#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
C1orf127	148345	broad.mit.edu	37	1	11008388	11008388	+	Missense_Mutation	SNP	C	C	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr1:11008388C>T	ENST00000377008.4	-	11	1749	c.1303G>A	c.(1303-1305)Gag>Aag	p.E435K	C1orf127_ENST00000377004.4_Missense_Mutation_p.E602K			Q8N9H9	CA127_HUMAN	chromosome 1 open reading frame 127	435								p.E435K(1)|p.E602K(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(9)|ovary(1)|prostate(2)|skin(5)	32	Ovarian(185;0.249)	Lung NSC(185;0.000226)|all_lung(284;0.000302)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.0139)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0731)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.71e-07)|COAD - Colon adenocarcinoma(227;7.79e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000305)|Kidney(185;0.000785)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|READ - Rectum adenocarcinoma(331;0.0509)		ACCAGCTCCTCTGCAGCCAGT	0.672																																							uc010oao.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(1357-1359)GAG>AAG		hypothetical protein LOC148345							40.0	47.0	45.0					1																	11008388		2202	4300	6502	SO:0001583	missense	148345							g.chr1:11008388C>T	AK094437	CCDS53267.1	1p36.22	2008-02-05			ENSG00000175262	ENSG00000175262			26730	protein-coding gene	gene with protein product						14702039	Standard	NM_001170754		Approved	FLJ37118	uc010oao.2	Q8N9H9	OTTHUMG00000002032	ENST00000377008.4:c.1303G>A	1.37:g.11008388C>T	ENSP00000366207:p.Glu435Lys		Somatic				C1orf127_uc001arr.1_Missense_Mutation_p.E435K|C1orf127_uc001ars.1_Missense_Mutation_p.E427K	p.E453K	NM_173507	NP_775778	WXS	Illumina HiSeq	Unspecified	B7ZLG7	B7ZLG7_HUMAN	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.71e-07)|COAD - Colon adenocarcinoma(227;7.79e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000305)|Kidney(185;0.000785)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|READ - Rectum adenocarcinoma(331;0.0509)	8	1362	-	Ovarian(185;0.249)	Lung NSC(185;0.000226)|all_lung(284;0.000302)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.0139)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0731)	453					A0AVG8|A6NKM7|Q5VXJ2	Missense_Mutation	SNP	ENST00000377008.4	37	c.1357G>A		.	.	.	.	.	.	.	.	.	.	C	12.39	1.924380	0.34002	.	.	ENSG00000175262	ENST00000377004;ENST00000377008	T;T	0.33438	1.41;1.41	4.68	2.51	0.30379	.	0.197675	0.29152	N	0.012993	T	0.16041	0.0386	N	0.19112	0.55	0.09310	N	1	B;B;B	0.22909	0.077;0.077;0.077	B;B;B	0.18263	0.021;0.021;0.021	T	0.18808	-1.0325	10	0.24483	T	0.36	-12.2252	6.5759	0.22567	0.0:0.713:0.1765:0.1105	.	453;427;435	B7ZLG7;Q8N9H9-2;Q8N9H9	.;.;CA127_HUMAN	K	602;435	ENSP00000366203:E602K;ENSP00000366207:E435K	ENSP00000366203:E602K	E	-	1	0	C1orf127	10930975	0.000000	0.05858	0.004000	0.12327	0.003000	0.03518	-0.017000	0.12590	0.514000	0.28300	0.491000	0.48974	GAG		0.672	C1orf127-202	KNOWN	basic	protein_coding	protein_coding		NM_173507		17	35	0	0	0	1	0	17	35				
HSPG2	3339	broad.mit.edu	37	1	22166366	22166366	+	Missense_Mutation	SNP	C	C	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr1:22166366C>T	ENST00000374695.3	-	72	9737	c.9658G>A	c.(9658-9660)Gag>Aag	p.E3220K		NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	3220	Ig-like C2-type 18.				angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)	p.E3220K(1)		breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	ACAGTCAGCTCAGCTTCTTCA	0.642																																							uc001bfj.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|large_intestine(2)|central_nervous_system(1)|skin(1)	9						c.(9658-9660)GAG>AAG		heparan sulfate proteoglycan 2 precursor	Becaplermin(DB00102)|Palifermin(DB00039)						86.0	83.0	84.0					1																	22166366		2203	4300	6503	SO:0001583	missense	3339				angiogenesis|cell adhesion|lipid metabolic process|lipoprotein metabolic process	basement membrane|extracellular space|plasma membrane	protein C-terminus binding	g.chr1:22166366C>T	M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.9658G>A	1.37:g.22166366C>T	ENSP00000363827:p.Glu3220Lys		Somatic				HSPG2_uc009vqd.2_Missense_Mutation_p.E3221K	p.E3220K	NM_005529	NP_005520	WXS	Illumina HiSeq	Unspecified	P98160	PGBM_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	72	9698	-		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)	3220			Ig-like C2-type 18.		Q16287|Q5SZI3|Q9H3V5	Missense_Mutation	SNP	ENST00000374695.3	37	c.9658G>A	CCDS30625.1	.	.	.	.	.	.	.	.	.	.	C	11.80	1.748059	0.30955	.	.	ENSG00000142798	ENST00000374695	T	0.28255	1.62	5.69	5.69	0.88448	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.40385	N	0.001116	T	0.29914	0.0748	N	0.02842	-0.48	0.30197	N	0.79901	P;D	0.76494	0.943;0.999	P;D	0.74348	0.81;0.983	T	0.28713	-1.0035	10	0.11182	T	0.66	.	18.3847	0.90463	0.0:1.0:0.0:0.0	.	1160;3220	Q59EG0;P98160	.;PGBM_HUMAN	K	3220	ENSP00000363827:E3220K	ENSP00000363827:E3220K	E	-	1	0	HSPG2	22038953	0.987000	0.35691	0.973000	0.42090	0.540000	0.34992	2.977000	0.49297	2.688000	0.91661	0.563000	0.77884	GAG		0.642	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007598.1	NM_005529		28	61	0	0	0	1	0	28	61				
ARID1A	8289	broad.mit.edu	37	1	27088651	27088651	+	Nonsense_Mutation	SNP	C	C	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr1:27088651C>T	ENST00000324856.7	+	7	2631	c.2260C>T	c.(2260-2262)Cag>Tag	p.Q754*	RN7SL501P_ENST00000578818.1_RNA|ARID1A_ENST00000374152.2_Nonsense_Mutation_p.Q371*|ARID1A_ENST00000457599.2_Nonsense_Mutation_p.Q754*	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	754					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)	p.Q754*(1)	ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		AGGTTATATGCAGAGGAACCC	0.498			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																		uc001bmv.1		NA		Rec	yes		1	1p35.3	8289	Mis|N|F|S|D	AT rich interactive domain 1A (SWI-like)			E			clear cell ovarian carcinoma|RCC		1	Substitution - Nonsense(1)		lung(1)	ovary(124)|pancreas(5)|central_nervous_system(3)|endometrium(3)|kidney(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	142						c.(2260-2262)CAG>TAG		AT rich interactive domain 1A isoform a							84.0	90.0	88.0					1																	27088651		2203	4300	6503	SO:0001587	stop_gained	8289				androgen receptor signaling pathway|chromatin-mediated maintenance of transcription|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|nervous system development|nucleosome mobilization|transcription, DNA-dependent	nBAF complex|npBAF complex|SWI/SNF complex	DNA binding|protein binding	g.chr1:27088651C>T	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.2260C>T	1.37:g.27088651C>T	ENSP00000320485:p.Gln754*		Somatic				ARID1A_uc001bmt.1_Nonsense_Mutation_p.Q754*|ARID1A_uc001bmu.1_Nonsense_Mutation_p.Q754*|ARID1A_uc001bmw.1_Nonsense_Mutation_p.Q371*	p.Q754*	NM_006015	NP_006006	WXS	Illumina HiSeq	Unspecified	O14497	ARI1A_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)	7	2633	+		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)	754					D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Nonsense_Mutation	SNP	ENST00000324856.7	37	c.2260C>T	CCDS285.1	.	.	.	.	.	.	.	.	.	.	C	40	7.979164	0.98594	.	.	ENSG00000117713	ENST00000324856;ENST00000457599;ENST00000374152	.	.	.	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.25751	T	0.34	-6.9786	20.3932	0.98965	0.0:1.0:0.0:0.0	.	.	.	.	X	754;754;371	.	ENSP00000320485:Q754X	Q	+	1	0	ARID1A	26961238	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.487000	0.81328	2.824000	0.97209	0.655000	0.94253	CAG		0.498	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135		5	87	0	0	0	1	0	5	87				
CDC20	991	broad.mit.edu	37	1	43826219	43826219	+	Missense_Mutation	SNP	C	C	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr1:43826219C>T	ENST00000372462.1	+	6	1006	c.803C>T	c.(802-804)tCt>tTt	p.S268F	RP1-92O14.3_ENST00000424948.1_RNA|CDC20_ENST00000310955.6_Missense_Mutation_p.S268F|CDC20_ENST00000478882.1_3'UTR			Q12834	CDC20_HUMAN	cell division cycle 20	268					activation of anaphase-promoting complex activity (GO:0051488)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell cycle (GO:0007049)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of cell proliferation (GO:0008284)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic plasticity (GO:0031915)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein ubiquitination (GO:0016567)|regulation of dendrite development (GO:0050773)|regulation of meiosis (GO:0040020)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)|spindle (GO:0005819)	enzyme binding (GO:0019899)|protein C-terminus binding (GO:0008022)	p.S268F(1)		endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)	15	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				ACCAGTCACTCTGCCCGAGTG	0.498																																					Esophageal Squamous(137;1154 1759 10362 10401 46925)	Esophageal Squamous(137;1154 1759 10362 10401 46925)	uc001cix.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(802-804)TCT>TTT		cell division cycle 20							183.0	175.0	178.0					1																	43826219		2203	4300	6503	SO:0001583	missense	991				activation of anaphase-promoting complex activity|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of synapse maturation|positive regulation of synaptic plasticity|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle	cytosol|nucleoplasm|spindle	enzyme binding|protein C-terminus binding	g.chr1:43826219C>T	U05340	CCDS484.1	1p34.1	2013-01-17	2013-01-17		ENSG00000117399	ENSG00000117399		"""WD repeat domain containing"""	1723	protein-coding gene	gene with protein product		603618	"""CDC20 (cell division cycle 20, S. cerevisiae, homolog)"", ""CDC20 cell division cycle 20 homolog (S. cerevisiae)"", ""cell division cycle 20 homolog (S. cerevisiae)"""			7513050, 9353311	Standard	NM_001255		Approved	p55CDC, CDC20A	uc001cix.3	Q12834	OTTHUMG00000007420	ENST00000372462.1:c.803C>T	1.37:g.43826219C>T	ENSP00000361540:p.Ser268Phe		Somatic				CDC20_uc001ciy.2_Missense_Mutation_p.S268F	p.S268F	NM_001255	NP_001246	WXS	Illumina HiSeq	Unspecified	Q12834	CDC20_HUMAN			7	904	+	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)	268			WD 3.		B2R6Z6|D3DPJ1|Q5JUY4|Q9BW56|Q9UQI9	Missense_Mutation	SNP	ENST00000372462.1	37	c.803C>T	CCDS484.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.132288	0.77662	.	.	ENSG00000117399	ENST00000437896;ENST00000310955;ENST00000372462	T;T	0.31769	1.48;1.48	6.07	6.07	0.98685	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.150584	0.64402	D	0.000008	T	0.50120	0.1597	M	0.83223	2.63	0.80722	D	1	B	0.32543	0.375	B	0.42738	0.396	T	0.51647	-0.8679	10	0.87932	D	0	-17.0361	17.5216	0.87789	0.0:0.8766:0.1234:0.0	.	268	Q12834	CDC20_HUMAN	F	244;268;268	ENSP00000308450:S268F;ENSP00000361540:S268F	ENSP00000308450:S268F	S	+	2	0	CDC20	43598806	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.923000	0.63412	2.884000	0.98904	0.655000	0.94253	TCT		0.498	CDC20-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019488.1	NM_001255		43	70	0	0	0	1	0	43	70				
AKNAD1	254268	broad.mit.edu	37	1	109358811	109358811	+	Missense_Mutation	SNP	C	C	G			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr1:109358811C>G	ENST00000370001.3	-	16	2761	c.2493G>C	c.(2491-2493)agG>agC	p.R831S	AKNAD1_ENST00000477908.1_5'UTR	NM_152763.4	NP_689976.2	Q5T1N1	AKND1_HUMAN	AKNA domain containing 1	831						cytoplasm (GO:0005737)		p.R831S(1)		breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|ovary(3)|prostate(6)|skin(3)|stomach(2)	32						TCAGTCGATTCCTCCACCTCT	0.373																																							uc001dwa.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(2491-2493)AGG>AGC		hypothetical protein LOC254268							222.0	212.0	215.0					1																	109358811		2203	4300	6503	SO:0001583	missense	254268							g.chr1:109358811C>G	AK095517	CCDS791.2	1p13.3	2009-10-29	2009-10-29	2009-10-29	ENSG00000162641	ENSG00000162641			28398	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 62"""	C1orf62			Standard	NM_152763		Approved	MGC26989	uc001dwa.4	Q5T1N1	OTTHUMG00000011231	ENST00000370001.3:c.2493G>C	1.37:g.109358811C>G	ENSP00000359018:p.Arg831Ser		Somatic				AKNAD1_uc001dwb.2_RNA	p.R831S	NM_152763	NP_689976	WXS	Illumina HiSeq	Unspecified	Q5T1N1	AKND1_HUMAN			16	2762	-			831					B9EK62|Q5T1N0|Q8N990|Q8NCN9	Missense_Mutation	SNP	ENST00000370001.3	37	c.2493G>C	CCDS791.2	.	.	.	.	.	.	.	.	.	.	C	12.87	2.068634	0.36470	.	.	ENSG00000162641	ENST00000370001	T	0.25085	1.82	5.72	-0.342	0.12635	.	0.139201	0.33438	N	0.004910	T	0.16257	0.0391	L	0.27053	0.805	0.29603	N	0.84756	D	0.69078	0.997	D	0.66716	0.946	T	0.07888	-1.0749	10	0.72032	D	0.01	-14.5494	7.7917	0.29125	0.0:0.4075:0.0:0.5925	.	831	Q5T1N1	AKND1_HUMAN	S	831	ENSP00000359018:R831S	ENSP00000359018:R831S	R	-	3	2	AKNAD1	109160334	0.054000	0.20591	0.213000	0.23690	0.071000	0.16799	-0.268000	0.08607	0.085000	0.17107	-0.355000	0.07637	AGG		0.373	AKNAD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030923.2	NM_152763		30	45	0	0	0	1	0	30	45				
PDE4DIP	9659	broad.mit.edu	37	1	144994592	144994592	+	Splice_Site	SNP	C	C	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr1:144994592C>T	ENST00000369354.3	-	1	329	c.140G>A	c.(139-141)cGg>cAg	p.R47Q	PDE4DIP_ENST00000369359.4_Splice_Site_p.R184Q|PDE4DIP_ENST00000369348.3_Splice_Site_p.R184Q|PDE4DIP_ENST00000369347.4_Splice_Site_p.R47Q|PDE4DIP_ENST00000369349.3_Splice_Site_p.R47Q|PDE4DIP_ENST00000530740.1_Splice_Site_p.R184Q|PDE4DIP_ENST00000369356.4_Splice_Site_p.R47Q|PDE4DIP_ENST00000369351.3_Splice_Site_p.R47Q|PDE4DIP_ENST00000313382.9_Splice_Site_p.R113Q			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein	47					cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)	p.R47Q(2)|p.R184Q(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		TGCACTCACCCGCTTGTAGAT	0.612			T	PDGFRB	MPD																																		uc001elw.3		NA		Dom	yes		1	1q12	9659	T	phosphodiesterase 4D interacting protein (myomegalin)			L	PDGFRB		MPD		3	Substitution - Missense(3)		lung(3)	ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5						c.(139-141)CGG>CAG		phosphodiesterase 4D interacting protein isoform							111.0	109.0	109.0					1																	144994592		2203	4300	6503	SO:0001630	splice_region_variant	9659				cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding	g.chr1:144994592C>T	AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.141+1G>A	1.37:g.144994592C>T			Somatic				NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Missense_Mutation_p.R47Q|PDE4DIP_uc001ell.1_Missense_Mutation_p.R50Q|PDE4DIP_uc001elm.3_Missense_Mutation_p.R15Q|PDE4DIP_uc001eln.3_Missense_Mutation_p.R113Q|PDE4DIP_uc001elo.2_Missense_Mutation_p.R184Q|PDE4DIP_uc001elx.3_Missense_Mutation_p.R113Q|PDE4DIP_uc001emc.1_Missense_Mutation_p.R47Q|PDE4DIP_uc001emd.1_Missense_Mutation_p.R47Q|PDE4DIP_uc001emg.1_Missense_Mutation_p.R47Q|PDE4DIP_uc001emh.2_Missense_Mutation_p.R184Q	p.R47Q	NM_014644	NP_055459	WXS	Illumina HiSeq	Unspecified	Q5VU43	MYOME_HUMAN		Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)	1	431	-			47			Potential.		A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Missense_Mutation	SNP	ENST00000369354.3	37	c.140G>A	CCDS30824.1	.	.	.	.	.	.	.	.	.	.	C	17.56	3.418988	0.62622	.	.	ENSG00000178104	ENST00000313382;ENST00000369354;ENST00000369356;ENST00000530740;ENST00000369359;ENST00000369351;ENST00000369349;ENST00000530078;ENST00000534536;ENST00000369347;ENST00000369348;ENST00000531369	T;T;T;T;T;T;T;T;T;T;D	0.81659	2.12;2.12;2.12;2.12;2.12;2.12;2.12;2.12;2.12;2.12;-1.52	5.78	4.85	0.62838	Spindle associated (1);	.	.	.	.	T	0.72220	0.3433	N	0.17248	0.465	0.80722	D	1	D;P;P;B;D;P;P;P	0.71674	0.998;0.716;0.837;0.382;0.98;0.944;0.53;0.591	P;B;B;B;P;B;B;B	0.59643	0.797;0.233;0.218;0.168;0.861;0.346;0.148;0.168	T	0.76942	-0.2772	9	0.44086	T	0.13	.	14.485	0.67611	0.0:0.852:0.148:0.0	.	47;113;47;184;113;184;50;47	Q5VU43-7;Q5VU43-3;Q5VU43;E9PJ64;E9PQH9;F8WAP3;E9PS60;Q5VU43-10	.;.;MYOME_HUMAN;.;.;.;.;.	Q	113;47;47;184;184;47;47;113;50;47;184;114	ENSP00000327209:R113Q;ENSP00000358360:R47Q;ENSP00000358363:R47Q;ENSP00000435654:R184Q;ENSP00000358366:R184Q;ENSP00000358357:R47Q;ENSP00000358355:R47Q;ENSP00000435920:R50Q;ENSP00000358353:R47Q;ENSP00000358354:R184Q;ENSP00000435616:R114Q	ENSP00000327209:R113Q	R	-	2	0	PDE4DIP	143705949	1.000000	0.71417	1.000000	0.80357	0.708000	0.40852	1.983000	0.40648	1.407000	0.46875	0.650000	0.86243	CGG		0.612	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000038858.2	NM_022359	Missense_Mutation	6	164	0	0	0	1	0	6	164				
FLG	2312	broad.mit.edu	37	1	152285020	152285020	+	Missense_Mutation	SNP	T	T	C	rs138055273	byFrequency	TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr1:152285020T>C	ENST00000368799.1	-	3	2377	c.2342A>G	c.(2341-2343)gAc>gGc	p.D781G	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	781	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.D781G(1)		autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCCTGACCGGTCACGTGCGGA	0.562									Ichthyosis																														uc001ezu.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16						c.(2341-2343)GAC>GGC		filaggrin		C	GLY/ASP	6,4400		0,6,2197	332.0	317.0	323.0		2342	0.7	0.0	1	dbSNP_134	323	0,8600		0,0,4300	no	missense	FLG	NM_002016.1	94	0,6,6497	CC,CT,TT		0.0,0.1362,0.0461	benign	781/4062	152285020	6,13000	2203	4300	6503	SO:0001583	missense	2312	Ichthyosis	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity	g.chr1:152285020T>C	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.2342A>G	1.37:g.152285020T>C	ENSP00000357789:p.Asp781Gly		Somatic				uc001ezv.2_5'Flank	p.D781G	NM_002016	NP_002007	WXS	Illumina HiSeq	Unspecified	P20930	FILA_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	2378	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		781			Ser-rich.		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	c.2342A>G	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	-	5.947	0.358782	0.11239	0.001362	0.0	ENSG00000143631	ENST00000368799	T	0.02216	4.39	3.04	0.741	0.18336	.	.	.	.	.	T	0.00144	0.0004	N	0.00210	-1.845	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.36504	-0.9745	9	0.02654	T	1	.	2.8153	0.05454	0.0:0.4269:0.2478:0.3253	.	781	P20930	FILA_HUMAN	G	781	ENSP00000357789:D781G	ENSP00000357789:D781G	D	-	2	0	FLG	150551644	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	0.042000	0.13949	0.042000	0.15717	-0.348000	0.07805	GAC		0.562	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016		101	364	0	0	0	1	0	101	364				
CHRNB2	1141	broad.mit.edu	37	1	154543728	154543728	+	Silent	SNP	C	C	T	rs369264665		TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr1:154543728C>T	ENST00000368476.3	+	5	693	c.429C>T	c.(427-429)atC>atT	p.I143I		NM_000748.2	NP_000739.1	P17787	ACHB2_HUMAN	cholinergic receptor, nicotinic, beta 2 (neuronal)	143					action potential (GO:0001508)|associative learning (GO:0008306)|B cell activation (GO:0042113)|behavioral response to nicotine (GO:0035095)|calcium ion transport (GO:0006816)|cation transmembrane transport (GO:0098655)|central nervous system projection neuron axonogenesis (GO:0021952)|cognition (GO:0050890)|conditioned taste aversion (GO:0001661)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|lateral geniculate nucleus development (GO:0021771)|learning (GO:0007612)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|memory (GO:0007613)|negative regulation of action potential (GO:0045759)|neurological system process (GO:0050877)|optic nerve morphogenesis (GO:0021631)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of synaptic transmission, dopaminergic (GO:0032226)|protein heterooligomerization (GO:0051291)|regulation of circadian sleep/wake cycle, non-REM sleep (GO:0045188)|regulation of circadian sleep/wake cycle, REM sleep (GO:0042320)|regulation of dendrite morphogenesis (GO:0048814)|regulation of dopamine metabolic process (GO:0042053)|regulation of dopamine secretion (GO:0014059)|regulation of synapse assembly (GO:0051963)|regulation of synaptic transmission, dopaminergic (GO:0032225)|response to cocaine (GO:0042220)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to nicotine (GO:0035094)|sensory perception of pain (GO:0019233)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|smooth muscle contraction (GO:0006939)|social behavior (GO:0035176)|synaptic transmission (GO:0007268)|synaptic transmission involved in micturition (GO:0060084)|synaptic transmission, cholinergic (GO:0007271)|vestibulocochlear nerve development (GO:0021562)|visual learning (GO:0008542)|visual perception (GO:0007601)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|drug binding (GO:0008144)|ligand-gated ion channel activity (GO:0015276)	p.I143I(1)		cervix(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(12)|skin(1)|urinary_tract(3)	28	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)		Dextromethorphan(DB00514)|Galantamine(DB00674)|Nicotine(DB00184)	ATGGCAGCATCTTCTGGCTGC	0.537																																							uc001ffg.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(427-429)ATC>ATT		neuronal nicotinic acetylcholine receptor beta 2	Nicotine(DB00184)	C		0,4406		0,0,2203	118.0	108.0	112.0		429	4.4	1.0	1		112	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	CHRNB2	NM_000748.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		143/503	154543728	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	1141				B cell activation|behavioral response to nicotine|calcium ion transport|central nervous system projection neuron axonogenesis|lateral geniculate nucleus development|locomotory behavior|membrane depolarization|memory|negative regulation of action potential|optic nerve morphogenesis|positive regulation of B cell proliferation|positive regulation of dopamine secretion|regulation of circadian sleep/wake cycle, REM sleep|regulation of dendrite morphogenesis|regulation of dopamine metabolic process|regulation of synaptogenesis|response to cocaine|response to ethanol|response to hypoxia|sensory perception of pain|sensory perception of sound|smooth muscle contraction|social behavior|synaptic transmission involved in micturition|synaptic transmission, cholinergic|vestibulocochlear nerve development|visual learning|visual perception	cell junction|external side of plasma membrane|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity	g.chr1:154543728C>T	U62437	CCDS1070.1	1q21.3	2012-02-11	2006-02-01		ENSG00000160716	ENSG00000160716		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1962	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, beta 2 (neuronal)"""	118507	"""cholinergic receptor, nicotinic, beta polypeptide 2 (neuronal)"""			1505988	Standard	NM_000748		Approved		uc001ffg.3	P17787	OTTHUMG00000037262	ENST00000368476.3:c.429C>T	1.37:g.154543728C>T			Somatic					p.I143I	NM_000748	NP_000739	WXS	Illumina HiSeq	Unspecified	P17787	ACHB2_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.185)		5	693	+	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		143			Extracellular (Potential).		Q9UEH9	Silent	SNP	ENST00000368476.3	37	c.429C>T	CCDS1070.1																																																																																				0.537	CHRNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090697.1	NM_000748		31	119	0	0	0	1	0	31	119				
KIFAP3	22920	broad.mit.edu	37	1	170003513	170003513	+	Splice_Site	SNP	C	C	G			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr1:170003513C>G	ENST00000361580.2	-	7	969	c.742G>C	c.(742-744)Gtt>Ctt	p.V248L	KIFAP3_ENST00000538366.1_Splice_Site_p.V170L|KIFAP3_ENST00000490550.1_5'Flank|KIFAP3_ENST00000367767.1_Splice_Site_p.V204L|KIFAP3_ENST00000367765.1_Splice_Site_p.V208L	NM_014970.3	NP_055785.2	Q92845	KIFA3_HUMAN	kinesin-associated protein 3	248					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|blood coagulation (GO:0007596)|membrane organization (GO:0061024)|microtubule-based movement (GO:0007018)|microtubule-based process (GO:0007017)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|plus-end-directed vesicle transport along microtubule (GO:0072383)|positive regulation of calcium-dependent cell-cell adhesion (GO:0046587)|protein complex assembly (GO:0006461)|protein localization (GO:0008104)|signal transduction (GO:0007165)	centrosome (GO:0005813)|condensed nuclear chromosome (GO:0000794)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|intraciliary transport particle (GO:0030990)|kinesin II complex (GO:0016939)|microtubule cytoskeleton (GO:0015630)	kinesin binding (GO:0019894)	p.V248L(1)		endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(18)|prostate(2)|skin(3)|urinary_tract(2)	35	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					AAAAGGATATCAGCTTTCTTC	0.328																																							uc001ggv.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(742-744)GTT>CTT		kinesin-associated protein 3							113.0	109.0	111.0					1																	170003513		2203	4300	6503	SO:0001630	splice_region_variant	22920				blood coagulation|plus-end-directed vesicle transport along microtubule|protein complex assembly|signal transduction	centrosome|condensed nuclear chromosome|cytosol|endoplasmic reticulum|kinesin II complex|spindle microtubule	kinesin binding	g.chr1:170003513C>G	U59919	CCDS1288.1, CCDS55659.1, CCDS55660.1, CCDS55661.1	1q24.2	2012-09-20			ENSG00000075945	ENSG00000075945			17060	protein-coding gene	gene with protein product	"""Smg GDS"""	601836				8900189	Standard	NM_014970		Approved	SMAP, KAP3, FLA3, KAP-1	uc001ggv.3	Q92845	OTTHUMG00000035947	ENST00000361580.2:c.742+1G>C	1.37:g.170003513C>G			Somatic				KIFAP3_uc010ply.1_3'UTR|KIFAP3_uc001ggw.1_3'UTR	p.V248L	NM_014970	NP_055785	WXS	Illumina HiSeq	Unspecified	Q92845	KIFA3_HUMAN			7	1013	-	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)		248					B1AKU4|B1AKU5|B2RDL1|B7Z8A3|F5H591|Q8NHU7|Q9H416	Missense_Mutation	SNP	ENST00000361580.2	37	c.742G>C	CCDS1288.1	.	.	.	.	.	.	.	.	.	.	C	10.61	1.399307	0.25291	.	.	ENSG00000075945	ENST00000361580;ENST00000367765;ENST00000367767;ENST00000538366	T;T;T;T	0.44482	0.92;0.92;0.92;0.92	5.43	5.43	0.79202	.	0.460289	0.21894	N	0.067549	T	0.16471	0.0396	N	0.16656	0.425	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.06215	-1.0839	9	.	.	.	-0.5003	19.2008	0.93711	0.0:1.0:0.0:0.0	.	248	Q92845	KIFA3_HUMAN	L	248;208;204;170	ENSP00000354560:V248L;ENSP00000356739:V208L;ENSP00000356741:V204L;ENSP00000444622:V170L	.	V	-	1	0	KIFAP3	168270137	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	4.534000	0.60622	2.722000	0.93159	0.655000	0.94253	GTT		0.328	KIFAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087568.1	NM_014970	Missense_Mutation	10	38	0	0	0	1	0	10	38				
ASTN1	460	broad.mit.edu	37	1	177133601	177133601	+	Missense_Mutation	SNP	C	C	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr1:177133601C>A	ENST00000367654.3	-	1	423	c.212G>T	c.(211-213)cGc>cTc	p.R71L	ASTN1_ENST00000424564.2_Missense_Mutation_p.R71L|ASTN1_ENST00000361833.2_Missense_Mutation_p.R71L|ASTN1_ENST00000281881.3_5'UTR|ASTN1_ENST00000367657.3_Missense_Mutation_p.R71L	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	71					locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)		p.R71L(1)		NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						GAAGTCGTTGCGCACCGAGAA	0.647																																							uc001glc.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|skin(5)|central_nervous_system(2)|large_intestine(1)|lung(1)	15						c.(211-213)CGC>CTC		astrotactin isoform 1							64.0	52.0	56.0					1																	177133601		2203	4300	6503	SO:0001583	missense	460				cell migration|neuron cell-cell adhesion	integral to membrane		g.chr1:177133601C>A	AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.212G>T	1.37:g.177133601C>A	ENSP00000356626:p.Arg71Leu		Somatic				ASTN1_uc001glb.1_Missense_Mutation_p.R71L|ASTN1_uc001gld.1_Missense_Mutation_p.R71L|ASTN1_uc009wwx.1_Missense_Mutation_p.R71L	p.R71L	NM_004319	NP_004310	WXS	Illumina HiSeq	Unspecified	O14525	ASTN1_HUMAN			1	424	-			71					A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Missense_Mutation	SNP	ENST00000367654.3	37	c.212G>T		.	.	.	.	.	.	.	.	.	.	C	26.5	4.739222	0.89573	.	.	ENSG00000152092	ENST00000367657;ENST00000361833;ENST00000367654;ENST00000424564;ENST00000541808	T;T;T;T	0.16073	2.37;2.79;2.79;2.38	2.94	2.94	0.34122	.	0.088193	0.42420	N	0.000705	T	0.35189	0.0923	L	0.53249	1.67	0.80722	D	1	D;D;D	0.67145	0.996;0.987;0.992	D;D;D	0.76575	0.988;0.988;0.969	T	0.26189	-1.0110	10	0.87932	D	0	-20.079	13.9229	0.63942	0.0:1.0:0.0:0.0	.	71;71;71	O14525;O14525-2;B1AJS1	ASTN1_HUMAN;.;.	L	71	ENSP00000356629:R71L;ENSP00000354536:R71L;ENSP00000356626:R71L;ENSP00000395041:R71L	ENSP00000354536:R71L	R	-	2	0	ASTN1	175400224	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.204000	0.77872	1.659000	0.50751	0.385000	0.25706	CGC		0.647	ASTN1-201	KNOWN	basic	protein_coding	protein_coding		NM_004319		13	18	1	0	0.00136819	1	0.00139292	13	18				
ZNF648	127665	broad.mit.edu	37	1	182026921	182026921	+	Silent	SNP	G	G	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr1:182026921G>T	ENST00000339948.3	-	2	432	c.225C>A	c.(223-225)ggC>ggA	p.G75G		NM_001009992.1	NP_001009992.1	Q5T619	ZN648_HUMAN	zinc finger protein 648	75					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G75G(1)		breast(1)|endometrium(7)|large_intestine(10)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	40						CTTCCTCTTTGCCCAGTGGAT	0.567																																					NSCLC(71;908 1374 5429 20458 35642)	NSCLC(71;908 1374 5429 20458 35642)	uc001goz.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(223-225)GGC>GGA		zinc finger protein 648							74.0	77.0	76.0					1																	182026921		2203	4300	6503	SO:0001819	synonymous_variant	127665				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr1:182026921G>T	AK128654	CCDS30952.1	1q25.3	2013-01-08			ENSG00000179930	ENSG00000179930		"""Zinc fingers, C2H2-type"""	18190	protein-coding gene	gene with protein product							Standard	NM_001009992		Approved	FLJ46813	uc001goz.3	Q5T619	OTTHUMG00000037302	ENST00000339948.3:c.225C>A	1.37:g.182026921G>T			Somatic					p.G75G	NM_001009992	NP_001009992	WXS	Illumina HiSeq	Unspecified	Q5T619	ZN648_HUMAN			2	433	-			75					B2RP16	Silent	SNP	ENST00000339948.3	37	c.225C>A	CCDS30952.1																																																																																				0.567	ZNF648-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090794.1	XM_060597		19	44	1	0	6.49762e-13	1	7.1305e-13	19	44				
RNASEL	6041	broad.mit.edu	37	1	182555637	182555637	+	Missense_Mutation	SNP	G	G	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr1:182555637G>A	ENST00000367559.3	-	2	558	c.305C>T	c.(304-306)gCg>gTg	p.A102V	RNASEL_ENST00000444138.1_Missense_Mutation_p.A102V|RNASEL_ENST00000539397.1_Missense_Mutation_p.A102V	NM_021133.3	NP_066956.1	Q05823	RN5A_HUMAN	ribonuclease L (2',5'-oligoisoadenylate synthetase-dependent)	102					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|mRNA processing (GO:0006397)|negative regulation of viral genome replication (GO:0045071)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|rRNA processing (GO:0006364)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nuclear matrix (GO:0016363)	ATP binding (GO:0005524)|endoribonuclease activity (GO:0004521)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|RNA binding (GO:0003723)|rRNA binding (GO:0019843)	p.A102V(2)		NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(9)|ovary(4)|prostate(1)|stomach(1)|urinary_tract(1)	27						CACGCTCCCCGCAATCGCTGC	0.498																																							uc001gpj.1		NA																	2	Substitution - Missense(2)		large_intestine(1)|lung(1)	ovary(4)|stomach(1)	5						c.(304-306)GCG>GTG		ribonuclease L							60.0	58.0	58.0					1																	182555637		2203	4300	6503	SO:0001583	missense	6041	Hereditary_Prostate_Cancer			mRNA processing|response to virus|type I interferon-mediated signaling pathway	mitochondrion	ATP binding|endoribonuclease activity, producing 5'-phosphomonoesters|metal ion binding|protein kinase activity|RNA binding	g.chr1:182555637G>A	L10381	CCDS1347.1	1q25	2013-01-10			ENSG00000135828	ENSG00000135828	3.1.26.-	"""Ankyrin repeat domain containing"""	10050	protein-coding gene	gene with protein product		180435	"""prostate cancer 1"""	RNS4, PRCA1		7514564	Standard	NM_021133		Approved		uc009wxz.2	Q05823	OTTHUMG00000035213	ENST00000367559.3:c.305C>T	1.37:g.182555637G>A	ENSP00000356530:p.Ala102Val		Somatic				RNASEL_uc009wxz.1_Missense_Mutation_p.A102V|RNASEL_uc001gpk.2_Missense_Mutation_p.A102V|RNASEL_uc009wya.1_Missense_Mutation_p.A102V	p.A102V	NM_021133	NP_066956	WXS	Illumina HiSeq	Unspecified	Q05823	RN5A_HUMAN			1	472	-			102			ANK 3.		Q5W0L2|Q6AI46	Missense_Mutation	SNP	ENST00000367559.3	37	c.305C>T	CCDS1347.1	.	.	.	.	.	.	.	.	.	.	G	6.676	0.493248	0.12702	.	.	ENSG00000135828	ENST00000367559;ENST00000444138;ENST00000539397	T;T;T	0.65549	-0.16;-0.16;-0.16	4.71	-9.43	0.00607	Ankyrin repeat-containing domain (3);	2.736470	0.01078	N	0.004928	T	0.36608	0.0973	N	0.20685	0.6	0.09310	N	1	B;B;B	0.10296	0.003;0.001;0.003	B;B;B	0.06405	0.002;0.0;0.002	T	0.21724	-1.0237	10	0.26408	T	0.33	6.0179	1.1105	0.01703	0.1557:0.2965:0.1875:0.3604	.	102;102;102	Q5W0L2;Q6AI46;Q05823	.;.;RN5A_HUMAN	V	102	ENSP00000356530:A102V;ENSP00000411147:A102V;ENSP00000440844:A102V	ENSP00000356530:A102V	A	-	2	0	RNASEL	180822260	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.663000	0.01968	-2.466000	0.00533	-0.706000	0.03657	GCG		0.498	RNASEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085189.1	NM_021133		9	36	0	0	0	1	0	9	36				
RGS16	6004	broad.mit.edu	37	1	182571203	182571203	+	Nonsense_Mutation	SNP	C	C	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr1:182571203C>T	ENST00000367558.5	-	4	433	c.285G>A	c.(283-285)tgG>tgA	p.W95*		NM_002928.3	NP_002919.3	O15492	RGS16_HUMAN	regulator of G-protein signaling 16	95	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				positive regulation of GTPase activity (GO:0043547)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)	p.W95*(1)		NS(1)|endometrium(3)|large_intestine(2)|lung(4)|ovary(1)	11						CACAGGCCAGCCAGAACTCCA	0.537											OREG0014036	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001gpl.3		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)	1						c.(283-285)TGG>TGA		regulator of G-protein signalling 16							99.0	105.0	103.0					1																	182571203		2203	4300	6503	SO:0001587	stop_gained	6004				negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway|visual perception	cytoplasm|plasma membrane	calmodulin binding|GTPase activator activity|signal transducer activity	g.chr1:182571203C>T	U70426	CCDS1348.1	1q25-q31	2008-02-05	2007-08-14		ENSG00000143333	ENSG00000143333		"""Regulators of G-protein signaling"""	9997	protein-coding gene	gene with protein product		602514	"""regulator of G-protein signalling 16"""			9469939	Standard	NM_002928		Approved	A28-RGS14, RGS-r	uc001gpl.4	O15492	OTTHUMG00000035212	ENST00000367558.5:c.285G>A	1.37:g.182571203C>T	ENSP00000356529:p.Trp95*		Somatic	OREG0014036	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1977	RGS16_uc010pnv.1_Nonsense_Mutation_p.W95*	p.W95*	NM_002928	NP_002919	WXS	Illumina HiSeq	Unspecified	O15492	RGS16_HUMAN			4	439	-			95			RGS.		B2R4M4|Q5VYN9|Q99701	Nonsense_Mutation	SNP	ENST00000367558.5	37	c.285G>A	CCDS1348.1	.	.	.	.	.	.	.	.	.	.	C	37	6.333297	0.97480	.	.	ENSG00000143333	ENST00000367558	.	.	.	5.4	5.4	0.78164	.	0.112251	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.7685	0.91882	0.0:1.0:0.0:0.0	.	.	.	.	X	95	.	ENSP00000356529:W95X	W	-	3	0	RGS16	180837826	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	3.061000	0.49963	2.525000	0.85131	0.563000	0.77884	TGG		0.537	RGS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085188.1	NM_002928		29	75	0	0	0	1	0	29	75				
HMCN1	83872	broad.mit.edu	37	1	186023068	186023068	+	Missense_Mutation	SNP	C	C	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr1:186023068C>T	ENST00000271588.4	+	44	7041	c.6812C>T	c.(6811-6813)gCg>gTg	p.A2271V	HMCN1_ENST00000367492.2_Missense_Mutation_p.A2271V	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	2271	Ig-like C2-type 20.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.A2271V(1)		NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						TCATGTGTGGCGTCGAATGTT	0.403																																							uc001grq.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(22)|skin(1)	23						c.(6811-6813)GCG>GTG		hemicentin 1 precursor							110.0	108.0	109.0					1																	186023068		2203	4300	6503	SO:0001583	missense	83872				response to stimulus|visual perception	basement membrane	calcium ion binding	g.chr1:186023068C>T	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.6812C>T	1.37:g.186023068C>T	ENSP00000271588:p.Ala2271Val		Somatic					p.A2271V	NM_031935	NP_114141	WXS	Illumina HiSeq	Unspecified	Q96RW7	HMCN1_HUMAN			44	7041	+			2271			Ig-like C2-type 20.		A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	37	c.6812C>T	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	C	14.16	2.452190	0.43531	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.72505	-0.66;-0.66	4.78	4.78	0.61160	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.78194	0.4245	M	0.66439	2.03	0.80722	D	1	D	0.60575	0.988	P	0.53035	0.716	T	0.79227	-0.1890	10	0.42905	T	0.14	.	18.1723	0.89749	0.0:1.0:0.0:0.0	.	2271	Q96RW7	HMCN1_HUMAN	V	2271	ENSP00000271588:A2271V;ENSP00000356462:A2271V	ENSP00000271588:A2271V	A	+	2	0	HMCN1	184289691	1.000000	0.71417	0.993000	0.49108	0.387000	0.30353	6.360000	0.73064	2.353000	0.79882	0.411000	0.27672	GCG		0.403	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935		14	67	0	0	0	1	0	14	67				
F13B	2165	broad.mit.edu	37	1	197036345	197036345	+	Silent	SNP	C	C	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr1:197036345C>T	ENST00000367412.1	-	1	52	c.9G>A	c.(7-9)ttG>ttA	p.L3L		NM_001994.2	NP_001985.2	P05160	F13B_HUMAN	coagulation factor XIII, B polypeptide	3					blood coagulation (GO:0007596)	extracellular region (GO:0005576)		p.L3L(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(5)|liver(1)|lung(40)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	66						TCAGGTTTTTCAACCTCATCT	0.299																																							uc001gtt.1		NA																	1	Substitution - coding silent(1)		lung(1)	upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3						c.(7-9)TTG>TTA		coagulation factor XIII B subunit precursor							41.0	43.0	42.0					1																	197036345		2201	4282	6483	SO:0001819	synonymous_variant	2165				blood coagulation	extracellular region		g.chr1:197036345C>T	M14057	CCDS1388.1	1q31-q32.1	2012-10-02			ENSG00000143278	ENSG00000143278			3534	protein-coding gene	gene with protein product		134580				2339067, 2271707	Standard	NM_001994		Approved	FXIIIB	uc001gtt.1	P05160	OTTHUMG00000036519	ENST00000367412.1:c.9G>A	1.37:g.197036345C>T			Somatic					p.L3L	NM_001994	NP_001985	WXS	Illumina HiSeq	Unspecified	P05160	F13B_HUMAN			1	53	-			3					A8K3E5|Q5VYL5	Silent	SNP	ENST00000367412.1	37	c.9G>A	CCDS1388.1																																																																																				0.299	F13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088821.2	NM_001994		9	49	0	0	0	1	0	9	49				
CRB1	23418	broad.mit.edu	37	1	197411420	197411420	+	Missense_Mutation	SNP	G	G	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr1:197411420G>A	ENST00000367400.3	+	11	4138	c.4003G>A	c.(4003-4005)Gac>Aac	p.D1335N	CRB1_ENST00000535699.1_Missense_Mutation_p.D1311N|RP11-75C23.1_ENST00000422250.1_RNA|CRB1_ENST00000367397.1_3'UTR|CRB1_ENST00000367399.2_Missense_Mutation_p.D1223N|CRB1_ENST00000544212.1_Missense_Mutation_p.D816N|CRB1_ENST00000538660.1_Missense_Mutation_p.D799N	NM_201253.2	NP_957705.1	P82279	CRUM1_HUMAN	crumbs family member 1, photoreceptor morphogenesis associated	1335					cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|plasma membrane organization (GO:0007009)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D1335N(1)		NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(13)|kidney(4)|large_intestine(21)|lung(58)|ovary(7)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	132						CTGCGAGGTGGACGTAAGCAG	0.483																																							uc001gtz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|skin(3)|large_intestine(1)	9						c.(4003-4005)GAC>AAC		crumbs homolog 1 precursor							211.0	193.0	199.0					1																	197411420		2203	4300	6503	SO:0001583	missense	23418				cell-cell signaling|establishment or maintenance of cell polarity	apical plasma membrane|extracellular region|integral to membrane	calcium ion binding|protein binding	g.chr1:197411420G>A		CCDS1390.1, CCDS53454.1, CCDS58052.1, CCDS58053.1	1q31-q32.1	2014-02-06	2014-02-06		ENSG00000134376	ENSG00000134376			2343	protein-coding gene	gene with protein product		604210	"""crumbs (Drosophila) homolog 1"", ""crumbs homolog 1 (Drosophila)"""	RP12		10373321, 10508521	Standard	NM_201253		Approved	LCA8	uc001gtz.3	P82279	OTTHUMG00000035663	ENST00000367400.3:c.4003G>A	1.37:g.197411420G>A	ENSP00000356370:p.Asp1335Asn		Somatic				CRB1_uc010poz.1_Missense_Mutation_p.D1311N|CRB1_uc010ppa.1_RNA|CRB1_uc009wza.2_Missense_Mutation_p.D1223N|CRB1_uc010ppb.1_Missense_Mutation_p.D799N|CRB1_uc010ppd.1_Missense_Mutation_p.D816N|CRB1_uc001gub.1_3'UTR	p.D1335N	NM_201253	NP_957705	WXS	Illumina HiSeq	Unspecified	P82279	CRUM1_HUMAN			11	4138	+			1335			Extracellular (Potential).		A2A308|B7Z5T2|B9EG71|Q5K3A6|Q5TC28|Q5VUT1|Q6N027|Q8WWY0|Q8WWY1	Missense_Mutation	SNP	ENST00000367400.3	37	c.4003G>A	CCDS1390.1	.	.	.	.	.	.	.	.	.	.	G	24.5	4.536374	0.85812	.	.	ENSG00000134376	ENST00000535699;ENST00000538660;ENST00000367400;ENST00000367399;ENST00000544212;ENST00000448952	D;D;D;D;D;D	0.91577	-2.87;-2.87;-2.87;-2.87;-2.87;-2.09	5.6	3.73	0.42828	.	.	.	.	.	D	0.85915	0.5808	L	0.31476	0.935	0.80722	D	1	B;D;P;P	0.55385	0.149;0.971;0.925;0.914	B;P;P;B	0.47827	0.061;0.558;0.453;0.355	T	0.81008	-0.1127	9	0.20046	T	0.44	.	11.3811	0.49757	0.0682:0.1268:0.8049:0.0	.	799;1311;1223;1335	B7Z5T2;F5H0L2;P82279-3;P82279	.;.;.;CRUM1_HUMAN	N	1311;799;1335;1223;816;41	ENSP00000438786:D1311N;ENSP00000438091:D799N;ENSP00000356370:D1335N;ENSP00000356369:D1223N;ENSP00000444556:D816N;ENSP00000395407:D41N	ENSP00000356369:D1223N	D	+	1	0	CRB1	195678043	1.000000	0.71417	0.393000	0.26258	0.963000	0.63663	5.682000	0.68182	0.716000	0.32124	0.591000	0.81541	GAC		0.483	CRB1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086565.2	NM_201253		115	138	0	0	0	1	0	115	138				
LMOD1	25802	broad.mit.edu	37	1	201868453	201868453	+	Missense_Mutation	SNP	C	C	G			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr1:201868453C>G	ENST00000367288.4	-	2	1934	c.1688G>C	c.(1687-1689)gGa>gCa	p.G563A	RP11-307B6.3_ENST00000458139.1_RNA|RP11-307B6.3_ENST00000414927.1_RNA	NM_012134.2	NP_036266.2	P29536	LMOD1_HUMAN	leiomodin 1 (smooth muscle)	563					muscle contraction (GO:0006936)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)		p.G563A(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|liver(1)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26						GACTTTGTCTCCCATCTTCCT	0.567																																							uc001gxb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)|skin(1)	3						c.(1687-1689)GGA>GCA		leiomodin 1 (smooth muscle)							32.0	36.0	35.0					1																	201868453		1925	4115	6040	SO:0001583	missense	25802				muscle contraction	cytoskeleton|cytosol|membrane fraction	tropomyosin binding	g.chr1:201868453C>G	X54162	CCDS53457.1	1q32.1	2008-05-22			ENSG00000163431	ENSG00000163431			6647	protein-coding gene	gene with protein product		602715					Standard	NM_012134		Approved	64kD, D1, 1D	uc021phl.1	P29536	OTTHUMG00000035802	ENST00000367288.4:c.1688G>C	1.37:g.201868453C>G	ENSP00000356257:p.Gly563Ala		Somatic				LMOD1_uc010ppu.1_Missense_Mutation_p.G512A	p.G563A	NM_012134	NP_036266	WXS	Illumina HiSeq	Unspecified	P29536	LMOD1_HUMAN			2	1936	-			563					B1APV6|C4AMB1|Q68EN2	Missense_Mutation	SNP	ENST00000367288.4	37	c.1688G>C	CCDS53457.1	.	.	.	.	.	.	.	.	.	.	C	13.27	2.187161	0.38609	.	.	ENSG00000163431	ENST00000367288;ENST00000400965;ENST00000412469	D	0.90385	-2.66	5.11	4.14	0.48551	.	0.000000	0.39210	N	0.001421	D	0.82407	0.5030	L	0.31294	0.92	0.37926	D	0.931855	B;B	0.13145	0.007;0.007	B;B	0.11329	0.006;0.006	T	0.77443	-0.2586	10	0.27082	T	0.32	-24.6662	7.9104	0.29787	0.1804:0.645:0.1746:0.0	.	512;563	B4E3S9;P29536	.;LMOD1_HUMAN	A	563;563;512	ENSP00000356257:G563A	ENSP00000356257:G563A	G	-	2	0	LMOD1	200135076	0.548000	0.26473	0.991000	0.47740	0.999000	0.98932	0.859000	0.27858	2.345000	0.79718	0.655000	0.94253	GGA		0.567	LMOD1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087085.2			6	5	0	0	0	1	0	6	5				
CENPF	1063	broad.mit.edu	37	1	214788288	214788288	+	Silent	SNP	C	C	G			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr1:214788288C>G	ENST00000366955.3	+	3	444	c.276C>G	c.(274-276)gtC>gtG	p.V92V		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	0	Interaction with SNAP25 and required for localization to the cytoplasm. {ECO:0000250}.				cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)	p.V92V(1)		NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		AACTTCAAGTCAAGGAGTCAC	0.368																																					Colon(80;575 1284 11000 14801 43496)	Colon(80;575 1284 11000 14801 43496)	uc001hkm.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(6)|central_nervous_system(4)|large_intestine(2)|skin(1)	13						c.(274-276)GTC>GTG		centromere protein F							73.0	75.0	75.0					1																	214788288		2203	4300	6503	SO:0001819	synonymous_variant	1063				cell differentiation|cell division|cell proliferation|DNA replication|G2 phase of mitotic cell cycle|kinetochore assembly|metaphase plate congression|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|muscle organ development|negative regulation of transcription, DNA-dependent|protein transport|regulation of G2/M transition of mitotic cell cycle|regulation of striated muscle tissue development|response to drug	condensed chromosome outer kinetochore|cytosol|midbody|nuclear envelope|nuclear matrix|perinuclear region of cytoplasm|spindle pole	chromatin binding|dynein binding|protein C-terminus binding|protein homodimerization activity|transcription factor binding	g.chr1:214788288C>G	U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.276C>G	1.37:g.214788288C>G			Somatic					p.V92V	NM_016343	NP_057427	WXS	Illumina HiSeq	Unspecified	P49454	CENPF_HUMAN		all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)	3	450	+			92			Interaction with SNAP25 and required for localization to the cytoplasm (By similarity).|Potential.		Q13171|Q13246|Q5VVM7	Silent	SNP	ENST00000366955.3	37	c.276C>G	CCDS31023.1																																																																																				0.368	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089749.1	NM_016343		12	41	0	0	0	1	0	12	41				
OPN3	23596	broad.mit.edu	37	1	241767856	241767856	+	Silent	SNP	G	G	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr1:241767856G>A	ENST00000366554.2	-	2	505	c.399C>T	c.(397-399)acC>acT	p.T133T	OPN3_ENST00000331838.5_Intron|OPN3_ENST00000469376.1_5'UTR	NM_014322.2	NP_055137.2	Q9H1Y3	OPN3_HUMAN	opsin 3	133					detection of light stimulus (GO:0009583)|detection of visible light (GO:0009584)|G-protein coupled receptor signaling pathway (GO:0007186)|phototransduction (GO:0007602)|protein-chromophore linkage (GO:0018298)|regulation of circadian rhythm (GO:0042752)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	G-protein coupled photoreceptor activity (GO:0008020)|G-protein coupled receptor activity (GO:0004930)|photoreceptor activity (GO:0009881)	p.T133T(1)		endometrium(1)|large_intestine(5)|lung(5)	11	Ovarian(103;0.103)|all_lung(81;0.23)	all_cancers(173;0.0231)	OV - Ovarian serous cystadenocarcinoma(106;0.0125)			AGGCCAGCACGGTTAGGGTGG	0.507																																							uc001hza.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(397-399)ACC>ACT		opsin 3							58.0	58.0	58.0					1																	241767856		2203	4300	6503	SO:0001819	synonymous_variant	23596				phototransduction|protein-chromophore linkage|regulation of circadian rhythm|visual perception	integral to plasma membrane	G-protein coupled photoreceptor activity	g.chr1:241767856G>A	AF140242	CCDS31072.1	1q43	2014-06-13	2008-04-16		ENSG00000054277	ENSG00000054277		"""GPCR / Class A : Opsin receptors"""	14007	protein-coding gene	gene with protein product	"""panopsin"", ""protein phosphatase 1, regulatory subunit 116"""	606695	"""encephalopsin"""	ECPN		10234000, 11401433	Standard	NM_014322		Approved	ERO, NMO-1, encephalopsin, PPP1R116	uc001hza.3	Q9H1Y3	OTTHUMG00000039691	ENST00000366554.2:c.399C>T	1.37:g.241767856G>A			Somatic				OPN3_uc001hzb.2_RNA|OPN3_uc001hzc.2_Intron	p.T133T	NM_014322	NP_055137	WXS	Illumina HiSeq	Unspecified	Q9H1Y3	OPN3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0125)		2	544	-	Ovarian(103;0.103)|all_lung(81;0.23)	all_cancers(173;0.0231)	133			Helical; Name=3; (Potential).		Q8IX08|Q9Y344	Silent	SNP	ENST00000366554.2	37	c.399C>T	CCDS31072.1																																																																																				0.507	OPN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095713.1	NM_014322		6	25	0	0	0	1	0	6	25				
