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	c.13593C>A	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	G	16.11	3.030409	0.54790	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.88975	-2.45	5.24	5.24	0.73138	.	0.169215	0.37669	N	0.001995	D	0.88228	0.6380	N	0.22421	0.69	0.32049	N	0.597248	P	0.49447	0.924	P	0.57776	0.827	D	0.87268	0.2284	10	0.33940	T	0.23	.	14.511	0.67787	0.0:0.0:1.0:0.0	.	4531	Q9NZR2	LRP1B_HUMAN	L	4531;4469	ENSP00000374135:F4531L	ENSP00000374135:F4531L	F	-	3	2	LRP1B	140708891	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	4.521000	0.60532	2.880000	0.98712	0.650000	0.86243	TTC		0.408	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557		16	44	1	0	8.34094e-07	0.008871	1.09889e-06	16	44				
NEB	4703	broad.mit.edu	37	2	152527689	152527689	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr2:152527689T>C	ENST00000172853.10	-	38	4501	c.4354A>G	c.(4354-4356)Att>Gtt	p.I1452V	NEB_ENST00000603639.1_Missense_Mutation_p.I1452V|NEB_ENST00000604864.1_Missense_Mutation_p.I1452V|NEB_ENST00000427231.2_Missense_Mutation_p.I1452V|NEB_ENST00000397345.3_Missense_Mutation_p.I1452V|NEB_ENST00000409198.1_Missense_Mutation_p.I1452V			P20929	NEBU_HUMAN	nebulin	1452					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)	p.I1452V(2)		NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		AGGGAACCAATAGGGATCCAT	0.448																																							uc010fnx.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20						c.(4354-4356)ATT>GTT		nebulin isoform 3							126.0	118.0	120.0					2																	152527689		1948	4141	6089	SO:0001583	missense	4703				muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle	g.chr2:152527689T>C	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.4354A>G	2.37:g.152527689T>C	ENSP00000172853:p.Ile1452Val		Somatic					p.I1452V	NM_004543	NP_004534	WXS	Illumina HiSeq	Unspecified	P20929	NEBU_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.219)	38	4545	-			1452			Nebulin 37.		F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	ENST00000172853.10	37	c.4354A>G		.	.	.	.	.	.	.	.	.	.	T	10.85	1.467176	0.26335	.	.	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000172853	T;T;T;T	0.06068	3.35;3.42;3.42;3.35	5.42	0.00236	0.14050	.	0.126789	0.52532	D	0.000070	T	0.09247	0.0228	M	0.64567	1.98	0.51482	D	0.999929	B	0.26400	0.148	B	0.31442	0.13	T	0.16571	-1.0398	10	0.14656	T	0.56	.	17.4137	0.87494	0.0:0.0:0.6792:0.3208	.	1452	P20929	NEBU_HUMAN	V	1452	ENSP00000386259:I1452V;ENSP00000380505:I1452V;ENSP00000416578:I1452V;ENSP00000172853:I1452V	ENSP00000172853:I1452V	I	-	1	0	NEB	152235935	0.532000	0.26346	0.327000	0.25402	0.996000	0.88848	0.828000	0.27435	-0.148000	0.11234	0.533000	0.62120	ATT		0.448	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543		13	45	0	0	0	0.004007	0	13	45				
TBR1	10716	broad.mit.edu	37	2	162274750	162274750	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr2:162274750G>A	ENST00000389554.3	+	3	1203	c.886G>A	c.(886-888)Ggg>Agg	p.G296R	TBR1_ENST00000410035.1_Missense_Mutation_p.G9R	NM_006593.2	NP_006584.1	Q16650	TBR1_HUMAN	T-box, brain, 1	296					axon guidance (GO:0007411)|brain development (GO:0007420)|hindbrain development (GO:0030902)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of neuron projection development (GO:0010975)|specification of organ identity (GO:0010092)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G296R(1)		central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|prostate(1)|skin(3)	30						CCCCAACACTGGGGCTCACTG	0.478																																							uc002ubw.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(886-888)GGG>AGG		T-box, brain, 1							60.0	63.0	62.0					2																	162274750		2203	4300	6503	SO:0001583	missense	10716					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr2:162274750G>A	U49250	CCDS33310.1	2q24.2	2011-06-13			ENSG00000136535	ENSG00000136535		"""T-boxes"""	11590	protein-coding gene	gene with protein product		604616				7619531	Standard	NM_006593		Approved		uc002ubw.1	Q16650	OTTHUMG00000153888	ENST00000389554.3:c.886G>A	2.37:g.162274750G>A	ENSP00000374205:p.Gly296Arg		Somatic				TBR1_uc010foy.2_Missense_Mutation_p.G9R	p.G296R	NM_006593	NP_006584	WXS	Illumina HiSeq	Unspecified	Q16650	TBR1_HUMAN			3	1188	+			296			T-box.		B0AZS4|B2R6G5|Q14DC5|Q53TH0|Q56A81	Missense_Mutation	SNP	ENST00000389554.3	37	c.886G>A	CCDS33310.1	.	.	.	.	.	.	.	.	.	.	G	25.1	4.604232	0.87157	.	.	ENSG00000136535	ENST00000389554;ENST00000539334;ENST00000411412;ENST00000410035	D;D;D	0.97232	-4.3;-4.3;-4.3	5.07	5.07	0.68467	Transcription factor, T-box, conserved site (1);p53-like transcription factor, DNA-binding (1);	0.051651	0.85682	D	0.000000	D	0.99105	0.9692	H	0.97214	3.96	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99023	1.0818	10	0.87932	D	0	.	18.6122	0.91290	0.0:0.0:1.0:0.0	.	296	Q16650	TBR1_HUMAN	R	296;9;31;9	ENSP00000374205:G296R;ENSP00000393934:G31R;ENSP00000387023:G9R	ENSP00000374205:G296R	G	+	1	0	TBR1	161982996	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.754000	0.98908	2.790000	0.95986	0.650000	0.86243	GGG		0.478	TBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332845.1	NM_006593		20	77	0	0	0	0.010504	0	20	77				
KCNH7	90134	broad.mit.edu	37	2	163374483	163374483	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr2:163374483T>C	ENST00000332142.5	-	4	748	c.649A>G	c.(649-651)Aaa>Gaa	p.K217E	KCNH7_ENST00000328032.4_Missense_Mutation_p.K217E|KCNH7_ENST00000477019.1_5'UTR	NM_033272.3	NP_150375.2	Q9NS40	KCNH7_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 7	217					circadian rhythm (GO:0007623)|potassium ion transmembrane transport (GO:0071805)|protein heterooligomerization (GO:0051291)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)|signal transducer activity (GO:0004871)|voltage-gated potassium channel activity (GO:0005249)	p.K217E(2)		NS(1)|biliary_tract(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(22)|lung(53)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	108					Doxazosin(DB00590)|Ibutilide(DB00308)|Miconazole(DB01110)|Prazosin(DB00457)|Terazosin(DB01162)	ATCAAAGCTTTTGTGTCATCT	0.458																																					GBM(196;1492 2208 17507 24132 45496)	GBM(196;1492 2208 17507 24132 45496)	uc002uch.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|skin(2)	5						c.(649-651)AAA>GAA		potassium voltage-gated channel, subfamily H,	Ibutilide(DB00308)						153.0	148.0	150.0					2																	163374483		2203	4300	6503	SO:0001583	missense	90134				regulation of transcription, DNA-dependent	integral to membrane	protein binding|signal transducer activity	g.chr2:163374483T>C	AF032897	CCDS2219.1, CCDS2220.1	2q24.3	2012-07-05			ENSG00000184611	ENSG00000184611		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18863	protein-coding gene	gene with protein product		608169				16382104	Standard	NM_173162		Approved	Kv11.3, HERG3, erg3	uc002uch.2	Q9NS40	OTTHUMG00000132069	ENST00000332142.5:c.649A>G	2.37:g.163374483T>C	ENSP00000331727:p.Lys217Glu		Somatic				KCNH7_uc002uci.2_Missense_Mutation_p.K217E	p.K217E	NM_033272	NP_150375	WXS	Illumina HiSeq	Unspecified	Q9NS40	KCNH7_HUMAN			4	861	-			217			Cytoplasmic (Potential).		Q53QU4|Q53TB7|Q53TP9|Q8IV15	Missense_Mutation	SNP	ENST00000332142.5	37	c.649A>G	CCDS2219.1	.	.	.	.	.	.	.	.	.	.	T	10.46	1.355093	0.24512	.	.	ENSG00000184611	ENST00000332142;ENST00000328032	D;D	0.98400	-4.91;-4.91	5.65	5.65	0.86999	.	0.050906	0.85682	D	0.000000	D	0.94427	0.8207	N	0.19112	0.55	0.43471	D	0.995686	B;B	0.24882	0.002;0.113	B;B	0.25987	0.003;0.065	D	0.92201	0.5768	10	0.05721	T	0.95	.	15.8797	0.79195	0.0:0.0:0.0:1.0	.	217;217	Q9NS40-2;Q9NS40	.;KCNH7_HUMAN	E	217	ENSP00000331727:K217E;ENSP00000333781:K217E	ENSP00000333781:K217E	K	-	1	0	KCNH7	163082729	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.853000	0.69496	2.161000	0.67846	0.533000	0.62120	AAA		0.458	KCNH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255093.1	NM_033272		19	142	0	0	0	0.007413	0	19	142				
SCN3A	6328	broad.mit.edu	37	2	166019136	166019136	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr2:166019136C>A	ENST00000360093.3	-	8	1388	c.897G>T	c.(895-897)atG>atT	p.M299I	SCN3A_ENST00000409101.3_Missense_Mutation_p.M299I|SCN3A_ENST00000283254.7_Missense_Mutation_p.M299I	NM_001081677.1	NP_001075146.1	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha subunit	299					membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.M299I(2)		NS(1)|breast(7)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(19)|liver(2)|lung(47)|ovary(6)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(3)	120					Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CATTTGAATCCATTGTGCCAT	0.388																																							uc002ucx.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|breast(3)|skin(2)|central_nervous_system(1)	10						c.(895-897)ATG>ATT		sodium channel, voltage-gated, type III, alpha	Lamotrigine(DB00555)						121.0	122.0	121.0					2																	166019136		2203	4300	6503	SO:0001583	missense	6328					voltage-gated sodium channel complex	voltage-gated sodium channel activity	g.chr2:166019136C>A	AF035685	CCDS33312.1, CCDS46440.1	2q24	2012-02-26	2007-01-23		ENSG00000153253	ENSG00000153253		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10590	protein-coding gene	gene with protein product		182391	"""sodium channel, voltage-gated, type III, alpha polypeptide"""			9589372, 16382098	Standard	NM_001081676		Approved	Nav1.3	uc002ucx.3	Q9NY46	OTTHUMG00000044171	ENST00000360093.3:c.897G>T	2.37:g.166019136C>A	ENSP00000353206:p.Met299Ile		Somatic				SCN3A_uc002ucy.2_Missense_Mutation_p.M299I|SCN3A_uc002ucz.2_Missense_Mutation_p.M299I|SCN3A_uc002uda.1_Missense_Mutation_p.M168I|SCN3A_uc002udb.1_Missense_Mutation_p.M168I	p.M299I	NM_006922	NP_008853	WXS	Illumina HiSeq	Unspecified	Q9NY46	SCN3A_HUMAN			8	1389	-			299					Q16142|Q53SX0|Q9BZB3|Q9C006|Q9NYK2|Q9P2J1|Q9UPD1|Q9Y6P4	Missense_Mutation	SNP	ENST00000360093.3	37	c.897G>T		.	.	.	.	.	.	.	.	.	.	C	6.694	0.496618	0.12762	.	.	ENSG00000153253	ENST00000360093;ENST00000283254;ENST00000409101;ENST00000440431	D;D;D;D	0.95756	-3.8;-3.8;-3.74;-3.63	5.82	0.775	0.18527	Ion transport (1);	0.919650	0.09307	N	0.820148	T	0.78836	0.4346	N	0.00510	-1.415	0.09310	N	0.999997	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.04013	0.0;0.001;0.001;0.0;0.0	T	0.72984	-0.4125	10	0.10902	T	0.67	.	2.5644	0.04779	0.1188:0.4906:0.1158:0.2748	.	299;299;299;299;299	Q9NY46;E7EUE6;Q9NY46-2;Q9NY46-4;Q9NY46-3	SCN3A_HUMAN;.;.;.;.	I	299	ENSP00000353206:M299I;ENSP00000283254:M299I;ENSP00000386726:M299I;ENSP00000403348:M299I	ENSP00000283254:M299I	M	-	3	0	SCN3A	165727382	0.001000	0.12720	0.788000	0.31933	0.798000	0.45092	0.246000	0.18160	0.392000	0.25172	-0.136000	0.14681	ATG		0.388	SCN3A-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_006922		7	93	1	0	0.00198382	0.001984	0.00218378	7	93				
XIRP2	129446	broad.mit.edu	37	2	168102744	168102744	+	Silent	SNP	C	C	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr2:168102744C>A	ENST00000409195.1	+	9	4931	c.4842C>A	c.(4840-4842)tcC>tcA	p.S1614S	XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000409273.1_Silent_p.S1392S|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000295237.9_Silent_p.S1614S	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	1439					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)		p.S1614S(1)		NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						ACCTACTTTCCAAAAGGGACT	0.338																																							uc002udx.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(7)|ovary(6)|pancreas(1)	14						c.(4840-4842)TCC>TCA		xin actin-binding repeat containing 2 isoform 1							43.0	40.0	40.0					2																	168102744		1817	4081	5898	SO:0001819	synonymous_variant	129446				actin cytoskeleton organization	cell junction	actin binding	g.chr2:168102744C>A	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.4842C>A	2.37:g.168102744C>A			Somatic				XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Silent_p.S1439S|XIRP2_uc010fpq.2_Silent_p.S1392S|XIRP2_uc010fpr.2_Intron|XIRP2_uc010fps.1_5'Flank	p.S1614S	NM_152381	NP_689594	WXS	Illumina HiSeq	Unspecified	A4UGR9	XIRP2_HUMAN			8	4860	+			1439					A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Silent	SNP	ENST00000409195.1	37	c.4842C>A	CCDS42769.1																																																																																				0.338	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381		6	57	1	0	1.76689e-08	0.006214	2.5026e-08	6	57				
TTN	7273	broad.mit.edu	37	2	179397726	179397726	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr2:179397726G>T	ENST00000591111.1	-	308	98917	c.98693C>A	c.(98692-98694)cCt>cAt	p.P32898H	TTN-AS1_ENST00000431259.2_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000588244.1_RNA|TTN-AS1_ENST00000585487.1_RNA|TTN-AS1_ENST00000590040.1_RNA|TTN-AS1_ENST00000589391.1_RNA|TTN-AS1_ENST00000591466.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.P31971H|TTN-AS1_ENST00000589355.1_RNA|TTN-AS1_ENST00000589434.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000585358.1_RNA|TTN-AS1_ENST00000587944.1_RNA|TTN-AS1_ENST00000588716.1_RNA|TTN-AS1_ENST00000588257.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592836.1_RNA|TTN-AS1_ENST00000591867.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.P25666H|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000604571.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000588804.1_RNA|TTN-AS1_ENST00000589842.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000585625.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000587568.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.P25599H|TTN_ENST00000460472.2_Missense_Mutation_p.P25474H|TTN-AS1_ENST00000450692.2_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000442329.2_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592182.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.P34539H			Q8WZ42	TITIN_HUMAN	titin	32898					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.P31971H(1)|p.P25599H(1)|p.P31969H(1)|p.P25666H(1)|p.P25474H(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TACATCATAAGGCATCCGGAG	0.448																																							uc010zfg.1		NA																	5	Substitution - Missense(5)		lung(5)	ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(95911-95913)CCT>CAT		titin isoform N2-A							163.0	170.0	168.0					2																	179397726		2000	4174	6174	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179397726G>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.98693C>A	2.37:g.179397726G>T	ENSP00000465570:p.Pro32898His		Somatic				uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.P25666H|TTN_uc010zfi.1_Missense_Mutation_p.P25599H|TTN_uc010zfj.1_Missense_Mutation_p.P25474H	p.P31971H	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		307	96136	-			32898					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.95912C>A		.	.	.	.	.	.	.	.	.	.	G	19.09	3.759697	0.69763	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.78364	-1.17;-1.0;-1.01;-1.03	5.94	5.94	0.96194	Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);	.	.	.	.	T	0.82148	0.4974	N	0.19112	0.55	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.998;0.998;0.998	D	0.84179	0.0438	9	0.87932	D	0	.	19.9583	0.97232	0.0:0.0:1.0:0.0	.	25474;25599;25666;32898	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	H	31971;25474;25666;25599;25471	ENSP00000343764:P31971H;ENSP00000434586:P25474H;ENSP00000340554:P25666H;ENSP00000352154:P25599H	ENSP00000340554:P25666H	P	-	2	0	TTN	179105972	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	9.837000	0.99465	2.826000	0.97356	0.561000	0.74099	CCT		0.448	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		55	275	1	0	1.83081e-24	0.00361	3.48525e-24	55	275				
TTN	7273	broad.mit.edu	37	2	179412988	179412988	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr2:179412988A>T	ENST00000591111.1	-	289	88666	c.88442T>A	c.(88441-88443)gTt>gAt	p.V29481D	TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.V28554D|TTN-AS1_ENST00000586452.1_RNA|RP11-65L3.2_ENST00000603415.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.V22249D|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.V22182D|TTN_ENST00000460472.2_Missense_Mutation_p.V22057D|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.V31122D			Q8WZ42	TITIN_HUMAN	titin	29481	Fibronectin type-III 115. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.V22249D(1)|p.V28552D(1)|p.V22182D(1)|p.V22057D(1)|p.V28554D(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGTATCAACAACATCAAGTCT	0.483																																							uc010zfg.1		NA																	5	Substitution - Missense(5)		lung(5)	ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(85660-85662)GTT>GAT		titin isoform N2-A							163.0	163.0	163.0					2																	179412988		2042	4197	6239	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179412988A>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.88442T>A	2.37:g.179412988A>T	ENSP00000465570:p.Val29481Asp		Somatic				uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.V22249D|TTN_uc010zfi.1_Missense_Mutation_p.V22182D|TTN_uc010zfj.1_Missense_Mutation_p.V22057D	p.V28554D	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		288	85885	-			29481					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.85661T>A		.	.	.	.	.	.	.	.	.	.	A	12.45	1.941983	0.34283	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.61627	0.09;0.09;0.09;0.09	5.65	5.65	0.86999	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.78660	0.4318	M	0.91717	3.235	0.49389	D	0.999789	P;P;P;P	0.42483	0.781;0.781;0.781;0.781	P;P;P;P	0.54965	0.765;0.765;0.765;0.765	T	0.83221	-0.0068	9	0.87932	D	0	.	15.8787	0.79185	1.0:0.0:0.0:0.0	.	22057;22182;22249;29481	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	D	28554;22057;22249;22182;22054	ENSP00000343764:V28554D;ENSP00000434586:V22057D;ENSP00000340554:V22249D;ENSP00000352154:V22182D	ENSP00000340554:V22249D	V	-	2	0	TTN	179121234	0.999000	0.42202	0.004000	0.12327	0.402000	0.30811	9.339000	0.96797	2.139000	0.66308	0.533000	0.62120	GTT		0.483	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		10	184	0	0	0	0.000978	0	10	184				
ITGA4	3676	broad.mit.edu	37	2	182359483	182359483	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr2:182359483G>C	ENST00000397033.2	+	12	1713	c.1283G>C	c.(1282-1284)aGt>aCt	p.S428T		NM_000885.4	NP_000876.3	P13612	ITA4_HUMAN	integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor)	428					B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|blood vessel remodeling (GO:0001974)|cell-matrix adhesion (GO:0007160)|cell-matrix adhesion involved in ameboidal cell migration (GO:0003366)|chorio-allantoic fusion (GO:0060710)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|face development (GO:0060324)|heart development (GO:0007507)|heterophilic cell-cell adhesion (GO:0007157)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|negative regulation of protein homodimerization activity (GO:0090074)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell migration (GO:0072678)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alpha4-beta7 complex (GO:0034669)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)	p.S428T(1)		breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(27)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	58			OV - Ovarian serous cystadenocarcinoma(117;0.0593)		Natalizumab(DB00108)|Tinzaparin(DB06822)	AAATCGTTAAGTATGTTTGGA	0.313																																							uc002unu.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|lung(1)|central_nervous_system(1)|pancreas(1)	6						c.(1282-1284)AGT>ACT		integrin alpha 4 precursor	Natalizumab(DB00108)						157.0	149.0	151.0					2																	182359483		1828	4085	5913	SO:0001583	missense	3676				blood coagulation|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|leukocyte migration|regulation of immune response	integrin complex	identical protein binding|receptor activity	g.chr2:182359483G>C		CCDS42788.1	2q31-q32	2010-03-23			ENSG00000115232	ENSG00000115232		"""CD molecules"", ""Integrins"""	6140	protein-coding gene	gene with protein product		192975		CD49D		1537388	Standard	NM_000885		Approved	CD49d	uc002unu.3	P13612	OTTHUMG00000154212	ENST00000397033.2:c.1283G>C	2.37:g.182359483G>C	ENSP00000380227:p.Ser428Thr		Somatic					p.S428T	NM_000885	NP_000876	WXS	Illumina HiSeq	Unspecified	P13612	ITA4_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0593)		12	2046	+			428			FG-GAP 7.|Extracellular (Potential).		D3DPG4|Q7Z4L6	Missense_Mutation	SNP	ENST00000397033.2	37	c.1283G>C	CCDS42788.1	.	.	.	.	.	.	.	.	.	.	G	15.41	2.826064	0.50739	.	.	ENSG00000115232	ENST00000425522;ENST00000397033;ENST00000233573	T;T	0.62105	0.05;0.05	5.59	5.59	0.84812	.	0.313493	0.36167	N	0.002759	T	0.53286	0.1787	L	0.31845	0.965	0.33593	D	0.601369	B	0.28820	0.224	B	0.29353	0.101	T	0.56811	-0.7917	10	0.15066	T	0.55	.	19.6005	0.95560	0.0:0.0:1.0:0.0	.	428	P13612	ITA4_HUMAN	T	428	ENSP00000380227:S428T;ENSP00000233573:S428T	ENSP00000233573:S428T	S	+	2	0	ITGA4	182067728	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.479000	0.66813	2.634000	0.89283	0.655000	0.94253	AGT		0.313	ITGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334427.1			30	109	0	0	0	0.004289	0	30	109				
PDE1A	5136	broad.mit.edu	37	2	183051238	183051238	+	Nonsense_Mutation	SNP	C	C	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr2:183051238C>A	ENST00000410103.1	-	13	1416	c.1333G>T	c.(1333-1335)Gag>Tag	p.E445*	PDE1A_ENST00000358139.2_Nonsense_Mutation_p.E445*|PDE1A_ENST00000409365.1_Nonsense_Mutation_p.E429*|PDE1A_ENST00000456212.1_Nonsense_Mutation_p.E445*|PDE1A_ENST00000435564.1_Nonsense_Mutation_p.E445*|PDE1A_ENST00000346717.4_Nonsense_Mutation_p.E411*|PDE1A_ENST00000331935.6_Nonsense_Mutation_p.E445*|PDE1A_ENST00000536095.1_Nonsense_Mutation_p.E341*|PDE1A_ENST00000351439.5_Nonsense_Mutation_p.E429*	NM_001003683.2	NP_001003683.1	P54750	PDE1A_HUMAN	phosphodiesterase 1A, calmodulin-dependent	445	Catalytic. {ECO:0000250}.				activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of smooth muscle cell apoptotic process (GO:0034391)|regulation of smooth muscle cell proliferation (GO:0048660)|signal transduction (GO:0007165)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|calcium- and calmodulin-regulated 3',5'-cyclic-GMP phosphodiesterase activity (GO:0048101)|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|cGMP binding (GO:0030553)|metal ion binding (GO:0046872)	p.E445*(2)		endometrium(5)|large_intestine(3)|lung(12)|ovary(1)|pancreas(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(2)	35			OV - Ovarian serous cystadenocarcinoma(117;0.061)		Bepridil(DB01244)|Caffeine(DB00201)|Felodipine(DB01023)|Nicardipine(DB00622)	GAGGCTTCCTCTATAAGAGGA	0.348																																							uc002uos.2		NA																	2	Substitution - Nonsense(2)		lung(2)	skin(2)|ovary(1)	3						c.(1333-1335)GAG>TAG		phosphodiesterase 1A isoform 2							74.0	75.0	75.0					2																	183051238		2203	4300	6503	SO:0001587	stop_gained	5136				activation of phospholipase C activity|nerve growth factor receptor signaling pathway|platelet activation	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding	g.chr2:183051238C>A		CCDS2285.1, CCDS33344.1, CCDS58741.1, CCDS74612.1	2q32.1	2008-03-18			ENSG00000115252	ENSG00000115252	3.1.4.17	"""Phosphodiesterases"""	8774	protein-coding gene	gene with protein product		171890				8557689, 11342109	Standard	NM_005019		Approved		uc010zfq.2	P54750	OTTHUMG00000132596	ENST00000410103.1:c.1333G>T	2.37:g.183051238C>A	ENSP00000387037:p.Glu445*		Somatic				PDE1A_uc010zfp.1_Nonsense_Mutation_p.E341*|PDE1A_uc002uoq.1_Nonsense_Mutation_p.E445*|PDE1A_uc010zfq.1_Nonsense_Mutation_p.E445*|PDE1A_uc002uor.2_Nonsense_Mutation_p.E429*|PDE1A_uc002uou.2_Nonsense_Mutation_p.E411*	p.E445*	NM_001003683	NP_001003683	WXS	Illumina HiSeq	Unspecified	P54750	PDE1A_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.061)		13	1417	-			445			Catalytic (By similarity).		D3DPG5|Q86VZ0|Q9C0K8|Q9C0K9|Q9C0L0|Q9C0L1|Q9C0L2|Q9C0L3|Q9C0L4|Q9UFX3	Nonsense_Mutation	SNP	ENST00000410103.1	37	c.1333G>T	CCDS33344.1	.	.	.	.	.	.	.	.	.	.	C	33	5.207092	0.95033	.	.	ENSG00000115252	ENST00000435564;ENST00000346717;ENST00000536095;ENST00000409365;ENST00000331935;ENST00000351439;ENST00000410103;ENST00000358139;ENST00000456212	.	.	.	5.29	4.37	0.52481	.	0.098017	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.44086	T	0.13	.	15.667	0.77238	0.0:0.8632:0.1368:0.0	.	.	.	.	X	445;411;341;429;445;429;445;445;445	.	ENSP00000331574:E445X	E	-	1	0	PDE1A	182759483	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.416000	0.66417	2.645000	0.89757	0.655000	0.94253	GAG		0.348	PDE1A-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000334356.1			5	58	1	0	8.12818e-05	0.001984	9.77738e-05	5	58				
COL3A1	1281	broad.mit.edu	37	2	189868184	189868184	+	Silent	SNP	T	T	C			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr2:189868184T>C	ENST00000304636.3	+	37	2771	c.2601T>C	c.(2599-2601)ggT>ggC	p.G867G	COL3A1_ENST00000317840.5_Intron	NM_000090.3	NP_000081	P02461	CO3A1_HUMAN	collagen, type III, alpha 1	867	Triple-helical region.				aging (GO:0007568)|axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell-matrix adhesion (GO:0007160)|cellular response to amino acid stimulus (GO:0071230)|cerebral cortex development (GO:0021987)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|digestive tract development (GO:0048565)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of immune response (GO:0050777)|negative regulation of neuron migration (GO:2001223)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|positive regulation of Rho protein signal transduction (GO:0035025)|response to cytokine (GO:0034097)|response to mechanical stimulus (GO:0009612)|response to radiation (GO:0009314)|skeletal system development (GO:0001501)|skin development (GO:0043588)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	collagen type III trimer (GO:0005586)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)	p.G867G(1)		NS(2)|breast(1)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(60)|ovary(4)|pancreas(1)|prostate(5)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	126			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)	GCAGTCCTGGTGGACCTGTAA	0.378																																							uc002uqj.1		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(7)|ovary(4)|large_intestine(2)	13						c.(2599-2601)GGT>GGC		collagen type III alpha 1 preproprotein	Collagenase(DB00048)|Palifermin(DB00039)						100.0	102.0	101.0					2																	189868184		2203	4300	6503	SO:0001819	synonymous_variant	1281				axon guidance|cell-matrix adhesion|collagen biosynthetic process|collagen fibril organization|fibril organization|heart development|integrin-mediated signaling pathway|negative regulation of immune response|peptide cross-linking|platelet activation|response to cytokine stimulus|response to radiation|skin development|transforming growth factor beta receptor signaling pathway	collagen type III|extracellular space	extracellular matrix structural constituent|integrin binding|platelet-derived growth factor binding	g.chr2:189868184T>C	X15332	CCDS2297.1	2q32.2	2014-09-17	2008-06-23		ENSG00000168542	ENSG00000168542		"""Collagens"""	2201	protein-coding gene	gene with protein product		120180	"""Ehlers-Danlos syndrome type IV, autosomal dominant"""	EDS4A		2780304, 2834369	Standard	NM_000090		Approved		uc002uqj.1	P02461	OTTHUMG00000132648	ENST00000304636.3:c.2601T>C	2.37:g.189868184T>C			Somatic					p.G867G	NM_000090	NP_000081	WXS	Illumina HiSeq	Unspecified	P02461	CO3A1_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		37	2718	+			867			Triple-helical region.		D2JYH5|D3DPH4|P78429|Q15112|Q16403|Q53S91|Q541P8|Q6LDB3|Q6LDJ2|Q6LDJ3|Q7KZ56|Q8N6U4|Q9UC88|Q9UC89|Q9UC90|Q9UC91|R4N3C5|V9GZI1	Silent	SNP	ENST00000304636.3	37	c.2601T>C	CCDS2297.1																																																																																				0.378	COL3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255899.3	NM_000090		6	40	0	0	0	0.001984	0	6	40				
INO80D	54891	broad.mit.edu	37	2	206869874	206869874	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr2:206869874T>A	ENST00000403263.1	-	11	2706	c.2302A>T	c.(2302-2304)Act>Tct	p.T768S	Vault_ENST00000516676.1_RNA	NM_017759.4	NP_060229.3	Q53TQ3	IN80D_HUMAN	INO80 complex subunit D	768					DNA recombination (GO:0006310)|DNA repair (GO:0006281)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.T663S(1)|p.T768S(1)		NS(1)|cervix(2)|endometrium(3)|kidney(3)|large_intestine(3)|lung(9)|ovary(2)|prostate(1)|urinary_tract(2)	26						CTGATCAGAGTGGCAGAAGTA	0.597																																							uc002vaz.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(2302-2304)ACT>TCT		INO80 complex subunit D							63.0	62.0	62.0					2																	206869874		1977	4161	6138	SO:0001583	missense	54891				DNA recombination|DNA repair|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus		g.chr2:206869874T>A		CCDS46500.1	2q33.3	2011-07-06			ENSG00000114933	ENSG00000114933		"""INO80 complex subunits"""	25997	protein-coding gene	gene with protein product						16230350	Standard	NM_017759		Approved	FLJ20309	uc002vaz.4	Q53TQ3	OTTHUMG00000154649	ENST00000403263.1:c.2302A>T	2.37:g.206869874T>A	ENSP00000384198:p.Thr768Ser		Somatic					p.T768S	NM_017759	NP_060229	WXS	Illumina HiSeq	Unspecified	Q53TQ3	IN80D_HUMAN			11	2707	-			768					B3KU68|B9EG77|Q6PJC6|Q6PJU1|Q6PKA1|Q9NXD5	Missense_Mutation	SNP	ENST00000403263.1	37	c.2302A>T	CCDS46500.1	.	.	.	.	.	.	.	.	.	.	T	6.742	0.505616	0.12822	.	.	ENSG00000114933	ENST00000403263;ENST00000233270	T	0.29917	1.55	5.91	3.5	0.40072	.	0.213817	0.50627	D	0.000117	T	0.12263	0.0298	N	0.08118	0	0.39448	D	0.967362	B	0.17667	0.023	B	0.15484	0.013	T	0.19353	-1.0308	10	0.02654	T	1	.	8.6715	0.34154	0.0:0.0662:0.1299:0.8039	.	768	Q53TQ3-2	.	S	768	ENSP00000384198:T768S	ENSP00000233270:T768S	T	-	1	0	INO80D	206578119	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	2.726000	0.47302	0.472000	0.27344	-0.250000	0.11733	ACT		0.597	INO80D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336459.1	NM_017759		6	88	0	0	0	0.001984	0	6	88				
VWC2L	402117	broad.mit.edu	37	2	215279062	215279062	+	Silent	SNP	C	C	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr2:215279062C>A	ENST00000312504.5	+	2	947	c.145C>A	c.(145-147)Cga>Aga	p.R49R	VWC2L_ENST00000427124.1_Silent_p.R49R|AC107218.3_ENST00000412896.1_RNA|AC107218.3_ENST00000437883.1_RNA	NM_001080500.2	NP_001073969.1	B2RUY7	VWC2L_HUMAN	von Willebrand factor C domain containing protein 2-like	49					negative regulation of BMP signaling pathway (GO:0030514)|positive regulation of neuron differentiation (GO:0045666)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|extracellular space (GO:0005615)|synapse (GO:0045202)		p.R49R(1)		breast(1)|endometrium(1)|large_intestine(3)|lung(10)|prostate(1)	16						TGATGACTATCGAGGGAAAGG	0.478																																							uc002vet.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(145-147)CGA>AGA		von Willebrand factor C domain-containing							116.0	120.0	119.0					2																	215279062		1985	4167	6152	SO:0001819	synonymous_variant	402117					extracellular region		g.chr2:215279062C>A	AB374231	CCDS46509.1	2q34-q35	2011-01-25	2011-01-25		ENSG00000174453	ENSG00000174453			37203	protein-coding gene	gene with protein product			"""von Willebrand factor C domain-containing protein 2-like"""				Standard	NM_001080500		Approved		uc002vet.2	B2RUY7	OTTHUMG00000154811	ENST00000312504.5:c.145C>A	2.37:g.215279062C>A			Somatic				VWC2L_uc010zjl.1_Silent_p.R49R	p.R49R	NM_001080500	NP_001073969	WXS	Illumina HiSeq	Unspecified	B2RUY7	VWC2L_HUMAN			2	275	+			49					A6NC69|B2RUW7|B7X8X1	Silent	SNP	ENST00000312504.5	37	c.145C>A	CCDS46509.1																																																																																				0.478	VWC2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337175.1	NM_001080500		6	29	1	0	1.06961e-07	0.00308	1.45062e-07	6	29				
CYP27A1	1593	broad.mit.edu	37	2	219674425	219674425	+	Silent	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr2:219674425G>T	ENST00000258415.4	+	2	808	c.381G>T	c.(379-381)cgG>cgT	p.R127R		NM_000784.3	NP_000775.1	Q02318	CP27A_HUMAN	cytochrome P450, family 27, subfamily A, polypeptide 1	127					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cholesterol metabolic process (GO:0008203)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)	cholestanetriol 26-monooxygenase activity (GO:0047749)|cholesterol 26-hydroxylase activity (GO:0031073)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid hydroxylase activity (GO:0008395)|vitamin D3 25-hydroxylase activity (GO:0030343)	p.R127R(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)|prostate(3)|urinary_tract(1)	26		Renal(207;0.0474)		Epithelial(149;9.48e-07)|all cancers(144;0.000171)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.00981)	Chenodeoxycholic acid(DB06777)|Cholecalciferol(DB00169)|Ergocalciferol(DB00153)|Pegvisomant(DB00082)	ACCCAGTACGGAACGACATGG	0.607																																							uc002viz.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(379-381)CGG>CGT		cytochrome P450, family 27, subfamily A,	Cholecalciferol(DB00169)						148.0	125.0	133.0					2																	219674425		2203	4300	6503	SO:0001819	synonymous_variant	1593				bile acid biosynthetic process|xenobiotic metabolic process	mitochondrial matrix	cholestanetriol 26-monooxygenase activity|electron carrier activity|heme binding	g.chr2:219674425G>T	BC017044	CCDS2423.1	2q35	2013-09-19	2003-01-14		ENSG00000135929	ENSG00000135929		"""Cytochrome P450s"""	2605	protein-coding gene	gene with protein product	"""cerebrotendinous xanthomatosis"""	606530	"""cytochrome P450, subfamily XXVIIA (steroid 27-hydroxylase, cerebrotendinous xanthomatosis), polypeptide 1"""	CYP27		2019602	Standard	NM_000784		Approved	CTX, CP27	uc002viz.4	Q02318	OTTHUMG00000048238	ENST00000258415.4:c.381G>T	2.37:g.219674425G>T			Somatic					p.R127R	NM_000784	NP_000775	WXS	Illumina HiSeq	Unspecified	Q02318	CP27A_HUMAN		Epithelial(149;9.48e-07)|all cancers(144;0.000171)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.00981)	2	815	+		Renal(207;0.0474)	127					A8K303|Q6LDB4|Q86YQ6	Silent	SNP	ENST00000258415.4	37	c.381G>T	CCDS2423.1																																																																																				0.607	CYP27A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109734.4			13	107	1	0	4.93089e-13	0.00245	8.21815e-13	13	107				
OTOS	150677	broad.mit.edu	37	2	241078631	241078631	+	Silent	SNP	G	G	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr2:241078631G>A	ENST00000391989.2	-	5	456	c.226C>T	c.(226-228)Ctg>Ttg	p.L76L	MYEOV2_ENST00000607357.1_5'Flank|OTOS_ENST00000319460.1_Silent_p.L76L|MYEOV2_ENST00000307266.3_5'Flank			Q8NHW6	OTOSP_HUMAN	otospiralin	76					sensory perception of sound (GO:0007605)	extracellular region (GO:0005576)		p.L76L(1)		endometrium(2)|large_intestine(1)|lung(3)	6		all_epithelial(40;2.79e-15)|Breast(86;3.04e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0396)|Lung NSC(271;0.128)|Hepatocellular(293;0.148)|all_hematologic(139;0.158)|Melanoma(123;0.16)		Epithelial(32;2.56e-30)|all cancers(36;7.18e-28)|OV - Ovarian serous cystadenocarcinoma(60;2.37e-14)|Kidney(56;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;8.07e-06)|Lung(119;0.00344)|LUSC - Lung squamous cell carcinoma(224;0.0148)|Colorectal(34;0.019)|COAD - Colon adenocarcinoma(134;0.141)		GTGCTCCCCAGGGGGAAGTGG	0.652																																							uc002vyv.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(226-228)CTG>TTG		otospiralin precursor							61.0	61.0	61.0					2																	241078631		2203	4300	6503	SO:0001819	synonymous_variant	150677					extracellular region		g.chr2:241078631G>A		CCDS2533.1	2q37.3	2008-02-05			ENSG00000178602	ENSG00000178602			22644	protein-coding gene	gene with protein product		607877				12687421	Standard	NM_148961		Approved	OTOSP	uc002vyv.3	Q8NHW6	OTTHUMG00000133351	ENST00000391989.2:c.226C>T	2.37:g.241078631G>A			Somatic				MYEOV2_uc002vyu.1_5'Flank|MYEOV2_uc010zof.1_5'Flank	p.L76L	NM_148961	NP_683764	WXS	Illumina HiSeq	Unspecified	Q8NHW6	OTOSP_HUMAN		Epithelial(32;2.56e-30)|all cancers(36;7.18e-28)|OV - Ovarian serous cystadenocarcinoma(60;2.37e-14)|Kidney(56;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;8.07e-06)|Lung(119;0.00344)|LUSC - Lung squamous cell carcinoma(224;0.0148)|Colorectal(34;0.019)|COAD - Colon adenocarcinoma(134;0.141)	4	381	-		all_epithelial(40;2.79e-15)|Breast(86;3.04e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0396)|Lung NSC(271;0.128)|Hepatocellular(293;0.148)|all_hematologic(139;0.158)|Melanoma(123;0.16)	76					Q53SW6	Silent	SNP	ENST00000391989.2	37	c.226C>T	CCDS2533.1																																																																																				0.652	OTOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257181.3	NM_148961		23	80	0	0	0	0.00333	0	23	80				
NEU4	129807	broad.mit.edu	37	2	242757727	242757727	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr2:242757727C>A	ENST00000391969.2	+	5	1519	c.808C>A	c.(808-810)Ccc>Acc	p.P270T	NEU4_ENST00000404257.1_Missense_Mutation_p.P282T|NEU4_ENST00000405370.1_Missense_Mutation_p.P270T|NEU4_ENST00000407683.1_Missense_Mutation_p.P270T|NEU4_ENST00000325935.6_Missense_Mutation_p.P283T	NM_001167602.1	NP_001161074.1	Q8WWR8	NEUR4_HUMAN	sialidase 4	270					ganglioside catabolic process (GO:0006689)|glycoprotein catabolic process (GO:0006516)|glycosphingolipid metabolic process (GO:0006687)|oligosaccharide catabolic process (GO:0009313)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|organelle inner membrane (GO:0019866)	exo-alpha-(2->3)-sialidase activity (GO:0052794)|exo-alpha-(2->6)-sialidase activity (GO:0052795)|exo-alpha-(2->8)-sialidase activity (GO:0052796)|exo-alpha-sialidase activity (GO:0004308)	p.P282T(1)		breast(1)|lung(10)|prostate(2)|skin(2)	15		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;3.84e-33)|all cancers(36;8.08e-31)|OV - Ovarian serous cystadenocarcinoma(60;7.41e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0825)		GGCTTCCCTGCCCGAGACTGC	0.706																																							uc010fzr.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(808-810)CCC>ACC		sialidase 4							8.0	11.0	10.0					2																	242757727		2179	4261	6440	SO:0001583	missense	129807					lysosomal lumen|organelle inner membrane	exo-alpha-sialidase activity|protein binding	g.chr2:242757727C>A	BC012899	CCDS2553.1, CCDS54441.1, CCDS54442.1	2q37.3	2008-02-05			ENSG00000204099	ENSG00000204099			21328	protein-coding gene	gene with protein product		608527					Standard	NM_001167600		Approved		uc010fzr.3	Q8WWR8	OTTHUMG00000133412	ENST00000391969.2:c.808C>A	2.37:g.242757727C>A	ENSP00000375830:p.Pro270Thr		Somatic				NEU4_uc002wcl.2_RNA|NEU4_uc002wcm.2_Missense_Mutation_p.P270T|NEU4_uc002wcn.1_Missense_Mutation_p.P282T|NEU4_uc002wco.1_Missense_Mutation_p.P270T|NEU4_uc002wcp.1_Missense_Mutation_p.P282T	p.P270T	NM_080741	NP_542779	WXS	Illumina HiSeq	Unspecified	Q8WWR8	NEUR4_HUMAN		Epithelial(32;3.84e-33)|all cancers(36;8.08e-31)|OV - Ovarian serous cystadenocarcinoma(60;7.41e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0825)	4	894	+		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)	270					A8K056|J3KNJ5|Q96D64	Missense_Mutation	SNP	ENST00000391969.2	37	c.808C>A	CCDS54442.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.73|13.73	2.324998|2.324998	0.41197|0.41197	.|.	.|.	ENSG00000204099|ENSG00000204099	ENST00000415936;ENST00000426032|ENST00000407683;ENST00000405370;ENST00000472793;ENST00000404257;ENST00000391969;ENST00000325935	.|D;D;D;D;D	.|0.84873	.|-1.91;-1.91;-1.91;-1.91;-1.91	4.55|4.55	0.165|0.165	0.14995|0.14995	.|Neuraminidase (2);	.|0.343883	.|0.29900	.|N	.|0.010911	.|T	.|0.71358	.|0.3330	N|N	0.20610|0.20610	0.595|0.595	0.21984|0.21984	N|N	0.99943|0.99943	.|B;B;B	.|0.11235	.|0.003;0.002;0.004	.|B;B;B	.|0.06405	.|0.001;0.0;0.002	.|T	.|0.53982	.|-0.8361	.|10	0.17369|0.24483	T|T	0.5|0.36	-1.733|-1.733	11.3085|11.3085	0.49349|0.49349	0.0:0.3783:0.4966:0.125|0.0:0.3783:0.4966:0.125	.|.	.|282;282;270	.|A8K211;Q8WWR8-2;Q8WWR8	.|.;.;NEUR4_HUMAN	X|T	184;196|270;270;280;282;270;283	.|ENSP00000385402:P270T;ENSP00000384804:P270T;ENSP00000385149:P282T;ENSP00000375830:P270T;ENSP00000320318:P283T	ENSP00000397167:C184X|ENSP00000320318:P283T	C|P	+|+	3|1	2|0	NEU4|NEU4	242406400|242406400	1.000000|1.000000	0.71417|0.71417	0.001000|0.001000	0.08648|0.08648	0.016000|0.016000	0.09150|0.09150	2.624000|2.624000	0.46444|0.46444	-0.318000|-0.318000	0.08665|0.08665	-0.552000|-0.552000	0.04208|0.04208	TGC|CCC		0.706	NEU4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257270.2	NM_080741		5	10	1	0	3.59834e-05	0.001168	4.43119e-05	5	10				
RTP5	285093	broad.mit.edu	37	2	242814448	242814448	+	Missense_Mutation	SNP	C	C	A	rs374804727		TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr2:242814448C>A	ENST00000343216.3	+	2	769	c.741C>A	c.(739-741)ttC>ttA	p.F247L		NM_173821.2	NP_776182.2												p.F247L(1)									GCTCCATCTTCCTGTCTGGGG	0.692																																							uc010fzu.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(739-741)TTC>TTA		hypothetical protein LOC285093							23.0	27.0	26.0					2																	242814448		1887	4106	5993	SO:0001583	missense	285093					integral to membrane		g.chr2:242814448C>A																												ENST00000343216.3:c.741C>A	2.37:g.242814448C>A	ENSP00000345374:p.Phe247Leu		Somatic					p.F247L	NM_173821	NP_776182	WXS	Illumina HiSeq	Unspecified	Q14D33	CB085_HUMAN			2	764	+			247						Missense_Mutation	SNP	ENST00000343216.3	37	c.741C>A	CCDS42843.1	.	.	.	.	.	.	.	.	.	.	.	2.529	-0.309064	0.05458	.	.	ENSG00000188011	ENST00000343216	T	0.21734	1.99	2.93	-0.0694	0.13751	.	.	.	.	.	T	0.08935	0.0221	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.39354	-0.9618	9	0.20046	T	0.44	.	6.7041	0.23240	0.0:0.615:0.0:0.385	.	247	Q14D33	CB085_HUMAN	L	247	ENSP00000345374:F247L	ENSP00000345374:F247L	F	+	3	2	C2orf85	242463121	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.464000	0.21988	-0.014000	0.14175	-0.427000	0.05922	TTC		0.692	CXXC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322310.1			7	38	1	0	1.12685e-05	0.004482	1.42141e-05	7	38				
SIRPA	140885	broad.mit.edu	37	20	1896081	1896081	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr20:1896081G>A	ENST00000358771.4	+	2	568	c.416G>A	c.(415-417)gGc>gAc	p.G139D	SIRPA_ENST00000400068.3_Missense_Mutation_p.G139D|SIRPA_ENST00000356025.3_Missense_Mutation_p.G139D	NM_001040023.1	NP_001035112.1	P78324	SHPS1_HUMAN	signal-regulatory protein alpha	139					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|leukocyte migration (GO:0050900)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.G139D(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(13)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	21				Colorectal(46;0.018)|READ - Rectum adenocarcinoma(1;0.0556)		TCTGGAGCAGGCACTGAGCTG	0.532																																					GBM(155;1668 1920 5945 42733 48121)	GBM(155;1668 1920 5945 42733 48121)	uc002wfq.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(415-417)GGC>GAC		signal-regulatory protein alpha precursor							108.0	95.0	99.0					20																	1896081		2203	4298	6501	SO:0001583	missense	140885				blood coagulation|cell adhesion|cell junction assembly|leukocyte migration	integral to membrane|plasma membrane	SH3 domain binding	g.chr20:1896081G>A	D86043	CCDS13022.1	20p13	2013-01-11	2006-03-29	2006-03-29	ENSG00000198053	ENSG00000198053		"""Signal-regulatory proteins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	9662	protein-coding gene	gene with protein product		602461	"""protein tyrosine phosphatase, non-receptor type substrate 1"""	PTPNS1		9070220, 9062191, 16339511	Standard	XM_005260669		Approved	SHPS1, SIRP, MYD-1, BIT, P84, SHPS-1, SIRPalpha, CD172a, SIRPalpha2, MFR, SIRP-ALPHA-1	uc002wfr.3	P78324	OTTHUMG00000031682	ENST00000358771.4:c.416G>A	20.37:g.1896081G>A	ENSP00000351621:p.Gly139Asp		Somatic				SIRPA_uc010zps.1_Missense_Mutation_p.G119D|SIRPA_uc002wfr.2_Missense_Mutation_p.G139D|SIRPA_uc002wfs.2_Missense_Mutation_p.G139D|SIRPA_uc002wft.2_Missense_Mutation_p.G139D	p.G139D	NM_001040022	NP_001035111	WXS	Illumina HiSeq	Unspecified	P78324	SHPS1_HUMAN		Colorectal(46;0.018)|READ - Rectum adenocarcinoma(1;0.0556)	3	776	+			139			Extracellular (Potential).		A2A2E1|A8K411|B2R6C3|O00683|O43799|Q8N517|Q8TAL8|Q9H0Z2|Q9UDX2|Q9UIJ6|Q9Y4U9	Missense_Mutation	SNP	ENST00000358771.4	37	c.416G>A	CCDS13022.1	.	.	.	.	.	.	.	.	.	.	G	16.09	3.023142	0.54683	.	.	ENSG00000198053	ENST00000400068;ENST00000356025;ENST00000358771	T;T;T	0.03607	3.87;3.87;3.87	5.11	5.11	0.69529	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000009	T	0.30166	0.0756	H	0.97732	4.065	0.47441	D	0.999428	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.44452	-0.9327	10	0.87932	D	0	.	13.9546	0.64140	0.0:0.0:1.0:0.0	.	119;139;139	B4DP97;P78324-2;P78324	.;.;SHPS1_HUMAN	D	139	ENSP00000382941:G139D;ENSP00000348307:G139D;ENSP00000351621:G139D	ENSP00000348307:G139D	G	+	2	0	SIRPA	1844081	1.000000	0.71417	0.989000	0.46669	0.097000	0.18754	5.310000	0.65780	2.682000	0.91365	0.555000	0.69702	GGC		0.532	SIRPA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000077568.2	NM_080792		23	134	0	0	0	0.00333	0	23	134				
TGM6	343641	broad.mit.edu	37	20	2411621	2411621	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr20:2411621T>A	ENST00000202625.2	+	12	1976	c.1915T>A	c.(1915-1917)Tgt>Agt	p.C639S	TGM6_ENST00000381423.1_Intron	NM_198994.2	NP_945345.2	O95932	TGM3L_HUMAN	transglutaminase 6	639					cell death (GO:0008219)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)	p.C639S(1)		breast(1)|endometrium(6)|kidney(2)|large_intestine(2)|lung(32)|ovary(4)|prostate(1)|skin(4)	52					L-Glutamine(DB00130)	AGTGAAGGACTGTGCGCTGAT	0.597																																							uc002wfy.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(1)	4						c.(1915-1917)TGT>AGT		transglutaminase 6	L-Glutamine(DB00130)						146.0	122.0	130.0					20																	2411621		2203	4300	6503	SO:0001583	missense	343641				cell death|peptide cross-linking		acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity	g.chr20:2411621T>A	AF540970	CCDS13025.1, CCDS58761.1	20p13	2010-12-19	2004-07-05	2004-07-07	ENSG00000166948	ENSG00000166948		"""Transglutaminases"""	16255	protein-coding gene	gene with protein product	"""spinocerebellar ataxia 35"""	613900	"""transglutaminase 3-like"""	TGM3L		11390390, 21106500	Standard	NM_198994		Approved	dJ734P14.3, TGY, SCA35	uc002wfy.1	O95932	OTTHUMG00000031692	ENST00000202625.2:c.1915T>A	20.37:g.2411621T>A	ENSP00000202625:p.Cys639Ser		Somatic				TGM6_uc010gal.1_Intron	p.C639S	NM_198994	NP_945345	WXS	Illumina HiSeq	Unspecified	O95932	TGM3L_HUMAN			12	1976	+			639					Q5JXU4|Q5JXU5|Q719M2|Q719M3|Q9Y4U8	Missense_Mutation	SNP	ENST00000202625.2	37	c.1915T>A	CCDS13025.1	.	.	.	.	.	.	.	.	.	.	T	18.25	3.582899	0.65992	.	.	ENSG00000166948	ENST00000202625	T	0.34667	1.35	5.24	1.58	0.23477	Transglutaminase, C-terminal (2);Immunoglobulin-like fold (1);	0.255751	0.35151	N	0.003411	T	0.47210	0.1433	M	0.87682	2.9	0.80722	D	1	P	0.43938	0.822	P	0.48368	0.575	T	0.43114	-0.9411	10	0.72032	D	0.01	-5.9326	6.0574	0.19819	0.1578:0.0:0.329:0.5132	.	639	O95932	TGM3L_HUMAN	S	639	ENSP00000202625:C639S	ENSP00000202625:C639S	C	+	1	0	TGM6	2359621	1.000000	0.71417	0.972000	0.41901	0.926000	0.56050	1.400000	0.34577	0.077000	0.16863	0.533000	0.62120	TGT		0.597	TGM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077581.2	NM_198994		76	165	0	0	0	0.00361	0	76	165				
CPXM1	56265	broad.mit.edu	37	20	2779518	2779518	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr20:2779518C>A	ENST00000380605.2	-	2	258	c.194G>T	c.(193-195)cGg>cTg	p.R65L		NM_001184699.1|NM_019609.4	NP_001171628.1|NP_062555.1	Q96SM3	CPXM1_HUMAN	carboxypeptidase X (M14 family), member 1	65					cell adhesion (GO:0007155)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)	p.R65L(1)		endometrium(5)|kidney(5)|large_intestine(8)|lung(17)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	43						GACTCGAATCCGGACATGCTG	0.552																																							uc002wgu.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(2)	4						c.(193-195)CGG>CTG		carboxypeptidase X, member 1 precursor							123.0	121.0	122.0					20																	2779518		2203	4300	6503	SO:0001583	missense	56265				cell adhesion|proteolysis		metallocarboxypeptidase activity|zinc ion binding	g.chr20:2779518C>A	AL035460	CCDS13033.1	20p13	2012-02-10	2006-08-24	2006-08-24	ENSG00000088882	ENSG00000088882			15771	protein-coding gene	gene with protein product	"""carboxypeptidase-like protein X1"""	609555	"""carboxypeptidase X (M14 family)"""	CPXM		14702039	Standard	NM_019609		Approved	CPX-1, CPX1	uc002wgu.3	Q96SM3	OTTHUMG00000031706	ENST00000380605.2:c.194G>T	20.37:g.2779518C>A	ENSP00000369979:p.Arg65Leu		Somatic				CPXM1_uc010gas.2_Missense_Mutation_p.R65L	p.R65L	NM_019609	NP_062555	WXS	Illumina HiSeq	Unspecified	Q96SM3	CPXM1_HUMAN			2	258	-			65					Q6P4G8|Q6UW65|Q9NUB5	Missense_Mutation	SNP	ENST00000380605.2	37	c.194G>T	CCDS13033.1	.	.	.	.	.	.	.	.	.	.	C	13.44	2.239316	0.39598	.	.	ENSG00000088882	ENST00000380605	D	0.95622	-3.76	4.75	1.46	0.22682	.	1.682810	0.03416	N	0.205638	D	0.90452	0.7010	N	0.24115	0.695	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.80390	-0.1402	10	0.62326	D	0.03	-6.6423	3.1481	0.06478	0.2122:0.5621:0.0:0.2257	.	65;65	Q8N2E1;Q96SM3	.;CPXM1_HUMAN	L	65	ENSP00000369979:R65L	ENSP00000369979:R65L	R	-	2	0	CPXM1	2727518	0.039000	0.19947	0.005000	0.12908	0.895000	0.52256	0.710000	0.25748	0.587000	0.29643	0.563000	0.77884	CGG		0.552	CPXM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077643.2	NM_019609		76	173	1	0	1.50424e-25	0.00361	2.89009e-25	76	173				
MACROD2	140733	broad.mit.edu	37	20	16025241	16025241	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr20:16025241G>T	ENST00000310348.4	+	17	1257	c.1257G>T	c.(1255-1257)aaG>aaT	p.K419N	MACROD2_ENST00000407045.3_Missense_Mutation_p.K70N|MACROD2_ENST00000402914.1_Missense_Mutation_p.K184N|MACROD2_ENST00000217246.4_Intron|MACROD2_ENST00000378058.3_Missense_Mutation_p.K184N			A1Z1Q3	MACD2_HUMAN	MACRO domain containing 2	419					brain development (GO:0007420)|cellular response to DNA damage stimulus (GO:0006974)|protein de-ADP-ribosylation (GO:0051725)|purine nucleoside metabolic process (GO:0042278)	nucleus (GO:0005634)	deacetylase activity (GO:0019213)|hydrolase activity, acting on glycosyl bonds (GO:0016798)	p.K184N(1)		breast(2)|kidney(4)|large_intestine(5)|lung(8)|skin(1)	20		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)				AGGTTGACAAGGTAAATGACC	0.343																																							uc002wou.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1255-1257)AAG>AAT		MACRO domain containing 2 isoform 1							86.0	81.0	83.0					20																	16025241		2203	4300	6503	SO:0001583	missense	140733							g.chr20:16025241G>T	BC101218	CCDS13120.2, CCDS33443.1	20p12.1	2011-04-28	2007-07-24	2007-07-24	ENSG00000172264	ENSG00000172264			16126	protein-coding gene	gene with protein product		611567	"""chromosome 20 open reading frame 133"""	C20orf133			Standard	NM_080676		Approved	dJ631M13.5	uc002wot.3	A1Z1Q3	OTTHUMG00000031919	ENST00000310348.4:c.1257G>T	20.37:g.16025241G>T	ENSP00000309809:p.Lys419Asn		Somatic				MACROD2_uc002wot.2_Intron|MACROD2_uc002woz.2_Missense_Mutation_p.K184N|MACROD2_uc002wpb.2_Intron|MACROD2_uc002wpd.2_Missense_Mutation_p.K70N	p.K419N	NM_080676	NP_542407	WXS	Illumina HiSeq	Unspecified	A1Z1Q3	MACD2_HUMAN			17	1521	+		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)	419					A6NFF7|B0QZ39|B3KWV0|Q0P6D5|Q495E0|Q5W199|Q6ZN71	Missense_Mutation	SNP	ENST00000310348.4	37	c.1257G>T	CCDS13120.2	.	.	.	.	.	.	.	.	.	.	G	0.162	-1.080314	0.01888	.	.	ENSG00000172264	ENST00000310348;ENST00000402914;ENST00000378058;ENST00000407045	T;T;T	0.46451	2.49;0.87;0.87	5.51	3.21	0.36854	.	.	.	.	.	T	0.23410	0.0566	.	.	.	0.21950	N	0.999453	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.26258	-1.0108	8	0.15499	T	0.54	.	7.1205	0.25442	0.0:0.0764:0.1492:0.7744	.	70;419	A1Z1Q3-6;A1Z1Q3	.;MACD2_HUMAN	N	419;184;184;70	ENSP00000309809:K419N;ENSP00000385290:K184N;ENSP00000367297:K184N	ENSP00000309809:K419N	K	+	3	2	MACROD2	15973241	1.000000	0.71417	0.995000	0.50966	0.568000	0.35870	0.735000	0.26115	0.453000	0.26858	-0.266000	0.10368	AAG		0.343	MACROD2-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_080676		13	35	1	0	5.01169e-05	0.00499	6.13526e-05	13	35				
KIF16B	55614	broad.mit.edu	37	20	16360585	16360585	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr20:16360585G>T	ENST00000354981.2	-	19	2219	c.2062C>A	c.(2062-2064)Cag>Aag	p.Q688K	KIF16B_ENST00000355755.3_Missense_Mutation_p.Q688K|KIF16B_ENST00000408042.1_Missense_Mutation_p.Q688K|KIF16B_ENST00000378003.2_5'UTR	NM_001199865.1|NM_024704.4	NP_001186794.1|NP_078980.3	Q96L93	KI16B_HUMAN	kinesin family member 16B	688	Glu-rich.				ATP catabolic process (GO:0006200)|early endosome to late endosome transport (GO:0045022)|endoderm development (GO:0007492)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|formation of primary germ layer (GO:0001704)|Golgi to endosome transport (GO:0006895)|microtubule-based movement (GO:0007018)|receptor catabolic process (GO:0032801)|regulation of receptor recycling (GO:0001919)	early endosome (GO:0005769)|endosome (GO:0005768)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|plus-end-directed microtubule motor activity (GO:0008574)	p.Q688K(2)		NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(24)|ovary(1)|prostate(15)|skin(3)|upper_aerodigestive_tract(2)	74						TCGATTTCCTGCTGTTCCCTC	0.488																																							uc002wpg.1		NA																	2	Substitution - Missense(2)		lung(2)	skin(2)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|ovary(1)|kidney(1)	8						c.(2062-2064)CAG>AAG		kinesin-like motor protein C20orf23							142.0	124.0	130.0					20																	16360585		2203	4300	6503	SO:0001583	missense	55614				cell communication|early endosome to late endosome transport|endoderm development|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|formation of primary germ layer|Golgi to endosome transport|microtubule-based movement|receptor catabolic process|regulation of receptor recycling	early endosome membrane|microtubule	ATP binding|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding|plus-end-directed microtubule motor activity	g.chr20:16360585G>T	AK000142	CCDS13122.1, CCDS56178.1	20p11.23	2008-03-03	2008-03-03	2008-03-03	ENSG00000089177	ENSG00000089177		"""Kinesins"""	15869	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 23"""	C20orf23		16084724, 16782399	Standard	NM_024704		Approved	FLJ20135, dJ971B4.1, SNX23	uc010gci.2	Q96L93	OTTHUMG00000031927	ENST00000354981.2:c.2062C>A	20.37:g.16360585G>T	ENSP00000347076:p.Gln688Lys		Somatic				KIF16B_uc002wpe.1_Missense_Mutation_p.Q70K|KIF16B_uc002wpf.1_Missense_Mutation_p.Q70K|KIF16B_uc010gch.1_Missense_Mutation_p.Q688K|KIF16B_uc010gci.1_Missense_Mutation_p.Q688K|KIF16B_uc010gcj.1_Missense_Mutation_p.Q699K	p.Q688K	NM_024704	NP_078980	WXS	Illumina HiSeq	Unspecified	Q96L93	KI16B_HUMAN			19	2220	-			688			Glu-rich.|Potential.		A6NKJ9|A7E2A8|B1AKG3|B1AKT7|C9JDN5|C9JI52|C9JSM8|C9JWJ7|Q2TBF5|Q5HYC0|Q5HYK1|Q5JWW3|Q5TFK5|Q86VL9|Q86YS5|Q8IYU0|Q9BQJ8|Q9BQM0|Q9BQM1|Q9BQM5|Q9H5U0|Q9HCI2|Q9NXN9	Missense_Mutation	SNP	ENST00000354981.2	37	c.2062C>A	CCDS13122.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.40|16.40	3.112517|3.112517	0.56398|0.56398	.|.	.|.	ENSG00000089177|ENSG00000089177	ENST00000354981;ENST00000355755;ENST00000408042|ENST00000450176	T;T;T|.	0.17213|.	2.29;2.29;2.29|.	5.39|5.39	5.39|5.39	0.77823|0.77823	.|.	0.125415|.	0.53938|.	D|.	0.000041|.	T|T	0.71736|0.71736	0.3375|0.3375	L|L	0.55103|0.55103	1.725|1.725	0.80722|0.80722	D|D	1|1	P;P;P;P|.	0.44241|.	0.629;0.829;0.629;0.495|.	B;B;B;B|.	0.42625|.	0.213;0.393;0.213;0.106|.	T|T	0.68469|0.68469	-0.5400|-0.5400	10|5	0.19590|.	T|.	0.45|.	.|.	19.152|19.152	0.93493|0.93493	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	688;688;688;688|.	Q96L93-4;Q96L93-2;Q96L93-6;Q96L93|.	.;.;.;KI16B_HUMAN|.	K|R	688|122	ENSP00000347076:Q688K;ENSP00000347995:Q688K;ENSP00000384164:Q688K|.	ENSP00000347076:Q688K|.	Q|S	-|-	1|3	0|2	KIF16B|KIF16B	16308585|16308585	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.872000|0.872000	0.50106|0.50106	4.822000|4.822000	0.62686|0.62686	2.531000|2.531000	0.85337|0.85337	0.655000|0.655000	0.94253|0.94253	CAG|AGC		0.488	KIF16B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078104.2	NM_017683		27	301	1	0	8.24728e-16	0.004656	1.45026e-15	27	301				
SSTR4	6754	broad.mit.edu	37	20	23016906	23016906	+	Silent	SNP	G	G	T	rs72547257	byFrequency	TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr20:23016906G>T	ENST00000255008.3	+	1	850	c.786G>T	c.(784-786)ctG>ctT	p.L262L	RP4-753D10.3_ENST00000440921.1_RNA	NM_001052.2	NP_001043.2	P31391	SSR4_HUMAN	somatostatin receptor 4	262					arachidonic acid metabolic process (GO:0019369)|cell migration (GO:0016477)|cellular response to glucocorticoid stimulus (GO:0071385)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cAMP metabolic process (GO:0030815)|negative regulation of cell proliferation (GO:0008285)|positive regulation of MAPK cascade (GO:0043410)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	somatostatin receptor activity (GO:0004994)	p.L262L(1)		breast(1)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|upper_aerodigestive_tract(1)	32	Colorectal(13;0.0518)|Lung NSC(19;0.0542)|all_lung(19;0.118)					GGCTGGTGCTGATGGTCGTGG	0.612													G|||	5	0.000998403	0.0038	0.0	5008	,	,		15713	0.0		0.0	False		,,,				2504	0.0				Esophageal Squamous(15;850 1104 16640)	Esophageal Squamous(15;850 1104 16640)	uc002wsr.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(784-786)CTG>CTT		somatostatin receptor 4		G		11,4389	17.9+/-39.9	0,11,2189	195.0	202.0	200.0		786	-1.9	0.8	20	dbSNP_130	200	0,8596		0,0,4298	no	coding-synonymous	SSTR4	NM_001052.2		0,11,6487	TT,TG,GG		0.0,0.25,0.0846		262/389	23016906	11,12985	2200	4298	6498	SO:0001819	synonymous_variant	6754				G-protein signaling, coupled to cyclic nucleotide second messenger|negative regulation of cell proliferation	integral to plasma membrane	somatostatin receptor activity	g.chr20:23016906G>T		CCDS42856.1	20p11.21	2014-07-11			ENSG00000132671	ENSG00000132671		"""GPCR / Class A : Somatostatin receptors"""	11333	protein-coding gene	gene with protein product		182454				8483934	Standard	NM_001052		Approved		uc002wsr.2	P31391	OTTHUMG00000032054	ENST00000255008.3:c.786G>T	20.37:g.23016906G>T			Somatic					p.L262L	NM_001052	NP_001043	WXS	Illumina HiSeq	Unspecified	P31391	SSR4_HUMAN			1	850	+	Colorectal(13;0.0518)|Lung NSC(19;0.0542)|all_lung(19;0.118)		262			Helical; Name=6; (Potential).		Q17RM1|Q17RM3|Q9UIY1	Silent	SNP	ENST00000255008.3	37	c.786G>T	CCDS42856.1																																																																																				0.612	SSTR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078308.1			44	97	1	0	1.56793e-16	0.00361	2.79266e-16	44	97				
CDK5RAP1	51654	broad.mit.edu	37	20	31973519	31973519	+	Silent	SNP	C	C	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr20:31973519C>A	ENST00000357886.4	-	7	966	c.813G>T	c.(811-813)cgG>cgT	p.R271R	CDK5RAP1_ENST00000477105.1_5'UTR|CDK5RAP1_ENST00000544843.1_Silent_p.R271R|CDK5RAP1_ENST00000346416.2_Silent_p.R271R|CDK5RAP1_ENST00000473997.1_Silent_p.R181R|CDK5RAP1_ENST00000339269.5_Silent_p.R271R			Q96SZ6	CK5P1_HUMAN	CDK5 regulatory subunit associated protein 1	271					brain development (GO:0007420)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|regulation of neuron differentiation (GO:0045664)|tRNA modification (GO:0006400)	cytoplasm (GO:0005737)	4 iron, 4 sulfur cluster binding (GO:0051539)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|transferase activity (GO:0016740)	p.R271R(1)		endometrium(2)|kidney(2)|large_intestine(3)|lung(12)|ovary(3)|skin(3)|urinary_tract(1)	26						TCTCCCTGCCCCGGGTGAAAG	0.493																																							uc010gek.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|skin(2)|lung(1)	5						c.(811-813)CGG>CGT		CDK5 regulatory subunit associated protein 1							104.0	94.0	97.0					20																	31973519		2203	4300	6503	SO:0001819	synonymous_variant	51654				brain development|negative regulation of cyclin-dependent protein kinase activity|regulation of neuron differentiation|tRNA modification	cytoplasm	4 iron, 4 sulfur cluster binding|metal ion binding|neuronal Cdc2-like kinase binding|transferase activity	g.chr20:31973519C>A	AF152097	CCDS13219.1, CCDS63255.1	20q11.21	2012-09-20	2002-07-22	2002-07-26	ENSG00000101391	ENSG00000101391			15880	protein-coding gene	gene with protein product		608200	"""chromosome 20 open reading frame 34"""	C20orf34		10721722, 11882646, 15329498	Standard	NM_016408		Approved	CGI-05, HSPC167, C42	uc002wyy.4	Q96SZ6	OTTHUMG00000032256	ENST00000357886.4:c.813G>T	20.37:g.31973519C>A			Somatic				CDK5RAP1_uc002wyy.2_Silent_p.R181R|CDK5RAP1_uc002wyz.2_Silent_p.R271R|CDK5RAP1_uc002wza.2_Silent_p.R271R|CDK5RAP1_uc010gel.2_Silent_p.R180R|CDK5RAP1_uc010gem.2_Silent_p.R271R|CDK5RAP1_uc002wzc.1_Silent_p.R271R|CDK5RAP1_uc010gen.2_Silent_p.R271R	p.R271R	NM_016408	NP_057492	WXS	Illumina HiSeq	Unspecified	Q96SZ6	CK5P1_HUMAN			7	937	-			271					A8K7R0|Q5QP46|Q5QP47|Q5QP48|Q675N4|Q675N5|Q9BVG6|Q9BWZ5|Q9H859|Q9NZZ9|Q9Y3F0	Silent	SNP	ENST00000357886.4	37	c.813G>T																																																																																					0.493	CDK5RAP1-011	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000078697.1	NM_016408		15	119	1	0	3.62473e-10	0.001882	5.53038e-10	15	119				
TSHZ2	128553	broad.mit.edu	37	20	51872011	51872011	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr20:51872011C>A	ENST00000371497.5	+	2	2901	c.2014C>A	c.(2014-2016)Ccc>Acc	p.P672T	TSHZ2_ENST00000603338.2_Missense_Mutation_p.P669T|RP4-678D15.1_ENST00000606932.1_RNA|TSHZ2_ENST00000329613.6_Missense_Mutation_p.P669T	NM_001193421.1|NM_173485.5	NP_001180350.1|NP_775756.3	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	672					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.P672T(1)		NS(2)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(16)|lung(38)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	84			STAD - Stomach adenocarcinoma(23;0.1)			GCCCCTGGAGCCCACATCTGC	0.612																																							uc002xwo.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6						c.(2014-2016)CCC>ACC		teashirt zinc finger homeobox 2							55.0	53.0	54.0					20																	51872011		2203	4300	6503	SO:0001583	missense	128553				multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr20:51872011C>A	AF230201	CCDS33490.1, CCDS54474.1	20q13.2	2013-11-20	2007-07-16	2006-03-14	ENSG00000182463	ENSG00000182463		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	13010	protein-coding gene	gene with protein product		614118	"""chromosome 20 open reading frame 17"", ""zinc finger protein 218"", ""teashirt family zinc finger 2"""	C20orf17, ZNF218		9671742	Standard	NM_173485		Approved	ZABC2, OVC10-2, TSH2	uc021wex.1	Q9NRE2	OTTHUMG00000033058	ENST00000371497.5:c.2014C>A	20.37:g.51872011C>A	ENSP00000360552:p.Pro672Thr		Somatic					p.P672T	NM_173485	NP_775756	WXS	Illumina HiSeq	Unspecified	Q9NRE2	TSH2_HUMAN	STAD - Stomach adenocarcinoma(23;0.1)		2	2970	+			672					B7Z7W1|J3KNQ0|Q4VXM4|Q6N003|Q8N260	Missense_Mutation	SNP	ENST00000371497.5	37	c.2014C>A	CCDS33490.1	.	.	.	.	.	.	.	.	.	.	C	4.903	0.167746	0.09339	.	.	ENSG00000182463	ENST00000371497;ENST00000329613;ENST00000450262	T;T	0.38560	1.13;1.13	5.47	-0.944	0.10392	.	0.172349	0.51477	D	0.000089	T	0.28532	0.0706	L	0.50333	1.59	0.49299	D	0.999772	B	0.06786	0.001	B	0.09377	0.004	T	0.07616	-1.0763	10	0.56958	D	0.05	-6.308	2.5197	0.04676	0.1172:0.4089:0.2332:0.2406	.	672	Q9NRE2	TSH2_HUMAN	T	672;669;198	ENSP00000360552:P672T;ENSP00000333114:P669T	ENSP00000333114:P669T	P	+	1	0	TSHZ2	51305418	0.981000	0.34729	0.042000	0.18584	0.451000	0.32288	0.280000	0.18790	-0.012000	0.14223	-0.189000	0.12847	CCC		0.612	TSHZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080398.6	NM_173485		4	92	1	0	0.00024832	0.009096	0.000288663	4	92				
