#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
MIIP	60672	broad.mit.edu	37	1	12089847	12089847	+	Silent	SNP	G	G	T	rs138345116		TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr1:12089847G>T	ENST00000235332.4	+	7	910	c.741G>T	c.(739-741)cgG>cgT	p.R247R	MIIP_ENST00000436478.2_Silent_p.R247R|MIIP_ENST00000466860.1_3'UTR	NM_021933.3	NP_068752.2	Q5JXC2	MIIP_HUMAN	migration and invasion inhibitory protein	247	Interaction with IGFBP2.		R -> W (in dbSNP:rs2295289).					p.R247R(1)		autonomic_ganglia(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)|skin(1)	15						GTGTCAACCGGCGCCTGTTCC	0.697																																							uc001ato.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(739-741)CGG>CGT		invasion inhibitory protein 45							57.0	54.0	55.0					1																	12089847		2203	4299	6502	SO:0001819	synonymous_variant	60672							g.chr1:12089847G>T	AK022500	CCDS143.1	1p36.22	2009-07-09			ENSG00000116691	ENSG00000116691			25715	protein-coding gene	gene with protein product	"""invasion inhibitory protein 45"""	608772				15867349, 14617774	Standard	NM_021933		Approved	FLJ12438, IIp45	uc001ato.2	Q5JXC2	OTTHUMG00000002439	ENST00000235332.4:c.741G>T	1.37:g.12089847G>T			Somatic					p.R247R	NM_021933	NP_068752	WXS	Illumina HiSeq	Unspecified	Q5JXC2	MIIP_HUMAN			7	921	+			247			Interaction with IGFBP2.		C0KL22|Q96HU6|Q9H839|Q9HA00	Silent	SNP	ENST00000235332.4	37	c.741G>T	CCDS143.1																																																																																				0.697	MIIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006941.1	NM_021933		3	28	1	0	6.4e-05	0.004672	8.97834e-05	3	28				
PRAMEF12	390999	broad.mit.edu	37	1	12837707	12837707	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr1:12837707C>A	ENST00000357726.4	+	3	1444	c.1417C>A	c.(1417-1419)Ctg>Atg	p.L473M		NM_001080830.1	NP_001074299.1	O95522	PRA12_HUMAN	PRAME family member 12	473					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)			p.L473M(1)		NS(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(9)|ovary(3)|skin(1)|urinary_tract(1)	23	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00818)|Colorectal(212;5.04e-06)|Kidney(185;4.99e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000198)|COAD - Colon adenocarcinoma(227;0.000245)|BRCA - Breast invasive adenocarcinoma(304;0.000295)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		CAGTCACTGTCTGTTGAATGC	0.507																																							uc001aui.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(1417-1419)CTG>ATG		PRAME family member 12							90.0	92.0	91.0					1																	12837707		2203	4300	6503	SO:0001583	missense	390999							g.chr1:12837707C>A		CCDS41254.1	1p36.21	2013-01-17			ENSG00000116726	ENSG00000116726		"""-"""	22125	protein-coding gene	gene with protein product							Standard	NM_001080830		Approved	OTTHUMG00000001927	uc001aui.3	O95522	OTTHUMG00000001927	ENST00000357726.4:c.1417C>A	1.37:g.12837707C>A	ENSP00000350358:p.Leu473Met		Somatic					p.L473M	NM_001080830	NP_001074299	WXS	Illumina HiSeq	Unspecified	O95522	PRA12_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00818)|Colorectal(212;5.04e-06)|Kidney(185;4.99e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000198)|COAD - Colon adenocarcinoma(227;0.000245)|BRCA - Breast invasive adenocarcinoma(304;0.000295)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)	3	1444	+	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)	473						Missense_Mutation	SNP	ENST00000357726.4	37	c.1417C>A	CCDS41254.1	.	.	.	.	.	.	.	.	.	.	.	11.87	1.769107	0.31320	.	.	ENSG00000116726	ENST00000357726	T	0.01335	5.0	2.45	1.51	0.23008	.	3.379960	0.01149	N	0.006362	T	0.02533	0.0077	L	0.32530	0.975	0.09310	N	1	D	0.55605	0.972	P	0.49085	0.6	T	0.43048	-0.9415	10	0.34782	T	0.22	.	6.4058	0.21664	0.2913:0.7087:0.0:0.0	.	473	O95522	PRA12_HUMAN	M	473	ENSP00000350358:L473M	ENSP00000350358:L473M	L	+	1	2	PRAMEF12	12760294	0.000000	0.05858	0.001000	0.08648	0.204000	0.24138	-0.054000	0.11826	0.567000	0.29293	0.205000	0.17691	CTG		0.507	PRAMEF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005457.1	XM_372760		11	98	1	0	0.00010058	0.001368	0.000136701	11	98				
PRAMEF13	400736	broad.mit.edu	37	1	13448266	13448266	+	Silent	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr1:13448266C>A	ENST00000376132.3	-	4	1311	c.1209G>T	c.(1207-1209)ggG>ggT	p.G403G		NM_001024661.1	NP_001019832.1	Q5VWM6	PRA13_HUMAN	PRAME family member 13	403					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)			p.G403G(1)		breast(1)|large_intestine(1)|lung(3)|skin(2)	7	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;9.86e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|COAD - Colon adenocarcinoma(227;0.000502)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		ACTTGCTCAGCCCACTGGTGT	0.557																																							uc010obi.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1207-1209)GGG>GGT		PRAME family member 13							54.0	50.0	51.0					1																	13448266		2202	4296	6498	SO:0001819	synonymous_variant	400736							g.chr1:13448266C>A			1p36.21	2013-01-17			ENSG00000204495			"""-"""	13262	protein-coding gene	gene with protein product							Standard	NG_005159		Approved	OTTHUMG00000008034	uc010obi.1	Q5VWM6	OTTHUMG00000008034	ENST00000376132.3:c.1209G>T	1.37:g.13448266C>A			Somatic				PRAMEF14_uc009vnt.1_Silent_p.G355G	p.G403G	NM_001024661	NP_001019832	WXS	Illumina HiSeq	Unspecified	Q5VWM6	PRA13_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;9.86e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|COAD - Colon adenocarcinoma(227;0.000502)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)	4	1312	-	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)	403						Silent	SNP	ENST00000376132.3	37	c.1209G>T	CCDS41257.1																																																																																				0.557	PRAMEF13-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022040.1	XM_375688		9	136	1	0	1.76689e-08	0.006214	3.19204e-08	9	136				
C1orf94	84970	broad.mit.edu	37	1	34663388	34663388	+	Silent	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr1:34663388C>A	ENST00000488417.1	+	2	1003	c.883C>A	c.(883-885)Cga>Aga	p.R295R	C1orf94_ENST00000373374.3_Silent_p.R105R	NM_001134734.1	NP_001128206.1	Q6P1W5	CA094_HUMAN	chromosome 1 open reading frame 94	295								p.R105R(1)|p.R295R(1)		central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(15)|skin(4)|upper_aerodigestive_tract(2)	32		Myeloproliferative disorder(586;0.0393)				GCTGCCTCCCCGACCTCCTCC	0.602																																							uc001bxs.3		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(313-315)CGA>AGA		hypothetical protein LOC84970 isoform b							64.0	57.0	59.0					1																	34663388		2203	4300	6503	SO:0001819	synonymous_variant	84970						protein binding	g.chr1:34663388C>A	AK123355	CCDS381.1, CCDS44108.1	1p34.3	2012-06-26			ENSG00000142698	ENSG00000142698			28250	protein-coding gene	gene with protein product						12477932	Standard	NM_001134734		Approved	MGC15882	uc001bxt.3	Q6P1W5	OTTHUMG00000004012	ENST00000488417.1:c.883C>A	1.37:g.34663388C>A			Somatic				C1orf94_uc001bxt.2_Silent_p.R295R	p.R105R	NM_032884	NP_116273	WXS	Illumina HiSeq	Unspecified	Q6P1W5	CA094_HUMAN			2	712	+		Myeloproliferative disorder(586;0.0393)	105					B3KVT1|D3DPR3|E9PJ76|Q96IC8	Silent	SNP	ENST00000488417.1	37	c.313C>A	CCDS44108.1																																																																																				0.602	C1orf94-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036845.2	NM_032884		4	78	1	0	0.000602214	0.000602	0.000753197	4	78				
SF3A3	10946	broad.mit.edu	37	1	38435025	38435025	+	Splice_Site	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr1:38435025C>A	ENST00000373019.4	-	14	2237		c.e14+1		SF3A3_ENST00000448721.2_Splice_Site	NM_006802.2	NP_006793.1	Q12874	SF3A3_HUMAN	splicing factor 3a, subunit 3, 60kDa						gene expression (GO:0010467)|mRNA 3'-splice site recognition (GO:0000389)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.?(1)		breast(1)|endometrium(1)|kidney(3)|large_intestine(1)|liver(1)|lung(3)|prostate(2)	12	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				GAATTCCTTACAGCAAAGTGT	0.448																																							uc001cci.2		NA																	1	Unknown(1)		lung(1)		0						c.e14+1		splicing factor 3a, subunit 3							69.0	68.0	69.0					1																	38435025		2203	4300	6503	SO:0001630	splice_region_variant	10946				nuclear mRNA 3'-splice site recognition	catalytic step 2 spliceosome|nuclear speck	nucleic acid binding|protein binding|zinc ion binding	g.chr1:38435025C>A	U08815	CCDS428.1	1p34.3	2012-06-07	2002-08-29		ENSG00000183431	ENSG00000183431			10767	protein-coding gene	gene with protein product		605596	"""splicing factor 3a, subunit 3, 60kD"""			7816610, 8022796	Standard	NM_006802		Approved	SF3a60, SAP61, PRP9, PRPF9	uc001cci.3	Q12874	OTTHUMG00000004438	ENST00000373019.4:c.1281+1G>T	1.37:g.38435025C>A			Somatic				SF3A3_uc010oik.1_Splice_Site_p.A374_splice	p.A427_splice	NM_006802	NP_006793	WXS	Illumina HiSeq	Unspecified	Q12874	SF3A3_HUMAN			14	1405	-	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)						D3DPT5|Q15460|Q5VT87	Splice_Site	SNP	ENST00000373019.4	37	c.1281_splice	CCDS428.1	.	.	.	.	.	.	.	.	.	.	C	24.5	4.543759	0.86022	.	.	ENSG00000183431	ENST00000373019;ENST00000448721	.	.	.	5.0	5.0	0.66597	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.1935	0.93677	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SF3A3	38207612	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.389000	0.79806	2.713000	0.92767	0.655000	0.94253	.		0.448	SF3A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012976.1	NM_006802	Intron	5	59	1	0	0.00116845	0.001168	0.00143281	5	59				
PPAP2B	8613	broad.mit.edu	37	1	56989949	56989949	+	Splice_Site	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr1:56989949C>A	ENST00000371250.3	-	3	1126	c.575G>T	c.(574-576)aGg>aTg	p.R192M		NM_003713.4	NP_003704.3	O14495	LPP3_HUMAN	phosphatidic acid phosphatase type 2B	192					Bergmann glial cell differentiation (GO:0060020)|blood vessel development (GO:0001568)|canonical Wnt signaling pathway involved in positive regulation of cell-cell adhesion (GO:0044329)|canonical Wnt signaling pathway involved in positive regulation of endothelial cell migration (GO:0044328)|canonical Wnt signaling pathway involved in positive regulation of wound healing (GO:0044330)|dephosphorylation (GO:0016311)|gastrulation with mouth forming second (GO:0001702)|germ cell migration (GO:0008354)|homotypic cell-cell adhesion (GO:0034109)|lipid metabolic process (GO:0006629)|negative regulation of protein phosphorylation (GO:0001933)|phospholipid metabolic process (GO:0006644)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein stabilization (GO:0050821)|regulation of sphingolipid mediated signaling pathway (GO:1902068)|regulation of Wnt signaling pathway (GO:0030111)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	adherens junction (GO:0005912)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	lipid phosphatase activity (GO:0042577)|phosphatidate phosphatase activity (GO:0008195)|phosphoprotein phosphatase activity (GO:0004721)|sphingosine-1-phosphate phosphatase activity (GO:0042392)	p.R192M(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	17						GGTGTCTCACCTGGCTTCCTG	0.512																																							uc001cyj.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(574-576)AGG>ATG		phosphatidic acid phosphatase type 2B							123.0	119.0	120.0					1																	56989949		2203	4300	6503	SO:0001630	splice_region_variant	8613				canonical Wnt receptor signaling pathway involved in positive regulation of cell-cell adhesion|canonical Wnt receptor signaling pathway involved in positive regulation of endothelial cell migration|canonical Wnt receptor signaling pathway involved in positive regulation of wound healing|germ cell migration|homotypic cell-cell adhesion|negative regulation of protein phosphorylation|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|sphingolipid metabolic process	adherens junction|Golgi apparatus|integral to membrane	phosphatidate phosphatase activity|phosphoprotein phosphatase activity|protein binding|sphingosine-1-phosphate phosphatase activity	g.chr1:56989949C>A	AB000889	CCDS604.1	1p32.2	2009-05-27			ENSG00000162407	ENSG00000162407	3.1.3.4		9229	protein-coding gene	gene with protein product		607125				9305923	Standard	NM_003713		Approved	PAP-2b, LPP3	uc001cyj.2	O14495	OTTHUMG00000008160	ENST00000371250.3:c.575+1G>T	1.37:g.56989949C>A			Somatic					p.R192M	NM_177414	NP_803133	WXS	Illumina HiSeq	Unspecified	O14495	LPP3_HUMAN			4	1076	-			192			Lumenal (Potential).		B2R651|D3DQ52|Q5U0F7|Q96GW0|Q99782	Missense_Mutation	SNP	ENST00000371250.3	37	c.575G>T	CCDS604.1	.	.	.	.	.	.	.	.	.	.	C	34	5.403043	0.96030	.	.	ENSG00000162407	ENST00000371250	T	0.75704	-0.96	5.56	5.56	0.83823	Phosphatidic acid phosphatase/chloroperoxidase, N-terminal (1);	0.041576	0.85682	D	0.000000	D	0.88636	0.6490	M	0.88031	2.925	0.80722	D	1	D	0.71674	0.998	D	0.76575	0.988	D	0.89757	0.3944	9	.	.	.	.	18.5086	0.90907	0.0:1.0:0.0:0.0	.	192	O14495	LPP3_HUMAN	M	192	ENSP00000360296:R192M	.	R	-	2	0	PPAP2B	56762537	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.747000	0.85070	2.598000	0.87819	0.655000	0.94253	AGG		0.512	PPAP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022334.2	NM_003713	Missense_Mutation	11	116	1	0	3.86212e-05	0.008291	5.52271e-05	11	116				
LRRC7	57554	broad.mit.edu	37	1	70504491	70504491	+	Missense_Mutation	SNP	C	C	G			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr1:70504491C>G	ENST00000035383.5	+	19	2900	c.2870C>G	c.(2869-2871)aCa>aGa	p.T957R	LRRC7_ENST00000310961.5_Missense_Mutation_p.T962R|LRRC7_ENST00000415775.2_Missense_Mutation_p.T241R	NM_020794.2	NP_065845.1	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	957						cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)		p.T957R(1)		breast(11)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(3)|lung(81)|ovary(9)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	162						GACATTGGTACATATAAGGTG	0.403																																							uc001dep.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(9)|breast(2)|central_nervous_system(2)|liver(1)	14						c.(2869-2871)ACA>AGA		leucine rich repeat containing 7							75.0	72.0	73.0					1																	70504491		2203	4300	6503	SO:0001583	missense	57554					centrosome|focal adhesion|nucleolus	protein binding	g.chr1:70504491C>G		CCDS645.1	1p31.1	2008-02-05			ENSG00000033122	ENSG00000033122			18531	protein-coding gene	gene with protein product		614453				12525888	Standard	NM_020794		Approved	KIAA1365, densin-180	uc001dep.3	Q96NW7	OTTHUMG00000059194	ENST00000035383.5:c.2870C>G	1.37:g.70504491C>G	ENSP00000035383:p.Thr957Arg		Somatic				LRRC7_uc009wbg.2_Missense_Mutation_p.T241R|LRRC7_uc001deq.2_Missense_Mutation_p.T198R	p.T957R	NM_020794	NP_065845	WXS	Illumina HiSeq	Unspecified	Q96NW7	LRRC7_HUMAN			19	2900	+			957					Q5VXC2|Q5VXC3|Q68D07|Q86VE8|Q8WX20|Q9P2I2	Missense_Mutation	SNP	ENST00000035383.5	37	c.2870C>G	CCDS645.1	.	.	.	.	.	.	.	.	.	.	C	8.658	0.899965	0.17686	.	.	ENSG00000033122	ENST00000310961;ENST00000035383;ENST00000415775;ENST00000370957	T;T;T	0.38077	1.16;1.24;2.33	5.67	5.67	0.87782	.	0.058514	0.64402	D	0.000001	T	0.26557	0.0649	L	0.44542	1.39	0.45946	D	0.99877	B;P;P	0.41848	0.045;0.763;0.651	B;B;B	0.41619	0.031;0.361;0.198	T	0.02728	-1.1118	10	0.46703	T	0.11	.	18.7487	0.91804	0.0:1.0:0.0:0.0	.	241;957;957	F8WE45;Q96NW7-2;Q96NW7	.;.;LRRC7_HUMAN	R	962;957;241;780	ENSP00000309245:T962R;ENSP00000035383:T957R;ENSP00000394867:T241R	ENSP00000035383:T957R	T	+	2	0	LRRC7	70277079	0.932000	0.31603	0.701000	0.30321	0.119000	0.20118	7.273000	0.78527	2.686000	0.91538	0.467000	0.42956	ACA		0.403	LRRC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131261.1	NM_020794		5	87	0	0	0	0.000602	0	5	87				
GSTM5	2949	broad.mit.edu	37	1	110256125	110256125	+	Missense_Mutation	SNP	G	G	T	rs199509387		TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr1:110256125G>T	ENST00000256593.3	+	4	255	c.197G>T	c.(196-198)gGg>gTg	p.G66V	GSTM5_ENST00000369812.5_Missense_Mutation_p.G85V|GSTM5_ENST00000369813.1_Missense_Mutation_p.G25V	NM_000851.3	NP_000842.2	P46439	GSTM5_HUMAN	glutathione S-transferase mu 5	66	GST N-terminal.				glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	glutathione transferase activity (GO:0004364)	p.G66V(1)		NS(1)|central_nervous_system(6)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(2)|urinary_tract(2)	21		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		Colorectal(144;0.0131)|all cancers(265;0.0252)|Epithelial(280;0.0265)|Lung(183;0.0425)|COAD - Colon adenocarcinoma(174;0.0474)|LUSC - Lung squamous cell carcinoma(189;0.228)	Glutathione(DB00143)	TTGATTGATGGGGCTCACAAG	0.587																																							uc001dyn.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(6)	6						c.(196-198)GGG>GTG		glutathione S-transferase mu 5	Glutathione(DB00143)						288.0	224.0	246.0					1																	110256125		2203	4300	6503	SO:0001583	missense	2949				xenobiotic metabolic process	endoplasmic reticulum membrane	glutathione transferase activity	g.chr1:110256125G>T	L02321	CCDS811.1	1p13.3	2012-06-21	2008-11-26		ENSG00000134201	ENSG00000134201	2.5.1.18	"""Glutathione S-transferases / Soluble"""	4637	protein-coding gene	gene with protein product		138385	"""glutathione S-transferase M5"""			8473333	Standard	NM_000851		Approved		uc001dyn.3	P46439	OTTHUMG00000011644	ENST00000256593.3:c.197G>T	1.37:g.110256125G>T	ENSP00000256593:p.Gly66Val		Somatic				GSTM5_uc010ovu.1_Missense_Mutation_p.G25V	p.G66V	NM_000851	NP_000842	WXS	Illumina HiSeq	Unspecified	P46439	GSTM5_HUMAN		Colorectal(144;0.0131)|all cancers(265;0.0252)|Epithelial(280;0.0265)|Lung(183;0.0425)|COAD - Colon adenocarcinoma(174;0.0474)|LUSC - Lung squamous cell carcinoma(189;0.228)	4	268	+		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)	66			GST N-terminal.		A8K0V8|Q6PD78	Missense_Mutation	SNP	ENST00000256593.3	37	c.197G>T	CCDS811.1	.	.	.	.	.	.	.	.	.	.	G	14.45	2.539205	0.45176	.	.	ENSG00000134201	ENST00000256593;ENST00000369813;ENST00000369812	T;T;T	0.56444	0.46;2.91;0.46	4.33	4.33	0.51752	Glutathione S-transferase, N-terminal (2);Thioredoxin-like fold (2);	0.000000	0.64402	U	0.000001	T	0.81959	0.4933	H	0.99415	4.555	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	D	0.89107	0.3493	10	0.87932	D	0	.	14.198	0.65684	0.0:0.0:1.0:0.0	.	25;66	Q5T8Q9;P46439	.;GSTM5_HUMAN	V	66;25;85	ENSP00000256593:G66V;ENSP00000358828:G25V;ENSP00000358827:G85V	ENSP00000256593:G66V	G	+	2	0	GSTM5	110057648	1.000000	0.71417	0.547000	0.28179	0.025000	0.11179	8.044000	0.89434	2.383000	0.81215	0.505000	0.49811	GGG		0.587	GSTM5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000032200.1	NM_000851		7	166	1	0	0.00307968	0.00308	0.00362461	7	166				
TBX15	6913	broad.mit.edu	37	1	119469162	119469162	+	Silent	SNP	G	G	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr1:119469162G>A	ENST00000369429.3	-	3	501	c.492C>T	c.(490-492)gaC>gaT	p.D164D	TBX15_ENST00000207157.3_Silent_p.D58D			Q96SF7	TBX15_HUMAN	T-box 15	164					embryonic cranial skeleton morphogenesis (GO:0048701)	Tle3-Aes complex (GO:0070722)	RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)	p.D58D(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(19)|ovary(1)|pancreas(1)|skin(5)	37	all_neural(166;0.117)	all_cancers(81;0.000692)|all_lung(203;3.05e-06)|Lung NSC(69;2.13e-05)|all_epithelial(167;0.000237)		Lung(183;0.044)|LUSC - Lung squamous cell carcinoma(189;0.141)		CAGGCACAATGTCCATTGCTA	0.413																																							uc001ehl.1		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(1)|pancreas(1)	2						c.(172-174)GAC>GAT		T-box 15							173.0	142.0	152.0					1																	119469162		2203	4300	6503	SO:0001819	synonymous_variant	6913					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr1:119469162G>A	AK127536	CCDS30816.1	1p11.1	2008-02-05	2004-10-05		ENSG00000092607	ENSG00000092607		"""T-boxes"""	11594	protein-coding gene	gene with protein product		604127	"""T-box 14"""	TBX14		9693034	Standard	XM_005271162		Approved		uc001ehl.1	Q96SF7	OTTHUMG00000012263	ENST00000369429.3:c.492C>T	1.37:g.119469162G>A			Somatic					p.D58D	NM_152380	NP_689593	WXS	Illumina HiSeq	Unspecified	Q96SF7	TBX15_HUMAN		Lung(183;0.044)|LUSC - Lung squamous cell carcinoma(189;0.141)	3	489	-	all_neural(166;0.117)	all_cancers(81;0.000692)|all_lung(203;3.05e-06)|Lung NSC(69;2.13e-05)|all_epithelial(167;0.000237)	164			T-box.		Q08E76|Q5JT54|Q5T9S7	Silent	SNP	ENST00000369429.3	37	c.174C>T																																																																																					0.413	TBX15-002	PUTATIVE	not_organism_supported|upstream_ATG|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000034351.1	NM_152380		5	79	0	0	0	0.000602	0	5	79				
PPIAL4G	644591	broad.mit.edu	37	1	143767862	143767863	+	De_novo_Start_OutOfFrame	DNP	GG	GG	TT			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr1:143767862_143767863GG>TT	ENST00000419275.1	-	0	18_19					NM_001123068.1	NP_001116540.1	A2BFH1	PAL4G_HUMAN	peptidylprolyl isomerase A (cyclophilin A)-like 4G						protein folding (GO:0006457)	cytoplasm (GO:0005737)	peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			breast(1)|endometrium(2)|kidney(1)|lung(8)|ovary(1)|skin(1)	14						TGATAGTACAGGGCTCACAGCG	0.455																																							uc001ejt.2		NA																	0					0						c.(-16--11)GCCCTG>GCAATG		peptidylprolyl isomerase A (cyclophilin A)-like																																						644591				protein folding	cytoplasm	peptidyl-prolyl cis-trans isomerase activity	g.chr1:143767862_143767863GG>TT		CCDS41375.1, CCDS41375.2	1q21.1	2010-06-03			ENSG00000236334	ENSG00000236334			33996	protein-coding gene	gene with protein product							Standard	NM_001123068		Approved		uc001ejt.3	A2BFH1	OTTHUMG00000013629	ENST00000419275.1:c.1_1delinsTT	1.37:g.143767862_143767863delinsTT			Somatic						NM_001123068	NP_001116540	WXS	Illumina HiSeq	Unspecified	A2BFH1	PAL4G_HUMAN			1	19_20	-								A1L431	Translation_Start_Site	DNP	ENST00000419275.1	37	c.-14_-13CC>AA	CCDS41375.1																																																																																				0.455	PPIAL4G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000037969.1	NM_001123068		16	148	0	0	0	0.004672	0	16	148				
ANKRD34A	284615	broad.mit.edu	37	1	145474697	145474697	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr1:145474697G>T	ENST00000323397.4	+	4	2662	c.1369G>T	c.(1369-1371)Ggg>Tgg	p.G457W	LIX1L_ENST00000369308.3_5'Flank|RP11-315I20.1_ENST00000600340.1_RNA	NM_001039888.2	NP_001034977.1	Q69YU3	AN34A_HUMAN	ankyrin repeat domain 34A	457	Pro-rich.					cytoplasm (GO:0005737)		p.G457W(1)		endometrium(2)|kidney(2)|large_intestine(2)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)	20	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					TCCTTATGCCGGGGCGCCAGG	0.642																																							uc001enq.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1369-1371)GGG>TGG		ankyrin repeat domain 34							20.0	23.0	22.0					1																	145474697		2201	4297	6498	SO:0001583	missense	284615							g.chr1:145474697G>T	AK128050	CCDS72874.1	1q21.1	2013-01-10	2007-11-20	2007-11-20	ENSG00000181039	ENSG00000272031		"""Ankyrin repeat domain containing"""	27639	protein-coding gene	gene with protein product			"""ankyrin repeat domain 34"""	ANKRD34			Standard	NM_001039888		Approved		uc001enq.1	Q69YU3	OTTHUMG00000013740	ENST00000323397.4:c.1369G>T	1.37:g.145474697G>T	ENSP00000314103:p.Gly457Trp		Somatic				NBPF10_uc001emp.3_Intron|LIX1L_uc001enr.2_5'Flank	p.G457W	NM_001039888	NP_001034977	WXS	Illumina HiSeq	Unspecified	Q69YU3	AN34A_HUMAN			4	2662	+	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)		457			Pro-rich.		B3KSU3	Missense_Mutation	SNP	ENST00000323397.4	37	c.1369G>T	CCDS30829.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.275094	0.80580	.	.	ENSG00000181039	ENST00000323397	T	0.17213	2.29	5.32	5.32	0.75619	.	0.878344	0.09769	N	0.758250	T	0.16769	0.0403	N	0.08118	0	0.47659	D	0.999486	D	0.69078	0.997	D	0.70016	0.967	T	0.32295	-0.9912	10	0.72032	D	0.01	-15.5331	16.6075	0.84834	0.0:0.0:1.0:0.0	.	457	Q69YU3	AN34A_HUMAN	W	457	ENSP00000314103:G457W	ENSP00000314103:G457W	G	+	1	0	ANKRD34A	144186054	0.964000	0.33143	0.995000	0.50966	0.915000	0.54546	1.562000	0.36353	2.770000	0.95276	0.650000	0.86243	GGG		0.642	ANKRD34A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038512.1			6	37	1	0	6.5536e-12	0.00308	1.29596e-11	6	37				
SV2A	9900	broad.mit.edu	37	1	149885086	149885086	+	Silent	SNP	G	G	T	rs144624887		TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr1:149885086G>T	ENST00000369146.3	-	2	797	c.307C>A	c.(307-309)Cgg>Agg	p.R103R	SV2A_ENST00000369145.1_Silent_p.R103R	NM_001278719.1|NM_014849.3	NP_001265648.1|NP_055664.3	Q7L0J3	SV2A_HUMAN	synaptic vesicle glycoprotein 2A	103					cellular calcium ion homeostasis (GO:0006874)|neurotransmitter transport (GO:0006836)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)	protein kinase binding (GO:0019901)|receptor activity (GO:0004872)|transmembrane transporter activity (GO:0022857)	p.R103R(1)		breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|lung(16)|ovary(6)|pancreas(1)|prostate(8)|skin(2)|urinary_tract(2)	55	Breast(34;0.00769)|all_hematologic(923;0.127)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)		Levetiracetam(DB01202)	GACTCTGCCCGGGGAATGCCC	0.632																																							uc001etg.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(6)|pancreas(1)	7						c.(307-309)CGG>AGG		synaptic vesicle glycoprotein 2	Levetiracetam(DB01202)						107.0	106.0	106.0					1																	149885086		2203	4300	6503	SO:0001819	synonymous_variant	9900				neurotransmitter transport	cell junction|endoplasmic reticulum|integral to membrane|synaptic vesicle membrane	transmembrane transporter activity	g.chr1:149885086G>T	AB018279	CCDS940.1	1q21.2	2008-02-05			ENSG00000159164	ENSG00000159164			20566	protein-coding gene	gene with protein product		185860				7681585, 10611374	Standard	NM_014849		Approved	SV2, KIAA0736	uc001etg.3	Q7L0J3	OTTHUMG00000012209	ENST00000369146.3:c.307C>A	1.37:g.149885086G>T			Somatic				SV2A_uc001eth.2_Silent_p.R103R	p.R103R	NM_014849	NP_055664	WXS	Illumina HiSeq	Unspecified	Q7L0J3	SV2A_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)		2	798	-	Breast(34;0.00769)|all_hematologic(923;0.127)|Colorectal(459;0.171)		103			Cytoplasmic (Potential).		D3DUZ7|O94841|Q5QNX8|Q7Z3L6|Q8NBJ6|Q9BVZ9	Silent	SNP	ENST00000369146.3	37	c.307C>A	CCDS940.1																																																																																				0.632	SV2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033754.1			10	163	1	0	2.68362e-12	0.001368	5.35504e-12	10	163				
PLEKHO1	51177	broad.mit.edu	37	1	150129601	150129601	+	Missense_Mutation	SNP	A	A	C			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr1:150129601A>C	ENST00000369124.4	+	5	724	c.446A>C	c.(445-447)tAt>tCt	p.Y149S	PLEKHO1_ENST00000025469.6_Intron|PLEKHO1_ENST00000369126.1_Intron|PLEKHO1_ENST00000479194.1_3'UTR	NM_016274.4	NP_057358.2	Q53GL0	PKHO1_HUMAN	pleckstrin homology domain containing, family O member 1	149	Interaction with ATM, CKIP, IFP35 and NMI.|Interaction with capping proteins (CPs).					cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.Y149S(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|skin(2)	22	Lung NSC(24;7.78e-28)|Breast(34;0.00211)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			GAGGACAGCTATCTTGCCCAT	0.542																																							uc001ett.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)	1						c.(445-447)TAT>TCT		pleckstrin homology domain containing, family O							124.0	100.0	108.0					1																	150129601		2203	4300	6503	SO:0001583	missense	51177					cytoplasm|nucleus|plasma membrane		g.chr1:150129601A>C	AF073836	CCDS945.1	1q21.2	2013-01-10			ENSG00000023902	ENSG00000023902		"""Pleckstrin homology (PH) domain containing"""	24310	protein-coding gene	gene with protein product		608335				10799509	Standard	NM_016274		Approved	CKIP-1, OC120	uc001ett.3	Q53GL0	OTTHUMG00000012510	ENST00000369124.4:c.446A>C	1.37:g.150129601A>C	ENSP00000358120:p.Tyr149Ser		Somatic				PLEKHO1_uc001etr.2_5'UTR|PLEKHO1_uc001ets.2_Intron|PLEKHO1_uc001etu.2_5'UTR	p.Y149S	NM_016274	NP_057358	WXS	Illumina HiSeq	Unspecified	Q53GL0	PKHO1_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.171)		5	724	+	Lung NSC(24;7.78e-28)|Breast(34;0.00211)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		149			Interaction with ATM, CKIP, IFP35 and NMI.|Interaction with capping proteins (CPs).		Q336K5|Q8IZ51|Q9NRV3|Q9UL48	Missense_Mutation	SNP	ENST00000369124.4	37	c.446A>C	CCDS945.1	.	.	.	.	.	.	.	.	.	.	A	14.26	2.483164	0.44147	.	.	ENSG00000023902	ENST00000369124;ENST00000441340	T;T	0.20598	2.06;2.06	4.69	1.03	0.20045	.	.	.	.	.	T	0.05502	0.0145	L	0.46157	1.445	0.80722	D	1	B	0.17038	0.02	B	0.17433	0.018	T	0.22695	-1.0209	9	0.21014	T	0.42	-4.1731	3.7983	0.08749	0.5763:0.0:0.1562:0.2674	.	149	Q53GL0	PKHO1_HUMAN	S	149;29	ENSP00000358120:Y149S;ENSP00000409060:Y29S	ENSP00000358120:Y149S	Y	+	2	0	PLEKHO1	148396225	0.999000	0.42202	0.999000	0.59377	0.990000	0.78478	0.632000	0.24583	0.070000	0.16634	0.454000	0.30748	TAT		0.542	PLEKHO1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034962.1	NM_016274		9	86	0	0	0	0.006214	0	9	86				
GABPB2	126626	broad.mit.edu	37	1	151070440	151070440	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr1:151070440C>A	ENST00000368918.3	+	5	915	c.584C>A	c.(583-585)gCa>gAa	p.A195E	GABPB2_ENST00000368916.1_Missense_Mutation_p.A195E|GABPB2_ENST00000368917.1_Missense_Mutation_p.A195E|GABPB2_ENST00000467551.1_3'UTR	NM_144618.2	NP_653219.1	Q8TAK5	GABP2_HUMAN	GA binding protein transcription factor, beta subunit 2	195					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|endometrium(2)|large_intestine(3)|liver(2)|lung(7)	15				all cancers(107;7.17e-05)|GBM - Glioblastoma multiforme(94;0.000662)		GTTAACCTCGCAAGCCTTATT	0.413																																							uc001ewr.2		NA																	0					0						c.(583-585)GCA>GAA		GA repeat binding protein, beta 2							102.0	90.0	94.0					1																	151070440		2203	4300	6503	SO:0001583	missense	126626				positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	protein heterodimerization activity|transcription regulatory region DNA binding	g.chr1:151070440C>A		CCDS983.1	1q21.2	2013-01-10			ENSG00000143458	ENSG00000143458		"""Ankyrin repeat domain containing"""	28441	protein-coding gene	gene with protein product						7958862	Standard	NM_144618		Approved	MGC29891	uc001ewr.2	Q8TAK5	OTTHUMG00000012193	ENST00000368918.3:c.584C>A	1.37:g.151070440C>A	ENSP00000357914:p.Ala195Glu		Somatic				GABPB2_uc010pcp.1_Missense_Mutation_p.A211E|GABPB2_uc001ews.2_Missense_Mutation_p.A155E|GABPB2_uc001ewt.2_Missense_Mutation_p.A94E	p.A195E	NM_144618	NP_653219	WXS	Illumina HiSeq	Unspecified	Q8TAK5	GABP2_HUMAN		all cancers(107;7.17e-05)|GBM - Glioblastoma multiforme(94;0.000662)	5	915	+			195					B1AVJ8|D3DV14|Q8NAR5	Missense_Mutation	SNP	ENST00000368918.3	37	c.584C>A	CCDS983.1	.	.	.	.	.	.	.	.	.	.	C	12.26	1.885956	0.33348	.	.	ENSG00000143458	ENST00000368918;ENST00000368917;ENST00000446567;ENST00000368916	T;T;T	0.59083	0.3;0.29;0.29	5.46	5.46	0.80206	.	0.686708	0.15825	N	0.242783	T	0.50718	0.1632	L	0.50333	1.59	0.32052	N	0.596867	D;P;P;P	0.54964	0.969;0.747;0.586;0.79	P;B;B;B	0.48654	0.585;0.224;0.411;0.306	T	0.51172	-0.8739	9	.	.	.	-2.2428	18.0541	0.89358	0.0:1.0:0.0:0.0	.	211;195;195;195	B4DXA3;Q5SZG2;B2R924;Q8TAK5	.;.;.;GABP2_HUMAN	E	195;195;211;195	ENSP00000357914:A195E;ENSP00000357913:A195E;ENSP00000357912:A195E	.	A	+	2	0	GABPB2	149337064	0.132000	0.22450	0.408000	0.26446	0.006000	0.05464	4.243000	0.58721	2.840000	0.97914	0.655000	0.94253	GCA		0.413	GABPB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033700.2	NM_144618		6	41	1	0	4.54149e-19	0.002299	9.7731e-19	6	41				
FLG	2312	broad.mit.edu	37	1	152278647	152278647	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr1:152278647C>A	ENST00000368799.1	-	3	8750	c.8715G>T	c.(8713-8715)gaG>gaT	p.E2905D	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2905	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.E2905D(1)		autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CAGACCACCTCTCAGAGTCTT	0.567									Ichthyosis																														uc001ezu.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16						c.(8713-8715)GAG>GAT		filaggrin							109.0	176.0	155.0					1																	152278647		2028	4296	6324	SO:0001583	missense	2312	Ichthyosis	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity	g.chr1:152278647C>A	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.8715G>T	1.37:g.152278647C>A	ENSP00000357789:p.Glu2905Asp		Somatic					p.E2905D	NM_002016	NP_002007	WXS	Illumina HiSeq	Unspecified	P20930	FILA_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	8751	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		2905			Ser-rich.		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	c.8715G>T	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	C	8.648	0.897496	0.17686	.	.	ENSG00000143631	ENST00000368799;ENST00000368796	T	0.01745	4.66	2.41	0.162	0.14981	.	.	.	.	.	T	0.00815	0.0027	M	0.72894	2.215	0.09310	N	1	B	0.18310	0.027	B	0.14578	0.011	T	0.42275	-0.9461	9	0.22109	T	0.4	.	7.8836	0.29637	0.0:0.4901:0.5099:0.0	.	2905	P20930	FILA_HUMAN	D	2905;167	ENSP00000357789:E2905D	ENSP00000357786:E167D	E	-	3	2	FLG	150545271	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.607000	0.02070	0.045000	0.15804	0.306000	0.20318	GAG		0.567	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016		16	476	1	0	9.78306e-22	0.001786	2.12612e-21	16	476				
FLG	2312	broad.mit.edu	37	1	152283455	152283455	+	Missense_Mutation	SNP	T	T	C			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr1:152283455T>C	ENST00000368799.1	-	3	3942	c.3907A>G	c.(3907-3909)Aga>Gga	p.R1303G	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	1303	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			gagccatctcttgactgctcc	0.542									Ichthyosis																														uc001ezu.1		NA																	0				ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16						c.(3907-3909)AGA>GGA		filaggrin							190.0	186.0	187.0					1																	152283455		2203	4300	6503	SO:0001583	missense	2312	Ichthyosis	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity	g.chr1:152283455T>C	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.3907A>G	1.37:g.152283455T>C	ENSP00000357789:p.Arg1303Gly		Somatic				uc001ezv.2_5'Flank	p.R1303G	NM_002016	NP_002007	WXS	Illumina HiSeq	Unspecified	P20930	FILA_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	3943	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		1303			Ser-rich.		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	c.3907A>G	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	T	6.675	0.493110	0.12702	.	.	ENSG00000143631	ENST00000368799	T	0.04317	3.65	3.1	-1.16	0.09678	.	.	.	.	.	T	0.01254	0.0041	L	0.54323	1.7	0.09310	N	1	B	0.12630	0.006	B	0.15870	0.014	T	0.47368	-0.9123	9	0.19590	T	0.45	.	2.5492	0.04744	0.2248:0.1966:0.0:0.5787	.	1303	P20930	FILA_HUMAN	G	1303	ENSP00000357789:R1303G	ENSP00000357789:R1303G	R	-	1	2	FLG	150550079	0.000000	0.05858	0.001000	0.08648	0.024000	0.10985	-0.809000	0.04510	0.030000	0.15379	0.249000	0.18162	AGA		0.542	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016		16	340	0	0	0	0.00499	0	16	340				
CRNN	49860	broad.mit.edu	37	1	152383311	152383311	+	Missense_Mutation	SNP	G	G	C			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr1:152383311G>C	ENST00000271835.3	-	3	309	c.247C>G	c.(247-249)Cag>Gag	p.Q83E	RP1-91G5.3_ENST00000411804.1_RNA	NM_016190.2	NP_057274.1	Q9UBG3	CRNN_HUMAN	cornulin	83	EF-hand. {ECO:0000255|PROSITE- ProRule:PRU00448}.				response to heat (GO:0009408)|single organismal cell-cell adhesion (GO:0016337)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(16)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			AAACAGGCCTGGGCAACTTTA	0.567																																							uc001ezx.2		NA																	0				ovary(2)|skin(1)	3						c.(247-249)CAG>GAG		cornulin							79.0	87.0	84.0					1																	152383311		2203	4300	6503	SO:0001583	missense	49860				cell-cell adhesion|response to heat	cytoplasm|membrane	calcium ion binding	g.chr1:152383311G>C	AF077831	CCDS1010.1	1q21	2014-01-28	2005-06-13	2005-06-13	ENSG00000143536	ENSG00000143536		"""EF-hand domain containing"""	1230	protein-coding gene	gene with protein product		611312	"""chromosome 1 open reading frame 10"""	C1orf10		11056050, 15854041	Standard	NM_016190		Approved	SEP53	uc001ezx.2	Q9UBG3	OTTHUMG00000012383	ENST00000271835.3:c.247C>G	1.37:g.152383311G>C	ENSP00000271835:p.Gln83Glu		Somatic					p.Q83E	NM_016190	NP_057274	WXS	Illumina HiSeq	Unspecified	Q9UBG3	CRNN_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	321	-	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		83			EF-hand.		B2RE60|Q8N613	Missense_Mutation	SNP	ENST00000271835.3	37	c.247C>G	CCDS1010.1	.	.	.	.	.	.	.	.	.	.	G	14.52	2.560553	0.45590	.	.	ENSG00000143536	ENST00000271835;ENST00000451038	T	0.13901	2.55	4.73	4.73	0.59995	EF-hand-like domain (1);	0.153280	0.30723	N	0.009010	T	0.10551	0.0258	M	0.83012	2.62	0.25800	N	0.984516	P	0.44006	0.824	B	0.39465	0.3	T	0.08186	-1.0734	10	0.37606	T	0.19	.	13.0803	0.59109	0.0:0.0:1.0:0.0	.	83	Q9UBG3	CRNN_HUMAN	E	83	ENSP00000271835:Q83E	ENSP00000271835:Q83E	Q	-	1	0	CRNN	150649935	1.000000	0.71417	0.996000	0.52242	0.651000	0.38670	2.231000	0.43009	2.449000	0.82847	0.305000	0.20034	CAG		0.567	CRNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034503.1	NM_016190		33	209	0	0	0	0.002836	0	33	209				
LCE1F	353137	broad.mit.edu	37	1	152748887	152748887	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr1:152748887C>A	ENST00000334371.2	+	1	40	c.40C>A	c.(40-42)Ccc>Acc	p.P14T		NM_178354.2	NP_848131.1	Q5T754	LCE1F_HUMAN	late cornified envelope 1F	14	Pro-rich.				keratinization (GO:0031424)			p.P14T(1)		kidney(1)|large_intestine(2)|lung(7)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCAGCCccctcccaagtgcac	0.622																																							uc010pdv.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(40-42)CCC>ACC		late cornified envelope 1F							60.0	60.0	60.0					1																	152748887		2203	4300	6503	SO:0001583	missense	353137				keratinization			g.chr1:152748887C>A		CCDS1023.1	1q21.3	2008-02-05			ENSG00000240386	ENSG00000240386		"""Late cornified envelopes"""	29467	protein-coding gene	gene with protein product		612608				11698679	Standard	NM_178354		Approved	LEP6	uc010pdv.2	Q5T754	OTTHUMG00000012403	ENST00000334371.2:c.40C>A	1.37:g.152748887C>A	ENSP00000334187:p.Pro14Thr		Somatic					p.P14T	NM_178354	NP_848131	WXS	Illumina HiSeq	Unspecified	Q5T754	LCE1F_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		1	40	+	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		14			Pro-rich.			Missense_Mutation	SNP	ENST00000334371.2	37	c.40C>A	CCDS1023.1	.	.	.	.	.	.	.	.	.	.	C	11.71	1.720925	0.30503	.	.	ENSG00000240386	ENST00000334371	T	0.04454	3.62	4.42	4.42	0.53409	.	.	.	.	.	T	0.15392	0.0371	M	0.87269	2.87	0.26891	N	0.967339	D	0.89917	1.0	D	0.83275	0.996	T	0.01711	-1.1290	9	0.87932	D	0	.	12.7047	0.57054	0.0:1.0:0.0:0.0	.	14	Q5T754	LCE1F_HUMAN	T	14	ENSP00000334187:P14T	ENSP00000334187:P14T	P	+	1	0	LCE1F	151015511	0.998000	0.40836	1.000000	0.80357	0.957000	0.61999	2.598000	0.46223	2.444000	0.82710	0.563000	0.77884	CCC		0.622	LCE1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034523.2	NM_178354		5	57	1	0	1.26484e-09	0.00308	2.35283e-09	5	57				
GATAD2B	57459	broad.mit.edu	37	1	153800615	153800615	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr1:153800615C>A	ENST00000368655.4	-	2	452	c.209G>T	c.(208-210)aGt>aTt	p.S70I		NM_020699.2	NP_065750.1	Q8WXI9	P66B_HUMAN	GATA zinc finger domain containing 2B	70					ATP-dependent chromatin remodeling (GO:0043044)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.S70I(1)		breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(5)|lung(12)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	38	all_lung(78;1.34e-32)|Lung NSC(65;1.04e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			CTTGACACCACTGCCATCCTG	0.473																																							uc001fdb.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(208-210)AGT>ATT		GATA zinc finger domain containing 2B							221.0	188.0	199.0					1																	153800615		2203	4300	6503	SO:0001583	missense	57459					nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr1:153800615C>A	AF411836	CCDS1054.1	1q21.3	2013-01-25			ENSG00000143614	ENSG00000143614		"""GATA zinc finger domain containing"""	30778	protein-coding gene	gene with protein product	"""transcription repressor p66 beta component of the MeCP1 complex"""	614998				10574461, 11756549	Standard	NM_020699		Approved	P66beta	uc001fdb.4	Q8WXI9	OTTHUMG00000037162	ENST00000368655.4:c.209G>T	1.37:g.153800615C>A	ENSP00000357644:p.Ser70Ile		Somatic					p.S70I	NM_020699	NP_065750	WXS	Illumina HiSeq	Unspecified	Q8WXI9	P66B_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.151)		2	453	-	all_lung(78;1.34e-32)|Lung NSC(65;1.04e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		70					D3DUZ2|Q5VUR2|Q7LG68|Q9ULS0	Missense_Mutation	SNP	ENST00000368655.4	37	c.209G>T	CCDS1054.1	.	.	.	.	.	.	.	.	.	.	C	14.84	2.656716	0.47467	.	.	ENSG00000143614	ENST00000368655	T	0.31769	1.48	5.53	5.53	0.82687	.	0.232500	0.45867	D	0.000337	T	0.11452	0.0279	N	0.22421	0.69	0.32466	N	0.543507	B	0.02656	0.0	B	0.01281	0.0	T	0.04870	-1.0921	10	0.38643	T	0.18	-17.283	14.8344	0.70172	0.0:1.0:0.0:0.0	.	70	Q8WXI9	P66B_HUMAN	I	70	ENSP00000357644:S70I	ENSP00000357644:S70I	S	-	2	0	GATAD2B	152067239	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.636000	0.46545	2.882000	0.98803	0.655000	0.94253	AGT		0.473	GATAD2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090305.1	NM_020699		15	287	1	0	4.14922e-12	0.004007	8.24211e-12	15	287				
NUP210L	91181	broad.mit.edu	37	1	154112395	154112395	+	Silent	SNP	G	G	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr1:154112395G>A	ENST00000368559.3	-	5	671	c.600C>T	c.(598-600)ccC>ccT	p.P200P	NUP210L_ENST00000271854.3_Silent_p.P200P	NM_207308.2	NP_997191.2	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like	200					Sertoli cell development (GO:0060009)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)		p.P200P(1)		NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|lung(34)|ovary(4)|pancreas(1)|prostate(2)|skin(6)|urinary_tract(2)	80	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			TATATATTGGGGGAGCATATT	0.368																																							uc001fdw.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(5)|ovary(4)|large_intestine(1)|central_nervous_system(1)	11						c.(598-600)CCC>CCT		nucleoporin 210kDa-like isoform 1							257.0	249.0	252.0					1																	154112395		1816	4082	5898	SO:0001819	synonymous_variant	91181					integral to membrane		g.chr1:154112395G>A	AK125924	CCDS41399.1, CCDS53370.1	1q21.3	2008-02-05			ENSG00000143552	ENSG00000143552			29915	protein-coding gene	gene with protein product							Standard	NM_207308		Approved		uc001fdw.3	Q5VU65	OTTHUMG00000035852	ENST00000368559.3:c.600C>T	1.37:g.154112395G>A			Somatic				NUP210L_uc010peh.1_Silent_p.P200P	p.P200P	NM_207308	NP_997191	WXS	Illumina HiSeq	Unspecified	Q5VU65	P210L_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)		5	672	-	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		200					E7EP56|Q5T4L7|Q6ZRN1|Q6ZRT4|Q6ZU81|Q8NDI6|Q9UF31	Silent	SNP	ENST00000368559.3	37	c.600C>T	CCDS41399.1																																																																																				0.368	NUP210L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087270.3	NM_207308		27	554	0	0	0	0.005443	0	27	554				
AQP10	89872	broad.mit.edu	37	1	154296832	154296832	+	Missense_Mutation	SNP	A	A	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr1:154296832A>T	ENST00000324978.3	+	6	822	c.782A>T	c.(781-783)cAg>cTg	p.Q261L	ATP8B2_ENST00000368487.3_5'Flank|AQP10_ENST00000484864.1_3'UTR	NM_080429.2	NP_536354.2	Q96PS8	AQP10_HUMAN	aquaporin 10	261					response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)	p.Q261L(2)		central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(14)|stomach(2)|upper_aerodigestive_tract(1)	23	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			GCCACTTACCAGCTGTTGGTG	0.602											OREG0013832	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001feu.2		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(1)	1						c.(781-783)CAG>CTG		aquaporin 10							53.0	54.0	54.0					1																	154296832		2203	4300	6503	SO:0001583	missense	89872				response to toxin|transmembrane transport|water transport	integral to membrane|plasma membrane	transporter activity	g.chr1:154296832A>T	AF159174	CCDS1065.1	1q21.3	2008-02-05			ENSG00000143595	ENSG00000143595		"""Ion channels / Aquaporins"""	16029	protein-coding gene	gene with protein product		606578				11573934	Standard	NM_080429		Approved		uc001feu.3	Q96PS8	OTTHUMG00000035980	ENST00000324978.3:c.782A>T	1.37:g.154296832A>T	ENSP00000318355:p.Gln261Leu		Somatic	OREG0013832	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1762	AQP10_uc001fev.2_3'UTR|ATP8B2_uc001few.2_5'Flank	p.Q261L	NM_080429	NP_536354	WXS	Illumina HiSeq	Unspecified	Q96PS8	AQP10_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.185)		6	822	+	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		261			Extracellular (Potential).		Q5VYD3|Q5VYD4|Q8NG70	Missense_Mutation	SNP	ENST00000324978.3	37	c.782A>T	CCDS1065.1	.	.	.	.	.	.	.	.	.	.	A	7.313	0.615362	0.14129	.	.	ENSG00000143595	ENST00000324978	T	0.11169	2.8	4.46	4.46	0.54185	Aquaporin-like (2);	0.278179	0.34245	N	0.004131	T	0.01800	0.0057	N	0.08118	0	0.80722	D	1	B	0.10296	0.003	B	0.08055	0.003	T	0.38436	-0.9661	10	0.09084	T	0.74	-2.3148	13.0459	0.58925	1.0:0.0:0.0:0.0	.	261	Q96PS8	AQP10_HUMAN	L	261	ENSP00000318355:Q261L	ENSP00000318355:Q261L	Q	+	2	0	AQP10	152563456	0.011000	0.17503	0.099000	0.21106	0.957000	0.61999	1.908000	0.39907	2.030000	0.59900	0.454000	0.30748	CAG		0.602	AQP10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087661.1	NM_080429		10	70	0	0	0	0.000978	0	10	70				
PEAR1	375033	broad.mit.edu	37	1	156883518	156883518	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr1:156883518C>A	ENST00000338302.3	+	22	2904	c.2679C>A	c.(2677-2679)agC>agA	p.S893R	PEAR1_ENST00000292357.7_Missense_Mutation_p.S893R			Q5VY43	PEAR1_HUMAN	platelet endothelial aggregation receptor 1	893	Pro-rich.				recognition of apoptotic cell (GO:0043654)	integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)		p.S893R(1)		breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(6)|lung(22)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)	43	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					ACAGCTATAGCTACAGCAATG	0.602																																							uc001fqj.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(2677-2679)AGC>AGA		platelet endothelial aggregation receptor 1							44.0	46.0	45.0					1																	156883518		2203	4300	6503	SO:0001583	missense	375033					integral to membrane		g.chr1:156883518C>A	AK098809	CCDS30892.1	1q23.1	2008-02-05	2007-10-25	2007-10-25	ENSG00000187800	ENSG00000187800			33631	protein-coding gene	gene with protein product		610278	"""multiple EGF-like-domains 12"""	MEGF12		15851471	Standard	NM_001080471		Approved	JEDI, FLJ00193	uc001fqj.1	Q5VY43	OTTHUMG00000041293	ENST00000338302.3:c.2679C>A	1.37:g.156883518C>A	ENSP00000344465:p.Ser893Arg		Somatic				PEAR1_uc001fqk.1_Missense_Mutation_p.S518R	p.S893R	NM_001080471	NP_001073940	WXS	Illumina HiSeq	Unspecified	Q5VY43	PEAR1_HUMAN			21	2795	+	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)		893			Pro-rich.		Q8TEK2	Missense_Mutation	SNP	ENST00000338302.3	37	c.2679C>A	CCDS30892.1	.	.	.	.	.	.	.	.	.	.	C	9.261	1.043149	0.19748	.	.	ENSG00000187800	ENST00000338302;ENST00000292357	D;D	0.89123	-2.47;-2.47	2.93	1.03	0.20045	.	0.548634	0.15516	N	0.258317	T	0.55162	0.1903	N	0.14661	0.345	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.48990	-0.8985	10	0.16420	T	0.52	.	4.7147	0.12889	0.0:0.6964:0.0:0.3036	.	893	Q5VY43	PEAR1_HUMAN	R	893	ENSP00000344465:S893R;ENSP00000292357:S893R	ENSP00000292357:S893R	S	+	3	2	PEAR1	155150142	0.068000	0.21057	0.158000	0.22627	0.823000	0.46562	0.182000	0.16900	0.299000	0.22661	0.563000	0.77884	AGC		0.602	PEAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098937.2	NM_001080471		9	49	1	0	4.3838e-07	0.001855	7.28973e-07	9	49				
FCRL4	83417	broad.mit.edu	37	1	157556006	157556006	+	Missense_Mutation	SNP	T	T	G			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr1:157556006T>G	ENST00000271532.1	-	6	1222	c.1087A>C	c.(1087-1089)Aac>Cac	p.N363H	FCRL4_ENST00000448509.2_5'UTR	NM_031282.2	NP_112572.1	Q96PJ5	FCRL4_HUMAN	Fc receptor-like 4	363	Ig-like C2-type 4.				immune system process (GO:0002376)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.N363H(1)		breast(2)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(5)|lung(20)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	40	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.245)				CCGTAGCTGTTGTCTGCTGTA	0.502																																							uc001fqw.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|kidney(1)|skin(1)	4						c.(1087-1089)AAC>CAC		Fc receptor-like 4 precursor							111.0	97.0	102.0					1																	157556006		2203	4300	6503	SO:0001583	missense	83417					integral to membrane|plasma membrane	receptor activity	g.chr1:157556006T>G	AF343661	CCDS1166.1	1q21	2013-01-14			ENSG00000163518	ENSG00000163518		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18507	protein-coding gene	gene with protein product		605876				11290337, 11493702	Standard	NM_031282		Approved	FCRH4, IRTA1, IGFP2, CD307d	uc001fqw.3	Q96PJ5	OTTHUMG00000035488	ENST00000271532.1:c.1087A>C	1.37:g.157556006T>G	ENSP00000271532:p.Asn363His		Somatic				FCRL4_uc010phy.1_RNA	p.N363H	NM_031282	NP_112572	WXS	Illumina HiSeq	Unspecified	Q96PJ5	FCRL4_HUMAN			6	1223	-	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.245)	363			Ig-like C2-type 4.|Extracellular (Potential).		Q96PJ3|Q96RE0	Missense_Mutation	SNP	ENST00000271532.1	37	c.1087A>C	CCDS1166.1	.	.	.	.	.	.	.	.	.	.	T	14.52	2.560066	0.45590	.	.	ENSG00000163518	ENST00000271532	D	0.87729	-2.29	4.01	2.83	0.33086	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.42682	D	0.000677	D	0.90133	0.6917	M	0.89030	3	0.19300	N	0.999978	D	0.89917	1.0	D	0.87578	0.998	T	0.83109	-0.0124	10	0.87932	D	0	.	6.537	0.22359	0.2147:0.0:0.0:0.7853	.	363	Q96PJ5	FCRL4_HUMAN	H	363	ENSP00000271532:N363H	ENSP00000271532:N363H	N	-	1	0	FCRL4	155822630	0.989000	0.36119	0.195000	0.23364	0.097000	0.18754	2.107000	0.41844	0.640000	0.30582	0.383000	0.25322	AAC		0.502	FCRL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086180.1	NM_031282		17	185	0	0	0	0.001523	0	17	185				
CD1B	910	broad.mit.edu	37	1	158299700	158299700	+	Silent	SNP	G	G	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr1:158299700G>T	ENST00000368168.3	-	3	656	c.549C>A	c.(547-549)acC>acA	p.T183T		NM_001764.2	NP_001755.1	P29016	CD1B_HUMAN	CD1b molecule	183					antigen processing and presentation (GO:0019882)|immune response (GO:0006955)	cell surface (GO:0009986)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)		p.T183T(1)		breast(2)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	30	all_hematologic(112;0.0378)					ATCGGGGGCAGGTTTCATAGA	0.473																																							uc001frx.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(547-549)ACC>ACA		CD1B antigen precursor							134.0	124.0	127.0					1																	158299700		2203	4300	6503	SO:0001819	synonymous_variant	910				antigen processing and presentation|immune response	endosome membrane|integral to membrane|lysosomal membrane|plasma membrane	protein binding	g.chr1:158299700G>T	M28826	CCDS1176.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158485	ENSG00000158485		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1635	protein-coding gene	gene with protein product		188360	"""CD1B antigen, b polypeptide"", ""CD1b antigen"""	CD1		2447586	Standard	NM_001764		Approved		uc001frx.3	P29016	OTTHUMG00000017513	ENST00000368168.3:c.549C>A	1.37:g.158299700G>T			Somatic				CD1B_uc001frw.2_Silent_p.T76T	p.T183T	NM_001764	NP_001755	WXS	Illumina HiSeq	Unspecified	P29016	CD1B_HUMAN			3	657	-	all_hematologic(112;0.0378)		183			Extracellular (Potential).		Q5TDK9|Q5TDL0|Q9UMM2	Silent	SNP	ENST00000368168.3	37	c.549C>A	CCDS1176.1	.	.	.	.	.	.	.	.	.	.	G	2.757	-0.258704	0.05791	.	.	ENSG00000158485	ENST00000451207	.	.	.	4.46	-1.31	0.09230	.	.	.	.	.	T	0.06508	0.0167	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.36040	-0.9764	4	.	.	.	-1.2598	0.8773	0.01227	0.1887:0.1455:0.3274:0.3384	.	.	.	.	M	151	.	.	L	-	1	2	CD1B	156566324	0.000000	0.05858	0.016000	0.15963	0.088000	0.18126	-0.755000	0.04782	-0.327000	0.08551	-0.844000	0.03045	CTG		0.473	CD1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046350.2	NM_001764		11	236	1	0	6.40141e-05	0.000978	8.97834e-05	11	236				
PYHIN1	149628	broad.mit.edu	37	1	158943507	158943507	+	Missense_Mutation	SNP	C	C	A	rs372542909		TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr1:158943507C>A	ENST00000368140.1	+	8	1675	c.1430C>A	c.(1429-1431)cCt>cAt	p.P477H	PYHIN1_ENST00000392254.2_Intron|PYHIN1_ENST00000392252.3_Intron|PYHIN1_ENST00000368138.3_Missense_Mutation_p.P468H	NM_152501.4|NM_198928.4|NM_198929.4	NP_689714.2|NP_945146.1|NP_945147.1	Q6K0P9	IFIX_HUMAN	pyrin and HIN domain family, member 1	477					cell cycle (GO:0007049)	nucleus (GO:0005634)		p.P477H(1)		breast(2)|endometrium(3)|large_intestine(10)|lung(32)|ovary(3)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_hematologic(112;0.0378)					ACTGTGGCCCCTCCTCTTTCT	0.438																																							uc001ftb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|pancreas(1)	4						c.(1429-1431)CCT>CAT		pyrin and HIN domain family, member 1 alpha 1							162.0	144.0	150.0					1																	158943507		2203	4300	6503	SO:0001583	missense	149628				cell cycle	nuclear speck		g.chr1:158943507C>A	AY185344	CCDS1178.1, CCDS1179.1, CCDS30907.1, CCDS30908.1	1q23.1	2008-02-05			ENSG00000163564	ENSG00000163564			28894	protein-coding gene	gene with protein product		612677				15122330	Standard	NM_152501		Approved	IFIX, MGC23885	uc001ftb.3	Q6K0P9	OTTHUMG00000037109	ENST00000368140.1:c.1430C>A	1.37:g.158943507C>A	ENSP00000357122:p.Pro477His		Somatic				PYHIN1_uc001ftc.2_Missense_Mutation_p.P468H|PYHIN1_uc001ftd.2_Intron|PYHIN1_uc001fte.2_Intron	p.P477H	NM_152501	NP_689714	WXS	Illumina HiSeq	Unspecified	Q6K0P9	IFIX_HUMAN			8	1675	+	all_hematologic(112;0.0378)		477					Q5T3W6|Q6K0P6|Q6K0P7|Q6K0P8|Q8WW65	Missense_Mutation	SNP	ENST00000368140.1	37	c.1430C>A	CCDS1178.1	.	.	.	.	.	.	.	.	.	.	C	1.423	-0.572331	0.03882	.	.	ENSG00000163564	ENST00000368140;ENST00000368138	T;T	0.06768	3.29;3.26	1.4	-2.79	0.05841	.	.	.	.	.	T	0.00998	0.0033	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.44997	-0.9291	9	0.87932	D	0	.	4.6196	0.12444	0.2927:0.419:0.2883:0.0	.	468;477	Q6K0P9-2;Q6K0P9	.;IFIX_HUMAN	H	477;468	ENSP00000357122:P477H;ENSP00000357120:P468H	ENSP00000357120:P468H	P	+	2	0	PYHIN1	157210131	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.862000	0.00348	-2.522000	0.00497	-1.511000	0.00944	CCT		0.438	PYHIN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000090110.1	NM_152501		9	144	1	0	0.00448238	0.004482	0.00523342	9	144				
FAM78B	149297	broad.mit.edu	37	1	166039567	166039567	+	Missense_Mutation	SNP	C	C	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr1:166039567C>T	ENST00000338353.3	-	3	1286	c.697G>A	c.(697-699)Gca>Aca	p.A233T	FAM78B_ENST00000354422.3_Missense_Mutation_p.A233T			Q5VT40	FA78B_HUMAN	family with sequence similarity 78, member B	233								p.A233T(1)		central_nervous_system(1)|endometrium(5)|large_intestine(1)|lung(8)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	19	all_hematologic(923;0.0813)|Acute lymphoblastic leukemia(8;0.155)					TTCACTAGTGCATTAGGGGGG	0.627																																							uc001gdr.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)|skin(1)	2						c.(697-699)GCA>ACA		hypothetical protein LOC149297							93.0	92.0	92.0					1																	166039567		2203	4300	6503	SO:0001583	missense	149297							g.chr1:166039567C>T	AL626787	CCDS30931.1	1q24.1	2008-02-05			ENSG00000188859	ENSG00000188859			13495	protein-coding gene	gene with protein product							Standard	NM_001017961		Approved		uc021pee.1	Q5VT40	OTTHUMG00000034705	ENST00000338353.3:c.697G>A	1.37:g.166039567C>T	ENSP00000339681:p.Ala233Thr		Somatic				FAM78B_uc010plc.1_RNA|FAM78B_uc001gdq.2_RNA	p.A233T	NM_001017961	NP_001017961	WXS	Illumina HiSeq	Unspecified	Q5VT40	FA78B_HUMAN			3	1287	-	all_hematologic(923;0.0813)|Acute lymphoblastic leukemia(8;0.155)		233					B7Z693	Missense_Mutation	SNP	ENST00000338353.3	37	c.697G>A	CCDS30931.1	.	.	.	.	.	.	.	.	.	.	C	17.86	3.492584	0.64074	.	.	ENSG00000188859	ENST00000354422;ENST00000338353	D;D	0.95001	-3.58;-3.58	5.71	5.71	0.89125	.	0.045964	0.85682	D	0.000000	D	0.92315	0.7562	M	0.71036	2.16	0.50313	D	0.999863	P	0.42456	0.78	B	0.39068	0.289	D	0.94040	0.7308	9	0.87932	D	0	-7.08	17.3517	0.87326	0.0:1.0:0.0:0.0	.	233	Q5VT40	FA78B_HUMAN	T	233	ENSP00000346404:A233T;ENSP00000339681:A233T	ENSP00000339681:A233T	A	-	1	0	FAM78B	164306191	1.000000	0.71417	0.965000	0.40720	0.982000	0.71751	5.918000	0.69996	2.687000	0.91594	0.655000	0.94253	GCA		0.627	FAM78B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343108.1	NM_001017961		5	138	0	0	0	0.000602	0	5	138				
MPZL1	9019	broad.mit.edu	37	1	167745338	167745338	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr1:167745338G>T	ENST00000359523.2	+	5	845	c.643G>T	c.(643-645)Gct>Tct	p.A215S	MPZL1_ENST00000403379.3_3'UTR|MPZL1_ENST00000474859.1_Intron|MPZL1_ENST00000392121.3_Intron	NM_003953.5|NM_024569.4	NP_003944.1|NP_078845.3	O95297	MPZL1_HUMAN	myelin protein zero-like 1	215					cell-cell signaling (GO:0007267)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)	structural molecule activity (GO:0005198)	p.A215S(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(2)	15	all_hematologic(923;0.215)					AGTTAAGCAGGCTCCTCGGAA	0.423																																							uc001geo.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(643-645)GCT>TCT		myelin protein zero-like 1 isoform a							77.0	75.0	76.0					1																	167745338		2203	4300	6503	SO:0001583	missense	9019				cell-cell signaling|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	protein binding|structural molecule activity	g.chr1:167745338G>T	AF087020	CCDS1264.1, CCDS44273.1, CCDS53425.1	1q24.2	2013-01-11			ENSG00000197965	ENSG00000197965		"""Immunoglobulin superfamily / V-set domain containing"""	7226	protein-coding gene	gene with protein product		604376				9792637	Standard	NM_003953		Approved	PZR, FLJ21047	uc001geo.3	O95297	OTTHUMG00000034571	ENST00000359523.2:c.643G>T	1.37:g.167745338G>T	ENSP00000352513:p.Ala215Ser		Somatic				MPZL1_uc001gep.2_Intron|MPZL1_uc001geq.2_Intron|MPZL1_uc009wvh.2_RNA	p.A215S	NM_003953	NP_003944	WXS	Illumina HiSeq	Unspecified	O95297	MPZL1_HUMAN			5	845	+	all_hematologic(923;0.215)		215			Cytoplasmic (Potential).		B2REB9|B2REC0|Q5R332|Q8IX11|Q9BWZ3|Q9NYK4|Q9UL20	Missense_Mutation	SNP	ENST00000359523.2	37	c.643G>T	CCDS1264.1	.	.	.	.	.	.	.	.	.	.	G	13.90	2.375910	0.42105	.	.	ENSG00000197965	ENST00000359523	D	0.96168	-3.93	5.28	2.39	0.29439	.	.	.	.	.	D	0.83408	0.5248	N	0.24115	0.695	0.30600	N	0.760641	B	0.23377	0.084	B	0.22386	0.039	T	0.69628	-0.5094	8	0.31617	T	0.26	.	9.5957	0.39573	0.2194:0.0:0.7806:0.0	.	215	O95297	MPZL1_HUMAN	S	215	ENSP00000352513:A215S	ENSP00000352513:A215S	A	+	1	0	MPZL1	166011962	1.000000	0.71417	0.996000	0.52242	0.997000	0.91878	4.018000	0.57174	0.446000	0.26666	0.650000	0.86243	GCT		0.423	MPZL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083655.2	NM_024569		5	59	1	0	3.59834e-05	0.001168	5.19628e-05	5	59				
TBX19	9095	broad.mit.edu	37	1	168262493	168262493	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr1:168262493G>T	ENST00000367821.3	+	3	631	c.580G>T	c.(580-582)Gtg>Ttg	p.V194L		NM_005149.2	NP_005140.1	O60806	TBX19_HUMAN	T-box 19	194					anatomical structure morphogenesis (GO:0009653)|cell fate commitment (GO:0045165)|pituitary gland development (GO:0021983)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell differentiation (GO:0045595)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	enhancer sequence-specific DNA binding (GO:0001158)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.V194L(1)		NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|liver(1)|lung(11)|prostate(2)|skin(2)|urinary_tract(1)	34	all_hematologic(923;0.215)					GTTCATAGCCGTGACTGCCTA	0.483																																							uc001gfl.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(580-582)GTG>TTG		T-box 19							81.0	60.0	67.0					1																	168262493		2203	4300	6503	SO:0001583	missense	9095				anatomical structure morphogenesis	nucleus	DNA binding	g.chr1:168262493G>T	AJ010277	CCDS1272.1	1q23-q24	2008-02-05			ENSG00000143178	ENSG00000143178		"""T-boxes"""	11596	protein-coding gene	gene with protein product	"""TBS 19"""	604614				9888994	Standard	NM_005149		Approved	dj747L4.1, TPIT	uc001gfl.3	O60806	OTTHUMG00000034648	ENST00000367821.3:c.580G>T	1.37:g.168262493G>T	ENSP00000356795:p.Val194Leu		Somatic				TBX19_uc001gfj.3_Missense_Mutation_p.V125L	p.V194L	NM_005149	NP_005140	WXS	Illumina HiSeq	Unspecified	O60806	TBX19_HUMAN			3	631	+	all_hematologic(923;0.215)		194			T-box.		Q52M53	Missense_Mutation	SNP	ENST00000367821.3	37	c.580G>T	CCDS1272.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	27.9|27.9	4.873442|4.873442	0.91664|0.91664	.|.	.|.	ENSG00000143178|ENSG00000143178	ENST00000431969|ENST00000367821;ENST00000367828	.|D	.|0.88277	.|-2.36	5.02|5.02	5.02|5.02	0.67125|0.67125	.|p53-like transcription factor, DNA-binding (1);	.|0.000000	.|0.64402	.|D	.|0.000005	D|D	0.97334|0.97334	0.9128|0.9128	H|H	0.99682|0.99682	4.7|4.7	.|.	.|.	.|.	.|D;D	.|0.89917	.|1.0;0.999	.|D;D	.|0.91635	.|0.999;0.996	D|D	0.99771|0.99771	1.1024|1.1024	4|9	.|0.87932	.|D	.|0	.|.	17.9571|17.9571	0.89073|0.89073	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|194;125	.|O60806;B3KRD9	.|TBX19_HUMAN;.	L|L	126|194;134	.|ENSP00000356795:V194L	.|ENSP00000356795:V194L	R|V	+|+	2|1	0|0	TBX19|TBX19	166529117|166529117	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.994000|0.994000	0.84299|0.84299	9.236000|9.236000	0.95360|0.95360	2.323000|2.323000	0.78572|0.78572	0.563000|0.563000	0.77884|0.77884	CGT|GTG		0.483	TBX19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083825.1	NM_005149		3	40	1	0	6.4e-05	0.004672	8.97834e-05	3	40				
HMCN1	83872	broad.mit.edu	37	1	185959439	185959439	+	Silent	SNP	C	C	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr1:185959439C>T	ENST00000271588.4	+	22	3470	c.3241C>T	c.(3241-3243)Ctg>Ttg	p.L1081L	HMCN1_ENST00000485744.1_3'UTR|HMCN1_ENST00000367492.2_Silent_p.L1081L	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	1081	Ig-like C2-type 8.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						TCAACGAGGACTGTCCCAGGA	0.428																																							uc001grq.1		NA																	0				ovary(22)|skin(1)	23						c.(3241-3243)CTG>TTG		hemicentin 1 precursor							281.0	288.0	286.0					1																	185959439		2203	4300	6503	SO:0001819	synonymous_variant	83872				response to stimulus|visual perception	basement membrane	calcium ion binding	g.chr1:185959439C>T	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.3241C>T	1.37:g.185959439C>T			Somatic				HMCN1_uc001grr.1_Silent_p.L422L	p.L1081L	NM_031935	NP_114141	WXS	Illumina HiSeq	Unspecified	Q96RW7	HMCN1_HUMAN			22	3470	+			1081			Ig-like C2-type 8.		A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Silent	SNP	ENST00000271588.4	37	c.3241C>T	CCDS30956.1																																																																																				0.428	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935		78	456	0	0	0	0.00361	0	78	456				
LAX1	54900	broad.mit.edu	37	1	203743207	203743207	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr1:203743207G>T	ENST00000442561.2	+	5	985	c.595G>T	c.(595-597)Gca>Tca	p.A199S	LAX1_ENST00000367217.5_Missense_Mutation_p.A183S|LAX1_ENST00000367215.1_3'UTR	NM_017773.3	NP_060243.2	Q8IWV1	LAX1_HUMAN	lymphocyte transmembrane adaptor 1	199					antigen receptor-mediated signaling pathway (GO:0050851)|B cell activation (GO:0042113)|immune response (GO:0006955)|immunoglobulin secretion (GO:0048305)|inactivation of MAPK activity (GO:0000188)|intracellular signal transduction (GO:0035556)|negative regulation of T cell activation (GO:0050868)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|SH2 domain binding (GO:0042169)	p.A199S(1)		central_nervous_system(2)|endometrium(3)|large_intestine(2)|lung(13)|prostate(1)|stomach(1)|urinary_tract(2)	24	all_cancers(21;0.0915)		BRCA - Breast invasive adenocarcinoma(75;0.109)			TGTCCCCACAGCAGAAGAGAT	0.478																																							uc001haa.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)	2						c.(595-597)GCA>TCA		lymphocyte transmembrane adaptor 1 isoform a							88.0	84.0	85.0					1																	203743207		2203	4300	6503	SO:0001583	missense	54900				B cell activation|immune response|inactivation of MAPK activity|intracellular signal transduction|negative regulation of T cell activation	Golgi apparatus|integral to membrane|plasma membrane	protein kinase binding|SH2 domain binding	g.chr1:203743207G>T	AK000347	CCDS1441.2, CCDS44297.1	1q32.1	2008-02-05			ENSG00000122188	ENSG00000122188			26005	protein-coding gene	gene with protein product	"""LAT-like membrane associated protein"", ""linker for activation of x cells"""					12359715	Standard	NM_017773		Approved	LAX, FLJ20340	uc001haa.3	Q8IWV1	OTTHUMG00000035908	ENST00000442561.2:c.595G>T	1.37:g.203743207G>T	ENSP00000406970:p.Ala199Ser		Somatic				LAX1_uc010pql.1_Missense_Mutation_p.A183S|LAX1_uc001hab.2_Missense_Mutation_p.A123S	p.A199S	NM_017773	NP_060243	WXS	Illumina HiSeq	Unspecified	Q8IWV1	LAX1_HUMAN	BRCA - Breast invasive adenocarcinoma(75;0.109)		5	1005	+	all_cancers(21;0.0915)		199			Cytoplasmic (Potential).		B7Z744|J3KP69|Q6NSZ6|Q9NXB4	Missense_Mutation	SNP	ENST00000442561.2	37	c.595G>T	CCDS1441.2	.	.	.	.	.	.	.	.	.	.	G	22.1	4.245321	0.80024	.	.	ENSG00000122188	ENST00000442561;ENST00000367217	.	.	.	5.3	2.42	0.29668	.	0.457752	0.20448	N	0.092144	T	0.46521	0.1397	L	0.59436	1.845	0.09310	N	1	P;P	0.52061	0.95;0.95	P;P	0.52066	0.689;0.689	T	0.34428	-0.9829	9	0.66056	D	0.02	-1.0202	7.4542	0.27257	0.2702:0.0:0.7298:0.0	.	183;199	B7Z744;Q8IWV1	.;LAX1_HUMAN	S	199;183	.	ENSP00000356186:A183S	A	+	1	0	LAX1	202009830	0.038000	0.19896	0.000000	0.03702	0.697000	0.40408	2.126000	0.42026	0.240000	0.21263	0.655000	0.94253	GCA		0.478	LAX1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000087468.3	NM_017773		12	119	1	0	1.08611e-07	0.000978	1.85526e-07	12	119				
DIEXF	27042	broad.mit.edu	37	1	210015678	210015678	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr1:210015678G>T	ENST00000491415.2	+	9	1611	c.1554G>T	c.(1552-1554)atG>atT	p.M518I		NM_014388.6	NP_055203.4	Q68CQ4	DIEXF_HUMAN	digestive organ expansion factor homolog (zebrafish)	518					multicellular organismal development (GO:0007275)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.M518I(1)		breast(6)|central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(15)|large_intestine(7)|lung(12)|ovary(1)|skin(3)|stomach(1)|urinary_tract(2)	53						GAGTGCGGATGTGGAGCCTCA	0.448																																							uc001hhr.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1552-1554)ATG>ATT		digestive-organ expansion factor homolog							118.0	111.0	113.0					1																	210015678		2203	4300	6503	SO:0001583	missense	27042				multicellular organismal development	nucleus		g.chr1:210015678G>T	BC022964	CCDS1493.1	1q32.2	2011-08-12	2011-02-16	2011-02-16	ENSG00000117597	ENSG00000117597			28440	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 107"""	C1orf107		16322560	Standard	NM_014388		Approved	MGC29875, DEF, UTP25	uc001hhr.2	Q68CQ4	OTTHUMG00000036654	ENST00000491415.2:c.1554G>T	1.37:g.210015678G>T	ENSP00000419005:p.Met518Ile		Somatic				C1orf107_uc009xcu.1_Missense_Mutation_p.M233I	p.M518I	NM_014388	NP_055203	WXS	Illumina HiSeq	Unspecified	Q68CQ4	DIEXF_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0367)	9	1630	+			518					O75992|Q4VY00|Q63HL9	Missense_Mutation	SNP	ENST00000491415.2	37	c.1554G>T	CCDS1493.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	25.7|25.7	4.665649|4.665649	0.88251|0.88251	.|.	.|.	ENSG00000117597|ENSG00000117597	ENST00000457820|ENST00000491415	.|T	.|0.38722	.|1.12	6.17|6.17	6.17|6.17	0.99709|0.99709	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.68879|0.68879	0.3049|0.3049	M|M	0.82323|0.82323	2.585|2.585	0.58432|0.58432	D|D	0.999999|0.999999	.|D	.|0.71674	.|0.998	.|D	.|0.69479	.|0.964	T|T	0.65294|0.65294	-0.6203|-0.6203	5|10	.|0.38643	.|T	.|0.18	-39.4995|-39.4995	20.8794|20.8794	0.99867|0.99867	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|518	.|Q68CQ4	.|DIEXF_HUMAN	F|I	199|518	.|ENSP00000419005:M518I	.|ENSP00000419005:M518I	C|M	+|+	2|3	0|0	DIEXF|DIEXF	208082301|208082301	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	6.342000|6.342000	0.72982|0.72982	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	TGT|ATG		0.448	DIEXF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089127.2	NM_014388		4	112	1	0	0.00024832	0.000248	0.000326385	4	112				
SLC30A10	55532	broad.mit.edu	37	1	220100447	220100448	+	Splice_Site	DNP	CC	CC	AA			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr1:220100447_220100448CC>AA	ENST00000366926.3	-	2	802	c.641_641GG>TT	c.(640-642)gGGg>gTTgg	p.G214V	SLC30A10_ENST00000536446.1_5'UTR	NM_018713.2	NP_061183.2	Q6XR72	ZNT10_HUMAN	solute carrier family 30, member 10	214					zinc ion transport (GO:0006829)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation transmembrane transporter activity (GO:0008324)	p.?(1)		NS(1)|endometrium(1)|large_intestine(1)|lung(9)|skin(1)	13				GBM - Glioblastoma multiforme(131;0.051)|all cancers(67;0.209)		GAAGGAATCACCTGCATTCAAA	0.337																																					Colon(76;360 1614 43677 51136)	Colon(76;360 1614 43677 51136)	uc001hlw.2		NA																	1	Unknown(1)		lung(1)		0						c.e2-1		solute carrier family 30 (zinc transporter),																																				SO:0001630	splice_region_variant	55532				zinc ion transport	integral to membrane|plasma membrane	cation transmembrane transporter activity	g.chr1:220100447_220100448CC>AA	AY212919	CCDS31026.1	1q41	2013-05-22			ENSG00000196660	ENSG00000196660		"""Solute carriers"""	25355	protein-coding gene	gene with protein product	"""zinc transporter 8"""	611146				15154973	Standard	NR_046437		Approved	DKFZp547M236, ZnT-10, ZRC1, ZNT8	uc001hlw.3	Q6XR72	OTTHUMG00000037434	ENST00000366926.3:c.641_641delinsAA	1.37:g.220100447_220100448delinsAA			Somatic				SLC30A10_uc001hlu.1_Splice_Site|SLC30A10_uc001hlx.2_5'UTR	p.G214_splice	NM_018713	NP_061183	WXS	Illumina HiSeq	Unspecified	Q6XR72	ZNT10_HUMAN		GBM - Glioblastoma multiforme(131;0.051)|all cancers(67;0.209)	2	852	-								Q49AL9|Q9NPW0	Splice_Site	DNP	ENST00000366926.3	37	c.641_splice	CCDS31026.1																																																																																				0.337	SLC30A10-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357709.1	NM_018713	Missense_Mutation	20	123	0	0	0	0.004672	0	20	123				
SIPA1L2	57568	broad.mit.edu	37	1	232577115	232577115	+	Silent	SNP	G	G	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr1:232577115G>A	ENST00000366630.1	-	13	3922	c.3564C>T	c.(3562-3564)tcC>tcT	p.S1188S	SIPA1L2_ENST00000262861.4_Silent_p.S1188S|SIPA1L2_ENST00000308942.4_Silent_p.S262S			Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like 2	1188					regulation of small GTPase mediated signal transduction (GO:0051056)		GTPase activator activity (GO:0005096)	p.S1188S(1)		NS(1)|breast(5)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(49)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	103		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)				CCAGGACTTTGGAAGGTGGGC	0.413																																							uc001hvg.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|central_nervous_system(2)|pancreas(1)|skin(1)	6						c.(3562-3564)TCC>TCT		signal-induced proliferation-associated 1 like							207.0	214.0	212.0					1																	232577115		1828	4090	5918	SO:0001819	synonymous_variant	57568				regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity	g.chr1:232577115G>A	AB037810	CCDS41474.1	1q42.2	2008-02-05			ENSG00000116991	ENSG00000116991			23800	protein-coding gene	gene with protein product		611609					Standard	NM_020808		Approved	KIAA1389	uc001hvg.3	Q9P2F8	OTTHUMG00000037820	ENST00000366630.1:c.3564C>T	1.37:g.232577115G>A			Somatic				SIPA1L2_uc001hvf.2_Silent_p.S262S	p.S1188S	NM_020808	NP_065859	WXS	Illumina HiSeq	Unspecified	Q9P2F8	SI1L2_HUMAN			12	3722	-		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)	1188					Q2TV88|Q5VXR7|Q5VXR8|Q641Q4|Q8NA38|Q96DZ3|Q9H9F6	Silent	SNP	ENST00000366630.1	37	c.3564C>T	CCDS41474.1																																																																																				0.413	SIPA1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092318.1	XM_045839		25	419	0	0	0	0.004656	0	25	419				
TARBP1	6894	broad.mit.edu	37	1	234565957	234565957	+	Nonsense_Mutation	SNP	G	G	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr1:234565957G>A	ENST00000040877.1	-	15	2484	c.2485C>T	c.(2485-2487)Cag>Tag	p.Q829*		NM_005646.3	NP_005637.3	Q13395	TARB1_HUMAN	TAR (HIV-1) RNA binding protein 1	829					regulation of transcription from RNA polymerase II promoter (GO:0006357)|RNA processing (GO:0006396)	nucleus (GO:0005634)	RNA binding (GO:0003723)|RNA methyltransferase activity (GO:0008173)	p.Q829*(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(7)|large_intestine(6)|lung(22)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	55	Ovarian(103;0.0339)	all_cancers(173;0.00995)|Prostate(94;0.0115)|all_epithelial(177;0.172)	OV - Ovarian serous cystadenocarcinoma(106;0.000263)			GAGTCCAGCTGCAGCTCAGGC	0.552																																							uc001hwd.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(2)|skin(1)	3						c.(2485-2487)CAG>TAG		TAR RNA binding protein 1							92.0	96.0	95.0					1																	234565957		2203	4300	6503	SO:0001587	stop_gained	6894				regulation of transcription from RNA polymerase II promoter|RNA processing	nucleus	RNA binding|RNA methyltransferase activity	g.chr1:234565957G>A		CCDS1601.1	1q42.2	2012-06-12	2007-06-26		ENSG00000059588	ENSG00000059588			11568	protein-coding gene	gene with protein product	"""tRNA methyltransferase 3 homolog (S. cerevisiae)"""	605052	"""Tar (HIV-1) RNA binding protein 1"""			1936997	Standard	NM_005646		Approved	TRP-185, TRM3	uc001hwd.3	Q13395	OTTHUMG00000037947	ENST00000040877.1:c.2485C>T	1.37:g.234565957G>A	ENSP00000040877:p.Gln829*		Somatic					p.Q829*	NM_005646	NP_005637	WXS	Illumina HiSeq	Unspecified	Q13395	TARB1_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.000263)		15	2485	-	Ovarian(103;0.0339)	all_cancers(173;0.00995)|Prostate(94;0.0115)|all_epithelial(177;0.172)	829					Q9H581	Nonsense_Mutation	SNP	ENST00000040877.1	37	c.2485C>T	CCDS1601.1	.	.	.	.	.	.	.	.	.	.	G	37	6.110278	0.97291	.	.	ENSG00000059588	ENST00000040877	.	.	.	5.11	0.644	0.17776	.	0.258185	0.40728	N	0.001022	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.23302	T	0.38	-15.3008	4.9608	0.14065	0.077:0.2733:0.5088:0.141	.	.	.	.	X	829	.	ENSP00000040877:Q829X	Q	-	1	0	TARBP1	232632580	0.994000	0.37717	0.006000	0.13384	0.182000	0.23217	2.402000	0.44521	0.228000	0.21019	0.650000	0.86243	CAG		0.552	TARBP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092616.1	NM_005646		23	152	0	0	0	0.002299	0	23	152				
RYR2	6262	broad.mit.edu	37	1	237947042	237947042	+	Silent	SNP	G	G	C			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr1:237947042G>C	ENST00000366574.2	+	90	12347	c.12030G>C	c.(12028-12030)gtG>gtC	p.V4010V	RYR2_ENST00000609119.1_3'UTR|RYR2_ENST00000542537.1_Silent_p.V3994V|RYR2_ENST00000360064.6_Silent_p.V4016V	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	4010					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.V4008V(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CCAACAACGTGGAGATGATTC	0.368																																							uc001hyl.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(12028-12030)GTG>GTC		cardiac muscle ryanodine receptor							47.0	45.0	46.0					1																	237947042		1856	4108	5964	SO:0001819	synonymous_variant	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237947042G>C	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.12030G>C	1.37:g.237947042G>C			Somatic				RYR2_uc010pya.1_Silent_p.V425V	p.V4010V	NM_001035	NP_001026	WXS	Illumina HiSeq	Unspecified	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		90	12150	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	4010					Q15411|Q546N8|Q5T3P2	Silent	SNP	ENST00000366574.2	37	c.12030G>C	CCDS55691.1																																																																																				0.368	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		3	39	0	0	0	0.004672	0	3	39				
EXO1	9156	broad.mit.edu	37	1	242042514	242042514	+	Missense_Mutation	SNP	A	A	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr1:242042514A>T	ENST00000366548.3	+	13	2571	c.1978A>T	c.(1978-1980)Agt>Tgt	p.S660C	EXO1_ENST00000518483.1_Missense_Mutation_p.S660C|EXO1_ENST00000348581.5_Missense_Mutation_p.S660C	NM_130398.3	NP_569082.2	Q9UQ84	EXO1_HUMAN	exonuclease 1	660	Interaction with MSH2.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA catabolic process, exonucleolytic (GO:0000738)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|humoral immune response mediated by circulating immunoglobulin (GO:0002455)|isotype switching (GO:0045190)|meiotic nuclear division (GO:0007126)|mismatch repair (GO:0006298)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|somatic hypermutation of immunoglobulin genes (GO:0016446)	nucleus (GO:0005634)	5'-3' exodeoxyribonuclease activity (GO:0035312)|5'-3' exonuclease activity (GO:0008409)|DNA binding (GO:0003677)|double-stranded DNA 5'-3' exodeoxyribonuclease activity (GO:0051908)|exonuclease activity (GO:0004527)|flap endonuclease activity (GO:0048256)|metal ion binding (GO:0046872)|RNA-DNA hybrid ribonuclease activity (GO:0004523)|single-stranded DNA 5'-3' exodeoxyribonuclease activity (GO:0045145)|structure-specific DNA binding (GO:0043566)	p.S660C(1)		NS(1)|central_nervous_system(2)|endometrium(3)|large_intestine(3)|lung(29)|ovary(2)|skin(1)|stomach(2)|urinary_tract(2)	45	Ovarian(103;0.103)	all_cancers(173;0.0555)	OV - Ovarian serous cystadenocarcinoma(106;0.0107)			CGAGGAGTCCAGTGACGATGA	0.473								Editing and processing nucleases																															uc001hzh.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|lung(2)|skin(1)	5						c.(1978-1980)AGT>TGT	Direct_reversal_of_damage|Editing_and_processing_nucleases	exonuclease 1 isoform b							67.0	64.0	65.0					1																	242042514		2203	4300	6503	SO:0001583	missense	9156				meiosis|mismatch repair	nucleus	double-stranded DNA specific 5'-3' exodeoxyribonuclease activity|flap endonuclease activity|metal ion binding|protein binding|protein binding|ribonuclease H activity|single-stranded DNA specific 5'-3' exodeoxyribonuclease activity	g.chr1:242042514A>T	AF042282	CCDS1620.1, CCDS44336.1	1q42-q43	2008-07-18			ENSG00000174371	ENSG00000174371			3511	protein-coding gene	gene with protein product	"""rad2 nuclease family member, homolog of S. cerevisiae exonuclease 1"""	606063				9685493, 9788596	Standard	NM_003686		Approved	HEX1, hExoI	uc001hzh.3	Q9UQ84	OTTHUMG00000039965	ENST00000366548.3:c.1978A>T	1.37:g.242042514A>T	ENSP00000355506:p.Ser660Cys		Somatic				EXO1_uc001hzi.2_Missense_Mutation_p.S660C|EXO1_uc001hzj.2_Missense_Mutation_p.S660C|EXO1_uc009xgq.2_Missense_Mutation_p.S659C	p.S660C	NM_130398	NP_569082	WXS	Illumina HiSeq	Unspecified	Q9UQ84	EXO1_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0107)		13	2518	+	Ovarian(103;0.103)	all_cancers(173;0.0555)	660			Interaction with MSH2.		O60545|O75214|O75466|Q5T396|Q96IJ1|Q9UG38|Q9UNW0	Missense_Mutation	SNP	ENST00000366548.3	37	c.1978A>T	CCDS1620.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.33|14.33	2.503217|2.503217	0.44558|0.44558	.|.	.|.	ENSG00000174371|ENSG00000174371	ENST00000521202|ENST00000366548;ENST00000348581;ENST00000518483	.|T;T;T	.|0.50548	.|0.74;0.74;0.74	5.42|5.42	1.2|1.2	0.21068|0.21068	.|.	.|1.014050	.|0.07846	.|N	.|0.963834	T|T	0.48447|0.48447	0.1500|0.1500	L|L	0.54323|0.54323	1.7|1.7	0.09310|0.09310	N|N	1|1	.|P;P;P	.|0.48230	.|0.85;0.907;0.85	.|B;P;B	.|0.46452	.|0.319;0.517;0.319	T|T	0.38023|0.38023	-0.9680|-0.9680	5|10	.|0.51188	.|T	.|0.08	-27.8918|-27.8918	8.7206|8.7206	0.34439|0.34439	0.3501:0.0:0.6499:0.0|0.3501:0.0:0.6499:0.0	.|.	.|659;660;660	.|A8K5H6;Q9UQ84-4;Q9UQ84	.|.;.;EXO1_HUMAN	L|C	58|660	.|ENSP00000355506:S660C;ENSP00000311873:S660C;ENSP00000430251:S660C	.|ENSP00000311873:S660C	Q|S	+|+	2|1	0|0	EXO1|EXO1	240109137|240109137	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.068000|0.068000	0.16541|0.16541	-0.315000|-0.315000	0.08081|0.08081	0.029000|0.029000	0.15352|0.15352	-0.248000|-0.248000	0.11899|0.11899	CAG|AGT		0.473	EXO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000096405.1	NM_006027		4	80	0	0	0	0.000248	0	4	80				