ITIH2	3698	broad.mit.edu	37	10	7759700	7759700	+	Silent	SNP	C	C	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr10:7759700C>A	ENST00000358415.4	+	6	745	c.579C>A	c.(577-579)tcC>tcA	p.S193S	ITIH2_ENST00000379587.4_Silent_p.S182S|ITIH2_ENST00000480387.1_3'UTR	NM_002216.2	NP_002207.2	P19823	ITIH2_HUMAN	inter-alpha-trypsin inhibitor heavy chain 2	193					hyaluronan metabolic process (GO:0030212)|negative regulation of endopeptidase activity (GO:0010951)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.S193S(1)		NS(2)|breast(1)|endometrium(8)|kidney(1)|large_intestine(17)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	64						AGCTGGGCTCCTATGAGCACA	0.498																																							uc001ijs.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|pancreas(1)|skin(1)	3						c.(577-579)TCC>TCA		inter-alpha globulin inhibitor H2 polypeptide							154.0	149.0	150.0					10																	7759700		2203	4300	6503	SO:0001819	synonymous_variant	3698				hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity	g.chr10:7759700C>A	X07173	CCDS31141.1	10p14	2011-10-26	2011-10-26		ENSG00000151655	ENSG00000151655			6167	protein-coding gene	gene with protein product		146640	"""inter-alpha (globulin) inhibitor, H2 polypeptide"""			1385302, 10100603	Standard	NM_002216		Approved	H2P	uc001ijs.3	P19823	OTTHUMG00000017633	ENST00000358415.4:c.579C>A	10.37:g.7759700C>A			Somatic					p.S193S	NM_002216	NP_002207	WXS	Illumina HiSeq	Unspecified	P19823	ITIH2_HUMAN			6	741	+			193					Q14659|Q15484|Q5T986	Silent	SNP	ENST00000358415.4	37	c.579C>A	CCDS31141.1																																																																																				0.498	ITIH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046678.2	NM_002216		3	51	1	0	0.004672	1	0.00469981	3	51				
TAF3	83860	broad.mit.edu	37	10	7860740	7860740	+	Missense_Mutation	SNP	G	G	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr10:7860740G>T	ENST00000344293.5	+	1	274	c.68G>T	c.(67-69)tGg>tTg	p.W23L		NM_031923.3	NP_114129.1	Q5VWG9	TAF3_HUMAN	TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140kDa	23				WDS -> TRP (in Ref. 4; CAB56032). {ECO:0000305}.	maintenance of protein location in nucleus (GO:0051457)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	zinc ion binding (GO:0008270)	p.W23L(1)		NS(2)|breast(4)|endometrium(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(3)|prostate(4)|skin(2)	40						GCGCTGGGCTGGGACTCGGTG	0.667																																							uc010qbd.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(67-69)TGG>TTG		RNA polymerase II transcription factor TAFII140							19.0	26.0	24.0					10																	7860740		1991	4160	6151	SO:0001583	missense	83860				maintenance of protein location in nucleus|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	transcription factor TFIID complex	protein binding|zinc ion binding	g.chr10:7860740G>T	AJ292190	CCDS41487.1	10p15.1	2013-01-28	2002-08-29		ENSG00000165632	ENSG00000165632		"""Zinc fingers, PHD-type"""	17303	protein-coding gene	gene with protein product		606576	"""TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140 kD"""			11438666, 18549481	Standard	NM_031923		Approved	TAF140, TAFII140	uc010qbd.3	Q5VWG9	OTTHUMG00000017643	ENST00000344293.5:c.68G>T	10.37:g.7860740G>T	ENSP00000340271:p.Trp23Leu		Somatic					p.W23L	NM_031923	NP_114129	WXS	Illumina HiSeq	Unspecified	Q5VWG9	TAF3_HUMAN			1	68	+			23	W->R: Loss of interaction with TAF10.|WDS -> TRP (in Ref. 4; CAB56032).				Q05DA0|Q6GMS5|Q6P6B5|Q86VY6|Q9BQS9|Q9UFI8	Missense_Mutation	SNP	ENST00000344293.5	37	c.68G>T	CCDS41487.1	.	.	.	.	.	.	.	.	.	.	G	34	5.356466	0.95854	.	.	ENSG00000165632	ENST00000344293;ENST00000542889	T	0.23147	1.92	4.71	4.71	0.59529	Bromodomain transcription factor (2);	0.000000	0.32161	N	0.006484	T	0.45836	0.1362	M	0.79475	2.455	0.80722	D	1	D	0.55385	0.971	P	0.53360	0.724	T	0.52124	-0.8617	10	0.66056	D	0.02	-7.9984	17.8107	0.88614	0.0:0.0:1.0:0.0	.	23	Q5VWG9	TAF3_HUMAN	L	23	ENSP00000340271:W23L	ENSP00000340271:W23L	W	+	2	0	TAF3	7900746	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.747000	0.91610	2.596000	0.87737	0.491000	0.48974	TGG		0.667	TAF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046725.1	NM_031923		7	2	1	0	8.12818e-05	1	8.4794e-05	7	2				
WAPAL	23063	broad.mit.edu	37	10	88213467	88213467	+	Missense_Mutation	SNP	C	C	G			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr10:88213467C>G	ENST00000298767.5	-	13	3251	c.2779G>C	c.(2779-2781)Gag>Cag	p.E927Q	WAPAL_ENST00000372075.1_Missense_Mutation_p.E194Q|WAPAL_ENST00000263070.7_Missense_Mutation_p.E194Q	NM_015045.2	NP_055860.1	Q7Z5K2	WAPL_HUMAN	wings apart-like homolog (Drosophila)	927	WAPL. {ECO:0000255|PROSITE- ProRule:PRU00603}.				mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of chromatin binding (GO:0035562)|negative regulation of DNA replication (GO:0008156)|negative regulation of sister chromatid cohesion (GO:0045875)|positive regulation of fibroblast proliferation (GO:0048146)|protein localization to chromatin (GO:0071168)|regulation of chromosome condensation (GO:0060623)|regulation of cohesin localization to chromatin (GO:0071922)|response to toxic substance (GO:0009636)|viral process (GO:0016032)	chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)		p.E927Q(1)		breast(2)|endometrium(2)|kidney(5)|large_intestine(6)|lung(13)|ovary(2)|stomach(1)	31						ATGCAGTCCTCCACTGCTTTG	0.413																																							uc001kdo.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(2779-2781)GAG>CAG		wings apart-like homolog							133.0	115.0	121.0					10																	88213467		2203	4300	6503	SO:0001583	missense	23063				cell division|interspecies interaction between organisms|mitosis|negative regulation of chromatin binding|negative regulation of DNA replication|negative regulation of sister chromatid cohesion|protein localization to chromatin|regulation of cohesin localization to chromatin	chromatin|cohesin complex|cytoplasm	protein binding	g.chr10:88213467C>G	AB065003	CCDS7375.1	10q23.31	2006-12-08	2006-03-16	2006-03-16	ENSG00000062650	ENSG00000062650			23293	protein-coding gene	gene with protein product	"""friend of EBNA2"""	610754	"""KIAA0261"""	KIAA0261		9039502, 17112726	Standard	XM_006717726		Approved	FOE, WAPL	uc001kdo.3	Q7Z5K2	OTTHUMG00000018651	ENST00000298767.5:c.2779G>C	10.37:g.88213467C>G	ENSP00000298767:p.Glu927Gln		Somatic				WAPAL_uc009xsv.2_Missense_Mutation_p.E241Q|WAPAL_uc001kdn.2_Missense_Mutation_p.E964Q|WAPAL_uc009xsw.2_Missense_Mutation_p.E921Q	p.E927Q	NM_015045	NP_055860	WXS	Illumina HiSeq	Unspecified	Q7Z5K2	WAPL_HUMAN			13	3221	-			927			WAPL.		A7E2B5|Q5VSK5|Q8IX10|Q92549	Missense_Mutation	SNP	ENST00000298767.5	37	c.2779G>C	CCDS7375.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.148147	0.78001	.	.	ENSG00000062650	ENST00000342368;ENST00000298767;ENST00000372076;ENST00000372075;ENST00000263070	T	0.51325	0.71	5.82	4.87	0.63330	Armadillo-type fold (1);	0.048034	0.85682	D	0.000000	T	0.46756	0.1409	L	0.56769	1.78	0.80722	D	1	B;B;B;B	0.29301	0.004;0.077;0.004;0.241	B;B;B;B	0.29598	0.005;0.064;0.005;0.104	T	0.37572	-0.9700	10	0.24483	T	0.36	.	18.5496	0.91058	0.0:0.8731:0.1269:0.0	.	921;965;927;964	B2RTX8;E9PH12;Q7Z5K2;Q7Z5K2-2	.;.;WAPL_HUMAN;.	Q	1012;927;1012;194;194	ENSP00000298767:E927Q	ENSP00000263070:E194Q	E	-	1	0	WAPAL	88203447	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.790000	0.69038	2.765000	0.95021	0.591000	0.81541	GAG		0.413	WAPAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049151.2	NM_015045		19	19	0	0	0	1	0	19	19				
BMPR1A	657	broad.mit.edu	37	10	88677025	88677025	+	Silent	SNP	C	C	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr10:88677025C>T	ENST00000372037.3	+	9	1347	c.810C>T	c.(808-810)agC>agT	p.S270S		NM_004329.2	NP_004320.2	P36894	BMR1A_HUMAN	bone morphogenetic protein receptor, type IA	270	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				BMP signaling pathway (GO:0030509)|cartilage development (GO:0051216)|developmental growth (GO:0048589)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic digit morphogenesis (GO:0042733)|embryonic organ development (GO:0048568)|endocardial cushion formation (GO:0003272)|heart formation (GO:0060914)|hindlimb morphogenesis (GO:0035137)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|lateral mesoderm development (GO:0048368)|lung development (GO:0030324)|mesendoderm development (GO:0048382)|mesoderm formation (GO:0001707)|Mullerian duct regression (GO:0001880)|negative regulation of neurogenesis (GO:0050768)|neural crest cell development (GO:0014032)|neural plate mediolateral regionalization (GO:0021998)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|paraxial mesoderm structural organization (GO:0048352)|pituitary gland development (GO:0021983)|positive regulation of bone mineralization (GO:0030501)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of lateral mesodermal cell fate specification (GO:0048378)|somitogenesis (GO:0001756)|stem cell maintenance (GO:0019827)|transforming growth factor beta receptor signaling pathway (GO:0007179)	dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|SMAD binding (GO:0046332)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)	p.S270S(2)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(12)|ovary(1)|skin(1)|stomach(1)	24						AAGAAGCCAGCTGGTTTCGAG	0.448			"""Mis, N, F"""			gastrointestinal polyps			Juvenile Polyposis;Hereditary Mixed Polyposis syndrome type 2																												Ovarian(190;603 2086 22044 30335 47971)	Ovarian(190;603 2086 22044 30335 47971)	uc001kdy.2		NA	yes	Rec		Juvenile polyposis	10	10q22.3	657	Mis|N|F	"""bone morphogenetic protein receptor, type IA"""			E		gastrointestinal polyps			2	Substitution - coding silent(2)		lung(2)	lung(3)|large_intestine(1)|stomach(1)|central_nervous_system(1)|breast(1)|kidney(1)	8						c.(808-810)AGC>AGT		bone morphogenetic protein receptor, type IA							39.0	36.0	37.0					10																	88677025		2203	4297	6500	SO:0001819	synonymous_variant	657	Hereditary_Mixed_Polyposis_syndrome_type_2|Juvenile_Polyposis	Familial Cancer Database	incl.: Juvenile Polyposis of the Stomach;HMPS2	BMP signaling pathway|immune response|positive regulation of bone mineralization|positive regulation of osteoblast differentiation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of SMAD protein import into nucleus|transforming growth factor beta receptor signaling pathway	integral to membrane|plasma membrane	ATP binding|metal ion binding|protein homodimerization activity|SMAD binding|transforming growth factor beta receptor activity	g.chr10:88677025C>T	BC028383	CCDS7378.1	10q22.3	2014-09-17			ENSG00000107779	ENSG00000107779		"""CD molecules"""	1076	protein-coding gene	gene with protein product		601299		ACVRLK3		8397373, 9730621	Standard	NM_004329		Approved	ALK3, CD292	uc001kdy.3	P36894	OTTHUMG00000018657	ENST00000372037.3:c.810C>T	10.37:g.88677025C>T			Somatic					p.S270S	NM_004329	NP_004320	WXS	Illumina HiSeq	Unspecified	P36894	BMR1A_HUMAN			9	1358	+			270			Cytoplasmic (Potential).|Protein kinase.		A8K6U9|Q8NEN8	Silent	SNP	ENST00000372037.3	37	c.810C>T	CCDS7378.1																																																																																				0.448	BMPR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049170.3	NM_004329		4	6	0	0	0	1	0	4	6				
ATE1	11101	broad.mit.edu	37	10	123670659	123670659	+	Silent	SNP	G	G	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr10:123670659G>A	ENST00000224652.6	-	5	430	c.345C>T	c.(343-345)ccC>ccT	p.P115P	ATE1_ENST00000535655.1_5'UTR|ATE1_ENST00000369040.3_Silent_p.P19P|ATE1_ENST00000369043.3_Silent_p.P115P|ATE1_ENST00000540606.1_Silent_p.P108P|ATE1_ENST00000543447.1_5'UTR	NM_001001976.1	NP_001001976.1	O95260	ATE1_HUMAN	arginyltransferase 1	115					protein arginylation (GO:0016598)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	arginyltransferase activity (GO:0004057)	p.P115P(2)		endometrium(2)|kidney(2)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	14		all_neural(114;0.061)|Lung NSC(174;0.095)|all_lung(145;0.124)|Breast(234;0.212)				TGGAATCCATGGGCTCATCTA	0.358																																							uc001lfp.2		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(343-345)CCC>CCT		arginyltransferase 1 isoform 2							100.0	105.0	103.0					10																	123670659		2203	4300	6503	SO:0001819	synonymous_variant	11101				protein arginylation	cytoplasm|nucleus	acyltransferase activity|arginyltransferase activity	g.chr10:123670659G>A	AF079098	CCDS31299.1, CCDS31300.1, CCDS73211.1, CCDS73212.1, CCDS73213.1	10q26	2013-05-08			ENSG00000107669	ENSG00000107669	2.3.2.8		782	protein-coding gene	gene with protein product		607103				16002466, 16943202	Standard	XM_005269458		Approved		uc001lfq.3	O95260	OTTHUMG00000019178	ENST00000224652.6:c.345C>T	10.37:g.123670659G>A			Somatic				ATE1_uc001lfq.2_Silent_p.P115P|ATE1_uc010qtr.1_5'UTR|ATE1_uc010qts.1_Silent_p.P19P|ATE1_uc010qtt.1_Silent_p.P108P|ATE1_uc001lfr.2_5'UTR|ATE1_uc009xzu.2_Intron	p.P115P	NM_007041	NP_008972	WXS	Illumina HiSeq	Unspecified	O95260	ATE1_HUMAN			5	427	-		all_neural(114;0.061)|Lung NSC(174;0.095)|all_lung(145;0.124)|Breast(234;0.212)	115					O95261|Q5SQQ3|Q8WW04	Silent	SNP	ENST00000224652.6	37	c.345C>T	CCDS31300.1	.	.	.	.	.	.	.	.	.	.	G	9.518	1.107428	0.20714	.	.	ENSG00000107669	ENST00000423243	.	.	.	5.78	0.5	0.16919	.	.	.	.	.	T	0.51618	0.1685	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.40346	-0.9568	4	.	.	.	-18.0399	5.6717	0.17725	0.4926:0.139:0.3683:0.0	.	.	.	.	Y	112	.	.	H	-	1	0	ATE1	123660649	0.889000	0.30405	1.000000	0.80357	0.900000	0.52787	-0.302000	0.08221	0.298000	0.22638	0.563000	0.77884	CAT		0.358	ATE1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_001001976		27	21	0	0	0	1	0	27	21				
UBQLNL	143630	broad.mit.edu	37	11	5536678	5536678	+	Missense_Mutation	SNP	T	T	G			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr11:5536678T>G	ENST00000380184.1	-	1	1257	c.994A>C	c.(994-996)Atc>Ctc	p.I332L	HBG2_ENST00000380259.2_Intron	NM_145053.4	NP_659490.4	Q8IYU4	UBQLN_HUMAN	ubiquilin-like	332								p.I332L(1)		endometrium(1)|kidney(3)|large_intestine(9)|lung(13)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	33		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;1.92e-09)|BRCA - Breast invasive adenocarcinoma(625;0.136)		CTATTATAGATGACTCGGGTT	0.498																																							uc001maz.3		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(2)|skin(1)	3						c.(994-996)ATC>CTC		ubiquilin-like							217.0	200.0	206.0					11																	5536678		2201	4297	6498	SO:0001583	missense	143630							g.chr11:5536678T>G	AK127987	CCDS31385.1	11p15.4	2014-02-12			ENSG00000175518	ENSG00000175518		"""Ubiquilin family"""	28294	protein-coding gene	gene with protein product							Standard	NM_145053		Approved	MGC20470, MGC26958	uc001maz.4	Q8IYU4	OTTHUMG00000066903	ENST00000380184.1:c.994A>C	11.37:g.5536678T>G	ENSP00000369531:p.Ile332Leu		Somatic				HBG2_uc001mak.1_Intron	p.I332L	NM_145053	NP_659490	WXS	Illumina HiSeq	Unspecified	Q8IYU4	UBQLN_HUMAN		Epithelial(150;1.92e-09)|BRCA - Breast invasive adenocarcinoma(625;0.136)	1	1279	-		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)	332					Q6ZRU1|Q96EK3|Q96MB0	Missense_Mutation	SNP	ENST00000380184.1	37	c.994A>C	CCDS31385.1	.	.	.	.	.	.	.	.	.	.	T	4.198	0.035427	0.08148	.	.	ENSG00000175518	ENST00000380184	T	0.43688	0.94	4.23	4.23	0.50019	.	0.421653	0.19970	N	0.102006	T	0.33089	0.0851	L	0.45581	1.43	0.23156	N	0.998204	P	0.34615	0.459	B	0.32624	0.149	T	0.15723	-1.0427	10	0.27785	T	0.31	.	10.0061	0.41957	0.0:0.0:0.0:1.0	.	332	Q8IYU4	UBQLN_HUMAN	L	332	ENSP00000369531:I332L	ENSP00000369531:I332L	I	-	1	0	UBQLNL	5493254	0.666000	0.27475	0.749000	0.31150	0.010000	0.07245	3.721000	0.54941	2.117000	0.64856	0.533000	0.62120	ATC		0.498	UBQLNL-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143386.1	NM_145053		30	56	0	0	0	1	0	30	56				
SBF2	81846	broad.mit.edu	37	11	9861153	9861153	+	Missense_Mutation	SNP	C	C	G			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr11:9861153C>G	ENST00000256190.8	-	26	3484	c.3347G>C	c.(3346-3348)aGa>aCa	p.R1116T	RP11-1H15.2_ENST00000533659.1_RNA	NM_030962.3	NP_112224.1	Q86WG5	MTMRD_HUMAN	SET binding factor 2	1116	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.				cell death (GO:0008219)|myelination (GO:0042552)|positive regulation of Rab GTPase activity (GO:0032851)|protein tetramerization (GO:0051262)	membrane (GO:0016020)|vacuolar membrane (GO:0005774)	phosphatase activity (GO:0016791)|phosphatase regulator activity (GO:0019208)|phosphatidylinositol binding (GO:0035091)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.R1116T(1)		breast(4)|endometrium(8)|kidney(2)|large_intestine(8)|lung(16)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48				all cancers(16;2.88e-11)|Epithelial(150;3.61e-10)|BRCA - Breast invasive adenocarcinoma(625;0.00887)		CTGATAGTCTCTGAAACAAGC	0.463																																							uc001mib.2		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3						c.(3346-3348)AGA>ACA		SET binding factor 2							152.0	151.0	151.0					11																	9861153		2201	4294	6495	SO:0001583	missense	81846				myelination	cytoplasm|membrane	phosphatase activity|protein binding	g.chr11:9861153C>G	AB051553	CCDS31427.1	11p15.3	2014-09-17	2004-11-12	2004-11-12	ENSG00000133812	ENSG00000133812		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"", ""DENN/MADD domain containing"", ""Pleckstrin homology (PH) domain containing"""	2135	protein-coding gene	gene with protein product	"""myotubularin related 13"""	607697	"""Charcot-Marie-Tooth neuropathy 4B2 (autosomal recessive, with myelin outfolding)"", ""DENN/MADD domain containing 7B"""	CMT4B2		10644431	Standard	NM_030962		Approved	KIAA1766, MTMR13, DENND7B	uc001mib.2	Q86WG5	OTTHUMG00000165890	ENST00000256190.8:c.3347G>C	11.37:g.9861153C>G	ENSP00000256190:p.Arg1116Thr		Somatic				SBF2_uc001mif.3_Missense_Mutation_p.R872T|uc001mig.2_Intron	p.R1116T	NM_030962	NP_112224	WXS	Illumina HiSeq	Unspecified	Q86WG5	MTMRD_HUMAN		all cancers(16;2.88e-11)|Epithelial(150;3.61e-10)|BRCA - Breast invasive adenocarcinoma(625;0.00887)	26	3485	-			1116			Myotubularin phosphatase.		Q3MJF0|Q68DQ3|Q6P459|Q6PJD1|Q7Z325|Q7Z621|Q86VE2|Q96FE2|Q9C097	Missense_Mutation	SNP	ENST00000256190.8	37	c.3347G>C	CCDS31427.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.946094	0.73672	.	.	ENSG00000133812	ENST00000256190	T	0.10477	2.87	5.48	5.48	0.80851	Myotubularin phosphatase domain (1);	.	.	.	.	T	0.25195	0.0612	M	0.67569	2.06	0.58432	D	0.999996	P	0.51791	0.948	P	0.50791	0.65	T	0.00394	-1.1767	9	0.72032	D	0.01	.	19.7827	0.96424	0.0:1.0:0.0:0.0	.	1116	Q86WG5	MTMRD_HUMAN	T	1116	ENSP00000256190:R1116T	ENSP00000256190:R1116T	R	-	2	0	SBF2	9817729	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.050000	0.71063	2.747000	0.94245	0.650000	0.86243	AGA		0.463	SBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386911.2	NM_030962		4	100	0	0	0	1	0	4	100				
SLC39A13	91252	broad.mit.edu	37	11	47431696	47431696	+	Silent	SNP	C	C	G			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr11:47431696C>G	ENST00000362021.4	+	2	93	c.51C>G	c.(49-51)ctC>ctG	p.L17L	SLC39A13_ENST00000524928.1_Silent_p.L17L|RP11-750H9.5_ENST00000532340.1_RNA|SLC39A13_ENST00000533076.1_Silent_p.L17L|SLC39A13_ENST00000531974.1_Silent_p.L17L|SLC39A13_ENST00000354884.4_Silent_p.L17L|RP11-750H9.5_ENST00000532943.1_RNA	NM_001128225.2	NP_001121697	Q96H72	S39AD_HUMAN	solute carrier family 39 (zinc transporter), member 13	17					cellular zinc ion homeostasis (GO:0006882)|connective tissue development (GO:0061448)|zinc ion transmembrane transport (GO:0071577)	Golgi apparatus (GO:0005794)|integral component of Golgi membrane (GO:0030173)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)	protein homodimerization activity (GO:0042803)|zinc ion transmembrane transporter activity (GO:0005385)	p.L17L(1)		breast(1)|kidney(1)|lung(1)|prostate(1)	4				Lung(87;0.0936)		CAAGGCTCCTCTTCCTCACTG	0.637																																							uc009ylq.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(49-51)CTC>CTG		solute carrier family 39 (zinc transporter),							57.0	65.0	62.0					11																	47431696		2188	4275	6463	SO:0001819	synonymous_variant	91252				zinc ion transport	integral to membrane	metal ion transmembrane transporter activity	g.chr11:47431696C>G		CCDS7934.1, CCDS44592.1	11p11.2	2013-05-22			ENSG00000165915	ENSG00000165915		"""Solute carriers"""	20859	protein-coding gene	gene with protein product		608735	"""solute carrier family 39 (metal ion transporter), member 13"""			12659941	Standard	NM_001128225		Approved	FLJ25785	uc009ylq.3	Q96H72	OTTHUMG00000166890	ENST00000362021.4:c.51C>G	11.37:g.47431696C>G			Somatic				SLC39A13_uc001nfd.2_Silent_p.L17L|SLC39A13_uc001nfe.1_RNA|SLC39A13_uc001nff.3_Silent_p.L17L|SLC39A13_uc001nfg.3_Silent_p.L17L	p.L17L	NM_001128225	NP_001121697	WXS	Illumina HiSeq	Unspecified	Q96H72	S39AD_HUMAN		Lung(87;0.0936)	2	222	+			17			Helical; (Potential).		D3DQR6|D3DQR7|E9PLY1|E9PQV3|Q659D9|Q8N7C9|Q8WV10	Silent	SNP	ENST00000362021.4	37	c.51C>G	CCDS44592.1																																																																																				0.637	SLC39A13-012	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000395652.1	NM_152264		30	75	0	0	0	1	0	30	75				
OR4C3	256144	broad.mit.edu	37	11	48346598	48346598	+	Missense_Mutation	SNP	G	G	C			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr11:48346598G>C	ENST00000319856.4	+	1	127	c.106G>C	c.(106-108)Gaa>Caa	p.E36Q		NM_001004702.1	NP_001004702.1	Q8NH37	OR4C3_HUMAN	olfactory receptor, family 4, subfamily C, member 3	9						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.E36Q(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(18)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	32						AAATATCACAGAATTTTTCAT	0.408																																							uc010rhv.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(106-108)GAA>CAA		olfactory receptor, family 4, subfamily C,							125.0	123.0	124.0					11																	48346598		2201	4298	6499	SO:0001583	missense	256144				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:48346598G>C	AB065567	CCDS31489.1	11p11.2	2012-08-09				ENSG00000176547		"""GPCR / Class A : Olfactory receptors"""	14697	protein-coding gene	gene with protein product							Standard	NM_001004702		Approved		uc010rhv.2	Q8NH37	OTTHUMG00000166579	ENST00000319856.4:c.106G>C	11.37:g.48346598G>C	ENSP00000321419:p.Glu36Gln		Somatic					p.E36Q	NM_001004702	NP_001004702	WXS	Illumina HiSeq	Unspecified	Q8NH37	OR4C3_HUMAN			1	106	+			9			Extracellular (Potential).		B2RNF2|Q6IFB3	Missense_Mutation	SNP	ENST00000319856.4	37	c.106G>C	CCDS31489.1	.	.	.	.	.	.	.	.	.	.	G	16.70	3.197259	0.58126	.	.	ENSG00000176547	ENST00000319856	T	0.01126	5.3	5.88	5.88	0.94601	.	0.124728	0.36268	N	0.002694	T	0.07863	0.0197	M	0.87381	2.88	0.09310	N	1	D	0.76494	0.999	D	0.74674	0.984	T	0.05699	-1.0869	10	0.72032	D	0.01	.	12.7861	0.57507	0.0:0.0:0.8364:0.1636	.	9	Q8NH37	OR4C3_HUMAN	Q	36	ENSP00000321419:E36Q	ENSP00000321419:E36Q	E	+	1	0	OR4C3	48303174	0.002000	0.14202	0.485000	0.27403	0.983000	0.72400	1.164000	0.31810	2.829000	0.97493	0.549000	0.68633	GAA		0.408	OR4C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390557.1	NM_001004702		23	69	0	0	0	1	0	23	69				
OR4D6	219983	broad.mit.edu	37	11	59224646	59224646	+	Silent	SNP	C	C	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr11:59224646C>T	ENST00000300127.2	+	1	236	c.213C>T	c.(211-213)atC>atT	p.I71I		NM_001004708.1	NP_001004708.1	Q8NGJ1	OR4D6_HUMAN	olfactory receptor, family 4, subfamily D, member 6	71						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.I71I(1)		breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(20)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	34						TCCTGGACATCGTTTTTTCAT	0.463																																							uc010rku.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(211-213)ATC>ATT		olfactory receptor, family 4, subfamily D,							142.0	120.0	128.0					11																	59224646		2201	4295	6496	SO:0001819	synonymous_variant	219983				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:59224646C>T	AB065803	CCDS31562.1	11q12.1	2012-08-09			ENSG00000166884	ENSG00000166884		"""GPCR / Class A : Olfactory receptors"""	15175	protein-coding gene	gene with protein product							Standard	NM_001004708		Approved		uc010rku.2	Q8NGJ1	OTTHUMG00000167340	ENST00000300127.2:c.213C>T	11.37:g.59224646C>T			Somatic					p.I71I	NM_001004708	NP_001004708	WXS	Illumina HiSeq	Unspecified	Q8NGJ1	OR4D6_HUMAN			1	213	+			71			Helical; Name=2; (Potential).		B2RNP7|Q6IFF5|Q96R74	Silent	SNP	ENST00000300127.2	37	c.213C>T	CCDS31562.1																																																																																				0.463	OR4D6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394234.1	NM_001004708		19	55	0	0	0	1	0	19	55				
CCDC83	220047	broad.mit.edu	37	11	85626533	85626533	+	Missense_Mutation	SNP	C	C	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr11:85626533C>T	ENST00000342404.3	+	9	1082	c.866C>T	c.(865-867)aCa>aTa	p.T289I	CCDC83_ENST00000280245.4_Missense_Mutation_p.T320I|RP11-90K17.2_ENST00000531414.1_RNA|CCDC83_ENST00000376067.1_Missense_Mutation_p.T190I			Q8IWF9	CCD83_HUMAN	coiled-coil domain containing 83	289								p.T320I(1)		breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(12)|skin(3)|upper_aerodigestive_tract(2)	29		Acute lymphoblastic leukemia(157;4.88e-06)|all_hematologic(158;0.00572)				TTGCCAGAAACACATATAGGT	0.353																																							uc001pbh.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(865-867)ACA>ATA		coiled-coil domain containing 83							143.0	134.0	137.0					11																	85626533		2203	4299	6502	SO:0001583	missense	220047							g.chr11:85626533C>T	AK124113	CCDS8271.1, CCDS66196.1	11q14.1-q14.2	2014-01-21			ENSG00000150676	ENSG00000150676			28535	protein-coding gene	gene with protein product						12477932	Standard	XM_005273842		Approved	MGC34732, FLJ42119, CT148	uc001pbg.1	Q8IWF9	OTTHUMG00000166978	ENST00000342404.3:c.866C>T	11.37:g.85626533C>T	ENSP00000344512:p.Thr289Ile		Somatic				CCDC83_uc001pbg.1_Missense_Mutation_p.T320I|CCDC83_uc001pbi.1_RNA|CCDC83_uc001pbj.1_Missense_Mutation_p.T190I	p.T289I	NM_173556	NP_775827	WXS	Illumina HiSeq	Unspecified	Q8IWF9	CCD83_HUMAN			9	1378	+		Acute lymphoblastic leukemia(157;4.88e-06)|all_hematologic(158;0.00572)	289					B2RA49|Q6X7T2|Q6ZVT5|Q8N9Y1	Missense_Mutation	SNP	ENST00000342404.3	37	c.866C>T		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.97|10.97	1.501762|1.501762	0.26949|0.26949	.|.	.|.	ENSG00000150676|ENSG00000150676	ENST00000526729|ENST00000280245;ENST00000376067;ENST00000342404	.|T;T;T	.|0.44482	.|0.92;0.92;0.92	5.49|5.49	-3.17|-3.17	0.05202|0.05202	.|.	.|1.771640	.|0.02339	.|N	.|0.074654	T|T	0.26376|0.26376	0.0644|0.0644	N|N	0.20685|0.20685	0.6|0.6	0.09310|0.09310	N|N	1|1	.|B;B;B	.|0.09022	.|0.001;0.001;0.002	.|B;B;B	.|0.11329	.|0.001;0.003;0.006	T|T	0.11891|0.11891	-1.0569|-1.0569	5|9	.|.	.|.	.|.	0.2944|0.2944	6.6967|6.6967	0.23203|0.23203	0.0:0.4368:0.1264:0.4368|0.0:0.4368:0.1264:0.4368	.|.	.|190;289;320	.|Q8IWF9-3;Q8IWF9;Q8IWF9-2	.|.;CCD83_HUMAN;.	Y|I	195|320;190;289	.|ENSP00000280245:T320I;ENSP00000365235:T190I;ENSP00000344512:T289I	.|.	H|T	+|+	1|2	0|0	CCDC83|CCDC83	85304181|85304181	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.630000|0.630000	0.37929|0.37929	-1.285000|-1.285000	0.02791|0.02791	-0.570000|-0.570000	0.06022|0.06022	0.655000|0.655000	0.94253|0.94253	CAC|ACA		0.353	CCDC83-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000392215.1	NM_173556		14	42	0	0	0	1	0	14	42				
ARHGEF12	23365	broad.mit.edu	37	11	120298837	120298837	+	Missense_Mutation	SNP	C	C	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr11:120298837C>T	ENST00000397843.2	+	8	632	c.466C>T	c.(466-468)Ctt>Ttt	p.L156F	ARHGEF12_ENST00000532993.1_Missense_Mutation_p.L53F|ARHGEF12_ENST00000356641.3_Missense_Mutation_p.L137F	NM_015313.2	NP_056128.1	Q9NZN5	ARHGC_HUMAN	Rho guanine nucleotide exchange factor (GEF) 12	156					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.L156F(1)		NS(1)|breast(5)|endometrium(6)|kidney(5)|large_intestine(13)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(2)	61		Breast(109;0.000813)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_hematologic(192;0.107)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.231)		CCAGATTCCACTTGCCGACTC	0.527			T	MLL	AML																																		uc001pxl.1		NA		Dom	yes		11	11q23.3	23365	T	RHO guanine nucleotide exchange factor (GEF) 12 (LARG)			L	MLL		AML		1	Substitution - Missense(1)		lung(1)	lung(2)|breast(2)|skin(2)|ovary(1)	7						c.(466-468)CTT>TTT		Rho guanine nucleotide exchange factor (GEF) 12							151.0	148.0	149.0					11																	120298837		1868	4114	5982	SO:0001583	missense	23365				apoptosis|axon guidance|G-protein coupled receptor protein signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane	G-protein-coupled receptor binding|GTPase activator activity|Rho guanyl-nucleotide exchange factor activity	g.chr11:120298837C>T	AF180681	CCDS41727.1, CCDS55794.1	11q23.3	2011-11-16			ENSG00000196914	ENSG00000196914		"""Rho guanine nucleotide exchange factors"""	14193	protein-coding gene	gene with protein product		604763				10681437, 9205841	Standard	NM_001198665		Approved	KIAA0382, LARG	uc001pxl.2	Q9NZN5	OTTHUMG00000166143	ENST00000397843.2:c.466C>T	11.37:g.120298837C>T	ENSP00000380942:p.Leu156Phe		Somatic				ARHGEF12_uc009zat.2_Missense_Mutation_p.L137F|ARHGEF12_uc010rzn.1_Missense_Mutation_p.L53F|ARHGEF12_uc009zau.1_Missense_Mutation_p.L53F	p.L156F	NM_015313	NP_056128	WXS	Illumina HiSeq	Unspecified	Q9NZN5	ARHGC_HUMAN		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.231)	8	473	+		Breast(109;0.000813)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_hematologic(192;0.107)|all_neural(223;0.112)	156					O15086|Q6P526	Missense_Mutation	SNP	ENST00000397843.2	37	c.466C>T	CCDS41727.1	.	.	.	.	.	.	.	.	.	.	C	20.1	3.932975	0.73442	.	.	ENSG00000196914	ENST00000397843;ENST00000356641;ENST00000532993	T;T;T	0.71222	-0.47;-0.55;-0.45	5.68	4.67	0.58626	.	0.000000	0.34067	N	0.004290	T	0.77909	0.4201	M	0.65498	2.005	0.52099	D	0.999945	D;D;D	0.76494	0.999;0.998;0.989	D;D;P	0.71184	0.972;0.964;0.823	T	0.75648	-0.3245	10	0.34782	T	0.22	-12.5513	6.6087	0.22739	0.0:0.7498:0.0:0.2502	.	53;137;156	B4DGW2;Q9NZN5-2;Q9NZN5	.;.;ARHGC_HUMAN	F	156;137;53	ENSP00000380942:L156F;ENSP00000349056:L137F;ENSP00000432984:L53F	ENSP00000349056:L137F	L	+	1	0	ARHGEF12	119804047	0.932000	0.31603	0.998000	0.56505	0.990000	0.78478	0.980000	0.29513	2.673000	0.90976	0.655000	0.94253	CTT		0.527	ARHGEF12-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388052.1	NM_015313		54	103	0	0	0	1	0	54	103				
VSIG2	23584	broad.mit.edu	37	11	124619682	124619682	+	Missense_Mutation	SNP	C	C	T	rs114520645		TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr11:124619682C>T	ENST00000326621.5	-	4	608	c.508G>A	c.(508-510)Gag>Aag	p.E170K	VSIG2_ENST00000403470.1_Missense_Mutation_p.E170K	NM_014312.3	NP_055127.2	Q96IQ7	VSIG2_HUMAN	V-set and immunoglobulin domain containing 2	170	Ig-like C2-type.					integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)		p.E170K(1)		central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(5)	19	all_hematologic(175;0.215)	Breast(109;0.00663)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0215)		GGAGCCCCCTCGGAAGAGCTG	0.512													C|||	1	0.000199681	0.0	0.0	5008	,	,		16962	0.001		0.0	False		,,,				2504	0.0						uc001qas.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|central_nervous_system(1)	4						c.(508-510)GAG>AAG		V-set and immunoglobulin domain containing 2		C	LYS/GLU	0,4402		0,0,2201	82.0	80.0	81.0		508	-1.4	0.0	11	dbSNP_132	81	4,8594	3.7+/-12.6	0,4,4295	yes	missense	VSIG2	NM_014312.3	56	0,4,6496	TT,TC,CC		0.0465,0.0,0.0308	benign	170/328	124619682	4,12996	2201	4299	6500	SO:0001583	missense	23584					integral to plasma membrane|membrane fraction		g.chr11:124619682C>T	AF061022	CCDS8452.1	11q24	2013-01-11			ENSG00000019102	ENSG00000019102		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"""	17149	protein-coding gene	gene with protein product		606011				9862345	Standard	NM_014312		Approved	CTXL, CTH	uc001qas.3	Q96IQ7	OTTHUMG00000150357	ENST00000326621.5:c.508G>A	11.37:g.124619682C>T	ENSP00000318684:p.Glu170Lys		Somatic				VSIG2_uc001qat.2_Missense_Mutation_p.E170K	p.E170K	NM_014312	NP_055127	WXS	Illumina HiSeq	Unspecified	Q96IQ7	VSIG2_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0215)	4	584	-	all_hematologic(175;0.215)	Breast(109;0.00663)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)	170			Extracellular (Potential).|Ig-like C2-type.		O95791|Q9NX42	Missense_Mutation	SNP	ENST00000326621.5	37	c.508G>A	CCDS8452.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	1.847	-0.465960	0.04476	0.0	4.65E-4	ENSG00000019102	ENST00000326621;ENST00000403470	T;T	0.15372	2.43;2.43	5.5	-1.39	0.08997	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.891618	0.09653	N	0.773384	T	0.16471	0.0396	L	0.60904	1.88	0.09310	N	1	B	0.14012	0.009	B	0.12837	0.008	T	0.31194	-0.9952	10	0.34782	T	0.22	.	8.9176	0.35592	0.0:0.2985:0.542:0.1595	.	170	Q96IQ7	VSIG2_HUMAN	K	170	ENSP00000318684:E170K;ENSP00000385013:E170K	ENSP00000318684:E170K	E	-	1	0	VSIG2	124124892	0.001000	0.12720	0.006000	0.13384	0.695000	0.40330	-0.161000	0.10026	-0.378000	0.07918	-0.165000	0.13383	GAG		0.512	VSIG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317785.1	NM_014312		15	46	0	0	0	1	0	15	46				
C1R	715	broad.mit.edu	37	12	7188187	7188187	+	Missense_Mutation	SNP	C	C	G			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr12:7188187C>G	ENST00000542285.1	-	11	1760	c.1611G>C	c.(1609-1611)ttG>ttC	p.L537F				P00736	C1R_HUMAN	complement component 1, r subcomponent	589	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|immune response (GO:0006955)|innate immune response (GO:0045087)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.L552F(1)		endometrium(4)|kidney(1)|large_intestine(4)|lung(6)|pancreas(1)	16					Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	CATAGCCCATCAAGCCCAGGT	0.567																																							uc010sfy.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1765-1767)TTG>TTC		complement component 1, r subcomponent	Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Immune globulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)						55.0	56.0	56.0					12																	7188187		2086	4223	6309	SO:0001583	missense	715				complement activation, classical pathway|innate immune response|proteolysis	extracellular region	calcium ion binding|serine-type endopeptidase activity	g.chr12:7188187C>G	M14058		12p13.31	2014-05-14			ENSG00000159403	ENSG00000159403	3.4.21.41	"""Complement system"""	1246	protein-coding gene	gene with protein product		613785					Standard	NM_001733		Approved		uc010sfy.2	P00736	OTTHUMG00000168149	ENST00000542285.1:c.1611G>C	12.37:g.7188187C>G	ENSP00000438615:p.Leu537Phe		Somatic					p.L589F	NM_001733	NP_001724	WXS	Illumina HiSeq	Unspecified	P00736	C1R_HUMAN			10	1826	-			589			Peptidase S1.		A6NJQ8|Q68D77|Q8J012	Missense_Mutation	SNP	ENST00000542285.1	37	c.1767G>C		.	.	.	.	.	.	.	.	.	.	C	2.599	-0.293469	0.05568	.	.	ENSG00000159403	ENST00000290575;ENST00000542285	D	0.88741	-2.42	5.64	1.55	0.23275	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.570777	0.15982	N	0.235235	T	0.76292	0.3967	.	.	.	0.21220	N	0.99976	B	0.06786	0.001	B	0.09377	0.004	T	0.56811	-0.7917	9	0.10111	T	0.7	.	9.6522	0.39904	0.1527:0.3734:0.4739:0.0	.	589	P00736	C1R_HUMAN	F	552;537	ENSP00000438615:L537F	ENSP00000290575:L552F	L	-	3	2	C1R	7058442	0.490000	0.26012	0.983000	0.44433	0.579000	0.36224	0.237000	0.17985	0.297000	0.22615	-0.165000	0.13383	TTG		0.567	C1R-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_001733		8	23	0	0	0	1	0	8	23				
PDZRN4	29951	broad.mit.edu	37	12	41967475	41967475	+	Missense_Mutation	SNP	G	G	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr12:41967475G>A	ENST00000402685.2	+	10	2902	c.2894G>A	c.(2893-2895)cGa>cAa	p.R965Q	PDZRN4_ENST00000298919.7_Missense_Mutation_p.R705Q|PDZRN4_ENST00000539469.2_Missense_Mutation_p.R707Q	NM_001164595.1	NP_001158067.1	Q6ZMN7	PZRN4_HUMAN	PDZ domain containing ring finger 4	965							ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R707Q(2)|p.R965Q(1)		breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	77	all_cancers(12;0.000673)	Lung NSC(34;0.0205)|all_lung(34;0.0264)				TTCATGATGCGAAGCAGGTTA	0.507																																							uc010skn.1		NA																	3	Substitution - Missense(3)		lung(2)|large_intestine(1)	lung(3)|skin(3)|ovary(2)|large_intestine(1)|kidney(1)|pancreas(1)	11						c.(2296-2298)CGA>CAA		PDZ domain containing RING finger 4 isoform 2							69.0	64.0	66.0					12																	41967475		2203	4300	6503	SO:0001583	missense	29951						ubiquitin-protein ligase activity|zinc ion binding	g.chr12:41967475G>A	AK094690	CCDS8739.1, CCDS53777.1	12q12	2008-08-14	2008-08-14			ENSG00000165966		"""RING-type (C3HC4) zinc fingers"""	30552	protein-coding gene	gene with protein product	"""similar to semaF cytoplasmic domain associated protein 3"""	609730				11230166, 15010864	Standard	NM_013377		Approved	DKFZp434B0417, LNX4, FLJ33777, IMAGE5767589	uc010skn.2	Q6ZMN7		ENST00000402685.2:c.2894G>A	12.37:g.41967475G>A	ENSP00000384197:p.Arg965Gln		Somatic				PDZRN4_uc001rmq.3_Missense_Mutation_p.R707Q|PDZRN4_uc009zjz.2_Missense_Mutation_p.R705Q|PDZRN4_uc001rmr.2_Missense_Mutation_p.R592Q	p.R766Q	NM_013377	NP_037509	WXS	Illumina HiSeq	Unspecified	Q6ZMN7	PZRN4_HUMAN			10	2365	+	all_cancers(12;0.000673)	Lung NSC(34;0.0205)|all_lung(34;0.0264)	965					Q52LY3|Q52LY4|Q6N052|Q8IUU1|Q9NTP7	Missense_Mutation	SNP	ENST00000402685.2	37	c.2297G>A	CCDS53777.1	.	.	.	.	.	.	.	.	.	.	G	1.545	-0.540706	0.04053	.	.	ENSG00000165966	ENST00000402685;ENST00000539469;ENST00000298919	T;T;T	0.75704	-0.96;-0.96;-0.96	4.9	4.9	0.64082	.	0.000000	0.64402	D	0.000001	T	0.40719	0.1128	N	0.00801	-1.175	0.80722	D	1	P;B;B	0.45986	0.87;0.032;0.032	B;B;B	0.36504	0.226;0.012;0.012	T	0.61387	-0.7073	10	0.02654	T	1	-25.0878	18.9769	0.92740	0.0:0.0:1.0:0.0	.	965;705;707	Q6ZMN7;Q6ZMN7-4;Q6ZMN7-2	PZRN4_HUMAN;.;.	Q	965;707;705	ENSP00000384197:R965Q;ENSP00000439990:R707Q;ENSP00000298919:R705Q	ENSP00000298919:R705Q	R	+	2	0	PDZRN4	40253742	1.000000	0.71417	1.000000	0.80357	0.325000	0.28411	4.735000	0.62051	2.656000	0.90262	0.557000	0.71058	CGA		0.507	PDZRN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403701.1	NM_013377		5	16	0	0	0	1	0	5	16				
PUS7L	83448	broad.mit.edu	37	12	44124206	44124206	+	Silent	SNP	C	C	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr12:44124206C>T	ENST00000416848.2	-	9	2567	c.2079G>A	c.(2077-2079)ctG>ctA	p.L693L	PUS7L_ENST00000431332.3_Silent_p.L380L|PUS7L_ENST00000551923.1_Silent_p.L693L|PUS7L_ENST00000344862.5_Silent_p.L693L	NM_001098615.1|NM_001271826.1	NP_001092085.1|NP_001258755.1	Q9H0K6	PUS7L_HUMAN	pseudouridylate synthase 7 homolog (S. cerevisiae)-like	693					pseudouridine synthesis (GO:0001522)|tRNA processing (GO:0008033)		pseudouridine synthase activity (GO:0009982)|RNA binding (GO:0003723)	p.L693L(1)		NS(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(15)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	all_cancers(12;0.00027)	Lung NSC(34;0.114)|all_lung(34;0.24)		GBM - Glioblastoma multiforme(48;0.0402)		TTATTTCCTTCAGACAAACGG	0.373																																							uc001rnq.3		NA																	1	Substitution - coding silent(1)		lung(1)	pancreas(1)	1						c.(2077-2079)CTG>CTA		pseudouridylate synthase 7 homolog (S.							78.0	74.0	75.0					12																	44124206		2203	4300	6503	SO:0001819	synonymous_variant	83448				pseudouridine synthesis|tRNA processing		pseudouridine synthase activity|RNA binding	g.chr12:44124206C>T	BX647494	CCDS8743.1, CCDS61104.1	12q12	2006-02-07				ENSG00000129317			25276	protein-coding gene	gene with protein product						11230166	Standard	NM_001098615		Approved	DKFZP434G1415	uc001rnr.5	Q9H0K6	OTTHUMG00000169423	ENST00000416848.2:c.2079G>A	12.37:g.44124206C>T			Somatic				PUS7L_uc001rnr.3_Silent_p.L693L|PUS7L_uc001rns.3_Silent_p.L693L|PUS7L_uc009zkb.2_Silent_p.L380L	p.L693L	NM_001098615	NP_001092085	WXS	Illumina HiSeq	Unspecified	Q9H0K6	PUS7L_HUMAN		GBM - Glioblastoma multiforme(48;0.0402)	9	2568	-	all_cancers(12;0.00027)	Lung NSC(34;0.114)|all_lung(34;0.24)	693					B3KUJ1|Q05CU0|Q6AHZ3|Q6NUP2	Silent	SNP	ENST00000416848.2	37	c.2079G>A	CCDS8743.1																																																																																				0.373	PUS7L-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403931.1	NM_031292		15	34	0	0	0	1	0	15	34				
HDAC7	51564	broad.mit.edu	37	12	48179570	48179570	+	Missense_Mutation	SNP	A	A	G			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr12:48179570A>G	ENST00000427332.2	-	23	2710	c.2554T>C	c.(2554-2556)Tct>Cct	p.S852P	HDAC7_ENST00000354334.3_Missense_Mutation_p.S854P|HDAC7_ENST00000080059.7_Missense_Mutation_p.S891P|AC004466.1_ENST00000599515.1_3'UTR|HDAC7_ENST00000552960.1_Missense_Mutation_p.S874P|HDAC7_ENST00000380610.4_Missense_Mutation_p.S908P			Q8WUI4	HDAC7_HUMAN	histone deacetylase 7	852	Histone deacetylase.				cell-cell junction assembly (GO:0007043)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	14-3-3 protein binding (GO:0071889)|activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein kinase binding (GO:0019901)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)	p.S852P(1)		breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25				GBM - Glioblastoma multiforme(48;0.137)		CAGGCCTCAGAGGCGTCACAG	0.602																																							uc010slo.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)|breast(1)	2						c.(2671-2673)TCT>CCT		histone deacetylase 7 isoform a							43.0	32.0	36.0					12																	48179570		2203	4300	6503	SO:0001583	missense	51564				negative regulation of interleukin-2 production|negative regulation of osteoblast differentiation|positive regulation of cell migration involved in sprouting angiogenesis|transcription, DNA-dependent	cytoplasm|histone deacetylase complex	activating transcription factor binding|histone deacetylase activity (H3-K16 specific)|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|protein kinase C binding|repressing transcription factor binding	g.chr12:48179570A>G	AF239243	CCDS8756.2, CCDS41776.1	12q13.1	2008-02-25	2008-02-25	2008-02-25	ENSG00000061273	ENSG00000061273			14067	protein-coding gene	gene with protein product		606542	"""histone deacetylase 7A"""	HDAC7A		10922406, 10640276	Standard	NM_015401		Approved	DKFZP586J0917	uc010slo.2	Q8WUI4	OTTHUMG00000152968	ENST00000427332.2:c.2554T>C	12.37:g.48179570A>G	ENSP00000404394:p.Ser852Pro		Somatic				HDAC7_uc009zku.2_RNA|HDAC7_uc001rqe.2_Missense_Mutation_p.S325P|HDAC7_uc001rqj.3_Missense_Mutation_p.S854P|HDAC7_uc001rqk.3_Missense_Mutation_p.S874P|HDAC7_uc010slp.1_Missense_Mutation_p.S135P	p.S891P	NM_015401	NP_056216	WXS	Illumina HiSeq	Unspecified	Q8WUI4	HDAC7_HUMAN		GBM - Glioblastoma multiforme(48;0.137)	23	2866	-			852			Histone deacetylase.		B3KY08|B4DWI0|B4E0Q5|Q6P1W9|Q6W9G7|Q7Z4K2|Q7Z5I1|Q96K01|Q9BR73|Q9H7L0|Q9NW41|Q9NWA9|Q9NYK9|Q9UFU7	Missense_Mutation	SNP	ENST00000427332.2	37	c.2671T>C		.	.	.	.	.	.	.	.	.	.	A	23.3	4.393561	0.83011	.	.	ENSG00000061273	ENST00000080059;ENST00000354334;ENST00000552960;ENST00000380610;ENST00000427332	T;T;T;T;T	0.70516	-0.49;-0.49;-0.49;-0.49;-0.49	4.25	4.25	0.50352	Histone deacetylase domain (2);	0.000000	0.85682	D	0.000000	D	0.83839	0.5341	M	0.85373	2.75	0.80722	D	1	D;D;D;D	0.76494	0.996;0.997;0.997;0.999	P;P;P;D	0.70487	0.906;0.9;0.848;0.969	D	0.86254	0.1651	10	0.62326	D	0.03	.	12.6905	0.56972	1.0:0.0:0.0:0.0	.	852;891;874;854	Q8WUI4;Q8WUI4-5;Q8WUI4-6;Q8WUI4-7	HDAC7_HUMAN;.;.;.	P	891;854;874;908;852	ENSP00000080059:S891P;ENSP00000351326:S854P;ENSP00000448532:S874P;ENSP00000369984:S908P;ENSP00000404394:S852P	ENSP00000080059:S891P	S	-	1	0	HDAC7	46465837	1.000000	0.71417	0.992000	0.48379	0.990000	0.78478	9.104000	0.94239	1.950000	0.56595	0.444000	0.29173	TCT		0.602	HDAC7-013	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000328804.2			3	4	0	0	0	1	0	3	4				
SUOX	6821	broad.mit.edu	37	12	56398128	56398128	+	Missense_Mutation	SNP	G	G	C			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr12:56398128G>C	ENST00000394109.3	+	3	1679	c.955G>C	c.(955-957)Gag>Cag	p.E319Q	SUOX_ENST00000551841.2_3'UTR|SUOX_ENST00000394115.2_Missense_Mutation_p.E319Q|SUOX_ENST00000548274.1_Missense_Mutation_p.E319Q|SUOX_ENST00000266971.3_Missense_Mutation_p.E319Q|SUOX_ENST00000356124.4_Missense_Mutation_p.E319Q			P51687	SUOX_HUMAN	sulfite oxidase	319	Moco domain. {ECO:0000250}.				cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|sulfide oxidation, using sulfide:quinone oxidoreductase (GO:0070221)|sulfur amino acid catabolic process (GO:0000098)|sulfur amino acid metabolic process (GO:0000096)	mitochondrial matrix (GO:0005759)	electron carrier activity (GO:0009055)|heme binding (GO:0020037)|molybdenum ion binding (GO:0030151)|molybdopterin cofactor binding (GO:0043546)|sulfite oxidase activity (GO:0008482)	p.E319Q(1)		central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(6)	15			UCEC - Uterine corpus endometrioid carcinoma (6;0.0471)|OV - Ovarian serous cystadenocarcinoma(18;0.119)			CGTCTGCTTTGAGGGACTGGA	0.602																																							uc001six.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(955-957)GAG>CAG		sulfite oxidase precursor							51.0	46.0	48.0					12																	56398128		2203	4300	6503	SO:0001583	missense	6821					mitochondrial intermembrane space	electron carrier activity|molybdenum ion binding|sulfite oxidase activity	g.chr12:56398128G>C	BC065193	CCDS8901.2	12q13.13	2011-02-10			ENSG00000139531	ENSG00000139531	1.8.3.1		11460	protein-coding gene	gene with protein product		606887				7599189	Standard	XM_005269112		Approved		uc001siz.3	P51687	OTTHUMG00000128503	ENST00000394109.3:c.955G>C	12.37:g.56398128G>C	ENSP00000377668:p.Glu319Gln		Somatic				SUOX_uc001siy.2_Missense_Mutation_p.E319Q|SUOX_uc001siz.2_Missense_Mutation_p.E319Q|SUOX_uc001sja.2_Missense_Mutation_p.E319Q	p.E319Q	NM_000456	NP_000447	WXS	Illumina HiSeq	Unspecified	P51687	SUOX_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (6;0.0471)|OV - Ovarian serous cystadenocarcinoma(18;0.119)		6	1281	+			319			Molybdenum-pterin domain (By similarity).			Missense_Mutation	SNP	ENST00000394109.3	37	c.955G>C	CCDS8901.2	.	.	.	.	.	.	.	.	.	.	G	22.6	4.306267	0.81247	.	.	ENSG00000139531	ENST00000356124;ENST00000266971;ENST00000394115;ENST00000548274;ENST00000394109	D;D;D;D;D	0.94650	-3.48;-3.48;-3.48;-3.48;-3.48	5.11	5.11	0.69529	Oxidoreductase, molybdopterin-binding domain (3);	0.113820	0.56097	D	0.000028	D	0.97188	0.9081	M	0.87381	2.88	0.80722	D	1	D	0.58970	0.984	P	0.60682	0.878	D	0.97289	0.9923	10	0.59425	D	0.04	-0.1032	17.8518	0.88748	0.0:0.0:1.0:0.0	.	319	P51687	SUOX_HUMAN	Q	319	ENSP00000348440:E319Q;ENSP00000266971:E319Q;ENSP00000377674:E319Q;ENSP00000450245:E319Q;ENSP00000377668:E319Q	ENSP00000266971:E319Q	E	+	1	0	SUOX	54684395	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.678000	0.91211	2.832000	0.97577	0.585000	0.79938	GAG		0.602	SUOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250309.1	NM_000456		17	22	0	0	0	1	0	17	22				