ZNF831	128611	broad.mit.edu	37	20	57766620	57766620	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr20:57766620G>T	ENST00000371030.2	+	1	546	c.546G>T	c.(544-546)aaG>aaT	p.K182N		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	182							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)	p.K182N(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					TCGCCTTTAAGACCCAGAGCA	0.647																																							uc002yan.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(13)|ovary(1)	14						c.(544-546)AAG>AAT		zinc finger protein 831							60.0	69.0	66.0					20																	57766620		2085	4215	6300	SO:0001583	missense	128611					intracellular	nucleic acid binding|zinc ion binding	g.chr20:57766620G>T	AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.546G>T	20.37:g.57766620G>T	ENSP00000360069:p.Lys182Asn		Somatic					p.K182N	NM_178457	NP_848552	WXS	Illumina HiSeq	Unspecified	Q5JPB2	ZN831_HUMAN			1	546	+	all_lung(29;0.0085)		182			C2H2-type 2.		Q5TDR4|Q8TCP0	Missense_Mutation	SNP	ENST00000371030.2	37	c.546G>T	CCDS42894.1	.	.	.	.	.	.	.	.	.	.	G	19.10	3.761606	0.69763	.	.	ENSG00000124203	ENST00000371030	T	0.20738	2.05	5.41	5.41	0.78517	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.33030	0.0849	L	0.31371	0.925	0.44409	D	0.997326	D	0.89917	1.0	D	0.91635	0.999	T	0.04413	-1.0953	9	0.72032	D	0.01	-20.0848	11.565	0.50800	0.0907:0.0:0.9093:0.0	.	182	Q5JPB2	ZN831_HUMAN	N	182	ENSP00000360069:K182N	ENSP00000360069:K182N	K	+	3	2	ZNF831	57200015	1.000000	0.71417	1.000000	0.80357	0.847000	0.48162	2.587000	0.46128	2.538000	0.85594	0.561000	0.74099	AAG		0.647	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000079916.2	NM_178457		97	166	1	0	9.53958e-58	0.00361	1.90333e-57	97	166				
ZBTB46	140685	broad.mit.edu	37	20	62421767	62421767	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr20:62421767G>T	ENST00000245663.4	-	2	494	c.344C>A	c.(343-345)aCg>aAg	p.T115K	ZBTB46_ENST00000395104.1_Missense_Mutation_p.T115K|ZBTB46_ENST00000480766.1_5'Flank|ZBTB46_ENST00000302995.2_Missense_Mutation_p.T115K	NM_025224.3	NP_079500.2	Q86UZ6	ZBT46_HUMAN	zinc finger and BTB domain containing 46	115					negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of monocyte differentiation (GO:0045656)|positive regulation of dendritic cell differentiation (GO:2001200)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)	p.T115K(1)		endometrium(2)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	24	all_cancers(38;2.09e-12)|all_epithelial(29;3.8e-14)|Lung NSC(23;7.61e-10)|all_lung(23;2.64e-09)					CACGATGTCCGTCATCTGCAG	0.597																																							uc002ygv.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|ovary(1)	2						c.(343-345)ACG>AAG		zinc finger and BTB domain containing 46							44.0	36.0	39.0					20																	62421767		2203	4300	6503	SO:0001583	missense	140685				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding	g.chr20:62421767G>T	AK131482	CCDS13538.1	20q13.33	2013-01-08	2006-09-19	2006-09-19	ENSG00000130584	ENSG00000130584		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	16094	protein-coding gene	gene with protein product	"""BTB-ZF protein expressed in effector lymphocytes"""	614639	"""BTB (POZ) domain containing 4"""	ZNF340, BTBD4			Standard	NM_025224		Approved	FLJ13502, RINZF, BZEL	uc002ygv.2	Q86UZ6	OTTHUMG00000033001	ENST00000245663.4:c.344C>A	20.37:g.62421767G>T	ENSP00000245663:p.Thr115Lys		Somatic				ZBTB46_uc002ygu.2_RNA	p.T115K	NM_025224	NP_079500	WXS	Illumina HiSeq	Unspecified	Q86UZ6	ZBT46_HUMAN			2	545	-	all_cancers(38;2.09e-12)|all_epithelial(29;3.8e-14)|Lung NSC(23;7.61e-10)|all_lung(23;2.64e-09)		115					E1P5K9|Q5JWJ3|Q6GMV4|Q9BQK3|Q9H3Z8|Q9H3Z9	Missense_Mutation	SNP	ENST00000245663.4	37	c.344C>A	CCDS13538.1	.	.	.	.	.	.	.	.	.	.	G	32	5.136505	0.94517	.	.	ENSG00000130584	ENST00000245663;ENST00000302995;ENST00000395104	T;T;T	0.65364	-0.15;-0.15;-0.15	5.65	5.65	0.86999	BTB/POZ-like (1);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	T	0.72748	0.3499	L	0.43554	1.36	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.65788	-0.6083	10	0.20046	T	0.44	.	18.7103	0.91653	0.0:0.0:1.0:0.0	.	115	Q86UZ6	ZBT46_HUMAN	K	115	ENSP00000245663:T115K;ENSP00000303102:T115K;ENSP00000378536:T115K	ENSP00000245663:T115K	T	-	2	0	ZBTB46	61892211	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.725000	0.98778	2.679000	0.91253	0.655000	0.94253	ACG		0.597	ZBTB46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080232.2	NM_025224		3	21	1	0	6.4e-05	0.004672	7.74515e-05	3	21				
ZBTB21	49854	broad.mit.edu	37	21	43414063	43414063	+	Missense_Mutation	SNP	A	A	C			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr21:43414063A>C	ENST00000310826.5	-	3	325	c.142T>G	c.(142-144)Ttg>Gtg	p.L48V	ZBTB21_ENST00000398505.3_Missense_Mutation_p.L48V|ZBTB21_ENST00000398499.1_Missense_Mutation_p.L48V|ZBTB21_ENST00000398511.3_Missense_Mutation_p.L48V|ZBTB21_ENST00000465968.1_Intron	NM_001098402.1	NP_001091872.1	Q9ULJ3	ZBT21_HUMAN	zinc finger and BTB domain containing 21	48	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.|Mediates homodimerization.				negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyl-CpG binding (GO:0008327)	p.L48V(1)									CTGGCAGCCAAGACGTTTTTA	0.438																																							uc002zab.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)|skin(1)	3						c.(142-144)TTG>GTG		zinc finger protein 295 isoform L							98.0	92.0	94.0					21																	43414063		2203	4300	6503	SO:0001583	missense	49854				negative regulation of transcription, DNA-dependent|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|nucleus	methyl-CpG binding|protein binding|zinc ion binding	g.chr21:43414063A>C	AB033053	CCDS13678.1, CCDS42934.1	21q22.3	2013-01-09	2013-01-09	2013-01-09	ENSG00000173276	ENSG00000173276		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	13083	protein-coding gene	gene with protein product			"""zinc finger protein 295"""	ZNF295			Standard	NM_020727		Approved	KIAA1227	uc002yzy.4	Q9ULJ3	OTTHUMG00000086789	ENST00000310826.5:c.142T>G	21.37:g.43414063A>C	ENSP00000308759:p.Leu48Val		Somatic				ZNF295_uc002yzz.3_Missense_Mutation_p.L48V|ZNF295_uc002yzy.3_Missense_Mutation_p.L48V|ZNF295_uc002zaa.3_Missense_Mutation_p.L48V|ZNF295_uc010gov.1_Missense_Mutation_p.L48V|ZNF295_uc002zac.2_Missense_Mutation_p.L48V	p.L48V	NM_001098402	NP_001091872	WXS	Illumina HiSeq	Unspecified	Q9ULJ3	ZN295_HUMAN			3	356	-			48			Mediates homodimerization.|BTB.		Q5R2W1|Q5R2W2|Q6P4R0	Missense_Mutation	SNP	ENST00000310826.5	37	c.142T>G	CCDS13678.1	.	.	.	.	.	.	.	.	.	.	A	19.58	3.854031	0.71719	.	.	ENSG00000173276	ENST00000398505;ENST00000310826;ENST00000398499;ENST00000398511;ENST00000425521;ENST00000449949;ENST00000398497	D;D;D;D;D;T;T	0.89485	-2.52;-2.52;-2.52;-2.52;-2.52;-0.11;-0.11	5.85	-0.542	0.11854	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.64402	D	0.000005	D	0.94066	0.8098	M	0.89353	3.025	0.40050	D	0.975766	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.93177	0.6571	10	0.87932	D	0	-16.6233	12.0866	0.53700	0.452:0.0:0.548:0.0	.	48;48	Q9ULJ3-2;Q9ULJ3	.;ZN295_HUMAN	V	48	ENSP00000381517:L48V;ENSP00000308759:L48V;ENSP00000381512:L48V;ENSP00000381523:L48V;ENSP00000387788:L48V;ENSP00000395186:L48V;ENSP00000381510:L48V	ENSP00000308759:L48V	L	-	1	2	ZNF295	42287132	0.969000	0.33509	0.921000	0.36526	0.998000	0.95712	1.050000	0.30404	-0.314000	0.08716	0.533000	0.62120	TTG		0.438	ZBTB21-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195308.1	NM_020727		13	97	0	0	0	0.00245	0	13	97				
CECR2	27443	broad.mit.edu	37	22	18020342	18020342	+	Silent	SNP	C	C	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr22:18020342C>T	ENST00000400585.2	+	14	1686	c.1248C>T	c.(1246-1248)ccC>ccT	p.P416P	CECR2_ENST00000400573.5_Silent_p.P557P|CECR2_ENST00000262608.8_Silent_p.P558P			Q9BXF3	CECR2_HUMAN	cat eye syndrome chromosome region, candidate 2	599					apoptotic DNA fragmentation (GO:0006309)|ATP-dependent chromatin remodeling (GO:0043044)|cytokinesis (GO:0000910)|cytoskeleton organization (GO:0007010)|execution phase of apoptosis (GO:0097194)|neural tube development (GO:0021915)|vesicle-mediated transport (GO:0016192)	CERF complex (GO:0090537)|nucleus (GO:0005634)		p.P557P(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	59		all_epithelial(15;0.139)		Lung(27;0.146)		CGTTGCCCCCCACACGCCGAG	0.637																																							uc010gqw.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|skin(1)	2						c.(1669-1671)CCC>CCT		cat eye syndrome chromosome region, candidate 2							47.0	59.0	55.0					22																	18020342		1988	4145	6133	SO:0001819	synonymous_variant	27443				chromatin modification|cytokinesis|cytoskeleton organization|DNA fragmentation involved in apoptotic nuclear change|vesicle-mediated transport		protein binding	g.chr22:18020342C>T	AF336133		22q11.2	2012-04-19			ENSG00000099954	ENSG00000099954			1840	protein-coding gene	gene with protein product		607576				11381032	Standard	XM_006724077		Approved	KIAA1740	uc002zml.2	Q9BXF3	OTTHUMG00000150072	ENST00000400585.2:c.1248C>T	22.37:g.18020342C>T			Somatic				CECR2_uc010gqv.1_Silent_p.P416P|CECR2_uc002zml.2_Silent_p.P416P	p.P557P	NM_031413	NP_113601	WXS	Illumina HiSeq	Unspecified	Q9BXF3	CECR2_HUMAN		Lung(27;0.146)	13	1797	+		all_epithelial(15;0.139)	599					A8MS90|A8MX16|Q658Z4|Q96P58|Q9C0C3	Silent	SNP	ENST00000400585.2	37	c.1671C>T																																																																																					0.637	CECR2-002	NOVEL	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000316226.2	NM_031413		5	57	0	0	0	0.004482	0	5	57				
HIRA	7290	broad.mit.edu	37	22	19365417	19365417	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr22:19365417C>G	ENST00000263208.5	-	14	1844	c.1588G>C	c.(1588-1590)Gca>Cca	p.A530P	HIRA_ENST00000546308.1_Missense_Mutation_p.A486P|HIRA_ENST00000340170.4_Missense_Mutation_p.A530P|HIRA_ENST00000541063.1_Missense_Mutation_p.A486P	NM_003325.3	NP_003316.3	P54198	HIRA_HUMAN	histone cell cycle regulator	530	Interaction with CCNA1.				anatomical structure morphogenesis (GO:0009653)|chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|gastrulation (GO:0007369)|muscle cell differentiation (GO:0042692)|osteoblast differentiation (GO:0001649)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.A530P(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(14)|ovary(2)|prostate(1)|skin(1)	37	Colorectal(54;0.0993)					GAATCGCCTGCAGGTCTGGCA	0.542																																							uc002zpf.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1588-1590)GCA>CCA		HIR histone cell cycle regulation defective							83.0	92.0	89.0					22																	19365417		2203	4300	6503	SO:0001583	missense	7290				chromatin modification|regulation of transcription from RNA polymerase II promoter	PML body	chromatin binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity	g.chr22:19365417C>G	X75296	CCDS13759.1	22q11.2	2013-05-03	2013-05-03		ENSG00000100084	ENSG00000100084		"""WD repeat domain containing"""	4916	protein-coding gene	gene with protein product	"""DiGeorge critical region gene 1"""	600237	"""HIR (histone cell cycle regulation defective) homolog A (S. cerevisiae)"", ""HIR histone cell cycle regulation defective homolog A (S. cerevisiae)"""	TUPLE1		8111380, 7633437, 9731536	Standard	NM_003325		Approved	DGCR1, TUP1	uc002zpf.1	P54198	OTTHUMG00000150134	ENST00000263208.5:c.1588G>C	22.37:g.19365417C>G	ENSP00000263208:p.Ala530Pro		Somatic				HIRA_uc011agx.1_Missense_Mutation_p.A396P|HIRA_uc010grn.1_Missense_Mutation_p.A530P|HIRA_uc010gro.1_Missense_Mutation_p.A486P|HIRA_uc010grp.2_RNA	p.A530P	NM_003325	NP_003316	WXS	Illumina HiSeq	Unspecified	P54198	HIRA_HUMAN			14	1808	-	Colorectal(54;0.0993)		530			Interaction with CCNA1.		Q05BU9|Q8IXN2	Missense_Mutation	SNP	ENST00000263208.5	37	c.1588G>C	CCDS13759.1	.	.	.	.	.	.	.	.	.	.	C	15.91	2.971828	0.53614	.	.	ENSG00000100084	ENST00000340170;ENST00000263208;ENST00000541063;ENST00000539600;ENST00000546308	T;T;T;T	0.72725	-0.53;-0.68;-0.53;-0.48	5.28	2.03	0.26663	.	0.561697	0.19480	N	0.113239	T	0.56321	0.1977	N	0.24115	0.695	0.80722	D	1	P;P;B	0.45212	0.853;0.514;0.167	P;B;B	0.44394	0.448;0.354;0.123	T	0.45366	-0.9266	10	0.26408	T	0.33	-0.3142	9.512	0.39082	0.0:0.6869:0.0:0.3131	.	486;530;530	F5H4M2;P54198-2;P54198	.;.;HIRA_HUMAN	P	530;530;486;39;486	ENSP00000345350:A530P;ENSP00000263208:A530P;ENSP00000446073:A486P;ENSP00000441870:A486P	ENSP00000263208:A530P	A	-	1	0	HIRA	17745417	0.974000	0.33945	0.600000	0.28864	0.979000	0.70002	0.218000	0.17622	0.359000	0.24239	0.655000	0.94253	GCA		0.542	HIRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316488.2	NM_003325		7	136	0	0	0	0.001368	0	7	136				
MYO18B	84700	broad.mit.edu	37	22	26165096	26165096	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr22:26165096G>C	ENST00000407587.2	+	4	1382	c.1213G>C	c.(1213-1215)Gca>Cca	p.A405P	MYO18B_ENST00000335473.7_Missense_Mutation_p.A405P|MYO18B_ENST00000536101.1_Missense_Mutation_p.A405P			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	405						cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.A405P(1)		NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						GTCCGGGAACGCAGGTGAAGC	0.607																																							uc003abz.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|central_nervous_system(3)|large_intestine(2)|breast(2)	12						c.(1213-1215)GCA>CCA		myosin XVIIIB							34.0	40.0	38.0					22																	26165096		2142	4244	6386	SO:0001583	missense	84700					nucleus|sarcomere|unconventional myosin complex	actin binding|ATP binding|motor activity	g.chr22:26165096G>C	AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.1213G>C	22.37:g.26165096G>C	ENSP00000386096:p.Ala405Pro		Somatic				MYO18B_uc003aca.1_Missense_Mutation_p.A286P|MYO18B_uc010guy.1_Missense_Mutation_p.A286P|MYO18B_uc010guz.1_Missense_Mutation_p.A286P|MYO18B_uc011aka.1_5'UTR|MYO18B_uc011akb.1_5'Flank	p.A405P	NM_032608	NP_115997	WXS	Illumina HiSeq	Unspecified	Q8IUG5	MY18B_HUMAN			4	1463	+			405					B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Missense_Mutation	SNP	ENST00000407587.2	37	c.1213G>C		.	.	.	.	.	.	.	.	.	.	G	12.72	2.022683	0.35701	.	.	ENSG00000133454	ENST00000536101;ENST00000335473;ENST00000407587	D;D;D	0.87029	-2.18;-2.18;-2.2	4.62	4.62	0.57501	.	.	.	.	.	D	0.87489	0.6190	L	0.57536	1.79	0.09310	N	1	P;D;D	0.57571	0.929;0.98;0.958	B;P;P	0.52454	0.423;0.699;0.626	T	0.78175	-0.2306	9	0.27785	T	0.31	.	9.0632	0.36447	0.102:0.0:0.898:0.0	.	405;405;405	Q8IUG5;F5GXR6;F5GYU7	MY18B_HUMAN;.;.	P	405	ENSP00000441229:A405P;ENSP00000334563:A405P;ENSP00000386096:A405P	ENSP00000334563:A405P	A	+	1	0	MYO18B	24495096	0.003000	0.15002	0.004000	0.12327	0.015000	0.08874	1.168000	0.31859	2.265000	0.75225	0.491000	0.48974	GCA		0.607	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000400691.1	NM_032608		3	37	0	0	0	0.004672	0	3	37				
HPS4	89781	broad.mit.edu	37	22	26868863	26868863	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr22:26868863G>A	ENST00000398145.2	-	5	935	c.319C>T	c.(319-321)Cgg>Tgg	p.R107W	HPS4_ENST00000398141.1_Missense_Mutation_p.R102W|HPS4_ENST00000336873.5_Missense_Mutation_p.R107W|HPS4_ENST00000402105.3_Missense_Mutation_p.R102W	NM_022081.5	NP_071364.4	Q9NQG7	HPS4_HUMAN	Hermansky-Pudlak syndrome 4	107					blood coagulation (GO:0007596)|hemostasis (GO:0007599)|lysosome organization (GO:0007040)|melanocyte differentiation (GO:0030318)|positive regulation of eye pigmentation (GO:0048075)|protein stabilization (GO:0050821)|protein targeting (GO:0006605)	BLOC-3 complex (GO:0031085)|cytoplasm (GO:0005737)|lysosome (GO:0005764)|melanosome (GO:0042470)|membrane (GO:0016020)|platelet dense granule (GO:0042827)	protein dimerization activity (GO:0046983)|protein homodimerization activity (GO:0042803)	p.R102W(1)|p.R107W(1)		breast(2)|endometrium(3)|kidney(5)|large_intestine(4)|lung(12)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	32						TCCAGAAACCGCTTGCAGCTG	0.478									Hermansky-Pudlak syndrome																														uc003acl.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(319-321)CGG>TGG		light ear protein isoform a							88.0	90.0	89.0					22																	26868863		2203	4300	6503	SO:0001583	missense	89781	Hermansky-Pudlak_syndrome	Familial Cancer Database	HPS, HPS1-8	lysosome organization|positive regulation of eye pigmentation|protein stabilization|protein targeting	lysosome|melanosome|membrane fraction|platelet dense granule	protein homodimerization activity	g.chr22:26868863G>A		CCDS13835.1, CCDS46677.1	22q12.1	2014-09-17			ENSG00000100099	ENSG00000100099			15844	protein-coding gene	gene with protein product		606682				11836498, 12663659	Standard	NM_022081		Approved	KIAA1667, LE	uc003aci.4	Q9NQG7	OTTHUMG00000030459	ENST00000398145.2:c.319C>T	22.37:g.26868863G>A	ENSP00000381213:p.Arg107Trp		Somatic				HPS4_uc003aci.2_Missense_Mutation_p.R102W|HPS4_uc003acj.2_5'UTR|HPS4_uc003ack.2_5'UTR|HPS4_uc003acn.2_5'UTR|HPS4_uc010gvd.1_Missense_Mutation_p.R107W|HPS4_uc003ach.2_5'Flank	p.R107W	NM_022081	NP_071364	WXS	Illumina HiSeq	Unspecified	Q9NQG7	HPS4_HUMAN			5	978	-			107					B1AHQ4|Q5H8V6|Q96LX6|Q9BY93|Q9UH37|Q9UH38	Missense_Mutation	SNP	ENST00000398145.2	37	c.319C>T	CCDS13835.1	.	.	.	.	.	.	.	.	.	.	G	14.66	2.600877	0.46423	.	.	ENSG00000100099	ENST00000398145;ENST00000398141;ENST00000402105;ENST00000336873;ENST00000312736;ENST00000422379	D;D;D;D;D	0.90197	-2.63;-2.63;-2.63;-2.63;-2.63	5.3	3.12	0.35913	.	0.713260	0.14112	N	0.340632	D	0.90407	0.6997	L	0.29908	0.895	0.09310	N	1	D;D;D	0.71674	0.998;0.998;0.998	P;P;P	0.56700	0.804;0.804;0.804	D	0.83779	0.0224	10	0.87932	D	0	-8.4892	14.7715	0.69681	0.0:0.1183:0.7705:0.1112	.	107;107;102	Q6ICH6;Q9NQG7;Q9NQG7-3	.;HPS4_HUMAN;.	W	107;102;102;107;107;107	ENSP00000381213:R107W;ENSP00000381210:R102W;ENSP00000384185:R102W;ENSP00000338457:R107W;ENSP00000415081:R107W	ENSP00000325840:R107W	R	-	1	2	HPS4	25198863	0.623000	0.27094	0.145000	0.22337	0.901000	0.52897	1.607000	0.36836	0.816000	0.34421	-1.357000	0.01221	CGG		0.478	HPS4-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320778.1	NM_022081		10	155	0	0	0	0.006214	0	10	155				
MYH9	4627	broad.mit.edu	37	22	36708162	36708162	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr22:36708162G>T	ENST00000216181.5	-	14	1890	c.1660C>A	c.(1660-1662)Ccc>Acc	p.P554T		NM_002473.4	NP_002464.1	P35579	MYH9_HUMAN	myosin, heavy chain 9, non-muscle	554	Myosin motor.				actin cytoskeleton reorganization (GO:0031532)|actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|angiogenesis (GO:0001525)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood vessel endothelial cell migration (GO:0043534)|cytokinesis (GO:0000910)|establishment of meiotic spindle localization (GO:0051295)|establishment of T cell polarity (GO:0001768)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|meiotic spindle organization (GO:0000212)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte differentiation (GO:0030224)|myoblast fusion (GO:0007520)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of cell shape (GO:0008360)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|uropod organization (GO:0032796)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|actomyosin contractile ring (GO:0005826)|cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|cleavage furrow (GO:0032154)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|spindle (GO:0005819)|stress fiber (GO:0001725)|uropod (GO:0001931)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)	p.P554T(1)		NS(1)|breast(8)|central_nervous_system(3)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(16)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(3)	86						TGGAACTTGGGGTGGGTGCCC	0.612			T	ALK	ALCL		"""Deafness, autosomal dominant 17, Epstein syndrome, Fechtner syndrome, May-Hegglin anomaly, Sebastian syndrome"""		Hereditary Macrothrombocytopenia, MYH9-associated																														uc003apg.2		NA		Dom	yes		22	22q13.1	4627	T	"""myosin, heavy polypeptide 9, non-muscle"""	yes	Deafness|autosomal dominant 17|Epstein syndrome|Fechtner syndrome|May-Hegglin anomaly|Sebastian syndrome	L	ALK		ALCL		1	Substitution - Missense(1)		lung(1)	breast(3)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|lung(1)|skin(1)|kidney(1)|pancreas(1)	11						c.(1660-1662)CCC>ACC		myosin, heavy polypeptide 9, non-muscle							160.0	127.0	138.0					22																	36708162		2203	4300	6503	SO:0001583	missense	4627	Hereditary_Macrothrombocytopenia_MYH9-associated	Familial Cancer Database	MYHIIA syndrome, incl. Fechtner Syndrome, FTNS, and May-Hegglin Anomaly, MHA	actin cytoskeleton reorganization|actin filament-based movement|angiogenesis|axon guidance|blood vessel endothelial cell migration|cytokinesis|integrin-mediated signaling pathway|leukocyte migration|membrane protein ectodomain proteolysis|monocyte differentiation|platelet formation|protein transport|regulation of cell shape	actomyosin contractile ring|cleavage furrow|cytosol|myosin complex|nucleus|ruffle|stress fiber|uropod	actin filament binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|microfilament motor activity|protein anchor|protein homodimerization activity	g.chr22:36708162G>T		CCDS13927.1	22q13.1	2014-09-17	2006-09-29		ENSG00000100345	ENSG00000100345		"""Myosins / Myosin superfamily : Class II"""	7579	protein-coding gene	gene with protein product	"""nonmuscle myosin heavy chain II-A"""	160775	"""myosin, heavy polypeptide 9, non-muscle"""	DFNA17		1860190, 11023810	Standard	NM_002473		Approved	NMMHCA, NMHC-II-A, MHA, FTNS, EPSTS	uc003apg.3	P35579	OTTHUMG00000030429	ENST00000216181.5:c.1660C>A	22.37:g.36708162G>T	ENSP00000216181:p.Pro554Thr		Somatic				MYH9_uc003aph.1_Missense_Mutation_p.P418T	p.P554T	NM_002473	NP_002464	WXS	Illumina HiSeq	Unspecified	P35579	MYH9_HUMAN			14	1891	-			554			Myosin head-like.		A8K6E4|O60805|Q60FE2|Q86T83	Missense_Mutation	SNP	ENST00000216181.5	37	c.1660C>A	CCDS13927.1	.	.	.	.	.	.	.	.	.	.	G	14.74	2.624800	0.46840	.	.	ENSG00000100345	ENST00000337818;ENST00000216181	D	0.87571	-2.27	4.57	4.57	0.56435	Myosin head, motor domain (2);	0.057492	0.64402	D	0.000001	D	0.85779	0.5776	M	0.69185	2.1	0.80722	D	1	B	0.30236	0.274	B	0.35899	0.213	D	0.83622	0.0140	10	0.36615	T	0.2	.	10.968	0.47424	0.0875:0.0:0.9125:0.0	.	554	P35579	MYH9_HUMAN	T	418;554	ENSP00000216181:P554T	ENSP00000216181:P554T	P	-	1	0	MYH9	35038108	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.481000	0.53179	2.258000	0.74832	0.561000	0.74099	CCC		0.612	MYH9-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000259110.3	NM_002473		10	128	1	0	0.000442599	0.006214	0.000501854	10	128				
TTLL1	25809	broad.mit.edu	37	22	43460246	43460246	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr22:43460246G>T	ENST00000266254.7	-	6	828	c.588C>A	c.(586-588)gaC>gaA	p.D196E	TTLL1_ENST00000331018.7_Missense_Mutation_p.D196E	NM_012263.4	NP_036395.1	O95922	TTLL1_HUMAN	tubulin tyrosine ligase-like family, member 1	196	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				axoneme assembly (GO:0035082)|epithelial cilium movement (GO:0003351)|protein polyglutamylation (GO:0018095)	cytoplasm (GO:0005737)|microtubule (GO:0005874)	tubulin-glutamic acid ligase activity (GO:0070740)	p.D196E(1)		breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|skin(2)|stomach(1)	23		Ovarian(80;0.0694)		BRCA - Breast invasive adenocarcinoma(115;0.00461)		ACAAGCGCAGGTCGAACTTCC	0.463																																							uc003bdi.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(586-588)GAC>GAA		tubulin tyrosine ligase-like family, member 1							125.0	110.0	115.0					22																	43460246		2203	4300	6503	SO:0001583	missense	25809				protein polyglutamylation	cytoplasm|microtubule	ATP binding|tubulin-glutamic acid ligase activity|tubulin-tyrosine ligase activity	g.chr22:43460246G>T	AL096886	CCDS14043.1	22q13.1	2013-02-14			ENSG00000100271	ENSG00000100271		"""Tubulin tyrosine ligase-like family"""	1312	protein-coding gene	gene with protein product		608955	"""tubulin tyrosine ligase-like 1"""	C22orf7		10591208, 11054573	Standard	NM_012263		Approved		uc003bdi.3	O95922	OTTHUMG00000150699	ENST00000266254.7:c.588C>A	22.37:g.43460246G>T	ENSP00000266254:p.Asp196Glu		Somatic				TTLL1_uc010gzh.2_Missense_Mutation_p.D196E|TTLL1_uc003bdj.2_Missense_Mutation_p.D82E|TTLL1_uc003bdh.2_Missense_Mutation_p.D158E	p.D196E	NM_012263	NP_036395	WXS	Illumina HiSeq	Unspecified	O95922	TTLL1_HUMAN		BRCA - Breast invasive adenocarcinoma(115;0.00461)	6	829	-		Ovarian(80;0.0694)	196			TTL.		B2RDS7|Q9BR27|Q9NRS9|Q9UMU0	Missense_Mutation	SNP	ENST00000266254.7	37	c.588C>A	CCDS14043.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.66|19.66	3.868238|3.868238	0.72065|0.72065	.|.	.|.	ENSG00000100271|ENSG00000100271	ENST00000331018;ENST00000266254|ENST00000495814	T;T|.	0.17854|.	2.25;2.25|.	5.7|5.7	5.7|5.7	0.88788|0.88788	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.89146|0.89146	0.6632|0.6632	H|H	0.99090|0.99090	4.425|4.425	0.80722|0.80722	D|D	1|1	D;D|.	0.76494|.	0.998;0.999|.	D;D|.	0.71414|.	0.953;0.973|.	D|D	0.92676|0.92676	0.6154|0.6154	10|5	0.72032|.	D|.	0.01|.	.|.	13.2918|13.2918	0.60274|0.60274	0.0752:0.0:0.9248:0.0|0.0752:0.0:0.9248:0.0	.|.	196;196|.	O95922-4;O95922|.	.;TTLL1_HUMAN|.	E|N	196|122	ENSP00000333734:D196E;ENSP00000266254:D196E|.	ENSP00000266254:D196E|.	D|T	-|-	3|2	2|0	TTLL1|TTLL1	41790190|41790190	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.351000|0.351000	0.29236|0.29236	2.570000|2.570000	0.45981|0.45981	2.681000|2.681000	0.91329|0.91329	0.467000|0.467000	0.42956|0.42956	GAC|ACC		0.463	TTLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319659.1	NM_012263		7	84	1	0	0.000274275	0.004482	0.000316178	7	84				
IL5RA	3568	broad.mit.edu	37	3	3136995	3136995	+	Silent	SNP	A	A	G			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr3:3136995A>G	ENST00000446632.2	-	8	1417	c.843T>C	c.(841-843)aaT>aaC	p.N281N	IL5RA_ENST00000418488.2_Intron|IL5RA_ENST00000456302.1_Silent_p.N281N|IL5RA_ENST00000383846.1_Silent_p.N281N|IL5RA_ENST00000438560.1_Silent_p.N281N|IL5RA_ENST00000445864.2_Intron|IL5RA_ENST00000430514.2_Silent_p.N281N|IL5RA_ENST00000311981.8_Silent_p.N281N|IL5RA_ENST00000256452.3_Silent_p.N281N	NM_175726.3	NP_783853.1	Q01344	IL5RA_HUMAN	interleukin 5 receptor, alpha	281	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell proliferation (GO:0008283)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-5-mediated signaling pathway (GO:0038043)|regulation of interleukin-5 production (GO:0032674)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-5 receptor activity (GO:0004914)	p.N281N(1)		cervix(1)|endometrium(2)|large_intestine(7)|lung(9)|ovary(1)|prostate(2)|skin(2)	24				Epithelial(13;0.00278)|all cancers(10;0.00809)|OV - Ovarian serous cystadenocarcinoma(96;0.00944)		GCAAATATCCATTCCTTGTAT	0.323																																					GBM(169;430 2801 24955 28528)	GBM(169;430 2801 24955 28528)	uc011ask.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(841-843)AAT>AAC		interleukin 5 receptor, alpha isoform 1							69.0	70.0	70.0					3																	3136995		2202	4300	6502	SO:0001819	synonymous_variant	3568				cell proliferation	extracellular space|integral to membrane|plasma membrane	interleukin-5 receptor activity	g.chr3:3136995A>G	M96652	CCDS2559.1, CCDS2560.1, CCDS46739.1, CCDS58813.1	3p26-p24	2008-01-11			ENSG00000091181	ENSG00000091181		"""Interleukins and interleukin receptors"", ""CD molecules"""	6017	protein-coding gene	gene with protein product		147851		IL5R		1732409	Standard	NM_175727		Approved	CDw125, CD125	uc010hbs.3	Q01344	OTTHUMG00000090245	ENST00000446632.2:c.843T>C	3.37:g.3136995A>G			Somatic				IL5RA_uc010hbq.2_Intron|IL5RA_uc010hbr.2_Intron|IL5RA_uc010hbs.2_Silent_p.N281N|IL5RA_uc011asl.1_Silent_p.N281N|IL5RA_uc011asm.1_Silent_p.N281N|IL5RA_uc010hbt.2_Silent_p.N281N|IL5RA_uc011asn.1_Silent_p.N281N|IL5RA_uc010hbu.2_Silent_p.N281N|IL5RA_uc010hbp.2_5'Flank	p.N281N	NM_000564	NP_000555	WXS	Illumina HiSeq	Unspecified	Q01344	IL5RA_HUMAN		Epithelial(13;0.00278)|all cancers(10;0.00809)|OV - Ovarian serous cystadenocarcinoma(96;0.00944)	9	1487	-			281			Extracellular (Potential).		B3IU77|B4E2G0|Q14633|Q15469|Q6ISX9	Silent	SNP	ENST00000446632.2	37	c.843T>C	CCDS2559.1																																																																																				0.323	IL5RA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337537.2			8	41	0	0	0	0.001855	0	8	41				
LMCD1	29995	broad.mit.edu	37	3	8590464	8590464	+	Missense_Mutation	SNP	G	G	A	rs576471098		TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr3:8590464G>A	ENST00000157600.3	+	4	830	c.598G>A	c.(598-600)Gcc>Acc	p.A200T	LMCD1_ENST00000454244.1_Missense_Mutation_p.A127T|LMCD1_ENST00000397386.3_Missense_Mutation_p.A88T|LMCD1_ENST00000535732.1_Missense_Mutation_p.A200T|LMCD1-AS1_ENST00000439407.1_RNA	NM_014583.2	NP_055398.1	Q9NZU5	LMCD1_HUMAN	LIM and cysteine-rich domains 1	200	PET. {ECO:0000255|PROSITE- ProRule:PRU00636}.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|regulation of cardiac muscle hypertrophy (GO:0010611)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.A200T(1)		breast(2)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)	16				OV - Ovarian serous cystadenocarcinoma(96;0.124)		GGGAGAAGTGGCCCTCCCGGG	0.592													G|||	1	0.000199681	0.0	0.0	5008	,	,		18938	0.0		0.0	False		,,,				2504	0.001						uc003bqq.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(598-600)GCC>ACC		LIM and cysteine-rich domains 1							66.0	68.0	67.0					3																	8590464		2203	4300	6503	SO:0001583	missense	29995				positive regulation of calcineurin-NFAT signaling pathway|regulation of cardiac muscle hypertrophy|transcription, DNA-dependent	cytoplasm|extracellular space|nucleus	transcription corepressor activity|zinc ion binding	g.chr3:8590464G>A	AF169284	CCDS33688.1, CCDS63533.1, CCDS63534.1	3p26-p24	2008-07-18			ENSG00000071282	ENSG00000071282			6633	protein-coding gene	gene with protein product	"""dyxin"""	604859				10662546	Standard	NM_001278233		Approved		uc003bqq.4	Q9NZU5	OTTHUMG00000154971	ENST00000157600.3:c.598G>A	3.37:g.8590464G>A	ENSP00000157600:p.Ala200Thr		Somatic				LMCD1_uc011atd.1_Missense_Mutation_p.A127T|LMCD1_uc011ate.1_Missense_Mutation_p.A88T|LMCD1_uc011atf.1_Missense_Mutation_p.A127T	p.A200T	NM_014583	NP_055398	WXS	Illumina HiSeq	Unspecified	Q9NZU5	LMCD1_HUMAN		OV - Ovarian serous cystadenocarcinoma(96;0.124)	4	712	+			200			PET.		B4DG80	Missense_Mutation	SNP	ENST00000157600.3	37	c.598G>A	CCDS33688.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.940058	0.73557	.	.	ENSG00000071282	ENST00000157600;ENST00000415597;ENST00000535732;ENST00000454244;ENST00000397386;ENST00000426878	D;D;D;D;D;D	0.86097	-2.07;-2.07;-2.07;-2.07;-2.07;-2.07	5.75	5.75	0.90469	PET domain (2);	0.077547	0.53938	D	0.000052	D	0.90380	0.6989	L	0.55481	1.735	0.47123	D	0.999326	D;B;D	0.89917	1.0;0.368;0.999	D;B;D	0.87578	0.998;0.196;0.942	D	0.87271	0.2286	10	0.24483	T	0.36	-37.6121	18.5236	0.90963	0.0:0.0:1.0:0.0	.	200;88;200	F5GX84;B4DEY6;Q9NZU5	.;.;LMCD1_HUMAN	T	200;206;200;127;88;157	ENSP00000157600:A200T;ENSP00000400555:A206T;ENSP00000441100:A200T;ENSP00000396515:A127T;ENSP00000380542:A88T;ENSP00000411222:A157T	ENSP00000157600:A200T	A	+	1	0	LMCD1	8565464	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	3.517000	0.53443	2.716000	0.92895	0.655000	0.94253	GCC		0.592	LMCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337854.1	NM_014583		23	127	0	0	0	0.004656	0	23	127				
OGG1	4968	broad.mit.edu	37	3	9792684	9792684	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr3:9792684A>G	ENST00000344629.7	+	2	536	c.193A>G	c.(193-195)Aca>Gca	p.T65A	OGG1_ENST00000436092.1_3'UTR|OGG1_ENST00000339511.5_Missense_Mutation_p.T65A|OGG1_ENST00000302036.7_Missense_Mutation_p.T65A|OGG1_ENST00000449570.2_Missense_Mutation_p.T65A|OGG1_ENST00000349503.5_Missense_Mutation_p.T65A|OGG1_ENST00000383826.5_Missense_Mutation_p.T65A|OGG1_ENST00000302008.8_Missense_Mutation_p.T65A|OGG1_ENST00000302003.7_Missense_Mutation_p.T65A			O15527	OGG1_HUMAN	8-oxoguanine DNA glycosylase	65					acute inflammatory response (GO:0002526)|base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|cellular response to cadmium ion (GO:0071276)|depurination (GO:0045007)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair (GO:0006289)|regulation of protein import into nucleus, translocation (GO:0033158)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to folic acid (GO:0051593)|response to oxidative stress (GO:0006979)|response to radiation (GO:0009314)	mitochondrion (GO:0005739)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	8-oxo-7,8-dihydroguanine DNA N-glycosylase activity (GO:0034039)|damaged DNA binding (GO:0003684)|endonuclease activity (GO:0004519)|oxidized purine nucleobase lesion DNA N-glycosylase activity (GO:0008534)	p.T65A(4)		kidney(2)|large_intestine(2)|lung(2)|skin(1)|urinary_tract(1)	8	Medulloblastoma(99;0.227)					TCAAGTATGGACACTGACTCA	0.572								Base excision repair (BER), DNA glycosylases																															uc003bsi.2		NA																	4	Substitution - Missense(4)		lung(4)		0						c.(193-195)ACA>GCA	BER_DNA_glycosylases	8-oxoguanine DNA-glycosylase 1 isoform 1a							115.0	87.0	97.0					3																	9792684		2203	4300	6503	SO:0001583	missense	4968				depurination|nucleotide-excision repair|regulation of protein import into nucleus, translocation|regulation of transcription, DNA-dependent|response to oxidative stress|response to radiation	mitochondrion|nuclear matrix|nuclear speck	damaged DNA binding|endonuclease activity|oxidized purine base lesion DNA N-glycosylase activity|protein binding	g.chr3:9792684A>G	U96710	CCDS2576.1, CCDS2577.1, CCDS2578.1, CCDS2579.1, CCDS2580.1, CCDS2581.1, CCDS43046.1, CCDS46742.1	3p26	2010-11-23			ENSG00000114026	ENSG00000114026	3.2.2.-, 4.2.99.18		8125	protein-coding gene	gene with protein product	"""8-hydroxyguanine DNA glycosylase"", ""OGG1 type 1e"", ""OGG1 type 1d"", ""OGG1 type 1g"", ""OGG1 type 1h"""	601982				9207108, 10449904	Standard	NM_002542		Approved	HMMH, HOGG1, OGH1, MUTM	uc003bsj.3	O15527	OTTHUMG00000097091	ENST00000344629.7:c.193A>G	3.37:g.9792684A>G	ENSP00000342851:p.Thr65Ala		Somatic				OGG1_uc003bsh.2_Missense_Mutation_p.T65A|OGG1_uc003bsj.2_Missense_Mutation_p.T65A|OGG1_uc003bsk.2_Missense_Mutation_p.T65A|OGG1_uc003bsl.2_Missense_Mutation_p.T65A|OGG1_uc003bsm.2_Missense_Mutation_p.T65A|OGG1_uc003bsn.2_Missense_Mutation_p.T65A|OGG1_uc003bso.2_Missense_Mutation_p.T65A|OGG1_uc003bsp.1_5'Flank|OGG1_uc010hcm.1_5'Flank|OGG1_uc003bsq.1_5'Flank|OGG1_uc003bsr.1_5'Flank	p.T65A	NM_002542	NP_002533	WXS	Illumina HiSeq	Unspecified	O15527	OGG1_HUMAN			2	536	+	Medulloblastoma(99;0.227)		65					A8K1E3|O00390|O00670|O00705|O14876|O95488|P78554|Q9BW42|Q9UIK0|Q9UIK1|Q9UIK2|Q9UL34|Q9Y2C0|Q9Y2C1|Q9Y6C3|Q9Y6C4	Missense_Mutation	SNP	ENST00000344629.7	37	c.193A>G	CCDS2581.1	.	.	.	.	.	.	.	.	.	.	A	14.20	2.464264	0.43736	.	.	ENSG00000114026	ENST00000302003;ENST00000344629;ENST00000302036;ENST00000349503;ENST00000339511;ENST00000449570;ENST00000302008;ENST00000383826	T;T;T;T;T;T;T;T	0.55052	0.54;0.54;0.54;0.54;0.54;0.54;0.54;0.54	5.54	5.54	0.83059	8-oxoguanine DNA glycosylase, N-terminal (1);Transcription factor TFIID, C-terminal/DNA glycosylase, N-terminal (1);	0.044258	0.85682	D	0.000000	T	0.69187	0.3083	M	0.62088	1.915	0.80722	D	1	P;D;D;D;D;D;P;D	0.89917	0.925;0.995;1.0;0.98;0.98;0.98;0.47;0.993	P;D;D;P;P;P;B;P	0.77557	0.792;0.947;0.99;0.723;0.653;0.846;0.088;0.602	T	0.68157	-0.5483	10	0.37606	T	0.19	-10.9536	15.6881	0.77426	1.0:0.0:0.0:0.0	.	65;65;65;65;65;65;65;65	E5KPM8;E5KPM6;E5KPM5;E5KPM7;E5KPM9;E5KPN0;O15527;O15527-2	.;.;.;.;.;.;OGG1_HUMAN;.	A	65	ENSP00000305584:T65A;ENSP00000342851:T65A;ENSP00000306561:T65A;ENSP00000303132:T65A;ENSP00000345520:T65A;ENSP00000403598:T65A;ENSP00000305527:T65A;ENSP00000373337:T65A	ENSP00000305584:T65A	T	+	1	0	OGG1	9767684	1.000000	0.71417	1.000000	0.80357	0.148000	0.21650	8.173000	0.89680	2.107000	0.64212	0.533000	0.62120	ACA		0.572	OGG1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214223.2	NM_016821		4	38	0	0	0	0.000602	0	4	38				
ATP2B2	491	broad.mit.edu	37	3	10381973	10381973	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr3:10381973A>T	ENST00000352432.4	-	20	3259	c.3190T>A	c.(3190-3192)Tgg>Agg	p.W1064R	ATP2B2_ENST00000383800.4_Missense_Mutation_p.W1019R|ATP2B2_ENST00000360273.2_Missense_Mutation_p.W1064R|ATP2B2_ENST00000397077.1_Missense_Mutation_p.W1019R|ATP2B2_ENST00000343816.4_Missense_Mutation_p.W1050R			Q01814	AT2B2_HUMAN	ATPase, Ca++ transporting, plasma membrane 2	1064					auditory receptor cell stereocilium organization (GO:0060088)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cerebellar granule cell differentiation (GO:0021707)|cerebellar Purkinje cell differentiation (GO:0021702)|cGMP metabolic process (GO:0046068)|cochlea development (GO:0090102)|cytosolic calcium ion homeostasis (GO:0051480)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotion (GO:0040011)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|organelle organization (GO:0006996)|otolith mineralization (GO:0045299)|positive regulation of calcium ion transport (GO:0051928)|regulation of cell size (GO:0008361)|regulation of synaptic plasticity (GO:0048167)|sensory perception of sound (GO:0007605)|serotonin metabolic process (GO:0042428)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cilium (GO:0005929)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-dependent ATPase activity (GO:0030899)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein C-terminus binding (GO:0008022)	p.W1064R(1)|p.W1019R(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|large_intestine(19)|lung(29)|ovary(5)|prostate(2)|skin(4)|stomach(2)|urinary_tract(2)	74						CACCACATCCACTGGTCCAGC	0.557																																					Ovarian(125;1619 1709 15675 19819 38835)	Ovarian(125;1619 1709 15675 19819 38835)	uc003bvt.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|skin(2)|central_nervous_system(1)	6						c.(3190-3192)TGG>AGG		plasma membrane calcium ATPase 2 isoform 1							98.0	87.0	90.0					3																	10381973		2203	4300	6503	SO:0001583	missense	491				ATP biosynthetic process|cytosolic calcium ion homeostasis|platelet activation	cytosol|integral to membrane|plasma membrane	ATP binding|ATP binding|calcium ion binding|calcium-transporting ATPase activity|calcium-transporting ATPase activity|calmodulin binding|calmodulin binding|metal ion binding|PDZ domain binding|protein C-terminus binding	g.chr3:10381973A>T	X63575	CCDS2601.1, CCDS33701.1	3p25.3	2010-04-20	2001-12-04		ENSG00000157087	ENSG00000157087	3.6.3.8	"""ATPases / P-type"""	815	protein-coding gene	gene with protein product	"""plasma membrane Ca2+ pump 2"", ""plasma membrane calcium-transporting ATPase 2"""	108733				1313367	Standard	NM_001001331		Approved	PMCA2	uc003bvt.3	Q01814	OTTHUMG00000128679	ENST00000352432.4:c.3190T>A	3.37:g.10381973A>T	ENSP00000324172:p.Trp1064Arg		Somatic				ATP2B2_uc003bvv.2_Missense_Mutation_p.W1019R|ATP2B2_uc003bvw.2_Missense_Mutation_p.W1019R|ATP2B2_uc010hdo.2_Missense_Mutation_p.W769R	p.W1064R	NM_001001331	NP_001001331	WXS	Illumina HiSeq	Unspecified	Q01814	AT2B2_HUMAN			21	3629	-			1064			Helical; (Potential).		O00766|Q12994|Q16818	Missense_Mutation	SNP	ENST00000352432.4	37	c.3190T>A	CCDS33701.1	.	.	.	.	.	.	.	.	.	.	A	21.7	4.188414	0.78789	.	.	ENSG00000157087	ENST00000352432;ENST00000383800;ENST00000397077;ENST00000360273;ENST00000343816;ENST00000535386;ENST00000429937;ENST00000452124;ENST00000342354	D;D;D;D;D;D	0.97688	-4.49;-4.49;-4.49;-4.49;-4.49;-4.49	4.18	4.18	0.49190	ATPase, P-type cation-transporter, C-terminal (1);ATPase, P-type,  transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.99248	0.9738	H	0.99011	4.4	0.80722	D	1	D;D;D	0.89917	0.998;1.0;1.0	D;D;D	0.97110	0.994;1.0;0.996	D	0.98521	1.0623	10	0.87932	D	0	-7.5472	13.2623	0.60113	1.0:0.0:0.0:0.0	.	999;1031;1064	F5H7F7;Q4LE63;Q01814	.;.;AT2B2_HUMAN	R	1064;1019;1019;1064;1050;999;253;920;1064	ENSP00000324172:W1064R;ENSP00000373311:W1019R;ENSP00000380267:W1019R;ENSP00000353414:W1064R;ENSP00000344677:W1050R;ENSP00000414854:W920R	ENSP00000342954:W1064R	W	-	1	0	ATP2B2	10356973	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.044000	0.93805	1.534000	0.49203	0.460000	0.39030	TGG		0.557	ATP2B2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250576.2	NM_001683		19	78	0	0	0	0.002299	0	19	78				
SGOL1	151648	broad.mit.edu	37	3	20216127	20216127	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr3:20216127T>C	ENST00000263753.4	-	6	1035	c.896A>G	c.(895-897)aAc>aGc	p.N299S	SGOL1_ENST00000421451.1_Missense_Mutation_p.N299S|SGOL1_ENST00000383774.1_Intron|SGOL1_ENST00000425061.1_Intron|SGOL1-AS1_ENST00000448208.1_RNA|SGOL1_ENST00000443724.1_Intron|SGOL1-AS1_ENST00000441442.1_RNA|SGOL1_ENST00000442720.1_Intron|SGOL1_ENST00000417364.1_Intron|SGOL1_ENST00000412997.1_Missense_Mutation_p.N299S|SGOL1_ENST00000429446.3_Intron|SGOL1_ENST00000437051.1_Intron|SGOL1_ENST00000306698.2_Intron|SGOL1_ENST00000412868.1_Missense_Mutation_p.N299S|SGOL1_ENST00000419233.2_Intron|SGOL1_ENST00000452020.1_Intron	NM_001012410.3|NM_001199252.1	NP_001012410.1|NP_001186181.1	Q5FBB7	SGOL1_HUMAN	shugoshin-like 1 (S. pombe)	299					attachment of spindle microtubules to kinetochore (GO:0008608)|centriole-centriole cohesion (GO:0010457)|chromosome segregation (GO:0007059)|meiotic chromosome segregation (GO:0045132)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|chromosome, centromeric region (GO:0000775)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome, centromeric region (GO:0000780)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|mitotic cohesin complex (GO:0030892)|nucleus (GO:0005634)|spindle pole (GO:0000922)	kinase binding (GO:0019900)	p.N299S(1)		kidney(1)|large_intestine(4)|lung(6)|skin(1)|urinary_tract(2)	14						ttttctcctgttagcttttct	0.279																																							uc003cbs.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(895-897)AAC>AGC		shugoshin-like 1 isoform A2							39.0	37.0	38.0					3																	20216127		2196	4295	6491	SO:0001583	missense	151648				attachment of spindle microtubules to kinetochore|cell division|centriole-centriole cohesion|meiotic chromosome segregation|mitotic prometaphase	centrosome|condensed chromosome kinetochore|cytosol|mitotic cohesin complex|spindle pole	protein binding	g.chr3:20216127T>C	BC001339	CCDS2635.1, CCDS33716.1, CCDS46771.1, CCDS46772.1, CCDS46773.1, CCDS46774.1, CCDS56243.1	3p24.3	2005-07-27			ENSG00000129810	ENSG00000129810			25088	protein-coding gene	gene with protein product		609168				12747765	Standard	NM_001199251		Approved	NY-BR-85	uc003cbu.3	Q5FBB7	OTTHUMG00000130479	ENST00000263753.4:c.896A>G	3.37:g.20216127T>C	ENSP00000263753:p.Asn299Ser		Somatic				SGOL1_uc003cbr.2_Intron|SGOL1_uc010hfa.2_Intron|SGOL1_uc003cbt.2_Intron|SGOL1_uc003cbu.2_Missense_Mutation_p.N299S|SGOL1_uc003cbv.2_Intron|SGOL1_uc003cbw.2_Intron|SGOL1_uc003cbx.2_Intron|SGOL1_uc003cby.2_Intron|SGOL1_uc003cbz.2_Missense_Mutation_p.N299S|SGOL1_uc003cca.2_Missense_Mutation_p.N299S|SGOL1_uc003ccb.2_Intron|SGOL1_uc003ccc.2_Intron	p.N299S	NM_001012410	NP_001012410	WXS	Illumina HiSeq	Unspecified	Q5FBB7	SGOL1_HUMAN			6	1083	-			299			Potential.		Q588H5|Q5FBB4|Q5FBB5|Q5FBB6|Q5FBB8|Q8N579|Q8WVL0|Q9BVA8|Q9H275	Missense_Mutation	SNP	ENST00000263753.4	37	c.896A>G	CCDS33716.1	.	.	.	.	.	.	.	.	.	.	T	7.963	0.747426	0.15710	.	.	ENSG00000129810	ENST00000263753;ENST00000421451;ENST00000412997;ENST00000412868	T;T;T;T	0.30448	3.02;3.02;1.53;1.53	5.11	3.98	0.46160	.	0.667691	0.16490	N	0.212141	T	0.14874	0.0359	N	0.19112	0.55	0.23809	N	0.996781	B;B	0.21520	0.057;0.057	B;B	0.15052	0.008;0.012	T	0.22521	-1.0214	10	0.11182	T	0.66	-16.3329	4.5462	0.12081	0.0:0.1727:0.0:0.8273	.	299;299	B5BUA4;Q5FBB7	.;SGOL1_HUMAN	S	299	ENSP00000263753:N299S;ENSP00000414129:N299S;ENSP00000410458:N299S;ENSP00000406880:N299S	ENSP00000263753:N299S	N	-	2	0	SGOL1	20191131	0.005000	0.15991	0.513000	0.27749	0.273000	0.26683	0.586000	0.23894	1.939000	0.56221	0.402000	0.26972	AAC		0.279	SGOL1-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000340498.1	NM_138484		6	55	0	0	0	0.001984	0	6	55				
DCLK3	85443	broad.mit.edu	37	3	36779774	36779774	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr3:36779774C>T	ENST00000416516.2	-	2	867	c.377G>A	c.(376-378)gGg>gAg	p.G126E		NM_033403.1	NP_208382.1	Q9C098	DCLK3_HUMAN	doublecortin-like kinase 3	126						cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.G126E(1)		breast(3)|endometrium(3)|kidney(2)|large_intestine(11)|lung(20)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	48						AATCTCCACCCCAAGATGCTT	0.567																																							uc003cgi.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(3)|large_intestine(2)|breast(1)|skin(1)|ovary(1)|kidney(1)	9						c.(376-378)GGG>GAG		doublecortin-like kinase 3							148.0	148.0	148.0					3																	36779774		1883	4105	5988	SO:0001583	missense	85443					cytoplasm|nucleus	ATP binding|protein serine/threonine kinase activity	g.chr3:36779774C>T	AB051552	CCDS43064.1	3p22.3	2007-04-02	2007-04-02	2007-04-02	ENSG00000163673	ENSG00000163673			19005	protein-coding gene	gene with protein product		613167	"""doublecortin and CaM kinase-like 3"""	DCAMKL3		11214970, 16869982	Standard	NM_033403		Approved	KIAA1765, DCDC3C	uc003cgi.2	Q9C098	OTTHUMG00000155805	ENST00000416516.2:c.377G>A	3.37:g.36779774C>T	ENSP00000394484:p.Gly126Glu		Somatic					p.G126E	NM_033403	NP_208382	WXS	Illumina HiSeq	Unspecified	Q9C098	DCLK3_HUMAN			2	868	-			126						Missense_Mutation	SNP	ENST00000416516.2	37	c.377G>A	CCDS43064.1	.	.	.	.	.	.	.	.	.	.	C	3.399	-0.122724	0.06795	.	.	ENSG00000163673	ENST00000416516	T	0.64803	-0.12	4.7	2.76	0.32466	.	0.000000	0.33346	N	0.005003	T	0.42291	0.1196	L	0.32530	0.975	0.09310	N	1	B	0.27882	0.192	B	0.21151	0.033	T	0.13575	-1.0504	10	0.19147	T	0.46	.	6.2865	0.21037	0.0:0.5286:0.346:0.1254	.	126	Q9C098	DCLK3_HUMAN	E	126	ENSP00000394484:G126E	ENSP00000394484:G126E	G	-	2	0	DCLK3	36754778	0.120000	0.22244	0.936000	0.37596	0.680000	0.39746	0.990000	0.29642	1.104000	0.41587	0.655000	0.94253	GGG		0.567	DCLK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341727.1	XM_047355		32	266	0	0	0	0.002836	0	32	266				
TDGF1	6997	broad.mit.edu	37	3	46621261	46621261	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr3:46621261G>T	ENST00000296145.5	+	4	989	c.256G>T	c.(256-258)Ggg>Tgg	p.G86W	TDGF1_ENST00000542931.1_Missense_Mutation_p.G70W|LRRC2_ENST00000296144.3_Intron	NM_003212.3	NP_003203.1	P13385	TDGF1_HUMAN	teratocarcinoma-derived growth factor 1	86	EGF-like. {ECO:0000255|PROSITE- ProRule:PRU00076}.				activation of MAPK activity (GO:0000187)|anterior/posterior axis specification, embryo (GO:0008595)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle cell differentiation (GO:0055007)|cell differentiation (GO:0030154)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|cellular response to interferon-gamma (GO:0071346)|cellular response to interleukin-6 (GO:0071354)|cellular response to tumor necrosis factor (GO:0071356)|embryo development (GO:0009790)|gastrulation (GO:0007369)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|mammary gland development (GO:0030879)|morphogenesis of a branching structure (GO:0001763)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of signal transduction (GO:0009966)|vasculogenesis (GO:0001570)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|extracellular space (GO:0005615)|extrinsic component of plasma membrane (GO:0019897)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	growth factor activity (GO:0008083)|receptor binding (GO:0005102)	p.G86W(1)		cervix(2)|endometrium(1)|kidney(1)|lung(4)	8				BRCA - Breast invasive adenocarcinoma(193;0.00114)|KIRC - Kidney renal clear cell carcinoma(197;0.0173)|Kidney(197;0.0204)		CTGCCTGAATGGGGGAACCTG	0.527																																							uc003cpv.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(256-258)GGG>TGG		teratocarcinoma-derived growth factor 1							108.0	111.0	110.0					3																	46621261		2203	4300	6503	SO:0001583	missense	6997				activation of MAPK activity|anterior/posterior axis specification, embryo|mammary gland development|morphogenesis of a branching structure|negative regulation of apoptosis|peptidyl-serine phosphorylation|positive regulation of cell migration|positive regulation of peptidyl-tyrosine phosphorylation	anchored to membrane|cell surface|extrinsic to plasma membrane	growth factor activity	g.chr3:46621261G>T	M96955	CCDS2742.1, CCDS54575.1	3p21.31	2012-10-03			ENSG00000241186	ENSG00000241186			11701	protein-coding gene	gene with protein product		187395				1882841, 10393436	Standard	NM_003212		Approved	CRIPTO, CR, Cripto-1	uc021wxd.1	P13385	OTTHUMG00000133482	ENST00000296145.5:c.256G>T	3.37:g.46621261G>T	ENSP00000296145:p.Gly86Trp		Somatic				LRRC2_uc003cpu.3_Intron	p.G86W	NM_003212	NP_003203	WXS	Illumina HiSeq	Unspecified	P13385	TDGF1_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.00114)|KIRC - Kidney renal clear cell carcinoma(197;0.0173)|Kidney(197;0.0204)	4	536	+			86			EGF-like.		Q8TCC1	Missense_Mutation	SNP	ENST00000296145.5	37	c.256G>T	CCDS2742.1	.	.	.	.	.	.	.	.	.	.	G	24.7	4.559727	0.86335	.	.	ENSG00000241186	ENST00000542931;ENST00000296145	T;T	0.80304	-1.36;-1.34	4.61	4.61	0.57282	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.92861	0.7729	H	0.97465	4.01	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94549	0.7752	10	0.87932	D	0	.	13.1556	0.59516	0.0:0.0:1.0:0.0	.	86	P13385	TDGF1_HUMAN	W	70;86	ENSP00000446375:G70W;ENSP00000296145:G86W	ENSP00000296145:G86W	G	+	1	0	AC104304.1	46596265	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.396000	0.79891	2.574000	0.86865	0.650000	0.86243	GGG		0.527	TDGF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257378.2	NM_003212		27	203	1	0	5.77227e-19	0.008361	1.05528e-18	27	203				
WDR6	11180	broad.mit.edu	37	3	49052329	49052329	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr3:49052329C>T	ENST00000608424.1	+	6	3013	c.2974C>T	c.(2974-2976)Cgt>Tgt	p.R992C	DALRD3_ENST00000496568.1_5'Flank|WDR6_ENST00000415265.2_Missense_Mutation_p.R440C|WDR6_ENST00000395474.3_Missense_Mutation_p.R1022C|WDR6_ENST00000448293.1_Missense_Mutation_p.R941C			Q9NNW5	WDR6_HUMAN	WD repeat domain 6	992					cell cycle arrest (GO:0007050)|negative regulation of autophagy (GO:0010507)|negative regulation of cell proliferation (GO:0008285)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)	p.R992C(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(1)|liver(1)|lung(9)|ovary(1)|prostate(2)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	26				Kidney(197;9.12e-07)|KIRC - Kidney renal clear cell carcinoma(197;1.32e-05)|BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000155)		CTTGCCCACCCGTGAGGGCCA	0.587																																							uc003cvj.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(3064-3066)CGT>TGT		WD repeat domain 6 protein							98.0	99.0	98.0					3																	49052329		2203	4300	6503	SO:0001583	missense	11180				cell cycle arrest|negative regulation of cell proliferation	cytoplasm		g.chr3:49052329C>T	AF099100	CCDS2782.2	3p21.31	2013-01-09			ENSG00000178252	ENSG00000178252		"""WD repeat domain containing"""	12758	protein-coding gene	gene with protein product		606031					Standard	NM_018031		Approved		uc003cvj.2	Q9NNW5	OTTHUMG00000133546	ENST00000608424.1:c.2974C>T	3.37:g.49052329C>T	ENSP00000477389:p.Arg992Cys		Somatic				WDR6_uc011bby.1_Missense_Mutation_p.R470C|WDR6_uc010hkn.2_Missense_Mutation_p.R966C|WDR6_uc011bbz.1_Missense_Mutation_p.R941C	p.R1022C	NM_018031	NP_060501	WXS	Illumina HiSeq	Unspecified	Q9NNW5	WDR6_HUMAN		Kidney(197;9.12e-07)|KIRC - Kidney renal clear cell carcinoma(197;1.32e-05)|BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000155)	6	3202	+			992			WD 15.		B4DHK2|Q3MIT1|Q9UF63	Missense_Mutation	SNP	ENST00000608424.1	37	c.3064C>T		.	.	.	.	.	.	.	.	.	.	C	5.071	0.198806	0.09652	.	.	ENSG00000178252	ENST00000395474;ENST00000415265;ENST00000448293	T;T	0.60548	0.18;0.19	4.68	-1.68	0.08212	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	1.464360	0.03622	N	0.236545	T	0.39708	0.1088	N	0.22421	0.69	0.09310	N	1	B;B;B	0.12630	0.006;0.001;0.002	B;B;B	0.10450	0.005;0.001;0.002	T	0.23762	-1.0179	10	0.54805	T	0.06	0.2624	1.7354	0.02941	0.4262:0.2764:0.1052:0.1922	.	440;992;941	E9PBK6;Q9NNW5;E9PDU5	.;WDR6_HUMAN;.	C	1022;440;941	ENSP00000378857:R1022C;ENSP00000413432:R941C	ENSP00000378857:R1022C	R	+	1	0	WDR6	49027333	0.000000	0.05858	0.000000	0.03702	0.275000	0.26752	-0.956000	0.03865	-0.247000	0.09597	-0.314000	0.08810	CGT		0.587	WDR6-024	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000471652.1			10	67	0	0	0	0.001368	0	10	67				
LRTM1	57408	broad.mit.edu	37	3	54961995	54961995	+	De_novo_Start_InFrame	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr3:54961995G>T	ENST00000273286.5	-	0	106				CACNA2D3_ENST00000415676.2_Intron|LRTM1_ENST00000493075.1_Intron|CACNA2D3_ENST00000490478.1_Intron|CACNA2D3_ENST00000474759.1_Intron|CACNA2D3_ENST00000288197.5_Intron	NM_020678.2	NP_065729.1	Q9HBL6	LRTM1_HUMAN	leucine-rich repeats and transmembrane domains 1							integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|large_intestine(7)|lung(6)|prostate(1)|skin(4)	21				KIRC - Kidney renal clear cell carcinoma(284;0.00975)|Kidney(284;0.0112)|OV - Ovarian serous cystadenocarcinoma(275;0.0502)		TTAATGTGCAGAGCAACACAC	0.478																																							uc003dhl.2		NA																	0					0						c.(-58--54)CTCTG>CTATG		leucine-rich repeats and transmembrane domains 1							98.0	81.0	86.0					3																	54961995		692	1591	2283			57408					integral to membrane		g.chr3:54961995G>T	AF225421	CCDS2876.1	3p14.3	2006-01-02			ENSG00000144771	ENSG00000144771			25023	protein-coding gene	gene with protein product						12477932	Standard	NM_020678		Approved	HT017	uc003dhl.3	Q9HBL6	OTTHUMG00000158578		3.37:g.54961995G>T			Somatic				CACNA2D3_uc003dhf.2_Intron|CACNA2D3_uc003dhg.1_Intron|CACNA2D3_uc003dhh.1_Intron		NM_020678	NP_065729	WXS	Illumina HiSeq	Unspecified	Q9HBL6	LRTM1_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.00975)|Kidney(284;0.0112)|OV - Ovarian serous cystadenocarcinoma(275;0.0502)	1	78	-								Q8IUU2	Translation_Start_Site	SNP	ENST00000273286.5	37	c.-56C>A	CCDS2876.1																																																																																				0.478	LRTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351399.1	NM_020678		7	144	1	0	4.84862e-15	0.000978	8.41914e-15	7	144				
CADPS	8618	broad.mit.edu	37	3	62478119	62478119	+	Silent	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr3:62478119G>T	ENST00000383710.4	-	20	3079	c.2730C>A	c.(2728-2730)gcC>gcA	p.A910A	CADPS_ENST00000357948.3_Silent_p.A880A|CADPS_ENST00000283269.9_Silent_p.A920A	NM_003716.3	NP_003707.2	Q9ULU8	CAPS1_HUMAN	Ca++-dependent secretion activator	910	Interaction with DRD2.				catecholamine secretion (GO:0050432)|exocytosis (GO:0006887)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)|vesicle organization (GO:0016050)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)|synapse (GO:0045202)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)	p.A920A(1)|p.A910A(1)		breast(3)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(24)|lung(38)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(2)	92		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)		ACCACGCAAAGGCCTTTAAAA	0.448																																							uc003dll.2		NA																	2	Substitution - coding silent(2)		lung(2)	central_nervous_system(2)|ovary(1)	3						c.(2728-2730)GCC>GCA		Ca2+-dependent secretion activator isoform 1							238.0	249.0	245.0					3																	62478119		2203	4300	6503	SO:0001819	synonymous_variant	8618				exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|cytosol|synapse	lipid binding|metal ion binding	g.chr3:62478119G>T	U36448	CCDS2898.1, CCDS2899.1, CCDS46858.1	3p21.1	2013-01-10	2008-08-28		ENSG00000163618	ENSG00000163618		"""Pleckstrin homology (PH) domain containing"""	1426	protein-coding gene	gene with protein product		604667				1516133	Standard	NM_183393		Approved	CAPS, KIAA1121, CAPS1	uc003dll.2	Q9ULU8	OTTHUMG00000158651	ENST00000383710.4:c.2730C>A	3.37:g.62478119G>T			Somatic				CADPS_uc003dlk.1_Silent_p.A407A|CADPS_uc003dlm.2_Silent_p.A920A|CADPS_uc003dln.2_Silent_p.A880A	p.A910A	NM_003716	NP_003707	WXS	Illumina HiSeq	Unspecified	Q9ULU8	CAPS1_HUMAN		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)	20	3090	-		Lung SC(41;0.0452)	910			Interaction with DRD2.		A6NF60|Q13339|Q6GQQ6|Q8N2Z5|Q8N3M7|Q8NFR0|Q96BC2	Silent	SNP	ENST00000383710.4	37	c.2730C>A	CCDS46858.1	.	.	.	.	.	.	.	.	.	.	G	11.09	1.536948	0.27475	.	.	ENSG00000163618	ENST00000491424	.	.	.	6.17	5.29	0.74685	.	.	.	.	.	T	0.57373	0.2049	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.54111	-0.8342	4	.	.	.	.	7.0459	0.25044	0.0667:0.1236:0.6817:0.1279	.	.	.	.	I	213	.	.	L	-	1	0	CADPS	62453159	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.135000	0.31454	2.941000	0.99782	0.655000	0.94253	CTT		0.448	CADPS-013	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351951.5	NM_003716, NM_183393, NM_183394		21	504	1	0	1.10513e-12	0.002299	1.81996e-12	21	504				
SLC25A26	115286	broad.mit.edu	37	3	66413339	66413339	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr3:66413339G>A	ENST00000413054.1	+	5	364	c.290G>A	c.(289-291)tGt>tAt	p.C97Y	SLC25A26_ENST00000536651.1_3'UTR|SLC25A26_ENST00000354883.6_Missense_Mutation_p.C185Y|SLC25A26_ENST00000336733.6_Missense_Mutation_p.C97Y|SLC25A26_ENST00000484768.1_Intron			Q70HW3	SAMC_HUMAN	solute carrier family 25 (S-adenosylmethionine carrier), member 26	185					S-adenosyl-L-methionine transmembrane transport (GO:1901962)|S-adenosyl-L-methionine transport (GO:0015805)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	S-adenosyl-L-methionine transmembrane transporter activity (GO:0000095)	p.C185Y(1)		endometrium(1)|large_intestine(1)|lung(2)|pancreas(1)|stomach(2)|urinary_tract(1)	8		Lung NSC(201;0.00774)		BRCA - Breast invasive adenocarcinoma(55;0.00046)|KIRC - Kidney renal clear cell carcinoma(15;0.0515)|Kidney(15;0.0648)		TCAGCAGTCTGTGGAGCTTTT	0.383																																							uc011bfq.1		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)	1						c.(553-555)TGT>TAT		solute carrier family 25, member 26 isoform a							57.0	60.0	59.0					3																	66413339		2203	4300	6503	SO:0001583	missense	115286					integral to membrane|mitochondrial inner membrane|nucleus	S-adenosylmethionine transmembrane transporter activity	g.chr3:66413339G>A	AJ580932	CCDS54604.1, CCDS2905.2	3p14.2	2013-05-22	2012-03-29		ENSG00000144741	ENSG00000144741		"""Solute carriers"""	20661	protein-coding gene	gene with protein product		611037	"""solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 26"""			14674884	Standard	NM_173471		Approved		uc011bfq.2	Q70HW3	OTTHUMG00000149917	ENST00000413054.1:c.290G>A	3.37:g.66413339G>A	ENSP00000415304:p.Cys97Tyr		Somatic				SLC25A26_uc011bfs.1_Missense_Mutation_p.C97Y|SLC25A26_uc011bft.1_RNA|SLC25A26_uc011bfr.1_Missense_Mutation_p.C185Y|SLC25A26_uc003dmt.2_Missense_Mutation_p.C97Y	p.C185Y	NM_173471	NP_775742	WXS	Illumina HiSeq	Unspecified	Q70HW3	SAMC_HUMAN		BRCA - Breast invasive adenocarcinoma(55;0.00046)|KIRC - Kidney renal clear cell carcinoma(15;0.0515)|Kidney(15;0.0648)	8	1282	+		Lung NSC(201;0.00774)	185			Helical; Name=5; (Potential).|Solcar 3.		A8K758|B3KRZ7|Q7Z786|Q96E68	Missense_Mutation	SNP	ENST00000413054.1	37	c.554G>A		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.48|15.48	2.846288|2.846288	0.51164|0.51164	.|.	.|.	ENSG00000144741|ENSG00000144741	ENST00000354883;ENST00000336733|ENST00000413054	T;T|.	0.79141|.	-1.24;-1.24|.	5.73|5.73	5.73|5.73	0.89815|0.89815	Mitochondrial carrier domain (2);|.	0.043482|.	0.85682|.	D|.	0.000000|.	D|D	0.82692|0.82692	0.5092|0.5092	M|M	0.83223|0.83223	2.63|2.63	0.80722|0.80722	D|D	1|1	P;P|.	0.40834|.	0.684;0.73|.	P;P|.	0.55391|.	0.666;0.775|.	T|T	0.83017|0.83017	-0.0169|-0.0169	10|5	0.87932|.	D|.	0|.	-12.3017|-12.3017	19.8975|19.8975	0.96972|0.96972	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	185;185|.	F8WAB8;Q70HW3|.	.;SAMC_HUMAN|.	Y|M	185;97|122	ENSP00000346955:C185Y;ENSP00000336801:C97Y|.	ENSP00000336801:C97Y|.	C|V	+|+	2|1	0|0	SLC25A26|SLC25A26	66496029|66496029	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.265000|0.265000	0.26407|0.26407	8.534000|8.534000	0.90620|0.90620	2.693000|2.693000	0.91896|0.91896	0.563000|0.563000	0.77884|0.77884	TGT|GTG		0.383	SLC25A26-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000313895.2	NM_173471		5	17	0	0	0	0.000602	0	5	17				
CNTN3	5067	broad.mit.edu	37	3	74315728	74315728	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr3:74315728G>T	ENST00000263665.6	-	21	2917	c.2890C>A	c.(2890-2892)Ctg>Atg	p.L964M	CNTN3_ENST00000477856.1_5'UTR	NM_020872.1	NP_065923.1	Q9P232	CNTN3_HUMAN	contactin 3 (plasmacytoma associated)	964	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|nervous system development (GO:0007399)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.L964M(1)		NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(39)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	83		Lung NSC(201;0.138)|Lung SC(41;0.21)		Epithelial(33;0.00212)|BRCA - Breast invasive adenocarcinoma(55;0.00258)|LUSC - Lung squamous cell carcinoma(21;0.00461)|Lung(16;0.01)		TTAATGGGCAGCACAAGTTCA	0.393																																							uc003dpm.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(3)|ovary(1)|skin(1)	5						c.(2890-2892)CTG>ATG		contactin 3 precursor							263.0	239.0	247.0					3																	74315728		2203	4300	6503	SO:0001583	missense	5067				cell adhesion	anchored to membrane|plasma membrane	protein binding	g.chr3:74315728G>T	AB040929	CCDS33790.1	3p12.3	2013-02-11			ENSG00000113805	ENSG00000113805		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2173	protein-coding gene	gene with protein product		601325		PANG		8661054, 8586965	Standard	XM_005264757		Approved	BIG-1	uc003dpm.1	Q9P232	OTTHUMG00000158813	ENST00000263665.6:c.2890C>A	3.37:g.74315728G>T	ENSP00000263665:p.Leu964Met		Somatic					p.L964M	NM_020872	NP_065923	WXS	Illumina HiSeq	Unspecified	Q9P232	CNTN3_HUMAN		Epithelial(33;0.00212)|BRCA - Breast invasive adenocarcinoma(55;0.00258)|LUSC - Lung squamous cell carcinoma(21;0.00461)|Lung(16;0.01)	21	2970	-		Lung NSC(201;0.138)|Lung SC(41;0.21)	964			Fibronectin type-III 4.		B9EK50|Q9H039	Missense_Mutation	SNP	ENST00000263665.6	37	c.2890C>A	CCDS33790.1	.	.	.	.	.	.	.	.	.	.	G	18.34	3.603187	0.66445	.	.	ENSG00000113805	ENST00000263665	D	0.84873	-1.91	5.42	4.52	0.55395	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.90229	0.6945	M	0.62723	1.935	0.51767	D	0.999934	D	0.56287	0.975	D	0.70487	0.969	D	0.90290	0.4322	10	0.56958	D	0.05	.	13.0091	0.58722	0.0815:0.0:0.9185:0.0	.	964	Q9P232	CNTN3_HUMAN	M	964	ENSP00000263665:L964M	ENSP00000263665:L964M	L	-	1	2	CNTN3	74398418	0.998000	0.40836	0.994000	0.49952	0.865000	0.49528	2.685000	0.46959	1.215000	0.43411	0.655000	0.94253	CTG		0.393	CNTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352306.1	NM_020872		20	189	1	0	1.28384e-07	0.001882	1.72425e-07	20	189				
PROS1	5627	broad.mit.edu	37	3	93605343	93605343	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr3:93605343G>A	ENST00000394236.3	-	11	1476	c.1160C>T	c.(1159-1161)tCt>tTt	p.S387F	PROS1_ENST00000407433.1_Missense_Mutation_p.S256F	NM_000313.3	NP_000304.2	P07225	PROS_HUMAN	protein S (alpha)	387	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|fibrinolysis (GO:0042730)|innate immune response (GO:0045087)|leukocyte migration (GO:0050900)|negative regulation of endopeptidase activity (GO:0010951)|peptidyl-glutamic acid carboxylation (GO:0017187)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|Golgi membrane (GO:0000139)|platelet alpha granule lumen (GO:0031093)	calcium ion binding (GO:0005509)|endopeptidase inhibitor activity (GO:0004866)	p.S387F(1)		endometrium(3)|kidney(5)|large_intestine(8)|lung(26)|ovary(1)|skin(2)|urinary_tract(1)	46					Drotrecogin alfa(DB00055)|Menadione(DB00170)|Sodium Tetradecyl Sulfate(DB00464)	TTCTTCCACAGACACCTACAA	0.294																																							uc003drb.3		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)	1						c.(1159-1161)TCT>TTT		protein S, alpha preproprotein	Antihemophilic Factor(DB00025)|Drotrecogin alfa(DB00055)|Menadione(DB00170)						79.0	89.0	85.0					3																	93605343		2203	4299	6502	SO:0001583	missense	5627				leukocyte migration|peptidyl-glutamic acid carboxylation|platelet activation|platelet degranulation|post-translational protein modification|proteolysis	endoplasmic reticulum membrane|extracellular region|Golgi lumen|Golgi membrane|platelet alpha granule lumen	calcium ion binding|endopeptidase inhibitor activity	g.chr3:93605343G>A		CCDS2923.1	3q11.1	2013-06-03			ENSG00000184500	ENSG00000184500			9456	protein-coding gene	gene with protein product		176880		PROS		214811, 1833851	Standard	NM_000313		Approved		uc003drb.4	P07225	OTTHUMG00000150354	ENST00000394236.3:c.1160C>T	3.37:g.93605343G>A	ENSP00000377783:p.Ser387Phe		Somatic				PROS1_uc010hoo.2_Missense_Mutation_p.S256F|PROS1_uc003dqz.3_Missense_Mutation_p.S256F	p.S387F	NM_000313	NP_000304	WXS	Illumina HiSeq	Unspecified	P07225	PROS_HUMAN			11	1501	-			387			Laminin G-like 1.		A8KAC9|D3DN28|Q15518|Q7Z715|Q9UCZ8	Missense_Mutation	SNP	ENST00000394236.3	37	c.1160C>T	CCDS2923.1	.	.	.	.	.	.	.	.	.	.	G	18.77	3.694735	0.68386	.	.	ENSG00000184500	ENST00000394236;ENST00000407433	T;T	0.76316	-1.01;-1.01	3.42	3.42	0.39159	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 1 (1);	0.064368	0.64402	U	0.000004	D	0.87517	0.6197	M	0.87827	2.91	0.58432	D	0.999999	D	0.59767	0.986	P	0.60541	0.876	D	0.90445	0.4434	10	0.72032	D	0.01	.	15.0387	0.71770	0.0:0.0:1.0:0.0	.	387	P07225	PROS_HUMAN	F	387;256	ENSP00000377783:S387F;ENSP00000385794:S256F	ENSP00000377783:S387F	S	-	2	0	PROS1	95088033	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.859000	0.92264	1.735000	0.51646	0.655000	0.94253	TCT		0.294	PROS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317762.1	NM_000313		30	147	0	0	0	0.009535	0	30	147				