SDCCAG8	10806	broad.mit.edu	37	1	243579109	243579109	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr1:243579109G>T	ENST00000366541.3	+	14	1840	c.1722G>T	c.(1720-1722)atG>atT	p.M574I	SDCCAG8_ENST00000343783.6_Missense_Mutation_p.M429I|SDCCAG8_ENST00000355875.4_Missense_Mutation_p.M531I	NM_006642.3	NP_006633.1	Q86SQ7	SDCG8_HUMAN	serologically defined colon cancer antigen 8	574	Gln-rich.|Mediates interaction with OFD1.|Sufficient for homodimerization. {ECO:0000250}.				establishment of cell polarity (GO:0030010)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|tube formation (GO:0035148)	cell-cell junction (GO:0005911)|centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)		p.M574I(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_cancers(71;0.000545)|all_epithelial(71;0.000509)|all_lung(81;0.0821)|Ovarian(71;0.0919)|all_neural(11;0.101)|Breast(184;0.218)	all_cancers(173;0.00395)	all cancers(7;1.58e-07)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00392)	COAD - Colon adenocarcinoma(196;0.145)		TACAGCAAATGGAGGCCCAGC	0.507																																							uc001hzw.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1720-1722)ATG>ATT		serologically defined colon cancer antigen 8							80.0	72.0	75.0					1																	243579109		2203	4300	6503	SO:0001583	missense	10806				establishment of cell polarity|G2/M transition of mitotic cell cycle|tube formation	cell-cell junction|centriole|cytosol	protein binding	g.chr1:243579109G>T	AF039690	CCDS31075.1	1q43	2011-08-02			ENSG00000054282	ENSG00000054282			10671	protein-coding gene	gene with protein product		613524				9610721, 20835237	Standard	NM_006642		Approved	NY-CO-8, CCCAP, SLSN7, NPHP10, BBS16	uc001hzw.3	Q86SQ7	OTTHUMG00000039996	ENST00000366541.3:c.1722G>T	1.37:g.243579109G>T	ENSP00000355499:p.Met574Ile		Somatic				SDCCAG8_uc010pyk.1_Missense_Mutation_p.M429I|SDCCAG8_uc010pyl.1_Missense_Mutation_p.M386I|SDCCAG8_uc001hzx.2_Intron	p.M574I	NM_006642	NP_006633	WXS	Illumina HiSeq	Unspecified	Q86SQ7	SDCG8_HUMAN	all cancers(7;1.58e-07)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00392)	COAD - Colon adenocarcinoma(196;0.145)	14	1878	+	all_cancers(71;0.000545)|all_epithelial(71;0.000509)|all_lung(81;0.0821)|Ovarian(71;0.0919)|all_neural(11;0.101)|Breast(184;0.218)	all_cancers(173;0.00395)	574			Mediates interaction with OFD1.|Gln-rich.|Potential.|Sufficient for homodimerization (By similarity).		O60527|Q3ZCR6|Q8N5F2|Q9P0F1	Missense_Mutation	SNP	ENST00000366541.3	37	c.1722G>T	CCDS31075.1	.	.	.	.	.	.	.	.	.	.	G	14.82	2.648626	0.47258	.	.	ENSG00000054282	ENST00000355875;ENST00000366541;ENST00000343783	T;T;T	0.49139	0.84;0.79;0.86	5.6	5.6	0.85130	.	0.094127	0.64402	D	0.000002	T	0.58004	0.2092	L	0.27053	0.805	0.58432	D	0.999997	D	0.67145	0.996	D	0.75484	0.986	T	0.52786	-0.8529	10	0.32370	T	0.25	-14.5821	19.9854	0.97342	0.0:0.0:1.0:0.0	.	574	Q86SQ7	SDCG8_HUMAN	I	531;574;429	ENSP00000348137:M531I;ENSP00000355499:M574I;ENSP00000341260:M429I	ENSP00000341260:M429I	M	+	3	0	SDCCAG8	241645732	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.786000	0.85741	2.786000	0.95864	0.563000	0.77884	ATG		0.507	SDCCAG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096485.1	NM_006642		7	32	1	0	0.00198382	0.001984	0.00237301	7	32				
OR1C1	26188	broad.mit.edu	37	1	247921475	247921475	+	Silent	SNP	G	G	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr1:247921475G>T	ENST00000408896.2	-	1	507	c.234C>A	c.(232-234)gtC>gtA	p.V78V		NM_012353.2	NP_036485.2	Q15619	OR1C1_HUMAN	olfactory receptor, family 1, subfamily C, member 1	78					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V78V(1)		central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(32)|skin(2)|upper_aerodigestive_tract(1)	46	all_cancers(71;4.34e-05)|all_epithelial(71;1.13e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)	all_cancers(173;0.0247)	OV - Ovarian serous cystadenocarcinoma(106;0.0168)			CCATTTGGGGGACTGTAGTCG	0.453																																							uc010pza.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(232-234)GTC>GTA		olfactory receptor, family 1, subfamily C,							69.0	65.0	66.0					1																	247921475		2039	4198	6237	SO:0001819	synonymous_variant	26188				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:247921475G>T	X89674	CCDS41481.1	1q44	2012-08-09			ENSG00000221888	ENSG00000221888		"""GPCR / Class A : Olfactory receptors"""	8182	protein-coding gene	gene with protein product						9119360	Standard	NM_012353		Approved	TPCR27, HSTPCR27	uc010pza.2	Q15619	OTTHUMG00000040198	ENST00000408896.2:c.234C>A	1.37:g.247921475G>T			Somatic					p.V78V	NM_012353	NP_036485	WXS	Illumina HiSeq	Unspecified	Q15619	OR1C1_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0168)		1	234	-	all_cancers(71;4.34e-05)|all_epithelial(71;1.13e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)	all_cancers(173;0.0247)	78			Helical; Name=2; (Potential).		B9EIR9|Q5VVD2|Q6IF97|Q8NGZ1|Q96R83	Silent	SNP	ENST00000408896.2	37	c.234C>A	CCDS41481.1																																																																																				0.453	OR1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096855.1			8	52	1	0	5.18039e-06	0.00308	8.15123e-06	8	52				
OR2L8	391190	broad.mit.edu	37	1	248112412	248112412	+	Missense_Mutation	SNP	C	C	G			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr1:248112412C>G	ENST00000357191.3	+	1	253	c.253C>G	c.(253-255)Ctg>Gtg	p.L85V	OR2L13_ENST00000366478.2_Intron	NM_001001963.1	NP_001001963.1	Q8NGY9	OR2L8_HUMAN	olfactory receptor, family 2, subfamily L, member 8 (gene/pseudogene)	85						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L85V(1)		endometrium(1)|kidney(3)|large_intestine(3)|lung(30)|ovary(1)|prostate(1)|skin(3)	42	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0152)			ATCTGATTTTCTGCATGGAAA	0.453																																							uc001idt.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(253-255)CTG>GTG		olfactory receptor, family 2, subfamily L,							278.0	249.0	259.0					1																	248112412		2203	4297	6500	SO:0001583	missense	391190				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248112412C>G	BK004459	CCDS31101.1	1q44	2013-10-10	2013-10-10		ENSG00000196936	ENSG00000196936		"""GPCR / Class A : Olfactory receptors"""	15014	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily L, member 8"""				Standard	NM_001001963		Approved		uc001idt.1	Q8NGY9	OTTHUMG00000040196	ENST00000357191.3:c.253C>G	1.37:g.248112412C>G	ENSP00000349719:p.Leu85Val		Somatic				OR2L13_uc001ids.2_Intron	p.L85V	NM_001001963	NP_001001963	WXS	Illumina HiSeq	Unspecified	Q8NGY9	OR2L8_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0152)		1	253	+	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		85			Extracellular (Potential).		Q6IF03	Missense_Mutation	SNP	ENST00000357191.3	37	c.253C>G	CCDS31101.1	.	.	.	.	.	.	.	.	.	.	C	6.850	0.526168	0.13066	.	.	ENSG00000196936	ENST00000357191	T	0.00532	6.75	1.64	0.389	0.16269	GPCR, rhodopsin-like superfamily (1);	0.000000	0.26394	U	0.024624	T	0.00580	0.0019	L	0.60904	1.88	0.09310	N	1	B	0.28667	0.219	B	0.27170	0.077	T	0.45571	-0.9252	10	0.34782	T	0.22	.	9.5448	0.39273	0.0:0.7831:0.2169:0.0	.	85	Q8NGY9	OR2L8_HUMAN	V	85	ENSP00000349719:L85V	ENSP00000349719:L85V	L	+	1	2	OR2L8	246179035	0.000000	0.05858	0.013000	0.15412	0.151000	0.21798	-1.306000	0.02735	0.905000	0.36596	0.479000	0.44913	CTG		0.453	OR2L8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096853.2			73	520	0	0	0	0.00361	0	73	520				
OR2L13	284521	broad.mit.edu	37	1	248263130	248263130	+	Silent	SNP	G	G	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr1:248263130G>T	ENST00000358120.2	+	2	598	c.453G>T	c.(451-453)ggG>ggT	p.G151G	OR2L13_ENST00000366478.2_Silent_p.G151G			Q8N349	OR2LD_HUMAN	olfactory receptor, family 2, subfamily L, member 13	151						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G151G(2)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(12)|lung(32)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	59	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0132)			GGACACTGGGGTCCATCAACT	0.488																																							uc001ids.2		NA																	2	Substitution - coding silent(2)		lung(2)	central_nervous_system(2)|ovary(1)|skin(1)	4						c.(451-453)GGG>GGT		olfactory receptor, family 2, subfamily L,							252.0	217.0	229.0					1																	248263130		2203	4300	6503	SO:0001819	synonymous_variant	284521				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity|protein binding	g.chr1:248263130G>T	BC028158	CCDS1637.1	1q44	2012-08-09			ENSG00000196071	ENSG00000196071		"""GPCR / Class A : Olfactory receptors"""	19578	protein-coding gene	gene with protein product				OR2L14			Standard	NM_175911		Approved		uc001ids.3	Q8N349	OTTHUMG00000040446	ENST00000358120.2:c.453G>T	1.37:g.248263130G>T			Somatic					p.G151G	NM_175911	NP_787107	WXS	Illumina HiSeq	Unspecified	Q8N349	OR2LD_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0132)		3	790	+	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		151			Helical; Name=4; (Potential).		Q5VUR5	Silent	SNP	ENST00000358120.2	37	c.453G>T	CCDS1637.1																																																																																				0.488	OR2L13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097342.1	NM_175911		55	363	1	0	1.67886e-27	0.00361	3.70361e-27	55	363				
OR2T6	254879	broad.mit.edu	37	1	248551546	248551546	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr1:248551546G>T	ENST00000355728.2	+	1	637	c.637G>T	c.(637-639)Gtg>Ttg	p.V213L		NM_001005471.1	NP_001005471.1	Q8NHC8	OR2T6_HUMAN	olfactory receptor, family 2, subfamily T, member 6	213						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V213L(1)		endometrium(3)|large_intestine(5)|lung(38)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CCCCTTCTCGGTGGTGACTGC	0.532																																							uc001iei.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(637-639)GTG>TTG		olfactory receptor, family 2, subfamily T,							295.0	223.0	247.0					1																	248551546		2203	4300	6503	SO:0001583	missense	254879				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248551546G>T	AF399481	CCDS31114.1	1q44	2012-08-09		2004-03-10	ENSG00000198104	ENSG00000198104		"""GPCR / Class A : Olfactory receptors"""	15018	protein-coding gene	gene with protein product				OR2T6P, OR2T9			Standard	NM_001005471		Approved	OST703	uc001iei.1	Q8NHC8	OTTHUMG00000040448	ENST00000355728.2:c.637G>T	1.37:g.248551546G>T	ENSP00000347965:p.Val213Leu		Somatic					p.V213L	NM_001005471	NP_001005471	WXS	Illumina HiSeq	Unspecified	Q8NHC8	OR2T6_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0265)		1	637	+	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		213			Helical; Name=5; (Potential).		A6NE36	Missense_Mutation	SNP	ENST00000355728.2	37	c.637G>T	CCDS31114.1	.	.	.	.	.	.	.	.	.	.	G	3.219	-0.159947	0.06502	.	.	ENSG00000198104	ENST00000355728	T	0.36157	1.27	4.13	3.21	0.36854	GPCR, rhodopsin-like superfamily (1);	0.000000	0.41001	D	0.000969	T	0.11793	0.0287	N	0.01729	-0.75	0.09310	N	1	B	0.23650	0.089	B	0.30716	0.119	T	0.37596	-0.9699	10	0.08179	T	0.78	.	5.1626	0.15070	0.1051:0.0:0.5384:0.3565	.	213	Q8NHC8	OR2T6_HUMAN	L	213	ENSP00000347965:V213L	ENSP00000347965:V213L	V	+	1	0	OR2T6	246618169	0.000000	0.05858	0.166000	0.22797	0.594000	0.36715	-0.723000	0.04952	2.295000	0.77249	0.643000	0.83706	GTG		0.532	OR2T6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097344.1	NM_001005471		14	102	1	0	1.3612e-06	0.003163	2.22144e-06	14	102				
FAM208B	54906	broad.mit.edu	37	10	5782212	5782212	+	Silent	SNP	G	G	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr10:5782212G>A	ENST00000328090.5	+	13	2704	c.2079G>A	c.(2077-2079)ggG>ggA	p.G693G	RP11-336A10.2_ENST00000411512.2_RNA	NM_017782.4	NP_060252	Q5VWN6	F208B_HUMAN	family with sequence similarity 208, member B	693								p.G693G(1)									CCCCAGTGGGGAAAGTCATGC	0.532																																							uc001iij.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(2077-2079)GGG>GGA		hypothetical protein LOC54906							88.0	91.0	90.0					10																	5782212		1867	4099	5966	SO:0001819	synonymous_variant	54906							g.chr10:5782212G>A	BX649177	CCDS41485.1	10p15.1	2011-09-14	2011-09-14	2011-09-14	ENSG00000108021	ENSG00000108021			23484	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 18"""	C10orf18		12477932	Standard	NM_017782		Approved	FLJ20360, bA318E3.2, KIAA2006	uc001iij.3	Q5VWN6	OTTHUMG00000017605	ENST00000328090.5:c.2079G>A	10.37:g.5782212G>A			Somatic				C10orf18_uc001iik.2_Intron	p.G693G	NM_017782	NP_060252	WXS	Illumina HiSeq	Unspecified	Q5VWN6	CJ018_HUMAN			13	2704	+			693					Q2YD91|Q5VWN5|Q6ZRQ8|Q8IVG4|Q9BUZ7|Q9H5J9|Q9H7A4|Q9H996|Q9NXA1	Silent	SNP	ENST00000328090.5	37	c.2079G>A	CCDS41485.1																																																																																				0.532	FAM208B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046571.2	NM_017782		5	168	0	0	0	0.000602	0	5	168				
PTF1A	256297	broad.mit.edu	37	10	23481584	23481584	+	Missense_Mutation	SNP	T	T	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr10:23481584T>A	ENST00000376504.3	+	1	329	c.125T>A	c.(124-126)cTg>cAg	p.L42Q		NM_178161.2	NP_835455.1	Q7RTS3	PTF1A_HUMAN	pancreas specific transcription factor, 1a	42					amacrine cell differentiation (GO:0035881)|cerebellum development (GO:0021549)|embryo development (GO:0009790)|endocrine pancreas development (GO:0031018)|exocrine pancreas development (GO:0031017)|neuron fate commitment (GO:0048663)|pancreas development (GO:0031016)|regulation of neural retina development (GO:0061074)|regulation of transcription, DNA-templated (GO:0006355)|retina layer formation (GO:0010842)|retinoic acid receptor signaling pathway (GO:0048384)|tissue development (GO:0009888)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)	p.L42Q(1)		endometrium(1)|large_intestine(1)|lung(3)|pancreas(1)|skin(1)	7						GGCGATGAGCTGCTGGCGGAC	0.667																																							uc001irp.2		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)|skin(1)	2						c.(124-126)CTG>CAG		pancreas specific transcription factor, 1a							46.0	42.0	43.0					10																	23481584		2203	4300	6503	SO:0001583	missense	256297				endocrine pancreas development|exocrine pancreas development|regulation of transcription, DNA-dependent|tissue development|transcription, DNA-dependent	cytoplasm|transcription factor complex		g.chr10:23481584T>A	BK000272	CCDS7143.1	10p12.31	2013-05-21			ENSG00000168267	ENSG00000168267		"""Basic helix-loop-helix proteins"""	23734	protein-coding gene	gene with protein product		607194				8703005	Standard	NM_178161		Approved	PTF1-p48, bHLHa29	uc001irp.3	Q7RTS3	OTTHUMG00000017815	ENST00000376504.3:c.125T>A	10.37:g.23481584T>A	ENSP00000365687:p.Leu42Gln		Somatic					p.L42Q	NM_178161	NP_835455	WXS	Illumina HiSeq	Unspecified	Q7RTS3	PTF1A_HUMAN			1	125	+			42					Q9HC25	Missense_Mutation	SNP	ENST00000376504.3	37	c.125T>A	CCDS7143.1	.	.	.	.	.	.	.	.	.	.	T	15.78	2.935058	0.52866	.	.	ENSG00000168267	ENST00000376504	D	0.96104	-3.91	2.96	2.96	0.34315	.	0.079800	0.50627	U	0.000106	D	0.94255	0.8155	L	0.29908	0.895	0.36095	D	0.843753	D	0.64830	0.994	P	0.58520	0.84	D	0.95380	0.8472	10	0.72032	D	0.01	-8.8853	10.8942	0.47012	0.0:0.0:0.0:1.0	.	42	Q7RTS3	PTF1A_HUMAN	Q	42	ENSP00000365687:L42Q	ENSP00000365687:L42Q	L	+	2	0	PTF1A	23521590	0.999000	0.42202	1.000000	0.80357	0.297000	0.27493	2.686000	0.46968	1.222000	0.43521	0.260000	0.18958	CTG		0.667	PTF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047210.1	NM_178161		4	39	0	0	0	0.000248	0	4	39				
ABI1	10006	broad.mit.edu	37	10	27048010	27048010	+	Silent	SNP	T	T	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr10:27048010T>A	ENST00000376142.2	-	9	1130	c.1059A>T	c.(1057-1059)ccA>ccT	p.P353P	ABI1_ENST00000376139.2_Silent_p.P321P|ABI1_ENST00000376166.1_Silent_p.P320P|ABI1_ENST00000376160.1_Silent_p.P320P|ABI1_ENST00000490841.2_Intron|ABI1_ENST00000376138.3_Silent_p.P326P|ABI1_ENST00000359188.4_Silent_p.P325P|ABI1_ENST00000376137.4_Intron|ABI1_ENST00000376170.4_Silent_p.P325P|ABI1_ENST00000536334.1_Intron|ABI1_ENST00000355394.4_Silent_p.P354P|ABI1_ENST00000376134.3_Silent_p.P327P|ABI1_ENST00000376140.3_Silent_p.P326P|ABI1_ENST00000346832.5_Silent_p.P370P	NM_005470.3	NP_005461.2	Q8IZP0	ABI1_HUMAN	abl-interactor 1	353	Pro-rich.				actin polymerization or depolymerization (GO:0008154)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|lamellipodium morphogenesis (GO:0072673)|megakaryocyte development (GO:0035855)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|somitogenesis (GO:0001756)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|intracellular (GO:0005622)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|SCAR complex (GO:0031209)	cytoskeletal protein binding (GO:0008092)|protein complex binding (GO:0032403)|protein tyrosine kinase activator activity (GO:0030296)	p.P353P(1)		central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(9)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						GAGAATAAAGTGGACCTCCAT	0.418																																							uc001isx.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)	1						c.(1057-1059)CCA>CCT		abl-interactor 1 isoform a							116.0	111.0	112.0					10																	27048010		2203	4300	6503	SO:0001819	synonymous_variant	10006				actin polymerization or depolymerization|cellular component movement|negative regulation of cell proliferation|peptidyl-tyrosine phosphorylation|transmembrane receptor protein tyrosine kinase signaling pathway	cell junction|cytoskeleton|cytosol|endoplasmic reticulum|filopodium|growth cone|lamellipodium|nucleus|soluble fraction|synapse|synaptosome	cytoskeletal protein binding	g.chr10:27048010T>A	U87166	CCDS7150.1, CCDS31169.1, CCDS31170.1, CCDS31171.1, CCDS53497.1, CCDS53498.1, CCDS53499.1, CCDS53500.1, CCDS53501.1, CCDS73077.1, CCDS73078.1	10p12.1	2009-05-29	2004-03-17	2004-03-19	ENSG00000136754	ENSG00000136754			11320	protein-coding gene	gene with protein product		603050	"""spectrin SH3 domain binding protein 1"""	SSH3BP1		9593709, 9010225	Standard	NM_005470		Approved	E3B1, ABI-1	uc001isx.3	Q8IZP0	OTTHUMG00000017848	ENST00000376142.2:c.1059A>T	10.37:g.27048010T>A			Somatic				ABI1_uc001ite.2_Silent_p.P320P|ABI1_uc010qdh.1_Intron|ABI1_uc010qdi.1_Intron|ABI1_uc001isy.2_Silent_p.P326P|ABI1_uc001ita.2_Silent_p.P326P|ABI1_uc001isz.2_Silent_p.P321P|ABI1_uc001itb.2_Silent_p.P370P|ABI1_uc001itc.2_Silent_p.P325P|ABI1_uc010qdj.1_Intron|ABI1_uc001itd.2_Silent_p.P325P|ABI1_uc010qdk.1_Intron|ABI1_uc010qdg.1_Silent_p.P192P	p.P353P	NM_005470	NP_005461	WXS	Illumina HiSeq	Unspecified	Q8IZP0	ABI1_HUMAN			9	1226	-			353			Pro-rich.		A9Z1Y6|B3KX62|B4DQ58|H7BXI6|O15147|O76049|O95060|Q5T2R3|Q5T2R4|Q5T2R6|Q5T2R7|Q5T2R9|Q5W070|Q5W072|Q8TB63|Q96S81|Q9NXZ9|Q9NYB8	Silent	SNP	ENST00000376142.2	37	c.1059A>T	CCDS7150.1																																																																																				0.418	ABI1-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000047287.1	NM_005470		5	126	0	0	0	0.001168	0	5	126				
RBP3	5949	broad.mit.edu	37	10	48389044	48389044	+	Missense_Mutation	SNP	C	C	G			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr10:48389044C>G	ENST00000224600.4	-	1	1947	c.1834G>C	c.(1834-1836)Gtg>Ctg	p.V612L	AL731561.2_ENST00000581861.1_RNA	NM_002900.2	NP_002891.1	P10745	RET3_HUMAN	retinol binding protein 3, interstitial	612	4 X approximate tandem repeats.				lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transport (GO:0006810)|visual perception (GO:0007601)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|interphotoreceptor matrix (GO:0033165)|vesicle (GO:0031982)	retinal binding (GO:0016918)|retinoid binding (GO:0005501)|retinol binding (GO:0019841)|serine-type peptidase activity (GO:0008236)	p.V612L(1)		central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(30)|ovary(1)|prostate(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	59					Vitamin A(DB00162)	GCATCGGGCACCACTCCACCA	0.672																																							uc001jez.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|central_nervous_system(1)	2						c.(1834-1836)GTG>CTG		retinol-binding protein 3 precursor	Vitamin A(DB00162)						32.0	34.0	34.0					10																	48389044		2198	4292	6490	SO:0001583	missense	5949				lipid metabolic process|proteolysis|transport|visual perception	interphotoreceptor matrix	retinal binding|serine-type peptidase activity	g.chr10:48389044C>G	M22453	CCDS73119.1	10q11.2	2014-05-06	2001-11-28		ENSG00000107618	ENSG00000265203			9921	protein-coding gene	gene with protein product		180290	"""retinol-binding protein 3, interstitial"""				Standard	NM_002900		Approved	D10S64, D10S65, D10S66, RP66	uc001jez.3	P10745	OTTHUMG00000188321	ENST00000224600.4:c.1834G>C	10.37:g.48389044C>G	ENSP00000224600:p.Val612Leu		Somatic					p.V612L	NM_002900	NP_002891	WXS	Illumina HiSeq	Unspecified	P10745	RET3_HUMAN			1	1948	-			612			4 X approximate tandem repeats.|2.		Q0QD34|Q5VSR0|Q8IXN0	Missense_Mutation	SNP	ENST00000224600.4	37	c.1834G>C	CCDS7218.1	.	.	.	.	.	.	.	.	.	.	C	15.53	2.861977	0.51482	.	.	ENSG00000107618	ENST00000224600	T	0.47177	0.85	5.53	4.63	0.57726	Interphotoreceptor retinol-binding (2);	0.000000	0.64402	D	0.000001	T	0.55081	0.1898	L	0.45581	1.43	0.52501	D	0.999953	D	0.58620	0.983	P	0.55713	0.782	T	0.59247	-0.7490	10	0.87932	D	0	-19.7645	13.458	0.61210	0.0:0.9248:0.0:0.0752	.	612	P10745	RET3_HUMAN	L	612	ENSP00000224600:V612L	ENSP00000224600:V612L	V	-	1	0	RBP3	48009050	1.000000	0.71417	0.974000	0.42286	0.783000	0.44284	7.038000	0.76537	1.360000	0.45960	0.561000	0.74099	GTG		0.672	RBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047888.1	NM_002900		4	52	0	0	0	0.000602	0	4	52				
GDF2	2658	broad.mit.edu	37	10	48414372	48414372	+	Silent	SNP	G	G	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr10:48414372G>A	ENST00000249598.1	-	2	655	c.496C>T	c.(496-498)Ctg>Ttg	p.L166L		NM_016204.1	NP_057288.1	Q9UK05	GDF2_HUMAN	growth differentiation factor 2	166					activin receptor signaling pathway (GO:0032924)|angiogenesis (GO:0001525)|blood vessel morphogenesis (GO:0048514)|BMP signaling pathway (GO:0030509)|cartilage development (GO:0051216)|cellular iron ion homeostasis (GO:0006879)|cellular response to BMP stimulus (GO:0071773)|growth (GO:0040007)|negative regulation of angiogenesis (GO:0016525)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell growth (GO:0030308)|negative regulation of DNA biosynthetic process (GO:2000279)|negative regulation of DNA replication (GO:0008156)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|ossification (GO:0001503)|osteoblast differentiation (GO:0001649)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|patterning of blood vessels (GO:0001569)|positive regulation of angiogenesis (GO:0045766)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.L166L(1)		breast(1)|endometrium(2)|large_intestine(3)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	28						CTTCCTTTCAGGTCATGAGAG	0.502																																							uc001jfa.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|skin(1)	3						c.(496-498)CTG>TTG		growth differentiation factor 2 precursor							75.0	66.0	69.0					10																	48414372		2203	4300	6503	SO:0001819	synonymous_variant	2658				activin receptor signaling pathway|BMP signaling pathway|cartilage development|cellular iron ion homeostasis|growth|negative regulation of angiogenesis|negative regulation of blood vessel endothelial cell migration|negative regulation of cell growth|negative regulation of DNA replication|negative regulation of endothelial cell proliferation|ossification|pathway-restricted SMAD protein phosphorylation|patterning of blood vessels|positive regulation of angiogenesis|positive regulation of endothelial cell proliferation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of transcription, DNA-dependent	extracellular space	cytokine activity|growth factor activity	g.chr10:48414372G>A	AF156891	CCDS73118.1	10q11.22	2014-05-06			ENSG00000128802	ENSG00000263761		"""Endogenous ligands"""	4217	protein-coding gene	gene with protein product		605120				10849432	Standard	NM_016204		Approved	BMP-9, BMP9	uc001jfa.1	Q9UK05	OTTHUMG00000188320	ENST00000249598.1:c.496C>T	10.37:g.48414372G>A			Somatic					p.L166L	NM_016204	NP_057288	WXS	Illumina HiSeq	Unspecified	Q9UK05	GDF2_HUMAN			2	659	-			166					Q5VSQ9|Q9Y571	Silent	SNP	ENST00000249598.1	37	c.496C>T	CCDS7219.1																																																																																				0.502	GDF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047891.1	NM_016204		3	67	0	0	0	0.004672	0	3	67				
PCDH15	65217	broad.mit.edu	37	10	55996679	55996679	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr10:55996679G>T	ENST00000320301.6	-	9	1283	c.889C>A	c.(889-891)Ccc>Acc	p.P297T	PCDH15_ENST00000395440.1_Missense_Mutation_p.P297T|PCDH15_ENST00000409834.1_Intron|PCDH15_ENST00000395442.1_Missense_Mutation_p.P297T|PCDH15_ENST00000414778.1_Missense_Mutation_p.P302T|PCDH15_ENST00000373957.3_Missense_Mutation_p.P275T|PCDH15_ENST00000373955.1_Missense_Mutation_p.P297T|PCDH15_ENST00000395430.1_Missense_Mutation_p.P297T|PCDH15_ENST00000395438.1_Missense_Mutation_p.P297T|PCDH15_ENST00000395445.1_Missense_Mutation_p.P297T|PCDH15_ENST00000395446.1_Missense_Mutation_p.P297T|PCDH15_ENST00000437009.1_Missense_Mutation_p.P297T|PCDH15_ENST00000395432.2_Missense_Mutation_p.P260T|PCDH15_ENST00000373965.2_Missense_Mutation_p.P297T|PCDH15_ENST00000361849.3_Missense_Mutation_p.P297T|PCDH15_ENST00000395433.1_Missense_Mutation_p.P275T	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	297	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)	p.P297T(2)|p.P302T(2)		NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				ACAATAATGGGGTTCAGTTCT	0.398										HNSCC(58;0.16)																													uc001jju.1		NA																	4	Substitution - Missense(4)		lung(4)	pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13						c.(889-891)CCC>ACC		protocadherin 15 isoform CD1-4 precursor							160.0	154.0	156.0					10																	55996679		2203	4300	6503	SO:0001583	missense	65217				equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding	g.chr10:55996679G>T	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.889C>A	10.37:g.55996679G>T	ENSP00000322604:p.Pro297Thr	HNSCC(58;0.16)	Somatic				PCDH15_uc010qhq.1_Missense_Mutation_p.P302T|PCDH15_uc010qhr.1_Missense_Mutation_p.P297T|PCDH15_uc010qhs.1_Missense_Mutation_p.P302T|PCDH15_uc010qht.1_Missense_Mutation_p.P297T|PCDH15_uc010qhu.1_Missense_Mutation_p.P297T|PCDH15_uc001jjv.1_Missense_Mutation_p.P275T|PCDH15_uc010qhv.1_Missense_Mutation_p.P297T|PCDH15_uc010qhw.1_Missense_Mutation_p.P260T|PCDH15_uc010qhx.1_Missense_Mutation_p.P297T|PCDH15_uc010qhy.1_Missense_Mutation_p.P302T|PCDH15_uc010qhz.1_Missense_Mutation_p.P297T|PCDH15_uc010qia.1_Missense_Mutation_p.P275T|PCDH15_uc010qib.1_Missense_Mutation_p.P275T|PCDH15_uc001jjw.2_Missense_Mutation_p.P297T	p.P297T	NM_033056	NP_149045	WXS	Illumina HiSeq	Unspecified	Q96QU1	PCD15_HUMAN			9	1284	-		Melanoma(3;0.117)|Lung SC(717;0.238)	297			Cadherin 3.|Extracellular (Potential).		A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	ENST00000320301.6	37	c.889C>A	CCDS7248.1	.	.	.	.	.	.	.	.	.	.	G	15.67	2.902003	0.52227	.	.	ENSG00000150275	ENST00000373965;ENST00000414778;ENST00000455746;ENST00000395438;ENST00000395445;ENST00000395446;ENST00000395442;ENST00000395440;ENST00000395432;ENST00000361849;ENST00000395433;ENST00000373957;ENST00000320301;ENST00000395430;ENST00000417177;ENST00000437009;ENST00000373955	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.58797	1.04;1.04;1.04;1.04;1.04;1.04;1.04;0.31;1.04;1.04;1.04;1.04;1.04;1.04;1.04	5.19	4.29	0.51040	Cadherin (2);Cadherin-like (1);	.	.	.	.	T	0.66036	0.2749	L	0.41573	1.285	0.37686	D	0.923658	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;0.999;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.97110	0.999;0.99;0.987;0.993;0.999;0.99;0.999;0.999;0.987;0.978;0.993;0.997;1.0;0.999;0.993	T	0.67738	-0.5593	9	0.35671	T	0.21	.	12.6863	0.56949	0.0816:0.0:0.9184:0.0	.	275;297;297;302;297;260;297;297;297;297;297;302;297;275;297	A2A3E8;E7EMG4;A2A3E7;C9JIG1;E7EM53;E7EMG0;A2A3E6;A2A3E3;C6ZEF5;A2A3E2;C6ZEF7;C9J4F3;Q96QU1-3;A2A3D8;Q96QU1	.;.;.;.;.;.;.;.;.;.;.;.;.;.;PCD15_HUMAN	T	297;302;297;297;297;297;297;297;260;297;275;275;297;297;302;297;297	ENSP00000363076:P297T;ENSP00000410304:P302T;ENSP00000378826:P297T;ENSP00000378832:P297T;ENSP00000378833:P297T;ENSP00000378829:P297T;ENSP00000378827:P297T;ENSP00000378820:P260T;ENSP00000354950:P297T;ENSP00000378821:P275T;ENSP00000363068:P275T;ENSP00000322604:P297T;ENSP00000378818:P297T;ENSP00000412628:P297T;ENSP00000363066:P297T	ENSP00000322604:P297T	P	-	1	0	PCDH15	55666685	1.000000	0.71417	1.000000	0.80357	0.621000	0.37620	8.866000	0.92307	1.193000	0.43086	-0.145000	0.13849	CCC		0.398	PCDH15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048121.2	NM_033056		16	200	1	0	0.000422831	0.004007	0.000542757	16	200				
RHOBTB1	9886	broad.mit.edu	37	10	62632019	62632019	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr10:62632019C>A	ENST00000337910.5	-	10	2182	c.1845G>T	c.(1843-1845)tgG>tgT	p.W615C	RHOBTB1_ENST00000357917.4_Missense_Mutation_p.W615C|RHOBTB1_ENST00000490827.1_5'UTR	NM_001242359.1|NM_014836.4	NP_001229288.1|NP_055651.1	O94844	RHBT1_HUMAN	Rho-related BTB domain containing 1	615					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)	p.W615C(1)		endometrium(4)|large_intestine(6)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)	23	Prostate(12;0.0112)					GGTGCAAACACCAGGCGGCCA	0.473																																							uc001jli.2		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)	1						c.(1843-1845)TGG>TGT		Rho-related BTB domain containing 1							145.0	138.0	140.0					10																	62632019		2203	4300	6503	SO:0001583	missense	9886				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|plasma membrane	GTP binding	g.chr10:62632019C>A	AB018283	CCDS7261.1	10q22.1	2013-01-08			ENSG00000072422	ENSG00000072422		"""BTB/POZ domain containing"""	18738	protein-coding gene	gene with protein product		607351				11222756	Standard	NM_014836		Approved	KIAA0740	uc001jlh.3	O94844	OTTHUMG00000018292	ENST00000337910.5:c.1845G>T	10.37:g.62632019C>A	ENSP00000338671:p.Trp615Cys		Somatic				RHOBTB1_uc001jlh.2_Missense_Mutation_p.W615C|RHOBTB1_uc001jlj.2_Missense_Mutation_p.W615C|RHOBTB1_uc001jlk.2_Missense_Mutation_p.W615C|RHOBTB1_uc009xpe.1_Missense_Mutation_p.W553C|RHOBTB1_uc009xpd.2_Intron|RHOBTB1_uc001jll.2_Missense_Mutation_p.W365C	p.W615C	NM_014836	NP_055651	WXS	Illumina HiSeq	Unspecified	O94844	RHBT1_HUMAN			11	2283	-	Prostate(12;0.0112)		615						Missense_Mutation	SNP	ENST00000337910.5	37	c.1845G>T	CCDS7261.1	.	.	.	.	.	.	.	.	.	.	C	17.60	3.429909	0.62844	.	.	ENSG00000072422	ENST00000357917;ENST00000337910	T;T	0.18657	2.2;2.2	5.6	5.6	0.85130	.	0.000000	0.64402	D	0.000001	T	0.40791	0.1131	M	0.88450	2.955	0.80722	D	1	P	0.41475	0.751	B	0.42738	0.396	T	0.49322	-0.8952	10	0.56958	D	0.05	.	19.6143	0.95626	0.0:1.0:0.0:0.0	.	615	O94844	RHBT1_HUMAN	C	615	ENSP00000350595:W615C;ENSP00000338671:W615C	ENSP00000338671:W615C	W	-	3	0	RHOBTB1	62302025	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.787000	0.85759	2.640000	0.89533	0.561000	0.74099	TGG		0.473	RHOBTB1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048220.1			9	104	1	0	0.00448238	0.004482	0.00523342	9	104				
DNAJC12	56521	broad.mit.edu	37	10	69565369	69565369	+	Silent	SNP	T	T	C			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr10:69565369T>C	ENST00000225171.2	-	4	626	c.474A>G	c.(472-474)tcA>tcG	p.S158S	RNU6-1250P_ENST00000391218.1_RNA|DNAJC12_ENST00000483798.2_Silent_p.S188S	NM_021800.2	NP_068572.1	Q9UKB3	DJC12_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 12	158								p.S158S(1)		breast(2)|kidney(2)|large_intestine(1)|lung(6)|upper_aerodigestive_tract(1)	12						GCGGGGAGACTGACTTCTCTA	0.393																																							uc001jnb.2		NA																	1	Substitution - coding silent(1)		lung(1)	breast(1)	1						c.(472-474)TCA>TCG		J domain containing protein 1 isoform a							281.0	300.0	294.0					10																	69565369		2203	4300	6503	SO:0001819	synonymous_variant	56521				protein folding		heat shock protein binding|unfolded protein binding	g.chr10:69565369T>C	AF176012	CCDS7271.1, CCDS7272.1	10q21.3	2011-09-02			ENSG00000108176	ENSG00000108176		"""Heat shock proteins / DNAJ (HSP40)"""	28908	protein-coding gene	gene with protein product	"""J domain protein 1"""	606060				10760603	Standard	NM_021800		Approved	JDP1	uc001jnb.3	Q9UKB3	OTTHUMG00000018339	ENST00000225171.2:c.474A>G	10.37:g.69565369T>C			Somatic					p.S158S	NM_021800	NP_068572	WXS	Illumina HiSeq	Unspecified	Q9UKB3	DJC12_HUMAN			4	642	-			158					Q5JVQ1|Q9UKB2	Silent	SNP	ENST00000225171.2	37	c.474A>G	CCDS7271.1																																																																																				0.393	DNAJC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048291.1	NM_021800		49	594	0	0	0	0.00361	0	49	594				
SGPL1	8879	broad.mit.edu	37	10	72614534	72614534	+	Missense_Mutation	SNP	G	G	C			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr10:72614534G>C	ENST00000373202.3	+	5	531	c.331G>C	c.(331-333)Gag>Cag	p.E111Q		NM_003901.3	NP_003892.2	O95470	SGPL1_HUMAN	sphingosine-1-phosphate lyase 1	111					androgen metabolic process (GO:0008209)|apoptotic signaling pathway (GO:0097190)|ceramide metabolic process (GO:0006672)|estrogen metabolic process (GO:0008210)|face morphogenesis (GO:0060325)|fatty acid metabolic process (GO:0006631)|fibroblast migration (GO:0010761)|hemopoiesis (GO:0030097)|kidney development (GO:0001822)|Leydig cell differentiation (GO:0033327)|luteinization (GO:0001553)|palate development (GO:0060021)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|post-embryonic development (GO:0009791)|regulation of multicellular organism growth (GO:0040014)|skeletal system morphogenesis (GO:0048705)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid catabolic process (GO:0030149)|sphingolipid metabolic process (GO:0006665)|vasculogenesis (GO:0001570)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)	carboxy-lyase activity (GO:0016831)|pyridoxal phosphate binding (GO:0030170)|sphinganine-1-phosphate aldolase activity (GO:0008117)	p.E111Q(1)		large_intestine(4)	4						AGTGGACAAAGAGTATGTGAA	0.408																																					Colon(151;1054 2458 6676 40971)	Colon(151;1054 2458 6676 40971)	uc001jrm.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(331-333)GAG>CAG		sphingosine-1-phosphate lyase 1	Pyridoxal Phosphate(DB00114)						232.0	215.0	221.0					10																	72614534		2203	4300	6503	SO:0001583	missense	8879				apoptosis|carboxylic acid metabolic process|ceramide metabolic process|sphingolipid catabolic process	integral to endoplasmic reticulum membrane	carboxy-lyase activity|pyridoxal phosphate binding|sphinganine-1-phosphate aldolase activity	g.chr10:72614534G>C	AI128825	CCDS31216.1	10q21	2008-08-01			ENSG00000166224	ENSG00000166224			10817	protein-coding gene	gene with protein product		603729				9464245, 17090686	Standard	NM_003901		Approved	SPL	uc001jrm.3	O95470	OTTHUMG00000018421	ENST00000373202.3:c.331G>C	10.37:g.72614534G>C	ENSP00000362298:p.Glu111Gln		Somatic					p.E111Q	NM_003901	NP_003892	WXS	Illumina HiSeq	Unspecified	O95470	SGPL1_HUMAN			5	553	+			111			Cytoplasmic (Potential).		B2RBD4|Q7Z732|Q9ULG8|Q9UN89	Missense_Mutation	SNP	ENST00000373202.3	37	c.331G>C	CCDS31216.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.15|12.15	1.850919|1.850919	0.32699|0.32699	.|.	.|.	ENSG00000166224|ENSG00000166224	ENST00000373202;ENST00000299297|ENST00000409118	T;T|.	0.44083|.	0.93;1.06|.	5.92|5.92	5.92|5.92	0.95590|0.95590	Pyridoxal phosphate-dependent transferase, major domain (1);|.	0.476064|.	0.27016|.	N|.	0.021355|.	T|T	0.31606|0.31606	0.0802|0.0802	N|N	0.16743|0.16743	0.435|0.435	0.26659|0.26659	N|N	0.971954|0.971954	B|.	0.15719|.	0.014|.	B|.	0.12156|.	0.007|.	T|T	0.18871|0.18871	-1.0323|-1.0323	10|6	0.13853|0.17832	T|T	0.58|0.49	-10.8828|-10.8828	13.4377|13.4377	0.61094|0.61094	0.0:0.157:0.843:0.0|0.0:0.157:0.843:0.0	.|.	111|.	O95470|.	SGPL1_HUMAN|.	Q|N	111;94|24	ENSP00000362298:E111Q;ENSP00000299297:E94Q|.	ENSP00000299297:E94Q|ENSP00000386549:K24N	E|K	+|+	1|3	0|2	SGPL1|SGPL1	72284540|72284540	1.000000|1.000000	0.71417|0.71417	0.989000|0.989000	0.46669|0.46669	0.963000|0.963000	0.63663|0.63663	3.933000|3.933000	0.56545|0.56545	2.813000|2.813000	0.96785|0.96785	0.561000|0.561000	0.74099|0.74099	GAG|AAG		0.408	SGPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048533.1	NM_003901		22	305	0	0	0	0.00278	0	22	305				
PIPSL	266971	broad.mit.edu	37	10	95720745	95720745	+	RNA	SNP	C	C	A	rs183136411	byFrequency	TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr10:95720745C>A	ENST00000480546.1	-	0	552					NR_002319.2		A2A3N6	PIPSL_HUMAN	PIP5K1A and PSMD4-like, pseudogene							cytoplasm (GO:0005737)	phosphatidylinositol phosphate kinase activity (GO:0016307)										ACAATGAACTCATCGTCGCTG	0.493													C|||	3	0.000599042	0.0	0.0	5008	,	,		20921	0.0		0.003	False		,,,				2504	0.0						uc009xuj.2		NA																	0					0						c.(409-411)GAG>TAG		RecName: Full=Phosphatidylinositol-4-phosphate 5-kinase type-1 alpha;          Short=PtdIns(4)P-5-kinase alpha;          Short=PIP5KIalpha;          EC=2.7.1.68; AltName: Full=Phosphatidylinositol-4-phosphate 5-kinase type I alpha; AltName: Full=68 kDa type I phosphatidylinositol-4-phosphate 5-kinase alpha;																																						266971							g.chr10:95720745C>A	BC068549		10q23.33	2010-10-27	2010-10-27	2007-07-06	ENSG00000180764	ENSG00000180764		"""Proteasome (prosome, macropain) subunits"""	23733	pseudogene	pseudogene			"""proteasome (prosome, macropain) 26S subunit, non-ATPase, 4, pseudogene 2"", ""phosphatidylinositol-4-phosphate 5-kinase, type I-like 1"", ""PIP5K1A and PSMD4-like"""	PSMD4P2, PIP5K1L1		16344562	Standard	NR_002319		Approved	PIP5K1A-PSMD4, PIP5K1P3	uc009xuj.2	A2A3N6	OTTHUMG00000137480		10.37:g.95720745C>A			Somatic					p.E137*	NR_002319		WXS	Illumina HiSeq	Unspecified					1	928	-								Q6NUK8	Nonsense_Mutation	SNP	ENST00000480546.1	37	c.409G>T																																																																																					0.493	PIPSL-002	PUTATIVE	basic	processed_transcript	pseudogene	OTTHUMT00000351483.1	NR_002319		8	58	1	0	0.000274275	0.004482	0.000355182	8	58				
NOC3L	64318	broad.mit.edu	37	10	96099536	96099536	+	Nonsense_Mutation	SNP	G	G	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr10:96099536G>T	ENST00000371361.3	-	17	2022	c.1922C>A	c.(1921-1923)tCa>tAa	p.S641*	NOC3L_ENST00000371350.1_Nonsense_Mutation_p.S641*|NOC3L_ENST00000543788.1_Nonsense_Mutation_p.S379*	NM_022451.9	NP_071896.8	Q8WTT2	NOC3L_HUMAN	nucleolar complex associated 3 homolog (S. cerevisiae)	641					fat cell differentiation (GO:0045444)	nuclear speck (GO:0016607)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)	p.S641*(1)		endometrium(3)|large_intestine(17)|lung(5)|ovary(1)|skin(2)|stomach(1)	29		Colorectal(252;0.0897)				GCCAATACTTGAATTTGGAAG	0.368																																							uc001kjq.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)	1						c.(1921-1923)TCA>TAA		nucleolar complex associated 3 homolog							89.0	86.0	87.0					10																	96099536		2203	4300	6503	SO:0001587	stop_gained	64318					nuclear speck|nucleolus	binding	g.chr10:96099536G>T	AL355341	CCDS7433.1	10q23.33	2004-04-20	2005-08-01	2005-08-01	ENSG00000173145	ENSG00000173145			24034	protein-coding gene	gene with protein product		610769	"""chromosome 10 open reading frame 117"""	C10orf117		15564382	Standard	NM_022451		Approved	AD24, FLJ12820, FAD24	uc001kjq.1	Q8WTT2	OTTHUMG00000018788	ENST00000371361.3:c.1922C>A	10.37:g.96099536G>T	ENSP00000360412:p.Ser641*		Somatic					p.S641*	NM_022451	NP_071896	WXS	Illumina HiSeq	Unspecified	Q8WTT2	NOC3L_HUMAN			17	2010	-		Colorectal(252;0.0897)	641					Q9H5M6|Q9H9D8	Nonsense_Mutation	SNP	ENST00000371361.3	37	c.1922C>A	CCDS7433.1	.	.	.	.	.	.	.	.	.	.	G	36	5.958141	0.97145	.	.	ENSG00000173145	ENST00000543788;ENST00000371361;ENST00000371350	.	.	.	5.28	5.28	0.74379	.	0.125321	0.56097	D	0.000034	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-3.3869	19.2708	0.94008	0.0:0.0:1.0:0.0	.	.	.	.	X	379;641;641	.	ENSP00000360401:S641X	S	-	2	0	NOC3L	96089526	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.580000	0.82523	2.640000	0.89533	0.561000	0.74099	TCA		0.368	NOC3L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049466.1	NM_022451		5	84	1	0	1.23904e-05	0.000602	1.87565e-05	5	84				
ANKRD2	26287	broad.mit.edu	37	10	99341096	99341096	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr10:99341096G>T	ENST00000307518.5	+	6	927	c.660G>T	c.(658-660)tgG>tgT	p.W220C	ANKRD2_ENST00000298808.5_Missense_Mutation_p.W220C|ANKRD2_ENST00000370655.1_Missense_Mutation_p.W193C|ANKRD2_ENST00000455090.1_Missense_Mutation_p.W193C			Q9GZV1	ANKR2_HUMAN	ankyrin repeat domain 2 (stretch responsive muscle)	220					muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|skeletal muscle cell differentiation (GO:0035914)	cytosol (GO:0005829)|euchromatin (GO:0000791)|I band (GO:0031674)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	protein kinase B binding (GO:0043422)|structural constituent of muscle (GO:0008307)	p.W220C(1)		breast(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|stomach(1)	7		all_hematologic(284;1.95e-06)|Colorectal(252;0.0163)		Epithelial(162;1.18e-94)|all cancers(201;9.31e-86)|BRCA - Breast invasive adenocarcinoma(275;0.0233)|STAD - Stomach adenocarcinoma(243;0.181)|KIRC - Kidney renal clear cell carcinoma(50;0.206)|Kidney(138;0.241)		CCATGCATTGGGCCTGCCGCG	0.527																																							uc001knw.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(658-660)TGG>TGT		ankyrin repeat domain 2 isoform a							54.0	57.0	56.0					10																	99341096		2203	4300	6503	SO:0001583	missense	26287				muscle contraction|muscle organ development		structural constituent of muscle	g.chr10:99341096G>T	AJ304805	CCDS7466.1, CCDS44468.1	10q23	2013-01-10			ENSG00000165887	ENSG00000165887		"""Ankyrin repeat domain containing"""	495	protein-coding gene	gene with protein product		610734				10873377, 15136035, 15677738	Standard	NM_001129981		Approved	ARPP	uc001knw.3	Q9GZV1	OTTHUMG00000018860	ENST00000307518.5:c.660G>T	10.37:g.99341096G>T	ENSP00000306163:p.Trp220Cys		Somatic				ANKRD2_uc009xvu.2_Missense_Mutation_p.W220C	p.W220C	NM_020349	NP_065082	WXS	Illumina HiSeq	Unspecified	Q9GZV1	ANKR2_HUMAN		Epithelial(162;1.18e-94)|all cancers(201;9.31e-86)|BRCA - Breast invasive adenocarcinoma(275;0.0233)|STAD - Stomach adenocarcinoma(243;0.181)|KIRC - Kidney renal clear cell carcinoma(50;0.206)|Kidney(138;0.241)	6	869	+		all_hematologic(284;1.95e-06)|Colorectal(252;0.0163)	220			ANK 3.		Q3B778|Q5T456|Q70EZ9|Q8WUD7|Q96MG0|Q9NQC9	Missense_Mutation	SNP	ENST00000307518.5	37	c.660G>T	CCDS7466.1	.	.	.	.	.	.	.	.	.	.	G	16.04	3.010684	0.54361	.	.	ENSG00000165887	ENST00000307518;ENST00000298808;ENST00000370655;ENST00000455090	T;T;T;T	0.64803	-0.12;-0.12;-0.12;-0.12	5.41	5.41	0.78517	Ankyrin repeat-containing domain (4);	0.000000	0.64402	D	0.000003	T	0.72011	0.3408	L	0.37630	1.12	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.988;0.999	T	0.70575	-0.4834	10	0.39692	T	0.17	-16.3524	17.9772	0.89131	0.0:0.0:1.0:0.0	.	220;220	Q9GZV1-2;Q9GZV1	.;ANKR2_HUMAN	C	220;220;193;193	ENSP00000306163:W220C;ENSP00000298808:W220C;ENSP00000359689:W193C;ENSP00000403114:W193C	ENSP00000298808:W220C	W	+	3	0	ANKRD2	99331086	1.000000	0.71417	1.000000	0.80357	0.355000	0.29361	8.006000	0.88564	2.525000	0.85131	0.650000	0.86243	TGG		0.527	ANKRD2-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				4	65	1	0	0.00024832	0.000248	0.000326385	4	65				
HPSE2	60495	broad.mit.edu	37	10	100995383	100995383	+	Silent	SNP	G	G	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr10:100995383G>A	ENST00000370552.3	-	1	236	c.177C>T	c.(175-177)acC>acT	p.T59T	HPSE2_ENST00000404542.1_Silent_p.T59T|HPSE2_ENST00000370546.1_Silent_p.T59T|HPSE2_ENST00000370549.1_Silent_p.T59T	NM_021828.4	NP_068600.4	Q8WWQ2	HPSE2_HUMAN	heparanase 2 (inactive)	59					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	intracellular (GO:0005622)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	heparan sulfate proteoglycan binding (GO:0043395)|heparanase activity (GO:0030305)	p.T59T(2)		NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	40				Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)		GTAGAATCAGGGTCTTTTCCT	0.522																																							uc001kpn.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(175-177)ACC>ACT		heparanase 2							183.0	181.0	182.0					10																	100995383		2203	4300	6503	SO:0001819	synonymous_variant	60495				carbohydrate metabolic process	intracellular|membrane	cation binding|heparanase activity	g.chr10:100995383G>A	AF282885	CCDS7477.1, CCDS53567.1, CCDS53568.1	10q23-q24	2014-05-09	2014-05-09		ENSG00000172987	ENSG00000172987			18374	protein-coding gene	gene with protein product		613469	"""urofacial syndrome"", ""heparanase 2"""	UFS		11027606, 20605132, 9199567, 20576607	Standard	NM_021828		Approved	HPA2, HPR2	uc001kpn.2	Q8WWQ2	OTTHUMG00000018880	ENST00000370552.3:c.177C>T	10.37:g.100995383G>A			Somatic				HPSE2_uc009xwc.1_Silent_p.T49T|HPSE2_uc001kpo.1_Silent_p.T49T|HPSE2_uc009xwd.1_Silent_p.T49T	p.T59T	NM_021828	NP_068600	WXS	Illumina HiSeq	Unspecified	Q8WWQ2	HPSE2_HUMAN		Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)	1	237	-			59					Q5VUH4|Q5VUH5|Q5VUH6|Q8WWQ1|Q9HB37|Q9HB38|Q9HB39	Silent	SNP	ENST00000370552.3	37	c.177C>T	CCDS7477.1																																																																																				0.522	HPSE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049789.1	NM_021828		22	274	0	0	0	0.001882	0	22	274				
SEC31B	25956	broad.mit.edu	37	10	102249904	102249904	+	Silent	SNP	C	C	G			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr10:102249904C>G	ENST00000370345.3	-	21	2923	c.2826G>C	c.(2824-2826)ctG>ctC	p.L942L		NM_015490.3	NP_056305.1	Q9NQW1	SC31B_HUMAN	SEC31 homolog B (S. cerevisiae)	942	Pro-rich.				protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|vesicle coat (GO:0030120)		p.L942L(1)		NS(1)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(3)|lung(17)|ovary(1)|urinary_tract(1)	36		Colorectal(252;0.117)		Epithelial(162;2.36e-10)|all cancers(201;2.09e-08)		CTAGTGGTCTCAGAGGAAGCA	0.622																																							uc001krc.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(2824-2826)CTG>CTC		SEC31 homolog B							87.0	84.0	85.0					10																	102249904		2203	4300	6503	SO:0001819	synonymous_variant	25956				protein transport|vesicle-mediated transport	endoplasmic reticulum membrane|ER to Golgi transport vesicle membrane		g.chr10:102249904C>G	AF274863	CCDS7495.1	10q24.32	2013-01-10	2006-10-05	2006-09-07	ENSG00000075826	ENSG00000075826		"""WD repeat domain containing"""	23197	protein-coding gene	gene with protein product		610258	"""SEC31-like 2 (S. cerevisiae)"""	SEC31L2		16495487	Standard	NM_015490		Approved	SEC31B-1, DKFZP434M183	uc001krc.1	Q9NQW1	OTTHUMG00000019342	ENST00000370345.3:c.2826G>C	10.37:g.102249904C>G			Somatic				SEC31B_uc010qpo.1_Silent_p.L941L|SEC31B_uc001krd.1_Silent_p.L479L|SEC31B_uc001krf.1_Intron|SEC31B_uc001kre.1_Intron	p.L942L	NM_015490	NP_056305	WXS	Illumina HiSeq	Unspecified	Q9NQW1	SC31B_HUMAN		Epithelial(162;2.36e-10)|all cancers(201;2.09e-08)	21	2928	-		Colorectal(252;0.117)	942			Pro-rich.		B7ZM75|Q6MZS3|Q86UF0|Q9Y4Q8	Silent	SNP	ENST00000370345.3	37	c.2826G>C	CCDS7495.1																																																																																				0.622	SEC31B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051198.1	NM_015490		4	87	0	0	0	0.000248	0	4	87				
ABLIM1	3983	broad.mit.edu	37	10	116203832	116203832	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr10:116203832C>A	ENST00000277895.5	-	17	1986	c.1889G>T	c.(1888-1890)aGg>aTg	p.R630M	ABLIM1_ENST00000369266.3_Missense_Mutation_p.R307M|ABLIM1_ENST00000369252.4_Missense_Mutation_p.R570M|ABLIM1_ENST00000392952.3_Missense_Mutation_p.R307M|ABLIM1_ENST00000369253.2_Missense_Mutation_p.R253M|ABLIM1_ENST00000533213.2_Missense_Mutation_p.R570M	NM_002313.5	NP_002304.3	O14639	ABLM1_HUMAN	actin binding LIM protein 1	630					axon guidance (GO:0007411)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|lamellipodium assembly (GO:0030032)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|visual perception (GO:0007601)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	actin binding (GO:0003779)|zinc ion binding (GO:0008270)	p.R570M(1)|p.R630M(1)|p.R307M(1)		breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	30		Colorectal(252;0.0373)|Breast(234;0.231)		Epithelial(162;0.0132)|all cancers(201;0.0383)		CAGAGATGACCTTTCCCGGCT	0.453																																							uc010qsg.1		NA																	3	Substitution - Missense(3)		lung(3)	breast(1)	1						c.(1888-1890)AGG>ATG		actin-binding LIM protein 1 isoform a							168.0	167.0	167.0					10																	116203832		2203	4300	6503	SO:0001583	missense	3983				axon guidance|cytoskeleton organization|organ morphogenesis|visual perception	actin cytoskeleton|cytoplasm	actin binding|zinc ion binding	g.chr10:116203832C>A	AF005654	CCDS7590.1, CCDS31289.1	10q25	2008-07-07		2002-09-13	ENSG00000099204	ENSG00000099204			78	protein-coding gene	gene with protein product		602330		LIMAB1, ABLIM		9245787	Standard	NM_002313		Approved	abLIM, limatin	uc021pyw.1	O14639	OTTHUMG00000019088	ENST00000277895.5:c.1889G>T	10.37:g.116203832C>A	ENSP00000277895:p.Arg630Met		Somatic				ABLIM1_uc010qsh.1_Missense_Mutation_p.R598M|ABLIM1_uc010qsi.1_Missense_Mutation_p.R570M|ABLIM1_uc010qsk.1_Missense_Mutation_p.R507M|ABLIM1_uc009xyp.2_Missense_Mutation_p.R594M|ABLIM1_uc010qsf.1_Missense_Mutation_p.R307M|ABLIM1_uc009xyn.2_Missense_Mutation_p.R246M|ABLIM1_uc010qsj.1_Missense_Mutation_p.R225M|ABLIM1_uc009xyo.2_Missense_Mutation_p.R443M	p.R630M	NM_002313	NP_002304	WXS	Illumina HiSeq	Unspecified	O14639	ABLM1_HUMAN		Epithelial(162;0.0132)|all cancers(201;0.0383)	17	1988	-		Colorectal(252;0.0373)|Breast(234;0.231)	630					A6NI16|A6NJ06|A8MXA9|B3KVH2|Q15039|Q5JVV1|Q5JVV2|Q5T6N2|Q5T6N3|Q5T6N5|Q68CQ9|Q9BUP1	Missense_Mutation	SNP	ENST00000277895.5	37	c.1889G>T	CCDS7590.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.87|16.87	3.240791|3.240791	0.58995|0.58995	.|.	.|.	ENSG00000099204|ENSG00000099204	ENST00000392955|ENST00000336585;ENST00000369252;ENST00000392952;ENST00000369257;ENST00000369267;ENST00000533213;ENST00000369262;ENST00000369263;ENST00000369266;ENST00000369256;ENST00000369260;ENST00000277895;ENST00000369253	.|T;T;T;T	.|0.30182	.|1.54;1.54;1.54;1.54	5.79|5.79	4.89|4.89	0.63831|0.63831	.|.	.|0.189683	.|0.45361	.|D	.|0.000378	T|T	0.43055|0.43055	0.1230|0.1230	M|M	0.76328|0.76328	2.33|2.33	0.45634|0.45634	D|D	0.99856|0.99856	.|B;P;P;B;B;P;B;B;P	.|0.41673	.|0.391;0.662;0.508;0.396;0.021;0.742;0.26;0.396;0.759	.|B;B;B;B;B;B;B;B;P	.|0.48189	.|0.117;0.213;0.337;0.212;0.028;0.382;0.289;0.149;0.57	T|T	0.37314|0.37314	-0.9711|-0.9711	5|10	.|0.59425	.|D	.|0.04	.|.	11.2622|11.2622	0.49089|0.49089	0.0:0.9158:0.0:0.0842|0.0:0.9158:0.0:0.0842	.|.	.|507;232;570;598;630;307;600;554;253	.|B7Z4H1;B4DQA3;F8W8M4;A6NKJ2;O14639;O14639-5;B3KVH2;C9K0X4;O14639-4	.|.;.;.;.;ABLM1_HUMAN;.;.;.;.	C|M	504|630;570;307;253;598;570;698;554;307;554;507;698;382	.|ENSP00000358256:R570M;ENSP00000376679:R307M;ENSP00000433629:R570M;ENSP00000358270:R307M	.|ENSP00000277895:R698M	G|R	-|-	1|2	0|0	ABLIM1|ABLIM1	116193822|116193822	0.995000|0.995000	0.38212|0.38212	0.890000|0.890000	0.34922|0.34922	0.981000|0.981000	0.71138|0.71138	3.318000|3.318000	0.51975|0.51975	2.735000|2.735000	0.93741|0.93741	0.591000|0.591000	0.81541|0.81541	GGT|AGG		0.453	ABLIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050469.3			11	214	1	0	1.08611e-07	0.000978	1.85526e-07	11	214				
PNLIPRP1	5407	broad.mit.edu	37	10	118355742	118355742	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr10:118355742C>A	ENST00000528052.1	+	6	553	c.482C>A	c.(481-483)cCc>cAc	p.P161H	PNLIPRP1_ENST00000358834.4_Missense_Mutation_p.P161H|PNLIPRP1_ENST00000534537.1_Missense_Mutation_p.P161H			P54315	LIPR1_HUMAN	pancreatic lipase-related protein 1	161					lipid metabolic process (GO:0006629)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|triglyceride lipase activity (GO:0004806)	p.P161H(1)		breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(1)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	38				all cancers(201;0.0161)		TATAGCTACCCCCCTTCCAAA	0.502																																							uc001lco.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)	2						c.(481-483)CCC>CAC		pancreatic lipase-related protein 1 precursor							171.0	178.0	175.0					10																	118355742		2203	4300	6503	SO:0001583	missense	5407				lipid metabolic process		calcium ion binding|triglyceride lipase activity	g.chr10:118355742C>A	BC025784	CCDS7595.1	10q26.12	2006-07-04			ENSG00000187021	ENSG00000187021			9156	protein-coding gene	gene with protein product		604422				1379598	Standard	NM_006229		Approved	PLRP1	uc001lco.1	P54315	OTTHUMG00000019109	ENST00000528052.1:c.482C>A	10.37:g.118355742C>A	ENSP00000433933:p.Pro161His		Somatic				PNLIPRP1_uc001lcp.2_Missense_Mutation_p.P161H|PNLIPRP1_uc009xys.1_RNA	p.P161H	NM_006229	NP_006220	WXS	Illumina HiSeq	Unspecified	P54315	LIPR1_HUMAN		all cancers(201;0.0161)	6	500	+			161					Q68D83|Q68DR6|Q8TAU2|Q9BS82	Missense_Mutation	SNP	ENST00000528052.1	37	c.482C>A	CCDS7595.1	.	.	.	.	.	.	.	.	.	.	C	11.43	1.635313	0.29068	.	.	ENSG00000187021	ENST00000531984;ENST00000358834;ENST00000528052;ENST00000530319;ENST00000534537	D;D;D;D;D	0.91351	-2.83;-2.83;-2.83;-2.83;-2.83	5.37	4.46	0.54185	Lipase, N-terminal (1);	0.261248	0.33217	N	0.005142	D	0.91442	0.7299	M	0.66297	2.02	0.46113	D	0.99887	P	0.47545	0.897	P	0.48089	0.566	D	0.92057	0.5653	10	0.72032	D	0.01	-0.337	14.4639	0.67470	0.0:0.7205:0.2795:0.0	.	161	P54315	LIPR1_HUMAN	H	161;161;161;116;161	ENSP00000436123:P161H;ENSP00000351695:P161H;ENSP00000433933:P161H;ENSP00000437263:P116H;ENSP00000434159:P161H	ENSP00000351695:P161H	P	+	2	0	PNLIPRP1	118345732	0.766000	0.28496	0.635000	0.29338	0.004000	0.04260	1.330000	0.33781	1.379000	0.46325	0.655000	0.94253	CCC		0.502	PNLIPRP1-011	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000384633.1	NM_006229		15	317	1	0	2.31682e-05	0.003163	3.44775e-05	15	317				
PDZD8	118987	broad.mit.edu	37	10	119043973	119043973	+	Silent	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr10:119043973C>A	ENST00000334464.5	-	5	2510	c.2271G>T	c.(2269-2271)ctG>ctT	p.L757L	PDZD8_ENST00000482496.1_5'UTR	NM_173791.3	NP_776152.1	Q8NEN9	PDZD8_HUMAN	PDZ domain containing 8	757					cytoskeleton organization (GO:0007010)|intracellular signal transduction (GO:0035556)|regulation of cell morphogenesis (GO:0022604)|viral process (GO:0016032)	membrane (GO:0016020)	metal ion binding (GO:0046872)	p.L757L(1)		kidney(3)|large_intestine(8)|lung(24)|upper_aerodigestive_tract(3)	38		Colorectal(252;0.19)		all cancers(201;0.0121)		AGGGGGCTTCCAGTCTCAATT	0.423																																							uc001lde.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(2269-2271)CTG>CTT		PDZ domain containing 8							130.0	116.0	121.0					10																	119043973		2203	4300	6503	SO:0001819	synonymous_variant	118987				intracellular signal transduction		metal ion binding	g.chr10:119043973C>A	AL122051	CCDS7600.1	10q26.12	2006-01-24		2006-01-24	ENSG00000165650	ENSG00000165650			26974	protein-coding gene	gene with protein product		614235		PDZK8		12477932	Standard	NM_173791		Approved	bA129M16.2, FLJ34427	uc001lde.1	Q8NEN9	OTTHUMG00000019122	ENST00000334464.5:c.2271G>T	10.37:g.119043973C>A			Somatic					p.L757L	NM_173791	NP_776152	WXS	Illumina HiSeq	Unspecified	Q8NEN9	PDZD8_HUMAN		all cancers(201;0.0121)	5	2470	-		Colorectal(252;0.19)	757					Q86WE0|Q86WE5|Q9UFF1	Silent	SNP	ENST00000334464.5	37	c.2271G>T	CCDS7600.1																																																																																				0.423	PDZD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050565.1	NM_173791		18	75	1	0	3.52763e-06	0.00499	5.59072e-06	18	75				
BUB3	9184	broad.mit.edu	37	10	124922239	124922239	+	Missense_Mutation	SNP	C	C	G	rs201610216		TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr10:124922239C>G	ENST00000368865.4	+	7	1075	c.866C>G	c.(865-867)aCt>aGt	p.T289S	BUB3_ENST00000538238.1_Missense_Mutation_p.T209S|BUB3_ENST00000481952.1_3'UTR|BUB3_ENST00000368859.2_Intron|BUB3_ENST00000368858.5_Missense_Mutation_p.T289S	NM_004725.3	NP_004716.1	O43684	BUB3_HUMAN	BUB3 mitotic checkpoint protein	289					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|attachment of spindle microtubules to kinetochore (GO:0008608)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|regulation of chromosome segregation (GO:0051983)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|spindle assembly checkpoint (GO:0071173)	cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleus (GO:0005634)		p.T289S(2)		endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)	9		all_neural(114;0.0765)|Colorectal(57;0.102)|all_lung(145;0.11)|Lung NSC(174;0.163)				AATGATGGGACTACGCTTGCA	0.423																																					GBM(161;1111 1985 17553 20049 26037)	GBM(161;1111 1985 17553 20049 26037)	uc001lhe.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(865-867)ACT>AGT		budding uninhibited by benzimidazoles 3 isoform							131.0	117.0	122.0					10																	124922239		2203	4300	6503	SO:0001583	missense	9184				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|attachment of spindle microtubules to kinetochore|cell division|meiosis|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle	condensed chromosome kinetochore|cytosol|nucleus	protein binding	g.chr10:124922239C>G	AF053304	CCDS7635.1, CCDS31306.1	10q24	2013-01-17	2013-01-17		ENSG00000154473	ENSG00000154473		"""WD repeat domain containing"""	1151	protein-coding gene	gene with protein product		603719	"""BUB3 (budding uninhibited by benzimidazoles 3, yeast) homolog"", ""budding uninhibited by benzimidazoles 3 homolog (yeast)"""			9660858	Standard	NM_004725		Approved	BUB3L	uc001lhe.2	O43684	OTTHUMG00000019197	ENST00000368865.4:c.866C>G	10.37:g.124922239C>G	ENSP00000357858:p.Thr289Ser		Somatic				BUB3_uc001lhf.3_Missense_Mutation_p.T289S|BUB3_uc001lhd.2_Missense_Mutation_p.T289S|BUB3_uc010qud.1_Missense_Mutation_p.T209S	p.T289S	NM_004725	NP_004716	WXS	Illumina HiSeq	Unspecified	O43684	BUB3_HUMAN			7	1108	+		all_neural(114;0.0765)|Colorectal(57;0.102)|all_lung(145;0.11)|Lung NSC(174;0.163)	289					A6NJ42|B2R6E7|D3DRE9|O43685	Missense_Mutation	SNP	ENST00000368865.4	37	c.866C>G	CCDS7635.1	.	.	.	.	.	.	.	.	.	.	C	8.652	0.898538	0.17686	.	.	ENSG00000154473	ENST00000368865;ENST00000538238;ENST00000368858	T;T;T	0.69561	-0.41;1.65;-0.41	5.4	5.4	0.78164	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.048483	0.85682	D	0.000000	T	0.35566	0.0936	N	0.01482	-0.84	0.47476	D	0.999436	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.44190	-0.9344	10	0.02654	T	1	-16.0111	15.0679	0.72011	0.0:0.8585:0.1415:0.0	.	289;289	O43684;O43684-2	BUB3_HUMAN;.	S	289;209;289	ENSP00000357858:T289S;ENSP00000444354:T209S;ENSP00000357851:T289S	ENSP00000357851:T289S	T	+	2	0	BUB3	124912229	1.000000	0.71417	0.962000	0.40283	0.992000	0.81027	4.768000	0.62293	2.684000	0.91462	0.650000	0.86243	ACT		0.423	BUB3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050835.1			6	174	0	0	0	0.001984	0	6	174				
FAM175B	23172	broad.mit.edu	37	10	126523082	126523082	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr10:126523082G>T	ENST00000298492.5	+	9	835	c.790G>T	c.(790-792)Gca>Tca	p.A264S		NM_032182.3	NP_115558.3	Q15018	F175B_HUMAN	family with sequence similarity 175, member B	264					cellular response to freezing (GO:0071497)	BRISC complex (GO:0070552)|cytoplasm (GO:0005737)	polyubiquitin binding (GO:0031593)	p.A264S(1)		NS(1)	1						ATTGCAGCAGGCAGTGTTAAG	0.473																																							uc001lib.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(790-792)GCA>TCA		hypothetical protein LOC23172							59.0	54.0	56.0					10																	126523082		2203	4300	6503	SO:0001583	missense	23172					BRISC complex	polyubiquitin binding	g.chr10:126523082G>T	D63877	CCDS31308.2	10q26.2	2013-01-24	2008-07-02	2008-07-02	ENSG00000165660	ENSG00000165660			28975	protein-coding gene	gene with protein product	"""Abraxas brother"""	611144	"""KIAA0157"""	KIAA0157		8590280	Standard	NM_032182		Approved	Em:AC068896.4, ABRO1	uc001lib.4	Q15018	OTTHUMG00000019218	ENST00000298492.5:c.790G>T	10.37:g.126523082G>T	ENSP00000298492:p.Ala264Ser		Somatic					p.A264S	NM_032182	NP_115558	WXS	Illumina HiSeq	Unspecified	Q15018	F175B_HUMAN			9	835	+			264			Potential.		B4DKR2|Q96H11	Missense_Mutation	SNP	ENST00000298492.5	37	c.790G>T	CCDS31308.2	.	.	.	.	.	.	.	.	.	.	G	14.21	2.468733	0.43839	.	.	ENSG00000165660	ENST00000298492	T	0.53206	0.63	5.23	4.3	0.51218	.	0.384079	0.31797	N	0.007049	T	0.27134	0.0665	N	0.16656	0.425	0.42541	D	0.993077	B	0.28419	0.211	B	0.27608	0.081	T	0.07065	-1.0792	10	0.12103	T	0.63	-35.5067	8.9033	0.35507	0.1751:0.0:0.8249:0.0	.	264	Q15018	F175B_HUMAN	S	264	ENSP00000298492:A264S	ENSP00000298492:A264S	A	+	1	0	FAM175B	126513072	1.000000	0.71417	0.956000	0.39512	0.883000	0.51084	2.114000	0.41911	1.368000	0.46115	0.655000	0.94253	GCA		0.473	FAM175B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050891.2	NM_032182		14	49	1	0	9.31168e-06	0.001855	1.44958e-05	14	49				
MKI67	4288	broad.mit.edu	37	10	129905645	129905645	+	Nonsense_Mutation	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr10:129905645C>A	ENST00000368654.3	-	13	4834	c.4459G>T	c.(4459-4461)Gag>Tag	p.E1487*	MKI67_ENST00000368653.3_Nonsense_Mutation_p.E1127*	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	1487	16 X 122 AA approximate repeats.				cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				GTAGTTTTCTCGTGAGTCGTG	0.512																																							uc001lke.2		NA																	0				ovary(4)|central_nervous_system(2)|skin(1)	7						c.(4459-4461)GAG>TAG		antigen identified by monoclonal antibody Ki-67							292.0	274.0	280.0					10																	129905645		2203	4300	6503	SO:0001587	stop_gained	4288				cell proliferation	nucleolus	ATP binding|protein C-terminus binding	g.chr10:129905645C>A	X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.4459G>T	10.37:g.129905645C>A	ENSP00000357643:p.Glu1487*		Somatic				MKI67_uc001lkf.2_Nonsense_Mutation_p.E1127*|MKI67_uc009yav.1_Nonsense_Mutation_p.E1062*|MKI67_uc009yaw.1_Nonsense_Mutation_p.E637*	p.E1487*	NM_002417	NP_002408	WXS	Illumina HiSeq	Unspecified	P46013	KI67_HUMAN			13	4654	-		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)	1487			5.|16 X 122 AA approximate repeats.		Q5VWH2	Nonsense_Mutation	SNP	ENST00000368654.3	37	c.4459G>T	CCDS7659.1	.	.	.	.	.	.	.	.	.	.	C	44	10.782047	0.99466	.	.	ENSG00000148773	ENST00000368654;ENST00000368653;ENST00000537609	.	.	.	3.46	0.409	0.16382	.	2.462970	0.02088	N	0.052910	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.13470	T	0.59	.	5.4388	0.16496	0.0:0.6251:0.1696:0.2053	.	.	.	.	X	1487;1127;1486	.	ENSP00000357642:E1127X	E	-	1	0	MKI67	129795635	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.795000	0.04580	0.261000	0.21753	-0.258000	0.10820	GAG		0.512	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050999.1	NM_002417		93	377	1	0	1.82171e-49	0.00361	4.03905e-49	93	377				
STK32C	282974	broad.mit.edu	37	10	134059441	134059441	+	Missense_Mutation	SNP	T	T	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr10:134059441T>A	ENST00000368625.4	-	2	405	c.320A>T	c.(319-321)cAg>cTg	p.Q107L	STK32C_ENST00000368622.1_5'UTR					serine/threonine kinase 32C									p.Q107L(1)|p.Q94L(1)		breast(1)|endometrium(2)|large_intestine(2)|lung(15)|ovary(2)|skin(1)	23		all_cancers(35;2.72e-11)|all_epithelial(44;2.33e-08)|Lung NSC(174;0.000855)|all_lung(145;0.00146)|all_neural(114;0.0299)|Breast(234;0.106)|Colorectal(31;0.112)|Melanoma(40;0.124)|Glioma(114;0.203)		Epithelial(32;3.99e-05)|all cancers(32;5.58e-05)|OV - Ovarian serous cystadenocarcinoma(35;9.96e-05)|BRCA - Breast invasive adenocarcinoma(275;0.222)		CCGAAGGATCTGGAAGTGGTC	0.637																																							uc001lle.1		NA																	2	Substitution - Missense(2)		lung(2)	large_intestine(2)|lung(2)|breast(1)	5						c.(280-282)CAG>CTG		serine/threonine kinase 32C							90.0	78.0	82.0					10																	134059441		2203	4300	6503	SO:0001583	missense	282974						ATP binding|metal ion binding|protein serine/threonine kinase activity	g.chr10:134059441T>A	AK057849	CCDS7666.1	10q26.3	2004-07-22			ENSG00000165752	ENSG00000165752			21332	protein-coding gene	gene with protein product							Standard	NM_173575		Approved	PKE, MGC23665, YANK3	uc001lle.1	Q86UX6	OTTHUMG00000019285	ENST00000368625.4:c.320A>T	10.37:g.134059441T>A	ENSP00000357614:p.Gln107Leu		Somatic				STK32C_uc001lld.1_5'UTR|STK32C_uc010quu.1_Missense_Mutation_p.Q107L|STK32C_uc009ybc.1_5'UTR|STK32C_uc009ybd.1_5'UTR|STK32C_uc001llc.1_RNA	p.Q94L	NM_173575	NP_775846	WXS	Illumina HiSeq	Unspecified	Q86UX6	ST32C_HUMAN		Epithelial(32;3.99e-05)|all cancers(32;5.58e-05)|OV - Ovarian serous cystadenocarcinoma(35;9.96e-05)|BRCA - Breast invasive adenocarcinoma(275;0.222)	2	421	-		all_cancers(35;2.72e-11)|all_epithelial(44;2.33e-08)|Lung NSC(174;0.000855)|all_lung(145;0.00146)|all_neural(114;0.0299)|Breast(234;0.106)|Colorectal(31;0.112)|Melanoma(40;0.124)|Glioma(114;0.203)	94			Protein kinase.			Missense_Mutation	SNP	ENST00000368625.4	37	c.281A>T		.	.	.	.	.	.	.	.	.	.	T	11.66	1.704295	0.30232	.	.	ENSG00000165752	ENST00000298630;ENST00000368625;ENST00000368620	T;T	0.66638	-0.22;-0.22	4.34	4.34	0.51931	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.60547	0.2277	L	0.32530	0.975	0.38803	D	0.955243	P;B	0.44281	0.831;0.261	P;B	0.46419	0.516;0.149	T	0.66803	-0.5831	9	0.87932	D	0	.	10.0979	0.42486	0.0:0.0:0.0:1.0	.	107;94	B7Z7J1;Q86UX6	.;ST32C_HUMAN	L	94;107;144	ENSP00000298630:Q94L;ENSP00000357614:Q107L	ENSP00000298630:Q94L	Q	-	2	0	STK32C	133909431	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	3.176000	0.50863	1.960000	0.56953	0.533000	0.62120	CAG		0.637	STK32C-201	KNOWN	basic	protein_coding	protein_coding		NM_173575		14	42	0	0	0	0.004007	0	14	42				
NAP1L4	4676	broad.mit.edu	37	11	2979700	2979700	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr11:2979700C>A	ENST00000380542.4	-	10	961	c.821G>T	c.(820-822)cGa>cTa	p.R274L	NAP1L4_ENST00000526115.1_Missense_Mutation_p.R274L	NM_005969.3	NP_005960.1	Q99733	NP1L4_HUMAN	nucleosome assembly protein 1-like 4	274					nucleosome assembly (GO:0006334)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)	p.R274L(1)		endometrium(2)|kidney(3)|large_intestine(1)|lung(6)|ovary(1)	13		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00301)|LUSC - Lung squamous cell carcinoma(625;0.211)		AACAGTGCCTCGACCCTTATG	0.388																																							uc001lxc.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(820-822)CGA>CTA		nucleosome assembly protein 1-like 4							218.0	201.0	206.0					11																	2979700		1916	4124	6040	SO:0001583	missense	4676				nucleosome assembly	chromatin assembly complex|cytoplasm	unfolded protein binding	g.chr11:2979700C>A	AA573896, BC022090, U77456	CCDS41599.1	11p15.5	2007-12-06			ENSG00000205531	ENSG00000205531			7640	protein-coding gene	gene with protein product		601651				8923002	Standard	NM_005969		Approved	NAP2	uc001lxc.3	Q99733	OTTHUMG00000011009	ENST00000380542.4:c.821G>T	11.37:g.2979700C>A	ENSP00000369915:p.Arg274Leu		Somatic				NAP1L4_uc009ydt.2_RNA|NAP1L4_uc010qxm.1_Missense_Mutation_p.R274L|NAP1L4_uc010qxn.1_Missense_Mutation_p.R274L	p.R274L	NM_005969	NP_005960	WXS	Illumina HiSeq	Unspecified	Q99733	NP1L4_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.00301)|LUSC - Lung squamous cell carcinoma(625;0.211)	10	962	-		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)	274					B2R6J4|F5HFY4	Missense_Mutation	SNP	ENST00000380542.4	37	c.821G>T	CCDS41599.1	.	.	.	.	.	.	.	.	.	.	C	27.8	4.862142	0.91511	.	.	ENSG00000205531	ENST00000399624;ENST00000380542;ENST00000526115	T;T	0.45668	0.89;0.89	4.4	4.4	0.53042	.	0.000000	0.85682	D	0.000000	T	0.72835	0.3510	M	0.93763	3.455	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.77004	0.989;0.975	T	0.80248	-0.1461	10	0.48119	T	0.1	-10.1007	17.1819	0.86857	0.0:1.0:0.0:0.0	.	274;274	F5HFY4;Q99733	.;NP1L4_HUMAN	L	274	ENSP00000369915:R274L;ENSP00000436397:R274L	ENSP00000369915:R274L	R	-	2	0	NAP1L4	2936276	1.000000	0.71417	0.831000	0.32960	0.833000	0.47200	7.207000	0.77899	2.283000	0.76528	0.591000	0.81541	CGA		0.388	NAP1L4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030273.3	NM_005969		6	71	1	0	0.00198382	0.001984	0.00237301	6	71				
OR51F2	119694	broad.mit.edu	37	11	4842727	4842727	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr11:4842727C>A	ENST00000322110.5	+	1	177	c.112C>A	c.(112-114)Cag>Aag	p.Q38K	MMP26_ENST00000380390.1_Intron|MMP26_ENST00000477339.1_Intron	NM_001004753.1	NP_001004753.1	Q8NH61	O51F2_HUMAN	olfactory receptor, family 51, subfamily F, member 2	38						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Q38K(1)		breast(2)|endometrium(4)|large_intestine(3)|lung(16)|ovary(1)|pancreas(1)|prostate(4)|skin(2)	33		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.0778)		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)		GAAAGCCACCCAGTACTGGAT	0.493																																							uc010qyn.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(112-114)CAG>AAG		olfactory receptor, family 51, subfamily F,							263.0	260.0	261.0					11																	4842727		2201	4298	6499	SO:0001583	missense	119694				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:4842727C>A	BK004281	CCDS31361.1	11p15.4	2012-08-09			ENSG00000176925	ENSG00000176925		"""GPCR / Class A : Olfactory receptors"""	15197	protein-coding gene	gene with protein product							Standard	NM_001004753		Approved		uc010qyn.2	Q8NH61	OTTHUMG00000066508	ENST00000322110.5:c.112C>A	11.37:g.4842727C>A	ENSP00000323952:p.Gln38Lys		Somatic					p.Q38K	NM_001004753	NP_001004753	WXS	Illumina HiSeq	Unspecified	Q8NH61	O51F2_HUMAN		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)	1	112	+		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.0778)	38			Extracellular (Potential).		Q6IFI1	Missense_Mutation	SNP	ENST00000322110.5	37	c.112C>A	CCDS31361.1	.	.	.	.	.	.	.	.	.	.	C	5.444	0.266953	0.10294	.	.	ENSG00000176925	ENST00000322110	T	0.00299	8.22	4.6	3.69	0.42338	.	0.407546	0.17365	N	0.176869	T	0.00241	0.0007	L	0.48362	1.52	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.39375	-0.9617	10	0.66056	D	0.02	.	11.8343	0.52314	0.0:0.9131:0.0:0.0869	.	38	Q8NH61	O51F2_HUMAN	K	38	ENSP00000323952:Q38K	ENSP00000323952:Q38K	Q	+	1	0	OR51F2	4799303	0.111000	0.22076	0.085000	0.20634	0.129000	0.20672	1.125000	0.31332	1.297000	0.44761	0.561000	0.74099	CAG		0.493	OR51F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142181.1	NM_001004753		30	428	1	0	9.39395e-14	0.00632	1.93612e-13	30	428				
OR51L1	119682	broad.mit.edu	37	11	5020793	5020793	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr11:5020793C>A	ENST00000321543.1	+	1	581	c.581C>A	c.(580-582)gCc>gAc	p.A194D		NM_001004755.1	NP_001004755.1	Q8NGJ5	O51L1_HUMAN	olfactory receptor, family 51, subfamily L, member 1	194						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A194D(1)		central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(19)|skin(2)|stomach(1)	31		Medulloblastoma(188;0.0061)|all_neural(188;0.0479)|Breast(177;0.086)		Epithelial(150;1.75e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0285)|LUSC - Lung squamous cell carcinoma(625;0.19)		TGTACAGATGCCAGGACCAAC	0.428																																							uc010qyu.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(580-582)GCC>GAC		olfactory receptor, family 51, subfamily L,							223.0	190.0	202.0					11																	5020793		2201	4298	6499	SO:0001583	missense	119682				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:5020793C>A	AB065799	CCDS31369.1	11p15.4	2012-08-09			ENSG00000176798	ENSG00000176798		"""GPCR / Class A : Olfactory receptors"""	14759	protein-coding gene	gene with protein product							Standard	NM_001004755		Approved		uc010qyu.2	Q8NGJ5	OTTHUMG00000066605	ENST00000321543.1:c.581C>A	11.37:g.5020793C>A	ENSP00000322156:p.Ala194Asp		Somatic					p.A194D	NM_001004755	NP_001004755	WXS	Illumina HiSeq	Unspecified	Q8NGJ5	O51L1_HUMAN		Epithelial(150;1.75e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0285)|LUSC - Lung squamous cell carcinoma(625;0.19)	1	581	+		Medulloblastoma(188;0.0061)|all_neural(188;0.0479)|Breast(177;0.086)	194			Extracellular (Potential).		Q6IFE5	Missense_Mutation	SNP	ENST00000321543.1	37	c.581C>A	CCDS31369.1	.	.	.	.	.	.	.	.	.	.	C	11.34	1.610259	0.28712	.	.	ENSG00000176798	ENST00000321543	T	0.00152	8.66	5.18	5.18	0.71444	GPCR, rhodopsin-like superfamily (1);	0.157082	0.29916	N	0.010875	T	0.00328	0.0010	L	0.47716	1.5	0.09310	N	0.999997	D	0.76494	0.999	D	0.71184	0.972	T	0.60480	-0.7255	10	0.72032	D	0.01	.	10.9225	0.47174	0.0:0.9145:0.0:0.0855	.	194	Q8NGJ5	O51L1_HUMAN	D	194	ENSP00000322156:A194D	ENSP00000322156:A194D	A	+	2	0	OR51L1	4977369	0.000000	0.05858	0.992000	0.48379	0.029000	0.11900	-0.288000	0.08377	2.685000	0.91497	0.557000	0.71058	GCC		0.428	OR51L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142812.1	NM_001004755		9	159	1	0	4.68919e-08	0.008291	8.26729e-08	9	159				
OR51L1	119682	broad.mit.edu	37	11	5020889	5020889	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr11:5020889C>A	ENST00000321543.1	+	1	677	c.677C>A	c.(676-678)aCt>aAt	p.T226N		NM_001004755.1	NP_001004755.1	Q8NGJ5	O51L1_HUMAN	olfactory receptor, family 51, subfamily L, member 1	226						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(19)|skin(2)|stomach(1)	31		Medulloblastoma(188;0.0061)|all_neural(188;0.0479)|Breast(177;0.086)		Epithelial(150;1.75e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0285)|LUSC - Lung squamous cell carcinoma(625;0.19)		ATTCTTAATACTGTGCTGGAT	0.418																																							uc010qyu.1		NA																	0				skin(1)	1						c.(676-678)ACT>AAT		olfactory receptor, family 51, subfamily L,							206.0	183.0	190.0					11																	5020889		2201	4298	6499	SO:0001583	missense	119682				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:5020889C>A	AB065799	CCDS31369.1	11p15.4	2012-08-09			ENSG00000176798	ENSG00000176798		"""GPCR / Class A : Olfactory receptors"""	14759	protein-coding gene	gene with protein product							Standard	NM_001004755		Approved		uc010qyu.2	Q8NGJ5	OTTHUMG00000066605	ENST00000321543.1:c.677C>A	11.37:g.5020889C>A	ENSP00000322156:p.Thr226Asn		Somatic					p.T226N	NM_001004755	NP_001004755	WXS	Illumina HiSeq	Unspecified	Q8NGJ5	O51L1_HUMAN		Epithelial(150;1.75e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0285)|LUSC - Lung squamous cell carcinoma(625;0.19)	1	677	+		Medulloblastoma(188;0.0061)|all_neural(188;0.0479)|Breast(177;0.086)	226			Cytoplasmic (Potential).		Q6IFE5	Missense_Mutation	SNP	ENST00000321543.1	37	c.677C>A	CCDS31369.1	.	.	.	.	.	.	.	.	.	.	C	10.86	1.470280	0.26423	.	.	ENSG00000176798	ENST00000321543	T	0.00193	8.58	5.18	5.18	0.71444	GPCR, rhodopsin-like superfamily (1);	0.340480	0.21111	N	0.079998	T	0.00356	0.0011	M	0.85041	2.73	0.21878	N	0.999492	P	0.35821	0.523	B	0.36418	0.224	T	0.43393	-0.9394	10	0.87932	D	0	.	17.4256	0.87525	0.0:1.0:0.0:0.0	.	226	Q8NGJ5	O51L1_HUMAN	N	226	ENSP00000322156:T226N	ENSP00000322156:T226N	T	+	2	0	OR51L1	4977465	0.019000	0.18553	0.997000	0.53966	0.583000	0.36354	2.380000	0.44327	2.685000	0.91497	0.557000	0.71058	ACT		0.418	OR51L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142812.1	NM_001004755		14	113	1	0	1.05317e-09	0.00245	1.97582e-09	14	113				
CNGA4	1262	broad.mit.edu	37	11	6261622	6261622	+	Missense_Mutation	SNP	G	G	T	rs201720317	byFrequency	TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr11:6261622G>T	ENST00000379936.2	+	4	713	c.598G>T	c.(598-600)Gca>Tca	p.A200S	CNGA4_ENST00000533426.1_Intron	NM_001037329.3	NP_001032406.1	Q8IV77	CNGA4_HUMAN	cyclic nucleotide gated channel alpha 4	200					phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|sensory perception of smell (GO:0007608)	integral component of plasma membrane (GO:0005887)	cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)	p.A200S(1)		endometrium(2)|kidney(1)|large_intestine(9)|lung(24)|prostate(3)|skin(1)	40		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;2.04e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CGGGCGTGACGCATGGGTGTA	0.557													G|||	2	0.000399361	0.0	0.0	5008	,	,		17637	0.002		0.0	False		,,,				2504	0.0						uc001mco.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(598-600)GCA>TCA		cyclic nucleotide gated channel alpha 4							63.0	68.0	66.0					11																	6261622		2200	4296	6496	SO:0001583	missense	1262				response to stimulus|sensory perception of smell		cAMP binding	g.chr11:6261622G>T	AK122736	CCDS31408.1	11p15.4	2011-07-05		2002-01-18		ENSG00000132259		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2152	protein-coding gene	gene with protein product		609472	"""cyclic nucleotide gated channel beta 2"""	CNCA2, CNGB2		11764791, 16382102	Standard	NM_001037329		Approved	OCNC2, OCNCb, CNG5	uc001mco.3	Q8IV77		ENST00000379936.2:c.598G>T	11.37:g.6261622G>T	ENSP00000369268:p.Ala200Ser		Somatic				CNGA4_uc010raa.1_Intron|CNGA4_uc001mcn.2_Missense_Mutation_p.A160S	p.A200S	NM_001037329	NP_001032406	WXS	Illumina HiSeq	Unspecified	Q8IV77	CNGA4_HUMAN		Epithelial(150;2.04e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)	4	705	+		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)	200			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000379936.2	37	c.598G>T	CCDS31408.1	2	9.157509157509158E-4	0	0.0	0	0.0	2	0.0034965034965034965	0	0.0	G	0.009	-1.846089	0.00568	.	.	ENSG00000132259	ENST00000379936	D	0.98419	-4.92	5.25	1.04	0.20106	Ion transport (1);	0.557871	0.20372	N	0.093629	D	0.86727	0.6002	N	0.00841	-1.15	0.09310	N	1	B;B	0.17852	0.0;0.024	B;B	0.15484	0.008;0.013	T	0.81953	-0.0697	10	0.02654	T	1	.	3.0316	0.06109	0.1954:0.2264:0.4626:0.1156	.	200;160	Q8IV77;Q8IV77-2	CNGA4_HUMAN;.	S	200	ENSP00000369268:A200S	ENSP00000369268:A200S	A	+	1	0	CNGA4	6218198	0.000000	0.05858	0.000000	0.03702	0.113000	0.19764	-0.521000	0.06245	-0.203000	0.10251	-0.813000	0.03139	GCA		0.557	CNGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383765.2	NM_001037329		12	157	1	0	0.00010058	0.001368	0.000136701	12	157				
OLFML1	283298	broad.mit.edu	37	11	7530738	7530738	+	Nonsense_Mutation	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr11:7530738C>A	ENST00000329293.3	+	3	922	c.528C>A	c.(526-528)taC>taA	p.Y176*	CTD-2516F10.2_ENST00000530201.1_RNA|OLFML1_ENST00000530135.1_Nonsense_Mutation_p.Y176*|OLFML1_ENST00000528758.1_3'UTR	NM_198474.3	NP_940876.2	Q6UWY5	OLFL1_HUMAN	olfactomedin-like 1	176	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.					extracellular region (GO:0005576)		p.Y176*(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(8)|ovary(3)|prostate(2)	24				Epithelial(150;6.96e-08)|BRCA - Breast invasive adenocarcinoma(625;0.194)		CAAAGGTGTACTTATTAATTG	0.418																																							uc001mfi.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(2)	2						c.(526-528)TAC>TAA		olfactomedin-like 1 precursor							109.0	107.0	108.0					11																	7530738		2201	4296	6497	SO:0001587	stop_gained	283298					extracellular region		g.chr11:7530738C>A	AY358591	CCDS7779.1	11p15	2008-02-05			ENSG00000183801	ENSG00000183801			24473	protein-coding gene	gene with protein product							Standard	NM_198474		Approved	UNQ564	uc001mfi.3	Q6UWY5	OTTHUMG00000165527	ENST00000329293.3:c.528C>A	11.37:g.7530738C>A	ENSP00000332511:p.Tyr176*		Somatic				OLFML1_uc010raz.1_Nonsense_Mutation_p.Y40*|OLFML1_uc010rba.1_Nonsense_Mutation_p.Y176*	p.Y176*	NM_198474	NP_940876	WXS	Illumina HiSeq	Unspecified	Q6UWY5	OLFL1_HUMAN		Epithelial(150;6.96e-08)|BRCA - Breast invasive adenocarcinoma(625;0.194)	3	880	+			176			Olfactomedin-like.		B4DP03|Q569G4	Nonsense_Mutation	SNP	ENST00000329293.3	37	c.528C>A	CCDS7779.1	.	.	.	.	.	.	.	.	.	.	C	36	5.808077	0.96967	.	.	ENSG00000183801	ENST00000530135;ENST00000329293	.	.	.	5.78	4.66	0.58398	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.3672	0.38232	0.0:0.086:0.0:0.914	.	.	.	.	X	176	.	ENSP00000332511:Y176X	Y	+	3	2	OLFML1	7487314	0.334000	0.24739	0.786000	0.31890	0.890000	0.51754	0.581000	0.23819	1.023000	0.39654	-0.471000	0.05019	TAC		0.418	OLFML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384656.1	NM_198474		5	179	1	0	1.23904e-05	0.000602	1.87565e-05	5	179				
LDHA	3939	broad.mit.edu	37	11	18424404	18424404	+	Missense_Mutation	SNP	G	G	T	rs200268273		TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr11:18424404G>T	ENST00000422447.3	+	5	709	c.436G>T	c.(436-438)Gtg>Ttg	p.V146L	LDHA_ENST00000379412.5_Missense_Mutation_p.V146L|AC084117.3_ENST00000496975.2_RNA|LDHA_ENST00000227157.4_Missense_Mutation_p.V146L|LDHA_ENST00000542179.1_Missense_Mutation_p.V146L|LDHA_ENST00000430553.2_Missense_Mutation_p.V88L|LDHA_ENST00000540430.1_Missense_Mutation_p.V175L|LDHA_ENST00000396222.2_Missense_Mutation_p.V146L	NM_001135239.1|NM_005566.3	NP_001128711.1|NP_005557.1	P00338	LDHA_HUMAN	lactate dehydrogenase A	146					cellular carbohydrate metabolic process (GO:0044262)|cellular metabolic process (GO:0044237)|cellular response to extracellular stimulus (GO:0031668)|glycolytic process (GO:0006096)|pyruvate metabolic process (GO:0006090)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)	L-lactate dehydrogenase activity (GO:0004459)	p.V146L(2)|p.V175L(1)		central_nervous_system(3)|endometrium(1)|large_intestine(4)|lung(4)	12						CTTGACCTACGTGGCTTGGAA	0.413																																							uc001mok.3		NA																	3	Substitution - Missense(3)		lung(3)	central_nervous_system(3)	3						c.(436-438)GTG>TTG		lactate dehydrogenase A isoform 1	NADH(DB00157)						146.0	144.0	144.0					11																	18424404		2199	4293	6492	SO:0001583	missense	3939				glycolysis|pyruvate metabolic process	cytosol	L-lactate dehydrogenase activity|protein binding	g.chr11:18424404G>T	X02152	CCDS7839.1, CCDS44549.1, CCDS53609.1, CCDS53610.1, CCDS53611.1	11p15.1	2012-10-02			ENSG00000134333	ENSG00000134333	1.1.1.27		6535	protein-coding gene	gene with protein product		150000				3000353	Standard	NM_005566		Approved		uc010rdd.2	P00338	OTTHUMG00000167721	ENST00000422447.3:c.436G>T	11.37:g.18424404G>T	ENSP00000395337:p.Val146Leu		Somatic				LDHA_uc010rdc.1_Missense_Mutation_p.V88L|LDHA_uc009yhn.2_Missense_Mutation_p.V146L|LDHA_uc009yho.2_5'UTR|LDHA_uc001mol.3_Missense_Mutation_p.V146L|LDHA_uc010rdd.1_Missense_Mutation_p.V175L	p.V146L	NM_005566	NP_005557	WXS	Illumina HiSeq	Unspecified	P00338	LDHA_HUMAN			5	708	+			146					B4DKQ2|B7Z5E3|D3DQY3|F8W819|Q53G53|Q6IBM7|Q6ZNV1|Q9UDE8|Q9UDE9	Missense_Mutation	SNP	ENST00000422447.3	37	c.436G>T	CCDS7839.1	.	.	.	.	.	.	.	.	.	.	G	35	5.533350	0.96460	.	.	ENSG00000134333	ENST00000422447;ENST00000543445;ENST00000430553;ENST00000396222;ENST00000541620;ENST00000445376;ENST00000227157;ENST00000540430;ENST00000379412;ENST00000542179	D;D;D;D;D;D;D;D	0.91740	-2.9;-2.9;-2.9;-2.9;-2.9;-2.9;-2.9;-2.9	5.35	5.35	0.76521	Lactate/malate dehydrogenase, N-terminal (1);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.96081	0.8723	M	0.81802	2.56	0.80722	D	1	P;B;D;D;P	0.63880	0.665;0.194;0.993;0.965;0.66	B;B;D;P;B	0.66497	0.402;0.233;0.944;0.506;0.402	D	0.96003	0.8995	10	0.87932	D	0	-2.0415	19.6142	0.95626	0.0:0.0:1.0:0.0	.	175;88;119;146;146	B7Z5E3;B4DKQ2;B4DJI1;F8W819;P00338	.;.;.;.;LDHA_HUMAN	L	146;146;88;146;118;119;146;175;146;146	ENSP00000395337:V146L;ENSP00000440161:V146L;ENSP00000406172:V88L;ENSP00000379524:V146L;ENSP00000227157:V146L;ENSP00000445175:V175L;ENSP00000368722:V146L;ENSP00000445331:V146L	ENSP00000227157:V146L	V	+	1	0	LDHA	18380980	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.434000	0.97515	2.941000	0.99782	0.655000	0.94253	GTG		0.413	LDHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258172.2	NM_005566		6	135	1	0	0.000157383	0.00308	0.000210004	6	135				