CAND1	55832	broad.mit.edu	37	12	67699360	67699360	+	Missense_Mutation	SNP	T	T	C			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr12:67699360T>C	ENST00000545606.1	+	10	2349	c.1912T>C	c.(1912-1914)Tca>Cca	p.S638P		NM_018448.3	NP_060918.2	Q86VP6	CAND1_HUMAN	cullin-associated and neddylation-dissociated 1	638					cell differentiation (GO:0030154)|negative regulation of catalytic activity (GO:0043086)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|protein ubiquitination (GO:0016567)|SCF complex assembly (GO:0010265)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)		p.S638P(1)		NS(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(12)|prostate(1)|skin(2)|stomach(1)	35			GBM - Glioblastoma multiforme(1;1.13e-10)|Lung(24;0.000342)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(28;0.0279)		GATTGCTGGGTCACCTTTGAA	0.413																																							uc001stn.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)|skin(1)	2						c.(1912-1914)TCA>CCA		TIP120 protein							104.0	108.0	107.0					12																	67699360		2203	4300	6503	SO:0001583	missense	55832				cell differentiation|negative regulation of catalytic activity|protein ubiquitination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|ubiquitin ligase complex	protein binding	g.chr12:67699360T>C		CCDS8977.1	12q14	2008-02-05			ENSG00000111530	ENSG00000111530			30688	protein-coding gene	gene with protein product	"""TBP interacting protein"""	607727				10048485, 8954946	Standard	NM_018448		Approved	TIP120A, DKFZp434M1414, KIAA0829, TIP120	uc001stn.2	Q86VP6	OTTHUMG00000169060	ENST00000545606.1:c.1912T>C	12.37:g.67699360T>C	ENSP00000442318:p.Ser638Pro		Somatic				CAND1_uc001sto.2_Missense_Mutation_p.S148P	p.S638P	NM_018448	NP_060918	WXS	Illumina HiSeq	Unspecified	Q86VP6	CAND1_HUMAN	GBM - Glioblastoma multiforme(1;1.13e-10)|Lung(24;0.000342)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(28;0.0279)	10	2349	+			638			HEAT 14.		B2RAU3|O94918|Q6PIY4|Q8NDJ4|Q96JZ9|Q96T19|Q9BTC4|Q9H0G2|Q9P0H7|Q9UF85	Missense_Mutation	SNP	ENST00000545606.1	37	c.1912T>C	CCDS8977.1	.	.	.	.	.	.	.	.	.	.	T	18.16	3.561982	0.65538	.	.	ENSG00000111530	ENST00000545606;ENST00000299218;ENST00000544619	T;T	0.54279	0.58;0.58	5.83	5.83	0.93111	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.77343	0.4116	M	0.89095	3.005	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.81406	-0.0947	9	.	.	.	-10.5998	16.1946	0.82018	0.0:0.0:0.0:1.0	.	470;638	Q86VP6-2;Q86VP6	.;CAND1_HUMAN	P	638;638;178	ENSP00000442318:S638P;ENSP00000444089:S178P	.	S	+	1	0	CAND1	65985627	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.981000	0.88123	2.228000	0.72767	0.528000	0.53228	TCA		0.413	CAND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402105.1	NM_018448		35	89	0	0	0	1	0	35	89				
DUSP6	1848	broad.mit.edu	37	12	89743067	89743067	+	Missense_Mutation	SNP	C	C	G			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr12:89743067C>G	ENST00000279488.7	-	3	2341	c.1110G>C	c.(1108-1110)caG>caC	p.Q370H	DUSP6_ENST00000547140.1_5'Flank|DUSP6_ENST00000308385.6_Missense_Mutation_p.Q224H|DUSP6_ENST00000547291.1_Missense_Mutation_p.Q245H	NM_001946.2	NP_001937.2	Q16828	DUS6_HUMAN	dual specificity phosphatase 6	370	Tyrosine-protein phosphatase.				cell differentiation (GO:0030154)|dorsal/ventral pattern formation (GO:0009953)|inactivation of MAPK activity (GO:0000188)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of apoptotic process (GO:0043065)|regulation of endodermal cell fate specification (GO:0042663)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of heart growth (GO:0060420)|response to drug (GO:0042493)|response to nitrosative stress (GO:0051409)|response to organic cyclic compound (GO:0014070)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|protein tyrosine phosphatase activity (GO:0004725)	p.Q370H(1)		large_intestine(5)|lung(8)|skin(2)|urinary_tract(1)	16						GGTATACATTCTGGTTGGAAG	0.547																																					Colon(132;3456 5224)	Colon(132;3456 5224)	uc001tay.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1108-1110)CAG>CAC		dual specificity phosphatase 6 isoform a							141.0	139.0	140.0					12																	89743067		2203	4300	6503	SO:0001583	missense	1848				dorsal/ventral pattern formation|inactivation of MAPK activity|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of ERK1 and ERK2 cascade|nerve growth factor receptor signaling pathway|positive regulation of apoptosis|regulation of endodermal cell fate specification|regulation of fibroblast growth factor receptor signaling pathway|regulation of heart growth|response to nitrosative stress|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	MAP kinase tyrosine/serine/threonine phosphatase activity|protein tyrosine phosphatase activity	g.chr12:89743067C>G	BC037236	CCDS9033.1, CCDS9034.1	12q22-q23	2011-06-09				ENSG00000139318		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3072	protein-coding gene	gene with protein product		602748				8626780, 9205128	Standard	NM_001946		Approved	MKP-3, PYST1	uc001tay.3	Q16828		ENST00000279488.7:c.1110G>C	12.37:g.89743067C>G	ENSP00000279488:p.Gln370His		Somatic				DUSP6_uc001taz.2_Missense_Mutation_p.Q224H	p.Q370H	NM_001946	NP_001937	WXS	Illumina HiSeq	Unspecified	Q16828	DUS6_HUMAN			3	1590	-			370			Tyrosine-protein phosphatase.		O75109|Q53Y75|Q9BSH6	Missense_Mutation	SNP	ENST00000279488.7	37	c.1110G>C	CCDS9033.1	.	.	.	.	.	.	.	.	.	.	C	1.497	-0.552966	0.03996	.	.	ENSG00000139318	ENST00000279488;ENST00000308385;ENST00000547291	T;T;T	0.06687	4.34;3.27;4.11	5.98	5.98	0.97165	.	0.105726	0.64402	D	0.000002	T	0.03220	0.0094	N	0.02011	-0.69	0.50039	D	0.999847	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.52480	-0.8570	10	0.15066	T	0.55	.	10.7388	0.46141	0.0:0.8599:0.0:0.1401	.	224;370	Q16828-2;Q16828	.;DUS6_HUMAN	H	370;224;245	ENSP00000279488:Q370H;ENSP00000307835:Q224H;ENSP00000449838:Q245H	ENSP00000279488:Q370H	Q	-	3	2	DUSP6	88267198	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.603000	0.54074	2.835000	0.97688	0.650000	0.86243	CAG		0.547	DUSP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406534.2	NM_001946, NM_022652		30	56	0	0	0	1	0	30	56				
TMEM132D	121256	broad.mit.edu	37	12	129558864	129558864	+	Missense_Mutation	SNP	G	G	C	rs375992244		TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr12:129558864G>C	ENST00000422113.2	-	9	3182	c.2856C>G	c.(2854-2856)ttC>ttG	p.F952L	TMEM132D_ENST00000389441.4_Missense_Mutation_p.F490L	NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	952					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)		p.F952L(1)		NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		CCTGCTCCTCGAAGGGAACCT	0.463																																							uc009zyl.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(10)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	14						c.(2854-2856)TTC>TTG		transmembrane protein 132D precursor							120.0	108.0	112.0					12																	129558864		2203	4300	6503	SO:0001583	missense	121256					integral to membrane		g.chr12:129558864G>C	AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.2856C>G	12.37:g.129558864G>C	ENSP00000408581:p.Phe952Leu		Somatic				TMEM132D_uc001uia.2_Missense_Mutation_p.F490L	p.F952L	NM_133448	NP_597705	WXS	Illumina HiSeq	Unspecified	Q14C87	T132D_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)	9	3184	-	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)	952			Cytoplasmic (Potential).		Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Missense_Mutation	SNP	ENST00000422113.2	37	c.2856C>G	CCDS9266.1	.	.	.	.	.	.	.	.	.	.	G	3.983	-0.006099	0.07773	.	.	ENSG00000151952	ENST00000389441;ENST00000422113	T;T	0.08546	3.08;3.9	4.14	-6.95	0.01628	.	0.327802	0.26366	N	0.024785	T	0.02418	0.0074	N	0.10782	0.045	0.26169	N	0.979894	B;B	0.12630	0.006;0.001	B;B	0.12837	0.008;0.003	T	0.33777	-0.9855	9	.	.	.	-14.8729	3.0917	0.06296	0.4461:0.2769:0.1843:0.0928	.	952;490	Q14C87;Q14C87-2	T132D_HUMAN;.	L	490;952	ENSP00000374092:F490L;ENSP00000408581:F952L	.	F	-	3	2	TMEM132D	128124817	0.000000	0.05858	0.001000	0.08648	0.941000	0.58515	-3.378000	0.00492	-1.128000	0.02922	0.411000	0.27672	TTC		0.463	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399592.1	NM_133448		32	59	0	0	0	1	0	32	59				
OR4Q3	441669	broad.mit.edu	37	14	20216038	20216038	+	Missense_Mutation	SNP	G	G	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr14:20216038G>A	ENST00000331723.1	+	1	452	c.452G>A	c.(451-453)tGt>tAt	p.C151Y		NM_172194.1	NP_751944.1	Q8NH05	OR4Q3_HUMAN	olfactory receptor, family 4, subfamily Q, member 3	151						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.C151Y(1)		NS(2)|breast(4)|endometrium(3)|kidney(2)|large_intestine(1)|lung(28)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)	47	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		GCCTGCTGGTGTGGGGGTTTT	0.498																																							uc010tkt.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(3)	3						c.(451-453)TGT>TAT		olfactory receptor, family 4, subfamily Q,							89.0	91.0	91.0					14																	20216038		2203	4298	6501	SO:0001583	missense	441669				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr14:20216038G>A	AF179768	CCDS32020.1	14p13	2012-08-09				ENSG00000182652		"""GPCR / Class A : Olfactory receptors"""	15426	protein-coding gene	gene with protein product				OR4Q4			Standard	NM_172194		Approved	C14orf13	uc010tkt.2	Q8NH05		ENST00000331723.1:c.452G>A	14.37:g.20216038G>A	ENSP00000330049:p.Cys151Tyr		Somatic					p.C151Y	NM_172194	NP_751944	WXS	Illumina HiSeq	Unspecified	Q8NH05	OR4Q3_HUMAN	Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)	1	452	+	all_cancers(95;0.00108)		151			Helical; Name=4; (Potential).		Q6IEX4	Missense_Mutation	SNP	ENST00000331723.1	37	c.452G>A	CCDS32020.1	.	.	.	.	.	.	.	.	.	.	.	9.396	1.076836	0.20227	.	.	ENSG00000182652	ENST00000331723	T	0.37058	1.22	4.09	0.988	0.19796	GPCR, rhodopsin-like superfamily (1);	0.403439	0.17772	U	0.162549	T	0.20618	0.0496	N	0.19112	0.55	0.09310	N	0.999999	B	0.20550	0.046	B	0.20384	0.029	T	0.19811	-1.0294	10	0.72032	D	0.01	.	6.2602	0.20895	0.0:0.3238:0.3622:0.3139	.	151	Q8NH05	OR4Q3_HUMAN	Y	151	ENSP00000330049:C151Y	ENSP00000330049:C151Y	C	+	2	0	OR4Q3	19285878	0.000000	0.05858	1.000000	0.80357	0.793000	0.44817	0.935000	0.28924	0.891000	0.36235	0.406000	0.27484	TGT		0.498	OR4Q3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409818.2			14	48	0	0	0	1	0	14	48				
OR4K13	390433	broad.mit.edu	37	14	20502887	20502887	+	Missense_Mutation	SNP	C	C	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr14:20502887C>T	ENST00000315693.2	-	1	32	c.31G>A	c.(31-33)Gaa>Aaa	p.E11K	AL359218.1_ENST00000580563.1_RNA	NM_001004714.1	NP_001004714.1	Q8NH42	OR4KD_HUMAN	olfactory receptor, family 4, subfamily K, member 13	11						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.E11K(1)		endometrium(3)|kidney(1)|large_intestine(2)|lung(11)|ovary(3)|skin(4)	24	all_cancers(95;0.00108)		Epithelial(56;4.65e-07)|all cancers(55;2.9e-06)	GBM - Glioblastoma multiforme(265;0.0064)		AAAATAAATTCCGATACCACT	0.373																																							uc010tkz.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(31-33)GAA>AAA		olfactory receptor, family 4, subfamily K,							51.0	54.0	53.0					14																	20502887		2201	4297	6498	SO:0001583	missense	390433				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr14:20502887C>T		CCDS32028.1	14q11.2	2013-09-23			ENSG00000176253	ENSG00000176253		"""GPCR / Class A : Olfactory receptors"""	15351	protein-coding gene	gene with protein product							Standard	NM_001004714		Approved		uc010tkz.2	Q8NH42	OTTHUMG00000170781	ENST00000315693.2:c.31G>A	14.37:g.20502887C>T	ENSP00000319322:p.Glu11Lys		Somatic					p.E11K	NM_001004714	NP_001004714	WXS	Illumina HiSeq	Unspecified	Q8NH42	OR4KD_HUMAN	Epithelial(56;4.65e-07)|all cancers(55;2.9e-06)	GBM - Glioblastoma multiforme(265;0.0064)	1	31	-	all_cancers(95;0.00108)		11			Extracellular (Potential).		Q6IF13	Missense_Mutation	SNP	ENST00000315693.2	37	c.31G>A	CCDS32028.1	.	.	.	.	.	.	.	.	.	.	.	15.48	2.845779	0.51164	.	.	ENSG00000176253	ENST00000315693	T	0.01119	5.31	3.52	3.52	0.40303	.	0.000000	0.32578	U	0.005917	T	0.02727	0.0082	M	0.83603	2.65	0.09310	N	0.999997	P	0.35192	0.489	B	0.34138	0.176	T	0.15378	-1.0439	10	0.72032	D	0.01	.	13.9607	0.64177	0.0:1.0:0.0:0.0	.	11	Q8NH42	OR4KD_HUMAN	K	11	ENSP00000319322:E11K	ENSP00000319322:E11K	E	-	1	0	OR4K13	19572727	0.053000	0.20554	0.044000	0.18714	0.010000	0.07245	0.720000	0.25896	1.811000	0.52892	0.430000	0.28490	GAA		0.373	OR4K13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410344.1			8	30	0	0	0	1	0	8	30				
KIAA0391	9692	broad.mit.edu	37	14	35739633	35739633	+	Missense_Mutation	SNP	A	A	G			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr14:35739633A>G	ENST00000557565.1	+	7	1832	c.1451A>G	c.(1450-1452)tAt>tGt	p.Y484C	KIAA0391_ENST00000534898.4_Missense_Mutation_p.Y484C|KIAA0391_ENST00000605870.1_Missense_Mutation_p.Y112C|KIAA0391_ENST00000603544.1_Missense_Mutation_p.Y468C|KIAA0391_ENST00000321130.10_Missense_Mutation_p.Y468C|KIAA0391_ENST00000250377.7_Missense_Mutation_p.Y389C|KIAA0391_ENST00000604948.1_Missense_Mutation_p.Y389C	NM_001282234.1	NP_001269163.1	O15091	MRRP3_HUMAN	KIAA0391	484					tRNA processing (GO:0008033)	mitochondrion (GO:0005739)		p.Y484C(1)		central_nervous_system(1)|endometrium(4)|large_intestine(2)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	14	Breast(36;0.0545)|Hepatocellular(127;0.158)|Prostate(35;0.184)		Lung(238;2.93e-05)|LUAD - Lung adenocarcinoma(48;3.86e-05)|Epithelial(34;0.0114)|all cancers(34;0.0277)	GBM - Glioblastoma multiforme(112;0.0593)		TTCCTTCTGTATGCCACACTG	0.512																																							uc001wsy.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1450-1452)TAT>TGT		mitochondrial RNase P protein 3 precursor							161.0	134.0	143.0					14																	35739633		2203	4300	6503	SO:0001583	missense	9692				tRNA processing	mitochondrion		g.chr14:35739633A>G	AB002389	CCDS32063.1, CCDS58312.1, CCDS58313.1, CCDS58314.1	14q13.2	2013-06-18			ENSG00000100890	ENSG00000100890			19958	protein-coding gene	gene with protein product	"""mitochondrial RNase P subunit 3"", ""proteinaceous RNase P"""	609947				9205841, 18984158	Standard	NM_001256678		Approved	MRPP3, PRORP	uc001wsy.2	O15091		ENST00000557565.1:c.1451A>G	14.37:g.35739633A>G	ENSP00000454657:p.Tyr484Cys		Somatic				KIAA0391_uc010tps.1_Missense_Mutation_p.Y389C|KIAA0391_uc001wsz.1_Missense_Mutation_p.Y468C|KIAA0391_uc001wta.2_RNA|KIAA0391_uc001wtb.1_Missense_Mutation_p.Y468C|KIAA0391_uc001wtc.1_Missense_Mutation_p.Y112C	p.Y484C	NM_014672	NP_055487	WXS	Illumina HiSeq	Unspecified	O15091	MRRP3_HUMAN	Lung(238;2.93e-05)|LUAD - Lung adenocarcinoma(48;3.86e-05)|Epithelial(34;0.0114)|all cancers(34;0.0277)	GBM - Glioblastoma multiforme(112;0.0593)	7	1811	+	Breast(36;0.0545)|Hepatocellular(127;0.158)|Prostate(35;0.184)		484					B4DXD9|B4E0S8|B4E211|C4AM93|D3DS99|D3DSA1|Q86SZ4|Q86YB5|Q8N5L5	Missense_Mutation	SNP	ENST00000557565.1	37	c.1451A>G	CCDS32063.1	.	.	.	.	.	.	.	.	.	.	A	24.0	4.477404	0.84640	.	.	ENSG00000100890	ENST00000554896;ENST00000250377;ENST00000321130;ENST00000534898;ENST00000556121;ENST00000556912;ENST00000557404	T;T;T;T	0.64260	0.22;-0.09;0.14;0.99	5.46	5.46	0.80206	.	0.000000	0.64402	D	0.000001	T	0.76162	0.3949	M	0.78223	2.4	0.80722	D	1	D;D	0.57899	0.981;0.981	P;P	0.59288	0.855;0.855	T	0.78816	-0.2055	10	0.54805	T	0.06	-13.5124	14.8123	0.70006	1.0:0.0:0.0:0.0	.	468;484	O15091-2;O15091	.;MRRP3_HUMAN	C	389;389;468;484;468;112;112	ENSP00000250377:Y389C;ENSP00000324697:Y468C;ENSP00000440915:Y484C;ENSP00000450898:Y112C	ENSP00000250377:Y389C	Y	+	2	0	KIAA0391	34809384	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.023000	0.76437	2.199000	0.70637	0.402000	0.26972	TAT		0.512	KIAA0391-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	nonsense_mediated_decay	protein_coding	OTTHUMT00000411280.1	NM_014672		19	46	0	0	0	1	0	19	46				
NKX2-1	7080	broad.mit.edu	37	14	36988447	36988447	+	Missense_Mutation	SNP	G	G	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr14:36988447G>A	ENST00000518149.1	-	2	721	c.116C>T	c.(115-117)gCg>gTg	p.A39V	NKX2-1_ENST00000522719.2_Missense_Mutation_p.A39V|NKX2-1-AS1_ENST00000521292.2_RNA|RP11-896J10.3_ENST00000521945.1_RNA|NKX2-1_ENST00000498187.2_Missense_Mutation_p.A39V|NKX2-1_ENST00000354822.5_Missense_Mutation_p.A69V			P43699	NKX21_HUMAN	NK2 homeobox 1	39					anatomical structure formation involved in morphogenesis (GO:0048646)|axon guidance (GO:0007411)|brain development (GO:0007420)|cerebral cortex cell migration (GO:0021795)|cerebral cortex GABAergic interneuron differentiation (GO:0021892)|Clara cell differentiation (GO:0060486)|developmental induction (GO:0031128)|endoderm development (GO:0007492)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|forebrain development (GO:0030900)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain neuron fate commitment (GO:0021877)|globus pallidus development (GO:0021759)|hippocampus development (GO:0021766)|Leydig cell differentiation (GO:0033327)|locomotory behavior (GO:0007626)|lung development (GO:0030324)|lung saccule development (GO:0060430)|menarche (GO:0042696)|negative regulation of cell migration (GO:0030336)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron migration (GO:0001764)|oligodendrocyte differentiation (GO:0048709)|phospholipid metabolic process (GO:0006644)|pituitary gland development (GO:0021983)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|rhythmic process (GO:0048511)|thyroid gland development (GO:0030878)|Type II pneumocyte differentiation (GO:0060510)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.A39V(1)		large_intestine(1)|lung(3)|skin(1)|upper_aerodigestive_tract(2)	7	all_cancers(3;4.47e-51)|Hepatocellular(127;0.158)|Esophageal squamous(585;0.164)|Breast(36;0.165)		Lung(8;1.8e-08)|LUAD - Lung adenocarcinoma(9;2.16e-07)|Epithelial(34;0.014)|all cancers(34;0.0366)|LUSC - Lung squamous cell carcinoma(13;0.132)	GBM - Glioblastoma multiforme(112;0.0171)		CCTGTACGCCGCCAGCGGAGC	0.682			A		NSCLC																																		uc001wtt.2		NA		Dom	yes		14	14q13	7080	A	NK2 homeobox 1			E			NSCLC		1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(115-117)GCG>GTG		thyroid transcription factor 1 isoform 2							7.0	9.0	8.0					14																	36988447		2134	4217	6351	SO:0001583	missense	7080				epithelial tube branching involved in lung morphogenesis|globus pallidus development|negative regulation of cell migration|negative regulation of epithelial to mesenchymal transition|negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to hormone stimulus|thyroid gland development		protein binding|transcription regulatory region DNA binding	g.chr14:36988447G>A		CCDS9659.1, CCDS41945.1	14q13.3	2012-03-09	2007-07-26	2007-07-26	ENSG00000136352	ENSG00000136352		"""Homeoboxes / ANTP class : NKL subclass"""	11825	protein-coding gene	gene with protein product		600635	"""benign chorea"", ""thyroid transcription factor 1"""	NKX2A, BCH, TITF1		1976511	Standard	NM_001079668		Approved	TTF-1, TTF1	uc001wtu.3	P43699	OTTHUMG00000140225	ENST00000518149.1:c.116C>T	14.37:g.36988447G>A	ENSP00000428341:p.Ala39Val		Somatic				SFTA3_uc001wts.2_Intron|NKX2-1_uc001wtu.2_Missense_Mutation_p.A69V|NKX2-1_uc001wtv.2_Missense_Mutation_p.A39V|uc001wtw.1_5'Flank	p.A39V	NM_003317	NP_003308	WXS	Illumina HiSeq	Unspecified	P43699	NKX21_HUMAN	Lung(8;1.8e-08)|LUAD - Lung adenocarcinoma(9;2.16e-07)|Epithelial(34;0.014)|all cancers(34;0.0366)|LUSC - Lung squamous cell carcinoma(13;0.132)	GBM - Glioblastoma multiforme(112;0.0171)	1	457	-	all_cancers(3;4.47e-51)|Hepatocellular(127;0.158)|Esophageal squamous(585;0.164)|Breast(36;0.165)		39					D3DSA3|O14954|O14955|Q7KZF6|Q9BRJ8	Missense_Mutation	SNP	ENST00000518149.1	37	c.116C>T	CCDS9659.1	.	.	.	.	.	.	.	.	.	.	G	18.27	3.586320	0.66105	.	.	ENSG00000136352	ENST00000354822;ENST00000498187;ENST00000518149;ENST00000522719	T;T;T;T	0.71341	-0.56;-0.56;-0.56;-0.56	5.12	5.12	0.69794	.	0.272597	0.35436	N	0.003205	T	0.64983	0.2648	L	0.51422	1.61	0.54753	D	0.999984	P;P	0.46706	0.883;0.814	B;B	0.37091	0.241;0.122	T	0.68398	-0.5419	10	0.39692	T	0.17	.	18.5237	0.90963	0.0:0.0:1.0:0.0	.	69;39	P43699-3;P43699	.;NKX21_HUMAN	V	69;39;39;39	ENSP00000346879:A69V;ENSP00000429607:A39V;ENSP00000428341:A39V;ENSP00000429519:A39V	ENSP00000346879:A69V	A	-	2	0	NKX2-1	36058198	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.391000	0.79828	2.381000	0.81170	0.462000	0.41574	GCG		0.682	NKX2-1-004	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376225.2	NM_003317		9	26	0	0	0	1	0	9	26				
C14orf37	145407	broad.mit.edu	37	14	58599890	58599890	+	Silent	SNP	C	C	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr14:58599890C>A	ENST00000267485.7	-	3	1733	c.1539G>T	c.(1537-1539)ctG>ctT	p.L513L	C14orf37_ENST00000334342.5_5'UTR	NM_001001872.2	NP_001001872.2	Q86TY3	CN037_HUMAN	chromosome 14 open reading frame 37	513						integral component of membrane (GO:0016021)		p.L513L(1)		breast(7)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(16)|pancreas(1)|skin(1)	33						ATCTTCTTGACAGCTGAGTAA	0.498																																							uc001xdc.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1537-1539)CTG>CTT		hypothetical protein LOC145407 precursor							112.0	113.0	113.0					14																	58599890		2203	4300	6503	SO:0001819	synonymous_variant	145407					integral to membrane	binding	g.chr14:58599890C>A		CCDS32089.1	14q23.1	2012-09-03			ENSG00000139971	ENSG00000139971			19846	protein-coding gene	gene with protein product							Standard	NM_001001872		Approved		uc001xdc.3	Q86TY3	OTTHUMG00000171173	ENST00000267485.7:c.1539G>T	14.37:g.58599890C>A			Somatic				C14orf37_uc010tro.1_Silent_p.L551L|C14orf37_uc001xdd.2_Silent_p.L513L|C14orf37_uc001xde.2_Silent_p.L513L	p.L513L	NM_001001872	NP_001001872	WXS	Illumina HiSeq	Unspecified	Q86TY3	CN037_HUMAN			3	1650	-			513			Extracellular (Potential).		A8K8Z8|Q6P5Q1|Q86TY1	Silent	SNP	ENST00000267485.7	37	c.1539G>T	CCDS32089.1																																																																																				0.498	C14orf37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412059.1	NM_001001872		22	55	1	0	1.10513e-12	1	1.20495e-12	22	55				
ATP6V1D	51382	broad.mit.edu	37	14	67807182	67807182	+	Missense_Mutation	SNP	C	C	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr14:67807182C>T	ENST00000216442.7	-	8	1127	c.577G>A	c.(577-579)Gag>Aag	p.E193K	Y_RNA_ENST00000362885.1_RNA|ATP6V1D_ENST00000555431.1_Missense_Mutation_p.E138K|ATP6V1D_ENST00000555474.1_Missense_Mutation_p.E94K|ATP6V1D_ENST00000553974.1_5'Flank|ATP6V1D_ENST00000554236.1_Missense_Mutation_p.M170I	NM_015994.3	NP_057078.1	Q9Y5K8	VATD_HUMAN	ATPase, H+ transporting, lysosomal 34kDa, V1 subunit D	193					cellular iron ion homeostasis (GO:0006879)|cilium assembly (GO:0042384)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|protein localization to cilium (GO:0061512)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|vacuolar proton-transporting V-type ATPase complex (GO:0016471)	ATPase activity, coupled to transmembrane movement of substances (GO:0042626)	p.E193K(1)		lung(3)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	7				all cancers(60;0.000739)|OV - Ovarian serous cystadenocarcinoma(108;0.00597)|BRCA - Breast invasive adenocarcinoma(234;0.00957)		CGCTCTCTCTCATCCAGCTCT	0.358																																							uc001xjf.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|lung(1)	2						c.(577-579)GAG>AAG		H(+)-transporting two-sector ATPase							118.0	115.0	116.0					14																	67807182		2203	4300	6503	SO:0001583	missense	51382				ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytosol|proton-transporting two-sector ATPase complex, catalytic domain|vacuolar proton-transporting V-type ATPase complex	protein binding|proton-transporting ATPase activity, rotational mechanism	g.chr14:67807182C>T	AF145316	CCDS9780.1	14q23-q24.2	2010-04-21	2002-08-29	2002-05-10	ENSG00000100554	ENSG00000100554		"""ATPases / V-type"""	13527	protein-coding gene	gene with protein product		609398	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump)"""	ATP6M		9442887	Standard	NM_015994		Approved	VATD, VMA8	uc001xjf.3	Q9Y5K8		ENST00000216442.7:c.577G>A	14.37:g.67807182C>T	ENSP00000216442:p.Glu193Lys		Somatic				ATP6V1D_uc001xje.2_RNA	p.E193K	NM_015994	NP_057078	WXS	Illumina HiSeq	Unspecified	Q9Y5K8	VATD_HUMAN		all cancers(60;0.000739)|OV - Ovarian serous cystadenocarcinoma(108;0.00597)|BRCA - Breast invasive adenocarcinoma(234;0.00957)	8	753	-			193					B2RE33|Q9Y688	Missense_Mutation	SNP	ENST00000216442.7	37	c.577G>A	CCDS9780.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	37|37	5.981787|5.981787	0.97168|0.97168	.|.	.|.	ENSG00000100554|ENSG00000100554	ENST00000555474;ENST00000216442;ENST00000555431|ENST00000554236	.|.	.|.	.|.	6.17|6.17	6.17|6.17	0.99709|0.99709	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.91143|0.91143	0.7211|0.7211	H|H	0.97874|0.97874	4.095|4.095	0.40813|0.40813	D|D	0.983441|0.983441	D|.	0.76494|.	0.999|.	D|.	0.77004|.	0.989|.	D|D	0.93470|0.93470	0.6818|0.6818	9|5	0.87932|.	D|.	0|.	-17.102|-17.102	20.8794|20.8794	0.99867|0.99867	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	193|.	Q9Y5K8|.	VATD_HUMAN|.	K|I	94;193;138|170	.|.	ENSP00000216442:E193K|.	E|M	-|-	1|3	0|0	ATP6V1D|ATP6V1D	66876935|66876935	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.734000|7.734000	0.84928|0.84928	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	GAG|ATG		0.358	ATP6V1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412511.1	NM_015994		19	36	0	0	0	1	0	19	36				
SIPA1L1	26037	broad.mit.edu	37	14	72139160	72139160	+	Silent	SNP	G	G	A	rs201048906		TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr14:72139160G>A	ENST00000555818.1	+	9	3273	c.2925G>A	c.(2923-2925)gcG>gcA	p.A975A	SIPA1L1_ENST00000537413.1_Silent_p.A450A|SIPA1L1_ENST00000358550.2_Silent_p.A975A|SIPA1L1_ENST00000381232.3_Silent_p.A975A	NM_001284247.1|NM_015556.1	NP_001271176.1|NP_056371.1	O43166	SI1L1_HUMAN	signal-induced proliferation-associated 1 like 1	975	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				actin cytoskeleton reorganization (GO:0031532)|activation of Rap GTPase activity (GO:0032861)|ephrin receptor signaling pathway (GO:0048013)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rap GTPase activity (GO:0032317)|regulation of synaptic plasticity (GO:0048167)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)	p.A975A(1)		NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(1)|large_intestine(22)|liver(2)|lung(25)|ovary(3)|prostate(3)|skin(3)|stomach(1)	78				all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)		GCATTGTGGCGGATGTGGAGC	0.562																																							uc001xms.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|breast(1)	4						c.(2923-2925)GCG>GCA		signal-induced proliferation-associated 1 like		G		0,4406		0,0,2203	110.0	85.0	94.0		2925	-11.5	0.1	14		94	3,8597	3.0+/-9.4	0,3,4297	no	coding-synonymous	SIPA1L1	NM_015556.1		0,3,6500	AA,AG,GG		0.0349,0.0,0.0231		975/1805	72139160	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	26037				actin cytoskeleton reorganization|activation of Rap GTPase activity|regulation of dendritic spine morphogenesis	cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane|synaptosome	GTPase activator activity	g.chr14:72139160G>A	AB007900	CCDS9807.1, CCDS61490.1, CCDS61491.1	14q24.1	2003-12-11				ENSG00000197555			20284	protein-coding gene	gene with protein product						9858596	Standard	XM_005267514		Approved	KIAA0440, E6TP1	uc001xmr.1	O43166		ENST00000555818.1:c.2925G>A	14.37:g.72139160G>A			Somatic				SIPA1L1_uc001xmt.2_Silent_p.A975A|SIPA1L1_uc001xmu.2_Silent_p.A975A|SIPA1L1_uc001xmv.2_Silent_p.A975A|SIPA1L1_uc010ttm.1_Silent_p.A450A	p.A975A	NM_015556	NP_056371	WXS	Illumina HiSeq	Unspecified	O43166	SI1L1_HUMAN		all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)	9	3273	+			975			PDZ.		J3KP19|O95321|Q9UDU4|Q9UNU4	Silent	SNP	ENST00000555818.1	37	c.2925G>A	CCDS9807.1																																																																																				0.562	SIPA1L1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412806.1	NM_015556		23	34	0	0	0	1	0	23	34				
SETD3	84193	broad.mit.edu	37	14	99927677	99927677	+	Splice_Site	SNP	C	C	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr14:99927677C>A	ENST00000331768.5	-	4	356	c.197G>T	c.(196-198)gGt>gTt	p.G66V	SETD3_ENST00000329331.3_Splice_Site_p.G66V|SETD3_ENST00000436070.2_Splice_Site_p.G66V|SETD3_ENST00000453938.1_Intron	NM_032233.2	NP_115609.2	Q86TU7	SETD3_HUMAN	SET domain containing 3	66					histone H3-K36 methylation (GO:0010452)|peptidyl-lysine dimethylation (GO:0018027)|peptidyl-lysine monomethylation (GO:0018026)|peptidyl-lysine trimethylation (GO:0018023)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)	p.G66V(1)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(8)|ovary(1)|skin(1)	25		all_cancers(154;0.224)|all_epithelial(191;0.0644)|Melanoma(154;0.0866)				AACGGACAGACCTATATTAAT	0.373																																							uc001ygc.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(196-198)GGT>GTT		SET domain containing 3 isoform a							79.0	80.0	79.0					14																	99927677		2203	4299	6502	SO:0001630	splice_region_variant	84193				peptidyl-lysine dimethylation|peptidyl-lysine monomethylation|peptidyl-lysine trimethylation|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	histone methyltransferase activity (H3-K36 specific)|transcription coactivator activity	g.chr14:99927677C>A	AK026680	CCDS9951.1, CCDS9952.1	14q32.2	2006-02-15	2006-02-15	2006-02-15	ENSG00000183576	ENSG00000183576			20493	protein-coding gene	gene with protein product		615671	"""chromosome 14 open reading frame 154"""	C14orf154			Standard	NM_032233		Approved	FLJ23027	uc001ygc.3	Q86TU7	OTTHUMG00000028970	ENST00000331768.5:c.197-1G>T	14.37:g.99927677C>A			Somatic				SETD3_uc001ygd.2_Missense_Mutation_p.G66V|SETD3_uc001ygf.2_Missense_Mutation_p.G66V	p.G66V	NM_032233	NP_115609	WXS	Illumina HiSeq	Unspecified	Q86TU7	SETD3_HUMAN			4	367	-		all_cancers(154;0.224)|all_epithelial(191;0.0644)|Melanoma(154;0.0866)	66					A0PJU3|A5PLP0|B4DZE8|Q0VAQ2|Q659C0|Q86TU8|Q96GY9|Q9H5U5	Missense_Mutation	SNP	ENST00000331768.5	37	c.197G>T	CCDS9951.1	.	.	.	.	.	.	.	.	.	.	C	16.97	3.269990	0.59540	.	.	ENSG00000183576	ENST00000331768;ENST00000329331;ENST00000436070	T;T;T	0.23348	2.66;1.91;1.92	5.45	4.55	0.56014	.	0.000000	0.85682	D	0.000000	T	0.46014	0.1371	M	0.62723	1.935	0.80722	D	1	D;D;D	0.89917	0.999;0.996;1.0	D;P;D	0.69142	0.925;0.638;0.962	T	0.33803	-0.9854	10	0.22706	T	0.39	.	16.4316	0.83847	0.0:0.8683:0.1317:0.0	.	66;66;66	Q6NXR6;A0PJU3;Q86TU7	.;.;SETD3_HUMAN	V	66	ENSP00000327436:G66V;ENSP00000327910:G66V;ENSP00000408602:G66V	ENSP00000327910:G66V	G	-	2	0	SETD3	98997430	1.000000	0.71417	1.000000	0.80357	0.767000	0.43475	7.744000	0.85034	1.401000	0.46761	0.655000	0.94253	GGT		0.373	SETD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000072339.3	NM_032233	Missense_Mutation	12	43	1	0	0.00136819	1	0.00139292	12	43				
NPAP1	23742	broad.mit.edu	37	15	24924444	24924444	+	Missense_Mutation	SNP	G	G	C			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr15:24924444G>C	ENST00000329468.2	+	1	3904	c.3430G>C	c.(3430-3432)Gaa>Caa	p.E1144Q		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	1144					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)		p.E1144Q(1)									CTATGGACAAGAAACATATGT	0.448																																							uc001ywo.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|large_intestine(2)|skin(2)|kidney(1)|central_nervous_system(1)	8						c.(3430-3432)GAA>CAA		hypothetical protein LOC23742							105.0	94.0	98.0					15																	24924444		2203	4300	6503	SO:0001583	missense	23742				cell differentiation|multicellular organismal development|spermatogenesis			g.chr15:24924444G>C	AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.3430G>C	15.37:g.24924444G>C	ENSP00000333735:p.Glu1144Gln		Somatic					p.E1144Q	NM_018958	NP_061831	WXS	Illumina HiSeq	Unspecified	Q9NZP6	CO002_HUMAN		all cancers(64;3.19e-24)|Epithelial(43;2.67e-17)|GBM - Glioblastoma multiforme(186;7.36e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000273)|Lung(196;0.229)	1	3904	+		all_cancers(20;2.14e-21)|all_epithelial(15;4.77e-19)|Lung NSC(15;1.43e-14)|all_lung(15;9.57e-14)|Breast(32;0.00086)	1144						Missense_Mutation	SNP	ENST00000329468.2	37	c.3430G>C	CCDS10015.1	.	.	.	.	.	.	.	.	.	.	.	11.84	1.758330	0.31137	.	.	ENSG00000185823	ENST00000329468	T	0.08807	3.05	1.88	0.943	0.19531	.	.	.	.	.	T	0.08626	0.0214	N	0.22421	0.69	0.09310	N	1	D	0.65815	0.995	P	0.51945	0.685	T	0.27706	-1.0066	9	0.87932	D	0	.	4.3108	0.10969	0.2088:0.0:0.7912:0.0	.	1144	Q9NZP6	CO002_HUMAN	Q	1144	ENSP00000333735:E1144Q	ENSP00000333735:E1144Q	E	+	1	0	C15orf2	22475537	0.001000	0.12720	0.001000	0.08648	0.030000	0.12068	0.292000	0.19011	0.363000	0.24346	0.313000	0.20887	GAA		0.448	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251253.1	NM_018958		25	57	0	0	0	1	0	25	57				
ATP10A	57194	broad.mit.edu	37	15	25958906	25958906	+	Silent	SNP	G	G	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr15:25958906G>A	ENST00000356865.6	-	10	2370	c.2259C>T	c.(2257-2259)atC>atT	p.I753I		NM_024490.3	NP_077816.1	O60312	AT10A_HUMAN	ATPase, class V, type 10A	753					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|regulation of cell shape (GO:0008360)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.I753I(1)		NS(1)|breast(2)|endometrium(8)|kidney(2)|large_intestine(33)|liver(1)|lung(41)|ovary(3)|pancreas(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	103		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		GCGGGTGCCGGATCACCACTG	0.602																																							uc010ayu.2		NA																	1	Substitution - coding silent(1)		lung(1)	pancreas(2)|ovary(1)|breast(1)|liver(1)	5						c.(2257-2259)ATC>ATT		ATPase, class V, type 10A							78.0	72.0	74.0					15																	25958906		2203	4300	6503	SO:0001819	synonymous_variant	57194				ATP biosynthetic process|regulation of cell shape	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity	g.chr15:25958906G>A	AB011138	CCDS32178.1	15q12	2010-04-20	2007-09-19		ENSG00000206190	ENSG00000206190		"""ATPases / P-type"""	13542	protein-coding gene	gene with protein product		605855	"""ATPase, Class V, type 10C"", ""ATPase, Class V, type 10A"""	ATP10C		11015572, 9628581	Standard	NM_024490		Approved	ATPVA, ATPVC, KIAA0566	uc010ayu.3	O60312		ENST00000356865.6:c.2259C>T	15.37:g.25958906G>A			Somatic					p.I753I	NM_024490	NP_077816	WXS	Illumina HiSeq	Unspecified	O60312	AT10A_HUMAN		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)	10	2365	-		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)	753			Cytoplasmic (Potential).		Q4G0S9|Q969I4	Silent	SNP	ENST00000356865.6	37	c.2259C>T	CCDS32178.1																																																																																				0.602	ATP10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414830.1	NM_024490		10	36	0	0	0	1	0	10	36				
GABRA5	2558	broad.mit.edu	37	15	27182355	27182355	+	Missense_Mutation	SNP	G	G	A	rs375240262		TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr15:27182355G>A	ENST00000335625.5	+	8	1492	c.604G>A	c.(604-606)Gtt>Att	p.V202I	GABRA5_ENST00000400081.3_Missense_Mutation_p.V202I|GABRA5_ENST00000355395.5_Missense_Mutation_p.V202I|GABRB3_ENST00000541819.2_Intron	NM_000810.3	NP_000801.1	P31644	GBRA5_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 5	202					associative learning (GO:0008306)|behavioral fear response (GO:0001662)|brain development (GO:0007420)|cochlea development (GO:0090102)|gamma-aminobutyric acid signaling pathway (GO:0007214)|inner ear receptor cell development (GO:0060119)|innervation (GO:0060384)|ion transmembrane transport (GO:0034220)|negative regulation of neuron apoptotic process (GO:0043524)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|receptor activity (GO:0004872)|transporter activity (GO:0005215)	p.V202I(3)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(26)|ovary(1)|upper_aerodigestive_tract(1)	49		all_lung(180;4.59e-13)|Breast(32;0.000563)|Colorectal(260;0.227)		all cancers(64;1.45e-08)|Epithelial(43;4.96e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0232)|Lung(196;0.182)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zopiclone(DB01198)	TTCTGAAGTCGTTTACGTCTG	0.512																																							uc001zbd.1		NA																	3	Substitution - Missense(3)		lung(2)|NS(1)	ovary(1)	1						c.(604-606)GTT>ATT		gamma-aminobutyric acid A receptor, alpha 5	Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	G	ILE/VAL,ILE/VAL	1,3991		0,1,1995	135.0	134.0	134.0		604,604	0.2	0.0	15		134	1,8355		0,1,4177	no	missense,missense	GABRA5	NM_000810.3,NM_001165037.1	29,29	0,2,6172	AA,AG,GG		0.012,0.0251,0.0162	benign,benign	202/463,202/463	27182355	2,12346	1996	4178	6174	SO:0001583	missense	2558				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity	g.chr15:27182355G>A		CCDS45194.1	15q12	2012-06-22			ENSG00000186297	ENSG00000186297		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4079	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 5"""	137142				1321750	Standard	NM_000810		Approved		uc021sgi.1	P31644	OTTHUMG00000171824	ENST00000335625.5:c.604G>A	15.37:g.27182355G>A	ENSP00000335592:p.Val202Ile		Somatic				GABRB3_uc001zbb.2_Intron	p.V202I	NM_000810	NP_000801	WXS	Illumina HiSeq	Unspecified	P31644	GBRA5_HUMAN		all cancers(64;1.45e-08)|Epithelial(43;4.96e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0232)|Lung(196;0.182)	9	943	+		all_lung(180;4.59e-13)|Breast(32;0.000563)|Colorectal(260;0.227)	202			Extracellular (Potential).		A8K338|Q14DC2|Q53XL6|Q9NYT3|Q9NYT4|Q9NYT5	Missense_Mutation	SNP	ENST00000335625.5	37	c.604G>A	CCDS45194.1	.	.	.	.	.	.	.	.	.	.	G	3.147	-0.175002	0.06421	2.51E-4	1.2E-4	ENSG00000186297	ENST00000335625;ENST00000355395;ENST00000400081	T;T;T	0.79141	-1.24;-1.24;-1.24	4.92	0.241	0.15494	Neurotransmitter-gated ion-channel ligand-binding (3);	0.346500	0.32459	N	0.006065	T	0.51736	0.1692	N	0.14661	0.345	0.35993	D	0.836874	B	0.06786	0.001	B	0.15484	0.013	T	0.49331	-0.8951	10	0.02654	T	1	.	7.7976	0.29156	0.4929:0.0:0.5071:0.0	.	202	P31644	GBRA5_HUMAN	I	202	ENSP00000335592:V202I;ENSP00000347557:V202I;ENSP00000382953:V202I	ENSP00000335592:V202I	V	+	1	0	GABRA5	24765101	0.610000	0.26983	0.029000	0.17559	0.752000	0.42762	0.928000	0.28831	0.202000	0.20498	0.462000	0.41574	GTT		0.512	GABRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415234.1			15	34	0	0	0	1	0	15	34				
MGA	23269	broad.mit.edu	37	15	41961679	41961679	+	Missense_Mutation	SNP	C	C	G			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr15:41961679C>G	ENST00000570161.1	+	1	587	c.587C>G	c.(586-588)tCt>tGt	p.S196C	MGA_ENST00000568630.1_Intron|MGA_ENST00000545763.1_Missense_Mutation_p.S196C|MGA_ENST00000389936.4_Missense_Mutation_p.S196C|MGA_ENST00000219905.7_Missense_Mutation_p.S196C|MGA_ENST00000566586.1_Missense_Mutation_p.S196C			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0					carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)	p.S196C(1)		NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	ATCTTGCACTCTATGCATCGT	0.448																																							uc001zog.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|kidney(3)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	12						c.(586-588)TCT>TGT		MAX-interacting protein isoform 2							168.0	166.0	166.0					15																	41961679		1978	4161	6139	SO:0001583	missense	23269					MLL1 complex	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr15:41961679C>G	AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.587C>G	15.37:g.41961679C>G	ENSP00000457035:p.Ser196Cys		Somatic				MGA_uc010ucy.1_Missense_Mutation_p.S196C|MGA_uc010ucz.1_Missense_Mutation_p.S196C	p.S196C	NM_001080541	NP_001074010	WXS	Illumina HiSeq	Unspecified	Q8IWI9	MGAP_HUMAN		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	2	678	+		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)	196			T-box.		Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	ENST00000570161.1	37	c.587C>G	CCDS55959.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.275785	0.80580	.	.	ENSG00000174197	ENST00000219905;ENST00000389936;ENST00000545763	D;D;D	0.91894	-2.93;-2.93;-2.93	5.93	5.93	0.95920	.	0.095329	0.85682	D	0.000000	D	0.97284	0.9112	M	0.93062	3.375	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.97481	1.0047	10	0.87932	D	0	.	20.3363	0.98740	0.0:1.0:0.0:0.0	.	196;196	F5H7K2;E7ENI0	.;.	C	196	ENSP00000219905:S196C;ENSP00000374586:S196C;ENSP00000442467:S196C	ENSP00000219905:S196C	S	+	2	0	MGA	39748971	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.818000	0.86416	2.814000	0.96858	0.563000	0.77884	TCT		0.448	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000420229.1	NM_001164273.1		51	95	0	0	0	1	0	51	95				
MGA	23269	broad.mit.edu	37	15	42040834	42040834	+	Splice_Site	SNP	G	G	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr15:42040834G>A	ENST00000570161.1	+	15	5212		c.e15-1		MGA_ENST00000545763.1_Splice_Site|MGA_ENST00000389936.4_Splice_Site|MGA_ENST00000219905.7_Splice_Site|MGA_ENST00000566586.1_Splice_Site			O43451	MGA_HUMAN	MGA, MAX dimerization protein						carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)	p.?(1)		NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	CTGTTTTTCAGAAAATGCTGC	0.408																																							uc010ucy.1		NA																	1	Unknown(1)		lung(1)	ovary(6)|kidney(3)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	12						c.e16-1		MAX-interacting protein isoform 1							61.0	54.0	56.0					15																	42040834		1882	4133	6015	SO:0001630	splice_region_variant	23269					MLL1 complex	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr15:42040834G>A	AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.5213-1G>A	15.37:g.42040834G>A			Somatic				MGA_uc010ucz.1_Splice_Site_p.E1529_splice|MGA_uc010uda.1_Splice_Site_p.E354_splice|MGA_uc001zoi.2_5'Flank	p.E1738_splice	NM_001164273	NP_001157745	WXS	Illumina HiSeq	Unspecified	Q8IWI9	MGAP_HUMAN		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	16	5394	+		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)						Q0VAX6|Q75ME7|Q86UM5	Splice_Site	SNP	ENST00000570161.1	37	c.5213_splice	CCDS55959.1	.	.	.	.	.	.	.	.	.	.	G	14.85	2.657753	0.47467	.	.	ENSG00000174197	ENST00000219905;ENST00000389936;ENST00000545763	.	.	.	5.58	5.58	0.84498	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.5671	0.91120	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MGA	39828126	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.390000	0.66261	2.617000	0.88574	0.591000	0.81541	.		0.408	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000420229.1	NM_001164273.1	Intron	4	9	0	0	0	1	0	4	9				
FAM63B	54629	broad.mit.edu	37	15	59064389	59064389	+	Silent	SNP	C	C	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr15:59064389C>T	ENST00000559228.1	+	1	877	c.795C>T	c.(793-795)ccC>ccT	p.P265P	FAM63B_ENST00000450403.2_Silent_p.P265P|RP11-30K9.6_ENST00000500929.2_lincRNA			Q8NBR6	FA63B_HUMAN	family with sequence similarity 63, member B	265								p.P265P(1)		central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|liver(2)|lung(4)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	15						AGAACGGACCCTGCCCCTTGC	0.527																																							uc002afj.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)	1						c.(793-795)CCC>CCT		hypothetical protein LOC54629 isoform a							114.0	123.0	120.0					15																	59064389		2070	4221	6291	SO:0001819	synonymous_variant	54629							g.chr15:59064389C>T	AK075319	CCDS42046.1, CCDS45268.1	15q21.3	2005-08-09							26954	protein-coding gene	gene with protein product						10574461	Standard	NM_001040450		Approved	KIAA1164	uc002afj.3	Q8NBR6		ENST00000559228.1:c.795C>T	15.37:g.59064389C>T			Somatic				FAM63B_uc002afi.2_Silent_p.P265P|FAM63B_uc002afk.2_RNA|FAM63B_uc002afl.2_RNA	p.P265P	NM_001040450	NP_001035540	WXS	Illumina HiSeq	Unspecified	Q8NBR6	FA63B_HUMAN			1	997	+			265					B2RTT8|Q9ULQ6	Silent	SNP	ENST00000559228.1	37	c.795C>T	CCDS42046.1																																																																																				0.527	FAM63B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000416230.1	NM_019092		14	28	0	0	0	1	0	14	28				
RNF111	54778	broad.mit.edu	37	15	59323235	59323235	+	Missense_Mutation	SNP	C	C	G			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr15:59323235C>G	ENST00000557998.1	+	2	501	c.214C>G	c.(214-216)Caa>Gaa	p.Q72E	RNF111_ENST00000348370.4_Missense_Mutation_p.Q72E|RNF111_ENST00000434298.1_Missense_Mutation_p.Q72E|RNF111_ENST00000559209.1_Missense_Mutation_p.Q72E|RNF111_ENST00000561186.1_Missense_Mutation_p.Q72E	NM_001270530.1	NP_001257459.1	Q6ZNA4	RN111_HUMAN	ring finger protein 111	72					gene expression (GO:0010467)|pattern specification process (GO:0007389)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|protein polyubiquitination (GO:0000209)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent SMAD protein catabolic process (GO:0030579)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ligase activity (GO:0016874)|SUMO polymer binding (GO:0032184)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.Q72E(2)		breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(11)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35				all cancers(107;0.194)		TGATGATTCTCAAAAGCAAGA	0.443																																					NSCLC(72;983 1365 10746 34387 47081)	NSCLC(72;983 1365 10746 34387 47081)	uc002afv.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(214-216)CAA>GAA		ring finger protein 111							80.0	80.0	80.0					15																	59323235		2192	4292	6484	SO:0001583	missense	54778				multicellular organismal development|positive regulation of transcription, DNA-dependent	cytoplasm|nucleus	protein binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr15:59323235C>G	AL157474	CCDS10169.1, CCDS58365.1, CCDS58366.1	15q21	2013-01-09			ENSG00000157450	ENSG00000157450		"""RING-type (C3HC4) zinc fingers"""	17384	protein-coding gene	gene with protein product		605840				11298452	Standard	NM_017610		Approved	ARK, Arkadia, FLJ38008, DKFZP761D081	uc002aft.4	Q6ZNA4	OTTHUMG00000132716	ENST00000557998.1:c.214C>G	15.37:g.59323235C>G	ENSP00000452732:p.Gln72Glu		Somatic				RNF111_uc002afs.2_Missense_Mutation_p.Q72E|RNF111_uc002aft.2_Missense_Mutation_p.Q72E|RNF111_uc002afu.2_Missense_Mutation_p.Q72E|RNF111_uc002afw.2_Missense_Mutation_p.Q72E	p.Q72E	NM_017610	NP_060080	WXS	Illumina HiSeq	Unspecified	Q6ZNA4	RN111_HUMAN		all cancers(107;0.194)	2	493	+			72					C9JUS4|H0YN55|Q6P9A4|Q6ZMU2|Q7L428|Q7Z346|Q8N1P9|Q8WUA3|Q9NSR1	Missense_Mutation	SNP	ENST00000557998.1	37	c.214C>G	CCDS58366.1	.	.	.	.	.	.	.	.	.	.	C	13.78	2.338347	0.41398	.	.	ENSG00000157450	ENST00000348370;ENST00000434298	T;T	0.13901	2.55;2.55	5.58	5.58	0.84498	.	0.189365	0.48286	D	0.000189	T	0.13329	0.0323	L	0.36672	1.1	0.30924	N	0.727683	B;B;B	0.12013	0.005;0.003;0.005	B;B;B	0.15052	0.012;0.005;0.012	T	0.03344	-1.1046	10	0.87932	D	0	-14.0816	13.5206	0.61566	0.1558:0.8441:0.0:0.0	.	72;72;72	Q6ZNA4-3;Q6ZNA4;Q6ZNA4-2	.;RN111_HUMAN;.	E	72	ENSP00000288199:Q72E;ENSP00000393641:Q72E	ENSP00000288199:Q72E	Q	+	1	0	RNF111	57110527	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	5.122000	0.64697	2.621000	0.88768	0.491000	0.48974	CAA		0.443	RNF111-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000416012.1	NM_017610		10	15	0	0	0	1	0	10	15				
HAGHL	84264	broad.mit.edu	37	16	777579	777579	+	Missense_Mutation	SNP	G	G	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr16:777579G>A	ENST00000341413.4	+	2	351	c.70G>A	c.(70-72)Gag>Aag	p.E24K	CCDC78_ENST00000293889.6_5'Flank|HAGHL_ENST00000564537.1_Missense_Mutation_p.E24K|NARFL_ENST00000562862.1_5'Flank|HAGHL_ENST00000564545.1_Missense_Mutation_p.E24K|HAGHL_ENST00000549114.1_Missense_Mutation_p.E24K|HAGHL_ENST00000389703.3_Missense_Mutation_p.E24K|HAGHL_ENST00000561546.1_Missense_Mutation_p.E24K			Q6PII5	HAGHL_HUMAN	hydroxyacylglutathione hydrolase-like	24							hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)	p.E24K(1)		lung(3)	3		Hepatocellular(780;0.00335)				GCTCACGCGCGAGGCGGTGGC	0.701																																					Pancreas(46;538 1326 12403 32360)	Pancreas(46;538 1326 12403 32360)	uc002cjl.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(70-72)GAG>AAG		hydroxyacylglutathione hydrolase-like isoform 1							58.0	43.0	48.0					16																	777579		2186	4296	6482	SO:0001583	missense	84264						hydrolase activity|metal ion binding	g.chr16:777579G>A	AK054841	CCDS32354.1	16p13.3	2008-02-05	2003-11-04						14177	protein-coding gene	gene with protein product			"""hydroxyacyl glutathione hydrolase-like"""			12477932	Standard	XM_005255629		Approved	MGC2605	uc002cjo.1	Q6PII5		ENST00000341413.4:c.70G>A	16.37:g.777579G>A	ENSP00000341952:p.Glu24Lys		Somatic				CCDC78_uc002cjf.2_5'Flank|CCDC78_uc002cji.3_5'Flank|CCDC78_uc002cjg.2_5'Flank|CCDC78_uc002cjj.3_5'Flank|CCDC78_uc002cjh.2_5'Flank|CCDC78_uc010uuo.1_5'Flank|CCDC78_uc002cjk.2_5'Flank|HAGHL_uc002cjm.1_Missense_Mutation_p.E24K|HAGHL_uc002cjn.1_Missense_Mutation_p.E24K|HAGHL_uc002cjo.1_Missense_Mutation_p.E24K|HAGHL_uc010uup.1_Missense_Mutation_p.E24K	p.E24K	NM_207112	NP_996995	WXS	Illumina HiSeq	Unspecified	Q6PII5	HAGHL_HUMAN			2	351	+		Hepatocellular(780;0.00335)	24					A6NCC4|D3DU64|Q59FX8|Q96BZ3|Q96NR5|Q96S11|Q9BT45	Missense_Mutation	SNP	ENST00000341413.4	37	c.70G>A		.	.	.	.	.	.	.	.	.	.	G	12.45	1.941919	0.34283	.	.	ENSG00000103253	ENST00000549114;ENST00000341413;ENST00000389701;ENST00000389703	T;T;T	0.80033	-1.33;-1.33;-1.33	3.19	2.22	0.28083	Beta-lactamase-like (2);	0.359397	0.25543	N	0.029954	T	0.71685	0.3369	L	0.47078	1.49	0.22213	N	0.999289	P;D;P;P	0.57571	0.955;0.98;0.95;0.515	B;B;B;B	0.42112	0.376;0.259;0.215;0.074	T	0.63475	-0.6629	10	0.42905	T	0.14	-20.4216	8.9499	0.35783	0.1149:0.0:0.8851:0.0	.	24;24;24;24	B4DED4;Q6PII5-2;Q6PII5-3;Q6PII5	.;.;.;HAGHL_HUMAN	K	24	ENSP00000447170:E24K;ENSP00000341952:E24K;ENSP00000374353:E24K	ENSP00000341952:E24K	E	+	1	0	HAGHL	717580	0.019000	0.18553	0.013000	0.15412	0.322000	0.28314	0.828000	0.27435	0.525000	0.28522	0.561000	0.74099	GAG		0.701	HAGHL-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000409607.1	NM_032304		4	15	0	0	0	1	0	4	15				