CCDC80	151887	broad.mit.edu	37	3	112357838	112357838	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr3:112357838G>T	ENST00000206423.3	-	2	1868	c.915C>A	c.(913-915)agC>agA	p.S305R	CCDC80_ENST00000475181.1_5'Flank|CCDC80_ENST00000439685.2_Missense_Mutation_p.S305R	NM_199511.1|NM_199512.1	NP_955805.1|NP_955806.1	Q76M96	CCD80_HUMAN	coiled-coil domain containing 80	305					extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|interstitial matrix (GO:0005614)	heparin binding (GO:0008201)	p.S305R(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(21)|ovary(3)|pancreas(2)|prostate(4)	51						CGCTGCCCAGGCTTGGCCTTC	0.597																																							uc003dzf.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(913-915)AGC>AGA		steroid-sensitive protein 1 precursor							123.0	110.0	114.0					3																	112357838		2203	4300	6503	SO:0001583	missense	151887							g.chr3:112357838G>T	AY333429	CCDS2968.1	3q13.2	2010-12-24			ENSG00000091986	ENSG00000091986			30649	protein-coding gene	gene with protein product	"""steroid sensitive gene 1"""	608298				15325258, 18178152	Standard	XM_005247135		Approved	URB, SSG1, DRO1	uc003dzf.3	Q76M96	OTTHUMG00000159265	ENST00000206423.3:c.915C>A	3.37:g.112357838G>T	ENSP00000206423:p.Ser305Arg		Somatic				CCDC80_uc011bhv.1_Missense_Mutation_p.S305R|CCDC80_uc003dzg.2_Missense_Mutation_p.S305R|CCDC80_uc003dzh.1_Missense_Mutation_p.S305R	p.S305R	NM_199512	NP_955806	WXS	Illumina HiSeq	Unspecified	Q76M96	CCD80_HUMAN			2	1133	-			305					D3DN67|Q5PR20|Q6GPG9|Q8IVT6|Q8NBV1|Q8NHY8	Missense_Mutation	SNP	ENST00000206423.3	37	c.915C>A	CCDS2968.1	.	.	.	.	.	.	.	.	.	.	G	0.589	-0.833850	0.02713	.	.	ENSG00000091986	ENST00000206423;ENST00000439685	T;T	0.45276	0.9;0.9	4.5	2.57	0.30868	.	0.803549	0.12072	N	0.502172	T	0.20007	0.0481	N	0.08118	0	0.09310	N	1	B;B;B	0.11235	0.001;0.004;0.0	B;B;B	0.06405	0.002;0.002;0.001	T	0.15009	-1.0452	10	0.29301	T	0.29	-8.8269	5.1212	0.14862	0.0831:0.2785:0.5096:0.1287	.	316;305;305	Q76M96-2;A3KC71;Q76M96	.;.;CCD80_HUMAN	R	305	ENSP00000206423:S305R;ENSP00000411814:S305R	ENSP00000206423:S305R	S	-	3	2	CCDC80	113840528	0.004000	0.15560	0.261000	0.24466	0.096000	0.18686	0.664000	0.25068	1.063000	0.40649	0.555000	0.69702	AGC		0.597	CCDC80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354219.1	NM_199511		27	105	1	0	7.07758e-08	0.004656	9.72581e-08	27	105				
DRD3	1814	broad.mit.edu	37	3	113890615	113890615	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr3:113890615G>T	ENST00000460779.1	-	3	514	c.225C>A	c.(223-225)gaC>gaA	p.D75E	DRD3_ENST00000383673.2_Missense_Mutation_p.D75E|DRD3_ENST00000295881.7_Missense_Mutation_p.D75E|DRD3_ENST00000467632.1_Missense_Mutation_p.D75E	NM_001282563.1	NP_001269492.1	P35462	DRD3_HUMAN	dopamine receptor D3	75					acid secretion (GO:0046717)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|arachidonic acid secretion (GO:0050482)|behavioral response to cocaine (GO:0048148)|cellular calcium ion homeostasis (GO:0006874)|circadian regulation of gene expression (GO:0032922)|dopamine metabolic process (GO:0042417)|G-protein coupled receptor internalization (GO:0002031)|G-protein coupled receptor signaling pathway (GO:0007186)|gastric emptying (GO:0035483)|learning (GO:0007612)|learning or memory (GO:0007611)|locomotory behavior (GO:0007626)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of blood pressure (GO:0045776)|negative regulation of dopamine receptor signaling pathway (GO:0060160)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein secretion (GO:0050709)|negative regulation of sodium:proton antiporter activity (GO:0032416)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of mitosis (GO:0045840)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prepulse inhibition (GO:0060134)|regulation of blood volume by renin-angiotensin (GO:0002016)|regulation of cAMP metabolic process (GO:0030814)|regulation of circadian sleep/wake cycle, sleep (GO:0045187)|regulation of dopamine secretion (GO:0014059)|regulation of dopamine uptake involved in synaptic transmission (GO:0051584)|regulation of lipid metabolic process (GO:0019216)|regulation of locomotion involved in locomotory behavior (GO:0090325)|regulation of multicellular organism growth (GO:0040014)|response to amphetamine (GO:0001975)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to histamine (GO:0034776)|response to morphine (GO:0043278)|social behavior (GO:0035176)|synaptic transmission, dopaminergic (GO:0001963)|visual learning (GO:0008542)	apical part of cell (GO:0045177)|cell projection (GO:0042995)|endocytic vesicle (GO:0030139)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity, coupled via Gi/Go (GO:0001591)|drug binding (GO:0008144)	p.D75E(1)		central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(4)|liver(1)|lung(23)|ovary(1)|pancreas(1)|skin(1)	36					Amisulpride(DB06288)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Clozapine(DB00363)|Domperidone(DB01184)|Dopamine(DB00988)|Haloperidol(DB00502)|Iloperidone(DB04946)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Methotrimeprazine(DB01403)|Mianserin(DB06148)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Pimozide(DB01100)|Pramipexole(DB00413)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Sulpiride(DB00391)|Yohimbine(DB01392)|Ziprasidone(DB00246)	CCACCAGCAAGTCTGCCACAG	0.557																																							uc003ebd.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4						c.(223-225)GAC>GAA		dopamine receptor D3 isoform a	Apomorphine(DB00714)|Chlorprothixene(DB01239)|Cocaine(DB00907)|Methotrimeprazine(DB01403)|Olanzapine(DB00334)|Pramipexole(DB00413)|Ropinirole(DB00268)|Ziprasidone(DB00246)						118.0	107.0	111.0					3																	113890615		2203	4300	6503	SO:0001583	missense	1814				activation of adenylate cyclase activity by dopamine receptor signaling pathway|arachidonic acid secretion|behavioral response to cocaine|cellular calcium ion homeostasis|circadian regulation of gene expression|G-protein coupled receptor internalization|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|locomotory behavior|musculoskeletal movement, spinal reflex action|negative regulation of blood pressure|negative regulation of oligodendrocyte differentiation|negative regulation of protein kinase B signaling cascade|negative regulation of protein secretion|positive regulation of dopamine receptor signaling pathway|positive regulation of mitosis|prepulse inhibition|regulation of dopamine secretion|response to drug|response to histamine|response to morphine|social behavior|visual learning	integral to plasma membrane	dopamine D3 receptor activity|drug binding	g.chr3:113890615G>T		CCDS2978.1, CCDS33829.1	3q13.3	2012-08-08			ENSG00000151577	ENSG00000151577		"""GPCR / Class A : Dopamine receptors"""	3024	protein-coding gene	gene with protein product		126451				1916765	Standard	XM_005247171		Approved		uc003ebc.1	P35462	OTTHUMG00000159334	ENST00000460779.1:c.225C>A	3.37:g.113890615G>T	ENSP00000419402:p.Asp75Glu		Somatic				DRD3_uc010hqn.1_Missense_Mutation_p.D75E|DRD3_uc003ebb.1_Missense_Mutation_p.D75E|DRD3_uc003ebc.1_Missense_Mutation_p.D75E	p.D75E	NM_000796	NP_000787	WXS	Illumina HiSeq	Unspecified	P35462	DRD3_HUMAN			3	648	-			75			Helical; Name=2.		A1A4V5|Q4VBM8	Missense_Mutation	SNP	ENST00000460779.1	37	c.225C>A	CCDS2978.1	.	.	.	.	.	.	.	.	.	.	G	18.94	3.730294	0.69074	.	.	ENSG00000151577	ENST00000460779;ENST00000467632;ENST00000383673;ENST00000281274;ENST00000295881	D;D;D;D	0.87966	-2.32;-2.32;-2.32;-2.32	5.0	3.21	0.36854	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.95153	0.8429	H	0.98089	4.145	0.58432	D	0.999995	D;D;D;D	0.89917	0.999;0.999;0.999;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.93819	0.7117	10	0.87932	D	0	.	7.9654	0.30095	0.3788:0.0:0.6212:0.0	.	75;75;75;75	A1A4V4;A8K8E4;P35462;E9PCM4	.;.;DRD3_HUMAN;.	E	75	ENSP00000419402:D75E;ENSP00000420662:D75E;ENSP00000373169:D75E;ENSP00000295881:D75E	ENSP00000281274:D75E	D	-	3	2	DRD3	115373305	1.000000	0.71417	0.993000	0.49108	0.994000	0.84299	2.632000	0.46511	0.705000	0.31890	0.655000	0.94253	GAC		0.557	DRD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354699.1	NM_000796.3		11	105	1	0	2.61681e-11	0.00245	4.17684e-11	11	105				
ZNF80	7634	broad.mit.edu	37	3	113955452	113955452	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr3:113955452C>T	ENST00000482457.2	-	1	973	c.470G>A	c.(469-471)gGa>gAa	p.G157E	RP11-553L6.2_ENST00000493033.1_RNA|RP11-553L6.2_ENST00000481773.1_RNA	NM_007136.3	NP_009067.2	P51504	ZNF80_HUMAN	zinc finger protein 80	157					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G157E(1)		NS(1)|endometrium(1)|large_intestine(9)|lung(15)|ovary(2)|prostate(2)|urinary_tract(2)	32		Lung NSC(201;0.0233)|all_neural(597;0.0837)				GAGTTTTTCTCCAGTGTGGGT	0.483																																					GBM(23;986 1114 21716)	GBM(23;986 1114 21716)	uc010hqo.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(469-471)GGA>GAA		zinc finger protein 80							90.0	95.0	93.0					3																	113955452		2203	4300	6503	SO:0001583	missense	7634					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr3:113955452C>T	X65233	CCDS2979.1	3q13.31	2013-01-08	2006-05-12		ENSG00000174255	ENSG00000174255		"""Zinc fingers, C2H2-type"""	13155	protein-coding gene	gene with protein product		194553	"""zinc finger protein 80 (pT17)"""			8478004	Standard	NM_007136		Approved	pT17	uc010hqo.3	P51504	OTTHUMG00000159332	ENST00000482457.2:c.470G>A	3.37:g.113955452C>T	ENSP00000417192:p.Gly157Glu		Somatic				ZNF80_uc003ebf.2_RNA	p.G157E	NM_007136	NP_009067	WXS	Illumina HiSeq	Unspecified	P51504	ZNF80_HUMAN			1	974	-		Lung NSC(201;0.0233)|all_neural(597;0.0837)	157					Q6NSW4|Q6NT14	Missense_Mutation	SNP	ENST00000482457.2	37	c.470G>A	CCDS2979.1	.	.	.	.	.	.	.	.	.	.	C	18.77	3.694211	0.68386	.	.	ENSG00000174255	ENST00000482457	T	0.25749	1.78	2.66	0.756	0.18421	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.37489	0.1005	L	0.48362	1.52	0.26831	N	0.968588	D	0.89917	1.0	D	0.76071	0.987	T	0.14448	-1.0472	9	0.72032	D	0.01	.	5.5381	0.17023	0.0:0.6666:0.2058:0.1276	.	157	P51504	ZNF80_HUMAN	E	157	ENSP00000417192:G157E	ENSP00000309812:G157E	G	-	2	0	ZNF80	115438142	0.639000	0.27234	0.041000	0.18516	0.522000	0.34438	2.264000	0.43302	0.173000	0.19788	0.561000	0.74099	GGA		0.483	ZNF80-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354696.2	NM_007136		11	119	0	0	0	0.001368	0	11	119				
ARHGAP31	57514	broad.mit.edu	37	3	119133448	119133448	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr3:119133448A>T	ENST00000264245.4	+	12	3204	c.2672A>T	c.(2671-2673)gAt>gTt	p.D891V		NM_020754.2	NP_065805.2	Q2M1Z3	RHG31_HUMAN	Rho GTPase activating protein 31	891					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	GTPase activator activity (GO:0005096)	p.D891V(1)		breast(5)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(3)|large_intestine(11)|lung(29)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	67						TGTGACGAAGATGACACTGTG	0.557																																					Pancreas(7;176 297 5394 51128 51241)	Pancreas(7;176 297 5394 51128 51241)	uc003ecj.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(2671-2673)GAT>GTT		Cdc42 GTPase-activating protein							109.0	113.0	111.0					3																	119133448		2087	4224	6311	SO:0001583	missense	57514				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|focal adhesion|lamellipodium	GTPase activator activity	g.chr3:119133448A>T		CCDS43135.1	3q13.33	2011-06-29			ENSG00000031081	ENSG00000031081		"""Rho GTPase activating proteins"""	29216	protein-coding gene	gene with protein product		610911				9786927, 12819203, 16519628	Standard	NM_020754		Approved	CDGAP	uc003ecj.4	Q2M1Z3	OTTHUMG00000159362	ENST00000264245.4:c.2672A>T	3.37:g.119133448A>T	ENSP00000264245:p.Asp891Val		Somatic					p.D891V	NM_020754	NP_065805	WXS	Illumina HiSeq	Unspecified	Q2M1Z3	RHG31_HUMAN			12	3204	+			891					Q9ULL6	Missense_Mutation	SNP	ENST00000264245.4	37	c.2672A>T	CCDS43135.1	.	.	.	.	.	.	.	.	.	.	A	17.76	3.468934	0.63625	.	.	ENSG00000031081	ENST00000264245;ENST00000543280	T	0.08282	3.11	4.83	4.83	0.62350	.	0.103679	0.42682	D	0.000669	T	0.07234	0.0183	L	0.32530	0.975	0.80722	D	1	P	0.43431	0.807	B	0.34931	0.192	T	0.17349	-1.0372	10	0.87932	D	0	.	13.7229	0.62740	1.0:0.0:0.0:0.0	.	891	Q2M1Z3	RHG31_HUMAN	V	891	ENSP00000264245:D891V	ENSP00000264245:D891V	D	+	2	0	ARHGAP31	120616138	1.000000	0.71417	0.991000	0.47740	0.984000	0.73092	7.480000	0.81109	2.021000	0.59480	0.459000	0.35465	GAT		0.557	ARHGAP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354942.2			26	124	0	0	0	0.004656	0	26	124				
MED12L	116931	broad.mit.edu	37	3	150881712	150881712	+	Silent	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr3:150881712G>T	ENST00000474524.1	+	8	1178	c.1140G>T	c.(1138-1140)gtG>gtT	p.V380V	MED12L_ENST00000309237.4_Silent_p.V380V|MED12L_ENST00000422248.2_Silent_p.V380V|MED12L_ENST00000273432.4_Intron	NM_053002.4	NP_443728.3	Q86YW9	MD12L_HUMAN	mediator complex subunit 12-like	380						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)	p.V380V(1)		NS(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(27)|lung(50)|ovary(6)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	128			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			GTGCCTTGGTGTGGAATTATT	0.493																																							uc003eyp.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|large_intestine(1)|central_nervous_system(1)|skin(1)	7						c.(1138-1140)GTG>GTT		mediator of RNA polymerase II transcription,							68.0	63.0	65.0					3																	150881712		2203	4300	6503	SO:0001819	synonymous_variant	116931				regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	mediator complex		g.chr3:150881712G>T	AB046855, AF388364	CCDS33876.1	3q25.1	2007-07-30	2007-07-30		ENSG00000144893	ENSG00000144893			16050	protein-coding gene	gene with protein product		611318	"""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)-like"""			11524702	Standard	XM_006713487		Approved	KIAA1635, TNRC11L, TRALPUSH, TRALP	uc003eyp.3	Q86YW9	OTTHUMG00000159844	ENST00000474524.1:c.1140G>T	3.37:g.150881712G>T			Somatic				MED12L_uc011bnz.1_Intron|MED12L_uc003eyn.2_Silent_p.V380V|MED12L_uc003eyo.2_Silent_p.V380V	p.V380V	NM_053002	NP_443728	WXS	Illumina HiSeq	Unspecified	Q86YW9	MD12L_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)		8	1178	+			380					Q96PC7|Q96PC8|Q9H9M5|Q9HCD7|Q9UI69	Silent	SNP	ENST00000474524.1	37	c.1140G>T	CCDS33876.1																																																																																				0.493	MED12L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357707.2	NM_053002		9	107	1	0	0.000442599	0.006214	0.000501854	9	107				
PLCH1	23007	broad.mit.edu	37	3	155200774	155200774	+	Missense_Mutation	SNP	T	T	A	rs377124673		TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr3:155200774T>A	ENST00000340059.7	-	23	3064	c.3065A>T	c.(3064-3066)aAc>aTc	p.N1022I	PLCH1_ENST00000460012.1_Missense_Mutation_p.N984I|PLCH1_ENST00000414191.1_Missense_Mutation_p.N984I|PLCH1_ENST00000447496.2_3'UTR|PLCH1_ENST00000334686.6_Missense_Mutation_p.N984I|PLCH1_ENST00000494598.1_Intron|PLCH1-AS2_ENST00000472913.1_RNA	NM_001130960.1	NP_001124432.1	Q4KWH8	PLCH1_HUMAN	phospholipase C, eta 1	1022					inositol phosphate metabolic process (GO:0043647)|lipid catabolic process (GO:0016042)|phosphatidylinositol-mediated signaling (GO:0048015)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase C activity (GO:0050429)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)	p.N1022I(1)|p.N984I(1)		NS(3)|breast(3)|endometrium(9)|kidney(4)|large_intestine(20)|lung(45)|ovary(2)|prostate(5)|skin(8)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	107			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			TAACTTTTTGTTGAAATTTAG	0.408																																							uc011bok.1		NA																	2	Substitution - Missense(2)		lung(2)	skin(3)|ovary(1)	4						c.(3064-3066)AAC>ATC		phospholipase C eta 1 isoform a							159.0	162.0	161.0					3																	155200774		2203	4300	6503	SO:0001583	missense	23007				lipid catabolic process|phosphatidylinositol-mediated signaling	membrane	calcium ion binding|calcium-dependent phospholipase C activity|phosphatidylinositol phospholipase C activity|signal transducer activity	g.chr3:155200774T>A	AB028992	CCDS33881.1, CCDS46939.1, CCDS46940.1	3q25	2013-01-10	2006-03-16	2006-03-16	ENSG00000114805	ENSG00000114805	3.1.4.11	"""EF-hand domain containing"""	29185	protein-coding gene	gene with protein product		612835	"""phospholipase C-like 3"""	PLCL3		15702972	Standard	NM_014996		Approved	KIAA1069, MGC117152, DKFZp434C1372, PLCeta1	uc021xge.1	Q4KWH8	OTTHUMG00000158477	ENST00000340059.7:c.3065A>T	3.37:g.155200774T>A	ENSP00000345988:p.Asn1022Ile		Somatic				PLCH1_uc011boj.1_3'UTR|PLCH1_uc011bol.1_Missense_Mutation_p.N984I	p.N1022I	NM_001130960	NP_001124432	WXS	Illumina HiSeq	Unspecified	Q4KWH8	PLCH1_HUMAN	Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)		23	3342	-			1022					Q29RV9|Q4KWH9|Q68CN0|Q86XK4|Q9H9U2|Q9UPT3	Missense_Mutation	SNP	ENST00000340059.7	37	c.3065A>T	CCDS46939.1	.	.	.	.	.	.	.	.	.	.	T	13.86	2.363226	0.41902	.	.	ENSG00000114805	ENST00000460012;ENST00000340059;ENST00000334686;ENST00000414191	T;T;T;T	0.22336	1.96;1.96;1.96;1.96	5.27	-0.141	0.13452	.	1.266330	0.04858	N	0.443665	T	0.12220	0.0297	N	0.08118	0	0.28600	N	0.909204	B;B	0.30973	0.302;0.201	B;B	0.35413	0.202;0.1	T	0.34403	-0.9830	10	0.46703	T	0.11	.	5.0548	0.14527	0.1234:0.2093:0.0:0.6673	.	984;1022	Q4KWH8-2;Q4KWH8	.;PLCH1_HUMAN	I	984;1022;984;984	ENSP00000417502:N984I;ENSP00000345988:N1022I;ENSP00000335469:N984I;ENSP00000412977:N984I	ENSP00000335469:N984I	N	-	2	0	PLCH1	156683468	1.000000	0.71417	0.988000	0.46212	0.584000	0.36387	0.529000	0.23019	0.094000	0.17404	0.482000	0.46254	AAC		0.408	PLCH1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000351125.1	NM_014996		9	119	0	0	0	0.004482	0	9	119				
ATP13A4	84239	broad.mit.edu	37	3	193132540	193132540	+	Splice_Site	SNP	C	C	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr3:193132540C>A	ENST00000342695.4	-	26	3165		c.e26-1		ATP13A4_ENST00000400270.2_Splice_Site|ATP13A4_ENST00000482964.1_5'Flank|ATP13A4_ENST00000392443.3_Splice_Site	NM_032279.2	NP_115655.2	Q4VNC1	AT134_HUMAN	ATPase type 13A4							integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)	p.?(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(27)|ovary(2)|prostate(3)|skin(11)|upper_aerodigestive_tract(2)	71	all_cancers(143;1.76e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;2.72e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000109)		TTCAGATTCACTATAAAATAA	0.398																																							uc003ftd.2		NA																	1	Unknown(1)		lung(1)	ovary(2)	2						c.e26-1		ATPase type 13A4							51.0	48.0	49.0					3																	193132540		2203	4300	6503	SO:0001630	splice_region_variant	84239				ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding	g.chr3:193132540C>A	AK095277	CCDS3304.2	3q29	2010-04-20			ENSG00000127249	ENSG00000127249		"""ATPases / P-type"""	25422	protein-coding gene	gene with protein product		609556				14702039, 12975309	Standard	XM_005247829		Approved	DKFZp761I1011, FLJ37958	uc003ftd.3	Q4VNC1	OTTHUMG00000074067	ENST00000342695.4:c.2843-1G>T	3.37:g.193132540C>A			Somatic				ATP13A4_uc010hzi.2_Splice_Site	p.M948_splice	NM_032279	NP_115655	WXS	Illumina HiSeq	Unspecified	Q4VNC1	AT134_HUMAN	OV - Ovarian serous cystadenocarcinoma(49;2.72e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000109)	26	2951	-	all_cancers(143;1.76e-08)|Ovarian(172;0.0386)							B7WPC7|Q6UY23|Q8N1Q9|Q9H043	Splice_Site	SNP	ENST00000342695.4	37	c.2843_splice	CCDS3304.2	.	.	.	.	.	.	.	.	.	.	C	17.08	3.297692	0.60086	.	.	ENSG00000127249	ENST00000392443;ENST00000342695	.	.	.	6.02	6.02	0.97574	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.0311	0.89285	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ATP13A4	194615234	1.000000	0.71417	0.998000	0.56505	0.709000	0.40893	5.667000	0.68067	2.857000	0.98124	0.650000	0.86243	.		0.398	ATP13A4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157244.4	NM_032279	Intron	9	76	1	0	9.70103e-10	0.008291	1.46397e-09	9	76				
CPN2	1370	broad.mit.edu	37	3	194062704	194062704	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr3:194062704A>T	ENST00000323830.3	-	2	817	c.728T>A	c.(727-729)cTa>cAa	p.L243Q	CPN2_ENST00000429275.1_Missense_Mutation_p.L243Q	NM_001080513.2	NP_001073982	P22792	CPN2_HUMAN	carboxypeptidase N, polypeptide 2	243					protein stabilization (GO:0050821)|regulation of catalytic activity (GO:0050790)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	enzyme regulator activity (GO:0030234)	p.L243Q(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(11)|ovary(5)|prostate(1)	27	all_cancers(143;5.31e-09)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;2.2e-17)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;4.65e-05)		CAGCCTCTCTAGGCAGAAGAG	0.582																																							uc003fts.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)	5						c.(727-729)CTA>CAA		carboxypeptidase N, polypeptide 2							43.0	46.0	45.0					3																	194062704		2203	4300	6503	SO:0001583	missense	1370				protein stabilization	extracellular region	enzyme regulator activity	g.chr3:194062704A>T	J05158	CCDS33920.1	3q29	2012-02-10	2007-02-23		ENSG00000178772	ENSG00000178772	3.4.17.3		2313	protein-coding gene	gene with protein product		603104	"""carboxypeptidase N, polypeptide 2, 83kD"""	ACBP		2378615, 9628828	Standard	XM_005269280		Approved		uc003fts.3	P22792	OTTHUMG00000156047	ENST00000323830.3:c.728T>A	3.37:g.194062704A>T	ENSP00000319464:p.Leu243Gln		Somatic					p.L243Q	NM_001080513	NP_001073982	WXS	Illumina HiSeq	Unspecified	P22792	CPN2_HUMAN	OV - Ovarian serous cystadenocarcinoma(49;2.2e-17)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;4.65e-05)	2	818	-	all_cancers(143;5.31e-09)|Ovarian(172;0.0634)		243			LRR 7.		B2RPE7|Q86SU4|Q8N5V4	Missense_Mutation	SNP	ENST00000323830.3	37	c.728T>A	CCDS33920.1	.	.	.	.	.	.	.	.	.	.	A	15.68	2.905341	0.52333	.	.	ENSG00000178772	ENST00000323830;ENST00000429275	T;T	0.61742	0.08;0.08	5.05	5.05	0.67936	.	0.000000	0.27951	N	0.017184	D	0.84727	0.5536	H	0.98089	4.145	0.53005	D	0.999966	D	0.89917	1.0	D	0.97110	1.0	D	0.90539	0.4501	10	0.87932	D	0	.	15.1003	0.72269	1.0:0.0:0.0:0.0	.	243	P22792	CPN2_HUMAN	Q	243	ENSP00000319464:L243Q;ENSP00000402232:L243Q	ENSP00000319464:L243Q	L	-	2	0	CPN2	195544399	1.000000	0.71417	0.954000	0.39281	0.017000	0.09413	6.602000	0.74141	2.025000	0.59659	0.459000	0.35465	CTA		0.582	CPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342856.2	NM_001080513		5	42	0	0	0	0.001368	0	5	42				
USP46	64854	broad.mit.edu	37	4	53468216	53468216	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr4:53468216T>A	ENST00000441222.3	-	7	911	c.727A>T	c.(727-729)Agg>Tgg	p.R243W	USP46_ENST00000451218.2_Missense_Mutation_p.R216W|USP46_ENST00000508499.1_Missense_Mutation_p.R236W	NM_022832.3	NP_073743.2	P62068	UBP46_HUMAN	ubiquitin specific peptidase 46	243	USP.				adult feeding behavior (GO:0008343)|behavioral fear response (GO:0001662)|behavioral response to ethanol (GO:0048149)|protein deubiquitination (GO:0016579)|regulation of synaptic transmission, GABAergic (GO:0032228)|righting reflex (GO:0060013)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.R243W(1)		breast(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(2)	12			LUSC - Lung squamous cell carcinoma(32;0.0295)			TTTTTTACCCTCATCCTAAGA	0.448																																							uc003gzn.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(727-729)AGG>TGG		ubiquitin specific peptidase 46 isoform 1							93.0	90.0	91.0					4																	53468216		1924	4128	6052	SO:0001583	missense	64854				behavior|protein deubiquitination|regulation of synaptic transmission, GABAergic|ubiquitin-dependent protein catabolic process		protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity	g.chr4:53468216T>A	AK022614	CCDS47053.1, CCDS47054.1	4q12	2008-02-05	2005-08-08		ENSG00000109189	ENSG00000109189		"""Ubiquitin-specific peptidases"""	20075	protein-coding gene	gene with protein product		612849	"""ubiquitin specific protease 46"""			12838346	Standard	NM_022832		Approved	FLJ12552	uc003gzn.3	P62068	OTTHUMG00000160640	ENST00000441222.3:c.727A>T	4.37:g.53468216T>A	ENSP00000407818:p.Arg243Trp		Somatic				USP46_uc003gzm.3_Missense_Mutation_p.R236W|USP46_uc011bzr.1_Missense_Mutation_p.R220W|USP46_uc011bzs.1_Missense_Mutation_p.R127W	p.R243W	NM_022832	NP_073743	WXS	Illumina HiSeq	Unspecified	P62068	UBP46_HUMAN	LUSC - Lung squamous cell carcinoma(32;0.0295)		7	912	-			243					B7Z3Y7|B7Z675|B7Z7S3|G8ACC7|Q80V95|Q9H7U4|Q9H9T8	Missense_Mutation	SNP	ENST00000441222.3	37	c.727A>T	CCDS47053.1	.	.	.	.	.	.	.	.	.	.	T	16.50	3.142067	0.57044	.	.	ENSG00000109189	ENST00000441222;ENST00000451218;ENST00000508499	T;T;T	0.32515	1.45;1.45;1.45	5.03	3.81	0.43845	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.64402	D	0.000017	T	0.50034	0.1592	M	0.65320	2	0.80722	D	1	D;D;D;D	0.65815	0.992;0.96;0.984;0.995	P;P;P;D	0.72982	0.905;0.729;0.908;0.979	T	0.50398	-0.8833	10	0.87932	D	0	-13.153	11.5683	0.50818	0.0:0.0:0.2799:0.7201	.	127;231;243;236	P62068-2;P62068-4;P62068;P62068-3	.;.;UBP46_HUMAN;.	W	243;216;236	ENSP00000407818:R243W;ENSP00000390102:R216W;ENSP00000423244:R236W	ENSP00000407818:R243W	R	-	1	2	USP46	53162973	1.000000	0.71417	1.000000	0.80357	0.566000	0.35808	1.812000	0.38952	0.814000	0.34374	0.528000	0.53228	AGG		0.448	USP46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361516.2	NM_022832		10	82	0	0	0	0.006214	0	10	82				
KDR	3791	broad.mit.edu	37	4	55968660	55968660	+	Missense_Mutation	SNP	G	G	A	rs199774865	byFrequency	TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr4:55968660G>A	ENST00000263923.4	-	14	2298	c.2003C>T	c.(2002-2004)aCg>aTg	p.T668M		NM_002253.2	NP_002244.1	P35968	VGFR2_HUMAN	kinase insert domain receptor (a type III receptor tyrosine kinase)	668	Ig-like C2-type 7.				angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion homeostasis (GO:0055074)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic hemopoiesis (GO:0035162)|endothelial cell differentiation (GO:0045446)|endothelium development (GO:0003158)|extracellular matrix organization (GO:0030198)|lung alveolus development (GO:0048286)|lymph vessel development (GO:0001945)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of vasculogenesis (GO:2001214)|protein autophosphorylation (GO:0046777)|regulation of cell shape (GO:0008360)|signal transduction by phosphorylation (GO:0023014)|surfactant homeostasis (GO:0043129)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sorting endosome (GO:0097443)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|Hsp90 protein binding (GO:0051879)|integrin binding (GO:0005178)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)	p.T668M(1)|p.T668K(1)		NS(1)|breast(3)|central_nervous_system(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(16)|lung(71)|ovary(2)|prostate(2)|skin(10)|soft_tissue(4)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	135	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Axitinib(DB06626)|Cabozantinib(DB08875)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	TCCTGTGATCGTGGGTGCCAC	0.428			Mis		"""NSCLC, angiosarcoma"""					TSP Lung(20;0.16)			g|||	4	0.000798722	0.0	0.0014	5008	,	,		18923	0.0		0.0	False		,,,				2504	0.0031						uc003has.2		NA		Dom	yes		4	4q11-q12	3791	Mis	vascular endothelial growth factor receptor 2			E			NSCLC|angiosarcoma		2	Substitution - Missense(2)		lung(2)	lung(16)|soft_tissue(4)|central_nervous_system(4)|large_intestine(2)|stomach(2)|skin(2)|ovary(2)|kidney(1)	33						c.(2002-2004)ACG>ATG		kinase insert domain receptor precursor	Sorafenib(DB00398)|Sunitinib(DB01268)	G	MET/THR	0,4406		0,0,2203	148.0	122.0	131.0		2003	-2.2	0.1	4		131	2,8598	2.2+/-6.3	0,2,4298	yes	missense	KDR	NM_002253.2	81	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	benign	668/1357	55968660	2,13004	2203	4300	6503	SO:0001583	missense	3791	Familial_Infantile_Hemangioma			angiogenesis|cell differentiation|interspecies interaction between organisms|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of focal adhesion assembly|positive regulation of positive chemotaxis|regulation of cell shape	integral to plasma membrane	ATP binding|growth factor binding|Hsp90 protein binding|integrin binding|receptor signaling protein tyrosine kinase activity|vascular endothelial growth factor receptor activity	g.chr4:55968660G>A	AF035121	CCDS3497.1	4q11-q12	2013-01-29			ENSG00000128052	ENSG00000128052	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6307	protein-coding gene	gene with protein product		191306				1417831	Standard	NM_002253		Approved	FLK1, VEGFR, VEGFR2, CD309	uc003has.3	P35968	OTTHUMG00000128734	ENST00000263923.4:c.2003C>T	4.37:g.55968660G>A	ENSP00000263923:p.Thr668Met	TSP Lung(20;0.16)	Somatic				KDR_uc003hat.1_Missense_Mutation_p.T668M	p.T668M	NM_002253	NP_002244	WXS	Illumina HiSeq	Unspecified	P35968	VGFR2_HUMAN	Epithelial(7;0.189)		14	2305	-	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		668			Ig-like C2-type 7.|Extracellular (Potential).		A2RRS0|B5A925|C5IFA0|O60723|Q14178	Missense_Mutation	SNP	ENST00000263923.4	37	c.2003C>T	CCDS3497.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	g	0.407	-0.915041	0.02415	0.0	2.33E-4	ENSG00000128052	ENST00000263923	T	0.67698	-0.28	6.02	-2.17	0.07059	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.606205	0.18161	N	0.149788	T	0.47021	0.1423	L	0.41710	1.295	0.09310	N	1	B	0.10296	0.003	B	0.09377	0.004	T	0.20638	-1.0269	10	0.33940	T	0.23	.	3.6376	0.08155	0.3064:0.1307:0.4365:0.1264	.	668	P35968	VGFR2_HUMAN	M	668	ENSP00000263923:T668M	ENSP00000263923:T668M	T	-	2	0	KDR	55663417	0.006000	0.16342	0.090000	0.20809	0.050000	0.14768	0.074000	0.14662	-0.321000	0.08627	-1.137000	0.01932	ACG		0.428	KDR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250645.1			7	91	0	0	0	0.004482	0	7	91				
UGT2B4	7363	broad.mit.edu	37	4	70361472	70361472	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr4:70361472C>A	ENST00000305107.6	-	1	154	c.108G>T	c.(106-108)tgG>tgT	p.W36C	UGT2B4_ENST00000512583.1_Missense_Mutation_p.W36C|UGT2B4_ENST00000506580.1_5'UTR|UGT2B4_ENST00000381096.3_Intron	NM_021139.2	NP_066962.2	P06133	UD2B4_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B4	36					cellular glucuronidation (GO:0052695)|estrogen catabolic process (GO:0006711)|metabolic process (GO:0008152)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)	p.W36C(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(29)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	47					Canagliflozin(DB08907)|Codeine(DB00318)|Dapagliflozin(DB06292)|Flurbiprofen(DB00712)|Ibuprofen(DB01050)|Morphine(DB00295)	TTATATTCATCCAGTGGCTGA	0.468																																							uc003hek.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)	2						c.(106-108)TGG>TGT		UDP glucuronosyltransferase 2B4 precursor							140.0	142.0	141.0					4																	70361472		2203	4300	6503	SO:0001583	missense	7363				estrogen catabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity	g.chr4:70361472C>A	BC026264	CCDS43234.1, CCDS75137.1	4q13	2008-02-05	2005-07-20			ENSG00000156096		"""UDP glucuronosyltransferases"""	12553	protein-coding gene	gene with protein product		600067	"""UDP glycosyltransferase 2 family, polypeptide B4"""			3109396, 7835904	Standard	NM_021139		Approved	UGT2B11	uc003hek.4	P06133		ENST00000305107.6:c.108G>T	4.37:g.70361472C>A	ENSP00000305221:p.Trp36Cys		Somatic				UGT2B4_uc011cap.1_Intron|UGT2B4_uc003hel.3_Missense_Mutation_p.W36C	p.W36C	NM_021139	NP_066962	WXS	Illumina HiSeq	Unspecified	P06133	UD2B4_HUMAN			1	155	-			36					A6NCP7|B4DT75|G5E9X8|O60731|O60867|O75614|P36538|Q1HBF9|Q6QQX7	Missense_Mutation	SNP	ENST00000305107.6	37	c.108G>T	CCDS43234.1	.	.	.	.	.	.	.	.	.	.	C	14.23	2.474704	0.43942	.	.	ENSG00000156096	ENST00000512583;ENST00000305107;ENST00000510114	T;T;T	0.64991	-0.13;-0.13;-0.13	2.41	2.41	0.29592	.	0.186667	0.38164	U	0.001793	D	0.83663	0.5303	H	0.96970	3.915	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.994	D	0.87000	0.2116	10	0.87932	D	0	.	10.5565	0.45121	0.0:1.0:0.0:0.0	.	36;36	G5E9X8;P06133	.;UD2B4_HUMAN	C	36	ENSP00000421290:W36C;ENSP00000305221:W36C;ENSP00000421113:W36C	ENSP00000305221:W36C	W	-	3	0	UGT2B4	70396061	1.000000	0.71417	0.061000	0.19648	0.020000	0.10135	4.832000	0.62759	1.343000	0.45638	0.306000	0.20318	TGG		0.468	UGT2B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365526.1	NM_021139		13	189	1	0	0.000151284	0.001855	0.00017938	13	189				
LIN54	132660	broad.mit.edu	37	4	83905676	83905676	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr4:83905676C>A	ENST00000340417.3	-	2	699	c.322G>T	c.(322-324)Gtg>Ttg	p.V108L	LIN54_ENST00000510557.1_Intron|LIN54_ENST00000442461.2_Intron|LIN54_ENST00000395282.2_Missense_Mutation_p.V108L|LIN54_ENST00000505397.1_Missense_Mutation_p.V108L|LIN54_ENST00000506560.1_Missense_Mutation_p.V108L|LIN54_ENST00000395283.2_Missense_Mutation_p.V108L|LIN54_ENST00000446851.2_Intron	NM_194282.2	NP_919258.2	Q6MZP7	LIN54_HUMAN	lin-54 DREAM MuvB core complex component	108					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of cell cycle (GO:0051726)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)	p.V108L(1)		breast(2)|endometrium(2)|kidney(3)|large_intestine(2)|lung(5)	14		Hepatocellular(203;0.114)				GATATAGTCACAGGAGTCTGA	0.383																																							uc003hnx.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(322-324)GTG>TTG		lin-54 homolog isoform a							207.0	207.0	207.0					4																	83905676		2203	4300	6503	SO:0001583	missense	132660				cell cycle|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding	g.chr4:83905676C>A	BX537919	CCDS3599.1, CCDS47089.1, CCDS75157.1	4q21.22	2014-07-17	2014-07-17		ENSG00000189308	ENSG00000189308			25397	protein-coding gene	gene with protein product	"""CXC domain containing 1"""	613367	"""lin-54 homolog (C. elegans)"""			21498570	Standard	XM_005262749		Approved	MIP120, DKFZp686L1814, JC8.6, CXCDC1	uc003hnx.3	Q6MZP7	OTTHUMG00000130287	ENST00000340417.3:c.322G>T	4.37:g.83905676C>A	ENSP00000341947:p.Val108Leu		Somatic				LIN54_uc003hnz.3_Intron|LIN54_uc003hny.3_Intron|LIN54_uc010ijt.2_Missense_Mutation_p.V108L|LIN54_uc010iju.2_5'UTR|LIN54_uc010ijv.2_Intron	p.V108L	NM_194282	NP_919258	WXS	Illumina HiSeq	Unspecified	Q6MZP7	LIN54_HUMAN			2	700	-		Hepatocellular(203;0.114)	108					Q32M68|Q32M69|Q6N071|Q76B60	Missense_Mutation	SNP	ENST00000340417.3	37	c.322G>T	CCDS3599.1	.	.	.	.	.	.	.	.	.	.	C	10.86	1.469528	0.26423	.	.	ENSG00000189308	ENST00000340417;ENST00000395283;ENST00000395282;ENST00000506560;ENST00000505397	.	.	.	5.36	4.52	0.55395	.	0.074849	0.56097	D	0.000032	T	0.41558	0.1164	N	0.19112	0.55	0.46167	D	0.998904	B;B	0.17852	0.024;0.006	B;B	0.17722	0.019;0.008	T	0.19976	-1.0289	9	0.27785	T	0.31	-8.0929	12.3711	0.55256	0.0:0.9215:0.0:0.0785	.	108;108	Q6MZP7-2;Q6MZP7	.;LIN54_HUMAN	L	108	.	ENSP00000341947:V108L	V	-	1	0	LIN54	84124700	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	2.179000	0.42528	1.260000	0.44134	-0.140000	0.14226	GTG		0.383	LIN54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252626.2	NM_194282		14	182	1	0	3.27435e-08	0.00245	4.57527e-08	14	182				
DSPP	1834	broad.mit.edu	37	4	88535090	88535090	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr4:88535090C>A	ENST00000282478.7	+	4	1309	c.1276C>A	c.(1276-1278)Cct>Act	p.P426T	DSPP_ENST00000399271.1_Missense_Mutation_p.P426T|RP11-742B18.1_ENST00000506480.1_RNA			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	426					biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)	p.P426T(1)		breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		CATAGAAGGACCTGGCCAAAA	0.413																																							uc003hqu.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(1276-1278)CCT>ACT		dentin sialophosphoprotein preproprotein							145.0	135.0	138.0					4																	88535090		1947	4150	6097	SO:0001583	missense	1834				biomineral tissue development|ossification|skeletal system development	proteinaceous extracellular matrix	calcium ion binding|collagen binding|extracellular matrix structural constituent	g.chr4:88535090C>A	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.1276C>A	4.37:g.88535090C>A	ENSP00000282478:p.Pro426Thr		Somatic					p.P426T	NM_014208	NP_055023	WXS	Illumina HiSeq	Unspecified	Q9NZW4	DSPP_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000508)	5	1396	+		Hepatocellular(203;0.114)|all_hematologic(202;0.236)	426					A8MUI0|O95815	Missense_Mutation	SNP	ENST00000282478.7	37	c.1276C>A	CCDS43248.1	.	.	.	.	.	.	.	.	.	.	C	9.531	1.110781	0.20714	.	.	ENSG00000152591	ENST00000399271;ENST00000282478	D;D	0.88509	-2.39;-2.39	4.11	-0.633	0.11519	.	1.989150	0.03060	N	0.155729	D	0.82609	0.5074	L	0.46157	1.445	0.09310	N	1	B	0.24823	0.112	B	0.20184	0.028	T	0.62029	-0.6940	10	0.27082	T	0.32	0.0288	1.7761	0.03022	0.3807:0.3406:0.1666:0.112	.	426	Q9NZW4	DSPP_HUMAN	T	426	ENSP00000382213:P426T;ENSP00000282478:P426T	ENSP00000282478:P426T	P	+	1	0	DSPP	88754114	0.000000	0.05858	0.001000	0.08648	0.025000	0.11179	-0.032000	0.12266	0.002000	0.14630	0.446000	0.29264	CCT		0.413	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208		21	72	1	0	8.10497e-08	0.010504	1.11009e-07	21	72				
HERC6	55008	broad.mit.edu	37	4	89363544	89363544	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr4:89363544G>A	ENST00000264346.7	+	23	3060	c.3001G>A	c.(3001-3003)Gag>Aag	p.E1001K	HERC6_ENST00000380265.5_Missense_Mutation_p.E965K	NM_017912.3	NP_060382.3	Q8IVU3	HERC6_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 6	1001	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				hematopoietic progenitor cell differentiation (GO:0002244)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.E1001K(1)|p.M1000I(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)	11		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000222)		GGAAAGAATGGAGGAAGCACT	0.428																																							uc011cdi.1		NA																	2	Substitution - Missense(2)		lung(2)	lung(3)|ovary(1)|kidney(1)	5						c.(3001-3003)GAG>AAG		hect domain and RLD 6 isoform 1							78.0	78.0	78.0					4																	89363544		2045	4237	6282	SO:0001583	missense	55008				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytosol	ubiquitin-protein ligase activity	g.chr4:89363544G>A	AF336798	CCDS47098.1, CCDS54777.1	4q22	2012-02-23	2012-02-23		ENSG00000138642	ENSG00000138642			26072	protein-coding gene	gene with protein product		609249	"""hect domain and RLD 6"""				Standard	NM_001165136		Approved	FLJ20637	uc011cdi.2	Q8IVU3	OTTHUMG00000160983	ENST00000264346.7:c.3001G>A	4.37:g.89363544G>A	ENSP00000264346:p.Glu1001Lys		Somatic				HERC6_uc011cdj.1_Missense_Mutation_p.E965K|HERC6_uc011cdk.1_RNA|HERC6_uc011cdl.1_RNA	p.E1001K	NM_017912	NP_060382	WXS	Illumina HiSeq	Unspecified	Q8IVU3	HERC6_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000222)	23	3184	+		Hepatocellular(203;0.114)	1001			HECT.		B4DIY5|Q5GC90|Q5GRH3|Q5HYM6|Q5JPB6|Q6PIF4|Q8NAN3|Q9NWS4	Missense_Mutation	SNP	ENST00000264346.7	37	c.3001G>A	CCDS47098.1	.	.	.	.	.	.	.	.	.	.	G	10.52	1.371977	0.24857	.	.	ENSG00000138642	ENST00000380265;ENST00000264346	T;T	0.55760	0.5;0.5	4.69	0.326	0.15908	HECT (4);	0.365001	0.23524	N	0.047250	T	0.23611	0.0571	N	0.05441	-0.05	0.80722	D	1	B;B	0.11235	0.003;0.004	B;B	0.15052	0.007;0.012	T	0.30707	-0.9969	10	0.02654	T	1	.	8.8639	0.35274	0.6245:0.0:0.3755:0.0	.	965;1001	Q8IVU3-2;Q8IVU3	.;HERC6_HUMAN	K	965;1001	ENSP00000369617:E965K;ENSP00000264346:E1001K	ENSP00000264346:E1001K	E	+	1	0	HERC6	89582567	0.967000	0.33354	0.854000	0.33618	0.991000	0.79684	0.007000	0.13174	-0.079000	0.12707	0.591000	0.81541	GAG		0.428	HERC6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000363259.2			4	27	0	0	0	0.000602	0	4	27				
STPG2	285555	broad.mit.edu	37	4	98893504	98893504	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr4:98893504C>G	ENST00000295268.3	-	7	949	c.860G>C	c.(859-861)gGt>gCt	p.G287A		NM_174952.2	NP_777612.1	Q8N412	STPG2_HUMAN	sperm-tail PG-rich repeat containing 2	287								p.G287A(1)									AACAGAAGAACCAAATGCACT	0.348																																							uc003htt.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(859-861)GGT>GCT		hypothetical protein LOC285555							82.0	81.0	81.0					4																	98893504		2203	4300	6503	SO:0001583	missense	285555							g.chr4:98893504C>G	BC036870	CCDS3645.1	4q22.3-q23	2013-10-11	2012-07-30	2012-07-30	ENSG00000163116	ENSG00000163116			28712	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 37"""	C4orf37		23031811	Standard	NM_174952		Approved	MGC46496	uc003htt.2	Q8N412	OTTHUMG00000131009	ENST00000295268.3:c.860G>C	4.37:g.98893504C>G	ENSP00000295268:p.Gly287Ala		Somatic					p.G287A	NM_174952	NP_777612	WXS	Illumina HiSeq	Unspecified	Q8N412	CD037_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;2.27e-08)	7	950	-			287						Missense_Mutation	SNP	ENST00000295268.3	37	c.860G>C	CCDS3645.1	.	.	.	.	.	.	.	.	.	.	C	18.11	3.550704	0.65311	.	.	ENSG00000163116	ENST00000522676;ENST00000295268	T;T	0.68025	-0.3;2.51	5.45	5.45	0.79879	.	0.058346	0.64402	D	0.000004	T	0.80824	0.4697	M	0.66939	2.045	0.43885	D	0.9965	D	0.89917	1.0	D	0.91635	0.999	T	0.79990	-0.1570	10	0.44086	T	0.13	-18.2093	18.0593	0.89372	0.0:1.0:0.0:0.0	.	287	Q8N412	CD037_HUMAN	A	1;287	ENSP00000428346:G1A;ENSP00000295268:G287A	ENSP00000295268:G287A	G	-	2	0	C4orf37	99112527	1.000000	0.71417	1.000000	0.80357	0.417000	0.31264	4.564000	0.60830	2.555000	0.86185	0.557000	0.71058	GGT		0.348	STPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253642.1	NM_174952		7	45	0	0	0	0.001984	0	7	45				
AIMP1	9255	broad.mit.edu	37	4	107249400	107249400	+	Splice_Site	SNP	G	G	C			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr4:107249400G>C	ENST00000442366.1	+	4	443	c.391G>C	c.(391-393)Gga>Cga	p.G131R	AIMP1_ENST00000358008.3_Splice_Site_p.G131R|AIMP1_ENST00000394701.4_Splice_Site_p.G155R	NM_001142415.1	NP_001135887.1	Q12904	AIMP1_HUMAN	aminoacyl tRNA synthetase complex-interacting multifunctional protein 1	131	Interaction with HSP90B1. {ECO:0000250}.|Required for endothelial cell migration.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|chemotaxis (GO:0006935)|gene expression (GO:0010467)|glucose metabolic process (GO:0006006)|inflammatory response (GO:0006954)|leukocyte migration (GO:0050900)|negative regulation of endothelial cell proliferation (GO:0001937)|response to wounding (GO:0009611)|signal transduction (GO:0007165)|tRNA aminoacylation for protein translation (GO:0006418)	aminoacyl-tRNA synthetase multienzyme complex (GO:0017101)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	cytokine activity (GO:0005125)|protein homodimerization activity (GO:0042803)|tRNA binding (GO:0000049)	p.G131R(1)		breast(1)|endometrium(2)|kidney(1)|lung(5)|skin(1)|urinary_tract(1)	11						TGAAAAGAAAGGTATTTTTGA	0.318																																							uc011cfg.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(391-393)GGA>CGA		small inducible cytokine subfamily E, member 1							35.0	34.0	35.0					4																	107249400		2202	4299	6501	SO:0001630	splice_region_variant	9255				angiogenesis|apoptosis|cell adhesion|cell-cell signaling|chemotaxis|glucose metabolic process|inflammatory response|leukocyte migration|negative regulation of endothelial cell proliferation|signal transduction|tRNA aminoacylation for protein translation	aminoacyl-tRNA synthetase multienzyme complex|cytosol|endoplasmic reticulum|extracellular space|Golgi apparatus|nucleus|transport vesicle	cell surface binding|cytokine activity|protein homodimerization activity|tRNA binding	g.chr4:107249400G>C	U10117	CCDS3674.1, CCDS47121.1	4q24	2009-05-20	2009-05-20	2009-05-20	ENSG00000164022	ENSG00000164022			10648	protein-coding gene	gene with protein product	"""EMAP II"", ""ARS-interacting multifunctional protein 1"""	603605	"""small inducible cytokine subfamily E, member 1 (endothelial monocyte-activating)"""	SCYE1		7929199, 7545917	Standard	NM_004757		Approved	EMAPII, EMAP-2, p43	uc011cfg.2	Q12904	OTTHUMG00000131217	ENST00000442366.1:c.391+1G>C	4.37:g.107249400G>C			Somatic				AIMP1_uc003hyg.2_Missense_Mutation_p.G131R|AIMP1_uc003hyh.2_Missense_Mutation_p.G155R	p.G131R	NM_001142415	NP_001135887	WXS	Illumina HiSeq	Unspecified	Q12904	AIMP1_HUMAN			4	443	+			131			Interaction with HSP90B1 (By similarity).|Required for endothelial cell migration.		B3KTR2|B4E1S7|Q6FG28|Q96CQ9	Missense_Mutation	SNP	ENST00000442366.1	37	c.391G>C	CCDS3674.1	.	.	.	.	.	.	.	.	.	.	G	9.756	1.168809	0.21621	.	.	ENSG00000164022	ENST00000510207;ENST00000442366;ENST00000432345;ENST00000358008;ENST00000394701	T;T;T;T	0.26373	1.74;1.88;1.88;1.86	5.07	5.07	0.68467	.	2.073320	0.01760	N	0.030480	T	0.47340	0.1440	M	0.82323	2.585	0.80722	D	1	P;B	0.45768	0.866;0.002	P;B	0.46659	0.523;0.006	T	0.54997	-0.8209	10	0.15066	T	0.55	-9.1454	17.3891	0.87425	0.0:0.0:1.0:0.0	.	131;131	B4DNK3;Q12904	.;AIMP1_HUMAN	R	131;131;131;131;155	ENSP00000423681:G131R;ENSP00000405248:G131R;ENSP00000350699:G131R;ENSP00000378191:G155R	ENSP00000350699:G131R	G	+	1	0	AIMP1	107468849	1.000000	0.71417	1.000000	0.80357	0.291000	0.27294	5.593000	0.67550	2.501000	0.84356	0.655000	0.94253	GGA		0.318	AIMP1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253961.1	NM_004757	Missense_Mutation	4	18	0	0	0	0.009096	0	4	18				
ZGRF1	55345	broad.mit.edu	37	4	113540185	113540185	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr4:113540185A>T	ENST00000505019.1	-	6	1138	c.1013T>A	c.(1012-1014)aTa>aAa	p.I338K	C4orf21_ENST00000309071.5_Missense_Mutation_p.I338K|C4orf21_ENST00000445203.2_Missense_Mutation_p.I307K	NM_018392.4	NP_060862.3	Q86YA3	ZGRF1_HUMAN		338						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)	p.I338K(2)		breast(1)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(6)|lung(21)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	45		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000676)		AGAAGAATGTATAGGTGAACT	0.358																																							uc003iau.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(1012-1014)ATA>AAA		prematurely terminated mRNA decay factor-like							79.0	85.0	83.0					4																	113540185		2201	4300	6501	SO:0001583	missense	55345					integral to membrane	zinc ion binding	g.chr4:113540185A>T																												ENST00000505019.1:c.1013T>A	4.37:g.113540185A>T	ENSP00000424737:p.Ile338Lys		Somatic				C4orf21_uc003iaw.2_Missense_Mutation_p.I338K	p.I338K	NM_018392	NP_060862	WXS	Illumina HiSeq	Unspecified	Q6ZU11	YD002_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000676)	6	1224	-		Ovarian(17;0.156)	Error:Variant_position_missing_in_Q6ZU11_after_alignment					B3KQX2|B4DSN6|B4DYU8|E9PDE1|G5EA02|Q6ZU11|Q9NSW3|Q9NUJ4	Missense_Mutation	SNP	ENST00000505019.1	37	c.1013T>A		.	.	.	.	.	.	.	.	.	.	A	13.53	2.263409	0.39995	.	.	ENSG00000138658	ENST00000505019;ENST00000309071;ENST00000445203	D;T;T	0.82167	-1.58;1.91;1.5	5.17	-9.03	0.00737	.	3.235710	0.00864	N	0.001956	T	0.64811	0.2632	N	0.08118	0	0.09310	N	1	B;B	0.17667	0.023;0.016	B;B	0.16289	0.01;0.015	T	0.57957	-0.7721	10	0.56958	D	0.05	5.8185	8.915	0.35576	0.1335:0.0879:0.5914:0.1872	.	338;338	Q86YA3;G5EA02	CD021_HUMAN;.	K	338;338;307	ENSP00000424737:I338K;ENSP00000309095:I338K;ENSP00000390505:I307K	ENSP00000309095:I338K	I	-	2	0	C4orf21	113759634	0.000000	0.05858	0.000000	0.03702	0.249000	0.25844	-2.862000	0.00725	-1.745000	0.01337	0.455000	0.32223	ATA		0.358	C4orf21-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000256413.1			12	121	0	0	0	0.001368	0	12	121				
ANK2	287	broad.mit.edu	37	4	114278877	114278877	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr4:114278877A>G	ENST00000357077.4	+	38	9156	c.9103A>G	c.(9103-9105)Atc>Gtc	p.I3035V	ANK2_ENST00000394537.3_Intron|ANK2_ENST00000506722.1_Intron|ANK2_ENST00000264366.6_Missense_Mutation_p.I3002V|ANK2_ENST00000509550.1_Intron|ANK2_ENST00000510275.2_Intron	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	3035					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.I3035V(1)		NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		CAAAGTCATCATCACAAAAAC	0.413																																							uc003ibe.3		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14						c.(9103-9105)ATC>GTC		ankyrin 2 isoform 1							94.0	92.0	93.0					4																	114278877		2203	4300	6503	SO:0001583	missense	287				axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding	g.chr4:114278877A>G	M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.9103A>G	4.37:g.114278877A>G	ENSP00000349588:p.Ile3035Val		Somatic				ANK2_uc003ibd.3_Intron|ANK2_uc003ibf.3_Intron|ANK2_uc011cgc.1_Intron|ANK2_uc003ibg.3_Intron|ANK2_uc003ibh.3_Intron|ANK2_uc011cgd.1_Missense_Mutation_p.I337V|ANK2_uc011cgb.1_Missense_Mutation_p.I3050V	p.I3035V	NM_001148	NP_001139	WXS	Illumina HiSeq	Unspecified	Q01484	ANK2_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)	38	9203	+		Ovarian(17;0.0448)|Hepatocellular(203;0.218)	3002					Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	ENST00000357077.4	37	c.9103A>G	CCDS3702.1	.	.	.	.	.	.	.	.	.	.	A	15.46	2.838905	0.51057	.	.	ENSG00000145362	ENST00000357077;ENST00000264366;ENST00000505342	T;T;D	0.96619	-0.48;-0.48;-4.07	5.91	5.91	0.95273	.	0.000000	0.64402	D	0.000013	D	0.97074	0.9044	M	0.66939	2.045	0.80722	D	1	P;D	0.62365	0.905;0.991	B;D	0.72625	0.369;0.978	D	0.95576	0.8642	10	0.02654	T	1	.	16.3483	0.83171	1.0:0.0:0.0:0.0	.	3002;3035	Q01484;Q01484-4	ANK2_HUMAN;.	V	3035;3002;45	ENSP00000349588:I3035V;ENSP00000264366:I3002V;ENSP00000422498:I45V	ENSP00000264366:I3002V	I	+	1	0	ANK2	114498326	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.420000	0.66441	2.254000	0.74563	0.533000	0.62120	ATC		0.413	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148		24	159	0	0	0	0.00278	0	24	159				
ANK2	287	broad.mit.edu	37	4	114279344	114279344	+	Silent	SNP	A	A	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr4:114279344A>T	ENST00000357077.4	+	38	9623	c.9570A>T	c.(9568-9570)gtA>gtT	p.V3190V	ANK2_ENST00000394537.3_Intron|ANK2_ENST00000506722.1_Intron|ANK2_ENST00000264366.6_Silent_p.V3157V|ANK2_ENST00000509550.1_Intron|ANK2_ENST00000510275.2_Intron	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	3190					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.V3190V(1)		NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		GTGAGGAAGTAGAGGAAATAC	0.458																																							uc003ibe.3		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14						c.(9568-9570)GTA>GTT		ankyrin 2 isoform 1							65.0	64.0	64.0					4																	114279344		2203	4300	6503	SO:0001819	synonymous_variant	287				axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding	g.chr4:114279344A>T	M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.9570A>T	4.37:g.114279344A>T			Somatic				ANK2_uc003ibd.3_Intron|ANK2_uc003ibf.3_Intron|ANK2_uc011cgc.1_Intron|ANK2_uc003ibg.3_Intron|ANK2_uc003ibh.3_Intron|ANK2_uc011cgd.1_Silent_p.V492V|ANK2_uc011cgb.1_Silent_p.V3205V	p.V3190V	NM_001148	NP_001139	WXS	Illumina HiSeq	Unspecified	Q01484	ANK2_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)	38	9670	+		Ovarian(17;0.0448)|Hepatocellular(203;0.218)	3157					Q01485|Q08AC7|Q08AC8|Q7Z3L5	Silent	SNP	ENST00000357077.4	37	c.9570A>T	CCDS3702.1																																																																																				0.458	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148		8	60	0	0	0	0.006214	0	8	60				
FAT4	79633	broad.mit.edu	37	4	126411519	126411519	+	Silent	SNP	C	C	A	rs138057366		TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr4:126411519C>A	ENST00000394329.3	+	17	13555	c.13542C>A	c.(13540-13542)acC>acA	p.T4514T	FAT4_ENST00000335110.5_Silent_p.T2755T	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	4514					branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.T4457T(1)|p.T4514T(1)		NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						GCTGCGCAACCGTCTTGGCCC	0.567																																							uc003ifj.3		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18						c.(13540-13542)ACC>ACA		FAT tumor suppressor homolog 4 precursor							62.0	62.0	62.0					4																	126411519		2203	4300	6503	SO:0001819	synonymous_variant	79633				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr4:126411519C>A	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.13542C>A	4.37:g.126411519C>A			Somatic				FAT4_uc011cgp.1_Silent_p.T2755T|FAT4_uc003ifi.1_Silent_p.T1991T	p.T4514T	NM_024582	NP_078858	WXS	Illumina HiSeq	Unspecified	Q6V0I7	FAT4_HUMAN			17	13542	+			4514			Helical; (Potential).		A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Silent	SNP	ENST00000394329.3	37	c.13542C>A	CCDS3732.3																																																																																				0.567	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582		20	99	1	0	2.37509e-13	0.010504	4.00676e-13	20	99				
GALNTL6	442117	broad.mit.edu	37	4	173269702	173269702	+	Silent	SNP	C	C	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr4:173269702C>T	ENST00000506823.1	+	5	1072	c.415C>T	c.(415-417)Ctg>Ttg	p.L139L	GALNTL6_ENST00000508122.1_Silent_p.L122L|GALNTL6_ENST00000457021.1_3'UTR	NM_001034845.2	NP_001030017.2	Q49A17	GLTL6_HUMAN	polypeptide N-acetylgalactosaminyltransferase-like 6	139	Catalytic subdomain A.				protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.L139L(1)		breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|liver(2)|lung(21)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	45						TCTGGAAAGGCTGCCAAACAC	0.398																																							uc003isv.2		NA																	1	Substitution - coding silent(1)		lung(1)	breast(2)|ovary(1)|skin(1)	4						c.(415-417)CTG>TTG		N-acetylgalactosaminyltransferase-like 6							137.0	130.0	132.0					4																	173269702		2203	4300	6503	SO:0001819	synonymous_variant	442117					Golgi membrane|integral to membrane	metal ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding	g.chr4:173269702C>T		CCDS34104.1	4q34.1	2014-03-13	2014-03-13		ENSG00000174473	ENSG00000174473		"""Glycosyltransferase family 2 domain containing"""	33844	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase-like 6"""	615138	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 6"""				Standard	NM_001034845		Approved	GALNT17, GalNAc-T6L	uc003isv.3	Q49A17	OTTHUMG00000160807	ENST00000506823.1:c.415C>T	4.37:g.173269702C>T			Somatic					p.L139L	NM_001034845	NP_001030017	WXS	Illumina HiSeq	Unspecified	Q49A17	GLTL6_HUMAN			5	1151	+			139			Catalytic subdomain A.|Lumenal (Potential).		Q2L4S6	Silent	SNP	ENST00000506823.1	37	c.415C>T	CCDS34104.1																																																																																				0.398	GALNTL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362395.1	NM_001034845		20	106	0	0	0	0.004656	0	20	106				
FASTKD3	79072	broad.mit.edu	37	5	7866922	7866922	+	Silent	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr5:7866922G>T	ENST00000264669.5	-	2	1411	c.1275C>A	c.(1273-1275)gcC>gcA	p.A425A	MTRR_ENST00000264668.2_5'Flank|MTRR_ENST00000341013.6_5'Flank|MTRR_ENST00000502509.1_Intron|FASTKD3_ENST00000513658.1_Intron|MTRR_ENST00000440940.2_5'Flank	NM_024091.3	NP_076996.2	Q14CZ7	FAKD3_HUMAN	FAST kinase domains 3	425					cellular respiration (GO:0045333)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)	p.A425A(1)		breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(2)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						ATAAAGCAGAGGCATTTGGTG	0.348																																							uc003jeb.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|breast(1)|pancreas(1)	4						c.(1273-1275)GCC>GCA		FAST kinase domains 3							56.0	57.0	56.0					5																	7866922		2203	4300	6503	SO:0001819	synonymous_variant	79072				apoptosis|cellular respiration	mitochondrion	ATP binding|protein kinase activity	g.chr5:7866922G>T	AK026927	CCDS3873.1	5p15.31	2008-02-05			ENSG00000124279	ENSG00000124279			28758	protein-coding gene	gene with protein product						12477932	Standard	NM_024091		Approved	MGC5297, FLJ23274	uc003jeb.3	Q14CZ7	OTTHUMG00000131029	ENST00000264669.5:c.1275C>A	5.37:g.7866922G>T			Somatic				FASTKD3_uc011cmp.1_Silent_p.A127A|FASTKD3_uc003jec.2_Intron|MTRR_uc010itn.1_5'Flank|MTRR_uc003jee.3_5'Flank|MTRR_uc003jed.2_5'Flank|MTRR_uc003jef.3_5'Flank|MTRR_uc003jeg.3_5'Flank|MTRR_uc010ito.2_5'Flank	p.A425A	NM_024091	NP_076996	WXS	Illumina HiSeq	Unspecified	Q14CZ7	FAKD3_HUMAN			2	1412	-			425					Q9BVD3	Silent	SNP	ENST00000264669.5	37	c.1275C>A	CCDS3873.1																																																																																				0.348	FASTKD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253673.1	NM_024091		11	139	1	0	3.07112e-06	0.000978	3.97045e-06	11	139				
PRDM9	56979	broad.mit.edu	37	5	23527621	23527621	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr5:23527621G>T	ENST00000296682.3	+	11	2606	c.2424G>T	c.(2422-2424)gaG>gaT	p.E808D		NM_020227.2	NP_064612.2	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	808					meiotic gene conversion (GO:0006311)|positive regulation of meiosis I (GO:0060903)|positive regulation of reciprocal meiotic recombination (GO:0010845)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|metal ion binding (GO:0046872)|recombination hotspot binding (GO:0010844)|sequence-specific DNA binding (GO:0043565)	p.E808D(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(27)|lung(87)|ovary(6)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(11)	172						TCTGCAGGGAGTGTGGGCGGG	0.577										HNSCC(3;0.000094)																													uc003jgo.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|large_intestine(2)|pancreas(1)	6						c.(2422-2424)GAG>GAT		PR domain containing 9							46.0	54.0	52.0					5																	23527621		2167	4282	6449	SO:0001583	missense	56979				meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleoplasm	histone-lysine N-methyltransferase activity|nucleic acid binding|zinc ion binding	g.chr5:23527621G>T	AF275816	CCDS43307.1	5p14.2	2014-06-03			ENSG00000164256	ENSG00000164256		"""-"", ""Zinc fingers, C2H2-type"""	13994	protein-coding gene	gene with protein product	"""PR-domain containing protein 9"""	609760	"""minisatellite binding protein 3, 115kDa"", ""minisatellite binding protein 3 (115kD)"""	MSBP3		10668202, 2062643, 24634223	Standard	NM_020227		Approved	PFM6, ZNF899	uc003jgo.3	Q9NQV7	OTTHUMG00000161918	ENST00000296682.3:c.2424G>T	5.37:g.23527621G>T	ENSP00000296682:p.Glu808Asp	HNSCC(3;0.000094)	Somatic					p.E808D	NM_020227	NP_064612	WXS	Illumina HiSeq	Unspecified	Q9NQV7	PRDM9_HUMAN			11	2606	+			808			C2H2-type 12.		B4DX22|Q27Q50	Missense_Mutation	SNP	ENST00000296682.3	37	c.2424G>T	CCDS43307.1	.	.	.	.	.	.	.	.	.	.	G	6.793	0.515312	0.12944	.	.	ENSG00000164256	ENST00000296682	T	0.35973	1.28	3.02	3.02	0.34903	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.25269	0.0614	N	0.16862	0.45	0.23645	N	0.997213	P	0.37176	0.586	B	0.42188	0.379	T	0.09596	-1.0667	9	0.49607	T	0.09	.	6.2797	0.21001	0.1398:0.0:0.8602:0.0	.	808	Q9NQV7	PRDM9_HUMAN	D	808	ENSP00000296682:E808D	ENSP00000296682:E808D	E	+	3	2	PRDM9	23563378	0.005000	0.15991	1.000000	0.80357	0.067000	0.16453	-0.393000	0.07305	2.038000	0.60285	0.472000	0.43445	GAG		0.577	PRDM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366375.1	NM_020227		11	261	1	0	1.08611e-07	0.000978	1.46819e-07	11	261				
ADAMTS12	81792	broad.mit.edu	37	5	33662100	33662100	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr5:33662100A>T	ENST00000504830.1	-	6	1296	c.961T>A	c.(961-963)Ttc>Atc	p.F321I	ADAMTS12_ENST00000352040.3_Missense_Mutation_p.F321I|ADAMTS12_ENST00000504582.1_5'UTR	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	321	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.F321I(1)		NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						CACTTGCAGAAGCTAGACAGT	0.483										HNSCC(64;0.19)																													uc003jia.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9						c.(961-963)TTC>ATC		ADAM metallopeptidase with thrombospondin type 1							182.0	151.0	162.0					5																	33662100		2203	4300	6503	SO:0001583	missense	81792				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr5:33662100A>T	AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.961T>A	5.37:g.33662100A>T	ENSP00000422554:p.Phe321Ile	HNSCC(64;0.19)	Somatic				ADAMTS12_uc010iuq.1_Missense_Mutation_p.F321I	p.F321I	NM_030955	NP_112217	WXS	Illumina HiSeq	Unspecified	P58397	ATS12_HUMAN			6	1124	-			321			Peptidase M12B.		A2RRN9|A5D6V6|Q6UWL3	Missense_Mutation	SNP	ENST00000504830.1	37	c.961T>A	CCDS34140.1	.	.	.	.	.	.	.	.	.	.	A	35	5.435414	0.96150	.	.	ENSG00000151388	ENST00000504830;ENST00000352040	T;T	0.73047	-0.71;-0.71	5.83	5.83	0.93111	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.000000	0.85682	D	0.000000	D	0.89329	0.6684	H	0.96398	3.815	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.92606	0.6095	10	0.87932	D	0	.	16.2071	0.82135	1.0:0.0:0.0:0.0	.	321;321	P58397-3;P58397	.;ATS12_HUMAN	I	321	ENSP00000422554:F321I;ENSP00000344847:F321I	ENSP00000344847:F321I	F	-	1	0	ADAMTS12	33697857	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.255000	0.95524	2.240000	0.73641	0.477000	0.44152	TTC		0.483	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367164.2	NM_030955		53	76	0	0	0	0.00361	0	53	76				
UTP15	84135	broad.mit.edu	37	5	72863231	72863231	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr5:72863231A>T	ENST00000296792.4	+	2	317	c.62A>T	c.(61-63)cAa>cTa	p.Q21L	UTP15_ENST00000543251.1_Intron|ANKRA2_ENST00000296785.3_5'Flank|UTP15_ENST00000508491.1_Missense_Mutation_p.Q21L	NM_001284431.1|NM_032175.2	NP_001271360.1|NP_115551.2	Q8TED0	UTP15_HUMAN	UTP15, U3 small nucleolar ribonucleoprotein, homolog (S. cerevisiae)	21					rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)	p.Q21L(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|skin(2)	15		Lung NSC(167;0.00405)|Ovarian(174;0.0129)		OV - Ovarian serous cystadenocarcinoma(47;7.76e-55)		AAAATCACCCAAGATACACTG	0.378																																							uc003kcw.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(61-63)CAA>CTA		UTP15, U3 small nucleolar ribonucleoprotein,							150.0	151.0	151.0					5																	72863231		2203	4300	6503	SO:0001583	missense	84135				rRNA processing	cytoplasm|nucleolus		g.chr5:72863231A>T	AL831972	CCDS34186.1, CCDS68893.1, CCDS68894.1	5q13.2	2013-01-10	2006-04-20		ENSG00000164338	ENSG00000164338		"""WD repeat domain containing"""	25758	protein-coding gene	gene with protein product			"""UTP15, U3 small nucleolar ribonucleoprotein, homolog (yeast)"""			12477932	Standard	NM_032175		Approved	FLJ12787, NET21, FLJ23637	uc003kcw.1	Q8TED0	OTTHUMG00000162453	ENST00000296792.4:c.62A>T	5.37:g.72863231A>T	ENSP00000296792:p.Gln21Leu		Somatic				UTP15_uc011cso.1_Missense_Mutation_p.Q21L|UTP15_uc011csp.1_Intron|UTP15_uc010ize.1_Missense_Mutation_p.Q21L|ANKRA2_uc003kcu.1_5'Flank|ANKRA2_uc003kcv.2_5'Flank	p.Q21L	NM_032175	NP_115551	WXS	Illumina HiSeq	Unspecified	Q8TED0	UTP15_HUMAN		OV - Ovarian serous cystadenocarcinoma(47;7.76e-55)	2	285	+		Lung NSC(167;0.00405)|Ovarian(174;0.0129)	21					B4DU75|B4DXK8|Q6IA60|Q96E08|Q9H9F8	Missense_Mutation	SNP	ENST00000296792.4	37	c.62A>T	CCDS34186.1	.	.	.	.	.	.	.	.	.	.	A	18.87	3.716460	0.68844	.	.	ENSG00000164338	ENST00000513824;ENST00000296792;ENST00000508491	T;T	0.58060	0.49;0.36	5.06	5.06	0.68205	.	0.114382	0.64402	D	0.000013	T	0.49029	0.1533	L	0.54323	1.7	0.80722	D	1	P;P	0.34462	0.454;0.454	B;B	0.32677	0.15;0.15	T	0.52990	-0.8501	10	0.51188	T	0.08	.	14.7997	0.69906	1.0:0.0:0.0:0.0	.	21;21	B4DXK8;Q8TED0	.;UTP15_HUMAN	L	21	ENSP00000296792:Q21L;ENSP00000424609:Q21L	ENSP00000296792:Q21L	Q	+	2	0	UTP15	72898987	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	8.569000	0.90744	2.033000	0.60031	0.460000	0.39030	CAA		0.378	UTP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368965.1	NM_032175		20	77	0	0	0	0.008871	0	20	77				