NELL1	4745	broad.mit.edu	37	11	20982101	20982101	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr11:20982101G>T	ENST00000357134.5	+	12	1447	c.1295G>T	c.(1294-1296)tGt>tTt	p.C432F	NELL1_ENST00000325319.5_Missense_Mutation_p.C375F|NELL1_ENST00000298925.5_Missense_Mutation_p.C460F|NELL1_ENST00000532434.1_Missense_Mutation_p.C432F	NM_006157.3|NM_201551.1	NP_006148.2|NP_963845.1	Q92832	NELL1_HUMAN	NEL-like 1 (chicken)	432					cell differentiation (GO:0030154)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of osteoblast proliferation (GO:0033689)|nervous system development (GO:0007399)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of gene expression (GO:0010468)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)	p.C432F(1)		NS(1)|breast(3)|endometrium(5)|kidney(3)|large_intestine(15)|lung(36)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	70						TCTGCCTACTGTGAAGGTAAG	0.418																																							uc001mqe.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|large_intestine(1)	3						c.(1294-1296)TGT>TTT		nel-like 1 isoform 1 precursor							178.0	163.0	168.0					11																	20982101		2203	4300	6503	SO:0001583	missense	4745				cell adhesion|nervous system development	extracellular region	calcium ion binding|structural molecule activity	g.chr11:20982101G>T	AK127805	CCDS7855.1, CCDS44555.1, CCDS73267.1, CCDS73268.1	11p15.1	2008-02-01	2001-11-28		ENSG00000165973	ENSG00000165973			7750	protein-coding gene	gene with protein product		602319	"""nel (chicken)-like 1"""			8975702	Standard	NM_006157		Approved	IDH3GL, FLJ45906	uc001mqe.3	Q92832	OTTHUMG00000166042	ENST00000357134.5:c.1295G>T	11.37:g.20982101G>T	ENSP00000349654:p.Cys432Phe		Somatic				NELL1_uc001mqf.2_Missense_Mutation_p.C432F|NELL1_uc009yid.2_Missense_Mutation_p.C460F|NELL1_uc010rdo.1_Missense_Mutation_p.C375F|NELL1_uc010rdp.1_Missense_Mutation_p.C192F	p.C432F	NM_006157	NP_006148	WXS	Illumina HiSeq	Unspecified	Q92832	NELL1_HUMAN			12	1448	+			432			EGF-like 1.		B2CKC1|Q4VB90|Q4VB91|Q6NSY8|Q9Y472	Missense_Mutation	SNP	ENST00000357134.5	37	c.1295G>T	CCDS7855.1	.	.	.	.	.	.	.	.	.	.	G	19.94	3.919362	0.73098	.	.	ENSG00000165973	ENST00000298925;ENST00000357134;ENST00000325319;ENST00000532434	D;D;D;D	0.83335	-1.71;-1.71;-1.71;-1.71	5.38	5.38	0.77491	Epidermal growth factor-like (1);	0.000000	0.85682	D	0.000000	D	0.91563	0.7335	M	0.78344	2.41	0.80722	D	1	D;D;D;D	0.89917	0.999;0.998;1.0;0.998	D;D;D;D	0.83275	0.996;0.991;0.996;0.991	D	0.92143	0.5722	10	0.87932	D	0	-10.9363	19.4906	0.95048	0.0:0.0:1.0:0.0	.	375;460;432;432	F5H6I3;B3KXR2;Q92832-2;Q92832	.;.;.;NELL1_HUMAN	F	460;432;375;432	ENSP00000298925:C460F;ENSP00000349654:C432F;ENSP00000317837:C375F;ENSP00000437170:C432F	ENSP00000298925:C460F	C	+	2	0	NELL1	20938677	1.000000	0.71417	1.000000	0.80357	0.831000	0.47069	9.143000	0.94623	2.673000	0.90976	0.655000	0.94253	TGT		0.418	NELL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387588.1	NM_006157		5	162	1	0	3.59834e-05	0.001168	5.19628e-05	5	162				
NELL1	4745	broad.mit.edu	37	11	21594836	21594836	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr11:21594836C>A	ENST00000357134.5	+	19	2415	c.2263C>A	c.(2263-2265)Cta>Ata	p.L755I	NELL1_ENST00000325319.5_Missense_Mutation_p.L698I|NELL1_ENST00000529218.1_3'UTR|NELL1_ENST00000298925.5_Missense_Mutation_p.L783I|NELL1_ENST00000532434.1_Missense_Mutation_p.L708I	NM_006157.3|NM_201551.1	NP_006148.2|NP_963845.1	Q92832	NELL1_HUMAN	NEL-like 1 (chicken)	755					cell differentiation (GO:0030154)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of osteoblast proliferation (GO:0033689)|nervous system development (GO:0007399)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of gene expression (GO:0010468)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|endometrium(5)|kidney(3)|large_intestine(15)|lung(36)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	70						TGACCCCTGCCTAGCTGATAA	0.512																																							uc001mqe.2		NA																	0				ovary(2)|large_intestine(1)	3						c.(2263-2265)CTA>ATA		nel-like 1 isoform 1 precursor							143.0	128.0	133.0					11																	21594836		2203	4300	6503	SO:0001583	missense	4745				cell adhesion|nervous system development	extracellular region	calcium ion binding|structural molecule activity	g.chr11:21594836C>A	AK127805	CCDS7855.1, CCDS44555.1, CCDS73267.1, CCDS73268.1	11p15.1	2008-02-01	2001-11-28		ENSG00000165973	ENSG00000165973			7750	protein-coding gene	gene with protein product		602319	"""nel (chicken)-like 1"""			8975702	Standard	NM_006157		Approved	IDH3GL, FLJ45906	uc001mqe.3	Q92832	OTTHUMG00000166042	ENST00000357134.5:c.2263C>A	11.37:g.21594836C>A	ENSP00000349654:p.Leu755Ile		Somatic				NELL1_uc001mqf.2_Missense_Mutation_p.L708I|NELL1_uc009yid.2_Missense_Mutation_p.L783I|NELL1_uc010rdo.1_Missense_Mutation_p.L698I|NELL1_uc010rdp.1_Missense_Mutation_p.L468I|NELL1_uc001mqh.2_Missense_Mutation_p.L300I	p.L755I	NM_006157	NP_006148	WXS	Illumina HiSeq	Unspecified	Q92832	NELL1_HUMAN			19	2416	+			755			VWFC 5.		B2CKC1|Q4VB90|Q4VB91|Q6NSY8|Q9Y472	Missense_Mutation	SNP	ENST00000357134.5	37	c.2263C>A	CCDS7855.1	.	.	.	.	.	.	.	.	.	.	C	14.88	2.668353	0.47677	.	.	ENSG00000165973	ENST00000298925;ENST00000357134;ENST00000325319;ENST00000532434	T;T;T;T	0.79554	-1.28;-1.25;-1.17;-1.15	5.73	3.86	0.44501	.	0.096989	0.43110	D	0.000604	T	0.63034	0.2477	L	0.33485	1.01	0.33151	D	0.545726	B;B;P;B;B	0.38535	0.021;0.051;0.635;0.023;0.012	B;B;B;B;B	0.30495	0.046;0.02;0.116;0.041;0.02	T	0.64964	-0.6283	10	0.23302	T	0.38	-9.7136	5.6862	0.17805	0.1375:0.6496:0.0:0.2129	.	698;783;300;708;755	F5H6I3;B3KXR2;Q8N9Z6;Q92832-2;Q92832	.;.;.;.;NELL1_HUMAN	I	783;755;698;708	ENSP00000298925:L783I;ENSP00000349654:L755I;ENSP00000317837:L698I;ENSP00000437170:L708I	ENSP00000298925:L783I	L	+	1	2	NELL1	21551412	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	2.411000	0.44600	0.769000	0.33313	0.555000	0.69702	CTA		0.512	NELL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387588.1	NM_006157		17	176	1	0	2.94398e-08	0.007413	5.27514e-08	17	176				
CHST1	8534	broad.mit.edu	37	11	45671882	45671882	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr11:45671882G>T	ENST00000308064.2	-	4	1262	c.592C>A	c.(592-594)Cgc>Agc	p.R198S	CHST1_ENST00000533673.1_5'Flank|RP11-495O11.1_ENST00000525563.1_RNA	NM_003654.5	NP_003645.1	O43916	CHST1_HUMAN	carbohydrate (keratan sulfate Gal-6) sulfotransferase 1	198					carbohydrate metabolic process (GO:0005975)|galactose metabolic process (GO:0006012)|glycosaminoglycan metabolic process (GO:0030203)|inflammatory response (GO:0006954)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|polysaccharide metabolic process (GO:0005976)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	keratan sulfotransferase activity (GO:0045130)|sulfotransferase activity (GO:0008146)	p.R198S(1)		breast(1)|endometrium(3)|large_intestine(10)|lung(17)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(35;3e-06)|BRCA - Breast invasive adenocarcinoma(625;0.0781)		CTGCGCTCGCGGCACGCCTCG	0.682																																							uc001mys.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(4)|pancreas(1)	5						c.(592-594)CGC>AGC		carbohydrate (keratan sulfate Gal-6)							24.0	24.0	24.0					11																	45671882		2195	4287	6482	SO:0001583	missense	8534				galactose metabolic process|inflammatory response|keratan sulfate metabolic process	Golgi membrane|integral to membrane	keratan sulfotransferase activity	g.chr11:45671882G>T	U65637	CCDS7913.1	11p11.2	2010-04-29			ENSG00000175264	ENSG00000175264		"""Sulfotransferases, membrane-bound"""	1969	protein-coding gene	gene with protein product		603797				9405439, 9639683	Standard	NM_003654		Approved	C6ST, KSGal6ST	uc001mys.2	O43916		ENST00000308064.2:c.592C>A	11.37:g.45671882G>T	ENSP00000309270:p.Arg198Ser		Somatic					p.R198S	NM_003654	NP_003645	WXS	Illumina HiSeq	Unspecified	O43916	CHST1_HUMAN		GBM - Glioblastoma multiforme(35;3e-06)|BRCA - Breast invasive adenocarcinoma(625;0.0781)	4	1263	-			198			Lumenal (Potential).		D3DQP2	Missense_Mutation	SNP	ENST00000308064.2	37	c.592C>A	CCDS7913.1	.	.	.	.	.	.	.	.	.	.	G	15.45	2.837083	0.50951	.	.	ENSG00000175264	ENST00000308064	D	0.82803	-1.65	4.98	4.98	0.66077	Sulfotransferase domain (1);	0.122065	0.53938	D	0.000047	T	0.79857	0.4518	L	0.58669	1.825	0.50813	D	0.999897	P	0.48503	0.911	B	0.42916	0.402	T	0.78994	-0.1984	10	0.33940	T	0.23	-18.522	11.6314	0.51178	0.0:0.0:0.6931:0.3069	.	198	O43916	CHST1_HUMAN	S	198	ENSP00000309270:R198S	ENSP00000309270:R198S	R	-	1	0	CHST1	45628458	1.000000	0.71417	0.946000	0.38457	0.723000	0.41478	4.183000	0.58317	2.310000	0.77875	0.462000	0.41574	CGC		0.682	CHST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390127.1	NM_003654		4	18	1	0	1.024e-07	0.000602	1.78387e-07	4	18				
LOC440040	440040	broad.mit.edu	37	11	49805625	49805625	+	RNA	SNP	G	G	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr11:49805625G>T	ENST00000527477.1	+	0	1312																											TTCTGGGCAGGTGAGTGATGA	0.478																																							uc010rhy.1		NA																	0					0						c.e3+1		SubName: Full=cDNA FLJ60249, highly similar to Metabotropic glutamate receptor 5;																																						440040							g.chr11:49805625G>T																													11.37:g.49805625G>T			Somatic				LOC440040_uc009ymb.2_Splice_Site_p.R274_splice	p.R274_splice	NR_027044		WXS	Illumina HiSeq	Unspecified					3	1299	+									Splice_Site	SNP	ENST00000527477.1	37	c.821_splice																																																																																					0.478	RP11-707M1.1-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000391378.2			12	105	1	0	9.31168e-06	0.001855	1.44958e-05	12	105				
OR5L1	219437	broad.mit.edu	37	11	55579402	55579402	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr11:55579402G>T	ENST00000333973.2	+	1	549	c.460G>T	c.(460-462)Gtg>Ttg	p.V154L		NM_001004738.1	NP_001004738.1	Q8NGL2	OR5L1_HUMAN	olfactory receptor, family 5, subfamily L, member 1	154						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V154L(1)		NS(1)|breast(2)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(4)|liver(4)|lung(36)|ovary(2)|pancreas(1)|prostate(5)|skin(9)|stomach(4)|upper_aerodigestive_tract(3)	78		all_epithelial(135;0.208)				CTGTGGGACGGTGTGTTCTCT	0.458																																							uc001nhw.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|ovary(2)	5						c.(460-462)GTG>TTG		olfactory receptor, family 5, subfamily L,							219.0	184.0	196.0					11																	55579402		2200	4296	6496	SO:0001583	missense	219437				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55579402G>T	AB065780	CCDS31509.1	11q11	2012-08-09			ENSG00000186117	ENSG00000186117		"""GPCR / Class A : Olfactory receptors"""	8350	protein-coding gene	gene with protein product							Standard	NM_001004738		Approved	OST262	uc001nhw.1	Q8NGL2	OTTHUMG00000166810	ENST00000333973.2:c.460G>T	11.37:g.55579402G>T	ENSP00000335529:p.Val154Leu		Somatic					p.V154L	NM_001004738	NP_001004738	WXS	Illumina HiSeq	Unspecified	Q8NGL2	OR5L1_HUMAN			1	460	+		all_epithelial(135;0.208)	154			Helical; Name=4; (Potential).		B2RNK6|Q6IFD0	Missense_Mutation	SNP	ENST00000333973.2	37	c.460G>T	CCDS31509.1	.	.	.	.	.	.	.	.	.	.	g	11.93	1.784393	0.31593	.	.	ENSG00000186117	ENST00000333973	T	0.32023	1.47	3.98	-4.95	0.03048	GPCR, rhodopsin-like superfamily (1);	0.756428	0.11676	N	0.540337	T	0.10380	0.0254	N	0.02674	-0.535	0.09310	N	1	P	0.40578	0.722	P	0.45506	0.483	T	0.12091	-1.0561	10	0.02654	T	1	-9.3973	6.8974	0.24262	0.3588:0.4448:0.1964:0.0	.	154	Q8NGL2	OR5L1_HUMAN	L	154	ENSP00000335529:V154L	ENSP00000335529:V154L	V	+	1	0	OR5L1	55335978	0.000000	0.05858	0.000000	0.03702	0.491000	0.33493	-1.440000	0.02412	-0.994000	0.03463	-0.575000	0.04146	GTG		0.458	OR5L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391514.1	NM_001004738		26	205	1	0	7.38237e-10	0.00632	1.40297e-09	26	205				
OR5L1	219437	broad.mit.edu	37	11	55579854	55579854	+	Silent	SNP	G	G	C			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr11:55579854G>C	ENST00000333973.2	+	1	1001	c.912G>C	c.(910-912)gtG>gtC	p.V304V		NM_001004738.1	NP_001004738.1	Q8NGL2	OR5L1_HUMAN	olfactory receptor, family 5, subfamily L, member 1	304						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V304V(1)		NS(1)|breast(2)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(4)|liver(4)|lung(36)|ovary(2)|pancreas(1)|prostate(5)|skin(9)|stomach(4)|upper_aerodigestive_tract(3)	78		all_epithelial(135;0.208)				TCAGAAAAGTGATGGGCTCCA	0.468																																							uc001nhw.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(3)|ovary(2)	5						c.(910-912)GTG>GTC		olfactory receptor, family 5, subfamily L,							33.0	35.0	35.0					11																	55579854		2200	4296	6496	SO:0001819	synonymous_variant	219437				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55579854G>C	AB065780	CCDS31509.1	11q11	2012-08-09			ENSG00000186117	ENSG00000186117		"""GPCR / Class A : Olfactory receptors"""	8350	protein-coding gene	gene with protein product							Standard	NM_001004738		Approved	OST262	uc001nhw.1	Q8NGL2	OTTHUMG00000166810	ENST00000333973.2:c.912G>C	11.37:g.55579854G>C			Somatic					p.V304V	NM_001004738	NP_001004738	WXS	Illumina HiSeq	Unspecified	Q8NGL2	OR5L1_HUMAN			1	912	+		all_epithelial(135;0.208)	304			Cytoplasmic (Potential).		B2RNK6|Q6IFD0	Silent	SNP	ENST00000333973.2	37	c.912G>C	CCDS31509.1																																																																																				0.468	OR5L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391514.1	NM_001004738		3	54	0	0	0	0.000248	0	3	54				
OR5D18	219438	broad.mit.edu	37	11	55587432	55587432	+	Silent	SNP	G	G	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr11:55587432G>A	ENST00000333976.4	+	1	347	c.327G>A	c.(325-327)gtG>gtA	p.V109V		NM_001001952.1	NP_001001952.1	Q8NGL1	OR5DI_HUMAN	olfactory receptor, family 5, subfamily D, member 18	109						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V109V(2)		NS(2)|breast(1)|endometrium(3)|large_intestine(6)|lung(33)|ovary(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55		all_epithelial(135;0.208)				GTACCTTTGTGGTCACTGAAT	0.433																																							uc010rin.1		NA																	2	Substitution - coding silent(2)		prostate(1)|lung(1)	skin(2)|ovary(1)	3						c.(325-327)GTG>GTA		olfactory receptor, family 5, subfamily D,							168.0	169.0	169.0					11																	55587432		2200	4296	6496	SO:0001819	synonymous_variant	219438				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55587432G>A	AB065781	CCDS31510.1	11q11	2012-08-09			ENSG00000186119	ENSG00000186119		"""GPCR / Class A : Olfactory receptors"""	15285	protein-coding gene	gene with protein product							Standard	NM_001001952		Approved		uc010rin.2	Q8NGL1	OTTHUMG00000166811	ENST00000333976.4:c.327G>A	11.37:g.55587432G>A			Somatic					p.V109V	NM_001001952	NP_001001952	WXS	Illumina HiSeq	Unspecified	Q8NGL1	OR5DI_HUMAN			1	327	+		all_epithelial(135;0.208)	109			Helical; Name=3; (Potential).		Q6IF67|Q6IFD3|Q96RB3	Silent	SNP	ENST00000333976.4	37	c.327G>A	CCDS31510.1																																																																																				0.433	OR5D18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391515.1	NM_001001952		13	344	0	0	0	0.001855	0	13	344				
TRIM51	84767	broad.mit.edu	37	11	55659052	55659052	+	Missense_Mutation	SNP	C	C	A	rs148245438	byFrequency	TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr11:55659052C>A	ENST00000449290.2	+	7	1395	c.1303C>A	c.(1303-1305)Ccc>Acc	p.P435T	TRIM51_ENST00000244891.3_Missense_Mutation_p.P292T	NM_032681.3	NP_116070.2	Q9BSJ1	TRI51_HUMAN	tripartite motif-containing 51	435	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)	p.P435T(1)|p.P276T(1)									ATACACCATCCCCAATTGCTC	0.458																																							uc010rip.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(1303-1305)CCC>ACC		SPRY domain containing 5		C	THR/PRO	5,4343		0,5,2169	123.0	124.0	124.0		1303	0.3	0.0	11	dbSNP_134	124	0,8456		0,0,4228	no	missense	SPRYD5	NM_032681.3	38	0,5,6397	AA,AC,CC		0.0,0.115,0.0391	benign	435/453	55659052	5,12799	2174	4228	6402	SO:0001583	missense	84767					intracellular	zinc ion binding	g.chr11:55659052C>A	BC005014		11p11	2013-01-09	2012-05-18	2012-05-18	ENSG00000124900	ENSG00000124900		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19023	protein-coding gene	gene with protein product			"""SPRY domain containing 5"""	SPRYD5			Standard	NM_032681		Approved	TRIM51A	uc010rip.2	Q9BSJ1	OTTHUMG00000156437	ENST00000449290.2:c.1303C>A	11.37:g.55659052C>A	ENSP00000395086:p.Pro435Thr		Somatic				SPRYD5_uc010riq.1_Missense_Mutation_p.P292T	p.P435T	NM_032681	NP_116070	WXS	Illumina HiSeq	Unspecified	Q9BSJ1	SPRY5_HUMAN			7	1395	+		all_epithelial(135;0.226)	435			B30.2/SPRY.		A6NMG2	Missense_Mutation	SNP	ENST00000449290.2	37	c.1303C>A		.	.	.	.	.	.	.	.	.	.	.	8.726	0.915524	0.17907	0.00115	0.0	ENSG00000124900	ENST00000449290;ENST00000244891	T;T	0.66460	-0.21;-0.21	1.36	0.297	0.15762	Concanavalin A-like lectin/glucanase (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	.	.	.	.	T	0.45498	0.1345	N	0.19112	0.55	0.09310	N	1	P	0.35307	0.494	B	0.39935	0.314	T	0.33445	-0.9868	9	0.13470	T	0.59	.	3.0022	0.06017	0.0:0.6578:0.0:0.3422	.	435	Q9BSJ1	SPRY5_HUMAN	T	435;292	ENSP00000395086:P435T;ENSP00000244891:P292T	ENSP00000244891:P292T	P	+	1	0	SPRYD5	55415628	0.528000	0.26314	0.002000	0.10522	0.442000	0.32017	0.419000	0.21247	0.646000	0.30693	0.162000	0.16502	CCC		0.458	TRIM51-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000391522.1	NM_032681		15	230	1	0	0.000422831	0.004007	0.000542757	15	230				
OR8H3	390152	broad.mit.edu	37	11	55890175	55890175	+	Silent	SNP	T	T	C			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr11:55890175T>C	ENST00000313472.3	+	1	327	c.327T>C	c.(325-327)acT>acC	p.T109T		NM_001005201.1	NP_001005201.1	Q8N146	OR8H3_HUMAN	olfactory receptor, family 8, subfamily H, member 3	109						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T109T(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(30)|ovary(2)|prostate(1)|skin(3)|stomach(1)	42	Esophageal squamous(21;0.00693)					TCTTGGGTACTGCTGAATGTT	0.463																																							uc001nii.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(325-327)ACT>ACC		olfactory receptor, family 8, subfamily H,							293.0	282.0	285.0					11																	55890175		2201	4296	6497	SO:0001819	synonymous_variant	390152				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55890175T>C	AB065840	CCDS31519.1	11q11	2012-08-09			ENSG00000181761	ENSG00000181761		"""GPCR / Class A : Olfactory receptors"""	15309	protein-coding gene	gene with protein product							Standard	NM_001005201		Approved		uc001nii.1	Q8N146	OTTHUMG00000166833	ENST00000313472.3:c.327T>C	11.37:g.55890175T>C			Somatic					p.T109T	NM_001005201	NP_001005201	WXS	Illumina HiSeq	Unspecified	Q8N146	OR8H3_HUMAN			1	327	+	Esophageal squamous(21;0.00693)		109			Helical; Name=3; (Potential).		Q6IFB7	Silent	SNP	ENST00000313472.3	37	c.327T>C	CCDS31519.1																																																																																				0.463	OR8H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391541.1	NM_001005201		23	566	0	0	0	0.00278	0	23	566				
DLG2	1740	broad.mit.edu	37	11	84245668	84245668	+	Missense_Mutation	SNP	G	G	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr11:84245668G>A	ENST00000532653.1	-	2	451	c.149C>T	c.(148-150)tCt>tTt	p.S50F	DLG2_ENST00000376104.2_Missense_Mutation_p.S155F|DLG2_ENST00000398309.2_Missense_Mutation_p.S50F|DLG2_ENST00000524982.1_Missense_Mutation_p.S50F|DLG2_ENST00000543673.1_Missense_Mutation_p.S155F			Q14168	MPP2_HUMAN	discs, large homolog 2 (Drosophila)	0	L27 1. {ECO:0000255|PROSITE- ProRule:PRU00365}.				nucleotide phosphorylation (GO:0046939)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	guanylate kinase activity (GO:0004385)	p.S155F(1)|p.S50F(1)		breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(11)|lung(35)|ovary(3)|pancreas(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	71		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)				TTCTATTTGAGAGAGGTTCTT	0.423																																							uc001paj.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|pancreas(2)|skin(1)	6						c.(148-150)TCT>TTT		chapsyn-110 isoform 2							183.0	171.0	175.0					11																	84245668		1873	4104	5977	SO:0001583	missense	1740					cell junction|postsynaptic density|postsynaptic membrane	guanylate kinase activity|protein binding|protein binding	g.chr11:84245668G>A	U32376	CCDS41696.1, CCDS44690.1, CCDS44691.1, CCDS44692.1, CCDS55782.1, CCDS73357.1	11q21	2012-04-17	2008-12-15		ENSG00000150672	ENSG00000150672		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	2901	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 58"""	603583	"""discs, large homolog 2, chapsyn-110 (Drosophila)"""			8755482, 9806853	Standard	NM_001142702		Approved	PSD-93, PSD93, chapsyn-110, PPP1R58	uc001pak.2	Q15700	OTTHUMG00000134309	ENST00000532653.1:c.149C>T	11.37:g.84245668G>A	ENSP00000435849:p.Ser50Phe		Somatic				DLG2_uc010rsz.1_Missense_Mutation_p.S50F|DLG2_uc010rta.1_Missense_Mutation_p.S50F|DLG2_uc001pak.2_Missense_Mutation_p.S155F|DLG2_uc001pal.1_Missense_Mutation_p.S50F	p.S50F	NM_001364	NP_001355	WXS	Illumina HiSeq	Unspecified	Q15700	DLG2_HUMAN			2	452	-		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)	50					B4DGE9|B4DRJ0|B7Z3G8|E7EV80|E7EV91|E7EX01|Q53ES9|Q5CZB9|Q9BQJ2	Missense_Mutation	SNP	ENST00000532653.1	37	c.149C>T		.	.	.	.	.	.	.	.	.	.	G	28.3	4.909409	0.92107	.	.	ENSG00000150672	ENST00000398309;ENST00000376104;ENST00000543673;ENST00000524982;ENST00000532653;ENST00000546021;ENST00000527088	T;T;T;T;T;T	0.50813	0.73;0.73;0.73;0.73;0.73;0.73	5.88	5.88	0.94601	Membrane-associated guanylate kinase (MAGUK), PEST domain, N-terminal (1);	0.000000	0.51477	D	0.000085	T	0.68054	0.2959	M	0.62723	1.935	0.80722	D	1	D;D;D;P	0.76494	0.996;0.999;0.994;0.827	D;D;D;P	0.79784	0.993;0.981;0.989;0.511	T	0.63866	-0.6540	9	.	.	.	.	20.2279	0.98344	0.0:0.0:1.0:0.0	.	50;50;155;50	B7Z2T4;E9PN83;Q15700-2;Q15700	.;.;.;DLG2_HUMAN	F	50;155;155;50;50;155;71	ENSP00000381355:S50F;ENSP00000365272:S155F;ENSP00000441994:S155F;ENSP00000432894:S50F;ENSP00000435849:S50F;ENSP00000435809:S71F	.	S	-	2	0	DLG2	83923316	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.270000	0.95690	2.778000	0.95560	0.655000	0.94253	TCT		0.423	DLG2-009	NOVEL	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000259253.2	NM_001364		21	202	0	0	0	0.002299	0	21	202				
PPP2R1B	5519	broad.mit.edu	37	11	111636081	111636081	+	Missense_Mutation	SNP	A	A	G			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr11:111636081A>G	ENST00000527614.1	-	2	207	c.142T>C	c.(142-144)Tca>Cca	p.S48P	PPP2R1B_ENST00000393055.2_Missense_Mutation_p.S48P|PPP2R1B_ENST00000427203.2_5'UTR|PPP2R1B_ENST00000341980.6_Missense_Mutation_p.S48P|PPP2R1B_ENST00000311129.5_Missense_Mutation_p.S48P|PPP2R1B_ENST00000426998.2_Intron	NM_001177562.1|NM_002716.4	NP_001171033.1|NP_002707.3	P30154	2AAB_HUMAN	protein phosphatase 2, regulatory subunit A, beta	48					apoptotic process involved in morphogenesis (GO:0060561)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)	extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)		p.S48P(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|liver(1)|lung(10)|prostate(1)|urinary_tract(2)	22		all_cancers(61;2.34e-15)|all_epithelial(67;1.72e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|Epithelial(105;2.36e-06)|all cancers(92;3.78e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0761)		GCAATTGTTGATAACTTCTTA	0.368																																							uc001plx.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(142-144)TCA>CCA		beta isoform of regulatory subunit A, protein							111.0	110.0	111.0					11																	111636081		2201	4297	6498	SO:0001583	missense	5519						protein binding	g.chr11:111636081A>G	AF087438	CCDS8348.1, CCDS8349.1, CCDS53706.1, CCDS53707.1, CCDS53708.1	11q23.1	2010-06-18	2010-04-14		ENSG00000137713	ENSG00000137713	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9303	protein-coding gene	gene with protein product	"""PP2A-A-beta"", ""protein phosphatase 2A, regulatory subunit A, beta isoform"""	603113	"""protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65), beta isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit A, beta isoform"""			2159327, 9795170	Standard	NM_181699		Approved	PR65B, PP2A-Abeta	uc001plw.1	P30154	OTTHUMG00000166741	ENST00000527614.1:c.142T>C	11.37:g.111636081A>G	ENSP00000437193:p.Ser48Pro		Somatic				PPP2R1B_uc001plw.1_Missense_Mutation_p.S48P|PPP2R1B_uc010rwi.1_Intron|PPP2R1B_uc010rwj.1_5'UTR|PPP2R1B_uc010rwk.1_Missense_Mutation_p.S48P|PPP2R1B_uc010rwl.1_Missense_Mutation_p.S48P	p.S48P	NM_002716	NP_002707	WXS	Illumina HiSeq	Unspecified	P30154	2AAB_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|Epithelial(105;2.36e-06)|all cancers(92;3.78e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0761)	2	226	-		all_cancers(61;2.34e-15)|all_epithelial(67;1.72e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)	48			HEAT 1.		A8MY67|B0YJ69|B4DGQ6|B4DK91|B4DWW5|F8W8G1|O75620|Q8NHV8	Missense_Mutation	SNP	ENST00000527614.1	37	c.142T>C	CCDS8349.1	.	.	.	.	.	.	.	.	.	.	A	13.06	2.124623	0.37533	.	.	ENSG00000137713	ENST00000311129;ENST00000412902;ENST00000527614;ENST00000341980;ENST00000393055;ENST00000531373	T;T;T;T;T	0.34472	3.57;3.57;3.57;1.36;1.36	5.82	4.68	0.58851	Armadillo-like helical (1);Armadillo-type fold (1);	0.059624	0.64402	D	0.000002	T	0.39226	0.1070	M	0.74467	2.265	0.80722	D	1	B;B;B;B	0.21520	0.057;0.003;0.0;0.003	B;B;B;B	0.17098	0.017;0.008;0.002;0.002	T	0.24083	-1.0170	10	0.52906	T	0.07	-9.4661	11.4212	0.49982	0.8486:0.1514:0.0:0.0	.	48;48;48;48	A8MY67;F8W8G1;P30154;P30154-2	.;.;2AAB_HUMAN;.	P	48;48;48;48;48;33	ENSP00000311344:S48P;ENSP00000437193:S48P;ENSP00000343317:S48P;ENSP00000376775:S48P;ENSP00000434705:S33P	ENSP00000311344:S48P	S	-	1	0	PPP2R1B	111141291	1.000000	0.71417	1.000000	0.80357	0.071000	0.16799	6.881000	0.75584	1.006000	0.39211	0.533000	0.62120	TCA		0.368	PPP2R1B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000391298.1	NM_002716		12	142	0	0	0	0.000978	0	12	142				
DSCAML1	57453	broad.mit.edu	37	11	117302317	117302317	+	Silent	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr11:117302317C>A	ENST00000321322.6	-	31	5488	c.5487G>T	c.(5485-5487)gtG>gtT	p.V1829V	DSCAML1_ENST00000527706.1_Silent_p.V1559V	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	1769					axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)	p.V1829V(1)		breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		GCTGGGAGCCCACGGTGCGCC	0.647																																							uc001prh.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|large_intestine(2)|skin(2)|upper_aerodigestive_tract(1)	8						c.(5485-5487)GTG>GTT		Down syndrome cell adhesion molecule like 1							101.0	96.0	98.0					11																	117302317		2201	4296	6497	SO:0001819	synonymous_variant	57453				axonogenesis|brain development|cell fate determination|dorsal/ventral pattern formation|embryonic skeletal system morphogenesis|homophilic cell adhesion	cell surface|integral to membrane|plasma membrane	protein homodimerization activity	g.chr11:117302317C>A		CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.5487G>T	11.37:g.117302317C>A			Somatic					p.V1829V	NM_020693	NP_065744	WXS	Illumina HiSeq	Unspecified	Q8TD84	DSCL1_HUMAN		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)	31	5489	-	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)	1769			Cytoplasmic (Potential).		Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Silent	SNP	ENST00000321322.6	37	c.5487G>T	CCDS8384.1																																																																																				0.647	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392907.2	NM_020693		9	90	1	0	0.00136819	0.001368	0.00167308	9	90				
ABCG4	64137	broad.mit.edu	37	11	119027327	119027327	+	Silent	SNP	G	G	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr11:119027327G>T	ENST00000449422.2	+	8	1052	c.864G>T	c.(862-864)ctG>ctT	p.L288L	ABCG4_ENST00000307417.3_Silent_p.L288L|ABCG4_ENST00000531739.1_Silent_p.L288L	NM_001142505.1	NP_001135977.1	Q9H172	ABCG4_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 4	288	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cholesterol efflux (GO:0033344)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|cholesterol transporter activity (GO:0017127)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.L288L(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(28)|ovary(2)|prostate(1)|skin(1)	44	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.7e-05)		TCACCAACCTGATCCCCTATC	0.577																																							uc001pvs.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(862-864)CTG>CTT		ATP-binding cassette, subfamily G, member 4							144.0	137.0	140.0					11																	119027327		2200	4295	6495	SO:0001819	synonymous_variant	64137				cholesterol efflux	integral to membrane	ATP binding|ATPase activity|protein heterodimerization activity|protein homodimerization activity	g.chr11:119027327G>T	AJ300465	CCDS8415.1	11q23	2012-03-14			ENSG00000172350	ENSG00000172350		"""ATP binding cassette transporters / subfamily G"""	13884	protein-coding gene	gene with protein product	"""putative ABC transporter"", ""ATP-binding cassette, subfamily G, member 4"""	607784				11435397	Standard	NM_022169		Approved	WHITE2	uc001pvs.3	Q9H172	OTTHUMG00000166169	ENST00000449422.2:c.864G>T	11.37:g.119027327G>T			Somatic				ABCG4_uc009zar.2_Silent_p.L288L	p.L288L	NM_022169	NP_071452	WXS	Illumina HiSeq	Unspecified	Q9H172	ABCG4_HUMAN		BRCA - Breast invasive adenocarcinoma(274;7.7e-05)	8	1200	+	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)	288			Cytoplasmic (Potential).|ABC transporter.		A8K1B5|Q8WWH0|Q8WWH1|Q8WWH2	Silent	SNP	ENST00000449422.2	37	c.864G>T	CCDS8415.1																																																																																				0.577	ABCG4-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388215.1	NM_022169		19	123	1	0	1.50039e-11	0.001882	2.9405e-11	19	123				
FAM118B	79607	broad.mit.edu	37	11	126110730	126110730	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr11:126110730G>T	ENST00000533050.1	+	4	623	c.130G>T	c.(130-132)Gtg>Ttg	p.V44L	FAM118B_ENST00000360194.4_Missense_Mutation_p.V44L|FAM118B_ENST00000529731.1_Missense_Mutation_p.V44L|FAM118B_ENST00000525728.1_3'UTR	NM_024556.3	NP_078832.1	Q9BPY3	F118B_HUMAN	family with sequence similarity 118, member B	44								p.V44L(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|skin(1)	13	all_hematologic(175;0.145)	Breast(109;0.00156)|Lung NSC(97;0.00948)|all_lung(97;0.0101)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.15e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0784)		TCGAGAACTTGTGCTAGTGAT	0.453																																							uc001qdf.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(130-132)GTG>TTG		hypothetical protein LOC79607							160.0	174.0	169.0					11																	126110730		2201	4299	6500	SO:0001583	missense	79607							g.chr11:126110730G>T	BC001340	CCDS8470.1	11q24.2	2014-03-13				ENSG00000197798			26110	protein-coding gene	gene with protein product						24569877	Standard	NM_024556		Approved	FLJ21103	uc001qdf.3	Q9BPY3		ENST00000533050.1:c.130G>T	11.37:g.126110730G>T	ENSP00000433343:p.Val44Leu		Somatic				FAM118B_uc009zca.2_Missense_Mutation_p.V48L|FAM118B_uc001qdg.2_Missense_Mutation_p.V44L	p.V44L	NM_024556	NP_078832	WXS	Illumina HiSeq	Unspecified	Q9BPY3	F118B_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.15e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0784)	4	313	+	all_hematologic(175;0.145)	Breast(109;0.00156)|Lung NSC(97;0.00948)|all_lung(97;0.0101)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)	44					Q9H7B0	Missense_Mutation	SNP	ENST00000533050.1	37	c.130G>T	CCDS8470.1	.	.	.	.	.	.	.	.	.	.	G	18.02	3.529461	0.64860	.	.	ENSG00000197798	ENST00000533050;ENST00000528985;ENST00000529731;ENST00000360194;ENST00000530043;ENST00000525338	T;T;T;T;T;T	0.54675	1.35;1.33;0.56;1.33;0.85;0.57	5.95	5.04	0.67666	.	0.000000	0.85682	D	0.000000	T	0.48352	0.1495	N	0.03608	-0.345	0.80722	D	1	B;D;D	0.58970	0.01;0.984;0.984	B;D;D	0.68192	0.004;0.956;0.956	T	0.55444	-0.8140	10	0.26408	T	0.33	-19.8389	15.0642	0.71980	0.0677:0.0:0.9323:0.0	.	44;44;44	G3V179;E9PMJ2;Q9BPY3	.;.;F118B_HUMAN	L	44	ENSP00000433343:V44L;ENSP00000434952:V44L;ENSP00000432712:V44L;ENSP00000353321:V44L;ENSP00000437285:V44L;ENSP00000435754:V44L	ENSP00000353321:V44L	V	+	1	0	FAM118B	125615940	1.000000	0.71417	0.989000	0.46669	0.893000	0.52053	9.611000	0.98342	1.534000	0.49203	-0.339000	0.08088	GTG		0.453	FAM118B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386346.1	NM_024556		38	355	1	0	1.47244e-24	0.00623	3.23202e-24	38	355				
OPCML	4978	broad.mit.edu	37	11	132306643	132306643	+	Missense_Mutation	SNP	G	G	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr11:132306643G>A	ENST00000331898.7	-	5	1273	c.695C>T	c.(694-696)aCt>aTt	p.T232I	OPCML_ENST00000529038.1_5'UTR|OPCML_ENST00000524381.1_Missense_Mutation_p.T225I|OPCML_ENST00000374778.4_Missense_Mutation_p.T191I|OPCML_ENST00000541867.1_Missense_Mutation_p.T232I	NM_002545.3	NP_002536.1	Q14982	OPCM_HUMAN	opioid binding protein/cell adhesion molecule-like	232	Ig-like C2-type 3.				cell adhesion (GO:0007155)|neuron recognition (GO:0008038)|opioid receptor signaling pathway (GO:0038003)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	opioid receptor activity (GO:0004985)	p.T225I(1)|p.T232I(1)		endometrium(5)|kidney(1)|large_intestine(12)|lung(17)|ovary(2)|skin(2)|urinary_tract(8)	47	all_hematologic(175;0.019)	all_cancers(12;5.86e-24)|all_epithelial(12;2.65e-17)|all_lung(97;2.89e-05)|Lung NSC(97;6.16e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0269)|all_neural(223;0.0326)|Esophageal squamous(93;0.129)		all cancers(11;4.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.012)		TGAAACACCAGTGTTCTTGGC	0.498																																							uc001qgs.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|skin(1)	3						c.(694-696)ACT>ATT		opioid binding protein/cell adhesion							122.0	106.0	112.0					11																	132306643		2201	4297	6498	SO:0001583	missense	4978				cell adhesion|neuron recognition	anchored to membrane|integral to plasma membrane	opioid receptor activity	g.chr11:132306643G>A	BX537377	CCDS8492.1, CCDS31722.1	11q25	2013-01-11	2001-11-28		ENSG00000183715	ENSG00000183715		"""Immunoglobulin superfamily / I-set domain containing"""	8143	protein-coding gene	gene with protein product	"""IgLON family member 1"""	600632	"""opioid-binding protein/cell adhesion molecule-like"""			8244387	Standard	XM_005271578		Approved	OPCM, OBCAM, IGLON1	uc001qgs.3	Q14982	OTTHUMG00000163658	ENST00000331898.7:c.695C>T	11.37:g.132306643G>A	ENSP00000330862:p.Thr232Ile		Somatic				OPCML_uc001qgu.2_Missense_Mutation_p.T225I|OPCML_uc010sck.1_Missense_Mutation_p.T232I|OPCML_uc001qgt.2_Missense_Mutation_p.T231I|OPCML_uc010scl.1_Missense_Mutation_p.T191I	p.T232I	NM_002545	NP_002536	WXS	Illumina HiSeq	Unspecified	Q14982	OPCM_HUMAN		all cancers(11;4.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.012)	5	745	-	all_hematologic(175;0.019)	all_cancers(12;5.86e-24)|all_epithelial(12;2.65e-17)|all_lung(97;2.89e-05)|Lung NSC(97;6.16e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0269)|all_neural(223;0.0326)|Esophageal squamous(93;0.129)	232			Ig-like C2-type 3.		B2CZX2|B7ZLQ1|Q17RN7|Q7Z3W6	Missense_Mutation	SNP	ENST00000331898.7	37	c.695C>T	CCDS8492.1	.	.	.	.	.	.	.	.	.	.	G	16.05	3.011893	0.54468	.	.	ENSG00000183715	ENST00000331898;ENST00000524381;ENST00000374778;ENST00000416724;ENST00000541867	T;T;T;T	0.65178	-0.14;-0.14;-0.14;-0.14	5.68	4.77	0.60923	Immunoglobulin I-set (1);Immunoglobulin-like (1);	0.104853	0.64402	D	0.000003	T	0.49813	0.1579	L	0.27944	0.81	0.58432	D	0.999999	B;B;B;B	0.32302	0.363;0.363;0.199;0.199	B;B;B;B	0.31614	0.133;0.133;0.081;0.081	T	0.50448	-0.8827	10	0.45353	T	0.12	-6.6099	14.308	0.66397	0.072:0.0:0.928:0.0	.	232;225;231;232	B7ZLQ1;Q7Z3W6;B7ZLQ0;Q14982	.;.;.;OPCM_HUMAN	I	232;225;191;199;232	ENSP00000330862:T232I;ENSP00000434750:T225I;ENSP00000363910:T191I;ENSP00000445496:T232I	ENSP00000330862:T232I	T	-	2	0	OPCML	131811853	1.000000	0.71417	0.956000	0.39512	0.815000	0.46073	4.383000	0.59600	1.397000	0.46682	0.650000	0.86243	ACT		0.498	OPCML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374689.3	NM_001012393		4	64	0	0	0	0.000602	0	4	64				
CLEC6A	93978	broad.mit.edu	37	12	8610547	8610547	+	Missense_Mutation	SNP	G	G	C			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr12:8610547G>C	ENST00000382073.3	+	2	271	c.85G>C	c.(85-87)Gca>Cca	p.A29P		NM_001007033.1	NP_001007034.1	Q6EIG7	CLC6A_HUMAN	C-type lectin domain family 6, member A	29					defense response to fungus (GO:0050832)|innate immune response (GO:0045087)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)	p.A29P(1)		breast(1)|large_intestine(2)|lung(7)	10	Lung SC(5;0.184)					GATTTCCATTGCACTCCTCAG	0.483																																							uc001qum.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(85-87)GCA>CCA		dectin-2							188.0	162.0	171.0					12																	8610547		2203	4300	6503	SO:0001583	missense	93978				defense response to fungus|innate immune response|positive regulation of cytokine secretion|positive regulation of I-kappaB kinase/NF-kappaB cascade	integral to membrane	sugar binding	g.chr12:8610547G>C	AY321309	CCDS31739.1	12p13	2005-09-21	2005-02-09	2005-02-11	ENSG00000205846	ENSG00000205846		"""C-type lectin domain containing"""	14556	protein-coding gene	gene with protein product		613579	"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 10"""	CLECSF10			Standard	NM_001007033		Approved	dectin-2	uc001qum.1	Q6EIG7	OTTHUMG00000168672	ENST00000382073.3:c.85G>C	12.37:g.8610547G>C	ENSP00000371505:p.Ala29Pro		Somatic					p.A29P	NM_001007033	NP_001007034	WXS	Illumina HiSeq	Unspecified	Q6EIG7	CLC6A_HUMAN			2	202	+	Lung SC(5;0.184)		29			Helical; Signal-anchor for type II membrane protein; (Potential).		A2RUK3	Missense_Mutation	SNP	ENST00000382073.3	37	c.85G>C	CCDS31739.1	.	.	.	.	.	.	.	.	.	.	.	17.00	3.277594	0.59758	.	.	ENSG00000205846	ENST00000382073	T	0.05996	3.36	4.11	-4.6	0.03390	.	0.986667	0.08219	N	0.979389	T	0.02610	0.0079	N	0.14661	0.345	0.09310	N	1	P	0.44578	0.838	B	0.38562	0.276	T	0.29243	-1.0018	10	0.33141	T	0.24	.	0.4238	0.00460	0.2865:0.1256:0.2147:0.3732	.	29	Q6EIG7	CLC6A_HUMAN	P	29	ENSP00000371505:A29P	ENSP00000371505:A29P	A	+	1	0	CLEC6A	8501814	0.000000	0.05858	0.000000	0.03702	0.857000	0.48899	-2.499000	0.00968	-0.966000	0.03587	0.655000	0.94253	GCA		0.483	CLEC6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400562.1	NM_001007033		9	64	0	0	0	0.004482	0	9	64				
CLEC1B	51266	broad.mit.edu	37	12	10149523	10149523	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr12:10149523G>T	ENST00000298527.6	-	4	539	c.360C>A	c.(358-360)aaC>aaA	p.N120K	CLEC1B_ENST00000428126.2_Missense_Mutation_p.N87K|CLEC1B_ENST00000348658.4_Missense_Mutation_p.N87K	NM_016509.3	NP_057593.3	Q9P126	CLC1B_HUMAN	C-type lectin domain family 1, member B	120	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|platelet formation (GO:0030220)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)	p.N120K(1)|p.N24K(1)		NS(1)|breast(1)|central_nervous_system(1)|large_intestine(2)|lung(12)|stomach(1)|urinary_tract(1)	19						CCCATGTTAAGTTGTGCCTGA	0.433																																							uc001qwu.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(358-360)AAC>AAA		C-type lectin domain family 1, member B isoform							180.0	161.0	167.0					12																	10149523		1898	4131	6029	SO:0001583	missense	51266				cell surface receptor linked signaling pathway|defense response	integral to plasma membrane	protein binding|sugar binding|transmembrane receptor activity	g.chr12:10149523G>T	AF124841	CCDS41751.1, CCDS41752.1	12p13.31	2006-04-12				ENSG00000165682		"""C-type lectin domain containing"""	24356	protein-coding gene	gene with protein product		606783				10671229, 11745369	Standard	NM_016509		Approved	CLEC2	uc001qwu.3	Q9P126		ENST00000298527.6:c.360C>A	12.37:g.10149523G>T	ENSP00000298527:p.Asn120Lys		Somatic				CLEC1B_uc009zhd.2_Missense_Mutation_p.N87K	p.N120K	NM_016509	NP_057593	WXS	Illumina HiSeq	Unspecified	Q9P126	CLC1B_HUMAN			4	560	-			120			C-type lectin.|Extracellular (Potential).		Q6UWX7|Q8NHR6	Missense_Mutation	SNP	ENST00000298527.6	37	c.360C>A	CCDS41752.1	.	.	.	.	.	.	.	.	.	.	G	10.03	1.238921	0.22711	.	.	ENSG00000165682	ENST00000398937;ENST00000428126;ENST00000298527;ENST00000348658;ENST00000398939	T;T;T;T	0.16196	2.36;2.36;2.36;2.36	4.05	-0.0809	0.13704	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (2);	0.092966	0.46758	D	0.000276	T	0.22205	0.0535	L	0.48642	1.525	0.28973	N	0.889092	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.19289	-1.0310	10	0.06236	T	0.91	.	5.9776	0.19389	0.5126:0.0:0.4873:0.0	.	87;120	Q9P126-2;Q9P126	.;CLC1B_HUMAN	K	27;87;120;87;24	ENSP00000381910:N27K;ENSP00000406338:N87K;ENSP00000298527:N120K;ENSP00000327169:N87K	ENSP00000298527:N120K	N	-	3	2	CLEC1B	10040790	0.515000	0.26210	0.804000	0.32291	0.375000	0.29983	0.045000	0.14013	0.046000	0.15833	0.491000	0.48974	AAC		0.433	CLEC1B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399922.1	NM_016509		29	214	1	0	9.39395e-14	0.00632	1.93612e-13	29	214				
RERGL	79785	broad.mit.edu	37	12	18237551	18237551	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr12:18237551C>A	ENST00000229002.2	-	5	441	c.235G>T	c.(235-237)Ggg>Tgg	p.G79W	RERGL_ENST00000536890.1_Intron|RERGL_ENST00000541632.1_5'UTR|RERGL_ENST00000538724.1_Missense_Mutation_p.G78W	NM_024730.2	NP_079006.1	Q9H628	RERGL_HUMAN	RERG/RAS-like	79	Small GTPase-like.				GTP catabolic process (GO:0006184)|small GTPase mediated signal transduction (GO:0007264)	membrane (GO:0016020)	GTP binding (GO:0005525)	p.G79W(2)		endometrium(1)|large_intestine(5)|lung(8)|prostate(1)|skin(1)|urinary_tract(1)	17						ATAACAAACCCATCTGCCCAG	0.403																																							uc001rdq.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(235-237)GGG>TGG		RERG/RAS-like							144.0	138.0	140.0					12																	18237551		2203	4300	6503	SO:0001583	missense	79785				signal transduction	membrane	GTP binding|GTPase activity	g.chr12:18237551C>A	AK026308	CCDS8679.1, CCDS66332.1	12p12.3	2014-08-12			ENSG00000111404	ENSG00000111404			26213	protein-coding gene	gene with protein product						24127187	Standard	NM_001286201		Approved	FLJ22655	uc001rdq.3	Q9H628	OTTHUMG00000168820	ENST00000229002.2:c.235G>T	12.37:g.18237551C>A	ENSP00000229002:p.Gly79Trp		Somatic				RERGL_uc001rdr.2_Missense_Mutation_p.G78W	p.G79W	NM_024730	NP_079006	WXS	Illumina HiSeq	Unspecified	Q9H628	RERGL_HUMAN			5	429	-			79			Small GTPase-like.			Missense_Mutation	SNP	ENST00000229002.2	37	c.235G>T	CCDS8679.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.213867	0.79352	.	.	ENSG00000111404	ENST00000229002;ENST00000538724	D;D	0.82711	-1.64;-1.64	4.79	4.79	0.61399	.	0.000000	0.85682	D	0.000000	D	0.94195	0.8137	H	0.97158	3.95	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.95932	0.8939	10	0.87932	D	0	.	16.8961	0.86101	0.0:1.0:0.0:0.0	.	78;79	F5H686;Q9H628	.;RERGL_HUMAN	W	79;78	ENSP00000229002:G79W;ENSP00000437814:G78W	ENSP00000229002:G79W	G	-	1	0	RERGL	18128818	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	6.912000	0.75753	2.599000	0.87857	0.467000	0.42956	GGG		0.403	RERGL-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000401198.1	NM_024730		16	155	1	0	0.00074312	0.006122	0.000918957	16	155				
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	A	rs121913529		TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr12:25398284C>A	ENST00000256078.4	-	2	98	c.35G>T	c.(34-36)gGt>gTt	p.G12V	KRAS_ENST00000556131.1_Missense_Mutation_p.G12V|KRAS_ENST00000557334.1_Missense_Mutation_p.G12V|KRAS_ENST00000311936.3_Missense_Mutation_p.G12V	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	uc001rgp.1	G12D(HPAC_PANCREAS)|G12V(SW403_LARGE_INTESTINE)|G12D(HPAFII_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12V(NCIH441_LUNG)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(PK1_PANCREAS)|G12V(KP3_PANCREAS)|G12D(PANC0813_PANCREAS)|G12A(SW1116_LARGE_INTESTINE)|G12D(LS180_LARGE_INTESTINE)|G12V(NCIH727_LUNG)|G12V(PATU8988S_PANCREAS)|G12V(CAPAN2_PANCREAS)|G12D(KP4_PANCREAS)|G12D(LS513_LARGE_INTESTINE)|G12D(SNUC2A_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(COLO668_LUNG)|G12D(COLO678_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12D(PANC0203_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(SW900_LUNG)|G12V(LCLC97TM1_LUNG)|G12V(SW620_LARGE_INTESTINE)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12V(SH10TC_STOMACH)|G12V(A498_KIDNEY)|G12D(PK59_PANCREAS)|G12D(HEC1A_ENDOMETRIUM)|G12D(PANC0504_PANCREAS)|G12V(SNGM_ENDOMETRIUM)|G12A(RERFLCAD1_LUNG)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12D(ASPC1_PANCREAS)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12V(RCM1_LARGE_INTESTINE)|G12V(CORL23_LUNG)|G12D(SW1990_PANCREAS)|G12D(HEYA8_OVARY)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12V(HUPT4_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(HEC50B_ENDOMETRIUM)|G12V(YAPC_PANCREAS)|G12V(NCIH2444_LUNG)|G12V(HCC56_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12V(DANG_PANCREAS)|G12V(SHP77_LUNG)|G12D(AGS_STOMACH)|G12D(SKLU1_LUNG)|G12V(QGP1_PANCREAS)|G12D(L33_PANCREAS)|G12V(PANC0327_PANCREAS)|G12D(PANC1_PANCREAS)|G12V(RKN_OVARY)|G12V(PATU8902_PANCREAS)	119		Dom	yes		12	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog			"""L, E, M, O"""			pancreatic|colorectal|lung|thyroid|AML|others		15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(7175)|p.G12V(4780)|p.G12C(2482)|p.G12A(1180)|p.G12S(1119)|p.G12R(691)|p.G12?(50)|p.G12F(34)|p.G12N(6)|p.G12G(6)|p.G12L(5)|p.G12I(4)|p.G12_G13insG(4)|p.G12E(3)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12fs*3(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	large_intestine(12391)|pancreas(3285)|lung(2847)|biliary_tract(521)|ovary(443)|endometrium(339)|haematopoietic_and_lymphoid_tissue(318)|stomach(203)|thyroid(149)|prostate(85)|soft_tissue(77)|small_intestine(62)|upper_aerodigestive_tract(59)|cervix(49)|urinary_tract(48)|skin(38)|liver(31)|breast(28)|testis(17)|oesophagus(15)|central_nervous_system(9)|peritoneum(6)|salivary_gland(6)|kidney(5)|gastrointestinal_tract_(site_indeterminate)(5)|thymus(5)|eye(4)|autonomic_ganglia(2)|bone(2)|genital_tract(1)|penis(1)|adrenal_gland(1)	21052						c.(34-36)GGT>GTT		c-K-ras2 protein isoform a precursor							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	Cardiofaciocutaneous_syndrome|Noonan_syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	activation of MAPKK activity|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	plasma membrane	GTP binding|GTPase activity|protein binding	g.chr12:25398284C>A	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>T	12.37:g.25398284C>A	ENSP00000256078:p.Gly12Val	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)	Somatic				KRAS_uc001rgq.1_Missense_Mutation_p.G12V|KRAS_uc001rgr.2_RNA	p.G12V	NM_033360	NP_203524	WXS	Illumina HiSeq	Unspecified	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)		2	216	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		12		G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation).|G -> R (in lung cancer and bladder cancer; somatic mutation).|G -> S (in lung carcinoma and GASC; somatic mutation).|G -> A (in a colorectal cancer sample; somatic mutation).|G -> C (in lung carcinoma; somatic mutation).|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation).	GTP.		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	c.35G>T	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.808637	0.90707	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90373	0.6987	M	0.90650	3.135	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.72625	0.969;0.978	D	0.91773	0.5429	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	V	12	ENSP00000308495:G12V;ENSP00000452512:G12V;ENSP00000256078:G12V;ENSP00000451856:G12V	ENSP00000256078:G12V	G	-	2	0	KRAS	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360		5	26	1	0	1.23904e-05	0.000602	1.87565e-05	5	26				
CAPRIN2	65981	broad.mit.edu	37	12	30879010	30879010	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr12:30879010C>A	ENST00000395805.2	-	9	2342	c.1795G>T	c.(1795-1797)Gtg>Ttg	p.V599L	CAPRIN2_ENST00000308433.5_Missense_Mutation_p.V266L|CAPRIN2_ENST00000538387.1_5'Flank|CAPRIN2_ENST00000298892.5_Missense_Mutation_p.V599L|CAPRIN2_ENST00000251071.5_Missense_Mutation_p.V599L|CAPRIN2_ENST00000417045.1_Missense_Mutation_p.V599L	NM_001206856.1	NP_001193785.1			caprin family member 2									p.V599L(1)		breast(1)|central_nervous_system(1)|endometrium(8)|kidney(4)|large_intestine(13)|lung(16)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	48	all_lung(12;1.13e-09)|Lung NSC(12;7.98e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					GGCTGATGCACAGGCTTAGGC	0.403																																							uc001rji.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(1795-1797)GTG>TTG		C1q domain containing 1 isoform 1							88.0	85.0	86.0					12																	30879010		2203	4300	6503	SO:0001583	missense	65981				negative regulation of cell growth|negative regulation of translation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of dendrite morphogenesis|positive regulation of dendritic spine morphogenesis|positive regulation of peptidyl-serine phosphorylation|positive regulation of protein binding|positive regulation of transcription from RNA polymerase II promoter	mitochondrion|receptor complex	receptor binding|RNA binding	g.chr12:30879010C>A	AY074491	CCDS8720.1, CCDS41766.1, CCDS41766.2, CCDS55816.1	12p11	2010-08-03	2007-03-27	2007-03-27	ENSG00000110888	ENSG00000110888			21259	protein-coding gene	gene with protein product		610375	"""C1q domain containing 1"""	C1QDC1		11347906, 14764709	Standard	NM_001002259		Approved	EEG1, FLJ22569, FLJ11391, caprin-2, RNG140	uc001rji.1	Q6IMN6	OTTHUMG00000169185	ENST00000395805.2:c.1795G>T	12.37:g.30879010C>A	ENSP00000379150:p.Val599Leu		Somatic				CAPRIN2_uc001rjf.1_Missense_Mutation_p.V396L|CAPRIN2_uc001rjg.1_Missense_Mutation_p.V266L|CAPRIN2_uc001rjh.1_Missense_Mutation_p.V599L|CAPRIN2_uc001rjj.1_Missense_Mutation_p.V266L|CAPRIN2_uc001rjk.3_Missense_Mutation_p.V599L|CAPRIN2_uc001rjl.3_Missense_Mutation_p.V599L|CAPRIN2_uc001rjm.1_Missense_Mutation_p.V266L	p.V599L	NM_001002259	NP_001002259	WXS	Illumina HiSeq	Unspecified	Q6IMN6	CAPR2_HUMAN			9	2546	-	all_lung(12;1.13e-09)|Lung NSC(12;7.98e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)		599						Missense_Mutation	SNP	ENST00000395805.2	37	c.1795G>T	CCDS55816.1	.	.	.	.	.	.	.	.	.	.	C	7.474	0.647276	0.14516	.	.	ENSG00000110888	ENST00000433722;ENST00000298892;ENST00000395805;ENST00000251071;ENST00000308433;ENST00000417045;ENST00000438006;ENST00000537108	T;T;T;T;T;T;T	0.75821	2.33;-0.65;2.84;-0.67;-0.97;2.78;2.38	5.1	-10.2	0.00374	.	1.117090	0.06661	N	0.764457	T	0.42517	0.1206	N	0.08118	0	0.09310	N	1	B;B;B;B;B;B	0.06786	0.0;0.0;0.001;0.0;0.0;0.0	B;B;B;B;B;B	0.06405	0.001;0.0;0.002;0.0;0.001;0.0	T	0.22521	-1.0214	10	0.24483	T	0.36	0.4924	2.8382	0.05521	0.2778:0.3523:0.2612:0.1087	.	325;599;599;599;599;599	E9PAU5;Q149P6;Q6IMN6-3;Q6IMN6;Q6IMN6-2;E4NKG2	.;.;.;CAPR2_HUMAN;.;.	L	345;599;599;599;266;599;325;518	ENSP00000415407:V345L;ENSP00000298892:V599L;ENSP00000379150:V599L;ENSP00000251071:V599L;ENSP00000309785:V266L;ENSP00000391479:V599L;ENSP00000438010:V518L	ENSP00000251071:V599L	V	-	1	0	CAPRIN2	30770277	0.101000	0.21875	0.001000	0.08648	0.583000	0.36354	-0.257000	0.08745	-2.354000	0.00614	-0.295000	0.09555	GTG		0.403	CAPRIN2-004	PUTATIVE	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000403322.2	NM_023925		9	81	1	0	0.000274275	0.004482	0.000355182	9	81				
BICD1	636	broad.mit.edu	37	12	32447000	32447000	+	Silent	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr12:32447000C>A	ENST00000281474.5	+	3	602	c.499C>A	c.(499-501)Cgg>Agg	p.R167R	BICD1_ENST00000548411.1_Silent_p.R167R	NM_001714.2	NP_001705.2	Q96G01	BICD1_HUMAN	bicaudal D homolog 1 (Drosophila)	167					anatomical structure morphogenesis (GO:0009653)|intracellular mRNA localization (GO:0008298)|microtubule anchoring at microtubule organizing center (GO:0072393)|minus-end-directed organelle transport along microtubule (GO:0072385)|negative regulation of phospholipase C activity (GO:1900275)|negative regulation of phospholipase C-activating G-protein coupled receptor signaling pathway (GO:1900737)|positive regulation of receptor-mediated endocytosis (GO:0048260)|protein localization to organelle (GO:0033365)|regulation of proteinase activated receptor activity (GO:1900276)|RNA processing (GO:0006396)|stress granule assembly (GO:0034063)|viral process (GO:0016032)	cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|host cell viral assembly compartment (GO:0072517)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)	cytoskeletal adaptor activity (GO:0008093)|dynactin binding (GO:0034452)|dynein binding (GO:0045502)|proteinase activated receptor binding (GO:0031871)|Rab GTPase binding (GO:0017137)|structural constituent of cytoskeleton (GO:0005200)	p.R167R(1)		NS(1)|breast(2)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46	all_cancers(9;5.13e-11)|all_epithelial(9;2.71e-11)|all_lung(12;6.66e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0213)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		OV - Ovarian serous cystadenocarcinoma(6;0.0201)			CCGGGAGGCACGGCTCCTTCA	0.398																																							uc001rku.2		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(1)|central_nervous_system(1)	2						c.(499-501)CGG>AGG		bicaudal D homolog 1 isoform 1							67.0	67.0	67.0					12																	32447000		2203	4300	6503	SO:0001819	synonymous_variant	636				anatomical structure morphogenesis|intracellular mRNA localization|microtubule anchoring at microtubule organizing center|minus-end-directed organelle transport along microtubule|positive regulation of receptor-mediated endocytosis|protein localization to organelle|RNA processing|stress granule assembly|viral reproduction	cytoplasmic vesicle|cytoskeleton|cytosol|host cell viral assembly compartment|membrane|perinuclear region of cytoplasm|trans-Golgi network	cytoskeletal adaptor activity|dynactin binding|dynein binding|proteinase activated receptor binding|Rab GTPase binding|structural constituent of cytoskeleton	g.chr12:32447000C>A	U90028	CCDS8726.1, CCDS44859.1	12p11.2-p11.1	2005-01-13	2001-11-28			ENSG00000151746			1049	protein-coding gene	gene with protein product		602204	"""Bicaudal D (Drosophila) homolog 1"""			9367685	Standard	NM_001714		Approved		uc001rku.3	Q96G01	OTTHUMG00000169307	ENST00000281474.5:c.499C>A	12.37:g.32447000C>A			Somatic				BICD1_uc001rkv.2_Silent_p.R167R|BICD1_uc010skd.1_RNA	p.R167R	NM_001714	NP_001705	WXS	Illumina HiSeq	Unspecified	Q96G01	BICD1_HUMAN	OV - Ovarian serous cystadenocarcinoma(6;0.0201)		3	580	+	all_cancers(9;5.13e-11)|all_epithelial(9;2.71e-11)|all_lung(12;6.66e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0213)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		167			Potential.		A8K2C3|F8W113|O43892|O43893	Silent	SNP	ENST00000281474.5	37	c.499C>A	CCDS8726.1																																																																																				0.398	BICD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403380.1	NM_001714		7	58	1	0	0.000157383	0.00308	0.000210004	7	58				
OR6C4	341418	broad.mit.edu	37	12	55945335	55945335	+	Nonsense_Mutation	SNP	G	G	T	rs78982301	byFrequency	TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr12:55945335G>T	ENST00000394256.2	+	1	353	c.325G>T	c.(325-327)Gag>Tag	p.E109*	RP11-110A12.2_ENST00000556750.1_RNA|RP11-110A12.2_ENST00000555138.1_RNA	NM_001005494.1	NP_001005494.1	Q8NGE1	OR6C4_HUMAN	olfactory receptor, family 6, subfamily C, member 4	109						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.E109*(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|skin(1)	11						TGGAGCTACCGAGTTTTACCT	0.423																																							uc010spp.1		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(325-327)GAG>TAG		olfactory receptor, family 6, subfamily C,							79.0	84.0	82.0					12																	55945335		2203	4299	6502	SO:0001587	stop_gained	341418				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr12:55945335G>T	BK004261	CCDS31827.1	12q14.2	2012-08-09				ENSG00000179626		"""GPCR / Class A : Olfactory receptors"""	19632	protein-coding gene	gene with protein product							Standard	NM_001005494		Approved		uc010spp.2	Q8NGE1	OTTHUMG00000169959	ENST00000394256.2:c.325G>T	12.37:g.55945335G>T	ENSP00000377799:p.Glu109*		Somatic					p.E109*	NM_001005494	NP_001005494	WXS	Illumina HiSeq	Unspecified	Q8NGE1	OR6C4_HUMAN			1	325	+			109			Helical; Name=3; (Potential).		A8MZG7|B2RNN2|Q6IFK1	Nonsense_Mutation	SNP	ENST00000394256.2	37	c.325G>T	CCDS31827.1	.	.	.	.	.	.	.	.	.	.	G	32	5.149498	0.94645	.	.	ENSG00000179626	ENST00000394256	.	.	.	5.05	5.05	0.67936	.	0.000000	0.50627	D	0.000110	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	18.5989	0.91240	0.0:0.0:1.0:0.0	.	.	.	.	X	109	.	ENSP00000377799:E109X	E	+	1	0	OR6C4	54231602	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	3.988000	0.56951	2.792000	0.96026	0.650000	0.86243	GAG		0.423	OR6C4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406678.1			10	147	1	0	0.00621372	0.006214	0.0072356	10	147				
E2F7	144455	broad.mit.edu	37	12	77449706	77449706	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr12:77449706C>A	ENST00000322886.7	-	3	533	c.298G>T	c.(298-300)Gac>Tac	p.D100Y	E2F7_ENST00000416496.2_Missense_Mutation_p.D100Y	NM_203394.2	NP_976328.2	Q96AV8	E2F7_HUMAN	E2F transcription factor 7	100					chorionic trophoblast cell differentiation (GO:0060718)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|hepatocyte differentiation (GO:0070365)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cytokinesis (GO:0032466)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|placenta development (GO:0001890)|positive regulation of DNA endoreduplication (GO:0032877)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|sprouting angiogenesis (GO:0002040)|trophoblast giant cell differentiation (GO:0060707)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|identical protein binding (GO:0042802)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.D100Y(2)		central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(15)|lung(14)|ovary(3)|upper_aerodigestive_tract(2)	42						TTCTCCCGGTCCCTTATATCT	0.463																																							uc001sym.3		NA																	2	Substitution - Missense(2)		lung(2)	upper_aerodigestive_tract(1)|ovary(1)|kidney(1)	3						c.(298-300)GAC>TAC		E2F transcription factor 7							153.0	147.0	149.0					12																	77449706		2203	4300	6503	SO:0001583	missense	144455				cell cycle	transcription factor complex	DNA binding|identical protein binding	g.chr12:77449706C>A	BC016658	CCDS9016.1	12q21.1	2008-02-05				ENSG00000165891			23820	protein-coding gene	gene with protein product		612046				12893818	Standard	NM_203394		Approved		uc001sym.4	Q96AV8	OTTHUMG00000169969	ENST00000322886.7:c.298G>T	12.37:g.77449706C>A	ENSP00000323246:p.Asp100Tyr		Somatic				E2F7_uc001syn.2_Missense_Mutation_p.D100Y	p.D100Y	NM_203394	NP_976328	WXS	Illumina HiSeq	Unspecified	Q96AV8	E2F7_HUMAN			3	534	-			100					A6NC74|B2RMR7|B3KTZ5|B3KUP8|B5MED9	Missense_Mutation	SNP	ENST00000322886.7	37	c.298G>T	CCDS9016.1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.565389	0.86439	.	.	ENSG00000165891	ENST00000322886;ENST00000416496;ENST00000550669;ENST00000547316	D;D;D;D	0.85171	-1.95;-1.95;-1.95;-1.95	5.7	5.7	0.88788	.	0.042718	0.85682	D	0.000000	D	0.91643	0.7359	M	0.62723	1.935	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	D	0.91979	0.5593	10	0.87932	D	0	-13.6558	18.8265	0.92121	0.0:1.0:0.0:0.0	.	100;100	F8VSE7;Q96AV8	.;E2F7_HUMAN	Y	100	ENSP00000323246:D100Y;ENSP00000393639:D100Y;ENSP00000448245:D100Y;ENSP00000449033:D100Y	ENSP00000323246:D100Y	D	-	1	0	E2F7	75973837	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.683000	0.46943	2.683000	0.91414	0.650000	0.86243	GAC		0.463	E2F7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406716.1	XM_084871		14	204	1	0	3.27435e-08	0.00245	5.84326e-08	14	204				
LRRIQ1	84125	broad.mit.edu	37	12	85450741	85450741	+	Missense_Mutation	SNP	A	A	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr12:85450741A>T	ENST00000393217.2	+	8	2231	c.2170A>T	c.(2170-2172)Agc>Tgc	p.S724C		NM_001079910.1	NP_001073379.1	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	724								p.S724C(2)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|liver(1)|lung(28)|ovary(5)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	83				GBM - Glioblastoma multiforme(134;0.212)		TGAACCTGATAGCATGACCTG	0.353																																							uc001tac.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|central_nervous_system(1)|skin(1)	6						c.(2170-2172)AGC>TGC		leucine-rich repeats and IQ motif containing 1							197.0	214.0	208.0					12																	85450741		2203	4299	6502	SO:0001583	missense	84125							g.chr12:85450741A>T	AK022365	CCDS41816.1	12q21	2008-02-05			ENSG00000133640	ENSG00000133640			25708	protein-coding gene	gene with protein product						11347906	Standard	NM_001079910		Approved	FLJ12303, KIAA1801	uc001tac.3	Q96JM4	OTTHUMG00000166185	ENST00000393217.2:c.2170A>T	12.37:g.85450741A>T	ENSP00000376910:p.Ser724Cys		Somatic				LRRIQ1_uc001tab.1_Missense_Mutation_p.S724C|LRRIQ1_uc001taa.1_Missense_Mutation_p.S699C	p.S724C	NM_001079910	NP_001073379	WXS	Illumina HiSeq	Unspecified	Q96JM4	LRIQ1_HUMAN		GBM - Glioblastoma multiforme(134;0.212)	8	2281	+			724					Q567P4|Q9BS17|Q9HA36	Missense_Mutation	SNP	ENST00000393217.2	37	c.2170A>T	CCDS41816.1	.	.	.	.	.	.	.	.	.	.	A	12.64	1.999635	0.35320	.	.	ENSG00000133640	ENST00000256007;ENST00000378580;ENST00000393217	T	0.53640	0.61	5.66	-6.06	0.02165	.	1.537080	0.04135	N	0.318552	T	0.25419	0.0618	N	0.08118	0	0.09310	N	1	P;P	0.48640	0.913;0.913	B;B	0.40741	0.339;0.339	T	0.39035	-0.9633	10	0.56958	D	0.05	.	8.3274	0.32165	0.2643:0.0:0.5198:0.2159	.	724;699	Q96JM4;C9JI57	LRIQ1_HUMAN;.	C	724;699;724	ENSP00000376910:S724C	ENSP00000256007:S724C	S	+	1	0	LRRIQ1	83974872	0.000000	0.05858	0.000000	0.03702	0.026000	0.11368	0.007000	0.13174	-0.730000	0.04869	0.482000	0.46254	AGC		0.353	LRRIQ1-004	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388249.2	NM_032165		23	579	0	0	0	0.00333	0	23	579				
PLXNC1	10154	broad.mit.edu	37	12	94641809	94641809	+	Missense_Mutation	SNP	A	A	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr12:94641809A>T	ENST00000258526.4	+	13	2768	c.2519A>T	c.(2518-2520)tAt>tTt	p.Y840F		NM_005761.2	NP_005752.1	O60486	PLXC1_HUMAN	plexin C1	840					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|receptor binding (GO:0005102)	p.Y840F(1)		breast(2)|central_nervous_system(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(12)|lung(30)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	64						ACCCTGCAGTATCGGGAGGAC	0.483																																							uc001tdc.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(2518-2520)TAT>TTT		plexin C1 precursor							92.0	86.0	88.0					12																	94641809		2203	4300	6503	SO:0001583	missense	10154				axon guidance|cell adhesion	integral to membrane|intracellular|plasma membrane	receptor activity|receptor binding	g.chr12:94641809A>T	AF030339	CCDS9049.1	12q23	2009-04-17				ENSG00000136040		"""CD molecules"", ""Plexins"""	9106	protein-coding gene	gene with protein product		604259					Standard	NR_037687		Approved	VESPR, CD232	uc001tdc.3	O60486	OTTHUMG00000170235	ENST00000258526.4:c.2519A>T	12.37:g.94641809A>T	ENSP00000258526:p.Tyr840Phe		Somatic					p.Y840F	NM_005761	NP_005752	WXS	Illumina HiSeq	Unspecified	O60486	PLXC1_HUMAN			13	2768	+			840			Extracellular (Potential).		Q59H25	Missense_Mutation	SNP	ENST00000258526.4	37	c.2519A>T	CCDS9049.1	.	.	.	.	.	.	.	.	.	.	A	16.93	3.259213	0.59321	.	.	ENSG00000136040	ENST00000258526	D	0.83419	-1.72	6.16	6.16	0.99307	Cell surface receptor IPT/TIG (2);	0.065487	0.64402	D	0.000006	D	0.87099	0.6093	L	0.36672	1.1	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	D	0.88011	0.2762	10	0.66056	D	0.02	.	14.547	0.68038	1.0:0.0:0.0:0.0	.	840	O60486	PLXC1_HUMAN	F	840	ENSP00000258526:Y840F	ENSP00000258526:Y840F	Y	+	2	0	PLXNC1	93165940	0.999000	0.42202	0.936000	0.37596	0.024000	0.10985	5.275000	0.65575	2.367000	0.80283	0.528000	0.53228	TAT		0.483	PLXNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408126.2			5	110	0	0	0	0.000602	0	5	110				
CFAP54	144535	broad.mit.edu	37	12	97114182	97114182	+	Splice_Site	SNP	G	G	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr12:97114182G>T	ENST00000524981.4	+	50	6827		c.e50-1					Q96N23	CL055_HUMAN										p.?(1)									CCTTTCCTTAGTCGATGTTAC	0.423																																							uc001tet.1		NA																	1	Unknown(1)		lung(1)	skin(6)|ovary(1)	7						c.e17-1		hypothetical protein LOC374467							122.0	101.0	108.0					12																	97114182		2203	4300	6503	SO:0001630	splice_region_variant	374467							g.chr12:97114182G>T																												ENST00000524981.4:c.6805-1G>T	12.37:g.97114182G>T			Somatic					p.S694_splice	NM_198520	NP_940922	WXS	Illumina HiSeq	Unspecified	Q6ZTY8	CL063_HUMAN			17	2158	+									Splice_Site	SNP	ENST00000524981.4	37	c.2080_splice		.	.	.	.	.	.	.	.	.	.	G	12.12	1.843879	0.32606	.	.	ENSG00000188596	ENST00000524981;ENST00000342887	.	.	.	4.88	4.88	0.63580	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.2497	0.66011	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	C12orf63	95638313	0.995000	0.38212	0.075000	0.20258	0.003000	0.03518	5.103000	0.64578	2.646000	0.89796	0.655000	0.94253	.		0.423	C12orf55-003	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000395046.4		Intron	6	70	1	0	4.68919e-08	0.008291	8.26729e-08	6	70				
ANKS1B	56899	broad.mit.edu	37	12	99223026	99223026	+	Missense_Mutation	SNP	C	C	G			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr12:99223026C>G	ENST00000547776.2	-	19	2991	c.2992G>C	c.(2992-2994)Gat>Cat	p.D998H	ANKS1B_ENST00000329257.7_Missense_Mutation_p.D998H|ANKS1B_ENST00000550693.2_Intron|ANKS1B_ENST00000549558.2_Intron|ANKS1B_ENST00000549493.2_Missense_Mutation_p.D224H|ANKS1B_ENST00000546960.1_Missense_Mutation_p.D224H|ANKS1B_ENST00000549025.2_Intron|ANKS1B_ENST00000546568.1_Intron|ANKS1B_ENST00000333732.7_Missense_Mutation_p.D4H|ANKS1B_ENST00000547446.1_Intron|ANKS1B_ENST00000341752.7_Missense_Mutation_p.D4H|ANKS1B_ENST00000332712.7_Intron|ANKS1B_ENST00000547010.1_Intron	NM_152788.4	NP_690001.3	Q7Z6G8	ANS1B_HUMAN	ankyrin repeat and sterile alpha motif domain containing 1B	998						cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	ephrin receptor binding (GO:0046875)			NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(15)|lung(38)|pancreas(1)|prostate(2)|skin(1)	70		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)		CTCCTTGCATCGCCCTGCATG	0.463																																							uc001tge.1		NA																	0					0						c.(2992-2994)GAT>CAT		cajalin 2 isoform a							235.0	230.0	231.0					12																	99223026		1949	4149	6098	SO:0001583	missense	56899					Cajal body|cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane		g.chr12:99223026C>G	AF145204	CCDS55864.1, CCDS55865.1, CCDS55866.1, CCDS55867.1, CCDS55868.1, CCDS55869.1, CCDS55870.1, CCDS55871.1, CCDS55872.1	12q23.1	2013-01-10						"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	24600	protein-coding gene	gene with protein product		607815				10490826, 12415113	Standard	NM_020140		Approved	EB-1, AIDA-1, cajalin-2, ANKS2	uc001tge.2	Q7Z6G8		ENST00000547776.2:c.2992G>C	12.37:g.99223026C>G	ENSP00000449629:p.Asp998His		Somatic				ANKS1B_uc001tgf.1_Intron|ANKS1B_uc001tgk.2_Missense_Mutation_p.D295H|ANKS1B_uc010svd.1_Missense_Mutation_p.D4H|ANKS1B_uc001tgd.1_Intron|ANKS1B_uc009ztq.2_5'UTR|ANKS1B_uc010sve.1_Missense_Mutation_p.D4H|ANKS1B_uc001tgh.3_Missense_Mutation_p.D4H|ANKS1B_uc001tgi.2_Missense_Mutation_p.D224H|ANKS1B_uc009ztr.2_Intron|ANKS1B_uc001tgj.2_Intron|ANKS1B_uc009ztp.2_Missense_Mutation_p.D4H|ANKS1B_uc010svf.1_Missense_Mutation_p.D4H|ANKS1B_uc001tgg.3_Intron|ANKS1B_uc010svg.1_Intron|ANKS1B_uc009zts.1_Missense_Mutation_p.D224H	p.D998H	NM_152788	NP_690001	WXS	Illumina HiSeq	Unspecified	Q7Z6G8	ANS1B_HUMAN		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)	19	3409	-		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)	998					A5PKY5|A7E259|A8K153|A8MSN4|B4DFP6|B4DH98|F8VPM3|F8VZR9|F8WC27|Q5XLJ0|Q6IVB5|Q6NUS4|Q7Z6G6|Q7Z6G7|Q8TAP3|Q9NRX7|Q9Y5K9	Missense_Mutation	SNP	ENST00000547776.2	37	c.2992G>C	CCDS55872.1	.	.	.	.	.	.	.	.	.	.	C	24.8	4.570432	0.86542	.	.	ENSG00000185046	ENST00000341752;ENST00000547776;ENST00000329257;ENST00000549493;ENST00000333732;ENST00000546960	T;T;T;T;T;T	0.78595	-0.53;0.81;0.81;-0.6;-1.19;-0.26	5.26	5.26	0.73747	.	0.000000	0.64402	D	0.000003	D	0.85168	0.5635	L	0.46157	1.445	0.80722	D	1	D;D;D;D;B;D;D	0.89917	0.998;0.997;0.997;1.0;0.264;0.997;1.0	D;P;D;D;B;D;D	0.91635	0.941;0.875;0.955;0.999;0.191;0.937;0.997	D	0.84321	0.0516	10	0.44086	T	0.13	-12.8684	19.2203	0.93793	0.0:1.0:0.0:0.0	.	4;4;224;113;212;224;998	F8VR14;B7Z9I9;Q7Z6G8-4;B1VKB5;F8VQW6;Q7Z6G8-3;Q7Z6G8	.;.;.;.;.;.;ANS1B_HUMAN	H	4;998;998;224;4;224	ENSP00000345510:D4H;ENSP00000449629:D998H;ENSP00000331381:D998H;ENSP00000448203:D224H;ENSP00000331256:D4H;ENSP00000447839:D224H	ENSP00000331381:D998H	D	-	1	0	ANKS1B	97747157	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.445000	0.80570	2.631000	0.89168	0.655000	0.94253	GAT		0.463	ANKS1B-003	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000408421.3	NM_020140		15	249	0	0	0	0.00245	0	15	249				
KBTBD6	89890	broad.mit.edu	37	13	41705565	41705565	+	Silent	SNP	T	T	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr13:41705565T>A	ENST00000379485.1	-	1	1317	c.1083A>T	c.(1081-1083)ccA>ccT	p.P361P	KBTBD6_ENST00000499385.2_Silent_p.P295P	NM_152903.4	NP_690867.3	Q86V97	KBTB6_HUMAN	kelch repeat and BTB (POZ) domain containing 6	361								p.P361P(1)		NS(1)|breast(1)|endometrium(8)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|skin(4)|urinary_tract(4)	43		Lung NSC(96;4.52e-06)|Breast(139;0.00123)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		all cancers(112;4.08e-09)|Epithelial(112;4.74e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000131)|GBM - Glioblastoma multiforme(144;0.000876)|BRCA - Breast invasive adenocarcinoma(63;0.0673)		CCCCCGAGTATGGATCACAGC	0.507																																							uc001uxu.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|skin(1)	2						c.(1081-1083)CCA>CCT		kelch repeat and BTB (POZ) domain-containing 6							97.0	95.0	96.0					13																	41705565		2203	4300	6503	SO:0001819	synonymous_variant	89890						protein binding	g.chr13:41705565T>A	AK056633	CCDS9376.1	13q13.3	2013-01-08			ENSG00000165572	ENSG00000165572		"""BTB/POZ domain containing"""	25340	protein-coding gene	gene with protein product						12477932	Standard	NM_152903		Approved	DKFZp547E1912	uc001uxu.1	Q86V97	OTTHUMG00000016786	ENST00000379485.1:c.1083A>T	13.37:g.41705565T>A			Somatic				KBTBD6_uc010ace.1_Intron|KBTBD6_uc010tfe.1_Silent_p.P295P|uc001uxv.1_5'Flank	p.P361P	NM_152903	NP_690867	WXS	Illumina HiSeq	Unspecified	Q86V97	KBTB6_HUMAN		all cancers(112;4.08e-09)|Epithelial(112;4.74e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000131)|GBM - Glioblastoma multiforme(144;0.000876)|BRCA - Breast invasive adenocarcinoma(63;0.0673)	1	1372	-		Lung NSC(96;4.52e-06)|Breast(139;0.00123)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)	361					Q5T6Y8|Q8N8L0|Q8NDM5|Q96MP6	Silent	SNP	ENST00000379485.1	37	c.1083A>T	CCDS9376.1																																																																																				0.507	KBTBD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044657.1	NM_152903		9	143	0	0	0	0.008291	0	9	143				
TBC1D4	9882	broad.mit.edu	37	13	75936627	75936627	+	Silent	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr13:75936627C>A	ENST00000377636.3	-	2	961	c.615G>T	c.(613-615)ctG>ctT	p.L205L	TBC1D4_ENST00000377625.2_Silent_p.L205L|TBC1D4_ENST00000425511.1_5'UTR|TBC1D4_ENST00000431480.2_Silent_p.L205L	NM_014832.2	NP_055647.2	O60343	TBCD4_HUMAN	TBC1 domain family, member 4	205	PID 1. {ECO:0000255|PROSITE- ProRule:PRU00148}.				cellular response to insulin stimulus (GO:0032869)|membrane organization (GO:0061024)|negative regulation of vesicle fusion (GO:0031339)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)	Rab GTPase activator activity (GO:0005097)	p.L205L(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(12)|lung(18)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Prostate(6;0.014)|Breast(118;0.0982)		GBM - Glioblastoma multiforme(99;0.0116)		TTCCACAGTACAGGACTTCGA	0.507																																							uc001vjl.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|central_nervous_system(1)|skin(1)	6						c.(613-615)CTG>CTT		TBC1 domain family, member 4							190.0	188.0	189.0					13																	75936627		2009	4167	6176	SO:0001819	synonymous_variant	9882					cytoplasm	Rab GTPase activator activity	g.chr13:75936627C>A	AB011175	CCDS41901.1, CCDS66563.1, CCDS66564.1	13q22.2	2013-07-09			ENSG00000136111	ENSG00000136111			19165	protein-coding gene	gene with protein product	"""Akt substrate of 160 kDa"""	612465				11829485, 11994271, 15304337	Standard	XM_005266603		Approved	KIAA0603, AS160, DKFZp779C0666	uc001vjl.1	O60343	OTTHUMG00000017088	ENST00000377636.3:c.615G>T	13.37:g.75936627C>A			Somatic				TBC1D4_uc010aer.2_Silent_p.L205L|TBC1D4_uc010aes.2_Silent_p.L205L	p.L205L	NM_014832	NP_055647	WXS	Illumina HiSeq	Unspecified	O60343	TBCD4_HUMAN		GBM - Glioblastoma multiforme(99;0.0116)	2	962	-		Prostate(6;0.014)|Breast(118;0.0982)	205			PID 1.		A7E2X8|B4DU25|B4E235|B6ETN8|B6ETN9|Q5W0B9|Q68D14	Silent	SNP	ENST00000377636.3	37	c.615G>T	CCDS41901.1																																																																																				0.507	TBC1D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045283.1	NM_014832		35	294	1	0	9.04072e-19	0.003271	1.92664e-18	35	294				
RNF219	79596	broad.mit.edu	37	13	79190730	79190730	+	Missense_Mutation	SNP	G	G	C			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr13:79190730G>C	ENST00000282003.6	-	6	1224	c.1166C>G	c.(1165-1167)cCt>cGt	p.P389R	RNF219-AS1_ENST00000560584.2_RNA|RNF219-AS1_ENST00000606429.1_RNA|RNF219-AS1_ENST00000560209.2_RNA	NM_024546.3	NP_078822.3	Q5W0B1	RN219_HUMAN	ring finger protein 219	389							zinc ion binding (GO:0008270)	p.P389R(1)		breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(11)|liver(1)|lung(11)|prostate(1)|skin(1)	32		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.0848)		GBM - Glioblastoma multiforme(99;0.0414)		AGGAGTACAAGGAGCTGGAAG	0.423																																							uc001vkw.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(2)	2						c.(1165-1167)CCT>CGT		ring finger protein 219							165.0	148.0	153.0					13																	79190730		2203	4300	6503	SO:0001583	missense	79596						zinc ion binding	g.chr13:79190730G>C	BC028586	CCDS31997.1	13q31.1	2011-05-23	2008-03-26	2008-03-26	ENSG00000152193	ENSG00000152193		"""RING-type (C3HC4) zinc fingers"""	20308	protein-coding gene	gene with protein product		615906	"""chromosome 13 open reading frame 7"""	C13orf7			Standard	XM_006719865		Approved	FLJ13449	uc001vkw.1	Q5W0B1	OTTHUMG00000017122	ENST00000282003.6:c.1166C>G	13.37:g.79190730G>C	ENSP00000282003:p.Pro389Arg		Somatic				uc001vku.1_RNA|RNF219_uc010afb.1_Missense_Mutation_p.P199R|RNF219_uc010afc.2_Intron	p.P389R	NM_024546	NP_078822	WXS	Illumina HiSeq	Unspecified	Q5W0B1	RN219_HUMAN		GBM - Glioblastoma multiforme(99;0.0414)	6	1225	-		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.0848)	389					B2RN99|Q8TBY2|Q9H0T2|Q9H8M0	Missense_Mutation	SNP	ENST00000282003.6	37	c.1166C>G	CCDS31997.1	.	.	.	.	.	.	.	.	.	.	G	14.96	2.692197	0.48202	.	.	ENSG00000152193	ENST00000282003	T	0.13778	2.56	5.92	5.92	0.95590	.	0.329712	0.32918	N	0.005483	T	0.21267	0.0512	L	0.48642	1.525	0.43814	D	0.996378	P	0.41366	0.747	B	0.43508	0.422	T	0.00217	-1.1909	10	0.87932	D	0	-17.2506	20.3206	0.98668	0.0:0.0:1.0:0.0	.	389	Q5W0B1	RN219_HUMAN	R	389	ENSP00000282003:P389R	ENSP00000282003:P389R	P	-	2	0	RNF219	78088731	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.090000	0.89526	2.809000	0.96659	0.655000	0.94253	CCT		0.423	RNF219-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045363.1	NM_024546		17	166	0	0	0	0.004007	0	17	166				
OR4Q3	441669	broad.mit.edu	37	14	20215964	20215964	+	Silent	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr14:20215964C>A	ENST00000331723.1	+	1	378	c.378C>A	c.(376-378)gcC>gcA	p.A126A		NM_172194.1	NP_751944.1	Q8NH05	OR4Q3_HUMAN	olfactory receptor, family 4, subfamily Q, member 3	126						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A126A(1)		NS(2)|breast(4)|endometrium(3)|kidney(2)|large_intestine(1)|lung(28)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)	47	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		GGTATGTTGCCATCTGTAACC	0.493																																							uc010tkt.1		NA																	1	Substitution - coding silent(1)		lung(1)	breast(3)	3						c.(376-378)GCC>GCA		olfactory receptor, family 4, subfamily Q,							115.0	116.0	115.0					14																	20215964		2203	4300	6503	SO:0001819	synonymous_variant	441669				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr14:20215964C>A	AF179768	CCDS32020.1	14p13	2012-08-09				ENSG00000182652		"""GPCR / Class A : Olfactory receptors"""	15426	protein-coding gene	gene with protein product				OR4Q4			Standard	NM_172194		Approved	C14orf13	uc010tkt.2	Q8NH05		ENST00000331723.1:c.378C>A	14.37:g.20215964C>A			Somatic					p.A126A	NM_172194	NP_751944	WXS	Illumina HiSeq	Unspecified	Q8NH05	OR4Q3_HUMAN	Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)	1	378	+	all_cancers(95;0.00108)		126			Cytoplasmic (Potential).		Q6IEX4	Silent	SNP	ENST00000331723.1	37	c.378C>A	CCDS32020.1																																																																																				0.493	OR4Q3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409818.2			6	122	1	0	3.59834e-05	0.001168	5.19628e-05	6	122				
OR4N5	390437	broad.mit.edu	37	14	20612538	20612538	+	Missense_Mutation	SNP	T	T	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr14:20612538T>A	ENST00000333629.1	+	1	644	c.644T>A	c.(643-645)cTg>cAg	p.L215Q	RNA5SP381_ENST00000516076.1_RNA	NM_001004724.1	NP_001004724.1	Q8IXE1	OR4N5_HUMAN	olfactory receptor, family 4, subfamily N, member 5	215						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L215Q(1)		endometrium(2)|lung(23)|ovary(1)|skin(2)|urinary_tract(1)	29	all_cancers(95;0.00108)		Epithelial(56;7.58e-07)|all cancers(55;3.84e-06)	GBM - Glioblastoma multiforme(265;0.0143)		CTGGGCCTTCTGGCCTCCTAT	0.512																																							uc010tla.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(643-645)CTG>CAG		olfactory receptor, family 4, subfamily N,							99.0	86.0	90.0					14																	20612538		2203	4300	6503	SO:0001583	missense	390437				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr14:20612538T>A		CCDS32031.1	14q11.2	2013-09-23			ENSG00000184394	ENSG00000184394		"""GPCR / Class A : Olfactory receptors"""	15358	protein-coding gene	gene with protein product							Standard	NM_001004724		Approved		uc010tla.2	Q8IXE1	OTTHUMG00000170784	ENST00000333629.1:c.644T>A	14.37:g.20612538T>A	ENSP00000332110:p.Leu215Gln		Somatic					p.L215Q	NM_001004724	NP_001004724	WXS	Illumina HiSeq	Unspecified	Q8IXE1	OR4N5_HUMAN	Epithelial(56;7.58e-07)|all cancers(55;3.84e-06)	GBM - Glioblastoma multiforme(265;0.0143)	1	644	+	all_cancers(95;0.00108)		215			Helical; Name=5; (Potential).		Q6IF11	Missense_Mutation	SNP	ENST00000333629.1	37	c.644T>A	CCDS32031.1	.	.	.	.	.	.	.	.	.	.	T	15.83	2.950381	0.53186	.	.	ENSG00000184394	ENST00000333629	T	0.00277	8.34	3.88	3.88	0.44766	GPCR, rhodopsin-like superfamily (1);	0.000000	0.34200	N	0.004179	T	0.01092	0.0036	H	0.97732	4.065	0.32918	D	0.515459	D	0.89917	1.0	D	0.97110	1.0	T	0.01635	-1.1307	10	0.87932	D	0	.	10.9699	0.47434	0.0:0.0:0.0:1.0	.	215	Q8IXE1	OR4N5_HUMAN	Q	215	ENSP00000332110:L215Q	ENSP00000332110:L215Q	L	+	2	0	OR4N5	19682378	0.003000	0.15002	0.998000	0.56505	0.975000	0.68041	1.398000	0.34554	1.753000	0.51906	0.533000	0.62120	CTG		0.512	OR4N5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410347.1			25	137	0	0	0	0.00333	0	25	137				
BNIP3P1	319138	broad.mit.edu	37	14	28734072	28734072	+	RNA	SNP	G	G	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr14:28734072G>T	ENST00000550043.1	+	0	477									BCL2/adenovirus E1B 19kDa interacting protein 3 pseudogene 1																		GAGAAGGAAGGAAGTTGAAAG	0.438																																							uc001wqd.2		NA																	0					NA						c.(313-315)GAA>TAA		SubName: Full=cDNA FLJ60537, highly similar to BCL2/adenovirus E1B 19 kDa protein-interacting protein 3;																																						0							g.chr14:28734072G>T			14q12	2014-02-04	2011-03-18	2011-03-18	ENSG00000197358	ENSG00000197358			19922	pseudogene	pseudogene			"""BCL2/adenovirus E1B 19kDa interacting protein 3 pseudogene"""	BNIP3P			Standard	NG_002516		Approved				OTTHUMG00000170378		14.37:g.28734072G>T			Somatic					p.E105*			WXS	Illumina HiSeq	Unspecified					1	453	+									Nonsense_Mutation	SNP	ENST00000550043.1	37	c.313G>T																																																																																					0.438	BNIP3P1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000408770.1			10	106	1	0	9.70103e-10	0.008291	1.83567e-09	10	106				
NID2	22795	broad.mit.edu	37	14	52508829	52508829	+	Missense_Mutation	SNP	G	G	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr14:52508829G>A	ENST00000216286.5	-	7	1818	c.1819C>T	c.(1819-1821)Ctc>Ttc	p.L607F	NID2_ENST00000541773.1_Missense_Mutation_p.L554F	NM_007361.3	NP_031387.3	Q14112	NID2_HUMAN	nidogen 2 (osteonidogen)	607	Nidogen G2 beta-barrel. {ECO:0000255|PROSITE-ProRule:PRU00348}.				basement membrane organization (GO:0071711)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|cell surface (GO:0009986)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)	p.L607F(1)		NS(1)|breast(5)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(40)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	87	Breast(41;0.0639)|all_epithelial(31;0.123)					TCACCTGCGAGGCTGAAGCCG	0.577																																							uc001wzo.2		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(2)|breast(2)|ovary(1)|liver(1)|skin(1)	7						c.(1819-1821)CTC>TTC		nidogen 2 precursor							63.0	69.0	67.0					14																	52508829		2203	4300	6503	SO:0001583	missense	22795					basement membrane	calcium ion binding|collagen binding	g.chr14:52508829G>A	AB009799	CCDS9706.1	14q22.1	2008-05-14			ENSG00000087303	ENSG00000087303			13389	protein-coding gene	gene with protein product		605399				9733643	Standard	NM_007361		Approved		uc001wzo.3	Q14112	OTTHUMG00000140298	ENST00000216286.5:c.1819C>T	14.37:g.52508829G>A	ENSP00000216286:p.Leu607Phe		Somatic				NID2_uc010tqs.1_Missense_Mutation_p.L607F|NID2_uc010tqt.1_Missense_Mutation_p.L607F|NID2_uc001wzp.2_Missense_Mutation_p.L607F	p.L607F	NM_007361	NP_031387	WXS	Illumina HiSeq	Unspecified	Q14112	NID2_HUMAN			7	2053	-	Breast(41;0.0639)|all_epithelial(31;0.123)		607			Nidogen G2 beta-barrel.		A8K6I7|B4DU19|O43710	Missense_Mutation	SNP	ENST00000216286.5	37	c.1819C>T	CCDS9706.1	.	.	.	.	.	.	.	.	.	.	G	13.63	2.293129	0.40594	.	.	ENSG00000087303	ENST00000216286;ENST00000316204;ENST00000541773;ENST00000395707	T;T	0.30981	1.51;1.51	5.93	0.338	0.15974	G2 nidogen/fibulin G2F (3);Green fluorescent protein-like (1);	0.382204	0.30446	N	0.009607	T	0.16981	0.0408	N	0.21508	0.67	0.36953	D	0.892964	B;B;B;B	0.20459	0.045;0.008;0.034;0.025	B;B;B;B	0.26310	0.049;0.019;0.046;0.068	T	0.06338	-1.0832	10	0.41790	T	0.15	.	4.4176	0.11465	0.321:0.0:0.2949:0.3841	.	201;554;609;607	E7EPP3;Q14112-2;Q5CZI2;Q14112	.;.;.;NID2_HUMAN	F	607;201;554;609	ENSP00000216286:L607F;ENSP00000443730:L554F	ENSP00000216286:L607F	L	-	1	0	NID2	51578579	0.997000	0.39634	0.998000	0.56505	0.978000	0.69477	0.462000	0.21956	0.110000	0.17919	0.655000	0.94253	CTC		0.577	NID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276888.1			4	120	0	0	0	0.000602	0	4	120				