CIITA	4261	broad.mit.edu	37	16	10995954	10995954	+	Missense_Mutation	SNP	A	A	C			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr16:10995954A>C	ENST00000324288.8	+	7	674	c.541A>C	c.(541-543)Acc>Ccc	p.T181P	CIITA_ENST00000537380.1_3'UTR|CIITA_ENST00000381835.5_Intron	NM_000246.3	NP_000237	P33076	C2TA_HUMAN	class II, major histocompatibility complex, transactivator	181					aging (GO:0007568)|cellular response to electrical stimulus (GO:0071257)|cellular response to exogenous dsRNA (GO:0071360)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|inflammatory response (GO:0006954)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of collagen biosynthetic process (GO:0032966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to antibiotic (GO:0046677)|response to interferon-gamma (GO:0034341)|transcription, DNA-templated (GO:0006351)	cell surface (GO:0009986)|nucleoplasm (GO:0005654)|PML body (GO:0016605)	activating transcription factor binding (GO:0033613)|ATP binding (GO:0005524)|GTP binding (GO:0005525)|kinase activity (GO:0016301)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|transferase activity, transferring acyl groups (GO:0016746)			central_nervous_system(1)|large_intestine(7)|ovary(1)|skin(1)|stomach(2)	12						CGACTGCTCCACCCTGCCCTG	0.617			T	"""FLJ27352, CD274, CD273, RALGDS, RUNDC2A, C16orf75, BCL6"""	"""PMBL, Hodgkin Lymphona, """																																		uc002dai.3		NA		Dom	yes		16	16p13	4261	T	"""class II, major histocompatibility complex, transactivator"""			L	FLJ27352|CD274|CD273|RALGDS|RUNDC2A|C16orf75		PMBL|Hodgkin Lymphona|		0				central_nervous_system(1)	1						c.(541-543)ACC>CCC		class II transactivator							61.0	65.0	64.0					16																	10995954		2197	4300	6497	SO:0001583	missense	4261				interferon-gamma-mediated signaling pathway|negative regulation of transcription from RNA polymerase II promoter|positive regulation of MHC class I biosynthetic process|positive regulation of transcription from RNA polymerase II promoter|response to antibiotic|transcription, DNA-dependent	nucleus	activating transcription factor binding|ATP binding|protein C-terminus binding|protein complex binding|transcription coactivator activity|transcription regulatory region DNA binding	g.chr16:10995954A>C	U18259	CCDS10544.1, CCDS66943.1, CCDS73826.1	16p13	2014-09-17	2005-08-12	2005-08-12	ENSG00000179583	ENSG00000179583		"""Nucleotide-binding domain and leucine rich repeat containing"""	7067	protein-coding gene	gene with protein product	"""NLR family, acid domain containing"", ""nucleotide-binding oligomerization domain, leucine rich repeat and acid domain containing"""	600005	"""MHC class II transactivator"""	MHC2TA		8402893	Standard	NM_000246		Approved	C2TA, NLRA	uc002dai.4	P33076	OTTHUMG00000129753	ENST00000324288.8:c.541A>C	16.37:g.10995954A>C	ENSP00000316328:p.Thr181Pro		Somatic				CIITA_uc002daj.3_Missense_Mutation_p.T182P|CIITA_uc002dak.3_Intron|CIITA_uc002dag.2_Missense_Mutation_p.T181P|CIITA_uc002dah.2_Intron|CIITA_uc010bup.1_Missense_Mutation_p.T181P	p.T181P	NM_000246	NP_000237	WXS	Illumina HiSeq	Unspecified	P33076	C2TA_HUMAN			7	674	+			181					A0N0N9|D3DUG0|E9PFE0|Q29675|Q8SNB8|Q96KL4	Missense_Mutation	SNP	ENST00000324288.8	37	c.541A>C	CCDS10544.1	.	.	.	.	.	.	.	.	.	.	A	7.514	0.655234	0.14580	.	.	ENSG00000179583	ENST00000324288;ENST00000537380	T	0.73047	-0.71	4.22	-2.45	0.06481	.	.	.	.	.	T	0.35828	0.0945	N	0.02011	-0.69	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.12993	-1.0526	9	0.38643	T	0.18	.	1.9005	0.03267	0.1905:0.3642:0.3008:0.1445	.	181;181;181;181	F5H2J4;A0N0N9;P33076;Q96KL4	.;.;C2TA_HUMAN;.	P	181	ENSP00000316328:T181P	ENSP00000316328:T181P	T	+	1	0	CIITA	10903455	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.077000	0.11394	-0.689000	0.05149	-2.403000	0.00223	ACC		0.617	CIITA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251966.2	NM_000246		7	58	0	0	0	1	0	7	58				
CES5A	221223	broad.mit.edu	37	16	55905608	55905608	+	Missense_Mutation	SNP	C	C	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr16:55905608C>T	ENST00000290567.9	-	3	467	c.346G>A	c.(346-348)Gga>Aga	p.G116R	CES5A_ENST00000319165.9_Missense_Mutation_p.G116R|CES5A_ENST00000520435.1_Intron|CES5A_ENST00000518005.1_Missense_Mutation_p.G10R|CES5A_ENST00000541580.1_Intron|CES5A_ENST00000521992.1_Missense_Mutation_p.G145R	NM_001143685.1	NP_001137157.1	Q6NT32	EST5A_HUMAN	carboxylesterase 5A	116						extracellular region (GO:0005576)	carboxylic ester hydrolase activity (GO:0052689)	p.G116R(1)|p.G145R(1)		breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(13)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	39						TCTGACACTCCGAATTTCGGG	0.537																																							uc002eip.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(346-348)GGA>AGA		carboxylesterase 7 isoform 1							98.0	76.0	84.0					16																	55905608		2198	4300	6498	SO:0001583	missense	221223					extracellular region	carboxylesterase activity|methyl indole-3-acetate esterase activity|methyl jasmonate esterase activity|methyl salicylate esterase activity	g.chr16:55905608C>T	AK090997	CCDS10755.1, CCDS45490.1, CCDS54012.1	16q13	2010-10-12	2010-10-12	2010-10-12	ENSG00000159398	ENSG00000159398	3.1.1.1	"""Carboxylesterases"""	26459	protein-coding gene	gene with protein product			"""carboxylesterase 7"""	CES7		20931200	Standard	NM_145024		Approved	FLJ31547, CES4C1, CES5, CAUXIN	uc021tir.1	Q6NT32	OTTHUMG00000133236	ENST00000290567.9:c.346G>A	16.37:g.55905608C>T	ENSP00000290567:p.Gly116Arg		Somatic				CES7_uc002eio.2_Missense_Mutation_p.G116R|CES7_uc002eiq.2_5'UTR|CES7_uc002eir.2_Missense_Mutation_p.G10R	p.G116R	NM_001143685	NP_001137157	WXS	Illumina HiSeq	Unspecified	Q6NT32	EST5A_HUMAN		all cancers(182;0.229)|Epithelial(162;0.231)	3	495	-			116					B7Z252|B7ZLB6|Q8NBC8|Q96DN9	Missense_Mutation	SNP	ENST00000290567.9	37	c.346G>A	CCDS45490.1	.	.	.	.	.	.	.	.	.	.	C	7.349	0.622394	0.14193	.	.	ENSG00000159398	ENST00000521992;ENST00000319165;ENST00000518005;ENST00000290567;ENST00000536025	T;T;T;T;T	0.69435	-0.4;-0.4;-0.4;-0.4;-0.4	4.89	-4.53	0.03462	Carboxylesterase, type B (1);	2.011570	0.02124	N	0.055882	T	0.45094	0.1325	N	0.12746	0.255	0.09310	N	0.999999	B;B	0.25206	0.12;0.03	B;B	0.19946	0.027;0.004	T	0.28744	-1.0034	10	0.32370	T	0.25	.	7.391	0.26909	0.0:0.247:0.1364:0.6166	.	116;116	Q6NT32;Q6NT32-2	EST5A_HUMAN;.	R	145;116;10;116;10	ENSP00000428864:G145R;ENSP00000324271:G116R;ENSP00000428571:G10R;ENSP00000290567:G116R;ENSP00000439810:G10R	ENSP00000290567:G116R	G	-	1	0	CES5A	54463109	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.092000	0.03366	-0.752000	0.04728	0.655000	0.94253	GGA		0.537	CES5A-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000256975.3	NM_145024		12	25	0	0	0	1	0	12	25				
AMFR	267	broad.mit.edu	37	16	56436943	56436943	+	Missense_Mutation	SNP	G	G	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr16:56436943G>A	ENST00000290649.5	-	7	1138	c.928C>T	c.(928-930)Cgt>Tgt	p.R310C		NM_001144.5	NP_001135.3	Q9UKV5	AMFR_HUMAN	autocrine motility factor receptor, E3 ubiquitin protein ligase	310					aging (GO:0007568)|cellular component movement (GO:0006928)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|learning or memory (GO:0007611)|protein oligomerization (GO:0051259)|protein polyubiquitination (GO:0000209)|signal transduction (GO:0007165)|ubiquitin-dependent protein catabolic process (GO:0006511)	dendrite (GO:0030425)|endoplasmic reticulum membrane (GO:0005789)|growth cone (GO:0030426)|Hrd1p ubiquitin ligase complex (GO:0000836)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)	ligase activity (GO:0016874)|receptor activity (GO:0004872)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R310C(1)		NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	17						TTGTGCCGACGAATTCGACGT	0.428																																					Pancreas(2;144 323 39528)	Pancreas(2;144 323 39528)	uc002eiy.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(2)	2						c.(928-930)CGT>TGT		autocrine motility factor receptor							180.0	151.0	161.0					16																	56436943		2198	4300	6498	SO:0001583	missense	267				endoplasmic reticulum unfolded protein response|ER-associated protein catabolic process|protein oligomerization|protein polyubiquitination	integral to endoplasmic reticulum membrane|integral to membrane of membrane fraction	protein binding|protein binding|receptor activity|ubiquitin-protein ligase activity|zinc ion binding	g.chr16:56436943G>A	L35233	CCDS10758.1	16q21	2013-01-09	2012-02-23		ENSG00000159461	ENSG00000159461		"""RING-type (C3HC4) zinc fingers"""	463	protein-coding gene	gene with protein product		603243	"""autocrine motility factor receptor"""			1649192	Standard	NM_001144		Approved	RNF45, gp78	uc002eiy.4	Q9UKV5	OTTHUMG00000133239	ENST00000290649.5:c.928C>T	16.37:g.56436943G>A	ENSP00000290649:p.Arg310Cys		Somatic				AMFR_uc002eix.2_Silent_p.F7F	p.R310C	NM_001144	NP_001135	WXS	Illumina HiSeq	Unspecified	Q9UKV5	AMFR2_HUMAN			7	1133	-			310					P26442|Q8IZ70	Missense_Mutation	SNP	ENST00000290649.5	37	c.928C>T	CCDS10758.1	.	.	.	.	.	.	.	.	.	.	G	35	5.568285	0.96540	.	.	ENSG00000159461	ENST00000290649	T	0.18174	2.23	5.74	5.74	0.90152	.	0.097382	0.64402	D	0.000001	T	0.28566	0.0707	L	0.55481	1.735	0.80722	D	1	D	0.65815	0.995	P	0.48571	0.582	T	0.01013	-1.1481	10	0.72032	D	0.01	-9.9755	19.9015	0.96985	0.0:0.0:1.0:0.0	.	310	Q9UKV5	AMFR2_HUMAN	C	310	ENSP00000290649:R310C	ENSP00000290649:R310C	R	-	1	0	AMFR	54994444	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.807000	0.99171	2.704000	0.92352	0.655000	0.94253	CGT		0.428	AMFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256978.2			25	55	0	0	0	1	0	25	55				
CDT1	81620	broad.mit.edu	37	16	88872241	88872241	+	Missense_Mutation	SNP	G	G	C			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr16:88872241G>C	ENST00000301019.4	+	5	1415	c.796G>C	c.(796-798)Gat>Cat	p.D266H		NM_030928.3	NP_112190.2			chromatin licensing and DNA replication factor 1									p.D266H(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|lung(3)	7				BRCA - Breast invasive adenocarcinoma(80;0.0476)		CAGGAGGTCAGATTACCAGCT	0.617																																					Melanoma(159;511 3380 30971)	Melanoma(159;511 3380 30971)	uc002flu.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(796-798)GAT>CAT		chromatin licensing and DNA replication factor							41.0	43.0	43.0					16																	88872241		2195	4299	6494	SO:0001583	missense	81620				DNA replication|DNA replication checkpoint|M/G1 transition of mitotic cell cycle|regulation of DNA-dependent DNA replication initiation|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle	cytosol|nucleoplasm	DNA binding|protein binding	g.chr16:88872241G>C	AF070552	CCDS32510.1	16q24.3	2014-08-12			ENSG00000167513	ENSG00000167513			24576	protein-coding gene	gene with protein product		605525				11896191, 11555648	Standard	NM_030928		Approved	DUP, RIS2	uc002flu.3	Q9H211	OTTHUMG00000173467	ENST00000301019.4:c.796G>C	16.37:g.88872241G>C	ENSP00000301019:p.Asp266His		Somatic					p.D266H	NM_030928	NP_112190	WXS	Illumina HiSeq	Unspecified	Q9H211	CDT1_HUMAN		BRCA - Breast invasive adenocarcinoma(80;0.0476)	5	850	+			266						Missense_Mutation	SNP	ENST00000301019.4	37	c.796G>C	CCDS32510.1	.	.	.	.	.	.	.	.	.	.	G	10.62	1.402542	0.25291	.	.	ENSG00000167513	ENST00000301019	T	0.31247	1.5	4.83	2.8	0.32819	.	0.515096	0.21935	N	0.066971	T	0.49626	0.1568	M	0.70595	2.14	0.09310	N	1	D	0.89917	1.0	D	0.71870	0.975	T	0.35574	-0.9783	10	0.56958	D	0.05	.	9.6251	0.39746	0.0753:0.2668:0.6579:0.0	.	266	Q9H211	CDT1_HUMAN	H	266	ENSP00000301019:D266H	ENSP00000301019:D266H	D	+	1	0	CDT1	87399742	0.966000	0.33281	0.082000	0.20525	0.100000	0.18952	2.197000	0.42696	0.432000	0.26286	0.462000	0.41574	GAT		0.617	CDT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000423215.1	NM_030928		9	15	0	0	0	1	0	9	15				
NUFIP2	57532	broad.mit.edu	37	17	27613864	27613864	+	Missense_Mutation	SNP	G	G	C			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr17:27613864G>C	ENST00000225388.4	-	2	1206	c.1148C>G	c.(1147-1149)tCt>tGt	p.S383C	NUFIP2_ENST00000579665.1_Intron	NM_020772.2	NP_065823.1	Q7Z417	NUFP2_HUMAN	nuclear fragile X mental retardation protein interacting protein 2	383	Ser-rich.					cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|polysomal ribosome (GO:0042788)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.S383C(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|liver(1)|lung(7)|ovary(1)|prostate(2)|skin(4)|urinary_tract(1)	24			BRCA - Breast invasive adenocarcinoma(11;0.000457)|Colorectal(6;0.0178)|COAD - Colon adenocarcinoma(6;0.0551)			AGATGATGAAGATGATGAAGA	0.393																																							uc002hdy.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)|breast(1)	4						c.(1147-1149)TCT>TGT		nuclear fragile X mental retardation protein							163.0	161.0	161.0					17																	27613864		2203	4300	6503	SO:0001583	missense	57532					nucleus|polysomal ribosome	protein binding|RNA binding	g.chr17:27613864G>C	AB037742	CCDS32600.1	17q11.1	2006-03-01				ENSG00000108256			17634	protein-coding gene	gene with protein product		609356				12837692, 16407062	Standard	NM_020772		Approved	KIAA1321, MGC117262, PIG1, 182-FIP, FIP-82, 82-FIP	uc002hdy.4	Q7Z417		ENST00000225388.4:c.1148C>G	17.37:g.27613864G>C	ENSP00000225388:p.Ser383Cys		Somatic				NUFIP2_uc002hdx.3_Intron	p.S383C	NM_020772	NP_065823	WXS	Illumina HiSeq	Unspecified	Q7Z417	NUFP2_HUMAN	BRCA - Breast invasive adenocarcinoma(11;0.000457)|Colorectal(6;0.0178)|COAD - Colon adenocarcinoma(6;0.0551)		2	1237	-			383			Ser-rich.		A1L3A6|Q9P2M5	Missense_Mutation	SNP	ENST00000225388.4	37	c.1148C>G	CCDS32600.1	.	.	.	.	.	.	.	.	.	.	G	12.66	2.004428	0.35320	.	.	ENSG00000108256	ENST00000225388	.	.	.	6.17	6.17	0.99709	.	0.073714	0.64402	D	0.000018	T	0.52092	0.1713	L	0.27053	0.805	0.80722	D	1	B	0.24317	0.101	B	0.20767	0.031	T	0.47169	-0.9138	9	0.54805	T	0.06	-4.3202	16.7251	0.85419	0.0:0.1291:0.8708:0.0	.	383	Q7Z417	NUFP2_HUMAN	C	383	.	ENSP00000225388:S383C	S	-	2	0	NUFIP2	24637990	1.000000	0.71417	0.651000	0.29564	0.694000	0.40290	7.317000	0.79018	2.941000	0.99782	0.655000	0.94253	TCT		0.393	NUFIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447015.2	NM_020772		5	142	0	0	0	1	0	5	142				
NF1	4763	broad.mit.edu	37	17	29664477	29664477	+	Silent	SNP	T	T	G			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr17:29664477T>G	ENST00000358273.4	+	43	6902	c.6519T>G	c.(6517-6519)gcT>gcG	p.A2173A	NF1_ENST00000444181.2_5'Flank|NF1_ENST00000356175.3_Silent_p.A2152A|NF1_ENST00000417592.2_5'Flank	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	2173					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(3)|p.A2173A(2)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		TCAAGTCAGCTGCTGTCATTG	0.453			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																													uc002hgg.2		NA	yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	D|Mis|N|F|S|O	neurofibromatosis type 1 gene			O		neurofibroma|glioma	neurofibroma|glioma		13	Whole gene deletion(8)|Unknown(3)|Substitution - coding silent(2)	p.E2143_S2180del(1)	soft_tissue(7)|lung(3)|autonomic_ganglia(2)|central_nervous_system(1)	soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330						c.(6517-6519)GCT>GCG		neurofibromin isoform 1							142.0	123.0	130.0					17																	29664477		2203	4300	6503	SO:0001819	synonymous_variant	4763	Neurofibromatosis_type_1	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome	actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity	g.chr17:29664477T>G		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.6519T>G	17.37:g.29664477T>G		TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)	Somatic				NF1_uc002hgh.2_Silent_p.A2152A|NF1_uc010cso.2_Silent_p.A361A|NF1_uc010wbt.1_5'Flank|NF1_uc010wbu.1_5'Flank	p.A2173A	NM_001042492	NP_001035957	WXS	Illumina HiSeq	Unspecified	P21359	NF1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)	43	6852	+		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)	2173					O00662|Q14284|Q14930|Q14931|Q9UMK3	Silent	SNP	ENST00000358273.4	37	c.6519T>G	CCDS42292.1																																																																																				0.453	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256351.2	NM_000267		13	54	0	0	0	1	0	13	54				
PSMD11	5717	broad.mit.edu	37	17	30781559	30781559	+	Missense_Mutation	SNP	C	C	G			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr17:30781559C>G	ENST00000261712.3	+	3	503	c.240C>G	c.(238-240)atC>atG	p.I80M	PSMD11_ENST00000457654.2_Missense_Mutation_p.I80M	NM_001270482.1|NM_002815.3	NP_001257411.1|NP_002806.2	O00231	PSD11_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 11	80					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasome assembly (GO:0043248)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|stem cell differentiation (GO:0048863)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)		p.I80M(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	19		Breast(31;0.159)|Ovarian(249;0.182)	BRCA - Breast invasive adenocarcinoma(9;0.109)			TGAATTCCATCAGCAAGGCTA	0.428																																					Ovarian(130;1038 1716 9294 11987 19279)	Ovarian(130;1038 1716 9294 11987 19279)	uc010cta.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(238-240)ATC>ATG		proteasome 26S non-ATPase subunit 11							162.0	137.0	146.0					17																	30781559		2203	4300	6503	SO:0001583	missense	5717				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome complex	protein binding	g.chr17:30781559C>G	AB003102	CCDS11272.1	17q12	2008-05-22			ENSG00000108671	ENSG00000108671		"""Proteasome (prosome, macropain) subunits"""	9556	protein-coding gene	gene with protein product		604449				9426256, 9119060	Standard	NM_001270482		Approved	S9, p44.5, MGC3844, Rpn6	uc010cta.2	O00231	OTTHUMG00000132811	ENST00000261712.3:c.240C>G	17.37:g.30781559C>G	ENSP00000261712:p.Ile80Met		Somatic				PSMD11_uc010wbz.1_Missense_Mutation_p.I80M|PSMD11_uc002hhm.2_Missense_Mutation_p.I80M	p.I80M	NM_002815	NP_002806	WXS	Illumina HiSeq	Unspecified	O00231	PSD11_HUMAN	BRCA - Breast invasive adenocarcinoma(9;0.109)		3	280	+		Breast(31;0.159)|Ovarian(249;0.182)	80					A8K3I7|E1P663|O00495|Q53FT5	Missense_Mutation	SNP	ENST00000261712.3	37	c.240C>G	CCDS11272.1	.	.	.	.	.	.	.	.	.	.	C	13.97	2.395066	0.42512	.	.	ENSG00000108671	ENST00000261712	T	0.41400	1.0	5.43	2.32	0.28847	.	0.000000	0.85682	D	0.000000	T	0.43255	0.1239	M	0.77616	2.38	0.54753	D	0.999985	B;B	0.22909	0.077;0.042	B;B	0.30716	0.119;0.034	T	0.36915	-0.9728	10	0.62326	D	0.03	-35.0046	6.6008	0.22699	0.1456:0.6977:0.0:0.1567	.	80;80	B4DTS5;O00231	.;PSD11_HUMAN	M	80	ENSP00000261712:I80M	ENSP00000261712:I80M	I	+	3	3	PSMD11	27805672	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.395000	0.44459	0.394000	0.25230	0.655000	0.94253	ATC		0.428	PSMD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256252.2	NM_002815		24	68	0	0	0	1	0	24	68				
GPR179	440435	broad.mit.edu	37	17	36486375	36486375	+	Missense_Mutation	SNP	C	C	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr17:36486375C>T	ENST00000342292.4	-	11	3097	c.3077G>A	c.(3076-3078)cGa>cAa	p.R1026Q	GPR179_ENST00000584976.1_5'Flank	NM_001004334.2	NP_001004334.2	Q6PRD1	GP179_HUMAN	G protein-coupled receptor 179	1026					visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.R1026Q(1)		breast(4)|cervix(2)|endometrium(9)|kidney(3)|large_intestine(16)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)				GAGCCTGGCTCGAGCTGGGGC	0.612																																							uc002hpz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(3076-3078)CGA>CAA		GPR158-like 1 precursor							49.0	51.0	50.0					17																	36486375		1925	4138	6063	SO:0001583	missense	440435					integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr17:36486375C>T		CCDS42308.1	17q21.1	2014-05-06	2006-02-16	2006-02-16	ENSG00000188888	ENSG00000277399		"""GPCR / Class C : Orphans"""	31371	protein-coding gene	gene with protein product		614515	"""GPR158-like 1"", ""GPR179"""	GPR158L1			Standard	NM_001004334		Approved	CSNB1E	uc002hpz.3	Q6PRD1	OTTHUMG00000188545	ENST00000342292.4:c.3077G>A	17.37:g.36486375C>T	ENSP00000345060:p.Arg1026Gln		Somatic					p.R1026Q	NM_001004334	NP_001004334	WXS	Illumina HiSeq	Unspecified	Q6PRD1	GP179_HUMAN			11	3098	-	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)	1026			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000342292.4	37	c.3077G>A	CCDS42308.1	.	.	.	.	.	.	.	.	.	.	C	15.35	2.808392	0.50421	.	.	ENSG00000188888	ENST00000342292	T	0.58358	0.34	5.38	4.4	0.53042	.	0.190854	0.32901	N	0.005519	T	0.54175	0.1842	L	0.32530	0.975	0.09310	N	1	D	0.89917	1.0	P	0.59546	0.859	T	0.45498	-0.9257	10	0.54805	T	0.06	-17.0047	8.8919	0.35439	0.1699:0.6663:0.1638:0.0	.	1026	Q6PRD1	GP179_HUMAN	Q	1026	ENSP00000345060:R1026Q	ENSP00000345060:R1026Q	R	-	2	0	GPR179	33739901	0.000000	0.05858	0.558000	0.28319	0.703000	0.40648	-0.184000	0.09698	1.486000	0.48398	0.462000	0.41574	CGA		0.612	GPR179-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255329.2			14	51	0	0	0	1	0	14	51				
PSMC3IP	29893	broad.mit.edu	37	17	40729545	40729545	+	Missense_Mutation	SNP	C	C	G	rs539283944		TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr17:40729545C>G	ENST00000393795.3	-	2	177	c.69G>C	c.(67-69)caG>caC	p.Q23H	PSMC3IP_ENST00000253789.5_Missense_Mutation_p.Q23H|PSMC3IP_ENST00000587209.1_5'UTR|PSMC3IP_ENST00000590760.1_5'UTR	NM_001256015.1|NM_001256016.1|NM_016556.3	NP_001242944.1|NP_001242945.1|NP_057640.1	Q9P2W1	HOP2_HUMAN	PSMC3 interacting protein	23					DNA recombination (GO:0006310)|meiotic nuclear division (GO:0007126)|regulation of RNA biosynthetic process (GO:2001141)	nucleus (GO:0005634)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)	p.Q23H(1)		endometrium(2)|large_intestine(1)|lung(1)|skin(1)|upper_aerodigestive_tract(2)	7		all_cancers(22;0.00426)|Breast(137;0.00116)|all_epithelial(22;0.0395)		BRCA - Breast invasive adenocarcinoma(366;0.13)		AGGGCCGGTTCTGCTCCTGCA	0.662																																							uc002iai.2		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|skin(1)	2						c.(67-69)CAG>CAC		PSMC3 interacting protein isoform 2							44.0	45.0	45.0					17																	40729545		2203	4300	6503	SO:0001583	missense	29893				DNA recombination|meiosis	nucleus	DNA binding	g.chr17:40729545C>G	AB030304, NM_013290, BC008792	CCDS11431.1, CCDS45688.1, CCDS59289.1	17q21.2	2012-04-10				ENSG00000131470		"""Proteasome (prosome, macropain) subunits"""	17928	protein-coding gene	gene with protein product	"""TBP-1 interacting protein"""	608665				7490091, 10806355, 11739747	Standard	NM_016556		Approved	TBPIP, GT198, HUMGT198A	uc002iai.3	Q9P2W1		ENST00000393795.3:c.69G>C	17.37:g.40729545C>G	ENSP00000377384:p.Gln23His		Somatic				PSMC3IP_uc002iaj.2_5'UTR|PSMC3IP_uc002iak.2_Missense_Mutation_p.Q23H|PSMC3IP_uc010wgn.1_5'UTR|PSMC3IP_uc010wgo.1_RNA|PSMC3IP_uc010wgp.1_RNA	p.Q23H	NM_016556	NP_057640	WXS	Illumina HiSeq	Unspecified	Q9P2W1	HOP2_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.13)	2	112	-		all_cancers(22;0.00426)|Breast(137;0.00116)|all_epithelial(22;0.0395)	23					C5ILB7|Q14458|Q8WXG2|Q96HA2	Missense_Mutation	SNP	ENST00000393795.3	37	c.69G>C	CCDS45688.1	.	.	.	.	.	.	.	.	.	.	C	24.8	4.571120	0.86542	.	.	ENSG00000131470	ENST00000393795;ENST00000253789	T;T	0.50277	0.75;0.75	5.04	4.06	0.47325	Winged helix-turn-helix transcription repressor DNA-binding (1);	0.054100	0.85682	D	0.000000	T	0.68970	0.3059	M	0.87827	2.91	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.77557	0.983;0.99	T	0.71951	-0.4437	10	0.52906	T	0.07	-25.5649	9.7818	0.40653	0.0:0.83:0.0:0.17	.	23;23	Q9P2W1-2;Q9P2W1	.;HOP2_HUMAN	H	23	ENSP00000377384:Q23H;ENSP00000253789:Q23H	ENSP00000253789:Q23H	Q	-	3	2	PSMC3IP	37983071	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.568000	0.53820	1.341000	0.45600	0.655000	0.94253	CAG		0.662	PSMC3IP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450427.1	NM_013290		16	34	0	0	0	1	0	16	34				
TLK2	11011	broad.mit.edu	37	17	60655841	60655841	+	Missense_Mutation	SNP	G	G	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr17:60655841G>A	ENST00000326270.9	+	15	1526	c.1258G>A	c.(1258-1260)Gaa>Aaa	p.E420K	TLK2_ENST00000542523.1_Missense_Mutation_p.E366K|TLK2_ENST00000343388.7_Missense_Mutation_p.E366K|TLK2_ENST00000582809.1_Missense_Mutation_p.E249K|TLK2_ENST00000346027.5_Missense_Mutation_p.E398K	NM_001284333.1	NP_001271262.1	Q86UE8	TLK2_HUMAN	tousled-like kinase 2	420					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|chromatin modification (GO:0016568)|chromosome segregation (GO:0007059)|intracellular signal transduction (GO:0035556)|negative regulation of autophagy (GO:0010507)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|peptidyl-serine phosphorylation (GO:0018105)|protein phosphorylation (GO:0006468)|regulation of chromatin assembly or disassembly (GO:0001672)	intermediate filament (GO:0005882)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.E420K(1)|p.E397K(1)|p.E398K(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(4)|large_intestine(6)|liver(2)|lung(10)|prostate(1)|stomach(1)|urinary_tract(1)	39						GCTTTAGGAGGAAGCAGAGAT	0.368																																							uc010ddp.2		NA																	3	Substitution - Missense(3)		lung(3)	stomach(1)|kidney(1)	2						c.(1258-1260)GAA>AAA		tousled-like kinase 2 isoform A							75.0	75.0	75.0					17																	60655841		2203	4300	6503	SO:0001583	missense	11011				cell cycle|chromatin modification|intracellular signal transduction|regulation of chromatin assembly or disassembly|response to DNA damage stimulus	nucleus	ATP binding|protein binding|protein serine/threonine kinase activity	g.chr17:60655841G>A	AB004884	CCDS11633.1, CCDS45753.1, CCDS62283.1	17q23	2008-07-18							11842	protein-coding gene	gene with protein product		608439				9427565, 10523312	Standard	NM_006852		Approved	PKU-ALPHA, MGC44450	uc002izz.4	Q86UE8		ENST00000326270.9:c.1258G>A	17.37:g.60655841G>A	ENSP00000316512:p.Glu420Lys		Somatic				TLK2_uc002izx.3_Missense_Mutation_p.E246K|TLK2_uc002izz.3_Missense_Mutation_p.E398K|TLK2_uc002jaa.3_Missense_Mutation_p.E366K|TLK2_uc010wpd.1_Missense_Mutation_p.E366K	p.E420K	NM_006852	NP_006843	WXS	Illumina HiSeq	Unspecified	Q86UE8	TLK2_HUMAN			15	1526	+			420			Potential.		D3DU07|Q9UKI7|Q9Y4F7	Missense_Mutation	SNP	ENST00000326270.9	37	c.1258G>A		.	.	.	.	.	.	.	.	.	.	G	17.85	3.489787	0.64074	.	.	ENSG00000146872	ENST00000346027;ENST00000343388;ENST00000326270;ENST00000542523	T;T;T;T	0.67865	-0.27;-0.29;-0.25;-0.29	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	D	0.83585	0.5286	M	0.85630	2.765	0.80722	D	1	D;D;D;D	0.71674	0.995;0.995;0.995;0.998	D;D;D;D	0.69142	0.913;0.962;0.962;0.946	D	0.86136	0.1578	10	0.87932	D	0	-1.8999	18.333	0.90277	0.0:0.0:1.0:0.0	.	420;366;398;398	Q86UE8;Q86UE8-3;Q86UE8-2;D3DU05	TLK2_HUMAN;.;.;.	K	398;366;420;366	ENSP00000275780:E398K;ENSP00000340800:E366K;ENSP00000316512:E420K;ENSP00000442311:E366K	ENSP00000316512:E420K	E	+	1	0	TLK2	58009573	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.813000	0.99286	2.640000	0.89533	0.655000	0.94253	GAA		0.368	TLK2-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000445140.1	NM_006852		8	32	0	0	0	1	0	8	32				
DSC3	1825	broad.mit.edu	37	18	28602410	28602410	+	Silent	SNP	C	C	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr18:28602410C>T	ENST00000360428.4	-	7	914	c.834G>A	c.(832-834)acG>acA	p.T278T	DSC3_ENST00000434452.1_Silent_p.T278T	NM_001941.3	NP_001932.2	Q14574	DSC3_HUMAN	desmocollin 3	278	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|protein stabilization (GO:0050821)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|desmosome (GO:0030057)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)	p.T278T(2)		endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(6)|lung(29)|ovary(2)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	56			OV - Ovarian serous cystadenocarcinoma(10;0.125)			ATTTCAGGCGCGTATGCATTG	0.453																																							uc002kwj.3		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)|skin(2)	4						c.(832-834)ACG>ACA		desmocollin 3 isoform Dsc3a preproprotein							148.0	126.0	133.0					18																	28602410		2203	4300	6503	SO:0001819	synonymous_variant	1825				homophilic cell adhesion|protein stabilization	desmosome|integral to membrane|membrane fraction	calcium ion binding|gamma-catenin binding	g.chr18:28602410C>T	X83929	CCDS32810.1	18q12.1	2014-07-30			ENSG00000134762	ENSG00000134762		"""Cadherins / Major cadherins"""	3037	protein-coding gene	gene with protein product		600271		DSC4		7774948, 8486729	Standard	NM_001941		Approved	CDHF3, DSC, DSC1, DSC2	uc002kwj.4	Q14574	OTTHUMG00000179622	ENST00000360428.4:c.834G>A	18.37:g.28602410C>T			Somatic				DSC3_uc002kwi.3_Silent_p.T278T	p.T278T	NM_001941	NP_001932	WXS	Illumina HiSeq	Unspecified	Q14574	DSC3_HUMAN	OV - Ovarian serous cystadenocarcinoma(10;0.125)		7	989	-			278			Extracellular (Potential).|Cadherin 2.		A6NN35|Q14200|Q9HAZ9	Silent	SNP	ENST00000360428.4	37	c.834G>A	CCDS32810.1																																																																																				0.453	DSC3-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000447384.1	NM_001941, NM_024423		3	40	0	0	0	1	0	3	40				
SMAD4	4089	broad.mit.edu	37	18	48584552	48584552	+	Nonsense_Mutation	SNP	C	C	G			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr18:48584552C>G	ENST00000342988.3	+	6	1263	c.725C>G	c.(724-726)tCa>tGa	p.S242*	SMAD4_ENST00000398417.2_Nonsense_Mutation_p.S242*|SMAD4_ENST00000588745.1_Intron	NM_005359.5	NP_005350.1	Q13485	SMAD4_HUMAN	SMAD family member 4	242					atrioventricular canal development (GO:0036302)|atrioventricular valve formation (GO:0003190)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|brainstem development (GO:0003360)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|developmental growth (GO:0048589)|endocardial cell differentiation (GO:0060956)|endoderm development (GO:0007492)|endothelial cell activation (GO:0042118)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|formation of anatomical boundary (GO:0048859)|gastrulation with mouth forming second (GO:0001702)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|metanephric mesenchyme morphogenesis (GO:0072133)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neural crest cell differentiation (GO:0014033)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation involved in heart valve morphogenesis (GO:0003251)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of binding (GO:0051098)|regulation of hair follicle development (GO:0051797)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to transforming growth factor beta (GO:0071559)|sebaceous gland development (GO:0048733)|SMAD protein complex assembly (GO:0007183)|SMAD protein signal transduction (GO:0060395)|somite rostral/caudal axis specification (GO:0032525)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	activin responsive factor complex (GO:0032444)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|R-SMAD binding (GO:0070412)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity (GO:0030616)	p.0?(36)|p.?(2)|p.S242*(1)		NS(2)|biliary_tract(19)|breast(9)|central_nervous_system(2)|endometrium(2)|gastrointestinal_tract_(site_indeterminate)(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(142)|liver(2)|lung(27)|oesophagus(4)|ovary(7)|pancreas(180)|prostate(3)|skin(1)|small_intestine(9)|stomach(5)|testis(2)|thyroid(19)|upper_aerodigestive_tract(10)|urinary_tract(2)|vulva(1)	454		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		CAGATAGCATCAGGGCCTCAG	0.433																																							uc010xdp.1		NA																	39	Whole gene deletion(36)|Unknown(2)|Substitution - Nonsense(1)	p.0?(35)|p.?(2)	pancreas(26)|stomach(3)|lung(3)|breast(3)|large_intestine(2)|upper_aerodigestive_tract(1)|oesophagus(1)	pancreas(170)|large_intestine(108)|thyroid(19)|lung(11)|small_intestine(9)|upper_aerodigestive_tract(8)|biliary_tract(8)|ovary(7)|breast(6)|stomach(5)|oesophagus(3)|testis(2)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|gastrointestinal_tract_(site_indeterminate)(2)|liver(2)|kidney(1)|urinary_tract(1)|vulva(1)|skin(1)|NS(1)	369						c.(724-726)TCA>TGA		mothers against decapentaplegic homolog 4							87.0	81.0	83.0					18																	48584552		2203	4300	6503	SO:0001587	stop_gained	4089	Juvenile_Polyposis|Hereditary_Hemorrhagic_Telangiectasia			BMP signaling pathway|negative regulation of cell growth|negative regulation of protein catabolic process|negative regulation of transcription, DNA-dependent|palate development|positive regulation of epithelial to mesenchymal transition|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of SMAD protein import into nucleus|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of transforming growth factor-beta2 production|response to hypoxia|response to transforming growth factor beta stimulus|SMAD protein complex assembly|SMAD protein signal transduction|transforming growth factor beta receptor signaling pathway	activin responsive factor complex|centrosome|cytosol	I-SMAD binding|protein homodimerization activity|R-SMAD binding|transcription regulatory region DNA binding|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity	g.chr18:48584552C>G	U44378	CCDS11950.1	18q21.1	2014-09-17	2006-11-06	2004-05-26	ENSG00000141646	ENSG00000141646		"""SMADs"""	6770	protein-coding gene	gene with protein product		600993	"""MAD, mothers against decapentaplegic homolog 4 (Drosophila)"", ""SMAD, mothers against DPP homolog 4 (Drosophila)"""	MADH4		8553070, 8774881	Standard	NM_005359		Approved	DPC4	uc010xdp.2	Q13485	OTTHUMG00000132696	ENST00000342988.3:c.725C>G	18.37:g.48584552C>G	ENSP00000341551:p.Ser242*		Somatic				SMAD4_uc010xdo.1_RNA|SMAD4_uc002lfb.3_Nonsense_Mutation_p.S87*	p.S242*	NM_005359	NP_005350	WXS	Illumina HiSeq	Unspecified	Q13485	SMAD4_HUMAN		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)	6	1263	+		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)	242					A8K405	Nonsense_Mutation	SNP	ENST00000342988.3	37	c.725C>G	CCDS11950.1	.	.	.	.	.	.	.	.	.	.	C	39	7.838980	0.98519	.	.	ENSG00000141646	ENST00000342988;ENST00000544926;ENST00000398417	.	.	.	5.76	5.76	0.90799	.	0.245141	0.35262	N	0.003326	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	.	19.0946	0.93244	0.0:1.0:0.0:0.0	.	.	.	.	X	242	.	ENSP00000341551:S242X	S	+	2	0	SMAD4	46838550	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.740000	0.68629	2.882000	0.98803	0.655000	0.94253	TCA		0.433	SMAD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255993.3	NM_005359		14	8	0	0	0	1	0	14	8				
ATP8B3	148229	broad.mit.edu	37	19	1785556	1785556	+	Missense_Mutation	SNP	C	C	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr19:1785556C>T	ENST00000310127.6	-	26	3543	c.3305G>A	c.(3304-3306)cGc>cAc	p.R1102H	ATP8B3_ENST00000539485.1_Missense_Mutation_p.R1112H|ATP8B3_ENST00000525591.1_Missense_Mutation_p.R1065H	NM_138813.3	NP_620168.1	O60423	AT8B3_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 3	1102					binding of sperm to zona pellucida (GO:0007339)	acrosomal vesicle (GO:0001669)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.R1112H(1)		central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(9)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	23		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGCCGTGTCGCGGCTGATCCA	0.602																																							uc002ltw.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(3304-3306)CGC>CAC		ATPase, class I, type 8B, member 3							35.0	43.0	40.0					19																	1785556		2076	4197	6273	SO:0001583	missense	148229				ATP biosynthetic process		ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity	g.chr19:1785556C>T	AA827939	CCDS45901.1, CCDS54196.1	19p13.3	2010-04-28	2010-04-28		ENSG00000130270	ENSG00000130270		"""ATPases / P-type"""	13535	protein-coding gene	gene with protein product	"""aminophospholipid translocase ATP8B3"", ""potential phospholipid-transporting ATPase IK"""	605866	"""ATPase, Class I, type 8B, member 3"", ""ATPase, class I, type 8B, member 3"""			11015572	Standard	NM_138813		Approved	ATPIK	uc002ltw.4	O60423	OTTHUMG00000166189	ENST00000310127.6:c.3305G>A	19.37:g.1785556C>T	ENSP00000311336:p.Arg1102His		Somatic				ATP8B3_uc002ltv.2_Missense_Mutation_p.R1065H|ATP8B3_uc002ltx.2_RNA	p.R1102H	NM_138813	NP_620168	WXS	Illumina HiSeq	Unspecified	O60423	AT8B3_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	26	3539	-		Hepatocellular(1079;0.137)	1102			Extracellular (Potential).		Q7Z485|Q8IVB8|Q8N4Y8|Q96M22	Missense_Mutation	SNP	ENST00000310127.6	37	c.3305G>A	CCDS45901.1	.	.	.	.	.	.	.	.	.	.	C	7.549	0.662266	0.14645	.	.	ENSG00000130270	ENST00000310127;ENST00000539485;ENST00000525591	T;T;T	0.39406	1.08;1.08;1.08	4.48	-8.96	0.00761	.	1.486560	0.04271	N	0.342003	T	0.26048	0.0635	L	0.28054	0.825	0.09310	N	1	B;B	0.11235	0.004;0.001	B;B	0.04013	0.001;0.001	T	0.15235	-1.0444	10	0.17369	T	0.5	.	12.2844	0.54783	0.0:0.0924:0.1805:0.7271	.	1102;1065	O60423;Q7Z485	AT8B3_HUMAN;.	H	1102;1112;1065	ENSP00000311336:R1102H;ENSP00000443574:R1112H;ENSP00000437115:R1065H	ENSP00000311336:R1102H	R	-	2	0	ATP8B3	1736556	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.942000	0.00682	-2.215000	0.00733	-0.768000	0.03414	CGC		0.602	ATP8B3-002	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000388279.1	NM_138813		10	15	0	0	0	1	0	10	15				
NFIC	4782	broad.mit.edu	37	19	3381997	3381997	+	Silent	SNP	C	C	G			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr19:3381997C>G	ENST00000443272.2	+	2	369	c.318C>G	c.(316-318)ctC>ctG	p.L106L	NFIC_ENST00000589123.1_Silent_p.L97L|NFIC_ENST00000346156.5_Silent_p.L97L|NFIC_ENST00000395111.3_Silent_p.L97L|NFIC_ENST00000590282.1_Silent_p.L106L|NFIC_ENST00000341919.3_Silent_p.L106L|NFIC_ENST00000586919.1_Silent_p.L97L	NM_001245002.1	NP_001231931.1	P08651	NFIC_HUMAN	nuclear factor I/C (CCAAT-binding transcription factor)	106					DNA replication (GO:0006260)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	nucleolus (GO:0005730)|nucleus (GO:0005634)	core promoter proximal region DNA binding (GO:0001159)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L97L(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	21		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;7.8e-05)|Epithelial(107;2.94e-108)|BRCA - Breast invasive adenocarcinoma(158;0.00154)|STAD - Stomach adenocarcinoma(1328;0.191)		GCTGCGTGCTCTCCAACCCCG	0.667																																							uc010xhi.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(316-318)CTC>CTG		nuclear factor I/C isoform 2							77.0	83.0	81.0					19																	3381997		2203	4300	6503	SO:0001819	synonymous_variant	4782				DNA replication|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr19:3381997C>G	X12492	CCDS12107.1, CCDS45914.1, CCDS58640.1, CCDS59330.1, CCDS59331.1	19p13.3	2008-02-05				ENSG00000141905			7786	protein-coding gene	gene with protein product		600729		NFI		3398920, 7590749	Standard	NM_205843		Approved	CTF, NF-I, CTF5	uc010xhi.2	P08651		ENST00000443272.2:c.318C>G	19.37:g.3381997C>G			Somatic				NFIC_uc002lxo.2_Silent_p.L97L|NFIC_uc010xhh.1_Silent_p.L97L|NFIC_uc002lxp.2_Silent_p.L106L|NFIC_uc010xhj.1_Silent_p.L106L|NFIC_uc002lxq.1_Silent_p.L58L	p.L106L	NM_205843	NP_995315	WXS	Illumina HiSeq	Unspecified	P08651	NFIC_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;7.8e-05)|Epithelial(107;2.94e-108)|BRCA - Breast invasive adenocarcinoma(158;0.00154)|STAD - Stomach adenocarcinoma(1328;0.191)	2	380	+		Hepatocellular(1079;0.137)	106			CTF/NF-I.		A8K1H0|B7Z4U5|B7Z9C3|K7EMU1|P08652|Q14932|Q9UPJ3|Q9UPJ9|Q9UPK0|Q9UPK1	Silent	SNP	ENST00000443272.2	37	c.318C>G	CCDS59330.1																																																																																				0.667	NFIC-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452834.1	NM_005597		42	53	0	0	0	1	0	42	53				
C3	718	broad.mit.edu	37	19	6707234	6707234	+	Missense_Mutation	SNP	C	C	G			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr19:6707234C>G	ENST00000245907.6	-	17	2190	c.2098G>C	c.(2098-2100)Gag>Cag	p.E700Q		NM_000064.2	NP_000055.2	P01024	CO3_HUMAN	complement component 3	700	Anaphylatoxin-like. {ECO:0000255|PROSITE- ProRule:PRU00022}.			E -> Q (in Ref. 6; AA sequence). {ECO:0000305}.	complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|fatty acid metabolic process (GO:0006631)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of activation of membrane attack complex (GO:0001970)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic cell clearance (GO:2000427)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|positive regulation of glucose transport (GO:0010828)|positive regulation of lipid storage (GO:0010884)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of type IIa hypersensitivity (GO:0001798)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|regulation of immune response (GO:0050776)|regulation of triglyceride biosynthetic process (GO:0010866)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	C5L2 anaphylatoxin chemotactic receptor binding (GO:0031715)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)	p.E700Q(1)		breast(5)|endometrium(7)|kidney(6)|large_intestine(18)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)	72				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)	Intravenous Immunoglobulin(DB00028)	ATGGGGTTCTCCCGCATGCCG	0.652																																							uc002mfm.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|ovary(1)|pancreas(1)	5						c.(2098-2100)GAG>CAG		complement component 3 precursor							37.0	34.0	35.0					19																	6707234		2201	4297	6498	SO:0001583	missense	718				complement activation, alternative pathway|complement activation, classical pathway|G-protein coupled receptor protein signaling pathway|inflammatory response|positive regulation vascular endothelial growth factor production	extracellular space	endopeptidase inhibitor activity|receptor binding	g.chr19:6707234C>G	J04763	CCDS32883.1	19p13.3-p13.2	2014-09-17			ENSG00000125730	ENSG00000125730	3.4.21.43	"""Complement system"", ""Endogenous ligands"""	1318	protein-coding gene	gene with protein product	"""C3a anaphylatoxin"", ""complement component C3a"", ""complement component C3b"", ""prepro-C3"""	120700					Standard	NM_000064		Approved	CPAMD1, ARMD9, C3a, C3b	uc002mfm.3	P01024	OTTHUMG00000150335	ENST00000245907.6:c.2098G>C	19.37:g.6707234C>G	ENSP00000245907:p.Glu700Gln		Somatic					p.E700Q	NM_000064	NP_000055	WXS	Illumina HiSeq	Unspecified	P01024	CO3_HUMAN		GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)	17	2160	-			700	E -> Q (in Ref. 5; AA sequence).		Anaphylatoxin-like.		A7E236	Missense_Mutation	SNP	ENST00000245907.6	37	c.2098G>C	CCDS32883.1	.	.	.	.	.	.	.	.	.	.	C	14.28	2.487932	0.44249	.	.	ENSG00000125730	ENST00000245907	T	0.23147	1.92	4.85	3.71	0.42584	Anaphylatoxin (2);Anaphylatoxin/fibulin (4);	1.153370	0.06447	N	0.727121	T	0.42426	0.1202	M	0.67517	2.055	0.09310	N	1	P	0.43542	0.81	P	0.50490	0.642	T	0.40831	-0.9542	10	0.18710	T	0.47	.	15.6716	0.77283	0.0:0.8495:0.1505:0.0	.	700	P01024	CO3_HUMAN	Q	700	ENSP00000245907:E700Q	ENSP00000245907:E700Q	E	-	1	0	C3	6658234	0.122000	0.22280	0.914000	0.36105	0.165000	0.22458	1.641000	0.37197	2.244000	0.73946	0.591000	0.81541	GAG		0.652	C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317636.2	NM_000064		8	12	0	0	0	1	0	8	12				
ZNF180	7733	broad.mit.edu	37	19	44980651	44980651	+	Missense_Mutation	SNP	G	G	C			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr19:44980651G>C	ENST00000221327.4	-	5	2328	c.2047C>G	c.(2047-2049)Cat>Gat	p.H683D	ZNF180_ENST00000391956.4_Missense_Mutation_p.H658D|AC069278.4_ENST00000591684.1_lincRNA|ZNF180_ENST00000585514.1_5'Flank|ZNF180_ENST00000592529.1_Missense_Mutation_p.H656D	NM_013256.3	NP_037388.2	Q9UJW8	ZN180_HUMAN	zinc finger protein 180	683					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.H683D(1)		NS(1)|breast(1)|endometrium(3)|kidney(5)|large_intestine(14)|lung(6)|ovary(2)|urinary_tract(1)	33		Prostate(69;0.0435)				TCTTCAGTATGAGTTGCCTGA	0.313																																					Esophageal Squamous(180;1353 2003 32862 46574 49854)	Esophageal Squamous(180;1353 2003 32862 46574 49854)	uc002ozf.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(2047-2049)CAT>GAT		zinc finger protein 180							78.0	84.0	82.0					19																	44980651		2202	4299	6501	SO:0001583	missense	7733				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:44980651G>C	AF192913	CCDS12639.1, CCDS62707.1, CCDS62708.1	19q13.2	2013-01-08	2006-08-22			ENSG00000167384		"""Zinc fingers, C2H2-type"", ""-"""	12970	protein-coding gene	gene with protein product		606740	"""zinc finger protein 180 (HHZ168)"""				Standard	NM_001288762		Approved	HHZ168	uc002ozf.4	Q9UJW8		ENST00000221327.4:c.2047C>G	19.37:g.44980651G>C	ENSP00000221327:p.His683Asp		Somatic				ZNF180_uc002ozh.3_Missense_Mutation_p.H340D|ZNF180_uc002ozi.3_Missense_Mutation_p.H656D|ZNF180_uc002ozg.3_Missense_Mutation_p.H682D|ZNF180_uc010ejm.2_Missense_Mutation_p.H658D	p.H683D	NM_013256	NP_037388	WXS	Illumina HiSeq	Unspecified	Q9UJW8	ZN180_HUMAN			5	2329	-		Prostate(69;0.0435)	683			C2H2-type 12.		B2RCN6|B3KV56|K7EQX9|Q58F03|Q9P1U2	Missense_Mutation	SNP	ENST00000221327.4	37	c.2047C>G	CCDS12639.1	.	.	.	.	.	.	.	.	.	.	G	16.38	3.108444	0.56291	.	.	ENSG00000167384	ENST00000221327;ENST00000391956	T;T	0.03152	4.03;4.03	5.48	3.21	0.36854	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.43416	D	0.000564	T	0.10809	0.0264	M	0.94063	3.49	0.80722	D	1	B;B;B	0.32338	0.365;0.25;0.25	B;B;B	0.33620	0.167;0.081;0.081	T	0.01149	-1.1436	10	0.87932	D	0	-18.5196	10.0965	0.42478	0.0771:0.138:0.785:0.0	.	658;682;683	G5E9B8;Q58F03;Q9UJW8	.;.;ZN180_HUMAN	D	683;658	ENSP00000221327:H683D;ENSP00000375818:H658D	ENSP00000221327:H683D	H	-	1	0	ZNF180	49672491	1.000000	0.71417	0.674000	0.29902	0.903000	0.53119	5.538000	0.67193	1.453000	0.47775	0.591000	0.81541	CAT		0.313	ZNF180-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451601.1	NM_013256		26	67	0	0	0	1	0	26	67				
FTL	2512	broad.mit.edu	37	19	49469553	49469553	+	Missense_Mutation	SNP	G	G	C	rs559631027		TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr19:49469553G>C	ENST00000331825.6	+	3	472	c.265G>C	c.(265-267)Gag>Cag	p.E89Q	CTD-2639E6.9_ENST00000599784.1_lincRNA	NM_000146.3	NP_000137.2	P02792	FRIL_HUMAN	ferritin, light polypeptide	89	Ferritin-like diiron. {ECO:0000255|PROSITE-ProRule:PRU00085}.			E -> W (in Ref. 12; AA sequence). {ECO:0000305}.	cell death (GO:0008219)|cellular iron ion homeostasis (GO:0006879)|iron ion homeostasis (GO:0055072)|iron ion transport (GO:0006826)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular ferritin complex (GO:0008043)|membrane (GO:0016020)	ferric iron binding (GO:0008199)|identical protein binding (GO:0042802)|iron ion binding (GO:0005506)	p.E89Q(1)		cervix(1)|kidney(3)|lung(5)	9		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000152)|all cancers(93;0.000435)|GBM - Glioblastoma multiforme(486;0.0171)|Epithelial(262;0.0267)	Iron Dextran(DB00893)	AGCTGAAGATGAGTGGGGTAA	0.512																																							uc002plo.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(265-267)GAG>CAG		ferritin, light polypeptide	Iron Dextran(DB00893)						45.0	50.0	48.0					19																	49469553		2203	4300	6503	SO:0001583	missense	2512				cell death|cellular iron ion homeostasis|cellular membrane organization|iron ion transport|post-Golgi vesicle-mediated transport	cytosol|intracellular ferritin complex	ferric iron binding|identical protein binding|oxidoreductase activity	g.chr19:49469553G>C	AY207005	CCDS33070.1	19q13.33	2014-05-19			ENSG00000087086	ENSG00000087086			3999	protein-coding gene	gene with protein product	"""ferritin light polypeptide-like 3"", ""L apoferritin"", ""ferritin L subunit"", ""ferritin light chain"", ""ferritin L-chain"", ""neurodegeneration with brain iron accumulation 3"""	134790				3000916, 9526618	Standard	NM_000146		Approved	MGC71996, NBIA3	uc002plo.3	P02792		ENST00000331825.6:c.265G>C	19.37:g.49469553G>C	ENSP00000366525:p.Glu89Gln		Somatic				FTL_uc002pln.1_3'UTR	p.E89Q	NM_000146	NP_000137	WXS	Illumina HiSeq	Unspecified	P02792	FRIL_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.000152)|all cancers(93;0.000435)|GBM - Glioblastoma multiforme(486;0.0171)|Epithelial(262;0.0267)	3	464	+		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)	89	E -> W (in Ref. 12; AA sequence).		Ferritin-like diiron.		B2R4B9|Q6IBT7|Q7Z2W1|Q86WI9|Q8WU07|Q96AU9|Q96CU0|Q9BTZ8	Missense_Mutation	SNP	ENST00000331825.6	37	c.265G>C	CCDS33070.1	.	.	.	.	.	.	.	.	.	.	G	18.83	3.707285	0.68615	.	.	ENSG00000087086	ENST00000331825;ENST00000397259	T	0.70869	-0.52	4.46	4.46	0.54185	Ferritin/ribonucleotide reductase-like (1);Ferritin-related (1);Ferritin/DPS protein domain (1);Ferritin-like (1);	0.054750	0.64402	D	0.000001	T	0.76933	0.4057	M	0.82056	2.57	0.38622	D	0.95115	P	0.35959	0.53	B	0.42692	0.395	T	0.82824	-0.0266	10	0.87932	D	0	.	15.0094	0.71539	0.0:0.0:1.0:0.0	.	89	P02792	FRIL_HUMAN	Q	89	ENSP00000366525:E89Q	ENSP00000366525:E89Q	E	+	1	0	FTL	54161365	1.000000	0.71417	1.000000	0.80357	0.617000	0.37484	7.011000	0.76359	2.485000	0.83878	0.563000	0.77884	GAG		0.512	FTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466233.1	NM_000146		15	31	0	0	0	1	0	15	31				