CRHBP	1393	broad.mit.edu	37	5	76249973	76249973	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr5:76249973C>A	ENST00000274368.4	+	3	717	c.295C>A	c.(295-297)Cag>Aag	p.Q99K	CRHBP_ENST00000506501.1_Missense_Mutation_p.Q99K	NM_001882.3	NP_001873.2	P24387	CRHBP_HUMAN	corticotropin releasing hormone binding protein	99					behavioral response to ethanol (GO:0048149)|cellular response to calcium ion (GO:0071277)|cellular response to cAMP (GO:0071320)|cellular response to cocaine (GO:0071314)|cellular response to drug (GO:0035690)|cellular response to estradiol stimulus (GO:0071392)|cellular response to estrogen stimulus (GO:0071391)|cellular response to gonadotropin-releasing hormone (GO:0097211)|cellular response to potassium ion (GO:0035865)|cellular response to stress (GO:0033554)|cellular response to tumor necrosis factor (GO:0071356)|female pregnancy (GO:0007565)|hormone metabolic process (GO:0042445)|hormone-mediated signaling pathway (GO:0009755)|inflammatory response (GO:0006954)|learning or memory (GO:0007611)|maternal aggressive behavior (GO:0002125)|negative regulation of corticotropin secretion (GO:0051460)|negative regulation of corticotropin-releasing hormone receptor activity (GO:1900011)|regulated secretory pathway (GO:0045055)|regulation of corticotropin secretion (GO:0051459)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|signal transduction (GO:0007165)|synaptic transmission, dopaminergic (GO:0001963)	axon terminus (GO:0043679)|dendrite (GO:0030425)|dense core granule (GO:0031045)|extracellular space (GO:0005615)|intracellular (GO:0005622)|microtubule (GO:0005874)|multivesicular body (GO:0005771)|nucleus (GO:0005634)|perikaryon (GO:0043204)|secondary lysosome (GO:0005767)|secretory granule (GO:0030141)|varicosity (GO:0043196)	corticotropin-releasing hormone binding (GO:0051424)|peptide binding (GO:0042277)	p.Q99K(1)		kidney(3)|large_intestine(4)|lung(6)|prostate(1)|skin(2)	16		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Ovarian(174;0.0129)|Prostate(461;0.11)		OV - Ovarian serous cystadenocarcinoma(54;2.17e-51)|Epithelial(54;8.79e-46)|all cancers(79;2.49e-41)		CCACTACGACCAGGTCTCCAT	0.657																																							uc003ker.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(295-297)CAG>AAG		corticotropin releasing hormone binding protein							60.0	69.0	66.0					5																	76249973		2203	4300	6503	SO:0001583	missense	1393				female pregnancy|learning or memory|signal transduction	soluble fraction		g.chr5:76249973C>A	X58022	CCDS4034.1	5q	2008-07-18	2001-11-28		ENSG00000145708	ENSG00000145708			2356	protein-coding gene	gene with protein product		122559	"""corticotropin releasing hormone-binding protein"""			8198617	Standard	NM_001882		Approved	CRF-BP, CRFBP	uc003ker.3	P24387	OTTHUMG00000102133	ENST00000274368.4:c.295C>A	5.37:g.76249973C>A	ENSP00000274368:p.Gln99Lys		Somatic				CRHBP_uc010izx.2_Missense_Mutation_p.Q99K	p.Q99K	NM_001882	NP_001873	WXS	Illumina HiSeq	Unspecified	P24387	CRHBP_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;2.17e-51)|Epithelial(54;8.79e-46)|all cancers(79;2.49e-41)	3	575	+		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Ovarian(174;0.0129)|Prostate(461;0.11)	99					Q53F32|Q6FHT5	Missense_Mutation	SNP	ENST00000274368.4	37	c.295C>A	CCDS4034.1	.	.	.	.	.	.	.	.	.	.	C	11.50	1.657774	0.29425	.	.	ENSG00000145708	ENST00000274368;ENST00000506501	T;T	0.59502	0.26;0.26	4.01	4.01	0.46588	CUB (1);	0.840569	0.10702	N	0.643870	T	0.36468	0.0968	N	0.14661	0.345	0.09310	N	1	B;B	0.10296	0.001;0.003	B;B	0.13407	0.007;0.009	T	0.09930	-1.0652	10	0.29301	T	0.29	.	5.0448	0.14477	0.0:0.7253:0.0:0.2747	.	99;99	D6RHH7;P24387	.;CRHBP_HUMAN	K	99	ENSP00000274368:Q99K;ENSP00000426097:Q99K	ENSP00000274368:Q99K	Q	+	1	0	CRHBP	76285729	0.033000	0.19621	0.999000	0.59377	0.990000	0.78478	0.717000	0.25851	2.225000	0.72522	0.462000	0.41574	CAG		0.657	CRHBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219972.2	NM_001882		6	80	1	0	0.00198382	0.001984	0.00218378	6	80				
CMYA5	202333	broad.mit.edu	37	5	79026350	79026350	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr5:79026350G>T	ENST00000446378.2	+	2	1793	c.1762G>T	c.(1762-1764)Gtt>Ttt	p.V588F		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	588	Glu-rich.				negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)		p.V588F(2)		NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		AATTGCATCTGTTTCTACTGG	0.423																																							uc003kgc.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(6)|pancreas(2)|lung(1)	9						c.(1762-1764)GTT>TTT		cardiomyopathy associated 5							257.0	253.0	254.0					5																	79026350		1912	4144	6056	SO:0001583	missense	202333					perinuclear region of cytoplasm		g.chr5:79026350G>T	AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.1762G>T	5.37:g.79026350G>T	ENSP00000394770:p.Val588Phe		Somatic					p.V588F	NM_153610	NP_705838	WXS	Illumina HiSeq	Unspecified	Q8N3K9	CMYA5_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)	2	1834	+		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)	588			Glu-rich.		A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Missense_Mutation	SNP	ENST00000446378.2	37	c.1762G>T	CCDS47238.1	.	.	.	.	.	.	.	.	.	.	G	12.26	1.885569	0.33255	.	.	ENSG00000164309	ENST00000446378	T	0.48836	0.8	5.8	2.7	0.31948	.	0.874561	0.09677	N	0.770323	T	0.39279	0.1072	L	0.34521	1.04	0.20403	N	0.999909	P	0.52316	0.952	P	0.48921	0.595	T	0.36456	-0.9747	10	0.62326	D	0.03	.	1.1862	0.01856	0.1831:0.1456:0.4167:0.2546	.	588	Q8N3K9	CMYA5_HUMAN	F	588	ENSP00000394770:V588F	ENSP00000394770:V588F	V	+	1	0	CMYA5	79062106	0.931000	0.31567	1.000000	0.80357	0.840000	0.47671	0.346000	0.19997	1.470000	0.48102	0.563000	0.77884	GTT		0.423	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369497.1	NM_153610		64	360	1	0	4.60868e-44	0.00361	9.15121e-44	64	360				
PCSK1	5122	broad.mit.edu	37	5	95761538	95761538	+	Nonsense_Mutation	SNP	G	G	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr5:95761538G>A	ENST00000311106.3	-	3	619	c.382C>T	c.(382-384)Cag>Tag	p.Q128*	PCSK1_ENST00000508626.1_Nonsense_Mutation_p.Q81*|CTD-2337A12.1_ENST00000502645.2_RNA	NM_000439.4|NM_001177876.1	NP_000430.3|NP_001171347.1	P29120	NEC1_HUMAN	proprotein convertase subtilisin/kexin type 1	128					cell-cell signaling (GO:0007267)|cellular protein metabolic process (GO:0044267)|metabolic process (GO:0008152)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|proteolysis (GO:0006508)|regulation of insulin secretion (GO:0050796)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|secretory granule lumen (GO:0034774)	serine-type endopeptidase activity (GO:0004252)	p.Q128*(1)		NS(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(14)|ovary(2)|prostate(3)|skin(3)|urinary_tract(2)	36		all_cancers(142;2.67e-06)|all_epithelial(76;6.92e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.0112)|Colorectal(57;0.0341)|Breast(839;0.244)		all cancers(79;3.44e-16)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	TACCATTGCTGATTCCACATG	0.408																																							uc003kls.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(2)	2						c.(382-384)CAG>TAG		proprotein convertase subtilisin/kexin type 1	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)						156.0	133.0	141.0					5																	95761538		2203	4300	6503	SO:0001587	stop_gained	5122				cell-cell signaling|cellular nitrogen compound metabolic process|energy reserve metabolic process|hormone biosynthetic process|peptide biosynthetic process|peptide hormone processing|regulation of insulin secretion	extracellular space|stored secretory granule|transport vesicle	serine-type endopeptidase activity	g.chr5:95761538G>A		CCDS4081.1, CCDS54881.1	5q15-q21	2008-07-18			ENSG00000175426	ENSG00000175426			8743	protein-coding gene	gene with protein product	"""prohormone convertase 3"", ""prohormone convertase 1"", ""neuroendocrine convertase 1"", ""proprotein convertase 1"""	162150		NEC1		1765368	Standard	NM_000439		Approved	PC1, PC3, SPC3	uc003kls.2	P29120	OTTHUMG00000122089	ENST00000311106.3:c.382C>T	5.37:g.95761538G>A	ENSP00000308024:p.Gln128*		Somatic					p.Q128*	NM_000439	NP_000430	WXS	Illumina HiSeq	Unspecified	P29120	NEC1_HUMAN		all cancers(79;3.44e-16)	3	588	-		all_cancers(142;2.67e-06)|all_epithelial(76;6.92e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.0112)|Colorectal(57;0.0341)|Breast(839;0.244)	128			Catalytic.		B7Z8T7|E9PHA1|P78478|Q92532	Nonsense_Mutation	SNP	ENST00000311106.3	37	c.382C>T	CCDS4081.1	.	.	.	.	.	.	.	.	.	.	G	34	5.355543	0.95854	.	.	ENSG00000175426	ENST00000311106;ENST00000508626;ENST00000509190	.	.	.	5.93	5.93	0.95920	.	0.051789	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.15066	T	0.55	-18.5237	19.9318	0.97122	0.0:0.0:1.0:0.0	.	.	.	.	X	128;81;128	.	ENSP00000308024:Q128X	Q	-	1	0	PCSK1	95787294	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.607000	0.82883	2.805000	0.96524	0.655000	0.94253	CAG		0.408	PCSK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000242851.1	NM_000439		7	41	0	0	0	0.00308	0	7	41				
TSLP	85480	broad.mit.edu	37	5	110407675	110407675	+	Nonsense_Mutation	SNP	C	C	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr5:110407675C>A	ENST00000344895.3	+	1	286	c.87C>A	c.(85-87)taC>taA	p.Y29*	TSLP_ENST00000379706.4_5'Flank|TSLP_ENST00000420978.2_Nonsense_Mutation_p.Y29*	NM_033035.4	NP_149024.1	Q969D9	TSLP_HUMAN	thymic stromal lymphopoietin	29						extracellular space (GO:0005615)		p.Y29*(1)		breast(1)|kidney(1)|large_intestine(2)|lung(5)|prostate(1)|stomach(1)	11		all_cancers(142;2.72e-05)|all_epithelial(76;4.39e-07)|Prostate(80;0.00955)|Lung NSC(167;0.0417)|Ovarian(225;0.0443)|Colorectal(57;0.0464)|all_lung(232;0.0507)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;1.24e-08)|Epithelial(69;1.54e-07)|all cancers(49;1.73e-05)|COAD - Colon adenocarcinoma(37;0.109)		TGTTAACTTACGACTTCACTA	0.383																																							uc003kpb.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(85-87)TAC>TAA		thymic stromal lymphopoietin isoform 1							175.0	163.0	167.0					5																	110407675		2202	4300	6502	SO:0001587	stop_gained	85480					extracellular space	cytokine activity	g.chr5:110407675C>A	BC040592	CCDS4101.1	5q22.1	2007-08-24			ENSG00000145777	ENSG00000145777			30743	protein-coding gene	gene with protein product		607003				11418668, 11480573	Standard	NM_033035		Approved		uc003kpb.2	Q969D9	OTTHUMG00000128791	ENST00000344895.3:c.87C>A	5.37:g.110407675C>A	ENSP00000339804:p.Tyr29*		Somatic				TSLP_uc003kpa.2_RNA|TSLP_uc010jbt.1_5'Flank	p.Y29*	NM_033035	NP_149024	WXS	Illumina HiSeq	Unspecified	Q969D9	TSLP_HUMAN		OV - Ovarian serous cystadenocarcinoma(64;1.24e-08)|Epithelial(69;1.54e-07)|all cancers(49;1.73e-05)|COAD - Colon adenocarcinoma(37;0.109)	1	286	+		all_cancers(142;2.72e-05)|all_epithelial(76;4.39e-07)|Prostate(80;0.00955)|Lung NSC(167;0.0417)|Ovarian(225;0.0443)|Colorectal(57;0.0464)|all_lung(232;0.0507)|Breast(839;0.244)	29					Q8IW99	Nonsense_Mutation	SNP	ENST00000344895.3	37	c.87C>A	CCDS4101.1	.	.	.	.	.	.	.	.	.	.	C	49	14.993409	0.99818	.	.	ENSG00000145777	ENST00000420978;ENST00000344895	.	.	.	5.71	3.0	0.34707	.	0.474492	0.18024	N	0.154121	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.7984	7.7903	0.29116	0.0:0.743:0.0:0.257	.	.	.	.	X	29	.	ENSP00000339804:Y29X	Y	+	3	2	TSLP	110435574	1.000000	0.71417	0.987000	0.45799	0.941000	0.58515	1.250000	0.32850	0.359000	0.24239	-0.768000	0.03414	TAC		0.383	TSLP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250717.1	NM_033035		21	161	1	0	1.96292e-10	0.010504	3.05098e-10	21	161				
AFF4	27125	broad.mit.edu	37	5	132232314	132232314	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr5:132232314C>T	ENST00000265343.5	-	11	2387	c.2008G>A	c.(2008-2010)Gag>Aag	p.E670K	AFF4_ENST00000378595.3_Missense_Mutation_p.E670K	NM_014423.3	NP_055238.1	Q9UHB7	AFF4_HUMAN	AF4/FMR2 family, member 4	670					spermatid development (GO:0007286)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E670K(1)	SEPT8/AFF4(2)	breast(2)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(7)|lung(11)|ovary(3)|pancreas(1)|prostate(3)|skin(2)	43		all_cancers(142;0.145)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			CTATTGCTCTCGGGGTACTTA	0.443																																					Ovarian(126;889 1733 2942 10745 11605)	Ovarian(126;889 1733 2942 10745 11605)	uc003kyd.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|kidney(2)|skin(1)	5						c.(2008-2010)GAG>AAG		ALL1 fused gene from 5q31							80.0	82.0	81.0					5																	132232314		2203	4300	6503	SO:0001583	missense	27125				transcription from RNA polymerase II promoter	mitochondrion|nucleolus	protein binding|sequence-specific DNA binding transcription factor activity	g.chr5:132232314C>T	AF197927	CCDS4164.1	5q31	2006-04-28			ENSG00000072364	ENSG00000072364			17869	protein-coding gene	gene with protein product	"""ALL1 fused gene from 5q31"""	604417				10588740	Standard	XM_005271963		Approved	AF5Q31, MCEF	uc003kyd.3	Q9UHB7	OTTHUMG00000059838	ENST00000265343.5:c.2008G>A	5.37:g.132232314C>T	ENSP00000265343:p.Glu670Lys		Somatic				AFF4_uc011cxk.1_Missense_Mutation_p.E348K|AFF4_uc003kye.1_Missense_Mutation_p.E670K	p.E670K	NM_014423	NP_055238	WXS	Illumina HiSeq	Unspecified	Q9UHB7	AFF4_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		11	2416	-		all_cancers(142;0.145)|Breast(839;0.198)	670					B2RP19|B7WPD2|Q498B2|Q59FB3|Q6P592|Q8TDR1|Q9P0E4	Missense_Mutation	SNP	ENST00000265343.5	37	c.2008G>A	CCDS4164.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.072366	0.76415	.	.	ENSG00000072364	ENST00000265343;ENST00000378595	T;T	0.64260	-0.09;-0.09	5.24	5.24	0.73138	.	0.111372	0.64402	D	0.000008	T	0.53433	0.1796	L	0.46157	1.445	0.58432	D	0.999998	P;P	0.52577	0.954;0.851	B;B	0.38156	0.266;0.131	T	0.53788	-0.8389	10	0.14252	T	0.57	-1.8835	19.1844	0.93637	0.0:1.0:0.0:0.0	.	670;670	Q9UHB7-2;Q9UHB7	.;AFF4_HUMAN	K	670	ENSP00000265343:E670K;ENSP00000367858:E670K	ENSP00000265343:E670K	E	-	1	0	AFF4	132260213	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	7.204000	0.77872	2.580000	0.87095	0.563000	0.77884	GAG		0.443	AFF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133049.1	NM_014423		12	105	0	0	0	0.001855	0	12	105				
TCERG1	10915	broad.mit.edu	37	5	145838723	145838723	+	Missense_Mutation	SNP	G	G	T	rs527340881	byFrequency	TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr5:145838723G>T	ENST00000296702.5	+	4	753	c.715G>T	c.(715-717)Gcc>Tcc	p.A239S	TCERG1_ENST00000394421.2_Missense_Mutation_p.A239S	NM_006706.3	NP_006697.2	O14776	TCRG1_HUMAN	transcription elongation regulator 1	239	Ala/Gln-rich.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription corepressor activity (GO:0001106)|transcription coactivator activity (GO:0003713)	p.A239S(1)		breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(18)|lung(9)|ovary(2)|prostate(3)|skin(1)	46		Lung NSC(249;0.00188)|all_lung(500;0.00307)|all_neural(839;0.0424)|Breast(839;0.0743)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			tcaggcccaggcccaggctca	0.682																																							uc003lob.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(715-717)GCC>TCC		transcription elongation regulator 1 isoform 1							47.0	51.0	50.0					5																	145838723		2203	4300	6503	SO:0001583	missense	10915				regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	protein binding|transcription coactivator activity	g.chr5:145838723G>T	AF017789	CCDS4282.1, CCDS43379.1	5q31	2010-01-25	2002-01-24	2002-01-25	ENSG00000113649	ENSG00000113649			15630	protein-coding gene	gene with protein product	"""transcription factor CA150"", ""co-activator of 150 kDa"", ""TATA box binding protein (TBP)-associated factor, RNA polymerase II, S, 150kD"", ""TATA box-binding protein-associated factor 2S"""	605409	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, S, 150kD"""	TAF2S		9315662, 11003711	Standard	XM_005268365		Approved	CA150, Urn1	uc003lob.3	O14776	OTTHUMG00000129683	ENST00000296702.5:c.715G>T	5.37:g.145838723G>T	ENSP00000296702:p.Ala239Ser		Somatic				TCERG1_uc003loc.2_Missense_Mutation_p.A239S|TCERG1_uc011dbt.1_Missense_Mutation_p.A239S	p.A239S	NM_006706	NP_006697	WXS	Illumina HiSeq	Unspecified	O14776	TCRG1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		4	755	+		Lung NSC(249;0.00188)|all_lung(500;0.00307)|all_neural(839;0.0424)|Breast(839;0.0743)	239			Potential.|Ala/Gln-rich.		Q2NKN2|Q59EA1	Missense_Mutation	SNP	ENST00000296702.5	37	c.715G>T	CCDS4282.1	.	.	.	.	.	.	.	.	.	.	G	8.554	0.876219	0.17395	.	.	ENSG00000113649	ENST00000296702;ENST00000394421	T;T	0.33438	1.41;1.41	5.21	5.21	0.72293	.	0.000000	0.38663	U	0.001611	T	0.18425	0.0442	N	0.24115	0.695	0.29979	N	0.8179	B;B;B	0.11235	0.004;0.002;0.001	B;B;B	0.10450	0.002;0.005;0.002	T	0.12426	-1.0548	10	0.07813	T	0.8	-5.4579	11.6923	0.51523	0.0:0.0:0.8232:0.1768	.	239;239;239	B7Z921;O14776-2;O14776	.;.;TCRG1_HUMAN	S	239	ENSP00000296702:A239S;ENSP00000377943:A239S	ENSP00000296702:A239S	A	+	1	0	TCERG1	145818916	0.919000	0.31177	0.998000	0.56505	0.065000	0.16274	-0.190000	0.09615	2.584000	0.87258	0.563000	0.77884	GCC		0.682	TCERG1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251886.1	NM_001040006		12	41	1	0	5.16669e-11	0.000978	8.15276e-11	12	41				
SLIT3	6586	broad.mit.edu	37	5	168180932	168180932	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr5:168180932G>A	ENST00000519560.1	-	17	2185	c.1766C>T	c.(1765-1767)aCa>aTa	p.T589I	SLIT3_ENST00000404867.3_Missense_Mutation_p.T589I|SLIT3_ENST00000332966.8_Missense_Mutation_p.T589I	NM_001271946.1|NM_003062.2	NP_001258875.1|NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 (Drosophila)	589					apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|cellular response to hormone stimulus (GO:0032870)|negative chemotaxis (GO:0050919)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of gene expression (GO:0010629)|organ morphogenesis (GO:0009887)|response to cortisol (GO:0051414)|Roundabout signaling pathway (GO:0035385)	extracellular space (GO:0005615)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)	p.T589I(1)		endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(15)|liver(2)|lung(48)|ovary(4)|prostate(7)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	100	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CTGGTTCCCTGTCAGCATCAG	0.572																																					Ovarian(29;311 847 10864 17279 24903)	Ovarian(29;311 847 10864 17279 24903)	uc003mab.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(1)	4						c.(1765-1767)ACA>ATA		slit homolog 3 precursor							48.0	44.0	46.0					5																	168180932		2203	4300	6503	SO:0001583	missense	6586				apoptosis involved in luteolysis|axon extension involved in axon guidance|cellular response to hormone stimulus|negative chemotaxis|negative regulation of cell growth|negative regulation of chemokine-mediated signaling pathway|response to cortisol stimulus|Roundabout signaling pathway	extracellular space|mitochondrion	calcium ion binding|Roundabout binding	g.chr5:168180932G>A	AB011538	CCDS4369.1, CCDS64311.1	5q35	2008-07-18	2001-11-28		ENSG00000184347	ENSG00000184347			11087	protein-coding gene	gene with protein product		603745	"""slit (Drosophila) homolog 3"""	SLIL2		9693030, 9813312	Standard	NM_001271946		Approved	slit2, MEGF5, SLIT1, Slit-3	uc010jjg.4	O75094	OTTHUMG00000130409	ENST00000519560.1:c.1766C>T	5.37:g.168180932G>A	ENSP00000430333:p.Thr589Ile		Somatic				SLIT3_uc010jjg.2_Missense_Mutation_p.T589I	p.T589I	NM_003062	NP_003053	WXS	Illumina HiSeq	Unspecified	O75094	SLIT3_HUMAN	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		17	2186	-	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	589			LRR 14.		A6H8U9|J3KNP3|O95804|Q9UFH5	Missense_Mutation	SNP	ENST00000519560.1	37	c.1766C>T	CCDS4369.1	.	.	.	.	.	.	.	.	.	.	G	32	5.184534	0.94885	.	.	ENSG00000184347	ENST00000519560;ENST00000332966;ENST00000404867	T;T;T	0.57752	0.38;0.38;0.38	5.31	5.31	0.75309	.	0.090485	0.85682	D	0.000000	T	0.66877	0.2834	L	0.41236	1.265	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.69580	-0.5107	10	0.87932	D	0	.	18.98	0.92752	0.0:0.0:1.0:0.0	.	589	O75094	SLIT3_HUMAN	I	589	ENSP00000430333:T589I;ENSP00000332164:T589I;ENSP00000384890:T589I	ENSP00000332164:T589I	T	-	2	0	SLIT3	168113510	1.000000	0.71417	0.952000	0.39060	0.975000	0.68041	9.869000	0.99810	2.495000	0.84180	0.655000	0.94253	ACA		0.572	SLIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252792.4	NM_003062		11	34	0	0	0	0.000978	0	11	34				
FOXI1	2299	broad.mit.edu	37	5	169533452	169533452	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr5:169533452A>T	ENST00000306268.6	+	1	552	c.491A>T	c.(490-492)aAg>aTg	p.K164M	FOXI1_ENST00000449804.2_Missense_Mutation_p.K164M			Q12951	FOXI1_HUMAN	forkhead box I1	164					embryo development (GO:0009790)|inner ear morphogenesis (GO:0042472)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding, bending (GO:0008301)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.K164M(1)		breast(3)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(7)|lung(16)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35	Renal(175;0.000159)|Lung NSC(126;0.0267)|all_lung(126;0.04)	Medulloblastoma(196;0.0109)|all_neural(177;0.0298)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			AACAAGAGCAAGGCCGGCTGG	0.607									Pendred syndrome																														uc003mai.3		NA																	1	Substitution - Missense(1)		lung(1)	breast(3)|central_nervous_system(1)	4						c.(490-492)AAG>ATG		forkhead box I1 isoform a							45.0	46.0	45.0					5																	169533452		2203	4300	6503	SO:0001583	missense	2299	Pendred_syndrome	Familial Cancer Database	Goiter-Deafness syndrome	epidermal cell fate specification|otic placode formation|pattern specification process|positive regulation of transcription from RNA polymerase II promoter|regulation of sequence-specific DNA binding transcription factor activity	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|transcription regulatory region DNA binding	g.chr5:169533452A>T	BC029778	CCDS4372.1, CCDS47337.1	5q34	2008-02-05			ENSG00000168269	ENSG00000168269		"""Forkhead boxes"""	3815	protein-coding gene	gene with protein product		601093		FKHL10		7957066, 8825632	Standard	NM_144769		Approved	FREAC6	uc003mai.4	Q12951	OTTHUMG00000130436	ENST00000306268.6:c.491A>T	5.37:g.169533452A>T	ENSP00000304286:p.Lys164Met		Somatic				FOXI1_uc003maj.3_Missense_Mutation_p.K164M	p.K164M	NM_012188	NP_036320	WXS	Illumina HiSeq	Unspecified	Q12951	FOXI1_HUMAN	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		1	536	+	Renal(175;0.000159)|Lung NSC(126;0.0267)|all_lung(126;0.04)	Medulloblastoma(196;0.0109)|all_neural(177;0.0298)	164			Fork-head.		Q14518|Q66SR7|Q8N6L8	Missense_Mutation	SNP	ENST00000306268.6	37	c.491A>T	CCDS4372.1	.	.	.	.	.	.	.	.	.	.	A	22.6	4.317498	0.81469	.	.	ENSG00000168269	ENST00000306268;ENST00000449804	D;D	0.95853	-3.83;-3.83	4.86	4.86	0.63082	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (3);	0.000000	0.85682	D	0.000000	D	0.97885	0.9305	M	0.88310	2.945	0.80722	D	1	D;D	0.89917	0.997;1.0	D;D	0.97110	0.921;1.0	D	0.98894	1.0774	10	0.87932	D	0	.	14.6363	0.68692	1.0:0.0:0.0:0.0	.	164;164	Q12951-2;Q12951	.;FOXI1_HUMAN	M	164	ENSP00000304286:K164M;ENSP00000415483:K164M	ENSP00000304286:K164M	K	+	2	0	FOXI1	169466030	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.134000	0.94467	2.034000	0.60081	0.528000	0.53228	AAG		0.607	FOXI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252827.2	NM_144769, NM_012188		6	24	0	0	0	0.00308	0	6	24				
NSD1	64324	broad.mit.edu	37	5	176721186	176721186	+	Missense_Mutation	SNP	T	T	G			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr5:176721186T>G	ENST00000439151.2	+	23	6862	c.6817T>G	c.(6817-6819)Tgt>Ggt	p.C2273G	NSD1_ENST00000347982.4_Missense_Mutation_p.C2004G|NSD1_ENST00000354179.4_Missense_Mutation_p.C2004G|NSD1_ENST00000361032.4_Missense_Mutation_p.C2170G	NM_022455.4	NP_071900.2	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	2273	Pro-rich.				gastrulation with mouth forming second (GO:0001702)|histone H3-K36 methylation (GO:0010452)|histone H4-K20 methylation (GO:0034770)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H4-K20 specific) (GO:0042799)|retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.C2273G(2)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(18)|lung(24)|ovary(2)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(3)	96	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		GGCAGGGACTTGTCAGAGGCC	0.522			T	NUP98	AML		Sotos Syndrome		Weaver syndrome;Sotos syndrome;Beckwith-Wiedemann syndrome	HNSCC(47;0.14)																													uc003mfr.3		NA		Dom	yes		5	5q35	64324	T	nuclear receptor binding SET domain protein 1	yes	Sotos Syndrome	L	NUP98		AML		2	Substitution - Missense(2)		lung(2)	ovary(2)|kidney(1)	3						c.(6817-6819)TGT>GGT		nuclear receptor binding SET domain protein 1							95.0	100.0	98.0					5																	176721186		2203	4300	6503	SO:0001583	missense	64324	Beckwith-Wiedemann_syndrome|Sotos_syndrome|Weaver_syndrome	Familial Cancer Database	Weaver-Smith syndrome;Cerebral Gigantism;BWS, Exomphalos-Macroglossia-Gigantism (EMG) syndrome, Wiedemann-Beckwith syndrome, WBS	negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	androgen receptor binding|chromatin binding|estrogen receptor binding|histone methyltransferase activity (H3-K36 specific)|histone methyltransferase activity (H4-K20 specific)|ligand-dependent nuclear receptor binding|retinoid X receptor binding|thyroid hormone receptor binding|transcription corepressor activity|zinc ion binding	g.chr5:176721186T>G	AK026066	CCDS4412.1, CCDS4413.1	5q35	2014-09-17	2003-03-12		ENSG00000165671	ENSG00000165671		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	14234	protein-coding gene	gene with protein product		606681	"""Sotos syndrome"""	STO		9628876, 11896389	Standard	NM_022455		Approved	ARA267, FLJ22263, KMT3B	uc003mfr.4	Q96L73	OTTHUMG00000130846	ENST00000439151.2:c.6817T>G	5.37:g.176721186T>G	ENSP00000395929:p.Cys2273Gly	HNSCC(47;0.14)	Somatic				NSD1_uc003mft.3_Missense_Mutation_p.C2004G|NSD1_uc011dfx.1_Missense_Mutation_p.C1921G	p.C2273G	NM_022455	NP_071900	WXS	Illumina HiSeq	Unspecified	Q96L73	NSD1_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)	23	6955	+	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	2273			Pro-rich.		Q96PD8|Q96RN7	Missense_Mutation	SNP	ENST00000439151.2	37	c.6817T>G	CCDS4412.1	.	.	.	.	.	.	.	.	.	.	T	11.72	1.723467	0.30593	.	.	ENSG00000165671	ENST00000354179;ENST00000439151;ENST00000347982;ENST00000361032	D;D;D;D	0.93247	-3.08;-3.09;-3.08;-3.19	5.41	5.41	0.78517	.	0.186442	0.39274	N	0.001407	D	0.90331	0.6975	N	0.24115	0.695	0.33753	D	0.620831	D;D	0.57899	0.981;0.967	P;P	0.53593	0.73;0.541	D	0.91986	0.5599	10	0.59425	D	0.04	.	6.753	0.23497	0.0:0.0777:0.1543:0.768	.	2004;2273	Q96L73-2;Q96L73	.;NSD1_HUMAN	G	2004;2273;2004;2170	ENSP00000346111:C2004G;ENSP00000395929:C2273G;ENSP00000343209:C2004G;ENSP00000354310:C2170G	ENSP00000343209:C2004G	C	+	1	0	NSD1	176653792	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	2.453000	0.44970	2.281000	0.76405	0.533000	0.62120	TGT		0.522	NSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253412.2	NM_172349		28	213	0	0	0	0.002445	0	28	213				
HDGFL1	154150	broad.mit.edu	37	6	22569972	22569972	+	Silent	SNP	G	G	C			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr6:22569972G>C	ENST00000230012.3	+	1	295	c.168G>C	c.(166-168)ctG>ctC	p.L56L	HDGFL1_ENST00000510882.2_Silent_p.L56L	NM_138574.2	NP_612641.2	Q5TGJ6	HDGL1_HUMAN	hepatoma derived growth factor-like 1	56	PWWP. {ECO:0000255|PROSITE- ProRule:PRU00162}.							p.L56L(1)		kidney(1)|large_intestine(3)|lung(7)	11	Ovarian(93;0.163)					CCAAACGCCTGTTCCCGTACA	0.617																																							uc003nds.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(166-168)CTG>CTC		hepatoma derived growth factor-like 1							65.0	67.0	66.0					6																	22569972		2203	4300	6503	SO:0001819	synonymous_variant	154150							g.chr6:22569972G>C	AK056824	CCDS34347.1	6p22.2	2008-02-05	2005-04-07	2005-04-07	ENSG00000112273	ENSG00000112273			21095	protein-coding gene	gene with protein product			"""PWWP domain containing 1"""	PWWP1			Standard	NM_138574		Approved	dJ309H15.1	uc003nds.3	Q5TGJ6	OTTHUMG00000016206	ENST00000230012.3:c.168G>C	6.37:g.22569972G>C			Somatic					p.L56L	NM_138574	NP_612641	WXS	Illumina HiSeq	Unspecified	Q5TGJ6	HDGL1_HUMAN			1	295	+	Ovarian(93;0.163)		56			PWWP.		Q96MJ6	Silent	SNP	ENST00000230012.3	37	c.168G>C	CCDS34347.1																																																																																				0.617	HDGFL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043500.1	NM_138574		8	58	0	0	0	0.006214	0	8	58				
SLC17A1	6568	broad.mit.edu	37	6	25799037	25799037	+	Silent	SNP	T	T	C			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr6:25799037T>C	ENST00000244527.4	-	12	1495	c.1380A>G	c.(1378-1380)aaA>aaG	p.K460K	SLC17A1_ENST00000476801.1_Silent_p.K460K|SLC17A1_ENST00000427328.1_Silent_p.K406K|SLC17A1_ENST00000468082.1_Silent_p.K406K	NM_005074.3	NP_005065.2	Q14916	NPT1_HUMAN	solute carrier family 17 (organic anion transporter), member 1	460					ion transport (GO:0006811)|phosphate ion transport (GO:0006817)|sodium ion transport (GO:0006814)|sodium-dependent phosphate transport (GO:0044341)|transmembrane transport (GO:0055085)|urate metabolic process (GO:0046415)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|symporter activity (GO:0015293)	p.K460K(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(14)|ovary(3)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	36						GTTGTTTTTCTTTAGCCCAGT	0.428																																							uc003nfh.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|pancreas(1)	4						c.(1378-1380)AAA>AAG		solute carrier family 17 (sodium phosphate),							130.0	122.0	125.0					6																	25799037		2203	4300	6503	SO:0001819	synonymous_variant	6568				sodium ion transport|urate metabolic process	integral to plasma membrane|membrane fraction	sodium-dependent phosphate transmembrane transporter activity|symporter activity	g.chr6:25799037T>C		CCDS4565.1	6p22.2	2013-07-18	2013-07-18		ENSG00000124568	ENSG00000124568		"""Solute carriers"""	10929	protein-coding gene	gene with protein product		182308	"""solute carrier family 17 (sodium phosphate), member 1"""	NPT1		8288239	Standard	NM_005074		Approved	NAPI-1	uc003nfh.4	Q14916	OTTHUMG00000016297	ENST00000244527.4:c.1380A>G	6.37:g.25799037T>C			Somatic				SLC17A1_uc011djy.1_RNA|SLC17A1_uc010jqb.1_Silent_p.K458K|SLC17A1_uc010jqc.1_Silent_p.K404K	p.K460K	NM_005074	NP_005065	WXS	Illumina HiSeq	Unspecified	Q14916	NPT1_HUMAN			12	1496	-			460					A8K418|O60761|Q13783|Q3MIP5|Q5MJP8|Q5TB83|Q96KL8	Silent	SNP	ENST00000244527.4	37	c.1380A>G	CCDS4565.1																																																																																				0.428	SLC17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043647.2			15	109	0	0	0	0.004007	0	15	109				
NKAPL	222698	broad.mit.edu	37	6	28227314	28227314	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr6:28227314G>T	ENST00000343684.3	+	1	217	c.165G>T	c.(163-165)tgG>tgT	p.W55C	ZKSCAN4_ENST00000423974.2_5'Flank	NM_001007531.1	NP_001007532.1	Q5M9Q1	NKAPL_HUMAN	NFKB activating protein-like	55								p.W55C(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	31						GGCCTCCTTGGAGTGAGTTGG	0.652																																							uc003nkt.2		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|ovary(1)	2						c.(163-165)TGG>TGT		NFKB activating protein-like							52.0	56.0	55.0					6																	28227314		2203	4300	6503	SO:0001583	missense	222698							g.chr6:28227314G>T	BC038240	CCDS34353.1	6p21.33	2008-02-05	2007-08-16	2007-08-16	ENSG00000189134	ENSG00000189134			21584	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 194"""	C6orf194			Standard	NM_001007531		Approved	bA424I5.1	uc003nkt.4	Q5M9Q1	OTTHUMG00000014517	ENST00000343684.3:c.165G>T	6.37:g.28227314G>T	ENSP00000345716:p.Trp55Cys		Somatic				ZKSCAN4_uc011dlb.1_5'Flank	p.W55C	NM_001007531	NP_001007532	WXS	Illumina HiSeq	Unspecified	Q5M9Q1	NKAPL_HUMAN			1	217	+			55					Q3MIV1|Q9H4Q7	Missense_Mutation	SNP	ENST00000343684.3	37	c.165G>T	CCDS34353.1	.	.	.	.	.	.	.	.	.	.	G	8.098	0.776077	0.16051	.	.	ENSG00000189134	ENST00000343684	T	0.13657	2.57	4.59	1.75	0.24633	.	0.431514	0.24027	N	0.042227	T	0.03827	0.0108	L	0.41027	1.25	0.19300	N	0.999976	B	0.15141	0.012	B	0.14578	0.011	T	0.36962	-0.9726	10	0.62326	D	0.03	-1.8039	8.1339	0.31043	0.0:0.3289:0.501:0.17	.	55	Q5M9Q1	NKAPL_HUMAN	C	55	ENSP00000345716:W55C	ENSP00000345716:W55C	W	+	3	0	NKAPL	28335293	0.086000	0.21541	0.032000	0.17829	0.026000	0.11368	0.894000	0.28350	0.249000	0.21456	-0.962000	0.02626	TGG		0.652	NKAPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040185.1			16	117	1	0	1.56452e-12	0.007413	2.56631e-12	16	117				
ZSCAN31	64288	broad.mit.edu	37	6	28294239	28294239	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr6:28294239C>A	ENST00000414429.1	-	8	1828	c.925G>T	c.(925-927)Ggc>Tgc	p.G309C	ZSCAN31_ENST00000439158.1_Missense_Mutation_p.G309C|ZSCAN31_ENST00000344279.6_Missense_Mutation_p.G309C|ZSCAN31_ENST00000446474.1_Missense_Mutation_p.G150C|ZSCAN31_ENST00000481934.1_5'UTR|ZSCAN31_ENST00000396838.2_Missense_Mutation_p.G309C			Q96LW9	ZSC31_HUMAN	zinc finger and SCAN domain containing 31	309					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G309C(1)									CGAGTGAGGCCATTGCTGGCA	0.512																																						Colon(115;1052 1587 16954 47314 53012)	uc003nla.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(925-927)GGC>TGC		zinc finger protein 323							148.0	141.0	143.0					6																	28294239		2203	4300	6503	SO:0001583	missense	64288				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr6:28294239C>A		CCDS4649.1, CCDS59001.1	6p	2013-01-09	2013-01-08	2013-01-08	ENSG00000235109	ENSG00000235109		"""-"", ""Zinc fingers, C2H2-type"""	14097	protein-coding gene	gene with protein product		610794	"""zinc finger protein 310 pseudogene"", ""zinc finger protein 323"""	ZNF310P, ZNF323			Standard	NM_001135216		Approved		uc003nla.3	Q96LW9	OTTHUMG00000014518	ENST00000414429.1:c.925G>T	6.37:g.28294239C>A	ENSP00000390076:p.Gly309Cys		Somatic				ZNF323_uc003nld.2_Missense_Mutation_p.G309C|ZNF323_uc010jra.2_Missense_Mutation_p.G309C|ZNF323_uc003nlb.2_Missense_Mutation_p.G150C|ZNF323_uc010jrb.2_Missense_Mutation_p.G150C|ZNF323_uc003nlc.2_Missense_Mutation_p.G309C	p.G309C	NM_001135216	NP_001128688	WXS	Illumina HiSeq	Unspecified	Q96LW9	ZN323_HUMAN			4	1325	-			309			C2H2-type 3.		Q6P178|Q8WWS5	Missense_Mutation	SNP	ENST00000414429.1	37	c.925G>T	CCDS4649.1	.	.	.	.	.	.	.	.	.	.	C	16.81	3.226971	0.58668	.	.	ENSG00000235109	ENST00000396838;ENST00000439158;ENST00000414429;ENST00000446474;ENST00000344279;ENST00000435857	T;T;T;T;T;T	0.19669	3.16;3.16;3.16;3.16;3.16;2.13	4.37	1.35	0.21983	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.13072	0.0317	L	0.33339	1.005	0.09310	N	1	D	0.67145	0.996	P	0.61874	0.895	T	0.08391	-1.0724	9	0.54805	T	0.06	.	3.7384	0.08520	0.0:0.5598:0.2063:0.2339	.	309	Q96LW9	ZN323_HUMAN	C	309;309;309;150;309;150	ENSP00000380050:G309C;ENSP00000413705:G309C;ENSP00000390076:G309C;ENSP00000402937:G150C;ENSP00000345339:G309C;ENSP00000391235:G150C	ENSP00000345339:G309C	G	-	1	0	ZNF323	28402218	0.000000	0.05858	0.947000	0.38551	0.987000	0.75469	-3.996000	0.00317	0.930000	0.37217	0.585000	0.79938	GGC		0.512	ZSCAN31-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346804.1	NM_030899		42	233	1	0	1.15183e-24	0.009718	2.20281e-24	42	233				
OR2J3	442186	broad.mit.edu	37	6	29079836	29079836	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr6:29079836C>A	ENST00000377169.1	+	1	169	c.169C>A	c.(169-171)Cat>Aat	p.H57N		NM_001005216.2	NP_001005216.2	O76001	OR2J3_HUMAN	olfactory receptor, family 2, subfamily J, member 3	57						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.H57N(1)		endometrium(2)|large_intestine(5)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	24						CCTGGACTCCCATCTGCACAC	0.458																																							uc011dll.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(169-171)CAT>AAT		olfactory receptor, family 2, subfamily J,							289.0	302.0	298.0					6																	29079836		1356	2644	4000	SO:0001583	missense	442186				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr6:29079836C>A		CCDS43433.1	6p22.2-p21.31	2012-08-09			ENSG00000204701	ENSG00000204701		"""GPCR / Class A : Olfactory receptors"""	8261	protein-coding gene	gene with protein product		615016					Standard	NM_001005216		Approved	OR6-6	uc011dll.2	O76001	OTTHUMG00000031092	ENST00000377169.1:c.169C>A	6.37:g.29079836C>A	ENSP00000366374:p.His57Asn		Somatic					p.H57N	NM_001005216	NP_001005216	WXS	Illumina HiSeq	Unspecified	O76001	OR2J3_HUMAN			1	169	+			57			Cytoplasmic (Potential).		B0UY52|B9EH11|Q5SUJ7|Q6IF25|Q96R15|Q9GZK5|Q9GZL4|Q9GZL5	Missense_Mutation	SNP	ENST00000377169.1	37	c.169C>A	CCDS43433.1	.	.	.	.	.	.	.	.	.	.	C	3.253	-0.152813	0.06585	.	.	ENSG00000204701	ENST00000377169	T	0.00792	5.69	2.78	2.78	0.32641	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00496	0.0016	M	0.62266	1.93	0.09310	N	1	B	0.30584	0.286	B	0.29077	0.098	T	0.43048	-0.9415	9	0.72032	D	0.01	.	8.8234	0.35041	0.0:0.8793:0.0:0.1207	.	57	O76001	OR2J3_HUMAN	N	57	ENSP00000366374:H57N	ENSP00000366374:H57N	H	+	1	0	OR2J3	29187815	0.000000	0.05858	0.946000	0.38457	0.052000	0.14988	0.200000	0.17257	1.549000	0.49425	0.436000	0.28706	CAT		0.458	OR2J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076132.2			55	306	1	0	3.10202e-16	0.00361	5.49809e-16	55	306				
MOG	4340	broad.mit.edu	37	6	29640787	29640787	+	IGR	SNP	C	C	T	rs202183128		TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr6:29640787C>T	ENST00000376917.3	+	0	2160				ZFP57_ENST00000376883.1_Silent_p.Q347Q|ZFP57_ENST00000488757.1_Silent_p.Q367Q|ZFP57_ENST00000376881.3_Silent_p.Q347Q	NM_002433.4|NM_206809.3	NP_002424.3|NP_996532.2	Q16653	MOG_HUMAN	myelin oligodendrocyte glycoprotein						cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|positive regulation of MyD88-dependent toll-like receptor signaling pathway (GO:0034126)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.Q347Q(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(8)|ovary(1)|skin(2)	19						ATCTGGCATCCTGACAGAGGG	0.498																																							uc011dlw.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|skin(2)	5						c.(1099-1101)CAG>CAA		zinc finger protein 57 homolog							270.0	289.0	282.0					6																	29640787		1242	2546	3788	SO:0001628	intergenic_variant	346171				DNA methylation involved in embryo development|regulation of gene expression by genetic imprinting|transcription, DNA-dependent		DNA binding|zinc ion binding	g.chr6:29640787C>T		CCDS4667.1, CCDS34366.1, CCDS34367.1, CCDS34368.1, CCDS34369.1, CCDS34370.1, CCDS47394.1, CCDS47395.1, CCDS47395.2, CCDS54977.1	6p22.1	2014-01-16			ENSG00000204655	ENSG00000204655		"""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	7197	protein-coding gene	gene with protein product		159465					Standard	NM_002433		Approved	BTN6, BTNL11	uc003nne.3	Q16653	OTTHUMG00000031099		6.37:g.29640787C>T			Somatic				ZFP57_uc003nnl.3_Silent_p.Q347Q	p.Q367Q	NM_001109809	NP_001103279	WXS	Illumina HiSeq	Unspecified	Q9NU63	ZFP57_HUMAN			4	1252	-			283					A6NDR4|A6NNJ9|A8MY31|B0UZR9|E9PGF0|F8W9D5|O00713|O00714|O00715|Q13054|Q13055|Q14855|Q29ZN8|Q56UY0|Q5JNX7|Q5JNY1|Q5JNY2|Q5JNY4|Q5SSB5|Q5SSB6|Q5STL9|Q5STM0|Q5STM1|Q5STM2|Q5STM5|Q5SUK5|Q5SUK7|Q5SUK8|Q5SUK9|Q5SUL0|Q5SUL1|Q8IYG5|Q92891|Q92892|Q92893|Q92894|Q92895|Q93053|Q96KU9|Q96KV0|Q96KV1|Q99605	Silent	SNP	ENST00000376917.3	37	c.1101G>A	CCDS34370.1																																																																																				0.498	MOG-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000076160.3	NM_002433		91	452	0	0	0	0.00361	0	91	452				
HSPA1L	3305	broad.mit.edu	37	6	31777930	31777930	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr6:31777930G>A	ENST00000375654.4	-	2	2009	c.1820C>T	c.(1819-1821)cCt>cTt	p.P607L	HSPA1L_ENST00000417199.3_Missense_Mutation_p.P607L	NM_005527.3	NP_005518.3	P34931	HS71L_HUMAN	heat shock 70kDa protein 1-like	607					binding of sperm to zona pellucida (GO:0007339)|protein refolding (GO:0042026)|response to unfolded protein (GO:0006986)	blood microparticle (GO:0072562)|cell body (GO:0044297)|cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|unfolded protein binding (GO:0051082)	p.P607L(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(10)|ovary(3)|pleura(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34						TGTGATGATAGGGTTACACAT	0.493																																							uc003nxh.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|pleura(1)|kidney(1)|skin(1)	6						c.(1819-1821)CCT>CTT		heat shock 70kDa protein 1-like							134.0	120.0	125.0					6																	31777930		2203	4300	6503	SO:0001583	missense	3305				response to unfolded protein		ATP binding	g.chr6:31777930G>A	D85730	CCDS34413.1	6p21.3	2014-01-21	2002-08-29		ENSG00000204390	ENSG00000204390		"""Heat shock proteins / HSP70"""	5234	protein-coding gene	gene with protein product		140559	"""heat shock 70kD protein-like 1"""			9685725, 9349405	Standard	NM_005527		Approved	HSP70-HOM, hum70t	uc003nxh.3	P34931	OTTHUMG00000031208	ENST00000375654.4:c.1820C>T	6.37:g.31777930G>A	ENSP00000364805:p.Pro607Leu		Somatic				HSPA1L_uc010jte.2_Missense_Mutation_p.P607L	p.P607L	NM_005527	NP_005518	WXS	Illumina HiSeq	Unspecified	P34931	HS71L_HUMAN			2	2003	-			607					A6NNB0|B0UXW8|O75634|Q2HXR3|Q8NE72|Q96QC9|Q9UQM1	Missense_Mutation	SNP	ENST00000375654.4	37	c.1820C>T	CCDS34413.1	.	.	.	.	.	.	.	.	.	.	G	15.59	2.879196	0.51801	.	.	ENSG00000204390	ENST00000375654;ENST00000417199;ENST00000375653	T;T	0.23552	1.9;1.9	5.94	5.94	0.96194	.	0.000000	0.34435	N	0.003969	T	0.62563	0.2438	H	0.97103	3.94	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.75113	-0.3432	10	0.87932	D	0	-8.0821	17.8531	0.88754	0.0:0.0:1.0:0.0	.	607	P34931	HS71L_HUMAN	L	607;607;552	ENSP00000364805:P607L;ENSP00000387691:P607L	ENSP00000364804:P552L	P	-	2	0	HSPA1L	31885909	1.000000	0.71417	0.968000	0.41197	0.189000	0.23516	8.016000	0.88706	2.807000	0.96579	0.591000	0.81541	CCT		0.493	HSPA1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076416.2			8	144	0	0	0	0.00308	0	8	144				
TTBK1	84630	broad.mit.edu	37	6	43221047	43221047	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr6:43221047G>T	ENST00000259750.4	+	4	358	c.275G>T	c.(274-276)aGg>aTg	p.R92M	TTBK1_ENST00000304139.5_Missense_Mutation_p.R41M	NM_032538.1	NP_115927.1	Q5TCY1	TTBK1_HUMAN	tau tubulin kinase 1	92	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.R92M(1)		breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(10)|liver(1)|lung(21)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	53			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0125)|OV - Ovarian serous cystadenocarcinoma(102;0.0399)			CATGTGTGCAGGTTCATTGGC	0.527																																							uc003ouq.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(4)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	9						c.(274-276)AGG>ATG		tau tubulin kinase 1							161.0	133.0	143.0					6																	43221047		2203	4300	6503	SO:0001583	missense	84630					cell junction|cytoplasm|nucleus	ATP binding|protein binding|protein serine/threonine kinase activity	g.chr6:43221047G>T	AB058758	CCDS34455.1	6p21.1	2008-02-05			ENSG00000146216	ENSG00000146216			19140	protein-coding gene	gene with protein product						11347906	Standard	XM_006715229		Approved	KIAA1855	uc003ouq.1	Q5TCY1	OTTHUMG00000014725	ENST00000259750.4:c.275G>T	6.37:g.43221047G>T	ENSP00000259750:p.Arg92Met		Somatic					p.R92M	NM_032538	NP_115927	WXS	Illumina HiSeq	Unspecified	Q5TCY1	TTBK1_HUMAN	Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0125)|OV - Ovarian serous cystadenocarcinoma(102;0.0399)		4	554	+			92			Protein kinase.		A2A2U5|Q2L6C6|Q6ZNH0|Q8N444|Q96JH2	Missense_Mutation	SNP	ENST00000259750.4	37	c.275G>T	CCDS34455.1	.	.	.	.	.	.	.	.	.	.	G	18.23	3.576929	0.65878	.	.	ENSG00000146216	ENST00000393984;ENST00000259750;ENST00000304139	T	0.22945	1.93	4.76	3.87	0.44632	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.059144	0.64402	D	0.000002	T	0.44912	0.1316	M	0.84511	2.7	0.48696	D	0.999699	D	0.89917	1.0	D	0.77557	0.99	T	0.51926	-0.8643	10	0.72032	D	0.01	.	12.3031	0.54887	0.0873:0.0:0.9127:0.0	.	92	Q5TCY1	TTBK1_HUMAN	M	41;92;41	ENSP00000259750:R92M	ENSP00000259750:R92M	R	+	2	0	TTBK1	43329025	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	6.741000	0.74837	2.176000	0.68965	0.462000	0.41574	AGG		0.527	TTBK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040584.3			9	190	1	0	7.93312e-07	0.00245	1.04849e-06	9	190				
TDRD6	221400	broad.mit.edu	37	6	46658183	46658183	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr6:46658183C>T	ENST00000316081.6	+	1	2318	c.2318C>T	c.(2317-2319)aCa>aTa	p.T773I	TDRD6_ENST00000544460.1_Missense_Mutation_p.T773I|RP11-446F17.3_ENST00000434329.2_RNA|RP11-446F17.3_ENST00000571590.1_RNA|RP11-446F17.3_ENST00000422284.2_RNA	NM_001010870.2	NP_001010870.1	O60522	TDRD6_HUMAN	tudor domain containing 6	773					germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|P granule (GO:0043186)		p.T773I(1)		NS(1)|breast(9)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80			Lung(136;0.192)			GTTGGAAGTACAGTAGAAGTC	0.398																																							uc003oyj.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(3)|ovary(2)|skin(1)	6						c.(2317-2319)ACA>ATA		tudor domain containing 6							53.0	54.0	53.0					6																	46658183		2203	4300	6503	SO:0001583	missense	221400				cell differentiation|multicellular organismal development|spermatogenesis	chromatoid body	nucleic acid binding	g.chr6:46658183C>T	AF039442	CCDS34470.1, CCDS55017.1	6p12.3	2013-01-23			ENSG00000180113	ENSG00000180113		"""Tudor domain containing"""	21339	protein-coding gene	gene with protein product	"""cancer/testis antigen 41.2"", ""spermatogenesis associated 36"""	611200				9610721	Standard	NM_001010870		Approved	NY-CO-45, bA446F17.4, CT41.2, SPATA36	uc003oyj.3	O60522	OTTHUMG00000014788	ENST00000316081.6:c.2318C>T	6.37:g.46658183C>T	ENSP00000346065:p.Thr773Ile		Somatic				TDRD6_uc010jze.2_Missense_Mutation_p.T767I	p.T773I	NM_001010870	NP_001010870	WXS	Illumina HiSeq	Unspecified	O60522	TDRD6_HUMAN	Lung(136;0.192)		1	2318	+			773					B3KWU2|F5H5M3|Q5HYB1|Q5VTS4|Q6ZMX5	Missense_Mutation	SNP	ENST00000316081.6	37	c.2318C>T	CCDS34470.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.236210	0.79800	.	.	ENSG00000180113	ENST00000544460;ENST00000316081	T;T	0.10382	2.88;2.88	5.85	5.85	0.93711	Maternal tudor protein (1);	0.579272	0.20439	N	0.092314	T	0.21468	0.0517	M	0.71581	2.175	0.35527	D	0.801902	D;D	0.61080	0.986;0.989	P;P	0.62885	0.85;0.908	T	0.01982	-1.1235	10	0.21014	T	0.42	-5.1104	20.1577	0.98120	0.0:1.0:0.0:0.0	.	773;773	F5H5M3;O60522	.;TDRD6_HUMAN	I	773	ENSP00000443299:T773I;ENSP00000346065:T773I	ENSP00000346065:T773I	T	+	2	0	TDRD6	46766142	1.000000	0.71417	0.940000	0.37924	0.916000	0.54674	3.670000	0.54569	2.767000	0.95098	0.655000	0.94253	ACA		0.398	TDRD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040800.1	XM_166443		67	64	0	0	0	0.00361	0	67	64				
PGK2	5232	broad.mit.edu	37	6	49754747	49754747	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr6:49754747C>T	ENST00000304801.3	-	1	306	c.154G>A	c.(154-156)Gac>Aac	p.D52N		NM_138733.4	NP_620061.2	P07205	PGK2_HUMAN	phosphoglycerate kinase 2	52					glycolytic process (GO:0006096)|phosphorylation (GO:0016310)|sperm motility (GO:0030317)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)	ATP binding (GO:0005524)|phosphoglycerate kinase activity (GO:0004618)	p.D52N(1)		autonomic_ganglia(1)|endometrium(3)|large_intestine(12)|lung(25)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	47	Lung NSC(77;0.0402)					GCTCCATTGTCCAGGCAGTAC	0.463																																							uc003ozu.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(154-156)GAC>AAC		phosphoglycerate kinase 2							204.0	172.0	183.0					6																	49754747		2203	4300	6503	SO:0001583	missense	5232				glycolysis	cytosol	ATP binding|phosphoglycerate kinase activity	g.chr6:49754747C>T	K03019	CCDS4930.1	6p12.3	2012-09-20		2002-04-19	ENSG00000170950	ENSG00000170950			8898	protein-coding gene	gene with protein product		172270				3839763, 3453121	Standard	NM_138733		Approved	PGKPS, PGK-2	uc003ozu.3	P07205	OTTHUMG00000014824	ENST00000304801.3:c.154G>A	6.37:g.49754747C>T	ENSP00000305995:p.Asp52Asn		Somatic					p.D52N	NM_138733	NP_620061	WXS	Illumina HiSeq	Unspecified	P07205	PGK2_HUMAN			1	261	-	Lung NSC(77;0.0402)		52					B2R6Y8|Q9H107	Missense_Mutation	SNP	ENST00000304801.3	37	c.154G>A	CCDS4930.1	.	.	.	.	.	.	.	.	.	.	C	13.80	2.345439	0.41498	.	.	ENSG00000170950	ENST00000304801	D	0.92397	-3.03	4.09	4.09	0.47781	Phosphoglycerate kinase, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.86297	0.5899	L	0.55213	1.73	0.54753	D	0.999988	B	0.12630	0.006	B	0.20384	0.029	D	0.85102	0.0958	10	0.52906	T	0.07	-28.6995	14.5839	0.68310	0.0:1.0:0.0:0.0	.	52	P07205	PGK2_HUMAN	N	52	ENSP00000305995:D52N	ENSP00000305995:D52N	D	-	1	0	PGK2	49862706	1.000000	0.71417	0.959000	0.39883	0.362000	0.29581	7.066000	0.76734	2.562000	0.86427	0.585000	0.79938	GAC		0.463	PGK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040872.1			66	158	0	0	0	0.00361	0	66	158				
GFRAL	389400	broad.mit.edu	37	6	55214930	55214930	+	Silent	SNP	A	A	C			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr6:55214930A>C	ENST00000340465.2	+	4	443	c.357A>C	c.(355-357)acA>acC	p.T119T		NM_207410.2	NP_997293.2	Q6UXV0	GFRAL_HUMAN	GDNF family receptor alpha like	119					negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of neuron apoptotic process (GO:0043524)|stress-activated protein kinase signaling cascade (GO:0031098)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.T119T(1)		NS(1)|breast(1)|endometrium(2)|kidney(5)|large_intestine(2)|liver(1)|lung(31)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	48	Lung NSC(77;0.0875)|Renal(3;0.122)		LUSC - Lung squamous cell carcinoma(124;0.23)			ATCTAACTACACGTTCCCATC	0.299																																							uc003pcm.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|breast(1)	2						c.(355-357)ACA>ACC		GDNF family receptor alpha like precursor							76.0	74.0	75.0					6																	55214930		2202	4297	6499	SO:0001819	synonymous_variant	389400					integral to membrane	receptor activity	g.chr6:55214930A>C	AY358198	CCDS4957.1	6p12.1	2007-06-22			ENSG00000187871	ENSG00000187871			32789	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 144"""	C6orf144		16086688	Standard	NM_207410		Approved	GRAL, UNQ9356, bA360D14.1	uc003pcm.1	Q6UXV0	OTTHUMG00000014900	ENST00000340465.2:c.357A>C	6.37:g.55214930A>C			Somatic					p.T119T	NM_207410	NP_997293	WXS	Illumina HiSeq	Unspecified	Q6UXV0	GFRAL_HUMAN	LUSC - Lung squamous cell carcinoma(124;0.23)		4	443	+	Lung NSC(77;0.0875)|Renal(3;0.122)		119			Extracellular (Potential).		Q5VTF6	Silent	SNP	ENST00000340465.2	37	c.357A>C	CCDS4957.1																																																																																				0.299	GFRAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040995.2	NM_207410		6	23	0	0	0	0.001984	0	6	23				
OOEP	441161	broad.mit.edu	37	6	74078997	74078997	+	Missense_Mutation	SNP	C	C	A	rs531452415		TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr6:74078997C>A	ENST00000370359.5	-	2	301	c.302G>T	c.(301-303)cGt>cTt	p.R101L	OOEP_ENST00000370363.1_Missense_Mutation_p.R46L|OOEP-AS1_ENST00000445350.2_RNA	NM_001080507.2	NP_001073976.1	A6NGQ2	OOEP_HUMAN	oocyte expressed protein	101	KH; atypical.				cellular protein complex assembly (GO:0043623)|embryo implantation (GO:0007566)|embryonic pattern specification (GO:0009880)|establishment or maintenance of apical/basal cell polarity (GO:0035088)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|protein phosphorylation (GO:0006468)	apical part of cell (GO:0045177)|cell cortex (GO:0005938)|protein complex (GO:0043234)	RNA binding (GO:0003723)	p.R101L(1)		large_intestine(2)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	8						ATTCTGTACACGGGGCCGCCC	0.557																																							uc003pgu.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(301-303)CGT>CTT		oocyte expressed protein homolog							58.0	58.0	58.0					6																	74078997		1977	4148	6125	SO:0001583	missense	441161					cytoplasm		g.chr6:74078997C>A	BC024931	CCDS47451.1	6q13	2012-02-22	2012-02-22	2007-11-13	ENSG00000203907	ENSG00000203907			21382	protein-coding gene	gene with protein product	"""KH homology domain containing 2"""	611689	"""chromosome 6 open reading frame 156"", ""oocyte expressed protein homolog (dog)"""	C6orf156		17913455	Standard	NM_001080507		Approved	Em:AC019205.2, KHDC2	uc003pgu.4	A6NGQ2	OTTHUMG00000150057	ENST00000370359.5:c.302G>T	6.37:g.74078997C>A	ENSP00000359384:p.Arg101Leu		Somatic				OOEP_uc003pgv.3_Missense_Mutation_p.R46L	p.R101L	NM_001080507	NP_001073976	WXS	Illumina HiSeq	Unspecified	A6NGQ2	OOEP_HUMAN			2	302	-			101			KH; atypical.		A6NIN5|A9UIB7	Missense_Mutation	SNP	ENST00000370359.5	37	c.302G>T	CCDS47451.1	.	.	.	.	.	.	.	.	.	.	C	8.158	0.788932	0.16258	.	.	ENSG00000203907	ENST00000370363;ENST00000370359;ENST00000441145	T;T;T	0.12147	2.71;2.71;2.71	3.93	0.0682	0.14368	.	1.541110	0.03837	N	0.269927	T	0.01976	0.0062	N	0.24115	0.695	0.09310	N	1	P;P	0.47841	0.901;0.761	B;B	0.38327	0.149;0.271	T	0.27571	-1.0070	10	0.09843	T	0.71	1.0509	4.7352	0.12984	0.0:0.4108:0.3808:0.2084	.	46;101	F2Z364;A6NGQ2	.;OOEP_HUMAN	L	46;101;46	ENSP00000359388:R46L;ENSP00000359384:R101L;ENSP00000397430:R46L	ENSP00000359384:R101L	R	-	2	0	OOEP	74135718	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.363000	0.20301	-0.010000	0.14271	-0.165000	0.13383	CGT		0.557	OOEP-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000108414.2	NM_001080507		6	37	1	0	2.17888e-05	0.006214	2.70729e-05	6	37				
TRDN	10345	broad.mit.edu	37	6	123892215	123892215	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr6:123892215C>T	ENST00000398178.3	-	2	106	c.85G>A	c.(85-87)Gga>Aga	p.G29R	TRDN_ENST00000542443.1_Missense_Mutation_p.G29R|TRDN_ENST00000546248.1_Missense_Mutation_p.G29R|TRDN_ENST00000334268.4_Missense_Mutation_p.G29R	NM_006073.3	NP_006064.2	Q13061	TRDN_HUMAN	triadin	29					cellular calcium ion homeostasis (GO:0006874)|cytoplasmic microtubule organization (GO:0031122)|endoplasmic reticulum membrane organization (GO:0090158)|heart contraction (GO:0060047)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|myotube differentiation (GO:0014902)|negative regulation of ryanodine-sensitive calcium-release channel activity (GO:0060315)|positive regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901846)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to organic cyclic compound (GO:0014070)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)	ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|protein homodimerization activity (GO:0042803)	p.G29R(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(8)|liver(1)|lung(22)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	41				GBM - Glioblastoma multiforme(226;0.184)		AGCACTTTTCCGGGGGATTTG	0.453																																							uc003pzj.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(85-87)GGA>AGA		triadin							97.0	98.0	98.0					6																	123892215		1962	4154	6116	SO:0001583	missense	10345				muscle contraction	integral to membrane|plasma membrane|sarcoplasmic reticulum membrane	receptor binding	g.chr6:123892215C>T	U18985	CCDS59035.1, CCDS75511.1	6q22.31	2008-05-15			ENSG00000186439	ENSG00000186439			12261	protein-coding gene	gene with protein product		603283				7588753	Standard	NM_001251987		Approved		uc003pzj.2	Q13061	OTTHUMG00000015497	ENST00000398178.3:c.85G>A	6.37:g.123892215C>T	ENSP00000381240:p.Gly29Arg		Somatic				TRDN_uc003pzk.1_Missense_Mutation_p.G29R|TRDN_uc003pzl.1_Missense_Mutation_p.G29R|TRDN_uc010ken.2_Missense_Mutation_p.G29R|TRDN_uc010keo.1_Missense_Mutation_p.G29R	p.G29R	NM_006073	NP_006064	WXS	Illumina HiSeq	Unspecified	Q13061	TRDN_HUMAN		GBM - Glioblastoma multiforme(226;0.184)	2	107	-			29			Cytoplasmic.		A5D6W5|F5H2W7|Q6NSB8	Missense_Mutation	SNP	ENST00000398178.3	37	c.85G>A	CCDS55053.1	.	.	.	.	.	.	.	.	.	.	C	17.59	3.427464	0.62733	.	.	ENSG00000186439	ENST00000398178;ENST00000398161;ENST00000334268;ENST00000542014;ENST00000543022;ENST00000546248;ENST00000542443	T;T;T;T	0.64260	2.1;2.1;5.57;-0.09	5.82	5.82	0.92795	.	0.282791	0.36591	N	0.002519	T	0.64450	0.2599	L	0.51422	1.61	0.28912	N	0.892662	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;0.965;0.965;0.992	T	0.62978	-0.6739	10	0.56958	D	0.05	-19.1264	11.0821	0.48066	0.0:0.8884:0.0:0.1116	.	29;29;29;29;29	F5H6E3;F5H2W7;Q5SWK9;Q8IVK2;Q13061	.;.;.;.;TRDN_HUMAN	R	29	ENSP00000381240:G29R;ENSP00000333984:G29R;ENSP00000439281:G29R;ENSP00000437684:G29R	ENSP00000333984:G29R	G	-	1	0	TRDN	123933914	0.005000	0.15991	1.000000	0.80357	0.993000	0.82548	1.072000	0.30678	2.753000	0.94483	0.557000	0.71058	GGA		0.453	TRDN-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding				8	64	0	0	0	0.008291	0	8	64				
THBS2	7058	broad.mit.edu	37	6	169626329	169626329	+	Silent	SNP	A	A	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr6:169626329A>T	ENST00000366787.3	-	17	2733	c.2484T>A	c.(2482-2484)ggT>ggA	p.G828G	XXyac-YX65C7_A.2_ENST00000444188.1_RNA|THBS2_ENST00000488355.1_5'Flank	NM_003247.2	NP_003238.2	P35442	TSP2_HUMAN	thrombospondin 2	828					cell adhesion (GO:0007155)|negative regulation of angiogenesis (GO:0016525)|positive regulation of synapse assembly (GO:0051965)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|platelet alpha granule (GO:0031091)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)	p.G828G(1)		NS(3)|biliary_tract(1)|endometrium(8)|kidney(3)|large_intestine(23)|liver(1)|lung(56)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	111		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)		CCACACCGTCACCATCCGTGT	0.537																																					Esophageal Squamous(91;219 1934 18562 44706)	Esophageal Squamous(91;219 1934 18562 44706)	uc003qwt.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(5)	5						c.(2482-2484)GGT>GGA		thrombospondin 2 precursor							122.0	111.0	115.0					6																	169626329		2203	4300	6503	SO:0001819	synonymous_variant	7058				cell adhesion	extracellular region	calcium ion binding|heparin binding|protein binding|structural molecule activity	g.chr6:169626329A>T		CCDS34574.1	6q27	2008-07-28			ENSG00000186340	ENSG00000186340			11786	protein-coding gene	gene with protein product		188061				18455130	Standard	NM_003247		Approved	TSP2	uc003qwt.3	P35442	OTTHUMG00000045408	ENST00000366787.3:c.2484T>A	6.37:g.169626329A>T			Somatic					p.G828G	NM_003247	NP_003238	WXS	Illumina HiSeq	Unspecified	P35442	TSP2_HUMAN		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)	17	2732	-		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)	828			TSP type-3 5.		A6H8N1|A7E232|Q5RI52	Silent	SNP	ENST00000366787.3	37	c.2484T>A	CCDS34574.1																																																																																				0.537	THBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000105439.1	NM_003247		16	78	0	0	0	0.007413	0	16	78				
ABCA13	154664	broad.mit.edu	37	7	48684282	48684282	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr7:48684282G>C	ENST00000435803.1	+	61	15037	c.15013G>C	c.(15013-15015)Gtt>Ctt	p.V5005L	ABCA13_ENST00000544596.1_Missense_Mutation_p.V735L	NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	5005					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.V4950L(1)|p.V5005L(1)		breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						CTTGTTCAAAGTTATAGAGAA	0.323																																							uc003toq.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(5)|central_nervous_system(4)|skin(1)	10						c.(15013-15015)GTT>CTT		ATP binding cassette, sub-family A (ABC1),							71.0	73.0	72.0					7																	48684282		1833	4083	5916	SO:0001583	missense	154664				transport	integral to membrane	ATP binding|ATPase activity	g.chr7:48684282G>C	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.15013G>C	7.37:g.48684282G>C	ENSP00000411096:p.Val5005Leu		Somatic				ABCA13_uc010kys.1_Missense_Mutation_p.V2080L|ABCA13_uc010kyt.1_RNA|ABCA13_uc010kyu.1_Missense_Mutation_p.V735L	p.V5005L	NM_152701	NP_689914	WXS	Illumina HiSeq	Unspecified	Q86UQ4	ABCAD_HUMAN			61	15038	+			5005					K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	ENST00000435803.1	37	c.15013G>C	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	G	11.22	1.575011	0.28092	.	.	ENSG00000179869	ENST00000435803;ENST00000411975;ENST00000544596	T;T;T	0.74421	-0.84;-0.84;-0.84	5.2	2.38	0.29361	.	0.444963	0.16626	N	0.206272	T	0.48370	0.1496	N	0.20304	0.555	0.30350	N	0.784905	B;B;P	0.43431	0.01;0.138;0.807	B;B;B	0.35182	0.013;0.06;0.197	T	0.54309	-0.8313	10	0.02654	T	1	.	8.3274	0.32165	0.2565:0.0:0.7435:0.0	.	735;2707;5005	F5H7B7;Q86UQ4-3;Q86UQ4	.;.;ABCAD_HUMAN	L	5005;778;735	ENSP00000411096:V5005L;ENSP00000391042:V778L;ENSP00000442634:V735L	ENSP00000391042:V778L	V	+	1	0	ABCA13	48654828	0.745000	0.28261	0.960000	0.40013	0.967000	0.64934	0.892000	0.28322	0.571000	0.29365	0.650000	0.86243	GTT		0.323	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701		3	65	0	0	0	0.004672	0	3	65				
ZNF716	441234	broad.mit.edu	37	7	57529005	57529005	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr7:57529005C>A	ENST00000420713.1	+	4	950	c.838C>A	c.(838-840)Cgc>Agc	p.R280S		NM_001159279.1	NP_001152751.1	A6NP11	ZN716_HUMAN	zinc finger protein 716	280					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R280S(2)		breast(1)|kidney(1)|lung(20)|ovary(2)	24						AGTCTTTAGCCGCTCAACACT	0.413																																							uc011kdi.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(838-840)CGC>AGC		zinc finger protein 716							51.0	49.0	50.0					7																	57529005		692	1591	2283	SO:0001583	missense	441234							g.chr7:57529005C>A	AK131575	CCDS55112.1	7p11.1	2013-01-08			ENSG00000182111	ENSG00000182111		"""Zinc fingers, C2H2-type"", ""-"""	32458	protein-coding gene	gene with protein product							Standard	NM_001159279		Approved	FLJ46189	uc011kdi.1	A6NP11	OTTHUMG00000156689	ENST00000420713.1:c.838C>A	7.37:g.57529005C>A	ENSP00000394248:p.Arg280Ser		Somatic					p.R280S	NM_001159279	NP_001152751	WXS	Illumina HiSeq	Unspecified					4	950	+									Missense_Mutation	SNP	ENST00000420713.1	37	c.838C>A	CCDS55112.1	.	.	.	.	.	.	.	.	.	.	C	0.225	-1.025575	0.02045	.	.	ENSG00000182111	ENST00000420713;ENST00000418732	T	0.35605	1.3	0.195	0.195	0.15151	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.16769	0.0403	N	0.11673	0.155	0.09310	N	1	B	0.14438	0.01	B	0.08055	0.003	T	0.24225	-1.0166	8	0.26408	T	0.33	.	.	.	.	.	268	A6NP11	ZN716_HUMAN	S	280;268	ENSP00000394248:R280S	ENSP00000387687:R268S	R	+	1	0	ZNF716	57532947	0.000000	0.05858	0.013000	0.15412	0.014000	0.08584	-8.403000	0.00021	0.300000	0.22699	0.306000	0.20318	CGC		0.413	ZNF716-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345309.1	NM_001159279		10	28	1	0	4.68919e-08	0.008291	6.50841e-08	10	28				
AKAP9	10142	broad.mit.edu	37	7	91609624	91609624	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr7:91609624A>T	ENST00000359028.2	+	4	589	c.364A>T	c.(364-366)Aca>Tca	p.T122S	AKAP9_ENST00000358100.2_Missense_Mutation_p.T122S|AKAP9_ENST00000356239.3_Missense_Mutation_p.T110S|AKAP9_ENST00000394564.1_Missense_Mutation_p.T110S			Q99996	AKAP9_HUMAN	A kinase (PRKA) anchor protein 9	122					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|Sertoli cell development (GO:0060009)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|synaptic transmission (GO:0007268)|transport (GO:0006810)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|pericentriolar material (GO:0000242)|voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)	p.T110S(1)|p.T122S(1)		NS(1)|autonomic_ganglia(2)|breast(14)|central_nervous_system(3)|cervix(1)|endometrium(13)|kidney(12)|large_intestine(35)|lung(49)|ovary(8)|prostate(6)|skin(8)|stomach(1)|urinary_tract(2)	155	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			AATTTCAACCACAGCAGATGA	0.254			T	BRAF	papillary thyroid																																		uc003ulg.2		NA		Dom	yes		7	7q21-q22	10142	T	A kinase (PRKA) anchor protein (yotiao) 9			E	BRAF		papillary thyroid		2	Substitution - Missense(2)		lung(2)	breast(7)|ovary(6)|lung(5)|skin(3)|large_intestine(2)|prostate(2)|central_nervous_system(1)	26						c.(328-330)ACA>TCA		A-kinase anchor protein 9 isoform 2							33.0	39.0	37.0					7																	91609624		2181	4246	6427	SO:0001583	missense	10142				G2/M transition of mitotic cell cycle|signal transduction|synaptic transmission|transport	centrosome|cytosol|Golgi apparatus	receptor binding	g.chr7:91609624A>T	AF091711	CCDS5622.1	7q21-q22	2014-09-17	2013-09-25		ENSG00000127914	ENSG00000127914		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	379	protein-coding gene	gene with protein product	"""A-kinase anchoring protein 450"", ""AKAP9-BRAF fusion protein"", ""AKAP120-like protein"", ""centrosome- and golgi-localized protein kinase N-associated protein"", ""protein kinase A anchoring protein 9"", ""A-kinase anchor protein, 350kDa"", ""protein phosphatase 1, regulatory subunit 45"", ""yotiao"""	604001				9482789, 10390370, 24475373	Standard	NM_147185		Approved	KIAA0803, AKAP350, AKAP450, CG-NAP, YOTIAO, HYPERION, PRKA9, MU-RMS-40.16A, PPP1R45, LQT11	uc003ulg.3	Q99996	OTTHUMG00000131127	ENST00000359028.2:c.364A>T	7.37:g.91609624A>T	ENSP00000351922:p.Thr122Ser		Somatic				AKAP9_uc003uld.3_Missense_Mutation_p.T110S|AKAP9_uc003ule.2_Missense_Mutation_p.T122S|AKAP9_uc003ulf.2_Missense_Mutation_p.T110S	p.T110S	NM_005751	NP_005742	WXS	Illumina HiSeq	Unspecified	Q99996	AKAP9_HUMAN	STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)		3	553	+	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		122					A4D1F0|A4D1F2|A4D1F4|O14869|O43355|O94895|Q75N20|Q9UQH3|Q9UQQ4|Q9Y6B8|Q9Y6Y2	Missense_Mutation	SNP	ENST00000359028.2	37	c.328A>T		.	.	.	.	.	.	.	.	.	.	A	15.15	2.747904	0.49257	.	.	ENSG00000127914	ENST00000356239;ENST00000359028;ENST00000358100;ENST00000413120;ENST00000394565;ENST00000394564;ENST00000438114	T;T;T;T;T	0.15139	2.45;2.45;2.45;2.45;2.62	4.88	4.88	0.63580	.	0.000000	0.38778	N	0.001566	T	0.36303	0.0962	M	0.65498	2.005	0.37811	D	0.928031	D;D;D;D	0.76494	0.999;0.998;0.995;0.998	D;D;P;D	0.81914	0.995;0.987;0.814;0.987	T	0.25847	-1.0120	10	0.48119	T	0.1	.	9.7169	0.40281	0.9183:0.0:0.0817:0.0	.	110;110;122;110	Q99996-2;Q99996-3;A4D1E4;Q6PJH3	.;.;.;.	S	110;122;122;122;122;110;79	ENSP00000348573:T110S;ENSP00000351922:T122S;ENSP00000350813:T122S;ENSP00000378065:T110S;ENSP00000391704:T79S	ENSP00000348573:T110S	T	+	1	0	AKAP9	91447560	0.977000	0.34250	1.000000	0.80357	0.989000	0.77384	2.933000	0.48948	2.168000	0.68352	0.460000	0.39030	ACA		0.254	AKAP9-202	KNOWN	basic	protein_coding	protein_coding		NM_005751		4	55	0	0	0	0.000602	0	4	55				