AHNAK2	113146	broad.mit.edu	37	14	105412404	105412404	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr14:105412404G>T	ENST00000333244.5	-	7	9503	c.9384C>A	c.(9382-9384)gaC>gaA	p.D3128E	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	3128						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)		p.D3128E(1)		cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			CCAGGGACAGGTCCCCCTCCA	0.627																																							uc010axc.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(9382-9384)GAC>GAA		AHNAK nucleoprotein 2							151.0	128.0	136.0					14																	105412404		1959	4114	6073	SO:0001583	missense	113146					nucleus		g.chr14:105412404G>T	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.9384C>A	14.37:g.105412404G>T	ENSP00000353114:p.Asp3128Glu		Somatic				AHNAK2_uc001ypx.2_Missense_Mutation_p.D3028E	p.D3128E	NM_138420	NP_612429	WXS	Illumina HiSeq	Unspecified	Q8IVF2	AHNK2_HUMAN	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)		7	9504	-		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	3128					Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	c.9384C>A	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	N	7.264	0.605777	0.14002	.	.	ENSG00000185567	ENST00000333244	T	0.01228	5.14	2.76	-5.01	0.02991	.	.	.	.	.	T	0.02767	0.0083	L	0.37750	1.13	0.09310	N	1	D	0.61697	0.99	D	0.70935	0.971	T	0.13764	-1.0497	9	0.13853	T	0.58	.	8.7759	0.34762	0.192:0.5796:0.2284:0.0	.	3128	Q8IVF2	AHNK2_HUMAN	E	3128	ENSP00000353114:D3128E	ENSP00000353114:D3128E	D	-	3	2	AHNAK2	104483449	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-2.159000	0.01280	-1.107000	0.03004	0.313000	0.20887	GAC		0.627	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420		17	224	1	0	2.21704e-12	0.00278	4.44419e-12	17	224				
AHNAK2	113146	broad.mit.edu	37	14	105420209	105420209	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr14:105420209G>T	ENST00000333244.5	-	7	1698	c.1579C>A	c.(1579-1581)Ctg>Atg	p.L527M	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	527						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)		p.L527M(1)		cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			TCACCCTTCAGGCCAGTACCC	0.557																																							uc010axc.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1579-1581)CTG>ATG		AHNAK nucleoprotein 2							114.0	122.0	119.0					14																	105420209		2013	4159	6172	SO:0001583	missense	113146					nucleus		g.chr14:105420209G>T	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.1579C>A	14.37:g.105420209G>T	ENSP00000353114:p.Leu527Met		Somatic				AHNAK2_uc001ypx.2_Missense_Mutation_p.L427M	p.L527M	NM_138420	NP_612429	WXS	Illumina HiSeq	Unspecified	Q8IVF2	AHNK2_HUMAN	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)		7	1699	-		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	527					Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	c.1579C>A	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	g	8.823	0.938011	0.18206	.	.	ENSG00000185567	ENST00000333244	T	0.02631	4.22	3.53	-1.41	0.08941	.	.	.	.	.	T	0.01627	0.0052	N	0.14661	0.345	0.09310	N	1	P	0.46327	0.876	B	0.37888	0.26	T	0.49908	-0.8889	9	0.36615	T	0.2	.	5.575	0.17218	0.0977:0.5297:0.2586:0.114	.	527	Q8IVF2	AHNK2_HUMAN	M	527	ENSP00000353114:L527M	ENSP00000353114:L527M	L	-	1	2	AHNAK2	104491254	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	-4.519000	0.00222	-0.158000	0.11040	0.561000	0.74099	CTG		0.557	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420		6	127	1	0	0.00198382	0.001984	0.00237301	6	127				
MKRN3	7681	broad.mit.edu	37	15	23811793	23811793	+	Silent	SNP	C	C	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr15:23811793C>T	ENST00000314520.3	+	1	1340	c.864C>T	c.(862-864)gcC>gcT	p.A288A	RP11-73C9.1_ENST00000563044.1_RNA|MKRN3_ENST00000564592.1_Intron|MKRN3_ENST00000568945.1_3'UTR|MKRN3_ENST00000568252.1_Intron	NM_005664.3	NP_005655.1	Q13064	MKRN3_HUMAN	makorin ring finger protein 3	288	Makorin-type Cys-His.				protein ubiquitination (GO:0016567)	ribonucleoprotein complex (GO:0030529)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.A288A(1)		breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(33)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		all_cancers(20;8.44e-25)|all_epithelial(15;3.69e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000353)|Colorectal(260;0.14)		all cancers(64;3.02e-06)|Epithelial(43;1.94e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0012)		ATATGAGGGCCTGCATTGAAG	0.527																																							uc001ywh.3		NA																	1	Substitution - coding silent(1)		lung(1)	lung(6)|large_intestine(2)|ovary(2)	10						c.(862-864)GCC>GCT		makorin ring finger protein 3							98.0	94.0	95.0					15																	23811793		2203	4300	6503	SO:0001819	synonymous_variant	7681					ribonucleoprotein complex	ligase activity|nucleic acid binding|zinc ion binding	g.chr15:23811793C>T	U19107	CCDS10013.1	15q11-q13	2013-01-09	2008-08-13		ENSG00000179455	ENSG00000179455		"""RING-type (C3HC4) zinc fingers"""	7114	protein-coding gene	gene with protein product	"""zinc finger protein 127"""	603856		ZNF127, D15S9		10196367	Standard	NM_005664		Approved	RNF63, ZFP127, MGC88288	uc001ywh.4	Q13064	OTTHUMG00000129160	ENST00000314520.3:c.864C>T	15.37:g.23811793C>T			Somatic				MKRN3_uc001ywi.2_Intron|MKRN3_uc010ayi.1_Silent_p.A288A	p.A288A	NM_005664	NP_005655	WXS	Illumina HiSeq	Unspecified	Q13064	MKRN3_HUMAN		all cancers(64;3.02e-06)|Epithelial(43;1.94e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0012)	1	1340	+		all_cancers(20;8.44e-25)|all_epithelial(15;3.69e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000353)|Colorectal(260;0.14)	288			Makorin-type Cys-His.			Silent	SNP	ENST00000314520.3	37	c.864C>T	CCDS10013.1																																																																																				0.527	MKRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251225.1	NM_005664		7	58	0	0	0	0.001984	0	7	58				
TJP1	7082	broad.mit.edu	37	15	30024963	30024963	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr15:30024963C>A	ENST00000346128.6	-	14	2267	c.1793G>T	c.(1792-1794)cGt>cTt	p.R598L	TJP1_ENST00000545208.2_Missense_Mutation_p.R598L|TJP1_ENST00000400011.2_Missense_Mutation_p.R602L|TJP1_ENST00000356107.6_Missense_Mutation_p.R598L	NM_003257.3|NM_175610.2	NP_003248.3|NP_783297.2	Q07157	ZO1_HUMAN	tight junction protein 1	598	Guanylate kinase-like. {ECO:0000255|PROSITE-ProRule:PRU00100}.				apoptotic process (GO:0006915)|blastocyst formation (GO:0001825)|cell-cell junction assembly (GO:0007043)|cell-cell signaling involved in cell-cell junction organization (GO:1901350)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to glucose stimulus (GO:0071333)|hippo signaling (GO:0035329)|membrane organization (GO:0061024)|negative regulation of vascular permeability (GO:0043116)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to magnetism (GO:0071000)|sensory perception of sound (GO:0007605)	apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|gap junction (GO:0005921)|intercalated disc (GO:0014704)|intercellular canaliculus (GO:0046581)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)		p.R598L(1)		breast(4)|central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|urinary_tract(1)	68		all_lung(180;7.48e-11)|Breast(32;0.000153)		all cancers(64;3.29e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0034)|GBM - Glioblastoma multiforme(186;0.0139)|Lung(196;0.186)		GAAGTCAGCACGGTCTCCGCC	0.443																																					Melanoma(77;681 1843 6309 6570)	Melanoma(77;681 1843 6309 6570)	uc001zcr.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|central_nervous_system(1)|pancreas(1)	6						c.(1792-1794)CGT>CTT		tight junction protein 1 isoform a							51.0	51.0	51.0					15																	30024963		1845	4093	5938	SO:0001583	missense	7082				cell-cell junction assembly|cellular component disassembly involved in apoptosis	basolateral plasma membrane|cell-cell adherens junction|Golgi apparatus|tight junction		g.chr15:30024963C>A		CCDS42007.1, CCDS45199.1, CCDS73702.1	15q13	2012-07-12	2012-07-12		ENSG00000104067	ENSG00000104067			11827	protein-coding gene	gene with protein product	"""zona occludens 1"", ""tight junction protein ZO-1"""	601009				8825647	Standard	XM_005254616		Approved	ZO-1, MGC133289, DKFZp686M05161	uc001zcr.3	Q07157	OTTHUMG00000137397	ENST00000346128.6:c.1793G>T	15.37:g.30024963C>A	ENSP00000281537:p.Arg598Leu		Somatic				TJP1_uc010azl.2_Missense_Mutation_p.R586L|TJP1_uc001zcq.2_Missense_Mutation_p.R602L|TJP1_uc001zcs.2_Missense_Mutation_p.R598L	p.R598L	NM_003257	NP_003248	WXS	Illumina HiSeq	Unspecified	Q07157	ZO1_HUMAN		all cancers(64;3.29e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0034)|GBM - Glioblastoma multiforme(186;0.0139)|Lung(196;0.186)	14	2268	-		all_lung(180;7.48e-11)|Breast(32;0.000153)	598			Guanylate kinase-like.		B4E3K1|Q2NKP3|Q4ZGJ6	Missense_Mutation	SNP	ENST00000346128.6	37	c.1793G>T	CCDS42007.1	.	.	.	.	.	.	.	.	.	.	C	35	5.421447	0.96111	.	.	ENSG00000104067	ENST00000346128;ENST00000400011;ENST00000545208;ENST00000400007;ENST00000356107	T;T;T;T	0.11063	2.83;3.02;2.95;2.81	6.03	6.03	0.97812	Src homology-3 domain (1);	0.000000	0.85682	D	0.000000	T	0.40322	0.1112	M	0.82517	2.595	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.998	T	0.07083	-1.0791	9	.	.	.	.	20.5666	0.99351	0.0:1.0:0.0:0.0	.	591;598;598;602	A9CQZ8;Q07157-2;Q07157;G5E9E7	.;.;ZO1_HUMAN;.	L	598;602;598;598;598	ENSP00000281537:R598L;ENSP00000382890:R602L;ENSP00000441202:R598L;ENSP00000348416:R598L	.	R	-	2	0	TJP1	27812255	1.000000	0.71417	0.967000	0.41034	0.876000	0.50452	7.818000	0.86416	2.854000	0.98071	0.655000	0.94253	CGT		0.443	TJP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268237.3	NM_003257		5	56	1	0	0.000602214	0.000602	0.000753197	5	56				
TRPM1	4308	broad.mit.edu	37	15	31294304	31294304	+	Silent	SNP	G	G	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr15:31294304G>T	ENST00000256552.6	-	28	4746	c.4599C>A	c.(4597-4599)gtC>gtA	p.V1533V	RP11-348B17.1_ENST00000561299.1_RNA|TRPM1_ENST00000397795.2_Silent_p.V1511V|TRPM1_ENST00000542188.1_Silent_p.V1550V	NM_001252024.1	NP_001238953.1			transient receptor potential cation channel, subfamily M, member 1									p.V1511V(1)		NS(2)|breast(3)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(15)|lung(48)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(3)	99		all_lung(180;1.92e-11)		all cancers(64;3.52e-16)|Epithelial(43;1.65e-11)|GBM - Glioblastoma multiforme(186;3.57e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00533)|COAD - Colon adenocarcinoma(236;0.0609)|Lung(196;0.199)		TTGCTTCAGCGACATGGTGTT	0.458																																							uc001zfm.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|pancreas(1)|skin(1)	4						c.(4531-4533)GTC>GTA		transient receptor potential cation channel,							264.0	246.0	252.0					15																	31294304		2036	4178	6214	SO:0001819	synonymous_variant	4308				cellular response to light stimulus|visual perception	integral to plasma membrane	calcium channel activity|receptor activity	g.chr15:31294304G>T	AF071787	CCDS10024.2, CCDS58345.1, CCDS58346.1, CCDS58347.1	15q13.3	2014-01-28		2002-01-18	ENSG00000134160	ENSG00000134160		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	7146	protein-coding gene	gene with protein product		603576	"""melastatin 1"""	MLSN1		9806836, 9537257, 16382100	Standard	NM_001252020		Approved	LTRPC1, CSNB1C	uc021sia.1	Q7Z4N2	OTTHUMG00000129267	ENST00000256552.6:c.4599C>A	15.37:g.31294304G>T			Somatic				TRPM1_uc010azy.2_Silent_p.V1418V|TRPM1_uc001zfl.2_RNA	p.V1511V	NM_002420	NP_002411	WXS	Illumina HiSeq	Unspecified	Q7Z4N2	TRPM1_HUMAN		all cancers(64;3.52e-16)|Epithelial(43;1.65e-11)|GBM - Glioblastoma multiforme(186;3.57e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00533)|COAD - Colon adenocarcinoma(236;0.0609)|Lung(196;0.199)	27	4661	-		all_lung(180;1.92e-11)	1511			Cytoplasmic (Potential).			Silent	SNP	ENST00000256552.6	37	c.4533C>A	CCDS58346.1																																																																																				0.458	TRPM1-004	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417166.2	NM_002420		29	412	1	0	1.74807e-11	0.002096	3.41068e-11	29	412				
RYR3	6263	broad.mit.edu	37	15	33926871	33926871	+	Silent	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr15:33926871C>A	ENST00000389232.4	+	25	3182	c.3112C>A	c.(3112-3114)Cgg>Agg	p.R1038R	RYR3_ENST00000415757.3_Silent_p.R1038R	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	1038	4 X approximate repeats.|B30.2/SPRY 2. {ECO:0000255|PROSITE- ProRule:PRU00548}.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)	p.R1038R(1)		NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		GGACAGCCTGCGGGAAGCTGT	0.468																																							uc001zhi.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(5)|central_nervous_system(4)|lung(1)	10						c.(3112-3114)CGG>AGG		ryanodine receptor 3							147.0	145.0	146.0					15																	33926871		1930	4140	6070	SO:0001819	synonymous_variant	6263				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity	g.chr15:33926871C>A		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.3112C>A	15.37:g.33926871C>A			Somatic				RYR3_uc010bar.2_Silent_p.R1038R	p.R1038R	NM_001036	NP_001027	WXS	Illumina HiSeq	Unspecified	Q15413	RYR3_HUMAN		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)	25	3182	+		all_lung(180;7.18e-09)	1038			2.|B30.2/SPRY 2.|Cytoplasmic (By similarity).|4 X approximate repeats.		O15175|Q15412	Silent	SNP	ENST00000389232.4	37	c.3112C>A	CCDS45210.1																																																																																				0.468	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1			7	106	1	0	0.00198382	0.001984	0.00237301	7	106				
AQR	9716	broad.mit.edu	37	15	35198869	35198869	+	Missense_Mutation	SNP	T	T	C			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr15:35198869T>C	ENST00000156471.5	-	18	1933	c.1708A>G	c.(1708-1710)Aca>Gca	p.T570A		NM_014691.2	NP_055506.1	O60306	AQR_HUMAN	aquarius intron-binding spliceosomal factor	570					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.T570A(1)		breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(10)|lung(18)|ovary(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)	57		Lung NSC(122;8.7e-10)|all_lung(180;1.47e-08)		all cancers(64;4.34e-18)|GBM - Glioblastoma multiforme(113;4.59e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0283)		TAAGGTTTTGTGGGACGTACG	0.388																																							uc001ziv.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)	1						c.(1708-1710)ACA>GCA		aquarius							126.0	114.0	118.0					15																	35198869		1901	4137	6038	SO:0001583	missense	9716					catalytic step 2 spliceosome	RNA binding	g.chr15:35198869T>C	AB011132	CCDS42013.1	15q13	2013-09-12	2013-09-12			ENSG00000021776			29513	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 164"""	610548	"""aquarius homolog (mouse)"""			9626505, 16949364	Standard	NM_014691		Approved	KIAA0560, fSAP164, IBP160	uc001ziv.3	O60306		ENST00000156471.5:c.1708A>G	15.37:g.35198869T>C	ENSP00000156471:p.Thr570Ala		Somatic					p.T570A	NM_014691	NP_055506	WXS	Illumina HiSeq	Unspecified	O60306	AQR_HUMAN		all cancers(64;4.34e-18)|GBM - Glioblastoma multiforme(113;4.59e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0283)	18	1889	-		Lung NSC(122;8.7e-10)|all_lung(180;1.47e-08)	570					A0JP17|A5YKK3|Q2YDX9|Q6IRU8|Q6PIC8	Missense_Mutation	SNP	ENST00000156471.5	37	c.1708A>G	CCDS42013.1	.	.	.	.	.	.	.	.	.	.	T	11.74	1.727726	0.30593	.	.	ENSG00000021776	ENST00000156471;ENST00000543879	D	0.93811	-3.29	5.44	4.29	0.51040	.	0.192943	0.53938	D	0.000048	D	0.90525	0.7031	M	0.76574	2.34	0.36098	D	0.843964	B	0.17038	0.02	B	0.18263	0.021	D	0.84799	0.0783	10	0.13853	T	0.58	-16.1193	7.7977	0.29156	0.1378:0.0:0.1443:0.7178	.	570	O60306	AQR_HUMAN	A	570	ENSP00000156471:T570A	ENSP00000156471:T570A	T	-	1	0	AQR	32986161	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.785000	0.68998	0.865000	0.35603	0.482000	0.46254	ACA		0.388	AQR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417526.2	NM_014691		4	116	0	0	0	0.000248	0	4	116				
CHD2	1106	broad.mit.edu	37	15	93496623	93496623	+	Silent	SNP	A	A	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr15:93496623A>T	ENST00000394196.4	+	14	2607	c.1539A>T	c.(1537-1539)ctA>ctT	p.L513L	CHD2_ENST00000557381.1_Silent_p.L513L	NM_001271.3	NP_001262.3	O14647	CHD2_HUMAN	chromodomain helicase DNA binding protein 2	513	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|hematopoietic stem cell differentiation (GO:0060218)|muscle organ development (GO:0007517)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|histone binding (GO:0042393)|poly(A) RNA binding (GO:0044822)	p.L513L(2)		breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(10)|lung(17)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	47	Lung NSC(78;0.00976)|all_lung(78;0.016)		BRCA - Breast invasive adenocarcinoma(143;0.0282)|OV - Ovarian serous cystadenocarcinoma(32;0.0814)			AAATGGGCCTAGGAAAGACCA	0.398																																							uc002bsp.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)|skin(1)	2						c.(1537-1539)CTA>CTT		chromodomain helicase DNA binding protein 2							115.0	104.0	108.0					15																	93496623		2197	4298	6495	SO:0001819	synonymous_variant	1106				regulation of transcription from RNA polymerase II promoter	nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding	g.chr15:93496623A>T	AF006514	CCDS10374.2, CCDS45356.1	15q26	2008-07-18			ENSG00000173575	ENSG00000173575			1917	protein-coding gene	gene with protein product		602119				9326634	Standard	NM_001042572		Approved	FLJ38614, DKFZp547I1315, DKFZp781D1727, DKFZp686E01200	uc002bsp.3	O14647	OTTHUMG00000149845	ENST00000394196.4:c.1539A>T	15.37:g.93496623A>T			Somatic				CHD2_uc002bso.1_Silent_p.L513L	p.L513L	NM_001271	NP_001262	WXS	Illumina HiSeq	Unspecified	O14647	CHD2_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.0282)|OV - Ovarian serous cystadenocarcinoma(32;0.0814)		14	2114	+	Lung NSC(78;0.00976)|all_lung(78;0.016)		513			ATP (Potential).|Helicase ATP-binding.		C6G482|Q96IP5	Silent	SNP	ENST00000394196.4	37	c.1539A>T	CCDS10374.2																																																																																				0.398	CHD2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000313528.3	NM_001271		7	121	0	0	0	0.00308	0	7	121				
CHSY1	22856	broad.mit.edu	37	15	101717776	101717776	+	Silent	SNP	T	T	G			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr15:101717776T>G	ENST00000254190.3	-	3	2701	c.2226A>C	c.(2224-2226)gtA>gtC	p.V742V	CHSY1_ENST00000543813.1_5'UTR	NM_014918.4	NP_055733.2	Q86X52	CHSS1_HUMAN	chondroitin sulfate synthase 1	742					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|negative regulation of ossification (GO:0030279)|response to nutrient levels (GO:0031667)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047238)|metal ion binding (GO:0046872)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)	p.V742V(1)		central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(5)|skin(1)	24	Lung NSC(78;0.00217)|all_lung(78;0.00271)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			GGACGTGGACTACTCCTACTT	0.512																																							uc002bwt.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(2224-2226)GTA>GTC		chondroitin sulfate synthase 1							127.0	101.0	110.0					15																	101717776		2203	4300	6503	SO:0001819	synonymous_variant	22856				chondroitin sulfate biosynthetic process	Golgi cisterna membrane|integral to membrane	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity|metal ion binding|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity	g.chr15:101717776T>G	AB023207	CCDS10390.1	15q26.3	2013-02-19	2008-01-24	2008-01-24	ENSG00000131873	ENSG00000131873	2.4.1.175, 2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	17198	protein-coding gene	gene with protein product		608183	"""carbohydrate (chondroitin) synthase 1"""			11514575	Standard	NM_014918		Approved	KIAA0990, CSS1	uc021sxt.1	Q86X52	OTTHUMG00000149873	ENST00000254190.3:c.2226A>C	15.37:g.101717776T>G			Somatic				CHSY1_uc010usd.1_Silent_p.V470V	p.V742V	NM_014918	NP_055733	WXS	Illumina HiSeq	Unspecified	Q86X52	CHSS1_HUMAN	OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)		4	2709	-	Lung NSC(78;0.00217)|all_lung(78;0.00271)|Melanoma(26;0.00505)		742			Lumenal (Potential).		Q6UX38|Q7LFU5|Q9Y2J5	Silent	SNP	ENST00000254190.3	37	c.2226A>C	CCDS10390.1																																																																																				0.512	CHSY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313624.1	NM_014918		5	97	0	0	0	0.001168	0	5	97				
TSC2	7249	broad.mit.edu	37	16	2122317	2122317	+	Missense_Mutation	SNP	A	A	T	rs137854216		TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr16:2122317A>T	ENST00000219476.3	+	20	2803	c.2173A>T	c.(2173-2175)Act>Tct	p.T725S	TSC2_ENST00000401874.2_Missense_Mutation_p.T725S|TSC2_ENST00000382538.6_Missense_Mutation_p.T676S|TSC2_ENST00000353929.4_Missense_Mutation_p.T725S|TSC2_ENST00000350773.4_Missense_Mutation_p.T725S|TSC2_ENST00000568454.1_Missense_Mutation_p.T736S|TSC2_ENST00000439673.2_Missense_Mutation_p.T688S	NM_000548.3	NP_000539.2	P49815	TSC2_HUMAN	tuberous sclerosis 2	725					acute-phase response (GO:0006953)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive chemotaxis (GO:0050918)|positive regulation of Ras GTPase activity (GO:0032320)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein import into nucleus (GO:0006606)|protein kinase B signaling (GO:0043491)|protein localization (GO:0008104)|regulation of cell cycle (GO:0051726)|regulation of endocytosis (GO:0030100)|regulation of insulin receptor signaling pathway (GO:0046626)|response to hypoxia (GO:0001666)|vesicle-mediated transport (GO:0016192)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|TSC1-TSC2 complex (GO:0033596)	GTPase activator activity (GO:0005096)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)	p.T725S(2)		NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(3)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|soft_tissue(1)	56		Hepatocellular(780;0.0202)				GCTCATCTTTACTTCCCCTTG	0.602			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																														uc002con.2		NA	yes	Rec		Tuberous sclerosis 2	16	16p13.3	7249	D|Mis|N|F|S	tuberous sclerosis 2 gene			"""E, O"""		hamartoma|renal cell			2	Substitution - Missense(2)		lung(2)	central_nervous_system(4)|lung(3)|ovary(2)|pancreas(1)	10						c.(2173-2175)ACT>TCT		tuberous sclerosis 2 isoform 1							176.0	141.0	153.0					16																	2122317		2198	4300	6498	SO:0001583	missense	7249	Tuberous_Sclerosis	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	cell cycle arrest|endocytosis|heart development|insulin receptor signaling pathway|insulin-like growth factor receptor signaling pathway|negative regulation of cell size|negative regulation of phosphatidylinositol 3-kinase cascade|negative regulation of protein kinase B signaling cascade|negative regulation of TOR signaling cascade|negative regulation of Wnt receptor signaling pathway|nerve growth factor receptor signaling pathway|neural tube closure|phosphatidylinositol-mediated signaling|positive chemotaxis|protein import into nucleus|protein kinase B signaling cascade|regulation of endocytosis|regulation of insulin receptor signaling pathway|regulation of small GTPase mediated signal transduction	Golgi apparatus|nucleus|perinuclear region of cytoplasm|TSC1-TSC2 complex	GTPase activator activity|protein homodimerization activity	g.chr16:2122317A>T	AB014460	CCDS10458.1, CCDS45384.1, CCDS58408.1	16p13.3	2014-09-17			ENSG00000103197	ENSG00000103197			12363	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 160"""	191092		TSC4		1303246, 7558029	Standard	NM_001077183		Approved	tuberin, LAM, PPP1R160	uc002con.3	P49815	OTTHUMG00000128745	ENST00000219476.3:c.2173A>T	16.37:g.2122317A>T	ENSP00000219476:p.Thr725Ser		Somatic				TSC2_uc010bsd.2_Missense_Mutation_p.T725S|TSC2_uc002coo.2_Missense_Mutation_p.T725S|TSC2_uc010uvv.1_Missense_Mutation_p.T688S|TSC2_uc010uvw.1_Missense_Mutation_p.T676S|TSC2_uc002cop.2_Missense_Mutation_p.T525S	p.T725S	NM_000548	NP_000539	WXS	Illumina HiSeq	Unspecified	P49815	TSC2_HUMAN			20	2279	+		Hepatocellular(780;0.0202)	725					A7E2E2|B4DIL8|B4DIQ7|B4DRN2|B7Z2B8|C9J378|O75275|Q4LE71|Q8TAZ1	Missense_Mutation	SNP	ENST00000219476.3	37	c.2173A>T	CCDS10458.1	.	.	.	.	.	.	.	.	.	.	A	7.551	0.662612	0.14645	.	.	ENSG00000103197	ENST00000219476;ENST00000401874;ENST00000353929;ENST00000439673;ENST00000382538;ENST00000350773	D;D;D;D;D;D	0.86694	-2.16;-2.16;-2.16;-2.16;-2.16;-2.16	5.18	5.18	0.71444	Tuberin-type domain (1);	0.115808	0.64402	D	0.000018	D	0.83482	0.5264	N	0.12746	0.255	0.48696	D	0.999691	B;B;B;B;B;D	0.63046	0.004;0.004;0.001;0.007;0.001;0.992	B;B;B;B;B;D	0.76071	0.023;0.021;0.014;0.028;0.01;0.987	T	0.79205	-0.1899	10	0.05833	T	0.94	-27.6836	10.307	0.43687	0.853:0.0:0.0:0.147	.	676;688;725;725;725;725	B4DIL8;P49815-6;P49815-4;P49815-3;P49815-5;P49815	.;.;.;.;.;TSC2_HUMAN	S	725;725;725;688;676;725	ENSP00000219476:T725S;ENSP00000384468:T725S;ENSP00000248099:T725S;ENSP00000399232:T688S;ENSP00000371978:T676S;ENSP00000344383:T725S	ENSP00000219476:T725S	T	+	1	0	TSC2	2062318	1.000000	0.71417	0.698000	0.30274	0.132000	0.20833	7.264000	0.78432	1.962000	0.57031	0.459000	0.35465	ACT		0.602	TSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250657.2	NM_000548		5	144	0	0	0	0.000602	0	5	144				
GRIN2A	2903	broad.mit.edu	37	16	9943738	9943738	+	Silent	SNP	C	C	A	rs369027920		TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr16:9943738C>A	ENST00000396573.2	-	6	1512	c.1203G>T	c.(1201-1203)ccG>ccT	p.P401P	GRIN2A_ENST00000404927.2_Silent_p.P401P|GRIN2A_ENST00000396575.2_Silent_p.P401P|GRIN2A_ENST00000562109.1_Silent_p.P401P|GRIN2A_ENST00000535259.1_Silent_p.P244P|GRIN2A_ENST00000330684.3_Silent_p.P401P	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	401					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)	p.P401P(1)		NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GGTTGTCATCCGGCTCACAGT	0.587																																							uc002czo.3		NA																	1	Substitution - coding silent(1)		lung(1)	skin(32)|NS(5)|ovary(4)|large_intestine(1)|lung(1)|breast(1)|kidney(1)	45						c.(1201-1203)CCG>CCT		N-methyl-D-aspartate receptor subunit 2A isoform	Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)						153.0	123.0	133.0					16																	9943738		2197	4300	6497	SO:0001819	synonymous_variant	2903				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding	g.chr16:9943738C>A		CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.1203G>T	16.37:g.9943738C>A			Somatic				GRIN2A_uc010uym.1_Silent_p.P401P|GRIN2A_uc010uyn.1_Silent_p.P244P|GRIN2A_uc002czr.3_Silent_p.P401P	p.P401P	NM_001134407	NP_001127879	WXS	Illumina HiSeq	Unspecified	Q12879	NMDE1_HUMAN			5	1751	-			401			Extracellular (Potential).		O00669|Q17RZ6	Silent	SNP	ENST00000396573.2	37	c.1203G>T	CCDS10539.1																																																																																				0.587	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251930.3			6	123	1	0	3.59834e-05	0.001168	5.19628e-05	6	123				
ACSM5	54988	broad.mit.edu	37	16	20439113	20439113	+	Missense_Mutation	SNP	C	C	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr16:20439113C>T	ENST00000331849.4	+	7	1072	c.925C>T	c.(925-927)Ctc>Ttc	p.L309F		NM_017888.2	NP_060358.2	Q6NUN0	ACSM5_HUMAN	acyl-CoA synthetase medium-chain family member 5	309					fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|kidney(2)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(3)|urinary_tract(1)	51						TGTTTAGACTCTCTCCAAATT	0.473																																							uc002dhe.2		NA																	0				ovary(2)	2						c.(925-927)CTC>TTC		acyl-CoA synthetase medium-chain family member 5							220.0	197.0	205.0					16																	20439113		2203	4300	6503	SO:0001583	missense	54988				fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|GTP binding|metal ion binding	g.chr16:20439113C>T		CCDS10585.1	16p12.3	2007-10-17			ENSG00000183549	ENSG00000183549		"""Acyl-CoA synthetase family"""	26060	protein-coding gene	gene with protein product		614361				17762044	Standard	NM_017888		Approved	FLJ20581	uc002dhe.3	Q6NUN0	OTTHUMG00000131551	ENST00000331849.4:c.925C>T	16.37:g.20439113C>T	ENSP00000327916:p.Leu309Phe		Somatic					p.L309F	NM_017888	NP_060358	WXS	Illumina HiSeq	Unspecified	Q6NUN0	ACSM5_HUMAN			7	1072	+			309					Q96AV1|Q96CX8|Q9NWV3	Missense_Mutation	SNP	ENST00000331849.4	37	c.925C>T	CCDS10585.1	.	.	.	.	.	.	.	.	.	.	C	15.11	2.737290	0.49045	.	.	ENSG00000183549	ENST00000331849	T	0.49720	0.77	5.01	5.01	0.66863	AMP-dependent synthetase/ligase (1);	0.000000	0.53938	D	0.000055	T	0.68091	0.2963	M	0.76433	2.335	0.49389	D	0.999785	D	0.76494	0.999	D	0.70487	0.969	T	0.70761	-0.4784	10	0.54805	T	0.06	-8.0056	16.4766	0.84134	0.0:1.0:0.0:0.0	.	309	Q6NUN0	ACSM5_HUMAN	F	309	ENSP00000327916:L309F	ENSP00000327916:L309F	L	+	1	0	ACSM5	20346614	0.997000	0.39634	0.998000	0.56505	0.027000	0.11550	1.197000	0.32211	2.458000	0.83093	0.555000	0.69702	CTC		0.473	ACSM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254413.1	NM_017888		22	310	0	0	0	0.00333	0	22	310				
GTF3C1	2975	broad.mit.edu	37	16	27492447	27492447	+	Silent	SNP	C	C	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr16:27492447C>T	ENST00000356183.4	-	27	4164	c.4149G>A	c.(4147-4149)agG>agA	p.R1383R	GTF3C1_ENST00000561623.1_Silent_p.R1383R	NM_001520.3	NP_001511.2	Q12789	TF3C1_HUMAN	general transcription factor IIIC, polypeptide 1, alpha 220kDa	1383					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|rRNA transcription (GO:0009303)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription (GO:0009304)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)	p.R1383R(1)		breast(2)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|liver(3)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	80						GGTTAGAATTCCTTAGGGCTG	0.463																																							uc002dov.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|pancreas(1)|breast(1)|skin(1)	5						c.(4147-4149)AGG>AGA		general transcription factor IIIC, polypeptide							136.0	123.0	127.0					16																	27492447		2197	4300	6497	SO:0001819	synonymous_variant	2975					transcription factor TFIIIC complex	DNA binding|protein binding	g.chr16:27492447C>T	U06485	CCDS32414.1, CCDS66988.1	16p12	2010-03-23	2002-08-29			ENSG00000077235		"""General transcription factors"""	4664	protein-coding gene	gene with protein product		603246	"""general transcription factor IIIC, polypeptide 1 (alpha subunit, 220kD )"""			8164661, 8127861	Standard	NM_001520		Approved	TFIIIC220	uc002dov.2	Q12789		ENST00000356183.4:c.4149G>A	16.37:g.27492447C>T			Somatic				GTF3C1_uc002dou.2_Silent_p.R1383R	p.R1383R	NM_001520	NP_001511	WXS	Illumina HiSeq	Unspecified	Q12789	TF3C1_HUMAN			27	4189	-			1383					B2RP21|Q12838|Q6DKN9|Q9Y4W9	Silent	SNP	ENST00000356183.4	37	c.4149G>A	CCDS32414.1																																																																																				0.463	GTF3C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433856.1	NM_001520		7	124	0	0	0	0.00308	0	7	124				
CDH11	1009	broad.mit.edu	37	16	65005896	65005896	+	Missense_Mutation	SNP	A	A	C			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr16:65005896A>C	ENST00000268603.4	-	10	2077	c.1462T>G	c.(1462-1464)Ttt>Gtt	p.F488V	CDH11_ENST00000394156.3_Missense_Mutation_p.F488V|CDH11_ENST00000566827.1_Missense_Mutation_p.F362V	NM_001797.2	NP_001788.2	P55287	CAD11_HUMAN	cadherin 11, type 2, OB-cadherin (osteoblast)	488	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|corticospinal tract morphogenesis (GO:0021957)|homophilic cell adhesion (GO:0007156)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.F488V(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(19)|lung(40)|ovary(3)|prostate(3)|skin(2)|urinary_tract(2)	88		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)		GGGGCAGCAAACTTGGGAGCA	0.483			T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)																													uc002eoi.2		NA		Dom	yes		16	16q22.1	1009	T	"""cadherin 11, type 2, OB-cadherin (osteoblast)"""			M	USP6		aneurysmal bone cysts		1	Substitution - Missense(1)		lung(1)	lung(10)|ovary(3)|skin(1)	14						c.(1462-1464)TTT>GTT		cadherin 11, type 2 preproprotein							109.0	91.0	97.0					16																	65005896		2203	4300	6503	SO:0001583	missense	1009				adherens junction organization|cell junction assembly|homophilic cell adhesion|ossification|skeletal system development	integral to membrane|plasma membrane	calcium ion binding|protein binding	g.chr16:65005896A>C	D21255	CCDS10803.1	16q21	2010-01-26			ENSG00000140937	ENSG00000140937		"""Cadherins / Major cadherins"""	1750	protein-coding gene	gene with protein product	"""OB-Cadherin"""	600023				9615235	Standard	NM_001797		Approved	OB, CAD11	uc002eoi.3	P55287	OTTHUMG00000137494	ENST00000268603.4:c.1462T>G	16.37:g.65005896A>C	ENSP00000268603:p.Phe488Val	TSP Lung(24;0.17)	Somatic				CDH11_uc010cdn.2_Intron|CDH11_uc002eoj.2_Missense_Mutation_p.F488V|CDH11_uc010vin.1_Missense_Mutation_p.F362V	p.F488V	NM_001797	NP_001788	WXS	Illumina HiSeq	Unspecified	P55287	CAD11_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.205)	10	1896	-		Ovarian(137;0.0973)	488			Cadherin 5.|Extracellular (Potential).		A8K5D6|A8MZC8|B7WP28|Q15065|Q15066|Q9UQ93|Q9UQ94	Missense_Mutation	SNP	ENST00000268603.4	37	c.1462T>G	CCDS10803.1	.	.	.	.	.	.	.	.	.	.	A	21.5	4.161804	0.78226	.	.	ENSG00000140937	ENST00000268603;ENST00000394156;ENST00000538390	T;T	0.30448	1.53;4.23	5.91	4.81	0.61882	Cadherin (3);Cadherin-like (1);	0.047410	0.85682	D	0.000000	T	0.37265	0.0997	M	0.64080	1.96	0.58432	D	0.999999	P;P	0.48294	0.908;0.761	P;B	0.45753	0.492;0.265	T	0.24368	-1.0162	10	0.72032	D	0.01	.	12.5362	0.56142	0.8606:0.1394:0.0:0.0	.	488;488	P55287-2;P55287	.;CAD11_HUMAN	V	488;488;471	ENSP00000268603:F488V;ENSP00000377711:F488V	ENSP00000268603:F488V	F	-	1	0	CDH11	63563397	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.072000	0.76777	1.046000	0.40249	0.533000	0.62120	TTT		0.483	CDH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268755.1	NM_033664		3	53	0	0	0	0.004672	0	3	53				
ZNF23	7571	broad.mit.edu	37	16	71482488	71482488	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr16:71482488C>A	ENST00000393539.2	-	6	2253	c.1440G>T	c.(1438-1440)gaG>gaT	p.E480D	ZNF23_ENST00000428724.2_Missense_Mutation_p.E422D|ZNF23_ENST00000564528.1_Missense_Mutation_p.E422D|ZNF23_ENST00000539742.1_5'UTR|AC010547.9_ENST00000561908.1_3'UTR|ZNF23_ENST00000358700.2_3'UTR|ZNF23_ENST00000497160.1_3'UTR|ZNF23_ENST00000357254.4_Missense_Mutation_p.E480D|ZNF23_ENST00000417828.1_Missense_Mutation_p.E480D	NM_145911.1	NP_666016.1	P17027	ZNF23_HUMAN	zinc finger protein 23	480					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E480D(1)		NS(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(14)|stomach(1)|urinary_tract(1)	29		Ovarian(137;0.00768)		BRCA - Breast invasive adenocarcinoma(221;0.0686)		ATCTCCCACACTCATTACATT	0.423																																							uc002faf.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1438-1440)GAG>GAT		zinc finger protein 23							85.0	83.0	84.0					16																	71482488		2198	4300	6498	SO:0001583	missense	7571				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr16:71482488C>A	X52347	CCDS10900.1	16q22.2	2013-03-28	2012-07-12		ENSG00000167377	ENSG00000167377		"""Zinc fingers, C2H2-type"""	13023	protein-coding gene	gene with protein product		194527	"""zinc finger protein 359"""	ZNF359			Standard	NM_145911		Approved	KOX16, Zfp612, ZNF612	uc002faf.3	P17027	OTTHUMG00000176797	ENST00000393539.2:c.1440G>T	16.37:g.71482488C>A	ENSP00000377171:p.Glu480Asp		Somatic				ZNF23_uc002fad.2_Missense_Mutation_p.E422D|ZNF23_uc002fae.2_Missense_Mutation_p.E422D|ZNF23_uc010vmf.1_Missense_Mutation_p.E422D|ZNF23_uc002fag.2_Missense_Mutation_p.E422D|ZNF23_uc002fah.2_Missense_Mutation_p.E480D|ZNF23_uc002fai.2_Missense_Mutation_p.E519D	p.E480D	NM_145911	NP_666016	WXS	Illumina HiSeq	Unspecified	P17027	ZNF23_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.0686)	6	2254	-		Ovarian(137;0.00768)	480			C2H2-type 12.		Q8NDP5|Q96IT3|Q9UG42	Missense_Mutation	SNP	ENST00000393539.2	37	c.1440G>T	CCDS10900.1	.	.	.	.	.	.	.	.	.	.	C	6.891	0.533918	0.13188	.	.	ENSG00000167377	ENST00000393539;ENST00000357254;ENST00000417828;ENST00000428724;ENST00000539742;ENST00000358700	T;T;T;T	0.07567	3.18;3.18;3.18;3.18	4.27	-2.87	0.05700	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.44902	D	0.000406	T	0.13798	0.0334	L	0.38649	1.16	0.20926	N	0.999829	B;D	0.57257	0.28;0.979	B;D	0.66196	0.175;0.942	T	0.03344	-1.1046	10	0.39692	T	0.17	-30.7941	11.8926	0.52638	0.0:0.5075:0.0:0.4925	.	480;480	B3KR55;P17027	.;ZNF23_HUMAN	D	480;480;480;422;422;252	ENSP00000377171:E480D;ENSP00000349796:E480D;ENSP00000395712:E480D;ENSP00000387673:E422D	ENSP00000349796:E480D	E	-	3	2	ZNF23	70039989	0.001000	0.12720	0.871000	0.34182	0.849000	0.48306	-0.728000	0.04925	-0.805000	0.04404	-1.267000	0.01435	GAG		0.423	ZNF23-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268985.23	NM_145911		8	108	1	0	0.00307968	0.00308	0.00362461	8	108				
TCF25	22980	broad.mit.edu	37	16	89967042	89967042	+	Splice_Site	SNP	G	G	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr16:89967042G>T	ENST00000263346.8	+	12	1277		c.e12-1		TCF25_ENST00000263347.7_Splice_Site	NM_014972.2	NP_055787.1	Q9BQ70	TCF25_HUMAN	transcription factor 25 (basic helix-loop-helix)						heart development (GO:0007507)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.?(1)		breast(1)|endometrium(2)|large_intestine(1)|lung(8)|ovary(3)|skin(1)|urinary_tract(2)	18		all_cancers(9;4.71e-08)|Lung NSC(15;0.000192)|all_lung(18;0.000319)|all_neural(9;0.0122)|all_hematologic(23;0.027)		BRCA - Breast invasive adenocarcinoma(80;0.0288)		GTCCCTCGTAGGCTCATCGGA	0.527																																							uc002fpb.2		NA																	1	Unknown(1)		lung(1)		0						c.e12-1		NULP1							126.0	123.0	124.0					16																	89967042		2198	4300	6498	SO:0001630	splice_region_variant	22980				heart development|negative regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity	g.chr16:89967042G>T	AF322111	CCDS10987.1	16q24.3	2008-02-05			ENSG00000141002	ENSG00000141002			29181	protein-coding gene	gene with protein product		612326				12107429, 16574069	Standard	NM_014972		Approved	Nulp1, KIAA1049	uc002fpb.2	Q9BQ70	OTTHUMG00000138986	ENST00000263346.8:c.1222-1G>T	16.37:g.89967042G>T			Somatic				TCF25_uc002fpc.2_Splice_Site_p.A173_splice	p.A408_splice	NM_014972	NP_055787	WXS	Illumina HiSeq	Unspecified	Q9BQ70	TCF25_HUMAN		BRCA - Breast invasive adenocarcinoma(80;0.0288)	12	1304	+		all_cancers(9;4.71e-08)|Lung NSC(15;0.000192)|all_lung(18;0.000319)|all_neural(9;0.0122)|all_hematologic(23;0.027)						Q2MK75|Q9UPV3	Splice_Site	SNP	ENST00000263346.8	37	c.1222_splice	CCDS10987.1	.	.	.	.	.	.	.	.	.	.	G	15.71	2.914889	0.52546	.	.	ENSG00000141002	ENST00000263346;ENST00000263347	.	.	.	5.36	5.36	0.76844	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.0725	0.89415	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TCF25	88494543	1.000000	0.71417	1.000000	0.80357	0.415000	0.31203	8.935000	0.92923	2.526000	0.85167	0.563000	0.77884	.		0.527	TCF25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000272875.2	NM_014972	Intron	7	100	1	0	0.00198382	0.001984	0.00237301	7	100				
PRPF8	10594	broad.mit.edu	37	17	1579293	1579293	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr17:1579293C>A	ENST00000572621.1	-	17	2873	c.2608G>T	c.(2608-2610)Gcc>Tcc	p.A870S	PRPF8_ENST00000304992.6_Missense_Mutation_p.A870S			Q6P2Q9	PRP8_HUMAN	pre-mRNA processing factor 8	870	Reverse transcriptase homology domain.				gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|U5 snRNP (GO:0005682)	poly(A) RNA binding (GO:0044822)|U5 snRNA binding (GO:0030623)|U6 snRNA binding (GO:0017070)	p.A870S(1)		NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(13)|lung(24)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	77				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)		TTATCGTAGGCCTGCTCGATC	0.532																																							uc002fte.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(4)|ovary(2)	6						c.(2608-2610)GCC>TCC		U5 snRNP-specific protein							77.0	71.0	73.0					17																	1579293		2203	4300	6503	SO:0001583	missense	10594					catalytic step 2 spliceosome|nuclear speck|U5 snRNP	protein binding|RNA binding	g.chr17:1579293C>A	AB007510	CCDS11010.1	17p13.3	2013-07-16	2013-06-10		ENSG00000174231	ENSG00000174231			17340	protein-coding gene	gene with protein product		607300	"""PRP8 pre-mRNA processing factor 8 homolog (yeast)"", ""PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae)"""	RP13		11468273, 10411133	Standard	NM_006445		Approved	PRPC8, Prp8, hPrp8, SNRNP220	uc002fte.3	Q6P2Q9	OTTHUMG00000090553	ENST00000572621.1:c.2608G>T	17.37:g.1579293C>A	ENSP00000460348:p.Ala870Ser		Somatic					p.A870S	NM_006445	NP_006436	WXS	Illumina HiSeq	Unspecified	Q6P2Q9	PRP8_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)	18	2722	-			870					O14547|O75965	Missense_Mutation	SNP	ENST00000572621.1	37	c.2608G>T	CCDS11010.1	.	.	.	.	.	.	.	.	.	.	C	27.5	4.839215	0.91117	.	.	ENSG00000174231	ENST00000304992	D	0.84660	-1.88	6.01	6.01	0.97437	.	0.000000	0.85682	D	0.000000	D	0.93946	0.8062	M	0.88570	2.965	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.92959	0.6387	10	0.45353	T	0.12	.	20.5211	0.99222	0.0:1.0:0.0:0.0	.	870	Q6P2Q9	PRP8_HUMAN	S	870	ENSP00000304350:A870S	ENSP00000304350:A870S	A	-	1	0	PRPF8	1526043	1.000000	0.71417	1.000000	0.80357	0.766000	0.43426	7.818000	0.86416	2.861000	0.98227	0.650000	0.86243	GCC		0.532	PRPF8-002	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438412.2			7	58	1	0	8.12818e-05	0.001984	0.000111161	7	58				
TRPV2	51393	broad.mit.edu	37	17	16326965	16326965	+	Missense_Mutation	SNP	T	T	C			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr17:16326965T>C	ENST00000338560.7	+	5	1207	c.808T>C	c.(808-810)Tat>Cat	p.Y270H	TRPV2_ENST00000577397.1_Intron	NM_016113.4	NP_057197.2	Q9Y5S1	TRPV2_HUMAN	transient receptor potential cation channel, subfamily V, member 2	270	Required for interaction with SLC50A1. {ECO:0000250}.				calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|positive regulation of axon extension (GO:0045773)|positive regulation of calcium ion import (GO:0090280)|response to heat (GO:0009408)|response to temperature stimulus (GO:0009266)|sensory perception (GO:0007600)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axonal growth cone (GO:0044295)|cell body (GO:0044297)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endomembrane system (GO:0012505)|growth cone membrane (GO:0032584)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|ion channel activity (GO:0005216)|ion transmembrane transporter activity (GO:0015075)	p.Y270H(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|stomach(3)	28				UCEC - Uterine corpus endometrioid carcinoma (92;0.0837)		GACCAGCATGTATGATGGGCT	0.602																																							uc002gpy.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(808-810)TAT>CAT		transient receptor potential cation channel,							79.0	73.0	75.0					17																	16326965		2203	4300	6503	SO:0001583	missense	51393				sensory perception	integral to plasma membrane|melanosome	calcium channel activity	g.chr17:16326965T>C	AF129112	CCDS32576.1	17p11.2	2013-01-10			ENSG00000187688	ENSG00000187688		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18082	protein-coding gene	gene with protein product		606676				10201375, 16382100	Standard	NM_016113		Approved	VRL, VRL-1, VRL1	uc002gpy.3	Q9Y5S1	OTTHUMG00000058989	ENST00000338560.7:c.808T>C	17.37:g.16326965T>C	ENSP00000342222:p.Tyr270His		Somatic				TRPV2_uc002gpz.2_Intron	p.Y270H	NM_016113	NP_057197	WXS	Illumina HiSeq	Unspecified	Q9Y5S1	TRPV2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (92;0.0837)	5	1175	+			270			Cytoplasmic (Potential).|Required for interaction with SLC50A1 (By similarity).|ANK 5.		A6NML2|A8K0Z0|Q9Y670	Missense_Mutation	SNP	ENST00000338560.7	37	c.808T>C	CCDS32576.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	17.50|17.50	3.406084|3.406084	0.62288|0.62288	.|.	.|.	ENSG00000187688|ENSG00000187688	ENST00000455666|ENST00000338560	.|T	.|0.71341	.|-0.56	6.17|6.17	6.17|6.17	0.99709|0.99709	.|Ankyrin repeat-containing domain (3);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.82953|0.82953	0.5149|0.5149	M|M	0.68952|0.68952	2.095|2.095	0.80722|0.80722	D|D	1|1	.|D	.|0.71674	.|0.998	.|D	.|0.79108	.|0.992	D|D	0.84491|0.84491	0.0611|0.0611	5|10	.|0.87932	.|D	.|0	-7.5111|-7.5111	16.0034|16.0034	0.80327|0.80327	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|270	.|Q9Y5S1	.|TRPV2_HUMAN	A|H	227|270	.|ENSP00000342222:Y270H	.|ENSP00000342222:Y270H	V|Y	+|+	2|1	0|0	TRPV2|TRPV2	16267690|16267690	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.014000|0.014000	0.08584|0.08584	7.559000|7.559000	0.82265|0.82265	2.371000|2.371000	0.80710|0.80710	0.533000|0.533000	0.62120|0.62120	GTA|TAT		0.602	TRPV2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130464.2	NM_016113		7	67	0	0	0	0.001984	0	7	67				
CCT6B	10693	broad.mit.edu	37	17	33288403	33288403	+	Missense_Mutation	SNP	T	T	C	rs201942552		TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr17:33288403T>C	ENST00000314144.5	-	1	125	c.10A>G	c.(10-12)Ata>Gta	p.I4V	CCT6B_ENST00000421975.3_Missense_Mutation_p.I4V|CCT6B_ENST00000436961.3_Missense_Mutation_p.I4V|ZNF830_ENST00000361952.3_5'Flank	NM_006584.3	NP_006575.2	Q92526	TCPW_HUMAN	chaperonin containing TCP1, subunit 6B (zeta 2)	4					chaperone-mediated protein complex assembly (GO:0051131)|protein folding (GO:0006457)|protein transport (GO:0015031)|spermatogenesis (GO:0007283)	chaperonin-containing T-complex (GO:0005832)	ATP binding (GO:0005524)|protein transporter activity (GO:0008565)|unfolded protein binding (GO:0051082)	p.I4V(1)		NS(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(7)|ovary(1)|pancreas(1)	20		Ovarian(249;0.17)				ACGGCCTTTATCGCAGCCATA	0.577													T|||	1	0.000199681	0.0	0.0	5008	,	,		17916	0.001		0.0	False		,,,				2504	0.0						uc002hig.2		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)	1						c.(10-12)ATA>GTA		chaperonin containing TCP1, subunit 6B							41.0	45.0	44.0					17																	33288403		2203	4300	6503	SO:0001583	missense	10693				chaperone-mediated protein complex assembly|protein folding|spermatogenesis	cytoplasm	ATP binding|protein transporter activity|unfolded protein binding	g.chr17:33288403T>C	D78333	CCDS32617.1, CCDS54105.1, CCDS54106.1	17q	2011-09-02			ENSG00000132141	ENSG00000132141		"""Heat Shock Proteins / Chaperonins"""	1621	protein-coding gene	gene with protein product		610730				8812458, 9013858	Standard	NM_006584		Approved	Cctz2, TSA303	uc002hig.3	Q92526		ENST00000314144.5:c.10A>G	17.37:g.33288403T>C	ENSP00000327191:p.Ile4Val		Somatic				CCT6B_uc010ctg.2_Missense_Mutation_p.I4V|CCT6B_uc010wcc.1_Missense_Mutation_p.I4V|ZNF830_uc002hih.3_5'Flank	p.I4V	NM_006584	NP_006575	WXS	Illumina HiSeq	Unspecified	Q92526	TCPW_HUMAN			1	104	-		Ovarian(249;0.17)	4					B4DX20|B4DYB0|Q8TC34	Missense_Mutation	SNP	ENST00000314144.5	37	c.10A>G	CCDS32617.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	T	0.898	-0.723220	0.03158	.	.	ENSG00000132141	ENST00000421975;ENST00000314144;ENST00000436961	T;T;T	0.66099	-0.19;0.31;2.35	5.13	-1.91	0.07641	.	0.287434	0.37012	N	0.002290	T	0.35970	0.0950	L	0.28274	0.84	0.23645	N	0.997216	B;B;B	0.06786	0.0;0.0;0.001	B;B;B	0.09377	0.002;0.002;0.004	T	0.26360	-1.0105	10	0.07175	T	0.84	-1.5995	6.1878	0.20508	0.0:0.4455:0.1486:0.406	.	4;4;4	B4DYB0;B4DX20;Q92526	.;.;TCPW_HUMAN	V	4	ENSP00000398044:I4V;ENSP00000327191:I4V;ENSP00000400917:I4V	ENSP00000327191:I4V	I	-	1	0	CCT6B	30312516	0.339000	0.24784	0.021000	0.16686	0.505000	0.33919	0.499000	0.22546	-0.336000	0.08438	0.533000	0.62120	ATA		0.577	CCT6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448014.1	NM_006584		10	47	0	0	0	0.001368	0	10	47				
WIPF2	147179	broad.mit.edu	37	17	38416822	38416822	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr17:38416822G>T	ENST00000323571.4	+	3	339	c.99G>T	c.(97-99)gaG>gaT	p.E33D	WIPF2_ENST00000394103.3_Missense_Mutation_p.E33D|WIPF2_ENST00000583130.1_Missense_Mutation_p.E33D|WIPF2_ENST00000536600.1_Missense_Mutation_p.E33D|WIPF2_ENST00000494757.1_3'UTR|WIPF2_ENST00000585043.1_Missense_Mutation_p.E33D	NM_133264.4	NP_573571.1	Q8TF74	WIPF2_HUMAN	WAS/WASL interacting protein family, member 2	33					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)		p.E33D(1)		NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	30						GTAGAGATGAGCAGCGGGGTC	0.527										HNSCC(43;0.11)																													uc002hug.1		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)	3						c.(97-99)GAG>GAT		WIRE protein							100.0	89.0	93.0					17																	38416822		2203	4300	6503	SO:0001583	missense	147179					cytoplasm|cytoskeleton	actin binding	g.chr17:38416822G>T	BC025965	CCDS11364.1	17q21.2	2006-10-12			ENSG00000171475	ENSG00000171475			30923	protein-coding gene	gene with protein product		609692				12213210, 11829459	Standard	XM_005257083		Approved	WICH, WIRE	uc002hug.1	Q8TF74	OTTHUMG00000133331	ENST00000323571.4:c.99G>T	17.37:g.38416822G>T	ENSP00000320924:p.Glu33Asp	HNSCC(43;0.11)	Somatic				WIPF2_uc010cwv.1_Missense_Mutation_p.E33D|WIPF2_uc002huh.1_5'UTR|WIPF2_uc010cww.1_5'UTR|WIPF2_uc002hui.1_Missense_Mutation_p.E33D|WIPF2_uc010cwx.1_Missense_Mutation_p.E33D|WIPF2_uc010cwy.1_Missense_Mutation_p.E33D	p.E33D	NM_133264	NP_573571	WXS	Illumina HiSeq	Unspecified	Q8TF74	WIPF2_HUMAN			3	339	+			33					A8K0L3|Q658J8|Q71RE1|Q8TE44	Missense_Mutation	SNP	ENST00000323571.4	37	c.99G>T	CCDS11364.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.322134	0.81580	.	.	ENSG00000171475	ENST00000323571;ENST00000394103;ENST00000536600	T;T;T	0.47528	1.32;0.84;0.84	5.74	1.01	0.19927	.	0.048984	0.85682	D	0.000000	T	0.56731	0.2005	L	0.47078	1.49	0.20196	N	0.999929	D;D	0.71674	0.966;0.998	P;D	0.79108	0.787;0.992	T	0.50004	-0.8878	10	0.44086	T	0.13	-13.8816	11.4865	0.50356	0.3415:0.0:0.6585:0.0	.	33;33	A8MWR2;Q8TF74	.;WIPF2_HUMAN	D	33	ENSP00000320924:E33D;ENSP00000377663:E33D;ENSP00000439175:E33D	ENSP00000320924:E33D	E	+	3	2	WIPF2	35670348	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.658000	0.37376	0.364000	0.24374	0.555000	0.69702	GAG		0.527	WIPF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257157.2	NM_133264		6	105	1	0	1.12685e-05	0.004482	1.74186e-05	6	105				
CRHR1	1394	broad.mit.edu	37	17	43906655	43906655	+	Silent	SNP	C	C	G			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr17:43906655C>G	ENST00000398285.3	+	5	402	c.402C>G	c.(400-402)ctC>ctG	p.L134L	CRHR1_ENST00000352855.5_Silent_p.L94L|CRHR1_ENST00000293493.7_5'UTR|CRHR1_ENST00000577353.1_Silent_p.L134L|CRHR1_ENST00000314537.5_Silent_p.L134L|CRHR1_ENST00000339069.5_Silent_p.L33L	NM_001145146.1	NP_001138618.1	P34998	CRFR1_HUMAN	corticotropin releasing hormone receptor 1	134					activation of adenylate cyclase activity (GO:0007190)|adrenal gland development (GO:0030325)|behavioral response to cocaine (GO:0048148)|behavioral response to ethanol (GO:0048149)|behavioral response to pain (GO:0048266)|cellular response to corticotropin-releasing hormone stimulus (GO:0071376)|corticotropin secretion (GO:0051458)|epithelial cell differentiation (GO:0030855)|fear response (GO:0042596)|female pregnancy (GO:0007565)|general adaptation syndrome, behavioral process (GO:0051867)|hypothalamus development (GO:0021854)|immune response (GO:0006955)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|negative regulation of epinephrine secretion (GO:0032811)|negative regulation of feeding behavior (GO:2000252)|negative regulation of neuron death (GO:1901215)|negative regulation of voltage-gated calcium channel activity (GO:1901386)|neuropeptide signaling pathway (GO:0007218)|parturition (GO:0007567)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of mast cell degranulation (GO:0043306)|regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010578)|regulation of corticosterone secretion (GO:2000852)|response to hypoxia (GO:0001666)|response to immobilization stress (GO:0035902)|visual learning (GO:0008542)	apical part of cell (GO:0045177)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)|vesicle (GO:0031982)	corticotrophin-releasing factor receptor activity (GO:0015056)|corticotropin-releasing hormone binding (GO:0051424)|corticotropin-releasing hormone receptor activity (GO:0043404)	p.L134L(1)		NS(1)|breast(1)|endometrium(1)|large_intestine(4)|lung(15)|pancreas(1)|skin(1)	24	Colorectal(2;0.0416)			BRCA - Breast invasive adenocarcinoma(366;0.161)		TGGTGGCCCTCCTGGTGGCCT	0.577																																					Ovarian(110;57 1568 10207 38216 49865)	Ovarian(110;57 1568 10207 38216 49865)	uc010dap.2		NA																	1	Substitution - coding silent(1)		lung(1)	lung(3)	3						c.(400-402)CTC>CTG		corticotropin releasing hormone receptor 1							79.0	86.0	84.0					17																	43906655		2053	4193	6246	SO:0001819	synonymous_variant	1394				female pregnancy|immune response|parturition	integral to plasma membrane	corticotrophin-releasing factor receptor activity|protein binding	g.chr17:43906655C>G	L23332	CCDS42350.1, CCDS45712.1, CCDS45713.1, CCDS45714.1	17q12-q22	2012-08-14			ENSG00000120088	ENSG00000120088		"""GPCR / Class B : Corticotropin-releasing factor receptors"""	2357	protein-coding gene	gene with protein product	"""corticotropin-releasing factor receptor"""	122561		CRHR		7590738	Standard	NM_004382		Approved	CRF-R, CRF1	uc010dap.3	P34998		ENST00000398285.3:c.402C>G	17.37:g.43906655C>G			Somatic				CRHR1_uc010wjx.1_5'UTR|CRHR1_uc002ijp.2_Silent_p.L33L|CRHR1_uc002ijm.2_Silent_p.L134L|CRHR1_uc002ijn.2_Silent_p.L94L|CRHR1_uc010dar.2_Silent_p.L134L|CRHR1_uc010dao.2_Silent_p.L33L|CRHR1_uc010daq.2_5'UTR|CRHR1_uc010das.1_RNA|CRHR1_uc002ijo.1_RNA	p.L134L	NM_001145146	NP_001138618	WXS	Illumina HiSeq	Unspecified	P34998	CRFR1_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.161)	5	667	+	Colorectal(2;0.0416)		134			Helical; Name=1; (Potential).		B4DIE9|Q13008|Q4QRJ1|Q9UK64	Silent	SNP	ENST00000398285.3	37	c.402C>G	CCDS45712.1																																																																																				0.577	CRHR1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000441241.3			3	60	0	0	0	0.004672	0	3	60				
KANSL1	284058	broad.mit.edu	37	17	44249162	44249162	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr17:44249162C>A	ENST00000262419.6	-	2	818	c.348G>T	c.(346-348)caG>caT	p.Q116H	KANSL1_ENST00000393476.3_5'UTR|KANSL1_ENST00000572904.1_Missense_Mutation_p.Q116H|KANSL1_ENST00000574590.1_Missense_Mutation_p.Q116H|KANSL1_ENST00000575318.1_Missense_Mutation_p.Q116H|KANSL1_ENST00000432791.1_Missense_Mutation_p.Q116H|KANSL1_ENST00000576248.1_5'Flank	NM_001193466.1	NP_001180395	Q7Z3B3	KANL1_HUMAN	KAT8 regulatory NSL complex subunit 1	116					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)	histone acetyltransferase complex (GO:0000123)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.Q116H(1)									GTTCATAGGACTGAGATAAGA	0.458																																							uc002ikb.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)	2						c.(346-348)CAG>CAT		hypothetical protein LOC284058							108.0	148.0	135.0					17																	44249162		2203	4300	6503	SO:0001583	missense	284058					MLL1 complex	protein binding	g.chr17:44249162C>A	BX538006	CCDS11503.1, CCDS11503.2, CCDS74084.1	17q21.31	2012-02-20	2012-02-20	2012-02-20	ENSG00000120071	ENSG00000120071			24565	protein-coding gene	gene with protein product	"""centromere protein 36"""	612452	"""KIAA1267"""	KIAA1267		10574462	Standard	NM_015443		Approved	DKFZP727C091, MSL1v1, CENP-36, NSL1	uc002ikd.3	Q7Z3B3		ENST00000262419.6:c.348G>T	17.37:g.44249162C>A	ENSP00000262419:p.Gln116His		Somatic				KIAA1267_uc002ikc.2_Missense_Mutation_p.Q116H|KIAA1267_uc002ikd.2_Missense_Mutation_p.Q116H|KIAA1267_uc010dav.2_Missense_Mutation_p.Q116H	p.Q116H	NM_015443	NP_056258	WXS	Illumina HiSeq	Unspecified	Q7Z3B3	K1267_HUMAN			1	433	-		Melanoma(429;0.211)	116					A8K5E4|Q6AW85|Q8IYH1|Q9BRH0|Q9NTE7|Q9UFT0|Q9ULF3	Missense_Mutation	SNP	ENST00000262419.6	37	c.348G>T	CCDS11503.1	.	.	.	.	.	.	.	.	.	.	C	15.90	2.969553	0.53614	.	.	ENSG00000120071	ENST00000262419;ENST00000432791	T;T	0.13089	2.62;2.62	5.87	3.85	0.44370	.	0.285194	0.36932	N	0.002337	T	0.19886	0.0478	N	0.24115	0.695	0.80722	D	1	D;P	0.64830	0.994;0.899	D;P	0.67103	0.949;0.735	T	0.01500	-1.1339	10	0.59425	D	0.04	-10.531	9.0762	0.36522	0.0:0.8314:0.0:0.1686	.	116;116	C9JHY2;Q7Z3B3	.;K1267_HUMAN	H	116	ENSP00000262419:Q116H;ENSP00000387393:Q116H	ENSP00000262419:Q116H	Q	-	3	2	KIAA1267	41604939	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	1.761000	0.38440	0.768000	0.33290	0.655000	0.94253	CAG		0.458	KANSL1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440274.1	NM_015443		17	410	1	0	0.000566183	0.00499	0.000720448	17	410				
KPNB1	3837	broad.mit.edu	37	17	45752095	45752095	+	Missense_Mutation	SNP	G	G	C			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr17:45752095G>C	ENST00000290158.4	+	15	2266	c.1859G>C	c.(1858-1860)gGg>gCg	p.G620A	KPNB1_ENST00000537679.1_Missense_Mutation_p.G404A|KPNB1_ENST00000535458.2_Missense_Mutation_p.G475A|KPNB1_ENST00000540627.1_Missense_Mutation_p.G475A	NM_001276453.1|NM_002265.4	NP_001263382.1|NP_002256.2	Q14974	IMB1_HUMAN	karyopherin (importin) beta 1	620					apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cytokine-mediated signaling pathway (GO:0019221)|intracellular transport of virus (GO:0075733)|NLS-bearing protein import into nucleus (GO:0006607)|protein import into nucleus (GO:0006606)|protein import into nucleus, translocation (GO:0000060)|ribosomal protein import into nucleus (GO:0006610)|small molecule metabolic process (GO:0044281)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum tubular network (GO:0071782)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|nuclear localization sequence binding (GO:0008139)|poly(A) RNA binding (GO:0044822)|protein domain specific binding (GO:0019904)|protein transporter activity (GO:0008565)|zinc ion binding (GO:0008270)	p.G620A(1)		breast(1)|ovary(1)|pancreas(1)|skin(1)	4						AGCACAGCTGGGTCTGGGGGA	0.483																																							uc002ilt.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)|skin(1)	3						c.(1858-1860)GGG>GCG		karyopherin beta 1							165.0	148.0	154.0					17																	45752095		2203	4300	6503	SO:0001583	missense	3837				DNA fragmentation involved in apoptotic nuclear change|NLS-bearing substrate import into nucleus|protein import into nucleus, translocation|ribosomal protein import into nucleus|viral genome transport in host cell|viral infectious cycle	cytosol|nuclear pore|nucleoplasm	nuclear localization sequence binding|protein domain specific binding|zinc ion binding	g.chr17:45752095G>C	L39793	CCDS11513.1, CCDS62228.1	17q21.32	2013-02-14			ENSG00000108424	ENSG00000108424		"""Importins"", ""Armadillo repeat containing"""	6400	protein-coding gene	gene with protein product	"""importin 1"""	602738				7615630, 7627554	Standard	NM_002265		Approved	NTF97, IPOB, MGC2155, MGC2156, MGC2157, IMB1, Impnb, IPO1	uc002ilt.2	Q14974	OTTHUMG00000036957	ENST00000290158.4:c.1859G>C	17.37:g.45752095G>C	ENSP00000290158:p.Gly620Ala		Somatic				KPNB1_uc010wkw.1_Missense_Mutation_p.G475A|KPNB1_uc010wkx.1_Missense_Mutation_p.G404A	p.G620A	NM_002265	NP_002256	WXS	Illumina HiSeq	Unspecified	Q14974	IMB1_HUMAN			15	2195	+			620			HEAT 7.		B7ZAV6|D3DTT3|Q14637|Q53XN2|Q96J27	Missense_Mutation	SNP	ENST00000290158.4	37	c.1859G>C	CCDS11513.1	.	.	.	.	.	.	.	.	.	.	G	15.85	2.954924	0.53293	.	.	ENSG00000108424	ENST00000535458;ENST00000290158;ENST00000540627;ENST00000537679	T;T;T;T	0.64438	-0.1;-0.1;-0.1;-0.1	5.13	5.13	0.70059	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.56891	0.2016	M	0.62723	1.935	0.32386	N	0.553932	P;B	0.46395	0.877;0.404	B;B	0.37047	0.24;0.021	T	0.61917	-0.6964	9	0.12430	T	0.62	-15.7751	18.9602	0.92674	0.0:0.0:1.0:0.0	.	404;620	F5H4R7;Q14974	.;IMB1_HUMAN	A	475;620;475;404	ENSP00000438253:G475A;ENSP00000290158:G620A;ENSP00000438964:G475A;ENSP00000445006:G404A	ENSP00000290158:G620A	G	+	2	0	KPNB1	43107094	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	9.813000	0.99286	2.561000	0.86390	0.561000	0.74099	GGG		0.483	KPNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089755.2	NM_002265		12	180	0	0	0	0.000978	0	12	180				
COIL	8161	broad.mit.edu	37	17	55038337	55038337	+	Missense_Mutation	SNP	T	T	G			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr17:55038337T>G	ENST00000240316.4	-	1	78	c.44A>C	c.(43-45)tAc>tCc	p.Y15S		NM_004645.2	NP_004636.1	P38432	COIL_HUMAN	coilin	15						Cajal body (GO:0015030)|cytoplasm (GO:0005737)|female germ cell nucleus (GO:0001674)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	disulfide oxidoreductase activity (GO:0015036)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)			NS(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)|urinary_tract(1)	15	Breast(9;6.15e-08)					TGGCGGCGGGTAATCAAATTG	0.587											OREG0024594	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc002iuu.2		NA																	0				ovary(1)	1						c.(43-45)TAC>TCC		coilin							32.0	37.0	35.0					17																	55038337		2202	4300	6502	SO:0001583	missense	8161					Cajal body|nucleolus	protein C-terminus binding	g.chr17:55038337T>G	U06632	CCDS11592.1	17q22	2012-10-02			ENSG00000121058	ENSG00000121058			2184	protein-coding gene	gene with protein product		600272				7971277	Standard	NM_004645		Approved	CLN80, p80-coilin	uc002iuu.3	P38432	OTTHUMG00000178126	ENST00000240316.4:c.44A>C	17.37:g.55038337T>G	ENSP00000240316:p.Tyr15Ser		Somatic	OREG0024594	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1004		p.Y15S	NM_004645	NP_004636	WXS	Illumina HiSeq	Unspecified	P38432	COIL_HUMAN			1	75	-	Breast(9;6.15e-08)		15					B2R931	Missense_Mutation	SNP	ENST00000240316.4	37	c.44A>C	CCDS11592.1	.	.	.	.	.	.	.	.	.	.	T	22.3	4.273555	0.80580	.	.	ENSG00000121058	ENST00000240316	T	0.71222	-0.55	4.32	4.32	0.51571	.	0.063962	0.64402	D	0.000004	T	0.78729	0.4329	L	0.58101	1.795	0.48571	D	0.999672	D	0.76494	0.999	D	0.74674	0.984	T	0.79962	-0.1582	10	0.72032	D	0.01	-11.3212	9.2798	0.37722	0.1597:0.0:0.0:0.8403	.	15	P38432	COIL_HUMAN	S	15	ENSP00000240316:Y15S	ENSP00000240316:Y15S	Y	-	2	0	COIL	52393336	1.000000	0.71417	0.999000	0.59377	0.985000	0.73830	3.385000	0.52485	1.952000	0.56665	0.374000	0.22700	TAC		0.587	COIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440618.1			5	9	0	0	0	0.00499	0	5	9				
KCNJ16	3773	broad.mit.edu	37	17	68128403	68128403	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr17:68128403G>T	ENST00000589377.1	+	2	338	c.175G>T	c.(175-177)Gtt>Ttt	p.V59F	KCNJ16_ENST00000392670.1_Missense_Mutation_p.V59F|KCNJ16_ENST00000283936.1_Missense_Mutation_p.V59F|KCNJ16_ENST00000392671.1_Missense_Mutation_p.V59F|KCNJ16_ENST00000586462.1_Missense_Mutation_p.V98F|KCNJ16_ENST00000585558.1_Missense_Mutation_p.V94F	NM_001270422.1	NP_001257351.1	Q9NPI9	KCJ16_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 16	59					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	inward rectifier potassium channel activity (GO:0005242)	p.V59F(1)		breast(3)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	32	Breast(10;2.96e-09)					AAGCTATGTGGTTGACATCTT	0.403																																							uc002jin.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)|skin(1)	3						c.(175-177)GTT>TTT		potassium inwardly-rectifying channel J16							285.0	252.0	263.0					17																	68128403		2203	4300	6503	SO:0001583	missense	3773				synaptic transmission	voltage-gated potassium channel complex	inward rectifier potassium channel activity	g.chr17:68128403G>T	AF153815	CCDS11687.1, CCDS74141.1	17q24.3	2011-07-05				ENSG00000153822		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6262	protein-coding gene	gene with protein product		605722				11240146, 16382105	Standard	NM_018658		Approved	Kir5.1, BIR9	uc002jio.4	Q9NPI9		ENST00000589377.1:c.175G>T	17.37:g.68128403G>T	ENSP00000465967:p.Val59Phe		Somatic				KCNJ16_uc002jio.2_Missense_Mutation_p.V59F|KCNJ16_uc002jip.2_Missense_Mutation_p.V59F|KCNJ16_uc002jiq.2_Missense_Mutation_p.V91F	p.V59F	NM_018658	NP_061128	WXS	Illumina HiSeq	Unspecified	Q9NPI9	IRK16_HUMAN			5	661	+	Breast(10;2.96e-09)		59			Cytoplasmic (By similarity).			Missense_Mutation	SNP	ENST00000589377.1	37	c.175G>T	CCDS11687.1	.	.	.	.	.	.	.	.	.	.	G	14.13	2.444485	0.43429	.	.	ENSG00000153822	ENST00000283936;ENST00000392671;ENST00000392670	D;D;D	0.94046	-3.34;-3.34;-3.34	6.16	6.16	0.99307	Potassium channel, inwardly rectifying, Kir, conserved region 2 (1);	0.170776	0.51477	D	0.000083	D	0.94328	0.8177	L	0.40543	1.245	0.45554	D	0.998505	D;D	0.71674	0.998;0.966	D;P	0.66979	0.948;0.69	D	0.92917	0.6352	9	.	.	.	.	14.6055	0.68475	0.0697:0.0:0.9303:0.0	.	59;59	A8K434;Q9NPI9	.;IRK16_HUMAN	F	59	ENSP00000283936:V59F;ENSP00000376439:V59F;ENSP00000376438:V59F	.	V	+	1	0	KCNJ16	65639998	1.000000	0.71417	0.997000	0.53966	0.013000	0.08279	6.037000	0.70956	2.937000	0.99478	0.650000	0.86243	GTT		0.403	KCNJ16-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450880.1	NM_018658		11	209	1	0	0.000673444	0.008291	0.000835147	11	209				
TYMS	7298	broad.mit.edu	37	18	662311	662311	+	Missense_Mutation	SNP	A	A	G			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr18:662311A>G	ENST00000323274.10	+	3	584	c.445A>G	c.(445-447)Atg>Gtg	p.M149V	TYMS_ENST00000323224.7_Missense_Mutation_p.M149V|TYMS_ENST00000323250.5_Intron	NM_001071.2	NP_001062.1	P04818	TYSY_HUMAN	thymidylate synthetase	149					aging (GO:0007568)|cartilage development (GO:0051216)|circadian rhythm (GO:0007623)|deoxyribonucleoside monophosphate biosynthetic process (GO:0009157)|developmental growth (GO:0048589)|dTMP biosynthetic process (GO:0006231)|dTTP biosynthetic process (GO:0006235)|dUMP metabolic process (GO:0046078)|G1/S transition of mitotic cell cycle (GO:0000082)|immortalization of host cell by virus (GO:0019088)|intestinal epithelial cell maturation (GO:0060574)|mitotic cell cycle (GO:0000278)|nucleobase-containing compound metabolic process (GO:0006139)|nucleobase-containing small molecule metabolic process (GO:0055086)|organ regeneration (GO:0031100)|polysaccharide metabolic process (GO:0005976)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside biosynthetic process (GO:0046134)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to folic acid (GO:0051593)|response to glucocorticoid (GO:0051384)|response to organophosphorus (GO:0046683)|response to progesterone (GO:0032570)|response to toxic substance (GO:0009636)|response to vitamin A (GO:0033189)|small molecule metabolic process (GO:0044281)|tetrahydrofolate metabolic process (GO:0046653)|uracil metabolic process (GO:0019860)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cofactor binding (GO:0048037)|drug binding (GO:0008144)|folic acid binding (GO:0005542)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|thymidylate synthase activity (GO:0004799)			endometrium(1)|large_intestine(3)|lung(2)|urinary_tract(2)	8					Capecitabine(DB01101)|Floxuridine(DB00322)|Fluorouracil(DB00544)|Gemcitabine(DB00441)|Leucovorin(DB00650)|Methotrexate(DB00563)|Pemetrexed(DB00642)|Pralatrexate(DB06813)|Raltitrexed(DB00293)|Trifluridine(DB00432)|Trimethoprim(DB00440)	ATACAGAGATATGGAATCAGG	0.498																																							uc010dka.1		NA																	0					0						c.(445-447)ATG>GTG		thymidylate synthase	Capecitabine(DB01101)|Floxuridine(DB00322)|Fluorouracil(DB00544)|Gemcitabine(DB00441)|Leucovorin(DB00650)|Pemetrexed(DB00642)|Raltitrexed(DB00293)|Trifluridine(DB00432)						187.0	199.0	195.0					18																	662311		2203	4300	6503	SO:0001583	missense	7298				DNA repair|DNA replication|phosphatidylinositol-mediated signaling|pyrimidine base metabolic process|pyrimidine nucleoside biosynthetic process|regulation of transcription involved in G1/S phase of mitotic cell cycle|response to organophosphorus	cytosol	thymidylate synthase activity	g.chr18:662311A>G	X02308	CCDS11821.1	18p11.31-p11.21	2014-09-17			ENSG00000176890	ENSG00000176890	2.1.1.45		12441	protein-coding gene	gene with protein product		188350		TS			Standard	NM_001071		Approved	Tsase, TMS, HsT422	uc010dka.1	P04818	OTTHUMG00000131473	ENST00000323274.10:c.445A>G	18.37:g.662311A>G	ENSP00000315644:p.Met149Val		Somatic				TYMS_uc010dkb.1_Missense_Mutation_p.M149V|TYMS_uc010dkc.1_Intron	p.M149V	NM_001071	NP_001062	WXS	Illumina HiSeq	Unspecified	P04818	TYSY_HUMAN			3	584	+			149					Q8WYK3|Q8WYK4	Missense_Mutation	SNP	ENST00000323274.10	37	c.445A>G	CCDS11821.1	.	.	.	.	.	.	.	.	.	.	A	10.55	1.381011	0.24944	.	.	ENSG00000176890	ENST00000323274;ENST00000323224	.	.	.	5.7	4.54	0.55810	Thymidylate synthase/dCMP hydroxymethylase domain (2);	0.158593	0.64402	D	0.000002	T	0.60894	0.2304	M	0.75447	2.3	0.49798	D	0.999826	B;B	0.10296	0.001;0.003	B;B	0.12837	0.007;0.008	T	0.56697	-0.7936	9	0.33141	T	0.24	-15.4176	11.6277	0.51156	0.9302:0.0:0.0698:0.0	.	149;149	Q8WYK3;P04818	.;TYSY_HUMAN	V	149	.	ENSP00000314727:M149V	M	+	1	0	TYMS	652311	1.000000	0.71417	0.998000	0.56505	0.801000	0.45260	9.011000	0.93618	0.996000	0.38943	0.460000	0.39030	ATG		0.498	TYMS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254316.1	NM_001071		20	376	0	0	0	0.007413	0	20	376				
EPB41L3	23136	broad.mit.edu	37	18	5428374	5428374	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr18:5428374G>T	ENST00000341928.2	-	9	1343	c.1003C>A	c.(1003-1005)Ccc>Acc	p.P335T	EPB41L3_ENST00000540638.2_Missense_Mutation_p.P335T|EPB41L3_ENST00000400111.3_Missense_Mutation_p.P335T|EPB41L3_ENST00000544123.1_Missense_Mutation_p.P335T|EPB41L3_ENST00000342933.3_Missense_Mutation_p.P335T|EPB41L3_ENST00000542652.2_5'UTR	NM_012307.2	NP_036439.2	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	335	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				apoptotic process (GO:0006915)|cortical actin cytoskeleton organization (GO:0030866)|cortical cytoskeleton organization (GO:0030865)|cytoskeletal anchoring at plasma membrane (GO:0007016)|myelin maintenance (GO:0043217)|neuron projection morphogenesis (GO:0048812)|paranodal junction assembly (GO:0030913)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|protein localization to plasma membrane (GO:0072659)|regulation of cell shape (GO:0008360)	axolemma (GO:0030673)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|juxtaparanode region of axon (GO:0044224)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)	p.P335T(1)		breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(52)|ovary(5)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	105						AGAACCTTGGGCCAGGCAAAT	0.443																																							uc002kmt.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)	5						c.(1003-1005)CCC>ACC		erythrocyte membrane protein band 4.1-like 3							144.0	145.0	144.0					18																	5428374		2203	4300	6503	SO:0001583	missense	23136				cortical actin cytoskeleton organization	cell-cell junction|cytoplasm|cytoskeleton|extrinsic to membrane	actin binding|structural molecule activity	g.chr18:5428374G>T	AB023204	CCDS11838.1, CCDS62381.1, CCDS62382.1	18p11.32	2006-06-28			ENSG00000082397	ENSG00000082397			3380	protein-coding gene	gene with protein product		605331				9828140, 9892180	Standard	NM_012307		Approved	DAL1, KIAA0987, 4.1B	uc002kmt.1	Q9Y2J2	OTTHUMG00000131562	ENST00000341928.2:c.1003C>A	18.37:g.5428374G>T	ENSP00000343158:p.Pro335Thr		Somatic				EPB41L3_uc010wzh.1_Missense_Mutation_p.P335T|EPB41L3_uc002kmu.1_Missense_Mutation_p.P335T|EPB41L3_uc010dkq.1_Missense_Mutation_p.P226T|EPB41L3_uc010dks.1_Missense_Mutation_p.P357T	p.P335T	NM_012307	NP_036439	WXS	Illumina HiSeq	Unspecified	Q9Y2J2	E41L3_HUMAN			9	1089	-			335			FERM.		B7Z4I5|F5GX05|O95713|Q9BRP5	Missense_Mutation	SNP	ENST00000341928.2	37	c.1003C>A	CCDS11838.1	.	.	.	.	.	.	.	.	.	.	G	29.0	4.971653	0.92919	.	.	ENSG00000082397	ENST00000341928;ENST00000540638;ENST00000544123;ENST00000545076;ENST00000342933;ENST00000400111	D;D;D;D	0.82893	-1.66;-1.66;-1.66;-1.66	5.45	5.45	0.79879	FERM, C-terminal PH-like domain (1);FERM domain (1);Pleckstrin homology-type (1);	0.000000	0.85682	D	0.000000	D	0.93543	0.7939	M	0.92923	3.36	0.80722	D	1	D;D;D;D;D	0.89917	0.999;1.0;1.0;0.999;0.998	D;D;D;D;D	0.87578	0.993;0.993;0.998;0.985;0.997	D	0.94728	0.7907	10	0.87932	D	0	.	19.2922	0.94105	0.0:0.0:1.0:0.0	.	335;335;226;335;335	F5GX05;Q9Y2J2-3;A8K968;Q9Y2J2-2;Q9Y2J2	.;.;.;.;E41L3_HUMAN	T	335;226;335;226;335;335	ENSP00000343158:P335T;ENSP00000441174:P335T;ENSP00000341138:P335T;ENSP00000382981:P335T	ENSP00000343158:P335T	P	-	1	0	EPB41L3	5418374	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.813000	0.99286	2.547000	0.85894	0.655000	0.94253	CCC		0.443	EPB41L3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254424.1	NM_012307		11	208	1	0	3.07112e-06	0.000978	4.88486e-06	11	208				
ANKRD30B	374860	broad.mit.edu	37	18	14851650	14851650	+	Missense_Mutation	SNP	A	A	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr18:14851650A>T	ENST00000358984.4	+	36	3530	c.3350A>T	c.(3349-3351)aAg>aTg	p.K1117M		NM_001145029.1	NP_001138501.1	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B	1117								p.K1117M(1)		breast(3)|endometrium(4)|kidney(3)|lung(8)|ovary(1)|prostate(2)|skin(1)	22						GAGGACATTAAGATTTTACAA	0.348																																							uc010dlo.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(3349-3351)AAG>ATG		ankyrin repeat domain 30B							18.0	19.0	19.0					18																	14851650		692	1583	2275	SO:0001583	missense	374860							g.chr18:14851650A>T	BC028407	CCDS54182.1	18p11.21	2013-01-10			ENSG00000180777	ENSG00000180777		"""Ankyrin repeat domain containing"""	24165	protein-coding gene	gene with protein product						11280766	Standard	NM_001145029		Approved	NY-BR-1.1	uc010dlo.2	Q9BXX2		ENST00000358984.4:c.3350A>T	18.37:g.14851650A>T	ENSP00000351875:p.Lys1117Met		Somatic				ANKRD30B_uc010xal.1_Missense_Mutation_p.K259M	p.K1117M	NM_001145029	NP_001138501	WXS	Illumina HiSeq	Unspecified	Q9BXX2	AN30B_HUMAN			36	3530	+			1202			Potential.		B4DGP1|F8WAG3|Q4G175	Missense_Mutation	SNP	ENST00000358984.4	37	c.3350A>T	CCDS54182.1	.	.	.	.	.	.	.	.	.	.	A	11.31	1.602412	0.28534	.	.	ENSG00000180777	ENST00000358984;ENST00000320584;ENST00000277669	T	0.16743	2.32	1.39	1.39	0.22231	.	.	.	.	.	T	0.20047	0.0482	M	0.71206	2.165	0.80722	D	1	P;D	0.53462	0.932;0.96	B;P	0.44518	0.265;0.452	T	0.08126	-1.0737	9	0.87932	D	0	.	6.8687	0.24108	1.0:0.0:0.0:0.0	.	1202;1117	Q9BXX2;F8WAG3	AN30B_HUMAN;.	M	1117;511;537	ENSP00000351875:K1117M	ENSP00000277669:K537M	K	+	2	0	ANKRD30B	14841650	0.985000	0.35326	0.496000	0.27539	0.557000	0.35523	2.801000	0.47908	0.889000	0.36185	0.145000	0.16022	AAG		0.348	ANKRD30B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000443557.1	NM_001145029		4	50	0	0	0	0.000602	0	4	50				
DSC1	1823	broad.mit.edu	37	18	28737519	28737519	+	Missense_Mutation	SNP	G	G	T	rs370542497		TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr18:28737519G>T	ENST00000257198.5	-	3	427	c.166C>A	c.(166-168)Ctc>Atc	p.L56I	RP11-408H20.2_ENST00000581836.1_RNA|DSC1_ENST00000257197.3_Missense_Mutation_p.L56I	NM_024421.2	NP_077739.1	Q08554	DSC1_HUMAN	desmocollin 1	56					homophilic cell adhesion (GO:0007156)	desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|gap junction (GO:0005921)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.L56I(2)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(20)|ovary(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	53			OV - Ovarian serous cystadenocarcinoma(10;0.00778)			GCCGACTTGAGACACTCCTCC	0.448																																							uc002kwn.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|skin(1)	4						c.(166-168)CTC>ATC		desmocollin 1 isoform Dsc1a preproprotein							82.0	83.0	83.0					18																	28737519		2203	4300	6503	SO:0001583	missense	1823				homophilic cell adhesion	desmosome|gap junction|integral to membrane|membrane fraction	calcium ion binding	g.chr18:28737519G>T	AF293358	CCDS11894.1, CCDS11895.1	18q12.1	2010-01-26			ENSG00000134765	ENSG00000134765		"""Cadherins / Major cadherins"""	3035	protein-coding gene	gene with protein product		125643				8486729	Standard	NM_024421		Approved	CDHF1	uc002kwn.3	Q08554	OTTHUMG00000131982	ENST00000257198.5:c.166C>A	18.37:g.28737519G>T	ENSP00000257198:p.Leu56Ile		Somatic				DSC1_uc002kwm.2_Missense_Mutation_p.L56I	p.L56I	NM_024421	NP_077739	WXS	Illumina HiSeq	Unspecified	Q08554	DSC1_HUMAN	OV - Ovarian serous cystadenocarcinoma(10;0.00778)		3	428	-			56					Q9HB01	Missense_Mutation	SNP	ENST00000257198.5	37	c.166C>A	CCDS11894.1	.	.	.	.	.	.	.	.	.	.	G	14.90	2.674015	0.47781	.	.	ENSG00000134765	ENST00000257197;ENST00000257198	T;T	0.61274	0.12;0.12	5.55	1.51	0.23008	Cadherin prodomain-like (1);Cadherin-like (1);	0.304623	0.23706	N	0.045374	T	0.53690	0.1812	M	0.79926	2.475	0.37827	D	0.928588	P;P	0.36683	0.565;0.565	B;B	0.37015	0.239;0.239	T	0.51474	-0.8701	10	0.33141	T	0.24	.	6.3571	0.21406	0.3037:0.1321:0.5643:0.0	.	56;56	Q08554;Q9HB00	DSC1_HUMAN;.	I	56	ENSP00000257197:L56I;ENSP00000257198:L56I	ENSP00000257197:L56I	L	-	1	0	DSC1	26991517	1.000000	0.71417	0.938000	0.37757	0.911000	0.54048	1.573000	0.36472	0.326000	0.23384	0.563000	0.77884	CTC		0.448	DSC1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254946.1	NM_004948, NM_024421		9	88	1	0	2.17888e-05	0.006214	3.2646e-05	9	88				
PIGN	23556	broad.mit.edu	37	18	59777144	59777144	+	Silent	SNP	C	C	G			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr18:59777144C>G	ENST00000357637.5	-	17	1912	c.1497G>C	c.(1495-1497)ctG>ctC	p.L499L	PIGN_ENST00000400334.3_Silent_p.L499L	NM_176787.4	NP_789744.1	O95427	PIGN_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class N	499					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity (GO:0016740)	p.L499L(1)		breast(3)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	22		Colorectal(73;0.187)				CTTGAATCAGCAGAAAAAATG	0.393																																							uc002lii.3		NA																	1	Substitution - coding silent(1)		lung(1)	breast(2)|upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	5						c.(1495-1497)CTG>CTC		phosphatidylinositol glycan anchor biosynthesis,							127.0	122.0	124.0					18																	59777144		1876	4106	5982	SO:0001819	synonymous_variant	23556				C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|integral to membrane	phosphotransferase activity, for other substituted phosphate groups	g.chr18:59777144C>G	AF109219	CCDS45879.1	18q21.33	2013-02-26	2006-06-28		ENSG00000197563	ENSG00000197563		"""Phosphatidylinositol glycan anchor biosynthesis"""	8967	protein-coding gene	gene with protein product		606097	"""phosphatidylinositol glycan, class N"""			10069808, 10574991	Standard	NM_012327		Approved	MDC4, PIG-N	uc021ulb.1	O95427	OTTHUMG00000180098	ENST00000357637.5:c.1497G>C	18.37:g.59777144C>G			Somatic				PIGN_uc002lij.3_Silent_p.L499L	p.L499L	NM_176787	NP_789744	WXS	Illumina HiSeq	Unspecified	O95427	PIGN_HUMAN			18	1945	-		Colorectal(73;0.187)	499			Helical; (Potential).		Q7L8F8|Q8TC01|Q9NT05	Silent	SNP	ENST00000357637.5	37	c.1497G>C	CCDS45879.1																																																																																				0.393	PIGN-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449757.2	NM_176787		9	126	0	0	0	0.004482	0	9	126				
SERPINB13	5275	broad.mit.edu	37	18	61264592	61264592	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr18:61264592C>A	ENST00000344731.5	+	8	1273	c.1171C>A	c.(1171-1173)Cct>Act	p.P391T	SERPINB13_ENST00000269489.5_Missense_Mutation_p.P339T	NM_012397.3	NP_036529.1	Q9UIV8	SPB13_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 13	391					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)|response to UV (GO:0009411)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.P391T(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|prostate(2)|urinary_tract(1)	25						ATTTTCTTCTCCTTAAGATGA	0.403																																							uc002ljc.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1171-1173)CCT>ACT		serine (or cysteine) proteinase inhibitor, clade							84.0	73.0	76.0					18																	61264592		2203	4300	6503	SO:0001583	missense	5275				regulation of proteolysis|response to UV	cytoplasm|extracellular region	serine-type endopeptidase inhibitor activity	g.chr18:61264592C>A	AF169949, BC101821	CCDS11985.1	18q21.33	2014-02-18	2005-08-18		ENSG00000197641	ENSG00000197641		"""Serine (or cysteine) peptidase inhibitors"""	8944	protein-coding gene	gene with protein product		604445	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 13"""	PI13		9297979, 10512713, 24172014	Standard	NM_012397		Approved	HUR7, hurpin, headpin	uc002ljc.3	Q9UIV8	OTTHUMG00000060406	ENST00000344731.5:c.1171C>A	18.37:g.61264592C>A	ENSP00000341584:p.Pro391Thr		Somatic				SERPINB13_uc002ljd.2_Missense_Mutation_p.P255T|SERPINB13_uc010xep.1_Missense_Mutation_p.P400T|SERPINB13_uc010xeq.1_Missense_Mutation_p.P212T|SERPINB13_uc010xer.1_Missense_Mutation_p.P212T	p.P391T	NM_012397	NP_036529	WXS	Illumina HiSeq	Unspecified	Q9UIV8	SPB13_HUMAN			8	1339	+			391					A8K2Q8|Q3MII2|Q9HCX1|Q9UBW1|Q9UKG0	Missense_Mutation	SNP	ENST00000344731.5	37	c.1171C>A	CCDS11985.1	.	.	.	.	.	.	.	.	.	.	C	24.4	4.524097	0.85600	.	.	ENSG00000197641	ENST00000269489;ENST00000539341;ENST00000344731	T;D	0.96745	0.28;-4.11	5.4	5.4	0.78164	Serpin domain (3);	0.000000	0.53938	D	0.000056	D	0.98658	0.9550	M	0.93197	3.39	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.97110	1.0;0.998;0.999	D	0.99694	1.1002	10	0.87932	D	0	.	18.1788	0.89771	0.0:1.0:0.0:0.0	.	400;309;391	B7ZKV6;F5GZ40;Q9UIV8	.;.;SPB13_HUMAN	T	339;309;391	ENSP00000269489:P339T;ENSP00000341584:P391T	ENSP00000269489:P339T	P	+	1	0	SERPINB13	59415572	1.000000	0.71417	0.997000	0.53966	0.853000	0.48598	7.518000	0.81795	2.541000	0.85698	0.557000	0.71058	CCT		0.403	SERPINB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133798.1	NM_012397		7	134	1	0	1.76689e-08	0.006214	3.19204e-08	7	134				