FTL	2512	broad.mit.edu	37	19	49469609	49469609	+	Silent	SNP	G	G	T	rs11553263		TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr19:49469609G>T	ENST00000331825.6	+	3	528	c.321G>T	c.(319-321)ctG>ctT	p.L107L	CTD-2639E6.9_ENST00000599784.1_lincRNA	NM_000146.3	NP_000137.2	P02792	FRIL_HUMAN	ferritin, light polypeptide	107	Ferritin-like diiron. {ECO:0000255|PROSITE-ProRule:PRU00085}.				cell death (GO:0008219)|cellular iron ion homeostasis (GO:0006879)|iron ion homeostasis (GO:0055072)|iron ion transport (GO:0006826)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular ferritin complex (GO:0008043)|membrane (GO:0016020)	ferric iron binding (GO:0008199)|identical protein binding (GO:0042802)|iron ion binding (GO:0005506)	p.L107L(1)		cervix(1)|kidney(3)|lung(5)	9		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000152)|all cancers(93;0.000435)|GBM - Glioblastoma multiforme(486;0.0171)|Epithelial(262;0.0267)	Iron Dextran(DB00893)	AGAAAAAGCTGAACCAGGCCC	0.547																																							uc002plo.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(319-321)CTG>CTT		ferritin, light polypeptide	Iron Dextran(DB00893)						46.0	46.0	46.0					19																	49469609		2203	4300	6503	SO:0001819	synonymous_variant	2512				cell death|cellular iron ion homeostasis|cellular membrane organization|iron ion transport|post-Golgi vesicle-mediated transport	cytosol|intracellular ferritin complex	ferric iron binding|identical protein binding|oxidoreductase activity	g.chr19:49469609G>T	AY207005	CCDS33070.1	19q13.33	2014-05-19			ENSG00000087086	ENSG00000087086			3999	protein-coding gene	gene with protein product	"""ferritin light polypeptide-like 3"", ""L apoferritin"", ""ferritin L subunit"", ""ferritin light chain"", ""ferritin L-chain"", ""neurodegeneration with brain iron accumulation 3"""	134790				3000916, 9526618	Standard	NM_000146		Approved	MGC71996, NBIA3	uc002plo.3	P02792		ENST00000331825.6:c.321G>T	19.37:g.49469609G>T			Somatic				FTL_uc002pln.1_3'UTR	p.L107L	NM_000146	NP_000137	WXS	Illumina HiSeq	Unspecified	P02792	FRIL_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.000152)|all cancers(93;0.000435)|GBM - Glioblastoma multiforme(486;0.0171)|Epithelial(262;0.0267)	3	520	+		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)	107			Ferritin-like diiron.		B2R4B9|Q6IBT7|Q7Z2W1|Q86WI9|Q8WU07|Q96AU9|Q96CU0|Q9BTZ8	Silent	SNP	ENST00000331825.6	37	c.321G>T	CCDS33070.1																																																																																				0.547	FTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466233.1	NM_000146		17	28	1	0	3.52763e-06	1	3.77323e-06	17	28				
SPIB	6689	broad.mit.edu	37	19	50926966	50926966	+	Silent	SNP	G	G	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr19:50926966G>A	ENST00000595883.1	+	5	469	c.444G>A	c.(442-444)tcG>tcA	p.S148S	SPIB_ENST00000596074.1_Missense_Mutation_p.G77R|CTD-2545M3.6_ENST00000599632.1_Missense_Mutation_p.G283R|SPIB_ENST00000439922.2_Silent_p.S57S|SPIB_ENST00000270632.7_Silent_p.S148S|SPIB_ENST00000597855.1_Missense_Mutation_p.G137R	NM_001243999.1|NM_001244000.1|NM_003121.4	NP_001230928.1|NP_001230929.1|NP_003112.2	Q01892	SPIB_HUMAN	Spi-B transcription factor (Spi-1/PU.1 related)	148					cell differentiation (GO:0030154)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.S148S(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(8)	14		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00757)|GBM - Glioblastoma multiforme(134;0.0186)		ACAGCGAGTCGGATGAGGCCC	0.672																																							uc002psd.2		NA																	1	Substitution - coding silent(1)		lung(1)	lung(1)|kidney(1)	2						c.(442-444)TCG>TCA		Spi-B transcription factor (Spi-1/PU.1 related)							49.0	44.0	45.0					19																	50926966		2203	4300	6503	SO:0001819	synonymous_variant	6689				regulation of transcription from RNA polymerase II promoter	cytoplasm|microtubule cytoskeleton|nucleus	sequence-specific DNA binding	g.chr19:50926966G>A		CCDS33080.1, CCDS58674.1, CCDS59412.1	19q13.3-q13.4	2008-07-22				ENSG00000269404			11242	protein-coding gene	gene with protein product		606802				1406622	Standard	NM_003121		Approved	SPI-B	uc002psd.3	Q01892		ENST00000595883.1:c.444G>A	19.37:g.50926966G>A			Somatic				SPIB_uc002pse.2_Silent_p.S148S|SPIB_uc010ycc.1_Silent_p.S57S	p.S148S	NM_003121	NP_003112	WXS	Illumina HiSeq	Unspecified	Q01892	SPIB_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00757)|GBM - Glioblastoma multiforme(134;0.0186)	5	469	+		all_neural(266;0.131)	148					A8K9C9|B4DUG6|Q15359	Silent	SNP	ENST00000595883.1	37	c.444G>A	CCDS33080.1																																																																																				0.672	SPIB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464744.1	NM_003121		4	13	0	0	0	1	0	4	13				
ZNF836	162962	broad.mit.edu	37	19	52658555	52658555	+	Missense_Mutation	SNP	G	G	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr19:52658555G>A	ENST00000322146.8	-	5	2902	c.2381C>T	c.(2380-2382)gCa>gTa	p.A794V	CTC-471J1.8_ENST00000594362.1_RNA|ZNF836_ENST00000597252.1_Missense_Mutation_p.A794V	NM_001102657.1	NP_001096127.1	Q6ZNA1	ZN836_HUMAN	zinc finger protein 836	794					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A794V(2)		endometrium(2)|kidney(2)|large_intestine(9)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26						CCGATGACGTGCTAGTGTTGA	0.423																																							uc010ydi.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(2380-2382)GCA>GTA		zinc finger protein 836							118.0	125.0	123.0					19																	52658555		2203	4300	6503	SO:0001583	missense	162962				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:52658555G>A	BC011784	CCDS46162.1	19q13.33	2013-01-08			ENSG00000196267	ENSG00000196267		"""Zinc fingers, C2H2-type"", ""-"""	34333	protein-coding gene	gene with protein product							Standard	NM_001102657		Approved	FLJ16287	uc010ydj.2	Q6ZNA1		ENST00000322146.8:c.2381C>T	19.37:g.52658555G>A	ENSP00000325038:p.Ala794Val		Somatic				ZNF836_uc010ydj.1_Missense_Mutation_p.A794V	p.A794V	NM_001102657	NP_001096127	WXS	Illumina HiSeq	Unspecified	Q6ZNA1	ZN836_HUMAN			5	2755	-			794			C2H2-type 21.			Missense_Mutation	SNP	ENST00000322146.8	37	c.2381C>T	CCDS46162.1	.	.	.	.	.	.	.	.	.	.	G	3.175	-0.169134	0.06461	.	.	ENSG00000196267	ENST00000322146	T	0.36520	1.25	1.9	-3.8	0.04307	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.13200	0.0320	N	0.05199	-0.095	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.25779	-1.0122	9	0.14656	T	0.56	.	5.1443	0.14977	0.318:0.2724:0.4096:0.0	.	794	Q6ZNA1	ZN836_HUMAN	V	794	ENSP00000325038:A794V	ENSP00000325038:A794V	A	-	2	0	ZNF836	57350367	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	-4.622000	0.00207	-1.707000	0.01402	-0.439000	0.05793	GCA		0.423	ZNF836-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462456.1	NM_001102657		38	65	0	0	0	1	0	38	65				
ZBTB45	84878	broad.mit.edu	37	19	59028392	59028392	+	Missense_Mutation	SNP	C	C	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr19:59028392C>T	ENST00000594051.1	-	2	1129	c.649G>A	c.(649-651)Gag>Aag	p.E217K	ZBTB45_ENST00000600990.1_Missense_Mutation_p.E217K|ZBTB45_ENST00000354590.3_Missense_Mutation_p.E217K			Q96K62	ZBT45_HUMAN	zinc finger and BTB domain containing 45	217					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E217K(1)		breast(2)|endometrium(3)|lung(5)|urinary_tract(1)	11		all_cancers(17;1.81e-17)|all_epithelial(17;1.21e-12)|Lung NSC(17;2.8e-05)|all_lung(17;0.000139)|Colorectal(82;0.000147)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0165)|Lung(386;0.18)		CCATCGGTCTCATCGTCACTT	0.652											OREG0025700	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									NSCLC(164;1383 2017 5233 27540 46677)	NSCLC(164;1383 2017 5233 27540 46677)	uc002qtd.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(649-651)GAG>AAG		zinc finger and BTB domain containing 45							197.0	203.0	201.0					19																	59028392		2203	4300	6503	SO:0001583	missense	84878				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:59028392C>T	AK027392	CCDS12984.1	19q13.43	2013-10-10	2006-09-19	2006-09-19	ENSG00000119574	ENSG00000119574		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	23715	protein-coding gene	gene with protein product			"""zinc finger protein 499"""	ZNF499			Standard	NM_032792		Approved	FLJ14486	uc002qtd.3	Q96K62	OTTHUMG00000183545	ENST00000594051.1:c.649G>A	19.37:g.59028392C>T	ENSP00000469089:p.Glu217Lys		Somatic	OREG0025700	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1035	ZBTB45_uc002qte.2_Missense_Mutation_p.E217K|ZBTB45_uc002qtf.2_Missense_Mutation_p.E217K	p.E217K	NM_032792	NP_116181	WXS	Illumina HiSeq	Unspecified	Q96K62	ZBT45_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0165)|Lung(386;0.18)	2	941	-		all_cancers(17;1.81e-17)|all_epithelial(17;1.21e-12)|Lung NSC(17;2.8e-05)|all_lung(17;0.000139)|Colorectal(82;0.000147)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)	217						Missense_Mutation	SNP	ENST00000594051.1	37	c.649G>A	CCDS12984.1	.	.	.	.	.	.	.	.	.	.	c	11.57	1.676751	0.29783	.	.	ENSG00000119574	ENST00000354590	T	0.08546	3.08	3.03	3.03	0.35002	.	0.678073	0.10910	U	0.620728	T	0.04092	0.0114	N	0.14661	0.345	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.43669	-0.9377	10	0.07175	T	0.84	.	6.1436	0.20273	0.0:0.8602:0.0:0.1398	.	217	Q96K62	ZBT45_HUMAN	K	217	ENSP00000346603:E217K	ENSP00000346603:E217K	E	-	1	0	ZBTB45	63720204	0.670000	0.27512	0.015000	0.15790	0.070000	0.16714	3.316000	0.51960	2.014000	0.59158	0.467000	0.42956	GAG		0.652	ZBTB45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467067.1	NM_032792		10	324	0	0	0	1	0	10	324				
CLHC1	130162	broad.mit.edu	37	2	55439826	55439826	+	Missense_Mutation	SNP	G	G	C			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr2:55439826G>C	ENST00000401408.1	-	5	827	c.482C>G	c.(481-483)cCt>cGt	p.P161R	CLHC1_ENST00000407122.1_Missense_Mutation_p.P161R|CLHC1_ENST00000494539.1_Intron|CLHC1_ENST00000406437.2_Intron|CLHC1_ENST00000406076.1_Missense_Mutation_p.P39R|AC012358.7_ENST00000366153.2_RNA	NM_152385.2	NP_689598.2	Q8NHS4	CLHC1_HUMAN	clathrin heavy chain linker domain containing 1	161								p.P161R(2)									AGGTTTTGAAGGATCTTTGGA	0.313																																							uc002ryi.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|central_nervous_system(1)	3						c.(481-483)CCT>CGT		hypothetical protein LOC130162 isoform 1							108.0	105.0	106.0					2																	55439826		2201	4300	6501	SO:0001583	missense	130162						binding	g.chr2:55439826G>C		CCDS33201.1, CCDS46287.1	2p16.1	2012-08-03	2012-08-03	2012-08-03	ENSG00000162994	ENSG00000162994			26453	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 63"""	C2orf63			Standard	NM_152385		Approved	FLJ31438	uc002ryi.2	Q8NHS4	OTTHUMG00000151918	ENST00000401408.1:c.482C>G	2.37:g.55439826G>C	ENSP00000384869:p.Pro161Arg		Somatic				C2orf63_uc002ryh.2_Intron|C2orf63_uc002ryj.2_Missense_Mutation_p.P39R	p.P161R	NM_152385	NP_689598	WXS	Illumina HiSeq	Unspecified	Q8NHS4	CB063_HUMAN	LUSC - Lung squamous cell carcinoma(58;0.179)|Lung(47;0.189)		5	828	-			161					B2RDV1|Q53R93|Q8N403	Missense_Mutation	SNP	ENST00000401408.1	37	c.482C>G	CCDS33201.1	.	.	.	.	.	.	.	.	.	.	G	10.37	1.332311	0.24167	.	.	ENSG00000162994	ENST00000407122;ENST00000401408;ENST00000406076	T;T;T	0.18810	2.19;2.19;2.19	4.85	3.96	0.45880	.	0.485687	0.20613	N	0.088922	T	0.31199	0.0789	M	0.64997	1.995	0.80722	D	1	D	0.57899	0.981	P	0.52758	0.708	T	0.04005	-1.0985	10	0.59425	D	0.04	-3.6859	8.5479	0.33433	0.1112:0.0:0.8888:0.0	.	161	Q8NHS4	CB063_HUMAN	R	161;161;39	ENSP00000385778:P161R;ENSP00000384869:P161R;ENSP00000385512:P39R	ENSP00000384869:P161R	P	-	2	0	C2orf63	55293330	1.000000	0.71417	0.957000	0.39632	0.743000	0.42351	2.203000	0.42752	1.135000	0.42183	0.555000	0.69702	CCT		0.313	CLHC1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324412.4	NM_152385		12	31	0	0	0	1	0	12	31				
OTX1	5013	broad.mit.edu	37	2	63280140	63280140	+	Silent	SNP	C	C	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr2:63280140C>T	ENST00000282549.2	+	3	291	c.15C>T	c.(13-15)ctC>ctT	p.L5L	OTX1_ENST00000366671.3_Silent_p.L5L	NM_014562.3	NP_055377.1	P32242	OTX1_HUMAN	orthodenticle homeobox 1	5					anterior/posterior pattern specification (GO:0009952)|diencephalon morphogenesis (GO:0048852)|inner ear morphogenesis (GO:0042472)|metencephalon development (GO:0022037)|midbrain development (GO:0030901)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.L5L(1)		endometrium(1)|kidney(2)|large_intestine(6)|lung(6)|pancreas(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	20	Lung NSC(7;0.121)|all_lung(7;0.211)					TGTCTTACCTCAAACAACCCC	0.687																																							uc002scd.2		NA																	1	Substitution - coding silent(1)		lung(1)	pancreas(2)	2						c.(13-15)CTC>CTT		orthodenticle homeobox 1							72.0	84.0	80.0					2																	63280140		2203	4299	6502	SO:0001819	synonymous_variant	5013					nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr2:63280140C>T		CCDS1873.1	2p15	2011-06-20	2007-02-15		ENSG00000115507	ENSG00000115507		"""Homeoboxes / PRD class"""	8521	protein-coding gene	gene with protein product		600036	"""orthodenticle (Drosophila) homolog 1"", ""orthodenticle homolog 1 (Drosophila)"""			7959790	Standard	NM_001199770		Approved		uc002scd.3	P32242	OTTHUMG00000129454	ENST00000282549.2:c.15C>T	2.37:g.63280140C>T			Somatic				OTX1_uc010ypt.1_5'UTR	p.L5L	NM_014562	NP_055377	WXS	Illumina HiSeq	Unspecified	P32242	OTX1_HUMAN			3	263	+	Lung NSC(7;0.121)|all_lung(7;0.211)		5					A6NHA2|B3KTJ4|Q53TG6	Silent	SNP	ENST00000282549.2	37	c.15C>T	CCDS1873.1																																																																																				0.687	OTX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251617.1			18	92	0	0	0	1	0	18	92				
DYSF	8291	broad.mit.edu	37	2	71901354	71901354	+	Missense_Mutation	SNP	G	G	A	rs398123796		TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr2:71901354G>A	ENST00000258104.3	+	51	5972	c.5695G>A	c.(5695-5697)Gag>Aag	p.E1899K	DYSF_ENST00000409651.1_Missense_Mutation_p.E1931K|DYSF_ENST00000410041.1_Missense_Mutation_p.E1917K|DYSF_ENST00000394120.2_Missense_Mutation_p.E1900K|DYSF_ENST00000409582.3_Missense_Mutation_p.E1937K|DYSF_ENST00000429174.2_Missense_Mutation_p.E1920K|DYSF_ENST00000409366.1_Missense_Mutation_p.E1921K|DYSF_ENST00000409762.1_Missense_Mutation_p.E1916K|DYSF_ENST00000410020.3_Missense_Mutation_p.E1938K|DYSF_ENST00000409744.1_Missense_Mutation_p.E1907K|DYSF_ENST00000479049.2_3'UTR|DYSF_ENST00000413539.2_Missense_Mutation_p.E1930K	NM_001130976.1|NM_003494.3	NP_001124448.1|NP_003485.1	O75923	DYSF_HUMAN	dysferlin	1899	C2 7. {ECO:0000255|PROSITE- ProRule:PRU00041}.				plasma membrane repair (GO:0001778)|vesicle fusion (GO:0006906)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phospholipid binding (GO:0005543)	p.E1899K(1)|p.E1938K(1)		autonomic_ganglia(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(57)|ovary(3)|pancreas(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	111						GGACAAGACTGAGAGCAAAAT	0.502																																							uc002sie.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|breast(2)|pancreas(1)|skin(1)	7						c.(5695-5697)GAG>AAG		dysferlin isoform 8							144.0	125.0	132.0					2																	71901354		2203	4300	6503	SO:0001583	missense	8291					cytoplasmic vesicle membrane|integral to membrane|sarcolemma	calcium-dependent phospholipid binding	g.chr2:71901354G>A	AF075575	CCDS1918.1, CCDS46323.1, CCDS46324.1, CCDS46325.1, CCDS46326.1, CCDS46327.1, CCDS46328.1, CCDS46329.1, CCDS46330.1, CCDS46331.1, CCDS46332.1	2p13.3	2014-09-17	2013-09-12		ENSG00000135636	ENSG00000135636			3097	protein-coding gene	gene with protein product	"""fer-1-like family member 1"""	603009	"""limb girdle muscular dystrophy 2B (autosomal recessive)"""	LGMD2B		8320700	Standard	NM_003494		Approved	FER1L1	uc010fen.3	O75923	OTTHUMG00000129757	ENST00000258104.3:c.5695G>A	2.37:g.71901354G>A	ENSP00000258104:p.Glu1899Lys		Somatic				DYSF_uc010feg.2_Missense_Mutation_p.E1930K|DYSF_uc010feh.2_Missense_Mutation_p.E1906K|DYSF_uc002sig.3_Missense_Mutation_p.E1885K|DYSF_uc010yqx.1_RNA|DYSF_uc010fee.2_Missense_Mutation_p.E1920K|DYSF_uc010fef.2_Missense_Mutation_p.E1937K|DYSF_uc010fei.2_Missense_Mutation_p.E1916K|DYSF_uc010fek.2_Missense_Mutation_p.E1917K|DYSF_uc010fej.2_Missense_Mutation_p.E1907K|DYSF_uc010fel.2_Missense_Mutation_p.E1886K|DYSF_uc010feo.2_Missense_Mutation_p.E1931K|DYSF_uc010fem.2_Missense_Mutation_p.E1921K|DYSF_uc010fen.2_Missense_Mutation_p.E1938K|DYSF_uc002sif.2_Missense_Mutation_p.E1900K|DYSF_uc010yqy.1_Missense_Mutation_p.E780K|DYSF_uc010yqz.1_Missense_Mutation_p.E660K	p.E1899K	NM_003494	NP_003485	WXS	Illumina HiSeq	Unspecified	O75923	DYSF_HUMAN			51	6071	+			1899			Cytoplasmic (Potential).		A0FK00|B1PZ70|B1PZ71|B1PZ72|B1PZ73|B1PZ74|B1PZ75|B1PZ76|B1PZ77|B1PZ78|B1PZ79|B1PZ80|B1PZ81|B3KQB9|O75696|Q09EX5|Q0H395|Q53QY3|Q53TD2|Q8TEL8|Q9UEN7	Missense_Mutation	SNP	ENST00000258104.3	37	c.5695G>A	CCDS1918.1	.	.	.	.	.	.	.	.	.	.	G	35	5.434841	0.96150	.	.	ENSG00000135636	ENST00000413539;ENST00000409762;ENST00000409582;ENST00000429174;ENST00000258104;ENST00000409651;ENST00000394120;ENST00000409744;ENST00000409366;ENST00000410020;ENST00000410041	D;D;D;D;D;D;D;D;D;D;D	0.86030	-2.06;-2.06;-2.06;-2.06;-2.06;-2.06;-2.06;-2.06;-2.06;-2.06;-2.06	5.56	5.56	0.83823	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);	0.093765	0.64402	D	0.000001	D	0.92410	0.7591	M	0.80982	2.52	0.80722	D	1	D;D;D;D;D;D;D;D;P;D;D;D;D;D;D	0.69078	0.997;0.994;0.994;0.994;0.969;0.992;0.992;0.992;0.756;0.994;0.969;0.964;0.969;0.994;0.995	D;P;P;P;P;D;D;D;P;P;P;D;P;P;D	0.73380	0.98;0.889;0.889;0.889;0.842;0.973;0.939;0.973;0.591;0.889;0.721;0.918;0.842;0.889;0.932	D	0.92271	0.5825	10	0.52906	T	0.07	-37.3059	17.3679	0.87368	0.0:0.0:1.0:0.0	.	663;1931;1938;1921;1886;1917;1907;1916;1906;1930;1937;1920;1885;1900;1899	B7Z8G4;O75923-8;O75923-13;O75923-10;O75923-9;O75923-11;O75923-12;O75923-5;O75923-6;O75923-2;O75923-7;O75923-4;O75923-3;O75923-14;O75923	.;.;.;.;.;.;.;.;.;.;.;.;.;.;DYSF_HUMAN	K	1930;1916;1937;1920;1899;1931;1900;1907;1921;1938;1917	ENSP00000407046:E1930K;ENSP00000387137:E1916K;ENSP00000386547:E1937K;ENSP00000398305:E1920K;ENSP00000258104:E1899K;ENSP00000386683:E1931K;ENSP00000377678:E1900K;ENSP00000386285:E1907K;ENSP00000386512:E1921K;ENSP00000386881:E1938K;ENSP00000386617:E1917K	ENSP00000258104:E1899K	E	+	1	0	DYSF	71754862	1.000000	0.71417	0.972000	0.41901	0.991000	0.79684	9.680000	0.98651	2.779000	0.95612	0.561000	0.74099	GAG		0.502	DYSF-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251970.3	NM_003494		16	24	0	0	0	1	0	16	24				
CTNNA2	1496	broad.mit.edu	37	2	80101245	80101245	+	Missense_Mutation	SNP	G	G	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr2:80101245G>A	ENST00000402739.4	+	5	634	c.629G>A	c.(628-630)cGa>cAa	p.R210Q	CTNNA2_ENST00000540488.1_Missense_Mutation_p.R210Q|CTNNA2_ENST00000466387.1_Missense_Mutation_p.R210Q|CTNNA2_ENST00000361291.4_Missense_Mutation_p.R244Q|CTNNA2_ENST00000541047.1_Missense_Mutation_p.R210Q|CTNNA2_ENST00000496558.1_Missense_Mutation_p.R210Q	NM_001282597.1	NP_001269526.1	P26232	CTNA2_HUMAN	catenin (cadherin-associated protein), alpha 2	210					axonogenesis (GO:0007409)|brain morphogenesis (GO:0048854)|dendrite morphogenesis (GO:0048813)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|prepulse inhibition (GO:0060134)|radial glia guided migration of Purkinje cell (GO:0021942)|regulation of synapse structural plasticity (GO:0051823)|single organismal cell-cell adhesion (GO:0016337)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|axon (GO:0030424)|basolateral plasma membrane (GO:0016323)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	structural constituent of cytoskeleton (GO:0005200)	p.R210Q(2)|p.R210L(2)		breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(49)|pancreas(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	78						GCAGCCGCCCGAGGGGCTCTG	0.512																																							uc010ysh.1		NA																	4	Substitution - Missense(4)		urinary_tract(2)|lung(2)	pancreas(4)|lung(3)|breast(1)|skin(1)	9						c.(628-630)CGA>CAA		catenin, alpha 2 isoform 1							41.0	46.0	44.0					2																	80101245		2026	4187	6213	SO:0001583	missense	1496				axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton	g.chr2:80101245G>A		CCDS42703.2, CCDS62944.1, CCDS62945.1, CCDS74531.1	2p12-p11.1	2010-05-04			ENSG00000066032	ENSG00000066032			2510	protein-coding gene	gene with protein product	"""cadherin-associated protein, related"", ""cancer/testis antigen 114"""	114025				8432524	Standard	NM_004389		Approved	CAP-R, CT114	uc010ysf.2	P26232	OTTHUMG00000152903	ENST00000402739.4:c.629G>A	2.37:g.80101245G>A	ENSP00000384638:p.Arg210Gln		Somatic				CTNNA2_uc010yse.1_Missense_Mutation_p.R210Q|CTNNA2_uc010ysf.1_Missense_Mutation_p.R210Q|CTNNA2_uc010ysg.1_Missense_Mutation_p.R210Q	p.R210Q	NM_004389	NP_004380	WXS	Illumina HiSeq	Unspecified	P26232	CTNA2_HUMAN			5	634	+			210					B3KXE5|B7Z2W7|B7Z352|B7Z898|Q4ZFW1|Q53R26|Q53R33|Q53T67|Q53T71|Q53TM8|Q7Z3L1|Q7Z3Y0	Missense_Mutation	SNP	ENST00000402739.4	37	c.629G>A		.	.	.	.	.	.	.	.	.	.	G	36	5.765083	0.96906	.	.	ENSG00000066032	ENST00000466387;ENST00000496558;ENST00000361291;ENST00000402739;ENST00000541047;ENST00000540488	T;T;T;T;T;T	0.39406	1.08;1.08;1.08;1.08;1.08;1.08	5.7	5.7	0.88788	.	0.000000	0.64402	D	0.000002	T	0.74566	0.3733	M	0.92459	3.31	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.80115	-0.1517	10	0.66056	D	0.02	.	19.8351	0.96655	0.0:0.0:1.0:0.0	.	210;210;210	P26232;P26232-3;P26232-2	CTNA2_HUMAN;.;.	Q	210;210;244;210;210;210	ENSP00000418191:R210Q;ENSP00000419295:R210Q;ENSP00000355398:R244Q;ENSP00000384638:R210Q;ENSP00000444675:R210Q;ENSP00000441705:R210Q	ENSP00000355398:R244Q	R	+	2	0	CTNNA2	79954753	1.000000	0.71417	0.986000	0.45419	0.993000	0.82548	9.869000	0.99810	2.693000	0.91896	0.650000	0.86243	CGA		0.512	CTNNA2-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000328511.4	NM_004389		13	38	0	0	0	1	0	13	38				
GPR45	11250	broad.mit.edu	37	2	105859054	105859054	+	Missense_Mutation	SNP	C	C	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr2:105859054C>T	ENST00000258456.1	+	1	855	c.739C>T	c.(739-741)Cgg>Tgg	p.R247W		NM_007227.3	NP_009158.3	Q9Y5Y3	GPR45_HUMAN	G protein-coupled receptor 45	247						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.R247W(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(10)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	28						GGCGGGCCTGCGGCGCCTGCA	0.642																																							uc002tco.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)|central_nervous_system(1)	3						c.(739-741)CGG>TGG		G protein-coupled receptor 45							73.0	82.0	79.0					2																	105859054		2203	4300	6503	SO:0001583	missense	11250					integral to membrane|plasma membrane	G-protein coupled receptor activity|protein binding	g.chr2:105859054C>T	AF118266	CCDS2066.1	2q11.1-q12	2012-08-21			ENSG00000135973	ENSG00000135973		"""GPCR / Class A : Orphans"""	4503	protein-coding gene	gene with protein product		604838				10036181	Standard	NM_007227		Approved	PSP24, PSP24A	uc002tco.1	Q9Y5Y3	OTTHUMG00000130805	ENST00000258456.1:c.739C>T	2.37:g.105859054C>T	ENSP00000258456:p.Arg247Trp		Somatic					p.R247W	NM_007227	NP_009158	WXS	Illumina HiSeq	Unspecified	Q9Y5Y3	GPR45_HUMAN			1	855	+			247			Cytoplasmic (Potential).		Q6NWS4|Q6NXU6	Missense_Mutation	SNP	ENST00000258456.1	37	c.739C>T	CCDS2066.1	.	.	.	.	.	.	.	.	.	.	C	13.80	2.345031	0.41498	.	.	ENSG00000135973	ENST00000258456	T	0.75260	-0.92	5.1	1.57	0.23409	GPCR, rhodopsin-like superfamily (1);	0.140123	0.44483	D	0.000457	T	0.70894	0.3276	L	0.27053	0.805	0.19945	N	0.999949	D	0.76494	0.999	P	0.59703	0.862	T	0.62177	-0.6909	10	0.37606	T	0.19	-19.5312	9.6566	0.39930	0.5904:0.3203:0.0893:0.0	.	247	Q9Y5Y3	GPR45_HUMAN	W	247	ENSP00000258456:R247W	ENSP00000258456:R247W	R	+	1	2	GPR45	105225486	0.005000	0.15991	0.829000	0.32907	0.296000	0.27459	0.494000	0.22467	0.417000	0.25871	0.462000	0.41574	CGG		0.642	GPR45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253348.1	NM_007227		41	76	0	0	0	1	0	41	76				
ZEB2	9839	broad.mit.edu	37	2	145161555	145161555	+	Silent	SNP	G	G	C			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr2:145161555G>C	ENST00000558170.2	-	6	1919	c.735C>G	c.(733-735)ctC>ctG	p.L245L	ZEB2_ENST00000539609.3_Silent_p.L221L|ZEB2_ENST00000409487.3_Silent_p.L245L|ZEB2_ENST00000303660.4_Silent_p.L245L	NM_014795.3	NP_055610.1	O60315	ZEB2_HUMAN	zinc finger E-box binding homeobox 2	245					cell proliferation in forebrain (GO:0021846)|developmental pigmentation (GO:0048066)|hippocampus development (GO:0021766)|melanocyte migration (GO:0097324)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of melanin biosynthetic process (GO:0048023)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of melanosome organization (GO:1903056)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|phosphatase regulator activity (GO:0019208)	p.L245L(1)		breast(3)|central_nervous_system(1)|cervix(2)|endometrium(7)|kidney(6)|large_intestine(23)|lung(45)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	107				BRCA - Breast invasive adenocarcinoma(221;0.112)		TGTAGCTACAGAGAGGGCAGG	0.542																																					Melanoma(33;1235 1264 5755 16332)	Melanoma(33;1235 1264 5755 16332)	uc002tvu.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(5)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)	9						c.(733-735)CTC>CTG		zinc finger homeobox 1b							244.0	234.0	238.0					2																	145161555		2203	4300	6503	SO:0001819	synonymous_variant	9839					cytoplasm|nucleolus	phosphatase regulator activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|SMAD binding|zinc ion binding	g.chr2:145161555G>C	AB011141	CCDS2186.1, CCDS54403.1	2q22.3	2013-01-08	2007-02-15	2007-02-15	ENSG00000169554	ENSG00000169554		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	14881	protein-coding gene	gene with protein product	"""SMAD interacting protein 1"""	605802	"""zinc finger homeobox 1b"""	ZFHX1B			Standard	NM_014795		Approved	KIAA0569, SIP-1, SIP1	uc002tvu.3	O60315	OTTHUMG00000131834	ENST00000558170.2:c.735C>G	2.37:g.145161555G>C			Somatic				ZEB2_uc002tvv.2_Silent_p.L239L|ZEB2_uc010zbm.1_Silent_p.L216L|ZEB2_uc010fnp.2_Silent_p.L153L|ZEB2_uc010fnq.1_Silent_p.L274L	p.L245L	NM_014795	NP_055610	WXS	Illumina HiSeq	Unspecified	O60315	ZEB2_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.112)	6	1215	-			245			C2H2-type 2.		A0JP09|B7Z2P2|F5H814|Q9UED1	Silent	SNP	ENST00000558170.2	37	c.735C>G	CCDS2186.1	.	.	.	.	.	.	.	.	.	.	G	4.553	0.102646	0.08731	.	.	ENSG00000169554	ENST00000419938	.	.	.	5.65	-4.31	0.03698	.	.	.	.	.	T	0.51856	0.1699	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51092	-0.8749	4	.	.	.	-7.1476	9.437	0.38646	0.1554:0.4798:0.3648:0.0	.	.	.	.	C	134	.	.	S	-	2	0	ZEB2	144878025	0.955000	0.32602	0.967000	0.41034	0.996000	0.88848	0.139000	0.16036	-0.814000	0.04352	-0.302000	0.09304	TCT		0.542	ZEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254778.5	NM_014795		30	62	0	0	0	1	0	30	62				
IFIH1	64135	broad.mit.edu	37	2	163134108	163134108	+	Missense_Mutation	SNP	C	C	G			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr2:163134108C>G	ENST00000263642.2	-	10	2256	c.1861G>C	c.(1861-1863)Gat>Cat	p.D621H		NM_022168.3	NP_071451.2	Q9BYX4	IFIH1_HUMAN	interferon induced with helicase C domain 1	621					cytoplasmic pattern recognition receptor signaling pathway in response to virus (GO:0039528)|detection of virus (GO:0009597)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|protein sumoylation (GO:0016925)|regulation of apoptotic process (GO:0042981)|regulation of type III interferon production (GO:0034344)|response to virus (GO:0009615)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|ribonucleoprotein complex binding (GO:0043021)|single-stranded RNA binding (GO:0003727)|zinc ion binding (GO:0008270)	p.D621H(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	39						GTATACGCATCTATCATTCGA	0.373																																							uc002uce.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1861-1863)GAT>CAT		interferon induced with helicase C domain 1							138.0	125.0	130.0					2																	163134108		2203	4299	6502	SO:0001583	missense	64135				detection of virus|innate immune response|interspecies interaction between organisms|negative regulation of type I interferon production|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|regulation of apoptosis	cytosol|nucleus	ATP binding|DNA binding|double-stranded RNA binding|helicase activity|protein binding|ribonucleoprotein binding|zinc ion binding	g.chr2:163134108C>G	AF095844	CCDS2217.1	2q24.2	2010-02-09			ENSG00000115267	ENSG00000115267			18873	protein-coding gene	gene with protein product	"""helicard"""	606951					Standard	NM_022168		Approved	MDA-5, Hlcd, MDA5, IDDM19	uc002uce.4	Q9BYX4	OTTHUMG00000132055	ENST00000263642.2:c.1861G>C	2.37:g.163134108C>G	ENSP00000263642:p.Asp621His		Somatic					p.D621H	NM_022168	NP_071451	WXS	Illumina HiSeq	Unspecified	Q9BYX4	IFIH1_HUMAN			10	2083	-			621					Q2NKL6|Q6DC96|Q86X56|Q96MX8|Q9H3G6	Missense_Mutation	SNP	ENST00000263642.2	37	c.1861G>C	CCDS2217.1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.462579	0.84425	.	.	ENSG00000115267	ENST00000263642;ENST00000543192	T	0.12774	2.65	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.48554	0.1506	M	0.90309	3.105	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.57100	-0.7869	10	0.87932	D	0	-30.417	19.7554	0.96287	0.0:1.0:0.0:0.0	.	621	Q9BYX4	IFIH1_HUMAN	H	621	ENSP00000263642:D621H	ENSP00000263642:D621H	D	-	1	0	IFIH1	162842354	1.000000	0.71417	1.000000	0.80357	0.682000	0.39822	7.599000	0.82757	2.665000	0.90641	0.563000	0.77884	GAT		0.373	IFIH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255078.2	NM_022168		24	44	0	0	0	1	0	24	44				
COBLL1	22837	broad.mit.edu	37	2	165584560	165584560	+	Nonsense_Mutation	SNP	G	G	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr2:165584560G>A	ENST00000392717.2	-	5	698	c.694C>T	c.(694-696)Caa>Taa	p.Q232*	COBLL1_ENST00000409184.3_Nonsense_Mutation_p.Q232*|COBLL1_ENST00000375458.2_Nonsense_Mutation_p.Q194*|COBLL1_ENST00000194871.6_Nonsense_Mutation_p.Q247*|COBLL1_ENST00000491126.2_Intron|COBLL1_ENST00000342193.4_Nonsense_Mutation_p.Q194*			Q53SF7	COBL1_HUMAN	cordon-bleu WH2 repeat protein-like 1	232						extracellular vesicular exosome (GO:0070062)		p.Q194*(1)|p.Q194E(1)		central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(12)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	47						TCCTGCGATTGATAATCTTTC	0.393																																							uc010zcw.1		NA																	2	Substitution - Nonsense(1)|Substitution - Missense(1)		large_intestine(1)|lung(1)	ovary(2)|pancreas(1)	3						c.(739-741)CAA>TAA		COBL-like 1							124.0	121.0	122.0					2																	165584560		2203	4300	6503	SO:0001587	stop_gained	22837							g.chr2:165584560G>A	AB023194	CCDS2223.2, CCDS63045.1	2q24.3	2012-12-07	2012-12-07		ENSG00000082438	ENSG00000082438			23571	protein-coding gene	gene with protein product		610318	"""COBL-like 1"""				Standard	NM_001278458		Approved	KIAA0977	uc002ucp.3	Q53SF7	OTTHUMG00000074019	ENST00000392717.2:c.694C>T	2.37:g.165584560G>A	ENSP00000376478:p.Gln232*		Somatic				COBLL1_uc002ucp.2_Nonsense_Mutation_p.Q194*|COBLL1_uc002ucq.2_Nonsense_Mutation_p.Q194*|COBLL1_uc010zcx.1_Nonsense_Mutation_p.Q240*|COBLL1_uc002ucs.1_RNA	p.Q247*	NM_014900	NP_055715	WXS	Illumina HiSeq	Unspecified	Q53SF7	COBL1_HUMAN			6	863	-			232					A6NMZ3|Q6IQ33|Q7Z3I6|Q9BRH4|Q9UG88|Q9Y2I3	Nonsense_Mutation	SNP	ENST00000392717.2	37	c.739C>T		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.98|19.98	3.926488|3.926488	0.73327|0.73327	.|.	.|.	ENSG00000082438|ENSG00000082438	ENST00000375458;ENST00000342193;ENST00000409184;ENST00000392717;ENST00000194871;ENST00000456693|ENST00000452626	.|.	.|.	.|.	6.17|6.17	6.17|6.17	0.99709|0.99709	.|.	0.331824|.	0.34906|.	N|.	0.003597|.	.|T	.|0.81302	.|0.4794	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.78306	.|-0.2255	.|3	0.22706|.	T|.	0.39|.	-14.2422|-14.2422	20.8794|20.8794	0.99867|0.99867	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|L	194;194;232;232;247;169|196	.|.	ENSP00000194871:Q247X|.	Q|S	-|-	1|2	0|0	COBLL1|COBLL1	165292806|165292806	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.082000|0.082000	0.17680|0.17680	6.557000|6.557000	0.73937|0.73937	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	CAA|TCA		0.393	COBLL1-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_014900		34	50	0	0	0	1	0	34	50				
SESTD1	91404	broad.mit.edu	37	2	180014079	180014079	+	Missense_Mutation	SNP	C	C	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr2:180014079C>T	ENST00000428443.3	-	7	842	c.526G>A	c.(526-528)Gaa>Aaa	p.E176K		NM_178123.4	NP_835224.3	Q86VW0	SESD1_HUMAN	SEC14 and spectrin domains 1	176							phosphatidic acid binding (GO:0070300)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)	p.E176K(1)		breast(2)|endometrium(4)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|skin(3)	30			OV - Ovarian serous cystadenocarcinoma(117;0.0344)|Epithelial(96;0.0531)|all cancers(119;0.147)			AAAGCAAGTTCATCTAATAAT	0.289																																							uc002uni.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(526-528)GAA>AAA		SEC14 and spectrin domains 1							88.0	78.0	81.0					2																	180014079		2201	4297	6498	SO:0001583	missense	91404				regulation of calcium ion transport via voltage-gated calcium channel activity		phosphatidic acid binding|phosphatidylinositol-3,4-bisphosphate binding|phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-4,5-bisphosphate binding|phosphatidylinositol-4-phosphate binding|phosphatidylinositol-5-phosphate binding|protein binding	g.chr2:180014079C>T	AK096232	CCDS33338.1	2q31.3	2014-01-28			ENSG00000187231	ENSG00000187231			18379	protein-coding gene	gene with protein product						12837271	Standard	NM_178123		Approved	DKFZp434O0515, Solo	uc002uni.4	Q86VW0	OTTHUMG00000154554	ENST00000428443.3:c.526G>A	2.37:g.180014079C>T	ENSP00000415332:p.Glu176Lys		Somatic					p.E176K	NM_178123	NP_835224	WXS	Illumina HiSeq	Unspecified	Q86VW0	SESD1_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0344)|Epithelial(96;0.0531)|all cancers(119;0.147)		7	676	-			176					Q53R38|Q53SP3|Q5GM69|Q8N6M1|Q96LQ2	Missense_Mutation	SNP	ENST00000428443.3	37	c.526G>A	CCDS33338.1	.	.	.	.	.	.	.	.	.	.	C	24.5	4.535917	0.85812	.	.	ENSG00000187231	ENST00000428443	T	0.04758	3.56	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	T	0.11537	0.0281	N	0.19112	0.55	0.80722	D	1	D	0.63880	0.993	D	0.70935	0.971	T	0.40251	-0.9573	9	.	.	.	-24.3432	18.8932	0.92413	0.0:1.0:0.0:0.0	.	176	Q86VW0	SESD1_HUMAN	K	176	ENSP00000415332:E176K	.	E	-	1	0	SESTD1	179722324	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.791000	0.85805	2.546000	0.85860	0.655000	0.94253	GAA		0.289	SESTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335916.2	NM_178123		6	12	0	0	0	1	0	6	12				
XRCC5	7520	broad.mit.edu	37	2	217012854	217012854	+	Nonsense_Mutation	SNP	C	C	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr2:217012854C>T	ENST00000392133.3	+	16	1986	c.1525C>T	c.(1525-1527)Cag>Tag	p.Q509*	XRCC5_ENST00000392132.2_Nonsense_Mutation_p.Q509*			P13010	XRCC5_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining)	509	Pro-rich.				brain development (GO:0007420)|cell proliferation (GO:0008283)|cellular hyperosmotic salinity response (GO:0071475)|cellular response to fatty acid (GO:0071398)|cellular response to X-ray (GO:0071481)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|establishment of integrated proviral latency (GO:0075713)|hematopoietic stem cell differentiation (GO:0060218)|innate immune response (GO:0045087)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of neurogenesis (GO:0050769)|positive regulation of type I interferon production (GO:0032481)|response to drug (GO:0042493)|telomere maintenance (GO:0000723)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytosol (GO:0005829)|Ku70:Ku80 complex (GO:0043564)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nuclear chromosome, telomeric region (GO:0000784)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|telomeric DNA binding (GO:0042162)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)	p.Q509*(1)		endometrium(1)|kidney(3)|large_intestine(8)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24		Renal(323;0.0328)		Epithelial(149;9.78e-06)|all cancers(144;0.000632)|LUSC - Lung squamous cell carcinoma(224;0.00871)|Lung(261;0.0117)		ACCCCCAATTCAGCAGCATAT	0.433								Non-homologous end-joining																															uc002vfy.2		NA																	1	Substitution - Nonsense(1)		lung(1)	lung(1)|kidney(1)	2						c.(1525-1527)CAG>TAG	Direct_reversal_of_damage|NHEJ	ATP-dependent DNA helicase II							100.0	100.0	100.0					2																	217012854		2203	4300	6503	SO:0001587	stop_gained	7520				double-strand break repair via nonhomologous end joining|initiation of viral infection|negative regulation of transcription, DNA-dependent|provirus integration|telomere maintenance|transcription, DNA-dependent	Ku70:Ku80 complex|nonhomologous end joining complex|nuclear telomere cap complex|nucleoplasm	ATP binding|ATP-dependent DNA helicase activity|double-stranded DNA binding|protein C-terminus binding|telomeric DNA binding|transcription regulatory region DNA binding	g.chr2:217012854C>T	AF039597	CCDS2402.1	2q35	2008-07-31	2008-07-31		ENSG00000079246	ENSG00000079246			12833	protein-coding gene	gene with protein product	"""Ku autoantigen, 80kDa"""	194364	"""X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining; Ku autoantigen, 80kD)"""			9636207, 9214634	Standard	NM_021141		Approved	KU80, KARP-1, Ku86, KUB2	uc002vfy.3	P13010	OTTHUMG00000133059	ENST00000392133.3:c.1525C>T	2.37:g.217012854C>T	ENSP00000375978:p.Gln509*		Somatic				XRCC5_uc002vfz.2_Nonsense_Mutation_p.Q395*	p.Q509*	NM_021141	NP_066964	WXS	Illumina HiSeq	Unspecified	P13010	XRCC5_HUMAN		Epithelial(149;9.78e-06)|all cancers(144;0.000632)|LUSC - Lung squamous cell carcinoma(224;0.00871)|Lung(261;0.0117)	14	1665	+		Renal(323;0.0328)	509			Pro-rich.		A8K3X5|Q0Z7V0|Q4VBQ5|Q53HH7|Q7M4N0|Q9UCQ0|Q9UCQ1	Nonsense_Mutation	SNP	ENST00000392133.3	37	c.1525C>T	CCDS2402.1	.	.	.	.	.	.	.	.	.	.	C	39	7.575309	0.98368	.	.	ENSG00000079246	ENST00000392133;ENST00000392132	.	.	.	5.81	4.88	0.63580	.	0.177326	0.49305	D	0.000144	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.29301	T	0.29	.	12.0444	0.53471	0.0:0.8269:0.1731:0.0	.	.	.	.	X	509	.	ENSP00000375977:Q509X	Q	+	1	0	XRCC5	216721099	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.207000	0.51106	2.756000	0.94617	0.655000	0.94253	CAG		0.433	XRCC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256675.3	NM_021141		43	77	0	0	0	1	0	43	77				
SP140	11262	broad.mit.edu	37	2	231135347	231135347	+	Silent	SNP	G	G	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr2:231135347G>A	ENST00000392045.3	+	15	1605	c.1491G>A	c.(1489-1491)agG>agA	p.R497R	SP140_ENST00000420434.3_Silent_p.R470R|SP140_ENST00000350136.5_Silent_p.R366R|SP140_ENST00000417495.3_Silent_p.R383R|SP140_ENST00000343805.6_Silent_p.R437R|SP140_ENST00000486687.2_Silent_p.R421R	NM_007237.4	NP_009168.4	Q13342	SP140_HUMAN	SP140 nuclear body protein	497					defense response (GO:0006952)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.R497R(1)		NS(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)	12		Renal(207;0.0112)|all_lung(227;0.0221)|Lung NSC(271;0.0977)|all_hematologic(139;0.103)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		AACCCAAGAGGAAAAGAAGTA	0.284																																							uc002vql.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1489-1491)AGG>AGA		SP140 nuclear body protein isoform 1							59.0	55.0	56.0					2																	231135347		1785	4062	5847	SO:0001819	synonymous_variant	11262				defense response	cytoplasm|nuclear envelope|nucleolus|nucleoplasm	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr2:231135347G>A	U63420	CCDS33392.1, CCDS42831.1, CCDS63149.1, CCDS63150.1, CCDS63151.1	2q37.1	2013-01-28			ENSG00000079263	ENSG00000079263		"""Zinc fingers, PHD-type"""	17133	protein-coding gene	gene with protein product		608602				8695863, 8910577, 12368356	Standard	NM_001005176		Approved	LYSP100-B, LYSP100-A	uc002vql.3	Q13342	OTTHUMG00000153670	ENST00000392045.3:c.1491G>A	2.37:g.231135347G>A			Somatic				SP140_uc010zma.1_RNA|SP140_uc002vqn.2_Silent_p.R383R|SP140_uc002vqm.2_Silent_p.R437R|SP140_uc010fxl.2_Silent_p.R470R	p.R497R	NM_007237	NP_009168	WXS	Illumina HiSeq	Unspecified	Q13342	LY10_HUMAN		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)	15	1606	+		Renal(207;0.0112)|all_lung(227;0.0221)|Lung NSC(271;0.0977)|all_hematologic(139;0.103)|Acute lymphoblastic leukemia(138;0.167)	497			Nuclear localization signal (Potential).		E7ESH9|E7EUR5|E9PFJ6|Q0VGE5|Q13341|Q3KR17|Q4ZG66|Q53TG1|Q6NSG4|Q92881|Q96TG3	Silent	SNP	ENST00000392045.3	37	c.1491G>A	CCDS42831.1	.	.	.	.	.	.	.	.	.	.	G	1.480	-0.557573	0.03967	.	.	ENSG00000079263	ENST00000392044	.	.	.	2.79	-1.45	0.08828	.	.	.	.	.	T	0.34745	0.0908	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.39663	-0.9603	5	0.87932	D	0	-12.3965	3.3447	0.07131	0.436:0.2135:0.3505:0.0	.	.	.	.	E	400	.	ENSP00000375898:G400E	G	+	2	0	SP140	230843591	0.085000	0.21516	0.010000	0.14722	0.006000	0.05464	0.540000	0.23191	-0.346000	0.08312	-0.141000	0.14075	GGA		0.284	SP140-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000332015.1	NM_007237		5	26	0	0	0	1	0	5	26				
PYGB	5834	broad.mit.edu	37	20	25263896	25263896	+	Missense_Mutation	SNP	G	G	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr20:25263896G>A	ENST00000216962.4	+	13	1713	c.1603G>A	c.(1603-1605)Gtg>Atg	p.V535M		NM_002862.3	NP_002853.2	P11216	PYGB_HUMAN	phosphorylase, glycogen; brain	535					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	glycogen phosphorylase activity (GO:0008184)|pyridoxal phosphate binding (GO:0030170)	p.V535M(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	31						CATCAGGGACGTGGCCAAGGT	0.622																																							uc002wup.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)|skin(1)	2						c.(1603-1605)GTG>ATG		brain glycogen phosphorylase	Pyridoxal Phosphate(DB00114)						71.0	62.0	65.0					20																	25263896		2203	4300	6503	SO:0001583	missense	5834				glucose metabolic process|glycogen catabolic process	cytoplasm	glycogen phosphorylase activity|pyridoxal phosphate binding	g.chr20:25263896G>A		CCDS13171.1	20p11.21	2013-03-01			ENSG00000100994	ENSG00000100994	2.4.1.1	"""Glycogen phosphorylases"""	9723	protein-coding gene	gene with protein product	"""glycogen phosphorylase, brain form"""	138550					Standard	NM_002862		Approved		uc002wup.3	P11216	OTTHUMG00000032117	ENST00000216962.4:c.1603G>A	20.37:g.25263896G>A	ENSP00000216962:p.Val535Met		Somatic					p.V535M	NM_002862	NP_002853	WXS	Illumina HiSeq	Unspecified	P11216	PYGB_HUMAN			13	1712	+			535					Q96AK1|Q9NPX8	Missense_Mutation	SNP	ENST00000216962.4	37	c.1603G>A	CCDS13171.1	.	.	.	.	.	.	.	.	.	.	G	15.82	2.944783	0.53079	.	.	ENSG00000100994	ENST00000216962	D	0.93488	-3.23	3.66	3.66	0.41972	.	0.060350	0.64402	D	0.000005	D	0.91747	0.7390	M	0.68317	2.08	0.58432	D	0.999998	D	0.54601	0.967	B	0.41894	0.369	D	0.92087	0.5677	10	0.44086	T	0.13	-31.9926	15.512	0.75789	0.0:0.0:1.0:0.0	.	535	P11216	PYGB_HUMAN	M	535	ENSP00000216962:V535M	ENSP00000216962:V535M	V	+	1	0	PYGB	25211896	1.000000	0.71417	0.981000	0.43875	0.952000	0.60782	3.789000	0.55454	2.038000	0.60285	0.462000	0.41574	GTG		0.622	PYGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078415.2	NM_002862		25	26	0	0	0	1	0	25	26				
FRG1B	284802	broad.mit.edu	37	20	29628261	29628261	+	Missense_Mutation	SNP	T	T	C	rs111331725		TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr20:29628261T>C	ENST00000278882.3	+	6	643	c.263T>C	c.(262-264)tTt>tCt	p.F88S	FRG1B_ENST00000358464.4_Missense_Mutation_p.F88S|FRG1B_ENST00000439954.2_Missense_Mutation_p.F93S			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	88										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						AATAGCTGCTTTATTAGATGC	0.363																																							uc010ztl.1		NA																	0					0						c.(172-174)TTT>TCT		Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.																																				SO:0001583	missense	284802							g.chr20:29628261T>C			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.263T>C	20.37:g.29628261T>C	ENSP00000278882:p.Phe88Ser		Somatic				FRG1B_uc002wvm.1_RNA|FRG1B_uc010ztj.1_RNA|FRG1B_uc010gdr.1_RNA|FRG1B_uc010ztk.1_Missense_Mutation_p.F10S	p.F58S			WXS	Illumina HiSeq	Unspecified					3	205	+								C4AME5	Missense_Mutation	SNP	ENST00000278882.3	37	c.173T>C		.	.	.	.	.	.	.	.	.	.	t	18.59	3.656788	0.67586	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.66995	-0.24	2.08	2.08	0.27032	Actin cross-linking (1);	0.000000	0.85682	D	0.000000	T	0.78071	0.4226	.	.	.	0.58432	D	0.999995	D;D	0.89917	0.999;1.0	D;D	0.97110	0.998;1.0	T	0.78585	-0.2147	9	0.87932	D	0	.	8.0833	0.30758	0.0:0.0:0.0:1.0	.	93;88	F5H5R5;Q9BZ01	.;FRG1B_HUMAN	S	88;93;88	ENSP00000408863:F93S	ENSP00000278882:F88S	F	+	2	0	FRG1B	28241922	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	6.955000	0.76007	1.208000	0.43306	0.347000	0.21830	TTT		0.363	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579		5	41	0	0	0	1	0	5	41				
HNF4A	3172	broad.mit.edu	37	20	42984468	42984468	+	Silent	SNP	C	C	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr20:42984468C>T	ENST00000316673.4	+	1	129	c.24C>T	c.(22-24)ctC>ctT	p.L8L	RP5-881L22.5_ENST00000438702.1_RNA|HNF4A_ENST00000457232.1_Silent_p.L8L|HNF4A_ENST00000609795.1_Silent_p.L8L			P41235	HNF4A_HUMAN	hepatocyte nuclear factor 4, alpha	156					blood coagulation (GO:0007596)|endocrine pancreas development (GO:0031018)|gene expression (GO:0010467)|glucose homeostasis (GO:0042593)|lipid homeostasis (GO:0055088)|lipid metabolic process (GO:0006629)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|ornithine metabolic process (GO:0006591)|phospholipid homeostasis (GO:0055091)|positive regulation of cholesterol homeostasis (GO:2000189)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gastrulation (GO:0010470)|regulation of growth hormone receptor signaling pathway (GO:0060398)|regulation of insulin secretion (GO:0050796)|regulation of lipid metabolic process (GO:0019216)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to glucose (GO:0009749)|sex differentiation (GO:0007548)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein signal transduction (GO:0060395)|transcription initiation from RNA polymerase II promoter (GO:0006367)|triglyceride homeostasis (GO:0070328)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|fatty acid binding (GO:0005504)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.L8L(1)		endometrium(4)|large_intestine(7)|lung(17)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(2)	34		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			ACGCGCCCCTCGGGGCTCCAG	0.682																																					Colon(79;2 1269 8820 14841 52347)	Colon(79;2 1269 8820 14841 52347)	uc002xlv.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|lung(1)|skin(1)	3						c.(22-24)CTC>CTT		hepatocyte nuclear factor 4 alpha isoform d							23.0	28.0	26.0					20																	42984468		2052	4187	6239	SO:0001819	synonymous_variant	3172				blood coagulation|endocrine pancreas development|glucose homeostasis|negative regulation of cell growth|negative regulation of cell proliferation|ornithine metabolic process|phospholipid homeostasis|positive regulation of cholesterol homeostasis|regulation of growth hormone receptor signaling pathway|regulation of insulin secretion|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to glucose stimulus|triglyceride homeostasis|xenobiotic metabolic process	cytoplasm	activating transcription factor binding|protein homodimerization activity|receptor binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|steroid hormone receptor activity|transcription regulatory region DNA binding|zinc ion binding	g.chr20:42984468C>T	X76930	CCDS13330.1, CCDS13331.1, CCDS42876.1, CCDS46604.1, CCDS46605.1, CCDS68131.1, CCDS74728.1	20q13.12	2014-09-17			ENSG00000101076	ENSG00000101076		"""Nuclear hormone receptors"""	5024	protein-coding gene	gene with protein product		600281		TCF14, MODY, MODY1		7926813, 9048927	Standard	NM_001030003		Approved	NR2A1, HNF4	uc010zwo.1	P41235	OTTHUMG00000032531	ENST00000316673.4:c.24C>T	20.37:g.42984468C>T			Somatic				HNF4A_uc010zwo.1_5'UTR|HNF4A_uc002xlt.2_Silent_p.L8L|HNF4A_uc002xlu.2_Silent_p.L8L	p.L8L	NM_175914	NP_787110	WXS	Illumina HiSeq	Unspecified	P41235	HNF4A_HUMAN	COAD - Colon adenocarcinoma(18;0.00189)		1	28	+		Myeloproliferative disorder(115;0.0122)	156					A5JW41|B2RPP8|O00659|O00723|Q14540|Q5QPB8|Q6B4V5|Q6B4V6|Q6B4V7|Q92653|Q92654|Q92655|Q99864|Q9NQH0	Silent	SNP	ENST00000316673.4	37	c.24C>T	CCDS42876.1																																																																																				0.682	HNF4A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000079362.2			20	9	0	0	0	1	0	20	9				