GATAD1	57798	broad.mit.edu	37	7	92080020	92080020	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr7:92080020C>G	ENST00000287957.3	+	3	658	c.381C>G	c.(379-381)atC>atG	p.I127M		NM_021167.4	NP_066990.3	Q8WUU5	GATD1_HUMAN	GATA zinc finger domain containing 1	127						nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.I127M(1)|p.?(1)		endometrium(1)|kidney(2)|lung(3)	6	all_cancers(62;1.63e-10)|all_epithelial(64;8.33e-10)|Breast(17;0.00311)|all_lung(186;0.0498)|Lung NSC(181;0.0676)		STAD - Stomach adenocarcinoma(171;4.51e-05)|GBM - Glioblastoma multiforme(5;8.83e-05)|all cancers(6;0.000136)|Lung(22;0.123)|Epithelial(20;0.179)|LUSC - Lung squamous cell carcinoma(200;0.225)			CATAGCCCATCAAAGCTCCTG	0.398																																							uc003ulx.1		NA																	2	Substitution - Missense(1)|Unknown(1)		lung(1)|kidney(1)		0						c.(379-381)ATC>ATG		GATA zinc finger domain containing 1							99.0	95.0	96.0					7																	92080020		2203	4300	6503	SO:0001583	missense	57798						sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr7:92080020C>G		CCDS5625.1	7q21-q22	2014-09-17			ENSG00000157259	ENSG00000157259		"""GATA zinc finger domain containing"""	29941	protein-coding gene	gene with protein product	"""ocular development associated gene"""	614518				12062807	Standard	NM_021167		Approved	ODAG, RG083M05.2, FLJ22489	uc003ulx.2	Q8WUU5	OTTHUMG00000131201	ENST00000287957.3:c.381C>G	7.37:g.92080020C>G	ENSP00000287957:p.Ile127Met		Somatic				GATAD1_uc011khq.1_RNA	p.I127M	NM_021167	NP_066990	WXS	Illumina HiSeq	Unspecified	Q8WUU5	GATD1_HUMAN	STAD - Stomach adenocarcinoma(171;4.51e-05)|GBM - Glioblastoma multiforme(5;8.83e-05)|all cancers(6;0.000136)|Lung(22;0.123)|Epithelial(20;0.179)|LUSC - Lung squamous cell carcinoma(200;0.225)		3	660	+	all_cancers(62;1.63e-10)|all_epithelial(64;8.33e-10)|Breast(17;0.00311)|all_lung(186;0.0498)|Lung NSC(181;0.0676)		127					B2RE37|D6W5Q5|Q8N5Y5|Q99995|Q9H689	Missense_Mutation	SNP	ENST00000287957.3	37	c.381C>G	CCDS5625.1	.	.	.	.	.	.	.	.	.	.	C	16.93	3.259235	0.59321	.	.	ENSG00000157259	ENST00000287957	D	0.88431	-2.38	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	D	0.90494	0.7022	L	0.41710	1.295	0.58432	D	0.999999	D	0.64830	0.994	P	0.56916	0.809	D	0.89300	0.3625	10	0.40728	T	0.16	-26.3204	18.4846	0.90824	0.0:1.0:0.0:0.0	.	127	Q8WUU5	GATD1_HUMAN	M	127	ENSP00000287957:I127M	ENSP00000287957:I127M	I	+	3	3	GATAD1	91917956	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.905000	0.48727	2.878000	0.98634	0.650000	0.86243	ATC		0.398	GATAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253929.2	NM_021167		13	96	0	0	0	0.00245	0	13	96				
SAMD9L	219285	broad.mit.edu	37	7	92762064	92762064	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr7:92762064C>A	ENST00000318238.4	-	5	4437	c.3221G>T	c.(3220-3222)gGa>gTa	p.G1074V	SAMD9L_ENST00000411955.1_Missense_Mutation_p.G1074V|SAMD9L_ENST00000437805.1_Missense_Mutation_p.G1074V	NM_152703.2	NP_689916.2	Q8IVG5	SAM9L_HUMAN	sterile alpha motif domain containing 9-like	1074					common myeloid progenitor cell proliferation (GO:0035726)|endosomal vesicle fusion (GO:0034058)|hematopoietic progenitor cell differentiation (GO:0002244)|regulation of protein catabolic process (GO:0042176)|spleen development (GO:0048536)|stem cell division (GO:0017145)	early endosome (GO:0005769)		p.G1074V(1)		central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(23)|liver(2)|lung(31)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	88	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)		STAD - Stomach adenocarcinoma(171;0.000302)			TCGTCTACTTCCTGCACTCAA	0.413																																							uc003umh.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)	4						c.(3220-3222)GGA>GTA		sterile alpha motif domain containing 9-like							132.0	127.0	129.0					7																	92762064		2202	4299	6501	SO:0001583	missense	219285							g.chr7:92762064C>A	AB095926	CCDS34681.1	7q21.2	2013-01-10		2005-04-26	ENSG00000177409	ENSG00000177409		"""Sterile alpha motif (SAM) domain containing"""	1349	protein-coding gene	gene with protein product		611170	"""chromosome 7 open reading frame 6"""	C7orf6			Standard	NM_152703		Approved	KIAA2005, FLJ39885	uc003umh.1	Q8IVG5	OTTHUMG00000155807	ENST00000318238.4:c.3221G>T	7.37:g.92762064C>A	ENSP00000326247:p.Gly1074Val		Somatic				SAMD9L_uc003umj.1_Missense_Mutation_p.G1074V|SAMD9L_uc003umi.1_Missense_Mutation_p.G1074V|SAMD9L_uc010lfb.1_Missense_Mutation_p.G1074V|SAMD9L_uc003umk.1_Missense_Mutation_p.G1074V|SAMD9L_uc010lfc.1_Missense_Mutation_p.G1074V|SAMD9L_uc010lfd.1_Missense_Mutation_p.G1074V|SAMD9L_uc011khx.1_Intron	p.G1074V	NM_152703	NP_689916	WXS	Illumina HiSeq	Unspecified	Q8IVG5	SAM9L_HUMAN	STAD - Stomach adenocarcinoma(171;0.000302)		5	4437	-	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)		1074					A0JP23|A0JP24|A0PJG8|A4D1G8|D6W5Q6|Q2TV71|Q2TV75|Q2UZV8|Q8IWI4|Q8N3L9|Q8N875	Missense_Mutation	SNP	ENST00000318238.4	37	c.3221G>T	CCDS34681.1	.	.	.	.	.	.	.	.	.	.	C	11.71	1.720190	0.30503	.	.	ENSG00000177409	ENST00000318238;ENST00000411955;ENST00000437805	T;T;T	0.26067	1.76;1.76;1.76	4.89	4.89	0.63831	.	0.150471	0.41605	D	0.000852	T	0.42086	0.1187	L	0.47716	1.5	0.54753	D	0.999983	D	0.76494	0.999	D	0.65323	0.934	T	0.25641	-1.0126	10	0.72032	D	0.01	-16.3131	14.6323	0.68666	0.0:0.8535:0.1465:0.0	.	1074	Q8IVG5	SAM9L_HUMAN	V	1074	ENSP00000326247:G1074V;ENSP00000405760:G1074V;ENSP00000408796:G1074V	ENSP00000326247:G1074V	G	-	2	0	SAMD9L	92600000	1.000000	0.71417	0.297000	0.24988	0.404000	0.30871	4.103000	0.57783	2.528000	0.85240	0.467000	0.42956	GGA		0.413	SAMD9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341730.1	NM_152703		22	129	1	0	1.55795e-14	0.001882	2.67168e-14	22	129				
GNG11	2791	broad.mit.edu	37	7	93555509	93555509	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr7:93555509G>T	ENST00000248564.5	+	2	642	c.203G>T	c.(202-204)gGc>gTc	p.G68V		NM_004126.3	NP_004117.1	P61952	GBG11_HUMAN	guanine nucleotide binding protein (G protein), gamma 11	68					cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|G-protein coupled receptor signaling pathway (GO:0007186)|GTP catabolic process (GO:0006184)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	GTPase activity (GO:0003924)|signal transducer activity (GO:0004871)	p.G68V(1)		breast(1)|central_nervous_system(1)|kidney(1)|lung(2)|skin(1)	6	all_cancers(62;2.39e-10)|all_epithelial(64;1.54e-09)|Lung NSC(181;0.218)		STAD - Stomach adenocarcinoma(171;0.000967)			AAAGAAAAAGGCAGCTGTGTT	0.348																																							uc003und.2		NA																	1	Substitution - Missense(1)		lung(1)	kidney(1)	1						c.(202-204)GGC>GTC		guanine nucleotide binding protein gamma 11							76.0	81.0	79.0					7																	93555509		2203	4297	6500	SO:0001583	missense	2791				cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway	heterotrimeric G-protein complex	GTPase activity|signal transducer activity	g.chr7:93555509G>T		CCDS5634.1	7q31-q32	2008-07-18			ENSG00000127920	ENSG00000127920			4403	protein-coding gene	gene with protein product	"""G protein gamma-11 subunit"", ""guanine nucleotide-binding protein G(I)/G(S)/G(O) gamma-11 subunit"""	604390				7665596	Standard	NM_004126		Approved	GNGT11	uc003und.3	P61952	OTTHUMG00000023411	ENST00000248564.5:c.203G>T	7.37:g.93555509G>T	ENSP00000248564:p.Gly68Val		Somatic					p.G68V	NM_004126	NP_004117	WXS	Illumina HiSeq	Unspecified	P61952	GBG11_HUMAN	STAD - Stomach adenocarcinoma(171;0.000967)		2	637	+	all_cancers(62;2.39e-10)|all_epithelial(64;1.54e-09)|Lung NSC(181;0.218)		68					P50152	Missense_Mutation	SNP	ENST00000248564.5	37	c.203G>T	CCDS5634.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.066221	0.76187	.	.	ENSG00000127920	ENST00000248564	T	0.33438	1.41	4.38	4.38	0.52667	G-protein gamma domain (4);	0.048120	0.85682	D	0.000000	T	0.54886	0.1886	.	.	.	0.80722	D	1	D	0.58970	0.984	D	0.66084	0.941	T	0.59506	-0.7442	9	0.72032	D	0.01	-33.4741	16.9027	0.86117	0.0:0.0:1.0:0.0	.	68	P61952	GBG11_HUMAN	V	68	ENSP00000248564:G68V	ENSP00000248564:G68V	G	+	2	0	GNG11	93393445	1.000000	0.71417	1.000000	0.80357	0.744000	0.42396	6.791000	0.75120	2.719000	0.93026	0.655000	0.94253	GGC		0.348	GNG11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254719.3	NM_004126		9	101	1	0	2.17888e-05	0.006214	2.70729e-05	9	101				
PPP1R9A	55607	broad.mit.edu	37	7	94791228	94791228	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr7:94791228G>C	ENST00000433881.1	+	5	2231	c.1699G>C	c.(1699-1701)Ggt>Cgt	p.G567R	AC002429.5_ENST00000417881.2_RNA|PPP1R9A_ENST00000456331.2_Missense_Mutation_p.G567R|PPP1R9A_ENST00000433360.1_Missense_Mutation_p.G567R|PPP1R9A_ENST00000424654.1_Missense_Mutation_p.G567R|PPP1R9A_ENST00000340694.4_Missense_Mutation_p.G567R|PPP1R9A_ENST00000289495.5_Missense_Mutation_p.G567R			Q9ULJ8	NEB1_HUMAN	protein phosphatase 1, regulatory subunit 9A	567	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				actin filament organization (GO:0007015)|calcium-mediated signaling (GO:0019722)|neuron projection development (GO:0031175)	cell junction (GO:0030054)|cortical actin cytoskeleton (GO:0030864)|dendritic spine (GO:0043197)|filopodium (GO:0030175)|growth cone (GO:0030426)|synapse (GO:0045202)		p.G567R(2)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(11)|liver(2)|lung(22)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(8)|urinary_tract(5)	71	all_cancers(62;9.12e-11)|all_epithelial(64;4.34e-09)		STAD - Stomach adenocarcinoma(171;0.0031)			CAGCTTGGTGGGTGTGACACA	0.363										HNSCC(28;0.073)																													uc003unp.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4						c.(1699-1701)GGT>CGT		protein phosphatase 1, regulatory (inhibitor)							108.0	94.0	99.0					7																	94791228		2203	4300	6503	SO:0001583	missense	55607					cell junction|synapse|synaptosome	actin binding	g.chr7:94791228G>C	AB033048	CCDS34683.1, CCDS55127.1, CCDS55128.1	7q21.3	2013-01-10	2011-10-04		ENSG00000158528	ENSG00000158528		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Sterile alpha motif (SAM) domain containing"""	14946	protein-coding gene	gene with protein product		602468	"""protein phosphatase 1, regulatory (inhibitor) subunit 9A"""			10574462	Standard	NM_001166160		Approved	Neurabin-I, KIAA1222, FLJ20068	uc010lfj.3	Q9ULJ8	OTTHUMG00000155566	ENST00000433881.1:c.1699G>C	7.37:g.94791228G>C	ENSP00000398870:p.Gly567Arg	HNSCC(28;0.073)	Somatic				PPP1R9A_uc010lfj.2_Missense_Mutation_p.G567R|PPP1R9A_uc011kif.1_Missense_Mutation_p.G567R|PPP1R9A_uc003unq.2_Missense_Mutation_p.G567R|PPP1R9A_uc011kig.1_Missense_Mutation_p.G567R	p.G567R	NM_017650	NP_060120	WXS	Illumina HiSeq	Unspecified	Q9ULJ8	NEB1_HUMAN	STAD - Stomach adenocarcinoma(171;0.0031)		5	1981	+	all_cancers(62;9.12e-11)|all_epithelial(64;4.34e-09)		567			PDZ.		A1L494|B2RWQ1|E9PCA0|E9PCK6|E9PDX1|F8W7J9|O76059|Q9NXT2	Missense_Mutation	SNP	ENST00000433881.1	37	c.1699G>C	CCDS34683.1	.	.	.	.	.	.	.	.	.	.	G	28.9	4.959417	0.92726	.	.	ENSG00000158528	ENST00000433360;ENST00000340694;ENST00000424654;ENST00000433881;ENST00000289495;ENST00000456331	T;T;T;T;T;T	0.52295	0.67;0.67;0.67;0.67;0.67;0.67	4.85	4.85	0.62838	PDZ/DHR/GLGF (4);	0.000000	0.85682	D	0.000000	T	0.73473	0.3591	M	0.87097	2.86	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;0.999	T	0.78922	-0.2013	10	0.87932	D	0	.	17.6008	0.88024	0.0:0.0:1.0:0.0	.	567;567;567;567;567	B7ZLX4;F8W7J9;E9PDX1;E9PCK6;Q9ULJ8	.;.;.;.;NEB1_HUMAN	R	567	ENSP00000405514:G567R;ENSP00000344524:G567R;ENSP00000411342:G567R;ENSP00000398870:G567R;ENSP00000289495:G567R;ENSP00000402893:G567R	ENSP00000289495:G567R	G	+	1	0	PPP1R9A	94629164	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.335000	0.96500	2.634000	0.89283	0.591000	0.81541	GGT		0.363	PPP1R9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340662.1	NM_001166160		5	33	0	0	0	0.000602	0	5	33				
TRRAP	8295	broad.mit.edu	37	7	98495465	98495465	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr7:98495465G>C	ENST00000359863.4	+	8	818	c.609G>C	c.(607-609)gaG>gaC	p.E203D	TRRAP_ENST00000446306.3_Missense_Mutation_p.E203D|TRRAP_ENST00000355540.3_Missense_Mutation_p.E203D	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein	203					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)	p.E203D(2)		NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			TCAACCCGGAGCGTGAGGACA	0.473																																							uc003upp.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(9)|large_intestine(8)|central_nervous_system(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(1)|lung(1)|liver(1)	37						c.(607-609)GAG>GAC		transformation/transcription domain-associated							163.0	147.0	152.0					7																	98495465		2203	4300	6503	SO:0001583	missense	8295				histone deubiquitination|histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|PCAF complex|STAGA complex|transcription factor TFTC complex	phosphotransferase activity, alcohol group as acceptor|protein binding|transcription cofactor activity	g.chr7:98495465G>C	AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.609G>C	7.37:g.98495465G>C	ENSP00000352925:p.Glu203Asp		Somatic				TRRAP_uc011kis.1_Missense_Mutation_p.E203D|TRRAP_uc003upr.2_5'Flank	p.E203D	NM_003496	NP_003487	WXS	Illumina HiSeq	Unspecified	Q9Y4A5	TRRAP_HUMAN	STAD - Stomach adenocarcinoma(171;0.215)		8	818	+	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		203					A4D265|O75218|Q9Y631|Q9Y6H4	Missense_Mutation	SNP	ENST00000359863.4	37	c.609G>C	CCDS59066.1	.	.	.	.	.	.	.	.	.	.	G	13.38	2.218948	0.39201	.	.	ENSG00000196367	ENST00000359863;ENST00000355540;ENST00000446306	T;T	0.03004	4.08;4.08	5.58	4.59	0.56863	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.04588	0.0125	N	0.08118	0	0.52501	D	0.999956	D;P	0.56035	0.974;0.956	D;P	0.67725	0.953;0.899	T	0.58651	-0.7599	10	0.13108	T	0.6	.	7.4232	0.27083	0.2512:0.0:0.7488:0.0	.	203;203	Q9Y4A5-2;Q9Y4A5	.;TRRAP_HUMAN	D	203	ENSP00000352925:E203D;ENSP00000347733:E203D	ENSP00000347733:E203D	E	+	3	2	TRRAP	98333401	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	1.352000	0.34033	2.650000	0.89964	0.591000	0.81541	GAG		0.473	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317978.1	NM_003496		28	146	0	0	0	0.009535	0	28	146				
CYP3A5	1577	broad.mit.edu	37	7	99262907	99262907	+	Silent	SNP	A	A	G			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr7:99262907A>G	ENST00000222982.4	-	7	651	c.552T>C	c.(550-552)atT>atC	p.I184I	CYP3A5_ENST00000343703.5_Silent_p.I174I|CYP3A5_ENST00000339843.2_3'UTR|CYP3A5_ENST00000480723.1_5'Flank	NM_000777.3	NP_000768.1	P20815	CP3A5_HUMAN	cytochrome P450, family 3, subfamily A, polypeptide 5	184					alkaloid catabolic process (GO:0009822)|drug catabolic process (GO:0042737)|oxidative demethylation (GO:0070989)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity (GO:0016491)|oxygen binding (GO:0019825)	p.I184I(1)		NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16	all_epithelial(64;2.77e-08)|Lung NSC(181;0.00396)|all_lung(186;0.00659)|Esophageal squamous(72;0.0166)				ado-trastuzumab emtansine(DB05773)|Alfentanil(DB00802)|Alprazolam(DB00404)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amprenavir(DB00701)|Apixaban(DB06605)|Aprepitant(DB00673)|Argatroban(DB00278)|Aripiprazole(DB01238)|Artemether(DB06697)|Astemizole(DB00637)|Atorvastatin(DB01076)|Axitinib(DB06626)|Azelastine(DB00972)|Beclomethasone(DB00394)|Boceprevir(DB08873)|Brentuximab vedotin(DB08870)|Buprenorphine(DB00921)|Buspirone(DB00490)|Cabazitaxel(DB06772)|Caffeine(DB00201)|Carbamazepine(DB00564)|Chloramphenicol(DB00446)|Chloroquine(DB00608)|Chlorphenamine(DB01114)|Cilostazol(DB01166)|Cimetidine(DB00501)|Ciprofloxacin(DB00537)|Cisapride(DB00604)|Clarithromycin(DB01211)|Clonidine(DB00575)|Clopidogrel(DB00758)|Cocaine(DB00907)|Codeine(DB00318)|Crizotinib(DB08865)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dapsone(DB00250)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Delavirdine(DB00705)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Diazepam(DB00829)|Diltiazem(DB00343)|Disulfiram(DB00822)|Docetaxel(DB01248)|Dolutegravir(DB08930)|Domperidone(DB01184)|Dutasteride(DB01126)|Enzalutamide(DB08899)|Eplerenone(DB00700)|Erlotinib(DB00530)|Erythromycin(DB00199)|Estradiol(DB00783)|Estrone(DB00655)|Ethosuximide(DB00593)|Etoposide(DB00773)|Felodipine(DB01023)|Fentanyl(DB00813)|Finasteride(DB01216)|Fluconazole(DB00196)|Fluoxetine(DB00472)|Flutamide(DB00499)|Fluticasone Propionate(DB00588)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Gefitinib(DB00317)|Gestodene(DB06730)|Granisetron(DB00889)|Halofantrine(DB01218)|Haloperidol(DB00502)|Hydrocortisone(DB00741)|Ifosfamide(DB01181)|Iloperidone(DB04946)|Imatinib(DB00619)|Indinavir(DB00224)|Irinotecan(DB00762)|Itraconazole(DB01167)|Ketoconazole(DB01026)|Lapatinib(DB01259)|Lercanidipine(DB00528)|Levomethadyl Acetate(DB01227)|Lidocaine(DB00281)|Losartan(DB00678)|Lovastatin(DB00227)|Methadone(DB00333)|Midazolam(DB00683)|Mifepristone(DB00834)|Modafinil(DB00745)|Mycophenolate mofetil(DB00688)|Nateglinide(DB00731)|Nefazodone(DB01149)|Nelfinavir(DB00220)|Nevirapine(DB00238)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Norethindrone(DB00717)|Norfloxacin(DB01059)|Nortriptyline(DB00540)|Ondansetron(DB00904)|Oxazepam(DB00842)|Oxcarbazepine(DB00776)|Oxybutynin(DB01062)|Oxycodone(DB00497)|Paclitaxel(DB01229)|Paliperidone(DB01267)|Pentamidine(DB00738)|Perampanel(DB08883)|Phenelzine(DB00780)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pimozide(DB01100)|Ponatinib(DB08901)|Pravastatin(DB00175)|Praziquantel(DB01058)|Progesterone(DB00396)|Propranolol(DB00571)|Quetiapine(DB01224)|Quinacrine(DB01103)|Quinine(DB00468)|Ranitidine(DB00863)|Reserpine(DB00206)|Rifampicin(DB01045)|Rifapentine(DB01201)|Risperidone(DB00734)|Ritonavir(DB00503)|Rivaroxaban(DB06228)|Rosuvastatin(DB01098)|Salmeterol(DB00938)|Saquinavir(DB01232)|Saxagliptin(DB06335)|Sildenafil(DB00203)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sorafenib(DB00398)|Sulfasalazine(DB00795)|Sunitinib(DB01268)|Tacrolimus(DB00864)|Tamoxifen(DB00675)|Telithromycin(DB00976)|Temsirolimus(DB06287)|Teniposide(DB00444)|Testosterone(DB00624)|Thalidomide(DB01041)|Trazodone(DB00656)|Tretinoin(DB00755)|Triazolam(DB00897)|Troleandomycin(DB01361)|Udenafil(DB06267)|Valproic Acid(DB00313)|Vardenafil(DB00862)|Verapamil(DB00661)|Vincristine(DB00541)|Voriconazole(DB00582)|Zalcitabine(DB00943)|Zaleplon(DB00962)|Ziprasidone(DB00246)|Zolpidem(DB00425)	ATGTGCCAGTAATCACATCCA	0.428																																							uc003urq.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(550-552)ATT>ATC		cytochrome P450, family 3, subfamily A,	Alfentanil(DB00802)|Clopidogrel(DB00758)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Indinavir(DB00224)|Irinotecan(DB00762)|Ketoconazole(DB01026)|Lapatinib(DB01259)|Mephenytoin(DB00532)|Midazolam(DB00683)|Mifepristone(DB00834)|Phenytoin(DB00252)|Quinine(DB00468)|Saquinavir(DB01232)|Tacrolimus(DB00864)|Troleandomycin(DB01361)|Verapamil(DB00661)|Vincristine(DB00541)						165.0	144.0	151.0					7																	99262907		2203	4300	6503	SO:0001819	synonymous_variant	1577				alkaloid catabolic process|drug catabolic process|oxidative demethylation|steroid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding	g.chr7:99262907A>G	L26985	CCDS5672.1, CCDS55134.1	7q21.1	2007-12-14	2003-01-14		ENSG00000106258	ENSG00000106258		"""Cytochrome P450s"""	2638	protein-coding gene	gene with protein product		605325	"""cytochrome P450, subfamily IIIA (niphedipine oxidase), polypeptide 5"""				Standard	NR_033808		Approved	PCN3, P450PCN3, CP35		P20815	OTTHUMG00000156724	ENST00000222982.4:c.552T>C	7.37:g.99262907A>G			Somatic				ZNF498_uc003urn.2_Intron|CYP3A5_uc003urp.2_Silent_p.I4I|CYP3A5_uc003urr.2_Silent_p.I71I|CYP3A5_uc011kiy.1_Silent_p.I174I|CYP3A5_uc003urs.2_Intron|CYP3A5_uc010lgg.2_Intron	p.I184I	NM_000777	NP_000768	WXS	Illumina HiSeq	Unspecified	P20815	CP3A5_HUMAN			7	639	-	all_epithelial(64;2.77e-08)|Lung NSC(181;0.00396)|all_lung(186;0.00659)|Esophageal squamous(72;0.0166)		184					A4D289|B7Z5I7|Q53WY8|Q75MV0|Q9HB56	Silent	SNP	ENST00000222982.4	37	c.552T>C	CCDS5672.1																																																																																				0.428	CYP3A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345469.1			21	124	0	0	0	0.00278	0	21	124				
MYL10	93408	broad.mit.edu	37	7	101265451	101265451	+	Nonsense_Mutation	SNP	C	C	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr7:101265451C>A	ENST00000223167.4	-	5	556	c.379G>T	c.(379-381)Gag>Tag	p.E127*		NM_138403.4	NP_612412.2	Q9BUA6	MYL10_HUMAN	myosin, light chain 10, regulatory	127						mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)	p.E127*(1)		breast(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)	12						ACCATGGCCTCCAGTTCCTCG	0.597																																					Esophageal Squamous(24;575 709 17516 40384 51639)	Esophageal Squamous(24;575 709 17516 40384 51639)	uc003uyr.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)|breast(1)	2						c.(379-381)GAG>TAG		myosin, light chain 10, regulatory							110.0	90.0	97.0					7																	101265451		2203	4300	6503	SO:0001587	stop_gained	93408					mitochondrion	calcium ion binding	g.chr7:101265451C>A	BC002778	CCDS34713.1	7q22.1	2013-01-10			ENSG00000106436	ENSG00000106436		"""Myosins / Light chain"", ""EF-hand domain containing"""	29825	protein-coding gene	gene with protein product						1628631	Standard	NM_138403		Approved	MGC3479, MYLC2PL, PLRLC	uc003uyr.3	Q9BUA6	OTTHUMG00000157137	ENST00000223167.4:c.379G>T	7.37:g.101265451C>A	ENSP00000223167:p.Glu127*		Somatic					p.E127*	NM_138403	NP_612412	WXS	Illumina HiSeq	Unspecified	Q9BUA6	MYL10_HUMAN			5	557	-			127						Nonsense_Mutation	SNP	ENST00000223167.4	37	c.379G>T	CCDS34713.1	.	.	.	.	.	.	.	.	.	.	C	19.12	3.765517	0.69878	.	.	ENSG00000106436	ENST00000223167	.	.	.	4.28	3.39	0.38822	.	0.177050	0.37219	U	0.002185	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	.	11.1343	0.48365	0.0:0.9075:0.0:0.0925	.	.	.	.	X	127	.	ENSP00000223167:E127X	E	-	1	0	MYL10	101052171	1.000000	0.71417	1.000000	0.80357	0.024000	0.10985	7.045000	0.76585	0.938000	0.37419	-0.384000	0.06662	GAG		0.597	MYL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347575.1	NM_138403		10	67	1	0	1.5842e-08	0.001855	2.25152e-08	10	67				
LAMB1	3912	broad.mit.edu	37	7	107603427	107603427	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr7:107603427C>A	ENST00000222399.6	-	15	2010	c.1780G>T	c.(1780-1782)Ggg>Tgg	p.G594W	LAMB1_ENST00000393561.1_Missense_Mutation_p.G618W|LAMB1_ENST00000393560.1_Missense_Mutation_p.G594W	NM_002291.2	NP_002282.2	P07942	LAMB1_HUMAN	laminin, beta 1	594	Laminin IV type B. {ECO:0000255|PROSITE- ProRule:PRU00462}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|neuron projection development (GO:0031175)|neuronal-glial interaction involved in cerebral cortex radial glia guided migration (GO:0021812)|odontogenesis (GO:0042476)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell proliferation (GO:0050679)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-2 complex (GO:0005607)|laminin-8 complex (GO:0043257)|perinuclear region of cytoplasm (GO:0048471)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)|structural molecule activity (GO:0005198)	p.G594W(1)		NS(3)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(37)|ovary(6)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)	82						AAATAAGCCCCTTCAGGCACT	0.502																																							uc003vew.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	8						c.(1780-1782)GGG>TGG		laminin, beta 1 precursor	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)						107.0	110.0	109.0					7																	107603427		2203	4300	6503	SO:0001583	missense	3912				axon guidance|odontogenesis|positive regulation of cell migration|positive regulation of epithelial cell proliferation|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-2 complex|laminin-8 complex|perinuclear region of cytoplasm	extracellular matrix structural constituent	g.chr7:107603427C>A	M61916	CCDS5750.1	7q22	2013-03-01			ENSG00000091136	ENSG00000091136		"""Laminins"""	6486	protein-coding gene	gene with protein product		150240	"""cutis laxa with marfanoid phenotype"""	CLM		2563160, 2704655, 1864606	Standard	NM_002291		Approved		uc003vew.2	P07942	OTTHUMG00000149966	ENST00000222399.6:c.1780G>T	7.37:g.107603427C>A	ENSP00000222399:p.Gly594Trp		Somatic				LAMB1_uc003vev.2_Missense_Mutation_p.G618W|LAMB1_uc003vex.2_Missense_Mutation_p.G594W|LAMB1_uc010ljn.1_Missense_Mutation_p.G680W	p.G594W	NM_002291	NP_002282	WXS	Illumina HiSeq	Unspecified	P07942	LAMB1_HUMAN			15	2115	-			594			Laminin IV type B.		Q14D91	Missense_Mutation	SNP	ENST00000222399.6	37	c.1780G>T	CCDS5750.1	.	.	.	.	.	.	.	.	.	.	C	27.0	4.793951	0.90453	.	.	ENSG00000091136	ENST00000393561;ENST00000222399;ENST00000393560	T;T;T	0.43294	1.19;1.2;0.95	4.93	4.93	0.64822	Laminin IV (1);	.	.	.	.	T	0.70002	0.3174	M	0.86651	2.83	0.80722	D	1	D;D;D	0.76494	0.996;0.999;0.993	D;D;D	0.76071	0.941;0.987;0.961	T	0.76361	-0.2987	9	0.62326	D	0.03	.	18.1182	0.89563	0.0:1.0:0.0:0.0	.	594;594;618	E7EPA6;P07942;G3XAI2	.;LAMB1_HUMAN;.	W	618;594;594	ENSP00000377191:G618W;ENSP00000222399:G594W;ENSP00000377190:G594W	ENSP00000222399:G594W	G	-	1	0	LAMB1	107390663	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.377000	0.79668	2.291000	0.77112	0.563000	0.77884	GGG		0.502	LAMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314584.1	NM_002291		6	225	1	0	1.06961e-07	0.00308	1.45062e-07	6	225				
PTPRZ1	5803	broad.mit.edu	37	7	121651440	121651440	+	Silent	SNP	C	C	A	rs375140226		TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr7:121651440C>A	ENST00000393386.2	+	12	2751	c.2340C>A	c.(2338-2340)atC>atA	p.I780I	PTPRZ1_ENST00000483028.1_Intron|PTPRZ1_ENST00000449182.1_Intron	NM_001206838.1|NM_002851.2	NP_001193767.1|NP_002842.2	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type, Z polypeptide 1	780					axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|hematopoietic progenitor cell differentiation (GO:0002244)|learning or memory (GO:0007611)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)	integral component of plasma membrane (GO:0005887)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.I780I(2)		NS(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(12)|large_intestine(17)|liver(1)|lung(42)|ovary(4)|prostate(5)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	106						ACAATCAGATCCTCAACACTA	0.473																																							uc003vjy.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(3)|large_intestine(2)|lung(2)|central_nervous_system(1)|kidney(1)	9						c.(2338-2340)ATC>ATA		protein tyrosine phosphatase, receptor-type,		C	,,	0,4406		0,0,2203	254.0	219.0	231.0		,,2340	4.0	1.0	7		231	1,8599	1.2+/-3.3	0,1,4299	no	intron,intron,coding-synonymous	PTPRZ1	NM_001206838.1,NM_001206839.1,NM_002851.2	,,	0,1,6502	AA,AC,CC		0.0116,0.0,0.0077	,,	,,780/2316	121651440	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	5803				central nervous system development	integral to plasma membrane	protein binding|protein tyrosine/threonine phosphatase activity|transmembrane receptor protein tyrosine phosphatase activity	g.chr7:121651440C>A	M93426	CCDS34740.1, CCDS56505.1	7q31.3	2013-02-11			ENSG00000106278	ENSG00000106278		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9685	protein-coding gene	gene with protein product		176891		PTPZ, PTPRZ		7736789, 8387522	Standard	NM_001206838		Approved	PTP18, RPTPB, phosphacan	uc003vjy.3	P23471	OTTHUMG00000157057	ENST00000393386.2:c.2340C>A	7.37:g.121651440C>A			Somatic				PTPRZ1_uc003vjz.2_Intron|PTPRZ1_uc011knt.1_Intron	p.I780I	NM_002851	NP_002842	WXS	Illumina HiSeq	Unspecified	P23471	PTPRZ_HUMAN			12	2735	+			780			Extracellular (Potential).		A4D0W5|C9JFM0|O76043|Q9UDR6	Silent	SNP	ENST00000393386.2	37	c.2340C>A	CCDS34740.1																																																																																				0.473	PTPRZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347288.1	NM_002851		16	267	1	0	4.14922e-12	0.004007	6.7001e-12	16	267				
CLCN1	1180	broad.mit.edu	37	7	143013364	143013364	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr7:143013364C>A	ENST00000343257.2	+	1	146	c.59C>A	c.(58-60)cCc>cAc	p.P20H		NM_000083.2	NP_000074	P35523	CLCN1_HUMAN	chloride channel, voltage-sensitive 1	20					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|neuronal action potential propagation (GO:0019227)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	adenyl nucleotide binding (GO:0030554)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)	p.P20H(1)		breast(4)|central_nervous_system(1)|endometrium(1)|large_intestine(11)|lung(26)|ovary(3)|prostate(2)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	58	Melanoma(164;0.205)					GGTAGTGACCCCCAGTACCAG	0.642																																							uc003wcr.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5						c.(58-60)CCC>CAC		chloride channel 1, skeletal muscle							103.0	87.0	93.0					7																	143013364		2203	4300	6503	SO:0001583	missense	1180				muscle contraction	chloride channel complex|integral to plasma membrane	voltage-gated chloride channel activity	g.chr7:143013364C>A	Z25884	CCDS5881.1	7q12	2012-09-26	2012-02-23		ENSG00000188037	ENSG00000188037		"""Ion channels / Chloride channels : Voltage-sensitive"""	2019	protein-coding gene	gene with protein product	"""Thomsen disease, autosomal dominant"""	118425	"""chloride channel 1, skeletal muscle"""			1379744	Standard	NM_000083		Approved	CLC1, ClC-1	uc003wcr.1	P35523	OTTHUMG00000152695	ENST00000343257.2:c.59C>A	7.37:g.143013364C>A	ENSP00000339867:p.Pro20His		Somatic				CLCN1_uc011ktc.1_5'UTR	p.P20H	NM_000083	NP_000074	WXS	Illumina HiSeq	Unspecified	P35523	CLCN1_HUMAN			1	146	+	Melanoma(164;0.205)		20			Cytoplasmic (By similarity).		A4D2H5|Q2M202	Missense_Mutation	SNP	ENST00000343257.2	37	c.59C>A	CCDS5881.1	.	.	.	.	.	.	.	.	.	.	.	21.1	4.104490	0.77096	.	.	ENSG00000188037	ENST00000343257	D	0.88741	-2.42	5.19	5.19	0.71726	.	0.193026	0.34676	N	0.003768	D	0.93019	0.7778	L	0.54323	1.7	0.36686	D	0.879298	D	0.89917	1.0	D	0.87578	0.998	D	0.95081	0.8213	10	0.72032	D	0.01	.	16.9742	0.86309	0.0:1.0:0.0:0.0	.	20	P35523	CLCN1_HUMAN	H	20	ENSP00000339867:P20H	ENSP00000339867:P20H	P	+	2	0	CLCN1	142723486	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.419000	0.59835	2.427000	0.82271	0.650000	0.86243	CCC		0.642	CLCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327420.1	NM_000083		25	208	1	0	4.4004e-07	0.00333	5.8531e-07	25	208				
ABCB8	11194	broad.mit.edu	37	7	150732736	150732736	+	Silent	SNP	G	G	C	rs531746653		TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr7:150732736G>C	ENST00000297504.6	+	7	951	c.885G>C	c.(883-885)acG>acC	p.T295T	ABCB8_ENST00000358849.4_Silent_p.T278T|ABCB8_ENST00000498578.1_Silent_p.T278T|ABCB8_ENST00000477092.1_Silent_p.T278T|ABCB8_ENST00000542328.1_Silent_p.T190T|ABCB8_ENST00000477719.1_Silent_p.T278T|ABCB8_ENST00000356058.4_Silent_p.T315T			Q9NUT2	ABCB8_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 8	295	ABC transmembrane type-1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial envelope (GO:0005740)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)	p.T278T(1)		breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	26			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Doxorubicin(DB00997)	CACGCCTCACGCTGCTGCTGA	0.657																																							uc003wil.3		NA																	1	Substitution - coding silent(1)		lung(1)	breast(2)|upper_aerodigestive_tract(1)	3						c.(883-885)ACG>ACC		ATP-binding cassette, sub-family B, member 8							88.0	73.0	78.0					7																	150732736		2203	4300	6503	SO:0001819	synonymous_variant	11194					ATP-binding cassette (ABC) transporter complex|integral to membrane|membrane fraction|mitochondrial inner membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances	g.chr7:150732736G>C	AF047690	CCDS5913.1, CCDS64798.1, CCDS64799.1, CCDS64800.1	7q36.1	2012-05-16			ENSG00000197150	ENSG00000197150		"""ATP binding cassette transporters / subfamily B"""	49	protein-coding gene	gene with protein product	"""mitochondrial ABC protein"""	605464				8894702	Standard	NM_001282291		Approved	EST328128, M-ABC1, MABC1	uc003wik.4	Q9NUT2	OTTHUMG00000158686	ENST00000297504.6:c.885G>C	7.37:g.150732736G>C			Somatic				ABCB8_uc003wii.2_Silent_p.T315T|ABCB8_uc003wij.3_Silent_p.T278T|ABCB8_uc010lpw.1_Silent_p.T97T|ABCB8_uc010lpx.2_Silent_p.T278T|ABCB8_uc011kvd.1_Silent_p.T190T|ABCB8_uc003wim.3_Silent_p.T73T|ABCB8_uc003wik.3_Silent_p.T278T	p.T295T	NM_007188	NP_009119	WXS	Illumina HiSeq	Unspecified	Q9NUT2	ABCB8_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	7	978	+			295			ABC transmembrane type-1.		A5D8W3|B2RBL8|B3KND2|B4DG02|G3XAP3|O95787|Q53GM0	Silent	SNP	ENST00000297504.6	37	c.885G>C		.	.	.	.	.	.	.	.	.	.	G	6.942	0.543514	0.13250	.	.	ENSG00000197150	ENST00000491920	.	.	.	4.79	-9.59	0.00556	.	.	.	.	.	T	0.47097	0.1427	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.57010	-0.7884	4	.	.	.	-2.4516	9.0249	0.36222	0.1406:0.4259:0.4336:0.0	.	.	.	.	P	11	.	.	A	+	1	0	ABCB8	150363669	0.000000	0.05858	0.464000	0.27143	0.871000	0.50021	-3.707000	0.00387	-2.211000	0.00737	-1.080000	0.02220	GCT		0.657	ABCB8-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000351733.2	NM_007188		11	103	0	0	0	0.001855	0	11	103				
ABCF2	10061	broad.mit.edu	37	7	150915920	150915920	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr7:150915920C>A	ENST00000287844.2	-	9	1166	c.1057G>T	c.(1057-1059)Gcc>Tcc	p.A353S	ABCF2_ENST00000222388.2_Missense_Mutation_p.A353S|ABCF2_ENST00000473874.1_5'UTR	NM_007189.1	NP_009120.1	Q9UG63	ABCF2_HUMAN	ATP-binding cassette, sub-family F (GCN20), member 2	353					transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|membrane (GO:0016020)|mitochondrial envelope (GO:0005740)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|transporter activity (GO:0005215)	p.A353S(1)		breast(1)|central_nervous_system(1)|large_intestine(4)|lung(15)|ovary(1)|skin(2)	24			OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GCCTGCCGGGCCAGCTTGGCA	0.522																																							uc003wjp.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(1057-1059)GCC>TCC		ATP-binding cassette, sub-family F, member 2							111.0	102.0	105.0					7																	150915920		2203	4300	6503	SO:0001583	missense	10061					ATP-binding cassette (ABC) transporter complex|mitochondrial envelope	ATP binding|ATPase activity|transporter activity	g.chr7:150915920C>A	AJ005016	CCDS5922.1, CCDS5923.1	7q36.1	2012-03-14			ENSG00000033050	ENSG00000033050		"""ATP binding cassette transporters / subfamily F"""	71	protein-coding gene	gene with protein product		612510				8894702	Standard	NM_007189		Approved	EST133090, ABC28, M-ABC1, HUSSY-18	uc003wjo.1	Q9UG63	OTTHUMG00000154570	ENST00000287844.2:c.1057G>T	7.37:g.150915920C>A	ENSP00000287844:p.Ala353Ser		Somatic				ABCF2_uc003wjo.1_Missense_Mutation_p.A353S	p.A353S	NM_007189	NP_009120	WXS	Illumina HiSeq	Unspecified	Q9UG63	ABCF2_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	9	1168	-			353					O60864|Q75MJ0|Q75MJ1|Q96TE8	Missense_Mutation	SNP	ENST00000287844.2	37	c.1057G>T	CCDS5923.1	.	.	.	.	.	.	.	.	.	.	C	33	5.278925	0.95489	.	.	ENSG00000033050	ENST00000222388;ENST00000287844	D;D	0.92446	-2.99;-3.04	5.17	5.17	0.71159	.	0.104400	0.64402	D	0.000004	D	0.92724	0.7687	M	0.78801	2.425	0.80722	D	1	P;P	0.38250	0.624;0.624	B;B	0.42343	0.384;0.384	D	0.92172	0.5744	10	0.37606	T	0.19	-25.4992	15.9241	0.79603	0.0:1.0:0.0:0.0	.	353;353	Q9UG63;Q75MJ1	ABCF2_HUMAN;.	S	353	ENSP00000222388:A353S;ENSP00000287844:A353S	ENSP00000222388:A353S	A	-	1	0	ABCF2	150546853	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.225000	0.78051	2.419000	0.82065	0.558000	0.71614	GCC		0.522	ABCF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336086.1	NM_005692		25	131	1	0	2.81731e-10	0.002096	4.33032e-10	25	131				
HTR5A	3361	broad.mit.edu	37	7	154862977	154862977	+	Missense_Mutation	SNP	T	T	C	rs369204841		TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr7:154862977T>C	ENST00000287907.2	+	1	944	c.368T>C	c.(367-369)cTt>cCt	p.L123P	HTR5A-AS1_ENST00000395731.2_Missense_Mutation_p.S13G|HTR5A-AS1_ENST00000493904.1_5'UTR|HTR5A-AS1_ENST00000543018.1_Missense_Mutation_p.S13G	NM_024012.3	NP_076917.1	P47898	5HT5A_HUMAN	5-hydroxytryptamine (serotonin) receptor 5A, G protein-coupled	123					cAMP-mediated signaling (GO:0019933)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|hippocampus development (GO:0021766)|response to estradiol (GO:0032355)|serotonin receptor signaling pathway (GO:0007210)	dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	serotonin receptor activity (GO:0004993)	p.L123P(1)		NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(22)|ovary(2)|prostate(3)|stomach(1)	48	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0238)	UCEC - Uterine corpus endometrioid carcinoma (81;0.171)	Asenapine(DB06216)|Loxapine(DB00408)|Olanzapine(DB00334)	TGCGACGTGCTTTGCTGCACG	0.667																																							uc003wlu.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|large_intestine(1)	3						c.(367-369)CTT>CCT		5-hydroxytryptamine receptor 5A		T	PRO/LEU	0,4406		0,0,2203	68.0	52.0	58.0		368	4.5	1.0	7		58	1,8599	1.2+/-3.3	0,1,4299	no	missense	HTR5A	NM_024012.2	98	0,1,6502	CC,CT,TT		0.0116,0.0,0.0077	probably-damaging	123/358	154862977	1,13005	2203	4300	6503	SO:0001583	missense	3361					integral to plasma membrane	serotonin receptor activity	g.chr7:154862977T>C		CCDS5936.1	7q36.1	2012-08-08	2012-02-03		ENSG00000157219	ENSG00000157219		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5300	protein-coding gene	gene with protein product		601305	"""5-hydroxytryptamine (serotonin) receptor 5A"""			7988681	Standard	NM_024012		Approved	5-HT5A	uc003wlu.2	P47898	OTTHUMG00000151327	ENST00000287907.2:c.368T>C	7.37:g.154862977T>C	ENSP00000287907:p.Leu123Pro		Somatic				uc011kvt.1_Missense_Mutation_p.S13G|uc003wlt.2_Missense_Mutation_p.S13G	p.L123P	NM_024012	NP_076917	WXS	Illumina HiSeq	Unspecified	P47898	5HT5A_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0238)	UCEC - Uterine corpus endometrioid carcinoma (81;0.171)	1	432	+	all_neural(206;0.119)	all_hematologic(28;0.0592)	123			Helical; Name=3; (By similarity).		Q2M2D2	Missense_Mutation	SNP	ENST00000287907.2	37	c.368T>C	CCDS5936.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	20.3|20.3	3.969871|3.969871	0.74246|0.74246	0.0|0.0	1.16E-4|1.16E-4	ENSG00000157219|ENSG00000220575	ENST00000287907|ENST00000395731;ENST00000543018	T|.	0.74209|.	-0.82|.	4.52|4.52	4.52|4.52	0.55395|0.55395	GPCR, rhodopsin-like superfamily (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.80994|0.80994	0.4731|0.4731	H|H	0.97918|0.97918	4.105|4.105	0.80722|0.80722	D|D	1|1	D|P	0.89917|0.46142	1.0|0.873	D|B	0.85130|0.44044	0.997|0.439	D|D	0.88077|0.88077	0.2804|0.2804	10|8	0.87932|0.87932	D|D	0|0	.|.	14.0258|14.0258	0.64584|0.64584	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	123|13	P47898|B7Z8E6	5HT5A_HUMAN|.	P|G	123|13	ENSP00000287907:L123P|.	ENSP00000287907:L123P|ENSP00000379080:S13G	L|S	+|-	2|1	0|0	HTR5A|AC093726.4	154493910|154493910	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.719000|0.719000	0.41307|0.41307	7.523000|7.523000	0.81856|0.81856	1.896000|1.896000	0.54893|0.54893	0.460000|0.460000	0.39030|0.39030	CTT|AGC		0.667	HTR5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322240.1	NM_024012		10	32	0	0	0	0.001368	0	10	32				
PTPRN2	5799	broad.mit.edu	37	7	157929352	157929352	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr7:157929352G>T	ENST00000389418.4	-	8	1177	c.1168C>A	c.(1168-1170)Caa>Aaa	p.Q390K	PTPRN2_ENST00000389413.3_Missense_Mutation_p.Q390K|PTPRN2_ENST00000389416.4_Missense_Mutation_p.Q373K|PTPRN2_ENST00000404321.2_Missense_Mutation_p.Q413K|PTPRN2_ENST00000409483.1_Missense_Mutation_p.Q352K	NM_002847.3	NP_002838.2	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N polypeptide 2	390					negative regulation of GTPase activity (GO:0034260)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	endoplasmic reticulum lumen (GO:0005788)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)|secretory granule (GO:0030141)|terminal bouton (GO:0043195)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.Q390K(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(1)|lung(42)|ovary(4)|pleura(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	86	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		CTTACCTCTTGGTAAAGTCTA	0.413																																							uc003wno.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7						c.(1168-1170)CAA>AAA		protein tyrosine phosphatase, receptor type, N							184.0	143.0	156.0					7																	157929352		2203	4300	6503	SO:0001583	missense	5799					integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity	g.chr7:157929352G>T	AB002385	CCDS5947.1, CCDS5948.1, CCDS5949.1	7q36	2011-06-09			ENSG00000155093	ENSG00000155093		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9677	protein-coding gene	gene with protein product	"""IAR PTPRP"""	601698				8954911, 9220540	Standard	NM_130842		Approved	KIAA0387, phogrin, ICAAR, IA-2beta	uc003wno.3	Q92932	OTTHUMG00000152646	ENST00000389418.4:c.1168C>A	7.37:g.157929352G>T	ENSP00000374069:p.Gln390Lys		Somatic				PTPRN2_uc003wnp.2_Missense_Mutation_p.Q373K|PTPRN2_uc003wnq.2_Missense_Mutation_p.Q390K|PTPRN2_uc003wnr.2_Missense_Mutation_p.Q352K|PTPRN2_uc011kwa.1_Missense_Mutation_p.Q413K	p.Q390K	NM_002847	NP_002838	WXS	Illumina HiSeq	Unspecified	Q92932	PTPR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)	8	1289	-	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	390			Extracellular (Potential).		E9PC57|Q8N4I5|Q92662|Q9Y4F8|Q9Y4I6	Missense_Mutation	SNP	ENST00000389418.4	37	c.1168C>A	CCDS5947.1	.	.	.	.	.	.	.	.	.	.	G	5.409	0.260659	0.10239	.	.	ENSG00000155093	ENST00000409483;ENST00000389413;ENST00000389416;ENST00000389418;ENST00000404321	T;T;T;T;T	0.02606	4.23;4.24;4.23;4.23;4.23	4.54	-1.61	0.08399	.	.	.	.	.	T	0.01029	0.0034	N	0.02539	-0.55	0.09310	N	1	B;B;B;B;B	0.06786	0.001;0.0;0.0;0.0;0.0	B;B;B;B;B	0.04013	0.001;0.001;0.001;0.001;0.001	T	0.46233	-0.9206	9	0.05436	T	0.98	.	6.5044	0.22186	0.0:0.2532:0.5072:0.2396	.	413;352;390;373;390	Q92932-3;E7EM83;Q92932-2;E9PC57;Q92932	.;.;.;.;PTPR2_HUMAN	K	352;390;373;390;413	ENSP00000387114:Q352K;ENSP00000374064:Q390K;ENSP00000374067:Q373K;ENSP00000374069:Q390K;ENSP00000385464:Q413K	ENSP00000374064:Q390K	Q	-	1	0	PTPRN2	157622113	0.000000	0.05858	0.001000	0.08648	0.043000	0.13939	-1.527000	0.02227	-0.643000	0.05473	-0.321000	0.08615	CAA		0.413	PTPRN2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000353214.1			24	114	1	0	3.73148e-12	0.007291	6.04907e-12	24	114				
CSMD1	64478	broad.mit.edu	37	8	2949091	2949091	+	Missense_Mutation	SNP	C	C	T	rs201439492		TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr8:2949091C>T	ENST00000520002.1	-	49	7790	c.7235G>A	c.(7234-7236)cGc>cAc	p.R2412H	CSMD1_ENST00000602723.1_Missense_Mutation_p.R2412H|CSMD1_ENST00000400186.3_Missense_Mutation_p.R2412H|CSMD1_ENST00000542608.1_Missense_Mutation_p.R2411H|CSMD1_ENST00000602557.1_Missense_Mutation_p.R2412H|CSMD1_ENST00000537824.1_Missense_Mutation_p.R2411H			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	2412	CUB 14. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)		p.R2140H(1)|p.R2411H(1)		breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		AGTGGACCAGCGGAGATATAA	0.383																																							uc011kwk.1		NA																	2	Substitution - Missense(2)		lung(2)	breast(20)|large_intestine(5)	25						c.(7234-7236)CGC>CAC		CUB and Sushi multiple domains 1 precursor		C	HIS/ARG	0,3690		0,0,1845	111.0	106.0	107.0		7232	5.8	1.0	8		107	1,8167		0,1,4083	yes	missense	CSMD1	NM_033225.5	29	0,1,5928	TT,TC,CC		0.0122,0.0,0.0084	benign	2411/3565	2949091	1,11857	1845	4084	5929	SO:0001583	missense	64478					integral to membrane		g.chr8:2949091C>T			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.7235G>A	8.37:g.2949091C>T	ENSP00000430733:p.Arg2412His		Somatic				CSMD1_uc011kwj.1_Missense_Mutation_p.R1741H|CSMD1_uc010lrg.2_Missense_Mutation_p.R480H	p.R2412H	NM_033225	NP_150094	WXS	Illumina HiSeq	Unspecified	Q96PZ7	CSMD1_HUMAN		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)	48	7625	-		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)	2412			CUB 14.|Extracellular (Potential).		Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	37	c.7235G>A		.	.	.	.	.	.	.	.	.	.	C	16.49	3.136796	0.56936	0.0	1.22E-4	ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608	T;T;T;T	0.35973	1.28;1.28;1.28;1.28	5.8	5.8	0.92144	CUB (5);	0.000000	0.85682	D	0.000000	T	0.56775	0.2008	L	0.52011	1.625	0.80722	D	1	B;P;D	0.89917	0.302;0.791;1.0	B;P;D	0.91635	0.066;0.476;0.999	T	0.45948	-0.9226	10	0.34782	T	0.22	.	20.0421	0.97595	0.0:1.0:0.0:0.0	.	2412;2412;2411	E5RIG2;Q96PZ7;F5H2I8	.;CSMD1_HUMAN;.	H	2412;2412;2273;2411;2411	ENSP00000383047:R2412H;ENSP00000430733:R2412H;ENSP00000441462:R2411H;ENSP00000446243:R2411H	ENSP00000320445:R2273H	R	-	2	0	CSMD1	2936498	1.000000	0.71417	1.000000	0.80357	0.688000	0.40055	4.644000	0.61397	2.733000	0.93635	0.555000	0.69702	CGC		0.383	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225		8	30	0	0	0	0.006214	0	8	30				
RP1L1	94137	broad.mit.edu	37	8	10470413	10470413	+	Missense_Mutation	SNP	C	C	A	rs374843101		TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr8:10470413C>A	ENST00000382483.3	-	4	1418	c.1195G>T	c.(1195-1197)Ggg>Tgg	p.G399W		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	399					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)		p.G399W(1)|p.G399R(1)		breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		CCTGGCTGCCCGCCTCGGCCA	0.657																																							uc003wtc.2		NA																	2	Substitution - Missense(2)		lung(1)|kidney(1)	ovary(4)|breast(3)|central_nervous_system(1)	8						c.(1195-1197)GGG>TGG		retinitis pigmentosa 1-like 1							43.0	50.0	48.0					8																	10470413		1929	4130	6059	SO:0001583	missense	94137				intracellular signal transduction			g.chr8:10470413C>A	AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.1195G>T	8.37:g.10470413C>A	ENSP00000371923:p.Gly399Trp		Somatic					p.G399W	NM_178857	NP_849188	WXS	Illumina HiSeq	Unspecified	Q8IWN7	RP1L1_HUMAN		COAD - Colon adenocarcinoma(149;0.0811)	4	1424	-			399					Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Missense_Mutation	SNP	ENST00000382483.3	37	c.1195G>T	CCDS43708.1	.	.	.	.	.	.	.	.	.	.	C	13.19	2.162309	0.38217	.	.	ENSG00000183638	ENST00000382483	T	0.04502	3.61	4.7	-0.477	0.12097	.	1.566900	0.04684	U	0.412864	T	0.08268	0.0206	N	0.22421	0.69	0.09310	N	1	D	0.71674	0.998	D	0.65140	0.932	T	0.21965	-1.0230	10	0.49607	T	0.09	0.1054	1.5023	0.02479	0.3249:0.2719:0.2865:0.1167	.	399	A6NKC6	.	W	399	ENSP00000371923:G399W	ENSP00000371923:G399W	G	-	1	0	RP1L1	10507823	0.001000	0.12720	0.000000	0.03702	0.009000	0.06853	1.144000	0.31565	-0.159000	0.11021	-0.258000	0.10820	GGG		0.657	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1			11	102	1	0	0.000151284	0.001855	0.00017938	11	102				
KIAA1456	57604	broad.mit.edu	37	8	12878877	12878877	+	Missense_Mutation	SNP	C	C	A	rs377109904		TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr8:12878877C>A	ENST00000524591.2	+	5	1178	c.689C>A	c.(688-690)tCt>tAt	p.S230Y	KIAA1456_ENST00000447063.2_Intron	NM_001099677.1|NM_020844.2	NP_001093147.1|NP_065895.2	Q9P272	K1456_HUMAN	KIAA1456	230							methyltransferase activity (GO:0008168)	p.S143Y(1)|p.S230Y(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(4)	7						GCAAATATTTCTAAGGAAGGC	0.423																																							uc010lsq.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(688-690)TCT>TAT		hypothetical protein LOC57604 isoform 1							113.0	103.0	106.0					8																	12878877		1857	4104	5961	SO:0001583	missense	57604						methyltransferase activity	g.chr8:12878877C>A	BC035082	CCDS47808.1	8p22	2013-10-04	2011-02-23	2011-02-23	ENSG00000250305	ENSG00000250305			26725	protein-coding gene	gene with protein product		615666	"""chromosome 8 open reading frame 79"""	C8orf79		23381944	Standard	NM_020844		Approved	FLJ36980	uc010lsq.3	Q8N9K7	OTTHUMG00000165477	ENST00000524591.2:c.689C>A	8.37:g.12878877C>A	ENSP00000432695:p.Ser230Tyr		Somatic				C8orf79_uc011kxw.1_Intron|C8orf79_uc003wwj.3_Missense_Mutation_p.S143Y|C8orf79_uc010lsr.2_Missense_Mutation_p.S104Y	p.S230Y	NM_020844	NP_065895	WXS	Illumina HiSeq	Unspecified	Q9P272	K1456_HUMAN			5	1181	+			230					Q96AW6	Missense_Mutation	SNP	ENST00000524591.2	37	c.689C>A	CCDS47808.1	.	.	.	.	.	.	.	.	.	.	C	15.04	2.715766	0.48622	.	.	ENSG00000250305	ENST00000524591;ENST00000529978	T	0.12361	2.69	5.67	4.78	0.61160	.	0.742732	0.12141	N	0.495820	T	0.15349	0.0370	M	0.64997	1.995	0.27592	N	0.949247	P	0.35383	0.498	B	0.37304	0.246	T	0.16600	-1.0397	10	0.02654	T	1	-1.8066	11.9414	0.52903	0.0:0.81:0.1229:0.0671	.	230	Q9P272	K1456_HUMAN	Y	230;143	ENSP00000432695:S230Y	ENSP00000432695:S230Y	S	+	2	0	AC135352.2	12923248	0.002000	0.14202	0.015000	0.15790	0.414000	0.31173	1.584000	0.36589	1.509000	0.48786	0.650000	0.86243	TCT		0.423	KIAA1456-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383262.2	NM_001099677		10	128	1	0	0.00136819	0.001368	0.00153046	10	128				
CNOT7	29883	broad.mit.edu	37	8	17090038	17090038	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr8:17090038T>A	ENST00000361272.4	-	6	925	c.627A>T	c.(625-627)ttA>ttT	p.L209F	CNOT7_ENST00000523917.1_Missense_Mutation_p.L209F	NM_013354.5	NP_037486.2	Q9UIV1	CNOT7_HUMAN	CCR4-NOT transcription complex, subunit 7	209					carbohydrate metabolic process (GO:0005975)|cytoplasmic mRNA processing body assembly (GO:0033962)|deadenylation-dependent decapping of nuclear-transcribed mRNA (GO:0000290)|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|gene silencing by miRNA (GO:0035195)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of cell proliferation (GO:0008285)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cell proliferation (GO:0008284)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	3'-5'-exoribonuclease activity (GO:0000175)|exoribonuclease activity (GO:0004532)|metal ion binding (GO:0046872)|poly(A)-specific ribonuclease activity (GO:0004535)|RNA binding (GO:0003723)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)	p.L209F(1)		central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(6)	11				Colorectal(111;0.0523)|COAD - Colon adenocarcinoma(73;0.209)		CCACCTCCTGTAATCCACCCT	0.378																																							uc003wxf.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(625-627)TTA>TTT		CCR4-NOT transcription complex, subunit 7							145.0	146.0	145.0					8																	17090038		2203	4300	6503	SO:0001583	missense	29883				carbohydrate metabolic process|nuclear-transcribed mRNA poly(A) tail shortening	CCR4-NOT complex|cytoplasmic mRNA processing body|cytosol	nucleic acid binding|protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity	g.chr8:17090038T>A	L46722	CCDS6000.2, CCDS55202.1	8p22-p21.3	2008-08-07			ENSG00000198791	ENSG00000198791			14101	protein-coding gene	gene with protein product	"""BTG1 binding factor 1"""	604913		CAF1		10637334, 1538749, 17264152	Standard	XM_005273481		Approved		uc003wxg.1	Q9UIV1	OTTHUMG00000096971	ENST00000361272.4:c.627A>T	8.37:g.17090038T>A	ENSP00000355279:p.Leu209Phe		Somatic				CNOT7_uc003wxg.1_Missense_Mutation_p.L209F|CNOT7_uc003wxh.1_Missense_Mutation_p.L209F	p.L209F	NM_013354	NP_037486	WXS	Illumina HiSeq	Unspecified	Q9UIV1	CNOT7_HUMAN		Colorectal(111;0.0523)|COAD - Colon adenocarcinoma(73;0.209)	6	795	-			209					A8MZM5|B3KMP1|B3KN35|D3DSP6|G3V108|Q7Z530	Missense_Mutation	SNP	ENST00000361272.4	37	c.627A>T	CCDS6000.2	.	.	.	.	.	.	.	.	.	.	T	22.0	4.231806	0.79688	.	.	ENSG00000198791	ENST00000361272;ENST00000523917	T;T	0.74632	-0.86;-0.86	5.3	-3.15	0.05233	Ribonuclease H-like (1);	0.000000	0.85682	D	0.000000	D	0.89767	0.6810	H	0.97896	4.1	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.91759	0.5418	10	0.87932	D	0	-11.9539	15.925	0.79609	0.0:0.6918:0.0:0.3082	.	209;209	G3V108;Q9UIV1	.;CNOT7_HUMAN	F	209	ENSP00000355279:L209F;ENSP00000429093:L209F	ENSP00000355279:L209F	L	-	3	2	CNOT7	17134409	0.124000	0.22315	0.985000	0.45067	0.991000	0.79684	-0.456000	0.06754	-0.409000	0.07553	0.533000	0.62120	TTA		0.378	CNOT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214038.1	NM_013354		15	167	0	0	0	0.004007	0	15	167				
CNOT7	29883	broad.mit.edu	37	8	17090042	17090042	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr8:17090042C>A	ENST00000361272.4	-	6	921	c.623G>T	c.(622-624)gGa>gTa	p.G208V	CNOT7_ENST00000523917.1_Missense_Mutation_p.G208V	NM_013354.5	NP_037486.2	Q9UIV1	CNOT7_HUMAN	CCR4-NOT transcription complex, subunit 7	208					carbohydrate metabolic process (GO:0005975)|cytoplasmic mRNA processing body assembly (GO:0033962)|deadenylation-dependent decapping of nuclear-transcribed mRNA (GO:0000290)|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|gene silencing by miRNA (GO:0035195)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of cell proliferation (GO:0008285)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cell proliferation (GO:0008284)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	3'-5'-exoribonuclease activity (GO:0000175)|exoribonuclease activity (GO:0004532)|metal ion binding (GO:0046872)|poly(A)-specific ribonuclease activity (GO:0004535)|RNA binding (GO:0003723)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)	p.G208V(1)		central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(6)	11				Colorectal(111;0.0523)|COAD - Colon adenocarcinoma(73;0.209)		CTCCTGTAATCCACCCTAGAA	0.368																																							uc003wxf.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(622-624)GGA>GTA		CCR4-NOT transcription complex, subunit 7							134.0	136.0	135.0					8																	17090042		2203	4300	6503	SO:0001583	missense	29883				carbohydrate metabolic process|nuclear-transcribed mRNA poly(A) tail shortening	CCR4-NOT complex|cytoplasmic mRNA processing body|cytosol	nucleic acid binding|protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity	g.chr8:17090042C>A	L46722	CCDS6000.2, CCDS55202.1	8p22-p21.3	2008-08-07			ENSG00000198791	ENSG00000198791			14101	protein-coding gene	gene with protein product	"""BTG1 binding factor 1"""	604913		CAF1		10637334, 1538749, 17264152	Standard	XM_005273481		Approved		uc003wxg.1	Q9UIV1	OTTHUMG00000096971	ENST00000361272.4:c.623G>T	8.37:g.17090042C>A	ENSP00000355279:p.Gly208Val		Somatic				CNOT7_uc003wxg.1_Missense_Mutation_p.G208V|CNOT7_uc003wxh.1_Missense_Mutation_p.G208V	p.G208V	NM_013354	NP_037486	WXS	Illumina HiSeq	Unspecified	Q9UIV1	CNOT7_HUMAN		Colorectal(111;0.0523)|COAD - Colon adenocarcinoma(73;0.209)	6	791	-			208					A8MZM5|B3KMP1|B3KN35|D3DSP6|G3V108|Q7Z530	Missense_Mutation	SNP	ENST00000361272.4	37	c.623G>T	CCDS6000.2	.	.	.	.	.	.	.	.	.	.	C	26.8	4.774652	0.90108	.	.	ENSG00000198791	ENST00000361272;ENST00000523917	T;T	0.25579	1.79;1.79	5.3	5.3	0.74995	Ribonuclease H-like (1);	0.000000	0.85682	D	0.000000	T	0.68568	0.3015	H	0.97240	3.965	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.80202	-0.1480	10	0.87932	D	0	-15.7561	19.852	0.96744	0.0:1.0:0.0:0.0	.	208;208	G3V108;Q9UIV1	.;CNOT7_HUMAN	V	208	ENSP00000355279:G208V;ENSP00000429093:G208V	ENSP00000355279:G208V	G	-	2	0	CNOT7	17134413	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.487000	0.81328	2.861000	0.98227	0.655000	0.94253	GGA		0.368	CNOT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214038.1	NM_013354		15	159	1	0	6.72482e-11	0.003163	1.05712e-10	15	159				
AGPAT6	137964	broad.mit.edu	37	8	41476485	41476485	+	Silent	SNP	G	G	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr8:41476485G>A	ENST00000396987.3	+	12	2178	c.1251G>A	c.(1249-1251)gtG>gtA	p.V417V	RP11-360L9.8_ENST00000581909.1_RNA	NM_178819.3	NP_848934.1	Q86UL3	GPAT4_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 6	417					acyl-CoA metabolic process (GO:0006637)|CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|diacylglycerol metabolic process (GO:0046339)|fatty acid metabolic process (GO:0006631)|glandular epithelial cell maturation (GO:0002071)|glycerophospholipid biosynthetic process (GO:0046474)|lactation (GO:0007595)|lipid biosynthetic process (GO:0008610)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glycerol-3-phosphate O-acyltransferase activity (GO:0004366)	p.V417V(1)		endometrium(3)|kidney(2)|large_intestine(3)|lung(6)	14	Ovarian(28;0.00769)|Colorectal(14;0.0202)|Lung SC(25;0.211)	all_lung(54;0.0131)|Lung NSC(58;0.0363)|Hepatocellular(245;0.0462)|Esophageal squamous(32;0.0844)	OV - Ovarian serous cystadenocarcinoma(14;0.00126)|Colorectal(10;0.0014)|Lung(22;0.00177)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0147)			GAGGACTTGTGGACCTGCTGT	0.498																																							uc003xnz.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1249-1251)GTG>GTA		lysophosphatidic acid acyltransferase zeta							124.0	108.0	113.0					8																	41476485		2203	4300	6503	SO:0001819	synonymous_variant	137964				acyl-CoA metabolic process|lactation|phosphatidylcholine biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|membrane fraction	glycerol-3-phosphate O-acyltransferase activity	g.chr8:41476485G>A	AF406612	CCDS6117.1	8p11.21	2013-02-05	2013-02-05			ENSG00000158669	2.3.1.15	"""1-acylglycerol-3-phosphate O-acyltransferases"""	20880	protein-coding gene	gene with protein product	"""lysophosphatidic acid acyltransferase, zeta"""	608143	"""1-acylglycerol-3-phosphate O-acyltransferase 6 (lysophosphatidic acid acyltransferase, zeta)"""			12938015	Standard	NM_178819		Approved	DKFZp586M1819, LPAAT-zeta	uc003xnz.2	Q86UL3		ENST00000396987.3:c.1251G>A	8.37:g.41476485G>A			Somatic					p.V417V	NM_178819	NP_848934	WXS	Illumina HiSeq	Unspecified	Q86UL3	GPAT4_HUMAN	OV - Ovarian serous cystadenocarcinoma(14;0.00126)|Colorectal(10;0.0014)|Lung(22;0.00177)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0147)		12	2190	+	Ovarian(28;0.00769)|Colorectal(14;0.0202)|Lung SC(25;0.211)	all_lung(54;0.0131)|Lung NSC(58;0.0363)|Hepatocellular(245;0.0462)|Esophageal squamous(32;0.0844)	417					Q86V89	Silent	SNP	ENST00000396987.3	37	c.1251G>A	CCDS6117.1																																																																																				0.498	AGPAT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377158.1	NM_178819		12	58	0	0	0	0.000978	0	12	58				
SNTG1	54212	broad.mit.edu	37	8	51362272	51362272	+	Silent	SNP	C	C	G			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr8:51362272C>G	ENST00000522124.1	+	6	925	c.264C>G	c.(262-264)tcC>tcG	p.S88S	SNTG1_ENST00000517473.1_Silent_p.S88S|SNTG1_ENST00000276467.5_Silent_p.S88S|SNTG1_ENST00000518864.1_Silent_p.S88S	NM_018967.2	NP_061840.1	Q9NSN8	SNTG1_HUMAN	syntrophin, gamma 1	88	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell communication (GO:0007154)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)|syntrophin complex (GO:0016013)	protein C-terminus binding (GO:0008022)	p.S88S(2)		NS(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(36)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	66		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)				CAAAAATCTCCAAGGAACAAA	0.313																																							uc010lxy.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(5)	5						c.(262-264)TCC>TCG		syntrophin, gamma 1							73.0	71.0	72.0					8																	51362272		2203	4300	6503	SO:0001819	synonymous_variant	54212				cell communication	cytoplasm|cytoskeleton|nucleus|ruffle membrane|syntrophin complex	actin binding|protein C-terminus binding	g.chr8:51362272C>G	AJ003030	CCDS6147.1, CCDS75737.1	8q11-q12	2008-07-03				ENSG00000147481			13740	protein-coding gene	gene with protein product		608714				10747910	Standard	NM_018967		Approved	SYN4, G1SYN	uc003xqs.1	Q9NSN8		ENST00000522124.1:c.264C>G	8.37:g.51362272C>G			Somatic				SNTG1_uc003xqs.1_Silent_p.S88S|SNTG1_uc010lxz.1_Silent_p.S88S|SNTG1_uc011ldl.1_RNA	p.S88S	NM_018967	NP_061840	WXS	Illumina HiSeq	Unspecified	Q9NSN8	SNTG1_HUMAN			7	635	+		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)	88			PDZ.		Q2M3Q0|Q9NY98	Silent	SNP	ENST00000522124.1	37	c.264C>G	CCDS6147.1																																																																																				0.313	SNTG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377964.1			5	27	0	0	0	0.000602	0	5	27				
TRPA1	8989	broad.mit.edu	37	8	72942164	72942164	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr8:72942164T>A	ENST00000262209.4	-	24	3116	c.2909A>T	c.(2908-2910)cAt>cTt	p.H970L	RP11-383H13.1_ENST00000537896.1_Intron|RP11-383H13.1_ENST00000524152.1_Intron|RP11-383H13.1_ENST00000457356.4_Intron	NM_007332.2	NP_015628.2	O75762	TRPA1_HUMAN	transient receptor potential cation channel, subfamily A, member 1	970					calcium ion transmembrane transport (GO:0070588)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to pain (GO:0048265)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium bundle (GO:0032421)	calcium channel activity (GO:0005262)|channel activity (GO:0015267)	p.H970L(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(26)|lung(44)|ovary(4)|prostate(6)|stomach(1)	98			Epithelial(68;0.223)		Menthol(DB00825)	CAATGATGCATGTTTCTGGAC	0.388																																							uc003xza.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|lung(1)|kidney(1)	6						c.(2908-2910)CAT>CTT		ankyrin-like protein 1	Menthol(DB00825)						125.0	98.0	107.0					8																	72942164		2203	4300	6503	SO:0001583	missense	8989					integral to plasma membrane		g.chr8:72942164T>A	Y10601	CCDS34908.1	8q13	2013-01-10	2003-11-20	2003-11-20	ENSG00000104321	ENSG00000104321		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	497	protein-coding gene	gene with protein product		604775	"""ankyrin-like with transmembrane domains 1"""	ANKTM1		16382100	Standard	NM_007332		Approved		uc003xza.3	O75762	OTTHUMG00000164516	ENST00000262209.4:c.2909A>T	8.37:g.72942164T>A	ENSP00000262209:p.His970Leu		Somatic				uc011lff.1_Intron|uc003xyy.2_Intron	p.H970L	NM_007332	NP_015628	WXS	Illumina HiSeq	Unspecified	O75762	TRPA1_HUMAN	Epithelial(68;0.223)		24	3084	-			970			Cytoplasmic (Potential).		A6NIN6	Missense_Mutation	SNP	ENST00000262209.4	37	c.2909A>T	CCDS34908.1	.	.	.	.	.	.	.	.	.	.	T	14.96	2.691755	0.48097	.	.	ENSG00000104321	ENST00000523582;ENST00000262209	T;T	0.32272	1.46;1.46	6.03	4.86	0.63082	.	0.140401	0.64402	D	0.000008	T	0.29389	0.0732	L	0.60455	1.87	0.37652	D	0.922444	B	0.27450	0.179	B	0.24974	0.057	T	0.18304	-1.0341	10	0.52906	T	0.07	-24.387	9.251	0.37555	0.1222:0.0:0.1281:0.7497	.	970	O75762	TRPA1_HUMAN	L	822;970	ENSP00000428151:H822L;ENSP00000262209:H970L	ENSP00000262209:H970L	H	-	2	0	TRPA1	73104718	1.000000	0.71417	0.997000	0.53966	0.968000	0.65278	3.870000	0.56070	1.089000	0.41292	0.533000	0.62120	CAT		0.388	TRPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379079.2	NM_007332		16	61	0	0	0	0.004007	0	16	61				
ZFHX4	79776	broad.mit.edu	37	8	77764254	77764254	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr8:77764254G>T	ENST00000521891.2	+	10	5545	c.5097G>T	c.(5095-5097)caG>caT	p.Q1699H	ZFHX4_ENST00000518282.1_Missense_Mutation_p.Q1673H|ZFHX4_ENST00000050961.6_Missense_Mutation_p.Q1654H|ZFHX4_ENST00000455469.2_Missense_Mutation_p.Q1654H	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	1654	Gln-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.Q1699H(1)		NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			TGCAACTACAGCACGAATTAC	0.438										HNSCC(33;0.089)																													uc003yav.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(8)|large_intestine(4)|breast(2)|lung(1)	15						c.(4960-4962)CAG>CAT		zinc finger homeodomain 4							108.0	107.0	107.0					8																	77764254		2059	4233	6292	SO:0001583	missense	79776					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:77764254G>T		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.5097G>T	8.37:g.77764254G>T	ENSP00000430497:p.Gln1699His	HNSCC(33;0.089)	Somatic				ZFHX4_uc003yau.1_Missense_Mutation_p.Q1699H|ZFHX4_uc003yaw.1_Missense_Mutation_p.Q1654H	p.Q1654H	NM_024721	NP_078997	WXS	Illumina HiSeq	Unspecified	Q86UP3	ZFHX4_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.0895)		10	5349	+			1654			Gln-rich.		G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	c.4962G>T	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	G	8.073	0.770642	0.15983	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.59906	0.23;0.3;0.27;0.26	4.48	1.71	0.24356	.	0.000000	0.42294	U	0.000733	T	0.68568	0.3015	M	0.68593	2.085	0.54753	D	0.99998	D;D;D	0.69078	0.995;0.997;0.997	D;D;D	0.81914	0.99;0.995;0.995	T	0.66348	-0.5946	10	0.66056	D	0.02	.	7.6567	0.28379	0.3292:0.0:0.6708:0.0	.	1654;1654;1699	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	H	1699;1699;1654;1654;1673	ENSP00000430497:Q1699H;ENSP00000399605:Q1654H;ENSP00000050961:Q1654H;ENSP00000430848:Q1673H	ENSP00000050961:Q1654H	Q	+	3	2	ZFHX4	77926809	1.000000	0.71417	0.990000	0.47175	0.990000	0.78478	0.797000	0.26999	0.251000	0.21505	0.637000	0.83480	CAG		0.438	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721		7	89	1	0	5.4927e-09	0.004482	7.99815e-09	7	89				