SERPINB4	6318	broad.mit.edu	37	18	61306540	61306540	+	Missense_Mutation	SNP	T	T	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr18:61306540T>A	ENST00000341074.5	-	7	762	c.647A>T	c.(646-648)tAc>tTc	p.Y216F	SERPINB4_ENST00000356424.6_Intron	NM_002974.2	NP_002965.1	P48594	SPB4_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 4	216					negative regulation of endopeptidase activity (GO:0010951)|negative regulation of peptidase activity (GO:0010466)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	enzyme binding (GO:0019899)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.Y216F(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(22)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	42						AAAGGAATTGTATTGCCTCAT	0.363																																							uc002ljf.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|lung(1)	3						c.(646-648)TAC>TTC		serine (or cysteine) proteinase inhibitor, clade							117.0	99.0	105.0					18																	61306540		2203	4300	6503	SO:0001583	missense	6318				immune response|regulation of proteolysis	cytoplasm|extracellular region	protein binding|serine-type endopeptidase inhibitor activity	g.chr18:61306540T>A	X89015	CCDS11986.1	18q21.33	2014-02-18	2005-08-18		ENSG00000206073	ENSG00000206073		"""Serine (or cysteine) peptidase inhibitors"""	10570	protein-coding gene	gene with protein product	"""squamous cell carcinoma antigen 2"""	600518	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 4"""	SCCA2		7724531, 14630915, 24172014	Standard	NM_175041		Approved	PI11, LEUPIN, SCCA-2, SCCA1		P48594	OTTHUMG00000060405	ENST00000341074.5:c.647A>T	18.37:g.61306540T>A	ENSP00000343445:p.Tyr216Phe		Somatic				SERPINB4_uc002lje.2_Intron|SERPINB4_uc002ljg.2_Intron	p.Y216F	NM_002974	NP_002965	WXS	Illumina HiSeq	Unspecified	P48594	SPB4_HUMAN			7	733	-			216					A8K847	Missense_Mutation	SNP	ENST00000341074.5	37	c.647A>T	CCDS11986.1	.	.	.	.	.	.	.	.	.	.	T	8.269	0.813027	0.16537	.	.	ENSG00000206073	ENST00000341074;ENST00000436264	D;D	0.84146	-1.81;-1.81	4.17	-8.34	0.00988	Serpin domain (3);	2.298650	0.01735	N	0.029043	T	0.70219	0.3199	N	0.16266	0.395	0.09310	N	1	B	0.11235	0.004	B	0.24394	0.053	T	0.60860	-0.7179	10	0.38643	T	0.18	.	3.0635	0.06207	0.1424:0.1655:0.3947:0.2974	.	216	P48594	SPB4_HUMAN	F	216;173	ENSP00000343445:Y216F;ENSP00000399796:Y173F	ENSP00000343445:Y216F	Y	-	2	0	SERPINB4	59457520	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-8.069000	0.00025	-3.226000	0.00210	-1.303000	0.01326	TAC		0.363	SERPINB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133794.2	NM_175041		4	82	0	0	0	0.000248	0	4	82				
POLRMT	5442	broad.mit.edu	37	19	625204	625204	+	Silent	SNP	G	G	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr19:625204G>A	ENST00000588649.2	-	4	957	c.873C>T	c.(871-873)ggC>ggT	p.G291G	LLNLR-299G3.1_ENST00000607288.1_RNA	NM_005035.3	NP_005026.3	O00411	RPOM_HUMAN	polymerase (RNA) mitochondrial (DNA directed)	291					gene expression (GO:0010467)|transcription from mitochondrial promoter (GO:0006390)|transcription initiation from mitochondrial promoter (GO:0006391)	mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|poly(A) RNA binding (GO:0044822)	p.G291G(1)		cervix(2)|endometrium(3)|large_intestine(1)|lung(9)|ovary(1)|pancreas(2)|prostate(1)|stomach(1)	20		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCGGAGTCAAGCCGGCATCCT	0.627																																							uc002lpf.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(871-873)GGC>GGT		mitochondrial DNA-directed RNA polymerase							73.0	77.0	76.0					19																	625204		2203	4300	6503	SO:0001819	synonymous_variant	5442				transcription initiation from mitochondrial promoter	mitochondrial nucleoid	DNA binding|DNA-directed RNA polymerase activity|protein binding	g.chr19:625204G>A		CCDS12036.1	19p13.3	2010-10-22			ENSG00000099821	ENSG00000099821	2.7.7.6		9200	protein-coding gene	gene with protein product		601778				9097968	Standard	NM_005035		Approved	h-mtRPOL, APOLMT, MTRNAP, MTRPOL	uc002lpf.1	O00411		ENST00000588649.2:c.873C>T	19.37:g.625204G>A			Somatic					p.G291G	NM_005035	NP_005026	WXS	Illumina HiSeq	Unspecified	O00411	RPOM_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	4	929	-		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)	291					O60370	Silent	SNP	ENST00000588649.2	37	c.873C>T	CCDS12036.1																																																																																				0.627	POLRMT-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452172.3	NM_005035		4	92	0	0	0	0.000248	0	4	92				
MUC16	94025	broad.mit.edu	37	19	9058299	9058299	+	Missense_Mutation	SNP	G	G	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr19:9058299G>A	ENST00000397910.4	-	3	29350	c.29147C>T	c.(29146-29148)aCg>aTg	p.T9716M		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	9718	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.T9716M(1)|p.T5349M(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GCGAGGGCTCGTCCATGACAG	0.468																																							uc002mkp.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(29146-29148)ACG>ATG		mucin 16							82.0	77.0	78.0					19																	9058299		1958	4150	6108	SO:0001583	missense	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9058299G>A	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.29147C>T	19.37:g.9058299G>A	ENSP00000381008:p.Thr9716Met		Somatic					p.T9716M	NM_024690	NP_078966	WXS	Illumina HiSeq	Unspecified	Q8WXI7	MUC16_HUMAN			3	29351	-			9718			Ser-rich.|Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	c.29147C>T	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	4.810	0.150673	0.09185	.	.	ENSG00000181143	ENST00000397910	T	0.24151	1.87	2.78	1.7	0.24286	.	.	.	.	.	T	0.22437	0.0541	N	0.24115	0.695	.	.	.	D	0.54772	0.968	P	0.51453	0.67	T	0.24476	-1.0159	8	0.87932	D	0	.	5.9863	0.19436	0.1523:0.0:0.8477:0.0	.	9716	B5ME49	.	M	9716	ENSP00000381008:T9716M	ENSP00000381008:T9716M	T	-	2	0	MUC16	8919299	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	-0.442000	0.06871	0.726000	0.32339	0.585000	0.79938	ACG		0.468	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		6	47	0	0	0	0.001168	0	6	47				
MUC16	94025	broad.mit.edu	37	19	9073838	9073838	+	Missense_Mutation	SNP	G	G	C			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr19:9073838G>C	ENST00000397910.4	-	3	13811	c.13608C>G	c.(13606-13608)aaC>aaG	p.N4536K		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	4538	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.N4536K(2)|p.N169K(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TCACTGCTTTGTTTATGGAAG	0.453																																							uc002mkp.2		NA																	3	Substitution - Missense(3)		lung(3)	lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(13606-13608)AAC>AAG		mucin 16							126.0	122.0	123.0					19																	9073838		2015	4167	6182	SO:0001583	missense	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9073838G>C	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.13608C>G	19.37:g.9073838G>C	ENSP00000381008:p.Asn4536Lys		Somatic					p.N4536K	NM_024690	NP_078966	WXS	Illumina HiSeq	Unspecified	Q8WXI7	MUC16_HUMAN			3	13812	-			4538			Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	c.13608C>G	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	3.888	-0.024642	0.07589	.	.	ENSG00000181143	ENST00000397910	T	0.25414	1.8	1.5	-2.99	0.05497	.	.	.	.	.	T	0.13543	0.0328	L	0.48642	1.525	.	.	.	P	0.44344	0.833	B	0.29598	0.104	T	0.09885	-1.0654	8	0.87932	D	0	.	2.6116	0.04892	0.1861:0.0:0.3389:0.4749	.	4536	B5ME49	.	K	4536	ENSP00000381008:N4536K	ENSP00000381008:N4536K	N	-	3	2	MUC16	8934838	0.000000	0.05858	0.000000	0.03702	0.295000	0.27426	-0.183000	0.09712	-0.938000	0.03714	0.313000	0.20887	AAC		0.453	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		5	72	0	0	0	0.000602	0	5	72				
OR7G2	390882	broad.mit.edu	37	19	9213200	9213200	+	Silent	SNP	G	G	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr19:9213200G>T	ENST00000305456.2	-	1	782	c.783C>A	c.(781-783)acC>acA	p.T261T		NM_001005193.1	NP_001005193.1	Q8NG99	OR7G2_HUMAN	olfactory receptor, family 7, subfamily G, member 2	240						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T261T(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(5)|skin(3)	16						GAGACCCACAGGTGGAAACTG	0.478																																					Esophageal Squamous(67;143 1448 28637 40648)	Esophageal Squamous(67;143 1448 28637 40648)	uc010xkk.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(781-783)ACC>ACA		olfactory receptor, family 7, subfamily G,							116.0	104.0	108.0					19																	9213200		2203	4300	6503	SO:0001819	synonymous_variant	390882				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr19:9213200G>T		CCDS32897.1	19p13.2	2013-09-24			ENSG00000170923	ENSG00000170923		"""GPCR / Class A : Olfactory receptors"""	8466	protein-coding gene	gene with protein product							Standard	NM_001005193		Approved	OST260	uc010xkk.2	Q8NG99	OTTHUMG00000179931	ENST00000305456.2:c.783C>A	19.37:g.9213200G>T			Somatic					p.T261T	NM_001005193	NP_001005193	WXS	Illumina HiSeq	Unspecified	Q8NG99	OR7G2_HUMAN			1	783	-			240			Helical; Name=6; (Potential).		Q6IFJ4|Q96RA0	Silent	SNP	ENST00000305456.2	37	c.783C>A	CCDS32897.1																																																																																				0.478	OR7G2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448994.1			6	109	1	0	0.00116845	0.001168	0.00143281	6	109				
CD97	976	broad.mit.edu	37	19	14512216	14512216	+	Missense_Mutation	SNP	G	G	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr19:14512216G>A	ENST00000242786.5	+	10	996	c.916G>A	c.(916-918)Gat>Aat	p.D306N	CD97_ENST00000357355.3_Missense_Mutation_p.D257N|CTC-548K16.5_ENST00000590626.1_RNA|CD97_ENST00000358600.3_Missense_Mutation_p.D213N	NM_078481.3	NP_510966.1	P48960	CD97_HUMAN	CD97 molecule	306					cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular component movement (GO:0006928)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|neuropeptide signaling pathway (GO:0007218)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)	p.D306N(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30						CAAATTGGTGGATGAACTGAT	0.567																																							uc002myl.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|breast(1)	4						c.(916-918)GAT>AAT		CD97 antigen isoform 1 precursor							48.0	46.0	47.0					19																	14512216		2203	4300	6503	SO:0001583	missense	976				cell adhesion|cell-cell signaling|cellular component movement|immune response|inflammatory response|neuropeptide signaling pathway	extracellular space|integral to plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding	g.chr19:14512216G>A		CCDS32929.1, CCDS32930.1, CCDS32931.1	19p13	2014-08-08	2006-03-28			ENSG00000123146		"""CD molecules"", ""-"", ""GPCR / Class B : Orphans"""	1711	protein-coding gene	gene with protein product	"""leukocyte antigen CD97"", ""seven-span transmembrane protein"", ""seven-transmembrane, heterodimeric receptor associated with inflammation"", ""seven transmembrane helix receptor"""	601211	"""CD97 antigen"""			7636245, 8786105	Standard	NM_078481		Approved	TM7LN1	uc002myl.3	P48960		ENST00000242786.5:c.916G>A	19.37:g.14512216G>A	ENSP00000242786:p.Asp306Asn		Somatic				CD97_uc002mym.2_Missense_Mutation_p.D257N|CD97_uc002myn.2_Missense_Mutation_p.D213N	p.D306N	NM_078481	NP_510966	WXS	Illumina HiSeq	Unspecified	P48960	CD97_HUMAN			10	1039	+			306			Extracellular (Potential).		A8K7Z4|B2RBJ9|O00718|O76101|Q8NG72|Q8TBQ7	Missense_Mutation	SNP	ENST00000242786.5	37	c.916G>A	CCDS32929.1	.	.	.	.	.	.	.	.	.	.	G	16.44	3.122964	0.56613	.	.	ENSG00000123146	ENST00000242786;ENST00000357355;ENST00000358600;ENST00000393059	T;T;T	0.73047	-0.71;-0.65;-0.28	5.52	5.52	0.82312	.	0.285660	0.19378	N	0.115732	D	0.84042	0.5385	M	0.80746	2.51	0.39699	D	0.971151	D;D;P	0.89917	1.0;1.0;0.949	D;D;P	0.79784	0.993;0.993;0.76	D	0.84153	0.0424	10	0.40728	T	0.16	.	14.9365	0.70960	0.0:0.0:1.0:0.0	.	213;257;306	P48960-2;P48960-3;P48960	.;.;CD97_HUMAN	N	306;257;213;256	ENSP00000242786:D306N;ENSP00000349918:D257N;ENSP00000351413:D213N	ENSP00000242786:D306N	D	+	1	0	CD97	14373216	1.000000	0.71417	0.663000	0.29738	0.015000	0.08874	4.281000	0.58965	2.592000	0.87571	0.561000	0.74099	GAT		0.567	CD97-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459821.2	NM_078481		4	31	0	0	0	0.000248	0	4	31				
ZNF99	7652	broad.mit.edu	37	19	22940448	22940448	+	Missense_Mutation	SNP	G	G	C			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr19:22940448G>C	ENST00000596209.1	-	4	2353	c.2263C>G	c.(2263-2265)Cat>Gat	p.H755D	ZNF99_ENST00000397104.3_Missense_Mutation_p.H664D|CTC-451A6.4_ENST00000442497.2_lincRNA	NM_001080409.2	NP_001073878.2	A8MXY4	ZNF99_HUMAN	zinc finger protein 99	755					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.H664D(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(20)|lung(55)|ovary(2)|prostate(10)|skin(5)|stomach(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	124		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				TCTGCAGTATGAATTACCTTA	0.353																																							uc010xrh.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(1990-1992)CAT>GAT		zinc finger protein 99							26.0	27.0	27.0					19																	22940448		1904	4049	5953	SO:0001583	missense	7652							g.chr19:22940448G>C	BC021822	CCDS59369.1	19p12	2013-01-08	2006-01-17		ENSG00000213973	ENSG00000213973		"""Zinc fingers, C2H2-type"", ""-"""	13175	protein-coding gene	gene with protein product		603981	"""zinc finger protein 99 (F8281)"", ""chromosome 19 open reading frame 9"""	C19orf9			Standard	NM_001080409		Approved	MGC24986	uc021urt.1	A8MXY4		ENST00000596209.1:c.2263C>G	19.37:g.22940448G>C	ENSP00000472969:p.His755Asp		Somatic					p.H664D	NM_001080409	NP_001073878	WXS	Illumina HiSeq	Unspecified					5	1990	-		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)						M0R335	Missense_Mutation	SNP	ENST00000596209.1	37	c.1990C>G	CCDS59369.1	.	.	.	.	.	.	.	.	.	.	g	11.60	1.685851	0.29962	.	.	ENSG00000213973	ENST00000397104	T	0.29142	1.58	0.726	0.726	0.18248	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.62986	0.2473	H	0.95712	3.71	0.26667	N	0.971795	D	0.89917	1.0	D	0.97110	1.0	T	0.52881	-0.8516	9	0.87932	D	0	.	8.9692	0.35897	0.0:0.0:1.0:0.0	.	664	A8MXY4	ZNF99_HUMAN	D	664	ENSP00000380293:H664D	ENSP00000380293:H664D	H	-	1	0	ZNF99	22732288	0.998000	0.40836	0.006000	0.13384	0.035000	0.12851	4.228000	0.58619	0.680000	0.31366	0.400000	0.26472	CAT		0.353	ZNF99-001	NOVEL	not_best_in_genome_evidence|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000464591.1	XM_065124		10	108	0	0	0	0.000978	0	10	108				
ATP1A3	478	broad.mit.edu	37	19	42490070	42490070	+	Silent	SNP	C	C	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr19:42490070C>T	ENST00000302102.5	-	6	702	c.552G>A	c.(550-552)aaG>aaA	p.K184K	ATP1A3_ENST00000543770.1_Silent_p.K195K|ATP1A3_ENST00000468774.2_5'Flank|ATP1A3_ENST00000602133.1_Silent_p.K154K|ATP1A3_ENST00000545399.1_Silent_p.K197K	NM_152296.4	NP_689509.1	P13637	AT1A3_HUMAN	ATPase, Na+/K+ transporting, alpha 3 polypeptide	184					adult locomotory behavior (GO:0008344)|ATP biosynthetic process (GO:0006754)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|memory (GO:0007613)|potassium ion import (GO:0010107)|response to drug (GO:0042493)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)|visual learning (GO:0008542)	axon (GO:0030424)|dendritic spine head (GO:0044327)|dendritic spine neck (GO:0044326)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|myelin sheath (GO:0043209)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)|synapse (GO:0045202)|vesicle (GO:0031982)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)	p.K184K(1)		NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(11)|liver(1)|lung(19)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	52						GGTCTCCACCCTTGATCTCCA	0.642																																							uc002osg.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(550-552)AAG>AAA		Na+/K+ -ATPase alpha 3 subunit							167.0	146.0	153.0					19																	42490070		2203	4300	6503	SO:0001819	synonymous_variant	478				ATP biosynthetic process	endoplasmic reticulum|Golgi apparatus	ATP binding|metal ion binding|sodium:potassium-exchanging ATPase activity	g.chr19:42490070C>T		CCDS12594.1, CCDS58663.1, CCDS58664.1	19q13.2	2012-10-22			ENSG00000105409	ENSG00000105409	3.6.3.9	"""ATPases / P-type"""	801	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-3"", ""sodium pump subunit alpha-3"", ""sodium-potassium ATPase catalytic subunit alpha-3"""	182350	"""dystonia 12"""	DYT12		17282997	Standard	NM_152296		Approved		uc002osh.4	P13637	OTTHUMG00000137384	ENST00000302102.5:c.552G>A	19.37:g.42490070C>T			Somatic				ATP1A3_uc010xwf.1_Silent_p.K195K|ATP1A3_uc010xwg.1_Silent_p.K154K|ATP1A3_uc010xwh.1_Silent_p.K197K|ATP1A3_uc002osh.2_Silent_p.K184K	p.K184K	NM_152296	NP_689509	WXS	Illumina HiSeq	Unspecified	P13637	AT1A3_HUMAN			6	706	-			184			Cytoplasmic (Potential).		B7Z2T0|B7Z401|F5H6J6|Q16732|Q16735|Q969K5	Silent	SNP	ENST00000302102.5	37	c.552G>A	CCDS12594.1																																																																																				0.642	ATP1A3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268107.1	NM_152296		8	115	0	0	0	0.00308	0	8	115				
PSG6	5675	broad.mit.edu	37	19	43414968	43414968	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr19:43414968G>T	ENST00000292125.2	-	3	514	c.470C>A	c.(469-471)cCc>cAc	p.P157H	PSG6_ENST00000402603.4_Missense_Mutation_p.P157H|PSG6_ENST00000187910.2_Missense_Mutation_p.P157H	NM_002782.4	NP_002773.1	Q00889	PSG6_HUMAN	pregnancy specific beta-1-glycoprotein 6	157	Ig-like C2-type 1.				female pregnancy (GO:0007565)	extracellular region (GO:0005576)		p.P157H(1)		central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(19)|ovary(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	44		Prostate(69;0.00899)				GACCTCCCTGGGGTTTAAGTT	0.537																																							uc002ovj.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(469-471)CCC>CAC		pregnancy specific beta-1-glycoprotein 6 isoform							168.0	169.0	168.0					19																	43414968		2201	4299	6500	SO:0001583	missense	5675				female pregnancy	extracellular region		g.chr19:43414968G>T		CCDS12613.1, CCDS33038.1	19q13.2	2013-01-29			ENSG00000170848	ENSG00000170848		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9523	protein-coding gene	gene with protein product		176395				1690992	Standard	NM_002782		Approved			Q00889	OTTHUMG00000151127	ENST00000292125.2:c.470C>A	19.37:g.43414968G>T	ENSP00000292125:p.Pro157His		Somatic				PSG3_uc002ouf.2_Intron|PSG11_uc002ouw.2_Intron|PSG7_uc002ous.1_Intron|PSG7_uc002out.1_Intron|PSG10_uc002ouv.1_Intron|PSG6_uc002ovh.1_Missense_Mutation_p.P164H|PSG6_uc002ovi.2_Missense_Mutation_p.P158H|PSG6_uc010xwk.1_Intron|PSG11_uc002ovk.1_Intron|PSG6_uc002ove.1_5'UTR|PSG6_uc002ovf.1_Missense_Mutation_p.P157H|PSG6_uc002ovg.1_Missense_Mutation_p.P157H	p.P157H	NM_002782	NP_002773	WXS	Illumina HiSeq	Unspecified	Q00889	PSG6_HUMAN			3	522	-		Prostate(69;0.00899)	157			Ig-like C2-type 1.		O75244|Q15224|Q15235|Q549K1	Missense_Mutation	SNP	ENST00000292125.2	37	c.470C>A	CCDS12613.1	.	.	.	.	.	.	.	.	.	.	N	11.69	1.713712	0.30413	.	.	ENSG00000170848	ENST00000187910;ENST00000402603;ENST00000292125;ENST00000402456	T;T;T	0.12879	2.64;2.64;2.64	1.64	1.64	0.23874	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.39489	0.1080	M	0.90705	3.14	0.09310	N	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.997;0.998;1.0	T	0.08146	-1.0736	9	0.87932	D	0	.	6.6645	0.23032	0.0:0.0:1.0:0.0	.	157;157;157	Q00889;Q00889-2;B5MCE1	PSG6_HUMAN;.;.	H	157	ENSP00000187910:P157H;ENSP00000385736:P157H;ENSP00000292125:P157H	ENSP00000187910:P157H	P	-	2	0	PSG6	48106808	0.000000	0.05858	0.009000	0.14445	0.004000	0.04260	-0.031000	0.12287	0.894000	0.36317	0.194000	0.17425	CCC		0.537	PSG6-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000321436.1	NM_002782		15	220	1	0	4.7546e-09	0.004007	8.69696e-09	15	220				
PSG7	5676	broad.mit.edu	37	19	43430641	43430641	+	RNA	SNP	G	G	T	rs376480204		TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr19:43430641G>T	ENST00000406070.2	-	0	1033				PSG7_ENST00000446844.3_RNA	NM_002783.2	NP_002774.2	Q13046	PSG7_HUMAN	pregnancy specific beta-1-glycoprotein 7 (gene/pseudogene)						female pregnancy (GO:0007565)	extracellular region (GO:0005576)							Prostate(69;0.00682)				TATCGGTCCCGTATTTCACAT	0.522																																							uc002ovl.3		NA																	0					0						c.(937-939)CGG>AGG		pregnancy specific beta-1-glycoprotein 7							128.0	118.0	121.0					19																	43430641		2201	4296	6497			5676				female pregnancy	extracellular region		g.chr19:43430641G>T			19q13.2	2013-01-29	2010-02-26		ENSG00000221878	ENSG00000221878		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9524	protein-coding gene	gene with protein product		176396	"""pregnancy specific beta-1-glycoprotein 7"""				Standard	NM_002783		Approved		uc010xwl.2	Q13046	OTTHUMG00000151125		19.37:g.43430641G>T			Somatic				PSG3_uc002ouf.2_Intron|PSG11_uc002ouw.2_Intron|PSG7_uc002ous.1_RNA|PSG7_uc002out.1_Intron|PSG10_uc002ouv.1_Intron|PSG6_uc002ovh.1_Intron|PSG6_uc002ovi.2_Intron|PSG6_uc010xwk.1_Intron|PSG11_uc002ovk.1_Intron|PSG7_uc010xwl.1_Silent_p.R191R	p.R313R	NM_002783	NP_002774	WXS	Illumina HiSeq	Unspecified	Q13046	PSG7_HUMAN			5	1039	-		Prostate(69;0.00682)	313			Ig-like C2-type 2.		Q15232	Silent	SNP	ENST00000406070.2	37	c.937C>A																																																																																					0.522	PSG7-001	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000321431.2	NM_001206650		12	205	1	0	7.03913e-09	0.001368	1.28223e-08	12	205				
AP2S1	1175	broad.mit.edu	37	19	47342740	47342740	+	Silent	SNP	G	G	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr19:47342740G>A	ENST00000263270.6	-	3	474	c.249C>T	c.(247-249)gcC>gcT	p.A83A	AP2S1_ENST00000352203.4_Silent_p.A97A|AP2S1_ENST00000601649.1_Intron|AP2S1_ENST00000601498.1_Silent_p.A99A|AP2S1_ENST00000593442.1_Silent_p.A33A|AP2S1_ENST00000597020.1_Silent_p.A63A|AP2S1_ENST00000599990.1_Silent_p.A85A	NM_004069.3	NP_004060.2	P53680	AP2S1_HUMAN	adaptor-related protein complex 2, sigma 1 subunit	83				A -> G (in Ref. 1; CAA65782 and 2; CAA09018). {ECO:0000305}.	antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|regulation of endocytosis (GO:0030100)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	AP-2 adaptor complex (GO:0030122)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)	protein transporter activity (GO:0008565)|transporter activity (GO:0005215)	p.A83A(1)		central_nervous_system(1)|lung(1)|urinary_tract(1)	3		all_cancers(25;1.24e-06)|all_epithelial(76;1.09e-05)|all_lung(116;0.00019)|Lung NSC(112;0.000601)|Ovarian(192;0.0221)|all_neural(266;0.0459)|Breast(70;0.128)		OV - Ovarian serous cystadenocarcinoma(262;3.86e-05)|all cancers(93;0.000107)|Epithelial(262;0.00325)|GBM - Glioblastoma multiforme(486;0.0336)		AGTTGTGAATGGCCTCCAGGT	0.582																																							uc002pft.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(247-249)GCC>GCT		adaptor-related protein complex 2, sigma 1							204.0	183.0	190.0					19																	47342740		2203	4300	6503	SO:0001819	synonymous_variant	1175				axon guidance|clathrin coat assembly|epidermal growth factor receptor signaling pathway|intracellular protein transport|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|regulation of defense response to virus by virus|regulation of endocytosis|synaptic transmission|viral reproduction	AP-2 adaptor complex|cytosol	protein transporter activity	g.chr19:47342740G>A	AJ010148	CCDS12693.1, CCDS33062.1	19q13.2-q13.3	2014-02-04				ENSG00000042753			565	protein-coding gene	gene with protein product		602242	"""hypocalciuric hypercalcemia 3 (Oklahoma type)"""	CLAPS2, HHC3		9040778, 9767099, 23222959	Standard	XM_005258500		Approved	FBHOk, FBH3	uc002pft.1	P53680		ENST00000263270.6:c.249C>T	19.37:g.47342740G>A			Somatic				AP2S1_uc002pfu.1_Intron	p.A83A	NM_004069	NP_004060	WXS	Illumina HiSeq	Unspecified	P53680	AP2S1_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;3.86e-05)|all cancers(93;0.000107)|Epithelial(262;0.00325)|GBM - Glioblastoma multiforme(486;0.0336)	3	429	-		all_cancers(25;1.24e-06)|all_epithelial(76;1.09e-05)|all_lung(116;0.00019)|Lung NSC(112;0.000601)|Ovarian(192;0.0221)|all_neural(266;0.0459)|Breast(70;0.128)	83	A -> G (in Ref. 1; CAA65782 and 2; CAA09018).				B2R4Z4|O75977|Q6PK67	Silent	SNP	ENST00000263270.6	37	c.249C>T	CCDS33062.1																																																																																				0.582	AP2S1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000466643.1			6	202	0	0	0	0.00308	0	6	202				
ZNF765	91661	broad.mit.edu	37	19	53911926	53911926	+	Missense_Mutation	SNP	A	A	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr19:53911926A>T	ENST00000396408.3	+	4	1235	c.1118A>T	c.(1117-1119)cAt>cTt	p.H373L	ZNF765_ENST00000594030.1_Intron	NM_001040185.1	NP_001035275.1	Q7L2R6	ZN765_HUMAN	zinc finger protein 765	373					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.H373L(1)		endometrium(1)|lung(3)	4				GBM - Glioblastoma multiforme(134;0.00379)		TTTACATGCCATCATAGAGTT	0.408																																							uc010ydx.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1117-1119)CAT>CTT		zinc finger protein 765							114.0	116.0	116.0					19																	53911926		2203	4300	6503	SO:0001583	missense	91661				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:53911926A>T	BC017357	CCDS46171.1	19q13.41	2013-01-08				ENSG00000196417		"""Zinc fingers, C2H2-type"", ""-"""	25092	protein-coding gene	gene with protein product						12477932	Standard	XR_430215		Approved		uc002qbm.3	Q7L2R6		ENST00000396408.3:c.1118A>T	19.37:g.53911926A>T	ENSP00000379689:p.His373Leu		Somatic				ZNF765_uc002qbm.2_Missense_Mutation_p.H373L|ZNF765_uc002qbn.2_Intron	p.H373L	NM_001040185	NP_001035275	WXS	Illumina HiSeq	Unspecified	Q7L2R6	ZN765_HUMAN		GBM - Glioblastoma multiforme(134;0.00379)	6	1445	+			373			C2H2-type 6.		A8MYG0|B4DF18|B7ZAI5|B9EIL1|Q9BV49	Missense_Mutation	SNP	ENST00000396408.3	37	c.1118A>T	CCDS46171.1	.	.	.	.	.	.	.	.	.	.	A	15.33	2.801852	0.50315	.	.	ENSG00000196417	ENST00000396408	D	0.86865	-2.18	1.22	1.22	0.21188	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.94460	0.8217	H	0.96604	3.85	0.31124	N	0.708528	D	0.76494	0.999	D	0.71414	0.973	D	0.90014	0.4123	8	.	.	.	.	7.3101	0.26469	1.0:0.0:0.0:0.0	.	373	Q7L2R6	ZN765_HUMAN	L	373	ENSP00000379689:H373L	.	H	+	2	0	ZNF765	58603738	1.000000	0.71417	0.003000	0.11579	0.034000	0.12701	7.136000	0.77285	0.504000	0.28082	0.147000	0.16070	CAT		0.408	ZNF765-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371603.1	NM_138372		7	185	0	0	0	0.001984	0	7	185				
NLRP12	91662	broad.mit.edu	37	19	54299180	54299180	+	Missense_Mutation	SNP	C	C	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr19:54299180C>T	ENST00000324134.6	-	9	3199	c.3031G>A	c.(3031-3033)Ggg>Agg	p.G1011R	NLRP12_ENST00000391775.3_Missense_Mutation_p.G954R|NLRP12_ENST00000391773.1_Missense_Mutation_p.G1012R|NLRP12_ENST00000351894.4_Missense_Mutation_p.G899R|NLRP12_ENST00000345770.5_Intron|NLRP12_ENST00000535162.1_Intron|NLRP12_ENST00000391772.1_Intron|NLRP12_ENST00000354278.3_Intron	NM_001277126.1|NM_144687.2	NP_001264055.1|NP_653288.1	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12	1011					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to cytokine stimulus (GO:0071345)|dendritic cell migration (GO:0036336)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 secretion (GO:0050711)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of signal transduction (GO:0009968)|negative regulation of Toll signaling pathway (GO:0045751)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of MHC class I biosynthetic process (GO:0045345)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of interleukin-18 biosynthetic process (GO:0045381)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)	p.G1011R(1)		NS(1)|breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(36)|ovary(5)|pancreas(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	80	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		CCTGTGTCCCCTAGGGCGTTG	0.557																																							uc002qch.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|upper_aerodigestive_tract(2)|lung(1)	7						c.(3031-3033)GGG>AGG		NLR family, pyrin domain containing 12 isoform							121.0	89.0	100.0					19																	54299180		2203	4300	6503	SO:0001583	missense	91662				negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of interleukin-1 secretion|negative regulation of interleukin-6 biosynthetic process|negative regulation of protein autophosphorylation|negative regulation of Toll signaling pathway|positive regulation of inflammatory response|positive regulation of interleukin-1 beta secretion|regulation of interleukin-18 biosynthetic process|release of cytoplasmic sequestered NF-kappaB	cytoplasm	ATP binding|caspase activator activity|protein binding	g.chr19:54299180C>T	AY095146	CCDS12864.1, CCDS62784.1, CCDS62785.1	19q13.42	2014-09-17	2006-12-08	2006-12-08	ENSG00000142405	ENSG00000142405		"""Nucleotide-binding domain and leucine rich repeat containing"""	22938	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 12"""	609648	"""NACHT, leucine rich repeat and PYD containing 12"""	NALP12		12563287, 12019269	Standard	NM_001277129		Approved	RNO2, PYPAF7, Monarch1, PAN6, CLR19.3	uc002qcj.5	P59046	OTTHUMG00000060776	ENST00000324134.6:c.3031G>A	19.37:g.54299180C>T	ENSP00000319377:p.Gly1011Arg		Somatic				NLRP12_uc010eqw.2_Missense_Mutation_p.G237R|NLRP12_uc002qci.3_Missense_Mutation_p.G954R|NLRP12_uc002qcj.3_Missense_Mutation_p.G1012R|NLRP12_uc002qck.3_RNA|NLRP12_uc010eqx.2_Intron	p.G1011R	NM_144687	NP_653288	WXS	Illumina HiSeq	Unspecified	P59046	NAL12_HUMAN		GBM - Glioblastoma multiforme(134;0.026)	9	3251	-	Ovarian(34;0.19)		1011			LRR 7.		A8MTQ2|B3KTE7|Q8NEU4|Q9BY26	Missense_Mutation	SNP	ENST00000324134.6	37	c.3031G>A	CCDS12864.1	.	.	.	.	.	.	.	.	.	.	C	13.45	2.240007	0.39598	.	.	ENSG00000142405	ENST00000324134;ENST00000351894;ENST00000358661;ENST00000391775;ENST00000391773	T;T;T;T	0.58506	0.54;0.44;0.33;0.54	4.15	1.74	0.24563	.	0.228465	0.22055	N	0.065256	T	0.67869	0.2939	M	0.70842	2.15	0.30413	N	0.77886	D;D;D;D	0.89917	1.0;0.977;0.99;0.998	D;D;D;D	0.77004	0.989;0.934;0.943;0.976	T	0.63541	-0.6614	10	0.54805	T	0.06	.	4.8847	0.13697	0.0:0.6277:0.2317:0.1406	.	237;1011;954;1011	P59046-5;A8K407;A8MTQ2;P59046	.;.;.;NAL12_HUMAN	R	1011;899;237;954;1012	ENSP00000319377:G1011R;ENSP00000340473:G899R;ENSP00000375655:G954R;ENSP00000375653:G1012R	ENSP00000319377:G1011R	G	-	1	0	NLRP12	58990992	0.027000	0.19231	0.674000	0.29902	0.505000	0.33919	0.215000	0.17562	0.442000	0.26555	0.442000	0.29010	GGG		0.557	NLRP12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000134340.1	NM_144687		4	40	0	0	0	0.001984	0	4	40				
LILRB2	10288	broad.mit.edu	37	19	54783926	54783926	+	Silent	SNP	G	G	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr19:54783926G>T	ENST00000391749.4	-	4	346	c.75C>A	c.(73-75)acC>acA	p.T25T	LILRB2_ENST00000391746.1_Silent_p.T25T|LILRB2_ENST00000314446.5_Silent_p.T25T|LILRB2_ENST00000434421.1_Intron|LILRB2_ENST00000391748.1_Silent_p.T25T|LILRB2_ENST00000471216.1_5'UTR|MIR4752_ENST00000579672.1_RNA	NM_001278406.1	NP_001265335.1	Q8N423	LIRB2_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 2	25					cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular defense response (GO:0006968)|cellular response to lipopolysaccharide (GO:0071222)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|heterotypic cell-cell adhesion (GO:0034113)|immune response (GO:0006955)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|negative regulation of antigen processing and presentation (GO:0002578)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T cell tolerance induction (GO:0002666)|regulation of dendritic cell differentiation (GO:2001198)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|inhibitory MHC class I receptor activity (GO:0032396)|MHC class I protein binding (GO:0042288)|MHC class Ib protein binding (GO:0023029)|protein phosphatase 1 binding (GO:0008157)|receptor activity (GO:0004872)			breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(30)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	44	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		GCTTGGGAATGGTCCCTGGAA	0.582																																							uc002qfb.2		NA																	0				skin(1)	1						c.(73-75)ACC>ACA		leukocyte immunoglobulin-like receptor,							87.0	93.0	91.0					19																	54783926		2202	4300	6502	SO:0001819	synonymous_variant	10288				cell surface receptor linked signaling pathway|cell-cell signaling|cellular defense response|immune response|regulation of immune response	integral to plasma membrane|membrane fraction	receptor activity	g.chr19:54783926G>T	AF000574	CCDS12886.1, CCDS42612.1, CCDS62791.1, CCDS62792.1	19q13.4	2013-01-11			ENSG00000131042	ENSG00000131042		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6606	protein-coding gene	gene with protein product		604815				9151699, 9079806	Standard	XM_006722966		Approved	LIR-2, ILT4, MIR-10, LIR2, CD85d, MIR10	uc002qfb.3	Q8N423	OTTHUMG00000064896	ENST00000391749.4:c.75C>A	19.37:g.54783926G>T			Somatic				LILRA6_uc002qew.1_Intron|LILRB2_uc010eri.2_Silent_p.T25T|LILRB2_uc010erj.2_RNA|LILRB2_uc002qfc.2_Silent_p.T25T|LILRB2_uc010yet.1_Intron|LILRB2_uc010yeu.1_RNA	p.T25T	NM_005874	NP_005865	WXS	Illumina HiSeq	Unspecified	Q8N423	LIRB2_HUMAN		GBM - Glioblastoma multiforme(193;0.105)	4	341	-	Ovarian(34;0.19)		25			Extracellular (Potential).		A8MU67|C9JF29|O75017|Q8NHJ7|Q8NHJ8	Silent	SNP	ENST00000391749.4	37	c.75C>A	CCDS12886.1																																																																																				0.582	LILRB2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139510.1			11	182	1	0	4.68919e-08	0.008291	8.26729e-08	11	182				
NLRP8	126205	broad.mit.edu	37	19	56485017	56485017	+	Splice_Site	SNP	G	G	C			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr19:56485017G>C	ENST00000291971.3	+	7	2605		c.e7-1		NLRP8_ENST00000590542.1_Intron	NM_176811.2	NP_789781.2	Q86W28	NALP8_HUMAN	NLR family, pyrin domain containing 8						neuron death (GO:0070997)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)	p.?(1)		breast(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|ovary(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)	35		Colorectal(82;0.000147)|Ovarian(87;0.17)		GBM - Glioblastoma multiforme(193;0.0695)		CTCTCCCATAGGATAGAGAAC	0.517																																							uc002qmh.2		NA																	1	Unknown(1)		lung(1)	ovary(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|kidney(1)	13						c.e7-1		NLR family, pyrin domain containing 8							200.0	205.0	203.0					19																	56485017		2203	4300	6503	SO:0001630	splice_region_variant	126205					cytoplasm	ATP binding	g.chr19:56485017G>C	AY154463	CCDS12937.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179709		"""Nucleotide-binding domain and leucine rich repeat containing"""	22940	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 8"""	609659	"""NACHT, leucine rich repeat and PYD containing 8"""	NALP8		12563287	Standard	NM_176811		Approved	NOD16, PAN4, CLR19.2	uc002qmh.3	Q86W28		ENST00000291971.3:c.2535-1G>C	19.37:g.56485017G>C			Somatic				NLRP8_uc010etg.2_Intron	p.S845_splice	NM_176811	NP_789781	WXS	Illumina HiSeq	Unspecified	Q86W28	NALP8_HUMAN		GBM - Glioblastoma multiforme(193;0.0695)	7	2606	+		Colorectal(82;0.000147)|Ovarian(87;0.17)						Q7RTR4	Splice_Site	SNP	ENST00000291971.3	37	c.2535_splice	CCDS12937.1	.	.	.	.	.	.	.	.	.	.	G	11.14	1.552301	0.27739	.	.	ENSG00000179709	ENST00000291971	.	.	.	2.04	2.04	0.26737	.	.	.	.	.	.	.	.	.	.	.	0.26399	N	0.976458	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.6199	0.28179	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NLRP8	61176829	0.659000	0.27411	0.202000	0.23494	0.411000	0.31082	3.211000	0.51137	1.453000	0.47775	0.514000	0.50259	.		0.517	NLRP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457462.1	NM_176811	Intron	12	509	0	0	0	0.00245	0	12	509				
SNTG2	54221	broad.mit.edu	37	2	1251123	1251123	+	Missense_Mutation	SNP	G	G	C			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr2:1251123G>C	ENST00000308624.5	+	12	1042	c.913G>C	c.(913-915)Gag>Cag	p.E305Q	SNTG2_ENST00000407292.1_Missense_Mutation_p.E178Q	NM_018968.3	NP_061841.2	Q9NY99	SNTG2_HUMAN	syntrophin, gamma 2	305	PH.				central nervous system development (GO:0007417)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|syntrophin complex (GO:0016013)	PDZ domain binding (GO:0030165)	p.E305Q(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)		GTGGGTAAATGAGAAACTCCA	0.498																																							uc002qwq.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|large_intestine(1)|breast(1)	3						c.(913-915)GAG>CAG		syntrophin, gamma 2							57.0	60.0	59.0					2																	1251123		2025	4192	6217	SO:0001583	missense	54221				central nervous system development	cytoplasm|cytoskeleton|sarcolemma|syntrophin complex	actin binding|PDZ domain binding	g.chr2:1251123G>C	AJ003029	CCDS46220.1	2p25	2008-05-23			ENSG00000172554	ENSG00000172554			13741	protein-coding gene	gene with protein product		608715				10747910	Standard	NM_018968		Approved	SYN5, G2SYN	uc002qwq.3	Q9NY99	OTTHUMG00000151370	ENST00000308624.5:c.913G>C	2.37:g.1251123G>C	ENSP00000311837:p.Glu305Gln		Somatic				SNTG2_uc010ewi.2_Missense_Mutation_p.E178Q	p.E305Q	NM_018968	NP_061841	WXS	Illumina HiSeq	Unspecified	Q9NY99	SNTG2_HUMAN		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)	12	1041	+	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)	305			PH.		Q05AH5	Missense_Mutation	SNP	ENST00000308624.5	37	c.913G>C	CCDS46220.1	.	.	.	.	.	.	.	.	.	.	G	15.13	2.741155	0.49151	.	.	ENSG00000172554	ENST00000308624;ENST00000407292	T;T	0.78481	1.59;-1.18	5.23	4.35	0.52113	Pleckstrin homology domain (1);	0.112943	0.64402	D	0.000020	D	0.86260	0.5890	M	0.78637	2.42	0.54753	D	0.999986	D;D	0.76494	0.999;0.996	D;P	0.66351	0.943;0.794	D	0.87420	0.2381	10	0.72032	D	0.01	.	12.3439	0.55109	0.083:0.0:0.917:0.0	.	178;305	Q9NY99-2;Q9NY99	.;SNTG2_HUMAN	Q	305;178	ENSP00000311837:E305Q;ENSP00000385020:E178Q	ENSP00000311837:E305Q	E	+	1	0	SNTG2	1233674	1.000000	0.71417	0.421000	0.26609	0.117000	0.20001	4.454000	0.60068	1.193000	0.43086	0.650000	0.86243	GAG		0.498	SNTG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322454.1	NM_018968		6	61	0	0	0	0.001168	0	6	61				
APOB	338	broad.mit.edu	37	2	21229397	21229397	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr2:21229397G>T	ENST00000233242.1	-	26	10470	c.10343C>A	c.(10342-10344)aCc>aAc	p.T3448N		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	3448	Heparin-binding.				artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)	p.T3448N(1)		NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTTTGACTTGGTATTTCCATT	0.378																																							uc002red.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27						c.(10342-10344)ACC>AAC		apolipoprotein B precursor	Atorvastatin(DB01076)						159.0	163.0	162.0					2																	21229397		2203	4300	6503	SO:0001583	missense	338				cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity	g.chr2:21229397G>T	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.10343C>A	2.37:g.21229397G>T	ENSP00000233242:p.Thr3448Asn		Somatic					p.T3448N	NM_000384	NP_000375	WXS	Illumina HiSeq	Unspecified	P04114	APOB_HUMAN			26	10471	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		3448			Heparin-binding.		O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	ENST00000233242.1	37	c.10343C>A	CCDS1703.1	.	.	.	.	.	.	.	.	.	.	G	17.29	3.353416	0.61293	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.80824	-1.42	5.74	4.86	0.63082	.	0.000000	0.64402	D	0.000010	D	0.88945	0.6575	M	0.77616	2.38	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.88749	0.3249	10	0.48119	T	0.1	.	15.0463	0.71830	0.069:0.0:0.931:0.0	.	3448	P04114	APOB_HUMAN	N	3448	ENSP00000233242:T3448N	ENSP00000233242:T3448N	T	-	2	0	APOB	21082902	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.004000	0.57068	2.703000	0.92315	0.655000	0.94253	ACC		0.378	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1			22	302	1	0	4.54149e-19	0.002299	9.7731e-19	22	302				
APOB	338	broad.mit.edu	37	2	21233785	21233785	+	Silent	SNP	G	G	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr2:21233785G>A	ENST00000233242.1	-	26	6082	c.5955C>T	c.(5953-5955)acC>acT	p.T1985T		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	1985					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)	p.T1985T(1)		NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGTTAAATTGGGTCTTGAGTT	0.463																																							uc002red.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27						c.(5953-5955)ACC>ACT		apolipoprotein B precursor	Atorvastatin(DB01076)						176.0	160.0	165.0					2																	21233785		2203	4300	6503	SO:0001819	synonymous_variant	338				cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity	g.chr2:21233785G>A	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.5955C>T	2.37:g.21233785G>A			Somatic					p.T1985T	NM_000384	NP_000375	WXS	Illumina HiSeq	Unspecified	P04114	APOB_HUMAN			26	6083	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		1985					O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Silent	SNP	ENST00000233242.1	37	c.5955C>T	CCDS1703.1																																																																																				0.463	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1			10	141	0	0	0	0.006214	0	10	141				
STRN	6801	broad.mit.edu	37	2	37076763	37076763	+	Missense_Mutation	SNP	C	C	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr2:37076763C>T	ENST00000263918.4	-	18	2187	c.2179G>A	c.(2179-2181)Gac>Aac	p.D727N	STRN_ENST00000379213.2_Missense_Mutation_p.D678N	NM_003162.3	NP_003153.2	O43815	STRN_HUMAN	striatin, calmodulin binding protein	727					dendrite development (GO:0016358)|locomotory behavior (GO:0007626)|negative regulation of cell proliferation (GO:0008285)|tight junction assembly (GO:0070830)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|tight junction (GO:0005923)	armadillo repeat domain binding (GO:0070016)|calmodulin binding (GO:0005516)|estrogen receptor binding (GO:0030331)|protein complex binding (GO:0032403)|protein phosphatase 2A binding (GO:0051721)	p.D727N(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(16)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	33		Ovarian(717;0.0129)|all_hematologic(82;0.21)				ATTGAACAGTCATGACCTATA	0.308																																							uc002rpn.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(2179-2181)GAC>AAC		striatin, calmodulin binding protein							74.0	75.0	75.0					2																	37076763		2203	4300	6503	SO:0001583	missense	6801				dendrite development|locomotory behavior|negative regulation of cell proliferation|tight junction assembly|Wnt receptor signaling pathway	cytoplasm|dendritic spine|neuronal cell body|postsynaptic density|postsynaptic membrane|tight junction	armadillo repeat domain binding|calmodulin binding|estrogen receptor binding|protein complex binding|protein phosphatase 2A binding	g.chr2:37076763C>T	AJ223814	CCDS1784.1	2p22.2	2013-01-10	2001-11-28		ENSG00000115808	ENSG00000115808		"""WD repeat domain containing"""	11424	protein-coding gene	gene with protein product		614765	"""striatin, calmodulin-binding protein"""			9693043, 8769426	Standard	NM_003162		Approved	SG2NA	uc002rpn.3	O43815	OTTHUMG00000100959	ENST00000263918.4:c.2179G>A	2.37:g.37076763C>T	ENSP00000263918:p.Asp727Asn		Somatic				STRN_uc010ezx.2_Missense_Mutation_p.D690N	p.D727N	NM_003162	NP_003153	WXS	Illumina HiSeq	Unspecified	O43815	STRN_HUMAN			18	2188	-		Ovarian(717;0.0129)|all_hematologic(82;0.21)	727			WD 5.		Q3KP65|Q53TQ8|Q9NP38	Missense_Mutation	SNP	ENST00000263918.4	37	c.2179G>A	CCDS1784.1	.	.	.	.	.	.	.	.	.	.	C	27.7	4.851287	0.91355	.	.	ENSG00000115808	ENST00000263918;ENST00000538092;ENST00000379213	D;D	0.88975	-2.45;-2.45	5.64	5.64	0.86602	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40 repeat, conserved site (1);WD40-repeat-containing domain (1);	0.091156	0.85682	D	0.000000	D	0.95947	0.8680	M	0.90977	3.165	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.994;0.999	D	0.96277	0.9203	10	0.72032	D	0.01	-19.811	19.6984	0.96043	0.0:1.0:0.0:0.0	.	678;727	O43815-2;O43815	.;STRN_HUMAN	N	727;702;678	ENSP00000263918:D727N;ENSP00000368513:D678N	ENSP00000263918:D727N	D	-	1	0	STRN	36930267	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.818000	0.86416	2.658000	0.90341	0.655000	0.94253	GAC		0.308	STRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218568.1			5	88	0	0	0	0.001168	0	5	88				
EML4	27436	broad.mit.edu	37	2	42515415	42515415	+	Missense_Mutation	SNP	C	C	G			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr2:42515415C>G	ENST00000318522.5	+	11	1433	c.1171C>G	c.(1171-1173)Ctt>Gtt	p.L391V	EML4_ENST00000401738.3_Missense_Mutation_p.L402V|EML4_ENST00000402711.2_Missense_Mutation_p.L333V	NM_019063.3	NP_061936	Q9HC35	EMAL4_HUMAN	echinoderm microtubule associated protein like 4	391					microtubule-based process (GO:0007017)|mitotic nuclear division (GO:0007067)|negative regulation of microtubule depolymerization (GO:0007026)	cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule (GO:0005874)|mitotic spindle (GO:0072686)		p.L391V(1)	EML4/ALK(543)	NS(2)|breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	12						TGAGCATATGCTTACTGTATG	0.338			T	ALK	NSCLC																																		uc002rsi.2		NA		Dom	yes		2	2p21	27436	T	echinoderm microtubule associated protein like 4			E	ALK		NSCLC	EML4/ALK(246)	1	Substitution - Missense(1)		lung(1)	lung(246)|ovary(2)|central_nervous_system(1)|skin(1)	250						c.(1171-1173)CTT>GTT		echinoderm microtubule associated protein like 4							140.0	145.0	143.0					2																	42515415		2203	4300	6503	SO:0001583	missense	27436				microtubule-based process|mitosis	cytoplasm|microtubule	protein binding	g.chr2:42515415C>G	AF177377	CCDS1807.1, CCDS46266.1	2p21	2013-01-10		2002-02-15	ENSG00000143924	ENSG00000143924		"""WD repeat domain containing"""	1316	protein-coding gene	gene with protein product		607442		C2orf2			Standard	NM_019063		Approved	ROPP120, ELP120	uc002rsi.3	Q9HC35	OTTHUMG00000128603	ENST00000318522.5:c.1171C>G	2.37:g.42515415C>G	ENSP00000320663:p.Leu391Val		Somatic				EML4_uc010fap.2_Missense_Mutation_p.L333V|EML4_uc002rsj.2_Missense_Mutation_p.L80V	p.L391V	NM_019063	NP_061936	WXS	Illumina HiSeq	Unspecified	Q9HC35	EMAL4_HUMAN			11	1433	+			391			WD 2.		A6H8Y6|B2RBK3|B2RTW7|B5MCW9|Q3SWW0|Q53R29|Q53TW8|Q6PJ45|Q9NV40	Missense_Mutation	SNP	ENST00000318522.5	37	c.1171C>G	CCDS1807.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.962074	0.74016	.	.	ENSG00000143924	ENST00000318522;ENST00000402711;ENST00000401738	T;T;T	0.55052	0.54;0.54;0.54	5.43	5.43	0.79202	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);	0.000000	0.85682	D	0.000000	T	0.68044	0.2958	L	0.49640	1.575	0.80722	D	1	D;P;D	0.76494	0.999;0.833;0.998	D;B;D	0.83275	0.967;0.376;0.996	T	0.62623	-0.6815	10	0.28530	T	0.3	-9.8105	19.2432	0.93891	0.0:1.0:0.0:0.0	.	333;402;391	B5MCW9;B5MBZ0;Q9HC35	.;.;EMAL4_HUMAN	V	391;333;402	ENSP00000320663:L391V;ENSP00000385059:L333V;ENSP00000384939:L402V	ENSP00000320663:L391V	L	+	1	0	EML4	42368919	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.106000	0.41835	2.550000	0.86006	0.591000	0.81541	CTT		0.338	EML4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250463.3	NM_019063		5	131	0	0	0	0.001168	0	5	131				
PSME4	23198	broad.mit.edu	37	2	54159167	54159167	+	Missense_Mutation	SNP	T	T	C			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr2:54159167T>C	ENST00000404125.1	-	10	1176	c.1121A>G	c.(1120-1122)aAg>aGg	p.K374R	PSME4_ENST00000421748.2_Intron	NM_014614.2	NP_055429.2	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator subunit 4	374					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|spermatogenesis, exchange of chromosomal proteins (GO:0035093)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)|spermatoproteasome complex (GO:1990111)	lysine-acetylated histone binding (GO:0070577)|peptidase activator activity (GO:0016504)	p.K260R(1)|p.K374R(1)		breast(5)|endometrium(8)|kidney(1)|large_intestine(11)|lung(26)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(2)	60			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			AGAGGGCTTCTTGTATCTTTC	0.418																																							uc002rxp.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|breast(2)|pancreas(1)	5						c.(1120-1122)AAG>AGG		proteasome (prosome, macropain) activator							105.0	99.0	101.0					2																	54159167		2203	4300	6503	SO:0001583	missense	23198				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|cell differentiation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|M/G1 transition of mitotic cell cycle|mRNA metabolic process|multicellular organismal development|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|spermatogenesis|viral reproduction	nuclear speck|proteasome complex	binding	g.chr2:54159167T>C	D38521	CCDS33197.2	2p16.1	2003-04-14			ENSG00000068878	ENSG00000068878		"""Proteasome (prosome, macropain) subunits"""	20635	protein-coding gene	gene with protein product		607705				7584044, 12093752	Standard	NM_014614		Approved	PA200, KIAA0077	uc002rxp.2	Q14997	OTTHUMG00000151852	ENST00000404125.1:c.1121A>G	2.37:g.54159167T>C	ENSP00000384211:p.Lys374Arg		Somatic				PSME4_uc010yop.1_Missense_Mutation_p.K260R|PSME4_uc010yoq.1_RNA|PSME4_uc010fbu.1_5'UTR|PSME4_uc010fbv.1_Intron	p.K374R	NM_014614	NP_055429	WXS	Illumina HiSeq	Unspecified	Q14997	PSME4_HUMAN	Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)		10	1177	-			374					Q1XBG4|Q1XBG5|Q1XBG6|Q2M1Z0|Q6IPR2|Q86XF8	Missense_Mutation	SNP	ENST00000404125.1	37	c.1121A>G	CCDS33197.2	.	.	.	.	.	.	.	.	.	.	T	13.90	2.375839	0.42105	.	.	ENSG00000068878	ENST00000404125	T	0.23754	1.89	5.77	5.77	0.91146	.	0.047372	0.85682	D	0.000000	T	0.12817	0.0311	N	0.03891	-0.335	0.80722	D	1	B	0.10296	0.003	B	0.11329	0.006	T	0.18366	-1.0339	10	0.13470	T	0.59	.	16.3948	0.83586	0.0:0.0:0.0:1.0	.	374	Q14997	PSME4_HUMAN	R	374	ENSP00000384211:K374R	ENSP00000374643:K374R	K	-	2	0	PSME4	54012671	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.664000	0.46783	2.326000	0.78906	0.533000	0.62120	AAG		0.418	PSME4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324163.1	XM_040158		16	127	0	0	0	0.004007	0	16	127				
ACYP2	98	broad.mit.edu	37	2	54365795	54365795	+	Missense_Mutation	SNP	G	G	C			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr2:54365795G>C	ENST00000394666.3	+	3	290	c.95G>C	c.(94-96)aGg>aCg	p.R32T	ACYP2_ENST00000406041.1_Missense_Mutation_p.R60T|ACYP2_ENST00000303536.4_Missense_Mutation_p.R60T|ACYP2_ENST00000607452.1_Missense_Mutation_p.R105T|ACYP2_ENST00000606865.1_Missense_Mutation_p.R16T	NM_138448.3	NP_612457.1	P14621	ACYP2_HUMAN	acylphosphatase 2, muscle type	32	Acylphosphatase-like. {ECO:0000255|PROSITE-ProRule:PRU00520}.				phosphate-containing compound metabolic process (GO:0006796)	mitochondrion (GO:0005739)	acylphosphatase activity (GO:0003998)	p.R32T(1)		lung(1)	1						GATGAAGCTAGGAAAATAGGA	0.408																																							uc002rxq.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(94-96)AGG>ACG		acylphosphatase 2							74.0	78.0	77.0					2																	54365795		2203	4300	6503	SO:0001583	missense	98				phosphate metabolic process		acylphosphatase activity	g.chr2:54365795G>C	X84195	CCDS1850.1	2p16.2	2008-02-05			ENSG00000170634	ENSG00000170634	3.6.1.7		180	protein-coding gene	gene with protein product		102595				8268218	Standard	NM_138448		Approved		uc002rxq.4	P14621	OTTHUMG00000129287	ENST00000394666.3:c.95G>C	2.37:g.54365795G>C	ENSP00000378161:p.Arg32Thr		Somatic					p.R32T	NM_138448	NP_612457	WXS	Illumina HiSeq	Unspecified	P14621	ACYP2_HUMAN			3	521	+			32			Acylphosphatase-like.			Missense_Mutation	SNP	ENST00000394666.3	37	c.95G>C	CCDS1850.1	.	.	.	.	.	.	.	.	.	.	G	13.26	2.185403	0.38609	.	.	ENSG00000170634	ENST00000406041;ENST00000394666;ENST00000303536	.	.	.	5.93	-2.8	0.05823	Acylphosphatase-like (3);	0.555420	0.19375	N	0.115803	T	0.44993	0.1320	.	.	.	0.36255	D	0.854196	B	0.21381	0.055	B	0.23150	0.044	T	0.40194	-0.9576	8	0.42905	T	0.14	-7.2495	13.7413	0.62849	0.4301:0.0:0.5699:0.0	.	32	P14621	ACYP2_HUMAN	T	60;32;60	.	ENSP00000306448:R60T	R	+	2	0	ACYP2	54219299	0.968000	0.33430	0.598000	0.28837	0.963000	0.63663	0.163000	0.16520	-0.331000	0.08501	-0.290000	0.09829	AGG		0.408	ACYP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251415.3			6	59	0	0	0	0.001168	0	6	59				
SPTBN1	6711	broad.mit.edu	37	2	54839363	54839363	+	Silent	SNP	C	C	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr2:54839363C>T	ENST00000356805.4	+	4	647	c.366C>T	c.(364-366)ttC>ttT	p.F122F	SPTBN1_ENST00000333896.5_Silent_p.F109F	NM_003128.2	NP_003119.2	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1	122	Actin-binding.|CH 1. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi to plasma membrane protein transport (GO:0043001)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|plasma membrane organization (GO:0007009)|protein targeting to plasma membrane (GO:0072661)	axolemma (GO:0030673)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phospholipid binding (GO:0005543)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)	p.F109F(1)|p.F122F(1)		NS(1)|breast(8)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(27)|ovary(4)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	82			Lung(47;0.24)			CCCTTCAGTTCCTGAAGGAGC	0.537																																							uc002rxu.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(3)|breast(2)|central_nervous_system(2)|skin(1)	8						c.(364-366)TTC>TTT		spectrin, beta, non-erythrocytic 1 isoform 1							137.0	122.0	127.0					2																	54839363		2203	4300	6503	SO:0001819	synonymous_variant	6711				actin filament capping|axon guidance	cytosol|nucleolus|plasma membrane|sarcomere|spectrin	actin binding|calmodulin binding|protein binding|structural constituent of cytoskeleton	g.chr2:54839363C>T		CCDS33198.1, CCDS33199.1	2p21	2013-01-10			ENSG00000115306	ENSG00000115306		"""Pleckstrin homology (PH) domain containing"""	11275	protein-coding gene	gene with protein product		182790					Standard	NM_003128		Approved		uc002rxu.3	Q01082	OTTHUMG00000133746	ENST00000356805.4:c.366C>T	2.37:g.54839363C>T			Somatic				SPTBN1_uc002rxv.1_Silent_p.F122F|SPTBN1_uc002rxx.2_Silent_p.F109F	p.F122F	NM_003128	NP_003119	WXS	Illumina HiSeq	Unspecified	Q01082	SPTB2_HUMAN	Lung(47;0.24)		4	615	+			122			CH 1.|Actin-binding.		B2RP63|O60837|Q16057|Q53R99|Q59ER3|Q8IX99	Silent	SNP	ENST00000356805.4	37	c.366C>T	CCDS33198.1																																																																																				0.537	SPTBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258115.3			7	141	0	0	0	0.001984	0	7	141				
USP34	9736	broad.mit.edu	37	2	61484357	61484357	+	Missense_Mutation	SNP	T	T	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr2:61484357T>A	ENST00000398571.2	-	45	6049	c.5973A>T	c.(5971-5973)gaA>gaT	p.E1991D		NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	1991	USP.				positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.E1991D(1)		autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			GAGACATTTCTTCGATTTTGG	0.338																																							uc002sbe.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(8)|breast(5)|skin(3)|lung(2)|prostate(1)	19						c.(5971-5973)GAA>GAT		ubiquitin specific protease 34							99.0	92.0	94.0					2																	61484357		1807	4077	5884	SO:0001583	missense	9736				positive regulation of canonical Wnt receptor signaling pathway|protein K48-linked deubiquitination|ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity	g.chr2:61484357T>A	AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.5973A>T	2.37:g.61484357T>A	ENSP00000381577:p.Glu1991Asp		Somatic				USP34_uc002sbf.2_Missense_Mutation_p.E141D	p.E1991D	NM_014709	NP_055524	WXS	Illumina HiSeq	Unspecified	Q70CQ2	UBP34_HUMAN	Epithelial(17;0.229)		45	5995	-			1991					A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Missense_Mutation	SNP	ENST00000398571.2	37	c.5973A>T	CCDS42686.1	.	.	.	.	.	.	.	.	.	.	T	16.80	3.224051	0.58668	.	.	ENSG00000115464	ENST00000263989;ENST00000398569;ENST00000398571;ENST00000453734	T;T	0.32988	1.43;1.43	5.82	2.11	0.27256	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.30039	0.0752	L	0.41710	1.295	0.46725	D	0.999171	B	0.26445	0.149	B	0.40636	0.335	T	0.05649	-1.0872	10	0.24483	T	0.36	.	9.8042	0.40783	0.0:0.2709:0.0:0.7291	.	1991	Q70CQ2	UBP34_HUMAN	D	1839;1839;1991;269	ENSP00000381577:E1991D;ENSP00000410559:E269D	ENSP00000263989:E1839D	E	-	3	2	USP34	61337861	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.005000	0.29834	0.118000	0.18165	0.528000	0.53228	GAA		0.338	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325650.4			14	129	0	0	0	0.003163	0	14	129				
USP34	9736	broad.mit.edu	37	2	61566728	61566728	+	Missense_Mutation	SNP	C	C	G			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr2:61566728C>G	ENST00000398571.2	-	17	2665	c.2589G>C	c.(2587-2589)ttG>ttC	p.L863F		NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	863					positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.L863F(1)		autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			CTATATCCCACAACAAAGTAT	0.303																																							uc002sbe.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(8)|breast(5)|skin(3)|lung(2)|prostate(1)	19						c.(2587-2589)TTG>TTC		ubiquitin specific protease 34							85.0	77.0	79.0					2																	61566728		1817	4080	5897	SO:0001583	missense	9736				positive regulation of canonical Wnt receptor signaling pathway|protein K48-linked deubiquitination|ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity	g.chr2:61566728C>G	AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.2589G>C	2.37:g.61566728C>G	ENSP00000381577:p.Leu863Phe		Somatic					p.L863F	NM_014709	NP_055524	WXS	Illumina HiSeq	Unspecified	Q70CQ2	UBP34_HUMAN	Epithelial(17;0.229)		17	2611	-			863					A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Missense_Mutation	SNP	ENST00000398571.2	37	c.2589G>C	CCDS42686.1	.	.	.	.	.	.	.	.	.	.	C	18.57	3.652869	0.67472	.	.	ENSG00000115464	ENST00000263989;ENST00000398569;ENST00000398571	T	0.11385	2.78	5.69	2.9	0.33743	.	0.000000	0.64402	D	0.000001	T	0.24314	0.0589	L	0.57536	1.79	0.50813	D	0.999895	D	0.65815	0.995	D	0.72982	0.979	T	0.00298	-1.1837	10	0.56958	D	0.05	.	8.1436	0.31097	0.0:0.6906:0.1141:0.1953	.	863	Q70CQ2	UBP34_HUMAN	F	711;711;863	ENSP00000381577:L863F	ENSP00000263989:L711F	L	-	3	2	USP34	61420232	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	1.042000	0.30303	0.331000	0.23511	-0.384000	0.06662	TTG		0.303	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325650.4			5	71	0	0	0	0.000602	0	5	71				
ANTXR1	84168	broad.mit.edu	37	2	69304562	69304562	+	Missense_Mutation	SNP	A	A	C			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr2:69304562A>C	ENST00000303714.4	+	8	906	c.584A>C	c.(583-585)aAg>aCg	p.K195T	ANTXR1_ENST00000409349.3_Missense_Mutation_p.K195T|ANTXR1_ENST00000409829.3_Missense_Mutation_p.K195T	NM_032208.2	NP_115584.1	Q9H6X2	ANTR1_HUMAN	anthrax toxin receptor 1	195	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				actin cytoskeleton reorganization (GO:0031532)|reproductive process (GO:0022414)|signal transduction (GO:0007165)|substrate adhesion-dependent cell spreading (GO:0034446)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|integral component of membrane (GO:0016021)|lamellipodium membrane (GO:0031258)	actin filament binding (GO:0051015)|collagen binding (GO:0005518)|metal ion binding (GO:0046872)|transmembrane signaling receptor activity (GO:0004888)	p.K195T(2)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(16)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	29						GCGGACAGTAAGGATCATGTG	0.498									Familial Infantile Hemangioma																														uc002sfg.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|skin(2)	4						c.(583-585)AAG>ACG		anthrax toxin receptor 1 isoform 1 precursor							209.0	182.0	191.0					2																	69304562		2203	4300	6503	SO:0001583	missense	84168	Familial_Infantile_Hemangioma	Familial Cancer Database	Infantile Capillary Hemangioma, HCI, Hereditary Capillary Hemangioma	actin cytoskeleton reorganization|substrate adhesion-dependent cell spreading	filopodium membrane|integral to membrane|lamellipodium membrane	actin filament binding|collagen binding|metal ion binding|protein binding|transmembrane receptor activity	g.chr2:69304562A>C	AF421380	CCDS1892.1, CCDS46313.1, CCDS46314.1	2p13.1	2006-04-12			ENSG00000169604	ENSG00000169604			21014	protein-coding gene	gene with protein product	"""anthrax toxin receptor"", ""tumor endothelial marker 8 precursor"""	606410				10947988, 11559528	Standard	NM_032208		Approved	TEM8, FLJ21776, FLJ10601, ATR	uc002sfg.3	Q9H6X2	OTTHUMG00000129575	ENST00000303714.4:c.584A>C	2.37:g.69304562A>C	ENSP00000301945:p.Lys195Thr		Somatic				ANTXR1_uc002sfe.2_Missense_Mutation_p.K195T|ANTXR1_uc002sff.2_Missense_Mutation_p.K195T|ANTXR1_uc002sfd.2_Missense_Mutation_p.K195T	p.K195T	NM_032208	NP_115584	WXS	Illumina HiSeq	Unspecified	Q9H6X2	ANTR1_HUMAN			8	940	+			195			Extracellular (Potential).|VWFA.		A8K7U8|J7K7G4|J7KF88|Q4ZFV6|Q53QD8|Q96P02|Q9NVP3	Missense_Mutation	SNP	ENST00000303714.4	37	c.584A>C	CCDS1892.1	.	.	.	.	.	.	.	.	.	.	A	8.973	0.973331	0.18736	.	.	ENSG00000169604	ENST00000303714;ENST00000409829;ENST00000409349	T;T;T	0.64803	-0.12;-0.12;-0.12	5.39	5.39	0.77823	von Willebrand factor, type A (3);	0.000000	0.85682	D	0.000000	T	0.63581	0.2523	M	0.71036	2.16	0.52099	D	0.999942	B;B;B;B	0.31949	0.264;0.016;0.062;0.348	B;B;B;B	0.36766	0.232;0.052;0.071;0.103	T	0.62402	-0.6862	10	0.31617	T	0.26	-20.996	13.3611	0.60657	1.0:0.0:0.0:0.0	.	195;195;195;195	Q9H6X2;Q9H6X2-2;Q9H6X2-4;Q9H6X2-3	ANTR1_HUMAN;.;.;.	T	195	ENSP00000301945:K195T;ENSP00000387058:K195T;ENSP00000386494:K195T	ENSP00000301945:K195T	K	+	2	0	ANTXR1	69158066	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.906000	0.56340	2.054000	0.61138	0.533000	0.62120	AAG		0.498	ANTXR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251770.2	NM_032208		12	171	0	0	0	0.001855	0	12	171				
DYSF	8291	broad.mit.edu	37	2	71795382	71795382	+	Silent	SNP	G	G	C			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr2:71795382G>C	ENST00000258104.3	+	26	3001	c.2724G>C	c.(2722-2724)acG>acC	p.T908T	DYSF_ENST00000394120.2_Silent_p.T909T|DYSF_ENST00000409582.3_Silent_p.T925T|DYSF_ENST00000429174.2_Silent_p.T908T|DYSF_ENST00000413539.2_Silent_p.T939T|DYSF_ENST00000409744.1_Silent_p.T895T|DYSF_ENST00000409762.1_Silent_p.T925T|DYSF_ENST00000410041.1_Silent_p.T926T|DYSF_ENST00000409651.1_Silent_p.T940T|DYSF_ENST00000409366.1_Silent_p.T909T|DYSF_ENST00000410020.3_Silent_p.T926T	NM_001130976.1|NM_003494.3	NP_001124448.1|NP_003485.1	O75923	DYSF_HUMAN	dysferlin	908					plasma membrane repair (GO:0001778)|vesicle fusion (GO:0006906)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phospholipid binding (GO:0005543)	p.T908T(2)|p.T926T(2)		autonomic_ganglia(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(57)|ovary(3)|pancreas(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	111						CTGACGTCACGGGCAAGATCA	0.592																																							uc002sie.2		NA																	4	Substitution - coding silent(4)		lung(2)|kidney(2)	ovary(3)|breast(2)|pancreas(1)|skin(1)	7						c.(2722-2724)ACG>ACC		dysferlin isoform 8							204.0	209.0	207.0					2																	71795382		2203	4300	6503	SO:0001819	synonymous_variant	8291					cytoplasmic vesicle membrane|integral to membrane|sarcolemma	calcium-dependent phospholipid binding	g.chr2:71795382G>C	AF075575	CCDS1918.1, CCDS46323.1, CCDS46324.1, CCDS46325.1, CCDS46326.1, CCDS46327.1, CCDS46328.1, CCDS46329.1, CCDS46330.1, CCDS46331.1, CCDS46332.1	2p13.3	2014-09-17	2013-09-12		ENSG00000135636	ENSG00000135636			3097	protein-coding gene	gene with protein product	"""fer-1-like family member 1"""	603009	"""limb girdle muscular dystrophy 2B (autosomal recessive)"""	LGMD2B		8320700	Standard	NM_003494		Approved	FER1L1	uc010fen.3	O75923	OTTHUMG00000129757	ENST00000258104.3:c.2724G>C	2.37:g.71795382G>C			Somatic				DYSF_uc010feg.2_Silent_p.T939T|DYSF_uc010feh.2_Silent_p.T894T|DYSF_uc002sig.3_Silent_p.T894T|DYSF_uc010yqx.1_RNA|DYSF_uc010fee.2_Silent_p.T908T|DYSF_uc010fef.2_Silent_p.T925T|DYSF_uc010fei.2_Silent_p.T925T|DYSF_uc010fek.2_Silent_p.T926T|DYSF_uc010fej.2_Silent_p.T895T|DYSF_uc010fel.2_Silent_p.T895T|DYSF_uc010feo.2_Silent_p.T940T|DYSF_uc010fem.2_Silent_p.T909T|DYSF_uc010fen.2_Silent_p.T926T|DYSF_uc002sif.2_Silent_p.T909T	p.T908T	NM_003494	NP_003485	WXS	Illumina HiSeq	Unspecified	O75923	DYSF_HUMAN			26	3100	+			908			Cytoplasmic (Potential).		A0FK00|B1PZ70|B1PZ71|B1PZ72|B1PZ73|B1PZ74|B1PZ75|B1PZ76|B1PZ77|B1PZ78|B1PZ79|B1PZ80|B1PZ81|B3KQB9|O75696|Q09EX5|Q0H395|Q53QY3|Q53TD2|Q8TEL8|Q9UEN7	Silent	SNP	ENST00000258104.3	37	c.2724G>C	CCDS1918.1																																																																																				0.592	DYSF-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251970.3	NM_003494		23	412	0	0	0	0.003954	0	23	412				
DCTN1	1639	broad.mit.edu	37	2	74593020	74593020	+	Splice_Site	SNP	C	C	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr2:74593020C>T	ENST00000361874.3	-	24	3203	c.2886G>A	c.(2884-2886)aaG>aaA	p.K962K	DCTN1_ENST00000394003.3_Splice_Site_p.K955K|DCTN1_ENST00000409438.1_Splice_Site_p.K828K|DCTN1_ENST00000407639.2_Splice_Site_p.K828K|DCTN1_ENST00000409240.1_Splice_Site_p.K925K|DCTN1_ENST00000495643.1_5'Flank|DCTN1_ENST00000409868.1_Splice_Site_p.K945K|DCTN1_ENST00000409567.3_Splice_Site_p.K942K|RP11-287D1.3_ENST00000451608.2_5'Flank	NM_004082.4	NP_004073.2	Q14203	DCTN1_HUMAN	dynactin 1	962					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|G2/M transition of mitotic cell cycle (GO:0000086)|melanosome transport (GO:0032402)|microtubule-based transport (GO:0010970)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|nervous system development (GO:0007399)	cell leading edge (GO:0031252)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|dynein complex (GO:0030286)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|spindle pole (GO:0000922)	motor activity (GO:0003774)	p.K962K(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(20)|ovary(4)|prostate(1)|skin(3)	45						CTACCCTCACCTTAATCTTGA	0.512																																							uc002skx.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|skin(2)	5						c.(2884-2886)AAG>AAA		dynactin 1 isoform 1							142.0	131.0	134.0					2																	74593020		2203	4300	6503	SO:0001630	splice_region_variant	1639				cell death|G2/M transition of mitotic cell cycle|mitosis|nervous system development	centrosome|cytosol|kinetochore|microtubule|spindle pole	motor activity|protein binding	g.chr2:74593020C>T		CCDS1939.1, CCDS46341.1, CCDS46342.1, CCDS54368.1, CCDS54369.1	2p13	2014-09-17	2010-06-24		ENSG00000204843	ENSG00000204843			2711	protein-coding gene	gene with protein product	"""p150 glued homolog (Drosophila)"""	601143	"""dynactin 1 (p150, Glued (Drosophila) homolog)"""			1828535	Standard	NM_001190836		Approved		uc002skx.3	Q14203	OTTHUMG00000129963	ENST00000361874.3:c.2886+1G>A	2.37:g.74593020C>T			Somatic				SLC4A5_uc002skl.2_5'Flank|DCTN1_uc002skt.1_5'Flank|DCTN1_uc002skv.2_Silent_p.K828K|DCTN1_uc002sku.2_Silent_p.K828K|DCTN1_uc002skw.1_Silent_p.K938K|DCTN1_uc010ffd.2_Silent_p.K942K|DCTN1_uc002sky.2_Silent_p.K925K	p.K962K	NM_004082	NP_004073	WXS	Illumina HiSeq	Unspecified	Q14203	DCTN1_HUMAN			24	3197	-			962			Potential.		A8MY36|B4DM45|E9PFS5|E9PGE1|G5E9H4|O95296|Q6IQ37|Q9BRM9|Q9UIU1|Q9UIU2	Silent	SNP	ENST00000361874.3	37	c.2886G>A	CCDS1939.1																																																																																				0.512	DCTN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252227.3	NM_004082	Silent	14	207	0	0	0	0.003163	0	14	207				
MRPL35	51318	broad.mit.edu	37	2	86433312	86433312	+	Missense_Mutation	SNP	A	A	C			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr2:86433312A>C	ENST00000337109.4	+	2	161	c.127A>C	c.(127-129)Act>Cct	p.T43P	MRPL35_ENST00000254644.8_Missense_Mutation_p.T43P|MRPL35_ENST00000605125.1_Missense_Mutation_p.T43P|MRPL35_ENST00000409180.1_Missense_Mutation_p.T43P	NM_016622.3	NP_057706.2	Q9NZE8	RM35_HUMAN	mitochondrial ribosomal protein L35	43					translation (GO:0006412)	mitochondrial ribosome (GO:0005761)	structural constituent of ribosome (GO:0003735)	p.T43P(1)		cervix(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(4)|skin(1)|stomach(1)|urinary_tract(2)	14						TGCATTGTCCACTGGACGTTT	0.458																																							uc002srg.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(127-129)ACT>CCT		mitochondrial ribosomal protein L35 isoform a							153.0	147.0	149.0					2																	86433312		2203	4300	6503	SO:0001583	missense	51318				translation	mitochondrial ribosome	structural constituent of ribosome	g.chr2:86433312A>C	AF208849	CCDS1987.1, CCDS1988.1	2p11.2	2012-09-13			ENSG00000132313	ENSG00000132313		"""Mitochondrial ribosomal proteins / large subunits"""	14489	protein-coding gene	gene with protein product		611841				11042152, 11551941	Standard	NM_016622		Approved		uc002srg.4	Q9NZE8	OTTHUMG00000037385	ENST00000337109.4:c.127A>C	2.37:g.86433312A>C	ENSP00000338389:p.Thr43Pro		Somatic				MRPL35_uc002srf.3_Missense_Mutation_p.T43P	p.T43P	NM_016622	NP_057706	WXS	Illumina HiSeq	Unspecified	Q9NZE8	RM35_HUMAN			2	185	+			43					A6NKV6|B2RB93|Q658U7|Q8WWA2	Missense_Mutation	SNP	ENST00000337109.4	37	c.127A>C	CCDS1988.1	.	.	.	.	.	.	.	.	.	.	A	10.43	1.349082	0.24426	.	.	ENSG00000132313	ENST00000254644;ENST00000337109;ENST00000409180	T;T;T	0.14893	2.47;2.7;2.49	5.52	-5.02	0.02982	.	0.909453	0.09807	N	0.753378	T	0.09818	0.0241	L	0.41236	1.265	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.37126	-0.9719	10	0.38643	T	0.18	-1.0321	1.9015	0.03268	0.2321:0.3863:0.2433:0.1383	.	43	Q9NZE8	RM35_HUMAN	P	43	ENSP00000254644:T43P;ENSP00000338389:T43P;ENSP00000386255:T43P	ENSP00000254644:T43P	T	+	1	0	MRPL35	86286823	0.000000	0.05858	0.016000	0.15963	0.477000	0.33069	-0.691000	0.05133	-0.397000	0.07691	0.477000	0.44152	ACT		0.458	MRPL35-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000091002.2	NM_016622		24	259	0	0	0	0.007291	0	24	259				
RGPD4	285190	broad.mit.edu	37	2	108488728	108488728	+	Missense_Mutation	SNP	C	C	G			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr2:108488728C>G	ENST00000408999.3	+	20	4345	c.4268C>G	c.(4267-4269)aCa>aGa	p.T1423R	RGPD4_ENST00000354986.4_Missense_Mutation_p.T1423R	NM_182588.2	NP_872394.2	Q7Z3J3	RGPD4_HUMAN	RANBP2-like and GRIP domain containing 4	1423	RanBD1 2. {ECO:0000255|PROSITE- ProRule:PRU00164}.				protein targeting to Golgi (GO:0000042)			p.T1423R(1)		breast(1)|endometrium(7)|kidney(4)|lung(23)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(3)	43						ATGAAAGGGACAGAAAGAGTA	0.388																																							uc010ywk.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)	2						c.(4267-4269)ACA>AGA		RANBP2-like and GRIP domain containing 4							8.0	6.0	6.0					2																	108488728		668	1484	2152	SO:0001583	missense	285190				intracellular transport		binding	g.chr2:108488728C>G	BX537861	CCDS46381.1	2q12.3	2013-01-10			ENSG00000196862	ENSG00000196862		"""Tetratricopeptide (TTC) repeat domain containing"""	32417	protein-coding gene	gene with protein product		612707				15710750, 15815621	Standard	NM_182588		Approved	RGP4, DKFZp686P0288	uc010ywk.2	Q7Z3J3	OTTHUMG00000153208	ENST00000408999.3:c.4268C>G	2.37:g.108488728C>G	ENSP00000386810:p.Thr1423Arg		Somatic				RGPD4_uc002tdu.2_Missense_Mutation_p.T610R|RGPD4_uc010ywl.1_Intron	p.T1423R	NM_182588	NP_872394	WXS	Illumina HiSeq	Unspecified	Q7Z3J3	RGPD4_HUMAN			20	4350	+			1423			RanBD1 2.		B9A029	Missense_Mutation	SNP	ENST00000408999.3	37	c.4268C>G	CCDS46381.1	.	.	.	.	.	.	.	.	.	.	-	13.83	2.355059	0.41700	.	.	ENSG00000196862	ENST00000354986;ENST00000408999	T;T	0.45668	0.89;0.89	2.33	2.33	0.28932	Pleckstrin homology-type (1);Ran binding protein 1 (3);	.	.	.	.	T	0.40372	0.1114	N	0.10916	0.065	0.32600	N	0.526091	D	0.61697	0.99	P	0.62491	0.903	T	0.54636	-0.8264	9	0.72032	D	0.01	-28.7727	11.5771	0.50869	0.0:1.0:0.0:0.0	.	1423	Q7Z3J3	RGPD4_HUMAN	R	1423	ENSP00000347081:T1423R;ENSP00000386810:T1423R	ENSP00000347081:T1423R	T	+	2	0	RGPD4	107855160	0.992000	0.36948	1.000000	0.80357	0.683000	0.39861	5.806000	0.69150	1.303000	0.44873	0.162000	0.16502	ACA		0.388	RGPD4-001	NOVEL	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330096.2	XM_496581		55	462	0	0	0	0.00361	0	55	462				
RANBP2	5903	broad.mit.edu	37	2	109371430	109371430	+	Missense_Mutation	SNP	G	G	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr2:109371430G>A	ENST00000283195.6	+	16	2398	c.2272G>A	c.(2272-2274)Gaa>Aaa	p.E758K		NM_006267.4	NP_006258.3	P49792	RBP2_HUMAN	RAN binding protein 2	758					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of glucokinase activity (GO:0033132)|protein folding (GO:0006457)|protein import into nucleus (GO:0006606)|protein sumoylation (GO:0016925)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)	ligase activity (GO:0016874)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|Ran GTPase binding (GO:0008536)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.E758K(2)	RANBP2/ALK(34)	NS(1)|biliary_tract(1)|breast(3)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(21)|large_intestine(19)|lung(51)|pancreas(1)|prostate(8)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	129						AGACTATAGTGAAGGAGGTCC	0.378																																							uc002tem.3		NA																RANBP2/ALK(16)	2	Substitution - Missense(2)		lung(2)	soft_tissue(16)|lung(1)|pancreas(1)	18						c.(2272-2274)GAA>AAA		RAN binding protein 2							53.0	62.0	59.0					2																	109371430		2183	4274	6457	SO:0001583	missense	5903				carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA transport|protein folding|protein import into nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear pore	peptidyl-prolyl cis-trans isomerase activity|Ran GTPase binding|zinc ion binding	g.chr2:109371430G>A	D42063	CCDS2079.1	2q13	2013-11-14			ENSG00000153201	ENSG00000153201		"""Tetratricopeptide (TTC) repeat domain containing"""	9848	protein-coding gene	gene with protein product		601181	"""acute necrotizing encephalopathy 1 (autosomal dominant)"""	ANE1		7724562, 19118815	Standard	NM_006267		Approved	NUP358, ADANE	uc002tem.4	P49792	OTTHUMG00000130981	ENST00000283195.6:c.2272G>A	2.37:g.109371430G>A	ENSP00000283195:p.Glu758Lys		Somatic					p.E758K	NM_006267	NP_006258	WXS	Illumina HiSeq	Unspecified	P49792	RBP2_HUMAN			16	2398	+			758					Q13074|Q15280|Q53TE2|Q59FH7	Missense_Mutation	SNP	ENST00000283195.6	37	c.2272G>A	CCDS2079.1	.	.	.	.	.	.	.	.	.	.	g	18.90	3.721971	0.68959	.	.	ENSG00000153201	ENST00000409491;ENST00000283195	T	0.21031	2.03	5.77	5.77	0.91146	.	.	.	.	.	T	0.21227	0.0511	L	0.29908	0.895	0.31016	N	0.718669	B	0.24963	0.115	B	0.23275	0.045	T	0.08994	-1.0695	9	0.59425	D	0.04	-16.858	19.986	0.97351	0.0:0.0:1.0:0.0	.	758	P49792	RBP2_HUMAN	K	758	ENSP00000283195:E758K	ENSP00000283195:E758K	E	+	1	0	RANBP2	108737862	1.000000	0.71417	1.000000	0.80357	0.743000	0.42351	8.067000	0.89488	2.716000	0.92895	0.542000	0.68232	GAA		0.378	RANBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253594.1	NM_006267		23	375	0	0	0	0.00632	0	23	375				
BUB1	699	broad.mit.edu	37	2	111398671	111398671	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr2:111398671C>A	ENST00000302759.6	-	23	3013	c.2895G>T	c.(2893-2895)aaG>aaT	p.K965N	BUB1_ENST00000478175.1_5'Flank|BUB1_ENST00000409311.1_Missense_Mutation_p.K908N|BUB1_ENST00000535254.1_Missense_Mutation_p.K945N	NM_004336.3	NP_004327.1	O43683	BUB1_HUMAN	BUB1 mitotic checkpoint serine/threonine kinase	965	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|regulation of chromosome segregation (GO:0051983)|regulation of sister chromatid cohesion (GO:0007063)|spindle assembly checkpoint (GO:0071173)|viral process (GO:0016032)	condensed chromosome kinetochore (GO:0000777)|condensed nuclear chromosome, centromeric region (GO:0000780)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.K965N(1)		breast(3)|endometrium(8)|kidney(4)|large_intestine(9)|lung(18)|ovary(1)|prostate(1)|stomach(1)	45		Ovarian(717;0.0822)		BRCA - Breast invasive adenocarcinoma(221;0.0556)		ATGTTTCACACTTTGCTGTGA	0.383																																							uc002tgc.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)|breast(2)|stomach(1)|ovary(1)|kidney(1)	7						c.(2893-2895)AAG>AAT		budding uninhibited by benzimidazoles 1							90.0	88.0	88.0					2																	111398671		2203	4300	6503	SO:0001583	missense	699				apoptosis|cell division|chromosome segregation|interspecies interaction between organisms|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|regulation of sister chromatid cohesion	condensed chromosome kinetochore|cytosol	ATP binding|protein binding|protein serine/threonine kinase activity	g.chr2:111398671C>A	AF046078	CCDS33273.1, CCDS62984.1, CCDS62985.1	2q13	2013-01-17	2013-01-17		ENSG00000169679	ENSG00000169679			1148	protein-coding gene	gene with protein product		602452	"""budding uninhibited by benzimidazoles 1 (yeast homolog)"", ""budding uninhibited by benzimidazoles 1 homolog (yeast)"""	BUB1L			Standard	NM_004336		Approved	hBUB1, BUB1A	uc002tgc.3	O43683	OTTHUMG00000153638	ENST00000302759.6:c.2895G>T	2.37:g.111398671C>A	ENSP00000302530:p.Lys965Asn		Somatic				BUB1_uc010yxh.1_Missense_Mutation_p.K945N|BUB1_uc010fkb.2_Missense_Mutation_p.K908N	p.K965N	NM_004336	NP_004327	WXS	Illumina HiSeq	Unspecified	O43683	BUB1_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.0556)	23	3007	-		Ovarian(717;0.0822)	965			Protein kinase.		E9PC26|F5GXI5|O43430|O43643|O60626|Q53QE4	Missense_Mutation	SNP	ENST00000302759.6	37	c.2895G>T	CCDS33273.1	.	.	.	.	.	.	.	.	.	.	C	14.13	2.442817	0.43326	.	.	ENSG00000169679	ENST00000535254;ENST00000409311;ENST00000302759	T;T;T	0.64991	-0.13;2.13;-0.13	5.54	-3.53	0.04667	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.276343	0.43110	D	0.000620	T	0.60971	0.2310	L	0.39397	1.21	0.36508	D	0.869448	P;D;P	0.65815	0.924;0.995;0.738	P;P;P	0.61800	0.585;0.894;0.545	T	0.63829	-0.6548	10	0.17369	T	0.5	-12.6665	13.2007	0.59765	0.0:0.594:0.0:0.406	.	945;908;965	F5GXI5;E9PC26;O43683	.;.;BUB1_HUMAN	N	945;908;965	ENSP00000441013:K945N;ENSP00000386701:K908N;ENSP00000302530:K965N	ENSP00000302530:K965N	K	-	3	2	BUB1	111115143	0.010000	0.17322	0.012000	0.15200	0.690000	0.40134	-0.386000	0.07370	-0.689000	0.05149	-0.948000	0.02665	AAG		0.383	BUB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331925.1	NM_004336		19	170	1	0	1.56452e-12	0.007413	3.1651e-12	19	170				
DPP10	57628	broad.mit.edu	37	2	116525883	116525883	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr2:116525883C>A	ENST00000410059.1	+	13	1604	c.1124C>A	c.(1123-1125)cCc>cAc	p.P375H	DPP10_ENST00000310323.8_Missense_Mutation_p.P368H|DPP10_ENST00000393147.2_Missense_Mutation_p.P379H|DPP10_ENST00000409163.1_Missense_Mutation_p.P325H	NM_001178037.1|NM_020868.3	NP_001171508.1|NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl-peptidase 10 (non-functional)	375						integral component of membrane (GO:0016021)|membrane (GO:0016020)	serine-type peptidase activity (GO:0008236)	p.P375H(1)|p.P368H(1)		breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(24)|liver(2)|lung(48)|ovary(6)|prostate(1)|skin(5)|soft_tissue(1)	101						AATGAGGAGCCCGTGTTTTCT	0.448																																							uc002tla.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(5)|large_intestine(2)|skin(2)|breast(1)	10						c.(1123-1125)CCC>CAC		dipeptidyl peptidase 10 isoform long							121.0	115.0	117.0					2																	116525883		2203	4300	6503	SO:0001583	missense	57628				proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity	g.chr2:116525883C>A	AY172661	CCDS33278.1, CCDS46400.1, CCDS54388.1, CCDS54389.1	2q14.1	2010-05-04	2010-05-04		ENSG00000175497	ENSG00000175497			20823	protein-coding gene	gene with protein product		608209	"""dipeptidylpeptidase 10"", ""dipeptidyl-peptidase 10"""			10819331, 12662155	Standard	NM_020868		Approved	DPRP3	uc002tle.3	Q8N608	OTTHUMG00000153294	ENST00000410059.1:c.1124C>A	2.37:g.116525883C>A	ENSP00000386565:p.Pro375His		Somatic				DPP10_uc002tlb.1_Missense_Mutation_p.P325H|DPP10_uc002tlc.1_Missense_Mutation_p.P371H|DPP10_uc002tle.2_Missense_Mutation_p.P379H|DPP10_uc002tlf.1_Missense_Mutation_p.P368H	p.P375H	NM_020868	NP_065919	WXS	Illumina HiSeq	Unspecified	Q8N608	DPP10_HUMAN			13	1581	+			375			Extracellular (Potential).		A8K1Q2|J3KPP2|J3KQ46|Q0GLB8|Q53QT3|Q53S86|Q53SL8|Q53SS4|Q6TTV4|Q86YR9|Q9P236	Missense_Mutation	SNP	ENST00000410059.1	37	c.1124C>A	CCDS46400.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.362304	0.82353	.	.	ENSG00000175497	ENST00000410059;ENST00000409163;ENST00000393147;ENST00000310323;ENST00000476155	T;T;T;T	0.34667	1.35;1.35;1.35;1.35	5.25	5.25	0.73442	Peptidase S9B, dipeptidylpeptidase IV N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.69815	0.3153	M	0.92219	3.285	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;1.0;0.999	D;D;D;D	0.91635	0.974;0.996;0.999;0.985	T	0.77611	-0.2523	10	0.87932	D	0	-0.1184	17.5891	0.87991	0.0:1.0:0.0:0.0	.	368;379;371;375	Q8N608-2;Q0GLB8;Q0GLB9;Q8N608	.;.;.;DPP10_HUMAN	H	375;325;379;368;325	ENSP00000386565:P375H;ENSP00000387038:P325H;ENSP00000376855:P379H;ENSP00000309066:P368H	ENSP00000309066:P368H	P	+	2	0	DPP10	116242353	1.000000	0.71417	0.981000	0.43875	0.966000	0.64601	6.710000	0.74670	2.724000	0.93272	0.655000	0.94253	CCC		0.448	DPP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330580.4	NM_020868		10	74	1	0	0.000673444	0.008291	0.000835147	10	74				
GLI2	2736	broad.mit.edu	37	2	121743871	121743871	+	Silent	SNP	C	C	T	rs531891558		TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr2:121743871C>T	ENST00000452319.1	+	13	2034	c.1974C>T	c.(1972-1974)ccC>ccT	p.P658P	GLI2_ENST00000361492.4_Silent_p.P658P|GLI2_ENST00000314490.11_Silent_p.P330P|GLI2_ENST00000435313.2_3'UTR					GLI family zinc finger 2									p.P658P(1)		NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|lung(24)|ovary(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(3;0.0496)	Prostate(154;0.0623)				AGTCCAGCCCCGGGGCCCAGT	0.667													C|||	1	0.000199681	0.0	0.0	5008	,	,		17652	0.001		0.0	False		,,,				2504	0.0						uc010flp.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(8)|lung(2)|breast(1)|central_nervous_system(1)|pancreas(1)	13						c.(1972-1974)CCC>CCT		GLI-Kruppel family member GLI2							22.0	26.0	25.0					2																	121743871		2194	4283	6477	SO:0001819	synonymous_variant	2736				axon guidance|branching morphogenesis of a tube|cell proliferation|cerebellar cortex morphogenesis|developmental growth|embryonic digestive tract development|epidermal cell differentiation|floor plate formation|heart development|hindgut morphogenesis|kidney development|lung development|negative regulation of transcription from RNA polymerase II promoter|odontogenesis of dentine-containing tooth|osteoblast development|osteoblast differentiation|pituitary gland development|positive regulation of DNA replication|positive regulation of T cell differentiation in thymus|positive regulation of transcription from RNA polymerase II promoter|proximal/distal pattern formation|skeletal system development|smoothened signaling pathway involved in ventral spinal cord interneuron specification|spinal cord ventral commissure morphogenesis	nucleus|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr2:121743871C>T		CCDS33283.1	2q14	2013-01-25	2009-03-05		ENSG00000074047	ENSG00000074047		"""Zinc fingers, C2H2-type"""	4318	protein-coding gene	gene with protein product	"""tax-responsive element-2 holding protein"", ""tax helper protein 1"", ""tax helper protein 2"""	165230	"""GLI-Kruppel family member GLI2"", ""glioma-associated oncogene family zinc finger 2"""			2850480, 9557682	Standard	NM_005270		Approved	THP2, HPE9, THP1	uc010flp.3	P10070	OTTHUMG00000153741	ENST00000452319.1:c.1974C>T	2.37:g.121743871C>T			Somatic				GLI2_uc002tmq.1_Silent_p.P330P|GLI2_uc002tmr.1_Silent_p.P313P|GLI2_uc002tmt.3_Silent_p.P330P|GLI2_uc002tmu.3_Silent_p.P313P|GLI2_uc002tmw.1_Silent_p.P641P	p.P658P	NM_005270	NP_005261	WXS	Illumina HiSeq	Unspecified	P10070	GLI2_HUMAN			12	2004	+	Renal(3;0.0496)	Prostate(154;0.0623)	658						Silent	SNP	ENST00000452319.1	37	c.1974C>T	CCDS33283.1																																																																																				0.667	GLI2-009	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332293.3	NM_005270		4	29	0	0	0	0.000602	0	4	29				