SLC17A9	63910	broad.mit.edu	37	20	61596969	61596969	+	Missense_Mutation	SNP	G	G	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr20:61596969G>T	ENST00000370351.4	+	10	1084	c.953G>T	c.(952-954)gGc>gTc	p.G318V	SLC17A9_ENST00000370349.3_Missense_Mutation_p.G312V|SLC17A9_ENST00000488738.1_3'UTR	NM_022082.3	NP_071365	Q9BYT1	S17A9_HUMAN	solute carrier family 17 (vesicular nucleotide transporter), member 9	318					exocytosis (GO:0006887)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)	transporter activity (GO:0005215)	p.G318V(1)		endometrium(2)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	23						CAGGGCATGGGCCTTGGCCTC	0.662																																							uc002yea.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(952-954)GGC>GTC		vesicular nucleotide transporter SLC17A9							145.0	159.0	154.0					20																	61596969		2119	4228	6347	SO:0001583	missense	63910				exocytosis|transmembrane transport	integral to membrane	transporter activity	g.chr20:61596969G>T	AK027065	CCDS42901.1	20q13.33	2013-07-18	2013-07-18	2009-01-22	ENSG00000101194	ENSG00000101194		"""Solute carriers"""	16192	protein-coding gene	gene with protein product		612107	"""chromosome 20 open reading frame 59"", ""solute carrier family 17, member 9"""	C20orf59		18375752	Standard	NM_022082		Approved	FLJ23412, VNUT	uc002yea.4	Q9BYT1	OTTHUMG00000032951	ENST00000370351.4:c.953G>T	20.37:g.61596969G>T	ENSP00000359376:p.Gly318Val		Somatic				SLC17A9_uc002ydz.3_Missense_Mutation_p.G312V|SLC17A9_uc011aap.1_Missense_Mutation_p.G338V	p.G318V	NM_022082	NP_071365	WXS	Illumina HiSeq	Unspecified	Q9BYT1	S17A9_HUMAN			10	1137	+			318			Helical; (Potential).		B3KTF2|Q5W198|Q8TB07|Q8TBP4|Q8TEL5|Q9BYT0|Q9BYT2	Missense_Mutation	SNP	ENST00000370351.4	37	c.953G>T	CCDS42901.1	.	.	.	.	.	.	.	.	.	.	G	15.06	2.721008	0.48728	.	.	ENSG00000101194	ENST00000370351;ENST00000370349	T;T	0.63744	-0.06;-0.06	5.01	5.01	0.66863	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.107684	0.64402	D	0.000005	T	0.73071	0.3540	M	0.73962	2.25	0.80722	D	1	B;B;B	0.34241	0.444;0.283;0.24	P;B;B	0.45167	0.472;0.324;0.217	T	0.76688	-0.2867	10	0.87932	D	0	.	18.3223	0.90242	0.0:0.0:1.0:0.0	.	338;318;312	B4DPU8;Q9BYT1;Q9BYT1-2	.;S17A9_HUMAN;.	V	318;312	ENSP00000359376:G318V;ENSP00000359374:G312V	ENSP00000359374:G312V	G	+	2	0	SLC17A9	61067414	1.000000	0.71417	0.997000	0.53966	0.061000	0.15899	6.709000	0.74665	2.313000	0.78055	0.561000	0.74099	GGC		0.662	SLC17A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080100.1	NM_022082		62	163	1	0	2.32099e-22	1	2.58057e-22	62	163				
PTK6	5753	broad.mit.edu	37	20	62168655	62168655	+	Missense_Mutation	SNP	C	C	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr20:62168655C>A	ENST00000217185.2	-	1	40	c.13G>T	c.(13-15)Gac>Tac	p.D5Y	PTK6_ENST00000542869.1_5'UTR	NM_005975.3	NP_005966.1	Q13882	PTK6_HUMAN	protein tyrosine kinase 6	5					cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|intestinal epithelial cell differentiation (GO:0060575)|negative regulation of growth (GO:0045926)|negative regulation of protein tyrosine kinase activity (GO:0061099)|positive regulation of neuron projection development (GO:0010976)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|tyrosine phosphorylation of Stat3 protein (GO:0042503)|tyrosine phosphorylation of Stat5 protein (GO:0042506)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|ruffle (GO:0001726)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)	p.D5Y(1)		endometrium(3)|kidney(1)|lung(5)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	15	all_cancers(38;2.51e-11)		Epithelial(9;1.5e-08)|all cancers(9;8.67e-08)|BRCA - Breast invasive adenocarcinoma(10;6.43e-06)		Vandetanib(DB05294)	TGAGCCTGGTCCCGGGACACC	0.711																																							uc002yfg.2		NA																	1	Substitution - Missense(1)		lung(1)	stomach(1)|kidney(1)	2						c.(13-15)GAC>TAC		PTK6 protein tyrosine kinase 6							13.0	14.0	14.0					20																	62168655		2175	4283	6458	SO:0001583	missense	5753					cytoplasm|nucleus	ATP binding|non-membrane spanning protein tyrosine kinase activity	g.chr20:62168655C>A	U61412	CCDS13524.1, CCDS74750.1	20q13.3	2013-02-18	2013-02-18		ENSG00000101213	ENSG00000101213	2.7.10.1	"""SH2 domain containing"""	9617	protein-coding gene	gene with protein product		602004	"""PTK6 protein tyrosine kinase 6"""			8247543, 9284935	Standard	NM_005975		Approved	BRK	uc002yfg.4	Q13882	OTTHUMG00000033039	ENST00000217185.2:c.13G>T	20.37:g.62168655C>A	ENSP00000217185:p.Asp5Tyr		Somatic				PTK6_uc011aay.1_5'UTR|PTK6_uc011aba.1_Missense_Mutation_p.D5Y	p.D5Y	NM_005975	NP_005966	WXS	Illumina HiSeq	Unspecified	Q13882	PTK6_HUMAN	Epithelial(9;1.5e-08)|all cancers(9;8.67e-08)|BRCA - Breast invasive adenocarcinoma(10;6.43e-06)		1	53	-	all_cancers(38;2.51e-11)		5					B2RCR3|B4DW46|Q58F01	Missense_Mutation	SNP	ENST00000217185.2	37	c.13G>T	CCDS13524.1	.	.	.	.	.	.	.	.	.	.	C	13.18	2.160442	0.38119	.	.	ENSG00000101213	ENST00000217185	T	0.74632	-0.86	4.23	3.15	0.36227	.	0.910293	0.08899	U	0.877544	T	0.54095	0.1837	L	0.27053	0.805	0.22354	N	0.999179	P;P	0.43352	0.804;0.553	B;B	0.31614	0.133;0.094	T	0.53479	-0.8433	10	0.87932	D	0	.	3.7552	0.08582	0.0:0.6559:0.0:0.3441	.	5;5	B4DWV1;Q13882	.;PTK6_HUMAN	Y	5	ENSP00000217185:D5Y	ENSP00000217185:D5Y	D	-	1	0	PTK6	61639099	0.000000	0.05858	0.018000	0.16275	0.212000	0.24457	-0.059000	0.11731	1.906000	0.55180	0.491000	0.48974	GAC		0.711	PTK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080313.1			9	4	1	0	0.000442599	1	0.000458891	9	4				
IL10RB	3588	broad.mit.edu	37	21	34649001	34649001	+	Missense_Mutation	SNP	G	G	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr21:34649001G>A	ENST00000290200.2	+	3	382	c.274G>A	c.(274-276)Gaa>Aaa	p.E92K	AP000295.9_ENST00000433395.2_Silent_p.L219L	NM_000628.4	NP_000619.3	Q08334	I10R2_HUMAN	interleukin 10 receptor, beta	92	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|immune response (GO:0006955)|inflammatory response (GO:0006954)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|interleukin-28 receptor complex (GO:0032002)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)	p.E92K(1)		endometrium(1)|kidney(1)|large_intestine(6)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	14						AGTCAGGGCTGAATTTGCAGA	0.393																																					Melanoma(67;315 1275 21667 21943 44564)	Melanoma(67;315 1275 21667 21943 44564)	uc002yrk.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(274-276)GAA>AAA		interleukin 10 receptor, beta precursor							246.0	209.0	221.0					21																	34649001		2203	4300	6503	SO:0001583	missense	3588				immune response|inflammatory response	interleukin-28 receptor complex	protein binding|receptor activity	g.chr21:34649001G>A	U08988	CCDS13623.1	21q22.11	2014-09-17			ENSG00000243646	ENSG00000243646		"""Interleukins and interleukin receptors"", ""CD molecules"""	5965	protein-coding gene	gene with protein product		123889		CRFB4, D21S58, D21S66		8314576, 9312047	Standard	NM_000628		Approved	CRF2-4, CDW210B, IL-10R2		Q08334	OTTHUMG00000065128	ENST00000290200.2:c.274G>A	21.37:g.34649001G>A	ENSP00000290200:p.Glu92Lys		Somatic				IL10RB_uc002yrh.1_Missense_Mutation_p.E162K|IL10RB_uc002yri.1_Missense_Mutation_p.E45K|IL10RB_uc002yrl.1_Missense_Mutation_p.E94K	p.E92K	NM_000628	NP_000619	WXS	Illumina HiSeq	Unspecified	Q08334	I10R2_HUMAN			3	373	+			92			Extracellular (Potential).		Q9BUU4	Missense_Mutation	SNP	ENST00000290200.2	37	c.274G>A	CCDS13623.1	.	.	.	.	.	.	.	.	.	.	G	27.3	4.822130	0.90873	.	.	ENSG00000243646	ENST00000290200;ENST00000539894	T	0.76060	-0.99	5.73	4.84	0.62591	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.118214	0.53938	D	0.000045	D	0.83170	0.5196	M	0.78049	2.395	0.42748	D	0.99376	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.998	T	0.81629	-0.0846	10	0.07644	T	0.81	-20.649	13.2278	0.59924	0.0:0.1591:0.8409:0.0	.	94;92;92;92	Q6ZVU9;Q08334;B4DSX5;F5H766	.;I10R2_HUMAN;.;.	K	92	ENSP00000290200:E92K	ENSP00000290200:E92K	E	+	1	0	IL10RB	33570871	0.989000	0.36119	0.863000	0.33907	0.991000	0.79684	3.525000	0.53502	1.555000	0.49500	0.655000	0.94253	GAA		0.393	IL10RB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139831.3			45	77	0	0	0	1	0	45	77				
EWSR1	2130	broad.mit.edu	37	22	29668239	29668239	+	Silent	SNP	G	G	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr22:29668239G>A	ENST00000397938.2	+	2	367	c.48G>A	c.(46-48)caG>caA	p.Q16Q	EWSR1_ENST00000414183.2_Silent_p.Q16Q|EWSR1_ENST00000333395.6_Silent_p.Q16Q|EWSR1_ENST00000332035.6_Silent_p.Q16Q|EWSR1_ENST00000332050.6_Silent_p.Q16Q|EWSR1_ENST00000406548.1_Silent_p.Q16Q|EWSR1_ENST00000331029.7_Silent_p.Q16Q	NM_001163285.1|NM_001163286.1|NM_005243.3|NM_013986.3	NP_001156757.1|NP_001156758.1|NP_005234.1|NP_053733.2	Q01844	EWS_HUMAN	EWS RNA-binding protein 1	16	31 X approximate tandem repeats.|EAD (Gln/Pro/Thr-rich).				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.Q16Q(2)	EWSR1/ATF1(347)|EWSR1/POU5F1(10)|EWSR1/PBX1(3)|EWSR1/DDIT3(45)|EWSR1/FEV(11)|EWSR1/CREB1(44)|EWSR1/SMARCA5(2)|EWSR1/ETV4(6)|EWSR1/ERG(178)|EWSR1/ZNF384(4)|EWSR1/ETV1(7)|EWSR1/FLI1(2569)|EWSR1/NR4A3(146)|EWSR1/SP3(3)|EWSR1/PATZ1(2)|EWSR1/WT1(234)|EWSR1/NFATC2(9)	breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|liver(1)|lung(6)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						CAGCGCAGCAGGGGTAAGTCA	0.368			T	"""FLI1, ERG, ZNF278, NR4A3, FEV, ATF1, ETV1, ETV4, WT1, ZNF384, CREB1, POU5F1,  PBX1"""	"""Ewing sarcoma,  desmoplastic small round cell tumor , ALL, clear cell sarcoma, sarcoma, myoepithelioma"""																																		uc003aet.2		NA		Dom	yes		22	22q12	2130	T	Ewing sarcoma breakpoint region 1 (EWS)			"""L, M"""	FLI1|ERG|ZNF278|NR4A3|FEV|ATF1|ETV1|ETV4|WT1|ZNF384|CREB1|POU5F1| PBX1		Ewing sarcoma| desmoplastic small round cell tumor |ALL|clear cell sarcoma|sarcoma|myoepithelioma	EWSR1/FLI1(2266)|EWSR1/ATF1(323)|EWSR1/WT1(231)|EWSR1/ERG(162)|EWSR1/NR4A3(140)|EWSR1/DDIT3(43)|EWSR1/CREB1(42)|EWSR1/FEV(10)|EWSR1/POU5F1(10)|EWSR1/ETV1(7)|EWSR1/ETV4(6)|EWSR1/ZNF384(4)|EWSR1/PBX1(3)|EWSR1/SP3(3)|EWSR1/PATZ1(2)	2	Substitution - coding silent(2)		lung(2)	bone(2526)|soft_tissue(702)|skin(8)|autonomic_ganglia(4)|haematopoietic_and_lymphoid_tissue(4)|salivary_gland(2)|central_nervous_system(2)|NS(2)|pancreas(2)|lung(1)|ovary(1)	3254						c.(46-48)CAG>CAA		Ewing sarcoma breakpoint region 1 isoform 2							157.0	151.0	153.0					22																	29668239		2203	4300	6503	SO:0001819	synonymous_variant	2130				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	calmodulin binding|nucleotide binding|RNA binding|zinc ion binding	g.chr22:29668239G>A		CCDS13851.1, CCDS13852.1, CCDS13852.2, CCDS54512.1, CCDS54513.1, CCDS54514.1	22q12.2	2013-05-24	2013-05-24		ENSG00000182944	ENSG00000182944		"""RNA binding motif (RRM) containing"""	3508	protein-coding gene	gene with protein product		133450	"""Ewing sarcoma breakpoint region 1"""			1522903	Standard	NM_005243		Approved	EWS	uc003aev.3	Q01844	OTTHUMG00000151107	ENST00000397938.2:c.48G>A	22.37:g.29668239G>A			Somatic				EWSR1_uc003aes.3_Silent_p.Q16Q|EWSR1_uc003aev.2_Silent_p.Q16Q|EWSR1_uc003aew.2_Silent_p.Q16Q|EWSR1_uc003aex.2_Silent_p.Q16Q	p.Q16Q	NM_005243	NP_005234	WXS	Illumina HiSeq	Unspecified	Q01844	EWS_HUMAN			2	376	+			16			31 X approximate tandem repeats.|EAD (Gln/Pro/Thr-rich).|1.		B0QYK1|Q5THL0|Q92635|Q96FE8|Q96MN4|Q96MX4|Q9BWA2	Silent	SNP	ENST00000397938.2	37	c.48G>A	CCDS13851.1																																																																																				0.368	EWSR1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000321345.1	NM_005243		17	29	0	0	0	1	0	17	29				
EIF3L	51386	broad.mit.edu	37	22	38274173	38274173	+	Missense_Mutation	SNP	G	G	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr22:38274173G>A	ENST00000412331.2	+	11	2152	c.1570G>A	c.(1570-1572)Gat>Aat	p.D524N	EIF3L_ENST00000381683.6_Missense_Mutation_p.D476N|EIF3L_ENST00000406934.1_Missense_Mutation_p.D426N	NM_016091.3	NP_057175.1			eukaryotic translation initiation factor 3, subunit L									p.D524N(1)		kidney(2)|large_intestine(3)|lung(4)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						CTTCTACATTGATAAGGTATG	0.453																																							uc003auf.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1570-1572)GAT>AAT		eukaryotic translation initiation factor 3							56.0	53.0	54.0					22																	38274173		2056	4010	6066	SO:0001583	missense	51386					eukaryotic translation initiation factor 3 complex	protein binding|translation initiation factor activity	g.chr22:38274173G>A	AF083243	CCDS13960.1, CCDS56230.1	22q	2012-12-20	2009-01-07	2009-01-07	ENSG00000100129	ENSG00000100129			18138	protein-coding gene	gene with protein product			"""eukaryotic translation initiation factor 3, subunit 6 interacting protein"", ""eukaryotic translation initiation factor 3, subunit E interacting protein"""	EIF3S6IP, EIF3EIP		11042152, 11590142	Standard	NM_016091		Approved	HSPC021, HSPC025, EIF3S11	uc003auf.3	Q9Y262	OTTHUMG00000150671	ENST00000412331.2:c.1570G>A	22.37:g.38274173G>A	ENSP00000416892:p.Asp524Asn		Somatic				EIF3L_uc003aue.1_Missense_Mutation_p.D524N|EIF3L_uc011ann.1_Missense_Mutation_p.D476N|EIF3L_uc003aug.2_Missense_Mutation_p.D416N|EIF3L_uc003auh.2_Missense_Mutation_p.D257N	p.D524N	NM_016091	NP_057175	WXS	Illumina HiSeq	Unspecified	Q9Y262	EIF3L_HUMAN			11	1657	+			524						Missense_Mutation	SNP	ENST00000412331.2	37	c.1570G>A	CCDS13960.1	.	.	.	.	.	.	.	.	.	.	g	23.2	4.389822	0.82902	.	.	ENSG00000100129	ENST00000412331;ENST00000425539;ENST00000381683;ENST00000262832;ENST00000406934;ENST00000450376	T;T;T;T	0.53857	0.6;0.6;0.6;0.6	5.07	5.07	0.68467	.	0.000000	0.85682	D	0.000000	T	0.67543	0.2904	M	0.64170	1.965	0.80722	D	1	D;D;D;D	0.71674	0.998;0.983;0.975;0.988	P;P;P;P	0.61397	0.888;0.819;0.772;0.863	T	0.69128	-0.5227	10	0.52906	T	0.07	-16.7631	16.9934	0.86360	0.0:0.0:1.0:0.0	.	476;426;524;567	B4DYB2;B0QY90;Q9Y262;B0QY89	.;.;EIF3L_HUMAN;.	N	524;567;476;491;426;36	ENSP00000416892:D524N;ENSP00000371099:D476N;ENSP00000384634:D426N;ENSP00000412349:D36N	ENSP00000262832:D491N	D	+	1	0	EIF3L	36604119	1.000000	0.71417	0.990000	0.47175	0.861000	0.49209	9.824000	0.99380	2.497000	0.84241	0.443000	0.29094	GAT		0.453	EIF3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319551.2	NM_016091		17	31	0	0	0	1	0	17	31				
EFHB	151651	broad.mit.edu	37	3	19940970	19940970	+	Missense_Mutation	SNP	C	C	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr3:19940970C>A	ENST00000295824.9	-	7	1617	c.1456G>T	c.(1456-1458)Gat>Tat	p.D486Y	EFHB_ENST00000498089.1_5'UTR|EFHB_ENST00000344838.4_Missense_Mutation_p.D356Y	NM_144715.3	NP_653316.3	Q8N7U6	EFHB_HUMAN	EF-hand domain family, member B	486							calcium ion binding (GO:0005509)	p.D484Y(1)|p.D486Y(1)		breast(2)|endometrium(4)|kidney(1)|lung(17)|prostate(1)|urinary_tract(1)	26						TCTTTGAAATCATCTGCTCTT	0.294																																							uc003cbl.3		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(1456-1458)GAT>TAT		EF hand domain family, member B							92.0	99.0	96.0					3																	19940970		2201	4298	6499	SO:0001583	missense	151651				signal transduction	proteinaceous extracellular matrix	calcium ion binding	g.chr3:19940970C>A	AK122616	CCDS33715.2	3p24.3	2014-07-18			ENSG00000163576	ENSG00000163576		"""EF-hand domain containing"""	26330	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 21"""					12477932	Standard	NM_144715		Approved	FLJ25200, CFAP21	uc003cbl.4	Q8N7U6	OTTHUMG00000150505	ENST00000295824.9:c.1456G>T	3.37:g.19940970C>A	ENSP00000295824:p.Asp486Tyr		Somatic				EFHB_uc003cbm.2_Missense_Mutation_p.D356Y	p.D486Y	NM_144715	NP_653316	WXS	Illumina HiSeq	Unspecified	Q8N7U6	EFHB_HUMAN			7	1652	-			486					A6ND25|A8MPR3|Q6ZWK9|Q8IV58|Q96LQ6	Missense_Mutation	SNP	ENST00000295824.9	37	c.1456G>T	CCDS33715.2	.	.	.	.	.	.	.	.	.	.	C	15.22	2.769010	0.49680	.	.	ENSG00000163576	ENST00000295824;ENST00000344838;ENST00000389256;ENST00000440022	T;T;T;T	0.48522	1.0;1.04;1.3;0.81	5.57	4.7	0.59300	.	0.000000	0.64402	D	0.000001	T	0.67202	0.2868	M	0.83012	2.62	0.44995	D	0.998017	D;D	0.69078	0.997;0.995	D;P	0.63192	0.912;0.861	T	0.71293	-0.4636	9	.	.	.	-27.1949	12.6334	0.56669	0.0:0.9223:0.0:0.0777	.	356;486	Q8N7U6-3;Q8N7U6	.;EFHB_HUMAN	Y	486;356;486;223	ENSP00000295824:D486Y;ENSP00000342263:D356Y;ENSP00000373908:D486Y;ENSP00000396778:D223Y	.	D	-	1	0	EFHB	19915974	1.000000	0.71417	1.000000	0.80357	0.447000	0.32167	2.984000	0.49353	1.360000	0.45960	-0.254000	0.11334	GAT		0.294	EFHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318673.2	NM_144715		21	12	1	0	1.22574e-08	1	1.32788e-08	21	12				
SCN11A	11280	broad.mit.edu	37	3	38938482	38938482	+	Missense_Mutation	SNP	C	C	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr3:38938482C>A	ENST00000302328.3	-	14	2455	c.2257G>T	c.(2257-2259)Gat>Tat	p.D753Y	SCN11A_ENST00000456224.3_Missense_Mutation_p.D753Y|SCN11A_ENST00000450244.1_Missense_Mutation_p.D753Y|SCN11A_ENST00000444237.2_Missense_Mutation_p.D753Y	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit	753					cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.D753Y(1)		NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TGCCAGAAATCCCCCATGTGC	0.488																																							uc011ays.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(6)|ovary(1)|haematopoietic_and_lymphoid_tissue(1)|pancreas(1)	9						c.(2257-2259)GAT>TAT		sodium channel, voltage-gated, type XI, alpha	Cocaine(DB00907)						129.0	115.0	120.0					3																	38938482		2203	4300	6503	SO:0001583	missense	11280				response to drug	voltage-gated sodium channel complex	voltage-gated sodium channel activity	g.chr3:38938482C>A	AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.2257G>T	3.37:g.38938482C>A	ENSP00000307599:p.Asp753Tyr		Somatic				SCN11A_uc010hhn.1_5'Flank	p.D753Y	NM_014139	NP_054858	WXS	Illumina HiSeq	Unspecified	Q9UI33	SCNBA_HUMAN		Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	14	2456	-			753			II.		A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	Missense_Mutation	SNP	ENST00000302328.3	37	c.2257G>T	CCDS33737.1	.	.	.	.	.	.	.	.	.	.	C	20.1	3.931545	0.73442	.	.	ENSG00000168356	ENST00000302328;ENST00000450244;ENST00000456224;ENST00000444237	D;D;D;D	0.97731	-4.51;-4.51;-4.51;-4.51	5.95	2.17	0.27698	Ion transport (1);	0.097172	0.64402	D	0.000001	D	0.98695	0.9562	M	0.91510	3.215	0.48571	D	0.999678	D	0.89917	1.0	D	0.77557	0.99	D	0.98633	1.0672	10	0.87932	D	0	.	11.178	0.48612	0.0:0.7517:0.0:0.2483	.	753	Q9UI33	SCNBA_HUMAN	Y	753	ENSP00000307599:D753Y;ENSP00000400945:D753Y;ENSP00000416757:D753Y;ENSP00000408028:D753Y	ENSP00000307599:D753Y	D	-	1	0	SCN11A	38913486	0.999000	0.42202	0.879000	0.34478	0.857000	0.48899	4.028000	0.57246	0.117000	0.18138	0.650000	0.86243	GAT		0.488	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109746.4	NM_014139		12	11	1	0	2.27111e-07	1	2.4447e-07	12	11				
TTC21A	199223	broad.mit.edu	37	3	39159580	39159580	+	Missense_Mutation	SNP	G	G	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr3:39159580G>A	ENST00000431162.2	+	7	871	c.737G>A	c.(736-738)aGc>aAc	p.S246N	TTC21A_ENST00000440121.1_Missense_Mutation_p.S205N|TTC21A_ENST00000301819.6_Missense_Mutation_p.S246N			Q8NDW8	TT21A_HUMAN	tetratricopeptide repeat domain 21A	246								p.S246N(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(9)|lung(23)|ovary(1)|prostate(1)|skin(3)	50				KIRC - Kidney renal clear cell carcinoma(284;0.0588)|Kidney(284;0.0738)		AAAGATGAGAGCAATATTGAT	0.428																																							uc003cjc.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(736-738)AGC>AAC		tetratricopeptide repeat domain 21A isoform 2							150.0	155.0	153.0					3																	39159580		2096	4227	6323	SO:0001583	missense	199223						binding	g.chr3:39159580G>A	AJ487015	CCDS43068.1, CCDS46800.1, CCDS43068.2	3p22.2	2014-09-04			ENSG00000168026	ENSG00000168026		"""Tetratricopeptide (TTC) repeat domain containing"""	30761	protein-coding gene	gene with protein product		611430					Standard	NM_145755		Approved	STI2	uc003cjc.2	Q8NDW8	OTTHUMG00000155973	ENST00000431162.2:c.737G>A	3.37:g.39159580G>A	ENSP00000398211:p.Ser246Asn		Somatic				TTC21A_uc003cja.2_Missense_Mutation_p.S246N|TTC21A_uc010hho.1_Missense_Mutation_p.S168N|TTC21A_uc003cjb.2_3'UTR|TTC21A_uc003cje.2_Missense_Mutation_p.S246N|TTC21A_uc003cjd.2_RNA|TTC21A_uc011ayx.1_Missense_Mutation_p.S205N	p.S246N	NM_145755	NP_665698	WXS	Illumina HiSeq	Unspecified	Q8NDW8	TT21A_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.0588)|Kidney(284;0.0738)	7	914	+			246			TPR 5.		A1L388|B4DYF6|B4DYJ3|D3YTE7|D4PHA5|Q6P5W8|Q8N7G5|Q8NA02	Missense_Mutation	SNP	ENST00000431162.2	37	c.737G>A	CCDS46800.1	.	.	.	.	.	.	.	.	.	.	G	4.007	-0.001360	0.07819	.	.	ENSG00000168026	ENST00000301819;ENST00000424305;ENST00000431162;ENST00000440121	T;T;T	0.58797	0.31;0.31;0.31	5.43	-1.23	0.09465	Tetratricopeptide-like helical (1);	0.989764	0.08244	N	0.975662	T	0.26919	0.0659	N	0.04162	-0.26	0.09310	N	1	B;B;B;B;B	0.06786	0.001;0.001;0.001;0.001;0.001	B;B;B;B;B	0.06405	0.002;0.001;0.001;0.001;0.001	T	0.24333	-1.0163	10	0.05959	T	0.93	-3.3492	6.7611	0.23540	0.5505:0.1306:0.3189:0.0	.	205;246;246;246;246	Q8NDW8-6;Q8NDW8-5;Q8NDW8-7;Q8NDW8;F5H6V8	.;.;.;TT21A_HUMAN;.	N	246;246;246;205	ENSP00000301819:S246N;ENSP00000398211:S246N;ENSP00000410882:S205N	ENSP00000301819:S246N	S	+	2	0	TTC21A	39134584	0.000000	0.05858	0.001000	0.08648	0.979000	0.70002	-1.552000	0.02176	-0.143000	0.11334	0.563000	0.77884	AGC		0.428	TTC21A-021	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377829.1	NM_145755		32	22	0	0	0	1	0	32	22				
CX3CR1	1524	broad.mit.edu	37	3	39307728	39307728	+	Silent	SNP	C	C	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr3:39307728C>T	ENST00000541347.1	-	2	512	c.273G>A	c.(271-273)ttG>ttA	p.L91L	CX3CR1_ENST00000358309.3_Silent_p.L123L|CX3CR1_ENST00000399220.2_Silent_p.L91L|CX3CR1_ENST00000542107.1_Silent_p.L91L	NM_001171171.1	NP_001164642.1	P49238	CX3C1_HUMAN	chemokine (C-X3-C motif) receptor 1	91					cell adhesion (GO:0007155)|cellular defense response (GO:0006968)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cerebral cortex cell migration (GO:0021795)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|macrophage chemotaxis (GO:0048246)|microglial cell activation involved in immune response (GO:0002282)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|positive regulation of angiogenesis (GO:0045766)|response to wounding (GO:0009611)|viral process (GO:0016032)	integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|neuronal cell body membrane (GO:0032809)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	C-X3-C chemokine receptor activity (GO:0016495)|chemokine receptor activity (GO:0004950)	p.L91L(1)|p.L123L(1)		endometrium(3)|kidney(1)|large_intestine(4)|lung(13)|prostate(1)|skin(1)|urinary_tract(1)	24				KIRC - Kidney renal clear cell carcinoma(284;0.0557)|Kidney(284;0.0699)		TTTCATTTATCAAATAGTGAG	0.463																																							uc003cjl.2		NA																	2	Substitution - coding silent(2)		lung(2)	lung(3)	3						c.(271-273)TTG>TTA		chemokine (C-X3-C motif) receptor 1							157.0	152.0	154.0					3																	39307728		1942	4128	6070	SO:0001819	synonymous_variant	1524				cell adhesion|cellular defense response|chemotaxis|interspecies interaction between organisms|response to wounding	integral to plasma membrane	chemokine receptor activity	g.chr3:39307728C>T	BC028078	CCDS43069.1, CCDS54571.1	3p21.3	2012-08-08	2002-08-22		ENSG00000168329	ENSG00000168329		"""GPCR / Class A : Chemokine receptors : C-X-3-C motif"""	2558	protein-coding gene	gene with protein product		601470	"""chemokine (C-X3-C) receptor 1"""	GPR13, CMKBRL1		9726990, 7646814	Standard	NM_001171171		Approved	CMKDR1, V28, CCRL1	uc021wwc.1	P49238	OTTHUMG00000156249	ENST00000541347.1:c.273G>A	3.37:g.39307728C>T			Somatic					p.L91L	NM_001337	NP_001328	WXS	Illumina HiSeq	Unspecified	P49238	CX3C1_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.0557)|Kidney(284;0.0699)	2	365	-			91			Extracellular (Potential).		A0N0N6|B2R5Z4|J3KP17	Silent	SNP	ENST00000541347.1	37	c.273G>A	CCDS43069.1																																																																																				0.463	CX3CR1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343613.1	NM_001337		17	27	0	0	0	1	0	17	27				
ZNF502	91392	broad.mit.edu	37	3	44763268	44763268	+	Missense_Mutation	SNP	A	A	G			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr3:44763268A>G	ENST00000296091.4	+	4	1215	c.959A>G	c.(958-960)gAa>gGa	p.E320G	ZNF502_ENST00000449836.1_Missense_Mutation_p.E320G|ZNF502_ENST00000436624.2_Missense_Mutation_p.E320G	NM_001134440.1|NM_001282880.1|NM_033210.4	NP_001127912.1|NP_001269809.1|NP_149987.2	Q8TBZ5	ZN502_HUMAN	zinc finger protein 502	320					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(4)|large_intestine(8)|lung(4)|prostate(1)|urinary_tract(1)	19				BRCA - Breast invasive adenocarcinoma(193;0.00855)|KIRC - Kidney renal clear cell carcinoma(197;0.0471)|Kidney(197;0.0589)		CACACTGGGGAAAAACCCCAT	0.403																																							uc011baa.1		NA																	0					0						c.(958-960)GAA>GGA		zinc finger protein 502							90.0	98.0	95.0					3																	44763268		2202	4299	6501	SO:0001583	missense	91392				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr3:44763268A>G	AK022577	CCDS2719.1	3p21.32	2013-01-08			ENSG00000196653	ENSG00000196653		"""Zinc fingers, C2H2-type"""	23718	protein-coding gene	gene with protein product							Standard	NM_033210		Approved	FLJ14855, FLJ12515	uc003cnt.3	Q8TBZ5	OTTHUMG00000133086	ENST00000296091.4:c.959A>G	3.37:g.44763268A>G	ENSP00000296091:p.Glu320Gly		Somatic				ZNF502_uc003cns.2_Missense_Mutation_p.E320G|ZNF502_uc011bab.1_Missense_Mutation_p.E320G|ZNF502_uc003cnt.2_Missense_Mutation_p.E320G	p.E320G	NM_001134440	NP_001127912	WXS	Illumina HiSeq	Unspecified	Q8TBZ5	ZN502_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.00855)|KIRC - Kidney renal clear cell carcinoma(197;0.0471)|Kidney(197;0.0589)	4	1214	+			320						Missense_Mutation	SNP	ENST00000296091.4	37	c.959A>G	CCDS2719.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	17.37|17.37	3.373010|3.373010	0.61624|0.61624	.|.	.|.	ENSG00000196653|ENSG00000196653	ENST00000449836;ENST00000296091;ENST00000436624|ENST00000427783	T;T;T|.	0.27557|.	1.66;1.66;1.66|.	4.27|4.27	0.194|0.194	0.15143|0.15143	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);|.	.|.	.|.	.|.	.|.	T|T	0.29652|0.29652	0.0740|0.0740	L|L	0.49256|0.49256	1.55|1.55	0.27898|0.27898	N|N	0.939083|0.939083	B|.	0.21821|.	0.061|.	B|.	0.27262|.	0.078|.	T|T	0.34453|0.34453	-0.9828|-0.9828	9|6	0.87932|0.02654	D|T	0|1	-7.0608|-7.0608	6.3137|6.3137	0.21178|0.21178	0.6141:0.2972:0.0887:0.0|0.6141:0.2972:0.0887:0.0	.|.	320|.	Q8TBZ5|.	ZN502_HUMAN|.	G|E	320|320	ENSP00000397390:E320G;ENSP00000296091:E320G;ENSP00000406469:E320G|.	ENSP00000296091:E320G|ENSP00000397812:K320E	E|K	+|+	2|1	0|0	ZNF502|ZNF502	44738272|44738272	1.000000|1.000000	0.71417|0.71417	0.403000|0.403000	0.26384|0.26384	0.997000|0.997000	0.91878|0.91878	4.567000|4.567000	0.60850|0.60850	0.277000|0.277000	0.22141|0.22141	0.533000|0.533000	0.62120|0.62120	GAA|AAA		0.403	ZNF502-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256744.4	NM_033210		3	82	0	0	0	1	0	3	82				
EAF2	55840	broad.mit.edu	37	3	121591540	121591540	+	Nonsense_Mutation	SNP	C	C	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr3:121591540C>A	ENST00000273668.2	+	5	712	c.641C>A	c.(640-642)tCa>tAa	p.S214*	EAF2_ENST00000451944.2_Nonsense_Mutation_p.S214*	NM_018456.4	NP_060926.2	Q96CJ1	EAF2_HUMAN	ELL associated factor 2	214	Necessary for transactivation activity.				apoptotic process (GO:0006915)|negative regulation of cell growth (GO:0030308)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	ELL-EAF complex (GO:0032783)|transcription elongation factor complex (GO:0008023)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)	p.S214*(1)		endometrium(1)|kidney(2)|large_intestine(1)|lung(4)|prostate(1)	9				GBM - Glioblastoma multiforme(114;0.0972)		AATTGTGTCTCAGGACATCCT	0.393																																					Esophageal Squamous(194;1942 2097 24663 29345 31866)	Esophageal Squamous(194;1942 2097 24663 29345 31866)	uc003een.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(640-642)TCA>TAA		ELL associated factor 2							110.0	102.0	105.0					3																	121591540		2203	4300	6503	SO:0001587	stop_gained	55840				apoptosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear speck	protein binding	g.chr3:121591540C>A	AF517829	CCDS3006.1	3q21.1	2007-08-01			ENSG00000145088	ENSG00000145088			23115	protein-coding gene	gene with protein product		607659				12446457, 12907652	Standard	NM_018456		Approved	BM040, TRAITS, U19	uc003een.3	Q96CJ1	OTTHUMG00000159424	ENST00000273668.2:c.641C>A	3.37:g.121591540C>A	ENSP00000273668:p.Ser214*		Somatic				EAF2_uc003eeo.2_Nonsense_Mutation_p.S84*	p.S214*	NM_018456	NP_060926	WXS	Illumina HiSeq	Unspecified	Q96CJ1	EAF2_HUMAN		GBM - Glioblastoma multiforme(114;0.0972)	5	740	+			214			Necessary for transactivation activity.		Q9NZ82	Nonsense_Mutation	SNP	ENST00000273668.2	37	c.641C>A	CCDS3006.1	.	.	.	.	.	.	.	.	.	.	C	8.859	0.946405	0.18356	.	.	ENSG00000145088	ENST00000273668;ENST00000451944	.	.	.	4.51	4.51	0.55191	.	0.242285	0.33127	N	0.005253	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07030	T	0.85	-6.6411	12.5695	0.56328	0.0:1.0:0.0:0.0	.	.	.	.	X	214	.	ENSP00000273668:S214X	S	+	2	0	EAF2	123074230	0.194000	0.23325	0.462000	0.27118	0.071000	0.16799	2.280000	0.43443	2.343000	0.79666	0.313000	0.20887	TCA		0.393	EAF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355247.1	NM_018456		3	51	1	0	0.004672	1	0.00469981	3	51				
SLC7A14	57709	broad.mit.edu	37	3	170216672	170216672	+	Splice_Site	SNP	C	C	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr3:170216672C>A	ENST00000231706.5	-	4	858	c.543G>T	c.(541-543)ggG>ggT	p.G181G	CLDN11_ENST00000451576.1_Intron|CLDN11_ENST00000486975.1_Intron	NM_020949.2	NP_066000.2	Q8TBB6	S7A14_HUMAN	solute carrier family 7, member 14	181					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)|lysosome (GO:0005764)	amino acid transmembrane transporter activity (GO:0015171)	p.G181G(3)		central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|liver(1)|lung(23)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(4)	53	all_cancers(22;2.41e-22)|all_epithelial(15;4.2e-27)|all_lung(20;1.17e-16)|Lung NSC(18;4.91e-16)|Ovarian(172;0.000902)|Breast(254;0.137)		Lung(28;6.23e-13)|LUSC - Lung squamous cell carcinoma(14;1.48e-12)			CTTCACCTTTCCCTAGAGAGG	0.488																																							uc003fgz.2		NA																	3	Substitution - coding silent(3)		lung(3)	ovary(2)|upper_aerodigestive_tract(1)|liver(1)|central_nervous_system(1)	5						c.(541-543)GGG>GGT		solute carrier family 7 (cationic amino acid							88.0	72.0	78.0					3																	170216672		2203	4300	6503	SO:0001630	splice_region_variant	57709					integral to membrane	amino acid transmembrane transporter activity	g.chr3:170216672C>A	BC022968	CCDS33892.1	3q26.2	2014-06-13	2013-07-19		ENSG00000013293	ENSG00000013293		"""Solute carriers"""	29326	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 142"""	615720					Standard	NM_020949		Approved	KIAA1613, PPP1R142	uc003fgz.2	Q8TBB6	OTTHUMG00000158941	ENST00000231706.5:c.542-1G>T	3.37:g.170216672C>A			Somatic				CLDN11_uc011bpt.1_Intron|uc003fha.1_Intron	p.G181G	NM_020949	NP_066000	WXS	Illumina HiSeq	Unspecified	Q8TBB6	S7A14_HUMAN	Lung(28;6.23e-13)|LUSC - Lung squamous cell carcinoma(14;1.48e-12)		4	859	-	all_cancers(22;2.41e-22)|all_epithelial(15;4.2e-27)|all_lung(20;1.17e-16)|Lung NSC(18;4.91e-16)|Ovarian(172;0.000902)|Breast(254;0.137)		181					B3KV33|Q9HCF9	Silent	SNP	ENST00000231706.5	37	c.543G>T	CCDS33892.1																																																																																				0.488	SLC7A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352598.2	NM_020949	Silent	13	12	1	0	9.31168e-06	1	9.83546e-06	13	12				
RNF168	165918	broad.mit.edu	37	3	196199040	196199040	+	Missense_Mutation	SNP	C	C	G			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr3:196199040C>G	ENST00000318037.3	-	6	1960	c.1366G>C	c.(1366-1368)Gag>Cag	p.E456Q	CTD-2002J20.1_ENST00000610042.1_RNA	NM_152617.3	NP_689830.2	Q8IYW5	RN168_HUMAN	ring finger protein 168, E3 ubiquitin protein ligase	456					cellular response to DNA damage stimulus (GO:0006974)|double-strand break repair (GO:0006302)|histone H2A K63-linked ubiquitination (GO:0070535)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K13 ubiquitination (GO:0036351)|histone H2A-K15 ubiquitination (GO:0036352)|interstrand cross-link repair (GO:0036297)|isotype switching (GO:0045190)|negative regulation of translational elongation (GO:0045900)|positive regulation of DNA repair (GO:0045739)|protein K63-linked ubiquitination (GO:0070534)|protein ubiquitination (GO:0016567)|response to ionizing radiation (GO:0010212)|ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|K63-linked polyubiquitin binding (GO:0070530)|ligase activity (GO:0016874)|nucleosome binding (GO:0031491)|ubiquitin binding (GO:0043130)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.E456Q(1)		NS(1)|endometrium(2)|large_intestine(7)|lung(9)|ovary(1)	20	all_cancers(143;1e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;5.25e-24)|all cancers(36;5.47e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.76e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00348)		TTATCCACCTCCTTCTGAAGT	0.423																																							uc003fwq.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1366-1368)GAG>CAG		ring finger protein 168							197.0	192.0	194.0					3																	196199040		2203	4300	6503	SO:0001583	missense	165918				double-strand break repair|histone H2A K63-linked ubiquitination|positive regulation of DNA repair|response to ionizing radiation	nucleus|ubiquitin ligase complex	chromatin binding|histone binding|ubiquitin binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr3:196199040C>G	AK054732	CCDS3317.1	3q29	2014-09-17	2012-02-23		ENSG00000163961	ENSG00000163961		"""RING-type (C3HC4) zinc fingers"""	26661	protein-coding gene	gene with protein product		612688	"""ring finger protein 168"""			12477932	Standard	NM_152617		Approved	FLJ35794	uc003fwq.3	Q8IYW5	OTTHUMG00000155582	ENST00000318037.3:c.1366G>C	3.37:g.196199040C>G	ENSP00000320898:p.Glu456Gln		Somatic				RNF168_uc010iah.2_Missense_Mutation_p.E289Q|uc010iag.1_5'Flank	p.E456Q	NM_152617	NP_689830	WXS	Illumina HiSeq	Unspecified	Q8IYW5	RN168_HUMAN	Epithelial(36;5.25e-24)|all cancers(36;5.47e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.76e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00348)	6	1904	-	all_cancers(143;1e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		456			MIU motif 2.		Q8NA67|Q96NS4	Missense_Mutation	SNP	ENST00000318037.3	37	c.1366G>C	CCDS3317.1	.	.	.	.	.	.	.	.	.	.	C	13.68	2.309695	0.40895	.	.	ENSG00000163961	ENST00000318037	T	0.08896	3.04	5.95	4.12	0.48240	.	0.287596	0.29932	N	0.010825	T	0.18002	0.0432	M	0.69248	2.105	0.39193	D	0.963006	D	0.62365	0.991	P	0.54210	0.745	T	0.01566	-1.1323	10	0.44086	T	0.13	-11.828	10.8102	0.46543	0.0:0.6857:0.2463:0.0681	.	456	Q8IYW5	RN168_HUMAN	Q	456	ENSP00000320898:E456Q	ENSP00000320898:E456Q	E	-	1	0	RNF168	197683437	0.977000	0.34250	0.171000	0.22900	0.123000	0.20343	0.955000	0.29188	0.818000	0.34468	0.491000	0.48974	GAG		0.423	RNF168-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340778.1	NM_152617		65	50	0	0	0	1	0	65	50				
CRIPAK	285464	broad.mit.edu	37	4	1389587	1389587	+	Missense_Mutation	SNP	C	C	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr4:1389587C>T	ENST00000324803.4	+	1	4248	c.1288C>T	c.(1288-1290)Cgt>Tgt	p.R430C		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	430	Interaction with PAK1.				negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.R430C(2)		NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			CTTTTTAATACGTTTTTATGT	0.443																																							uc003gdf.2		NA																	2	Substitution - Missense(2)		lung(1)|breast(1)		0						c.(1288-1290)CGT>TGT		cysteine-rich PAK1 inhibitor							135.0	130.0	132.0					4																	1389587		2203	4300	6503	SO:0001583	missense	285464				ER-nucleus signaling pathway|negative regulation of protein kinase activity|regulation of cytoskeleton organization|response to estrogen stimulus	endoplasmic reticulum|nucleus|plasma membrane	protein binding	g.chr4:1389587C>T	AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.1288C>T	4.37:g.1389587C>T	ENSP00000323978:p.Arg430Cys		Somatic					p.R430C	NM_175918	NP_787114	WXS	Illumina HiSeq	Unspecified	Q8N1N5	CRPAK_HUMAN	OV - Ovarian serous cystadenocarcinoma(23;0.0106)		1	4248	+			430			Interaction with PAK1.		Q8NB03	Missense_Mutation	SNP	ENST00000324803.4	37	c.1288C>T	CCDS3349.1	.	.	.	.	.	.	.	.	.	.	C	9.578	1.122718	0.20877	.	.	ENSG00000179979	ENST00000324803;ENST00000382944	T	0.25912	1.77	1.47	-0.439	0.12264	.	.	.	.	.	T	0.15435	0.0372	N	0.08118	0	0.09310	N	1	D	0.71674	0.998	P	0.50136	0.632	T	0.13229	-1.0517	9	0.87932	D	0	.	3.9842	0.09507	0.0:0.5459:0.0:0.4541	.	430	Q8N1N5	CRPAK_HUMAN	C	430;372	ENSP00000323978:R430C	ENSP00000323978:R430C	R	+	1	0	CRIPAK	1379587	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.902000	0.04088	-0.197000	0.10350	-0.229000	0.12294	CGT		0.443	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2	NM_175918		9	52	0	0	0	1	0	9	52				
HTT	3064	broad.mit.edu	37	4	3156082	3156082	+	Silent	SNP	G	G	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr4:3156082G>A	ENST00000355072.5	+	27	3706	c.3561G>A	c.(3559-3561)gaG>gaA	p.E1187E		NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	1187					anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)	p.E1187E(1)		breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		AGGGGAAGGAGAAAGAACCAG	0.473																																							uc011bvq.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(2)|ovary(1)|lung(1)	4						c.(3565-3567)GAG>GAA		huntingtin							49.0	48.0	48.0					4																	3156082		2021	4195	6216	SO:0001819	synonymous_variant	3064				establishment of mitotic spindle orientation|Golgi organization|retrograde vesicle-mediated transport, Golgi to ER|vesicle transport along microtubule	autophagic vacuole|axon|cytoplasmic vesicle membrane|cytosol|dendrite|endoplasmic reticulum|Golgi apparatus|late endosome|membrane fraction|nucleus|protein complex	beta-tubulin binding|dynactin binding|dynein intermediate chain binding|p53 binding|transcription factor binding	g.chr4:3156082G>A	L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.3561G>A	4.37:g.3156082G>A			Somatic					p.E1189E	NM_002111	NP_002102	WXS	Illumina HiSeq	Unspecified	P42858	HD_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)	28	3712	+		all_epithelial(65;0.18)	1187					Q9UQB7	Silent	SNP	ENST00000355072.5	37	c.3567G>A	CCDS43206.1																																																																																				0.473	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358234.2	NM_002111		4	9	0	0	0	1	0	4	9				
MAN2B2	23324	broad.mit.edu	37	4	6580191	6580191	+	Silent	SNP	G	G	C			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr4:6580191G>C	ENST00000285599.3	+	3	393	c.357G>C	c.(355-357)gtG>gtC	p.V119V	MAN2B2_ENST00000504248.1_Silent_p.V119V	NM_015274.1	NP_056089.1	Q9Y2E5	MA2B2_HUMAN	mannosidase, alpha, class 2B, member 2	119					mannose metabolic process (GO:0006013)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-mannosidase activity (GO:0004559)|carbohydrate binding (GO:0030246)|zinc ion binding (GO:0008270)	p.V119V(1)		breast(2)|cervix(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(9)|ovary(4)|prostate(2)|skin(2)|urinary_tract(1)	30						ACGAGGCTGTGACGCACCTTG	0.592																																							uc003gjf.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(355-357)GTG>GTC		mannosidase, alpha, class 2B, member 2							107.0	71.0	84.0					4																	6580191		2203	4300	6503	SO:0001819	synonymous_variant	23324				mannose metabolic process	extracellular region	alpha-mannosidase activity|carbohydrate binding|zinc ion binding	g.chr4:6580191G>C	BC033307	CCDS33951.1	4p16.2	2005-11-09			ENSG00000013288	ENSG00000013288			29623	protein-coding gene	gene with protein product	"""core-specific lysosomal alpha-1,6-Mannosidase"""					10231032, 16115860	Standard	XR_241647		Approved	KIAA0935	uc003gjf.1	Q9Y2E5	OTTHUMG00000160073	ENST00000285599.3:c.357G>C	4.37:g.6580191G>C			Somatic				MAN2B2_uc003gje.1_Silent_p.V119V|MAN2B2_uc011bwf.1_Silent_p.V119V	p.V119V	NM_015274	NP_056089	WXS	Illumina HiSeq	Unspecified	Q9Y2E5	MA2B2_HUMAN			3	393	+			119					Q66MP2|Q86T67	Silent	SNP	ENST00000285599.3	37	c.357G>C	CCDS33951.1	.	.	.	.	.	.	.	.	.	.	g	0.377	-0.931024	0.02359	.	.	ENSG00000013288	ENST00000505907	.	.	.	4.63	2.8	0.32819	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-18.0106	9.0205	0.36198	0.0:0.3648:0.4845:0.1507	.	.	.	.	S	118	.	.	X	+	2	2	MAN2B2	6631092	1.000000	0.71417	0.087000	0.20705	0.046000	0.14306	2.434000	0.44802	0.278000	0.22164	-0.513000	0.04457	TGA		0.592	MAN2B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359106.2	NM_015274		4	10	0	0	0	1	0	4	10				
TBC1D19	55296	broad.mit.edu	37	4	26675489	26675489	+	Missense_Mutation	SNP	G	G	C			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr4:26675489G>C	ENST00000264866.4	+	11	1073	c.795G>C	c.(793-795)ttG>ttC	p.L265F	TBC1D19_ENST00000511789.1_Missense_Mutation_p.L200F	NM_018317.2	NP_060787.2	Q8N5T2	TBC19_HUMAN	TBC1 domain family, member 19	265	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.						Rab GTPase activator activity (GO:0005097)	p.L265F(1)		breast(4)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|skin(1)|upper_aerodigestive_tract(1)	17		Breast(46;0.0503)				CTCTCATTTTGAATATTTCCA	0.393																																							uc003gsf.3		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(793-795)TTG>TTC		TBC1 domain family, member 19							41.0	43.0	42.0					4																	26675489		2203	4300	6503	SO:0001583	missense	55296					intracellular	Rab GTPase activator activity	g.chr4:26675489G>C	AK001944	CCDS3439.1, CCDS75115.1	4p15.2	2008-02-05			ENSG00000109680	ENSG00000109680			25624	protein-coding gene	gene with protein product							Standard	XM_006713967		Approved	FLJ11082	uc003gsf.4	Q8N5T2	OTTHUMG00000097797	ENST00000264866.4:c.795G>C	4.37:g.26675489G>C	ENSP00000264866:p.Leu265Phe		Somatic				TBC1D19_uc010iew.2_Missense_Mutation_p.L265F|TBC1D19_uc011bxu.1_Missense_Mutation_p.L200F	p.L265F	NM_018317	NP_060787	WXS	Illumina HiSeq	Unspecified	Q8N5T2	TBC19_HUMAN			11	1065	+		Breast(46;0.0503)	265			Rab-GAP TBC.		B9A6M0|Q9NUX1	Missense_Mutation	SNP	ENST00000264866.4	37	c.795G>C	CCDS3439.1	.	.	.	.	.	.	.	.	.	.	G	17.77	3.472291	0.63737	.	.	ENSG00000109680	ENST00000512840;ENST00000264866;ENST00000505206;ENST00000511789	T;T;T;T	0.66815	3.14;3.14;-0.23;3.14	5.2	3.42	0.39159	Rab-GAP/TBC domain (2);	0.000000	0.64402	D	0.000001	T	0.77572	0.4150	M	0.73962	2.25	0.58432	D	0.999998	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.996;0.996;0.996	T	0.77975	-0.2385	10	0.87932	D	0	-8.6911	6.8914	0.24232	0.0708:0.1275:0.6697:0.132	.	200;265;265	B9A6M0;A8K0R6;Q8N5T2	.;.;TBC19_HUMAN	F	234;265;200;200	ENSP00000427033:L234F;ENSP00000264866:L265F;ENSP00000423097:L200F;ENSP00000425569:L200F	ENSP00000264866:L265F	L	+	3	2	TBC1D19	26284587	0.996000	0.38824	0.999000	0.59377	0.911000	0.54048	0.197000	0.17197	1.308000	0.44962	-0.176000	0.13171	TTG		0.393	TBC1D19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215052.2	NM_018317		5	17	0	0	0	1	0	5	17				
COL25A1	84570	broad.mit.edu	37	4	109784503	109784503	+	Missense_Mutation	SNP	C	C	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr4:109784503C>T	ENST00000399132.1	-	21	1654	c.1124G>A	c.(1123-1125)cGa>cAa	p.R375Q	COL25A1_ENST00000399127.1_Missense_Mutation_p.R371Q|COL25A1_ENST00000399126.1_Missense_Mutation_p.R375Q	NM_198721.2	NP_942014.1			collagen, type XXV, alpha 1									p.R375Q(3)		NS(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(19)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	49		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000173)		AGGTTCCCCTCGCTCACCTCT	0.493																																							uc003hze.1		NA																	3	Substitution - Missense(3)		lung(2)|upper_aerodigestive_tract(1)	ovary(2)	2						c.(1123-1125)CGA>CAA		collagen, type XXV, alpha 1 isoform 1							53.0	55.0	54.0					4																	109784503		1834	4086	5920	SO:0001583	missense	84570					collagen|extracellular space	beta-amyloid binding|heparin binding	g.chr4:109784503C>T	AF293340	CCDS43258.1, CCDS43259.1, CCDS58922.1	4q25	2013-01-16			ENSG00000188517	ENSG00000188517		"""Collagens"""	18603	protein-coding gene	gene with protein product		610004				11927537	Standard	NM_001256074		Approved		uc003hze.2	Q9BXS0	OTTHUMG00000150039	ENST00000399132.1:c.1124G>A	4.37:g.109784503C>T	ENSP00000382083:p.Arg375Gln		Somatic				COL25A1_uc003hzg.2_Missense_Mutation_p.R375Q|COL25A1_uc003hzd.2_RNA|COL25A1_uc003hzf.2_Missense_Mutation_p.R156Q	p.R375Q	NM_198721	NP_942014	WXS	Illumina HiSeq	Unspecified	Q9BXS0	COPA1_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000173)	20	1655	-		Hepatocellular(203;0.217)	375			Extracellular (Potential).|Collagen-like 5.			Missense_Mutation	SNP	ENST00000399132.1	37	c.1124G>A	CCDS43258.1	.	.	.	.	.	.	.	.	.	.	C	19.95	3.920913	0.73213	.	.	ENSG00000188517	ENST00000399132;ENST00000333642;ENST00000401873;ENST00000399127;ENST00000399126;ENST00000443653	D;D;D	0.93307	-3.2;-3.2;-3.2	5.52	5.52	0.82312	.	0.087086	0.47093	D	0.000243	D	0.94443	0.8212	L	0.28694	0.88	0.43300	D	0.995291	D;D	0.76494	0.999;0.998	D;D	0.79108	0.975;0.992	D	0.93494	0.6838	9	.	.	.	-10.2841	19.4425	0.94827	0.0:1.0:0.0:0.0	.	375;375	Q9BXS0-2;Q9BXS0	.;COPA1_HUMAN	Q	375;377;356;371;375;305	ENSP00000382083:R375Q;ENSP00000382078:R371Q;ENSP00000382077:R375Q	.	R	-	2	0	COL25A1	110003952	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.157000	0.58144	2.578000	0.87016	0.650000	0.86243	CGA		0.493	COL25A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315938.2	NM_032518		8	16	0	0	0	1	0	8	16				
DSP	1832	broad.mit.edu	37	6	7581355	7581355	+	Silent	SNP	G	G	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr6:7581355G>A	ENST00000379802.3	+	23	5273	c.4932G>A	c.(4930-4932)ctG>ctA	p.L1644L	DSP_ENST00000418664.2_Intron	NM_004415.2	NP_004406.2	P15924	DESP_HUMAN	desmoplakin	1644	Central fibrous rod domain.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|desmosome organization (GO:0002934)|epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein localization to adherens junction (GO:0071896)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular compact myocardium morphogenesis (GO:0003223)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cornified envelope (GO:0001533)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|protein kinase C binding (GO:0005080)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.L1644L(1)		biliary_tract(1)|breast(6)|central_nervous_system(7)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|liver(2)|lung(27)|ovary(4)|prostate(1)|skin(8)|stomach(3)|upper_aerodigestive_tract(7)|urinary_tract(5)	101	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		ATGGCCACCTGAGGGAAAAGC	0.567																																							uc003mxp.1		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(6)|ovary(2)|skin(1)	9						c.(4930-4932)CTG>CTA		desmoplakin isoform I							65.0	69.0	67.0					6																	7581355		2203	4300	6503	SO:0001819	synonymous_variant	1832				cellular component disassembly involved in apoptosis|keratinocyte differentiation|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural constituent of cytoskeleton	g.chr6:7581355G>A	J05211	CCDS4501.1, CCDS47368.1	6p24.3	2014-09-17	2003-05-20		ENSG00000096696	ENSG00000096696			3052	protein-coding gene	gene with protein product		125647	"""desmoplakin (DPI, DPII)"""			1889810	Standard	NM_004415		Approved	KPPS2, PPKS2, DPI, DPII	uc003mxp.1	P15924	OTTHUMG00000014212	ENST00000379802.3:c.4932G>A	6.37:g.7581355G>A			Somatic				DSP_uc003mxq.1_Intron	p.L1644L	NM_004415	NP_004406	WXS	Illumina HiSeq	Unspecified	P15924	DESP_HUMAN		OV - Ovarian serous cystadenocarcinoma(45;0.000508)	23	5211	+	Ovarian(93;0.0584)	all_hematologic(90;0.236)	1644			Central fibrous rod domain.|Potential.		B2RTT2|D7RX09|O75993|Q14189|Q9UHN4	Silent	SNP	ENST00000379802.3	37	c.4932G>A	CCDS4501.1																																																																																				0.567	DSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039786.2	NM_004415		40	19	0	0	0	1	0	40	19				