SLC7A13	157724	broad.mit.edu	37	8	87242421	87242421	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr8:87242421G>T	ENST00000297524.3	-	1	189	c.86C>A	c.(85-87)gCa>gAa	p.A29E	SLC7A13_ENST00000419776.2_Missense_Mutation_p.A29E|SLC7A13_ENST00000520624.1_Intron	NM_138817.2	NP_620172.2	Q8TCU3	S7A13_HUMAN	solute carrier family 7 (anionic amino acid transporter), member 13	29						integral component of membrane (GO:0016021)	amino acid transmembrane transporter activity (GO:0015171)	p.A29E(1)		breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	45						AAAAATTCCTGCACCAATGAT	0.453																																							uc003ydq.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(85-87)GCA>GAA		solute carrier family 7, (cationic amino acid							80.0	73.0	76.0					8																	87242421		2203	4300	6503	SO:0001583	missense	157724					integral to membrane	amino acid transmembrane transporter activity	g.chr8:87242421G>T	AJ417661	CCDS34917.1	8q21.3	2013-07-15	2011-07-12		ENSG00000164893	ENSG00000164893		"""Solute carriers"""	23092	protein-coding gene	gene with protein product						11907033, 11943479	Standard	XM_005250804		Approved	AGT-1, XAT2	uc003ydq.1	Q8TCU3	OTTHUMG00000163663	ENST00000297524.3:c.86C>A	8.37:g.87242421G>T	ENSP00000297524:p.Ala29Glu		Somatic				SLC7A13_uc003ydr.1_Missense_Mutation_p.A29E	p.A29E	NM_138817	NP_620172	WXS	Illumina HiSeq	Unspecified	Q8TCU3	S7A13_HUMAN			1	184	-			29			Helical; Name=1; (Potential).		Q05C37|Q08AH9|Q96N84	Missense_Mutation	SNP	ENST00000297524.3	37	c.86C>A	CCDS34917.1	.	.	.	.	.	.	.	.	.	.	G	15.18	2.758298	0.49468	.	.	ENSG00000164893	ENST00000297524;ENST00000419776	D;D	0.91068	-2.78;-2.78	3.74	1.95	0.26073	Amino acid permease domain (1);	0.104628	0.42172	D	0.000756	D	0.92954	0.7758	M	0.73962	2.25	0.31520	N	0.662558	D;D	0.63880	0.968;0.993	P;D	0.63113	0.738;0.911	D	0.91075	0.4895	10	0.87932	D	0	.	8.3752	0.32438	0.2008:0.0:0.7992:0.0	.	29;29	Q8TCU3-2;Q8TCU3	.;S7A13_HUMAN	E	29	ENSP00000297524:A29E;ENSP00000410982:A29E	ENSP00000297524:A29E	A	-	2	0	SLC7A13	87311537	0.997000	0.39634	0.133000	0.22050	0.536000	0.34869	1.878000	0.39608	0.555000	0.29079	0.609000	0.83330	GCA		0.453	SLC7A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374704.1	NM_138817		8	94	1	0	0.000157383	0.00308	0.000184503	8	94				
SNTB1	6641	broad.mit.edu	37	8	121706136	121706136	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr8:121706136C>A	ENST00000395601.3	-	3	998	c.584G>T	c.(583-585)cGa>cTa	p.R195L	SNTB1_ENST00000517992.1_Missense_Mutation_p.R195L|SNTB1_ENST00000519177.1_5'UTR	NM_021021.3	NP_066301.1	Q13884	SNTB1_HUMAN	syntrophin, beta 1 (dystrophin-associated protein A1, 59kDa, basic component 1)	195	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.|PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				muscle contraction (GO:0006936)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|focal adhesion (GO:0005925)|protein complex (GO:0043234)|synapse (GO:0045202)		p.R195L(1)|p.R195P(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(10)|prostate(2)|skin(6)	24	Lung NSC(37;4.46e-09)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)		STAD - Stomach adenocarcinoma(47;0.00503)			CGTGGCTTCTCGCATGTACTT	0.483																																							uc010mdg.2		NA																	2	Substitution - Missense(2)		lung(2)	skin(5)	5						c.(583-585)CGA>CTA		basic beta 1 syntrophin							75.0	79.0	78.0					8																	121706136		2203	4300	6503	SO:0001583	missense	6641				muscle contraction	cell junction|cytoplasm|cytoskeleton|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|calmodulin binding	g.chr8:121706136C>A	AF028828	CCDS6334.1	8q23-q24	2013-01-10	2002-08-29		ENSG00000172164	ENSG00000172164		"""Pleckstrin homology (PH) domain containing"""	11168	protein-coding gene	gene with protein product	"""tax interaction protein 43"""	600026	"""syntrophin, beta 1 (dystrophin-associated protein A1, 59kD, basic component 1)"""	SNT2B1		8183929, 9482110	Standard	NM_021021		Approved	59-DAP, A1B, BSYN2, TIP-43, SNT2	uc010mdg.3	Q13884	OTTHUMG00000165041	ENST00000395601.3:c.584G>T	8.37:g.121706136C>A	ENSP00000378965:p.Arg195Leu		Somatic				SNTB1_uc003ype.2_Missense_Mutation_p.R195L	p.R195L	NM_021021	NP_066301	WXS	Illumina HiSeq	Unspecified	Q13884	SNTB1_HUMAN	STAD - Stomach adenocarcinoma(47;0.00503)		2	810	-	Lung NSC(37;4.46e-09)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)		195			PH 1.|PDZ.		A8K9E0|O14912|Q4KMG8	Missense_Mutation	SNP	ENST00000395601.3	37	c.584G>T	CCDS6334.1	.	.	.	.	.	.	.	.	.	.	C	32	5.122012	0.94429	.	.	ENSG00000172164	ENST00000395601;ENST00000517992	T;T	0.58940	0.3;0.3	5.44	5.44	0.79542	PDZ/DHR/GLGF (3);Pleckstrin homology domain (2);	0.000000	0.85682	D	0.000000	T	0.73418	0.3584	L	0.56124	1.755	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.87578	0.975;0.998	T	0.72017	-0.4417	10	0.49607	T	0.09	.	19.443	0.94831	0.0:1.0:0.0:0.0	.	195;195	Q13884;Q13884-2	SNTB1_HUMAN;.	L	195	ENSP00000378965:R195L;ENSP00000431124:R195L	ENSP00000378965:R195L	R	-	2	0	SNTB1	121775317	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.016000	0.76393	2.814000	0.96858	0.655000	0.94253	CGA		0.483	SNTB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381535.1	NM_021021		11	76	1	0	0.00185496	0.001855	0.00206938	11	76				
TG	7038	broad.mit.edu	37	8	133953768	133953768	+	Silent	SNP	C	C	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr8:133953768C>A	ENST00000220616.4	+	26	5254	c.5214C>A	c.(5212-5214)gtC>gtA	p.V1738V	TG_ENST00000377869.1_Silent_p.V1681V|TG_ENST00000542445.1_Intron	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	1738					hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)		p.V1738V(1)		NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		ATGGCTTCGTCCTCACACAGG	0.542																																							uc003ytw.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(8)|breast(4)|pancreas(1)|central_nervous_system(1)|skin(1)	15						c.(5212-5214)GTC>GTA		thyroglobulin precursor							139.0	111.0	120.0					8																	133953768		2203	4300	6503	SO:0001819	synonymous_variant	7038				hormone biosynthetic process|signal transduction|thyroid gland development|thyroid hormone generation	extracellular space	hormone activity	g.chr8:133953768C>A	AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.5214C>A	8.37:g.133953768C>A			Somatic				TG_uc010mdw.2_Silent_p.V497V|TG_uc011ljb.1_Intron	p.V1738V	NM_003235	NP_003226	WXS	Illumina HiSeq	Unspecified	P01266	THYG_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)	26	5255	+	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	1738			Type IIIB.		O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Silent	SNP	ENST00000220616.4	37	c.5214C>A	CCDS34944.1																																																																																				0.542	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379606.1	NM_003235		13	79	1	0	0.000308642	0.003163	0.00035481	13	79				
FAM135B	51059	broad.mit.edu	37	8	139180236	139180236	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr8:139180236C>A	ENST00000395297.1	-	12	1330	c.1160G>T	c.(1159-1161)aGc>aTc	p.S387I		NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B	387								p.S387I(2)		NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			CGGGGGCATGCTAGTGAGGTA	0.607										HNSCC(54;0.14)																													uc003yuy.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(7)|skin(2)	9						c.(1159-1161)AGC>ATC		hypothetical protein LOC51059							110.0	118.0	115.0					8																	139180236		2110	4227	6337	SO:0001583	missense	51059							g.chr8:139180236C>A	AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.1160G>T	8.37:g.139180236C>A	ENSP00000378710:p.Ser387Ile	HNSCC(54;0.14)	Somatic				FAM135B_uc003yux.2_Missense_Mutation_p.S288I|FAM135B_uc003yuz.2_RNA	p.S387I	NM_015912	NP_056996	WXS	Illumina HiSeq	Unspecified	Q49AJ0	F135B_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.0805)		12	1331	-	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		387					B5MDB3|O95879|Q2WGJ7|Q3KP46	Missense_Mutation	SNP	ENST00000395297.1	37	c.1160G>T	CCDS6375.2	.	.	.	.	.	.	.	.	.	.	C	16.62	3.173669	0.57584	.	.	ENSG00000147724	ENST00000395297	D	0.88975	-2.45	5.66	4.79	0.61399	.	0.152808	0.64402	D	0.000015	D	0.85305	0.5666	L	0.54323	1.7	0.25339	N	0.988962	P	0.35383	0.498	B	0.31191	0.125	T	0.79478	-0.1787	10	0.56958	D	0.05	-19.7898	13.5222	0.61574	0.0:0.5847:0.4153:0.0	.	387	Q49AJ0	F135B_HUMAN	I	387	ENSP00000378710:S387I	ENSP00000276737:S387I	S	-	2	0	FAM135B	139249418	1.000000	0.71417	1.000000	0.80357	0.464000	0.32679	2.092000	0.41700	1.534000	0.49203	0.655000	0.94253	AGC		0.607	FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313590.3	NM_015912		32	152	1	0	1.62565e-12	0.002445	2.65608e-12	32	152				
SPATC1	375686	broad.mit.edu	37	8	145095635	145095635	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr8:145095635T>A	ENST00000377470.3	+	3	1035	c.933T>A	c.(931-933)agT>agA	p.S311R	SPATC1_ENST00000447830.2_Missense_Mutation_p.S311R	NM_198572.2	NP_940974.2	Q76KD6	SPERI_HUMAN	spermatogenesis and centriole associated 1	311						centrosome (GO:0005813)|cytoplasm (GO:0005737)		p.S311R(1)|p.S220R(1)		NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	15	all_cancers(97;8.2e-11)|all_epithelial(106;1.1e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;6.79e-41)|Epithelial(56;1.02e-39)|all cancers(56;3.67e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CCCAGCCCAGTGCCGCCCAGG	0.677																																							uc011lkw.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|central_nervous_system(1)	2						c.(931-933)AGT>AGA		spermatogenesis and centriole associated 1							175.0	80.0	112.0					8																	145095635		2203	4300	6503	SO:0001583	missense	375686							g.chr8:145095635T>A	BC053547	CCDS6413.2, CCDS47937.1	8q24.3	2005-01-11			ENSG00000186583	ENSG00000186583			30510	protein-coding gene	gene with protein product		610874				15280373	Standard	NM_198572		Approved	MGC61633, SPATA15, SPERIOLIN	uc011lkw.2	Q76KD6	OTTHUMG00000156976	ENST00000377470.3:c.933T>A	8.37:g.145095635T>A	ENSP00000366690:p.Ser311Arg		Somatic				SPATC1_uc011lkx.1_Missense_Mutation_p.S311R	p.S311R	NM_198572	NP_940974	WXS	Illumina HiSeq	Unspecified	Q76KD6	SPERI_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;6.79e-41)|Epithelial(56;1.02e-39)|all cancers(56;3.67e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)		3	1035	+	all_cancers(97;8.2e-11)|all_epithelial(106;1.1e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		311					B4DWW9|Q5U5I8|Q7Z6L7	Missense_Mutation	SNP	ENST00000377470.3	37	c.933T>A	CCDS6413.2	.	.	.	.	.	.	.	.	.	.	T	12.17	1.858071	0.32791	.	.	ENSG00000186583	ENST00000377470;ENST00000447830	T	0.54675	0.56	4.56	-1.18	0.09617	.	1.372080	0.04937	N	0.458044	T	0.42539	0.1207	L	0.36672	1.1	0.09310	N	1	P;P	0.40794	0.729;0.514	P;B	0.44518	0.452;0.354	T	0.28427	-1.0044	10	0.16896	T	0.51	0.8817	4.0604	0.09836	0.0:0.3104:0.1814:0.5082	.	311;311	B4DWW9;Q76KD6	.;SPERI_HUMAN	R	311	ENSP00000366690:S311R	ENSP00000366690:S311R	S	+	3	2	SPATC1	145167623	0.001000	0.12720	0.000000	0.03702	0.002000	0.02628	0.393000	0.20817	-0.050000	0.13356	0.459000	0.35465	AGT		0.677	SPATC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000346926.1	NM_198572		9	42	0	0	0	0.006214	0	9	42				
MROH1	727957	broad.mit.edu	37	8	145235188	145235188	+	Silent	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr8:145235188G>T	ENST00000528919.1	+	5	529	c.408G>T	c.(406-408)ggG>ggT	p.G136G	MROH1_ENST00000534366.1_Silent_p.G136G|MROH1_ENST00000398656.4_Silent_p.G136G|MROH1_ENST00000423230.2_Silent_p.G136G|MROH1_ENST00000326134.5_Silent_p.G136G	NM_032450.2	NP_115826	Q8NDA8	MROH1_HUMAN	maestro heat-like repeat family member 1	136								p.G136G(1)									TGCACCCTGGGACCCTGCCAC	0.697																																							uc003zbk.3		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(406-408)GGG>GGT		HEAT repeat containing 7A isoform 1							42.0	49.0	47.0					8																	145235188		2170	4276	6446	SO:0001819	synonymous_variant	727957						binding	g.chr8:145235188G>T		CCDS47938.1, CCDS47939.1, CCDS75803.1	8q24.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000179832	ENSG00000179832		"""maestro heat-like repeat containing"""	26958	protein-coding gene	gene with protein product			"""HEAT repeat containing 7A"""	HEATR7A		11347906	Standard	NM_032450		Approved	KIAA1833	uc003zbk.4	Q8NDA8	OTTHUMG00000165781	ENST00000528919.1:c.408G>T	8.37:g.145235188G>T			Somatic				HEATR7A_uc003zbg.2_Silent_p.G136G|HEATR7A_uc003zbh.3_Silent_p.G136G|HEATR7A_uc003zbi.3_Silent_p.G136G|HEATR7A_uc011lla.1_Silent_p.G136G|HEATR7A_uc010mft.2_Silent_p.G136G	p.G136G	NM_032450	NP_115826	WXS	Illumina HiSeq	Unspecified	Q8NDA8	HTR7A_HUMAN			6	645	+			136					C9JWM5|D3DWL5|Q0P612|Q569G6|Q6NVW4|Q8N230|Q8NAD1|Q8ND95|Q96JJ4	Silent	SNP	ENST00000528919.1	37	c.408G>T	CCDS47938.1																																																																																				0.697	MROH1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386183.1	NM_032450		6	36	1	0	2.0095e-06	0.001984	2.62246e-06	6	36				
FOCAD	54914	broad.mit.edu	37	9	20717833	20717833	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr9:20717833G>T	ENST00000380249.1	+	5	462	c.98G>T	c.(97-99)gGt>gTt	p.G33V	MIR491_ENST00000384877.1_RNA|FOCAD_ENST00000338382.6_Missense_Mutation_p.G33V	NM_017794.3	NP_060264.3	Q5VW36	FOCAD_HUMAN	focadhesin	33						focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)		p.G33V(1)									aaggaaaatggtttttcAGAA	0.333																																							uc003zog.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(8)|breast(1)|kidney(1)	10						c.(97-99)GGT>GTT		hypothetical protein LOC54914							138.0	130.0	133.0					9																	20717833		2203	4300	6503	SO:0001583	missense	54914					integral to membrane	binding	g.chr9:20717833G>T	AB058700	CCDS34993.1	9p21	2012-03-23	2012-03-23	2012-03-23	ENSG00000188352	ENSG00000188352			23377	protein-coding gene	gene with protein product		614606	"""KIAA1797"""	KIAA1797		22427331	Standard	XM_006716794		Approved	FLJ20375	uc003zog.1	Q5VW36	OTTHUMG00000066930	ENST00000380249.1:c.98G>T	9.37:g.20717833G>T	ENSP00000369599:p.Gly33Val		Somatic					p.G33V	NM_017794	NP_060264	WXS	Illumina HiSeq	Unspecified	Q5VW36	K1797_HUMAN		GBM - Glioblastoma multiforme(3;2.1e-125)|Lung(42;2.76e-14)|LUSC - Lung squamous cell carcinoma(42;1.99e-11)	5	461	+			33					D3DRJ9|Q6ZME1|Q8IZG0|Q96JM8|Q96MS9|Q9BVF3|Q9NX87	Missense_Mutation	SNP	ENST00000380249.1	37	c.98G>T	CCDS34993.1	.	.	.	.	.	.	.	.	.	.	G	7.596	0.671863	0.14776	.	.	ENSG00000188352	ENST00000380249;ENST00000338382	T;T	0.06687	3.27;3.27	5.3	1.4	0.22301	Domain of unknown function DUF3730 (1);	0.298462	0.35805	N	0.002972	T	0.04182	0.0116	N	0.12182	0.205	0.38409	D	0.945881	B	0.02656	0.0	B	0.08055	0.003	T	0.44283	-0.9338	10	0.32370	T	0.25	-0.0315	6.9807	0.24702	0.0816:0.0:0.5484:0.37	.	33	Q5VW36	K1797_HUMAN	V	33	ENSP00000369599:G33V;ENSP00000344307:G33V	ENSP00000344307:G33V	G	+	2	0	KIAA1797	20707833	0.536000	0.26378	0.503000	0.27626	0.988000	0.76386	0.533000	0.23082	0.095000	0.17434	0.561000	0.74099	GGT		0.333	FOCAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143442.1	NM_017794		8	39	1	0	0.00621372	0.006214	0.0066979	8	39				
FOCAD	54914	broad.mit.edu	37	9	20926351	20926351	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr9:20926351A>T	ENST00000380249.1	+	28	3377	c.3013A>T	c.(3013-3015)Aca>Tca	p.T1005S	FOCAD_ENST00000605086.1_Missense_Mutation_p.T441S|FOCAD_ENST00000338382.6_Missense_Mutation_p.T1005S	NM_017794.3	NP_060264.3	Q5VW36	FOCAD_HUMAN	focadhesin	1005						focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)		p.T1005S(1)									GGTACTTGATACACTCTTGGT	0.348																																							uc003zog.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(8)|breast(1)|kidney(1)	10						c.(3013-3015)ACA>TCA		hypothetical protein LOC54914							115.0	105.0	108.0					9																	20926351		2203	4300	6503	SO:0001583	missense	54914					integral to membrane	binding	g.chr9:20926351A>T	AB058700	CCDS34993.1	9p21	2012-03-23	2012-03-23	2012-03-23	ENSG00000188352	ENSG00000188352			23377	protein-coding gene	gene with protein product		614606	"""KIAA1797"""	KIAA1797		22427331	Standard	XM_006716794		Approved	FLJ20375	uc003zog.1	Q5VW36	OTTHUMG00000066930	ENST00000380249.1:c.3013A>T	9.37:g.20926351A>T	ENSP00000369599:p.Thr1005Ser		Somatic				KIAA1797_uc003zoh.1_Missense_Mutation_p.T441S	p.T1005S	NM_017794	NP_060264	WXS	Illumina HiSeq	Unspecified	Q5VW36	K1797_HUMAN		GBM - Glioblastoma multiforme(3;2.1e-125)|Lung(42;2.76e-14)|LUSC - Lung squamous cell carcinoma(42;1.99e-11)	28	3376	+			1005					D3DRJ9|Q6ZME1|Q8IZG0|Q96JM8|Q96MS9|Q9BVF3|Q9NX87	Missense_Mutation	SNP	ENST00000380249.1	37	c.3013A>T	CCDS34993.1	.	.	.	.	.	.	.	.	.	.	A	25.9	4.684857	0.88639	.	.	ENSG00000188352	ENST00000380249;ENST00000338382	T;T	0.67345	-0.26;-0.26	5.84	5.84	0.93424	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.80549	0.4644	M	0.69823	2.125	0.58432	D	0.999999	D	0.69078	0.997	D	0.75020	0.985	T	0.80527	-0.1343	10	0.44086	T	0.13	-11.544	15.9335	0.79683	1.0:0.0:0.0:0.0	.	1005	Q5VW36	K1797_HUMAN	S	1005	ENSP00000369599:T1005S;ENSP00000344307:T1005S	ENSP00000344307:T1005S	T	+	1	0	KIAA1797	20916351	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	7.195000	0.77798	2.240000	0.73641	0.477000	0.44152	ACA		0.348	FOCAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143442.1	NM_017794		13	103	0	0	0	0.001855	0	13	103				
PTENP1	11191	broad.mit.edu	37	9	33676082	33676082	+	RNA	SNP	G	G	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr9:33676082G>A	ENST00000532280.1	-	0	1415					NR_023917.1				phosphatase and tensin homolog pseudogene 1 (functional)																		AGTGCCACTGGTCTATAATCC	0.428																																							uc003zth.3		NA																	0					0						c.(466-468)CCA>TCA		SubName: Full=Phosphatase and tensin homolog 2; Flags: Fragment;																																						11191							g.chr9:33676082G>A	AF023139, BC038293, BY797336		9p13.3	2014-09-11	2014-01-16		ENSG00000237984	ENSG00000237984		"""-"""	9589	pseudogene	pseudogene		613531	"""phosphatase and tensin homolog pseudogene 1"""			9393738, 9620558	Standard	NR_023917		Approved	PTEN2, psiPTEN, PTH2, PTEN-rs, PTENpg1	uc003zth.4		OTTHUMG00000000410		9.37:g.33676082G>A			Somatic					p.P156S	NR_023917		WXS	Illumina HiSeq	Unspecified					1	1337	-									Missense_Mutation	SNP	ENST00000532280.1	37	c.466C>T																																																																																					0.428	PTENP1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000395145.1	NR_023917		16	183	0	0	0	0.003163	0	16	183				
CCIN	881	broad.mit.edu	37	9	36170205	36170205	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr9:36170205G>T	ENST00000335119.2	+	1	817	c.706G>T	c.(706-708)Gcc>Tcc	p.A236S		NM_005893.2	NP_005884.2	Q13939	CALI_HUMAN	calicin	236					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)		p.A236S(1)		breast(3)|endometrium(2)|large_intestine(4)|liver(2)|lung(5)|ovary(1)|skin(4)	21			STAD - Stomach adenocarcinoma(86;0.228)			GCTGGTGTTTGCCAGCAACAA	0.502																																							uc003zzb.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(706-708)GCC>TCC		calicin							45.0	41.0	43.0					9																	36170205		2203	4300	6503	SO:0001583	missense	881				cell differentiation|multicellular organismal development|spermatogenesis	cytoskeletal calyx	structural constituent of cytoskeleton	g.chr9:36170205G>T	Z46967	CCDS6599.1	9p13.1	2013-10-02			ENSG00000185972	ENSG00000185972		"""BTB/POZ domain containing"""	1568	protein-coding gene	gene with protein product		603960				7641791	Standard	NM_005893		Approved	KBTBD14, BTBD20	uc003zzb.4	Q13939	OTTHUMG00000019901	ENST00000335119.2:c.706G>T	9.37:g.36170205G>T	ENSP00000334996:p.Ala236Ser		Somatic					p.A236S	NM_005893	NP_005884	WXS	Illumina HiSeq	Unspecified	Q13939	CALI_HUMAN	STAD - Stomach adenocarcinoma(86;0.228)		1	817	+			236					Q9BXG7	Missense_Mutation	SNP	ENST00000335119.2	37	c.706G>T	CCDS6599.1	.	.	.	.	.	.	.	.	.	.	G	7.634	0.679496	0.14907	.	.	ENSG00000185972	ENST00000335119	T	0.64991	-0.13	5.84	4.01	0.46588	BTB/Kelch-associated (1);	0.114465	0.38959	N	0.001509	T	0.47746	0.1462	L	0.27053	0.805	0.28272	N	0.924383	B	0.19583	0.037	B	0.30943	0.122	T	0.38757	-0.9646	10	0.21540	T	0.41	.	8.9302	0.35666	0.1702:0.0:0.8298:0.0	.	236	Q13939	CALI_HUMAN	S	236	ENSP00000334996:A236S	ENSP00000334996:A236S	A	+	1	0	CCIN	36160205	1.000000	0.71417	0.962000	0.40283	0.747000	0.42532	2.383000	0.44354	0.823000	0.34589	0.563000	0.77884	GCC		0.502	CCIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052418.1	NM_005893		10	38	1	0	4.68919e-08	0.008291	6.50841e-08	10	38				
SPATA31A2	642265	broad.mit.edu	37	9	39888226	39888226	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr9:39888226C>A	ENST00000456183.2	+	4	1242	c.1213C>A	c.(1213-1215)Cag>Aag	p.Q405K		NM_001040065.1	NP_001035154.1	Q5RGS2	S31A2_HUMAN	SPATA31 subfamily A, member 2	405					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)		p.Q405K(1)									TAGGCTCTGGCAGGAAAGTTT	0.532																																							uc004abp.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1213-1215)CAG>AAG		hypothetical protein LOC642265							10.0	10.0	10.0					9																	39888226		1241	2717	3958	SO:0001583	missense	642265					integral to membrane		g.chr9:39888226C>A			9p13.1	2012-10-15	2012-10-12	2012-10-12	ENSG00000204848				32002	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member A2"""	FAM75A2		20850414	Standard			Approved	OTTHUMG00000013563	uc004abm.3	Q5RGS2	OTTHUMG00000013563	ENST00000456183.2:c.1213C>A	9.37:g.39888226C>A	ENSP00000406957:p.Gln405Lys		Somatic					p.Q405K	NM_001040065	NP_001035154	WXS	Illumina HiSeq	Unspecified	Q5RGS2	F75A2_HUMAN		GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)	4	1242	+			405						Missense_Mutation	SNP	ENST00000456183.2	37	c.1213C>A	CCDS43809.1	.	.	.	.	.	.	.	.	.	.	C	0.120	-1.127224	0.01770	.	.	ENSG00000204848	ENST00000456183	T	0.06142	3.34	1.85	-0.403	0.12400	.	1.370490	0.04797	N	0.432672	T	0.02083	0.0065	N	0.01109	-1.01	0.09310	N	1	B	0.14012	0.009	B	0.04013	0.001	T	0.42464	-0.9450	10	0.23302	T	0.38	-3.1525	3.8375	0.08900	0.0:0.2762:0.4506:0.2732	.	405	Q5RGS2	F75A2_HUMAN	K	405	ENSP00000406957:Q405K	ENSP00000406957:Q405K	Q	+	1	0	FAM75A2	39878226	0.000000	0.05858	0.001000	0.08648	0.025000	0.11179	-0.186000	0.09670	-0.066000	0.12998	0.121000	0.15741	CAG		0.532	SPATA31A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000037739.1	NM_001040065		73	352	1	0	9.35349e-44	0.00361	1.84843e-43	73	352				
SPATA31D1	389763	broad.mit.edu	37	9	84606311	84606311	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr9:84606311G>T	ENST00000344803.2	+	4	973	c.926G>T	c.(925-927)tGc>tTc	p.C309F		NM_001001670.2	NP_001001670.1	Q6ZQQ2	S31D1_HUMAN	SPATA31 subfamily D, member 1	309					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)		p.C309F(2)									CCGGAAGATTGCACTGTGACT	0.488																																							uc004amn.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(925-927)TGC>TTC		hypothetical protein LOC389763							257.0	223.0	234.0					9																	84606311		1970	4162	6132	SO:0001583	missense	389763					integral to membrane		g.chr9:84606311G>T		CCDS47986.1	9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000214929	ENSG00000214929			37283	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member D1"""	FAM75D1			Standard	NM_001001670		Approved	FLJ46321	uc004amn.3	Q6ZQQ2	OTTHUMG00000169122	ENST00000344803.2:c.926G>T	9.37:g.84606311G>T	ENSP00000341988:p.Cys309Phe		Somatic					p.C309F	NM_001001670	NP_001001670	WXS	Illumina HiSeq	Unspecified	Q6ZQQ2	F75D1_HUMAN			4	973	+			309						Missense_Mutation	SNP	ENST00000344803.2	37	c.926G>T	CCDS47986.1	.	.	.	.	.	.	.	.	.	.	G	8.618	0.890616	0.17613	.	.	ENSG00000214929	ENST00000344803	T	0.04970	3.52	2.99	-5.97	0.02227	.	.	.	.	.	T	0.04588	0.0125	L	0.43152	1.355	0.09310	N	1	B	0.24823	0.112	B	0.20767	0.031	T	0.44298	-0.9337	9	0.13108	T	0.6	.	8.4668	0.32960	0.0:0.5443:0.1817:0.274	.	309	Q6ZQQ2	F75D1_HUMAN	F	309	ENSP00000341988:C309F	ENSP00000341988:C309F	C	+	2	0	FAM75D1	83796131	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.960000	0.03849	-1.417000	0.02017	-0.181000	0.13052	TGC		0.488	SPATA31D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402325.1	NM_001001670		32	356	1	0	2.08457e-15	0.002096	3.63486e-15	32	356				
SPATA31D1	389763	broad.mit.edu	37	9	84608122	84608122	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr9:84608122A>T	ENST00000344803.2	+	4	2784	c.2737A>T	c.(2737-2739)Agg>Tgg	p.R913W		NM_001001670.2	NP_001001670.1	Q6ZQQ2	S31D1_HUMAN	SPATA31 subfamily D, member 1	913					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)		p.R913W(2)									TTTCCGTATGAGGATGCTGTG	0.458																																							uc004amn.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(2737-2739)AGG>TGG		hypothetical protein LOC389763							52.0	48.0	49.0					9																	84608122		1854	4088	5942	SO:0001583	missense	389763					integral to membrane		g.chr9:84608122A>T		CCDS47986.1	9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000214929	ENSG00000214929			37283	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member D1"""	FAM75D1			Standard	NM_001001670		Approved	FLJ46321	uc004amn.3	Q6ZQQ2	OTTHUMG00000169122	ENST00000344803.2:c.2737A>T	9.37:g.84608122A>T	ENSP00000341988:p.Arg913Trp		Somatic					p.R913W	NM_001001670	NP_001001670	WXS	Illumina HiSeq	Unspecified	Q6ZQQ2	F75D1_HUMAN			4	2784	+			913						Missense_Mutation	SNP	ENST00000344803.2	37	c.2737A>T	CCDS47986.1	.	.	.	.	.	.	.	.	.	.	A	14.60	2.583507	0.46006	.	.	ENSG00000214929	ENST00000344803	T	0.09255	3.0	3.09	-1.51	0.08664	.	1.446790	0.04182	N	0.326636	T	0.26774	0.0655	M	0.74881	2.28	0.09310	N	1	D	0.63046	0.992	P	0.62885	0.908	T	0.23154	-1.0196	10	0.87932	D	0	-0.6815	3.9488	0.09360	0.4147:0.4463:0.1391:0.0	.	913	Q6ZQQ2	F75D1_HUMAN	W	913	ENSP00000341988:R913W	ENSP00000341988:R913W	R	+	1	2	FAM75D1	83797942	0.005000	0.15991	0.002000	0.10522	0.014000	0.08584	0.494000	0.22467	-0.005000	0.14395	0.456000	0.33151	AGG		0.458	SPATA31D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402325.1	NM_001001670		12	47	0	0	0	0.000978	0	12	47				
KIF27	55582	broad.mit.edu	37	9	86503486	86503486	+	Missense_Mutation	SNP	A	A	C			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr9:86503486A>C	ENST00000297814.2	-	8	2144	c.2001T>G	c.(1999-2001)atT>atG	p.I667M	KIF27_ENST00000376347.1_Missense_Mutation_p.I58M|KIF27_ENST00000413982.1_Missense_Mutation_p.I667M|KIF27_ENST00000334204.2_Missense_Mutation_p.I667M	NM_017576.1	NP_060046.1	Q86VH2	KIF27_HUMAN	kinesin family member 27	667					ATP catabolic process (GO:0006200)|cilium assembly (GO:0042384)|epithelial cilium movement (GO:0003351)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|smoothened signaling pathway (GO:0007224)|ventricular system development (GO:0021591)	cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.I667M(1)		breast(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(7)|lung(17)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	43						CTGGCTTCTGAATCCATGAAC	0.348																																							uc004ana.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(4)|skin(1)	5						c.(1999-2001)ATT>ATG		kinesin family member 27							76.0	74.0	75.0					9																	86503486		2203	4300	6503	SO:0001583	missense	55582				cilium assembly|microtubule-based movement	cilium|cytoplasm|microtubule	ATP binding|microtubule motor activity	g.chr9:86503486A>C	AY237536	CCDS6665.1, CCDS65071.1, CCDS65072.1	9q21.32	2008-03-03			ENSG00000165115	ENSG00000165115		"""Kinesins"""	18632	protein-coding gene	gene with protein product		611253					Standard	NM_017576		Approved	DKFZp434D0917	uc004ana.4	Q86VH2	OTTHUMG00000020109	ENST00000297814.2:c.2001T>G	9.37:g.86503486A>C	ENSP00000297814:p.Ile667Met		Somatic				KIF27_uc010mpw.2_Missense_Mutation_p.I667M|KIF27_uc010mpx.2_Missense_Mutation_p.I667M	p.I667M	NM_017576	NP_060046	WXS	Illumina HiSeq	Unspecified	Q86VH2	KIF27_HUMAN			8	2145	-			667					B2RTR8|Q5T6W0|Q86VH0|Q86VH1|Q9UF54	Missense_Mutation	SNP	ENST00000297814.2	37	c.2001T>G	CCDS6665.1	.	.	.	.	.	.	.	.	.	.	A	15.32	2.799821	0.50208	.	.	ENSG00000165115	ENST00000297814;ENST00000413982;ENST00000334204;ENST00000376347	T;T;T;T	0.50001	0.76;0.76;0.76;0.76	4.27	3.13	0.36017	.	1.254160	0.06025	N	0.651919	T	0.40909	0.1136	L	0.34521	1.04	0.21499	N	0.999662	P;P;P	0.49783	0.799;0.928;0.855	B;P;B	0.45037	0.299;0.467;0.215	T	0.22695	-1.0209	10	0.41790	T	0.15	.	5.883	0.18866	0.8756:0.0:0.1244:0.0	.	667;667;667	Q86VH2-3;Q86VH2-2;Q86VH2	.;.;KIF27_HUMAN	M	667;667;667;58	ENSP00000297814:I667M;ENSP00000401688:I667M;ENSP00000333928:I667M;ENSP00000365525:I58M	ENSP00000297814:I667M	I	-	3	3	KIF27	85693306	0.997000	0.39634	0.952000	0.39060	0.909000	0.53808	1.453000	0.35167	0.812000	0.34326	0.477000	0.44152	ATT		0.348	KIF27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052861.1	NM_017576		6	60	0	0	0	0.001984	0	6	60				
NTRK2	4915	broad.mit.edu	37	9	87636230	87636230	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr9:87636230T>A	ENST00000323115.4	+	17	2700	c.2347T>A	c.(2347-2349)Tat>Aat	p.Y783N	NTRK2_ENST00000277120.3_Missense_Mutation_p.Y799N|NTRK2_ENST00000376214.1_Missense_Mutation_p.Y799N|NTRK2_ENST00000376213.1_Missense_Mutation_p.Y783N			Q16620	NTRK2_HUMAN	neurotrophic tyrosine kinase, receptor, type 2	783	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of adenylate cyclase activity (GO:0007190)|aging (GO:0007568)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|central nervous system neuron development (GO:0021954)|cerebral cortex development (GO:0021987)|circadian rhythm (GO:0007623)|feeding behavior (GO:0007631)|glutamate secretion (GO:0014047)|learning (GO:0007612)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|mechanoreceptor differentiation (GO:0042490)|negative regulation of anoikis (GO:2000811)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular junction development (GO:0007528)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peripheral nervous system neuron development (GO:0048935)|positive regulation of axonogenesis (GO:0050772)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein autophosphorylation (GO:0046777)|regulation of dendrite development (GO:0050773)|regulation of neurotransmitter secretion (GO:0046928)|regulation of protein kinase B signaling (GO:0051896)|regulation of Rac GTPase activity (GO:0032314)|response to auditory stimulus (GO:0010996)|retinal rod cell development (GO:0046548)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vasculogenesis (GO:0001570)	cell surface (GO:0009986)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|endosome (GO:0005768)|excitatory synapse (GO:0060076)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|receptor complex (GO:0043235)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|brain-derived neurotrophic factor binding (GO:0048403)|brain-derived neurotrophic factor-activated receptor activity (GO:0060175)|neurotrophin binding (GO:0043121)|protein homodimerization activity (GO:0042803)	p.Y799N(2)		breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|liver(1)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	46					Amitriptyline(DB00321)	CCAGGAGGTGTATGAGCTGAT	0.572										TSP Lung(25;0.17)																													uc004aoa.1		NA																	2	Substitution - Missense(2)		lung(2)	lung(11)|central_nervous_system(1)|breast(1)|skin(1)|ovary(1)|liver(1)	16						c.(2347-2349)TAT>AAT		neurotrophic tyrosine kinase, receptor, type 2							74.0	72.0	73.0					9																	87636230		2203	4300	6503	SO:0001583	missense	4915				activation of adenylate cyclase activity|cell differentiation|nerve growth factor receptor signaling pathway|nervous system development	integral to plasma membrane	ATP binding|neurotrophin receptor activity|transmembrane receptor protein tyrosine kinase activity	g.chr9:87636230T>A	AF410902	CCDS6671.1, CCDS35050.1, CCDS35051.1, CCDS35052.1, CCDS35053.1	9q22.1	2013-01-11			ENSG00000148053	ENSG00000148053	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8032	protein-coding gene	gene with protein product		600456				7789988	Standard	NM_001018065		Approved	TRKB	uc004anz.1	Q16620	OTTHUMG00000020120	ENST00000323115.4:c.2347T>A	9.37:g.87636230T>A	ENSP00000314586:p.Tyr783Asn	TSP Lung(25;0.17)	Somatic				NTRK2_uc004anz.1_Missense_Mutation_p.Y799N	p.Y783N	NM_001018064	NP_001018074	WXS	Illumina HiSeq	Unspecified	Q16620	NTRK2_HUMAN			20	3285	+			783			Protein kinase.|Cytoplasmic (Potential).		B1ANZ4|B4DFV9|Q16675|Q59GJ1|Q8WXJ5|Q8WXJ6|Q8WXJ7	Missense_Mutation	SNP	ENST00000323115.4	37	c.2347T>A	CCDS35050.1	.	.	.	.	.	.	.	.	.	.	T	22.7	4.319000	0.81469	.	.	ENSG00000148053	ENST00000376214;ENST00000376213;ENST00000277120;ENST00000323115	D;D;D;D	0.83992	-1.79;-1.79;-1.79;-1.79	5.99	5.99	0.97316	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.052568	0.85682	D	0.000000	D	0.92296	0.7556	M	0.87269	2.87	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.93420	0.6776	10	0.87932	D	0	.	16.4943	0.84223	0.0:0.0:0.0:1.0	.	783;799	Q16620;Q16620-4	NTRK2_HUMAN;.	N	799;783;799;783	ENSP00000365387:Y799N;ENSP00000365386:Y783N;ENSP00000277120:Y799N;ENSP00000314586:Y783N	ENSP00000277120:Y799N	Y	+	1	0	NTRK2	86826050	1.000000	0.71417	0.715000	0.30552	0.998000	0.95712	8.040000	0.89188	2.291000	0.77112	0.533000	0.62120	TAT		0.572	NTRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052882.1			8	63	0	0	0	0.006214	0	8	63				
TMEFF1	8577	broad.mit.edu	37	9	103279049	103279049	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr9:103279049G>T	ENST00000374879.4	+	5	988	c.556G>T	c.(556-558)Gtt>Ttt	p.V186F	TMEFF1_ENST00000334943.6_Missense_Mutation_p.V147F|MSANTD3-TMEFF1_ENST00000502978.1_Missense_Mutation_p.C149F	NM_003692.4	NP_003683.2	Q8IYR6	TEFF1_HUMAN	transmembrane protein with EGF-like and two follistatin-like domains 1	186	Kazal-like 2. {ECO:0000255|PROSITE- ProRule:PRU00798}.				multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.V186F(1)		NS(1)|kidney(1)|large_intestine(7)|lung(9)|stomach(1)	19		Acute lymphoblastic leukemia(62;0.0452)				TGCAGAAAATGTTGGGTGAGT	0.398																																							uc004baz.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(556-558)GTT>TTT		transmembrane protein with EGF-like and two							119.0	100.0	107.0					9																	103279049		2203	4300	6503	SO:0001583	missense	8577				multicellular organismal development	integral to membrane|plasma membrane		g.chr9:103279049G>T	U19878	CCDS6750.1	9q31	2010-05-04			ENSG00000241697	ENSG00000241697			11866	protein-coding gene	gene with protein product	"""tomoregulin-1"", ""cancer/testis antigen family 120, member 1"""	603421		C9orf2		9730596	Standard	NM_003692		Approved	H7365, CT120.1		Q8IYR6	OTTHUMG00000020367	ENST00000374879.4:c.556G>T	9.37:g.103279049G>T	ENSP00000364013:p.Val186Phe		Somatic				TMEFF1_uc004bay.1_Missense_Mutation_p.V260F	p.V186F	NM_003692	NP_003683	WXS	Illumina HiSeq	Unspecified	Q8IYR6	TEFF1_HUMAN			5	666	+		Acute lymphoblastic leukemia(62;0.0452)	186			Kazal-like 2.|Extracellular (Potential).		Q13086|Q8N3T8	Missense_Mutation	SNP	ENST00000374879.4	37	c.556G>T	CCDS6750.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.2|21.2	4.113138|4.113138	0.77210|0.77210	.|.	.|.	ENSG00000251349|ENSG00000241697	ENST00000502978|ENST00000334943;ENST00000374879	.|T;T	.|0.30182	.|1.54;1.54	5.74|5.74	4.85|4.85	0.62838|0.62838	.|.	.|0.063065	.|0.64402	.|D	.|0.000006	T|T	0.49558|0.49558	0.1564|0.1564	M|M	0.63843|0.63843	1.955|1.955	0.58432|0.58432	D|D	0.999999|0.999999	.|D;D	.|0.63880	.|0.993;0.991	.|D;P	.|0.66351	.|0.943;0.868	T|T	0.48625|0.48625	-0.9019|-0.9019	5|10	.|0.48119	.|T	.|0.1	-32.2739|-32.2739	12.8574|12.8574	0.57892|0.57892	0.079:0.0:0.921:0.0|0.079:0.0:0.921:0.0	.|.	.|186;147	.|Q8IYR6;Q8IYR6-2	.|TEFF1_HUMAN;.	F|F	149|147;186	.|ENSP00000334447:V147F;ENSP00000364013:V186F	.|ENSP00000334447:V147F	C|V	+|+	2|1	0|0	C9orf30-TMEFF1|TMEFF1	102318870|102318870	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.779000|0.779000	0.44077|0.44077	4.906000|4.906000	0.63293|0.63293	1.577000|1.577000	0.49804|0.49804	-0.251000|-0.251000	0.11542|0.11542	TGT|GTT		0.398	TMEFF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053418.1	NM_003692		11	64	1	0	1.5842e-08	0.001855	2.25152e-08	11	64				
AKAP2	11217	broad.mit.edu	37	9	112898590	112898590	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr9:112898590C>A	ENST00000259318.7	+	2	280	c.73C>A	c.(73-75)Cat>Aat	p.H25N	AKAP2_ENST00000510514.5_Missense_Mutation_p.H256N|PALM2-AKAP2_ENST00000302798.7_Missense_Mutation_p.H256N|AKAP2_ENST00000555236.1_Missense_Mutation_p.H256N|AKAP2_ENST00000434623.2_Missense_Mutation_p.H114N|AKAP2_ENST00000374525.1_Missense_Mutation_p.H114N|PALM2-AKAP2_ENST00000374530.3_Missense_Mutation_p.H256N	NM_001136562.2	NP_001130034.1	Q9Y2D5	AKAP2_HUMAN	A kinase (PRKA) anchor protein 2	25								p.H114N(1)|p.H256N(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	33						TCCCATGGACCATCCCTCCGC	0.478																																							uc004bei.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|central_nervous_system(2)|skin(1)	6						c.(1462-1464)CAT>AAT		A kinase (PRKA) anchor protein 2 isoform 2							189.0	174.0	179.0					9																	112898590		2203	4300	6503	SO:0001583	missense	445815						enzyme binding	g.chr9:112898590C>A	AB023137	CCDS43861.1, CCDS48003.1, CCDS56581.1	9q31.3	2009-10-16			ENSG00000241978	ENSG00000241978		"""A-kinase anchor proteins"""	372	protein-coding gene	gene with protein product	"""protein kinase A2"""	604582		PRKA2		10231032	Standard	NM_001136562		Approved	AKAP-KL, KIAA0920, DKFZp564L0716		Q9Y2D5	OTTHUMG00000156811	ENST00000259318.7:c.73C>A	9.37:g.112898590C>A	ENSP00000259318:p.His25Asn		Somatic				PALM2-AKAP2_uc004bek.3_Missense_Mutation_p.H256N|PALM2-AKAP2_uc004bej.3_Missense_Mutation_p.H256N|PALM2-AKAP2_uc004bel.1_Missense_Mutation_p.H66N|AKAP2_uc011lwi.1_Missense_Mutation_p.H114N|AKAP2_uc004bem.2_Missense_Mutation_p.H114N|PALM2-AKAP2_uc010mtw.1_Missense_Mutation_p.H74N|AKAP2_uc011lwj.1_Missense_Mutation_p.H25N|PALM2-AKAP2_uc004ben.2_Missense_Mutation_p.H25N	p.H488N	NM_001136562	NP_001130034	WXS	Illumina HiSeq	Unspecified	Q9Y2D5	AKAP2_HUMAN			9	1654	+			25					B1ALX9|B2RTU4|B3KQ00|B4DTZ2|B7ZW07|B9EJB5|Q9UG26	Missense_Mutation	SNP	ENST00000259318.7	37	c.1462C>A	CCDS48003.1	.	.	.	.	.	.	.	.	.	.	C	10.33	1.320724	0.23994	.	.	ENSG00000157654;ENSG00000157654;ENSG00000241978;ENSG00000241978;ENSG00000241978;ENSG00000241978;ENSG00000241978;ENSG00000241978	ENST00000374530;ENST00000302798;ENST00000555236;ENST00000510514;ENST00000434623;ENST00000374525;ENST00000480388;ENST00000259318	T;T;T;T;T;T;T;T	0.41065	2.34;2.34;2.34;2.34;1.6;1.01;1.02;1.61	6.17	4.13	0.48395	.	0.428871	0.23583	N	0.046640	T	0.32406	0.0828	L	0.43152	1.355	0.28188	N	0.927875	B;B;B;B;B;B;B;B	0.14438	0.001;0.01;0.005;0.01;0.006;0.001;0.001;0.0	B;B;B;B;B;B;B;B	0.16289	0.001;0.015;0.002;0.015;0.006;0.003;0.003;0.002	T	0.15752	-1.0426	10	0.21014	T	0.42	-12.7199	10.1592	0.42842	0.3159:0.5764:0.1077:0.0	.	25;114;108;114;115;256;256;74	Q9Y2D5;Q9Y2D5-7;B4E2K2;Q9Y2D5-5;B1ALY1;Q9Y2D5-6;Q9Y2D5-4;C9JVY5	AKAP2_HUMAN;.;.;.;.;.;.;.	N	256;256;256;256;114;114;74;25	ENSP00000363654:H256N;ENSP00000305861:H256N;ENSP00000451476:H256N;ENSP00000421522:H256N;ENSP00000404782:H114N;ENSP00000363649:H114N;ENSP00000419268:H74N;ENSP00000259318:H25N	ENSP00000259318:H25N	H	+	1	0	PALM2-AKAP2;AKAP2	111938411	0.977000	0.34250	0.844000	0.33320	0.429000	0.31625	1.739000	0.38217	1.575000	0.49775	0.655000	0.94253	CAT		0.478	AKAP2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000346067.3	NM_001004065		37	179	1	0	1.07121e-22	0.006999	2.02069e-22	37	179				
OR1L8	138881	broad.mit.edu	37	9	125330565	125330565	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr9:125330565C>A	ENST00000304865.2	-	1	273	c.192G>T	c.(190-192)ttG>ttT	p.L64F		NM_001004454.1	NP_001004454.1	Q8NGR8	OR1L8_HUMAN	olfactory receptor, family 1, subfamily L, member 8	64						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L64F(2)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20						ACAGAAAACTCAAGAAGAAAT	0.463																																							uc004bmp.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|central_nervous_system(1)	3						c.(190-192)TTG>TTT		olfactory receptor, family 1, subfamily L,							85.0	92.0	89.0					9																	125330565		2203	4300	6503	SO:0001583	missense	138881				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr9:125330565C>A		CCDS35124.1	9q33.2	2013-09-20			ENSG00000171496	ENSG00000171496		"""GPCR / Class A : Olfactory receptors"""	15110	protein-coding gene	gene with protein product							Standard	NM_001004454		Approved		uc004bmp.1	Q8NGR8	OTTHUMG00000020609	ENST00000304865.2:c.192G>T	9.37:g.125330565C>A	ENSP00000306607:p.Leu64Phe		Somatic					p.L64F	NM_001004454	NP_001004454	WXS	Illumina HiSeq	Unspecified	Q8NGR8	OR1L8_HUMAN			1	192	-			64			Helical; Name=2; (Potential).		A3KFM3|B9EIR6|Q6IF15|Q96R79	Missense_Mutation	SNP	ENST00000304865.2	37	c.192G>T	CCDS35124.1	.	.	.	.	.	.	.	.	.	.	C	14.40	2.524501	0.44969	.	.	ENSG00000171496	ENST00000304865	T	0.02103	4.45	4.29	-1.07	0.09968	GPCR, rhodopsin-like superfamily (1);	0.000000	0.33290	N	0.005067	T	0.16214	0.0390	H	0.98027	4.13	0.09310	N	1	D	0.89917	1.0	D	0.83275	0.996	T	0.03503	-1.1030	10	0.87932	D	0	-13.7911	6.1928	0.20534	0.0:0.375:0.3794:0.2456	.	64	Q8NGR8	OR1L8_HUMAN	F	64	ENSP00000306607:L64F	ENSP00000306607:L64F	L	-	3	2	OR1L8	124370386	0.000000	0.05858	0.232000	0.24009	0.962000	0.63368	-2.256000	0.01181	-0.045000	0.13468	0.449000	0.29647	TTG		0.463	OR1L8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053939.1			9	81	1	0	0.000274275	0.004482	0.000316178	9	81				
SDCCAG3	10807	broad.mit.edu	37	9	139304594	139304594	+	Silent	SNP	C	C	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr9:139304594C>A	ENST00000357365.3	-	2	297	c.168G>T	c.(166-168)ccG>ccT	p.P56P	PMPCA_ENST00000371720.1_5'Flank|PMPCA_ENST00000371717.3_5'Flank|PMPCA_ENST00000399219.3_5'Flank|SDCCAG3_ENST00000371725.3_Intron|SDCCAG3_ENST00000298537.7_Silent_p.P56P	NM_001039707.1	NP_001034796.1	Q96C92	SDCG3_HUMAN	serologically defined colon cancer antigen 3	56						cytoplasm (GO:0005737)		p.P56P(1)		NS(1)|breast(2)|cervix(1)|endometrium(2)|large_intestine(1)|lung(9)	16		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;8.18e-06)|Epithelial(140;9.31e-06)		ACATAAAGGCCGGCCGAATGC	0.662																																							uc004chi.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(166-168)CCG>CCT		serologically defined colon cancer antigen 3							22.0	29.0	27.0					9																	139304594		1909	4116	6025	SO:0001819	synonymous_variant	10807					cytoplasm		g.chr9:139304594C>A	AF039688	CCDS6999.2, CCDS43903.1, CCDS43904.1	9q34.3	2010-10-27			ENSG00000165689	ENSG00000165689			10667	protein-coding gene	gene with protein product						9610721	Standard	XM_005266050		Approved	NY-CO-3	uc004chi.3	Q96C92	OTTHUMG00000020928	ENST00000357365.3:c.168G>T	9.37:g.139304594C>A			Somatic				SDCCAG3_uc004chj.2_Silent_p.P56P|SDCCAG3_uc004chk.2_Intron|PMPCA_uc011mdy.1_5'Flank|PMPCA_uc010nbk.2_5'Flank|PMPCA_uc004chl.2_5'Flank|PMPCA_uc010nbl.2_5'Flank|PMPCA_uc011mdz.1_5'Flank	p.P56P	NM_001039707	NP_001034796	WXS	Illumina HiSeq	Unspecified	Q96C92	SDCG3_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;8.18e-06)|Epithelial(140;9.31e-06)	2	373	-		Myeloproliferative disorder(178;0.0511)	56					A6NCP1|O60525|Q5SXN1|Q5SXN2|Q5SXN3|Q5SXN4|Q5SXN8|Q6V704|Q9NVY5	Silent	SNP	ENST00000357365.3	37	c.168G>T	CCDS43904.1																																																																																				0.662	SDCCAG3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055060.2	NM_006643		6	22	1	0	0.00448238	0.004482	0.00488238	6	22				
PNPLA7	375775	broad.mit.edu	37	9	140356755	140356755	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr9:140356755C>A	ENST00000277531.4	-	30	3632	c.3446G>T	c.(3445-3447)cGc>cTc	p.R1149L	NSMF_ENST00000437259.1_5'Flank|NSMF_ENST00000371474.3_5'Flank|PNPLA7_ENST00000371457.1_Missense_Mutation_p.R755L|PNPLA7_ENST00000492278.1_5'UTR|NSMF_ENST00000392812.4_5'Flank|NSMF_ENST00000371473.3_5'Flank|PNPLA7_ENST00000406427.1_Missense_Mutation_p.R1174L|NSMF_ENST00000371475.3_5'Flank|NSMF_ENST00000265663.7_5'Flank	NM_152286.3	NP_689499.3	Q6ZV29	PLPL7_HUMAN	patatin-like phospholipase domain containing 7	1149					lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	lysophospholipase activity (GO:0004622)	p.R1149L(1)		breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	all_cancers(76;0.126)			OV - Ovarian serous cystadenocarcinoma(145;0.000268)|Epithelial(140;0.000839)		GTAGGCCAGGCGCGTCTGAAT	0.667																																							uc004cnf.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(3445-3447)CGC>CTC		patatin-like phospholipase domain containing 7							65.0	64.0	64.0					9																	140356755		2203	4298	6501	SO:0001583	missense	375775				lipid metabolic process	endoplasmic reticulum|integral to membrane|lysosomal membrane|microsome|mitochondrial membrane|nuclear membrane	hydrolase activity	g.chr9:140356755C>A	AK126267	CCDS7045.1, CCDS48070.1	9q34.3	2009-01-12	2006-06-12	2006-06-12	ENSG00000130653	ENSG00000130653		"""Patatin-like phospholipase domain containing"""	24768	protein-coding gene	gene with protein product		612122	"""chromosome 9 open reading frame 111"""	C9orf111		16799181, 12640454, 19029121	Standard	XM_005266082		Approved	FLJ43070, FLJ31318, FLJ44279, RP11-48C7.2, NTEL1, NTE-R1	uc010ncj.1	Q6ZV29	OTTHUMG00000020990	ENST00000277531.4:c.3446G>T	9.37:g.140356755C>A	ENSP00000277531:p.Arg1149Leu		Somatic				C9orf167_uc011mew.1_Intron|PNPLA7_uc004cnd.1_Intron|PNPLA7_uc004cne.1_Missense_Mutation_p.R415L|PNPLA7_uc011mfa.1_Missense_Mutation_p.R557L|PNPLA7_uc010ncj.1_Missense_Mutation_p.R1174L|NELF_uc004cna.2_5'Flank|NELF_uc011mez.1_5'Flank|NELF_uc004cmz.2_5'Flank|NELF_uc004cnc.2_5'Flank|NELF_uc004cnb.2_5'Flank	p.R1149L	NM_152286	NP_689499	WXS	Illumina HiSeq	Unspecified	Q6ZV29	PLPL7_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;0.000268)|Epithelial(140;0.000839)	30	3783	-	all_cancers(76;0.126)		1149					B5MDD3|Q5T364|Q658X0|Q658Y3|Q6ZTS1|Q86YU8|Q8TAY5|Q96N75|Q9H7N5	Missense_Mutation	SNP	ENST00000277531.4	37	c.3446G>T	CCDS7045.1	.	.	.	.	.	.	.	.	.	.	C	16.60	3.167196	0.57476	.	.	ENSG00000130653	ENST00000371457;ENST00000371446;ENST00000277531;ENST00000406427;ENST00000371451;ENST00000434090	T;T;T;T;T	0.35973	1.28;1.28;1.28;1.28;1.28	4.36	3.45	0.39498	Acyl transferase/acyl hydrolase/lysophospholipase (1);	0.000000	0.85682	D	0.000000	T	0.67011	0.2848	M	0.93462	3.42	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.91635	0.978;0.999;0.96	T	0.74581	-0.3618	10	0.87932	D	0	-25.1523	11.6024	0.51010	0.0:0.9117:0.0:0.0883	.	557;1174;1149	E2QRF8;Q6ZV29-5;Q6ZV29	.;.;PLPL7_HUMAN	L	755;557;1149;1174;1149;1140	ENSP00000360512:R755L;ENSP00000360501:R557L;ENSP00000277531:R1149L;ENSP00000384610:R1174L;ENSP00000400582:R1140L	ENSP00000277531:R1149L	R	-	2	0	PNPLA7	139476576	1.000000	0.71417	0.973000	0.42090	0.028000	0.11728	5.744000	0.68664	0.957000	0.37930	-0.258000	0.10820	CGC		0.667	PNPLA7-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254787.1	NM_152286		10	82	1	0	6.40141e-05	0.000978	7.74515e-05	10	82				
MXRA5	25878	broad.mit.edu	37	X	3235287	3235287	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chrX:3235287G>T	ENST00000217939.6	-	6	6589	c.6435C>A	c.(6433-6435)aaC>aaA	p.N2145K		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	2145						extracellular vesicular exosome (GO:0070062)		p.N2145K(2)		NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				TGATGCGCGCGTTGGCTGCTG	0.711																																							uc004crg.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(5)|lung(1)|central_nervous_system(1)|skin(1)	8						c.(6433-6435)AAC>AAA		adlican precursor							31.0	25.0	27.0					X																	3235287		2202	4299	6501	SO:0001583	missense	25878					extracellular region		g.chrX:3235287G>T	AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.6435C>A	X.37:g.3235287G>T	ENSP00000217939:p.Asn2145Lys		Somatic					p.N2145K	NM_015419	NP_056234	WXS	Illumina HiSeq	Unspecified	Q9NR99	MXRA5_HUMAN			6	6592	-		all_lung(23;0.00031)|Lung NSC(23;0.000946)	2145					Q6P1M7|Q9Y3Y8	Missense_Mutation	SNP	ENST00000217939.6	37	c.6435C>A	CCDS14124.1	.	.	.	.	.	.	.	.	.	.	G	4.749	0.139284	0.09083	.	.	ENSG00000101825	ENST00000381114;ENST00000217939	T	0.62941	-0.01	3.35	-2.28	0.06826	.	0.628334	0.12937	U	0.426891	T	0.20536	0.0494	N	0.01019	-1.045	0.27307	N	0.957418	B	0.32731	0.382	B	0.28709	0.093	T	0.38887	-0.9640	10	0.06236	T	0.91	.	6.3499	0.21370	0.646:0.1459:0.2081:0.0	.	2145	Q9NR99	MXRA5_HUMAN	K	2145	ENSP00000217939:N2145K	ENSP00000217939:N2145K	N	-	3	2	MXRA5	3245287	0.945000	0.32115	0.898000	0.35279	0.155000	0.21991	-0.016000	0.12613	-0.263000	0.09378	-0.329000	0.08387	AAC		0.711	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055655.2	NM_015419		7	31	1	0	1.12685e-05	0.004482	1.42141e-05	7	31				
MOSPD2	158747	broad.mit.edu	37	X	14934407	14934407	+	Silent	SNP	G	G	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chrX:14934407G>A	ENST00000380492.3	+	13	1363	c.1275G>A	c.(1273-1275)caG>caA	p.Q425Q	MOSPD2_ENST00000482354.1_Silent_p.Q425Q|MOSPD2_ENST00000495110.1_3'UTR	NM_001177475.1|NM_152581.3	NP_001170946.1|NP_689794.1	Q8NHP6	MSPD2_HUMAN	motile sperm domain containing 2	425	MSP. {ECO:0000255|PROSITE- ProRule:PRU00132}.					integral component of membrane (GO:0016021)|membrane (GO:0016020)	structural molecule activity (GO:0005198)	p.Q425Q(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20	Hepatocellular(33;0.183)					AATTAACTCAGTTTTGGAAAG	0.418																																							uc004cwi.2		NA																	1	Substitution - coding silent(1)		lung(1)	lung(1)	1						c.(1273-1275)CAG>CAA		motile sperm domain containing 2							155.0	147.0	150.0					X																	14934407		2203	4300	6503	SO:0001819	synonymous_variant	158747					integral to membrane	structural molecule activity	g.chrX:14934407G>A	AL834345	CCDS14162.1	Xp22.31	2006-03-16			ENSG00000130150	ENSG00000130150			28381	protein-coding gene	gene with protein product						15533722	Standard	NM_152581		Approved	MGC26706	uc004cwi.3	Q8NHP6	OTTHUMG00000021170	ENST00000380492.3:c.1275G>A	X.37:g.14934407G>A			Somatic				MOSPD2_uc004cwj.2_Silent_p.Q362Q	p.Q425Q	NM_152581	NP_689794	WXS	Illumina HiSeq	Unspecified	Q8NHP6	MSPD2_HUMAN			13	1363	+	Hepatocellular(33;0.183)		425			MSP.		Q8N3H2|Q8NA83	Silent	SNP	ENST00000380492.3	37	c.1275G>A	CCDS14162.1																																																																																				0.418	MOSPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055837.1	NM_152581		38	208	0	0	0	0.009718	0	38	208				
NHS	4810	broad.mit.edu	37	X	17744628	17744628	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chrX:17744628T>C	ENST00000380060.3	+	6	2677	c.2339T>C	c.(2338-2340)gTc>gCc	p.V780A	NHS_ENST00000398097.3_Missense_Mutation_p.V624A	NM_198270.2	NP_938011.1	Q6T4R5	NHS_HUMAN	Nance-Horan syndrome (congenital cataracts and dental anomalies)	801					cell differentiation (GO:0030154)|lens development in camera-type eye (GO:0002088)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|tight junction (GO:0005923)		p.V624A(1)|p.V780A(1)		breast(5)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(26)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	71	Hepatocellular(33;0.183)					AAGAGCTATGTCTGTCACTAT	0.512																																							uc004cxx.2		NA																	2	Substitution - Missense(2)		lung(2)	skin(3)|ovary(2)|breast(1)|central_nervous_system(1)	7						c.(2338-2340)GTC>GCC		Nance-Horan syndrome protein isoform 1							101.0	100.0	100.0					X																	17744628		2203	4300	6503	SO:0001583	missense	4810					nucleus		g.chrX:17744628T>C		CCDS14181.1, CCDS48087.1	Xp22.3-p21.1	2014-06-18			ENSG00000188158	ENSG00000188158			7820	protein-coding gene	gene with protein product		300457					Standard	NM_001136024		Approved		uc004cxx.3	Q6T4R5	OTTHUMG00000022799	ENST00000380060.3:c.2339T>C	X.37:g.17744628T>C	ENSP00000369400:p.Val780Ala		Somatic				NHS_uc011mix.1_Missense_Mutation_p.V801A|NHS_uc004cxy.2_Missense_Mutation_p.V624A|NHS_uc004cxz.2_Missense_Mutation_p.V603A|NHS_uc004cya.2_Missense_Mutation_p.V503A	p.V780A	NM_198270	NP_938011	WXS	Illumina HiSeq	Unspecified	Q6T4R5	NHS_HUMAN			6	2677	+	Hepatocellular(33;0.183)		780					B7ZVX8|E2DH69|Q5J7Q0|Q5J7Q1|Q68DR5	Missense_Mutation	SNP	ENST00000380060.3	37	c.2339T>C	CCDS14181.1	.	.	.	.	.	.	.	.	.	.	T	8.757	0.922716	0.18056	.	.	ENSG00000188158	ENST00000380060;ENST00000398097;ENST00000380057	T;T	0.42131	0.98;0.99	5.94	2.07	0.26955	.	0.387640	0.29987	N	0.010689	T	0.17023	0.0409	N	0.12182	0.205	0.29409	N	0.861344	B;B;B;P	0.36837	0.002;0.001;0.001;0.571	B;B;B;B	0.30855	0.004;0.003;0.003;0.121	T	0.18493	-1.0335	10	0.13108	T	0.6	-8.0002	6.2795	0.20999	0.0:0.1427:0.132:0.7253	.	801;622;624;780	B7ZVX8;C9IYM8;Q6T4R5-2;Q6T4R5	.;.;.;NHS_HUMAN	A	780;624;622	ENSP00000369400:V780A;ENSP00000381170:V624A	ENSP00000369397:V622A	V	+	2	0	NHS	17654549	0.998000	0.40836	0.916000	0.36221	0.981000	0.71138	1.725000	0.38074	0.342000	0.23796	0.441000	0.28932	GTC		0.512	NHS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059120.1	NM_198270		34	264	0	0	0	0.003755	0	34	264				
CHDC2	286464	broad.mit.edu	37	X	36122683	36122683	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chrX:36122683C>A	ENST00000313548.4	+	8	1106	c.920C>A	c.(919-921)aCa>aAa	p.T307K		NM_173695.2	NP_775966.1	Q8N9S7	CHDC2_HUMAN	calponin homology domain containing 2	307						integral component of membrane (GO:0016021)		p.T307K(1)									GTGCAAAATACACCAAAAGTC	0.363																																							uc004ddk.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(919-921)ACA>AAA		hypothetical protein LOC286464							131.0	109.0	117.0					X																	36122683		2202	4300	6502	SO:0001583	missense	286464					integral to membrane		g.chrX:36122683C>A	AK093920	CCDS14238.1	Xp21.1	2014-08-07	2012-11-28	2012-11-28	ENSG00000176034	ENSG00000176034			26708	protein-coding gene	gene with protein product			"""chromosome X open reading frame 59"""	CXorf59			Standard	NM_173695		Approved	FLJ36601, RP13-11B7.1	uc004ddk.1	Q8N9S7	OTTHUMG00000021351	ENST00000313548.4:c.920C>A	X.37:g.36122683C>A	ENSP00000324767:p.Thr307Lys		Somatic					p.T307K	NM_173695	NP_775966	WXS	Illumina HiSeq	Unspecified	Q8N9S7	CX059_HUMAN			8	1106	+			307						Missense_Mutation	SNP	ENST00000313548.4	37	c.920C>A	CCDS14238.1	.	.	.	.	.	.	.	.	.	.	C	0.018	-1.466377	0.01053	.	.	ENSG00000176034	ENST00000378660;ENST00000313548	.	.	.	5.53	2.23	0.28157	.	0.798013	0.10506	N	0.666791	T	0.16685	0.0401	N	0.08118	0	0.09310	N	1	B	0.19817	0.039	B	0.09377	0.004	T	0.22487	-1.0215	9	0.33940	T	0.23	-4.4866	4.1626	0.10291	0.4798:0.3539:0.0:0.1663	.	307	Q8N9S7	CX059_HUMAN	K	307	.	ENSP00000324767:T307K	T	+	2	0	CXorf59	36032604	0.055000	0.20627	0.001000	0.08648	0.013000	0.08279	1.677000	0.37576	0.238000	0.21222	-0.222000	0.12452	ACA		0.363	CHDC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_173695		7	124	1	0	5.18039e-06	0.00308	6.61496e-06	7	124				
CYBB	1536	broad.mit.edu	37	X	37658247	37658247	+	Silent	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chrX:37658247G>T	ENST00000378588.4	+	7	781	c.714G>T	c.(712-714)gtG>gtT	p.V238V	CYBB_ENST00000536160.1_5'UTR|CYBB_ENST00000545017.1_Silent_p.V206V|CYBB_ENST00000492288.1_3'UTR|TM4SF2_ENST00000465127.1_Intron	NM_000397.3	NP_000388.2	P04839	CY24B_HUMAN	cytochrome b-245, beta polypeptide	238	Ferric oxidoreductase.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|hydrogen peroxide biosynthetic process (GO:0050665)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interaction with host (GO:0051701)|oxidation-reduction process (GO:0055114)|phagosome maturation (GO:0090382)|respiratory burst (GO:0045730)|response to drug (GO:0042493)|response to nutrient (GO:0007584)|superoxide anion generation (GO:0042554)|superoxide metabolic process (GO:0006801)	dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|NADPH oxidase complex (GO:0043020)|neuronal cell body (GO:0043025)|phagocytic vesicle membrane (GO:0030670)|rough endoplasmic reticulum (GO:0005791)	flavin adenine dinucleotide binding (GO:0050660)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|superoxide-generating NADPH oxidase activity (GO:0016175)|voltage-gated ion channel activity (GO:0005244)	p.V238V(1)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(20)|prostate(2)|skin(2)	32					Dextromethorphan(DB00514)	GTTTGGCTGTGCATAATATAA	0.368																																							uc004ddr.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)|skin(1)	2						c.(712-714)GTG>GTT		cytochrome b-245 beta polypeptide							80.0	77.0	78.0					X																	37658247		2201	4300	6501	SO:0001819	synonymous_variant	1536				electron transport chain|inflammatory response|innate immune response|respiratory burst|superoxide anion generation	NADPH oxidase complex	electron carrier activity|flavin adenine dinucleotide binding|heme binding|protein heterodimerization activity|superoxide-generating NADPH oxidase activity|voltage-gated ion channel activity	g.chrX:37658247G>T	X04011	CCDS14242.1	Xp21.1	2014-09-17	2008-07-29		ENSG00000165168	ENSG00000165168		"""Cytochrome b genes"""	2578	protein-coding gene	gene with protein product		300481	"""chronic granulomatous disease"""	CGD			Standard	NM_000397		Approved	GP91-PHOX, NOX2	uc004ddr.2	P04839	OTTHUMG00000033175	ENST00000378588.4:c.714G>T	X.37:g.37658247G>T			Somatic				CYBB_uc011mke.1_RNA|CYBB_uc011mkf.1_Silent_p.V206V|CYBB_uc011mkg.1_5'UTR	p.V238V	NM_000397	NP_000388	WXS	Illumina HiSeq	Unspecified	P04839	CY24B_HUMAN			7	775	+			238			Extracellular (Potential).|Ferric oxidoreductase.		A8K138|Q2PP16	Silent	SNP	ENST00000378588.4	37	c.714G>T	CCDS14242.1																																																																																				0.368	CYBB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080881.1			5	39	1	0	1.23904e-05	0.000602	1.5488e-05	5	39				
RPGR	6103	broad.mit.edu	37	X	38132681	38132681	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chrX:38132681G>T	ENST00000339363.3	-	17	2981	c.2814C>A	c.(2812-2814)aaC>aaA	p.N938K	RPGR_ENST00000338898.3_3'UTR|RPGR_ENST00000309513.3_Missense_Mutation_p.N671K|RPGR_ENST00000318842.7_Missense_Mutation_p.N733K|TM4SF2_ENST00000465127.1_Intron			Q92834	RPGR_HUMAN	retinitis pigmentosa GTPase regulator	938					cilium assembly (GO:0042384)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|intraciliary transport (GO:0042073)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|Golgi apparatus (GO:0005794)|photoreceptor outer segment (GO:0001750)|sperm flagellum (GO:0036126)	guanyl-nucleotide exchange factor activity (GO:0005085)|poly(A) RNA binding (GO:0044822)	p.N733K(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	25						TTGTTTCACTGTTTTCTAGGA	0.299																																							uc004deb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(2197-2199)AAC>AAA		retinitis pigmentosa GTPase regulator isoform A							236.0	186.0	203.0					X																	38132681		2199	4300	6499	SO:0001583	missense	6103				intracellular protein transport|response to stimulus|visual perception	Golgi apparatus|photoreceptor outer segment	guanyl-nucleotide exchange factor activity|protein binding	g.chrX:38132681G>T	U57629	CCDS14246.1, CCDS35229.1	Xp11.4	2013-06-06	2004-02-13		ENSG00000156313	ENSG00000156313			10295	protein-coding gene	gene with protein product		312610	"""retinitis pigmentosa 15"", ""cone dystrophy 1 (X-linked)"""	CRD, RP3, RP15, COD1		8673101, 8817343	Standard	XM_005272633		Approved	CORDX1	uc004ded.1	Q92834	OTTHUMG00000021361	ENST00000339363.3:c.2814C>A	X.37:g.38132681G>T	ENSP00000343671:p.Asn938Lys		Somatic				RPGR_uc004dea.2_RNA|RPGR_uc004dec.2_RNA	p.N733K	NM_000328	NP_000319	WXS	Illumina HiSeq	Unspecified	Q92834	RPGR_HUMAN			18	2367	-			Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					B1ARN3|E9PE28|O00702|O00737|Q3KN84|Q8N5T6|Q93039|Q9HD29|Q9UMR1	Missense_Mutation	SNP	ENST00000339363.3	37	c.2199C>A		.	.	.	.	.	.	.	.	.	.	G	6.551	0.470031	0.12461	.	.	ENSG00000156313	ENST00000339363;ENST00000309513;ENST00000318842	T;T;T	0.17691	2.42;3.77;2.26	4.15	0.0552	0.14314	.	.	.	.	.	T	0.09512	0.0234	N	0.22421	0.69	0.09310	N	1	B	0.25169	0.119	B	0.21546	0.035	T	0.31888	-0.9927	9	0.41790	T	0.15	.	3.6421	0.08170	0.5868:0.1901:0.2231:0.0	.	733	Q92834-2	.	K	938;671;733	ENSP00000343671:N938K;ENSP00000308783:N671K;ENSP00000322219:N733K	ENSP00000308783:N671K	N	-	3	2	RPGR	38017625	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.077000	0.14738	-0.288000	0.09051	-0.728000	0.03583	AAC		0.299	RPGR-203	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_000328		5	32	1	0	8.12818e-05	0.001984	9.77738e-05	5	32				
USP9X	8239	broad.mit.edu	37	X	41012324	41012324	+	Silent	SNP	A	A	G			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chrX:41012324A>G	ENST00000324545.8	+	14	2520	c.1887A>G	c.(1885-1887)ctA>ctG	p.L629L	USP9X_ENST00000378308.2_Silent_p.L629L	NM_001039590.2|NM_001039591.2	NP_001034679.2|NP_001034680.2	Q93008	USP9X_HUMAN	ubiquitin specific peptidase 9, X-linked	629					axon extension (GO:0048675)|BMP signaling pathway (GO:0030509)|cerebellar cortex structural organization (GO:0021698)|chromosome segregation (GO:0007059)|female gamete generation (GO:0007292)|gene expression (GO:0010467)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|post-embryonic development (GO:0009791)|protein deubiquitination (GO:0016579)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)	co-SMAD binding (GO:0070410)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)	p.L629L(1)|p.L622L(1)		NS(3)|breast(6)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(16)|lung(29)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87						GCATGAGACTATATGCTAGAG	0.338																																					Ovarian(172;1807 2695 35459 49286)	Ovarian(172;1807 2695 35459 49286)	uc004dfb.2		NA																	2	Substitution - coding silent(2)		lung(2)	lung(3)|breast(2)|ovary(1)	6						c.(1885-1887)CTA>CTG		ubiquitin specific protease 9, X-linked isoform							114.0	105.0	108.0					X																	41012324		2159	4279	6438	SO:0001819	synonymous_variant	8239				BMP signaling pathway|cell division|chromosome segregation|female gamete generation|mitosis|protein deubiquitination|transforming growth factor beta receptor signaling pathway|ubiquitin-dependent protein catabolic process	cytoplasm	co-SMAD binding|cysteine-type endopeptidase activity|ubiquitin thiolesterase activity	g.chrX:41012324A>G	X98296	CCDS43930.1, CCDS55403.1	Xp11.4	2010-08-03	2006-02-14		ENSG00000124486	ENSG00000124486		"""Ubiquitin-specific peptidases"""	12632	protein-coding gene	gene with protein product		300072	"""ubiquitin specific protease 9, X chromosome (fat facets-like Drosophila)"", ""ubiquitin specific protease 9, X-linked (fat facets-like, Drosophila)"", ""ubiquitin specific peptidase 9, X-linked (fat facets-like, Drosophila)"""			8922996	Standard	NM_001039590		Approved	DFFRX, FAF	uc004dfb.3	Q93008	OTTHUMG00000021367	ENST00000324545.8:c.1887A>G	X.37:g.41012324A>G			Somatic				USP9X_uc004dfc.2_Silent_p.L629L	p.L629L	NM_001039590	NP_001034679	WXS	Illumina HiSeq	Unspecified	Q93008	USP9X_HUMAN			14	2520	+			629					O75550|Q8WWT3|Q8WX12	Silent	SNP	ENST00000324545.8	37	c.1887A>G	CCDS43930.1																																																																																				0.338	USP9X-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056250.4	NM_004652		24	109	0	0	0	0.003954	0	24	109				