NCKAP5	344148	broad.mit.edu	37	2	133542273	133542273	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr2:133542273C>A	ENST00000409261.1	-	14	2484	c.2111G>T	c.(2110-2112)gGa>gTa	p.G704V	NCKAP5_ENST00000409213.1_Intron|NCKAP5_ENST00000473859.1_5'Flank|NCKAP5_ENST00000405974.3_Intron|NCKAP5_ENST00000317721.6_Missense_Mutation_p.G704V	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	704								p.G704V(1)		NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						TGCCTTGGGTCCAGCAGGAGT	0.453																																							uc002ttp.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2110-2112)GGA>GTA		Nck-associated protein 5 isoform 1							122.0	114.0	117.0					2																	133542273		1875	4114	5989	SO:0001583	missense	344148						protein binding	g.chr2:133542273C>A	AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.2111G>T	2.37:g.133542273C>A	ENSP00000387128:p.Gly704Val		Somatic				NCKAP5_uc002ttq.2_Intron	p.G704V	NM_207363	NP_997246	WXS	Illumina HiSeq	Unspecified	O14513	NCKP5_HUMAN			14	2485	-			704					B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Missense_Mutation	SNP	ENST00000409261.1	37	c.2111G>T	CCDS46418.1	.	.	.	.	.	.	.	.	.	.	c	16.74	3.205904	0.58234	.	.	ENSG00000176771	ENST00000409261;ENST00000317721	T;T	0.39787	1.06;1.06	5.5	4.61	0.57282	.	0.187749	0.25677	U	0.029029	T	0.41858	0.1177	L	0.32530	0.975	0.80722	D	1	P	0.49090	0.919	P	0.48704	0.587	T	0.34800	-0.9814	10	0.51188	T	0.08	.	14.5263	0.67892	0.0:0.6998:0.3002:0.0	.	704	O14513	NCKP5_HUMAN	V	704	ENSP00000387128:G704V;ENSP00000380603:G704V	ENSP00000380603:G704V	G	-	2	0	NCKAP5	133258743	0.000000	0.05858	0.885000	0.34714	0.829000	0.46940	0.531000	0.23052	1.516000	0.48900	0.651000	0.88453	GGA		0.453	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331663.1	NM_207481		11	190	1	0	5.16669e-11	0.000978	9.99196e-11	11	190				
LRP1B	53353	broad.mit.edu	37	2	141135856	141135856	+	Splice_Site	SNP	C	C	G			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr2:141135856C>G	ENST00000389484.3	-	68	11503		c.e68-1			NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B						protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.?(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		GTCTGTGGCTCTGGGGATAAA	0.368										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	Colon(99;50 2074 2507 20106)	uc002tvj.1		NA																	1	Unknown(1)		lung(1)	lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50						c.e68-1		low density lipoprotein-related protein 1B							80.0	69.0	73.0					2																	141135856		2203	4300	6503	SO:0001630	splice_region_variant	53353				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding	g.chr2:141135856C>G	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.10532-1G>C	2.37:g.141135856C>G		TSP Lung(27;0.18)	Somatic					p.K3511_splice	NM_018557	NP_061027	WXS	Illumina HiSeq	Unspecified	Q9NZR2	LRP1B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)	68	11504	-		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)						Q8WY29|Q8WY30|Q8WY31	Splice_Site	SNP	ENST00000389484.3	37	c.10532_splice	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.278018	0.80692	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	.	.	.	5.6	5.6	0.85130	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.604	0.95574	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	LRP1B	140852326	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	4.494000	0.60347	2.642000	0.89623	0.591000	0.81541	.		0.368	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	Intron	6	38	0	0	0	0.001168	0	6	38				
CYTIP	9595	broad.mit.edu	37	2	158272583	158272583	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr2:158272583C>A	ENST00000264192.3	-	8	807	c.686G>T	c.(685-687)gGg>gTg	p.G229V	CYTIP_ENST00000540637.1_Missense_Mutation_p.G123V	NM_004288.4	NP_004279.3	O60759	CYTIP_HUMAN	cytohesin 1 interacting protein	229					regulation of cell adhesion (GO:0030155)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|endosome (GO:0005768)|nucleus (GO:0005634)		p.G229V(1)		breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	15						TGGGCCTGGCCCAGGCAGGGG	0.517																																							uc002tzj.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|kidney(1)|skin(1)	3						c.(685-687)GGG>GTG		cytohesin 1 interacting protein							54.0	51.0	52.0					2																	158272583		2203	4300	6503	SO:0001583	missense	9595				regulation of cell adhesion	cell cortex|early endosome	protein binding	g.chr2:158272583C>A	L06633	CCDS2204.1	2q11.2	2011-09-08	2008-08-14	2008-08-19	ENSG00000115165	ENSG00000115165			9506	protein-coding gene	gene with protein product	"""cytohesin binding protein HE"", ""cytohesin binder and regulator"""	604448	"""pleckstrin homology, Sec7 and coiled-coil domains, binding protein"""	PSCDBP		18926288, 10343115, 11867758, 20530790, 21562043	Standard	NM_004288		Approved	B3-1, HE, CYBR, CASP, CYTHIP	uc002tzj.1	O60759	OTTHUMG00000154551	ENST00000264192.3:c.686G>T	2.37:g.158272583C>A	ENSP00000264192:p.Gly229Val		Somatic				CYTIP_uc010zcl.1_Missense_Mutation_p.G123V	p.G229V	NM_004288	NP_004279	WXS	Illumina HiSeq	Unspecified	O60759	CYTIP_HUMAN			8	758	-			229					B4DWH9|Q15630|Q8NE32	Missense_Mutation	SNP	ENST00000264192.3	37	c.686G>T	CCDS2204.1	.	.	.	.	.	.	.	.	.	.	C	14.70	2.613653	0.46631	.	.	ENSG00000115165	ENST00000264192;ENST00000540637;ENST00000418920	T;T;T	0.44083	2.19;0.93;1.45	5.71	3.9	0.45041	.	1.148670	0.06053	N	0.656995	T	0.43678	0.1258	L	0.56769	1.78	0.37610	D	0.920882	B	0.20887	0.049	B	0.19666	0.026	T	0.15378	-1.0439	10	0.40728	T	0.16	-8.1875	10.3327	0.43831	0.1422:0.5831:0.2747:0.0	.	229	O60759	CYTIP_HUMAN	V	229;123;123	ENSP00000264192:G229V;ENSP00000440801:G123V;ENSP00000394308:G123V	ENSP00000264192:G229V	G	-	2	0	CYTIP	157980829	0.000000	0.05858	0.486000	0.27416	0.148000	0.21650	-0.461000	0.06712	0.755000	0.32990	0.655000	0.94253	GGG		0.517	CYTIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254926.1	NM_004288		5	89	1	0	3.59834e-05	0.001168	5.19628e-05	5	89				
XIRP2	129446	broad.mit.edu	37	2	168102024	168102024	+	Silent	SNP	C	C	A	rs376927051		TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr2:168102024C>A	ENST00000409195.1	+	9	4211	c.4122C>A	c.(4120-4122)gtC>gtA	p.V1374V	XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000409273.1_Silent_p.V1152V|XIRP2_ENST00000295237.9_Silent_p.V1374V|XIRP2_ENST00000420519.1_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	1199					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)		p.V1374V(1)		NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						TTAAATCTGTCACACAAGAAG	0.358																																							uc002udx.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(7)|ovary(6)|pancreas(1)	14						c.(4120-4122)GTC>GTA		xin actin-binding repeat containing 2 isoform 1							67.0	63.0	64.0					2																	168102024		1840	4094	5934	SO:0001819	synonymous_variant	129446				actin cytoskeleton organization	cell junction	actin binding	g.chr2:168102024C>A	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.4122C>A	2.37:g.168102024C>A			Somatic				XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Silent_p.V1199V|XIRP2_uc010fpq.2_Silent_p.V1152V|XIRP2_uc010fpr.2_Intron|XIRP2_uc010fps.1_5'Flank	p.V1374V	NM_152381	NP_689594	WXS	Illumina HiSeq	Unspecified	A4UGR9	XIRP2_HUMAN			8	4140	+			1199					A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Silent	SNP	ENST00000409195.1	37	c.4122C>A	CCDS42769.1																																																																																				0.358	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381		9	112	1	0	0.000274275	0.004482	0.000355182	9	112				
ZNF804A	91752	broad.mit.edu	37	2	185803228	185803228	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr2:185803228G>T	ENST00000302277.6	+	4	3699	c.3105G>T	c.(3103-3105)ttG>ttT	p.L1035F		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	1035							metal ion binding (GO:0046872)	p.L1035F(1)		NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						AAGCATTATTGATCCCACTAG	0.413																																							uc002uph.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|skin(3)|large_intestine(1)|pancreas(1)	11						c.(3103-3105)TTG>TTT		zinc finger protein 804A							73.0	71.0	71.0					2																	185803228		2203	4300	6503	SO:0001583	missense	91752					intracellular	zinc ion binding	g.chr2:185803228G>T	AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.3105G>T	2.37:g.185803228G>T	ENSP00000303252:p.Leu1035Phe		Somatic					p.L1035F	NM_194250	NP_919226	WXS	Illumina HiSeq	Unspecified	Q7Z570	Z804A_HUMAN			4	3699	+			1035					A7E253|Q6ZN26	Missense_Mutation	SNP	ENST00000302277.6	37	c.3105G>T	CCDS2291.1	.	.	.	.	.	.	.	.	.	.	G	13.31	2.200027	0.38905	.	.	ENSG00000170396	ENST00000302277	T	0.08008	3.14	5.09	3.2	0.36748	.	0.000000	0.36200	N	0.002732	T	0.16938	0.0407	L	0.57536	1.79	0.26818	N	0.968867	D	0.69078	0.997	D	0.63597	0.916	T	0.09314	-1.0680	10	0.62326	D	0.03	-6.4336	3.3167	0.07035	0.3316:0.0:0.488:0.1804	.	1035	Q7Z570	Z804A_HUMAN	F	1035	ENSP00000303252:L1035F	ENSP00000303252:L1035F	L	+	3	2	ZNF804A	185511473	0.320000	0.24616	0.904000	0.35570	0.889000	0.51656	-0.032000	0.12266	0.461000	0.27071	0.467000	0.42956	TTG		0.413	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255871.1	NM_194250		9	147	1	0	6.40141e-05	0.000978	8.97834e-05	9	147				
COL5A2	1290	broad.mit.edu	37	2	189904125	189904125	+	Silent	SNP	T	T	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr2:189904125T>A	ENST00000374866.3	-	51	4072	c.3798A>T	c.(3796-3798)ccA>ccT	p.P1266P		NM_000393.3	NP_000384.2	P05997	CO5A2_HUMAN	collagen, type V, alpha 2	1266	Fibrillar collagen NC1. {ECO:0000255|PROSITE-ProRule:PRU00793}.				axon guidance (GO:0007411)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|negative regulation of endodermal cell differentiation (GO:1903225)|skeletal system development (GO:0001501)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)	p.P1266P(1)		NS(3)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(53)|ovary(3)|prostate(2)|skin(6)|urinary_tract(3)	95			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			CATGAACCCCTGGGTCCGTTT	0.512																																							uc002uqk.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(3796-3798)CCA>CCT		alpha 2 type V collagen preproprotein							103.0	91.0	95.0					2																	189904125		2203	4300	6503	SO:0001819	synonymous_variant	1290				axon guidance|collagen fibril organization|eye morphogenesis|skin development	collagen type V	extracellular matrix structural constituent	g.chr2:189904125T>A	Y14690	CCDS33350.1	2q14-q32	2014-09-17			ENSG00000204262	ENSG00000204262		"""Collagens"""	2210	protein-coding gene	gene with protein product	"""AB collagen"""	120190				1572660	Standard	NM_000393		Approved		uc002uqk.3	P05997	OTTHUMG00000149842	ENST00000374866.3:c.3798A>T	2.37:g.189904125T>A			Somatic				COL5A2_uc010frx.2_Silent_p.P842P	p.P1266P	NM_000393	NP_000384	WXS	Illumina HiSeq	Unspecified	P05997	CO5A2_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)		51	4073	-			1266			Fibrillar collagen NC1.		P78440|Q13908|Q53WR4|Q59GR4|Q6LDJ5|Q7KZ55|Q86XF6|Q96QB0|Q96QB3	Silent	SNP	ENST00000374866.3	37	c.3798A>T	CCDS33350.1																																																																																				0.512	COL5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313523.1	NM_000393		4	54	0	0	0	0.000248	0	4	54				
CD28	940	broad.mit.edu	37	2	204591409	204591409	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr2:204591409G>T	ENST00000324106.8	+	2	255	c.106G>T	c.(106-108)Gtc>Ttc	p.V36F	CD28_ENST00000374481.3_Missense_Mutation_p.V36F|CD28_ENST00000458610.2_Missense_Mutation_p.V50F|CD28_ENST00000374478.4_Intron	NM_001243077.1|NM_006139.3	NP_001230006.1|NP_006130.1	P10747	CD28_HUMAN	CD28 molecule	36	Ig-like V-type.				apoptotic signaling pathway (GO:0097190)|cell surface receptor signaling pathway (GO:0007166)|cytokine biosynthetic process (GO:0042089)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|negative thymic T cell selection (GO:0045060)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of inflammatory response to antigenic stimulus (GO:0002863)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of isotype switching to IgG isotypes (GO:0048304)|positive regulation of mitosis (GO:0045840)|positive regulation of signal transduction (GO:0009967)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of translation (GO:0045727)|positive regulation of viral genome replication (GO:0045070)|regulation of defense response to virus by virus (GO:0050690)|regulatory T cell differentiation (GO:0045066)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|immunological synapse (GO:0001772)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	coreceptor activity (GO:0015026)|identical protein binding (GO:0042802)|protease binding (GO:0002020)|SH3/SH2 adaptor activity (GO:0005070)	p.V36F(1)		endometrium(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	13						CGACAATGCGGTCAACCTTAG	0.433																																							uc002vah.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(106-108)GTC>TTC		CD28 antigen precursor							108.0	100.0	103.0					2																	204591409		2203	4300	6503	SO:0001583	missense	940				cell surface receptor linked signaling pathway|cytokine biosynthetic process|humoral immune response|positive regulation of anti-apoptosis|positive regulation of interleukin-2 biosynthetic process|positive regulation of mitosis|positive regulation of translation|positive regulation of viral genome replication|regulation of defense response to virus by virus|regulatory T cell differentiation|T cell costimulation|viral reproduction	cytosol|external side of plasma membrane|integral to plasma membrane	coreceptor activity|protease binding|SH3/SH2 adaptor activity	g.chr2:204591409G>T	J02988	CCDS2361.1, CCDS58749.1	2q33	2013-01-11	2006-03-28		ENSG00000178562	ENSG00000178562		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1653	protein-coding gene	gene with protein product	"""T-cell-specific surface glycoprotein"""	186760	"""CD28 antigen (Tp44)"""			1355979	Standard	NM_006139		Approved		uc002vah.4	P10747	OTTHUMG00000132878	ENST00000324106.8:c.106G>T	2.37:g.204591409G>T	ENSP00000324890:p.Val36Phe		Somatic				CD28_uc002vag.1_RNA|CD28_uc010zio.1_RNA|CD28_uc010ftx.2_Intron|CD28_uc002vaj.3_RNA	p.V36F	NM_006139	NP_006130	WXS	Illumina HiSeq	Unspecified	P10747	CD28_HUMAN			2	328	+			36			Extracellular (Potential).|Ig-like V-type.		A8KAC1|Q13964|Q52M23|Q70WG0|Q8NI54|Q8NI55|Q8NI56|Q8WXJ2|Q9BYV0	Missense_Mutation	SNP	ENST00000324106.8	37	c.106G>T	CCDS2361.1	.	.	.	.	.	.	.	.	.	.	G	15.99	2.996311	0.54147	.	.	ENSG00000178562	ENST00000374481;ENST00000458610;ENST00000324106	T;T;T	0.81163	-1.46;-0.79;-0.79	5.78	4.88	0.63580	Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	0.164006	0.40385	N	0.001113	D	0.89653	0.6777	M	0.80616	2.505	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.91027	0.4861	10	0.87932	D	0	-28.791	14.63	0.68650	0.0:0.1455:0.8545:0.0	.	36	P10747	CD28_HUMAN	F	36;50;36	ENSP00000363605:V36F;ENSP00000393648:V50F;ENSP00000324890:V36F	ENSP00000324890:V36F	V	+	1	0	CD28	204299654	1.000000	0.71417	0.864000	0.33941	0.310000	0.27922	6.069000	0.71209	1.408000	0.46895	0.561000	0.74099	GTC		0.433	CD28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256366.3	NM_006139		11	139	1	0	1.08611e-07	0.000978	1.85526e-07	11	139				
GPR1	2825	broad.mit.edu	37	2	207041255	207041255	+	Silent	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr2:207041255C>A	ENST00000407325.2	-	3	1079	c.717G>T	c.(715-717)ctG>ctT	p.L239L	GPR1_ENST00000437420.1_Silent_p.L239L	NM_001098199.1|NM_001261452.1|NM_001261453.1|NM_001261454.1|NM_001261455.1|NM_005279.3	NP_001091669.1|NP_001248381.1|NP_001248382.1|NP_001248383.1|NP_001248384.1|NP_005270.2	P46091	GPR1_HUMAN	G protein-coupled receptor 1	239					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)	p.L239L(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(7)|skin(1)	18		Lung NSC(271;7.93e-06)|Renal(323;0.000147)|Hepatocellular(293;0.000888)		UCEC - Uterine corpus endometrioid carcinoma (47;0.000241)|Epithelial(149;1.91e-37)|STAD - Stomach adenocarcinoma(1183;0.00178)|Lung(261;0.111)|LUSC - Lung squamous cell carcinoma(261;0.184)		TACTGGAGATCAGGATGCTTC	0.438																																							uc002vbl.3		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(715-717)CTG>CTT		G protein-coupled receptor 1							98.0	100.0	99.0					2																	207041255		2203	4300	6503	SO:0001819	synonymous_variant	2825					integral to plasma membrane	G-protein coupled receptor activity	g.chr2:207041255C>A		CCDS2368.1	2q33.3	2014-01-30			ENSG00000183671	ENSG00000183671		"""GPCR / Class A : Orphans"""	4463	protein-coding gene	gene with protein product		600239				7851889	Standard	NM_005279		Approved		uc031rqv.1	P46091	OTTHUMG00000132894	ENST00000407325.2:c.717G>T	2.37:g.207041255C>A			Somatic				GPR1_uc010fue.2_Silent_p.L239L|GPR1_uc010fuf.2_Silent_p.L239L	p.L239L	NM_005279	NP_005270	WXS	Illumina HiSeq	Unspecified	P46091	GPR1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (47;0.000241)|Epithelial(149;1.91e-37)|STAD - Stomach adenocarcinoma(1183;0.00178)|Lung(261;0.111)|LUSC - Lung squamous cell carcinoma(261;0.184)	3	1103	-		Lung NSC(271;7.93e-06)|Renal(323;0.000147)|Hepatocellular(293;0.000888)	239			Cytoplasmic (Potential).		A5JUU6|A8K4L1|Q53TR9|Q6NVX4	Silent	SNP	ENST00000407325.2	37	c.717G>T	CCDS2368.1																																																																																				0.438	GPR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256394.2	NM_001098199		7	77	1	0	0.00307968	0.00308	0.00362461	7	77				
DYTN	391475	broad.mit.edu	37	2	207564941	207564941	+	Splice_Site	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr2:207564941C>A	ENST00000452335.2	-	6	600		c.e6-1		Y_RNA_ENST00000384589.1_RNA|DYTN_ENST00000477734.1_Splice_Site	NM_001093730.1	NP_001087199.1	A2CJ06	DYTN_HUMAN	dystrotelin							plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)	p.?(2)		breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(24)|ovary(1)|upper_aerodigestive_tract(1)	36				LUSC - Lung squamous cell carcinoma(261;0.082)|Epithelial(149;0.129)|Lung(261;0.153)		AAGTTGGGATCTGCAAGAGAC	0.552																																							uc002vbr.1		NA																	2	Unknown(2)		lung(2)	ovary(1)|central_nervous_system(1)	2						c.e6-1		dystrotelin							93.0	94.0	93.0					2																	207564941		1959	4158	6117	SO:0001630	splice_region_variant	391475					plasma membrane	zinc ion binding	g.chr2:207564941C>A	ABF55377	CCDS46502.1	2q33.3	2007-01-22			ENSG00000232125	ENSG00000232125			23279	protein-coding gene	gene with protein product						17233888	Standard	NM_001093730		Approved		uc002vbr.1	A2CJ06	OTTHUMG00000154729	ENST00000452335.2:c.484-1G>T	2.37:g.207564941C>A			Somatic					p.I162_splice	NM_001093730	NP_001087199	WXS	Illumina HiSeq	Unspecified	A2CJ06	DYTN_HUMAN		LUSC - Lung squamous cell carcinoma(261;0.082)|Epithelial(149;0.129)|Lung(261;0.153)	6	601	-									Splice_Site	SNP	ENST00000452335.2	37	c.484_splice	CCDS46502.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.273873	0.80580	.	.	ENSG00000232125	ENST00000452335	.	.	.	6.04	6.04	0.98038	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.7597	0.91845	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DYTN	207273186	1.000000	0.71417	0.999000	0.59377	0.984000	0.73092	5.360000	0.66086	2.873000	0.98535	0.561000	0.74099	.		0.552	DYTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336799.1		Intron	7	90	1	0	2.0095e-06	0.001984	3.24327e-06	7	90				
MARCH4	57574	broad.mit.edu	37	2	217124066	217124066	+	Missense_Mutation	SNP	C	C	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr2:217124066C>T	ENST00000273067.4	-	4	2968	c.1202G>A	c.(1201-1203)cGa>cAa	p.R401Q	AC012513.6_ENST00000417481.1_RNA	NM_020814.2	NP_065865.1	Q9P2E8	MARH4_HUMAN	membrane-associated ring finger (C3HC4) 4, E3 ubiquitin protein ligase	401						Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|trans-Golgi network (GO:0005802)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R401Q(1)		breast(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)|skin(1)	20		Renal(323;0.0854)		Epithelial(149;2.19e-05)|all cancers(144;0.00121)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(261;0.0125)		GACCAGCTCTCGGCTGCTGCC	0.612																																							uc002vgb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1201-1203)CGA>CAA		membrane-associated ring finger (C3HC4) 4							79.0	79.0	79.0					2																	217124066		2203	4300	6503	SO:0001583	missense	57574					Golgi membrane|Golgi stack|integral to membrane|trans-Golgi network	ubiquitin-protein ligase activity|zinc ion binding	g.chr2:217124066C>T	AB037820	CCDS33376.1	2q35	2013-01-09	2012-02-23		ENSG00000144583	ENSG00000144583		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	29269	protein-coding gene	gene with protein product		608208	"""membrane-associated ring finger (C3HC4) 4"""			10718198, 14722266	Standard	NM_020814		Approved	KIAA1399, MARCH-IV, RNF174	uc002vgb.3	Q9P2E8	OTTHUMG00000154824	ENST00000273067.4:c.1202G>A	2.37:g.217124066C>T	ENSP00000273067:p.Arg401Gln		Somatic					p.R401Q	NM_020814	NP_065865	WXS	Illumina HiSeq	Unspecified	Q9P2E8	MARH4_HUMAN		Epithelial(149;2.19e-05)|all cancers(144;0.00121)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(261;0.0125)	4	2969	-		Renal(323;0.0854)	401					Q4KMN7|Q86WR8	Missense_Mutation	SNP	ENST00000273067.4	37	c.1202G>A	CCDS33376.1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.345748	0.82022	.	.	ENSG00000144583	ENST00000273067	T	0.20463	2.07	5.47	5.47	0.80525	.	0.200639	0.41500	D	0.000876	T	0.28366	0.0701	M	0.64997	1.995	0.58432	D	0.99999	P	0.51653	0.947	B	0.42555	0.391	T	0.06250	-1.0837	10	0.56958	D	0.05	-15.6821	18.3253	0.90251	0.0:1.0:0.0:0.0	.	401	Q9P2E8	MARH4_HUMAN	Q	401	ENSP00000273067:R401Q	ENSP00000273067:R401Q	R	-	2	0	MARCH4	216832311	1.000000	0.71417	0.997000	0.53966	0.902000	0.53008	5.999000	0.70665	2.567000	0.86603	0.561000	0.74099	CGA		0.612	MARCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337272.2	NM_020814		5	99	0	0	0	0.000602	0	5	99				
PRKAG3	53632	broad.mit.edu	37	2	219695055	219695055	+	Silent	SNP	G	G	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr2:219695055G>A	ENST00000529249.1	-	4	594	c.279C>T	c.(277-279)ttC>ttT	p.F93F	PRKAG3_ENST00000545803.1_5'UTR|PRKAG3_ENST00000392098.3_Silent_p.F93F|PRKAG3_ENST00000439262.2_Silent_p.F68F			Q9UGI9	AAKG3_HUMAN	protein kinase, AMP-activated, gamma 3 non-catalytic subunit	93					cell cycle arrest (GO:0007050)|fatty acid biosynthetic process (GO:0006633)|glucose transport (GO:0015758)|glycogen biosynthetic process (GO:0005978)|insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|membrane organization (GO:0061024)|protein phosphorylation (GO:0006468)	AMP-activated protein kinase complex (GO:0031588)|cytosol (GO:0005829)|extracellular space (GO:0005615)	AMP-activated protein kinase activity (GO:0004679)|ATP binding (GO:0005524)|protein kinase binding (GO:0019901)	p.F93F(1)		large_intestine(7)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	20		Renal(207;0.0474)		Epithelial(149;4.35e-07)|all cancers(144;8.96e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	Acetylsalicylic acid(DB00945)	TGGTCTTGGGGAATGTGGCCT	0.632																																							uc002vjb.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|lung(1)	2						c.(277-279)TTC>TTT		AMP-activated protein kinase, non-catalytic							30.0	35.0	33.0					2																	219695055		2203	4299	6502	SO:0001819	synonymous_variant	53632				cell cycle arrest|fatty acid biosynthetic process|insulin receptor signaling pathway|intracellular protein kinase cascade|regulation of fatty acid oxidation	cytosol	AMP-activated protein kinase activity|protein kinase binding	g.chr2:219695055G>A	AF214519	CCDS2424.1	2q35	2012-09-20			ENSG00000115592	ENSG00000115592			9387	protein-coding gene	gene with protein product		604976				10818001	Standard	NM_017431		Approved		uc002vjb.1	Q9UGI9	OTTHUMG00000133078	ENST00000529249.1:c.279C>T	2.37:g.219695055G>A			Somatic				PRKAG3_uc010zkn.1_RNA|PRKAG3_uc010fvy.1_Silent_p.F93F|PRKAG3_uc010zko.1_Silent_p.F89F	p.F93F	NM_017431	NP_059127	WXS	Illumina HiSeq	Unspecified	Q9UGI9	AAKG3_HUMAN		Epithelial(149;4.35e-07)|all cancers(144;8.96e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	4	298	-		Renal(207;0.0474)	93					Q4QQG8|Q4V779|Q9NRL1	Silent	SNP	ENST00000529249.1	37	c.279C>T	CCDS2424.1																																																																																				0.632	PRKAG3-006	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385992.1			5	42	0	0	0	0.00308	0	5	42				
SPHKAP	80309	broad.mit.edu	37	2	228882479	228882479	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr2:228882479C>A	ENST00000392056.3	-	7	3137	c.3091G>T	c.(3091-3093)Gtc>Ttc	p.V1031F	SPHKAP_ENST00000344657.5_Missense_Mutation_p.V1031F	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	1031						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)	p.V1031F(2)		NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		GAATCTGGGACATCTTCAAGG	0.507																																							uc002vpq.2		NA																	2	Substitution - Missense(2)		lung(2)	skin(5)|ovary(4)|lung(1)	10						c.(3091-3093)GTC>TTC		sphingosine kinase type 1-interacting protein							100.0	90.0	93.0					2																	228882479		2203	4300	6503	SO:0001583	missense	80309					cytoplasm	protein binding	g.chr2:228882479C>A		CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.3091G>T	2.37:g.228882479C>A	ENSP00000375909:p.Val1031Phe		Somatic				SPHKAP_uc002vpp.2_Missense_Mutation_p.V1031F|SPHKAP_uc010zlx.1_Missense_Mutation_p.V1031F	p.V1031F	NM_001142644	NP_001136116	WXS	Illumina HiSeq	Unspecified	Q2M3C7	SPKAP_HUMAN		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)	7	3138	-		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)	1031					Q68DA3|Q68DR8|Q9C0I5	Missense_Mutation	SNP	ENST00000392056.3	37	c.3091G>T	CCDS46537.1	.	.	.	.	.	.	.	.	.	.	C	15.46	2.839617	0.51057	.	.	ENSG00000153820	ENST00000392056;ENST00000344657	T;T	0.12984	2.63;2.63	6.08	-9.08	0.00720	.	0.934789	0.09229	N	0.830859	T	0.12305	0.0299	N	0.19112	0.55	0.09310	N	1	P;P;P	0.50272	0.71;0.744;0.933	B;B;P	0.48921	0.303;0.125;0.595	T	0.39333	-0.9619	10	0.72032	D	0.01	.	17.6311	0.88108	0.0:0.7075:0.0888:0.2037	.	62;1031;1031	B3KR30;Q2M3C7;Q2M3C7-2	.;SPKAP_HUMAN;.	F	1031	ENSP00000375909:V1031F;ENSP00000339886:V1031F	ENSP00000339886:V1031F	V	-	1	0	SPHKAP	228590723	0.000000	0.05858	0.088000	0.20740	0.798000	0.45092	-0.417000	0.07088	-1.845000	0.01176	0.655000	0.94253	GTC		0.507	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331750.1	NM_030623		13	187	1	0	1.05317e-09	0.00245	1.97582e-09	13	187				
SAG	6295	broad.mit.edu	37	2	234227423	234227423	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr2:234227423C>A	ENST00000409110.1	+	4	393	c.163C>A	c.(163-165)Ctt>Att	p.L55I	SAG_ENST00000449594.2_5'Flank	NM_000541.4	NP_000532.2	P10523	ARRS_HUMAN	S-antigen; retina and pineal gland (arrestin)	55					cell surface receptor signaling pathway (GO:0007166)|negative regulation of catalytic activity (GO:0043086)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	cytosol (GO:0005829)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	protein phosphatase inhibitor activity (GO:0004864)	p.L55I(2)		cervix(1)|kidney(2)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	9		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.018)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.054)		Epithelial(121;2.86e-17)|BRCA - Breast invasive adenocarcinoma(100;0.00037)|LUSC - Lung squamous cell carcinoma(224;0.00608)|Lung(119;0.00714)|GBM - Glioblastoma multiforme(43;0.207)		TGATCCTGATCTTGTGAAGGG	0.512																																							uc002vuh.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(163-165)CTT>ATT		S-arrestin							235.0	233.0	233.0					2																	234227423		2034	4170	6204	SO:0001583	missense	6295				rhodopsin mediated phototransduction|rhodopsin mediated signaling pathway		protein phosphatase inhibitor activity	g.chr2:234227423C>A		CCDS46545.1	2q37.1	2013-02-14			ENSG00000130561	ENSG00000130561			10521	protein-coding gene	gene with protein product	"""arrestin 1"""	181031				2249983	Standard	NM_000541		Approved	ARRESTIN, RP47	uc002vuh.2	P10523	OTTHUMG00000153213	ENST00000409110.1:c.163C>A	2.37:g.234227423C>A	ENSP00000386444:p.Leu55Ile		Somatic				SAG_uc002vug.2_RNA|SAG_uc010zmq.1_5'UTR	p.L55I	NM_000541	NP_000532	WXS	Illumina HiSeq	Unspecified	P10523	ARRS_HUMAN		Epithelial(121;2.86e-17)|BRCA - Breast invasive adenocarcinoma(100;0.00037)|LUSC - Lung squamous cell carcinoma(224;0.00608)|Lung(119;0.00714)|GBM - Glioblastoma multiforme(43;0.207)	4	551	+		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.018)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.054)	55					A0FDN6|Q53SV3|Q99858	Missense_Mutation	SNP	ENST00000409110.1	37	c.163C>A	CCDS46545.1	.	.	.	.	.	.	.	.	.	.	C	5.681	0.310232	0.10733	.	.	ENSG00000130561	ENST00000252857;ENST00000447536;ENST00000409110;ENST00000415974;ENST00000478615	T;T;T	0.65732	-0.17;-0.17;2.27	4.64	4.64	0.57946	Arrestin, N-terminal (1);Immunoglobulin E-set (1);Arrestin-like, N-terminal (1);	0.727471	0.12765	N	0.440994	T	0.55970	0.1954	L	0.43923	1.385	0.09310	N	0.999999	B	0.09022	0.002	B	0.15052	0.012	T	0.50947	-0.8767	10	0.62326	D	0.03	-18.6039	12.7458	0.57280	0.2038:0.7962:0.0:0.0	.	55	P10523	ARRS_HUMAN	I	55;55;55;55;60	ENSP00000408937:L55I;ENSP00000386444:L55I;ENSP00000409475:L55I	ENSP00000252857:L55I	L	+	1	0	SAG	233892162	0.198000	0.23374	0.078000	0.20375	0.090000	0.18270	0.714000	0.25808	2.574000	0.86865	0.563000	0.77884	CTT		0.512	SAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330126.1	NM_000541		14	158	1	0	2.31682e-05	0.003163	3.44775e-05	14	158				
UGT1A6	54578	broad.mit.edu	37	2	234652384	234652384	+	Intron	SNP	T	T	C			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr2:234652384T>C	ENST00000305139.6	+	2	1000				UGT1A4_ENST00000373409.3_Intron|UGT1A9_ENST00000354728.4_Intron|UGT1A1_ENST00000609637.1_Intron|UGT1A10_ENST00000344644.5_Intron|UGT1A10_ENST00000373445.1_Intron|DNAJB3_ENST00000449667.1_RNA|UGT1A1_ENST00000373450.4_Intron|UGT1A6_ENST00000373424.1_Intron|UGT1A3_ENST00000482026.1_Intron|UGT1A7_ENST00000373426.3_Intron|UGT1A6_ENST00000406651.1_Intron|UGT1A1_ENST00000609767.1_Intron|UGT1A6_ENST00000480628.1_Intron|UGT1A1_ENST00000608381.1_Intron|UGT1A5_ENST00000373414.3_Intron	NM_001072.3	NP_001063.2	P19224	UD16_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A6						cellular glucuronidation (GO:0052695)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|skin(1)|upper_aerodigestive_tract(1)	22		Breast(86;0.000765)|all_lung(227;0.00267)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0457)|Lung SC(224;0.128)		Epithelial(121;5.86e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000384)|Lung(119;0.00306)|LUSC - Lung squamous cell carcinoma(224;0.00702)	Acetaminophen(DB00316)|Deferiprone(DB08826)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Propofol(DB00818)|Valproic Acid(DB00313)	ATCGCGTTTCTTGGCGTCCGA	0.622																																							uc002vuz.2		NA																	0					0						c.(178-180)AAG>AGG		DnaJ (Hsp40) homolog, subfamily B, member 3							145.0	157.0	153.0					2																	234652384		2061	4219	6280	SO:0001627	intron_variant	414061				protein folding		heat shock protein binding|unfolded protein binding	g.chr2:234652384T>C	M84130	CCDS2507.1, CCDS2508.1	2q37	2010-03-05	2005-07-20		ENSG00000167165	ENSG00000167165		"""UDP glucuronosyltransferases"""	12538	other	complex locus constituent		606431	"""UDP glycosyltransferase 1 family, polypeptide A6"""			9295054, 1339448	Standard	NM_001072		Approved	HLUGP, GNT1, UGT1F		P19224	OTTHUMG00000059122	ENST00000305139.6:c.862-23296T>C	2.37:g.234652384T>C			Somatic				UGT1A8_uc010zmv.1_Intron|UGT1A8_uc002vup.2_Intron|UGT1A10_uc002vuq.3_Intron|UGT1A10_uc002vur.2_Intron|UGT1A9_uc010zmw.1_Intron|UGT1A9_uc002vus.2_Intron|UGT1A7_uc010zmx.1_Intron|UGT1A7_uc002vut.2_Intron|UGT1A6_uc002vuu.2_Intron|UGT1A6_uc010zmy.1_Intron|UGT1A6_uc002vuv.3_Intron|UGT1A5_uc010zmz.1_Intron|UGT1A5_uc002vuw.2_Intron|UGT1A4_uc010zna.1_Intron|UGT1A4_uc002vux.2_Intron|UGT1A3_uc010znb.1_Intron|UGT1A3_uc002vuy.2_Intron	p.K60R	NM_001001394	NP_001001394	WXS	Illumina HiSeq	Unspecified	Q8WWF6	DNJB3_HUMAN			1	278	-			60			J.		A6NKK6|B8K289|Q96TE7	Missense_Mutation	SNP	ENST00000305139.6	37	c.179A>G	CCDS2507.1																																																																																				0.622	UGT1A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130988.1	NM_205862		11	167	0	0	0	0.001368	0	11	167				
HDAC4	9759	broad.mit.edu	37	2	239976512	239976512	+	Missense_Mutation	SNP	T	T	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr2:239976512T>A	ENST00000345617.3	-	25	3797	c.3006A>T	c.(3004-3006)gaA>gaT	p.E1002D	HDAC4_ENST00000543185.1_Missense_Mutation_p.E586D	NM_006037.3	NP_006028.2	P56524	HDAC4_HUMAN	histone deacetylase 4	1002	Histone deacetylase.				B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cardiac muscle hypertrophy in response to stress (GO:0014898)|chromatin remodeling (GO:0006338)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glycolytic process (GO:0045820)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|osteoblast development (GO:0002076)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein sumoylation (GO:0033235)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of gene expression, epigenetic (GO:0040029)|regulation of protein binding (GO:0043393)|regulation of skeletal muscle fiber development (GO:0048742)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|response to drug (GO:0042493)|response to interleukin-1 (GO:0070555)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	A band (GO:0031672)|actomyosin (GO:0042641)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone deacetylase complex (GO:0000118)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)|Z disc (GO:0030018)	activating transcription factor binding (GO:0033613)|core promoter binding (GO:0001047)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|potassium ion binding (GO:0030955)|protein deacetylase activity (GO:0033558)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.E1002D(1)		NS(1)|biliary_tract(1)|breast(4)|endometrium(5)|kidney(2)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(5)	62		all_epithelial(40;1.45e-17)|Breast(86;1.53e-05)|Renal(207;0.000355)|all_lung(227;0.0121)|Ovarian(221;0.0183)|Lung NSC(271;0.0413)|Melanoma(123;0.0749)|all_hematologic(139;0.159)		Epithelial(121;6.38e-25)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-12)|Kidney(56;6.04e-08)|KIRC - Kidney renal clear cell carcinoma(57;1.18e-06)|BRCA - Breast invasive adenocarcinoma(100;3.99e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.04)		GTAAAACCTTTTCTGGGAGAG	0.473																																							uc002vyk.3		NA																	1	Substitution - Missense(1)		lung(1)	breast(3)|skin(2)|ovary(1)	6						c.(3004-3006)GAA>GAT		histone deacetylase 4							121.0	114.0	116.0					2																	239976512		2203	4300	6503	SO:0001583	missense	9759				B cell differentiation|cardiac muscle hypertrophy in response to stress|chromatin remodeling|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of glycolysis|negative regulation of myotube differentiation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|nervous system development|peptidyl-lysine deacetylation|positive regulation of cell proliferation|positive regulation of protein sumoylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of protein binding|response to denervation involved in regulation of muscle adaptation|response to interleukin-1|transcription, DNA-dependent	histone deacetylase complex|transcriptional repressor complex	activating transcription factor binding|histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|potassium ion binding|repressing transcription factor binding|zinc ion binding	g.chr2:239976512T>A	AB006626	CCDS2529.1	2q37.3	2014-02-12			ENSG00000068024	ENSG00000068024			14063	protein-coding gene	gene with protein product		605314	"""brachydactyly-mental retardation syndrome"""	BDMR		10206986, 10220385, 20691407	Standard	NM_006037		Approved	KIAA0288, HDAC-A, HDACA, HD4, HA6116, HDAC-4	uc002vyk.4	P56524	OTTHUMG00000133344	ENST00000345617.3:c.3006A>T	2.37:g.239976512T>A	ENSP00000264606:p.Glu1002Asp		Somatic				HDAC4_uc010fyy.2_Missense_Mutation_p.E959D	p.E1002D	NM_006037	NP_006028	WXS	Illumina HiSeq	Unspecified	P56524	HDAC4_HUMAN		Epithelial(121;6.38e-25)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-12)|Kidney(56;6.04e-08)|KIRC - Kidney renal clear cell carcinoma(57;1.18e-06)|BRCA - Breast invasive adenocarcinoma(100;3.99e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.04)	25	3798	-		all_epithelial(40;1.45e-17)|Breast(86;1.53e-05)|Renal(207;0.000355)|all_lung(227;0.0121)|Ovarian(221;0.0183)|Lung NSC(271;0.0413)|Melanoma(123;0.0749)|all_hematologic(139;0.159)	1002			Histone deacetylase.		Q9UND6	Missense_Mutation	SNP	ENST00000345617.3	37	c.3006A>T	CCDS2529.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	8.043|8.043	0.764335|0.764335	0.15914|0.15914	.|.	.|.	ENSG00000068024|ENSG00000068024	ENST00000345617;ENST00000456922;ENST00000543185|ENST00000430200	T;T|.	0.42900|.	0.96;0.96|.	4.34|4.34	-5.56|-5.56	0.02529|0.02529	Histone deacetylase domain (1);Arb2 domain (1);|.	0.211633|.	0.48286|.	N|.	0.000192|.	T|T	0.50326|0.50326	0.1609|0.1609	L|L	0.52364|0.52364	1.645|1.645	0.43292|0.43292	D|D	0.995279|0.995279	B;B|.	0.02656|.	0.0;0.0|.	B;B|.	0.10450|.	0.002;0.005|.	T|T	0.51795|0.51795	-0.8660|-0.8660	10|5	0.36615|.	T|.	0.2|.	.|.	6.723|6.723	0.23340|0.23340	0.0:0.3697:0.2279:0.4024|0.0:0.3697:0.2279:0.4024	.|.	970;1002|.	Q53SM2;P56524|.	.;HDAC4_HUMAN|.	D|I	1002;890;586|93	ENSP00000264606:E1002D;ENSP00000440481:E586D|.	ENSP00000264606:E1002D|.	E|K	-|-	3|2	2|0	HDAC4|HDAC4	239641449|239641449	0.296000|0.296000	0.24398|0.24398	0.481000|0.481000	0.27354|0.27354	0.054000|0.054000	0.15201|0.15201	-0.684000|-0.684000	0.05173|0.05173	-1.117000|-1.117000	0.02965|0.02965	-0.313000|-0.313000	0.08912|0.08912	GAA|AAA		0.473	HDAC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257174.2	NM_006037		12	130	0	0	0	0.001855	0	12	130				
KIF16B	55614	broad.mit.edu	37	20	16355030	16355030	+	Silent	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr20:16355030C>A	ENST00000354981.2	-	20	3379	c.3222G>T	c.(3220-3222)ctG>ctT	p.L1074L	KIF16B_ENST00000408042.1_Silent_p.L1074L|KIF16B_ENST00000378003.2_Silent_p.L300L|KIF16B_ENST00000355755.3_Silent_p.L1074L	NM_001199865.1|NM_024704.4	NP_001186794.1|NP_078980.3	Q96L93	KI16B_HUMAN	kinesin family member 16B	1074					ATP catabolic process (GO:0006200)|early endosome to late endosome transport (GO:0045022)|endoderm development (GO:0007492)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|formation of primary germ layer (GO:0001704)|Golgi to endosome transport (GO:0006895)|microtubule-based movement (GO:0007018)|receptor catabolic process (GO:0032801)|regulation of receptor recycling (GO:0001919)	early endosome (GO:0005769)|endosome (GO:0005768)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|plus-end-directed microtubule motor activity (GO:0008574)	p.L1074L(2)		NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(24)|ovary(1)|prostate(15)|skin(3)|upper_aerodigestive_tract(2)	74						TCTTCTGTTTCAGCTGCTGGA	0.418																																							uc002wpg.1		NA																	2	Substitution - coding silent(2)		lung(2)	skin(2)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|ovary(1)|kidney(1)	8						c.(3220-3222)CTG>CTT		kinesin-like motor protein C20orf23							124.0	106.0	112.0					20																	16355030		2203	4300	6503	SO:0001819	synonymous_variant	55614				cell communication|early endosome to late endosome transport|endoderm development|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|formation of primary germ layer|Golgi to endosome transport|microtubule-based movement|receptor catabolic process|regulation of receptor recycling	early endosome membrane|microtubule	ATP binding|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding|plus-end-directed microtubule motor activity	g.chr20:16355030C>A	AK000142	CCDS13122.1, CCDS56178.1	20p11.23	2008-03-03	2008-03-03	2008-03-03	ENSG00000089177	ENSG00000089177		"""Kinesins"""	15869	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 23"""	C20orf23		16084724, 16782399	Standard	NM_024704		Approved	FLJ20135, dJ971B4.1, SNX23	uc010gci.2	Q96L93	OTTHUMG00000031927	ENST00000354981.2:c.3222G>T	20.37:g.16355030C>A			Somatic				KIF16B_uc002wpe.1_Silent_p.L456L|KIF16B_uc002wpf.1_Silent_p.L456L|KIF16B_uc010gch.1_Intron|KIF16B_uc010gci.1_Silent_p.L1074L	p.L1074L	NM_024704	NP_078980	WXS	Illumina HiSeq	Unspecified	Q96L93	KI16B_HUMAN			20	3380	-			1074			Potential.		A6NKJ9|A7E2A8|B1AKG3|B1AKT7|C9JDN5|C9JI52|C9JSM8|C9JWJ7|Q2TBF5|Q5HYC0|Q5HYK1|Q5JWW3|Q5TFK5|Q86VL9|Q86YS5|Q8IYU0|Q9BQJ8|Q9BQM0|Q9BQM1|Q9BQM5|Q9H5U0|Q9HCI2|Q9NXN9	Silent	SNP	ENST00000354981.2	37	c.3222G>T	CCDS13122.1																																																																																				0.418	KIF16B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078104.2	NM_017683		8	149	1	0	0.00448238	0.004482	0.00523342	8	149				
EMILIN3	90187	broad.mit.edu	37	20	39992319	39992319	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr20:39992319G>T	ENST00000332312.3	-	3	665	c.473C>A	c.(472-474)cCc>cAc	p.P158H		NM_052846.1	NP_443078.1	Q9NT22	EMIL3_HUMAN	elastin microfibril interfacer 3	158						cytoplasm (GO:0005737)|proteinaceous extracellular matrix (GO:0005578)		p.P158H(1)		biliary_tract(1)|endometrium(2)|kidney(1)|large_intestine(2)|liver(1)|lung(15)|ovary(1)|prostate(2)|skin(3)|urinary_tract(2)	30		Myeloproliferative disorder(115;0.00425)				AGGGGGCCTGGGGCCTGGGTC	0.647																																							uc002xjy.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(472-474)CCC>CAC		elastin microfibril interfacer 3							38.0	41.0	40.0					20																	39992319		2203	4300	6503	SO:0001583	missense	90187					proteinaceous extracellular matrix		g.chr20:39992319G>T	AL031667	CCDS13316.1	20q12	2005-11-06	2004-03-02	2004-03-02	ENSG00000183798	ENSG00000183798		"""EMI domain containing"""	16123	protein-coding gene	gene with protein product	"""chromosome 20 open reading frame 130"""	608929	"""elastin microfibril interfacer 5"""	C20orf130, EMILIN5		12221002	Standard	NM_052846		Approved	dJ620E11.4	uc002xjy.1	Q9NT22	OTTHUMG00000046304	ENST00000332312.3:c.473C>A	20.37:g.39992319G>T	ENSP00000332806:p.Pro158His		Somatic					p.P158H	NM_052846	NP_443078	WXS	Illumina HiSeq	Unspecified	Q9NT22	EMIL3_HUMAN			3	697	-		Myeloproliferative disorder(115;0.00425)	158					Q495S5|Q495S6|Q495S7|Q76KT4	Missense_Mutation	SNP	ENST00000332312.3	37	c.473C>A	CCDS13316.1	.	.	.	.	.	.	.	.	.	.	G	11.55	1.672396	0.29693	.	.	ENSG00000183798	ENST00000332312	T	0.15834	2.39	4.91	2.98	0.34508	.	0.503086	0.20571	N	0.089728	T	0.28267	0.0698	L	0.46741	1.465	0.26648	N	0.972156	D	0.89917	1.0	D	0.73380	0.98	T	0.03555	-1.1025	9	.	.	.	-8.3287	6.2685	0.20941	0.1533:0.0:0.6985:0.1481	.	158	Q9NT22	EMIL3_HUMAN	H	158	ENSP00000332806:P158H	.	P	-	2	0	EMILIN3	39425733	0.989000	0.36119	0.131000	0.22000	0.120000	0.20174	2.525000	0.45598	0.697000	0.31718	-0.403000	0.06358	CCC		0.647	EMILIN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106876.2	XM_029741		4	64	1	0	0.000602214	0.000602	0.000753197	4	64				
PTPRT	11122	broad.mit.edu	37	20	40748573	40748573	+	Splice_Site	SNP	A	A	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr20:40748573A>T	ENST00000373187.1	-	20	2884		c.e20+1		PTPRT_ENST00000373198.4_Splice_Site|PTPRT_ENST00000356100.2_Splice_Site|PTPRT_ENST00000373193.3_Splice_Site|PTPRT_ENST00000373184.1_Splice_Site|PTPRT_ENST00000373201.1_Splice_Site|PTPRT_ENST00000373190.1_Splice_Site			O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T						cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|protein tyrosine phosphatase activity (GO:0004725)	p.?(1)		NS(2)|breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(12)|large_intestine(26)|liver(1)|lung(63)|ovary(8)|pancreas(2)|prostate(5)|skin(35)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	176		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				GAGGGCACTTACCTTGAGTCG	0.512																																							uc002xkg.2		NA																	1	Unknown(1)		lung(1)	skin(8)|ovary(7)|lung(5)	20						c.e20+1		protein tyrosine phosphatase, receptor type, T							134.0	133.0	134.0					20																	40748573		1913	4133	6046	SO:0001630	splice_region_variant	11122				homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity	g.chr20:40748573A>T	AF043644	CCDS42874.1, CCDS68127.1	20q12-q13	2013-02-11			ENSG00000196090	ENSG00000196090		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9682	protein-coding gene	gene with protein product		608712				9486824, 9602027	Standard	NM_133170		Approved	RPTPrho, KIAA0283	uc010ggj.3	O14522	OTTHUMG00000033040	ENST00000373187.1:c.2884+1T>A	20.37:g.40748573A>T			Somatic				PTPRT_uc010ggj.2_Splice_Site_p.G981_splice|PTPRT_uc010ggi.2_Splice_Site_p.G165_splice	p.G962_splice	NM_007050	NP_008981	WXS	Illumina HiSeq	Unspecified	O14522	PTPRT_HUMAN			20	3068	-		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)						A8E4R6|O43655|O75664|Q5W0X9|Q5W0Y1|Q9BR24|Q9BR28|Q9H0Y8|Q9NTL1|Q9NU72|Q9UBD2|Q9UJL7	Splice_Site	SNP	ENST00000373187.1	37	c.2884_splice	CCDS42874.1	.	.	.	.	.	.	.	.	.	.	A	24.8	4.572525	0.86542	.	.	ENSG00000196090	ENST00000373190;ENST00000373187;ENST00000373193;ENST00000356100;ENST00000373198;ENST00000373184;ENST00000373201	.	.	.	5.6	5.6	0.85130	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.4825	0.44702	0.9182:0.0:0.0818:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PTPRT	40181987	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.358000	0.59442	2.126000	0.65437	0.533000	0.62120	.		0.512	PTPRT-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000080315.1		Intron	14	172	0	0	0	0.003163	0	14	172				
MYBL2	4605	broad.mit.edu	37	20	42331360	42331361	+	Missense_Mutation	DNP	CA	CA	TT			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	CA	CA	-	-	CA	CA	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr20:42331360_42331361CA>TT	ENST00000217026.4	+	8	1309_1310	c.1182_1183CA>TT	c.(1180-1185)ccCAgc>ccTTgc	p.S395C	MYBL2_ENST00000396863.4_Missense_Mutation_p.S371C	NM_002466.2	NP_002457.1	P10244	MYBB_HUMAN	v-myb avian myeloblastosis viral oncogene homolog-like 2	395					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle (GO:0051726)|spindle assembly involved in mitosis (GO:0090307)	Myb complex (GO:0031523)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S395C(1)		endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(7)|liver(2)|lung(18)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	46		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			CCATCTCCCCCAGCACTGAAGT	0.649																																							uc002xlb.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(3)|kidney(2)	5						c.(1180-1185)CCCAGC>CCTTGC		MYB-related protein B																																				SO:0001583	missense	4605					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr20:42331360_42331361CA>TT		CCDS13322.1, CCDS63276.1	20q13.1	2013-07-09	2013-07-09		ENSG00000101057	ENSG00000101057			7548	protein-coding gene	gene with protein product		601415				8812502	Standard	NM_002466		Approved	BMYB, B-MYB	uc002xlb.1	P10244	OTTHUMG00000033062	Exception_encountered	20.37:g.42331360_42331361delinsTT	ENSP00000217026:p.Ser395Cys		Somatic				MYBL2_uc010zwj.1_Missense_Mutation_p.S371C|MYBL2_uc002xla.1_Missense_Mutation_p.S395C	p.S395C	NM_002466	NP_002457	WXS	Illumina HiSeq	Unspecified	P10244	MYBB_HUMAN	COAD - Colon adenocarcinoma(18;0.0031)		8	1397_1398	+		Myeloproliferative disorder(115;0.00452)	395					B2RBS5|B7Z8D9|F8W6N6|Q53F07	Missense_Mutation	DNP	ENST00000217026.4	37	c.1182_1183CA>TT	CCDS13322.1																																																																																				0.649	MYBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080408.1	NM_002466		6	62	0	0	0	0.004672	0	6	62				
BMP7	655	broad.mit.edu	37	20	55803312	55803312	+	Missense_Mutation	SNP	T	T	C			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr20:55803312T>C	ENST00000395863.3	-	2	1089	c.584A>G	c.(583-585)tAt>tGt	p.Y195C	BMP7_ENST00000395864.3_Missense_Mutation_p.Y195C|BMP7_ENST00000450594.2_Missense_Mutation_p.Y195C	NM_001719.2	NP_001710.1	P18075	BMP7_HUMAN	bone morphogenetic protein 7	195					axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|branching involved in salivary gland morphogenesis (GO:0060445)|branching morphogenesis of an epithelial tube (GO:0048754)|cartilage development (GO:0051216)|cellular response to hypoxia (GO:0071456)|dendrite development (GO:0016358)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic limb morphogenesis (GO:0030326)|embryonic pattern specification (GO:0009880)|embryonic skeletal joint morphogenesis (GO:0060272)|epithelial cell differentiation (GO:0030855)|epithelial to mesenchymal transition (GO:0001837)|extracellular matrix organization (GO:0030198)|growth (GO:0040007)|mesenchymal cell differentiation (GO:0048762)|mesenchyme development (GO:0060485)|mesoderm formation (GO:0001707)|mesonephros development (GO:0001823)|metanephric mesenchymal cell proliferation involved in metanephros development (GO:0072136)|metanephric mesenchyme morphogenesis (GO:0072133)|metanephros development (GO:0001656)|monocyte aggregation (GO:0070487)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell death (GO:0060548)|negative regulation of glomerular mesangial cell proliferation (GO:0072125)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of mesenchymal cell apoptotic process involved in nephron morphogenesis (GO:0072040)|negative regulation of mitosis (GO:0045839)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of phosphorylation (GO:0042326)|negative regulation of prostatic bud formation (GO:0060686)|negative regulation of striated muscle cell apoptotic process (GO:0010664)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neuron projection morphogenesis (GO:0048812)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone mineralization (GO:0030501)|positive regulation of dendrite development (GO:1900006)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of hyaluranon cable assembly (GO:1900106)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to nucleus (GO:0034504)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of pathway-restricted SMAD protein phosphorylation (GO:0060393)|regulation of removal of superoxide radicals (GO:2000121)|response to estradiol (GO:0032355)|response to peptide hormone (GO:0043434)|response to vitamin D (GO:0033280)|skeletal system development (GO:0001501)|SMAD protein signal transduction (GO:0060395)|steroid hormone mediated signaling pathway (GO:0043401)|ureteric bud development (GO:0001657)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane-bounded vesicle (GO:0031988)	heparin binding (GO:0008201)	p.Y195C(1)		endometrium(4)|kidney(1)|large_intestine(7)|lung(6)|prostate(1)|skin(1)	20	all_lung(29;0.0133)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(4;2.49e-13)|Epithelial(14;1.74e-08)|all cancers(14;2.05e-07)			GAGCACCTGATAAACGCTGAT	0.572																																							uc010gip.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(583-585)TAT>TGT		bone morphogenetic protein 7 precursor							127.0	128.0	127.0					20																	55803312		2203	4300	6503	SO:0001583	missense	655				BMP signaling pathway|cartilage development|cellular response to hypoxia|epithelial to mesenchymal transition|growth|mesonephros development|negative regulation of glomerular mesangial cell proliferation|negative regulation of MAP kinase activity|negative regulation of mitosis|negative regulation of neuron differentiation|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|negative regulation of phosphorylation|negative regulation of striated muscle cell apoptosis|negative regulation of transcription, DNA-dependent|ossification|pathway-restricted SMAD protein phosphorylation|positive regulation of bone mineralization|positive regulation of osteoblast differentiation|positive regulation of pathway-restricted SMAD protein phosphorylation|protein localization to nucleus|regulation of removal of superoxide radicals|SMAD protein signal transduction|steroid hormone mediated signaling pathway|ureteric bud development	extracellular space	cytokine activity|growth factor activity	g.chr20:55803312T>C		CCDS13455.1	20q13	2014-01-30	2008-05-22		ENSG00000101144	ENSG00000101144		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1074	protein-coding gene	gene with protein product	"""osteogenic protein 1"""	112267				1427904	Standard	NM_001719		Approved	OP-1	uc010gip.1	P18075	OTTHUMG00000032812	ENST00000395863.3:c.584A>G	20.37:g.55803312T>C	ENSP00000379204:p.Tyr195Cys		Somatic				BMP7_uc010giq.1_Missense_Mutation_p.Y195C|BMP7_uc002xyc.2_Missense_Mutation_p.Y195C	p.Y195C	NM_001719	NP_001710	WXS	Illumina HiSeq	Unspecified	P18075	BMP7_HUMAN	BRCA - Breast invasive adenocarcinoma(4;2.49e-13)|Epithelial(14;1.74e-08)|all cancers(14;2.05e-07)		2	1113	-	all_lung(29;0.0133)|Melanoma(10;0.242)		195					Q9H512|Q9NTQ7	Missense_Mutation	SNP	ENST00000395863.3	37	c.584A>G	CCDS13455.1	.	.	.	.	.	.	.	.	.	.	T	21.3	4.132144	0.77662	.	.	ENSG00000101144	ENST00000395863;ENST00000395864;ENST00000450594	T;T;T	0.75260	-0.92;-0.92;-0.92	5.63	5.63	0.86233	Transforming growth factor-beta, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.89037	0.6601	M	0.90977	3.165	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.979;0.998;0.998	D	0.91493	0.5213	10	0.87932	D	0	.	15.8419	0.78852	0.0:0.0:0.0:1.0	.	195;195;195	B1AKZ9;P18075;B1AL00	.;BMP7_HUMAN;.	C	195	ENSP00000379204:Y195C;ENSP00000379205:Y195C;ENSP00000398687:Y195C	ENSP00000379204:Y195C	Y	-	2	0	BMP7	55236719	1.000000	0.71417	0.992000	0.48379	0.967000	0.64934	5.725000	0.68507	2.137000	0.66172	0.533000	0.62120	TAT		0.572	BMP7-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000079831.2			9	239	0	0	0	0.008291	0	9	239				
STX16	8675	broad.mit.edu	37	20	57245566	57245566	+	Splice_Site	SNP	A	A	C			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr20:57245566A>C	ENST00000371141.4	+	6	1280		c.e6-1		STX16_ENST00000361830.3_Splice_Site|STX16_ENST00000358029.4_Splice_Site|STX16-NPEPL1_ENST00000530122.1_Splice_Site|STX16_ENST00000371132.4_Splice_Site|STX16_ENST00000355957.5_Splice_Site|STX16_ENST00000496003.1_Splice_Site|STX16_ENST00000361770.5_Splice_Site|STX16_ENST00000359617.4_Splice_Site	NM_001001433.2	NP_001001433.1	O14662	STX16_HUMAN	syntaxin 16						intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|SNARE complex (GO:0031201)	SNAP receptor activity (GO:0005484)	p.?(1)		breast(1)|cervix(1)|large_intestine(3)|lung(9)|ovary(1)|pancreas(1)|urinary_tract(1)	17	all_lung(29;0.0175)		BRCA - Breast invasive adenocarcinoma(13;3.73e-09)|Epithelial(14;8.54e-06)|all cancers(14;6.89e-05)			TATCTGTGATAGGCATGAAGA	0.388																																							uc002xzi.2		NA																	1	Unknown(1)		lung(1)	ovary(1)	1						c.e6-2		syntaxin 16 isoform a							133.0	117.0	122.0					20																	57245566		2203	4300	6503	SO:0001630	splice_region_variant	8675				intra-Golgi vesicle-mediated transport|intracellular protein transport|retrograde transport, endosome to Golgi	Golgi membrane|integral to membrane|microsome|SNARE complex	SNAP receptor activity	g.chr20:57245566A>C	AF038897	CCDS13468.1, CCDS13469.1, CCDS46619.1, CCDS46620.1, CCDS56199.1	20q13.32	2008-07-02			ENSG00000124222	ENSG00000124222			11431	protein-coding gene	gene with protein product		603666				9464276, 9587053, 15800843	Standard	NM_003763		Approved	hsyn16, SYN16	uc002xzi.3	O14662	OTTHUMG00000033084	ENST00000371141.4:c.557-1A>C	20.37:g.57245566A>C			Somatic				STX16_uc010zzq.1_Splice_Site|STX16_uc002xzk.2_Splice_Site_p.R169_splice|STX16_uc002xzm.2_Splice_Site_p.R182_splice|STX16_uc002xzj.2_Splice_Site_p.R165_splice|STX16_uc002xzl.2_Splice_Site	p.R186_splice	NM_001001433	NP_001001433	WXS	Illumina HiSeq	Unspecified	O14662	STX16_HUMAN	BRCA - Breast invasive adenocarcinoma(13;3.73e-09)|Epithelial(14;8.54e-06)|all cancers(14;6.89e-05)		6	1292	+	all_lung(29;0.0175)							A6NK32|A6NN69|A8MPP0|B7ZBN1|B7ZBN2|B7ZBN3|E1P5M0|E1P607|O14661|O14663|O60517|Q5W084|Q5W086|Q5W087|Q5XKI6|Q6GMS8|Q9H0Z0|Q9H1T7|Q9H1T8|Q9UIX5	Splice_Site	SNP	ENST00000371141.4	37	c.557_splice	CCDS13468.1	.	.	.	.	.	.	.	.	.	.	A	17.14	3.313468	0.60414	.	.	ENSG00000124222	ENST00000355957;ENST00000361770;ENST00000312283;ENST00000359617;ENST00000371141;ENST00000371138;ENST00000371132;ENST00000358029;ENST00000361830;ENST00000438253	.	.	.	6.07	6.07	0.98685	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.81	0.78552	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	STX16	56678972	1.000000	0.71417	0.986000	0.45419	0.580000	0.36256	8.555000	0.90693	2.326000	0.78906	0.533000	0.62120	.		0.388	STX16-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080517.2	NM_001001433	Intron	3	82	0	0	0	0.004672	0	3	82				
LIPI	149998	broad.mit.edu	37	21	15537620	15537620	+	Nonsense_Mutation	SNP	A	A	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr21:15537620A>T	ENST00000536861.1	-	6	824	c.825T>A	c.(823-825)tgT>tgA	p.C275*	LIPI_ENST00000344577.2_Nonsense_Mutation_p.C296*			Q6XZB0	LIPI_HUMAN	lipase, member I	275					lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|phospholipase activity (GO:0004620)	p.C296*(1)		endometrium(1)|kidney(13)|large_intestine(9)|liver(3)|lung(24)|ovary(3)|urinary_tract(1)	54				Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.0015)|Colorectal(24;0.00693)|Lung(58;0.166)		TGTATGAACGACAAGGAAATG	0.358																																							uc002yjm.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(2)	2						c.(886-888)TGT>TGA		lipase, member I							90.0	89.0	90.0					21																	15537620		2203	4298	6501	SO:0001587	stop_gained	149998				lipid catabolic process	extracellular region|extracellular space|membrane|plasma membrane	heparin binding|phospholipase activity	g.chr21:15537620A>T	BC028732	CCDS13564.1	21q11.2	2012-07-31			ENSG00000188992	ENSG00000188992			18821	protein-coding gene	gene with protein product	"""membrane-associated phospholipase A1 beta"", ""cancer/testis antigen 17"""	609252				12719377	Standard	XM_005260924		Approved	PRED5, LPDL, CT17, mPA-PLA1beta, PLA1C	uc002yjm.3	Q6XZB0	OTTHUMG00000074258	ENST00000536861.1:c.825T>A	21.37:g.15537620A>T	ENSP00000440381:p.Cys275*		Somatic				LIPI_uc010gkw.1_Nonsense_Mutation_p.C199*	p.C296*	NM_198996	NP_945347	WXS	Illumina HiSeq	Unspecified	Q6XZB0	LIPI_HUMAN		Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.0015)|Colorectal(24;0.00693)|Lung(58;0.166)	6	898	-			275					G1JSG3|G1JSG4|G1JSG5|G1JSG6|G1JSG7|G1JSG8|G1JSG9	Nonsense_Mutation	SNP	ENST00000536861.1	37	c.888T>A		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	23.0|23.0	4.364593|4.364593	0.82463|0.82463	.|.	.|.	ENSG00000188992|ENSG00000188992	ENST00000344577;ENST00000536861;ENST00000382981|ENST00000400211	.|.	.|.	.|.	5.73|5.73	4.44|4.44	0.53790|0.53790	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|T	.|0.45054	.|0.1323	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.55068	.|-0.8198	.|3	0.02654|.	T|.	1|.	.|.	7.858|7.858	0.29493|0.29493	0.875:0.0:0.125:0.0|0.875:0.0:0.125:0.0	.|.	.|.	.|.	.|.	X|T	296;275;140|125	.|.	ENSP00000343331:C296X|.	C|S	-|-	3|1	2|0	LIPI|LIPI	14459491|14459491	0.978000|0.978000	0.34361|0.34361	0.937000|0.937000	0.37676|0.37676	0.970000|0.970000	0.65996|0.65996	2.499000|2.499000	0.45372|0.45372	2.311000|2.311000	0.77944|0.77944	0.528000|0.528000	0.53228|0.53228	TGT|TCG		0.358	LIPI-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_198996		11	99	0	0	0	0.008291	0	11	99				
ADAMTS5	11096	broad.mit.edu	37	21	28306829	28306829	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr21:28306829G>T	ENST00000284987.5	-	4	1766	c.1645C>A	c.(1645-1647)Ctg>Atg	p.L549M	AP001601.2_ENST00000426771.1_RNA	NM_007038.3	NP_008969.2	Q9UNA0	ATS5_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 5	549	Disintegrin.				defense response to bacterium (GO:0042742)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.L549M(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(34)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	72						TTGCCCTGCAGGCAGATTCTC	0.507																																					Esophageal Squamous(53;683 1080 10100 14424 45938)	Esophageal Squamous(53;683 1080 10100 14424 45938)	uc002ymg.2		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(2)|ovary(1)|pancreas(1)	4						c.(1645-1647)CTG>ATG		ADAM metallopeptidase with thrombospondin type 1							89.0	86.0	87.0					21																	28306829		2203	4300	6503	SO:0001583	missense	11096				proteolysis	proteinaceous extracellular matrix	integrin binding|metalloendopeptidase activity|zinc ion binding	g.chr21:28306829G>T	AF142099	CCDS13579.1	21q21.3	2008-07-31	2008-07-31		ENSG00000154736	ENSG00000154736		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	221	protein-coding gene	gene with protein product	"""aggrecanase-2"""	605007	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2)"""			10438522	Standard	NM_007038		Approved	ADMP-2, ADAMTS11	uc002ymg.3	Q9UNA0	OTTHUMG00000078686	ENST00000284987.5:c.1645C>A	21.37:g.28306829G>T	ENSP00000284987:p.Leu549Met		Somatic					p.L549M	NM_007038	NP_008969	WXS	Illumina HiSeq	Unspecified	Q9UNA0	ATS5_HUMAN			4	2374	-			549			Disintegrin.		Q52LV4|Q9UKP2	Missense_Mutation	SNP	ENST00000284987.5	37	c.1645C>A	CCDS13579.1	.	.	.	.	.	.	.	.	.	.	G	15.20	2.761990	0.49468	.	.	ENSG00000154736	ENST00000284987	T	0.63744	-0.06	5.53	2.72	0.32119	.	0.000000	0.85682	D	0.000000	T	0.46795	0.1411	L	0.38838	1.175	0.49798	D	0.999821	B	0.25809	0.135	B	0.24974	0.057	T	0.19321	-1.0309	10	0.22706	T	0.39	.	8.2726	0.31853	0.1353:0.0:0.7368:0.1279	.	549	Q9UNA0	ATS5_HUMAN	M	549	ENSP00000284987:L549M	ENSP00000284987:L549M	L	-	1	2	ADAMTS5	27228700	1.000000	0.71417	0.988000	0.46212	0.943000	0.58893	4.564000	0.60830	0.295000	0.22570	-0.252000	0.11476	CTG		0.507	ADAMTS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171648.1			8	137	1	0	0.000274275	0.004482	0.000355182	8	137				
KRTAP26-1	388818	broad.mit.edu	37	21	31692128	31692128	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr21:31692128G>T	ENST00000360542.3	-	1	479	c.226C>A	c.(226-228)Ctt>Att	p.L76I		NM_203405.1	NP_981950.1	Q6PEX3	KR261_HUMAN	keratin associated protein 26-1	76						intermediate filament (GO:0005882)		p.L76I(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(7)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	16						GAGGTTTCAAGATTGCCGGTC	0.547																																							uc002ynw.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(226-228)CTT>ATT		keratin associated protein 26-1							115.0	113.0	114.0					21																	31692128		2203	4300	6503	SO:0001583	missense	388818					intermediate filament		g.chr21:31692128G>T	AB096936	CCDS13588.1	21q22.11	2007-11-23			ENSG00000197683	ENSG00000197683		"""Keratin associated proteins"""	33760	protein-coding gene	gene with protein product							Standard	NM_203405		Approved		uc002ynw.3	Q6PEX3	OTTHUMG00000057766	ENST00000360542.3:c.226C>A	21.37:g.31692128G>T	ENSP00000353742:p.Leu76Ile		Somatic					p.L76I	NM_203405	NP_981950	WXS	Illumina HiSeq	Unspecified	Q6PEX3	KR261_HUMAN			1	480	-			76					B0RZD3	Missense_Mutation	SNP	ENST00000360542.3	37	c.226C>A	CCDS13588.1	.	.	.	.	.	.	.	.	.	.	G	9.428	1.084760	0.20309	.	.	ENSG00000197683	ENST00000360542	T	0.14640	2.49	5.07	2.69	0.31865	.	1.188910	0.06145	N	0.673028	T	0.10078	0.0247	N	0.24115	0.695	0.09310	N	1	B	0.25441	0.126	B	0.25614	0.062	T	0.37663	-0.9696	10	0.72032	D	0.01	-0.0024	3.3059	0.07000	0.6763:0.0:0.1205:0.2032	.	76	Q6PEX3	KR261_HUMAN	I	76	ENSP00000353742:L76I	ENSP00000353742:L76I	L	-	1	0	KRTAP26-1	30613999	0.002000	0.14202	0.011000	0.14972	0.970000	0.65996	1.034000	0.30204	0.452000	0.26830	0.655000	0.94253	CTT		0.547	KRTAP26-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128218.1	NM_203405		13	125	1	0	8.60227e-14	0.004007	1.78976e-13	13	125				
KRTAP19-3	337970	broad.mit.edu	37	21	31864089	31864089	+	Nonsense_Mutation	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr21:31864089C>A	ENST00000334063.4	-	1	186	c.187G>T	c.(187-189)Gga>Tga	p.G63*		NM_181609.3	NP_853640.1	Q7Z4W3	KR193_HUMAN	keratin associated protein 19-3	63						intermediate filament (GO:0005882)		p.G63*(1)		large_intestine(1)|lung(7)|upper_aerodigestive_tract(1)	9						CAGCCATATCCGTAGCCTCCG	0.502																																							uc002yog.1		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(187-189)GGA>TGA		keratin associated protein 19-3							163.0	171.0	168.0					21																	31864089		2203	4300	6503	SO:0001587	stop_gained	337970					intermediate filament		g.chr21:31864089C>A	AP001708	CCDS13596.1	21q22.1	2011-02-10			ENSG00000244025	ENSG00000244025		"""Keratin associated proteins"""	18938	protein-coding gene	gene with protein product						12359730	Standard	NM_181609		Approved	KAP19.3	uc002yog.1	Q7Z4W3	OTTHUMG00000057782	ENST00000334063.4:c.187G>T	21.37:g.31864089C>A	ENSP00000386376:p.Gly63*		Somatic					p.G63*	NM_181609	NP_853640	WXS	Illumina HiSeq	Unspecified	Q7Z4W3	KR193_HUMAN			1	187	-			63						Nonsense_Mutation	SNP	ENST00000334063.4	37	c.187G>T	CCDS13596.1	.	.	.	.	.	.	.	.	.	.	C	15.05	2.716909	0.48622	.	.	ENSG00000244025	ENST00000334063	.	.	.	5.26	3.4	0.38934	.	.	.	.	.	.	.	.	.	.	.	0.24741	N	0.993032	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	7.6763	0.28488	0.0:0.7963:0.0:0.2037	.	.	.	.	X	63	.	ENSP00000386376:G63X	G	-	1	0	KRTAP19-3	30785960	0.003000	0.15002	0.001000	0.08648	0.003000	0.03518	0.378000	0.20569	0.682000	0.31407	0.650000	0.86243	GGA		0.502	KRTAP19-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128234.2			6	122	1	0	0.000978159	0.000978	0.00120621	6	122				
MORC3	23515	broad.mit.edu	37	21	37741309	37741309	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr21:37741309G>T	ENST00000400485.1	+	15	1719	c.1643G>T	c.(1642-1644)cGt>cTt	p.R548L	MORC3_ENST00000487909.1_3'UTR	NM_015358.2	NP_056173.1	Q14149	MORC3_HUMAN	MORC family CW-type zinc finger 3	548					cell aging (GO:0007569)|maintenance of protein location in nucleus (GO:0051457)|negative regulation of fibroblast proliferation (GO:0048147)|peptidyl-serine phosphorylation (GO:0018105)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)	PML body (GO:0016605)	zinc ion binding (GO:0008270)	p.R548L(1)		breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(9)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	35						CTTTCTACTCGTTCCTCAATT	0.294																																							uc002yvi.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1642-1644)CGT>CTT		MORC family CW-type zinc finger 3							38.0	33.0	35.0					21																	37741309		1822	4081	5903	SO:0001583	missense	23515				cell aging|maintenance of protein location in nucleus|negative regulation of fibroblast proliferation|peptidyl-serine phosphorylation|protein stabilization	aggresome|intermediate filament cytoskeleton|PML body	ATP binding|zinc ion binding	g.chr21:37741309G>T	AK025327	CCDS42924.1	21q22.13	2005-06-15	2005-06-15	2005-06-15	ENSG00000159256	ENSG00000159256			23572	protein-coding gene	gene with protein product		610078	"""zinc finger, CW-type with coiled-coil domain 3"", ""zinc finger, CW type with coiled-coil domain 3"""	ZCWCC3		14607086	Standard	NM_015358		Approved	ZCW5, NXP2, KIAA0136	uc002yvi.3	Q14149	OTTHUMG00000086620	ENST00000400485.1:c.1643G>T	21.37:g.37741309G>T	ENSP00000383333:p.Arg548Leu		Somatic					p.R548L	NM_015358	NP_056173	WXS	Illumina HiSeq	Unspecified	Q14149	MORC3_HUMAN			15	1719	+			548					A8KA92|Q9UEZ2	Missense_Mutation	SNP	ENST00000400485.1	37	c.1643G>T	CCDS42924.1	.	.	.	.	.	.	.	.	.	.	G	12.14	1.847185	0.32606	.	.	ENSG00000159256	ENST00000400485	T	0.14391	2.51	5.53	3.58	0.41010	.	0.922068	0.09368	N	0.811701	T	0.12008	0.0292	L	0.44542	1.39	0.09310	N	1	B	0.25235	0.121	B	0.20577	0.03	T	0.28073	-1.0055	10	0.27082	T	0.32	-6.3574	7.0934	0.25297	0.1472:0.2505:0.6024:0.0	.	548	Q14149	MORC3_HUMAN	L	548	ENSP00000383333:R548L	ENSP00000383333:R548L	R	+	2	0	MORC3	36663179	0.052000	0.20516	0.878000	0.34440	0.992000	0.81027	1.501000	0.35693	1.306000	0.44926	0.491000	0.48974	CGT		0.294	MORC3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000194640.1	NM_015358		7	46	1	0	8.12818e-05	0.001984	0.000111161	7	46				
TRAPPC10	7109	broad.mit.edu	37	21	45522849	45522849	+	Silent	SNP	C	C	T	rs146580471		TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr21:45522849C>T	ENST00000291574.4	+	22	3712	c.3537C>T	c.(3535-3537)gaC>gaT	p.D1179D		NM_003274.4	NP_003265.3	P48553	TPC10_HUMAN	trafficking protein particle complex 10	1179					sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	sodium ion transmembrane transporter activity (GO:0015081)	p.D1179D(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(8)|ovary(1)|prostate(2)|skin(2)|urinary_tract(4)	41						CCCAACTGGACGCTGGTAAGG	0.512																																							uc002zea.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|skin(1)	2						c.(3535-3537)GAC>GAT		trafficking protein particle complex 10		C		1,4405	2.1+/-5.4	0,1,2202	77.0	69.0	72.0		3537	-4.0	0.9	21	dbSNP_134	72	0,8600		0,0,4300	no	coding-synonymous	TRAPPC10	NM_003274.4		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		1179/1260	45522849	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	7109				vesicle-mediated transport	Golgi apparatus|integral to membrane	binding|sodium ion transmembrane transporter activity	g.chr21:45522849C>T	U19252	CCDS13704.1	21q22.3	2008-05-07	2008-05-07	2008-05-07	ENSG00000160218	ENSG00000160218		"""Trafficking protein particle complex"""	11868	protein-coding gene	gene with protein product	"""trafficking protein particle complex subunit 130"", ""TRAPP 130 kDa subunit"""	602103	"""transmembrane protein 1"""	TMEM1		7633421	Standard	NM_003274		Approved	EHOC-1, TRS130	uc002zea.3	P48553	OTTHUMG00000086894	ENST00000291574.4:c.3537C>T	21.37:g.45522849C>T			Somatic				TRAPPC10_uc010gpo.2_Silent_p.D890D|TRAPPC10_uc011afa.1_Silent_p.D557D	p.D1179D	NM_003274	NP_003265	WXS	Illumina HiSeq	Unspecified	P48553	TPC10_HUMAN			22	3706	+			1179					Q3MIR2|Q86SI7|Q9UMD4|Q9Y4L3	Silent	SNP	ENST00000291574.4	37	c.3537C>T	CCDS13704.1																																																																																				0.512	TRAPPC10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000195737.1	NM_003274		3	71	0	0	0	0.004672	0	3	71				
KRTAP10-10	353333	broad.mit.edu	37	21	46057462	46057462	+	Missense_Mutation	SNP	C	C	A	rs587667830		TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr21:46057462C>A	ENST00000380095.1	+	1	190	c.128C>A	c.(127-129)aCc>aAc	p.T43N	TSPEAR_ENST00000323084.4_Intron	NM_181688.1	NP_859016.1	P60014	KR10A_HUMAN	keratin associated protein 10-10	43	15 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)		p.T43N(1)		NS(1)|endometrium(2)|kidney(1)|lung(6)|prostate(1)|skin(2)	13						CTGGTCTGCACCCCAGTGAGC	0.662																																							uc002zfq.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(127-129)ACC>AAC		keratin associated protein 10-10							55.0	62.0	59.0					21																	46057462		2203	4300	6503	SO:0001583	missense	353333					keratin filament		g.chr21:46057462C>A	AJ566387	CCDS33585.1	21q22.3	2006-03-13			ENSG00000221859	ENSG00000221859		"""Keratin associated proteins"""	22972	protein-coding gene	gene with protein product							Standard	NM_181688		Approved	KAP10.10, KAP18.10, KRTAP18-10	uc002zfq.3	P60014	OTTHUMG00000057631	ENST00000380095.1:c.128C>A	21.37:g.46057462C>A	ENSP00000369438:p.Thr43Asn		Somatic				C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	p.T43N	NM_181688	NP_859016	WXS	Illumina HiSeq	Unspecified	P60014	KR10A_HUMAN			1	190	+			43			15 X 5 AA repeats of C-C-X(3).			Missense_Mutation	SNP	ENST00000380095.1	37	c.128C>A	CCDS33585.1	.	.	.	.	.	.	.	.	.	.	c	13.26	2.183709	0.38609	.	.	ENSG00000221859	ENST00000380095	T	0.09630	2.96	3.52	2.52	0.30459	.	.	.	.	.	T	0.16938	0.0407	M	0.84511	2.7	0.23150	N	0.998211	P	0.43477	0.808	B	0.41412	0.356	T	0.13202	-1.0518	9	0.19590	T	0.45	.	10.0964	0.42478	0.0:0.793:0.207:0.0	.	43	P60014	KR10A_HUMAN	N	43	ENSP00000369438:T43N	ENSP00000369438:T43N	T	+	2	0	KRTAP10-10	44881890	0.031000	0.19500	0.999000	0.59377	0.635000	0.38103	0.408000	0.21065	1.661000	0.50771	0.467000	0.42956	ACC		0.662	KRTAP10-10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128034.1	NM_181688		3	38	1	0	3.59834e-05	0.001168	5.19628e-05	3	38				
PPIL2	23759	broad.mit.edu	37	22	22035675	22035675	+	Missense_Mutation	SNP	A	A	G			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr22:22035675A>G	ENST00000335025.8	+	7	474	c.383A>G	c.(382-384)tAt>tGt	p.Y128C	PPIL2_ENST00000412327.1_Missense_Mutation_p.Y128C|PPIL2_ENST00000456792.2_Missense_Mutation_p.Y107C|PPIL2_ENST00000492445.2_Missense_Mutation_p.Y128C|PPIL2_ENST00000398831.3_Missense_Mutation_p.Y128C|PPIL2_ENST00000406385.1_Missense_Mutation_p.Y128C					peptidylprolyl isomerase (cyclophilin)-like 2									p.Y128C(1)		endometrium(4)|kidney(2)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	17	Colorectal(54;0.105)					GTCTACGCCTATGAGGTGTGT	0.587																																							uc010gtj.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(382-384)TAT>TGT		peptidylprolyl isomerase-like 2 isoform a							118.0	86.0	97.0					22																	22035675		2203	4300	6503	SO:0001583	missense	23759				blood coagulation|leukocyte migration|protein folding|protein polyubiquitination	Golgi lumen|nucleus|ubiquitin ligase complex	peptidyl-prolyl cis-trans isomerase activity|ubiquitin-ubiquitin ligase activity	g.chr22:22035675A>G		CCDS13793.1	22q11.21	2013-01-29			ENSG00000100023	ENSG00000100023		"""U-box domain containing"""	9261	protein-coding gene	gene with protein product	"""U-box domain containing 7"""	607588				10591208	Standard	NM_014337		Approved	UBOX7, CYC4, Cyp-60	uc002zvh.4	Q13356	OTTHUMG00000030174	ENST00000335025.8:c.383A>G	22.37:g.22035675A>G	ENSP00000334553:p.Tyr128Cys		Somatic				PPIL2_uc002zvh.3_Missense_Mutation_p.Y128C|PPIL2_uc002zvi.3_Missense_Mutation_p.Y128C|PPIL2_uc002zvg.3_Missense_Mutation_p.Y128C|PPIL2_uc011aij.1_Missense_Mutation_p.Y107C	p.Y128C	NM_148175	NP_680480	WXS	Illumina HiSeq	Unspecified	Q13356	PPIL2_HUMAN			7	499	+	Colorectal(54;0.105)		128						Missense_Mutation	SNP	ENST00000335025.8	37	c.383A>G	CCDS13793.1	.	.	.	.	.	.	.	.	.	.	A	18.73	3.685933	0.68157	.	.	ENSG00000100023	ENST00000412327;ENST00000335025;ENST00000398831;ENST00000492445;ENST00000458567;ENST00000406385;ENST00000456792	T;T;T;T;T;T	0.30182	1.54;1.54;1.54;1.54;1.54;1.54	5.0	2.77	0.32553	.	0.240977	0.43416	D	0.000564	T	0.53642	0.1809	M	0.88105	2.93	0.44635	D	0.997616	D;D;P	0.64830	0.994;0.992;0.945	D;P;P	0.64687	0.928;0.873;0.877	T	0.59354	-0.7470	10	0.72032	D	0.01	.	7.5482	0.27778	0.777:0.1436:0.0794:0.0	.	107;128;128	E7EW80;Q13356-2;Q13356	.;.;PPIL2_HUMAN	C	128;128;128;128;159;128;107	ENSP00000390427:Y128C;ENSP00000334553:Y128C;ENSP00000381812:Y128C;ENSP00000445312:Y128C;ENSP00000384299:Y128C;ENSP00000396228:Y107C	ENSP00000334553:Y128C	Y	+	2	0	PPIL2	20365675	0.988000	0.35896	0.983000	0.44433	0.614000	0.37383	4.824000	0.62701	2.025000	0.59659	0.459000	0.35465	TAT		0.587	PPIL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075028.4			3	44	0	0	0	0.004672	0	3	44				
PRR14L	253143	broad.mit.edu	37	22	32108284	32108284	+	Silent	SNP	G	G	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr22:32108284G>T	ENST00000327423.6	-	4	5730	c.5541C>A	c.(5539-5541)acC>acA	p.T1847T	PRR14L_ENST00000397493.2_Silent_p.T1847T|PRR14L_ENST00000434485.1_Silent_p.T1847T	NM_173566.2	NP_775837.2	Q5THK1	PR14L_HUMAN	proline rich 14-like	1847								p.T1847T(2)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(5)|skin(1)|urinary_tract(2)	14						GCCTCTGCATGGTAGGCATGT	0.522																																							uc003alp.3		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(5539-5541)ACC>ACA		hypothetical protein LOC253143							92.0	93.0	93.0					22																	32108284		2203	4300	6503	SO:0001819	synonymous_variant	253143							g.chr22:32108284G>T	BC040859	CCDS13900.2	22q12.2	2011-01-25	2011-01-25	2011-01-25	ENSG00000183530	ENSG00000183530			28738	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 30"""	C22orf30		12477932	Standard	NM_173566		Approved	MGC50372	uc003alp.4	Q5THK1	OTTHUMG00000030139	ENST00000327423.6:c.5541C>A	22.37:g.32108284G>T			Somatic				C22orf30_uc003alo.1_Silent_p.T1646T|C22orf30_uc010gwj.1_Silent_p.T1646T	p.T1847T	NM_173566	NP_775837	WXS	Illumina HiSeq	Unspecified	Q5THK1	PR14L_HUMAN			4	5734	-			1847					Q5THK4|Q6ZNN1|Q6ZWH0|Q8IW74|Q9H5T4	Silent	SNP	ENST00000327423.6	37	c.5541C>A	CCDS13900.2	.	.	.	.	.	.	.	.	.	.	G	3.189	-0.166236	0.06461	.	.	ENSG00000183530	ENST00000330495	.	.	.	5.66	1.14	0.20703	.	.	.	.	.	T	0.53110	0.1776	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.39418	-0.9615	4	.	.	.	0.3905	6.0787	0.19928	0.217:0.0:0.6518:0.1313	.	.	.	.	N	150	.	.	H	-	1	0	PRR14L	30438284	0.970000	0.33590	0.135000	0.22099	0.686000	0.39977	0.351000	0.20096	0.032000	0.15435	-0.794000	0.03295	CAT		0.522	PRR14L-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000074993.2	NM_173566		6	94	1	0	0.00307968	0.00308	0.00362461	6	94				
CNTN4	152330	broad.mit.edu	37	3	2942376	2942376	+	Silent	SNP	T	T	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr3:2942376T>A	ENST00000397461.1	+	10	1332	c.948T>A	c.(946-948)ccT>ccA	p.P316P	CNTN4_ENST00000397459.2_5'UTR|CNTN4_ENST00000358480.3_Silent_p.P97P|CNTN4_ENST00000418658.1_Silent_p.P316P|CNTN4_ENST00000427331.1_Silent_p.P316P|CNTN4_ENST00000448906.2_5'UTR	NM_001206955.1	NP_001193884.1	Q8IWV2	CNTN4_HUMAN	contactin 4	316	Ig-like C2-type 4.				axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis (GO:0007409)|brain development (GO:0007420)|negative regulation of neuron differentiation (GO:0045665)|nervous system development (GO:0007399)|neuron cell-cell adhesion (GO:0007158)|neuron projection development (GO:0031175)|regulation of synaptic plasticity (GO:0048167)	anchored component of membrane (GO:0031225)|axon (GO:0030424)|extracellular region (GO:0005576)|plasma membrane (GO:0005886)		p.P316P(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(19)|ovary(2)|pancreas(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		Ovarian(110;0.156)		Epithelial(13;0.000695)|all cancers(10;0.0047)|OV - Ovarian serous cystadenocarcinoma(96;0.01)		TAGCTCAACCTAATTGGATTC	0.348																																							uc003bpc.2		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(2)|ovary(2)|lung(1)|central_nervous_system(1)|pancreas(1)	7						c.(946-948)CCT>CCA		contactin 4 isoform a precursor							105.0	102.0	103.0					3																	2942376		2203	4299	6502	SO:0001819	synonymous_variant	152330				axon guidance|axonal fasciculation|brain development|negative regulation of neuron differentiation|neuron cell-cell adhesion|regulation of synaptic plasticity	anchored to membrane|axon|extracellular region|plasma membrane	protein binding	g.chr3:2942376T>A	AW665944	CCDS2558.1, CCDS43041.1	3p26.3	2013-02-11			ENSG00000144619	ENSG00000144619		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2174	protein-coding gene	gene with protein product		607280				8586965, 12202991	Standard	NM_175607		Approved	BIG-2	uc003bpc.3	Q8IWV2	OTTHUMG00000119031	ENST00000397461.1:c.948T>A	3.37:g.2942376T>A			Somatic				CNTN4_uc003bpb.1_5'UTR|CNTN4_uc003bpd.1_Silent_p.P316P|CNTN4_uc003bpe.2_5'UTR|CNTN4_uc003bpf.2_5'UTR	p.P316P	NM_175607	NP_783200	WXS	Illumina HiSeq	Unspecified	Q8IWV2	CNTN4_HUMAN		Epithelial(13;0.000695)|all cancers(10;0.0047)|OV - Ovarian serous cystadenocarcinoma(96;0.01)	10	1169	+		Ovarian(110;0.156)	316			Ig-like C2-type 4.		B2RAX3|Q8IX14|Q8TC35	Silent	SNP	ENST00000397461.1	37	c.948T>A	CCDS43041.1																																																																																				0.348	CNTN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239236.2			4	149	0	0	0	0.000248	0	4	149				
KIF9	64147	broad.mit.edu	37	3	47289507	47289507	+	Splice_Site	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr3:47289507C>A	ENST00000265529.3	-	12	1809		c.e12+1		snoU13_ENST00000459492.1_RNA|KIF9-AS1_ENST00000429315.3_RNA|KIF9_ENST00000352910.4_Splice_Site|KIF9_ENST00000335044.2_Splice_Site|KIF9_ENST00000444589.2_Splice_Site|KIF9_ENST00000452770.2_Splice_Site|KIF9_ENST00000487440.1_Splice_Site			Q9HAQ2	KIF9_HUMAN	kinesin family member 9						ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|extracellular matrix disassembly (GO:0022617)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle disassembly (GO:1903008)|regulation of podosome assembly (GO:0071801)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|podosome (GO:0002102)|vesicle (GO:0031982)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|protein dimerization activity (GO:0046983)	p.?(1)		central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(15)|skin(4)|stomach(2)|upper_aerodigestive_tract(2)	34		Acute lymphoblastic leukemia(5;0.164)		BRCA - Breast invasive adenocarcinoma(193;0.000284)|KIRC - Kidney renal clear cell carcinoma(197;0.00609)|Kidney(197;0.007)		TAGCCTCTTACCAGGCTGTCA	0.577																																					Colon(44;962 1147 15977 24541)	Colon(44;962 1147 15977 24541)	uc010hjp.2		NA																	1	Unknown(1)		lung(1)	skin(1)	1						c.e12+1		kinesin family member 9 isoform 2							177.0	166.0	170.0					3																	47289507		2203	4300	6503	SO:0001630	splice_region_variant	64147				blood coagulation|microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity	g.chr3:47289507C>A	AF311212	CCDS2751.1, CCDS2752.1	3p21.31	2008-03-03			ENSG00000088727	ENSG00000088727		"""Kinesins"""	16666	protein-coding gene	gene with protein product		607910				11483511	Standard	NM_022342		Approved	MGC104186	uc003cqx.3	Q9HAQ2	OTTHUMG00000133512	ENST00000265529.3:c.1128+1G>T	3.37:g.47289507C>A			Somatic				KIF9_uc003cqx.2_Splice_Site_p.L376_splice|KIF9_uc003cqy.2_Splice_Site_p.L376_splice|KIF9_uc011bat.1_Splice_Site|KIF9_uc011bau.1_Splice_Site	p.L376_splice	NM_001134878	NP_001128350	WXS	Illumina HiSeq	Unspecified	Q9HAQ2	KIF9_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000284)|KIRC - Kidney renal clear cell carcinoma(197;0.00609)|Kidney(197;0.007)	12	1732	-		Acute lymphoblastic leukemia(5;0.164)						Q86Z28|Q9H8A4	Splice_Site	SNP	ENST00000265529.3	37	c.1128_splice	CCDS2752.1	.	.	.	.	.	.	.	.	.	.	C	9.620	1.133507	0.21041	.	.	ENSG00000088727	ENST00000335044;ENST00000265529;ENST00000444589;ENST00000452770;ENST00000352910	.	.	.	4.93	4.06	0.47325	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.0408	0.47829	0.0:0.9081:0.0:0.0919	.	.	.	.	.	-1	.	.	.	-	.	.	KIF9	47264511	1.000000	0.71417	0.999000	0.59377	0.007000	0.05969	5.895000	0.69814	1.078000	0.41014	-0.384000	0.06662	.		0.577	KIF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257475.2		Intron	18	168	1	0	2.44723e-14	0.004656	5.11588e-14	18	168				