HIST1H2BC	8347	broad.mit.edu	37	6	26123793	26123793	+	Missense_Mutation	SNP	C	C	G			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr6:26123793C>G	ENST00000314332.5	-	1	345	c.340G>C	c.(340-342)Gag>Cag	p.E114Q	HIST1H2BC_ENST00000396984.1_Missense_Mutation_p.E114Q|HIST1H2AC_ENST00000377791.2_5'Flank|HIST1H2AC_ENST00000602637.1_5'Flank			P62807	H2B1C_HUMAN	histone cluster 1, H2bc	114					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|nucleosome assembly (GO:0006334)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.E114Q(1)		NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(9)|ovary(1)	16						TTGGTGCCCTCCGACACGGCG	0.582																																							uc003ngk.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(340-342)GAG>CAG		histone cluster 1, H2bc							81.0	83.0	82.0					6																	26123793		2203	4299	6502	SO:0001583	missense	8347				defense response to bacterium|nucleosome assembly	nucleosome|nucleus	DNA binding|protein binding	g.chr6:26123793C>G	Z80783	CCDS4584.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000180596	ENSG00000180596		"""Histones / Replication-dependent"""	4757	protein-coding gene	gene with protein product		602847	"""H2B histone family, member L"", ""histone 1, H2bc"""	H2BFL		9119399, 12408966	Standard	NM_003526		Approved	H2B/l, H2B.1	uc003ngl.3	P62807	OTTHUMG00000014425	ENST00000314332.5:c.340G>C	6.37:g.26123793C>G	ENSP00000321744:p.Glu114Gln		Somatic				HIST1H2BC_uc003ngl.2_Missense_Mutation_p.E114Q|HIST1H2AC_uc003ngm.2_5'Flank|HIST1H2AC_uc003ngn.2_5'Flank|HIST1H2AC_uc003ngo.2_5'Flank|HIST1H2AC_uc003ngp.2_5'Flank	p.E114Q	NM_003526	NP_003517	WXS	Illumina HiSeq	Unspecified	P62807	H2B1C_HUMAN			1	362	-			114					P02278|Q3B872|Q4VB69|Q93078|Q93080	Missense_Mutation	SNP	ENST00000314332.5	37	c.340G>C	CCDS4584.1	.	.	.	.	.	.	.	.	.	.	.	24.1	4.489922	0.84962	.	.	ENSG00000180596	ENST00000314332;ENST00000396984	T;T	0.48836	0.8;0.8	5.61	5.61	0.85477	Histone-fold (2);	0.000000	0.40144	U	0.001170	T	0.35828	0.0945	.	.	.	0.42212	D	0.99181	B	0.27117	0.168	B	0.30251	0.113	T	0.28776	-1.0033	9	0.72032	D	0.01	.	18.9929	0.92801	0.0:1.0:0.0:0.0	.	114	P62807	H2B1C_HUMAN	Q	114	ENSP00000321744:E114Q;ENSP00000380180:E114Q	ENSP00000321744:E114Q	E	-	1	0	HIST1H2BC	26231772	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	5.979000	0.70508	2.799000	0.96334	0.650000	0.86243	GAG		0.582	HIST1H2BC-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000468022.1	NM_003526		21	49	0	0	0	1	0	21	49				
TREML1	340205	broad.mit.edu	37	6	41118012	41118012	+	Missense_Mutation	SNP	C	C	G			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr6:41118012C>G	ENST00000426005.2	-	5	651	c.608G>C	c.(607-609)aGa>aCa	p.R203T	TREML1_ENST00000373127.4_Intron|TREML1_ENST00000437044.2_Missense_Mutation_p.R92T	NM_178174.2	NP_835468.1	Q86YW5	TRML1_HUMAN	triggering receptor expressed on myeloid cells-like 1	203					calcium-mediated signaling (GO:0019722)|innate immune response (GO:0045087)|platelet activation (GO:0030168)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)		p.R203T(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)	13	Ovarian(28;0.0418)|Colorectal(47;0.196)					GCCTGAAACTCTGCTGCTCAG	0.572																																							uc011duc.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(607-609)AGA>ACA		triggering receptor expressed on myeloid							58.0	58.0	58.0					6																	41118012		2203	4300	6503	SO:0001583	missense	340205				calcium-mediated signaling|innate immune response|platelet activation	cell surface|integral to membrane|plasma membrane|platelet alpha granule	protein binding|receptor activity	g.chr6:41118012C>G	AF534822	CCDS4851.1, CCDS64420.1, CCDS64421.1	6p21.1	2013-01-11			ENSG00000161911	ENSG00000161911		"""Immunoglobulin superfamily / V-set domain containing"""	20434	protein-coding gene	gene with protein product	"""TREM-like transcript 1"""	609714				12393607, 12645956	Standard	NM_178174		Approved	TLT1, dJ238O23.3	uc011duc.3	Q86YW5	OTTHUMG00000016231	ENST00000426005.2:c.608G>C	6.37:g.41118012C>G	ENSP00000402855:p.Arg203Thr		Somatic				TREML1_uc003opx.2_Intron|TREML1_uc011dud.1_Missense_Mutation_p.R92T	p.R203T	NM_178174	NP_835468	WXS	Illumina HiSeq	Unspecified	Q86YW5	TRML1_HUMAN			5	652	-	Ovarian(28;0.0418)|Colorectal(47;0.196)		203			Cytoplasmic (Potential).		Q496B3|Q8IWY1|Q8IWY2	Missense_Mutation	SNP	ENST00000426005.2	37	c.608G>C	CCDS4851.1	.	.	.	.	.	.	.	.	.	.	C	16.29	3.082091	0.55861	.	.	ENSG00000161911	ENST00000373127;ENST00000437044	T	0.48201	0.82	5.24	4.24	0.50183	.	0.959472	0.08630	N	0.917113	T	0.13372	0.0324	N	0.22421	0.69	0.09310	N	1	B;P	0.42827	0.218;0.791	B;B	0.38378	0.124;0.272	T	0.01159	-1.1433	10	0.14656	T	0.56	.	5.8473	0.18673	0.0:0.8319:0.0:0.1681	.	92;203	Q86YW5-3;Q86YW5	.;TRML1_HUMAN	T	203;92	ENSP00000400405:R92T	ENSP00000362219:R203T	R	-	2	0	TREML1	41225990	0.000000	0.05858	0.007000	0.13788	0.998000	0.95712	0.767000	0.26575	2.443000	0.82685	0.655000	0.94253	AGA		0.572	TREML1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043538.2	NM_178174		9	15	0	0	0	1	0	9	15				
GRM1	2911	broad.mit.edu	37	6	146351273	146351273	+	Missense_Mutation	SNP	C	C	G			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr6:146351273C>G	ENST00000282753.1	+	1	855	c.620C>G	c.(619-621)tCt>tGt	p.S207C	GRM1_ENST00000355289.4_Missense_Mutation_p.S207C|GRM1_ENST00000392299.2_Missense_Mutation_p.S207C|GRM1_ENST00000492807.2_Missense_Mutation_p.S207C|GRM1_ENST00000507907.1_Missense_Mutation_p.S207C|GRM1_ENST00000361719.2_Missense_Mutation_p.S207C			Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1	207					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|cell death (GO:0008219)|cellular response to electrical stimulus (GO:0071257)|dimeric G-protein coupled receptor signaling pathway (GO:0038042)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|G-protein coupled receptor dimeric complex (GO:0038037)|G-protein coupled receptor homodimeric complex (GO:0038038)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)	p.S207C(2)		NS(2)|breast(5)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(54)|ovary(7)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	126		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)		GTTGTCCCTTCTGACACTTTG	0.478																																							uc010khw.1		NA																	2	Substitution - Missense(2)		lung(2)	lung(8)|ovary(4)|central_nervous_system(3)|large_intestine(2)|breast(2)	19						c.(619-621)TCT>TGT		glutamate receptor, metabotropic 1 isoform alpha	Acamprosate(DB00659)|L-Glutamic Acid(DB00142)						85.0	88.0	87.0					6																	146351273		2203	4300	6503	SO:0001583	missense	2911				synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity	g.chr6:146351273C>G	U31215	CCDS5209.1, CCDS47497.1, CCDS64548.1	6q24	2014-06-12			ENSG00000152822	ENSG00000152822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4593	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 85"""	604473				9076744, 9376535	Standard	NM_001278064		Approved	GPRC1A, mGlu1, MGLUR1, PPP1R85	uc010khw.2	Q13255	OTTHUMG00000015752	ENST00000282753.1:c.620C>G	6.37:g.146351273C>G	ENSP00000282753:p.Ser207Cys		Somatic				GRM1_uc010khu.1_Missense_Mutation_p.S207C|GRM1_uc010khv.1_Missense_Mutation_p.S207C|GRM1_uc003qll.2_Missense_Mutation_p.S207C|GRM1_uc011edz.1_Missense_Mutation_p.S207C|GRM1_uc011eea.1_Missense_Mutation_p.S207C	p.S207C	NM_000838	NP_000829	WXS	Illumina HiSeq	Unspecified	Q13255	GRM1_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)	2	1090	+		Ovarian(120;0.0387)	207			Extracellular (Potential).		B9EG79|F8W805|Q13256|Q14757|Q14758|Q5VTF7|Q5VTF8|Q9NU10|Q9UGS9|Q9UGT0	Missense_Mutation	SNP	ENST00000282753.1	37	c.620C>G	CCDS5209.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.375902	0.82682	.	.	ENSG00000152822	ENST00000361719;ENST00000392299;ENST00000492807;ENST00000282753;ENST00000355289;ENST00000507907	D;D;D;D;D;D	0.89050	-2.46;-2.46;-2.46;-2.46;-2.46;-2.46	5.79	5.79	0.91817	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.95290	0.8472	M	0.88377	2.95	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.996;0.999;0.997;0.996	D	0.95072	0.8205	10	0.62326	D	0.03	.	19.6316	0.95708	0.0:1.0:0.0:0.0	.	207;207;202;207	F8W805;Q13255;Q59HC2;Q13255-2	.;GRM1_HUMAN;.;.	C	207	ENSP00000354896:S207C;ENSP00000376119:S207C;ENSP00000424095:S207C;ENSP00000282753:S207C;ENSP00000347437:S207C;ENSP00000425599:S207C	ENSP00000282753:S207C	S	+	2	0	GRM1	146392966	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.736000	0.93811	0.561000	0.74099	TCT		0.478	GRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042574.1	NM_000838		20	60	0	0	0	1	0	20	60				
PLEKHG1	57480	broad.mit.edu	37	6	151089832	151089832	+	Missense_Mutation	SNP	C	C	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr6:151089832C>T	ENST00000358517.2	+	3	681	c.470C>T	c.(469-471)tCa>tTa	p.S157L	PLEKHG1_ENST00000367328.1_Missense_Mutation_p.S157L			Q9ULL1	PKHG1_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 1	157	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.						Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.S157L(1)		breast(3)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(19)|ovary(5)|prostate(4)|stomach(1)|urinary_tract(3)	53			BRCA - Breast invasive adenocarcinoma(37;0.0923)	OV - Ovarian serous cystadenocarcinoma(155;6.69e-13)		GAAGAAAGATCAGCCCTTTTT	0.393																																							uc003qny.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(469-471)TCA>TTA		pleckstrin homology domain containing, family G							116.0	106.0	109.0					6																	151089832		2203	4300	6503	SO:0001583	missense	57480				regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity	g.chr6:151089832C>T	AB033035	CCDS34552.1	6q25.1	2013-01-11			ENSG00000120278	ENSG00000120278		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	20884	protein-coding gene	gene with protein product						10574462	Standard	XM_005267064		Approved	KIAA1209, ARHGEF41	uc003qny.1	Q9ULL1	OTTHUMG00000015824	ENST00000358517.2:c.470C>T	6.37:g.151089832C>T	ENSP00000351318:p.Ser157Leu		Somatic				PLEKHG1_uc011eel.1_Missense_Mutation_p.S197L|PLEKHG1_uc011eem.1_Missense_Mutation_p.S216L|PLEKHG1_uc003qnz.2_Missense_Mutation_p.S157L	p.S157L	NM_001029884	NP_001025055	WXS	Illumina HiSeq	Unspecified	Q9ULL1	PKHG1_HUMAN	BRCA - Breast invasive adenocarcinoma(37;0.0923)	OV - Ovarian serous cystadenocarcinoma(155;6.69e-13)	4	782	+			157			DH.		Q5T1F2	Missense_Mutation	SNP	ENST00000358517.2	37	c.470C>T	CCDS34552.1	.	.	.	.	.	.	.	.	.	.	C	19.13	3.768349	0.69878	.	.	ENSG00000120278	ENST00000367328;ENST00000535018;ENST00000358517	T;T	0.63744	-0.06;-0.06	6.02	3.21	0.36854	Dbl homology (DH) domain (5);	0.815781	0.11817	N	0.526582	T	0.53286	0.1787	L	0.39514	1.22	0.09310	N	1	P;P	0.42409	0.779;0.779	P;P	0.56216	0.794;0.794	T	0.50750	-0.8791	10	0.62326	D	0.03	.	10.9577	0.47366	0.0:0.7902:0.0:0.2098	.	157;157	Q5JYA6;Q9ULL1	.;PKHG1_HUMAN	L	157	ENSP00000356297:S157L;ENSP00000351318:S157L	ENSP00000351318:S157L	S	+	2	0	PLEKHG1	151131525	0.028000	0.19301	0.000000	0.03702	0.993000	0.82548	0.496000	0.22499	0.395000	0.25257	-0.345000	0.07892	TCA		0.393	PLEKHG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042691.1			3	20	0	0	0	1	0	3	20				
HOXA1	3198	broad.mit.edu	37	7	27134880	27134880	+	Splice_Site	SNP	C	C	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr7:27134880C>A	ENST00000343060.4	-	1	713	c.652G>T	c.(652-654)Ggg>Tgg	p.G218W	HOTAIRM1_ENST00000495032.1_RNA|HOTAIRM1_ENST00000429611.3_RNA|HOTAIRM1_ENST00000425358.2_RNA|HOXA1_ENST00000355633.5_3'UTR|HOTAIRM1_ENST00000434063.3_RNA	NM_005522.4	NP_005513	P49639	HXA1_HUMAN	homeobox A1	218					abducens nerve formation (GO:0021599)|anatomical structure morphogenesis (GO:0009653)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|artery morphogenesis (GO:0048844)|central nervous system neuron differentiation (GO:0021953)|cochlea development (GO:0090102)|cochlea morphogenesis (GO:0090103)|cognition (GO:0050890)|embryonic neurocranium morphogenesis (GO:0048702)|facial nerve structural organization (GO:0021612)|facial nucleus development (GO:0021754)|inner ear development (GO:0048839)|motor neuron axon guidance (GO:0008045)|multicellular organismal development (GO:0007275)|neuromuscular process (GO:0050905)|optokinetic behavior (GO:0007634)|outer ear morphogenesis (GO:0042473)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of behavior (GO:0050795)|rhombomere 3 development (GO:0021569)|rhombomere 4 development (GO:0021570)|rhombomere 5 development (GO:0021571)|semicircular canal formation (GO:0060876)|sensory perception of sound (GO:0007605)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.G218W(1)		endometrium(2)|kidney(2)|large_intestine(4)|liver(1)|lung(14)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						CAGGACTGACCTGTTTTGGGA	0.463																																							uc003sye.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(652-654)GGG>TGG		homeobox A1 isoform a							40.0	46.0	44.0					7																	27134880		2203	4300	6503	SO:0001630	splice_region_variant	3198					nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr7:27134880C>A		CCDS5401.1, CCDS5402.2	7p15.2	2011-06-20	2005-12-22		ENSG00000105991	ENSG00000105991		"""Homeoboxes / ANTP class : HOXL subclass"""	5099	protein-coding gene	gene with protein product		142955	"""homeo box A1"""	HOX1F, HOX1		1973146	Standard	NM_153620		Approved		uc003sye.3	P49639	OTTHUMG00000023207	ENST00000343060.4:c.652+1G>T	7.37:g.27134880C>A			Somatic				HOXA1_uc003syd.2_3'UTR|uc003syg.2_5'Flank	p.G218W	NM_005522	NP_005513	WXS	Illumina HiSeq	Unspecified	P49639	HXA1_HUMAN			1	746	-			218					A4D184|B2R8U7|O43363	Missense_Mutation	SNP	ENST00000343060.4	37	c.652G>T	CCDS5401.1	.	.	.	.	.	.	.	.	.	.	C	19.78	3.891478	0.72524	.	.	ENSG00000105991	ENST00000343060	D	0.91686	-2.89	4.9	4.9	0.64082	.	0.000000	0.85682	D	0.000000	D	0.96225	0.8769	M	0.83603	2.65	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96189	0.9136	9	.	.	.	.	17.858	0.88772	0.0:1.0:0.0:0.0	.	218	P49639	HXA1_HUMAN	W	218	ENSP00000343246:G218W	.	G	-	1	0	HOXA1	27101405	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	6.954000	0.76001	2.541000	0.85698	0.561000	0.74099	GGG		0.463	HOXA1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000358454.1		Missense_Mutation	9	18	1	0	0.000673444	1	0.000693976	9	18				
COBL	23242	broad.mit.edu	37	7	51096213	51096213	+	Missense_Mutation	SNP	C	C	G			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr7:51096213C>G	ENST00000265136.7	-	10	2745	c.2580G>C	c.(2578-2580)caG>caC	p.Q860H	COBL_ENST00000395542.2_Missense_Mutation_p.Q942H	NM_015198.3	NP_056013.2	O75128	COBL_HUMAN	cordon-bleu WH2 repeat protein	860					actin filament network formation (GO:0051639)|actin filament polymerization (GO:0030041)|collateral sprouting in absence of injury (GO:0048669)|digestive tract development (GO:0048565)|embryonic axis specification (GO:0000578)|floor plate development (GO:0033504)|liver development (GO:0001889)|neural tube closure (GO:0001843)|notochord development (GO:0030903)|positive regulation of dendrite development (GO:1900006)|somite specification (GO:0001757)	actin filament (GO:0005884)|axon (GO:0030424)|axonal growth cone (GO:0044295)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic growth cone (GO:0044294)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	actin monomer binding (GO:0003785)	p.Q860H(1)		NS(2)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(26)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Glioma(55;0.08)					ACGTTCTTCTCTGAGGCTTGA	0.587																																					NSCLC(189;2119 2138 12223 30818 34679)	NSCLC(189;2119 2138 12223 30818 34679)	uc003tpr.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|ovary(2)	5						c.(2578-2580)CAG>CAC		cordon-bleu homolog							121.0	109.0	113.0					7																	51096213		2203	4300	6503	SO:0001583	missense	23242							g.chr7:51096213C>G	AB014533	CCDS34637.1, CCDS75601.1, CCDS75602.1	7p12.2-p12.1	2012-12-07	2012-12-07		ENSG00000106078	ENSG00000106078			22199	protein-coding gene	gene with protein product		610317	"""cordon-bleu homolog (mouse)"""				Standard	NM_015198		Approved	KIAA0633	uc003tpr.4	O75128	OTTHUMG00000155999	ENST00000265136.7:c.2580G>C	7.37:g.51096213C>G	ENSP00000265136:p.Gln860His		Somatic				COBL_uc003tps.2_Missense_Mutation_p.Q917H|COBL_uc011kcl.1_Missense_Mutation_p.Q860H|COBL_uc003tpp.3_Missense_Mutation_p.Q646H|COBL_uc003tpq.3_Missense_Mutation_p.Q801H|COBL_uc003tpo.3_Missense_Mutation_p.Q402H	p.Q860H	NM_015198	NP_056013	WXS	Illumina HiSeq	Unspecified	O75128	COBL_HUMAN			10	2765	-	Glioma(55;0.08)		860					A4D257|A7E2B0|B7ZLW9|B9EGF8|Q2T9J3|Q504Y4|Q86XA7|Q8N304|Q8TCM1	Missense_Mutation	SNP	ENST00000265136.7	37	c.2580G>C	CCDS34637.1	.	.	.	.	.	.	.	.	.	.	C	11.45	1.643278	0.29246	.	.	ENSG00000106078	ENST00000265136;ENST00000445054;ENST00000431948;ENST00000395542	T;T;T;T	0.13307	2.61;2.6;2.63;2.63	5.5	-2.86	0.05717	.	0.656962	0.12796	N	0.438480	T	0.21347	0.0514	L	0.47716	1.5	0.23180	N	0.99816	B;B;P;D;P	0.76494	0.021;0.01;0.524;0.999;0.583	B;B;B;D;B	0.85130	0.021;0.013;0.044;0.997;0.111	T	0.10177	-1.0641	10	0.33940	T	0.23	.	5.3091	0.15821	0.0933:0.2311:0.4812:0.1944	.	860;917;860;942;402	O75128-3;O75128-7;O75128;O75128-2;O75128-6	.;.;COBL_HUMAN;.;.	H	860;752;745;942	ENSP00000265136:Q860H;ENSP00000401204:Q752H;ENSP00000413498:Q745H;ENSP00000378912:Q942H	ENSP00000265136:Q860H	Q	-	3	2	COBL	51063707	0.958000	0.32768	0.228000	0.23943	0.636000	0.38137	0.039000	0.13884	-0.583000	0.05921	-0.300000	0.09419	CAG		0.587	COBL-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000342682.1	NM_015198		32	37	0	0	0	1	0	32	37				
COBL	23242	broad.mit.edu	37	7	51096593	51096593	+	Missense_Mutation	SNP	C	C	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr7:51096593C>T	ENST00000265136.7	-	10	2365	c.2200G>A	c.(2200-2202)Gac>Aac	p.D734N	COBL_ENST00000395542.2_Missense_Mutation_p.D816N	NM_015198.3	NP_056013.2	O75128	COBL_HUMAN	cordon-bleu WH2 repeat protein	734					actin filament network formation (GO:0051639)|actin filament polymerization (GO:0030041)|collateral sprouting in absence of injury (GO:0048669)|digestive tract development (GO:0048565)|embryonic axis specification (GO:0000578)|floor plate development (GO:0033504)|liver development (GO:0001889)|neural tube closure (GO:0001843)|notochord development (GO:0030903)|positive regulation of dendrite development (GO:1900006)|somite specification (GO:0001757)	actin filament (GO:0005884)|axon (GO:0030424)|axonal growth cone (GO:0044295)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic growth cone (GO:0044294)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	actin monomer binding (GO:0003785)	p.D734N(1)		NS(2)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(26)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Glioma(55;0.08)					CCCAGCTCGTCAATCTTAATG	0.507																																					NSCLC(189;2119 2138 12223 30818 34679)	NSCLC(189;2119 2138 12223 30818 34679)	uc003tpr.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|ovary(2)	5						c.(2200-2202)GAC>AAC		cordon-bleu homolog							98.0	82.0	88.0					7																	51096593		2203	4300	6503	SO:0001583	missense	23242							g.chr7:51096593C>T	AB014533	CCDS34637.1, CCDS75601.1, CCDS75602.1	7p12.2-p12.1	2012-12-07	2012-12-07		ENSG00000106078	ENSG00000106078			22199	protein-coding gene	gene with protein product		610317	"""cordon-bleu homolog (mouse)"""				Standard	NM_015198		Approved	KIAA0633	uc003tpr.4	O75128	OTTHUMG00000155999	ENST00000265136.7:c.2200G>A	7.37:g.51096593C>T	ENSP00000265136:p.Asp734Asn		Somatic				COBL_uc003tps.2_Missense_Mutation_p.D791N|COBL_uc011kcl.1_Missense_Mutation_p.D734N|COBL_uc003tpp.3_Missense_Mutation_p.D520N|COBL_uc003tpq.3_Missense_Mutation_p.D675N|COBL_uc003tpo.3_Missense_Mutation_p.D276N	p.D734N	NM_015198	NP_056013	WXS	Illumina HiSeq	Unspecified	O75128	COBL_HUMAN			10	2385	-	Glioma(55;0.08)		734					A4D257|A7E2B0|B7ZLW9|B9EGF8|Q2T9J3|Q504Y4|Q86XA7|Q8N304|Q8TCM1	Missense_Mutation	SNP	ENST00000265136.7	37	c.2200G>A	CCDS34637.1	.	.	.	.	.	.	.	.	.	.	C	17.53	3.413243	0.62511	.	.	ENSG00000106078	ENST00000265136;ENST00000445054;ENST00000431948;ENST00000395542	T;T;T;T	0.52983	0.7;0.64;0.74;0.72	5.83	4.95	0.65309	.	0.146541	0.31601	N	0.007363	T	0.63200	0.2491	L	0.55990	1.75	0.37330	D	0.909935	D;P;P;D;P	0.89917	0.972;0.889;0.952;1.0;0.859	P;P;B;D;B	0.87578	0.536;0.536;0.335;0.998;0.435	T	0.68580	-0.5371	10	0.48119	T	0.1	.	13.8151	0.63287	0.0:0.9272:0.0:0.0728	.	734;791;734;816;276	O75128-3;O75128-7;O75128;O75128-2;O75128-6	.;.;COBL_HUMAN;.;.	N	734;626;619;816	ENSP00000265136:D734N;ENSP00000401204:D626N;ENSP00000413498:D619N;ENSP00000378912:D816N	ENSP00000265136:D734N	D	-	1	0	COBL	51064087	1.000000	0.71417	0.483000	0.27378	0.690000	0.40134	5.190000	0.65104	1.473000	0.48159	0.655000	0.94253	GAC		0.507	COBL-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000342682.1	NM_015198		14	30	0	0	0	1	0	14	30				
SAMD9L	219285	broad.mit.edu	37	7	92763767	92763767	+	Silent	SNP	G	G	A	rs560813720		TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr7:92763767G>A	ENST00000318238.4	-	5	2734	c.1518C>T	c.(1516-1518)agC>agT	p.S506S	SAMD9L_ENST00000437805.1_Silent_p.S506S|SAMD9L_ENST00000411955.1_Silent_p.S506S	NM_152703.2	NP_689916.2	Q8IVG5	SAM9L_HUMAN	sterile alpha motif domain containing 9-like	506					common myeloid progenitor cell proliferation (GO:0035726)|endosomal vesicle fusion (GO:0034058)|hematopoietic progenitor cell differentiation (GO:0002244)|regulation of protein catabolic process (GO:0042176)|spleen development (GO:0048536)|stem cell division (GO:0017145)	early endosome (GO:0005769)		p.S506S(1)		central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(23)|liver(2)|lung(31)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	88	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)		STAD - Stomach adenocarcinoma(171;0.000302)			TATATGTCTCGCTTTTCAGGT	0.378													G|||	1	0.000199681	0.0	0.0	5008	,	,		18215	0.0		0.001	False		,,,				2504	0.0						uc003umh.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)	4						c.(1516-1518)AGC>AGT		sterile alpha motif domain containing 9-like							84.0	88.0	86.0					7																	92763767		2203	4300	6503	SO:0001819	synonymous_variant	219285							g.chr7:92763767G>A	AB095926	CCDS34681.1	7q21.2	2013-01-10		2005-04-26	ENSG00000177409	ENSG00000177409		"""Sterile alpha motif (SAM) domain containing"""	1349	protein-coding gene	gene with protein product		611170	"""chromosome 7 open reading frame 6"""	C7orf6			Standard	NM_152703		Approved	KIAA2005, FLJ39885	uc003umh.1	Q8IVG5	OTTHUMG00000155807	ENST00000318238.4:c.1518C>T	7.37:g.92763767G>A			Somatic				SAMD9L_uc003umj.1_Silent_p.S506S|SAMD9L_uc003umi.1_Silent_p.S506S|SAMD9L_uc010lfb.1_Silent_p.S506S|SAMD9L_uc003umk.1_Silent_p.S506S|SAMD9L_uc010lfc.1_Silent_p.S506S|SAMD9L_uc010lfd.1_Silent_p.S506S|SAMD9L_uc011khx.1_Intron	p.S506S	NM_152703	NP_689916	WXS	Illumina HiSeq	Unspecified	Q8IVG5	SAM9L_HUMAN	STAD - Stomach adenocarcinoma(171;0.000302)		5	2734	-	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)		506					A0JP23|A0JP24|A0PJG8|A4D1G8|D6W5Q6|Q2TV71|Q2TV75|Q2UZV8|Q8IWI4|Q8N3L9|Q8N875	Silent	SNP	ENST00000318238.4	37	c.1518C>T	CCDS34681.1																																																																																				0.378	SAMD9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341730.1	NM_152703		38	70	0	0	0	1	0	38	70				
SLC12A9	56996	broad.mit.edu	37	7	100457570	100457570	+	Missense_Mutation	SNP	G	G	C			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr7:100457570G>C	ENST00000354161.3	+	8	1166	c.1041G>C	c.(1039-1041)ttG>ttC	p.L347F	SLC12A9_ENST00000475623.1_3'UTR|SLC12A9_ENST00000540482.1_Missense_Mutation_p.L347F|SLC12A9_ENST00000428758.1_Missense_Mutation_p.L347F|SLC12A9_ENST00000415287.1_Missense_Mutation_p.L258F|SLC12A9_ENST00000275729.3_Missense_Mutation_p.L258F	NM_020246.3	NP_064631.2	Q9BXP2	S12A9_HUMAN	solute carrier family 12, member 9	347					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation:chloride symporter activity (GO:0015377)	p.L347F(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(10)|lung(20)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	41	Lung NSC(181;0.041)|all_lung(186;0.0581)					CACTGGTGTTGATCGGAATCT	0.597																																							uc003uwp.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1039-1041)TTG>TTC		solute carrier family 12 (potassium/chloride							126.0	116.0	119.0					7																	100457570		2203	4300	6503	SO:0001583	missense	56996					integral to membrane|plasma membrane	cation:chloride symporter activity	g.chr7:100457570G>C	AF284422	CCDS5707.1, CCDS59068.1, CCDS59069.1	7q22	2013-07-18	2013-07-18		ENSG00000146828	ENSG00000146828		"""Solute carriers"""	17435	protein-coding gene	gene with protein product	"""cation-chloride cotransporter-interacting protein"""					10871601, 11239002	Standard	NM_020246		Approved	CIP1	uc003uwp.4	Q9BXP2	OTTHUMG00000156045	ENST00000354161.3:c.1041G>C	7.37:g.100457570G>C	ENSP00000275730:p.Leu347Phe		Somatic				SLC12A9_uc003uwq.2_Missense_Mutation_p.L258F|SLC12A9_uc011kki.1_5'UTR|SLC12A9_uc003uwr.2_Missense_Mutation_p.L83F|SLC12A9_uc003uws.2_5'UTR|SLC12A9_uc003uwt.2_Missense_Mutation_p.L83F|SLC12A9_uc003uwv.2_5'UTR	p.L347F	NM_020246	NP_064631	WXS	Illumina HiSeq	Unspecified	Q9BXP2	S12A9_HUMAN			8	1183	+	Lung NSC(181;0.041)|all_lung(186;0.0581)		347			Helical; (Potential).		B7Z740|D6W5X0|D6W5X2|F5H8C2|Q9BWL2|Q9BXP1|Q9BYI0|Q9NQR5	Missense_Mutation	SNP	ENST00000354161.3	37	c.1041G>C	CCDS5707.1	.	.	.	.	.	.	.	.	.	.	G	12.53	1.966852	0.34659	.	.	ENSG00000146828	ENST00000540482;ENST00000418037;ENST00000428758;ENST00000275729;ENST00000415287;ENST00000354161;ENST00000416675	D;D;D;D;D;D;D	0.98792	-5.14;-5.14;-5.14;-5.14;-5.14;-5.14;-5.14	4.7	1.51	0.23008	Amino acid permease domain (1);	0.298427	0.31450	N	0.007635	D	0.95802	0.8634	L	0.41710	1.295	0.40708	D	0.982545	B;B	0.24576	0.045;0.106	B;B	0.34301	0.056;0.179	D	0.90029	0.4133	10	0.17832	T	0.49	.	5.6834	0.17788	0.2075:0.2119:0.5805:0.0	.	258;347	Q9BXP2-2;Q9BXP2	.;S12A9_HUMAN	F	347;83;347;258;258;347;155	ENSP00000443702:L347F;ENSP00000406560:L83F;ENSP00000408301:L347F;ENSP00000275729:L258F;ENSP00000413796:L258F;ENSP00000275730:L347F;ENSP00000410692:L155F	ENSP00000275729:L258F	L	+	3	2	SLC12A9	100295506	0.000000	0.05858	0.244000	0.24202	0.752000	0.42762	-0.463000	0.06696	0.503000	0.28060	-0.214000	0.12660	TTG		0.597	SLC12A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342837.1	NM_020246		25	53	0	0	0	1	0	25	53				
OR2F2	135948	broad.mit.edu	37	7	143633081	143633081	+	Silent	SNP	C	C	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr7:143633081C>T	ENST00000408955.2	+	1	823	c.756C>T	c.(754-756)taC>taT	p.Y252Y		NM_001004685.1	NP_001004685.1	O95006	OR2F2_HUMAN	olfactory receptor, family 2, subfamily F, member 2	252						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Y252Y(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(19)|ovary(3)|skin(2)|stomach(1)|urinary_tract(1)	32	Melanoma(164;0.0903)					CCCTGTGCTACGGCACAACGA	0.512																																							uc011ktv.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|skin(1)	4						c.(754-756)TAC>TAT		olfactory receptor, family 2, subfamily F,							126.0	121.0	123.0					7																	143633081		2203	4300	6503	SO:0001819	synonymous_variant	135948				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr7:143633081C>T		CCDS43666.1	7q33-q35	2012-08-09			ENSG00000221910	ENSG00000221910		"""GPCR / Class A : Olfactory receptors"""	8247	protein-coding gene	gene with protein product							Standard	NM_001004685		Approved	OR7-1	uc011ktv.2	O95006	OTTHUMG00000157768	ENST00000408955.2:c.756C>T	7.37:g.143633081C>T			Somatic					p.Y252Y	NM_001004685	NP_001004685	WXS	Illumina HiSeq	Unspecified	O95006	OR2F2_HUMAN			1	756	+	Melanoma(164;0.0903)		252			Helical; Name=6; (Potential).		A4D2G0|Q6IFP8	Silent	SNP	ENST00000408955.2	37	c.756C>T	CCDS43666.1																																																																																				0.512	OR2F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349570.1			22	42	0	0	0	1	0	22	42				
NPM2	10361	broad.mit.edu	37	8	21890671	21890671	+	Missense_Mutation	SNP	C	C	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr8:21890671C>T	ENST00000397940.1	+	5	1316	c.301C>T	c.(301-303)Cca>Tca	p.P101S	snoU13_ENST00000459495.1_RNA|NPM2_ENST00000521157.1_Missense_Mutation_p.P101S|NPM2_ENST00000381530.5_Missense_Mutation_p.P101S|NPM2_ENST00000518119.1_Missense_Mutation_p.P101S|NPM2_ENST00000520180.1_3'UTR|NPM2_ENST00000289820.6_Missense_Mutation_p.P101S			Q86SE8	NPM2_HUMAN	nucleophosmin/nucleoplasmin 2	101					chromatin remodeling (GO:0006338)|embryo development (GO:0009790)|oocyte differentiation (GO:0009994)|positive regulation of catalytic activity (GO:0043085)|positive regulation of DNA replication (GO:0045740)|positive regulation of meiosis (GO:0045836)|protein homooligomerization (GO:0051260)|regulation of exit from mitosis (GO:0007096)|single fertilization (GO:0007338)	cytoplasmic chromatin (GO:0000789)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|nucleic acid binding (GO:0003676)	p.P101S(1)		large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	4				Colorectal(74;8.48e-05)|READ - Rectum adenocarcinoma(5;0.0276)|COAD - Colon adenocarcinoma(73;0.0618)		GCTTTCTCCCCCAGTTACTTT	0.597																																							uc003xab.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(301-303)CCA>TCA		nucleoplasmin 2							107.0	94.0	98.0					8																	21890671		2203	4300	6503	SO:0001583	missense	10361				chromatin remodeling|embryo development|oocyte differentiation|positive regulation of meiosis|regulation of exit from mitosis|single fertilization	cytoplasmic chromatin|nuclear chromatin	histone binding|nucleic acid binding	g.chr8:21890671C>T	AY262113	CCDS6018.1, CCDS75703.1	8p21.3	2009-08-27	2009-08-27		ENSG00000158806	ENSG00000158806			7930	protein-coding gene	gene with protein product		608073				12714744	Standard	NM_182795		Approved		uc003xae.3	Q86SE8	OTTHUMG00000131129	ENST00000397940.1:c.301C>T	8.37:g.21890671C>T	ENSP00000381032:p.Pro101Ser		Somatic				NPM2_uc003xac.2_Missense_Mutation_p.P101S|NPM2_uc003xad.2_Missense_Mutation_p.P101S|NPM2_uc003xae.2_Missense_Mutation_p.P101S|NPM2_uc003xaf.2_Missense_Mutation_p.P101S	p.P101S	NM_182795	NP_877724	WXS	Illumina HiSeq	Unspecified	Q86SE8	NPM2_HUMAN		Colorectal(74;8.48e-05)|READ - Rectum adenocarcinoma(5;0.0276)|COAD - Colon adenocarcinoma(73;0.0618)	5	959	+			101					B3KSU0|D3DSQ8|Q6NVH6	Missense_Mutation	SNP	ENST00000397940.1	37	c.301C>T	CCDS6018.1	.	.	.	.	.	.	.	.	.	.	C	15.17	2.754498	0.49362	.	.	ENSG00000158806	ENST00000521157;ENST00000397940;ENST00000522813;ENST00000518119;ENST00000289820;ENST00000381530	T;T;T;T;T;T	0.57436	0.4;0.4;0.4;0.4;0.4;0.4	5.3	4.41	0.53225	Nucleoplasmin core (2);	0.000000	0.64402	D	0.000001	T	0.55847	0.1946	M	0.83483	2.645	0.46521	D	0.999082	P;P	0.50819	0.526;0.939	B;B	0.42386	0.239;0.386	T	0.62914	-0.6753	10	0.54805	T	0.06	-1.9116	10.5059	0.44834	0.0:0.9082:0.0:0.0918	.	101;101	Q6NVH6;Q86SE8	.;NPM2_HUMAN	S	101	ENSP00000429413:P101S;ENSP00000381032:P101S;ENSP00000428016:P101S;ENSP00000427741:P101S;ENSP00000289820:P101S;ENSP00000370941:P101S	ENSP00000289820:P101S	P	+	1	0	NPM2	21946617	0.221000	0.23642	0.762000	0.31397	0.688000	0.40055	1.511000	0.35801	1.347000	0.45714	0.655000	0.94253	CCA		0.597	NPM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253810.2	NM_182795		8	44	0	0	0	1	0	8	44				
RAD54B	25788	broad.mit.edu	37	8	95406084	95406084	+	Missense_Mutation	SNP	C	C	G			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr8:95406084C>G	ENST00000336148.5	-	9	1529	c.1405G>C	c.(1405-1407)Gaa>Caa	p.E469Q		NM_012415.3	NP_036547.1	Q9Y620	RA54B_HUMAN	RAD54 homolog B (S. cerevisiae)	469	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|DNA duplex unwinding (GO:0032508)|double-strand break repair via homologous recombination (GO:0000724)|mitotic recombination (GO:0006312)|reciprocal meiotic recombination (GO:0007131)	nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|RNA helicase activity (GO:0003724)	p.E469Q(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(10)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39	Breast(36;4.5e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00217)			GCAAAAAATTCTTGCAGATCA	0.318								Direct reversal of damage;Homologous recombination																															uc003ygk.2		NA																	1	Substitution - Missense(1)		lung(1)	kidney(2)|lung(1)|skin(1)	4						c.(1405-1407)GAA>CAA	Direct_reversal_of_damage|Homologous_recombination	RAD54 homolog B							68.0	74.0	72.0					8																	95406084		2203	4291	6494	SO:0001583	missense	25788				double-strand break repair via homologous recombination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA translocase activity|protein binding	g.chr8:95406084C>G	AF112481	CCDS6262.1, CCDS56546.1, CCDS75768.1	8q22.1	2014-08-08			ENSG00000197275	ENSG00000197275			17228	protein-coding gene	gene with protein product		604289				10362364, 10851248	Standard	NM_012415		Approved	RDH54	uc003ygk.3	Q9Y620	OTTHUMG00000133658	ENST00000336148.5:c.1405G>C	8.37:g.95406084C>G	ENSP00000336606:p.Glu469Gln		Somatic				RAD54B_uc010may.1_Missense_Mutation_p.E276Q|RAD54B_uc003ygl.1_RNA	p.E469Q	NM_012415	NP_036547	WXS	Illumina HiSeq	Unspecified	O95073	FSBP_HUMAN	BRCA - Breast invasive adenocarcinoma(8;0.00217)		9	1503	-	Breast(36;4.5e-05)		Error:Variant_position_missing_in_O95073_after_alignment					F6WBS8	Missense_Mutation	SNP	ENST00000336148.5	37	c.1405G>C	CCDS6262.1	.	.	.	.	.	.	.	.	.	.	C	29.5	5.013999	0.93404	.	.	ENSG00000197275	ENST00000336148;ENST00000546218	D	0.94828	-3.53	5.81	5.81	0.92471	DEAD-like helicase (2);SNF2-related (1);	0.120403	0.64402	D	0.000016	D	0.98785	0.9591	H	0.99642	4.675	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.99331	1.0909	10	0.87932	D	0	-15.3296	18.2609	0.90035	0.0:1.0:0.0:0.0	.	469	Q9Y620	RA54B_HUMAN	Q	469;142	ENSP00000336606:E469Q	ENSP00000336606:E469Q	E	-	1	0	RAD54B	95475260	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.729000	0.84864	2.738000	0.93877	0.655000	0.94253	GAA		0.318	RAD54B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257806.3	NM_012415		29	57	0	0	0	1	0	29	57				
CYP11B1	1584	broad.mit.edu	37	8	143958264	143958264	+	Silent	SNP	C	C	G			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr8:143958264C>G	ENST00000292427.4	-	4	665	c.633G>C	c.(631-633)ctG>ctC	p.L211L	CYP11B1_ENST00000517471.1_Silent_p.L211L|CYP11B1_ENST00000377675.3_Silent_p.L282L	NM_000497.3	NP_000488.3	P15538	C11B1_HUMAN	cytochrome P450, family 11, subfamily B, polypeptide 1	211					aldosterone biosynthetic process (GO:0032342)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|glucocorticoid biosynthetic process (GO:0006704)|glucose homeostasis (GO:0042593)|immune response (GO:0006955)|mineralocorticoid biosynthetic process (GO:0006705)|regulation of blood pressure (GO:0008217)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 11-beta-monooxygenase activity (GO:0004507)	p.L211L(1)		central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(10)|lung(36)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	67	all_cancers(97;4.74e-11)|all_epithelial(106;2.06e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Cimetidine(DB00501)|Clotrimazole(DB00257)|Etomidate(DB00292)|Fluconazole(DB00196)|Hydrocortisone(DB00741)|Ketoconazole(DB01026)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Miconazole(DB01110)|Mitotane(DB00648)|Phenytoin(DB00252)|Spironolactone(DB00421)	TGTGGCCAACCAGGCCCAGCC	0.627									Familial Hyperaldosteronism type I																														uc003yxi.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)	3						c.(631-633)CTG>CTC		cytochrome P450, family 11, subfamily B,	Mitotane(DB00648)						25.0	28.0	27.0					8																	143958264		2203	4300	6503	SO:0001819	synonymous_variant	1584	Familial_Hyperaldosteronism_type_I	Familial Cancer Database	Dexamethasone Sensitive Aldosteronism, FH-I	aldosterone biosynthetic process|cellular response to hormone stimulus|cellular response to potassium ion|cortisol biosynthetic process|glucose homeostasis|immune response|regulation of blood pressure|response to stress|xenobiotic metabolic process	mitochondrial inner membrane	electron carrier activity|steroid 11-beta-monooxygenase activity	g.chr8:143958264C>G	D16153	CCDS6392.1, CCDS34953.1	8q21-q22	2013-06-19	2003-01-14		ENSG00000160882	ENSG00000160882	1.14.15.4	"""Cytochrome P450s"""	2591	protein-coding gene	gene with protein product	"""steroid 11-beta-monooxygenase"""	610613	"""cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 1"""	CYP11B		1303253	Standard	XM_005250807		Approved	P450C11, FHI, CPN1	uc003yxi.3	P15538	OTTHUMG00000164637	ENST00000292427.4:c.633G>C	8.37:g.143958264C>G			Somatic				CYP11B1_uc010mex.2_5'Flank|CYP11B1_uc003yxh.2_5'Flank|CYP11B1_uc003yxj.2_Silent_p.L211L|CYP11B1_uc010mey.2_Silent_p.L282L	p.L211L	NM_000497	NP_000488	WXS	Illumina HiSeq	Unspecified	P15538	C11B1_HUMAN			4	640	-	all_cancers(97;4.74e-11)|all_epithelial(106;2.06e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)		211					Q14095|Q4VAQ8|Q4VAQ9|Q9UML2	Silent	SNP	ENST00000292427.4	37	c.633G>C	CCDS6392.1																																																																																				0.627	CYP11B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379475.2			8	13	0	0	0	1	0	8	13				
MPDZ	8777	broad.mit.edu	37	9	13126722	13126722	+	Missense_Mutation	SNP	C	C	G			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr9:13126722C>G	ENST00000319217.7	-	33	4761	c.4514G>C	c.(4513-4515)gGa>gCa	p.G1505A	MPDZ_ENST00000381022.2_Missense_Mutation_p.G1505A|MPDZ_ENST00000541718.1_Missense_Mutation_p.G1505A|MPDZ_ENST00000538841.1_Missense_Mutation_p.G364A|MPDZ_ENST00000381015.4_Missense_Mutation_p.G1505A|MPDZ_ENST00000447879.1_Missense_Mutation_p.G1472A|MPDZ_ENST00000546205.1_Missense_Mutation_p.G1519A|MPDZ_ENST00000536827.1_Missense_Mutation_p.G1472A|MPDZ_ENST00000541093.1_5'UTR	NM_001261406.1	NP_001248335.1	O75970	MPDZ_HUMAN	multiple PDZ domain protein	1505	PDZ 9. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell adhesion (GO:0007155)|myelination (GO:0042552)|viral process (GO:0016032)	apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|neuron projection (GO:0043005)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)	protein C-terminus binding (GO:0008022)	p.G1505A(2)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(15)|ovary(5)|prostate(7)|stomach(1)|urinary_tract(2)	61				GBM - Glioblastoma multiforme(50;2.03e-06)		TATGATGACTCCACTGAGTGT	0.408																																							uc010mia.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(5)|central_nervous_system(1)	6						c.(4513-4515)GGA>GCA		multiple PDZ domain protein							118.0	113.0	115.0					9																	13126722		1907	4129	6036	SO:0001583	missense	8777				interspecies interaction between organisms	apical plasma membrane|dendrite|postsynaptic density|postsynaptic membrane|synaptosome|tight junction	protein C-terminus binding	g.chr9:13126722C>G	AF093419	CCDS47951.1, CCDS59119.1, CCDS59120.1	9p23	2008-05-15			ENSG00000107186	ENSG00000107186			7208	protein-coding gene	gene with protein product		603785					Standard	NM_003829		Approved	MUPP1	uc003zlb.4	O75970	OTTHUMG00000021031	ENST00000319217.7:c.4514G>C	9.37:g.13126722C>G	ENSP00000320006:p.Gly1505Ala		Somatic				MPDZ_uc003zky.3_Missense_Mutation_p.G67A|MPDZ_uc010mib.2_Missense_Mutation_p.G210A|MPDZ_uc010mhx.2_Missense_Mutation_p.G327A|MPDZ_uc011lmm.1_Missense_Mutation_p.G364A|MPDZ_uc003zkz.3_Missense_Mutation_p.G198A|MPDZ_uc010mhy.2_Missense_Mutation_p.G1505A|MPDZ_uc010mhz.2_Missense_Mutation_p.G1472A|MPDZ_uc011lmn.1_Missense_Mutation_p.G1472A|MPDZ_uc003zlb.3_Missense_Mutation_p.G1505A	p.G1505A	NM_003829	NP_003820	WXS	Illumina HiSeq	Unspecified	O75970	MPDZ_HUMAN		GBM - Glioblastoma multiforme(50;2.03e-06)	32	4571	-			1505			PDZ 9.		A6NLC2|B2RTS3|B7ZMI4|O43798|Q4LE30|Q5CZ80|Q5JTX3|Q5JTX6|Q5JTX7|Q5JUC3|Q5JUC4|Q5VZ62|Q8N790	Missense_Mutation	SNP	ENST00000319217.7	37	c.4514G>C		.	.	.	.	.	.	.	.	.	.	C	16.86	3.239778	0.58995	.	.	ENSG00000107186	ENST00000319217;ENST00000541718;ENST00000381022;ENST00000438511;ENST00000545857;ENST00000538841;ENST00000536827;ENST00000447879;ENST00000381015;ENST00000399902;ENST00000546205	T;T;T;T;T;T;T;T;T;T	0.35048	1.33;1.33;1.33;1.33;1.33;1.33;1.33;1.33;1.33;1.33	6.17	6.17	0.99709	PDZ/DHR/GLGF (4);	0.000000	0.45867	D	0.000328	T	0.62720	0.2451	M	0.73217	2.22	0.52501	D	0.999957	D;P;P;D;D;D;P	0.89917	1.0;0.771;0.536;1.0;1.0;1.0;0.927	D;P;P;D;D;D;P	0.97110	1.0;0.574;0.549;1.0;1.0;1.0;0.759	T	0.55515	-0.8129	10	0.40728	T	0.16	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	1472;364;210;1472;1385;1505;1505	B7ZMI4;B7ZB24;B4DGX5;O75970-3;E7EPZ1;O75970-2;O75970	.;.;.;.;.;.;MPDZ_HUMAN	A	1505;1505;1505;74;441;364;1472;1472;1505;1385;1519	ENSP00000320006:G1505A;ENSP00000439807:G1505A;ENSP00000370410:G1505A;ENSP00000415964:G74A;ENSP00000444230:G441A;ENSP00000444717:G364A;ENSP00000444151:G1472A;ENSP00000415208:G1472A;ENSP00000370403:G1505A;ENSP00000446358:G1519A	ENSP00000320006:G1505A	G	-	2	0	MPDZ	13116722	1.000000	0.71417	0.998000	0.56505	0.089000	0.18198	6.011000	0.70760	2.941000	0.99782	0.655000	0.94253	GGA		0.408	MPDZ-001	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000055485.2	NM_003829		5	14	0	0	0	1	0	5	14				
DMD	1756	broad.mit.edu	37	X	31279101	31279101	+	Missense_Mutation	SNP	G	G	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chrX:31279101G>T	ENST00000357033.4	-	63	9463	c.9257C>A	c.(9256-9258)cCc>cAc	p.P3086H	DMD_ENST00000541735.1_Missense_Mutation_p.P626H|DMD_ENST00000359836.1_Missense_Mutation_p.P626H|DMD_ENST00000378680.2_Missense_Mutation_p.P18H|DMD_ENST00000378677.2_Missense_Mutation_p.P3082H|DMD_ENST00000343523.2_Missense_Mutation_p.P626H|DMD_ENST00000378723.3_Missense_Mutation_p.P18H|DMD_ENST00000361471.4_Missense_Mutation_p.P18H|DMD_ENST00000378702.4_Missense_Mutation_p.P18H|DMD_ENST00000474231.1_Missense_Mutation_p.P626H|DMD_ENST00000378707.3_Missense_Mutation_p.P626H	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	3086	Interaction with SYNM. {ECO:0000250}.|WW. {ECO:0000255|PROSITE- ProRule:PRU00224}.				cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)	p.P3086H(1)|p.P18H(1)|p.P3082H(1)|p.P1745H(1)|p.P3081H(1)|p.P626H(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TGTCATTTTGGGATGGTCCCA	0.393																																							uc004dda.1		NA																	6	Substitution - Missense(6)		lung(6)	ovary(3)|pancreas(2)|large_intestine(1)	6						c.(9256-9258)CCC>CAC		dystrophin Dp427m isoform							142.0	108.0	119.0					X																	31279101		2202	4300	6502	SO:0001583	missense	1756				muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding	g.chrX:31279101G>T	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.9257C>A	X.37:g.31279101G>T	ENSP00000354923:p.Pro3086His		Somatic				DMD_uc004dcq.1_Missense_Mutation_p.P357H|DMD_uc004dcr.1_Missense_Mutation_p.P626H|DMD_uc004dcs.1_Missense_Mutation_p.P626H|DMD_uc004dct.1_Missense_Mutation_p.P626H|DMD_uc004dcu.1_Missense_Mutation_p.P626H|DMD_uc004dcv.1_Missense_Mutation_p.P626H|DMD_uc004dcw.2_Missense_Mutation_p.P1742H|DMD_uc004dcx.2_Missense_Mutation_p.P1745H|DMD_uc004dcz.2_Missense_Mutation_p.P2963H|DMD_uc004dcy.1_Missense_Mutation_p.P3082H|DMD_uc004ddb.1_Missense_Mutation_p.P3078H|DMD_uc004dcm.1_Missense_Mutation_p.P18H|DMD_uc004dcn.1_Missense_Mutation_p.P18H|DMD_uc004dco.1_Missense_Mutation_p.P18H|DMD_uc004dcp.1_Missense_Mutation_p.P18H|DMD_uc011mkb.1_Missense_Mutation_p.P18H|DMD_uc010ngm.2_Missense_Mutation_p.P18H	p.P3086H	NM_004006	NP_003997	WXS	Illumina HiSeq	Unspecified	P11532	DMD_HUMAN			63	9501	-		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)	3086			Interaction with SYNM (By similarity).|WW.		E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	ENST00000357033.4	37	c.9257C>A	CCDS14233.1	.	.	.	.	.	.	.	.	.	.	G	24.5	4.535531	0.85812	.	.	ENSG00000198947	ENST00000534884;ENST00000378682;ENST00000378684;ENST00000378723;ENST00000358062;ENST00000378677;ENST00000357033;ENST00000359836;ENST00000343523;ENST00000542849;ENST00000535280;ENST00000378707;ENST00000541735;ENST00000378702;ENST00000474231;ENST00000361471;ENST00000378680	T;D;D;D;D;D;D;D;T;D;T;T	0.99388	-0.41;-5.81;-5.81;-5.81;-5.81;-5.81;-5.81;-5.81;-0.41;-5.81;-0.41;-0.41	5.87	5.87	0.94306	WW/Rsp5/WWP (5);	0.000000	0.33732	U	0.004620	D	0.99542	0.9836	M	0.90870	3.155	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.97110	0.995;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;0.998;1.0;1.0;0.999	D	0.98378	1.0557	10	0.87932	D	0	.	17.5602	0.87903	0.0:0.0:1.0:0.0	.	18;3078;3086;3082;1745;1742;626;626;626;626;626;2963;18;18;18;18	B4DSV7;P11532-4;P11532;E9PDN5;E7EQS7;E7EQS6;F8VX32;E7ESB2;E7EQS5;E7EQR9;F5GZY3;F5GZT3;P11532-5;Q8N754;Q6NSJ9;E9PDN1	.;.;DMD_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.	H	3078;1745;1742;18;782;3082;3086;626;626;3086;2963;626;626;18;626;18;18	ENSP00000367997:P18H;ENSP00000350765:P782H;ENSP00000367948:P3082H;ENSP00000354923:P3086H;ENSP00000352894:P626H;ENSP00000340057:P626H;ENSP00000367979:P626H;ENSP00000444119:P626H;ENSP00000367974:P18H;ENSP00000417123:P626H;ENSP00000354464:P18H;ENSP00000367951:P18H	ENSP00000340057:P626H	P	-	2	0	DMD	31189022	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.325000	0.90007	2.618000	0.88619	0.600000	0.82982	CCC		0.393	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006		17	28	1	0	1.00905e-13	1	1.11457e-13	17	28				