ZNF674	641339	broad.mit.edu	37	X	46387869	46387869	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chrX:46387869C>A	ENST00000523374.1	-	5	364	c.154G>T	c.(154-156)Ggg>Tgg	p.G52W	ZNF674_ENST00000414387.2_Missense_Mutation_p.G52W	NM_001039891.2|NM_001146291.1|NM_001190417.1	NP_001034980.1|NP_001139763.1|NP_001177346.1	Q2M3X9	ZN674_HUMAN	zinc finger protein 674	52	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)	2						TCTGGCTTCCCAACTAGATGC	0.567																																							uc004dgr.2		NA																	0				breast(2)	2						c.(154-156)GGG>TGG		zinc finger family member 674 isoform 1							122.0	113.0	116.0					X																	46387869		2203	4300	6503	SO:0001583	missense	641339				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chrX:46387869C>A	AY971607	CCDS48099.1, CCDS55406.1	Xp11.3	2013-01-08	2010-09-15		ENSG00000251192	ENSG00000251192		"""Zinc fingers, C2H2-type"", ""-"""	17625	protein-coding gene	gene with protein product		300573		MRX92		16385466	Standard	NM_001039891		Approved	ZNF673B	uc004dgr.3	Q2M3X9	OTTHUMG00000021420	ENST00000523374.1:c.154G>T	X.37:g.46387869C>A	ENSP00000429148:p.Gly52Trp		Somatic				ZNF674_uc011mlg.1_Missense_Mutation_p.G52W|ZNF674_uc010nhm.2_Missense_Mutation_p.G52W	p.G52W	NM_001039891	NP_001034980	WXS	Illumina HiSeq	Unspecified	Q2M3X9	ZN674_HUMAN			5	381	-			52			KRAB.		B4DHE2|E9PHQ4	Missense_Mutation	SNP	ENST00000523374.1	37	c.154G>T	CCDS48099.1	.	.	.	.	.	.	.	.	.	.	C	10.51	1.371418	0.24771	.	.	ENSG00000251192	ENST00000523374;ENST00000414387;ENST00000518708	T;T;T	0.00816	5.66;5.66;5.66	2.64	0.39	0.16275	Krueppel-associated box (3);	.	.	.	.	T	0.01320	0.0043	L	0.49513	1.565	0.09310	N	1	B;D;B	0.54047	0.072;0.964;0.185	B;P;B	0.46172	0.003;0.506;0.01	T	0.50939	-0.8768	9	0.51188	T	0.08	.	4.0024	0.09585	0.0:0.4035:0.4217:0.1748	.	52;52;52	E9PHQ4;E5RHV3;Q2M3X9	.;.;ZN674_HUMAN	W	52	ENSP00000429148:G52W;ENSP00000428248:G52W;ENSP00000429646:G52W	ENSP00000428248:G52W	G	-	1	0	ZNF674	46272813	0.000000	0.05858	0.001000	0.08648	0.009000	0.06853	-0.577000	0.05847	0.286000	0.22352	-0.393000	0.06486	GGG		0.567	ZNF674-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056357.2	NM_001039891		17	114	1	0	4.35082e-09	0.010504	6.42558e-09	17	114				
ZNF81	347344	broad.mit.edu	37	X	47774732	47774732	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chrX:47774732G>C	ENST00000376954.1	+	6	1055	c.687G>C	c.(685-687)caG>caC	p.Q229H	ZNF81_ENST00000338637.7_Missense_Mutation_p.Q229H			P51508	ZNF81_HUMAN	zinc finger protein 81	229					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q229H(1)		breast(1)|large_intestine(1)|lung(1)|skin(1)	4		all_lung(315;0.0973)				TTTTTACCCAGAACTCTTCTT	0.373																																							uc010nhy.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(685-687)CAG>CAC		zinc finger protein 81							61.0	59.0	60.0					X																	47774732		1887	4097	5984	SO:0001583	missense	347344					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chrX:47774732G>C	AK126949	CCDS43933.1	Xp11.23	2013-01-08	2006-05-12		ENSG00000197779	ENSG00000197779		"""Zinc fingers, C2H2-type"", ""-"""	13156	protein-coding gene	gene with protein product		314998	"""zinc finger protein 81 (HFZ20)"", ""mental retardation, X-linked 45"""	MRX45		8507979, 15121780	Standard	NM_007137		Approved	HFZ20	uc022bvq.1	P51508	OTTHUMG00000021462	ENST00000376954.1:c.687G>C	X.37:g.47774732G>C	ENSP00000366153:p.Gln229His		Somatic					p.Q229H	NM_007137	NP_009068	WXS	Illumina HiSeq	Unspecified	P51508	ZNF81_HUMAN			6	1055	+		all_lung(315;0.0973)	229					Q6RX22|Q96QH6	Missense_Mutation	SNP	ENST00000376954.1	37	c.687G>C	CCDS43933.1	.	.	.	.	.	.	.	.	.	.	G	0.009	-1.841322	0.00573	.	.	ENSG00000197779	ENST00000376954;ENST00000338637	T;T	0.15718	2.4;2.4	4.04	3.14	0.36123	.	0.378314	0.19592	N	0.110585	T	0.09291	0.0229	L	0.28192	0.835	0.09310	N	1	B	0.19073	0.033	B	0.15052	0.012	T	0.32877	-0.9890	10	0.15499	T	0.54	.	4.6628	0.12650	0.1222:0.2233:0.6545:0.0	.	229	P51508	ZNF81_HUMAN	H	229	ENSP00000366153:Q229H;ENSP00000341151:Q229H	ENSP00000341151:Q229H	Q	+	3	2	ZNF81	47659676	0.001000	0.12720	0.250000	0.24296	0.054000	0.15201	-0.118000	0.10692	1.024000	0.39682	0.600000	0.82982	CAG		0.373	ZNF81-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056455.2	NM_007137		10	111	0	0	0	0.008291	0	10	111				
TIMM17B	10245	broad.mit.edu	37	X	48754088	48754088	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chrX:48754088C>A	ENST00000376582.3	-	3	228	c.80G>T	c.(79-81)gGt>gTt	p.G27V	PQBP1_ENST00000447146.2_5'Flank|PQBP1_ENST00000376548.5_5'Flank|PQBP1_ENST00000396763.1_5'Flank|PQBP1_ENST00000376566.4_5'Flank|TIMM17B_ENST00000495490.2_Missense_Mutation_p.V13L|PQBP1_ENST00000376563.1_5'Flank|PQBP1_ENST00000218224.4_5'Flank|PQBP1_ENST00000247140.4_5'Flank|TIMM17B_ENST00000472645.1_5'UTR|TIMM17B_ENST00000396779.3_Missense_Mutation_p.G27V|TIMM17B_ENST00000465150.2_Missense_Mutation_p.G27V	NM_005834.3	NP_005825.1	O60830	TI17B_HUMAN	translocase of inner mitochondrial membrane 17 homolog B (yeast)	27					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)	integral component of mitochondrial inner membrane (GO:0031305)|mitochondrial inner membrane presequence translocase complex (GO:0005744)	P-P-bond-hydrolysis-driven protein transmembrane transporter activity (GO:0015450)	p.G27V(1)		kidney(1)|large_intestine(1)|lung(3)|ovary(1)	6						GACTCCGCCACCGATGACACC	0.587																																							uc004dlc.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(79-81)GGT>GTT		translocase of inner mitochondrial membrane 17							97.0	75.0	83.0					X																	48754088		2203	4300	6503	SO:0001583	missense	10245				protein targeting to mitochondrion	integral to membrane|microtubule cytoskeleton|mitochondrial inner membrane presequence translocase complex	P-P-bond-hydrolysis-driven protein transmembrane transporter activity	g.chrX:48754088C>A	AF034790	CCDS14308.1, CCDS55411.1	Xp11.23	2008-02-05			ENSG00000126768	ENSG00000126768			17310	protein-coding gene	gene with protein product		300249				10339406	Standard	NM_001167947		Approved	DXS9822, JM3	uc004dla.2	O60830	OTTHUMG00000034498	ENST00000376582.3:c.80G>T	X.37:g.48754088C>A	ENSP00000365766:p.Gly27Val		Somatic				PQBP1_uc004dle.2_5'Flank|PQBP1_uc004dlf.2_5'Flank|PQBP1_uc004dlg.2_5'Flank|PQBP1_uc004dld.2_5'Flank|PQBP1_uc004dlh.2_5'Flank|PQBP1_uc004dli.2_5'Flank|PQBP1_uc004dlj.1_5'Flank|PQBP1_uc004dln.2_5'Flank|PQBP1_uc010nih.2_5'Flank|PQBP1_uc010nii.2_5'Flank|PQBP1_uc004dlk.2_5'Flank|PQBP1_uc004dll.2_5'Flank|PQBP1_uc004dlm.2_5'Flank|PQBP1_uc010nij.2_5'Flank|TIMM17B_uc004dla.1_Missense_Mutation_p.G27V|TIMM17B_uc004dlb.1_Missense_Mutation_p.V13L	p.G27V	NM_005834	NP_005825	WXS	Illumina HiSeq	Unspecified	O60830	TI17B_HUMAN			3	229	-			27			Helical; (Potential).		A8K2E2|J3KPV3|Q9UJV0	Missense_Mutation	SNP	ENST00000376582.3	37	c.80G>T	CCDS14308.1	.	.	.	.	.	.	.	.	.	.	C	33	5.276018	0.95459	.	.	ENSG00000126768	ENST00000376582;ENST00000396779	T;T	0.28666	1.6;1.6	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	T	0.64821	0.2633	M	0.89840	3.065	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.71978	-0.4429	10	0.66056	D	0.02	-2.5366	17.6433	0.88142	0.0:1.0:0.0:0.0	.	27	O60830	TI17B_HUMAN	V	27	ENSP00000365766:G27V;ENSP00000379999:G27V	ENSP00000365766:G27V	G	-	2	0	TIMM17B	48639032	1.000000	0.71417	0.776000	0.31678	0.957000	0.61999	7.465000	0.80898	2.438000	0.82558	0.540000	0.68198	GGT		0.587	TIMM17B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083411.2	NM_005834		8	80	1	0	0.00307968	0.00308	0.00337221	8	80				
DGKK	139189	broad.mit.edu	37	X	50119912	50119912	+	RNA	SNP	A	A	G			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chrX:50119912A>G	ENST00000376025.2	-	0	3175							Q5KSL6	DGKK_HUMAN	diacylglycerol kinase, kappa						blood coagulation (GO:0007596)|diacylglycerol metabolic process (GO:0046339)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)	p.F807F(1)		central_nervous_system(1)|endometrium(12)|kidney(4)|large_intestine(5)|lung(18)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	Ovarian(276;0.236)					TTGAGTTCTCAAAGTCCTGGA	0.478																																							uc010njr.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|kidney(1)	2						c.(3115-3117)TTT>TTC		diacylglycerol kinase kappa							111.0	100.0	104.0					X																	50119912		1962	4142	6104			139189				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|diacylglycerol metabolic process|intracellular signal transduction|platelet activation|response to oxidative stress	cytoplasm|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding	g.chrX:50119912A>G	AB183864	CCDS75980.1	Xp11.22	2006-02-08				ENSG00000274588			32395	protein-coding gene	gene with protein product		300837				16210324	Standard	NM_001013742		Approved		uc010njr.2	Q5KSL6			X.37:g.50119912A>G			Somatic					p.F1039F	NM_001013742	NP_001013764	WXS	Illumina HiSeq	Unspecified	Q5KSL6	DGKK_HUMAN			24	3177	-	Ovarian(276;0.236)		1039					B2RP91	Silent	SNP	ENST00000376025.2	37	c.3117T>C																																																																																					0.478	DGKK-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000368187.1	NM_001013742		9	34	0	0	0	0.008291	0	9	34				
RRAGB	10325	broad.mit.edu	37	X	55784734	55784734	+	Silent	SNP	G	G	C			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chrX:55784734G>C	ENST00000262850.7	+	11	1526	c.1083G>C	c.(1081-1083)ctG>ctC	p.L361L	RRAGB_ENST00000374941.4_Silent_p.L333L	NM_016656.3	NP_057740.2			Ras-related GTP binding B									p.L361L(1)		breast(1)|endometrium(3)|large_intestine(5)|lung(3)|pancreas(1)|prostate(1)	14						TTGAAAAGCTGGAAAGAGTGG	0.423																																							uc004dup.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1081-1083)CTG>CTC		Ras-related GTP binding B long isoform							82.0	69.0	73.0					X																	55784734		2203	4300	6503	SO:0001819	synonymous_variant	10325				cellular protein localization|cellular response to amino acid stimulus|positive regulation of TOR signaling cascade|signal transduction	Golgi apparatus|lysosome|nucleus	GTP binding|protein binding	g.chrX:55784734G>C	X90530	CCDS14371.1, CCDS14372.1	Xp11.21	2008-02-05			ENSG00000083750	ENSG00000083750			19901	protein-coding gene	gene with protein product		300725				7499430, 9394008	Standard	NM_006064		Approved		uc004dup.3	Q5VZM2	OTTHUMG00000021662	ENST00000262850.7:c.1083G>C	X.37:g.55784734G>C			Somatic				RRAGB_uc004duq.2_Silent_p.L333L	p.L361L	NM_016656	NP_057740	WXS	Illumina HiSeq	Unspecified	Q5VZM2	RRAGB_HUMAN			11	1734	+			361						Silent	SNP	ENST00000262850.7	37	c.1083G>C	CCDS14372.1																																																																																				0.423	RRAGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056878.1	NM_016656		3	19	0	0	0	0.009096	0	3	19				
MED12	9968	broad.mit.edu	37	X	70342990	70342990	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chrX:70342990G>T	ENST00000374080.3	+	11	1563	c.1531G>T	c.(1531-1533)Gct>Tct	p.A511S	MED12_ENST00000374102.1_Missense_Mutation_p.A511S|MED12_ENST00000333646.6_Missense_Mutation_p.A511S			Q93074	MED12_HUMAN	mediator complex subunit 12	511					androgen receptor signaling pathway (GO:0030521)|axis elongation involved in somitogenesis (GO:0090245)|canonical Wnt signaling pathway (GO:0060070)|gene expression (GO:0010467)|heart development (GO:0007507)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|oligodendrocyte development (GO:0014003)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|Schwann cell development (GO:0014044)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|receptor activity (GO:0004872)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)	p.A511S(2)		breast(6)|central_nervous_system(2)|endometrium(22)|kidney(5)|large_intestine(8)|lung(31)|ovary(2)|pancreas(1)|prostate(11)|skin(5)|soft_tissue(323)|upper_aerodigestive_tract(1)|urinary_tract(3)	420	Renal(35;0.156)					ATGTGAATGGGCTGTCAGCTG	0.527			"""M, S"""		uterine leiomyoma		Opitz-Kaveggia Syndrome																																uc004dyy.2		NA		Dom	yes		X	Xq13	9968		mediator complex subunit 12	Yes		M					2	Substitution - Missense(2)		lung(2)	ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4						c.(1531-1533)GCT>TCT		mediator complex subunit 12							179.0	157.0	164.0					X																	70342990		2115	4219	6334	SO:0001583	missense	9968				androgen receptor signaling pathway|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|protein C-terminus binding|protein domain specific binding|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding	g.chrX:70342990G>T	U80742	CCDS43970.1	Xq13	2011-02-14	2007-07-30	2004-11-26	ENSG00000184634	ENSG00000184634			11957	protein-coding gene	gene with protein product		300188	"""trinucleotide repeat containing 11 (THR-associated protein, 230kDa subunit)"", ""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)"", ""FG syndrome 1"""	TNRC11, FGS1		9225980, 10198638, 17334363, 20507344	Standard	NM_005120		Approved	CAGH45, HOPA, OPA1, TRAP230, KIAA0192, OKS	uc004dyy.3	Q93074	OTTHUMG00000021788	ENST00000374080.3:c.1531G>T	X.37:g.70342990G>T	ENSP00000363193:p.Ala511Ser		Somatic				MED12_uc011mpq.1_Missense_Mutation_p.A511S|MED12_uc004dyz.2_Missense_Mutation_p.A511S|MED12_uc004dza.2_Missense_Mutation_p.A358S	p.A511S	NM_005120	NP_005111	WXS	Illumina HiSeq	Unspecified	Q93074	MED12_HUMAN			11	1730	+	Renal(35;0.156)		511					O15410|O75557|Q9UHV6|Q9UND7	Missense_Mutation	SNP	ENST00000374080.3	37	c.1531G>T	CCDS43970.1	.	.	.	.	.	.	.	.	.	.	.	29.4	5.000933	0.93227	.	.	ENSG00000184634	ENST00000333646;ENST00000536756;ENST00000374102;ENST00000374080;ENST00000430072	T;T;T;T	0.52754	0.65;0.65;0.65;0.65	4.46	4.46	0.54185	Mediator complex, subunit Med12, LCEWAV-domain (1);	0.000000	0.85682	D	0.000000	T	0.73583	0.3605	M	0.88450	2.955	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;1.0;1.0	D;D;D;D	0.91635	0.996;0.998;0.999;0.999	T	0.80580	-0.1319	10	0.72032	D	0.01	-10.5855	16.4447	0.83919	0.0:0.0:1.0:0.0	.	511;358;511;511	F5H3Y1;Q7Z3Z5;Q93074-3;Q93074	.;.;.;MED12_HUMAN	S	511;511;511;511;479	ENSP00000333125:A511S;ENSP00000363215:A511S;ENSP00000363193:A511S;ENSP00000414203:A479S	ENSP00000333125:A511S	A	+	1	0	MED12	70259715	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	8.983000	0.93477	2.050000	0.60909	0.509000	0.49947	GCT		0.527	MED12-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000057105.1	NM_005120		39	234	1	0	1.96642e-18	0.006999	3.5636e-18	39	234				
KIAA2022	340533	broad.mit.edu	37	X	73963899	73963899	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chrX:73963899G>C	ENST00000055682.6	-	3	1104	c.493C>G	c.(493-495)Ctg>Gtg	p.L165V		NM_001008537.2	NP_001008537.1	Q5QGS0	K2022_HUMAN	KIAA2022	165					base-excision repair, gap-filling (GO:0006287)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|nervous system development (GO:0007399)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)	delta DNA polymerase complex (GO:0043625)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|DNA-directed DNA polymerase activity (GO:0003887)	p.L165V(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(23)|liver(1)|lung(41)|ovary(7)|pancreas(2)|prostate(4)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	109						CCAACTTTCAGACTGATCCCT	0.448																																							uc004eby.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(7)|large_intestine(4)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	15						c.(493-495)CTG>GTG		hypothetical protein LOC340533							79.0	67.0	71.0					X																	73963899		2203	4300	6503	SO:0001583	missense	340533				base-excision repair, gap-filling|DNA replication proofreading|DNA replication, removal of RNA primer|nucleotide-excision repair, DNA gap filling|regulation of mitotic cell cycle|S phase of mitotic cell cycle	delta DNA polymerase complex	3'-5'-exodeoxyribonuclease activity|DNA-directed DNA polymerase activity	g.chrX:73963899G>C		CCDS35337.1	Xq13.3	2014-02-19			ENSG00000050030	ENSG00000050030			29433	protein-coding gene	gene with protein product	"""XLMR-related protein, neurite extension"""	300524				15466006, 23615299	Standard	NM_001008537		Approved	XPN, MRX98	uc004eby.3	Q5QGS0	OTTHUMG00000021860	ENST00000055682.6:c.493C>G	X.37:g.73963899G>C	ENSP00000055682:p.Leu165Val		Somatic					p.L165V	NM_001008537	NP_001008537	WXS	Illumina HiSeq	Unspecified	Q5QGS0	K2022_HUMAN			3	1110	-			165					A7YY87|Q5JUX9|Q8IVE9	Missense_Mutation	SNP	ENST00000055682.6	37	c.493C>G	CCDS35337.1	.	.	.	.	.	.	.	.	.	.	G	7.709	0.694762	0.15039	.	.	ENSG00000050030	ENST00000373468;ENST00000055682	T;T	0.36157	1.27;1.27	6.08	4.02	0.46733	.	0.268439	0.31061	N	0.008336	T	0.30448	0.0765	L	0.47716	1.5	0.41906	D	0.990444	B	0.31435	0.323	B	0.26770	0.073	T	0.20638	-1.0269	10	0.87932	D	0	-4.3525	11.3331	0.49487	0.228:0.0:0.772:0.0	.	165	Q5QGS0	K2022_HUMAN	V	165	ENSP00000362567:L165V;ENSP00000055682:L165V	ENSP00000055682:L165V	L	-	1	2	KIAA2022	73880624	1.000000	0.71417	0.983000	0.44433	0.996000	0.88848	2.810000	0.47979	1.311000	0.45024	0.600000	0.82982	CTG		0.448	KIAA2022-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057270.2	NM_001008537		10	117	0	0	0	0.008291	0	10	117				
MAGEE1	57692	broad.mit.edu	37	X	75649077	75649077	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chrX:75649077C>A	ENST00000361470.2	+	1	1032	c.754C>A	c.(754-756)Cgt>Agt	p.R252S		NM_020932.2	NP_065983.1	Q9HCI5	MAGE1_HUMAN	melanoma antigen family E, 1	252	Pro-rich.					dendrite (GO:0030425)|dystrophin-associated glycoprotein complex (GO:0016010)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)		p.R252S(2)		breast(3)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(12)|lung(20)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(1)	51						GCCACCCACCCGTGATGAGGG	0.697																																							uc004ecm.1		NA																	2	Substitution - Missense(2)		lung(2)	breast(3)|ovary(1)|pancreas(1)|skin(1)	6						c.(754-756)CGT>AGT		melanoma antigen family E, 1							25.0	25.0	25.0					X																	75649077		2200	4295	6495	SO:0001583	missense	57692					dendrite|nucleus|perinuclear region of cytoplasm|postsynaptic membrane		g.chrX:75649077C>A	AF490507	CCDS14433.1	Xq13	2008-02-05			ENSG00000198934	ENSG00000198934			24934	protein-coding gene	gene with protein product		300759				14623885	Standard	NM_020932		Approved	KIAA1587, DAMAGE	uc004ecm.2	Q9HCI5	OTTHUMG00000021879	ENST00000361470.2:c.754C>A	X.37:g.75649077C>A	ENSP00000354912:p.Arg252Ser		Somatic					p.R252S	NM_020932	NP_065983	WXS	Illumina HiSeq	Unspecified	Q9HCI5	MAGE1_HUMAN			1	961	+			252			Pro-rich.		Q5JXC7|Q86TG0|Q8TD92|Q9H216	Missense_Mutation	SNP	ENST00000361470.2	37	c.754C>A	CCDS14433.1	.	.	.	.	.	.	.	.	.	.	c	0.009	-1.829228	0.00584	.	.	ENSG00000198934	ENST00000361470	T	0.08984	3.03	2.28	-4.57	0.03421	.	.	.	.	.	T	0.02494	0.0076	N	0.03608	-0.345	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.43261	-0.9402	9	0.12430	T	0.62	.	3.7832	0.08689	0.1299:0.2837:0.4683:0.118	.	252	Q9HCI5	MAGE1_HUMAN	S	252	ENSP00000354912:R252S	ENSP00000354912:R252S	R	+	1	0	MAGEE1	75565481	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.962000	0.01514	-1.819000	0.01216	-2.209000	0.00301	CGT		0.697	MAGEE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057298.1	NM_020932		10	28	1	0	6.40141e-05	0.000978	7.74515e-05	10	28				
MAGT1	84061	broad.mit.edu	37	X	77086363	77086363	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chrX:77086363C>A	ENST00000358075.6	-	9	1113	c.1027G>T	c.(1027-1029)Gta>Tta	p.V343L		NM_032121.5	NP_115497.4	Q9H0U3	MAGT1_HUMAN	magnesium transporter 1	311					cellular protein metabolic process (GO:0044267)|cognition (GO:0050890)|magnesium ion transport (GO:0015693)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|oligosaccharyltransferase complex (GO:0008250)	magnesium ion transmembrane transporter activity (GO:0015095)	p.V311L(1)		cervix(1)|kidney(2)|large_intestine(3)|lung(9)|prostate(1)|upper_aerodigestive_tract(1)	17						AAGAATAATACAACAAGTCCA	0.323																																							uc004fof.2		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)	1						c.(1027-1029)GTA>TTA		magnesium transporter 1							82.0	74.0	77.0					X																	77086363		2203	4295	6498	SO:0001583	missense	84061				protein N-linked glycosylation via asparagine	integral to membrane|oligosaccharyltransferase complex		g.chrX:77086363C>A		CCDS14436.2	Xq21.1	2014-09-17			ENSG00000102158	ENSG00000102158			28880	protein-coding gene	gene with protein product	"""oligosaccharyltransferase 3 homolog B (S. cerevisiae)"""	300715				15804357	Standard	NM_032121		Approved	DKFZp564K142, IAP, OST3B, MRX95	uc004fof.3	Q9H0U3	OTTHUMG00000021882	ENST00000358075.6:c.1027G>T	X.37:g.77086363C>A	ENSP00000354649:p.Val343Leu		Somatic				MAGT1_uc004fog.3_RNA	p.V343L	NM_032121	NP_115497	WXS	Illumina HiSeq	Unspecified	Q9H0U3	MAGT1_HUMAN			9	1089	-			311		V -> G (in MRX95).	Helical; (Potential).		B2RAR4|D3DTE3|Q53G00|Q6P577|Q8NBN6	Missense_Mutation	SNP	ENST00000358075.6	37	c.1027G>T	CCDS14436.2	.	.	.	.	.	.	.	.	.	.	C	13.97	2.396704	0.42512	.	.	ENSG00000102158	ENST00000358075;ENST00000453109	T	0.76578	-1.03	5.49	3.74	0.42951	.	0.397772	0.25302	U	0.031657	T	0.73481	0.3592	L	0.61218	1.895	0.80722	D	1	B	0.15930	0.015	B	0.26969	0.075	T	0.63655	-0.6588	10	0.18710	T	0.47	-2.1522	11.5987	0.50990	0.0:0.8607:0.0:0.1393	.	311	Q9H0U3	MAGT1_HUMAN	L	343;194	ENSP00000354649:V343L	ENSP00000354649:V343L	V	-	1	0	MAGT1	76973019	1.000000	0.71417	0.988000	0.46212	0.671000	0.39405	1.719000	0.38011	0.515000	0.28320	-0.711000	0.03637	GTA		0.323	MAGT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057301.2	NM_032121		11	50	1	0	0.000151284	0.001855	0.00017938	11	50				
ZCCHC5	203430	broad.mit.edu	37	X	77913592	77913592	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chrX:77913592G>A	ENST00000321110.1	-	2	621	c.326C>T	c.(325-327)cCa>cTa	p.P109L		NM_152694.2	NP_689907.1	Q8N8U3	ZCHC5_HUMAN	zinc finger, CCHC domain containing 5	109	Pro-rich.						nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.P109L(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(18)|ovary(1)|prostate(1)|skin(1)	37						TGGGGCTGCTGGGGCCTCCTG	0.637																																							uc004edc.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(325-327)CCA>CTA		zinc finger, CCHC domain containing 5							19.0	22.0	21.0					X																	77913592		2200	4292	6492	SO:0001583	missense	203430						nucleic acid binding|zinc ion binding	g.chrX:77913592G>A	AK096184	CCDS14440.1	Xq13.3	2008-02-05			ENSG00000179300	ENSG00000179300		"""Zinc fingers, CCHC domain containing"""	22997	protein-coding gene	gene with protein product						15716091, 16093683	Standard	NM_152694		Approved	FLJ38865, Mar3, Mart3, ZHC5	uc004edc.1	Q8N8U3	OTTHUMG00000021892	ENST00000321110.1:c.326C>T	X.37:g.77913592G>A	ENSP00000316794:p.Pro109Leu		Somatic					p.P109L	NM_152694	NP_689907	WXS	Illumina HiSeq	Unspecified	Q8N8U3	ZCHC5_HUMAN			2	622	-			109			Pro-rich.		B2RMZ0|Q5JQE9	Missense_Mutation	SNP	ENST00000321110.1	37	c.326C>T	CCDS14440.1	.	.	.	.	.	.	.	.	.	.	G	8.261	0.811238	0.16537	.	.	ENSG00000179300	ENST00000321110	T	0.19105	2.17	3.01	1.19	0.21007	.	.	.	.	.	T	0.09730	0.0239	N	0.08118	0	0.09310	N	1	B	0.12013	0.005	B	0.08055	0.003	T	0.28004	-1.0057	9	0.56958	D	0.05	.	4.8855	0.13701	0.1276:0.0:0.6626:0.2098	.	109	Q8N8U3	ZCHC5_HUMAN	L	109	ENSP00000316794:P109L	ENSP00000316794:P109L	P	-	2	0	ZCCHC5	77800248	0.006000	0.16342	0.001000	0.08648	0.063000	0.16089	0.953000	0.29162	0.182000	0.20032	0.422000	0.28245	CCA		0.637	ZCCHC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057319.1	NM_152694		13	43	0	0	0	0.001855	0	13	43				
CSTF2	1478	broad.mit.edu	37	X	100086550	100086550	+	Silent	SNP	T	T	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chrX:100086550T>A	ENST00000372972.2	+	9	952	c.936T>A	c.(934-936)ccT>ccA	p.P312P	CSTF2_ENST00000415585.2_Silent_p.P332P	NM_001325.2	NP_001316.1	P33240	CSTF2_HUMAN	cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa	312	Gly/Pro-rich.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	cleavage body (GO:0071920)|mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.P312P(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|skin(2)|stomach(1)	13						GATCCTTGCCTGCGAATGTCC	0.527																																							uc004egh.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(934-936)CCT>CCA		cleavage stimulation factor subunit 2							127.0	110.0	116.0					X																	100086550		2203	4300	6503	SO:0001819	synonymous_variant	1478				mRNA cleavage|mRNA polyadenylation|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	cleavage body|mRNA cleavage and polyadenylation specificity factor complex	nucleotide binding|protein binding|protein binding|RNA binding	g.chrX:100086550T>A	BC017712	CCDS14473.1	Xq22.1	2013-02-12	2002-08-29		ENSG00000101811	ENSG00000101811		"""RNA binding motif (RRM) containing"""	2484	protein-coding gene	gene with protein product		300907	"""cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kD"""			1741396	Standard	XM_006724622		Approved		uc004egh.3	P33240	OTTHUMG00000022709	ENST00000372972.2:c.936T>A	X.37:g.100086550T>A			Somatic				CSTF2_uc010nnd.2_Silent_p.P332P|CSTF2_uc004egi.2_Silent_p.P295P	p.P312P	NM_001325	NP_001316	WXS	Illumina HiSeq	Unspecified	P33240	CSTF2_HUMAN			9	994	+			312			Gly/Pro-rich.		Q5H951|Q6LA74|Q8N502	Silent	SNP	ENST00000372972.2	37	c.936T>A	CCDS14473.1																																																																																				0.527	CSTF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058926.1	NM_001325		16	245	0	0	0	0.006122	0	16	245				
BHLHB9	80823	broad.mit.edu	37	X	102004639	102004639	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chrX:102004639C>T	ENST00000372735.1	+	4	1301	c.716C>T	c.(715-717)tCt>tTt	p.S239F	BHLHB9_ENST00000447531.1_Missense_Mutation_p.S239F|BHLHB9_ENST00000448867.1_Missense_Mutation_p.S239F|BHLHB9_ENST00000457056.1_Missense_Mutation_p.S239F|BHLHB9_ENST00000361229.4_Missense_Mutation_p.S239F			Q6PI77	BHLH9_HUMAN	basic helix-loop-helix domain containing, class B, 9	239					learning or memory (GO:0007611)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of neurogenesis (GO:0050769)|positive regulation of synapse assembly (GO:0051965)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)	p.S239F(1)		cervix(1)|endometrium(6)|kidney(3)|large_intestine(1)|lung(8)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						CAGGCACCATCTGAGGCAAGC	0.507																																							uc010nog.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(715-717)TCT>TTT		basic helix-loop-helix domain containing, class							76.0	71.0	73.0					X																	102004639		2203	4299	6502	SO:0001583	missense	80823					cytoplasm|nucleus	binding	g.chrX:102004639C>T	AB051488	CCDS14502.1	Xq23	2014-03-21			ENSG00000198908	ENSG00000198908		"""Basic helix-loop-helix proteins"", ""Armadillo repeat containing"""	29353	protein-coding gene	gene with protein product		300921				11214970, 15034937, 16221301	Standard	NM_030639		Approved	p60TRP, KIAA1701, GASP3	uc011mrv.2	Q6PI77	OTTHUMG00000022060	ENST00000372735.1:c.716C>T	X.37:g.102004639C>T	ENSP00000361820:p.Ser239Phe		Somatic				BHLHB9_uc011mrq.1_Missense_Mutation_p.S239F|BHLHB9_uc011mrr.1_Missense_Mutation_p.S239F|BHLHB9_uc011mrs.1_Missense_Mutation_p.S239F|BHLHB9_uc011mrt.1_Missense_Mutation_p.S239F|BHLHB9_uc004ejo.2_Missense_Mutation_p.S239F|BHLHB9_uc011mru.1_Missense_Mutation_p.S239F|BHLHB9_uc011mrv.1_Missense_Mutation_p.S239F	p.S239F	NM_001142526	NP_001135998	WXS	Illumina HiSeq	Unspecified	Q6PI77	BHLH9_HUMAN			4	1287	+			239					Q9C0G2	Missense_Mutation	SNP	ENST00000372735.1	37	c.716C>T	CCDS14502.1	.	.	.	.	.	.	.	.	.	.	C	1.960	-0.439030	0.04636	.	.	ENSG00000198908	ENST00000457056;ENST00000361229;ENST00000447531;ENST00000448867;ENST00000372735	T;T;T;T;T	0.11063	2.81;2.81;2.81;2.81;2.81	4.5	-3.99	0.04069	.	1.487090	0.04140	N	0.319367	T	0.04272	0.0118	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.34354	-0.9832	9	.	.	.	-14.6477	1.2874	0.02053	0.1324:0.2096:0.2577:0.4003	.	239	Q6PI77	BHLH9_HUMAN	F	239	ENSP00000403226:S239F;ENSP00000354675:S239F;ENSP00000405893:S239F;ENSP00000391722:S239F;ENSP00000361820:S239F	.	S	+	2	0	BHLHB9	101891295	0.003000	0.15002	0.000000	0.03702	0.234000	0.25298	-0.639000	0.05446	-1.131000	0.02910	-0.234000	0.12200	TCT		0.507	BHLHB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057630.1	NM_030639		24	193	0	0	0	0.002299	0	24	193				
ATG4A	115201	broad.mit.edu	37	X	107381398	107381398	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chrX:107381398C>A	ENST00000372232.3	+	9	950	c.791C>A	c.(790-792)gCg>gAg	p.A264E	ATG4A_ENST00000545696.1_Intron|ATG4A_ENST00000345734.3_Intron|ATG4A_ENST00000372254.3_Missense_Mutation_p.A240E	NM_052936.3	NP_443168.2	Q8WYN0	ATG4A_HUMAN	autophagy related 4A, cysteine peptidase	264					autophagy (GO:0006914)|protein transport (GO:0015031)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	cysteine-type peptidase activity (GO:0008234)	p.A264E(2)		endometrium(3)|large_intestine(3)|lung(3)|pancreas(1)|prostate(1)	11						CCAAATAACGCGTATTATTTC	0.458																																							uc004enr.2		NA																	2	Substitution - Missense(2)		lung(2)	pancreas(1)	1						c.(790-792)GCG>GAG		autophagy-related cysteine endopeptidase 2							168.0	154.0	159.0					X																	107381398		2203	4300	6503	SO:0001583	missense	115201				autophagy|protein transport|proteolysis	cytoplasm	cysteine-type peptidase activity	g.chrX:107381398C>A	AJ320508	CCDS14538.1, CCDS14539.1	Xq22.1-q22.3	2014-02-12	2012-06-06	2005-09-11	ENSG00000101844	ENSG00000101844			16489	protein-coding gene	gene with protein product		300663	"""AUT-like 2, cysteine endopeptidase (S. cerevisiae)"", ""APG4 autophagy 4 homolog A (S. cerevisiae)"", ""ATG4 autophagy related 4 homolog A (S. cerevisiae)"""	AUTL2, APG4A		12446702, 12473658	Standard	NM_052936		Approved		uc004enr.3	Q8WYN0	OTTHUMG00000022176	ENST00000372232.3:c.791C>A	X.37:g.107381398C>A	ENSP00000361306:p.Ala264Glu		Somatic				ATG4A_uc004ent.2_Intron|ATG4A_uc004ens.2_Missense_Mutation_p.A180E|ATG4A_uc011msl.1_Intron|ATG4A_uc010npi.2_Intron|ATG4A_uc004enu.2_Missense_Mutation_p.A180E	p.A264E	NM_052936	NP_443168	WXS	Illumina HiSeq	Unspecified	Q8WYN0	ATG4A_HUMAN			9	914	+			264					A6NCH2|B2RAZ7|D3DUY0|O95534|Q5JYY9|Q5JYZ0|Q86VE5|Q96KQ0|Q96KQ1	Missense_Mutation	SNP	ENST00000372232.3	37	c.791C>A	CCDS14538.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.4|25.4	4.633460|4.633460	0.87660|0.87660	.|.	.|.	ENSG00000101844|ENSG00000101844	ENST00000372232;ENST00000372254;ENST00000457035|ENST00000394892	T;T|.	0.58940|.	0.3;0.33|.	5.41|5.41	5.41|5.41	0.78517|0.78517	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.87330|0.87330	0.6150|0.6150	H|H	0.94698|0.94698	3.57|3.57	0.80722|0.80722	D|D	1|1	D|.	0.69078|.	0.997|.	D|.	0.81914|.	0.995|.	D|D	0.91055|0.91055	0.4881|0.4881	10|5	0.87932|.	D|.	0|.	-7.0194|-7.0194	18.2362|18.2362	0.89950|0.89950	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	264|.	Q8WYN0|.	ATG4A_HUMAN|.	E|S	264;240;187|237	ENSP00000361306:A264E;ENSP00000361328:A240E|.	ENSP00000361306:A264E|.	A|R	+|+	2|1	0|0	ATG4A|ATG4A	107268054|107268054	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	6.697000|6.697000	0.74603|0.74603	2.244000|2.244000	0.73946|0.73946	0.556000|0.556000	0.70494|0.70494	GCG|CGT		0.458	ATG4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057860.1	NM_052936		47	311	1	0	8.00217e-19	0.00361	1.45653e-18	47	311				
COL4A5	1287	broad.mit.edu	37	X	107821581	107821581	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chrX:107821581C>A	ENST00000361603.2	+	13	992	c.748C>A	c.(748-750)Cca>Aca	p.P250T	COL4A5_ENST00000328300.6_Missense_Mutation_p.P250T	NM_000495.4	NP_000486.1	P29400	CO4A5_HUMAN	collagen, type IV, alpha 5	250	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|neuromuscular junction (GO:0031594)	extracellular matrix structural constituent (GO:0005201)	p.P250T(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(32)|ovary(4)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	99						ACAGAAAAGACCAATTGATGT	0.423									Alport syndrome with Diffuse Leiomyomatosis																														uc004enz.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|central_nervous_system(1)	4						c.(748-750)CCA>ACA		type IV collagen alpha 5 isoform 2 precursor							90.0	92.0	91.0					X																	107821581		2203	4300	6503	SO:0001583	missense	1287	Alport_syndrome_with_Diffuse_Leiomyomatosis	Familial Cancer Database		axon guidance	collagen type IV	extracellular matrix structural constituent|protein binding	g.chrX:107821581C>A	M90464	CCDS14543.1, CCDS35366.1	Xq22	2014-09-17	2008-07-28		ENSG00000188153	ENSG00000188153		"""Collagens"""	2207	protein-coding gene	gene with protein product		303630	"""Alport syndrome"""	ASLN, ATS			Standard	NM_000495		Approved		uc004enz.2	P29400	OTTHUMG00000022182	ENST00000361603.2:c.748C>A	X.37:g.107821581C>A	ENSP00000354505:p.Pro250Thr		Somatic				COL4A5_uc011mso.1_Missense_Mutation_p.P250T	p.P250T	NM_033380	NP_203699	WXS	Illumina HiSeq	Unspecified	P29400	CO4A5_HUMAN			13	950	+			250			Triple-helical region.		Q16006|Q16126|Q6LD84|Q7Z700|Q9NUB7	Missense_Mutation	SNP	ENST00000361603.2	37	c.748C>A	CCDS14543.1	.	.	.	.	.	.	.	.	.	.	C	14.25	2.480746	0.44044	.	.	ENSG00000188153	ENST00000328300;ENST00000361603;ENST00000508186	D;D	0.97710	-4.5;-4.5	5.08	4.01	0.46588	.	0.151965	0.43110	D	0.000615	D	0.92388	0.7584	N	0.13327	0.33	0.44188	D	0.997002	B;B	0.34103	0.437;0.437	B;B	0.32090	0.14;0.14	D	0.91411	0.5151	10	0.12103	T	0.63	.	13.4841	0.61355	0.0:0.9069:0.0:0.0931	.	250;250	E7EVY4;P29400	.;CO4A5_HUMAN	T	250	ENSP00000331902:P250T;ENSP00000354505:P250T	ENSP00000331902:P250T	P	+	1	0	COL4A5	107708237	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.296000	0.43584	2.084000	0.62774	0.600000	0.82982	CCA		0.423	COL4A5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057880.2			15	119	1	0	5.01169e-05	0.00499	6.13526e-05	15	119				
GUCY2F	2986	broad.mit.edu	37	X	108708514	108708514	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chrX:108708514C>A	ENST00000218006.2	-	3	1180	c.889G>T	c.(889-891)Gtc>Ttc	p.V297F		NM_001522.2	NP_001513.2	P51841	GUC2F_HUMAN	guanylate cyclase 2F, retinal	297					intracellular signal transduction (GO:0035556)|phototransduction, visible light (GO:0007603)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|nuclear outer membrane (GO:0005640)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)	p.V297F(1)		breast(3)|central_nervous_system(2)|endometrium(5)|kidney(6)|large_intestine(14)|lung(33)|prostate(3)|skin(1)	67						TTCCTTAGGACCCGGTAGGGG	0.478																																							uc004eod.3		NA																	1	Substitution - Missense(1)		lung(1)	lung(4)|breast(3)|central_nervous_system(1)	8						c.(889-891)GTC>TTC		guanylate cyclase 2F precursor							141.0	118.0	126.0					X																	108708514		2203	4300	6503	SO:0001583	missense	2986				intracellular signal transduction|receptor guanylyl cyclase signaling pathway|visual perception	integral to plasma membrane|nuclear outer membrane	ATP binding|GTP binding|guanylate cyclase activity|protein kinase activity|receptor activity	g.chrX:108708514C>A	L37378	CCDS14545.1	Xq22	2008-08-01			ENSG00000101890	ENSG00000101890			4691	protein-coding gene	gene with protein product	"""guanylate cyclase 2D-like, membrane (retina-specific)"""	300041				8838319, 7777544	Standard	NM_001522		Approved	GUC2DL, GC-F, RetGC-2, ROS-GC2, CYGF	uc004eod.4	P51841	OTTHUMG00000022184	ENST00000218006.2:c.889G>T	X.37:g.108708514C>A	ENSP00000218006:p.Val297Phe		Somatic				GUCY2F_uc011msq.1_RNA	p.V297F	NM_001522	NP_001513	WXS	Illumina HiSeq	Unspecified	P51841	GUC2F_HUMAN			3	1165	-			297			Extracellular (Potential).		Q9UJF1	Missense_Mutation	SNP	ENST00000218006.2	37	c.889G>T	CCDS14545.1	.	.	.	.	.	.	.	.	.	.	C	15.64	2.892713	0.52121	.	.	ENSG00000101890	ENST00000218006	T	0.74106	-0.81	3.94	2.14	0.27477	Extracellular ligand-binding receptor (1);	0.355460	0.29046	N	0.013301	T	0.61999	0.2392	L	0.43923	1.385	0.27010	N	0.964719	B	0.32467	0.372	B	0.36030	0.216	T	0.55283	-0.8165	10	0.48119	T	0.1	.	2.7489	0.05274	0.2287:0.5275:0.0:0.2438	.	297	P51841	GUC2F_HUMAN	F	297	ENSP00000218006:V297F	ENSP00000218006:V297F	V	-	1	0	GUCY2F	108595170	0.014000	0.17966	0.716000	0.30569	0.991000	0.79684	0.265000	0.18515	0.432000	0.26286	0.600000	0.82982	GTC		0.478	GUCY2F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057884.1	NM_001522		42	181	1	0	2.59497e-14	0.007835	4.43174e-14	42	181				
TRPC5	7224	broad.mit.edu	37	X	111090471	111090471	+	Missense_Mutation	SNP	T	T	A	rs3027722		TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chrX:111090471T>A	ENST00000262839.2	-	6	2489	c.1571A>T	c.(1570-1572)tAc>tTc	p.Y524F		NM_012471.2	NP_036603.1	Q9UL62	TRPC5_HUMAN	transient receptor potential cation channel, subfamily C, member 5	524					axon guidance (GO:0007411)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|nervous system development (GO:0007399)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)	p.Y524F(1)		biliary_tract(1)|breast(4)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(38)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						TACCAGGCAGTAGATAAAGAG	0.463																																							uc004epl.1		NA																	1	Substitution - Missense(1)		lung(1)	urinary_tract(1)	1						c.(1570-1572)TAC>TTC		transient receptor potential cation channel,							159.0	142.0	148.0					X																	111090471		2203	4300	6503	SO:0001583	missense	7224				axon guidance	calcium channel complex|integral to plasma membrane	protein binding|store-operated calcium channel activity	g.chrX:111090471T>A	AF054568	CCDS14561.1	Xq23	2014-06-13			ENSG00000072315	ENSG00000072315		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12337	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 159"""	300334				10493832, 16382100	Standard	NM_012471		Approved	PPP1R159	uc004epl.1	Q9UL62	OTTHUMG00000022212	ENST00000262839.2:c.1571A>T	X.37:g.111090471T>A	ENSP00000262839:p.Tyr524Phe		Somatic				TRPC5_uc004epm.1_Missense_Mutation_p.Y524F	p.Y524F	NM_012471	NP_036603	WXS	Illumina HiSeq	Unspecified	Q9UL62	TRPC5_HUMAN			6	2490	-			524			Helical; (Potential).		B2RP53|O75233|Q5JXY8|Q9Y514	Missense_Mutation	SNP	ENST00000262839.2	37	c.1571A>T	CCDS14561.1	.	.	.	.	.	.	.	.	.	.	T	20.2	3.951466	0.73787	.	.	ENSG00000072315	ENST00000262839	D	0.98437	-4.93	5.38	5.38	0.77491	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.97548	0.9197	L	0.28649	0.875	0.80722	D	1	D;D	0.69078	0.988;0.997	D;D	0.71414	0.945;0.973	D	0.96508	0.9376	10	0.16896	T	0.51	-11.3402	14.5235	0.67870	0.0:0.0:0.0:1.0	rs3027722;rs3027722	525;524	Q59G51;Q9UL62	.;TRPC5_HUMAN	F	524	ENSP00000262839:Y524F	ENSP00000262839:Y524F	Y	-	2	0	TRPC5	110977127	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.997000	0.88414	1.810000	0.52873	0.356000	0.21956	TAC		0.463	TRPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057945.1	NM_012471		25	179	0	0	0	0.00278	0	25	179				
ZCCHC16	340595	broad.mit.edu	37	X	111698312	111698312	+	Missense_Mutation	SNP	G	G	C	rs149089921		TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chrX:111698312G>C	ENST00000340433.2	+	1	586	c.356G>C	c.(355-357)aGt>aCt	p.S119T		NM_001004308.2	NP_001004308.2	Q6ZR62	ZCH16_HUMAN	zinc finger, CCHC domain containing 16	119							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.S119T(1)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	27						CCTGACAAGAGTACCTTACTG	0.383																																							uc004epo.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(355-357)AGT>ACT		zinc finger, CCHC domain containing 16							97.0	88.0	91.0					X																	111698312		2203	4300	6503	SO:0001583	missense	340595						nucleic acid binding|zinc ion binding	g.chrX:111698312G>C	AK128465	CCDS35369.1	Xq23	2008-05-02			ENSG00000187823	ENSG00000187823		"""Zinc fingers, CCHC domain containing"""	25214	protein-coding gene	gene with protein product						15716091, 16093683	Standard	NM_001004308		Approved	Mart4, Mar4, FLJ46608	uc004epo.1	Q6ZR62	OTTHUMG00000159706	ENST00000340433.2:c.356G>C	X.37:g.111698312G>C	ENSP00000340590:p.Ser119Thr		Somatic					p.S119T	NM_001004308	NP_001004308	WXS	Illumina HiSeq	Unspecified	Q6ZR62	ZCH16_HUMAN			3	797	+			119					B2RPG1	Missense_Mutation	SNP	ENST00000340433.2	37	c.356G>C	CCDS35369.1	.	.	.	.	.	.	.	.	.	.	G	4.632	0.117436	0.08881	.	.	ENSG00000187823	ENST00000340433	T	0.44881	0.91	3.99	-1.55	0.08558	.	1.166430	0.06578	N	0.749699	T	0.27866	0.0686	L	0.27053	0.805	0.09310	N	1	P	0.36535	0.557	B	0.36186	0.219	T	0.21177	-1.0253	10	0.23891	T	0.37	0.25	8.1313	0.31029	0.5781:0.0:0.4219:0.0	.	119	Q6ZR62	ZCH16_HUMAN	T	119	ENSP00000340590:S119T	ENSP00000340590:S119T	S	+	2	0	ZCCHC16	111584968	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	-0.871000	0.04223	-0.505000	0.06568	0.523000	0.50628	AGT		0.383	ZCCHC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356964.1	NM_001004308		18	184	0	0	0	0.00499	0	18	184				
IL13RA2	3598	broad.mit.edu	37	X	114250291	114250291	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chrX:114250291T>A	ENST00000371936.1	-	4	437	c.188A>T	c.(187-189)aAg>aTg	p.K63M	IL13RA2_ENST00000243213.1_Missense_Mutation_p.K63M|IL13RA2_ENST00000468224.1_5'UTR			Q14627	I13R2_HUMAN	interleukin 13 receptor, alpha 2	63	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cytokine-mediated signaling pathway (GO:0019221)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	cytokine receptor activity (GO:0004896)|signal transducer activity (GO:0004871)	p.K63M(1)		NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(6)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	23						TGTGCATTCCTTAAAATGATC	0.408																																							uc004epx.2		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|ovary(1)|lung(1)	3						c.(187-189)AAG>ATG		interleukin 13 receptor, alpha 2 precursor							185.0	139.0	155.0					X																	114250291		2203	4300	6503	SO:0001583	missense	3598					extracellular space|integral to membrane|soluble fraction	cytokine receptor activity	g.chrX:114250291T>A	X95302	CCDS14565.1	Xq23	2014-01-21			ENSG00000123496	ENSG00000123496		"""Interleukins and interleukin receptors"", ""CD molecules"""	5975	protein-coding gene	gene with protein product	"""cancer/testis antigen 19"""	300130				8663118, 9083087	Standard	NM_000640		Approved	IL-13R, IL13BP, CD213a2, CT19	uc004epx.3	Q14627	OTTHUMG00000022229	ENST00000371936.1:c.188A>T	X.37:g.114250291T>A	ENSP00000361004:p.Lys63Met		Somatic				IL13RA2_uc010nqd.1_Missense_Mutation_p.K63M	p.K63M	NM_000640	NP_000631	WXS	Illumina HiSeq	Unspecified	Q14627	I13R2_HUMAN			3	313	-			63			Extracellular (Potential).|Fibronectin type-III 1.		A8K7E2|O00667	Missense_Mutation	SNP	ENST00000371936.1	37	c.188A>T	CCDS14565.1	.	.	.	.	.	.	.	.	.	.	T	14.08	2.429006	0.43122	.	.	ENSG00000123496	ENST00000371936;ENST00000243213	T;T	0.42900	0.96;0.96	4.99	4.99	0.66335	Fibronectin, type III (1);Immunoglobulin-like fold (1);	0.563827	0.20205	N	0.097003	T	0.48978	0.1530	L	0.51422	1.61	0.09310	N	1	D;D	0.69078	0.997;0.995	P;P	0.55667	0.781;0.701	T	0.41556	-0.9502	10	0.48119	T	0.1	-0.4704	9.8283	0.40925	0.0:0.0:0.0:1.0	.	63;63	D0EFR8;Q14627	.;I13R2_HUMAN	M	63	ENSP00000361004:K63M;ENSP00000243213:K63M	ENSP00000243213:K63M	K	-	2	0	IL13RA2	114156547	0.070000	0.21116	0.043000	0.18650	0.351000	0.29236	3.001000	0.49488	1.843000	0.53566	0.481000	0.45027	AAG		0.408	IL13RA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057966.1	NM_000640		20	91	0	0	0	0.008871	0	20	91				
UPF3B	65109	broad.mit.edu	37	X	118975155	118975155	+	Nonsense_Mutation	SNP	C	C	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chrX:118975155C>A	ENST00000276201.2	-	7	760	c.691G>T	c.(691-693)Gaa>Taa	p.E231*	UPF3B_ENST00000478840.1_5'UTR|UPF3B_ENST00000345865.2_Nonsense_Mutation_p.E231*	NM_080632.2	NP_542199.1	Q9BZI7	REN3B_HUMAN	UPF3 regulator of nonsense transcripts homolog B (yeast)	231	Necessary for interaction with UPF2.|Sufficient for association with EJC core.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.E231*(1)		breast(3)|endometrium(4)|kidney(1)|large_intestine(7)|lung(12)|ovary(2)|prostate(1)	30						ctcctctcttcttctctttgt	0.343																																							uc004erz.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(2)|kidney(1)	3						c.(691-693)GAA>TAA		UPF3 regulator of nonsense transcripts homolog B							206.0	166.0	180.0					X																	118975155		2202	4300	6502	SO:0001587	stop_gained	65109				mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|positive regulation of translation|termination of RNA polymerase II transcription	cytosol|exon-exon junction complex|nucleoplasm	mRNA binding|nucleocytoplasmic transporter activity|nucleotide binding|protein binding	g.chrX:118975155C>A	AF318576	CCDS14587.1, CCDS14588.1	Xq25-q26	2014-01-31			ENSG00000125351	ENSG00000125351			20439	protein-coding gene	gene with protein product		300298	"""mental retardation, X-linked 62"""	MRX62		11113196, 11163187, 19238151	Standard	NM_023010		Approved	RENT3B, UPF3X, HUPF3B	uc004erz.2	Q9BZI7	OTTHUMG00000022282	ENST00000276201.2:c.691G>T	X.37:g.118975155C>A	ENSP00000276201:p.Glu231*		Somatic				UPF3B_uc004esa.1_Nonsense_Mutation_p.E231*	p.E231*	NM_080632	NP_542199	WXS	Illumina HiSeq	Unspecified	Q9BZI7	REN3B_HUMAN			7	768	-			231			Sufficient for association with EJC core.|Necessary for interaction with UPF2.		D3DWI3|D3DWI4|Q0VAK8|Q9H1J0	Nonsense_Mutation	SNP	ENST00000276201.2	37	c.691G>T	CCDS14588.1	.	.	.	.	.	.	.	.	.	.	C	33	5.252994	0.95336	.	.	ENSG00000125351	ENST00000276201;ENST00000345865	.	.	.	5.15	5.15	0.70609	.	0.301734	0.37623	N	0.002018	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	.	15.1069	0.72329	0.0:1.0:0.0:0.0	.	.	.	.	X	231	.	ENSP00000276201:E231X	E	-	1	0	UPF3B	118859183	1.000000	0.71417	1.000000	0.80357	0.791000	0.44710	6.094000	0.71431	2.155000	0.67459	0.538000	0.68166	GAA		0.343	UPF3B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058068.1			8	49	1	0	0.000274275	0.004482	0.000316178	8	49				
THOC2	57187	broad.mit.edu	37	X	122765624	122765624	+	Nonsense_Mutation	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chrX:122765624G>T	ENST00000245838.8	-	22	2427	c.2396C>A	c.(2395-2397)tCa>tAa	p.S799*	THOC2_ENST00000491737.1_Nonsense_Mutation_p.S684*|THOC2_ENST00000355725.4_Nonsense_Mutation_p.S799*	NM_001081550.1	NP_001075019.1	Q8NI27	THOC2_HUMAN	THO complex 2	799					mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|poly(A)+ mRNA export from nucleus (GO:0016973)|RNA splicing (GO:0008380)|viral mRNA export from host cell nucleus (GO:0046784)	THO complex (GO:0000347)|THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	RNA binding (GO:0003723)	p.S720*(1)|p.S799*(1)		breast(2)|endometrium(13)|kidney(4)|large_intestine(11)|lung(26)|ovary(3)|skin(1)|upper_aerodigestive_tract(3)	63						TACATCAATTGAAGGCACTCG	0.378																																							uc004etu.2		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(3)	3						c.(2395-2397)TCA>TAA		THO complex 2							175.0	163.0	167.0					X																	122765624		1856	4094	5950	SO:0001587	stop_gained	57187				intronless viral mRNA export from host nucleus|mRNA processing|RNA splicing	THO complex part of transcription export complex	protein binding|RNA binding	g.chrX:122765624G>T	AF441770	CCDS43988.1	Xq25-q26.3	2013-02-11	2004-08-09		ENSG00000125676	ENSG00000125676		"""THO complex subunits"""	19073	protein-coding gene	gene with protein product		300395	"""chromosome X open reading frame 3"""	CXorf3		11979277	Standard	NM_001081550		Approved	THO2, dJ506G2.1	uc004etu.3	Q8NI27	OTTHUMG00000022334	ENST00000245838.8:c.2396C>A	X.37:g.122765624G>T	ENSP00000245838:p.Ser799*		Somatic				THOC2_uc011muh.1_Nonsense_Mutation_p.S724*	p.S799*	NM_001081550	NP_001075019	WXS	Illumina HiSeq	Unspecified	Q8NI27	THOC2_HUMAN			22	2428	-			799					A6NM50|Q5JZ12|Q6IN92|Q9H8I6	Nonsense_Mutation	SNP	ENST00000245838.8	37	c.2396C>A	CCDS43988.1	.	.	.	.	.	.	.	.	.	.	G	41	8.788797	0.98954	.	.	ENSG00000125676	ENST00000245838;ENST00000355725;ENST00000491737;ENST00000408933	.	.	.	5.97	5.97	0.96955	.	0.000000	0.56097	D	0.000039	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.0072	19.371	0.94484	0.0:0.0:1.0:0.0	.	.	.	.	X	799;799;684;724	.	ENSP00000245838:S799X	S	-	2	0	THOC2	122593305	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.848000	0.99507	2.527000	0.85204	0.600000	0.82982	TCA		0.378	THOC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058153.3			28	311	1	0	3.1745e-13	0.008361	5.33367e-13	28	311				
TENM1	10178	broad.mit.edu	37	X	123515111	123515111	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chrX:123515111G>T	ENST00000371130.3	-	31	7516	c.7453C>A	c.(7453-7455)Cag>Aag	p.Q2485K	TENM1_ENST00000422452.2_Missense_Mutation_p.Q2492K|STAG2_ENST00000469481.1_Intron	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	2485					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.Q2487K(1)									TTCCTGAGCTGTTTCTGGAGT	0.478																																							uc004euj.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(11)|breast(4)|large_intestine(2)|skin(2)|pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	23						c.(7453-7455)CAG>AAG		odz, odd Oz/ten-m homolog 1 isoform 3							109.0	108.0	108.0					X																	123515111		2201	4299	6500	SO:0001583	missense	10178				immune response|negative regulation of cell proliferation|nervous system development|signal transduction	extracellular region	heparin binding	g.chrX:123515111G>T	AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.7453C>A	X.37:g.123515111G>T	ENSP00000360171:p.Gln2485Lys		Somatic				ODZ1_uc011muj.1_Missense_Mutation_p.Q2491K|ODZ1_uc010nqy.2_Missense_Mutation_p.Q2492K	p.Q2485K	NM_014253	NP_055068	WXS	Illumina HiSeq	Unspecified	Q9UKZ4	TEN1_HUMAN			31	7517	-			2485			Extracellular (Potential).		B2RTR5|Q5JZ17	Missense_Mutation	SNP	ENST00000371130.3	37	c.7453C>A	CCDS14609.1	.	.	.	.	.	.	.	.	.	.	G	15.52	2.858165	0.51376	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	D;D	0.85411	-1.98;-1.94	5.83	5.83	0.93111	.	0.109593	0.64402	D	0.000005	D	0.83193	0.5201	M	0.62723	1.935	0.58432	D	0.999999	P;P;P	0.50617	0.688;0.688;0.937	B;B;B	0.40410	0.115;0.13;0.328	T	0.81415	-0.0943	10	0.16420	T	0.52	.	19.0992	0.93266	0.0:0.0:1.0:0.0	.	2491;2492;2485	B7ZMH4;B2RTR5;Q9UKZ4	.;.;TEN1_HUMAN	K	2485;2492	ENSP00000360171:Q2485K;ENSP00000403954:Q2492K	ENSP00000360171:Q2485K	Q	-	1	0	ODZ1	123342792	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.874000	0.87199	2.460000	0.83146	0.600000	0.82982	CAG		0.478	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058985.1	NM_014253		27	191	1	0	2.08457e-15	0.002096	3.63486e-15	27	191				
DCAF12L2	340578	broad.mit.edu	37	X	125298776	125298776	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chrX:125298776G>A	ENST00000360028.2	-	1	1158	c.1132C>T	c.(1132-1134)Cgc>Tgc	p.R378C	DCAF12L2_ENST00000538699.1_Missense_Mutation_p.R378C			Q5VW00	DC122_HUMAN	DDB1 and CUL4 associated factor 12-like 2	378								p.R378C(2)		NS(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(36)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(3)	64						TTCTGGGCGCGGATGTCATAG	0.642																																							uc004euk.1		NA																	2	Substitution - Missense(2)		lung(2)	lung(2)|skin(2)|large_intestine(1)|pancreas(1)|ovary(1)	7						c.(1132-1134)CGC>TGC		DDB1 and CUL4 associated factor 12-like 2							64.0	69.0	67.0					X																	125298776		2202	4299	6501	SO:0001583	missense	340578							g.chrX:125298776G>A	AL445072	CCDS43991.1	Xq25	2013-01-09	2009-07-17	2009-07-17	ENSG00000198354	ENSG00000198354		"""WD repeat domain containing"""	32950	protein-coding gene	gene with protein product			"""WD repeat domain 40C"""	WDR40C			Standard	NM_001013628		Approved		uc004euk.2	Q5VW00	OTTHUMG00000022348	ENST00000360028.2:c.1132C>T	X.37:g.125298776G>A	ENSP00000353128:p.Arg378Cys		Somatic					p.R378C	NM_001013628	NP_001013650	WXS	Illumina HiSeq	Unspecified	Q5VW00	DC122_HUMAN			1	1159	-			378			WD 4.		B2RN42	Missense_Mutation	SNP	ENST00000360028.2	37	c.1132C>T	CCDS43991.1	.	.	.	.	.	.	.	.	.	.	G	14.38	2.517737	0.44763	.	.	ENSG00000198354	ENST00000538699;ENST00000360028	T;T	0.64991	-0.13;-0.13	3.94	3.07	0.35406	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.36740	N	0.002424	T	0.77824	0.4188	M	0.83774	2.66	0.53005	D	0.999964	D	0.89917	1.0	D	0.85130	0.997	T	0.79569	-0.1749	10	0.87932	D	0	.	10.0918	0.42451	0.0:0.0:0.7982:0.2018	.	378	Q5VW00	DC122_HUMAN	C	378	ENSP00000441489:R378C;ENSP00000353128:R378C	ENSP00000353128:R378C	R	-	1	0	DCAF12L2	125126457	1.000000	0.71417	0.330000	0.25442	0.568000	0.35870	2.795000	0.47861	1.007000	0.39238	0.600000	0.82982	CGC		0.642	DCAF12L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058181.1	NM_001013628		18	191	0	0	0	0.008871	0	18	191				
RAB33A	9363	broad.mit.edu	37	X	129318306	129318306	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chrX:129318306G>T	ENST00000257017.4	+	2	720	c.306G>T	c.(304-306)atG>atT	p.M102I		NM_004794.2	NP_004785.1	Q14088	RB33A_HUMAN	RAB33A, member RAS oncogene family	102			M -> T.		antigen processing and presentation (GO:0019882)|GTP catabolic process (GO:0006184)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.M102I(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(5)	11						GCAAAAGCATGGTCGAGCATT	0.478																																							uc004evl.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(304-306)ATG>ATT		Ras-related protein Rab-33A							153.0	121.0	132.0					X																	129318306		2203	4300	6503	SO:0001583	missense	9363				protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding|GTPase activity|protein binding	g.chrX:129318306G>T	D14889	CCDS14621.1	Xq26	2008-02-05			ENSG00000134594	ENSG00000134594		"""RAB, member RAS oncogene"""	9773	protein-coding gene	gene with protein product		300333				7688322, 9512502	Standard	NM_004794		Approved	RabS10	uc004evl.3	Q14088	OTTHUMG00000022391	ENST00000257017.4:c.306G>T	X.37:g.129318306G>T	ENSP00000257017:p.Met102Ile		Somatic				RAB33A_uc010nre.2_RNA	p.M102I	NM_004794	NP_004785	WXS	Illumina HiSeq	Unspecified	Q14088	RB33A_HUMAN			2	570	+			102		M -> T.			Q5JUZ6|Q92465	Missense_Mutation	SNP	ENST00000257017.4	37	c.306G>T	CCDS14621.1	.	.	.	.	.	.	.	.	.	.	G	11.82	1.753350	0.31046	.	.	ENSG00000134594	ENST00000257017	T	0.75260	-0.92	4.71	4.71	0.59529	Small GTP-binding protein domain (1);	0.039641	0.85682	D	0.000000	T	0.50137	0.1598	N	0.00611	-1.325	0.80722	D	1	P	0.41624	0.757	P	0.48114	0.567	T	0.61377	-0.7075	10	0.02654	T	1	-23.1684	17.2062	0.86918	0.0:0.0:1.0:0.0	.	102	Q14088	RB33A_HUMAN	I	102	ENSP00000257017:M102I	ENSP00000257017:M102I	M	+	3	0	RAB33A	129145987	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	9.811000	0.99226	2.072000	0.62099	0.429000	0.28392	ATG		0.478	RAB33A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058246.1	NM_004794		20	122	1	0	3.08376e-08	0.00333	4.32352e-08	20	122				
PHF6	84295	broad.mit.edu	37	X	133527957	133527957	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chrX:133527957C>A	ENST00000332070.3	+	5	595	c.393C>A	c.(391-393)caC>caA	p.H131Q	PHF6_ENST00000370799.1_Missense_Mutation_p.H131Q|PHF6_ENST00000370803.3_Missense_Mutation_p.H131Q|PHF6_ENST00000416404.2_Missense_Mutation_p.H97Q|PHF6_ENST00000394292.1_Missense_Mutation_p.H131Q|PHF6_ENST00000370800.4_Missense_Mutation_p.H131Q	NM_032458.2	NP_115834.1	Q8IWS0	PHF6_HUMAN	PHD finger protein 6	131	Extended PHD1 domain (ePHD1).				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone binding (GO:0042393)|histone deacetylase binding (GO:0042826)|phosphoprotein binding (GO:0051219)|poly(A) RNA binding (GO:0044822)|ribonucleoprotein complex binding (GO:0043021)|scaffold protein binding (GO:0097110)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)	p.H131Q(2)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(88)|kidney(2)|large_intestine(1)|liver(1)|lung(6)|ovary(1)|skin(1)|urinary_tract(1)	103	Acute lymphoblastic leukemia(192;0.000127)					GCCGAAAACACAAGAAAACTG	0.318			"""F, N, Splice, Mis"""		ETP ALL																																Colon(100;666 1493 6344 21231 35807)	Colon(100;666 1493 6344 21231 35807)	uc004exj.2		NA		Rec	yes		X	Xq26.3	84295		PHD finger protein 6			L					2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(391-393)CAC>CAA		PHD finger protein 6 isoform 1							81.0	75.0	77.0					X																	133527957		2203	4300	6503	SO:0001583	missense	84295				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	zinc ion binding	g.chrX:133527957C>A	AB058726	CCDS14639.1, CCDS14640.1	Xq26	2014-09-17			ENSG00000156531	ENSG00000156531		"""Zinc fingers, PHD-type"""	18145	protein-coding gene	gene with protein product	"""centromere protein 31"""	300414	"""Borjeson-Forssman-Lehmann syndrome"""	BFLS, BORJ		12415272, 15466013	Standard	NM_032335		Approved	KIAA1823, MGC14797, CENP-31	uc004exk.3	Q8IWS0	OTTHUMG00000022453	ENST00000332070.3:c.393C>A	X.37:g.133527957C>A	ENSP00000329097:p.His131Gln		Somatic				PHF6_uc004exk.2_Missense_Mutation_p.H131Q|PHF6_uc011mvk.1_Missense_Mutation_p.H97Q|PHF6_uc004exh.2_Missense_Mutation_p.H131Q|PHF6_uc010nrr.2_Missense_Mutation_p.H131Q|PHF6_uc004exi.2_Missense_Mutation_p.H131Q	p.H131Q	NM_001015877	NP_001015877	WXS	Illumina HiSeq	Unspecified	Q8IWS0	PHF6_HUMAN			5	595	+	Acute lymphoblastic leukemia(192;0.000127)		131			Nuclear localization signal (Potential).|PHD-type 1; degenerate.		A8K230|B4E0G4|D3DTG3|E9PC97|Q5JRC7|Q5JRC8|Q96JK3|Q9BRU0	Missense_Mutation	SNP	ENST00000332070.3	37	c.393C>A	CCDS14639.1	.	.	.	.	.	.	.	.	.	.	C	17.30	3.354083	0.61293	.	.	ENSG00000156531	ENST00000370803;ENST00000332070;ENST00000394292;ENST00000370799;ENST00000416404;ENST00000370800	D;D;D;D;D;D	0.85955	-2.05;-2.05;-2.05;-2.05;-2.05;-2.05	4.92	3.05	0.35203	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, PHD-type (1);	0.000000	0.85682	D	0.000000	D	0.93187	0.7830	H	0.94808	3.585	0.53688	D	0.999975	D;D;D;D;D	0.89917	0.999;1.0;1.0;1.0;0.997	D;D;D;D;D	0.87578	0.996;0.998;0.998;0.998;0.986	D	0.91706	0.5377	10	0.87932	D	0	-10.8469	8.0406	0.30519	0.0:0.813:0.0:0.187	.	97;131;131;131;131	B4E0G4;A8K230;Q8IWS0;E9PC97;Q8IWS0-2	.;.;PHF6_HUMAN;.;.	Q	131;131;131;131;97;131	ENSP00000359839:H131Q;ENSP00000329097:H131Q;ENSP00000377831:H131Q;ENSP00000359835:H131Q;ENSP00000394480:H97Q;ENSP00000359836:H131Q	ENSP00000329097:H131Q	H	+	3	2	PHF6	133355623	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	2.195000	0.42677	0.380000	0.24823	0.462000	0.41574	CAC		0.318	PHF6-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058367.1	NM_032458		22	103	1	0	2.79863e-10	0.004656	4.31759e-10	22	103				
PHF6	84295	broad.mit.edu	37	X	133549067	133549067	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chrX:133549067C>A	ENST00000332070.3	+	8	953	c.751C>A	c.(751-753)Cag>Aag	p.Q251K	PHF6_ENST00000370799.1_Missense_Mutation_p.Q252K|PHF6_ENST00000370803.3_Missense_Mutation_p.Q251K|PHF6_ENST00000416404.2_Missense_Mutation_p.Q217K|PHF6_ENST00000394292.1_Missense_Mutation_p.Q252K|PHF6_ENST00000370800.4_Missense_Mutation_p.Q252K	NM_032458.2	NP_115834.1	Q8IWS0	PHF6_HUMAN	PHD finger protein 6	251	Extended PHD2 domain (ePHD2).				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone binding (GO:0042393)|histone deacetylase binding (GO:0042826)|phosphoprotein binding (GO:0051219)|poly(A) RNA binding (GO:0044822)|ribonucleoprotein complex binding (GO:0043021)|scaffold protein binding (GO:0097110)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)	p.Q251K(2)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(88)|kidney(2)|large_intestine(1)|liver(1)|lung(6)|ovary(1)|skin(1)|urinary_tract(1)	103	Acute lymphoblastic leukemia(192;0.000127)					TGGCACAGTCCAGCTCACAAC	0.328			"""F, N, Splice, Mis"""		ETP ALL																																Colon(100;666 1493 6344 21231 35807)	Colon(100;666 1493 6344 21231 35807)	uc004exj.2		NA		Rec	yes		X	Xq26.3	84295		PHD finger protein 6			L					2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(751-753)CAG>AAG		PHD finger protein 6 isoform 1							46.0	45.0	45.0					X																	133549067		2202	4297	6499	SO:0001583	missense	84295				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	zinc ion binding	g.chrX:133549067C>A	AB058726	CCDS14639.1, CCDS14640.1	Xq26	2014-09-17			ENSG00000156531	ENSG00000156531		"""Zinc fingers, PHD-type"""	18145	protein-coding gene	gene with protein product	"""centromere protein 31"""	300414	"""Borjeson-Forssman-Lehmann syndrome"""	BFLS, BORJ		12415272, 15466013	Standard	NM_032335		Approved	KIAA1823, MGC14797, CENP-31	uc004exk.3	Q8IWS0	OTTHUMG00000022453	ENST00000332070.3:c.751C>A	X.37:g.133549067C>A	ENSP00000329097:p.Gln251Lys		Somatic				PHF6_uc004exk.2_Missense_Mutation_p.Q251K|PHF6_uc011mvk.1_Missense_Mutation_p.Q217K|PHF6_uc004exh.2_Missense_Mutation_p.Q252K|PHF6_uc010nrr.2_Missense_Mutation_p.Q251K|PHF6_uc004exi.2_Missense_Mutation_p.Q252K	p.Q251K	NM_001015877	NP_001015877	WXS	Illumina HiSeq	Unspecified	Q8IWS0	PHF6_HUMAN			8	953	+	Acute lymphoblastic leukemia(192;0.000127)		251					A8K230|B4E0G4|D3DTG3|E9PC97|Q5JRC7|Q5JRC8|Q96JK3|Q9BRU0	Missense_Mutation	SNP	ENST00000332070.3	37	c.751C>A	CCDS14639.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.046787	0.75846	.	.	ENSG00000156531	ENST00000370803;ENST00000332070;ENST00000394292;ENST00000370799;ENST00000416404;ENST00000370800	T;T;T;T;T;D	0.89050	-0.52;-0.52;-0.52;-0.52;-0.52;-2.46	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	D	0.93566	0.7946	M	0.65677	2.01	0.80722	D	1	D;D;D;D;P	0.61080	0.963;0.989;0.963;0.963;0.954	D;D;D;D;D	0.71414	0.959;0.966;0.973;0.973;0.932	D	0.93655	0.6976	10	0.54805	T	0.06	-11.6691	17.4048	0.87470	0.0:1.0:0.0:0.0	.	217;251;251;252;252	B4E0G4;A8K230;Q8IWS0;E9PC97;Q8IWS0-2	.;.;PHF6_HUMAN;.;.	K	251;251;252;252;217;252	ENSP00000359839:Q251K;ENSP00000329097:Q251K;ENSP00000377831:Q252K;ENSP00000359835:Q252K;ENSP00000394480:Q217K;ENSP00000359836:Q252K	ENSP00000329097:Q251K	Q	+	1	0	PHF6	133376733	1.000000	0.71417	0.997000	0.53966	0.998000	0.95712	7.445000	0.80570	2.410000	0.81850	0.594000	0.82650	CAG		0.328	PHF6-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058367.1	NM_032458		4	45	1	0	0.00024832	0.009096	0.000288663	4	45				
DDX26B	203522	broad.mit.edu	37	X	134681099	134681099	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chrX:134681099T>A	ENST00000370752.4	+	6	985	c.651T>A	c.(649-651)aaT>aaA	p.N217K	DDX26B_ENST00000481908.1_3'UTR	NM_182540.4	NP_872346.3	Q5JSJ4	DX26B_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 26B	217	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.							p.N217K(2)		large_intestine(1)|lung(8)	9	Acute lymphoblastic leukemia(192;6.56e-05)					GAATGTTGAATCAATGTTTAG	0.328																																							uc004eyw.3		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(649-651)AAT>AAA		DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide							143.0	143.0	143.0					X																	134681099		2203	4297	6500	SO:0001583	missense	203522							g.chrX:134681099T>A	AK096544	CCDS35401.1	Xq26	2008-02-05			ENSG00000165359	ENSG00000165359		"""DEAD-boxes"""	27334	protein-coding gene	gene with protein product							Standard	NM_182540		Approved	FLJ41215	uc004eyw.4	Q5JSJ4	OTTHUMG00000022484	ENST00000370752.4:c.651T>A	X.37:g.134681099T>A	ENSP00000359788:p.Asn217Lys		Somatic					p.N217K	NM_182540	NP_872346	WXS	Illumina HiSeq	Unspecified	Q5JSJ4	DX26B_HUMAN			6	1014	+	Acute lymphoblastic leukemia(192;6.56e-05)		217			VWFA.		Q5CZA2|Q6IPS3|Q6ZTU5|Q6ZWE4	Missense_Mutation	SNP	ENST00000370752.4	37	c.651T>A	CCDS35401.1	.	.	.	.	.	.	.	.	.	.	T	13.07	2.126638	0.37533	.	.	ENSG00000165359	ENST00000370752	T	0.13657	2.57	5.28	1.49	0.22878	von Willebrand factor, type A (2);	0.043220	0.85682	D	0.000000	T	0.13372	0.0324	L	0.57536	1.79	0.58432	D	0.999995	P	0.36733	0.567	B	0.38500	0.275	T	0.08911	-1.0699	10	0.25106	T	0.35	-10.4353	8.0349	0.30486	0.0:0.3323:0.0:0.6677	.	217	Q5JSJ4	DX26B_HUMAN	K	217	ENSP00000359788:N217K	ENSP00000359788:N217K	N	+	3	2	DDX26B	134508765	1.000000	0.71417	0.996000	0.52242	0.997000	0.91878	1.114000	0.31196	0.208000	0.20626	0.430000	0.28490	AAT		0.328	DDX26B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058420.1	NM_182540		32	190	0	0	0	0.002836	0	32	190				
MAGEC1	9947	broad.mit.edu	37	X	140993253	140993253	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chrX:140993253T>A	ENST00000285879.4	+	4	349	c.63T>A	c.(61-63)agT>agA	p.S21R	MAGEC1_ENST00000406005.2_5'UTR	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	21								p.S21R(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					CCTCTGAGAGTCCTCAGAGTT	0.562										HNSCC(15;0.026)																													uc004fbt.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4						c.(61-63)AGT>AGA		melanoma antigen family C, 1							68.0	67.0	67.0					X																	140993253		2203	4300	6503	SO:0001583	missense	9947						protein binding	g.chrX:140993253T>A	AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.63T>A	X.37:g.140993253T>A	ENSP00000285879:p.Ser21Arg	HNSCC(15;0.026)	Somatic				MAGEC1_uc010nsl.1_5'UTR	p.S21R	NM_005462	NP_005453	WXS	Illumina HiSeq	Unspecified	O60732	MAGC1_HUMAN			4	349	+	Acute lymphoblastic leukemia(192;6.56e-05)		21					A0PK03|O75451|Q8TCV4	Missense_Mutation	SNP	ENST00000285879.4	37	c.63T>A	CCDS35417.1	.	.	.	.	.	.	.	.	.	.	t	10.49	1.365951	0.24684	.	.	ENSG00000155495	ENST00000285879;ENST00000370511;ENST00000370510	T;T	0.12774	4.12;2.65	0.149	0.149	0.14863	.	.	.	.	.	T	0.06962	0.0177	N	0.08118	0	0.09310	N	0.999999	P	0.39520	0.676	B	0.39706	0.307	T	0.30001	-0.9993	8	0.72032	D	0.01	.	.	.	.	.	21	O60732	MAGC1_HUMAN	R	21;21;20	ENSP00000285879:S21R;ENSP00000359542:S21R	ENSP00000285879:S21R	S	+	3	2	MAGEC1	140820919	0.000000	0.05858	0.008000	0.14137	0.008000	0.06430	-0.174000	0.09839	0.152000	0.19188	0.150000	0.16122	AGT		0.562	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058604.1	NM_005462		20	148	0	0	0	0.010504	0	20	148				