OR5K1	26339	broad.mit.edu	37	3	98188903	98188903	+	Silent	SNP	G	G	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr3:98188903G>T	ENST00000332650.5	+	1	580	c.483G>T	c.(481-483)ggG>ggT	p.G161G		NM_001004736.2	NP_001004736.2	Q8NHB7	OR5K1_HUMAN	olfactory receptor, family 5, subfamily K, member 1	161						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G161G(1)		breast(1)|endometrium(1)|large_intestine(4)|lung(21)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						TTCATGTAGGGCTTGTATTTA	0.418																																							uc003dsm.2		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(1)	1						c.(481-483)GGG>GGT		olfactory receptor, family 5, subfamily K,							218.0	221.0	220.0					3																	98188903		2203	4300	6503	SO:0001819	synonymous_variant	26339				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr3:98188903G>T	X64984	CCDS43115.1	3q11.2	2013-09-23			ENSG00000232382	ENSG00000232382		"""GPCR / Class A : Olfactory receptors"""	8349	protein-coding gene	gene with protein product						1370859	Standard	NM_001004736		Approved	HTPCRX10, HSHTPCRX10	uc003dsm.3	Q8NHB7	OTTHUMG00000160048	ENST00000332650.5:c.483G>T	3.37:g.98188903G>T			Somatic					p.G161G	NM_001004736	NP_001004736	WXS	Illumina HiSeq	Unspecified	Q8NHB7	OR5K1_HUMAN			1	483	+			161			Extracellular (Potential).		B9EGY5|Q6IF46	Silent	SNP	ENST00000332650.5	37	c.483G>T	CCDS43115.1																																																																																				0.418	OR5K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359019.1			11	375	1	0	0.00829132	0.008291	0.00962933	11	375				
IGSF11	152404	broad.mit.edu	37	3	118623644	118623644	+	Splice_Site	SNP	G	G	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr3:118623644G>A	ENST00000393775.2	-	6	1010	c.705C>T	c.(703-705)ccC>ccT	p.P235P	IGSF11_ENST00000425327.2_Splice_Site_p.P234P|IGSF11_ENST00000489689.1_Splice_Site_p.A211A|IGSF11_ENST00000441144.2_Splice_Site_p.A210A|IGSF11_ENST00000491903.1_Intron|IGSF11_ENST00000354673.2_Splice_Site_p.P234P	NM_001015887.1	NP_001015887.1	Q5DX21	IGS11_HUMAN	immunoglobulin superfamily, member 11	235					cell adhesion (GO:0007155)|regulation of growth (GO:0040008)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.P234P(1)|p.P235P(1)		autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|liver(1)|lung(20)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						TCCTGGGCTGGGCTGCAAAAT	0.348																																							uc003ebw.2		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(703-705)CCC>CCT		immunoglobulin superfamily, member 11 isoform b							78.0	90.0	86.0					3																	118623644		2199	4299	6498	SO:0001630	splice_region_variant	152404				cell adhesion|regulation of growth	integral to membrane|plasma membrane	receptor activity	g.chr3:118623644G>A	AB079879	CCDS2983.1, CCDS46891.1	3q21.2	2013-01-11			ENSG00000144847	ENSG00000144847		"""Immunoglobulin superfamily / I-set domain containing"""	16669	protein-coding gene	gene with protein product	"""cancer/testis antigen 119"""	608351				12207903	Standard	XM_006713516		Approved	BT-IgSF, MGC35227, Igsf13, VSIG3, CT119	uc003ebw.3	Q5DX21	OTTHUMG00000159387	ENST00000393775.2:c.704-1C>T	3.37:g.118623644G>A			Somatic				IGSF11_uc011biv.1_Intron|IGSF11_uc003ebx.2_Silent_p.A211A|IGSF11_uc003eby.2_Silent_p.P234P|IGSF11_uc003ebz.2_Silent_p.A210A|IGSF11_uc010hqs.2_Silent_p.P234P	p.P235P	NM_001015887	NP_001015887	WXS	Illumina HiSeq	Unspecified	Q5DX21	IGS11_HUMAN			6	952	-			235			Extracellular (Potential).		C9JZN0|Q8N4F1|Q8N7T8|Q8NDD2	Silent	SNP	ENST00000393775.2	37	c.705C>T	CCDS46891.1																																																																																				0.348	IGSF11-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355075.2		Silent	17	195	0	0	0	0.004007	0	17	195				
PARP9	83666	broad.mit.edu	37	3	122274537	122274537	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr3:122274537C>A	ENST00000360356.2	-	4	813	c.586G>T	c.(586-588)Gct>Tct	p.A196S	PARP9_ENST00000492382.1_Intron|PARP9_ENST00000477522.2_Missense_Mutation_p.A161S|PARP9_ENST00000462315.1_Missense_Mutation_p.A161S|PARP9_ENST00000471785.1_Missense_Mutation_p.A161S	NM_001146102.1|NM_031458.2	NP_001139574.1|NP_113646.2	Q8IXQ6	PARP9_HUMAN	poly (ADP-ribose) polymerase family, member 9	196	Macro 1. {ECO:0000255|PROSITE- ProRule:PRU00490}.				cell migration (GO:0016477)|double-strand break repair (GO:0006302)|regulation of response to interferon-gamma (GO:0060330)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	NAD+ ADP-ribosyltransferase activity (GO:0003950)	p.A196S(1)		endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(3)	34				GBM - Glioblastoma multiforme(114;0.0519)		GGCCCAACAGCATGGATGATC	0.463																																							uc010hri.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)|prostate(1)|skin(1)	4						c.(586-588)GCT>TCT		poly (ADP-ribose) polymerase family, member 9							65.0	61.0	62.0					3																	122274537		2203	4300	6503	SO:0001583	missense	83666				cell migration	cytosol|nucleus	NAD+ ADP-ribosyltransferase activity|protein binding	g.chr3:122274537C>A	AF307339	CCDS3014.1, CCDS54633.1, CCDS54634.1	3q13-q21	2010-02-16			ENSG00000138496	ENSG00000138496		"""Poly (ADP-ribose) polymerases"""	24118	protein-coding gene	gene with protein product		612065				11110709	Standard	NM_031458		Approved	BAL, BAL1	uc003efi.3	Q8IXQ6	OTTHUMG00000159522	ENST00000360356.2:c.586G>T	3.37:g.122274537C>A	ENSP00000353512:p.Ala196Ser		Somatic				PARP9_uc003eff.3_Missense_Mutation_p.A161S|PARP9_uc011bjs.1_Missense_Mutation_p.A161S|PARP9_uc003efg.2_Intron|PARP9_uc003efi.2_Missense_Mutation_p.A161S|PARP9_uc003efh.2_Missense_Mutation_p.A196S|PARP9_uc003efj.2_Missense_Mutation_p.A161S	p.A196S	NM_001146102	NP_001139574	WXS	Illumina HiSeq	Unspecified	Q8IXQ6	PARP9_HUMAN		GBM - Glioblastoma multiforme(114;0.0519)	4	731	-			196			Macro 1.		A8KA94|B2R8S9|E9PFM7|Q8TCP3|Q9BZL8|Q9BZL9	Missense_Mutation	SNP	ENST00000360356.2	37	c.586G>T	CCDS3014.1	.	.	.	.	.	.	.	.	.	.	C	27.0	4.791670	0.90367	.	.	ENSG00000138496	ENST00000360356;ENST00000477522;ENST00000471785;ENST00000452457;ENST00000462315	T;T;T;T	0.26810	1.71;1.71;1.71;1.71	5.49	5.49	0.81192	Appr-1-p processing (3);	0.000000	0.52532	D	0.000079	T	0.59676	0.2211	M	0.89287	3.02	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.993	T	0.65829	-0.6073	10	0.87932	D	0	.	18.1171	0.89559	0.0:1.0:0.0:0.0	.	161;196;161	E9PFM7;Q8IXQ6;Q8IXQ6-2	.;PARP9_HUMAN;.	S	196;161;161;119;161	ENSP00000353512:A196S;ENSP00000419506:A161S;ENSP00000419001:A161S;ENSP00000418894:A161S	ENSP00000353512:A196S	A	-	1	0	PARP9	123757227	1.000000	0.71417	1.000000	0.80357	0.682000	0.39822	3.833000	0.55790	2.865000	0.98341	0.655000	0.94253	GCT		0.463	PARP9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355957.1	NM_031458		4	58	1	0	0.00024832	0.000248	0.000326385	4	58				
RHO	6010	broad.mit.edu	37	3	129251250	129251250	+	Silent	SNP	C	C	A	rs143003934		TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr3:129251250C>A	ENST00000296271.3	+	3	781	c.687C>A	c.(685-687)acC>acA	p.T229T		NM_000539.3	NP_000530.1	P08100	OPSD_HUMAN	rhodopsin	229					G-protein coupled receptor signaling pathway (GO:0007186)|phototransduction, visible light (GO:0007603)|protein phosphorylation (GO:0006468)|protein-chromophore linkage (GO:0018298)|red, far-red light phototransduction (GO:0009585)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina development in camera-type eye (GO:0060041)|retinoid metabolic process (GO:0001523)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	cell-cell junction (GO:0005911)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|photoreceptor disc membrane (GO:0097381)|photoreceptor inner segment (GO:0001917)|photoreceptor inner segment membrane (GO:0060342)|photoreceptor outer segment (GO:0001750)|photoreceptor outer segment membrane (GO:0042622)|plasma membrane (GO:0005886)|rough endoplasmic reticulum membrane (GO:0030867)	G-protein coupled receptor activity (GO:0004930)|metal ion binding (GO:0046872)|photoreceptor activity (GO:0009881)|retinal binding (GO:0016918)	p.T229T(1)		breast(1)|endometrium(1)|large_intestine(10)|lung(6)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	22		all_neural(597;0.0227)|Myeloproliferative disorder(1037;0.0255)|Prostate(884;0.183)		GBM - Glioblastoma multiforme(114;2.58e-05)|Lung(219;0.0234)	Halothane(DB01159)	TCGTCTTCACCGTCAAGGAGG	0.592																																					Esophageal Squamous(118;214 1623 30842 43234 46940)	Esophageal Squamous(118;214 1623 30842 43234 46940)	uc003emt.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(685-687)ACC>ACA		rhodopsin	Halothane(DB01159)						143.0	130.0	134.0					3																	129251250		2203	4300	6503	SO:0001819	synonymous_variant	6010				protein-chromophore linkage|rhodopsin mediated signaling pathway	Golgi apparatus|integral to plasma membrane|photoreceptor inner segment membrane|photoreceptor outer segment membrane	G-protein coupled receptor activity|metal ion binding|photoreceptor activity|protein binding	g.chr3:129251250C>A	AB065668	CCDS3063.1	3q21-q24	2014-01-28	2008-04-16		ENSG00000163914	ENSG00000163914		"""GPCR / Class A : Opsin receptors"""	10012	protein-coding gene	gene with protein product	"""opsin 2, rod pigment"""	180380	"""retinitis pigmentosa 4, autosomal dominant"""	RP4		2016091	Standard	NM_000539		Approved	OPN2, CSNBAD1	uc003emt.3	P08100	OTTHUMG00000159542	ENST00000296271.3:c.687C>A	3.37:g.129251250C>A			Somatic					p.T229T	NM_000539	NP_000530	WXS	Illumina HiSeq	Unspecified	P08100	OPSD_HUMAN		GBM - Glioblastoma multiforme(114;2.58e-05)|Lung(219;0.0234)	3	782	+		all_neural(597;0.0227)|Myeloproliferative disorder(1037;0.0255)|Prostate(884;0.183)	229			Helical; Name=5; (Potential).		Q16414|Q2M249	Silent	SNP	ENST00000296271.3	37	c.687C>A	CCDS3063.1																																																																																				0.592	RHO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356101.1	NM_000539		9	99	1	0	3.86212e-05	0.008291	5.52271e-05	9	99				
CLRN1	7401	broad.mit.edu	37	3	150690263	150690263	+	Missense_Mutation	SNP	G	G	C			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr3:150690263G>C	ENST00000327047.1	-	1	523	c.233C>G	c.(232-234)gCa>gGa	p.A78G	CLRN1-AS1_ENST00000465576.1_RNA|CLRN1_ENST00000328863.4_Missense_Mutation_p.A78G|CLRN1-AS1_ENST00000476886.1_RNA|RP11-166N6.2_ENST00000469268.1_RNA	NM_174878.2	NP_777367.1	P58418	CLRN1_HUMAN	clarin 1	78					actin filament organization (GO:0007015)|auditory receptor cell stereocilium organization (GO:0060088)|cell motility (GO:0048870)|equilibrioception (GO:0050957)|photoreceptor cell maintenance (GO:0045494)|positive regulation of lamellipodium assembly (GO:0010592)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|microvillus (GO:0005902)|plasma membrane (GO:0005886)		p.A78G(1)		autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|skin(2)	14			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			AAAGGGCCTTGCTCCCAACCC	0.478																																							uc003eyk.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(232-234)GCA>GGA		clarin 1 isoform a							84.0	70.0	75.0					3																	150690263		2203	4300	6503	SO:0001583	missense	7401				equilibrioception|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	integral to membrane		g.chr3:150690263G>C	AF388366	CCDS3153.1, CCDS35492.1, CCDS56285.1	3q25.1	2014-09-17	2006-11-23	2006-11-23	ENSG00000163646	ENSG00000163646			12605	protein-coding gene	gene with protein product		606397	"""Usher syndrome 3A"""	USH3, USH3A, RP61		7711740, 8975700	Standard	NM_052995		Approved		uc021xfr.1	P58418	OTTHUMG00000140368	ENST00000327047.1:c.233C>G	3.37:g.150690263G>C	ENSP00000322280:p.Ala78Gly		Somatic				CLRN1OS_uc011bny.1_Intron|CLRN1OS_uc003eyl.2_5'Flank	p.A78G	NM_174878	NP_777367	WXS	Illumina HiSeq	Unspecified	P58418	CLRN1_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)		1	524	-			78					D3DNJ3|E1ACU9|Q8N6A9	Missense_Mutation	SNP	ENST00000327047.1	37	c.233C>G	CCDS3153.1	.	.	.	.	.	.	.	.	.	.	G	2.521	-0.310830	0.05458	.	.	ENSG00000163646	ENST00000327047;ENST00000328863	T;T	0.68479	-0.33;-0.19	5.5	1.36	0.22044	.	0.525232	0.19888	N	0.103802	T	0.29588	0.0738	N	0.02802	-0.49	0.30301	N	0.789489	B	0.02656	0.0	B	0.04013	0.001	T	0.30736	-0.9968	10	0.02654	T	1	-2.0489	3.3918	0.07291	0.0834:0.3179:0.3741:0.2246	.	78	P58418	CLRN1_HUMAN	G	78	ENSP00000322280:A78G;ENSP00000329158:A78G	ENSP00000322280:A78G	A	-	2	0	CLRN1	152172953	0.981000	0.34729	0.238000	0.24106	0.982000	0.71751	2.240000	0.43088	0.260000	0.21731	0.561000	0.74099	GCA		0.478	CLRN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277060.1			5	92	0	0	0	0.001168	0	5	92				
PPM1L	151742	broad.mit.edu	37	3	160474182	160474182	+	Missense_Mutation	SNP	T	T	C			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr3:160474182T>C	ENST00000498165.1	+	1	187	c.86T>C	c.(85-87)cTg>cCg	p.L29P	RP11-16N11.2_ENST00000566372.1_RNA|PPM1L_ENST00000497343.1_Missense_Mutation_p.L29P	NM_139245.2	NP_640338.2	Q5SGD2	PPM1L_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1L	29					MAPK cascade (GO:0000165)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)	p.L29P(1)		breast(1)|endometrium(1)|large_intestine(4)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	13			Lung(72;0.00149)|LUSC - Lung squamous cell carcinoma(72;0.00216)			CTTTTCCTGCTGTGCATCAGC	0.517																																					Pancreas(86;250 1994 13715 43211)	Pancreas(86;250 1994 13715 43211)	uc003fdr.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(85-87)CTG>CCG		protein phosphatase 1 (formerly 2C)-like							136.0	133.0	134.0					3																	160474182		2203	4300	6503	SO:0001583	missense	151742				protein dephosphorylation|sphingolipid metabolic process	endoplasmic reticulum membrane|integral to membrane|protein serine/threonine phosphatase complex	metal ion binding|protein serine/threonine phosphatase activity	g.chr3:160474182T>C	AK055115	CCDS33886.1	3q26.1	2012-04-17	2010-03-05		ENSG00000163590	ENSG00000163590	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	16381	protein-coding gene	gene with protein product	"""PP2Cepsilon"", ""Protein phosphatase 2C epsilon isoform"""	611931	"""protein phosphatase 1 (formerly 2C)-like"""			12556533	Standard	XM_006713507		Approved	PP2CE	uc003fdr.3	Q5SGD2	OTTHUMG00000159048	ENST00000498165.1:c.86T>C	3.37:g.160474182T>C	ENSP00000417659:p.Leu29Pro		Somatic					p.L29P	NM_139245	NP_640338	WXS	Illumina HiSeq	Unspecified	Q5SGD2	PPM1L_HUMAN	Lung(72;0.00149)|LUSC - Lung squamous cell carcinoma(72;0.00216)		1	187	+			29			Helical; (Potential).		Q2M3J2|Q96NM7	Missense_Mutation	SNP	ENST00000498165.1	37	c.86T>C	CCDS33886.1	.	.	.	.	.	.	.	.	.	.	T	18.88	3.717708	0.68844	.	.	ENSG00000163590	ENST00000497343;ENST00000498165	T	0.23552	1.9	4.73	3.57	0.40892	.	0.090627	0.45361	D	0.000367	T	0.23133	0.0559	N	0.08118	0	0.80722	D	1	D	0.69078	0.997	P	0.60789	0.879	T	0.04268	-1.0964	10	0.32370	T	0.25	.	9.4329	0.38622	0.0:0.0851:0.0:0.9149	.	29	Q5SGD2	PPM1L_HUMAN	P	29	ENSP00000417659:L29P	ENSP00000420354:L29P	L	+	2	0	PPM1L	161956876	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.452000	0.80683	0.672000	0.31204	0.402000	0.26972	CTG		0.517	PPM1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353019.1	NM_139245		16	88	0	0	0	0.007413	0	16	88				
SI	6476	broad.mit.edu	37	3	164709251	164709251	+	Silent	SNP	G	G	T	rs369099715		TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr3:164709251G>T	ENST00000264382.3	-	44	5060	c.4998C>A	c.(4996-4998)ggC>ggA	p.G1666G		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	1666	Sucrase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)	p.G1666G(1)		NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	GTCCTCTGACGCCAATATCTT	0.403										HNSCC(35;0.089)																													uc003fei.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(7)|upper_aerodigestive_tract(4)|skin(2)|pancreas(1)	14						c.(4996-4998)GGC>GGA		sucrase-isomaltase	Acarbose(DB00284)						102.0	92.0	95.0					3																	164709251		2203	4300	6503	SO:0001819	synonymous_variant	6476				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|brush border|Golgi apparatus|integral to membrane	carbohydrate binding|oligo-1,6-glucosidase activity|sucrose alpha-glucosidase activity	g.chr3:164709251G>T	X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.4998C>A	3.37:g.164709251G>T		HNSCC(35;0.089)	Somatic					p.G1666G	NM_001041	NP_001032	WXS	Illumina HiSeq	Unspecified	P14410	SUIS_HUMAN			44	5060	-		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)	1666			Sucrase.|Lumenal.		A2RUC3|Q1JQ80|Q1RMC2	Silent	SNP	ENST00000264382.3	37	c.4998C>A	CCDS3196.1																																																																																				0.403	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350116.1	NM_001041		8	66	1	0	0.000157383	0.00308	0.000210004	8	66				
HTR3E	285242	broad.mit.edu	37	3	183822012	183822012	+	Missense_Mutation	SNP	G	G	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr3:183822012G>A	ENST00000415389.2	+	4	788	c.322G>A	c.(322-324)Gag>Aag	p.E108K	HTR3E_ENST00000440596.2_Missense_Mutation_p.E108K|HTR3E_ENST00000335304.2_Missense_Mutation_p.E123K|HTR3E-AS1_ENST00000431427.1_RNA|HTR3E_ENST00000425359.2_Missense_Mutation_p.E93K|HTR3E_ENST00000436361.2_Missense_Mutation_p.E108K	NM_001256613.1|NM_198313.2	NP_001243542.1|NP_938055.1	A5X5Y0	5HT3E_HUMAN	5-hydroxytryptamine (serotonin) receptor 3E, ionotropic	108					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	extracellular ligand-gated ion channel activity (GO:0005230)	p.E123K(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(20)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	40	all_cancers(143;1.46e-10)|Ovarian(172;0.0303)		Epithelial(37;7.06e-36)|OV - Ovarian serous cystadenocarcinoma(80;3.11e-22)		Ergoloid mesylate(DB01049)	AGAGGAATGTGAGGGCATCAC	0.483																																					Melanoma(7;227 727 6634 44770)	Melanoma(7;227 727 6634 44770)	uc010hxq.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)|skin(1)	3						c.(322-324)GAG>AAG		5-hydroxytryptamine receptor 3 subunit E							63.0	54.0	57.0					3																	183822012		2203	4300	6503	SO:0001583	missense	285242					integral to membrane|plasma membrane|postsynaptic membrane	extracellular ligand-gated ion channel activity|receptor activity	g.chr3:183822012G>A	AY159813	CCDS3251.1, CCDS58868.1, CCDS58869.1, CCDS58870.1, CCDS58871.1	3q27	2012-05-22	2012-02-03		ENSG00000186038	ENSG00000186038		"""5-HT (serotonin) receptors"", ""Ligand-gated ion channels / 5-HT (serotonin) receptors, ionotropic"""	24005	protein-coding gene	gene with protein product		610123	"""5-hydroxytryptamine (serotonin) receptor 3, family member E"""			12801637, 15157181	Standard	NM_001256613		Approved		uc010hxr.3	A5X5Y0	OTTHUMG00000156857	ENST00000415389.2:c.322G>A	3.37:g.183822012G>A	ENSP00000401444:p.Glu108Lys		Somatic				HTR3E_uc003fml.3_Missense_Mutation_p.E93K|HTR3E_uc003fmm.2_Missense_Mutation_p.E123K|HTR3E_uc010hxr.2_Missense_Mutation_p.E108K|HTR3E_uc003fmn.2_Missense_Mutation_p.E108K	p.E108K	NM_182589	NP_872395	WXS	Illumina HiSeq	Unspecified	A5X5Y0	5HT3E_HUMAN	Epithelial(37;7.06e-36)|OV - Ovarian serous cystadenocarcinoma(80;3.11e-22)		4	788	+	all_cancers(143;1.46e-10)|Ovarian(172;0.0303)		108			Extracellular (Potential).		A8IKD7|E9PGF1|Q495G1|Q495G3|Q6V706|Q6V707|Q7Z6B2	Missense_Mutation	SNP	ENST00000415389.2	37	c.322G>A	CCDS58868.1	.	.	.	.	.	.	.	.	.	.	g	7.148	0.583175	0.13749	.	.	ENSG00000186038	ENST00000415389;ENST00000425359;ENST00000335304;ENST00000431041;ENST00000436361;ENST00000440596	T;T;T;T;T;T	0.79033	-1.23;-1.23;-1.23;-1.23;-1.23;-1.23	3.46	1.5	0.22942	Neurotransmitter-gated ion-channel ligand-binding (3);	0.686906	0.11529	N	0.554861	T	0.71451	0.3341	L	0.54323	1.7	0.22989	N	0.998463	B;P;B;P;B	0.36315	0.302;0.459;0.404;0.547;0.404	B;B;B;B;B	0.38156	0.266;0.167;0.104;0.104;0.066	T	0.58092	-0.7697	10	0.37606	T	0.19	.	7.6509	0.28348	0.195:0.0:0.805:0.0	.	108;108;108;123;93	E9PGF1;A5X5Y0;A5X5Y0-4;A5X5Y0-3;A5X5Y0-2	.;5HT3E_HUMAN;.;.;.	K	108;93;123;37;108;108	ENSP00000401444:E108K;ENSP00000401900:E93K;ENSP00000335511:E123K;ENSP00000391254:E37K;ENSP00000395833:E108K;ENSP00000406050:E108K	ENSP00000335511:E123K	E	+	1	0	HTR3E	185304706	1.000000	0.71417	0.021000	0.16686	0.239000	0.25481	4.610000	0.61155	0.217000	0.20800	-0.312000	0.09012	GAG		0.483	HTR3E-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000346284.1	NM_182589		3	36	0	0	0	0.000602	0	3	36				
ZFYVE28	57732	broad.mit.edu	37	4	2321937	2321937	+	Missense_Mutation	SNP	C	C	G			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr4:2321937C>G	ENST00000290974.2	-	7	1102	c.763G>C	c.(763-765)Gag>Cag	p.E255Q	ZFYVE28_ENST00000511071.1_Missense_Mutation_p.E225Q|ZFYVE28_ENST00000515312.1_Missense_Mutation_p.E185Q|RP11-478C1.7_ENST00000510632.1_RNA	NM_020972.2	NP_066023.2	Q9HCC9	LST2_HUMAN	zinc finger, FYVE domain containing 28	255					negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)	cytosol (GO:0005829)|early endosome membrane (GO:0031901)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)	p.E255Q(1)		NS(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(4)	31						CGGAACAGCTCGGACATGTCT	0.607																																							uc003gex.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)	3						c.(763-765)GAG>CAG		zinc finger, FYVE domain containing 28							115.0	100.0	105.0					4																	2321937		2203	4300	6503	SO:0001583	missense	57732				negative regulation of epidermal growth factor receptor activity	cytosol|early endosome membrane	metal ion binding|phosphatidylinositol-3-phosphate binding|protein binding	g.chr4:2321937C>G	AK126692	CCDS33942.1, CCDS54708.1, CCDS54709.1, CCDS54710.1, CCDS54711.1, CCDS54712.1	4p16.3	2008-05-02			ENSG00000159733	ENSG00000159733		"""Zinc fingers, FYVE domain containing"""	29334	protein-coding gene	gene with protein product		614176				10997877	Standard	NM_020972		Approved	KIAA1643	uc003gex.2	Q9HCC9	OTTHUMG00000160292	ENST00000290974.2:c.763G>C	4.37:g.2321937C>G	ENSP00000290974:p.Glu255Gln		Somatic				ZFYVE28_uc011bvk.1_Missense_Mutation_p.E185Q|ZFYVE28_uc011bvl.1_Missense_Mutation_p.E225Q|ZFYVE28_uc003gew.1_Missense_Mutation_p.E141Q	p.E255Q	NM_020972	NP_066023	WXS	Illumina HiSeq	Unspecified	Q9HCC9	LST2_HUMAN			7	1082	-			255					B2RP83|B3KX50|B7Z1Q7|B7Z2G9|B7Z2M2|B7ZB19|E9PB54|E9PB64|E9PG77|Q7Z6J3	Missense_Mutation	SNP	ENST00000290974.2	37	c.763G>C	CCDS33942.1	.	.	.	.	.	.	.	.	.	.	C	28.2	4.898023	0.91962	.	.	ENSG00000159733	ENST00000290974;ENST00000511071;ENST00000515312	T;T;T	0.29397	1.57;1.57;1.57	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	T	0.56001	0.1956	M	0.66939	2.045	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.58393	-0.7644	10	0.87932	D	0	.	17.8039	0.88596	0.0:1.0:0.0:0.0	.	225;255	Q9HCC9-2;Q9HCC9	.;LST2_HUMAN	Q	255;225;185	ENSP00000290974:E255Q;ENSP00000425706:E225Q;ENSP00000426299:E185Q	ENSP00000290974:E255Q	E	-	1	0	ZFYVE28	2291735	0.998000	0.40836	0.986000	0.45419	0.980000	0.70556	4.324000	0.59228	2.536000	0.85505	0.650000	0.86243	GAG		0.607	ZFYVE28-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000360078.1	XM_035371		7	47	0	0	0	0.00308	0	7	47				
EVC2	132884	broad.mit.edu	37	4	5693029	5693029	+	Missense_Mutation	SNP	G	G	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr4:5693029G>A	ENST00000344408.5	-	4	535	c.482C>T	c.(481-483)aCt>aTt	p.T161I	EVC2_ENST00000310917.2_Missense_Mutation_p.T81I|EVC2_ENST00000344938.1_Missense_Mutation_p.T161I	NM_147127.4	NP_667338.3	Q86UK5	LBN_HUMAN	Ellis van Creveld syndrome 2	161					smoothened signaling pathway (GO:0007224)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.T161I(1)		NS(2)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(32)|lung(28)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	81						ATTTTCAGAAGTCCCTTGAAC	0.299																																							uc003gij.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(3)|ovary(2)	5						c.(481-483)ACT>ATT		limbin							67.0	70.0	69.0					4																	5693029		2203	4299	6502	SO:0001583	missense	132884					integral to membrane		g.chr4:5693029G>A	AB083067	CCDS3382.2, CCDS54718.1	4p16.2-p16.1	2008-08-01	2008-08-01		ENSG00000173040	ENSG00000173040			19747	protein-coding gene	gene with protein product		607261				12136126, 12571802	Standard	NM_147127		Approved	LBN	uc003gij.3	Q86UK5	OTTHUMG00000125493	ENST00000344408.5:c.482C>T	4.37:g.5693029G>A	ENSP00000342144:p.Thr161Ile		Somatic				EVC2_uc011bwb.1_5'UTR|EVC2_uc003gik.2_Missense_Mutation_p.T81I	p.T161I	NM_147127	NP_667338	WXS	Illumina HiSeq	Unspecified	Q86UK5	LBN_HUMAN			4	536	-			161					Q86YT3|Q86YT4|Q8NG49	Missense_Mutation	SNP	ENST00000344408.5	37	c.482C>T	CCDS3382.2	.	.	.	.	.	.	.	.	.	.	G	13.22	2.171036	0.38315	.	.	ENSG00000173040	ENST00000344938;ENST00000310917;ENST00000344408	T;T;T	0.74209	-0.82;-0.81;-0.82	4.64	3.8	0.43715	.	0.508271	0.19933	N	0.102817	T	0.64659	0.2618	L	0.39898	1.24	0.09310	N	0.999993	P	0.40144	0.704	B	0.39531	0.302	T	0.57359	-0.7825	10	0.51188	T	0.08	-2.7434	8.737	0.34534	0.1061:0.0:0.8939:0.0	.	161	Q86UK5	LBN_HUMAN	I	161;81;161	ENSP00000339954:T161I;ENSP00000311683:T81I;ENSP00000342144:T161I	ENSP00000311683:T81I	T	-	2	0	EVC2	5743930	0.189000	0.23263	0.028000	0.17463	0.799000	0.45148	1.118000	0.31246	0.958000	0.37956	0.561000	0.74099	ACT		0.299	EVC2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000289822.2	NM_147127		5	147	0	0	0	0.001168	0	5	147				
PPEF2	5470	broad.mit.edu	37	4	76797517	76797517	+	Nonsense_Mutation	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr4:76797517C>A	ENST00000286719.7	-	11	1599	c.1243G>T	c.(1243-1245)Gag>Tag	p.E415*		NM_006239.2	NP_006230.2	O14830	PPE2_HUMAN	protein phosphatase, EF-hand calcium binding domain 2	415	Catalytic.				detection of stimulus involved in sensory perception (GO:0050906)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|protein dephosphorylation (GO:0006470)|regulation of JUN kinase activity (GO:0043506)|regulation of MAP kinase activity (GO:0043405)|visual perception (GO:0007601)	cilium (GO:0005929)|cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|Hsp70 protein binding (GO:0030544)|Hsp90 protein binding (GO:0051879)|iron ion binding (GO:0005506)|manganese ion binding (GO:0030145)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein serine/threonine phosphatase activity (GO:0004722)	p.E415*(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(25)|ovary(2)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	50			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			CGGGAGGGCTCCTCTTTCTCT	0.677																																					NSCLC(105;1359 1603 15961 44567 47947)	NSCLC(105;1359 1603 15961 44567 47947)	uc003hix.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(2)|lung(1)|central_nervous_system(1)	4						c.(1243-1245)GAG>TAG		serine/threonine protein phosphatase with							32.0	36.0	35.0					4																	76797517		2203	4300	6503	SO:0001587	stop_gained	5470				detection of stimulus involved in sensory perception|negative regulation of MAPKKK cascade|negative regulation of peptidyl-threonine phosphorylation|protein dephosphorylation|visual perception	cytoplasm|photoreceptor inner segment|photoreceptor outer segment	calcium ion binding|Hsp70 protein binding|Hsp90 protein binding|iron ion binding|manganese ion binding|mitogen-activated protein kinase kinase kinase binding|protein serine/threonine phosphatase activity	g.chr4:76797517C>A	AF023456	CCDS34013.1	4q21.1	2013-01-10			ENSG00000156194	ENSG00000156194		"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"", ""EF-hand domain containing"""	9244	protein-coding gene	gene with protein product	"""protein phosphatase 7, catalytic subunit, beta isozyme"""	602256				9326663, 12051765	Standard	NM_006239		Approved	PPP7CB	uc003hix.3	O14830	OTTHUMG00000160915	ENST00000286719.7:c.1243G>T	4.37:g.76797517C>A	ENSP00000286719:p.Glu415*		Somatic				PPEF2_uc003hiy.2_RNA|PPEF2_uc003hiz.1_Nonsense_Mutation_p.E415*	p.E415*	NM_006239	NP_006230	WXS	Illumina HiSeq	Unspecified	O14830	PPE2_HUMAN	Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)		11	1600	-			415			Catalytic.		O14831	Nonsense_Mutation	SNP	ENST00000286719.7	37	c.1243G>T	CCDS34013.1	.	.	.	.	.	.	.	.	.	.	C	37	6.622556	0.97714	.	.	ENSG00000156194	ENST00000286719;ENST00000337500	.	.	.	4.58	2.8	0.32819	.	1.754590	0.02559	N	0.096520	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	-22.3108	8.4859	0.33071	0.0:0.8037:0.0:0.1963	.	.	.	.	X	415	.	ENSP00000286719:E415X	E	-	1	0	PPEF2	77016541	0.923000	0.31300	0.006000	0.13384	0.004000	0.04260	3.891000	0.56227	1.067000	0.40740	0.491000	0.48974	GAG		0.677	PPEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362929.1	NM_006239		10	67	1	0	3.07112e-06	0.000978	4.88486e-06	10	67				
MRPL1	65008	broad.mit.edu	37	4	78830509	78830509	+	Nonsense_Mutation	SNP	C	C	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr4:78830509C>T	ENST00000315567.8	+	7	1089	c.760C>T	c.(760-762)Cag>Tag	p.Q254*		NM_020236.3	NP_064621.3	Q9BYD6	RM01_HUMAN	mitochondrial ribosomal protein L1	254					translation (GO:0006412)	large ribosomal subunit (GO:0015934)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)	p.Q254*(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)	17						GAACTTTCTCCAGACCAAAAT	0.294																																							uc003hku.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(760-762)CAG>TAG		mitochondrial ribosomal protein L1 precursor							71.0	77.0	75.0					4																	78830509		2202	4299	6501	SO:0001587	stop_gained	65008						RNA binding	g.chr4:78830509C>T	AB049474	CCDS3583.2	4q21.1	2012-09-13			ENSG00000169288	ENSG00000169288		"""Mitochondrial ribosomal proteins / large subunits"""	14275	protein-coding gene	gene with protein product		611821					Standard	NM_020236		Approved	BM022	uc003hku.2	Q9BYD6	OTTHUMG00000130200	ENST00000315567.8:c.760C>T	4.37:g.78830509C>T	ENSP00000315017:p.Gln254*		Somatic				MRPL1_uc010iji.1_Nonsense_Mutation_p.Q177*	p.Q254*	NM_020236	NP_064621	WXS	Illumina HiSeq	Unspecified	Q9BYD6	RM01_HUMAN			7	958	+			254					A6NG03|Q4W5B8|Q6IAG4|Q96BW3|Q9H793|Q9NRL5	Nonsense_Mutation	SNP	ENST00000315567.8	37	c.760C>T	CCDS3583.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	0.582|0.582	-0.836822|-0.836822	0.02692|0.02692	.|.	.|.	ENSG00000169288|ENSG00000169288	ENST00000502384|ENST00000315567;ENST00000538314	.|.	.|.	.|.	5.56|5.56	-11.1|-11.1	0.00147|0.00147	.|.	.|0.858938	.|0.10364	.|N	.|0.683710	T|.	0.06371|.	0.0164|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.16867|.	-1.0388|.	3|.	.|0.05351	.|T	.|0.99	8.0087|8.0087	4.4084|4.4084	0.11420|0.11420	0.1746:0.3489:0.3776:0.0988|0.1746:0.3489:0.3776:0.0988	.|.	.|.	.|.	.|.	L|X	207|254;232	.|.	.|ENSP00000315017:Q254X	P|Q	+|+	2|1	0|0	MRPL1|MRPL1	79049533|79049533	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.010000|0.010000	0.07245|0.07245	-2.458000|-2.458000	0.01000|0.01000	-1.996000|-1.996000	0.00970|0.00970	-0.868000|-0.868000	0.02995|0.02995	CCA|CAG		0.294	MRPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252518.3	NM_020236		7	133	0	0	0	0.001984	0	7	133				
UBE2D3	7323	broad.mit.edu	37	4	103723775	103723775	+	Silent	SNP	G	G	A	rs201479057		TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr4:103723775G>A	ENST00000453744.2	-	5	654	c.141C>T	c.(139-141)ggC>ggT	p.G47G	UBE2D3_ENST00000504211.1_Silent_p.G18G|UBE2D3_ENST00000394801.4_Silent_p.G47G|UBE2D3_ENST00000507845.1_Silent_p.G18G|UBE2D3_ENST00000505207.1_Silent_p.G18G|UBE2D3_ENST00000394803.5_Silent_p.G47G|UBE2D3_ENST00000349311.8_Silent_p.G47G|UBE2D3_ENST00000394804.2_Silent_p.G47G|UBE2D3_ENST00000357194.6_Silent_p.G49G|UBE2D3_ENST00000321805.7_Silent_p.G47G|UBE2D3_ENST00000338145.3_Silent_p.G47G|UBE2D3_ENST00000350435.7_Silent_p.G41G|UBE2D3_ENST00000343106.5_Silent_p.G47G|UBE2D3_ENST00000502404.1_Silent_p.G18G	NM_181891.1	NP_871620.1	P61077	UB2D3_HUMAN	ubiquitin-conjugating enzyme E2D 3	47					apoptotic process (GO:0006915)|BMP signaling pathway (GO:0030509)|cellular protein modification process (GO:0006464)|cellular response to hypoxia (GO:0071456)|DNA repair (GO:0006281)|gene expression (GO:0010467)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of type I interferon production (GO:0032480)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K11-linked ubiquitination (GO:0070979)|protein K48-linked ubiquitination (GO:0070936)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|ubiquitin-protein transferase activity (GO:0004842)	p.G49G(1)|p.G47G(1)		kidney(1)|lung(3)|skin(1)	5		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.13e-08)		AGAATACACCGCCTTGATATG	0.323													G|||	1	0.000199681	0.0	0.0	5008	,	,		18833	0.001		0.0	False		,,,				2504	0.0						uc003hwk.2		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(139-141)GGC>GGT		ubiquitin-conjugating enzyme E2D 3 isoform 1							93.0	99.0	97.0					4																	103723775		2203	4300	6503	SO:0001819	synonymous_variant	7323				apoptosis|BMP signaling pathway|DNA repair|negative regulation of type I interferon production|proteasomal ubiquitin-dependent protein catabolic process|protein K11-linked ubiquitination|protein K48-linked ubiquitination|protein monoubiquitination|transforming growth factor beta receptor signaling pathway	endosome membrane|plasma membrane	ATP binding|protein binding|ubiquitin-protein ligase activity	g.chr4:103723775G>A	U39318	CCDS3659.1, CCDS3660.1, CCDS3661.1, CCDS75172.1	4q24	2011-05-19	2011-05-19		ENSG00000109332	ENSG00000109332		"""Ubiquitin-conjugating enzymes E2"""	12476	protein-coding gene	gene with protein product		602963	"""ubiquitin-conjugating enzyme E2D 3 (homologous to yeast UBC4/5)"", ""ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast)"""			8530467	Standard	NM_181886		Approved	UbcH5C	uc003hwl.3	P61077	OTTHUMG00000131119	ENST00000453744.2:c.141C>T	4.37:g.103723775G>A			Somatic				UBE2D3_uc003hwi.2_Silent_p.G47G|UBE2D3_uc003hwj.2_RNA|UBE2D3_uc003hwl.2_Silent_p.G47G|UBE2D3_uc011cet.1_Silent_p.G47G|UBE2D3_uc011ceu.1_Silent_p.G47G|UBE2D3_uc003hwo.2_Silent_p.G47G|UBE2D3_uc003hwp.2_Silent_p.G47G|UBE2D3_uc003hwq.2_Silent_p.G49G|UBE2D3_uc003hwr.2_Silent_p.G47G	p.G47G	NM_181887	NP_871616	WXS	Illumina HiSeq	Unspecified	P61077	UB2D3_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;2.13e-08)	5	602	-		Hepatocellular(203;0.217)	47					A6NJ93|A6NJB1|A6NM99|P47986|Q6IB88|Q6NXS4|Q8N924	Silent	SNP	ENST00000453744.2	37	c.141C>T	CCDS3660.1																																																																																				0.323	UBE2D3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253791.2	NM_181893		6	133	0	0	0	0.001168	0	6	133				
SLC9B1	150159	broad.mit.edu	37	4	103910990	103910990	+	Missense_Mutation	SNP	G	G	C			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr4:103910990G>C	ENST00000296422.7	-	3	319	c.178C>G	c.(178-180)Cta>Gta	p.L60V	SLC9B1_ENST00000394789.3_Missense_Mutation_p.L60V	NM_139173.3	NP_631912	Q4ZJI4	SL9B1_HUMAN	solute carrier family 9, subfamily B (NHA1, cation proton antiporter 1), member 1	60					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	solute:proton antiporter activity (GO:0015299)	p.L60V(1)									ACTCCTCTTAGAGGACAAGAA	0.284																																							uc003hww.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(178-180)CTA>GTA		Na+/H+ exchanger domain containing 1 isoform 1							152.0	137.0	142.0					4																	103910990		2200	4293	6493	SO:0001583	missense	150159					integral to membrane	solute:hydrogen antiporter activity	g.chr4:103910990G>C	AF447585	CCDS34041.1, CCDS47119.1	4q24	2013-05-22	2012-03-22	2011-07-26	ENSG00000164037	ENSG00000164037		"""Solute carriers"""	24244	protein-coding gene	gene with protein product		611527	"""Na+/H+ exchanger domain containing 1"", ""solute carrier family 9, subfamily B (cation proton antiporter 2), member 1"""	NHEDC1		16850186	Standard	NM_139173		Approved	NHA1	uc003hww.3	Q4ZJI4	OTTHUMG00000161114	ENST00000296422.7:c.178C>G	4.37:g.103910990G>C	ENSP00000296422:p.Leu60Val		Somatic				NHEDC1_uc003hwu.2_Missense_Mutation_p.L60V|NHEDC1_uc010ilm.2_5'UTR|NHEDC1_uc003hwv.2_RNA|NHEDC1_uc011cev.1_Intron	p.L60V	NM_139173	NP_631912	WXS	Illumina HiSeq	Unspecified	Q4ZJI4	NHDC1_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;1.5e-08)	3	300	-		Hepatocellular(203;0.217)	60					A1KXV1|B9EH04|C9JBP7|Q49A30|Q8NCV2|Q8WVZ0	Missense_Mutation	SNP	ENST00000296422.7	37	c.178C>G	CCDS34041.1	.	.	.	.	.	.	.	.	.	.	G	9.671	1.146776	0.21288	.	.	ENSG00000164037	ENST00000394789;ENST00000296422;ENST00000514340;ENST00000452285	T;T;T	0.25085	2.31;2.33;1.82	4.23	4.23	0.50019	.	0.078757	0.51477	D	0.000100	T	0.17408	0.0418	N	0.22421	0.69	0.23515	N	0.997511	B;P	0.38978	0.389;0.652	B;B	0.37267	0.093;0.245	T	0.14727	-1.0462	10	0.41790	T	0.15	-20.1649	12.4589	0.55721	0.0:0.0:1.0:0.0	.	60;60	Q4ZJI4;Q4ZJI4-3	SL9B1_HUMAN;.	V	60	ENSP00000378269:L60V;ENSP00000296422:L60V;ENSP00000426056:L60V	ENSP00000296422:L60V	L	-	1	2	SLC9B1	104130439	1.000000	0.71417	0.996000	0.52242	0.054000	0.15201	3.426000	0.52778	2.648000	0.89879	0.650000	0.86243	CTA		0.284	SLC9B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363841.1	NM_139173		11	53	0	0	0	0.008291	0	11	53				
ANK2	287	broad.mit.edu	37	4	114177071	114177071	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr4:114177071C>A	ENST00000357077.4	+	11	1224	c.1171C>A	c.(1171-1173)Ccg>Acg	p.P391T	ANK2_ENST00000394537.3_Missense_Mutation_p.P391T|ANK2_ENST00000264366.6_Missense_Mutation_p.P391T|ANK2_ENST00000506722.1_Missense_Mutation_p.P370T	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	391					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.P391T(1)		NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		GAGAGCCAATCCGAACGCCAG	0.493																																							uc003ibe.3		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14						c.(1171-1173)CCG>ACG		ankyrin 2 isoform 1							107.0	99.0	101.0					4																	114177071		2203	4300	6503	SO:0001583	missense	287				axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding	g.chr4:114177071C>A	M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.1171C>A	4.37:g.114177071C>A	ENSP00000349588:p.Pro391Thr		Somatic				ANK2_uc003ibd.3_Missense_Mutation_p.P370T|ANK2_uc003ibf.3_Missense_Mutation_p.P391T|ANK2_uc003ibc.2_Missense_Mutation_p.P367T|ANK2_uc011cgb.1_Missense_Mutation_p.P406T	p.P391T	NM_001148	NP_001139	WXS	Illumina HiSeq	Unspecified	Q01484	ANK2_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)	11	1271	+		Ovarian(17;0.0448)|Hepatocellular(203;0.218)	391			ANK 11.		Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	ENST00000357077.4	37	c.1171C>A	CCDS3702.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.136930	0.77775	.	.	ENSG00000145362	ENST00000503271;ENST00000503423;ENST00000506722;ENST00000504454;ENST00000394537;ENST00000357077;ENST00000264366;ENST00000343056	T;T;T;T;T;T;T	0.71461	-0.57;-0.25;-0.25;-0.25;-0.25;-0.25;-0.25	5.91	5.06	0.68205	Ankyrin repeat-containing domain (3);	0.112103	0.40064	N	0.001191	T	0.79429	0.4444	L	0.45581	1.43	0.80722	D	1	D;D;B;P;P	0.65815	0.988;0.995;0.265;0.837;0.923	P;D;B;P;P	0.64410	0.9;0.925;0.379;0.457;0.763	T	0.81430	-0.0936	10	0.66056	D	0.02	.	17.0106	0.86405	0.0:0.8725:0.1275:0.0	.	391;391;391;370;370	Q01484;Q01484-2;Q01484-4;Q01484-5;F8WEF9	ANK2_HUMAN;.;.;.;.	T	370;370;370;406;391;391;391;370	ENSP00000423799:P370T;ENSP00000421011:P370T;ENSP00000421067:P370T;ENSP00000424722:P406T;ENSP00000378044:P391T;ENSP00000349588:P391T;ENSP00000264366:P391T	ENSP00000264366:P391T	P	+	1	0	ANK2	114396520	1.000000	0.71417	0.441000	0.26858	0.717000	0.41224	6.075000	0.71261	1.464000	0.47987	0.655000	0.94253	CCG		0.493	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148		8	120	1	0	0.000442599	0.006214	0.000564829	8	120				
TMEM144	55314	broad.mit.edu	37	4	159162701	159162701	+	Missense_Mutation	SNP	T	T	G			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr4:159162701T>G	ENST00000296529.6	+	11	1363	c.843T>G	c.(841-843)tgT>tgG	p.C281W	TMEM144_ENST00000503404.1_3'UTR	NM_018342.4	NP_060812.2	Q7Z5S9	TM144_HUMAN	transmembrane protein 144	281						integral component of membrane (GO:0016021)		p.C281W(1)		autonomic_ganglia(1)|endometrium(1)|large_intestine(7)|lung(9)|prostate(1)	19	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.0539)		CTACCTGCTGTTGGTTCATAG	0.408																																							uc003ipx.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(841-843)TGT>TGG		transmembrane protein 144							294.0	264.0	274.0					4																	159162701		2203	4300	6503	SO:0001583	missense	55314					integral to membrane		g.chr4:159162701T>G	AK002017	CCDS3799.1	4q32.1	2008-02-05			ENSG00000164124	ENSG00000164124			25633	protein-coding gene	gene with protein product						12477932	Standard	NM_018342		Approved	FLJ11155	uc003ipx.3	Q7Z5S9	OTTHUMG00000162013	ENST00000296529.6:c.843T>G	4.37:g.159162701T>G	ENSP00000296529:p.Cys281Trp		Somatic				TMEM144_uc010iqi.2_RNA	p.C281W	NM_018342	NP_060812	WXS	Illumina HiSeq	Unspecified	Q7Z5S9	TM144_HUMAN		COAD - Colon adenocarcinoma(41;0.0539)	11	1363	+	all_hematologic(180;0.24)	Renal(120;0.0854)	281			Helical; (Potential).		D3DP24|Q49A05|Q9NUT3	Missense_Mutation	SNP	ENST00000296529.6	37	c.843T>G	CCDS3799.1	.	.	.	.	.	.	.	.	.	.	T	20.1	3.940824	0.73557	.	.	ENSG00000164124	ENST00000296529	T	0.70045	-0.45	5.72	-5.35	0.02697	.	0.000000	0.85682	D	0.000000	T	0.73079	0.3541	M	0.79475	2.455	0.80722	D	1	D	0.71674	0.998	P	0.53809	0.735	T	0.77723	-0.2481	10	0.41790	T	0.15	-74.7869	19.4828	0.95017	0.0:0.8393:0.0:0.1607	.	281	Q7Z5S9	TM144_HUMAN	W	281	ENSP00000296529:C281W	ENSP00000296529:C281W	C	+	3	2	TMEM144	159382151	0.975000	0.34042	0.597000	0.28824	0.967000	0.64934	0.043000	0.13971	-1.113000	0.02981	0.477000	0.44152	TGT		0.408	TMEM144-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365597.1	NM_018342		27	273	0	0	0	0.001786	0	27	273				
DDX60L	91351	broad.mit.edu	37	4	169300609	169300609	+	Missense_Mutation	SNP	G	G	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr4:169300609G>A	ENST00000511577.1	-	32	4515	c.4268C>T	c.(4267-4269)gCa>gTa	p.A1423V	DDX60L_ENST00000260184.7_Missense_Mutation_p.A1423V			Q5H9U9	DDX6L_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60-like	1423							ATP binding (GO:0005524)|helicase activity (GO:0004386)|RNA binding (GO:0003723)	p.A1424V(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(23)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.175)		CAAATATGATGCAAGTCCTGC	0.328																																							uc003irq.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(4267-4269)GCA>GTA		DEAD (Asp-Glu-Ala-Asp) box polypeptide 60-like							52.0	52.0	52.0					4																	169300609		1820	4095	5915	SO:0001583	missense	91351						ATP binding|ATP-dependent helicase activity|RNA binding	g.chr4:169300609G>A	AK092461	CCDS47161.1	4q32.3	2008-01-08				ENSG00000181381			26429	protein-coding gene	gene with protein product							Standard	XM_005263341		Approved	FLJ31033	uc003irq.4	Q5H9U9		ENST00000511577.1:c.4268C>T	4.37:g.169300609G>A	ENSP00000422423:p.Ala1423Val		Somatic					p.A1423V	NM_001012967	NP_001012985	WXS	Illumina HiSeq	Unspecified	Q5H9U9	DDX6L_HUMAN		GBM - Glioblastoma multiforme(119;0.175)	32	4489	-		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)	1423					Q96ND6	Missense_Mutation	SNP	ENST00000511577.1	37	c.4268C>T		.	.	.	.	.	.	.	.	.	.	G	0.021	-1.418905	0.01136	.	.	ENSG00000181381	ENST00000260184;ENST00000511577	T;T	0.14022	2.54;2.54	3.51	0.544	0.17185	.	.	.	.	.	T	0.01976	0.0062	N	0.00092	-2.175	0.23827	N	0.996733	B	0.06786	0.001	B	0.04013	0.001	T	0.43458	-0.9390	9	0.02654	T	1	.	7.5063	0.27547	0.8042:0.0:0.1958:0.0	.	1423	Q5H9U9	DDX6L_HUMAN	V	1423	ENSP00000260184:A1423V;ENSP00000422423:A1423V	ENSP00000260184:A1423V	A	-	2	0	DDX60L	169537184	0.987000	0.35691	0.002000	0.10522	0.649000	0.38597	2.812000	0.47994	-0.032000	0.13758	-0.680000	0.03767	GCA		0.328	DDX60L-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000364839.1	NM_001012967		7	48	0	0	0	0.001984	0	7	48				
MFAP3L	9848	broad.mit.edu	37	4	170912688	170912688	+	Silent	SNP	T	T	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr4:170912688T>A	ENST00000361618.3	-	3	1378	c.1071A>T	c.(1069-1071)gcA>gcT	p.A357A	RP11-6E9.4_ENST00000508955.1_RNA|MFAP3L_ENST00000393704.3_Silent_p.A254A	NM_021647.6	NP_067679.6	O75121	MFA3L_HUMAN	microfibrillar-associated protein 3-like	357						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.A357A(1)		cervix(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22		Prostate(90;0.00601)|Renal(120;0.0183)|all_neural(102;0.122)|Melanoma(52;0.17)		GBM - Glioblastoma multiforme(119;0.0201)|LUSC - Lung squamous cell carcinoma(193;0.116)		TAGAAGGTTCTGCAGTTTCGG	0.507																																							uc003isp.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(1069-1071)GCA>GCT		microfibrillar-associated protein 3-like isoform							188.0	157.0	168.0					4																	170912688		2203	4300	6503	SO:0001819	synonymous_variant	9848					integral to membrane|plasma membrane		g.chr4:170912688T>A	AB014526	CCDS34103.1, CCDS43281.1	4q33	2014-08-12			ENSG00000198948	ENSG00000198948		"""Immunoglobulin superfamily / I-set domain containing"""	29083	protein-coding gene	gene with protein product						9734811	Standard	XM_005263366		Approved	KIAA0626, NYD-sp9	uc003isp.4	O75121	OTTHUMG00000160942	ENST00000361618.3:c.1071A>T	4.37:g.170912688T>A			Somatic				MFAP3L_uc003isn.3_Silent_p.A254A	p.A357A	NM_021647	NP_067679	WXS	Illumina HiSeq	Unspecified	O75121	MFA3L_HUMAN		GBM - Glioblastoma multiforme(119;0.0201)|LUSC - Lung squamous cell carcinoma(193;0.116)	3	1249	-		Prostate(90;0.00601)|Renal(120;0.0183)|all_neural(102;0.122)|Melanoma(52;0.17)	357			Cytoplasmic (Potential).		A8K1X6|D3DP35|Q4W5N7|Q4W5N9|Q6TNA8|Q9BVE1|Q9BXK0	Silent	SNP	ENST00000361618.3	37	c.1071A>T	CCDS34103.1																																																																																				0.507	MFAP3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363043.2	NM_021647		9	136	0	0	0	0.004482	0	9	136				
LINC01098	285501	broad.mit.edu	37	4	178896957	178896957	+	Splice_Site	SNP	G	G	C			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr4:178896957G>C	ENST00000507870.1	+	5	622		c.e5-1																p.?(2)		lung(8)|prostate(1)	9						TCTTTTCTTAGGAGAGAAGAC	0.423																																							uc010iru.2		NA																	2	Unknown(2)		lung(2)		0						c.e5-1		Homo sapiens cDNA clone IMAGE:4828874.							125.0	125.0	125.0					4																	178896957		1871	4095	5966	SO:0001630	splice_region_variant	285501							g.chr4:178896957G>C																												ENST00000507870.1:c.161-1G>C	4.37:g.178896957G>C			Somatic						NR_028342		WXS	Illumina HiSeq	Unspecified				all cancers(43;9.24e-25)|Epithelial(43;6.28e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.29e-10)|LUSC - Lung squamous cell carcinoma(1;2.61e-05)|Lung(1;3.22e-05)|GBM - Glioblastoma multiforme(59;0.000185)|Colorectal(24;0.000244)|STAD - Stomach adenocarcinoma(60;0.000777)|COAD - Colon adenocarcinoma(29;0.000884)	5		+		all_lung(41;6.03e-08)|Lung NSC(41;4.26e-07)|Breast(14;0.00066)|Melanoma(52;0.00168)|Prostate(90;0.0129)|all_hematologic(60;0.0202)|Renal(120;0.0246)|Colorectal(36;0.0508)|Hepatocellular(41;0.236)							Splice_Site	SNP	ENST00000507870.1	37	c.627_splice		.	.	.	.	.	.	.	.	.	.	G	13.45	2.239795	0.39598	.	.	ENSG00000231171	ENST00000507870	.	.	.	3.78	2.91	0.33838	.	.	.	.	.	.	.	.	.	.	.	0.23341	N	0.997875	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.6232	0.33872	0.0:0.0:0.7721:0.2279	.	.	.	.	.	-1	.	.	.	+	.	.	RP11-389E17.1	179133951	0.000000	0.05858	0.010000	0.14722	0.527000	0.34593	0.244000	0.18124	1.110000	0.41699	0.650000	0.86243	.		0.423	RP11-389E17.1-001	PUTATIVE	basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000361922.1		Intron	10	124	0	0	0	0.006214	0	10	124				
F11	2160	broad.mit.edu	37	4	187201386	187201386	+	Missense_Mutation	SNP	A	A	G			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr4:187201386A>G	ENST00000403665.2	+	9	1227	c.875A>G	c.(874-876)cAt>cGt	p.H292R	F11_ENST00000264692.4_Missense_Mutation_p.H240R	NM_000128.3	NP_000119.1	P03951	FA11_HUMAN	coagulation factor XI	292	Apple 4. {ECO:0000255|PROSITE- ProRule:PRU00315}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|plasminogen activation (GO:0031639)|positive regulation of fibrinolysis (GO:0051919)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|serine-type aminopeptidase activity (GO:0070009)|serine-type endopeptidase activity (GO:0004252)			NS(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(15)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	32		all_cancers(14;6.2e-52)|all_epithelial(14;1.62e-38)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|Colorectal(36;0.0161)|all_neural(102;0.202)		OV - Ovarian serous cystadenocarcinoma(60;2.13e-11)|BRCA - Breast invasive adenocarcinoma(30;4.59e-06)|GBM - Glioblastoma multiforme(59;0.000149)|STAD - Stomach adenocarcinoma(60;0.000314)|LUSC - Lung squamous cell carcinoma(40;0.00112)|READ - Rectum adenocarcinoma(43;0.176)	Coagulation Factor IX(DB00100)	GTGTTCTGCCATTCTTCATTT	0.502																																							uc003iza.1		NA																	0					0						c.(874-876)CAT>CGT		coagulation factor XI precursor	Coagulation Factor IX(DB00100)						170.0	168.0	168.0					4																	187201386		2203	4300	6503	SO:0001583	missense	2160				blood coagulation, intrinsic pathway|plasminogen activation|positive regulation of fibrinolysis	extracellular space|plasma membrane	heparin binding|serine-type endopeptidase activity	g.chr4:187201386A>G	M13142	CCDS3847.1	4q35	2008-08-01	2008-08-01		ENSG00000088926	ENSG00000088926	3.4.21.27		3529	protein-coding gene	gene with protein product	"""plasma thromboplastin antecedent"""	264900					Standard	NM_000128		Approved	FXI	uc003iza.1	P03951	OTTHUMG00000150311	ENST00000403665.2:c.875A>G	4.37:g.187201386A>G	ENSP00000384957:p.His292Arg		Somatic					p.H292R	NM_000128	NP_000119	WXS	Illumina HiSeq	Unspecified	P03951	FA11_HUMAN		OV - Ovarian serous cystadenocarcinoma(60;2.13e-11)|BRCA - Breast invasive adenocarcinoma(30;4.59e-06)|GBM - Glioblastoma multiforme(59;0.000149)|STAD - Stomach adenocarcinoma(60;0.000314)|LUSC - Lung squamous cell carcinoma(40;0.00112)|READ - Rectum adenocarcinoma(43;0.176)	9	1208	+		all_cancers(14;6.2e-52)|all_epithelial(14;1.62e-38)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|Colorectal(36;0.0161)|all_neural(102;0.202)	292			Apple 4.		D3DP64|Q4W5C2|Q9Y495	Missense_Mutation	SNP	ENST00000403665.2	37	c.875A>G	CCDS3847.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	2.620|2.620	-0.288836|-0.288836	0.05605|0.05605	.|.	.|.	ENSG00000088926|ENSG00000088926	ENST00000403665;ENST00000264692|ENST00000452239	D;D|.	0.88896|.	-2.44;-2.4|.	5.74|5.74	4.53|4.53	0.55603|0.55603	Apple domain (2);Apple-like (1);|.	0.396093|.	0.25186|.	N|.	0.032484|.	T|T	0.55401|0.55401	0.1918|0.1918	M|M	0.65975|0.65975	2.015|2.015	0.28320|0.28320	N|N	0.922273|0.922273	B|.	0.17038|.	0.02|.	B|.	0.24155|.	0.051|.	T|T	0.51332|0.51332	-0.8719|-0.8719	10|5	0.72032|.	D|.	0.01|.	.|.	11.913|11.913	0.52749|0.52749	0.8545:0.1455:0.0:0.0|0.8545:0.1455:0.0:0.0	.|.	292|.	P03951|.	FA11_HUMAN|.	R|V	292;240|108	ENSP00000384957:H292R;ENSP00000264692:H240R|.	ENSP00000264692:H240R|.	H|I	+|+	2|1	0|0	F11|F11	187438380|187438380	0.186000|0.186000	0.23225|0.23225	0.223000|0.223000	0.23860|0.23860	0.589000|0.589000	0.36550|0.36550	2.657000|2.657000	0.46724|0.46724	1.080000|1.080000	0.41073|0.41073	0.529000|0.529000	0.55759|0.55759	CAT|ATT		0.502	F11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317519.4			16	209	0	0	0	0.006122	0	16	209				
MARCH6	10299	broad.mit.edu	37	5	10410252	10410252	+	Splice_Site	SNP	G	G	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr5:10410252G>A	ENST00000274140.5	+	18	1687	c.1555G>A	c.(1555-1557)Gat>Aat	p.D519N	MARCH6_ENST00000449913.2_Splice_Site_p.D471N|MARCH6_ENST00000503788.1_Splice_Site_p.D414N|MARCH6_ENST00000510792.1_Splice_Site_p.D217N	NM_005885.3	NP_005876.2	O60337	MARH6_HUMAN	membrane-associated ring finger (C3HC4) 6, E3 ubiquitin protein ligase	519					protein K48-linked ubiquitination (GO:0070936)	integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)	enzyme binding (GO:0019899)|ligase activity (GO:0016874)|ubiquitin conjugating enzyme binding (GO:0031624)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.D519N(1)		breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(35)|ovary(1)|urinary_tract(3)	54						CTCTTTCAGTGATGCTCCAGT	0.433																																							uc003jet.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)	2						c.(1555-1557)GAT>AAT		membrane-associated ring finger (C3HC4) 6							148.0	134.0	139.0					5																	10410252		2203	4300	6503	SO:0001630	splice_region_variant	10299				protein K48-linked ubiquitination	integral to endoplasmic reticulum membrane	ubiquitin conjugating enzyme binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr5:10410252G>A	AB011169	CCDS34135.1, CCDS59487.1, CCDS59488.1	5p15.2	2013-01-09	2012-02-23		ENSG00000145495	ENSG00000145495		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	30550	protein-coding gene	gene with protein product		613297	"""membrane-associated ring finger (C3HC4) 6"""			14722266	Standard	NM_001270660		Approved	TEB4, MARCH-VI, RNF176	uc003jet.2	O60337	OTTHUMG00000162027	ENST00000274140.5:c.1554-1G>A	5.37:g.10410252G>A			Somatic				MARCH6_uc011cmu.1_Missense_Mutation_p.D471N|MARCH6_uc003jeu.1_Missense_Mutation_p.D217N|MARCH6_uc011cmv.1_Missense_Mutation_p.D414N	p.D519N	NM_005885	NP_005876	WXS	Illumina HiSeq	Unspecified	O60337	MARH6_HUMAN			18	1738	+			519			Extracellular (Potential).		A5PKZ4|B4DKJ2|B4DT33|D3DTC8|O14670|Q86X77	Missense_Mutation	SNP	ENST00000274140.5	37	c.1555G>A	CCDS34135.1	.	.	.	.	.	.	.	.	.	.	G	35	5.588978	0.96590	.	.	ENSG00000145495	ENST00000449913;ENST00000503788;ENST00000274140;ENST00000510792	T;T;T;T	0.33654	1.4;1.4;1.4;1.4	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	T	0.56877	0.2015	M	0.69185	2.1	0.80722	D	1	D;D;D;D	0.76494	0.979;0.998;0.999;0.995	P;P;D;P	0.63283	0.799;0.896;0.913;0.797	T	0.46624	-0.9178	10	0.23302	T	0.38	-29.3317	19.8218	0.96599	0.0:0.0:1.0:0.0	.	414;471;99;519	B4DKJ2;B4DT33;B2RBJ1;O60337	.;.;.;MARH6_HUMAN	N	471;414;519;217	ENSP00000414643:D471N;ENSP00000425930:D414N;ENSP00000274140:D519N;ENSP00000424512:D217N	ENSP00000274140:D519N	D	+	1	0	MARCH6	10463252	1.000000	0.71417	1.000000	0.80357	0.828000	0.46876	9.465000	0.97660	2.678000	0.91216	0.655000	0.94253	GAT		0.433	MARCH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366919.2	NM_005885	Missense_Mutation	54	200	0	0	0	0.00361	0	54	200				
PRDM9	56979	broad.mit.edu	37	5	23522766	23522766	+	Silent	SNP	C	C	G			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr5:23522766C>G	ENST00000296682.3	+	8	836	c.654C>G	c.(652-654)gcC>gcG	p.A218A		NM_020227.2	NP_064612.2	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	218					meiotic gene conversion (GO:0006311)|positive regulation of meiosis I (GO:0060903)|positive regulation of reciprocal meiotic recombination (GO:0010845)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|metal ion binding (GO:0046872)|recombination hotspot binding (GO:0010844)|sequence-specific DNA binding (GO:0043565)	p.A218A(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(27)|lung(87)|ovary(6)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(11)	172						GCTGTGCTGCCCATGGGCCCC	0.512										HNSCC(3;0.000094)																													uc003jgo.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|large_intestine(2)|pancreas(1)	6						c.(652-654)GCC>GCG		PR domain containing 9							51.0	50.0	50.0					5																	23522766		2203	4300	6503	SO:0001819	synonymous_variant	56979				meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleoplasm	histone-lysine N-methyltransferase activity|nucleic acid binding|zinc ion binding	g.chr5:23522766C>G	AF275816	CCDS43307.1	5p14.2	2014-06-03			ENSG00000164256	ENSG00000164256		"""-"", ""Zinc fingers, C2H2-type"""	13994	protein-coding gene	gene with protein product	"""PR-domain containing protein 9"""	609760	"""minisatellite binding protein 3, 115kDa"", ""minisatellite binding protein 3 (115kD)"""	MSBP3		10668202, 2062643, 24634223	Standard	NM_020227		Approved	PFM6, ZNF899	uc003jgo.3	Q9NQV7	OTTHUMG00000161918	ENST00000296682.3:c.654C>G	5.37:g.23522766C>G		HNSCC(3;0.000094)	Somatic					p.A218A	NM_020227	NP_064612	WXS	Illumina HiSeq	Unspecified	Q9NQV7	PRDM9_HUMAN			8	836	+			218					B4DX22|Q27Q50	Silent	SNP	ENST00000296682.3	37	c.654C>G	CCDS43307.1																																																																																				0.512	PRDM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366375.1	NM_020227		15	63	0	0	0	0.004007	0	15	63				
CDH9	1007	broad.mit.edu	37	5	26906121	26906121	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr5:26906121G>T	ENST00000231021.4	-	5	930	c.758C>A	c.(757-759)aCa>aAa	p.T253K		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	253	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.T253K(1)		breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						GATGTTCACTGTGGTGGTTCC	0.458																																					Melanoma(8;187 585 15745 40864 52829)	Melanoma(8;187 585 15745 40864 52829)	uc003jgs.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|skin(2)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)	9						c.(757-759)ACA>AAA		cadherin 9, type 2 preproprotein							259.0	235.0	243.0					5																	26906121		2203	4300	6503	SO:0001583	missense	1007				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:26906121G>T	AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.758C>A	5.37:g.26906121G>T	ENSP00000231021:p.Thr253Lys		Somatic				CDH9_uc010iug.2_Missense_Mutation_p.T253K	p.T253K	NM_016279	NP_057363	WXS	Illumina HiSeq	Unspecified	Q9ULB4	CADH9_HUMAN			5	927	-			253			Extracellular (Potential).|Cadherin 2.		Q3B7I5	Missense_Mutation	SNP	ENST00000231021.4	37	c.758C>A	CCDS3893.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.450893	0.84209	.	.	ENSG00000113100	ENST00000231021	T	0.54675	0.56	5.6	4.72	0.59763	Cadherin (5);Cadherin-like (1);	0.099034	0.64402	D	0.000002	T	0.57315	0.2045	L	0.46614	1.455	0.58432	D	0.999994	D	0.55605	0.972	P	0.53988	0.739	T	0.56226	-0.8014	9	.	.	.	.	13.4158	0.60968	0.0767:0.0:0.9233:0.0	.	253	Q9ULB4	CADH9_HUMAN	K	253	ENSP00000231021:T253K	.	T	-	2	0	CDH9	26941878	1.000000	0.71417	0.988000	0.46212	0.986000	0.74619	4.873000	0.63057	1.496000	0.48567	0.650000	0.86243	ACA		0.458	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207352.1	NM_016279		19	301	1	0	7.07596e-05	0.006122	9.89282e-05	19	301				
NPR3	4883	broad.mit.edu	37	5	32786366	32786366	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr5:32786366G>T	ENST00000265074.8	+	8	1884	c.1541G>T	c.(1540-1542)aGg>aTg	p.R514M	AC026703.1_ENST00000326958.1_5'Flank|NPR3_ENST00000415685.2_Missense_Mutation_p.R297M|NPR3_ENST00000415167.2_Missense_Mutation_p.R513M|NPR3_ENST00000434067.2_Missense_Mutation_p.R298M	NM_000908.3|NM_001204375.1	NP_000899.1|NP_001191304.1	P17342	ANPRC_HUMAN	natriuretic peptide receptor 3	514					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of smooth muscle cell proliferation (GO:0048662)|osteoclast proliferation (GO:0002158)|pancreatic juice secretion (GO:0030157)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of urine volume (GO:0035810)|regulation of blood pressure (GO:0008217)|regulation of osteoblast proliferation (GO:0033688)|skeletal system development (GO:0001501)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	G-protein coupled peptide receptor activity (GO:0008528)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)	p.R514M(2)		autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	24					Nesiritide(DB04899)	ACCATTGAGAGGCGAACCCAG	0.418																																							uc003jhv.2		NA																	2	Substitution - Missense(2)		large_intestine(1)|lung(1)	ovary(1)|central_nervous_system(1)	2						c.(1540-1542)AGG>ATG		natriuretic peptide receptor C/guanylate cyclase	Nesiritide(DB04899)						69.0	65.0	66.0					5																	32786366		1838	4085	5923	SO:0001583	missense	4883				osteoclast proliferation|positive regulation of urine volume|regulation of blood pressure|regulation of osteoblast proliferation|skeletal system development	integral to membrane	hormone binding|natriuretic peptide receptor activity	g.chr5:32786366G>T		CCDS47196.1, CCDS56356.1, CCDS56357.1	5p13.3	2014-03-03	2014-03-03		ENSG00000113389	ENSG00000113389			7945	protein-coding gene	gene with protein product	"""guanylate cyclase C"""	108962	"""chromosome 5 open reading frame 23"", ""atrionatriuretic peptide receptor C"", ""natriuretic peptide receptor C/guanylate cyclase C (atrionatriuretic peptide receptor C)"", ""natriuretic peptide receptor C"""	NPRC, ANPRC, C5orf23		2162522, 1979052	Standard	NM_000908		Approved	GUCY2B, FLJ14054	uc003jhv.3	P17342	OTTHUMG00000150316	ENST00000265074.8:c.1541G>T	5.37:g.32786366G>T	ENSP00000265074:p.Arg514Met		Somatic				NPR3_uc011cnz.1_Missense_Mutation_p.R297M|NPR3_uc003jhu.2_Missense_Mutation_p.R513M|C5orf23_uc003jhw.1_5'Flank	p.R514M	NM_000908	NP_000899	WXS	Illumina HiSeq	Unspecified	P17342	ANPRC_HUMAN			8	1759	+			514			Cytoplasmic (Potential).		A2RRD1|B4DT84|E7EPG9	Missense_Mutation	SNP	ENST00000265074.8	37	c.1541G>T	CCDS56357.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.522105	0.85600	.	.	ENSG00000113389	ENST00000434067;ENST00000415685;ENST00000265074;ENST00000415167	T;T;T;T	0.51325	0.71;0.71;0.71;0.71	6.17	6.17	0.99709	.	0.094270	0.64402	D	0.000001	T	0.59783	0.2219	L	0.27053	0.805	0.58432	D	0.999997	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.996;0.996;0.996	T	0.55127	-0.8189	10	0.40728	T	0.16	-26.1788	20.8794	0.99867	0.0:0.0:1.0:0.0	.	297;514;513	E7EPG9;P17342;Q60I31	.;ANPRC_HUMAN;.	M	298;297;514;513	ENSP00000388408:R298M;ENSP00000402490:R297M;ENSP00000265074:R514M;ENSP00000398028:R513M	ENSP00000265074:R514M	R	+	2	0	NPR3	32822123	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.443000	0.90320	2.941000	0.99782	0.655000	0.94253	AGG		0.418	NPR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317550.3	NM_000908		6	12	1	0	0.00198382	0.001984	0.00237301	6	12				
ADAMTS12	81792	broad.mit.edu	37	5	33546167	33546167	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr5:33546167G>T	ENST00000504830.1	-	22	4778	c.4443C>A	c.(4441-4443)gaC>gaA	p.D1481E	ADAMTS12_ENST00000352040.3_Missense_Mutation_p.D1396E	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	1481	TSP type-1 8. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.D1481E(1)		NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						GTCTTACCAGGTCCCAGTTCC	0.428										HNSCC(64;0.19)																													uc003jia.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9						c.(4441-4443)GAC>GAA		ADAM metallopeptidase with thrombospondin type 1							110.0	97.0	101.0					5																	33546167		2203	4300	6503	SO:0001583	missense	81792				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr5:33546167G>T	AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.4443C>A	5.37:g.33546167G>T	ENSP00000422554:p.Asp1481Glu	HNSCC(64;0.19)	Somatic				ADAMTS12_uc010iuq.1_Missense_Mutation_p.D1396E	p.D1481E	NM_030955	NP_112217	WXS	Illumina HiSeq	Unspecified	P58397	ATS12_HUMAN			22	4606	-			1481			TSP type-1 8.		A2RRN9|A5D6V6|Q6UWL3	Missense_Mutation	SNP	ENST00000504830.1	37	c.4443C>A	CCDS34140.1	.	.	.	.	.	.	.	.	.	.	G	7.731	0.699185	0.15106	.	.	ENSG00000151388	ENST00000504830;ENST00000352040	T;T	0.51574	0.7;0.7	5.36	-1.66	0.08265	.	0.768798	0.13054	N	0.417478	T	0.17323	0.0416	N	0.03224	-0.385	0.58432	D	0.999995	B;B	0.06786	0.001;0.001	B;B	0.10450	0.003;0.005	T	0.09378	-1.0677	10	0.33940	T	0.23	.	0.821	0.01111	0.3085:0.3034:0.2339:0.1542	.	1396;1481	P58397-3;P58397	.;ATS12_HUMAN	E	1481;1396	ENSP00000422554:D1481E;ENSP00000344847:D1396E	ENSP00000344847:D1396E	D	-	3	2	ADAMTS12	33581924	0.125000	0.22332	0.951000	0.38953	0.304000	0.27724	0.510000	0.22723	-0.198000	0.10333	-0.122000	0.15005	GAC		0.428	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367164.2	NM_030955		11	144	1	0	2.80697e-09	0.000978	5.17757e-09	11	144				
RAI14	26064	broad.mit.edu	37	5	34823639	34823639	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr5:34823639G>T	ENST00000265109.3	+	15	1979	c.1692G>T	c.(1690-1692)gaG>gaT	p.E564D	RAI14_ENST00000515799.1_Missense_Mutation_p.E567D|RAI14_ENST00000503673.1_Missense_Mutation_p.E564D|RAI14_ENST00000397449.1_Missense_Mutation_p.E557D|RAI14_ENST00000512629.1_Missense_Mutation_p.E535D|RAI14_ENST00000428746.2_Missense_Mutation_p.E564D|RAI14_ENST00000506376.1_Missense_Mutation_p.E556D	NM_001145522.1|NM_015577.2	NP_001138994.1|NP_056392.2	Q9P0K7	RAI14_HUMAN	retinoic acid induced 14	564						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)		p.E564D(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(19)|lung(22)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	56	all_lung(31;0.000191)					tagagagggagaaagGTACAG	0.358																																							uc003jir.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1690-1692)GAG>GAT		retinoic acid induced 14 isoform a							51.0	51.0	51.0					5																	34823639		2203	4300	6503	SO:0001583	missense	26064					cell cortex|cytoskeleton	protein binding	g.chr5:34823639G>T	AB037755	CCDS34142.1, CCDS54837.1, CCDS54838.1, CCDS54839.1	5p13.3-p13.2	2013-01-10			ENSG00000039560	ENSG00000039560		"""Ankyrin repeat domain containing"""	14873	protein-coding gene	gene with protein product	"""novel retinal pigment epithelial"""	606586				11042181	Standard	NM_015577		Approved	NORPEG, KIAA1334, RAI13, DKFZp564G013	uc011coj.2	Q9P0K7	OTTHUMG00000162019	ENST00000265109.3:c.1692G>T	5.37:g.34823639G>T	ENSP00000265109:p.Glu564Asp		Somatic				RAI14_uc010iur.2_Missense_Mutation_p.E535D|RAI14_uc011coj.1_Missense_Mutation_p.E564D|RAI14_uc003jis.2_Missense_Mutation_p.E567D|RAI14_uc003jit.2_Missense_Mutation_p.E564D|RAI14_uc011cok.1_Missense_Mutation_p.E556D	p.E564D	NM_015577	NP_056392	WXS	Illumina HiSeq	Unspecified	Q9P0K7	RAI14_HUMAN			15	1888	+	all_lung(31;0.000191)		564			Potential.		E9PED3|Q6V1W9|Q7Z5I4|Q7Z733|Q9P2L2|Q9Y3T5	Missense_Mutation	SNP	ENST00000265109.3	37	c.1692G>T	CCDS34142.1	.	.	.	.	.	.	.	.	.	.	G	8.868	0.948619	0.18356	.	.	ENSG00000039560	ENST00000265109;ENST00000512629;ENST00000428746;ENST00000503673;ENST00000515799;ENST00000506376;ENST00000397449	T;T;T;T;T;T;T	0.38722	1.17;1.12;1.17;1.17;1.17;1.21;1.2	5.42	2.63	0.31362	.	.	.	.	.	T	0.48502	0.1503	L	0.29908	0.895	0.09310	N	1	D;D;D;D	0.71674	0.998;0.997;0.997;0.997	D;D;P;D	0.77557	0.99;0.978;0.826;0.978	T	0.27088	-1.0084	9	0.59425	D	0.04	-11.7116	8.3353	0.32211	0.3637:0.0:0.6363:0.0	.	556;535;567;564	Q9P0K7-3;E9PED3;Q9P0K7-2;Q9P0K7	.;.;.;RAI14_HUMAN	D	564;535;564;564;567;556;557	ENSP00000265109:E564D;ENSP00000422377:E535D;ENSP00000388725:E564D;ENSP00000422942:E564D;ENSP00000427123:E567D;ENSP00000423854:E556D;ENSP00000380591:E557D	ENSP00000265109:E564D	E	+	3	2	RAI14	34859396	0.884000	0.30299	0.066000	0.19879	0.296000	0.27459	1.346000	0.33964	0.648000	0.30732	0.555000	0.69702	GAG		0.358	RAI14-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366786.1	NM_015577		8	101	1	0	1.26484e-09	0.00308	2.35283e-09	8	101				
NIPBL	25836	broad.mit.edu	37	5	36955648	36955648	+	Missense_Mutation	SNP	G	G	C			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr5:36955648G>C	ENST00000282516.8	+	3	638	c.139G>C	c.(139-141)Gca>Cca	p.A47P	NIPBL_ENST00000448238.2_Missense_Mutation_p.A47P	NM_015384.4|NM_133433.3	NP_056199.2|NP_597677.2	Q6KC79	NIPBL_HUMAN	Nipped-B homolog (Drosophila)	47					brain development (GO:0007420)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to X-ray (GO:0071481)|cognition (GO:0050890)|developmental growth (GO:0048589)|ear morphogenesis (GO:0042471)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|external genitalia morphogenesis (GO:0035261)|eye morphogenesis (GO:0048592)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|gall bladder development (GO:0061010)|heart morphogenesis (GO:0003007)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|metanephros development (GO:0001656)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of ossification (GO:0045778)|regulation of developmental growth (GO:0048638)|regulation of embryonic development (GO:0045995)|regulation of hair cycle (GO:0042634)|sensory perception of sound (GO:0007605)|stem cell maintenance (GO:0019827)|uterus morphogenesis (GO:0061038)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|histone deacetylase binding (GO:0042826)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)	p.A47P(2)		autonomic_ganglia(1)|breast(4)|endometrium(9)|kidney(22)|large_intestine(21)|liver(1)|lung(47)|ovary(7)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	128	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			TGCACGAATAGCAGAAGAGGT	0.413																																							uc003jkl.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|lung(2)|large_intestine(1)|breast(1)|kidney(1)	9						c.(139-141)GCA>CCA		delangin isoform A							138.0	127.0	130.0					5																	36955648		2203	4300	6503	SO:0001583	missense	25836				brain development|cellular protein localization|cellular response to X-ray|cognition|developmental growth|ear morphogenesis|embryonic arm morphogenesis|embryonic digestive tract morphogenesis|external genitalia morphogenesis|eye morphogenesis|face morphogenesis|gall bladder development|maintenance of mitotic sister chromatid cohesion|metanephros development|negative regulation of transcription from RNA polymerase II promoter|outflow tract morphogenesis|positive regulation of histone deacetylation|regulation of developmental growth|regulation of embryonic development|regulation of hair cycle|response to DNA damage stimulus|sensory perception of sound|uterus morphogenesis	SMC loading complex	chromo shadow domain binding|histone deacetylase binding|protein C-terminus binding|protein N-terminus binding	g.chr5:36955648G>C	AB019494	CCDS3920.1, CCDS47198.1	5p13.2	2009-08-28			ENSG00000164190	ENSG00000164190			28862	protein-coding gene	gene with protein product	"""sister chromatid cohesion 2 homolog (yeast)"""	608667				15146186, 15146185	Standard	NM_133433		Approved	IDN3, DKFZp434L1319, FLJ11203, FLJ12597, FLJ13354, FLJ13648, Scc2	uc003jkl.4	Q6KC79	OTTHUMG00000090795	ENST00000282516.8:c.139G>C	5.37:g.36955648G>C	ENSP00000282516:p.Ala47Pro		Somatic				NIPBL_uc003jkk.3_Missense_Mutation_p.A47P	p.A47P	NM_133433	NP_597677	WXS	Illumina HiSeq	Unspecified	Q6KC79	NIPBL_HUMAN	Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)		3	638	+	all_lung(31;0.000447)|Hepatocellular(1;0.108)		47					Q6KCD6|Q6N080|Q6ZT92|Q7Z2E6|Q8N4M5|Q9Y6Y3|Q9Y6Y4	Missense_Mutation	SNP	ENST00000282516.8	37	c.139G>C	CCDS3920.1	.	.	.	.	.	.	.	.	.	.	G	29.5	5.010781	0.93346	.	.	ENSG00000164190	ENST00000282516;ENST00000448238	D;D	0.97378	-4.34;-4.36	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	D	0.98112	0.9377	M	0.66297	2.02	0.50171	D	0.999855	D;D	0.76494	0.997;0.999	D;D	0.69654	0.923;0.965	D	0.98855	1.0760	10	0.66056	D	0.02	.	19.2931	0.94110	0.0:0.0:1.0:0.0	.	47;47	Q6KC79;Q6KC79-2	NIPBL_HUMAN;.	P	47	ENSP00000282516:A47P;ENSP00000406266:A47P	ENSP00000282516:A47P	A	+	1	0	NIPBL	36991405	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.292000	0.72725	2.567000	0.86603	0.585000	0.79938	GCA		0.413	NIPBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207582.1	NM_015384		60	172	0	0	0	0.00361	0	60	172				
NIPBL	25836	broad.mit.edu	37	5	37049220	37049220	+	Missense_Mutation	SNP	A	A	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr5:37049220A>T	ENST00000282516.8	+	40	7270	c.6771A>T	c.(6769-6771)aaA>aaT	p.K2257N	NIPBL_ENST00000448238.2_Missense_Mutation_p.K2257N	NM_015384.4|NM_133433.3	NP_056199.2|NP_597677.2	Q6KC79	NIPBL_HUMAN	Nipped-B homolog (Drosophila)	2257					brain development (GO:0007420)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to X-ray (GO:0071481)|cognition (GO:0050890)|developmental growth (GO:0048589)|ear morphogenesis (GO:0042471)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|external genitalia morphogenesis (GO:0035261)|eye morphogenesis (GO:0048592)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|gall bladder development (GO:0061010)|heart morphogenesis (GO:0003007)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|metanephros development (GO:0001656)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of ossification (GO:0045778)|regulation of developmental growth (GO:0048638)|regulation of embryonic development (GO:0045995)|regulation of hair cycle (GO:0042634)|sensory perception of sound (GO:0007605)|stem cell maintenance (GO:0019827)|uterus morphogenesis (GO:0061038)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|histone deacetylase binding (GO:0042826)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)	p.K2257N(2)		autonomic_ganglia(1)|breast(4)|endometrium(9)|kidney(22)|large_intestine(21)|liver(1)|lung(47)|ovary(7)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	128	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			TAGGGAAGAAAGTTGCAAAAC	0.358																																							uc003jkl.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|lung(2)|large_intestine(1)|breast(1)|kidney(1)	9						c.(6769-6771)AAA>AAT		delangin isoform A							140.0	137.0	138.0					5																	37049220		2203	4300	6503	SO:0001583	missense	25836				brain development|cellular protein localization|cellular response to X-ray|cognition|developmental growth|ear morphogenesis|embryonic arm morphogenesis|embryonic digestive tract morphogenesis|external genitalia morphogenesis|eye morphogenesis|face morphogenesis|gall bladder development|maintenance of mitotic sister chromatid cohesion|metanephros development|negative regulation of transcription from RNA polymerase II promoter|outflow tract morphogenesis|positive regulation of histone deacetylation|regulation of developmental growth|regulation of embryonic development|regulation of hair cycle|response to DNA damage stimulus|sensory perception of sound|uterus morphogenesis	SMC loading complex	chromo shadow domain binding|histone deacetylase binding|protein C-terminus binding|protein N-terminus binding	g.chr5:37049220A>T	AB019494	CCDS3920.1, CCDS47198.1	5p13.2	2009-08-28			ENSG00000164190	ENSG00000164190			28862	protein-coding gene	gene with protein product	"""sister chromatid cohesion 2 homolog (yeast)"""	608667				15146186, 15146185	Standard	NM_133433		Approved	IDN3, DKFZp434L1319, FLJ11203, FLJ12597, FLJ13354, FLJ13648, Scc2	uc003jkl.4	Q6KC79	OTTHUMG00000090795	ENST00000282516.8:c.6771A>T	5.37:g.37049220A>T	ENSP00000282516:p.Lys2257Asn		Somatic				NIPBL_uc003jkk.3_Missense_Mutation_p.K2257N|NIPBL_uc003jkn.2_5'Flank	p.K2257N	NM_133433	NP_597677	WXS	Illumina HiSeq	Unspecified	Q6KC79	NIPBL_HUMAN	Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)		40	7270	+	all_lung(31;0.000447)|Hepatocellular(1;0.108)		2257			HEAT 4.		Q6KCD6|Q6N080|Q6ZT92|Q7Z2E6|Q8N4M5|Q9Y6Y3|Q9Y6Y4	Missense_Mutation	SNP	ENST00000282516.8	37	c.6771A>T	CCDS3920.1	.	.	.	.	.	.	.	.	.	.	A	11.76	1.735006	0.30774	.	.	ENSG00000164190	ENST00000282516;ENST00000448238	D;D	0.94232	-3.38;-3.38	5.55	3.21	0.36854	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.88411	0.6429	L	0.39898	1.24	0.54753	D	0.999981	B;B	0.28801	0.223;0.176	B;B	0.29267	0.1;0.091	T	0.82735	-0.0310	10	0.54805	T	0.06	-14.8442	7.6415	0.28296	0.7592:0.0:0.2408:0.0	.	2257;2257	Q6KC79;Q6KC79-2	NIPBL_HUMAN;.	N	2257	ENSP00000282516:K2257N;ENSP00000406266:K2257N	ENSP00000282516:K2257N	K	+	3	2	NIPBL	37084977	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	1.470000	0.35354	0.418000	0.25898	-0.334000	0.08254	AAA		0.358	NIPBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207582.1	NM_015384		23	239	0	0	0	0.00333	0	23	239				
FYB	2533	broad.mit.edu	37	5	39134975	39134975	+	Silent	SNP	T	T	G			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr5:39134975T>G	ENST00000351578.6	-	8	1847	c.1657A>C	c.(1657-1659)Aga>Cga	p.R553R	FYB_ENST00000512982.1_Silent_p.R553R|FYB_ENST00000540520.1_Silent_p.R563R|FYB_ENST00000505428.1_Silent_p.R553R|FYB_ENST00000515010.1_Silent_p.R553R	NM_199335.3	NP_955367.1	O15117	FYB_HUMAN	FYN binding protein	553	SH3.				immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|NLS-bearing protein import into nucleus (GO:0006607)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|T cell receptor signaling pathway (GO:0050852)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	receptor binding (GO:0005102)	p.R553R(3)|p.R563R(1)		endometrium(2)|kidney(4)|large_intestine(6)|liver(1)|lung(29)|ovary(2)|upper_aerodigestive_tract(1)	45	all_lung(31;0.000343)		Epithelial(62;0.235)			CTTGCTGTTCTGCCCAACCAT	0.423																																							uc003jls.2		NA																	4	Substitution - coding silent(4)		lung(4)	ovary(2)	2						c.(1657-1659)AGA>CGA		FYN binding protein (FYB-120/130) isoform 2							186.0	174.0	177.0					5																	39134975		1897	4136	6033	SO:0001819	synonymous_variant	2533				cell junction assembly|immune response|intracellular protein kinase cascade|NLS-bearing substrate import into nucleus|protein phosphorylation|T cell receptor signaling pathway	cytosol|nucleus	protein binding	g.chr5:39134975T>G	U93049	CCDS47200.1, CCDS54848.1	5p13.1	2012-05-04	2010-05-04		ENSG00000082074	ENSG00000082074			4036	protein-coding gene	gene with protein product		602731	"""FYN-binding protein (FYB-120/130)"""			9115214, 9207119	Standard	NM_001465		Approved	SLAP-130, FYB-120/130	uc011cpl.2	O15117	OTTHUMG00000162071	ENST00000351578.6:c.1657A>C	5.37:g.39134975T>G			Somatic				FYB_uc003jlt.2_Silent_p.R553R|FYB_uc003jlu.2_Silent_p.R553R|FYB_uc011cpl.1_Silent_p.R563R	p.R553R	NM_199335	NP_955367	WXS	Illumina HiSeq	Unspecified	O15117	FYB_HUMAN	Epithelial(62;0.235)		7	1724	-	all_lung(31;0.000343)		553			SH3.		A8K2Y8|B4DLN2|E9PBV9|O00359|Q9NZI9	Silent	SNP	ENST00000351578.6	37	c.1657A>C	CCDS47200.1																																																																																				0.423	FYB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000367098.1	NM_001465		14	110	0	0	0	0.00245	0	14	110				
ZNF366	167465	broad.mit.edu	37	5	71756814	71756814	+	Silent	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr5:71756814C>A	ENST00000318442.5	-	2	1000	c.510G>T	c.(508-510)ctG>ctT	p.L170L		NM_152625.1	NP_689838.1	Q8N895	ZN366_HUMAN	zinc finger protein 366	170					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|estrogen receptor binding (GO:0030331)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)	p.L170L(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	35		Lung NSC(167;0.0247)|Ovarian(174;0.0908)|Prostate(461;0.155)		OV - Ovarian serous cystadenocarcinoma(47;2.51e-53)		AGGGCGTGGGCAGGAATGGAG	0.637																																							uc003kce.1		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)|skin(1)	2						c.(508-510)CTG>CTT		zinc finger protein 366							102.0	108.0	106.0					5																	71756814		2203	4300	6503	SO:0001819	synonymous_variant	167465				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr5:71756814C>A	AK097115	CCDS4015.1	5q13.1	2013-01-08			ENSG00000178175	ENSG00000178175		"""Zinc fingers, C2H2-type"""	18316	protein-coding gene	gene with protein product		610159					Standard	NM_152625		Approved	FLJ39796	uc003kce.1	Q8N895	OTTHUMG00000100965	ENST00000318442.5:c.510G>T	5.37:g.71756814C>A			Somatic					p.L170L	NM_152625	NP_689838	WXS	Illumina HiSeq	Unspecified	Q8N895	ZN366_HUMAN		OV - Ovarian serous cystadenocarcinoma(47;2.51e-53)	2	696	-		Lung NSC(167;0.0247)|Ovarian(174;0.0908)|Prostate(461;0.155)	170					Q5HYI9|Q7RTV4	Silent	SNP	ENST00000318442.5	37	c.510G>T	CCDS4015.1																																																																																				0.637	ZNF366-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218574.3			13	107	1	0	0.000308642	0.003163	0.000398511	13	107				
FAM169A	26049	broad.mit.edu	37	5	74100403	74100403	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr5:74100403G>T	ENST00000389156.4	-	8	917	c.827C>A	c.(826-828)cCt>cAt	p.P276H	FAM169A_ENST00000510496.1_Missense_Mutation_p.P216H|FAM169A_ENST00000380515.3_3'UTR	NM_015566.2	NP_056381.1	Q9Y6X4	F169A_HUMAN	family with sequence similarity 169, member A	276						membrane (GO:0016020)|nucleus (GO:0005634)		p.P276H(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(12)|prostate(2)|urinary_tract(1)	27						TCCAGACATAGGTCTTTTAGG	0.368																																							uc003kdm.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(826-828)CCT>CAT		hypothetical protein LOC26049							132.0	121.0	125.0					5																	74100403		1846	4090	5936	SO:0001583	missense	26049							g.chr5:74100403G>T		CCDS43330.1	5q13.3	2008-08-08			ENSG00000198780	ENSG00000198780			29138	protein-coding gene	gene with protein product		615769				10048485	Standard	NM_015566		Approved	KIAA0888	uc003kdm.4	Q9Y6X4	OTTHUMG00000162930	ENST00000389156.4:c.827C>A	5.37:g.74100403G>T	ENSP00000373808:p.Pro276His		Somatic				FAM169A_uc010izm.2_Missense_Mutation_p.P216H|FAM169A_uc003kdl.2_Missense_Mutation_p.P94H	p.P276H	NM_015566	NP_056381	WXS	Illumina HiSeq	Unspecified	Q9Y6X4	F169A_HUMAN			8	870	-			276					A8K1T9|Q6MZT0|Q9H989	Missense_Mutation	SNP	ENST00000389156.4	37	c.827C>A	CCDS43330.1	.	.	.	.	.	.	.	.	.	.	G	15.96	2.985609	0.53934	.	.	ENSG00000198780	ENST00000389156;ENST00000510496	T	0.46451	0.87	5.05	4.1	0.47936	.	1.142290	0.06457	N	0.728835	T	0.37571	0.1008	N	0.24115	0.695	0.22835	N	0.998678	P;P	0.41569	0.755;0.755	P;B	0.46479	0.518;0.346	T	0.20472	-1.0274	10	0.40728	T	0.16	-1.5092	7.5664	0.27881	0.1171:0.0:0.8829:0.0	.	216;276	D6RB01;Q9Y6X4	.;F169A_HUMAN	H	276;216	ENSP00000373808:P276H	ENSP00000373808:P276H	P	-	2	0	FAM169A	74136159	0.084000	0.21492	0.262000	0.24481	0.925000	0.55904	1.108000	0.31123	2.613000	0.88420	0.650000	0.86243	CCT		0.368	FAM169A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371092.2			10	140	1	0	2.27111e-07	0.001368	3.83468e-07	10	140				