HDAC6	10013	broad.mit.edu	37	X	48681322	48681322	+	Splice_Site	SNP	A	A	G			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chrX:48681322A>G	ENST00000334136.5	+	25	2691	c.2513A>G	c.(2512-2514)aAg>aGg	p.K838R	HDAC6_ENST00000376619.2_Splice_Site_p.K838R|HDAC6_ENST00000444343.2_Splice_Site_p.K852R			Q9UBN7	HDAC6_HUMAN	histone deacetylase 6	838					aggresome assembly (GO:0070842)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to misfolded protein (GO:0071218)|cellular response to topologically incorrect protein (GO:0035967)|histone deacetylation (GO:0016575)|Hsp90 deacetylation (GO:0070846)|intracellular protein transport (GO:0006886)|lysosome localization (GO:0032418)|macroautophagy (GO:0016236)|misfolded or incompletely synthesized protein catabolic process (GO:0006515)|negative regulation of hydrogen peroxide metabolic process (GO:0010727)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of oxidoreductase activity (GO:0051354)|negative regulation of protein complex disassembly (GO:0043242)|negative regulation of proteolysis (GO:0045861)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine deacetylation (GO:0034983)|polyubiquitinated misfolded protein transport (GO:0070845)|positive regulation of chaperone-mediated protein complex assembly (GO:0090035)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of hydrogen peroxide-mediated programmed cell death (GO:1901300)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of signal transduction (GO:0009967)|protein complex disassembly (GO:0043241)|protein deacetylation (GO:0006476)|protein polyubiquitination (GO:0000209)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of establishment of protein localization (GO:0070201)|regulation of gene expression, epigenetic (GO:0040029)|regulation of microtubule-based movement (GO:0060632)|regulation of receptor activity (GO:0010469)|response to growth factor (GO:0070848)|response to misfolded protein (GO:0051788)|response to organic substance (GO:0010033)|response to toxic substance (GO:0009636)|transcription, DNA-templated (GO:0006351)|tubulin deacetylation (GO:0090042)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	aggresome (GO:0016235)|axon (GO:0030424)|caveola (GO:0005901)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|dendrite (GO:0030425)|histone deacetylase complex (GO:0000118)|inclusion body (GO:0016234)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)	alpha-tubulin binding (GO:0043014)|beta-catenin binding (GO:0008013)|core promoter binding (GO:0001047)|dynein complex binding (GO:0070840)|enzyme binding (GO:0019899)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|Hsp90 protein binding (GO:0051879)|microtubule binding (GO:0008017)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|polyubiquitin binding (GO:0031593)|tau protein binding (GO:0048156)|tubulin deacetylase activity (GO:0042903)|zinc ion binding (GO:0008270)	p.K838R(1)		breast(2)|endometrium(6)|kidney(5)|large_intestine(8)|lung(9)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	40					Vorinostat(DB02546)	CTGGTTCCAGAGGTAGAAGAC	0.572																																					Pancreas(112;205 1675 2305 8976 15959)	Pancreas(112;205 1675 2305 8976 15959)	uc011mmi.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|upper_aerodigestive_tract(1)	4						c.(2512-2514)AAG>AGG		histone deacetylase 6	Vorinostat(DB02546)						48.0	41.0	43.0					X																	48681322		2203	4300	6503	SO:0001630	splice_region_variant	10013				aggresome assembly|cellular response to hydrogen peroxide|Hsp90 deacetylation|lysosome localization|macroautophagy|misfolded or incompletely synthesized protein catabolic process|negative regulation of proteolysis|negative regulation of transcription, DNA-dependent|peptidyl-lysine deacetylation|polyubiquitinated misfolded protein transport|positive regulation of apoptosis|positive regulation of cellular chaperone-mediated protein complex assembly|positive regulation of epithelial cell migration|positive regulation of receptor biosynthetic process|positive regulation of signal transduction|regulation of androgen receptor signaling pathway|regulation of receptor activity|response to growth factor stimulus|response to toxin|transcription, DNA-dependent|tubulin deacetylation	aggresome|caveola|cell leading edge|cytosol|histone deacetylase complex|microtubule associated complex|perinuclear region of cytoplasm	actin binding|alpha-tubulin binding|beta-catenin binding|dynein complex binding|histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|Hsp90 protein binding|microtubule binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|polyubiquitin binding|tau protein binding|tubulin deacetylase activity|zinc ion binding	g.chrX:48681322A>G	AF132609	CCDS14306.1	Xp11.23	2014-06-12			ENSG00000094631	ENSG00000094631			14064	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 90"""	300272				10220385, 10048485	Standard	NM_006044		Approved	KIAA0901, JM21, HD6, FLJ16239, PPP1R90	uc004dks.1	Q9UBN7	OTTHUMG00000034496	ENST00000334136.5:c.2513-1A>G	X.37:g.48681322A>G			Somatic				HDAC6_uc004dks.1_Missense_Mutation_p.K838R|HDAC6_uc010nig.1_Missense_Mutation_p.K686R|HDAC6_uc004dkt.1_Missense_Mutation_p.K838R|HDAC6_uc011mmk.1_Missense_Mutation_p.K819R|HDAC6_uc004dkv.1_Missense_Mutation_p.K486R|HDAC6_uc004dkw.1_Missense_Mutation_p.K486R|HDAC6_uc004dkx.1_Missense_Mutation_p.K201R	p.K838R	NM_006044	NP_006035	WXS	Illumina HiSeq	Unspecified	Q9UBN7	HDAC6_HUMAN			25	2608	+			838					O94975|Q6NT75|Q7L3E5|Q96CY0	Missense_Mutation	SNP	ENST00000334136.5	37	c.2513A>G	CCDS14306.1	.	.	.	.	.	.	.	.	.	.	A	15.57	2.874146	0.51695	.	.	ENSG00000094631	ENST00000444343;ENST00000334136;ENST00000376619	T;T;T	0.60299	0.2;0.21;0.21	5.05	2.67	0.31697	.	0.440717	0.23272	N	0.050014	T	0.53351	0.1791	L	0.60455	1.87	0.80722	D	1	P;D;D;P	0.56035	0.907;0.974;0.974;0.907	B;P;P;B	0.47346	0.444;0.544;0.521;0.346	T	0.48043	-0.9069	9	.	.	.	.	5.9807	0.19405	0.6854:0.0:0.3146:0.0	.	828;201;486;838	B4DZN1;B3KY98;B3KVK5;Q9UBN7	.;.;.;HDAC6_HUMAN	R	852;838;838	ENSP00000398566:K852R;ENSP00000334061:K838R;ENSP00000365804:K838R	.	K	+	2	0	HDAC6	48566266	0.992000	0.36948	0.451000	0.26982	0.920000	0.55202	2.577000	0.46042	0.332000	0.23536	0.486000	0.48141	AAG		0.572	HDAC6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083394.2	NM_006044	Missense_Mutation	3	24	0	0	0	1	0	3	24				
TRO	7216	broad.mit.edu	37	X	54950106	54950106	+	Missense_Mutation	SNP	C	C	G			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chrX:54950106C>G	ENST00000173898.7	+	3	1253	c.1141C>G	c.(1141-1143)Cag>Gag	p.Q381E	TRO_ENST00000484031.1_Intron|TRO_ENST00000399736.1_Intron|TRO_ENST00000420798.2_Intron|TRO_ENST00000375041.2_Intron|TRO_ENST00000319167.8_Missense_Mutation_p.Q381E|TRO_ENST00000375022.4_Missense_Mutation_p.Q381E	NM_001039705.2	NP_001034794.1	Q12816	TROP_HUMAN	trophinin	381					embryo implantation (GO:0007566)|homophilic cell adhesion (GO:0007156)|negative regulation of cell growth (GO:0030308)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.Q381E(2)		breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(19)|ovary(2)|skin(2)|urinary_tract(1)	37						CCTTGAGACTCAGGTTGCTGC	0.577																																							uc004dtq.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(1141-1143)CAG>GAG		trophinin isoform 5							38.0	42.0	41.0					X																	54950106		2006	4167	6173	SO:0001583	missense	7216				embryo implantation|homophilic cell adhesion	integral to plasma membrane		g.chrX:54950106C>G	U04811	CCDS43958.1, CCDS43959.1, CCDS59527.1, CCDS59528.1, CCDS59529.1	Xp11.22-p11.21	2008-02-05			ENSG00000067445	ENSG00000067445			12326	protein-coding gene	gene with protein product		300132				9533028, 11454705	Standard	NM_001039705		Approved	MAGE-D3, KIAA1114, MAGED3	uc004dtq.4	Q12816	OTTHUMG00000021640	ENST00000173898.7:c.1141C>G	X.37:g.54950106C>G	ENSP00000173898:p.Gln381Glu		Somatic				TRO_uc011moj.1_Missense_Mutation_p.Q324E|TRO_uc004dts.2_Missense_Mutation_p.Q381E|TRO_uc004dtr.2_Missense_Mutation_p.Q381E|TRO_uc004dtt.2_RNA|TRO_uc004dtu.2_Intron|TRO_uc004dtv.2_Intron|TRO_uc011mok.1_Intron|TRO_uc004dtw.2_Intron|TRO_uc004dtx.2_5'Flank	p.Q381E	NM_001039705	NP_001034794	WXS	Illumina HiSeq	Unspecified	Q12816	TROP_HUMAN			3	1248	+			381					B1AKE9|B1AKF1|F5GY27|Q96SX2|Q9NU89|Q9UPN8	Missense_Mutation	SNP	ENST00000173898.7	37	c.1141C>G	CCDS43959.1	.	.	.	.	.	.	.	.	.	.	C	12.73	2.025088	0.35701	.	.	ENSG00000067445	ENST00000173898;ENST00000319167;ENST00000375022	T;T;T	0.38560	1.13;1.13;1.13	2.87	2.87	0.33458	.	.	.	.	.	T	0.41903	0.1179	N	0.24115	0.695	0.80722	D	1	P;P	0.52842	0.915;0.956	P;P	0.62184	0.543;0.899	T	0.14008	-1.0488	8	.	.	.	.	8.3598	0.32353	0.0:1.0:0.0:0.0	.	381;381	Q96SX2;Q12816	.;TROP_HUMAN	E	381	ENSP00000173898:Q381E;ENSP00000318278:Q381E;ENSP00000364162:Q381E	.	Q	+	1	0	TRO	54966831	1.000000	0.71417	1.000000	0.80357	0.863000	0.49368	2.629000	0.46485	1.693000	0.51124	0.502000	0.49764	CAG		0.577	TRO-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056837.3	NM_016157		6	18	0	0	0	1	0	6	18				
ZXDA	7789	broad.mit.edu	37	X	57935303	57935303	+	Missense_Mutation	SNP	A	A	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chrX:57935303A>T	ENST00000358697.4	-	1	1764	c.1552T>A	c.(1552-1554)Tgt>Agt	p.C518S		NM_007156.4	NP_009087.1	P98168	ZXDA_HUMAN	zinc finger, X-linked, duplicated A	518	Required for interaction with ZXDC.				positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.C518S(1)		breast(2)|endometrium(9)|kidney(1)|large_intestine(7)|lung(13)|ovary(2)|prostate(2)|skin(1)	37						AACCTGGCACAGCAGCCTGCC	0.542																																							uc004dve.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1552-1554)TGT>AGT		zinc finger, X-linked, duplicated A							25.0	24.0	25.0					X																	57935303		2202	4292	6494	SO:0001583	missense	7789				positive regulation of transcription, DNA-dependent	nucleus	C2H2 zinc finger domain binding|identical protein binding|nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chrX:57935303A>T	L14787	CCDS14376.1	Xp11.21	2013-01-08			ENSG00000198205	ENSG00000198205		"""Zinc fingers, C2H2-type"""	13198	protein-coding gene	gene with protein product	"""zinc finger protein 896"""	300235				8268913	Standard	NM_007156		Approved	ZNF896	uc004dve.3	P98168	OTTHUMG00000021688	ENST00000358697.4:c.1552T>A	X.37:g.57935303A>T	ENSP00000351530:p.Cys518Ser		Somatic					p.C518S	NM_007156	NP_009087	WXS	Illumina HiSeq	Unspecified	P98168	ZXDA_HUMAN			1	1765	-			518			Required for interaction with ZXDC.|C2H2-type 9.		Q9UJP7	Missense_Mutation	SNP	ENST00000358697.4	37	c.1552T>A	CCDS14376.1	.	.	.	.	.	.	.	.	.	.	.	9.507	1.104774	0.20632	.	.	ENSG00000198205	ENST00000358697	T	0.58652	0.32	3.23	3.23	0.37069	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.371292	0.30959	N	0.008540	T	0.21267	0.0512	N	0.01134	-0.995	0.35205	D	0.774622	B	0.25955	0.138	B	0.24006	0.05	T	0.16808	-1.0390	9	.	.	.	.	5.8061	0.18440	0.7268:0.2731:0.0:0.0	.	518	P98168	ZXDA_HUMAN	S	518	ENSP00000351530:C518S	.	C	-	1	0	ZXDA	57952028	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	2.526000	0.45607	1.488000	0.48433	0.339000	0.21740	TGT		0.542	ZXDA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056925.1	NM_007156		19	24	0	0	0	1	0	19	24				
KIAA2022	340533	broad.mit.edu	37	X	73964097	73964097	+	Missense_Mutation	SNP	T	T	C			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chrX:73964097T>C	ENST00000055682.6	-	3	906	c.295A>G	c.(295-297)Atc>Gtc	p.I99V		NM_001008537.2	NP_001008537.1	Q5QGS0	K2022_HUMAN	KIAA2022	99					base-excision repair, gap-filling (GO:0006287)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|nervous system development (GO:0007399)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)	delta DNA polymerase complex (GO:0043625)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|DNA-directed DNA polymerase activity (GO:0003887)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(23)|liver(1)|lung(41)|ovary(7)|pancreas(2)|prostate(4)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	109						GTGAGGGAGATGGCATTCACA	0.517																																							uc004eby.2		NA																	0				ovary(7)|large_intestine(4)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	15						c.(295-297)ATC>GTC		hypothetical protein LOC340533							106.0	95.0	99.0					X																	73964097		2203	4300	6503	SO:0001583	missense	340533				base-excision repair, gap-filling|DNA replication proofreading|DNA replication, removal of RNA primer|nucleotide-excision repair, DNA gap filling|regulation of mitotic cell cycle|S phase of mitotic cell cycle	delta DNA polymerase complex	3'-5'-exodeoxyribonuclease activity|DNA-directed DNA polymerase activity	g.chrX:73964097T>C		CCDS35337.1	Xq13.3	2014-02-19			ENSG00000050030	ENSG00000050030			29433	protein-coding gene	gene with protein product	"""XLMR-related protein, neurite extension"""	300524				15466006, 23615299	Standard	NM_001008537		Approved	XPN, MRX98	uc004eby.3	Q5QGS0	OTTHUMG00000021860	ENST00000055682.6:c.295A>G	X.37:g.73964097T>C	ENSP00000055682:p.Ile99Val		Somatic					p.I99V	NM_001008537	NP_001008537	WXS	Illumina HiSeq	Unspecified	Q5QGS0	K2022_HUMAN			3	912	-			99					A7YY87|Q5JUX9|Q8IVE9	Missense_Mutation	SNP	ENST00000055682.6	37	c.295A>G	CCDS35337.1	.	.	.	.	.	.	.	.	.	.	T	14.78	2.636881	0.47049	.	.	ENSG00000050030	ENST00000373468;ENST00000055682	T;T	0.35605	1.3;1.3	5.2	5.2	0.72013	.	0.116446	0.56097	D	0.000025	T	0.46054	0.1373	L	0.44542	1.39	0.35882	D	0.829019	D	0.54601	0.967	P	0.55391	0.775	T	0.59445	-0.7453	10	0.87932	D	0	-10.0109	14.1679	0.65490	0.0:0.0:0.0:1.0	.	99	Q5QGS0	K2022_HUMAN	V	99	ENSP00000362567:I99V;ENSP00000055682:I99V	ENSP00000055682:I99V	I	-	1	0	KIAA2022	73880822	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.561000	0.53770	1.921000	0.55644	0.486000	0.48141	ATC		0.517	KIAA2022-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057270.2	NM_001008537		4	85	0	0	0	1	0	4	85				
NRK	203447	broad.mit.edu	37	X	105167115	105167115	+	Silent	SNP	A	A	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chrX:105167115A>T	ENST00000243300.9	+	18	2919	c.2616A>T	c.(2614-2616)ccA>ccT	p.P872P	NRK_ENST00000428173.2_Silent_p.P873P	NM_198465.2	NP_940867.2	Q7Z2Y5	NRK_HUMAN	Nik related kinase	872					activation of JNKK activity (GO:0007256)|negative regulation of cell proliferation (GO:0008285)|parturition (GO:0007567)|regulation of spongiotrophoblast cell proliferation (GO:0060721)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)	p.P873P(1)		breast(8)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(14)|lung(36)|ovary(3)|prostate(1)|skin(2)	76						CACAGGTTCCAGATGGATTTA	0.363										HNSCC(51;0.14)																													uc004emd.2		NA																	1	Substitution - coding silent(1)		lung(1)	breast(7)|ovary(3)|lung(2)|large_intestine(1)|central_nervous_system(1)	14						c.(2614-2616)CCA>CCT		Nik related kinase							117.0	107.0	110.0					X																	105167115		1853	4087	5940	SO:0001819	synonymous_variant	203447						ATP binding|protein serine/threonine kinase activity|small GTPase regulator activity	g.chrX:105167115A>T	BX538345	CCDS65305.1	Xq22.3	2008-02-05			ENSG00000123572	ENSG00000123572			25391	protein-coding gene	gene with protein product		300791					Standard	NM_198465		Approved	DKFZp686A17109	uc004emd.3	Q7Z2Y5	OTTHUMG00000022143	ENST00000243300.9:c.2616A>T	X.37:g.105167115A>T		HNSCC(51;0.14)	Somatic				NRK_uc010npc.1_Silent_p.P540P	p.P872P	NM_198465	NP_940867	WXS	Illumina HiSeq	Unspecified	Q7Z2Y5	NRK_HUMAN			18	2919	+			872					Q32ND6|Q5H9K2|Q6ZMP2	Silent	SNP	ENST00000243300.9	37	c.2616A>T																																																																																					0.363	NRK-001	KNOWN	non_canonical_conserved|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000106480.6	NM_198465		44	83	0	0	0	1	0	44	83				
DOCK11	139818	broad.mit.edu	37	X	117788871	117788871	+	Missense_Mutation	SNP	C	C	T	rs370101788		TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chrX:117788871C>T	ENST00000276202.7	+	44	4979	c.4916C>T	c.(4915-4917)gCg>gTg	p.A1639V	DOCK11_ENST00000276204.6_Missense_Mutation_p.A1639V	NM_144658.3	NP_653259.3	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11	1639	DHR-2.				blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.A1639V(1)		breast(4)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(17)|liver(1)|lung(35)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	84						TTTCAGGCTGCGATGTGTTAT	0.378																																							uc004eqp.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(4915-4917)GCG>GTG		dedicator of cytokinesis 11		C	VAL/ALA	0,3835		0,0,1632,571	201.0	178.0	186.0		4916	5.1	1.0	X		186	1,6727		0,1,2427,1872	no	missense	DOCK11	NM_144658.3	64	0,1,4059,2443	TT,TC,CC,C		0.0149,0.0,0.0095	probably-damaging	1639/2074	117788871	1,10562	2203	4300	6503	SO:0001583	missense	139818				blood coagulation	cytosol	GTP binding	g.chrX:117788871C>T	AK125641	CCDS35373.1	Xq24	2013-10-25			ENSG00000147251	ENSG00000147251		"""Pleckstrin homology (PH) domain containing"""	23483	protein-coding gene	gene with protein product	"""zizimin2"""	300681				12432077, 16968698	Standard	NM_144658		Approved	FLJ32122, FLJ43653, ZIZ2, ACG	uc004eqp.2	Q5JSL3	OTTHUMG00000022256	ENST00000276202.7:c.4916C>T	X.37:g.117788871C>T	ENSP00000276202:p.Ala1639Val		Somatic				DOCK11_uc004eqq.2_Missense_Mutation_p.A1418V	p.A1639V	NM_144658	NP_653259	WXS	Illumina HiSeq	Unspecified	Q5JSL3	DOC11_HUMAN			44	4979	+			1639			DHR-2.		A6NMF0|Q66M66|Q6ZUJ5|Q86VU8|Q96MN3	Missense_Mutation	SNP	ENST00000276202.7	37	c.4916C>T	CCDS35373.1	.	.	.	.	.	.	.	.	.	.	C	24.6	4.548636	0.86127	0.0	1.49E-4	ENSG00000147251	ENST00000276204;ENST00000276202	T;T	0.28069	1.63;1.63	5.07	5.07	0.68467	.	0.051034	0.85682	D	0.000000	T	0.65481	0.2695	M	0.92604	3.325	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.69824	0.966;0.966	T	0.76449	-0.2955	10	0.87932	D	0	-23.7243	17.5972	0.88016	0.0:1.0:0.0:0.0	.	1639;1639	A6NIW2;Q5JSL3	.;DOC11_HUMAN	V	1639	ENSP00000276204:A1639V;ENSP00000276202:A1639V	ENSP00000276202:A1639V	A	+	2	0	DOCK11	117672899	1.000000	0.71417	0.959000	0.39883	0.814000	0.46013	5.741000	0.68638	2.083000	0.62718	0.600000	0.82982	GCG		0.378	DOCK11-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000356002.1	NM_144658		43	76	0	0	0	1	0	43	76				
SLC9A6	10479	broad.mit.edu	37	X	135115594	135115594	+	Missense_Mutation	SNP	A	A	G			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chrX:135115594A>G	ENST00000370698.3	+	14	1608	c.1573A>G	c.(1573-1575)Aga>Gga	p.R525G	SLC9A6_ENST00000370701.1_Missense_Mutation_p.R505G|SLC9A6_ENST00000370695.4_Missense_Mutation_p.R557G	NM_006359.2	NP_006350.1	Q92581	SL9A6_HUMAN	solute carrier family 9, subfamily A (NHE6, cation proton antiporter 6), member 6	525					axon extension (GO:0048675)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|dendrite extension (GO:0097484)|dendritic spine development (GO:0060996)|ion transport (GO:0006811)|neuron projection morphogenesis (GO:0048812)|regulation of neurotrophin TRK receptor signaling pathway (GO:0051386)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon terminus (GO:0043679)|axonal spine (GO:0044308)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|early endosome membrane (GO:0031901)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)|synapse (GO:0045202)	sodium:proton antiporter activity (GO:0015385)	p.R525G(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(18)|ovary(2)|upper_aerodigestive_tract(1)	33	Acute lymphoblastic leukemia(192;0.000127)					AAATGAAAGGAGAACTACCAA	0.353																																							uc004ezj.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1573-1575)AGA>GGA		solute carrier family 9 (sodium/hydrogen							125.0	120.0	121.0					X																	135115594		2203	4300	6503	SO:0001583	missense	10479				regulation of pH	early endosome membrane|endoplasmic reticulum membrane|integral to membrane|microsome|plasma membrane|recycling endosome membrane	sodium:hydrogen antiporter activity	g.chrX:135115594A>G	AF030409	CCDS14654.1, CCDS44003.1, CCDS55504.1	Xq26.3	2013-05-22	2012-03-22		ENSG00000198689	ENSG00000198689		"""Solute carriers"""	11079	protein-coding gene	gene with protein product		300231	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 6"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 6"""			9507001	Standard	NM_001042537		Approved	NHE6, KIAA0267	uc004ezk.3	Q92581	OTTHUMG00000022498	ENST00000370698.3:c.1573A>G	X.37:g.135115594A>G	ENSP00000359732:p.Arg525Gly		Somatic				SLC9A6_uc004ezk.2_Missense_Mutation_p.R557G	p.R525G	NM_006359	NP_006350	WXS	Illumina HiSeq	Unspecified	Q92581	SL9A6_HUMAN			14	1649	+	Acute lymphoblastic leukemia(192;0.000127)		525					A6NIQ9|A8K160|B4DU30|B7ZAE0|Q3ZCW7|Q5JPP8|Q5JPP9|Q86VS0	Missense_Mutation	SNP	ENST00000370698.3	37	c.1573A>G	CCDS14654.1	.	.	.	.	.	.	.	.	.	.	A	15.86	2.957479	0.53400	.	.	ENSG00000198689	ENST00000370701;ENST00000370698;ENST00000370695	T;T;T	0.33865	1.39;1.39;1.39	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	T	0.36110	0.0955	L	0.58669	1.825	0.80722	D	1	B;B	0.11235	0.004;0.0	B;B	0.12156	0.007;0.001	T	0.12708	-1.0537	10	0.39692	T	0.17	.	13.0806	0.59112	1.0:0.0:0.0:0.0	.	557;525	Q92581-2;Q92581	.;SL9A6_HUMAN	G	505;525;557	ENSP00000359735:R505G;ENSP00000359732:R525G;ENSP00000359729:R557G	ENSP00000359729:R557G	R	+	1	2	SLC9A6	134943260	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.969000	0.76092	1.765000	0.52091	0.486000	0.48141	AGA		0.353	SLC9A6-001	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058450.1	NM_006359		45	83	0	0	0	1	0	45	83				
CD99L2	83692	broad.mit.edu	37	X	149944650	149944650	+	Nonsense_Mutation	SNP	G	G	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chrX:149944650G>A	ENST00000370377.3	-	9	769	c.652C>T	c.(652-654)Cag>Tag	p.Q218*	CD99L2_ENST00000355149.3_Nonsense_Mutation_p.Q146*|CD99L2_ENST00000437787.2_Nonsense_Mutation_p.Q145*|CD99L2_ENST00000466436.1_Nonsense_Mutation_p.Q169*|CD99L2_ENST00000346693.4_5'UTR	NM_001242614.1|NM_031462.3	NP_001229543.1|NP_113650.2	Q8TCZ2	C99L2_HUMAN	CD99 molecule-like 2	218					cell adhesion (GO:0007155)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.Q218*(1)		endometrium(4)|large_intestine(4)|lung(10)|ovary(3)|skin(1)|urinary_tract(1)	23	Acute lymphoblastic leukemia(192;6.56e-05)					CACTTACGCTGAATGCTGAAG	0.612																																							uc004fel.2		NA																	1	Substitution - Nonsense(1)		lung(1)	large_intestine(2)|ovary(1)	3						c.(652-654)CAG>TAG		CD99 antigen-like 2 isoform E3'-E4'-E3-E4							97.0	77.0	84.0					X																	149944650		2203	4300	6503	SO:0001587	stop_gained	83692				cell adhesion	cell junction|integral to membrane		g.chrX:149944650G>A	BC030536	CCDS14697.1, CCDS14698.1, CCDS35427.1, CCDS55527.1, CCDS76044.1	Xq28	2007-12-04	2006-03-28	2003-02-14	ENSG00000102181	ENSG00000102181			18237	protein-coding gene	gene with protein product		300846	"""MIC2 like 1"", ""CD99 antigen-like 2"""	MIC2L1			Standard	NM_001184808		Approved	CD99B	uc004fek.3	Q8TCZ2	OTTHUMG00000024247	ENST00000370377.3:c.652C>T	X.37:g.149944650G>A	ENSP00000359403:p.Gln218*		Somatic				CD99L2_uc004fek.2_RNA|CD99L2_uc004fem.2_Nonsense_Mutation_p.Q169*|CD99L2_uc004fen.2_Nonsense_Mutation_p.Q146*|CD99L2_uc004feo.2_RNA|CD99L2_uc011myb.1_Nonsense_Mutation_p.Q145*	p.Q218*	NM_031462	NP_113650	WXS	Illumina HiSeq	Unspecified	Q8TCZ2	C99L2_HUMAN			9	770	-	Acute lymphoblastic leukemia(192;6.56e-05)		218			Cytoplasmic (Potential).		A8K2D5|A8K5R0|B3KWG2|B4DDL7|E7EMK5|E9PD27|Q8TAW2|Q8TCZ0|Q8TCZ1|Q9BQG9	Nonsense_Mutation	SNP	ENST00000370377.3	37	c.652C>T	CCDS35427.1	.	.	.	.	.	.	.	.	.	.	G	26.0	4.693117	0.88735	.	.	ENSG00000102181	ENST00000370377;ENST00000438086;ENST00000355149;ENST00000437787;ENST00000466436	.	.	.	5.06	5.06	0.68205	.	0.065450	0.64402	D	0.000007	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-10.533	17.2774	0.87120	0.0:0.0:1.0:0.0	.	.	.	.	X	218;222;146;145;169	.	.	Q	-	1	0	CD99L2	149695308	1.000000	0.71417	0.957000	0.39632	0.885000	0.51271	8.726000	0.91474	2.104000	0.64026	0.523000	0.50628	CAG		0.612	CD99L2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000061199.1	NM_031462		21	43	0	0	0	1	0	21	43				
MAGEA10	4109	broad.mit.edu	37	X	151303180	151303180	+	Missense_Mutation	SNP	C	C	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chrX:151303180C>T	ENST00000370323.4	-	4	1229	c.913G>A	c.(913-915)Gaa>Aaa	p.E305K	RP11-1007I13.4_ENST00000509345.2_RNA|MAGEA10_ENST00000244096.3_Missense_Mutation_p.E305K	NM_001251828.1|NM_021048.4	NP_001238757.1|NP_066386	P43363	MAGAA_HUMAN	melanoma antigen family A, 10	305	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.					nucleus (GO:0005634)				endometrium(2)|kidney(2)|large_intestine(4)|lung(11)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	23	Acute lymphoblastic leukemia(192;6.56e-05)					TTCCTAATTTCAGCATGAGCC	0.502																																							uc004ffk.2		NA																	0					0						c.(913-915)GAA>AAA		melanoma antigen family A, 10							129.0	123.0	125.0					X																	151303180		2203	4300	6503	SO:0001583	missense	4109							g.chrX:151303180C>T		CCDS14705.1	Xq28	2009-03-13			ENSG00000124260	ENSG00000124260			6797	protein-coding gene	gene with protein product	"""MAGE-10 antigen"", ""melanoma-associated antigen 10"", ""cancer/testis antigen family 1, member 10"""	300343		MAGE10		8575766	Standard	NM_001011543		Approved	MGC10599, CT1.10	uc004ffl.3	P43363	OTTHUMG00000024180	ENST00000370323.4:c.913G>A	X.37:g.151303180C>T	ENSP00000359347:p.Glu305Lys		Somatic				MAGEA10_uc004ffl.2_Missense_Mutation_p.E305K	p.E305K	NM_001011543	NP_001011543	WXS	Illumina HiSeq	Unspecified	P43363	MAGAA_HUMAN			5	1321	-	Acute lymphoblastic leukemia(192;6.56e-05)		305			MAGE.			Missense_Mutation	SNP	ENST00000370323.4	37	c.913G>A	CCDS14705.1	.	.	.	.	.	.	.	.	.	.	C	15.61	2.884848	0.51908	.	.	ENSG00000124260	ENST00000370323;ENST00000244096	T;T	0.25912	1.77;1.77	2.6	2.6	0.31112	.	0.000000	0.85682	D	0.000000	T	0.55321	0.1913	M	0.93241	3.395	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.46911	-0.9157	10	0.66056	D	0.02	.	7.8732	0.29578	0.0:1.0:0.0:0.0	.	305	P43363	MAGAA_HUMAN	K	305	ENSP00000359347:E305K;ENSP00000244096:E305K	ENSP00000244096:E305K	E	-	1	0	MAGEA10	151053836	0.150000	0.22732	0.008000	0.14137	0.102000	0.19082	1.643000	0.37217	1.567000	0.49668	0.292000	0.19580	GAA		0.502	MAGEA10-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060916.3	NM_021048		7	179	0	0	0	1	0	7	179				
ARNT	405	broad.mit.edu	37	1	150789333	150789333	+	Frame_Shift_Del	DEL	G	G	-			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr1:150789333delG	ENST00000358595.5	-	18	1933	c.1733delC	c.(1732-1734)cctfs	p.P578fs	ARNT_ENST00000505755.1_Frame_Shift_Del_p.P563fs|ARNT_ENST00000515192.1_Frame_Shift_Del_p.P564fs|ARNT_ENST00000354396.2_Frame_Shift_Del_p.P578fs	NM_001197325.1|NM_001668.3|NM_178427.2	NP_001184254.1|NP_001659.1|NP_848514.1	P27540	ARNT_HUMAN	aryl hydrocarbon receptor nuclear translocator	578					cell differentiation (GO:0030154)|cellular response to hypoxia (GO:0071456)|embryonic placenta development (GO:0001892)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of glycolytic process (GO:0045821)|positive regulation of hormone biosynthetic process (GO:0046886)|positive regulation of protein sumoylation (GO:0033235)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0043619)|response to hypoxia (GO:0001666)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	aryl hydrocarbon receptor activity (GO:0004874)|aryl hydrocarbon receptor binding (GO:0017162)|enhancer binding (GO:0035326)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(11)|prostate(2)|skin(4)|stomach(1)	34	all_lung(15;9e-35)|Lung NSC(24;3.45e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.108)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.02)|BRCA - Breast invasive adenocarcinoma(12;0.00606)|LUSC - Lung squamous cell carcinoma(543;0.211)			TTGGGTGGCAGGGACAGTGCT	0.537			T	ETV6	AML																																		uc001evr.1		NA		Dom	yes		1	1q21	405	T	aryl hydrocarbon receptor nuclear translocator			L	ETV6		AML		0				skin(4)|lung(3)|central_nervous_system(1)|kidney(1)	9						c.(1732-1734)CCTfs		aryl hydrocarbon receptor nuclear translocator							126.0	110.0	116.0					1																	150789333		2203	4300	6503	SO:0001589	frameshift_variant	405				positive regulation of hormone biosynthetic process|positive regulation vascular endothelial growth factor production|regulation of transcription from RNA polymerase II promoter in response to oxidative stress|response to hypoxia		aryl hydrocarbon receptor binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription coactivator activity	g.chr1:150789333delG	AF001307	CCDS970.1, CCDS971.1, CCDS65641.1, CCDS65642.1	1q21	2013-05-21			ENSG00000143437	ENSG00000143437		"""Basic helix-loop-helix proteins"""	700	protein-coding gene	gene with protein product		126110					Standard	NM_001668		Approved	HIF-1beta, bHLHe2	uc001evr.2	P27540	OTTHUMG00000035011	ENST00000358595.5:c.1733delC	1.37:g.150789333delG	ENSP00000351407:p.Pro578fs		Somatic				ARNT_uc010pck.1_Frame_Shift_Del_p.P67fs|ARNT_uc001evs.1_Frame_Shift_Del_p.P563fs|ARNT_uc009wmb.1_Frame_Shift_Del_p.P564fs|ARNT_uc009wmc.1_Frame_Shift_Del_p.P578fs|ARNT_uc009wmd.1_Frame_Shift_Del_p.P563fs	p.P578fs	NM_001668	NP_001659	WXS	Illumina HiSeq	Unspecified	P27540	ARNT_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (35;0.02)|BRCA - Breast invasive adenocarcinoma(12;0.00606)|LUSC - Lung squamous cell carcinoma(543;0.211)		18	1876	-	all_lung(15;9e-35)|Lung NSC(24;3.45e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.108)|Melanoma(130;0.185)		578					B2R9H1|C4AMA1|F8WAP6|Q59ED4|Q5QP39|Q8NDC7	Frame_Shift_Del	DEL	ENST00000358595.5	37	c.1733delC	CCDS970.1																																																																																				0.537	ARNT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000084741.2			24	60	NA	NA	NA	NA	NA	24	60	---	---	---	---
FASLG	356	broad.mit.edu	37	1	172633495	172633495	+	Frame_Shift_Del	DEL	A	A	-	rs368143171|rs35774809		TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr1:172633495delA	ENST00000367721.2	+	3	600	c.416delA	c.(415-417)gaafs	p.E139fs	FASLG_ENST00000340030.3_Frame_Shift_Del_p.K125fs	NM_000639.1	NP_000630.1	P48023	TNFL6_HUMAN	Fas ligand (TNF superfamily, member 6)	139					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell-cell signaling (GO:0007267)|cellular chloride ion homeostasis (GO:0030644)|endosomal lumen acidification (GO:0048388)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|immune response (GO:0006955)|inflammatory cell apoptotic process (GO:0006925)|necroptotic process (GO:0070266)|necroptotic signaling pathway (GO:0097527)|negative regulation of angiogenesis (GO:0016525)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|response to growth factor (GO:0070848)|response to lipopolysaccharide (GO:0032496)|retinal cell programmed cell death (GO:0046666)|signal transduction (GO:0007165)|T cell apoptotic process (GO:0070231)|transcription, DNA-templated (GO:0006351)	caveola (GO:0005901)|cytoplasmic membrane-bounded vesicle (GO:0016023)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	receptor binding (GO:0005102)			breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(12)|prostate(1)|skin(1)	19						CCACCCCCTGAAAAAAAGGAG	0.408																																					Ovarian(28;486 876 30334 44033)	Ovarian(28;486 876 30334 44033)	uc001gis.2		NA																	0				lung(2)|breast(1)	3						c.(415-417)GAAfs		fas ligand							57.0	56.0	56.0					1																	172633495		2203	4300	6503	SO:0001589	frameshift_variant	356				activation of caspase activity|activation of pro-apoptotic gene products|cell-cell signaling|immune response|induction of necroptosis by extracellular signals|induction of necroptosis of activated-T cells|necrotic cell death|negative regulation of angiogenesis|positive regulation of I-kappaB kinase/NF-kappaB cascade|signal transduction	extracellular space|integral to plasma membrane	cytokine activity	g.chr1:172633495delA	U11821	CCDS1304.1	1q23	2014-09-17	2005-01-07	2005-01-07	ENSG00000117560	ENSG00000117560		"""Tumor necrosis factor (ligand) superfamily"", ""CD molecules"", ""Endogenous ligands"""	11936	protein-coding gene	gene with protein product		134638	"""tumor necrosis factor (ligand) superfamily, member 6"""	APT1LG1, TNFSF6		7826947, 9022072	Standard	NM_000639		Approved	FasL, CD178	uc001gis.3	P48023	OTTHUMG00000034841	ENST00000367721.2:c.416delA	1.37:g.172633495delA	ENSP00000356694:p.Glu139fs		Somatic				FASLG_uc001git.2_Frame_Shift_Del_p.K124fs	p.E139fs	NM_000639	NP_000630	WXS	Illumina HiSeq	Unspecified	P48023	TNFL6_HUMAN			3	573	+			139			Extracellular (Potential).		Q9BZP9	Frame_Shift_Del	DEL	ENST00000367721.2	37	c.416delA	CCDS1304.1																																																																																				0.408	FASLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084276.1			17	55	NA	NA	NA	NA	NA	17	55	---	---	---	---
RYR2	6262	broad.mit.edu	37	1	237972262	237972263	+	Frame_Shift_Ins	INS	-	-	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr1:237972262_237972263insT	ENST00000366574.2	+	100	14677_14678	c.14360_14361insT	c.(14359-14364)aattttfs	p.NF4787fs	RYR2_ENST00000360064.6_Frame_Shift_Ins_p.NF4793fs|RYR2_ENST00000542537.1_Frame_Shift_Ins_p.NF4771fs	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	4787					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.N4785I(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GTGGCATTCAATTTTTTCCGAA	0.356																																							uc001hyl.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(14359-14361)AATfs		cardiac muscle ryanodine receptor																																				SO:0001589	frameshift_variant	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237972262_237972263insT	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.14366dupT	1.37:g.237972268_237972268dupT	ENSP00000355533:p.Asn4787fs		Somatic				RYR2_uc010pyb.1_Frame_Shift_Ins_p.N220fs	p.N4787fs	NM_001035	NP_001026	WXS	Illumina HiSeq	Unspecified	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		100	14480_14481	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	4787					Q15411|Q546N8|Q5T3P2	Frame_Shift_Ins	INS	ENST00000366574.2	37	c.14360_14361insT	CCDS55691.1																																																																																				0.356	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		7	336	NA	NA	NA	NA	NA	7	336	---	---	---	---
SLC5A12	159963	broad.mit.edu	37	11	26725075	26725076	+	Intron	INS	-	-	A			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr11:26725075_26725076insA	ENST00000396005.3	-	6	1131				SLC5A12_ENST00000280467.6_Intron	NM_178498.3	NP_848593.2	Q1EHB4	SC5AC_HUMAN	solute carrier family 5 (sodium/monocarboxylate cotransporter), member 12						sodium ion transport (GO:0006814)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(1)	35						ACTGAGAACTTACAGCTTAGCA	0.376																																							uc001mra.2		NA																	0				ovary(1)|skin(1)	2						c.e6+1		solute carrier family 5 (sodium/glucose																																				SO:0001627	intron_variant	159963				sodium ion transport	apical plasma membrane|integral to membrane	symporter activity	g.chr11:26725075_26725076insA	BC049207	CCDS7860.2	11p14.2	2013-07-19	2013-07-19		ENSG00000148942	ENSG00000148942		"""Solute carriers"""	28750	protein-coding gene	gene with protein product		612455	"""solute carrier family 5 (sodium/glucose cotransporter), member 12"""			12477932	Standard	NM_178498		Approved	MGC52019, SMCT2	uc001mra.2	Q1EHB4	OTTHUMG00000150706	ENST00000396005.3:c.821+1->T	11.37:g.26725076_26725076dupA			Somatic				SLC5A12_uc001mrb.2_Splice_Site|SLC5A12_uc001mrc.3_Splice_Site_p.L274_splice	p.L274_splice	NM_178498	NP_848593	WXS	Illumina HiSeq	Unspecified	Q1EHB4	SC5AC_HUMAN			6	1134	-								Q86UC7	Splice_Site	INS	ENST00000396005.3	37	c.821_splice	CCDS7860.2																																																																																				0.376	SLC5A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319681.1	NM_178498		39	63	NA	NA	NA	NA	NA	39	63	---	---	---	---
KMT2A	4297	broad.mit.edu	37	11	118363894	118363894	+	Frame_Shift_Del	DEL	A	A	-			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr11:118363894delA	ENST00000389506.5	+	16	5118	c.5118delA	c.(5116-5118)ttafs	p.L1706fs	KMT2A_ENST00000534358.1_Frame_Shift_Del_p.L1709fs|KMT2A_ENST00000354520.4_Frame_Shift_Del_p.L1668fs			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	1706	Bromo; divergent. {ECO:0000255|PROSITE- ProRule:PRU00035}.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)										AGCAGCCTTTAGATCTAGAAG	0.478																																							uc001pta.2		NA								T|O					MLL|MLLT1|MLLT2|MLLT3|MLLT4|MLLT7|MLLT10|MLLT6|ELL|EPS15|AF1Q|CREBBP|SH3GL1|FNBP1|PNUTL1|MSF|GPHN|GMPS|SSH3BP1|ARHGEF12|GAS7|FOXO3A|LAF4|LCX|SEPT6|LPP|CBFA2T1|GRAF|EP300|PICALM|HEAB		AML|ALL		0				lung(7)|ovary(5)|kidney(5)|central_nervous_system(3)|pancreas(2)|urinary_tract(1)|breast(1)|skin(1)	25						c.(5116-5118)TTAfs		myeloid/lymphoid or mixed-lineage leukemia							118.0	109.0	112.0					11																	118363894		2200	4296	6496	SO:0001589	frameshift_variant	4297				apoptosis|embryonic hemopoiesis|histone H4-K16 acetylation|positive regulation of transcription, DNA-dependent|protein complex assembly|transcription from RNA polymerase II promoter	MLL1 complex	AT DNA binding|histone acetyl-lysine binding|histone methyltransferase activity (H3-K4 specific)|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|unmethylated CpG binding|zinc ion binding	g.chr11:118363894delA	L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.5118delA	11.37:g.118363894delA	ENSP00000374157:p.Leu1706fs		Somatic				MLL_uc001ptb.2_Frame_Shift_Del_p.L1709fs	p.L1706fs	NM_005933	NP_005924	WXS	Illumina HiSeq	Unspecified	Q03164	MLL1_HUMAN		OV - Ovarian serous cystadenocarcinoma(223;2.77e-44)|BRCA - Breast invasive adenocarcinoma(274;1.2e-11)|Lung(307;3.48e-06)|LUSC - Lung squamous cell carcinoma(976;7.92e-05)|Colorectal(284;0.144)	16	5141	+	all_hematologic(175;0.046)	all_hematologic(192;1.13e-50)|all_neural(223;3.18e-06)|Breast(348;1.07e-05)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.244)	1706			Bromo; divergent.		E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Frame_Shift_Del	DEL	ENST00000389506.5	37	c.5118delA	CCDS31686.1																																																																																				0.478	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399085.2	NM_005933		33	58	NA	NA	NA	NA	NA	33	58	---	---	---	---
IGHV7-27	28383	broad.mit.edu	37	14	106774086	106774087	+	IGR	INS	-	-	AGTAATACACGGCA	rs376590598		TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr14:106774086_106774087insAGTAATACACGGCA								IGHV2-26 (15970 upstream) : IGHV4-28 (6425 downstream)																							GCCTCTTGCACGTGTCCTCAGC	0.55																																							uc010tyt.1		NA																	0					0						c.e430+1		Parts of antibodies, mostly variable regions.																																				SO:0001628	intergenic_variant	8755							g.chr14:106774086_106774087insAGTAATACACGGCA																													14.37:g.106774086_106774087insAGTAATACACGGCA			Somatic								WXS	Illumina HiSeq	Unspecified					430		-									Splice_Site	INS		37	c.15674_splice																																																																																				0	0.550									4	7	NA	NA	NA	NA	NA	4	7	---	---	---	---
RANGRF	29098	broad.mit.edu	37	17	8192632	8192661	+	In_Frame_Del	DEL	CTGTTCAGCCTCTCAGTTTGGAGAACCTGG	CTGTTCAGCCTCTCAGTTTGGAGAACCTGG	-	rs112961604|rs199622161|rs138959557	byFrequency	TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	CTGTTCAGCCTCTCAGTTTGGAGAACCTGG	CTGTTCAGCCTCTCAGTTTGGAGAACCTGG	-	-	CTGTTCAGCCTCTCAGTTTGGAGAACCTGG	CTGTTCAGCCTCTCAGTTTGGAGAACCTGG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr17:8192632_8192661delCTGTTCAGCCTCTCAGTTTGGAGAACCTGG	ENST00000226105.6	+	3	543_572	c.251_280delCTGTTCAGCCTCTCAGTTTGGAGAACCTGG	c.(250-282)tctgttcagcctctcagtttggagaacctggcc>tcc	p.VQPLSLENLA85del	RANGRF_ENST00000407006.4_In_Frame_Del_p.VQPLSLENLA85del|SLC25A35_ENST00000380067.2_3'UTR|SLC25A35_ENST00000579192.1_Intron|SLC25A35_ENST00000581320.1_5'Flank|SLC25A35_ENST00000580340.1_3'UTR|RANGRF_ENST00000439238.3_In_Frame_Del_p.VQPLSLENLA85del|RANGRF_ENST00000580434.1_In_Frame_Del_p.VQPLSLENLA85del|SLC25A35_ENST00000396278.1_Intron	NM_016492.4	NP_057576.2	Q9HD47	MOG1_HUMAN	RAN guanine nucleotide release factor	85					ER to Golgi vesicle-mediated transport (GO:0006888)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein localization to cell surface (GO:2000010)|protein exit from endoplasmic reticulum (GO:0032527)|regulation of heart rate (GO:0002027)|regulation of membrane depolarization (GO:0003254)|regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900825)|regulation of membrane potential (GO:0042391)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	caveola (GO:0005901)|cytoplasm (GO:0005737)|intercalated disc (GO:0014704)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	guanyl-nucleotide exchange factor activity (GO:0005085)|ion channel binding (GO:0044325)|protein transporter activity (GO:0008565)|Ran GTPase binding (GO:0008536)|sodium channel regulator activity (GO:0017080)			endometrium(1)	1						CATGTGGAGTCTGTTCAGCCTCTCAGTTTGGAGAACCTGGCCCTGAGGGG	0.591																																							uc002gkv.2		NA																	0					0						c.(250-282)TCTGTTCAGCCTCTCAGTTTGGAGAACCTGGCC>TCC		RAN guanine nucleotide release factor																																				SO:0001651	inframe_deletion	29098				protein transport	cytoplasm|nucleus	guanyl-nucleotide exchange factor activity	g.chr17:8192632_8192661delCTGTTCAGCCTCTCAGTTTGGAGAACCTGG	AF151070	CCDS11137.1, CCDS54086.1, CCDS54087.1	17p13	2014-05-09				ENSG00000108961			17679	protein-coding gene	gene with protein product	"""MOG1 homolog (S. cerevisiae)"""	607954				11290418	Standard	NM_016492		Approved	MOG1, HSPC165, HSPC236, RANGNRF	uc002gkv.3	Q9HD47		ENST00000226105.6:c.251_280delCTGTTCAGCCTCTCAGTTTGGAGAACCTGG	17.37:g.8192632_8192661delCTGTTCAGCCTCTCAGTTTGGAGAACCTGG	ENSP00000226105:p.Val85_Ala94del		Somatic				SLC25A35_uc002gku.1_3'UTR|SLC25A35_uc002gkt.2_Intron|RANGRF_uc002gkw.2_In_Frame_Del_p.VQPLSLENLA85del|RANGRF_uc002gky.2_In_Frame_Del_p.VQPLSLENLA85del|RANGRF_uc002gkx.2_In_Frame_Del_p.VQPLSLENLA85del|SLC25A35_uc002gkz.1_RNA	p.VQPLSLENLA85del	NM_016492	NP_057576	WXS	Illumina HiSeq	Unspecified	Q9HD47	MOG1_HUMAN			3	369_398	+			85_94	ALR -> PE (in Ref. 3; AAF36156).				D3DTR6|Q68DI3|Q9BR68|Q9HD48|Q9NRU9|Q9P001|Q9P0P2	In_Frame_Del	DEL	ENST00000226105.6	37	c.251_280delCTGTTCAGCCTCTCAGTTTGGAGAACCTGG	CCDS11137.1																																																																																				0.591	RANGRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442127.1	NM_016492		10	76	NA	NA	NA	NA	NA	10	76	---	---	---	---
ERBB2	2064	broad.mit.edu	37	17	37880981	37880982	+	In_Frame_Ins	INS	-	-	GCATACGTGATG	rs397516976|rs397516975		TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr17:37880981_37880982insGCATACGTGATG	ENST00000269571.5	+	20	2469_2470	c.2310_2311insGCATACGTGATG	c.(2311-2313)gca>GCATACGTGATGgca	p.771_771A>AYVMA	ERBB2_ENST00000540147.1_In_Frame_Ins_p.741_741A>AYVMA|ERBB2_ENST00000406381.2_In_Frame_Ins_p.741_741A>AYVMA|ERBB2_ENST00000541774.1_In_Frame_Ins_p.756_756A>AYVMA|ERBB2_ENST00000445658.2_In_Frame_Ins_p.495_495A>AYVMA|ERBB2_ENST00000584450.1_In_Frame_Ins_p.771_771A>AYVMA|ERBB2_ENST00000584601.1_In_Frame_Ins_p.741_741A>AYVMA|MIR4728_ENST00000580969.1_RNA			P04626	ERBB2_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2	771	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|enzyme linked receptor protein signaling pathway (GO:0007167)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|motor neuron axon guidance (GO:0008045)|myelination (GO:0042552)|negative regulation of immature T cell proliferation in thymus (GO:0033088)|neuromuscular junction development (GO:0007528)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine phosphorylation (GO:0018108)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of angiogenesis (GO:0045765)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of microtubule-based process (GO:0032886)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|ErbB-3 class receptor binding (GO:0043125)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|RNA polymerase I core binding (GO:0001042)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(16)|central_nervous_system(17)|endometrium(6)|haematopoietic_and_lymphoid_tissue(8)|kidney(4)|large_intestine(16)|liver(3)|lung(125)|ovary(18)|pancreas(1)|prostate(4)|skin(1)|stomach(14)|upper_aerodigestive_tract(9)|urinary_tract(4)	247	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Lapatinib(DB01259)|Pertuzumab(DB06366)|Trastuzumab(DB00072)	GTCCCCAGGAAGCATACGTGAT	0.594		1	"""A, Mis, O"""		"""breast, ovarian, other tumour types, NSCLC, gastric"""					TCGA GBM(5;<1E-08)																													uc002hso.2		1		Dom	yes		17	17q21.1	2064	A|Mis|O	"""v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)"""			E			breast|ovarian|other tumour types|NSCLC|gastric		0		p.M774_A775insAYVM(24)		lung(73)|central_nervous_system(16)|ovary(16)|stomach(14)|breast(9)|upper_aerodigestive_tract(5)|large_intestine(3)|liver(3)|endometrium(2)|skin(1)|pancreas(1)	143						c.(2308-2313)insGCATACGTGATG		erbB-2 isoform a	Lapatinib(DB01259)|Letrozole(DB01006)|Trastuzumab(DB00072)																																			SO:0001652	inframe_insertion	2064				cell proliferation|heart development|phosphatidylinositol 3-kinase cascade|phosphatidylinositol-mediated signaling|positive regulation of cell adhesion|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|protein autophosphorylation|regulation of angiogenesis|regulation of microtubule-based process|regulation of transcription, DNA-dependent|transcription, DNA-dependent|wound healing	integral to membrane|nucleus|perinuclear region of cytoplasm|receptor complex	ATP binding|DNA binding|epidermal growth factor receptor activity|ErbB-3 class receptor binding|identical protein binding|protein C-terminus binding|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	g.chr17:37880981_37880982insGCATACGTGATG	X03363	CCDS32642.1, CCDS45667.1, CCDS74052.1	17q11.2-q12	2014-09-17	2013-07-09			ENSG00000141736		"""CD molecules"""	3430	protein-coding gene	gene with protein product	"""neuro/glioblastoma derived oncogene homolog"""	164870	"""v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2 (neuro/glioblastoma derived oncogene homolog)"""	NGL			Standard	XM_005257140		Approved	NEU, HER-2, CD340, HER2	uc002hso.3	P04626		ENST00000269571.5:c.2311_2322dupGCATACGTGATG	17.37:g.37880981_37880982insGCATACGTGATG	Exception_encountered	TCGA GBM(5;<1E-08)	Somatic				ERBB2_uc002hsm.2_In_Frame_Ins_p.744_745insAYVM|ERBB2_uc010cwa.2_In_Frame_Ins_p.759_760insAYVM|ERBB2_uc002hsp.2_In_Frame_Ins_p.577_578insAYVM|ERBB2_uc010cwb.2_In_Frame_Ins_p.774_775insAYVM|ERBB2_uc010wek.1_In_Frame_Ins_p.498_499insAYVM	p.774_775insAYVM	NM_004448	NP_004439	WXS	Illumina HiSeq	Unspecified	P04626	ERBB2_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	20	2548_2549	+	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	774_775			Cytoplasmic (Potential).|Protein kinase.		B2RZG3|B4DHN3|Q14256|Q6LDV1|Q9UMK4|X5D2V5	In_Frame_Ins	INS	ENST00000269571.5	37	c.2310_2311insGCATACGTGATG	CCDS32642.1																																																																																				0.594	ERBB2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445621.2			11	72	NA	NA	NA	NA	NA	11	72	---	---	---	---
NFKBIZ	64332	broad.mit.edu	37	3	101571949	101571950	+	Frame_Shift_Ins	INS	-	-	C			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr3:101571949_101571950insC	ENST00000326172.5	+	5	694_695	c.579_580insC	c.(580-582)ccafs	p.P194fs	NFKBIZ_ENST00000394054.2_Frame_Shift_Ins_p.P94fs|NFKBIZ_ENST00000326151.5_Frame_Shift_Ins_p.P194fs	NM_031419.3	NP_113607.1	Q9BYH8	IKBZ_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, zeta	194					inflammatory response (GO:0006954)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	24						CACCTCAAACACCAACGCCCGG	0.421																																							uc003dvp.2		NA																	0				ovary(2)	2						c.(577-582)ACACCAfs		nuclear factor of kappa light polypeptide gene																																				SO:0001589	frameshift_variant	64332				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus		g.chr3:101571949_101571950insC	AF548362	CCDS2946.1, CCDS43123.1	3p12-q12	2013-01-10			ENSG00000144802	ENSG00000144802		"""Ankyrin repeat domain containing"""	29805	protein-coding gene	gene with protein product	"""IL-1 inducible nuclear ankyrin-repeat protein"""	608004				12565889, 16513645	Standard	NM_031419		Approved	MAIL, FLJ34463, INAP	uc003dvp.3	Q9BYH8	OTTHUMG00000159194	ENST00000326172.5:c.581dupC	3.37:g.101571951_101571951dupC	ENSP00000325663:p.Pro194fs		Somatic				NFKBIZ_uc003dvo.2_Frame_Shift_Ins_p.T93fs|NFKBIZ_uc010hpo.2_Frame_Shift_Ins_p.T93fs|NFKBIZ_uc003dvq.2_Frame_Shift_Ins_p.T193fs	p.T193fs	NM_031419	NP_113607	WXS	Illumina HiSeq	Unspecified	Q9BYH8	IKBZ_HUMAN			5	694_695	+			193_194					B3KNR2|D3DN54|Q8IUL4|Q8NAZ8	Frame_Shift_Ins	INS	ENST00000326172.5	37	c.579_580insC	CCDS2946.1																																																																																				0.421	NFKBIZ-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000353793.1	NM_031419		23	16	NA	NA	NA	NA	NA	23	16	---	---	---	---
UBQLN1	29979	broad.mit.edu	37	9	86279969	86279970	+	Frame_Shift_Ins	INS	-	-	T			TCGA-05-5715-01A-01D-1625-08	TCGA-05-5715-10A-01D-1625-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	62fda17b-1de0-4b7e-bd28-a6793bc36d37	1b729e4e-a30c-4ae4-8de3-9fd4d7d3a146	g.chr9:86279969_86279970insT	ENST00000376395.4	-	9	1946_1947	c.1423_1424insA	c.(1423-1425)acgfs	p.T475fs	UBQLN1_ENST00000257468.7_Frame_Shift_Ins_p.T447fs	NM_013438.4|NM_053067.2	NP_038466.2|NP_444295.1	Q9UMX0	UBQL1_HUMAN	ubiquilin 1	475					cellular response to hypoxia (GO:0071456)|regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902175)|regulation of protein ubiquitination (GO:0031396)|response to endoplasmic reticulum stress (GO:0034976)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|proteasome complex (GO:0000502)|protein complex (GO:0043234)	kinase binding (GO:0019900)			breast(4)|endometrium(2)|kidney(4)|large_intestine(6)|lung(10)|prostate(1)	27						CGGGGCTTCCGTTGCTAATGTC	0.421																																					Melanoma(186;1284 2073 12755 14558 18426)	Melanoma(186;1284 2073 12755 14558 18426)	uc004amv.2		NA																	0					0						c.(1423-1425)ACGfs		ubiquilin 1 isoform 1																																				SO:0001589	frameshift_variant	29979				apoptosis|regulation of protein ubiquitination|response to hypoxia	endoplasmic reticulum|nucleus|perinuclear region of cytoplasm|proteasome complex	kinase binding	g.chr9:86279969_86279970insT	AF176069	CCDS6663.1, CCDS6664.1	9q22	2013-02-12			ENSG00000135018	ENSG00000135018		"""Ubiquilin family"""	12508	protein-coding gene	gene with protein product		605046				9303440, 10807547	Standard	NM_013438		Approved	DSK2, PLIC-1, XDRP1, DA41	uc004amv.3	Q9UMX0	OTTHUMG00000020104	ENST00000376395.4:c.1424dupA	9.37:g.86279971_86279971dupT	ENSP00000365576:p.Thr475fs		Somatic				UBQLN1_uc004amw.2_Frame_Shift_Ins_p.T447fs	p.T475fs	NM_013438	NP_038466	WXS	Illumina HiSeq	Unspecified	Q9UMX0	UBQL1_HUMAN			9	1997_1998	-			475					Q5T6J5|Q5T6J9|Q8IXS9|Q8N2Q3|Q9H0T8|Q9H3R4|Q9HAZ5	Frame_Shift_Ins	INS	ENST00000376395.4	37	c.1423_1424insA	CCDS6663.1																																																																																				0.421	UBQLN1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000052834.1	NM_013438		13	15	NA	NA	NA	NA	NA	13	15	---	---	---	---