SLITRK4	139065	broad.mit.edu	37	X	142717965	142717965	+	Silent	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chrX:142717965G>T	ENST00000381779.4	-	2	1185	c.960C>A	c.(958-960)gcC>gcA	p.A320A	SLITRK4_ENST00000338017.4_Silent_p.A320A|SLITRK4_ENST00000356928.1_Silent_p.A320A	NM_001184749.2|NM_001184750.1|NM_173078.4	NP_001171678.1|NP_001171679.1|NP_775101.1	Q8IW52	SLIK4_HUMAN	SLIT and NTRK-like family, member 4	320						integral component of membrane (GO:0016021)		p.A320A(1)		autonomic_ganglia(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(27)|ovary(2)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	60	Acute lymphoblastic leukemia(192;6.56e-05)					GGTTGGAGAGGGCTTTGCCTG	0.468																																							uc004fbx.2		NA																	1	Substitution - coding silent(1)		lung(1)	upper_aerodigestive_tract(1)|large_intestine(1)	2						c.(958-960)GCC>GCA		slit and trk like 4 protein precursor							145.0	130.0	135.0					X																	142717965		2203	4300	6503	SO:0001819	synonymous_variant	139065					integral to membrane		g.chrX:142717965G>T	BC040986	CCDS14679.1	Xq27.3	2004-06-23			ENSG00000179542	ENSG00000179542			23502	protein-coding gene	gene with protein product		300562				14557068	Standard	NM_001184749		Approved	DKFZp547M2010	uc004fby.3	Q8IW52	OTTHUMG00000022580	ENST00000381779.4:c.960C>A	X.37:g.142717965G>T			Somatic				SLITRK4_uc004fby.2_Silent_p.A320A	p.A320A	NM_173078	NP_775101	WXS	Illumina HiSeq	Unspecified	Q8IW52	SLIK4_HUMAN			2	1336	-	Acute lymphoblastic leukemia(192;6.56e-05)		320			Extracellular (Potential).		Q5JXG3|Q8TCM8|Q96DL3	Silent	SNP	ENST00000381779.4	37	c.960C>A	CCDS14679.1																																																																																				0.468	SLITRK4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058617.1	NM_173078		34	206	1	0	8.73648e-17	0.004289	1.56954e-16	34	206				
SLITRK2	84631	broad.mit.edu	37	X	144906317	144906317	+	Missense_Mutation	SNP	C	C	G	rs148553713		TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chrX:144906317C>G	ENST00000370490.1	+	1	6629	c.2374C>G	c.(2374-2376)Cgc>Ggc	p.R792G	SLITRK2_ENST00000413937.2_Missense_Mutation_p.R792G|TMEM257_ENST00000408967.2_5'Flank|SLITRK2_ENST00000428560.2_Missense_Mutation_p.R792G|SLITRK2_ENST00000434188.2_Missense_Mutation_p.R792G|SLITRK2_ENST00000447897.2_Missense_Mutation_p.R792G			Q9H156	SLIK2_HUMAN	SLIT and NTRK-like family, member 2	792					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)		p.R792G(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(17)|lung(40)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	86	Acute lymphoblastic leukemia(192;6.56e-05)					TGAATCTCGACGCCAAAACCA	0.453																																							uc004fcd.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|central_nervous_system(1)|pancreas(1)	7						c.(2374-2376)CGC>GGC		SLIT and NTRK-like family, member 2 precursor							128.0	121.0	123.0					X																	144906317		2203	4300	6503	SO:0001583	missense	84631					integral to membrane		g.chrX:144906317C>G	Y19205	CCDS14680.1	Xq27.3	2008-02-05	2004-03-11		ENSG00000185985	ENSG00000185985			13449	protein-coding gene	gene with protein product		300561	"""slit-like 1 (Drosophila)"""	SLITL1		11347906, 14557068	Standard	NM_032539		Approved	KIAA1854, CXorf2	uc011mwr.2	Q9H156	OTTHUMG00000022595	ENST00000370490.1:c.2374C>G	X.37:g.144906317C>G	ENSP00000359521:p.Arg792Gly		Somatic				SLITRK2_uc010nsp.2_Missense_Mutation_p.R792G|SLITRK2_uc010nso.2_Missense_Mutation_p.R792G|SLITRK2_uc011mwq.1_Missense_Mutation_p.R792G|SLITRK2_uc011mwr.1_Missense_Mutation_p.R792G|SLITRK2_uc011mws.1_Missense_Mutation_p.R792G|SLITRK2_uc004fcg.2_Missense_Mutation_p.R792G|SLITRK2_uc011mwt.1_Missense_Mutation_p.R792G|CXorf1_uc004fch.2_5'Flank	p.R792G	NM_032539	NP_115928	WXS	Illumina HiSeq	Unspecified	Q9H156	SLIK2_HUMAN			5	3364	+	Acute lymphoblastic leukemia(192;6.56e-05)		792			Cytoplasmic (Potential).		A8K117|Q2KHN3|Q5JXB1|Q8NBC7|Q96JH3	Missense_Mutation	SNP	ENST00000370490.1	37	c.2374C>G	CCDS14680.1	.	.	.	.	.	.	.	.	.	.	C	17.80	3.479407	0.63849	.	.	ENSG00000185985	ENST00000447897;ENST00000370490;ENST00000434188;ENST00000413937;ENST00000428560	T;T;T;T;T	0.54675	0.56;0.56;0.56;0.56;0.56	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	T	0.66046	0.2750	L	0.54323	1.7	0.54753	D	0.999985	D	0.65815	0.995	D	0.64144	0.922	T	0.66168	-0.5991	10	0.46703	T	0.11	-6.8786	15.4932	0.75629	0.0:1.0:0.0:0.0	.	792	Q9H156	SLIK2_HUMAN	G	792	ENSP00000411681:R792G;ENSP00000359521:R792G;ENSP00000397015:R792G;ENSP00000407347:R792G;ENSP00000412010:R792G	ENSP00000359521:R792G	R	+	1	0	SLITRK2	144714009	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.770000	0.55310	2.251000	0.74343	0.600000	0.82982	CGC		0.453	SLITRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058633.1	NM_032539		46	212	0	0	0	0.002852	0	46	212				
MAMLD1	10046	broad.mit.edu	37	X	149638184	149638184	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chrX:149638184G>C	ENST00000370401.2	+	4	649	c.339G>C	c.(337-339)ttG>ttC	p.L113F	MAMLD1_ENST00000468306.1_3'UTR|MAMLD1_ENST00000426613.2_Missense_Mutation_p.L88F|MAMLD1_ENST00000432680.2_Missense_Mutation_p.L88F|MAMLD1_ENST00000455522.2_5'Flank|MAMLD1_ENST00000262858.5_Missense_Mutation_p.L113F			Q13495	MAMD1_HUMAN	mastermind-like domain containing 1	113					male gonad development (GO:0008584)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.L113F(1)|p.L88F(1)|p.L40F(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(12)|lung(14)|ovary(1)|prostate(2)	37	Acute lymphoblastic leukemia(192;6.56e-05)					TCCCTCCATTGACAATAAATC	0.493																																							uc004fee.1		NA																	3	Substitution - Missense(3)		lung(3)		0						c.(337-339)TTG>TTC		mastermind-like domain containing 1							109.0	100.0	103.0					X																	149638184		2203	4300	6503	SO:0001583	missense	10046				male gonad development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus		g.chrX:149638184G>C	U46023	CCDS14693.2, CCDS55525.1, CCDS55526.1	Xq28	2008-02-05	2008-01-03	2008-01-03	ENSG00000013619	ENSG00000013619			2568	protein-coding gene	gene with protein product		300120	"""chromosome X open reading frame 6"""	CXorf6		9169146, 17086185, 18162467	Standard	NM_001177465		Approved	CG1, F18	uc011mxu.2	Q13495	OTTHUMG00000024157	ENST00000370401.2:c.339G>C	X.37:g.149638184G>C	ENSP00000359428:p.Leu113Phe		Somatic				MAMLD1_uc011mxt.1_Missense_Mutation_p.L75F|MAMLD1_uc011mxu.1_Missense_Mutation_p.L88F|MAMLD1_uc011mxv.1_Missense_Mutation_p.L88F|MAMLD1_uc011mxw.1_Missense_Mutation_p.L40F	p.L113F	NM_005491	NP_005482	WXS	Illumina HiSeq	Unspecified	Q13495	MAMD1_HUMAN			3	415	+	Acute lymphoblastic leukemia(192;6.56e-05)		113					B2RCQ4|B4DG93|B9EGA5	Missense_Mutation	SNP	ENST00000370401.2	37	c.339G>C	CCDS14693.2	.	.	.	.	.	.	.	.	.	.	G	8.376	0.836318	0.16891	.	.	ENSG00000013619	ENST00000445612;ENST00000370401;ENST00000432680;ENST00000358892;ENST00000262858;ENST00000426613	T;T;T;T	0.65364	0.22;-0.15;0.22;0.22	5.36	-9.55	0.00569	.	0.367344	0.25529	N	0.030045	T	0.54967	0.1891	L	0.29908	0.895	0.24066	N	0.995995	B;D;B;D	0.89917	0.034;1.0;0.154;0.992	B;D;B;P	0.85130	0.042;0.997;0.028;0.813	T	0.56613	-0.7950	10	0.35671	T	0.21	-2.1599	7.3876	0.26891	0.1242:0.1878:0.6112:0.0767	.	75;88;88;113	F6WVG1;Q13495-4;Q13495-3;Q13495	.;.;.;MAMD1_HUMAN	F	75;113;88;113;113;88	ENSP00000359428:L113F;ENSP00000414517:L88F;ENSP00000262858:L113F;ENSP00000397438:L88F	ENSP00000262858:L113F	L	+	3	2	MAMLD1	149388842	0.014000	0.17966	0.000000	0.03702	0.043000	0.13939	0.336000	0.19823	-1.308000	0.02318	-0.380000	0.06706	TTG		0.493	MAMLD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000060844.2	NM_005491		13	176	0	0	0	0.006122	0	13	176				
MAMLD1	10046	broad.mit.edu	37	X	149638523	149638523	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chrX:149638523G>C	ENST00000370401.2	+	4	988	c.678G>C	c.(676-678)caG>caC	p.Q226H	MAMLD1_ENST00000426613.2_Missense_Mutation_p.Q201H|MAMLD1_ENST00000432680.2_Missense_Mutation_p.Q201H|MAMLD1_ENST00000455522.2_5'Flank|MAMLD1_ENST00000262858.5_Missense_Mutation_p.Q226H			Q13495	MAMD1_HUMAN	mastermind-like domain containing 1	226					male gonad development (GO:0008584)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.Q201H(1)|p.Q226H(1)|p.Q153H(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(12)|lung(14)|ovary(1)|prostate(2)	37	Acute lymphoblastic leukemia(192;6.56e-05)					CTTCGGTTCAGATGTCACACT	0.517																																							uc004fee.1		NA																	3	Substitution - Missense(3)		lung(3)		0						c.(676-678)CAG>CAC		mastermind-like domain containing 1							200.0	176.0	184.0					X																	149638523		2203	4300	6503	SO:0001583	missense	10046				male gonad development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus		g.chrX:149638523G>C	U46023	CCDS14693.2, CCDS55525.1, CCDS55526.1	Xq28	2008-02-05	2008-01-03	2008-01-03	ENSG00000013619	ENSG00000013619			2568	protein-coding gene	gene with protein product		300120	"""chromosome X open reading frame 6"""	CXorf6		9169146, 17086185, 18162467	Standard	NM_001177465		Approved	CG1, F18	uc011mxu.2	Q13495	OTTHUMG00000024157	ENST00000370401.2:c.678G>C	X.37:g.149638523G>C	ENSP00000359428:p.Gln226His		Somatic				MAMLD1_uc011mxt.1_Missense_Mutation_p.Q188H|MAMLD1_uc011mxu.1_Missense_Mutation_p.Q201H|MAMLD1_uc011mxv.1_Missense_Mutation_p.Q201H|MAMLD1_uc011mxw.1_Missense_Mutation_p.Q153H	p.Q226H	NM_005491	NP_005482	WXS	Illumina HiSeq	Unspecified	Q13495	MAMD1_HUMAN			3	754	+	Acute lymphoblastic leukemia(192;6.56e-05)		226					B2RCQ4|B4DG93|B9EGA5	Missense_Mutation	SNP	ENST00000370401.2	37	c.678G>C	CCDS14693.2	.	.	.	.	.	.	.	.	.	.	G	7.273	0.607454	0.14002	.	.	ENSG00000013619	ENST00000445612;ENST00000370401;ENST00000432680;ENST00000262858;ENST00000426613	T;T;T;T	0.70631	-0.06;-0.5;-0.06;-0.08	5.23	3.38	0.38709	.	0.337088	0.28828	N	0.014001	T	0.62925	0.2468	M	0.63843	1.955	0.80722	D	1	B;B;B;B	0.16802	0.01;0.002;0.019;0.004	B;B;B;B	0.18561	0.006;0.004;0.022;0.006	T	0.53337	-0.8453	9	.	.	.	-0.4337	7.0385	0.25006	0.152:0.2878:0.5602:0.0	.	188;201;201;226	F6WVG1;Q13495-4;Q13495-3;Q13495	.;.;.;MAMD1_HUMAN	H	188;226;201;226;201	ENSP00000359428:Q226H;ENSP00000414517:Q201H;ENSP00000262858:Q226H;ENSP00000397438:Q201H	.	Q	+	3	2	MAMLD1	149389181	1.000000	0.71417	0.234000	0.24042	0.602000	0.36980	1.394000	0.34509	0.392000	0.25172	0.529000	0.55759	CAG		0.517	MAMLD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000060844.2	NM_005491		33	447	0	0	0	0.003271	0	33	447				
MAMLD1	10046	broad.mit.edu	37	X	149638601	149638601	+	Silent	SNP	G	G	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chrX:149638601G>A	ENST00000370401.2	+	4	1066	c.756G>A	c.(754-756)caG>caA	p.Q252Q	MAMLD1_ENST00000426613.2_Silent_p.Q227Q|MAMLD1_ENST00000432680.2_Silent_p.Q227Q|MAMLD1_ENST00000455522.2_5'Flank|MAMLD1_ENST00000262858.5_Silent_p.Q252Q			Q13495	MAMD1_HUMAN	mastermind-like domain containing 1	252					male gonad development (GO:0008584)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.Q227Q(1)|p.Q179Q(1)|p.Q252Q(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(12)|lung(14)|ovary(1)|prostate(2)	37	Acute lymphoblastic leukemia(192;6.56e-05)					TGTCACTTCAGATCCCATCCT	0.517																																							uc004fee.1		NA																	3	Substitution - coding silent(3)		lung(3)		0						c.(754-756)CAG>CAA		mastermind-like domain containing 1							172.0	150.0	158.0					X																	149638601		2203	4300	6503	SO:0001819	synonymous_variant	10046				male gonad development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus		g.chrX:149638601G>A	U46023	CCDS14693.2, CCDS55525.1, CCDS55526.1	Xq28	2008-02-05	2008-01-03	2008-01-03	ENSG00000013619	ENSG00000013619			2568	protein-coding gene	gene with protein product		300120	"""chromosome X open reading frame 6"""	CXorf6		9169146, 17086185, 18162467	Standard	NM_001177465		Approved	CG1, F18	uc011mxu.2	Q13495	OTTHUMG00000024157	ENST00000370401.2:c.756G>A	X.37:g.149638601G>A			Somatic				MAMLD1_uc011mxt.1_Silent_p.Q214Q|MAMLD1_uc011mxu.1_Silent_p.Q227Q|MAMLD1_uc011mxv.1_Silent_p.Q227Q|MAMLD1_uc011mxw.1_Silent_p.Q179Q	p.Q252Q	NM_005491	NP_005482	WXS	Illumina HiSeq	Unspecified	Q13495	MAMD1_HUMAN			3	832	+	Acute lymphoblastic leukemia(192;6.56e-05)		252					B2RCQ4|B4DG93|B9EGA5	Silent	SNP	ENST00000370401.2	37	c.756G>A	CCDS14693.2																																																																																				0.517	MAMLD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000060844.2	NM_005491		19	312	0	0	0	0.003954	0	19	312				
MAMLD1	10046	broad.mit.edu	37	X	149638622	149638622	+	Silent	SNP	G	G	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chrX:149638622G>A	ENST00000370401.2	+	4	1087	c.777G>A	c.(775-777)ggG>ggA	p.G259G	MAMLD1_ENST00000426613.2_Silent_p.G234G|MAMLD1_ENST00000432680.2_Silent_p.G234G|MAMLD1_ENST00000455522.2_5'Flank|MAMLD1_ENST00000262858.5_Silent_p.G259G			Q13495	MAMD1_HUMAN	mastermind-like domain containing 1	259					male gonad development (GO:0008584)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.G186G(1)|p.G234G(1)|p.G259G(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(12)|lung(14)|ovary(1)|prostate(2)	37	Acute lymphoblastic leukemia(192;6.56e-05)					CCTCCACAGGGATCAGCTATT	0.527																																							uc004fee.1		NA																	3	Substitution - coding silent(3)		lung(3)		0						c.(775-777)GGG>GGA		mastermind-like domain containing 1							157.0	137.0	144.0					X																	149638622		2203	4300	6503	SO:0001819	synonymous_variant	10046				male gonad development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus		g.chrX:149638622G>A	U46023	CCDS14693.2, CCDS55525.1, CCDS55526.1	Xq28	2008-02-05	2008-01-03	2008-01-03	ENSG00000013619	ENSG00000013619			2568	protein-coding gene	gene with protein product		300120	"""chromosome X open reading frame 6"""	CXorf6		9169146, 17086185, 18162467	Standard	NM_001177465		Approved	CG1, F18	uc011mxu.2	Q13495	OTTHUMG00000024157	ENST00000370401.2:c.777G>A	X.37:g.149638622G>A			Somatic				MAMLD1_uc011mxt.1_Silent_p.G221G|MAMLD1_uc011mxu.1_Silent_p.G234G|MAMLD1_uc011mxv.1_Silent_p.G234G|MAMLD1_uc011mxw.1_Silent_p.G186G	p.G259G	NM_005491	NP_005482	WXS	Illumina HiSeq	Unspecified	Q13495	MAMD1_HUMAN			3	853	+	Acute lymphoblastic leukemia(192;6.56e-05)		259					B2RCQ4|B4DG93|B9EGA5	Silent	SNP	ENST00000370401.2	37	c.777G>A	CCDS14693.2																																																																																				0.527	MAMLD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000060844.2	NM_005491		18	284	0	0	0	0.003954	0	18	284				
MAMLD1	10046	broad.mit.edu	37	X	149638634	149638634	+	Silent	SNP	G	G	A	rs150886306		TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chrX:149638634G>A	ENST00000370401.2	+	4	1099	c.789G>A	c.(787-789)tcG>tcA	p.S263S	MAMLD1_ENST00000426613.2_Silent_p.S238S|MAMLD1_ENST00000432680.2_Silent_p.S238S|MAMLD1_ENST00000455522.2_5'Flank|MAMLD1_ENST00000262858.5_Silent_p.S263S			Q13495	MAMD1_HUMAN	mastermind-like domain containing 1	263					male gonad development (GO:0008584)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.S263S(1)|p.S190S(1)|p.S238S(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(12)|lung(14)|ovary(1)|prostate(2)	37	Acute lymphoblastic leukemia(192;6.56e-05)					TCAGCTATTCGATTCCTTCCA	0.542																																							uc004fee.1		NA																	3	Substitution - coding silent(3)		lung(3)		0						c.(787-789)TCG>TCA		mastermind-like domain containing 1		G	,,	1,3834		0,1,1631,571	144.0	125.0	132.0		714,714,789	-10.5	0.0	X	dbSNP_134	132	0,6728		0,0,2428,1872	no	coding-synonymous,coding-synonymous,coding-synonymous	MAMLD1	NM_001177465.1,NM_001177466.1,NM_005491.3	,,	0,1,4059,2443	AA,AG,GG,G		0.0,0.0261,0.0095	,,	238/999,238/750,263/775	149638634	1,10562	2203	4300	6503	SO:0001819	synonymous_variant	10046				male gonad development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus		g.chrX:149638634G>A	U46023	CCDS14693.2, CCDS55525.1, CCDS55526.1	Xq28	2008-02-05	2008-01-03	2008-01-03	ENSG00000013619	ENSG00000013619			2568	protein-coding gene	gene with protein product		300120	"""chromosome X open reading frame 6"""	CXorf6		9169146, 17086185, 18162467	Standard	NM_001177465		Approved	CG1, F18	uc011mxu.2	Q13495	OTTHUMG00000024157	ENST00000370401.2:c.789G>A	X.37:g.149638634G>A			Somatic				MAMLD1_uc011mxt.1_Silent_p.S225S|MAMLD1_uc011mxu.1_Silent_p.S238S|MAMLD1_uc011mxv.1_Silent_p.S238S|MAMLD1_uc011mxw.1_Silent_p.S190S	p.S263S	NM_005491	NP_005482	WXS	Illumina HiSeq	Unspecified	Q13495	MAMD1_HUMAN			3	865	+	Acute lymphoblastic leukemia(192;6.56e-05)		263					B2RCQ4|B4DG93|B9EGA5	Silent	SNP	ENST00000370401.2	37	c.789G>A	CCDS14693.2																																																																																				0.542	MAMLD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000060844.2	NM_005491		19	257	0	0	0	0.004656	0	19	257				
MAMLD1	10046	broad.mit.edu	37	X	149639226	149639226	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chrX:149639226G>C	ENST00000370401.2	+	4	1691	c.1381G>C	c.(1381-1383)Gag>Cag	p.E461Q	MAMLD1_ENST00000426613.2_Missense_Mutation_p.E436Q|MAMLD1_ENST00000432680.2_Missense_Mutation_p.E436Q|MAMLD1_ENST00000455522.2_5'Flank|MAMLD1_ENST00000262858.5_Missense_Mutation_p.E461Q			Q13495	MAMD1_HUMAN	mastermind-like domain containing 1	461					male gonad development (GO:0008584)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.E461Q(1)|p.E436Q(1)|p.E388Q(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(12)|lung(14)|ovary(1)|prostate(2)	37	Acute lymphoblastic leukemia(192;6.56e-05)					CTATCGCCCAGAGAAGCTCTC	0.572																																							uc004fee.1		NA																	3	Substitution - Missense(3)		lung(3)		0						c.(1381-1383)GAG>CAG		mastermind-like domain containing 1							82.0	84.0	83.0					X																	149639226		2203	4300	6503	SO:0001583	missense	10046				male gonad development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus		g.chrX:149639226G>C	U46023	CCDS14693.2, CCDS55525.1, CCDS55526.1	Xq28	2008-02-05	2008-01-03	2008-01-03	ENSG00000013619	ENSG00000013619			2568	protein-coding gene	gene with protein product		300120	"""chromosome X open reading frame 6"""	CXorf6		9169146, 17086185, 18162467	Standard	NM_001177465		Approved	CG1, F18	uc011mxu.2	Q13495	OTTHUMG00000024157	ENST00000370401.2:c.1381G>C	X.37:g.149639226G>C	ENSP00000359428:p.Glu461Gln		Somatic				MAMLD1_uc011mxt.1_Missense_Mutation_p.E423Q|MAMLD1_uc011mxu.1_Missense_Mutation_p.E436Q|MAMLD1_uc011mxv.1_Missense_Mutation_p.E436Q|MAMLD1_uc011mxw.1_Missense_Mutation_p.E388Q	p.E461Q	NM_005491	NP_005482	WXS	Illumina HiSeq	Unspecified	Q13495	MAMD1_HUMAN			3	1457	+	Acute lymphoblastic leukemia(192;6.56e-05)		461					B2RCQ4|B4DG93|B9EGA5	Missense_Mutation	SNP	ENST00000370401.2	37	c.1381G>C	CCDS14693.2	.	.	.	.	.	.	.	.	.	.	G	14.97	2.695064	0.48202	.	.	ENSG00000013619	ENST00000445612;ENST00000370401;ENST00000432680;ENST00000262858;ENST00000426613	T;T;T;T	0.74737	-0.87;-0.87;-0.87;-0.87	5.58	5.58	0.84498	.	0.073201	0.56097	D	0.000035	D	0.86209	0.5878	M	0.76574	2.34	0.80722	D	1	D;D;D;D	0.89917	1.0;0.998;1.0;0.998	D;D;D;D	0.80764	0.982;0.994;0.989;0.994	D	0.86138	0.1579	9	.	.	.	-29.2678	18.66	0.91469	0.0:0.0:1.0:0.0	.	423;436;436;461	F6WVG1;Q13495-4;Q13495-3;Q13495	.;.;.;MAMD1_HUMAN	Q	423;461;436;461;436	ENSP00000359428:E461Q;ENSP00000414517:E436Q;ENSP00000262858:E461Q;ENSP00000397438:E436Q	.	E	+	1	0	MAMLD1	149389884	1.000000	0.71417	0.933000	0.37362	0.079000	0.17450	5.718000	0.68455	2.351000	0.79841	0.600000	0.82982	GAG		0.572	MAMLD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000060844.2	NM_005491		22	225	0	0	0	0.00333	0	22	225				
PASD1	139135	broad.mit.edu	37	X	150841005	150841005	+	Silent	SNP	C	C	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chrX:150841005C>A	ENST00000370357.4	+	14	2033	c.1788C>A	c.(1786-1788)ccC>ccA	p.P596P		NM_173493.2	NP_775764.2	Q8IV76	PASD1_HUMAN	PAS domain containing 1	596						nucleus (GO:0005634)	signal transducer activity (GO:0004871)	p.P596P(2)		breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(3)|liver(1)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	48	Acute lymphoblastic leukemia(192;6.56e-05)					TATCTGTGCCCCTCTGCAATC	0.502																																							uc004fev.3		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(3)	3						c.(1786-1788)CCC>CCA		PAS domain containing 1							191.0	135.0	154.0					X																	150841005		2203	4300	6503	SO:0001819	synonymous_variant	139135					nucleus	signal transducer activity	g.chrX:150841005C>A	AY270020	CCDS35431.1	Xq28	2009-08-06			ENSG00000166049	ENSG00000166049			20686	protein-coding gene	gene with protein product	"""cancer/testis antigen 63"""					15122589, 15162151	Standard	NM_173493		Approved	CT63	uc004fev.4	Q8IV76	OTTHUMG00000024169	ENST00000370357.4:c.1788C>A	X.37:g.150841005C>A			Somatic					p.P596P	NM_173493	NP_775764	WXS	Illumina HiSeq	Unspecified	Q8IV76	PASD1_HUMAN			14	2120	+	Acute lymphoblastic leukemia(192;6.56e-05)		596					Q3MNE0|Q69HD7|Q8N7X9	Silent	SNP	ENST00000370357.4	37	c.1788C>A	CCDS35431.1																																																																																				0.502	PASD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060879.2	NM_173493		13	121	1	0	0.00136819	0.001368	0.00153046	13	121				
CNGA2	1260	broad.mit.edu	37	X	150912053	150912053	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chrX:150912053G>T	ENST00000329903.4	+	6	1111	c.1078G>T	c.(1078-1080)Ggc>Tgc	p.G360C		NM_005140.1	NP_005131.1	Q16280	CNGA2_HUMAN	cyclic nucleotide gated channel alpha 2	360					phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|sensory perception of smell (GO:0007608)	integral component of plasma membrane (GO:0005887)	cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)	p.G360C(1)		breast(4)|endometrium(4)|large_intestine(5)|lung(34)|prostate(2)	49	Acute lymphoblastic leukemia(192;6.56e-05)					CTTCCTGATTGGCGTCCTCAT	0.512																																							uc004fey.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(3)	3						c.(1078-1080)GGC>TGC		cyclic nucleotide gated channel alpha 2							140.0	136.0	138.0					X																	150912053		2203	4300	6503	SO:0001583	missense	1260				response to stimulus|sensory perception of smell	intracellular cyclic nucleotide activated cation channel complex	cAMP binding|intracellular cAMP activated cation channel activity	g.chrX:150912053G>T	S76067	CCDS14701.1	Xq27	2011-07-05			ENSG00000183862	ENSG00000183862		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2149	protein-coding gene	gene with protein product		300338		CNCA1, CNCA		7532814, 16382102	Standard	NM_005140		Approved	CNG2, OCNC1, OCNCa, OCNCALPHA, OCNCalpha, FLJ46312	uc004fey.1	Q16280	OTTHUMG00000024173	ENST00000329903.4:c.1078G>T	X.37:g.150912053G>T	ENSP00000328478:p.Gly360Cys		Somatic					p.G360C	NM_005140	NP_005131	WXS	Illumina HiSeq	Unspecified	Q16280	CNGA2_HUMAN			7	1302	+	Acute lymphoblastic leukemia(192;6.56e-05)		360			Helical; Name=H5; (Potential).		A0AVD0	Missense_Mutation	SNP	ENST00000329903.4	37	c.1078G>T	CCDS14701.1	.	.	.	.	.	.	.	.	.	.	G	16.48	3.134322	0.56828	.	.	ENSG00000183862	ENST00000329903	D	0.99032	-5.35	4.96	4.96	0.65561	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99569	0.9845	H	0.98155	4.16	0.58432	D	0.999997	D	0.89917	1.0	D	0.97110	1.0	D	0.97742	1.0209	10	0.87932	D	0	.	14.8649	0.70406	0.0:0.0:1.0:0.0	.	360	Q16280	CNGA2_HUMAN	C	360	ENSP00000328478:G360C	ENSP00000328478:G360C	G	+	1	0	CNGA2	150662709	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	9.420000	0.97426	2.183000	0.69458	0.529000	0.55759	GGC		0.512	CNGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060888.1	NM_005140		18	159	1	0	6.94344e-10	0.006122	1.05165e-09	18	159				
MAGEA12	4111	broad.mit.edu	37	X	151899893	151899893	+	Missense_Mutation	SNP	G	G	T	rs375135415		TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chrX:151899893G>T	ENST00000357916.4	-	2	1063	c.908C>A	c.(907-909)cCc>cAc	p.P303H	MAGEA12_ENST00000393900.3_Missense_Mutation_p.P303H|MAGEA12_ENST00000393869.3_Missense_Mutation_p.P303H|CSAG4_ENST00000361201.4_RNA	NM_005367.5	NP_005358.2	P43365	MAGAC_HUMAN	melanoma antigen family A, 12	303	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.							p.P303H(1)		breast(5)|large_intestine(5)|liver(1)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28	Acute lymphoblastic leukemia(192;6.56e-05)					TTCATGCAGGGGTGGGTAGGA	0.567																																							uc010ntp.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(907-909)CCC>CAC		melanoma antigen family A, 12							158.0	151.0	154.0					X																	151899893		2203	4300	6503	SO:0001583	missense	4111							g.chrX:151899893G>T		CCDS76048.1	Xq28	2009-03-13			ENSG00000213401	ENSG00000213401			6799	protein-coding gene	gene with protein product	"""cancer/testis antigen family 1, member 12"""	300177		MAGE12		8575766	Standard	NM_001166386		Approved	CT1.12	uc004fgc.3	P43365	OTTHUMG00000022650	ENST00000357916.4:c.908C>A	X.37:g.151899893G>T	ENSP00000350592:p.Pro303His		Somatic				MAGEA12_uc004fgb.2_Intron|MAGEA12_uc004fgc.2_Missense_Mutation_p.P303H	p.P303H	NM_005367	NP_005358	WXS	Illumina HiSeq	Unspecified	P43365	MAGAC_HUMAN			3	1262	-	Acute lymphoblastic leukemia(192;6.56e-05)		303			MAGE.		Q9NSD3	Missense_Mutation	SNP	ENST00000357916.4	37	c.908C>A	CCDS14710.1	.	.	.	.	.	.	.	.	.	.	G	2.770	-0.255868	0.05829	.	.	ENSG00000213401	ENST00000357916;ENST00000393869;ENST00000393900	T;T;T	0.01572	4.76;4.76;4.76	0.809	0.809	0.18725	.	5.654110	0.00357	N	0.000025	T	0.02888	0.0086	L	0.35793	1.09	0.09310	N	1	P	0.47409	0.895	P	0.47430	0.547	T	0.46803	-0.9165	9	0.15499	T	0.54	.	.	.	.	.	303	P43365	MAGAC_HUMAN	H	303	ENSP00000350592:P303H;ENSP00000377447:P303H;ENSP00000377478:P303H	ENSP00000350592:P303H	P	-	2	0	MAGEA12	151650549	0.010000	0.17322	0.004000	0.12327	0.044000	0.14063	-0.108000	0.10857	0.675000	0.31264	0.181000	0.17075	CCC		0.567	MAGEA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058764.1	NM_005367		19	252	1	0	1.55795e-14	0.001882	2.67168e-14	19	252				
SRPK3	26576	broad.mit.edu	37	X	153048470	153048470	+	Silent	SNP	C	C	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chrX:153048470C>A	ENST00000370101.3	+	7	691	c.645C>A	c.(643-645)ccC>ccA	p.P215P	SRPK3_ENST00000370100.1_Silent_p.P173P|SRPK3_ENST00000393786.3_Silent_p.P215P|SRPK3_ENST00000489426.1_Silent_p.P282P|SRPK3_ENST00000370108.3_Silent_p.P215P|SRPK3_ENST00000370104.1_Silent_p.P215P	NM_001170760.1|NM_014370.3	NP_001164231.1|NP_055185.2	Q9UPE1	SRPK3_HUMAN	SRSF protein kinase 3	215	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell differentiation (GO:0030154)|muscle tissue development (GO:0060537)|skeletal muscle tissue development (GO:0007519)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.P215P(1)|p.P282P(1)		breast(1)|central_nervous_system(1)|endometrium(2)|lung(4)|ovary(2)|pancreas(2)|urinary_tract(1)	13	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					ACATCAAGCCCGAGAACATCT	0.652																																					Esophageal Squamous(167;766 3400 32156)	Esophageal Squamous(167;766 3400 32156)	uc004fil.2		NA																	2	Substitution - coding silent(2)	p.P215H(1)	lung(2)	pancreas(2)|lung(1)	3						c.(643-645)CCC>CCA		serine arginine rich protein-specific kinase 3							89.0	69.0	76.0					X																	153048470		2203	4299	6502	SO:0001819	synonymous_variant	26576				cell differentiation|muscle organ development|muscle tissue development		ATP binding|protein serine/threonine kinase activity	g.chrX:153048470C>A	AF027406	CCDS35441.1, CCDS55537.1, CCDS55538.1	Xq28	2010-06-23	2010-06-23	2006-08-17	ENSG00000184343	ENSG00000184343			11402	protein-coding gene	gene with protein product			"""serine/threonine kinase 23"", ""SFRS protein kinase 3"""	STK23		16140986	Standard	NM_014370		Approved	MSSK1	uc004fil.3	Q9UPE1	OTTHUMG00000024207	ENST00000370101.3:c.645C>A	X.37:g.153048470C>A			Somatic				SRPK3_uc004fik.2_Silent_p.P281P|SRPK3_uc010nul.2_Silent_p.P173P|SRPK3_uc004fin.2_Silent_p.P215P|SRPK3_uc004fim.2_Silent_p.P215P	p.P215P	NM_014370	NP_055185	WXS	Illumina HiSeq	Unspecified	Q9UPE1	SRPK3_HUMAN			7	677	+	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)		215			Protein kinase.		Q13583|Q4F970|Q562F5|Q9UM62	Silent	SNP	ENST00000370101.3	37	c.645C>A	CCDS35441.1																																																																																				0.652	SRPK3-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000354501.1	NM_014370		13	112	1	0	4.3838e-07	0.001855	5.84977e-07	13	112				
PDZD4	57595	broad.mit.edu	37	X	153069157	153069157	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chrX:153069157C>A	ENST00000164640.4	-	8	2152	c.1961G>T	c.(1960-1962)cGg>cTg	p.R654L	PDZD4_ENST00000544474.1_Missense_Mutation_p.R545L|PDZD4_ENST00000393758.2_Missense_Mutation_p.R579L|PDZD4_ENST00000475140.1_5'Flank	NM_032512.2	NP_115901.2	Q76G19	PDZD4_HUMAN	PDZ domain containing 4	654						cytoplasm (GO:0005737)		p.R654L(1)		breast(3)|cervix(1)|endometrium(5)|lung(13)|skin(1)	23	all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GCGCTCCTCCCGGATCTTCAG	0.652																																							uc004fiz.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(1960-1962)CGG>CTG		PDZ domain containing 4							45.0	44.0	44.0					X																	153069157		2203	4298	6501	SO:0001583	missense	57595					cell cortex		g.chrX:153069157C>A	AK091444	CCDS14732.1	Xq28	2008-02-05		2006-01-24	ENSG00000067840	ENSG00000067840			21167	protein-coding gene	gene with protein product		300634		PDZK4		10819331, 15077175	Standard	NM_032512		Approved	KIAA1444, LU1, FLJ34125, PDZRN4L	uc004fiz.1	Q76G19	OTTHUMG00000024209	ENST00000164640.4:c.1961G>T	X.37:g.153069157C>A	ENSP00000164640:p.Arg654Leu		Somatic				PDZD4_uc004fiy.1_Missense_Mutation_p.R579L|PDZD4_uc004fix.2_Missense_Mutation_p.R558L|PDZD4_uc004fja.1_Missense_Mutation_p.R660L|PDZD4_uc011mze.1_Missense_Mutation_p.R545L	p.R654L	NM_032512	NP_115901	WXS	Illumina HiSeq	Unspecified	Q76G19	PDZD4_HUMAN			8	2211	-	all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)		654					B3KXB1|B7ZKY3|Q8NB75|Q9BUH9|Q9P284	Missense_Mutation	SNP	ENST00000164640.4	37	c.1961G>T	CCDS14732.1	.	.	.	.	.	.	.	.	.	.	C	15.49	2.850008	0.51270	.	.	ENSG00000067840	ENST00000164640;ENST00000393758;ENST00000537633;ENST00000544474	T;T;T	0.48201	0.82;0.82;0.82	5.67	5.67	0.87782	.	0.116516	0.53938	D	0.000049	T	0.58104	0.2099	L	0.60455	1.87	0.48975	D	0.999732	B;D;P;D;B	0.60575	0.208;0.983;0.858;0.988;0.208	B;P;B;P;B	0.57425	0.049;0.82;0.314;0.806;0.049	T	0.61855	-0.6977	10	0.87932	D	0	-34.066	11.0287	0.47759	0.0:0.9117:0.0:0.0883	.	545;660;654;579;558	B7ZKY3;Q17RL8;Q76G19;D3DWW0;B3KVR9	.;.;PDZD4_HUMAN;.;.	L	654;579;558;545	ENSP00000164640:R654L;ENSP00000377355:R579L;ENSP00000442033:R545L	ENSP00000164640:R654L	R	-	2	0	PDZD4	152722351	0.812000	0.29077	0.998000	0.56505	0.940000	0.58332	1.404000	0.34623	2.385000	0.81259	0.529000	0.55759	CGG		0.652	PDZD4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061013.3	NM_032512		16	92	1	0	1.5739e-10	0.004007	2.45552e-10	16	92				
MPP1	4354	broad.mit.edu	37	X	154007556	154007556	+	Missense_Mutation	SNP	A	A	T	rs374639579		TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chrX:154007556A>T	ENST00000369534.3	-	12	1444	c.1297T>A	c.(1297-1299)Tca>Aca	p.S433T	MPP1_ENST00000413259.3_Missense_Mutation_p.S403T|MPP1_ENST00000393531.1_Missense_Mutation_p.S413T	NM_001166460.1|NM_001166461.1|NM_002436.3	NP_001159932.1|NP_001159933.1|NP_002427.1	Q00013	EM55_HUMAN	membrane protein, palmitoylated 1, 55kDa	433	Guanylate kinase-like. {ECO:0000255|PROSITE-ProRule:PRU00100}.|Interaction with MPP5.				nucleotide phosphorylation (GO:0046939)|regulation of neutrophil chemotaxis (GO:0090022)|signal transduction (GO:0007165)	cell projection (GO:0042995)|cortical cytoskeleton (GO:0030863)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|membrane (GO:0016020)	guanylate kinase activity (GO:0004385)	p.S433T(1)		central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(1)|lung(9)|ovary(2)|prostate(1)	21	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					TTGACCAGTGAGAGGTCAAAG	0.507																																							uc004fmp.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(1297-1299)TCA>ACA		palmitoylated membrane protein 1							111.0	88.0	96.0					X																	154007556		2203	4300	6503	SO:0001583	missense	4354				regulation of neutrophil chemotaxis|signal transduction	integral to plasma membrane|membrane fraction|stereocilium	guanylate kinase activity|protein binding	g.chrX:154007556A>T		CCDS14762.1, CCDS55544.1, CCDS55545.1	Xq28	2008-03-04	2002-08-29		ENSG00000130830	ENSG00000130830			7219	protein-coding gene	gene with protein product		305360	"""membrane protein, palmitoylated 1 (55kD)"""	DXS552E		1713685	Standard	NM_002436		Approved	PEMP	uc004fmp.2	Q00013	OTTHUMG00000024244	ENST00000369534.3:c.1297T>A	X.37:g.154007556A>T	ENSP00000358547:p.Ser433Thr		Somatic				MPP1_uc010nvg.1_Missense_Mutation_p.S413T|MPP1_uc011mzv.1_Missense_Mutation_p.S403T|MPP1_uc004fmq.1_Missense_Mutation_p.S387T|MPP1_uc011mzw.1_Missense_Mutation_p.S416T	p.S433T	NM_002436	NP_002427	WXS	Illumina HiSeq	Unspecified	Q00013	EM55_HUMAN			12	1412	-	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)		433			Guanylate kinase-like.|Interaction with MPP5.		B4DZV5|G3XAI1|Q2TSB6|Q5J7V5	Missense_Mutation	SNP	ENST00000369534.3	37	c.1297T>A	CCDS14762.1	.	.	.	.	.	.	.	.	.	.	A	2.135	-0.398222	0.04865	.	.	ENSG00000130830	ENST00000369534;ENST00000413259;ENST00000393531	T;T;T	0.42131	0.98;0.98;0.98	5.76	4.47	0.54385	Guanylate kinase/L-type calcium channel (1);Guanylate kinase (2);	0.281945	0.37095	N	0.002260	T	0.14960	0.0361	N	0.02247	-0.625	0.32529	N	0.535193	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.20672	-1.0268	10	0.02654	T	1	.	9.882	0.41238	0.7624:0.0:0.0:0.2376	.	416;403;413;433	B4E325;B4DZV5;G3XAI1;Q00013	.;.;.;EM55_HUMAN	T	433;403;413	ENSP00000358547:S433T;ENSP00000400155:S403T;ENSP00000377165:S413T	ENSP00000358547:S433T	S	-	1	0	MPP1	153660750	0.998000	0.40836	0.594000	0.28785	0.901000	0.52897	2.257000	0.43240	1.934000	0.56057	0.486000	0.48141	TCA		0.507	MPP1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061191.3	NM_002436		18	135	0	0	0	0.002299	0	18	135				
CYP1A1	1543	broad.mit.edu	37	15	75013022	75013022	+	Frame_Shift_Del	DEL	G	G	-			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr15:75013022delG	ENST00000379727.3	-	7	1545	c.1347delC	c.(1345-1347)atcfs	p.I449fs	CYP1A1_ENST00000567032.1_Frame_Shift_Del_p.I449fs|CYP1A1_ENST00000395048.2_Frame_Shift_Del_p.I449fs|CYP1A1_ENST00000395049.4_Frame_Shift_Del_p.I420fs			P04798	CP1A1_HUMAN	cytochrome P450, family 1, subfamily A, polypeptide 1	449					9-cis-retinoic acid biosynthetic process (GO:0042904)|aging (GO:0007568)|amine metabolic process (GO:0009308)|arachidonic acid metabolic process (GO:0019369)|camera-type eye development (GO:0043010)|cell proliferation (GO:0008283)|cellular lipid metabolic process (GO:0044255)|cellular response to organic cyclic compound (GO:0071407)|coumarin metabolic process (GO:0009804)|dibenzo-p-dioxin catabolic process (GO:0019341)|digestive tract development (GO:0048565)|drug metabolic process (GO:0017144)|embryo development ending in birth or egg hatching (GO:0009792)|epoxygenase P450 pathway (GO:0019373)|flavonoid metabolic process (GO:0009812)|hepatocyte differentiation (GO:0070365)|hydrogen peroxide biosynthetic process (GO:0050665)|insecticide metabolic process (GO:0017143)|maternal process involved in parturition (GO:0060137)|omega-hydroxylase P450 pathway (GO:0097267)|oxidation-reduction process (GO:0055114)|porphyrin-containing compound metabolic process (GO:0006778)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|response to antibiotic (GO:0046677)|response to arsenic-containing substance (GO:0046685)|response to drug (GO:0042493)|response to food (GO:0032094)|response to herbicide (GO:0009635)|response to hyperoxia (GO:0055093)|response to hypoxia (GO:0001666)|response to iron(III) ion (GO:0010041)|response to lipopolysaccharide (GO:0032496)|response to nematode (GO:0009624)|response to virus (GO:0009615)|response to vitamin A (GO:0033189)|response to wounding (GO:0009611)|small molecule metabolic process (GO:0044281)|vitamin D metabolic process (GO:0042359)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|mitochondrion (GO:0005739)	aromatase activity (GO:0070330)|demethylase activity (GO:0032451)|flavonoid 3'-monooxygenase activity (GO:0016711)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity (GO:0016491)|oxidoreductase activity, acting on diphenols and related substances as donors (GO:0016679)|oxygen binding (GO:0019825)|steroid hydroxylase activity (GO:0008395)|vitamin D 24-hydroxylase activity (GO:0070576)			autonomic_ganglia(1)|breast(2)|endometrium(1)|large_intestine(7)|lung(13)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	34					Acetaminophen(DB00316)|Albendazole(DB00518)|Amiodarone(DB01118)|Amlodipine(DB00381)|Amodiaquine(DB00613)|Arsenic trioxide(DB01169)|Azelastine(DB00972)|Benzyl alcohol(DB06770)|Bezafibrate(DB01393)|Bortezomib(DB00188)|Caffeine(DB00201)|Carvedilol(DB01136)|Chloroquine(DB00608)|Chlorzoxazone(DB00356)|Cholecalciferol(DB00169)|Cinnarizine(DB00568)|Clenbuterol(DB01407)|Clobetasol propionate(DB01013)|Clofibrate(DB00636)|Clomifene(DB00882)|Clonidine(DB00575)|Clozapine(DB00363)|Dacarbazine(DB00851)|Dapagliflozin(DB06292)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Debrisoquin(DB04840)|Dexamethasone(DB01234)|Dexmedetomidine(DB00633)|Diclofenac(DB00586)|Dicyclomine(DB00804)|Dronabinol(DB00470)|Erlotinib(DB00530)|Estradiol(DB00783)|Estrone(DB00655)|Ethanol(DB00898)|Flunarizine(DB04841)|Fluorescein(DB00693)|Flutamide(DB00499)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Gefitinib(DB00317)|Granisetron(DB00889)|Haloperidol(DB00502)|Isoprenaline(DB01064)|Itraconazole(DB01167)|Ketoconazole(DB01026)|Lansoprazole(DB00448)|Lorcaserin(DB04871)|Mebendazole(DB00643)|Melatonin(DB01065)|Menadione(DB00170)|Methoxsalen(DB00553)|Nicotine(DB00184)|Nifedipine(DB01115)|Nitroprusside(DB00325)|Norfloxacin(DB01059)|Omeprazole(DB00338)|Ouabain(DB01092)|Oxaliplatin(DB00526)|Pentamidine(DB00738)|Phenobarbital(DB01174)|Prazosin(DB00457)|Primaquine(DB01087)|Progesterone(DB00396)|Propofol(DB00818)|Propranolol(DB00571)|Pyridoxine(DB00165)|Quinidine(DB00908)|Quinine(DB00468)|Rabeprazole(DB01129)|Riluzole(DB00740)|Sildenafil(DB00203)|Streptozocin(DB00428)|Sulindac(DB00605)|Tamoxifen(DB00675)|Testosterone(DB00624)|Thalidomide(DB01041)|Theophylline(DB00277)|Thiabendazole(DB00730)|Ticlopidine(DB00208)|Toremifene(DB00539)|Tretinoin(DB00755)|Vitamin A(DB00162)|Warfarin(DB00682)	CCATGCCAAAGATAATCACCT	0.522									Endometrial Cancer, Familial Clustering of;ACTH-independent macronodular adrenal hyperplasia																														uc002ayp.3		NA																	0				ovary(2)|breast(2)|pancreas(1)	5						c.(1345-1347)ATCfs		cytochrome P450, family 1, subfamily A,	Arsenic trioxide(DB01169)|Benzphetamine(DB00865)|Bleomycin(DB00290)|Chlorzoxazone(DB00356)|Dacarbazine(DB00851)|Dactinomycin(DB00970)|Esomeprazole(DB00736)|Estrone(DB00655)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Ginseng(DB01404)|Granisetron(DB00889)|Ketoconazole(DB01026)|Menadione(DB00170)|Picrotoxin(DB00466)|Primaquine(DB01087)|Quinidine(DB00908)|Quinine(DB00468)|Thiabendazole(DB00730)						149.0	141.0	144.0					15																	75013022		2197	4296	6493	SO:0001589	frameshift_variant	1543	Endometrial_Cancer_Familial_Clustering_of|ACTH-independent_macronodular_adrenal_hyperplasia	Familial Cancer Database	;AIMAH, Cushing disease, Adrenal, Familial	cellular lipid metabolic process|drug metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding|vitamin D 24-hydroxylase activity	g.chr15:75013022delG	BC023019	CCDS10268.1	15q24.1	2007-12-14	2003-01-14		ENSG00000140465	ENSG00000140465	1.14.14.1	"""Cytochrome P450s"""	2595	protein-coding gene	gene with protein product		108330	"""cytochrome P450, subfamily I (aromatic compound-inducible), polypeptide 1"""	CYP1		15128046	Standard	NM_000499		Approved	P450DX, P1-450, P450-C, CP11	uc002ayp.4	P04798	OTTHUMG00000142812	ENST00000379727.3:c.1347delC	15.37:g.75013022delG	ENSP00000369050:p.Ile449fs		Somatic				CYP1A1_uc010bjv.2_RNA|CYP1A1_uc010bjw.2_RNA|CYP1A1_uc010bju.2_Frame_Shift_Del_p.I185fs|CYP1A1_uc010bjx.2_Frame_Shift_Del_p.I185fs|CYP1A1_uc002ayq.3_Frame_Shift_Del_p.I449fs|CYP1A1_uc010bjy.2_Frame_Shift_Del_p.I420fs	p.I449fs	NM_000499	NP_000490	WXS	Illumina HiSeq	Unspecified	P04798	CP1A1_HUMAN			7	1469	-			449					A4F3V9|A4F3W0|Q53G18	Frame_Shift_Del	DEL	ENST00000379727.3	37	c.1347delC	CCDS10268.1																																																																																				0.522	CYP1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286396.1	NM_000499		21	238	NA	NA	NA	NA	NA	21	238	---	---	---	---
RLTPR	146206	broad.mit.edu	37	16	67683455	67683455	+	Frame_Shift_Del	DEL	G	G	-			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr16:67683455delG	ENST00000334583.6	+	20	2180	c.1852delG	c.(1852-1854)ggcfs	p.G618fs	RLTPR_ENST00000545661.1_Frame_Shift_Del_p.G582fs	NM_001013838.1	NP_001013860.1	Q6F5E8	LR16C_HUMAN	RGD motif, leucine rich repeats, tropomodulin domain and proline-rich containing	618	Tropomodulin-like.				cell migration (GO:0016477)|establishment of protein localization (GO:0045184)|homeostasis of number of cells (GO:0048872)|maintenance of cell polarity (GO:0030011)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interferon-gamma secretion (GO:1902715)|positive regulation of interleukin-2 secretion (GO:1900042)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell proliferation (GO:0042102)|T cell receptor signaling pathway (GO:0050852)|thymus development (GO:0048538)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|F-actin capping protein complex (GO:0008290)|immunological synapse (GO:0001772)|membrane (GO:0016020)				breast(1)|cervix(1)|endometrium(4)|kidney(1)|lung(9)|urinary_tract(2)	18		Acute lymphoblastic leukemia(13;3.23e-05)|all_hematologic(13;0.00251)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0146)|Epithelial(162;0.0481)|all cancers(182;0.232)		GGATATCAGCGGCAACGCCAT	0.682																																							uc002etn.2		NA																	0				breast(1)	1						c.(1852-1854)GGCfs		RGD motif, leucine rich repeats, tropomodulin							26.0	31.0	29.0					16																	67683455		1978	4137	6115	SO:0001589	frameshift_variant	146206							g.chr16:67683455delG	AB113647	CCDS45513.1	16q22.1	2010-09-10				ENSG00000159753			27089	protein-coding gene	gene with protein product	"""RGD, leucine-rich repeat, tropomodulin and proline-rich containing protein"", ""leucine rich repeat containing 16C"""	610859				15588584, 19846667	Standard	XM_005255807		Approved	LRRC16C, CARMIL2	uc002etn.3	Q6F5E8		ENST00000334583.6:c.1852delG	16.37:g.67683455delG	ENSP00000334958:p.Gly618fs		Somatic				RLTPR_uc010cel.1_Frame_Shift_Del_p.G611fs|RLTPR_uc010vjr.1_Frame_Shift_Del_p.G582fs	p.G618fs	NM_001013838	NP_001013860	WXS	Illumina HiSeq	Unspecified	Q6F5E8	LR16C_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.0146)|Epithelial(162;0.0481)|all cancers(182;0.232)	20	1972	+		Acute lymphoblastic leukemia(13;3.23e-05)|all_hematologic(13;0.00251)|Ovarian(137;0.192)	618			Tropomodulin-like.|LRR 14.		B8X2Z3	Frame_Shift_Del	DEL	ENST00000334583.6	37	c.1852delG	CCDS45513.1																																																																																				0.682	RLTPR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000467858.1	NM_001013838		7	77	NA	NA	NA	NA	NA	7	77	---	---	---	---
MYBPC2	4606	broad.mit.edu	37	19	50957526	50957526	+	Frame_Shift_Del	DEL	C	C	-			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr19:50957526delC	ENST00000357701.5	+	18	1965	c.1914delC	c.(1912-1914)gtcfs	p.V638fs		NM_004533.3	NP_004524.3	Q14324	MYPC2_HUMAN	myosin binding protein C, fast type	638	Ig-like C2-type 5.				cell adhesion (GO:0007155)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			breast(1)	1		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.0079)|GBM - Glioblastoma multiforme(134;0.0144)		CTGCAGATGTCCCAGACCCCC	0.642																																							uc002psf.2		NA																	0				breast(1)	1						c.(1912-1914)GTCfs		myosin binding protein C, fast type							33.0	36.0	35.0					19																	50957526		1998	4157	6155	SO:0001589	frameshift_variant	4606				cell adhesion|muscle filament sliding	cytosol|myosin filament	actin binding|structural constituent of muscle	g.chr19:50957526delC		CCDS46152.1	19q13.33	2013-02-11	2001-11-28		ENSG00000086967	ENSG00000086967		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7550	protein-coding gene	gene with protein product	"""fast-type muscle myosin-binding-protein C"""	160793	"""myosin-binding protein C, fast-type"""			8375400	Standard	NM_004533		Approved	MYBPCF, MYBPC, MGC163408	uc002psf.2	Q14324		ENST00000357701.5:c.1914delC	19.37:g.50957526delC	ENSP00000350332:p.Val638fs		Somatic					p.V638fs	NM_004533	NP_004524	WXS	Illumina HiSeq	Unspecified	Q14324	MYPC2_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.0079)|GBM - Glioblastoma multiforme(134;0.0144)	18	1965	+		all_neural(266;0.057)	638			Ig-like C2-type 5.		A1L4G9	Frame_Shift_Del	DEL	ENST00000357701.5	37	c.1914delC	CCDS46152.1																																																																																				0.642	MYBPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464751.1	NM_004533		10	74	NA	NA	NA	NA	NA	10	74	---	---	---	---
SIGLEC6	946	broad.mit.edu	37	19	52023487	52023487	+	Frame_Shift_Del	DEL	G	G	-			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr19:52023487delG	ENST00000425629.3	-	8	1365	c.1211delC	c.(1210-1212)acafs	p.T404fs	SIGLEC6_ENST00000359982.4_Frame_Shift_Del_p.Q388fs|CTD-3073N11.9_ENST00000598220.1_RNA|SIGLEC6_ENST00000436458.1_Frame_Shift_Del_p.T352fs|SIGLEC6_ENST00000391797.3_Frame_Shift_Del_p.D334fs|SIGLEC6_ENST00000346477.3_Frame_Shift_Del_p.T388fs|SIGLEC6_ENST00000343300.4_Frame_Shift_Del_p.D345fs|SIGLEC6_ENST00000474054.1_5'UTR	NM_001245.5	NP_001236.4	O43699	SIGL6_HUMAN	sialic acid binding Ig-like lectin 6	404					cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)			endometrium(3)|kidney(1)|large_intestine(6)|liver(1)|lung(15)|ovary(1)|stomach(1)	28		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.00115)|OV - Ovarian serous cystadenocarcinoma(262;0.0165)		AACTATGCCTGTCTGGAACTG	0.502																																							uc002pwy.2		NA																	0				ovary(1)	1						c.(1210-1212)ACAfs		sialic acid binding Ig-like lectin 6 isoform 1							179.0	171.0	173.0					19																	52023487		1955	4140	6095	SO:0001589	frameshift_variant	946				cell adhesion|cell-cell signaling	cytoplasm|extracellular region|integral to plasma membrane|membrane fraction|nucleus		g.chr19:52023487delG	D86358	CCDS12834.3, CCDS12835.3, CCDS12836.3, CCDS54307.1, CCDS54308.1, CCDS59417.1	19q13.3	2013-01-29			ENSG00000105492	ENSG00000105492		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10875	protein-coding gene	gene with protein product		604405		CD33L, CD33L1		9465907	Standard	NM_001245		Approved	OB-BP1, SIGLEC-6, CD327	uc002pwy.3	O43699	OTTHUMG00000133571	ENST00000425629.3:c.1211delC	19.37:g.52023487delG	ENSP00000401502:p.Thr404fs		Somatic				SIGLEC6_uc002pwz.2_Frame_Shift_Del_p.T388fs|SIGLEC6_uc002pxa.2_Frame_Shift_Del_p.D345fs|SIGLEC6_uc010ydb.1_Frame_Shift_Del_p.T341fs|SIGLEC6_uc010ydc.1_Frame_Shift_Del_p.Q377fs|SIGLEC6_uc010eoz.1_Frame_Shift_Del_p.D323fs	p.T404fs	NM_001245	NP_001236	WXS	Illumina HiSeq	Unspecified	O43699	SIGL6_HUMAN		GBM - Glioblastoma multiforme(134;0.00115)|OV - Ovarian serous cystadenocarcinoma(262;0.0165)	8	1373	-		all_neural(266;0.0199)	404			Cytoplasmic (Potential).		A8MV71|B2RTS8|C9JBE5|F8WA78|O15388|O43700	Frame_Shift_Del	DEL	ENST00000425629.3	37	c.1211delC	CCDS12834.3																																																																																				0.502	SIGLEC6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257670.3	NM_001245		23	320	NA	NA	NA	NA	NA	23	320	---	---	---	---
FAM209A	200232	broad.mit.edu	37	20	55100858	55100882	+	Splice_Site	DEL	AGGAGCAGAGTCCTCCTGGCCTTCG	AGGAGCAGAGTCCTCCTGGCCTTCG	-	rs368902169|rs560673730		TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	AGGAGCAGAGTCCTCCTGGCCTTCG	AGGAGCAGAGTCCTCCTGGCCTTCG	-	-	AGGAGCAGAGTCCTCCTGGCCTTCG	AGGAGCAGAGTCCTCCTGGCCTTCG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr20:55100858_55100882delAGGAGCAGAGTCCTCCTGGCCTTCG	ENST00000371328.3	+	2	572_595	c.249_272delAGGAGCAGAGTCCTCCTGGCCTTCG	c.(247-273)aaaggagcagagtcctcctggccttcg>aag	p.GAESSWPS84fs	GCNT7_ENST00000243913.4_5'UTR|FAM209A_ENST00000481560.1_3'UTR	NM_001012971.3	NP_001012989.2	Q5JX71	F209A_HUMAN	family with sequence similarity 209, member A	84						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)											CTTTCCTGACAGGAGCAGAGTCCTCCTGGCCTTCGAGGCGGCCAA	0.436																																							uc002xxx.2		NA																	0					0						c.e2-1		hypothetical protein LOC200232 precursor																																				SO:0001630	splice_region_variant	200232					integral to membrane		g.chr20:55100858_55100882delAGGAGCAGAGTCCTCCTGGCCTTCG	AL109806	CCDS33493.1	20q13.31	2011-11-24	2011-11-24	2011-11-24	ENSG00000124103	ENSG00000124103			16100	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 106"""	C20orf106			Standard	NM_001012971		Approved	dJ1153D9.3		Q5JX71	OTTHUMG00000032799	ENST00000371328.3:c.250-1AGGAGCAGAGTCCTCCTGGCCTTCG>-	20.37:g.55100858_55100882delAGGAGCAGAGTCCTCCTGGCCTTCG			Somatic				GCNT7_uc010zzg.1_5'UTR|C20orf107_uc010zzh.1_Intron	p.E84_splice	NM_001012971	NP_001012989	WXS	Illumina HiSeq	Unspecified	Q5JX71	CT106_HUMAN	Colorectal(105;0.202)		2	330	+								Q05C43	Splice_Site	DEL	ENST00000371328.3	37	c.250_splice	CCDS33493.1																																																																																				0.436	FAM209A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079815.2		Frame_Shift_Del	19	498	NA	NA	NA	NA	NA	19	498	---	---	---	---
GALNT15	117248	broad.mit.edu	37	3	16254176	16254176	+	Frame_Shift_Del	DEL	C	C	-			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr3:16254176delC	ENST00000339732.5	+	6	1801	c.1298delC	c.(1297-1299)accfs	p.T433fs	GALNT15_ENST00000437509.1_Frame_Shift_Del_p.T433fs	NM_054110.4	NP_473451.3	Q8N3T1	GLT15_HUMAN	polypeptide N-acetylgalactosaminyltransferase 15	433					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|transport vesicle (GO:0030133)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)										CAGGAGGCCACCCTGAGGAAC	0.552																																							uc003car.3		NA																	0				breast(1)	1						c.(1297-1299)ACCfs		UDP-N-acetyl-alpha-D-galactosamine:polypeptide							103.0	97.0	99.0					3																	16254176		2203	4300	6503	SO:0001589	frameshift_variant	117248					Golgi membrane|integral to membrane|transport vesicle	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding	g.chr3:16254176delC	AY358443	CCDS33711.1	3p25.1	2014-03-13	2014-03-13	2013-01-25	ENSG00000131386	ENSG00000131386	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	21531	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 15"""	615131	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 2"", ""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 15"""	GALNTL2		12975309, 14702039, 15147861	Standard	NM_054110		Approved	GALNT7, pp-GalNAc-T15	uc003car.4	Q8N3T1	OTTHUMG00000156893	ENST00000339732.5:c.1298delC	3.37:g.16254176delC	ENSP00000344260:p.Thr433fs		Somatic				GALNTL2_uc003caq.3_Frame_Shift_Del_p.T166fs	p.T433fs	NM_054110	NP_473451	WXS	Illumina HiSeq	Unspecified	Q8N3T1	GLTL2_HUMAN			6	1773	+			433			Lumenal (Potential).		A6NMN1|B2R638|F1LIP6|Q86T60|Q96C46|Q96DJ5	Frame_Shift_Del	DEL	ENST00000339732.5	37	c.1298delC	CCDS33711.1																																																																																				0.552	GALNT15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346483.2	NM_054110		39	165	NA	NA	NA	NA	NA	39	165	---	---	---	---
UROC1	131669	broad.mit.edu	37	3	126220105	126220106	+	Frame_Shift_Ins	INS	-	-	T	rs569784894		TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr3:126220105_126220106insT	ENST00000290868.2	-	10	973_974	c.920_921insA	c.(919-921)aagfs	p.K307fs	UROC1_ENST00000383579.3_Frame_Shift_Ins_p.K367fs	NM_144639.2	NP_653240.1	Q96N76	HUTU_HUMAN	urocanate hydratase 1	307					cellular nitrogen compound metabolic process (GO:0034641)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	urocanate hydratase activity (GO:0016153)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(27)|ovary(1)|skin(1)	39				GBM - Glioblastoma multiforme(114;0.17)		TGAGCACCTCCTTTTTTTTCCT	0.584																																							uc003eiz.1		NA																	0				ovary(1)	1						c.(919-921)AAGfs		urocanase domain containing 1 isoform 1																																				SO:0001589	frameshift_variant	131669				histidine catabolic process	cytosol	urocanate hydratase activity	g.chr3:126220105_126220106insT	AK055862	CCDS3038.1, CCDS54636.1	3q21.2	2012-08-21	2012-08-21		ENSG00000159650	ENSG00000159650	4.2.1.49		26444	protein-coding gene	gene with protein product	"""urocanase 1"""	613012	"""urocanase domain containing 1"""			19304569	Standard	NM_144639		Approved	FLJ31300, HMFN0320	uc010hsi.2	Q96N76	OTTHUMG00000162753	ENST00000290868.2:c.921dupA	3.37:g.126220113_126220113dupT	ENSP00000290868:p.Lys307fs		Somatic				UROC1_uc010hsi.1_Frame_Shift_Ins_p.K367fs	p.K307fs	NM_144639	NP_653240	WXS	Illumina HiSeq	Unspecified	Q96N76	HUTU_HUMAN		GBM - Glioblastoma multiforme(114;0.17)	10	952_953	-			307					E9PE13|Q14C64|Q68CJ7	Frame_Shift_Ins	INS	ENST00000290868.2	37	c.920_921insA	CCDS3038.1																																																																																				0.584	UROC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370325.2	NM_144639		8	375	NA	NA	NA	NA	NA	8	375	---	---	---	---
ADD1	118	broad.mit.edu	37	4	2930188	2930190	+	In_Frame_Del	DEL	AAG	AAG	-			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	AAG	AAG	-	-	AAG	AAG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr4:2930188_2930190delAAG	ENST00000398129.1	+	14	2172_2174	c.2152_2154delAAG	c.(2152-2154)aagdel	p.K721del	ADD1_ENST00000503455.2_3'UTR|ADD1_ENST00000398123.2_3'UTR|ADD1_ENST00000264758.7_In_Frame_Del_p.K752del|ADD1_ENST00000398125.1_3'UTR|ADD1_ENST00000355842.3_3'UTR|ADD1_ENST00000446856.1_In_Frame_Del_p.K721del|ADD1_ENST00000513328.2_3'UTR			P35611	ADDA_HUMAN	adducin 1 (alpha)	721	Interaction with calmodulin. {ECO:0000255}.				actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|activation of signaling protein activity involved in unfolded protein response (GO:0006987)|apoptotic process (GO:0006915)|barbed-end actin filament capping (GO:0051016)|cell morphogenesis (GO:0000902)|cell volume homeostasis (GO:0006884)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular protein metabolic process (GO:0044267)|cellular response to retinoic acid (GO:0071300)|endoplasmic reticulum unfolded protein response (GO:0030968)|erythrocyte differentiation (GO:0030218)|hemoglobin metabolic process (GO:0020027)|homeostasis of number of cells within a tissue (GO:0048873)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endocytosis (GO:0045807)|positive regulation of protein binding (GO:0032092)	cytosol (GO:0005829)|dendritic spine (GO:0043197)|F-actin capping protein complex (GO:0008290)|focal adhesion (GO:0005925)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|spectrin binding (GO:0030507)|structural molecule activity (GO:0005198)|transcription factor binding (GO:0008134)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)	22				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		CCCGTCCAAAAAGAAGAAGAAGT	0.626																																					Esophageal Squamous(71;505 1201 20414 34538 37449)	Esophageal Squamous(71;505 1201 20414 34538 37449)	uc003gfr.2		NA																	0				ovary(1)	1						c.(2152-2154)AAGdel		adducin 1 (alpha) isoform a			,,,	2,4264		0,2,2131					,,,	-3.8	1.0			74	8,8246		0,8,4119	no	utr-3,utr-3,coding,coding	ADD1	NM_176801.2,NM_014190.3,NM_014189.3,NM_001119.4	,,,	0,10,6250	A1A1,A1R,RR		0.0969,0.0469,0.0799	,,,	,,,		10,12510				SO:0001651	inframe_deletion	118				actin filament bundle assembly|barbed-end actin filament capping|cellular component disassembly involved in apoptosis|positive regulation of protein binding	cytosol|F-actin capping protein complex|nucleus|plasma membrane	actin filament binding|calmodulin binding|metal ion binding|protein heterodimerization activity|protein homodimerization activity|spectrin binding|transcription factor binding	g.chr4:2930188_2930190delAAG	L07261	CCDS3363.1, CCDS3364.1, CCDS43205.1, CCDS75094.1	4p16.3	2009-04-22			ENSG00000087274	ENSG00000087274			243	protein-coding gene	gene with protein product		102680				1840603	Standard	NM_001119		Approved		uc003gfq.3	P35611	OTTHUMG00000122080	ENST00000398129.1:c.2152_2154delAAG	4.37:g.2930197_2930199delAAG	ENSP00000381197:p.Lys721del		Somatic				ADD1_uc003gfn.2_RNA|ADD1_uc003gfo.2_3'UTR|ADD1_uc003gfp.2_3'UTR|ADD1_uc003gfq.2_In_Frame_Del_p.K752del|ADD1_uc003gfs.2_3'UTR	p.K721del	NM_001119	NP_001110	WXS	Illumina HiSeq	Unspecified	P35611	ADDA_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (64;0.168)	15	2340_2342	+			721			Interaction with calmodulin (Potential).		A2A3N8|A2A3P0|B4DI79|D3DVR3|D3DVR4|D3DVR5|Q13734|Q14729|Q16156|Q86XM2|Q9UJB6	In_Frame_Del	DEL	ENST00000398129.1	37	c.2152_2154delAAG	CCDS43205.1																																																																																				0.626	ADD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000242840.1	NM_014189		20	266	NA	NA	NA	NA	NA	20	266	---	---	---	---
RNF144B	255488	broad.mit.edu	37	6	18399839	18399839	+	Frame_Shift_Del	DEL	C	C	-			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr6:18399839delC	ENST00000259939.3	+	2	391	c.74delC	c.(73-75)gccfs	p.A25fs	RNF144B_ENST00000486622.1_3'UTR|RNF144B_ENST00000429054.2_Intron|snoU13_ENST00000459328.1_RNA	NM_182757.3	NP_877434.2	Q7Z419	R144B_HUMAN	ring finger protein 144B	25					apoptotic process (GO:0006915)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|mitochondrial membrane (GO:0031966)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(1)|lung(7)	11	Ovarian(93;0.00365)|Breast(50;0.0145)	all_hematologic(90;0.0536)	OV - Ovarian serous cystadenocarcinoma(7;0.00165)|all cancers(50;0.0102)|Epithelial(50;0.0105)			CTGGCTCCGGCCCCCCTCATC	0.537																																							uc003ncs.2		NA																	0					0						c.(73-75)GCCfs		IBR domain containing 2							82.0	77.0	79.0					6																	18399839		2203	4300	6503	SO:0001589	frameshift_variant	255488				apoptosis|positive regulation of anti-apoptosis|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	integral to membrane|mitochondrial membrane	protein binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr6:18399839delC	AK096832	CCDS34345.1	6p22.3	2011-05-23	2009-01-05	2007-08-20	ENSG00000137393	ENSG00000137393		"""RING-type (C3HC4) zinc fingers"""	21578	protein-coding gene	gene with protein product			"""IBR domain containing 2"""	IBRDC2			Standard	NM_182757		Approved	bA528A10.3	uc003ncs.3	Q7Z419	OTTHUMG00000014322	ENST00000259939.3:c.74delC	6.37:g.18399839delC	ENSP00000259939:p.Ala25fs		Somatic					p.A25fs	NM_182757	NP_877434	WXS	Illumina HiSeq	Unspecified	Q7Z419	R144B_HUMAN	OV - Ovarian serous cystadenocarcinoma(7;0.00165)|all cancers(50;0.0102)|Epithelial(50;0.0105)		2	378	+	Ovarian(93;0.00365)|Breast(50;0.0145)	all_hematologic(90;0.0536)	25					B3KUA8|B4DZI2|Q5TB85|Q6P4Q0|Q8N3R7|Q9BX38	Frame_Shift_Del	DEL	ENST00000259939.3	37	c.74delC	CCDS34345.1																																																																																				0.537	RNF144B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039965.2	XM_172581		18	93	NA	NA	NA	NA	NA	18	93	---	---	---	---
FAM47A	158724	broad.mit.edu	37	X	34149308	34149309	+	Frame_Shift_Ins	INS	-	-	A			TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chrX:34149308_34149309insA	ENST00000346193.3	-	1	1138_1139	c.1087_1088insT	c.(1087-1089)cgcfs	p.R363fs		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	363										NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						AGGCGCTAGGCGGAGACGGGAC	0.639																																							uc004ddg.2		NA																	0				ovary(4)|central_nervous_system(1)	5						c.(1087-1089)CGCfs		hypothetical protein LOC158724																																				SO:0001589	frameshift_variant	158724							g.chrX:34149308_34149309insA	BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.1087_1088insT	X.37:g.34149308_34149309insA	ENSP00000345029:p.Arg363fs		Somatic					p.R363fs	NM_203408	NP_981953	WXS	Illumina HiSeq	Unspecified	Q5JRC9	FA47A_HUMAN			1	1120_1121	-			363					A8K8I9|Q8TAA0	Frame_Shift_Ins	INS	ENST00000346193.3	37	c.1087_1088insT	CCDS43926.1																																																																																				0.639	FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056205.1	NM_203408		11	84	NA	NA	NA	NA	NA	11	84	---	---	---	---
KRAS	3845	broad.mit.edu	37	12	25398285	25398285	+	Missense_Mutation	SNP	C	C	A	rs121913530		TCGA-05-4430-01A-02D-1265-08	TCGA-05-4430-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	23398531-3f4c-45e6-980b-755165c04974	00df5c73-c2a7-47b4-8007-e7042ce81305	g.chr12:25398285C>A	ENST00000256078.4	-	2	97	c.34G>T	c.(34-36)Ggt>Tgt	p.G12C	KRAS_ENST00000311936.3_Missense_Mutation_p.G12C|KRAS_ENST00000557334.1_Missense_Mutation_p.G12C|KRAS_ENST00000556131.1_Missense_Mutation_p.G12C	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CCTACGCCACCAGCTCCAACT	0.348	G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	uc001rgp.1	G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12C(CALU1_LUNG)|G12C(NCIH2030_LUNG)|G12C(LU99_LUNG)|G12C(NCIH1792_LUNG)|G12R(KP2_PANCREAS)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(NCIH2122_LUNG)|G12C(NCIH358_LUNG)|G12R(PSN1_PANCREAS)|G12C(KYSE410_OESOPHAGUS)|G12S(A549_LUNG)|G12R(HUPT3_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12C(HCC44_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(SW1463_LARGE_INTESTINE)|G12C(NCIH23_LUNG)|G12C(LU65_LUNG)|G12C(NCIH1373_LUNG)|G12C(MIAPACA2_PANCREAS)|G12R(HS274T_BREAST)|G12S(LS123_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(OV56_OVARY)|G12C(IALM_LUNG)	119		Dom	yes		12	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog			"""L, E, M, O"""			pancreatic|colorectal|lung|thyroid|AML|others		5144	Substitution - Missense(5142)|Insertion - In frame(2)	p.G12D(7175)|p.G12V(4780)|p.G12C(2482)|p.G12A(1180)|p.G12S(1119)|p.G12R(691)|p.G12?(50)|p.G12F(34)|p.G12G(6)|p.G12N(6)|p.G12L(5)|p.G12I(4)|p.G12_G13insG(4)|p.G12E(3)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12fs*3(1)	large_intestine(2360)|lung(1649)|pancreas(656)|biliary_tract(125)|ovary(56)|endometrium(54)|haematopoietic_and_lymphoid_tissue(49)|thyroid(42)|stomach(21)|cervix(19)|upper_aerodigestive_tract(17)|urinary_tract(17)|soft_tissue(15)|small_intestine(13)|prostate(11)|breast(9)|skin(8)|testis(7)|liver(6)|oesophagus(3)|peritoneum(1)|autonomic_ganglia(1)|kidney(1)|central_nervous_system(1)|NS(1)|penis(1)|adrenal_gland(1)	large_intestine(12391)|pancreas(3285)|lung(2847)|biliary_tract(521)|ovary(443)|endometrium(339)|haematopoietic_and_lymphoid_tissue(318)|stomach(203)|thyroid(149)|prostate(85)|soft_tissue(77)|small_intestine(62)|upper_aerodigestive_tract(59)|cervix(49)|urinary_tract(48)|skin(38)|liver(31)|breast(28)|testis(17)|oesophagus(15)|central_nervous_system(9)|peritoneum(6)|salivary_gland(6)|kidney(5)|gastrointestinal_tract_(site_indeterminate)(5)|thymus(5)|eye(4)|autonomic_ganglia(2)|bone(2)|genital_tract(1)|penis(1)|adrenal_gland(1)	21052	GRCh37	CM076251	KRAS	M	rs121913530	c.(34-36)GGT>TGT		c-K-ras2 protein isoform a precursor							93.0	83.0	86.0					12																	25398285		2203	4300	6503	SO:0001583	missense	3845	Cardiofaciocutaneous_syndrome|Noonan_syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	activation of MAPKK activity|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	plasma membrane	GTP binding|GTPase activity|protein binding	g.chr12:25398285C>A	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.34G>T	12.37:g.25398285C>A	ENSP00000256078:p.Gly12Cys	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)	Somatic				KRAS_uc001rgq.1_Missense_Mutation_p.G12C|KRAS_uc001rgr.2_RNA	p.G12C	NM_033360	NP_203524	WXS	Illumina HiSeq	Unspecified	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)		2	215	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		12		G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation).|G -> R (in lung cancer and bladder cancer; somatic mutation).|G -> S (in lung carcinoma and GASC; somatic mutation).|G -> A (in a colorectal cancer sample; somatic mutation).|G -> C (in lung carcinoma; somatic mutation).|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation).	GTP.		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	c.34G>T	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.676185	0.88445	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.79141	-1.24;-1.24;-1.24;-1.24	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90466	0.7014	M	0.90650	3.135	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.993	D	0.91833	0.5477	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	C	12	ENSP00000308495:G12C;ENSP00000452512:G12C;ENSP00000256078:G12C;ENSP00000451856:G12C	ENSP00000256078:G12C	G	-	1	0	KRAS	25289552	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360		6	16	1	1	0.0293803	0.001984	0.0304821	6	16	NA	NA	NA	NA