MEGF10	84466	broad.mit.edu	37	5	126754829	126754829	+	Silent	SNP	C	C	G			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr5:126754829C>G	ENST00000274473.6	+	12	1590	c.1323C>G	c.(1321-1323)acC>acG	p.T441T	MEGF10_ENST00000508365.1_Silent_p.T441T|MEGF10_ENST00000503335.2_Silent_p.T441T|MEGF10_ENST00000418761.2_Silent_p.T441T	NM_032446.2	NP_115822.1	Q96KG7	MEG10_HUMAN	multiple EGF-like-domains 10	441	Necessary for interaction with AP2M1, self-assembly and formation of the irregular, mosaic-like adhesion pattern.				homotypic cell-cell adhesion (GO:0034109)|muscle cell development (GO:0055001)|recognition of apoptotic cell (GO:0043654)|regulation of muscle cell differentiation (GO:0051147)|regulation of skeletal muscle tissue development (GO:0048641)|skeletal muscle satellite cell activation (GO:0014719)|skeletal muscle satellite cell differentiation (GO:0014816)|skeletal muscle satellite cell proliferation (GO:0014841)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)		p.T441T(1)		breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(28)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	68		Prostate(80;0.165)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0657)|Epithelial(69;0.123)		ACTGCTCTACCCCATGCCCTC	0.448																																							uc003kuh.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)	4						c.(1321-1323)ACC>ACG		multiple EGF-like-domains 10 precursor							230.0	212.0	218.0					5																	126754829		2203	4300	6503	SO:0001819	synonymous_variant	84466				cell adhesion|phagocytosis	basolateral plasma membrane|cell projection|integral to membrane|phagocytic cup		g.chr5:126754829C>G	AK021631	CCDS4142.1	5q33	2008-02-05			ENSG00000145794	ENSG00000145794			29634	protein-coding gene	gene with protein product		612453				11347906	Standard	NM_032446		Approved	KIAA1780	uc003kui.4	Q96KG7	OTTHUMG00000128984	ENST00000274473.6:c.1323C>G	5.37:g.126754829C>G			Somatic				MEGF10_uc010jdc.1_Silent_p.T441T|MEGF10_uc010jdd.1_Silent_p.T441T|MEGF10_uc003kui.3_Silent_p.T441T	p.T441T	NM_032446	NP_115822	WXS	Illumina HiSeq	Unspecified	Q96KG7	MEG10_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0657)|Epithelial(69;0.123)	12	1685	+		Prostate(80;0.165)	441			Extracellular (Potential).|Necessary for interaction with AP2M1, self-assembly and formation of the irregular, mosaic-like adhesion pattern.		Q68DE5|Q8WUL3	Silent	SNP	ENST00000274473.6	37	c.1323C>G	CCDS4142.1																																																																																				0.448	MEGF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250973.2	NM_032446		13	202	0	0	0	0.003163	0	13	202				
MEGF10	84466	broad.mit.edu	37	5	126792950	126792950	+	Silent	SNP	C	C	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr5:126792950C>T	ENST00000274473.6	+	26	3630	c.3363C>T	c.(3361-3363)tcC>tcT	p.S1121S	MEGF10_ENST00000503335.2_Silent_p.S1121S	NM_032446.2	NP_115822.1	Q96KG7	MEG10_HUMAN	multiple EGF-like-domains 10	1121	Necessary for formation of large intracellular vacuoles.|Ser-rich.				homotypic cell-cell adhesion (GO:0034109)|muscle cell development (GO:0055001)|recognition of apoptotic cell (GO:0043654)|regulation of muscle cell differentiation (GO:0051147)|regulation of skeletal muscle tissue development (GO:0048641)|skeletal muscle satellite cell activation (GO:0014719)|skeletal muscle satellite cell differentiation (GO:0014816)|skeletal muscle satellite cell proliferation (GO:0014841)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)		p.S1121S(1)		breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(28)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	68		Prostate(80;0.165)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0657)|Epithelial(69;0.123)		ACAGTTCATCCTCCCCTAAGC	0.532																																							uc003kuh.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)	4						c.(3361-3363)TCC>TCT		multiple EGF-like-domains 10 precursor							119.0	100.0	107.0					5																	126792950		2203	4300	6503	SO:0001819	synonymous_variant	84466				cell adhesion|phagocytosis	basolateral plasma membrane|cell projection|integral to membrane|phagocytic cup		g.chr5:126792950C>T	AK021631	CCDS4142.1	5q33	2008-02-05			ENSG00000145794	ENSG00000145794			29634	protein-coding gene	gene with protein product		612453				11347906	Standard	NM_032446		Approved	KIAA1780	uc003kui.4	Q96KG7	OTTHUMG00000128984	ENST00000274473.6:c.3363C>T	5.37:g.126792950C>T			Somatic				MEGF10_uc003kui.3_Silent_p.S1121S	p.S1121S	NM_032446	NP_115822	WXS	Illumina HiSeq	Unspecified	Q96KG7	MEG10_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0657)|Epithelial(69;0.123)	26	3725	+		Prostate(80;0.165)	1121			Cytoplasmic (Potential).|Necessary for formation of large intracellular vacuoles.|Ser-rich.		Q68DE5|Q8WUL3	Silent	SNP	ENST00000274473.6	37	c.3363C>T	CCDS4142.1																																																																																				0.532	MEGF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250973.2	NM_032446		6	30	0	0	0	0.00308	0	6	30				
SEC24A	10802	broad.mit.edu	37	5	134002584	134002584	+	Missense_Mutation	SNP	C	C	T	rs375080345		TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr5:134002584C>T	ENST00000398844.2	+	3	925	c.637C>T	c.(637-639)Cct>Tct	p.P213S	SEC24A_ENST00000322887.4_Missense_Mutation_p.P213S	NM_021982.2	NP_068817.1	O95486	SC24A_HUMAN	SEC24 family member A	213	Pro-rich.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|positive regulation of cholesterol homeostasis (GO:2000189)|positive regulation of protein secretion (GO:0050714)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045714)|small molecule metabolic process (GO:0044281)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	zinc ion binding (GO:0008270)	p.P213S(1)		NS(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(13)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	36			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TCATGGGCCCCCTCCAGCTGG	0.522																																							uc003kzs.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(637-639)CCT>TCT		SEC24 related gene family, member A		C	SER/PRO	0,3616		0,0,1808	61.0	64.0	63.0		637	4.9	1.0	5		63	1,8157		0,1,4078	no	missense	SEC24A	NM_021982.1	74	0,1,5886	TT,TC,CC		0.0123,0.0,0.0085	probably-damaging	213/1094	134002584	1,11773	1808	4079	5887	SO:0001583	missense	10802				COPII vesicle coating|intracellular protein transport|post-translational protein modification|protein N-linked glycosylation via asparagine	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|Golgi membrane|perinuclear region of cytoplasm	zinc ion binding	g.chr5:134002584C>T	AJ131244	CCDS43363.1, CCDS58967.1	5q31.1	2013-10-21	2013-10-21		ENSG00000113615	ENSG00000113615			10703	protein-coding gene	gene with protein product		607183	"""SEC24 (S. cerevisiae) related gene family, member A"", ""SEC24 family, member A (S. cerevisiae)"""			10075675, 10329445	Standard	NM_021982		Approved		uc003kzs.3	O95486	OTTHUMG00000163064	ENST00000398844.2:c.637C>T	5.37:g.134002584C>T	ENSP00000381823:p.Pro213Ser		Somatic				SEC24A_uc011cxu.1_5'UTR	p.P213S	NM_021982	NP_068817	WXS	Illumina HiSeq	Unspecified	O95486	SC24A_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		3	925	+			213			Pro-rich.		A8MVW3|Q8WUV2|Q96GP7	Missense_Mutation	SNP	ENST00000398844.2	37	c.637C>T	CCDS43363.1	.	.	.	.	.	.	.	.	.	.	C	16.32	3.089983	0.55968	0.0	1.23E-4	ENSG00000113615	ENST00000398844;ENST00000322887	D;D	0.96685	-4.09;-4.09	4.94	4.94	0.65067	.	0.146052	0.47093	D	0.000248	D	0.95661	0.8589	L	0.48642	1.525	0.58432	D	0.999998	D	0.53619	0.961	P	0.49637	0.617	D	0.95856	0.8879	10	0.56958	D	0.05	-16.2937	16.7049	0.85369	0.0:1.0:0.0:0.0	.	213	O95486	SC24A_HUMAN	S	213	ENSP00000381823:P213S;ENSP00000321749:P213S	ENSP00000321749:P213S	P	+	1	0	SEC24A	134030483	0.999000	0.42202	0.991000	0.47740	0.144000	0.21451	5.073000	0.64395	2.428000	0.82296	0.603000	0.83216	CCT		0.522	SEC24A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371563.1			9	83	0	0	0	0.000978	0	9	83				
PCDHA2	56146	broad.mit.edu	37	5	140175994	140175994	+	Missense_Mutation	SNP	C	C	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr5:140175994C>T	ENST00000526136.1	+	1	1445	c.1445C>T	c.(1444-1446)gCg>gTg	p.A482V	PCDHA1_ENST00000504120.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA2_ENST00000520672.2_Missense_Mutation_p.A482V|PCDHA2_ENST00000378132.1_Missense_Mutation_p.A482V	NM_018905.2	NP_061728.1	Q9Y5H9	PCDA2_HUMAN	protocadherin alpha 2	482	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.A482V(2)		NS(1)|breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(16)|lung(26)|ovary(4)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCGTGGGATGCGGACGCGCAG	0.657																																							uc003lhd.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)	4						c.(1444-1446)GCG>GTG		protocadherin alpha 2 isoform 1 precursor							73.0	75.0	74.0					5																	140175994		2203	4300	6503	SO:0001583	missense	56146				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding	g.chr5:140175994C>T	AF152480	CCDS54914.1, CCDS64269.1	5q31	2010-11-26				ENSG00000204969		"""Cadherins / Protocadherins : Clustered"""	8668	other	complex locus constituent	"""KIAA0345-like 12"""	606308				10380929	Standard	NM_018905		Approved			Q9Y5H9		ENST00000526136.1:c.1445C>T	5.37:g.140175994C>T	ENSP00000431748:p.Ala482Val		Somatic				PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhc.1_Missense_Mutation_p.A482V|PCDHA2_uc011czy.1_Missense_Mutation_p.A482V	p.A482V	NM_018905	NP_061728	WXS	Illumina HiSeq	Unspecified	Q9Y5H9	PCDA2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1551	+			482			Cadherin 5.|Extracellular (Potential).		O75287|Q9BTV3	Missense_Mutation	SNP	ENST00000526136.1	37	c.1445C>T	CCDS54914.1	.	.	.	.	.	.	.	.	.	.	N	5.048	0.194525	0.09599	.	.	ENSG00000204969	ENST00000520672;ENST00000378132;ENST00000526136	T;T;T	0.61627	0.09;0.09;0.09	3.94	1.07	0.20283	Cadherin (4);Cadherin-like (1);	0.984890	0.08216	N	0.979935	T	0.52917	0.1764	L	0.47190	1.495	0.09310	N	1	B;B;B	0.33549	0.414;0.417;0.135	B;B;B	0.36504	0.152;0.226;0.098	T	0.49943	-0.8885	10	0.66056	D	0.02	.	10.122	0.42627	0.0:0.7574:0.0:0.2426	.	482;482;482	Q9Y5H9-3;Q9Y5H9;Q9Y5H9-2	.;PCDA2_HUMAN;.	V	482	ENSP00000430584:A482V;ENSP00000367372:A482V;ENSP00000431748:A482V	ENSP00000367372:A482V	A	+	2	0	PCDHA2	140156178	0.000000	0.05858	0.902000	0.35471	0.112000	0.19704	1.076000	0.30729	0.254000	0.21573	-0.208000	0.12717	GCG		0.657	PCDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372877.3	NM_018905		3	54	0	0	0	0.004672	0	3	54				
PCDHA3	56145	broad.mit.edu	37	5	140181956	140181956	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr5:140181956C>A	ENST00000522353.2	+	1	1174	c.1174C>A	c.(1174-1176)Cac>Aac	p.H392N	PCDHA1_ENST00000504120.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA2_ENST00000520672.2_Intron|PCDHA3_ENST00000532566.2_Missense_Mutation_p.H392N	NM_018906.2	NP_061729.1	Q9Y5H8	PCDA3_HUMAN	protocadherin alpha 3	392	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.H392N(2)		NS(1)|breast(1)|endometrium(16)|kidney(3)|large_intestine(19)|lung(36)|ovary(7)|prostate(8)|skin(3)|stomach(1)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCTGACGCCCCACGTCCCCTT	0.567																																							uc003lhf.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(6)|skin(2)	8						c.(1174-1176)CAC>AAC		protocadherin alpha 3 isoform 1 precursor							130.0	119.0	123.0					5																	140181956		2203	4300	6503	SO:0001583	missense	56145				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding	g.chr5:140181956C>A	AF152481	CCDS54915.1	5q31	2010-11-26				ENSG00000255408		"""Cadherins / Protocadherins : Clustered"""	8669	other	complex locus constituent	"""KIAA0345-like 11"""	606309				10380929	Standard	NM_018906		Approved	PCDH-ALPHA3		Q9Y5H8		ENST00000522353.2:c.1174C>A	5.37:g.140181956C>A	ENSP00000429808:p.His392Asn		Somatic				PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA2_uc011czy.1_Intron|PCDHA3_uc011czz.1_Missense_Mutation_p.H392N	p.H392N	NM_018906	NP_061729	WXS	Illumina HiSeq	Unspecified	Q9Y5H8	PCDA3_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1174	+			392			Cadherin 4.|Extracellular (Potential).		O75286	Missense_Mutation	SNP	ENST00000522353.2	37	c.1174C>A	CCDS54915.1	.	.	.	.	.	.	.	.	.	.	c	0.340	-0.950953	0.02285	.	.	ENSG00000255408	ENST00000522353;ENST00000532566	T;T	0.51325	0.71;0.71	4.79	0.725	0.18242	Cadherin (4);Cadherin-like (1);	0.573326	0.14231	U	0.332715	T	0.15998	0.0385	N	0.00670	-1.27	0.09310	N	1	B;B	0.11235	0.001;0.004	B;B	0.23018	0.01;0.043	T	0.32561	-0.9902	10	0.10902	T	0.67	.	11.1138	0.48249	0.0:0.4261:0.5013:0.0726	.	392;392	Q9Y5H8-2;Q9Y5H8	.;PCDA3_HUMAN	N	392	ENSP00000429808:H392N;ENSP00000434086:H392N	ENSP00000429808:H392N	H	+	1	0	PCDHA3	140162140	0.000000	0.05858	0.000000	0.03702	0.867000	0.49689	-1.512000	0.02258	-0.091000	0.12440	0.467000	0.42956	CAC		0.567	PCDHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372848.2	NM_018906		5	102	1	0	3.59834e-05	0.001168	5.19628e-05	5	102				
PCDHA11	56138	broad.mit.edu	37	5	140249814	140249814	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr5:140249814C>A	ENST00000398640.2	+	1	1126	c.1126C>A	c.(1126-1128)Cgt>Agt	p.R376S	PCDHA4_ENST00000530339.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA7_ENST00000525929.1_Intron	NM_018902.3	NP_061725.1	Q9Y5I1	PCDAB_HUMAN	protocadherin alpha 11	376	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.R376S(1)		breast(1)|lung(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGTGTCTGACCGTGACTCAGG	0.572																																							uc003lia.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(1126-1128)CGT>AGT		protocadherin alpha 11 isoform 1 precursor							100.0	92.0	94.0					5																	140249814		2203	4300	6503	SO:0001583	missense	56138				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding	g.chr5:140249814C>A	AF152476	CCDS47284.1, CCDS75326.1	5q31	2010-11-26			ENSG00000249158	ENSG00000249158		"""Cadherins / Protocadherins : Clustered"""	8665	other	complex locus constituent	"""KIAA0345-like 3"", ""ortholog of mouse CNR7"""	606317		CNRS7		10380929, 10662547	Standard	NM_018902		Approved	CNR7, CRNR7, CNRN7, PCDH-ALPHA11		Q9Y5I1	OTTHUMG00000163369	ENST00000398640.2:c.1126C>A	5.37:g.140249814C>A	ENSP00000381636:p.Arg376Ser		Somatic				PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc011dae.1_Missense_Mutation_p.R376S	p.R376S	NM_018902	NP_061725	WXS	Illumina HiSeq	Unspecified	Q9Y5I1	PCDAB_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1984	+			376			Cadherin 4.|Extracellular (Potential).		B2RN58|O75279	Missense_Mutation	SNP	ENST00000398640.2	37	c.1126C>A	CCDS47284.1	.	.	.	.	.	.	.	.	.	.	C	8.820	0.937401	0.18206	.	.	ENSG00000249158	ENST00000398640	T	0.51071	0.72	5.85	5.85	0.93711	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.58308	0.2113	L	0.52126	1.63	0.24027	N	0.996128	B;B	0.29085	0.016;0.232	B;P	0.45712	0.255;0.491	T	0.57294	-0.7836	9	0.59425	D	0.04	.	15.3805	0.74651	0.14:0.86:0.0:0.0	.	376;376	Q9Y5I1-2;Q9Y5I1	.;PCDAB_HUMAN	S	376	ENSP00000381636:R376S	ENSP00000381636:R376S	R	+	1	0	PCDHA11	140229998	0.000000	0.05858	0.966000	0.40874	0.081000	0.17604	-1.545000	0.02190	2.767000	0.95098	0.563000	0.77884	CGT		0.572	PCDHA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372885.2	NM_018902		12	94	1	0	7.93312e-07	0.00245	1.29949e-06	12	94				
RANBP17	64901	broad.mit.edu	37	5	170640697	170640697	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr5:170640697G>T	ENST00000523189.1	+	21	2458	c.2294G>T	c.(2293-2295)tGt>tTt	p.C765F	RANBP17_ENST00000521759.1_3'UTR	NM_022897.3	NP_075048.1	Q9H2T7	RBP17_HUMAN	RAN binding protein 17	765					mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|nuclear pore (GO:0005643)	GTP binding (GO:0005525)	p.C765F(1)		breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(25)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	50	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			GAGCCAACATGTACAACTCCC	0.418			T	TRD@	ALL																																		uc003mba.2		NA		Dom	yes		5	5q34	64901	T	RAN binding protein 17			L	TRD@		ALL		1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(2293-2295)TGT>TTT		RAN binding protein 17							197.0	184.0	189.0					5																	170640697		2203	4300	6503	SO:0001583	missense	64901				mRNA transport|protein import into nucleus|transmembrane transport	cytoplasm|nuclear pore	GTP binding|protein transporter activity	g.chr5:170640697G>T	AF222747	CCDS34287.1	5q34	2009-01-12			ENSG00000204764	ENSG00000204764			14428	protein-coding gene	gene with protein product		606141				11024021	Standard	NM_022897		Approved		uc003mba.3	Q9H2T7	OTTHUMG00000163203	ENST00000523189.1:c.2294G>T	5.37:g.170640697G>T	ENSP00000427975:p.Cys765Phe		Somatic				RANBP17_uc003mbb.2_Missense_Mutation_p.C90F|RANBP17_uc003mbd.2_Missense_Mutation_p.C128F|RANBP17_uc010jjs.2_RNA	p.C765F	NM_022897	NP_075048	WXS	Illumina HiSeq	Unspecified	Q9H2T7	RBP17_HUMAN	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)		21	2310	+	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	765					Q8IU74	Missense_Mutation	SNP	ENST00000523189.1	37	c.2294G>T	CCDS34287.1	.	.	.	.	.	.	.	.	.	.	G	16.88	3.245302	0.59103	.	.	ENSG00000204764	ENST00000523189;ENST00000534916	T	0.64618	-0.11	5.97	5.97	0.96955	Armadillo-type fold (1);	0.000000	0.64402	D	0.000002	T	0.55049	0.1896	L	0.36672	1.1	0.52501	D	0.999959	P;P	0.39831	0.69;0.69	B;B	0.34873	0.191;0.191	T	0.57900	-0.7731	10	0.52906	T	0.07	-13.0022	20.0338	0.97549	0.0:0.0:1.0:0.0	.	765;765	Q546R4;Q9H2T7	.;RBP17_HUMAN	F	765;195	ENSP00000427975:C765F	ENSP00000427975:C765F	C	+	2	0	RANBP17	170573302	1.000000	0.71417	0.644000	0.29465	0.581000	0.36288	7.994000	0.88315	2.836000	0.97738	0.655000	0.94253	TGT		0.418	RANBP17-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000372036.1	NM_022897		26	232	1	0	2.65835e-16	0.007291	5.63775e-16	26	232				
CDHR2	54825	broad.mit.edu	37	5	176011514	176011514	+	Silent	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr5:176011514C>A	ENST00000510636.1	+	19	2506	c.2232C>A	c.(2230-2232)atC>atA	p.I744I	CDHR2_ENST00000506348.1_Silent_p.I744I|CDHR2_ENST00000261944.5_Silent_p.I744I	NM_001171976.1	NP_001165447.1	Q9BYE9	CDHR2_HUMAN	cadherin-related family member 2	744	Cadherin 7. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|negative regulation of cell growth (GO:0030308)	cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(8)|liver(1)|lung(23)|ovary(3)|prostate(5)|skin(4)|urinary_tract(1)	56						ACTTCATGATCCGAGGCTTGG	0.632																																							uc003mem.1		NA																	0				ovary(2)	2						c.(2230-2232)ATC>ATA		protocadherin LKC precursor							101.0	99.0	100.0					5																	176011514		2203	4300	6503	SO:0001819	synonymous_variant	54825				homophilic cell adhesion|negative regulation of cell growth	apical plasma membrane|cell junction|integral to membrane	calcium ion binding|protein binding	g.chr5:176011514C>A	AB047004	CCDS34297.1	5q35.2	2011-07-01	2010-01-25	2010-01-25		ENSG00000074276		"""Cadherins / Cadherin-related"""	18231	protein-coding gene	gene with protein product	"""protocadherin LKC"""		"""protocadherin 24"""	PCDH24		11082270, 12117771	Standard	NM_001171976		Approved	PC-LKC, FLJ20124, FLJ20383, PCLKC	uc003mem.2	Q9BYE9		ENST00000510636.1:c.2232C>A	5.37:g.176011514C>A			Somatic				CDHR2_uc003men.1_Silent_p.I744I	p.I744I	NM_017675	NP_060145	WXS	Illumina HiSeq	Unspecified	Q9BYE9	CDHR2_HUMAN			19	2298	+			744			Cadherin 7.|Extracellular (Potential).		A1L3U4|A6NC80|Q9NXP8	Silent	SNP	ENST00000510636.1	37	c.2232C>A	CCDS34297.1																																																																																				0.632	CDHR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372201.1	NM_017675		10	138	1	0	0.00185496	0.001855	0.00226202	10	138				
OR2Y1	134083	broad.mit.edu	37	5	180166174	180166174	+	Silent	SNP	G	G	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr5:180166174G>A	ENST00000307832.2	-	1	925	c.885C>T	c.(883-885)gaC>gaT	p.D295D		NM_001001657.1	NP_001001657.1	Q8NGV0	OR2Y1_HUMAN	olfactory receptor, family 2, subfamily Y, member 1	295						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.D295D(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(9)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	20	all_cancers(89;1.25e-05)|all_epithelial(37;4.36e-06)|Renal(175;0.000159)|Lung NSC(126;0.00317)|all_lung(126;0.0041)|Breast(19;0.114)	all_cancers(40;0.0834)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.191)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CCCCCTTCACGTCCTTGTTTC	0.408																																							uc003mmf.1		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)	1						c.(883-885)GAC>GAT		olfactory receptor, family 2, subfamily Y,							91.0	102.0	98.0					5																	180166174		2203	4300	6503	SO:0001819	synonymous_variant	134083				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr5:180166174G>A	AB065676	CCDS34323.1	5q35	2012-08-09			ENSG00000174339	ENSG00000174339		"""GPCR / Class A : Olfactory receptors"""	14837	protein-coding gene	gene with protein product							Standard	NM_001001657		Approved		uc003mmf.1	Q8NGV0	OTTHUMG00000162237	ENST00000307832.2:c.885C>T	5.37:g.180166174G>A			Somatic					p.D295D	NM_001001657	NP_001001657	WXS	Illumina HiSeq	Unspecified	Q8NGV0	OR2Y1_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		1	885	-	all_cancers(89;1.25e-05)|all_epithelial(37;4.36e-06)|Renal(175;0.000159)|Lung NSC(126;0.00317)|all_lung(126;0.0041)|Breast(19;0.114)	all_cancers(40;0.0834)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.191)	295			Cytoplasmic (Potential).		B9EIP1|Q6IFB1|Q96R16	Silent	SNP	ENST00000307832.2	37	c.885C>T	CCDS34323.1																																																																																				0.408	OR2Y1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368059.2	XM_068682		8	231	0	0	0	0.008291	0	8	231				
MGAT1	4245	broad.mit.edu	37	5	180218718	180218718	+	Silent	SNP	A	A	C			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr5:180218718A>C	ENST00000446023.2	-	3	2004	c.1254T>G	c.(1252-1254)ggT>ggG	p.G418G	MGAT1_ENST00000393340.3_Silent_p.G418G|MGAT1_ENST00000307826.4_Silent_p.G418G|MGAT1_ENST00000333055.3_Silent_p.G418G|MGAT1_ENST00000427865.2_Silent_p.G418G	NM_001114617.1|NM_001114618.1	NP_001108089.1|NP_001108090.1	P26572	MGAT1_HUMAN	mannosyl (alpha-1,3-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase	418					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|in utero embryonic development (GO:0001701)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)|UDP-N-acetylglucosamine catabolic process (GO:0006049)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|vesicle (GO:0031982)	acetylglucosaminyltransferase activity (GO:0008375)|alpha-1,3-mannosylglycoprotein 2-beta-N-acetylglucosaminyltransferase activity (GO:0003827)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(2)|lung(7)|ovary(2)|urinary_tract(1)	13	all_cancers(89;1.11e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.0027)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00356)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			AGGTGACAATACCCCGGTAGC	0.612																																							uc003mmg.3		NA																	0				ovary(1)	1						c.(1252-1254)GGT>GGG		mannosyl (alpha-1,3-)-glycoprotein							49.0	52.0	51.0					5																	180218718		2203	4300	6503	SO:0001819	synonymous_variant	4245				post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-1,3-mannosylglycoprotein 2-beta-N-acetylglucosaminyltransferase activity|metal ion binding	g.chr5:180218718A>C	M61829	CCDS4458.1	5q35.3	2013-02-25			ENSG00000131446	ENSG00000131446	2.4.1.101	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7044	protein-coding gene	gene with protein product		160995		MGAT, GLYT1		1827260	Standard	NM_002406		Approved	GNT-1, GLCNAC-TI	uc003mmg.4	P26572	OTTHUMG00000130937	ENST00000446023.2:c.1254T>G	5.37:g.180218718A>C			Somatic				MGAT1_uc010jlf.2_Silent_p.G418G|MGAT1_uc010jlg.2_Silent_p.G418G|MGAT1_uc003mmh.3_Silent_p.G418G|MGAT1_uc010jlh.2_Silent_p.G418G|MGAT1_uc003mmi.3_Silent_p.G418G	p.G418G	NM_002406	NP_002397	WXS	Illumina HiSeq	Unspecified	P26572	MGAT1_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		2	1749	-	all_cancers(89;1.11e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.0027)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00356)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	418			Lumenal (Potential).		A8K404|B3KRU8|D3DWR1|Q6IBE3	Silent	SNP	ENST00000446023.2	37	c.1254T>G	CCDS4458.1																																																																																				0.612	MGAT1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368189.1	NM_001114618		7	26	0	0	0	0.000978	0	7	26				
KLHL31	401265	broad.mit.edu	37	6	53519984	53519984	+	Silent	SNP	T	T	C			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr6:53519984T>C	ENST00000407079.1	-	1	86	c.87A>G	c.(85-87)aaA>aaG	p.K29K	KLHL31_ENST00000370905.3_Silent_p.K29K			Q9H511	KLH31_HUMAN	kelch-like family member 31	29					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)			p.K29K(1)		autonomic_ganglia(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|prostate(3)	20	Lung NSC(77;0.0158)					AAGCATTCAGTTTGTTTAGGG	0.423																																							uc003pcb.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(85-87)AAA>AAG		kelch repeat and BTB (POZ) domain containing 1							91.0	85.0	87.0					6																	53519984		2203	4300	6503	SO:0001819	synonymous_variant	401265				regulation of transcription, DNA-dependent|transcription, DNA-dependent			g.chr6:53519984T>C		CCDS34478.1	6p12.1	2013-09-27	2013-02-22	2007-01-09	ENSG00000124743	ENSG00000124743		"""Kelch-like"", ""BTB/POZ domain containing"""	21353	protein-coding gene	gene with protein product		610749	"""kelch repeat and BTB (POZ) domain containing 1"", ""kelch-like 31 (Drosophila)"""	KBTBD1			Standard	NM_001003760		Approved	bA345L23.2, BKLHD6	uc003pcb.4	Q9H511	OTTHUMG00000014882	ENST00000407079.1:c.87A>G	6.37:g.53519984T>C			Somatic					p.K29K	NM_001003760	NP_001003760	WXS	Illumina HiSeq	Unspecified	Q9H511	KLH31_HUMAN			2	228	-	Lung NSC(77;0.0158)		29					A6N9J2|B2RP49	Silent	SNP	ENST00000407079.1	37	c.87A>G	CCDS34478.1																																																																																				0.423	KLHL31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040965.1	NM_001003760		6	88	0	0	0	0.001168	0	6	88				
GJA10	84694	broad.mit.edu	37	6	90604267	90604267	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr6:90604267C>A	ENST00000369352.1	+	1	80	c.80C>A	c.(79-81)aCc>aAc	p.T27N		NM_032602.1	NP_115991.1	P57773	CXA9_HUMAN	gap junction protein, alpha 10, 62kDa	27					cell communication (GO:0007154)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)		p.T27N(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(10)|lung(17)|ovary(1)|skin(3)|urinary_tract(1)	37		all_cancers(76;5.71e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00527)		BRCA - Breast invasive adenocarcinoma(108;0.0915)		ATCTGGCTGACCATCCTCTTC	0.507																																							uc011eaa.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(79-81)ACC>AAC		gap junction protein, alpha 10							142.0	132.0	136.0					6																	90604267		2203	4300	6503	SO:0001583	missense	84694				synaptic transmission	connexon complex|integral to membrane	gap junction channel activity	g.chr6:90604267C>A	AF296766	CCDS5025.1	6q15-q16	2008-02-05			ENSG00000135355	ENSG00000135355		"""Ion channels / Gap junction proteins (connexins)"""	16995	protein-coding gene	gene with protein product	"""connexin 62"""	611924					Standard	NM_032602		Approved	CX62	uc011eaa.2	Q969M2	OTTHUMG00000015210	ENST00000369352.1:c.80C>A	6.37:g.90604267C>A	ENSP00000358358:p.Thr27Asn		Somatic					p.T27N	NM_032602	NP_115991	WXS	Illumina HiSeq	Unspecified	Q969M2	CXA10_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0915)	1	80	+		all_cancers(76;5.71e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00527)	27			Helical; (Potential).		B2R722|B3KVQ2|Q5TA63|Q96KG0	Missense_Mutation	SNP	ENST00000369352.1	37	c.80C>A	CCDS5025.1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.399290	0.83120	.	.	ENSG00000135355	ENST00000369352	D	0.99176	-5.52	4.79	4.79	0.61399	Connexin, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.99429	0.9798	M	0.89534	3.04	0.58432	D	0.999997	D	0.89917	1.0	D	0.97110	1.0	D	0.98773	1.0729	10	0.87932	D	0	.	18.027	0.89272	0.0:1.0:0.0:0.0	.	27	Q969M2	CXA10_HUMAN	N	27	ENSP00000358358:T27N	ENSP00000358358:T27N	T	+	2	0	GJA10	90660988	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.780000	0.68956	2.507000	0.84556	0.557000	0.71058	ACC		0.507	GJA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041505.1	NM_032602		19	156	1	0	1.33834e-09	0.007413	2.47903e-09	19	156				
EPHA7	2045	broad.mit.edu	37	6	94120814	94120814	+	Silent	SNP	G	G	T	rs373822401		TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr6:94120814G>T	ENST00000369303.4	-	3	421	c.237C>A	c.(235-237)ccC>ccA	p.P79P	EPHA7_ENST00000369297.1_Silent_p.P79P	NM_004440.3	NP_004431.1	Q15375	EPHA7_HUMAN	EPH receptor A7	79	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				brain development (GO:0007420)|branching morphogenesis of a nerve (GO:0048755)|ephrin receptor signaling pathway (GO:0048013)|negative chemotaxis (GO:0050919)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of cell-cell adhesion (GO:0022407)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of protein autophosphorylation (GO:0031952)|retinal ganglion cell axon guidance (GO:0031290)	dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|chemorepellent activity (GO:0045499)|GPI-linked ephrin receptor activity (GO:0005004)|protein tyrosine kinase activity (GO:0004713)	p.P79P(1)		NS(1)|breast(1)|central_nervous_system(7)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|lung(43)|ovary(8)|pancreas(1)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(13)|urinary_tract(1)	112		all_cancers(76;7.47e-10)|Acute lymphoblastic leukemia(125;1.88e-09)|all_hematologic(75;1.75e-07)|all_epithelial(107;3.6e-05)|Lung NSC(302;0.0368)|all_lung(197;0.0509)|Colorectal(196;0.142)		BRCA - Breast invasive adenocarcinoma(108;0.0847)		TGTTTTGGTTGGGCTCCATGA	0.418																																							uc003poe.2		NA																	1	Substitution - coding silent(1)		lung(1)	lung(8)|ovary(7)|upper_aerodigestive_tract(3)|central_nervous_system(3)|skin(3)|large_intestine(2)|stomach(1)|pancreas(1)	28						c.(235-237)CCC>CCA		ephrin receptor EphA7 precursor							110.0	115.0	113.0					6																	94120814		2202	4299	6501	SO:0001819	synonymous_variant	2045					integral to plasma membrane	ATP binding|ephrin receptor activity	g.chr6:94120814G>T	L36642	CCDS5031.1, CCDS75494.1	6q16.3	2013-02-11	2004-10-28		ENSG00000135333	ENSG00000135333		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3390	protein-coding gene	gene with protein product		602190	"""EphA7"""			9267020	Standard	NM_004440		Approved	Hek11	uc003poe.3	Q15375	OTTHUMG00000015228	ENST00000369303.4:c.237C>A	6.37:g.94120814G>T			Somatic				EPHA7_uc003pof.2_Silent_p.P79P|EPHA7_uc011eac.1_Silent_p.P79P|EPHA7_uc003pog.3_Silent_p.P79P	p.P79P	NM_004440	NP_004431	WXS	Illumina HiSeq	Unspecified	Q15375	EPHA7_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0847)	3	478	-		all_cancers(76;7.47e-10)|Acute lymphoblastic leukemia(125;1.88e-09)|all_hematologic(75;1.75e-07)|all_epithelial(107;3.6e-05)|Lung NSC(302;0.0368)|all_lung(197;0.0509)|Colorectal(196;0.142)	79			Extracellular (Potential).		A0AUX7|B2R8W1|B7ZLJ9|B7ZLK0|Q59G40|Q5VTU0|Q8N368|Q9H124	Silent	SNP	ENST00000369303.4	37	c.237C>A	CCDS5031.1																																																																																				0.418	EPHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041545.1			13	179	1	0	1.36491e-13	0.001855	2.77405e-13	13	179				
BCLAF1	9774	broad.mit.edu	37	6	136597201	136597201	+	Missense_Mutation	SNP	T	T	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr6:136597201T>A	ENST00000531224.1	-	5	1714	c.1462A>T	c.(1462-1464)Ata>Tta	p.I488L	BCLAF1_ENST00000530767.1_Intron|BCLAF1_ENST00000527536.1_Missense_Mutation_p.I488L|BCLAF1_ENST00000527759.1_Missense_Mutation_p.I486L|BCLAF1_ENST00000392348.2_Missense_Mutation_p.I486L|BCLAF1_ENST00000353331.4_Missense_Mutation_p.I486L	NM_001077441.1|NM_014739.2	NP_001070909.1|NP_055554.1	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1	488					apoptotic process (GO:0006915)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA-templated transcription, initiation (GO:2000144)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of response to DNA damage stimulus (GO:2001022)|regulation of DNA-templated transcription in response to stress (GO:0043620)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.I488L(1)		haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|ovary(1)|skin(1)	9	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		TTTACTGTTATTCTTTCAGAA	0.363																																					Colon(142;1534 1789 5427 7063 28491)	Colon(142;1534 1789 5427 7063 28491)	uc003qgx.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1462-1464)ATA>TTA		BCL2-associated transcription factor 1 isoform							166.0	173.0	170.0					6																	136597201		2203	4300	6503	SO:0001583	missense	9774				induction of apoptosis|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding	g.chr6:136597201T>A	AF249273	CCDS5177.1, CCDS47485.1, CCDS47486.1, CCDS75525.1	6q22-q23	2007-03-02			ENSG00000029363	ENSG00000029363			16863	protein-coding gene	gene with protein product		612588				8724849, 10330179	Standard	NM_001077440		Approved	KIAA0164, BTF	uc003qgx.1	Q9NYF8	OTTHUMG00000033323	ENST00000531224.1:c.1462A>T	6.37:g.136597201T>A	ENSP00000435210:p.Ile488Leu		Somatic				BCLAF1_uc003qgw.1_Intron|BCLAF1_uc003qgy.1_Missense_Mutation_p.I486L|BCLAF1_uc011edc.1_Intron|BCLAF1_uc011edd.1_RNA|BCLAF1_uc011ede.1_Missense_Mutation_p.I486L	p.I488L	NM_014739	NP_055554	WXS	Illumina HiSeq	Unspecified	Q9NYF8	BCLF1_HUMAN		GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)	5	1715	-	Colorectal(23;0.24)		488					A2RU75|B7ZM58|E1P586|Q14673|Q86WU6|Q86WY0	Missense_Mutation	SNP	ENST00000531224.1	37	c.1462A>T	CCDS5177.1	.	.	.	.	.	.	.	.	.	.	T	5.989	0.366429	0.11352	.	.	ENSG00000029363	ENST00000531224;ENST00000353331;ENST00000527536;ENST00000527759;ENST00000392348;ENST00000529826	T;T;T;T;T;T	0.13778	2.56;2.56;2.56;2.56;2.56;2.56	5.22	5.22	0.72569	.	0.083362	0.51477	D	0.000089	T	0.03095	0.0091	N	0.22421	0.69	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.001	T	0.33548	-0.9864	10	0.11485	T	0.65	-9.6625	10.516	0.44889	0.0:0.0:0.2725:0.7275	.	486;486;488	Q9NYF8-2;Q9NYF8-3;Q9NYF8	.;.;BCLF1_HUMAN	L	488;486;488;486;486;488	ENSP00000435210:I488L;ENSP00000229446:I486L;ENSP00000435441:I488L;ENSP00000434826:I486L;ENSP00000376159:I486L;ENSP00000431734:I488L	ENSP00000229446:I486L	I	-	1	0	BCLAF1	136638894	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.689000	0.46993	2.124000	0.65301	0.373000	0.22412	ATA		0.363	BCLAF1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042375.2	NM_014739		17	355	0	0	0	0.007413	0	17	355				
CCDC28A	25901	broad.mit.edu	37	6	139097279	139097279	+	Missense_Mutation	SNP	A	A	G			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr6:139097279A>G	ENST00000332797.6	+	2	447	c.292A>G	c.(292-294)Agg>Ggg	p.R98G		NM_015439.2	NP_056254.1	Q8IWP9	CC28A_HUMAN	coiled-coil domain containing 28A	98								p.R98G(1)		autonomic_ganglia(1)|large_intestine(3)|lung(8)|ovary(1)	13				OV - Ovarian serous cystadenocarcinoma(155;0.000201)|GBM - Glioblastoma multiforme(68;0.000306)		GAAAGTGAAGAGGAGGAGTCC	0.403																																							uc003qie.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(292-294)AGG>GGG		coiled-coil domain containing 28A							122.0	118.0	119.0					6																	139097279		2203	4300	6503	SO:0001583	missense	25901							g.chr6:139097279A>G	AY167571	CCDS5192.1	6q23.1-q24.1	2008-02-05	2005-09-12	2005-09-12	ENSG00000024862	ENSG00000024862			21098	protein-coding gene	gene with protein product		615353	"""chromosome 6 open reading frame 80"""	C6orf80			Standard	NM_015439		Approved	CCRL1AP, DKFZp586D0623	uc003qie.3	Q8IWP9	OTTHUMG00000015683	ENST00000332797.6:c.292A>G	6.37:g.139097279A>G	ENSP00000332716:p.Arg98Gly		Somatic				uc003qid.1_5'Flank	p.R98G	NM_015439	NP_056254	WXS	Illumina HiSeq	Unspecified	Q8IWP9	CC28A_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;0.000201)|GBM - Glioblastoma multiforme(68;0.000306)	2	447	+			98					E1P591|Q32NC7|Q66K67|Q96E23|Q9Y430	Missense_Mutation	SNP	ENST00000332797.6	37	c.292A>G	CCDS5192.1	.	.	.	.	.	.	.	.	.	.	A	21.4	4.140648	0.77775	.	.	ENSG00000024862	ENST00000332797	T	0.31247	1.5	5.57	4.36	0.52297	.	0.000000	0.85682	D	0.000000	T	0.40595	0.1123	M	0.64170	1.965	0.58432	D	0.999997	D	0.76494	0.999	D	0.80764	0.994	T	0.42120	-0.9470	10	0.87932	D	0	-19.2	12.446	0.55651	0.8597:0.1403:0.0:0.0	.	98	Q8IWP9	CC28A_HUMAN	G	98	ENSP00000332716:R98G	ENSP00000332716:R98G	R	+	1	2	CCDC28A	139138972	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.275000	0.58927	0.896000	0.36366	0.459000	0.35465	AGG		0.403	CCDC28A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042444.1	NM_015439		22	101	0	0	0	0.002299	0	22	101				
SYNE1	23345	broad.mit.edu	37	6	152725441	152725441	+	Silent	SNP	A	A	C			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr6:152725441A>C	ENST00000367255.5	-	46	7333	c.6732T>G	c.(6730-6732)gtT>gtG	p.V2244V	SYNE1_ENST00000265368.4_Silent_p.V2244V|RP3-398G3.5_ENST00000458194.1_RNA|SYNE1_ENST00000341594.5_Silent_p.V2281V|SYNE1_ENST00000448038.1_Silent_p.V2251V|SYNE1_ENST00000423061.1_Silent_p.V2251V	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	2244					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.V2244V(2)|p.V2251V(1)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CTTTGTTTTTAACTTCAGACT	0.333										HNSCC(10;0.0054)																													uc010kiw.2		NA																	3	Substitution - coding silent(3)		lung(3)	central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45						c.(6730-6732)GTT>GTG		spectrin repeat containing, nuclear envelope 1							116.0	119.0	118.0					6																	152725441		2201	4297	6498	SO:0001819	synonymous_variant	23345				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding	g.chr6:152725441A>C	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.6732T>G	6.37:g.152725441A>C		HNSCC(10;0.0054)	Somatic				SYNE1_uc003qot.3_Silent_p.V2251V|SYNE1_uc003qou.3_Silent_p.V2244V|SYNE1_uc010kjb.1_Silent_p.V2227V	p.V2244V	NM_182961	NP_892006	WXS	Illumina HiSeq	Unspecified	Q8NF91	SYNE1_HUMAN	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)	46	7334	-		Ovarian(120;0.0955)	2244			Potential.|Cytoplasmic (Potential).		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Silent	SNP	ENST00000367255.5	37	c.6732T>G	CCDS5236.2																																																																																				0.333	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961		9	139	0	0	0	0.006214	0	9	139				
SCAF8	22828	broad.mit.edu	37	6	155152133	155152133	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr6:155152133G>T	ENST00000367178.3	+	19	2794	c.2218G>T	c.(2218-2220)Ggt>Tgt	p.G740C	SCAF8_ENST00000417268.1_Missense_Mutation_p.G740C|TIAM2_ENST00000461783.3_5'Flank|SCAF8_ENST00000367186.4_Missense_Mutation_p.G806C	NM_014892.3	NP_055707.3	Q9UPN6	SCAF8_HUMAN	SR-related CTD-associated factor 8	740	Pro-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nuclear matrix (GO:0016363)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|RNA polymerase core enzyme binding (GO:0043175)	p.G740C(2)		breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(15)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	46						TATACCAGGCGGTTCTGTTGC	0.433																																							uc003qqa.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(2218-2220)GGT>TGT		RNA-binding motif protein 16							85.0	87.0	86.0					6																	155152133		2203	4300	6503	SO:0001583	missense	22828				mRNA processing|RNA splicing	nuclear matrix|spliceosomal complex	nucleotide binding|RNA binding|RNA polymerase core enzyme binding	g.chr6:155152133G>T	AB029039	CCDS5247.1, CCDS69226.1, CCDS75541.1	6q25.1-q25.3	2013-02-12	2011-01-10	2011-01-10	ENSG00000213079	ENSG00000213079		"""RNA binding motif (RRM) containing"""	20959	protein-coding gene	gene with protein product			"""RNA binding motif protein 16"""	RBM16		10470851	Standard	NM_001286189		Approved	KIAA1116	uc003qpz.3	Q9UPN6	OTTHUMG00000015877	ENST00000367178.3:c.2218G>T	6.37:g.155152133G>T	ENSP00000356146:p.Gly740Cys		Somatic				TIAM2_uc003qqb.2_5'Flank|RBM16_uc011efj.1_Missense_Mutation_p.G806C|RBM16_uc011efk.1_Missense_Mutation_p.G785C|RBM16_uc003qpz.2_Missense_Mutation_p.G740C|RBM16_uc010kji.2_Missense_Mutation_p.G761C	p.G740C	NM_014892	NP_055707	WXS	Illumina HiSeq	Unspecified	Q9UPN6	SCAF8_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;2.33e-15)|BRCA - Breast invasive adenocarcinoma(81;0.00524)	20	2450	+		Ovarian(120;0.196)	740			Pro-rich.		B7Z888|Q5TBU6|Q6NSK3|Q9BQN8|Q9BX43	Missense_Mutation	SNP	ENST00000367178.3	37	c.2218G>T	CCDS5247.1	.	.	.	.	.	.	.	.	.	.	G	16.68	3.191136	0.58017	.	.	ENSG00000213079	ENST00000367178;ENST00000417268;ENST00000367186	T;T;T	0.50548	0.77;0.77;0.74	5.53	5.53	0.82687	.	0.191031	0.33161	U	0.005218	T	0.55955	0.1953	L	0.51422	1.61	0.42611	D	0.993312	D;D;D;D	0.89917	0.999;0.999;0.993;1.0	P;P;P;D	0.65987	0.892;0.892;0.764;0.94	T	0.58194	-0.7679	10	0.66056	D	0.02	.	17.6421	0.88139	0.0:0.0:1.0:0.0	.	785;806;818;740	B7Z876;B7Z888;B7Z3A4;Q9UPN6	.;.;.;SCAF8_HUMAN	C	740;740;806	ENSP00000356146:G740C;ENSP00000413098:G740C;ENSP00000356154:G806C	ENSP00000356146:G740C	G	+	1	0	SCAF8	155193825	1.000000	0.71417	1.000000	0.80357	0.385000	0.30292	5.064000	0.64338	2.595000	0.87683	0.591000	0.81541	GGT		0.433	SCAF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042798.1	NM_014892		16	131	1	0	1.00905e-13	0.008871	2.06033e-13	16	131				
MAP3K4	4216	broad.mit.edu	37	6	161508882	161508882	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr6:161508882G>T	ENST00000392142.4	+	10	2867	c.2719G>T	c.(2719-2721)Ggt>Tgt	p.G907C	MAP3K4_ENST00000366919.2_Missense_Mutation_p.G907C|MAP3K4_ENST00000366920.2_Missense_Mutation_p.G907C|MAP3K4_ENST00000348824.7_Missense_Mutation_p.G907C	NM_005922.2	NP_005913	Q9Y6R4	M3K4_HUMAN	mitogen-activated protein kinase kinase kinase 4	907					activation of MAPKK activity (GO:0000186)|chorionic trophoblast cell differentiation (GO:0060718)|intracellular signal transduction (GO:0035556)|male germ-line sex determination (GO:0019100)|MAPK cascade (GO:0000165)|placenta development (GO:0001890)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of p38MAPK cascade (GO:1900745)|regulation of gene expression (GO:0010468)|response to UV-C (GO:0010225)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)	p.G907C(2)		breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|lung(28)|ovary(3)|skin(2)|stomach(1)	77		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)		GACCAAGCACGGTGATCGAGC	0.512																																							uc003qtn.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|lung(3)|skin(2)|stomach(1)	9						c.(2719-2721)GGT>TGT		mitogen-activated protein kinase kinase kinase 4							138.0	111.0	120.0					6																	161508882		2203	4300	6503	SO:0001583	missense	4216				activation of MAPKK activity|JNK cascade|positive regulation of JUN kinase activity	perinuclear region of cytoplasm	ATP binding|MAP kinase kinase kinase activity|metal ion binding|protein binding	g.chr6:161508882G>T	AF002715	CCDS34565.1, CCDS34566.1, CCDS75544.1	6q26	2012-10-02			ENSG00000085511	ENSG00000085511		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6856	protein-coding gene	gene with protein product		602425		MEKK4		9305639	Standard	XM_005266988		Approved	MTK1, MAPKKK4, KIAA0213	uc003qtn.3	Q9Y6R4	OTTHUMG00000015968	ENST00000392142.4:c.2719G>T	6.37:g.161508882G>T	ENSP00000375986:p.Gly907Cys		Somatic				MAP3K4_uc010kkc.1_Missense_Mutation_p.G907C|MAP3K4_uc003qto.2_Missense_Mutation_p.G907C|MAP3K4_uc011efz.1_RNA|MAP3K4_uc011ega.1_Missense_Mutation_p.G360C	p.G907C	NM_005922	NP_005913	WXS	Illumina HiSeq	Unspecified	Q9Y6R4	M3K4_HUMAN		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)	10	2861	+		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)	907					A6H8W0|B7ZLD3|B9EG75|Q5VTT8|Q5VTT9|Q92612|Q9H408	Missense_Mutation	SNP	ENST00000392142.4	37	c.2719G>T	CCDS34565.1	.	.	.	.	.	.	.	.	.	.	G	12.40	1.927751	0.34002	.	.	ENSG00000085511	ENST00000366919;ENST00000392142;ENST00000540111;ENST00000366920;ENST00000348824	T;T;T;T	0.71934	-0.6;-0.61;-0.6;-0.6	5.63	-4.28	0.03732	.	0.427784	0.25419	N	0.030818	T	0.57636	0.2067	L	0.50333	1.59	0.09310	N	1	D;D;P	0.60575	0.971;0.988;0.951	P;P;P	0.54460	0.753;0.735;0.67	T	0.66677	-0.5863	10	0.56958	D	0.05	-4.7445	13.2064	0.59798	0.6036:0.0:0.3964:0.0	.	907;907;907	F5H538;Q9Y6R4-2;Q9Y6R4	.;.;M3K4_HUMAN	C	907	ENSP00000355886:G907C;ENSP00000375986:G907C;ENSP00000355887:G907C;ENSP00000297332:G907C	ENSP00000297332:G907C	G	+	1	0	MAP3K4	161428872	0.392000	0.25229	0.002000	0.10522	0.006000	0.05464	1.080000	0.30779	-0.617000	0.05664	-1.875000	0.00549	GGT		0.512	MAP3K4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042988.3			23	112	1	0	2.21704e-12	0.00278	4.44419e-12	23	112				
PDE10A	10846	broad.mit.edu	37	6	165792703	165792703	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr6:165792703G>T	ENST00000366882.1	-	19	2089	c.1935C>A	c.(1933-1935)aaC>aaA	p.N645K	PDE10A_ENST00000354448.4_Missense_Mutation_p.N645K|PDE10A_ENST00000539869.2_Missense_Mutation_p.N655K			Q9Y233	PDE10_HUMAN	phosphodiesterase 10A	645					blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of protein kinase A signaling (GO:0010738)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|metal ion binding (GO:0046872)	p.N645K(1)		breast(4)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(39)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	71		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	Caffeine(DB00201)|Dipyridamole(DB00975)|Papaverine(DB01113)|Tofisopam(DB08811)|Triflusal(DB08814)	GATTATTAAGGTTTAGTGATC	0.368																																					Esophageal Squamous(22;308 615 5753 12038 40624)	Esophageal Squamous(22;308 615 5753 12038 40624)	uc003qun.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(2)	5						c.(1933-1935)AAC>AAA		phosphodiesterase 10A isoform 2	Dipyridamole(DB00975)						119.0	117.0	118.0					6																	165792703		2203	4300	6503	SO:0001583	missense	10846				platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cAMP binding|cGMP binding|metal ion binding	g.chr6:165792703G>T	AB020593	CCDS47513.1	6q26	2008-03-18			ENSG00000112541	ENSG00000112541	3.1.4.17	"""Phosphodiesterases"""	8772	protein-coding gene	gene with protein product		610652				10373451	Standard	NM_001130690		Approved		uc003quo.3	Q9Y233	OTTHUMG00000015986	ENST00000366882.1:c.1935C>A	6.37:g.165792703G>T	ENSP00000355847:p.Asn645Lys		Somatic				PDE10A_uc011egj.1_RNA|PDE10A_uc011egk.1_Missense_Mutation_p.N575K|PDE10A_uc003quo.2_Missense_Mutation_p.N655K	p.N645K	NM_006661	NP_006652	WXS	Illumina HiSeq	Unspecified	Q9Y233	PDE10_HUMAN		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	19	2176	-		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)	645					Q6FHX1|Q9HCP9|Q9NTV4|Q9ULW9|Q9Y5T1	Missense_Mutation	SNP	ENST00000366882.1	37	c.1935C>A		.	.	.	.	.	.	.	.	.	.	G	14.81	2.645167	0.47258	.	.	ENSG00000112541	ENST00000366882;ENST00000539869;ENST00000343842;ENST00000354448;ENST00000392126	T;T	0.77489	-1.1;-1.1	5.95	4.19	0.49359	Metal-dependent phosphohydrolase, HD domain (1);5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);	0.040834	0.85682	D	0.000000	T	0.50752	0.1634	L	0.49126	1.545	0.45108	D	0.99812	B;P	0.39282	0.372;0.666	B;B	0.28784	0.094;0.084	T	0.53165	-0.8477	10	0.37606	T	0.19	.	8.9116	0.35557	0.2728:0.0:0.7272:0.0	.	655;645	Q9ULW9;Q9Y233	.;PDE10_HUMAN	K	645;673;655;645;644	ENSP00000355847:N645K;ENSP00000346435:N645K	ENSP00000341187:N655K	N	-	3	2	PDE10A	165712693	1.000000	0.71417	0.987000	0.45799	0.964000	0.63967	2.577000	0.46042	0.862000	0.35528	0.655000	0.94253	AAC		0.368	PDE10A-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000043031.1			14	165	1	0	4.3838e-07	0.001855	7.28973e-07	14	165				
AGMO	392636	broad.mit.edu	37	7	15430503	15430503	+	Missense_Mutation	SNP	T	T	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr7:15430503T>A	ENST00000342526.3	-	7	873	c.704A>T	c.(703-705)aAt>aTt	p.N235I		NM_001004320.1	NP_001004320.1	Q6ZNB7	ALKMO_HUMAN	alkylglycerol monooxygenase	235					ether lipid metabolic process (GO:0046485)|fatty acid biosynthetic process (GO:0006633)|membrane lipid metabolic process (GO:0006643)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glyceryl-ether monooxygenase activity (GO:0050479)|iron ion binding (GO:0005506)	p.N235I(1)		breast(1)|kidney(1)|large_intestine(6)|liver(1)|lung(30)|prostate(1)|skin(2)	42						ACCAGCATAATTTTTGTCTAT	0.259																																							uc003stb.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(703-705)AAT>ATT		transmembrane protein 195							30.0	32.0	32.0					7																	15430503		2168	4265	6433	SO:0001583	missense	392636				ether lipid metabolic process|fatty acid biosynthetic process|membrane lipid metabolic process	endoplasmic reticulum membrane|integral to membrane	glyceryl-ether monooxygenase activity|iron ion binding	g.chr7:15430503T>A		CCDS34604.1	7p21.1	2013-03-04	2011-01-31	2011-01-31	ENSG00000187546	ENSG00000187546	1.14.16.5	"""Fatty acid hydroxylase domain containing"""	33784	protein-coding gene	gene with protein product		613738	"""transmembrane protein 195"""	TMEM195		20643956	Standard	NM_001004320		Approved	FLJ16237	uc003stb.1	Q6ZNB7	OTTHUMG00000152387	ENST00000342526.3:c.704A>T	7.37:g.15430503T>A	ENSP00000341662:p.Asn235Ile		Somatic					p.N235I	NM_001004320	NP_001004320	WXS	Illumina HiSeq	Unspecified	Q6ZNB7	ALKMO_HUMAN			7	874	-			235					A4D114|A6NCH5	Missense_Mutation	SNP	ENST00000342526.3	37	c.704A>T	CCDS34604.1	.	.	.	.	.	.	.	.	.	.	T	18.52	3.641624	0.67244	.	.	ENSG00000187546	ENST00000342526	D	0.81908	-1.55	5.33	4.14	0.48551	.	0.000000	0.85682	D	0.000000	D	0.93174	0.7826	H	0.95187	3.635	0.53005	D	0.999962	D	0.89917	1.0	D	0.97110	1.0	D	0.94050	0.7317	10	0.87932	D	0	-15.587	12.4958	0.55927	0.0:0.0:0.1398:0.8602	.	235	Q6ZNB7	ALKMO_HUMAN	I	235	ENSP00000341662:N235I	ENSP00000341662:N235I	N	-	2	0	AGMO	15397028	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	4.158000	0.58150	0.924000	0.37069	0.482000	0.46254	AAT		0.259	AGMO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326049.2	NM_001004320		10	38	0	0	0	0.000978	0	10	38				
FERD3L	222894	broad.mit.edu	37	7	19184745	19184745	+	Nonsense_Mutation	SNP	C	C	A	rs138944204		TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr7:19184745C>A	ENST00000275461.3	-	1	299	c.241G>T	c.(241-243)Gag>Tag	p.E81*	AC003986.5_ENST00000452700.1_RNA	NM_152898.2	NP_690862.1	Q96RJ6	FER3L_HUMAN	Fer3-like bHLH transcription factor	81	Poly-Glu.				cell development (GO:0048468)|floor plate development (GO:0033504)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of neurogenesis (GO:0050767)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.E81*(1)		breast(1)|endometrium(4)|large_intestine(8)|lung(16)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	35						cttccgcgctcctcttcctcc	0.617																																							uc003suo.1		NA																	1	Substitution - Nonsense(1)		lung(1)	large_intestine(1)	1						c.(241-243)GAG>TAG		nephew of atonal 3							73.0	54.0	60.0					7																	19184745		2203	4300	6503	SO:0001587	stop_gained	222894				negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding	g.chr7:19184745C>A	AF369897	CCDS5368.1	7p21.3	2013-10-17	2013-10-17		ENSG00000146618	ENSG00000146618		"""Basic helix-loop-helix proteins"""	16660	protein-coding gene	gene with protein product			"""Fer3-like (Drosophila)"""			11472856, 12217327	Standard	NM_152898		Approved	NATO3, N-TWIST, bHLHa31	uc003suo.1	Q96RJ6	OTTHUMG00000090823	ENST00000275461.3:c.241G>T	7.37:g.19184745C>A	ENSP00000275461:p.Glu81*		Somatic				uc003sun.1_RNA	p.E81*	NM_152898	NP_690862	WXS	Illumina HiSeq	Unspecified	Q96RJ6	FER3L_HUMAN			1	300	-			81			Poly-Glu.		Q495K0	Nonsense_Mutation	SNP	ENST00000275461.3	37	c.241G>T	CCDS5368.1	.	.	.	.	.	.	.	.	.	.	C	28.3	4.910769	0.92178	.	.	ENSG00000146618	ENST00000275461	.	.	.	5.66	5.66	0.87406	.	2.160480	0.01412	N	0.014045	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07990	T	0.79	0.0233	17.9316	0.88999	0.0:1.0:0.0:0.0	.	.	.	.	X	81	.	ENSP00000275461:E81X	E	-	1	0	FERD3L	19151270	0.143000	0.22626	0.745000	0.31077	0.948000	0.59901	2.433000	0.44793	2.693000	0.91896	0.650000	0.86243	GAG		0.617	FERD3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207627.1			7	30	1	0	8.12818e-05	0.001984	0.000111161	7	30				
CLK2P1	1197	broad.mit.edu	37	7	23625238	23625238	+	IGR	SNP	C	C	G			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr7:23625238C>G								TRA2A (53578 upstream) : CCDC126 (11759 downstream)																							ACACTGCGCTCATGTCGCTTC	0.493																																							uc003swk.2		NA																	0					0						c.(259-261)GAG>CAG		SubName: Full=cDNA FLJ61616, highly similar to Dual specificity protein kinase CLK2 (EC 2.7.12.1); SubName: Full=CDC-like kinase 2, isoform CRA_c; SubName: Full=Putative uncharacterized protein CLK2;																																				SO:0001628	intergenic_variant	1197							g.chr7:23625238C>G																													7.37:g.23625238C>G			Somatic					p.E87Q	NR_002711		WXS	Illumina HiSeq	Unspecified					1	909	-									Missense_Mutation	SNP		37	c.259G>C																																																																																				0	0.493									8	136	0	0	0	0.00308	0	8	136				
HOXA2	3199	broad.mit.edu	37	7	27141063	27141063	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr7:27141063C>A	ENST00000222718.5	-	2	723	c.413G>T	c.(412-414)gGc>gTc	p.G138V	HOTAIRM1_ENST00000434063.3_RNA|HOTAIRM1_ENST00000428939.3_RNA|HOTAIRM1_ENST00000425358.2_RNA|HOTAIRM1_ENST00000593300.1_RNA|HOTAIRM1_ENST00000429611.3_RNA	NM_006735.3	NP_006726.1	O43364	HXA2_HUMAN	homeobox A2	138					anterior/posterior pattern specification (GO:0009952)|brain segmentation (GO:0035284)|cell fate determination (GO:0001709)|dorsal/ventral pattern formation (GO:0009953)|embryonic viscerocranium morphogenesis (GO:0048703)|middle ear morphogenesis (GO:0042474)|motor neuron axon guidance (GO:0008045)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|osteoblast development (GO:0002076)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|rhombomere 2 development (GO:0021568)|rhombomere 3 morphogenesis (GO:0021658)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G138V(1)		breast(3)|cervix(1)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|skin(1)	22						CCCGCCGCTGCCATCGGCGAT	0.542																																							uc003syh.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(412-414)GGC>GTC		homeobox A2							21.0	23.0	22.0					7																	27141063		2152	4210	6362	SO:0001583	missense	3199					nucleus	sequence-specific DNA binding transcription factor activity	g.chr7:27141063C>A		CCDS5403.1	7p15.2	2011-06-20	2005-12-22		ENSG00000105996	ENSG00000105996		"""Homeoboxes / ANTP class : HOXL subclass"""	5103	protein-coding gene	gene with protein product		604685	"""homeo box A2"""	HOX1K		1358459	Standard	NM_006735		Approved		uc003syh.3	O43364	OTTHUMG00000023208	ENST00000222718.5:c.413G>T	7.37:g.27141063C>A	ENSP00000222718:p.Gly138Val		Somatic					p.G138V	NM_006735	NP_006726	WXS	Illumina HiSeq	Unspecified	O43364	HXA2_HUMAN			2	688	-			138					A1L4K3|B2RMW3	Missense_Mutation	SNP	ENST00000222718.5	37	c.413G>T	CCDS5403.1	.	.	.	.	.	.	.	.	.	.	C	11.97	1.796920	0.31777	.	.	ENSG00000105996	ENST00000222718	D	0.95656	-3.77	5.45	4.34	0.51931	Homeodomain-related (1);Homeodomain-like (1);	0.293944	0.42821	D	0.000645	D	0.91576	0.7339	L	0.46157	1.445	0.80722	D	1	B	0.12013	0.005	B	0.11329	0.006	D	0.87061	0.2153	10	0.48119	T	0.1	.	7.2521	0.26156	0.0:0.7466:0.0:0.2534	.	138	O43364	HXA2_HUMAN	V	138	ENSP00000222718:G138V	ENSP00000222718:G138V	G	-	2	0	HOXA2	27107588	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.509000	0.35780	2.716000	0.92895	0.655000	0.94253	GGC		0.542	HOXA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358508.2			3	28	1	0	0.000602214	0.000602	0.000753197	3	28				
POU6F2	11281	broad.mit.edu	37	7	39247049	39247049	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr7:39247049C>A	ENST00000403058.1	+	5	495	c.341C>A	c.(340-342)cCc>cAc	p.P114H	POU6F2_ENST00000518318.2_Missense_Mutation_p.P114H|POU6F2_ENST00000559001.1_Missense_Mutation_p.P106H|POU6F2_ENST00000517348.1_3'UTR	NM_001166018.1|NM_007252.3	NP_001159490.1|NP_009183.3	P78424	PO6F2_HUMAN	POU class 6 homeobox 2	114					central nervous system development (GO:0007417)|ganglion mother cell fate determination (GO:0007402)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|visual perception (GO:0007601)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P114H(1)		NS(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(16)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	42						CCGGGAGGCCCCCCAGCCCTC	0.582																																							uc003thb.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(340-342)CCC>CAC		POU class 6 homeobox 2 isoform 1							100.0	103.0	102.0					7																	39247049		2203	4300	6503	SO:0001583	missense	11281				central nervous system development|ganglion mother cell fate determination|transcription from RNA polymerase II promoter|visual perception		sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr7:39247049C>A	U91934	CCDS34620.2, CCDS55103.1	7p14.1	2011-06-20	2007-07-13		ENSG00000106536	ENSG00000106536		"""Homeoboxes / POU class"""	21694	protein-coding gene	gene with protein product	"""Retina-derived POU-domain factor-1"""	609062	"""POU domain, class 6, transcription factor 2"""			8601806	Standard	NM_007252		Approved	RPF-1	uc003thb.2	P78424	OTTHUMG00000150803	ENST00000403058.1:c.341C>A	7.37:g.39247049C>A	ENSP00000384004:p.Pro114His		Somatic				POU6F2_uc010kxo.2_Missense_Mutation_p.P106H	p.P114H	NM_007252	NP_009183	WXS	Illumina HiSeq	Unspecified	P78424	PO6F2_HUMAN			4	383	+			114					A4D1W2|C4AMB9|P78425|Q75ME8|Q86UM6|Q9UDS7	Missense_Mutation	SNP	ENST00000403058.1	37	c.341C>A	CCDS34620.2	.	.	.	.	.	.	.	.	.	.	C	23.8	4.454524	0.84209	.	.	ENSG00000106536	ENST00000403058;ENST00000518318;ENST00000451021	D;D	0.85088	-1.88;-1.94	6.17	6.17	0.99709	.	2.258910	0.01529	N	0.018700	T	0.81978	0.4937	N	0.08118	0	0.32619	N	0.523594	P;B	0.48016	0.904;0.371	P;B	0.46339	0.513;0.293	T	0.73325	-0.4018	10	0.51188	T	0.08	.	16.2608	0.82541	0.0:0.8683:0.1316:0.0	.	114;114	P78424-2;P78424	.;PO6F2_HUMAN	H	114;114;115	ENSP00000384004:P114H;ENSP00000430514:P114H	ENSP00000384004:P114H	P	+	2	0	POU6F2	39213574	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	5.696000	0.68287	2.941000	0.99782	0.655000	0.94253	CCC		0.582	POU6F2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000320146.3	NM_007252		10	94	1	0	6.31663e-08	0.003163	1.1092e-07	10	94				
HECW1	23072	broad.mit.edu	37	7	43531769	43531769	+	Silent	SNP	A	A	G			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr7:43531769A>G	ENST00000395891.2	+	18	3935	c.3330A>G	c.(3328-3330)tcA>tcG	p.S1110S	HECW1_ENST00000453890.1_Silent_p.S1076S	NM_015052.3	NP_055867.3	Q76N89	HECW1_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1	1110					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.S1089S(1)|p.S1110S(1)		NS(2)|breast(10)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(57)|ovary(8)|pancreas(2)|prostate(2)|skin(6)|urinary_tract(3)	125						AACATGAGTCATTGCCACTGG	0.433																																							uc003tid.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(8)|lung(6)|breast(4)|skin(4)|pancreas(1)	23						c.(3328-3330)TCA>TCG		NEDD4-like ubiquitin-protein ligase 1							57.0	58.0	57.0					7																	43531769		1905	4120	6025	SO:0001819	synonymous_variant	23072				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin-protein ligase activity	g.chr7:43531769A>G	AB048365	CCDS5469.2, CCDS69286.1	7p13	2004-12-13			ENSG00000002746	ENSG00000002746			22195	protein-coding gene	gene with protein product		610384				12690205, 14684739	Standard	XM_005249665		Approved	KIAA0322, NEDL1	uc003tid.1	Q76N89	OTTHUMG00000128917	ENST00000395891.2:c.3330A>G	7.37:g.43531769A>G			Somatic				HECW1_uc011kbi.1_Silent_p.S1076S	p.S1110S	NM_015052	NP_055867	WXS	Illumina HiSeq	Unspecified	Q76N89	HECW1_HUMAN			18	3935	+			1110					A7E2X0|A8MYS3|B4DH42|O15036|Q9HCC7	Silent	SNP	ENST00000395891.2	37	c.3330A>G	CCDS5469.2																																																																																				0.433	HECW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250893.2	NM_015052		9	69	0	0	0	0.008291	0	9	69				
RAMP3	10268	broad.mit.edu	37	7	45222926	45222926	+	Missense_Mutation	SNP	C	C	T	rs146295145	byFrequency	TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr7:45222926C>T	ENST00000242249.4	+	3	400	c.362C>T	c.(361-363)cCg>cTg	p.P121L	RAMP3_ENST00000481345.1_Missense_Mutation_p.P121L|RAMP3_ENST00000496212.1_Missense_Mutation_p.P121L	NM_005856.2	NP_005847.1	O60896	RAMP3_HUMAN	receptor (G protein-coupled) activity modifying protein 3	121					calcium ion transport (GO:0006816)|cellular response to estradiol stimulus (GO:0071392)|G-protein coupled receptor signaling pathway involved in heart process (GO:0086103)|intracellular protein transport (GO:0006886)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of receptor recycling (GO:0001921)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|receptor internalization (GO:0031623)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	coreceptor activity (GO:0015026)|protein transporter activity (GO:0008565)|receptor activity (GO:0004872)	p.P121L(1)		breast(1)|endometrium(1)|large_intestine(4)|lung(4)|stomach(1)	11					Pramlintide(DB01278)	GTTCTCATCCCGCTGATCGTT	0.622													C|||	3	0.000599042	0.0	0.0	5008	,	,		20881	0.001		0.0	False		,,,				2504	0.002						uc003tnb.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(361-363)CCG>CTG		receptor activity modifying protein 3 precursor	Pramlintide(DB01278)	C	LEU/PRO	0,4406		0,0,2203	130.0	123.0	125.0		362	4.4	0.9	7	dbSNP_134	125	1,8599	1.2+/-3.3	0,1,4299	yes	missense	RAMP3	NM_005856.2	98	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging	121/149	45222926	1,13005	2203	4300	6503	SO:0001583	missense	10268				intracellular protein transport|receptor-mediated endocytosis|regulation of G-protein coupled receptor protein signaling pathway	integral to plasma membrane|lysosome	protein transporter activity	g.chr7:45222926C>T	AJ001016	CCDS5503.1	7p13-p12	2006-11-21	2006-11-21		ENSG00000122679	ENSG00000122679		"""Receptor (G protein-coupled) activity modifying proteins"""	9845	protein-coding gene	gene with protein product		605155	"""receptor activity modifying protein 3"", ""receptor (calcitonin) activity modifying protein 3"""				Standard	NM_005856		Approved		uc003tnb.3	O60896	OTTHUMG00000023729	ENST00000242249.4:c.362C>T	7.37:g.45222926C>T	ENSP00000242249:p.Pro121Leu		Somatic				RAMP3_uc003tnc.2_Missense_Mutation_p.P89L	p.P121L	NM_005856	NP_005847	WXS	Illumina HiSeq	Unspecified	O60896	RAMP3_HUMAN			3	423	+			121			Helical; (Potential).		Q7Z2Y1	Missense_Mutation	SNP	ENST00000242249.4	37	c.362C>T	CCDS5503.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	13.33	2.204979	0.38905	0.0	1.16E-4	ENSG00000122679	ENST00000242249;ENST00000481345;ENST00000496212	T;T;T	0.47869	0.83;0.83;0.83	4.37	4.37	0.52481	.	0.204924	0.43416	D	0.000564	T	0.56187	0.1968	M	0.85373	2.75	0.49213	D	0.999769	D	0.54047	0.964	P	0.44518	0.452	T	0.67530	-0.5647	10	0.56958	D	0.05	-6.2003	14.3953	0.67007	0.0:1.0:0.0:0.0	.	121	O60896	RAMP3_HUMAN	L	121	ENSP00000242249:P121L;ENSP00000419012:P121L;ENSP00000418460:P121L	ENSP00000242249:P121L	P	+	2	0	RAMP3	45189451	0.358000	0.24947	0.889000	0.34880	0.036000	0.12997	3.089000	0.50183	1.955000	0.56771	0.655000	0.94253	CCG		0.622	RAMP3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251343.1	NM_005856		11	193	0	0	0	0.000978	0	11	193				
ZNF479	90827	broad.mit.edu	37	7	57188064	57188064	+	Missense_Mutation	SNP	T	T	C			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr7:57188064T>C	ENST00000331162.4	-	5	1328	c.1058A>G	c.(1057-1059)tAt>tGt	p.Y353C		NM_033273.1	NP_150376.1	Q96JC4	ZN479_HUMAN	zinc finger protein 479	353					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Y353C(1)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(53)|ovary(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	84			GBM - Glioblastoma multiforme(1;9.18e-12)			TTCACAGGCATAGGGTTTCTC	0.438																																							uc010kzo.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(1)	4						c.(1057-1059)TAT>TGT		zinc finger protein 479							24.0	27.0	26.0					7																	57188064		2077	4245	6322	SO:0001583	missense	90827				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr7:57188064T>C	AF277624	CCDS43590.1	7p11.2	2013-01-08			ENSG00000185177	ENSG00000185177		"""Zinc fingers, C2H2-type"", ""-"""	23258	protein-coding gene	gene with protein product						11410164	Standard	NM_033273		Approved	KR19	uc010kzo.3	Q96JC4	OTTHUMG00000156682	ENST00000331162.4:c.1058A>G	7.37:g.57188064T>C	ENSP00000333776:p.Tyr353Cys		Somatic					p.Y353C	NM_033273	NP_150376	WXS	Illumina HiSeq	Unspecified	Q96JC4	ZN479_HUMAN	GBM - Glioblastoma multiforme(1;9.18e-12)		5	1329	-			353			C2H2-type 7.			Missense_Mutation	SNP	ENST00000331162.4	37	c.1058A>G	CCDS43590.1	.	.	.	.	.	.	.	.	.	.	t	7.344	0.621495	0.14193	.	.	ENSG00000185177	ENST00000331162	T	0.25414	1.8	0.946	-1.7	0.08159	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.40322	0.1112	M	0.72624	2.21	0.18873	N	0.999989	D	0.89917	1.0	D	0.87578	0.998	T	0.29027	-1.0025	9	0.72032	D	0.01	.	1.5244	0.02522	0.3053:0.2408:0.0:0.4539	.	353	Q96JC4	ZN479_HUMAN	C	353	ENSP00000333776:Y353C	ENSP00000333776:Y353C	Y	-	2	0	ZNF479	57192006	0.002000	0.14202	0.002000	0.10522	0.002000	0.02628	0.126000	0.15769	-0.681000	0.05204	-0.720000	0.03607	TAT		0.438	ZNF479-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345302.1	XM_291202		12	72	0	0	0	0.001855	0	12	72				
ABCB1	5243	broad.mit.edu	37	7	87179543	87179543	+	Missense_Mutation	SNP	C	C	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr7:87179543C>T	ENST00000265724.3	-	13	1711	c.1294G>A	c.(1294-1296)Ggg>Agg	p.G432R	ABCB1_ENST00000543898.1_Missense_Mutation_p.G368R	NM_000927.4	NP_000918.2	P08183	MDR1_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 1	432	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				drug transmembrane transport (GO:0006855)|G2/M transition of mitotic cell cycle (GO:0000086)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|stem cell proliferation (GO:0072089)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)|xenobiotic-transporting ATPase activity (GO:0008559)	p.G432R(1)		NS(1)|breast(6)|central_nervous_system(2)|endometrium(14)|kidney(9)|large_intestine(14)|lung(48)|ovary(4)|prostate(6)|skin(6)|upper_aerodigestive_tract(1)	111	Esophageal squamous(14;0.00164)				Acebutolol(DB01193)|Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Adenosine triphosphate(DB00171)|ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Albendazole(DB00518)|Alfentanil(DB00802)|Alitretinoin(DB00523)|Amantadine(DB00915)|Aminohippurate(DB00345)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amprenavir(DB00701)|Amsacrine(DB00276)|Apixaban(DB06605)|Arsenic trioxide(DB01169)|Astemizole(DB00637)|Atazanavir(DB01072)|Atenolol(DB00335)|Atorvastatin(DB01076)|Axitinib(DB06626)|Azelastine(DB00972)|Azithromycin(DB00207)|Benzocaine(DB01086)|Bepridil(DB01244)|Betamethasone(DB00443)|Biperiden(DB00810)|Boceprevir(DB08873)|Bosutinib(DB06616)|Brentuximab vedotin(DB08870)|Bromocriptine(DB01200)|Buprenorphine(DB00921)|Buspirone(DB00490)|Cabazitaxel(DB06772)|Caffeine(DB00201)|Canagliflozin(DB08907)|Candesartan(DB00796)|Captopril(DB01197)|Carbamazepine(DB00564)|Carfilzomib(DB08889)|Carvedilol(DB01136)|Caspofungin(DB00520)|Chloroquine(DB00608)|Chlorpromazine(DB00477)|Chlorpropamide(DB00672)|Chlorprothixene(DB01239)|Cilazapril(DB01340)|Cimetidine(DB00501)|Ciprofloxacin(DB00537)|Cisplatin(DB00515)|Citalopram(DB00215)|Clarithromycin(DB01211)|Clobazam(DB00349)|Clofazimine(DB00845)|Clomifene(DB00882)|Clomipramine(DB01242)|Clonidine(DB00575)|Clopidogrel(DB00758)|Clotrimazole(DB00257)|Clozapine(DB00363)|Colchicine(DB01394)|Conjugated Estrogens(DB00286)|Crizotinib(DB08865)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dabigatran etexilate(DB06695)|Dabrafenib(DB08912)|Dactinomycin(DB00970)|Dapagliflozin(DB06292)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Debrisoquin(DB04840)|Desipramine(DB01151)|Desloratadine(DB00967)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Diazepam(DB00829)|Diclofenac(DB00586)|Diethylstilbestrol(DB00255)|Digitoxin(DB01396)|Digoxin(DB00390)|Dihydroergotamine(DB00320)|Diltiazem(DB00343)|Dipyridamole(DB00975)|Docetaxel(DB01248)|Domperidone(DB01184)|Doxazosin(DB00590)|Doxepin(DB01142)|Doxorubicin(DB00997)|Dronabinol(DB00470)|Dronedarone(DB04855)|Eletriptan(DB00216)|Enalapril(DB00584)|Enzalutamide(DB08899)|Epinastine(DB00751)|Ergonovine(DB01253)|Ergotamine(DB00696)|Erlotinib(DB00530)|Erythromycin(DB00199)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Etravirine(DB06414)|Ezetimibe(DB00973)|Felodipine(DB01023)|Fentanyl(DB00813)|Fesoterodine(DB06702)|Fexofenadine(DB00950)|Fidaxomicin(DB08874)|Fluconazole(DB00196)|Fluoxetine(DB00472)|Flupentixol(DB00875)|Fluphenazine(DB00623)|Flurazepam(DB00690)|Fluticasone furoate(DB08906)|Fluvoxamine(DB00176)|Gefitinib(DB00317)|Gemcitabine(DB00441)|Glyburide(DB01016)|Gramicidin D(DB00027)|Haloperidol(DB00502)|Hydrocortisone(DB00741)|Ibuprofen(DB01050)|Imatinib(DB00619)|Imipramine(DB00458)|Indacaterol(DB05039)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Itraconazole(DB01167)|Ivacaftor(DB08820)|Ivermectin(DB00602)|Ketamine(DB01221)|Ketazolam(DB01587)|Ketoconazole(DB01026)|Lamivudine(DB00709)|Lamotrigine(DB00555)|Lansoprazole(DB00448)|Lapatinib(DB01259)|Lenalidomide(DB00480)|Levetiracetam(DB01202)|Levofloxacin(DB01137)|Levomilnacipran(DB08918)|Levothyroxine(DB00451)|Lidocaine(DB00281)|Linagliptin(DB08882)|Liothyronine(DB00279)|Liotrix(DB01583)|Lisinopril(DB00722)|Lomitapide(DB08827)|Loperamide(DB00836)|Lopinavir(DB01601)|Loratadine(DB00455)|Losartan(DB00678)|Lovastatin(DB00227)|Mannitol(DB00742)|Maprotiline(DB00934)|Mebendazole(DB00643)|Mefloquine(DB00358)|Megestrol acetate(DB00351)|Meprobamate(DB00371)|Methadone(DB00333)|Methotrexate(DB00563)|Methylprednisolone(DB00959)|Metoprolol(DB00264)|Miconazole(DB01110)|Midazolam(DB00683)|Mifepristone(DB00834)|Mirabegron(DB08893)|Mitomycin(DB00305)|Mitoxantrone(DB01204)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Nadolol(DB01203)|Naloxone(DB01183)|Naltrexone(DB00704)|Nefazodone(DB01149)|Nelfinavir(DB00220)|Neostigmine(DB01400)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nisoldipine(DB00401)|Nitrazepam(DB01595)|Nitrendipine(DB01054)|Nizatidine(DB00585)|Norethindrone(DB00717)|Olanzapine(DB00334)|Omeprazole(DB00338)|Paclitaxel(DB01229)|Pantoprazole(DB00213)|Paroxetine(DB00715)|Pazopanib(DB06589)|Perindopril(DB00790)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pimozide(DB01100)|Pitavastatin(DB08860)|Pomalidomide(DB08910)|Ponatinib(DB08901)|Posaconazole(DB01263)|Pravastatin(DB00175)|Prazosin(DB00457)|Prednisolone(DB00860)|Prednisone(DB00635)|Probenecid(DB01032)|Progesterone(DB00396)|Promethazine(DB01069)|Propafenone(DB01182)|Propranolol(DB00571)|Protriptyline(DB00344)|Quetiapine(DB01224)|Quinacrine(DB01103)|Quinidine(DB00908)|Quinine(DB00468)|Ranitidine(DB00863)|Reboxetine(DB00234)|Regorafenib(DB08896)|Reserpine(DB00206)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Risperidone(DB00734)|Ritonavir(DB00503)|Rivaroxaban(DB06228)|Roxithromycin(DB00778)|Salicylic acid(DB00936)|Saquinavir(DB01232)|Scopolamine(DB00747)|Selegiline(DB01037)|Sertraline(DB01104)|Silodosin(DB06207)|SIMEPREVIR(DB06290)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sitagliptin(DB01261)|SOFOSBUVIR(DB08934)|Sorafenib(DB00398)|Sparfloxacin(DB01208)|Spironolactone(DB00421)|Streptozocin(DB00428)|Sulfinpyrazone(DB01138)|Sumatriptan(DB00669)|Sunitinib(DB01268)|Tacrolimus(DB00864)|Tamoxifen(DB00675)|Telaprevir(DB05521)|Telmisartan(DB00966)|Temsirolimus(DB06287)|Terazosin(DB01162)|Testosterone(DB00624)|Ticagrelor(DB08816)|Timolol(DB00373)|Tolvaptan(DB06212)|Topotecan(DB01030)|Toremifene(DB00539)|Trazodone(DB00656)|Trifluoperazine(DB00831)|Triflupromazine(DB00508)|Trimethoprim(DB00440)|Trimipramine(DB00726)|Troleandomycin(DB01361)|Vecuronium(DB01339)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)|Vinorelbine(DB00361)|Vismodegib(DB08828)|Voacamine(DB04877)|Zidovudine(DB00495)	GTGCTCTTCCCACAGCCACTG	0.552																																							uc003uiz.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	7						c.(1294-1296)GGG>AGG		ATP-binding cassette, subfamily B, member 1	Adenosine triphosphate(DB00171)|Alfentanil(DB00802)|Arsenic trioxide(DB01169)|Atazanavir(DB01072)|Carvedilol(DB01136)|Colchicine(DB01394)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dipyridamole(DB00975)|Estramustine(DB01196)|Flupenthixol(DB00875)|Imatinib(DB00619)|Itraconazole(DB01167)|Nicardipine(DB00622)|Propafenone(DB01182)|Quinacrine(DB01103)|Quinidine(DB00908)|Ranolazine(DB00243)|Rifampin(DB01045)|Roxithromycin(DB00778)|Saquinavir(DB01232)|Tamoxifen(DB00675)|Vinblastine(DB00570)						110.0	81.0	91.0					7																	87179543		2203	4300	6503	SO:0001583	missense	5243				G2/M transition of mitotic cell cycle|stem cell proliferation	apical plasma membrane|cell surface|Golgi membrane|integral to membrane|intercellular canaliculus|membrane fraction	ATP binding|protein binding|xenobiotic-transporting ATPase activity	g.chr7:87179543C>T	M14758	CCDS5608.1	7q21.12	2012-03-14	2004-05-12		ENSG00000085563	ENSG00000085563		"""CD molecules"", ""ATP binding cassette transporters / subfamily B"""	40	protein-coding gene	gene with protein product	"""multidrug resistance protein 1"""	171050	"""colchicin sensitivity"""	PGY1, MDR1, CLCS		3027054	Standard	NM_000927		Approved	P-gp, CD243, GP170, ABC20	uc003uiz.2	P08183	OTTHUMG00000023393	ENST00000265724.3:c.1294G>A	7.37:g.87179543C>T	ENSP00000265724:p.Gly432Arg		Somatic				ABCB1_uc011khc.1_Missense_Mutation_p.G368R	p.G432R	NM_000927	NP_000918	WXS	Illumina HiSeq	Unspecified	P08183	MDR1_HUMAN			13	1712	-	Esophageal squamous(14;0.00164)		432			ATP 1 (By similarity).|ABC transporter 1.|Cytoplasmic (Potential).		A8K294|B5AK60|Q12755|Q14812	Missense_Mutation	SNP	ENST00000265724.3	37	c.1294G>A	CCDS5608.1	.	.	.	.	.	.	.	.	.	.	C	32	5.145539	0.94603	.	.	ENSG00000085563	ENST00000543174;ENST00000265724;ENST00000543898	D;D	0.99863	-7.27;-7.27	6.16	6.16	0.99307	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.000000	0.85682	D	0.000000	D	0.99930	0.9968	H	0.98701	4.305	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.96364	0.9268	10	0.87932	D	0	-17.8869	20.8598	0.99761	0.0:1.0:0.0:0.0	.	368;432	B5AK60;P08183	.;MDR1_HUMAN	R	213;432;368	ENSP00000265724:G432R;ENSP00000444095:G368R	ENSP00000265724:G432R	G	-	1	0	ABCB1	87017479	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.818000	0.86416	2.937000	0.99478	0.650000	0.86243	GGG		0.552	ABCB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335444.2	NM_000927		4	36	0	0	0	0.001984	0	4	36				
SAMD9	54809	broad.mit.edu	37	7	92731291	92731291	+	Nonsense_Mutation	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr7:92731291C>A	ENST00000379958.2	-	3	4389	c.4120G>T	c.(4120-4122)Gaa>Taa	p.E1374*		NM_001193307.1|NM_017654.3	NP_001180236.1|NP_060124.2	Q5K651	SAMD9_HUMAN	sterile alpha motif domain containing 9	1374						cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)		p.E1374*(1)		NS(1)|breast(4)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(20)|lung(32)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	88	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		STAD - Stomach adenocarcinoma(171;0.000302)			GTGCATTGTTCTAAGAGAAAA	0.363																																							uc003umf.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(3)|skin(2)|breast(1)|central_nervous_system(1)	7						c.(4120-4122)GAA>TAA		sterile alpha motif domain containing 9							109.0	113.0	111.0					7																	92731291		2203	4298	6501	SO:0001587	stop_gained	54809					cytoplasm		g.chr7:92731291C>A	AB095925	CCDS34680.1	7q21.2	2013-01-10	2004-07-15	2004-07-16	ENSG00000205413	ENSG00000205413		"""Sterile alpha motif (SAM) domain containing"""	1348	protein-coding gene	gene with protein product		610456	"""chromosome 7 open reading frame 5"""	C7orf5			Standard	NM_017654		Approved	KIAA2004, FLJ20073	uc003umg.3	Q5K651	OTTHUMG00000155809	ENST00000379958.2:c.4120G>T	7.37:g.92731291C>A	ENSP00000369292:p.Glu1374*		Somatic				SAMD9_uc003umg.2_Nonsense_Mutation_p.E1374*	p.E1374*	NM_017654	NP_060124	WXS	Illumina HiSeq	Unspecified	Q5K651	SAMD9_HUMAN	STAD - Stomach adenocarcinoma(171;0.000302)		3	4376	-	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		1374					A2RU68|Q5K649|Q6P080|Q75N21|Q8IVG6|Q9NXS8	Nonsense_Mutation	SNP	ENST00000379958.2	37	c.4120G>T	CCDS34680.1	.	.	.	.	.	.	.	.	.	.	C	38	7.047119	0.98025	.	.	ENSG00000205413	ENST00000379958	.	.	.	4.41	2.4	0.29515	.	0.464806	0.19168	N	0.121002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.12766	T	0.61	-13.564	7.4495	0.27229	0.0:0.4352:0.4679:0.0969	.	.	.	.	X	1374	.	ENSP00000369292:E1374X	E	-	1	0	SAMD9	92569227	0.000000	0.05858	0.354000	0.25760	0.176000	0.22953	-0.381000	0.07417	1.165000	0.42670	0.603000	0.83216	GAA		0.363	SAMD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341761.1	NM_017654		18	191	1	0	2.94398e-08	0.007413	5.27514e-08	18	191				
DYNC1I1	1780	broad.mit.edu	37	7	95616384	95616384	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr7:95616384G>T	ENST00000324972.6	+	9	1004	c.811G>T	c.(811-813)Gcc>Tcc	p.A271S	DYNC1I1_ENST00000437599.1_Missense_Mutation_p.A251S|DYNC1I1_ENST00000359388.4_Missense_Mutation_p.A234S|DYNC1I1_ENST00000447467.2_Missense_Mutation_p.A254S|DYNC1I1_ENST00000457059.1_Missense_Mutation_p.A254S|DYNC1I1_ENST00000537881.1_Missense_Mutation_p.A234S	NM_004411.4	NP_004402.1	O14576	DC1I1_HUMAN	dynein, cytoplasmic 1, intermediate chain 1	271					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|metabolic process (GO:0008152)|vesicle transport along microtubule (GO:0047496)	cytoplasmic dynein complex (GO:0005868)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|kinetochore (GO:0000776)|microtubule (GO:0005874)|perinuclear region of cytoplasm (GO:0048471)|spindle pole (GO:0000922)|vesicle (GO:0031982)	microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)|spectrin binding (GO:0030507)	p.A271S(1)		NS(2)|autonomic_ganglia(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(27)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	54	all_cancers(62;9.39e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.165)|all_lung(186;0.191)		STAD - Stomach adenocarcinoma(171;0.0957)			TCAGGCTGGAGCCAATCTTTC	0.433																																							uc003uoc.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|kidney(1)	4						c.(811-813)GCC>TCC		dynein, cytoplasmic 1, intermediate chain 1							278.0	272.0	274.0					7																	95616384		2203	4300	6503	SO:0001583	missense	1780				vesicle transport along microtubule	condensed chromosome kinetochore|cytoplasmic dynein complex|microtubule|perinuclear region of cytoplasm|spindle pole|vesicle	microtubule binding|microtubule motor activity	g.chr7:95616384G>T	AF063228	CCDS5644.1, CCDS47645.1, CCDS47646.1, CCDS64718.1	7q21.3-q22.1	2013-01-18	2005-11-24	2005-11-24	ENSG00000158560	ENSG00000158560		"""Cytoplasmic dyneins"", ""WD repeat domain containing"""	2963	protein-coding gene	gene with protein product		603772	"""dynein, cytoplasmic, intermediate polypeptide 1"""	DNCI1		10049579, 16260502	Standard	NM_004411		Approved	DNCIC1	uc003uoc.4	O14576	OTTHUMG00000153983	ENST00000324972.6:c.811G>T	7.37:g.95616384G>T	ENSP00000320130:p.Ala271Ser		Somatic				DYNC1I1_uc003uod.3_Missense_Mutation_p.A254S|DYNC1I1_uc003uob.2_Missense_Mutation_p.A234S|DYNC1I1_uc003uoe.3_Missense_Mutation_p.A251S|DYNC1I1_uc010lfl.2_Missense_Mutation_p.A260S	p.A271S	NM_004411	NP_004402	WXS	Illumina HiSeq	Unspecified	O14576	DC1I1_HUMAN	STAD - Stomach adenocarcinoma(171;0.0957)		9	1088	+	all_cancers(62;9.39e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.165)|all_lung(186;0.191)		271					B4DME3|F5H050|G5E9K1|Q8TBF7|Q9Y2X1	Missense_Mutation	SNP	ENST00000324972.6	37	c.811G>T	CCDS5644.1	.	.	.	.	.	.	.	.	.	.	G	15.58	2.874918	0.51695	.	.	ENSG00000158560	ENST00000447467;ENST00000324972;ENST00000537881;ENST00000437599;ENST00000359388;ENST00000457059	T;T;T;T;T;T	0.73152	-0.49;-0.5;-0.72;-0.5;-0.5;-0.49	3.72	3.72	0.42706	WD40 repeat-like-containing domain (1);	0.065254	0.64402	D	0.000009	T	0.57636	0.2067	L	0.28400	0.85	0.80722	D	1	B;B;B;B;B	0.13594	0.005;0.008;0.008;0.005;0.004	B;B;B;B;B	0.15484	0.006;0.013;0.013;0.006;0.008	T	0.53422	-0.8441	10	0.13108	T	0.6	-3.4384	16.8119	0.85724	0.0:0.0:1.0:0.0	.	254;251;254;271;234	Q7Z6M0;G5E9K1;O14576-2;O14576;O14576-3	.;.;.;DC1I1_HUMAN;.	S	254;271;234;251;234;254	ENSP00000392337:A254S;ENSP00000320130:A271S;ENSP00000438377:A234S;ENSP00000398118:A251S;ENSP00000352348:A234S;ENSP00000412444:A254S	ENSP00000320130:A271S	A	+	1	0	DYNC1I1	95454320	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	4.323000	0.59221	2.361000	0.80049	0.563000	0.77884	GCC		0.433	DYNC1I1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333432.1	NM_004411		25	560	1	0	1.77063e-15	0.005443	3.73705e-15	25	560				
LMTK2	22853	broad.mit.edu	37	7	97822649	97822649	+	Missense_Mutation	SNP	G	G	T	rs367912151		TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr7:97822649G>T	ENST00000297293.5	+	11	3165	c.2872G>T	c.(2872-2874)Gca>Tca	p.A958S		NM_014916.3	NP_055731.2	Q8IWU2	LMTK2_HUMAN	lemur tyrosine kinase 2	958					early endosome to late endosome transport (GO:0045022)|endocytic recycling (GO:0032456)|negative regulation of catalytic activity (GO:0043086)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|receptor recycling (GO:0001881)|transferrin transport (GO:0033572)	early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|myosin VI binding (GO:0070853)|protein phosphatase inhibitor activity (GO:0004864)|protein serine/threonine kinase activity (GO:0004674)	p.A958S(2)|p.A958T(1)		NS(2)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(25)|ovary(1)|pancreas(2)|skin(2)|stomach(3)	59	all_cancers(62;3.23e-09)|all_epithelial(64;7.65e-10)|Lung NSC(181;0.00902)|all_lung(186;0.0104)|Esophageal squamous(72;0.0125)					TTCTAAAGACGCAGCAAAAGA	0.502																																							uc003upd.1		NA																	3	Substitution - Missense(3)	p.A958T(1)	lung(2)|stomach(1)	lung(9)|stomach(3)|pancreas(2)|large_intestine(1)|breast(1)	16						c.(2872-2874)GCA>TCA		lemur tyrosine kinase 2 precursor							83.0	91.0	89.0					7																	97822649		2203	4300	6503	SO:0001583	missense	22853				early endosome to late endosome transport|endocytic recycling|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|protein autophosphorylation|receptor recycling|transferrin transport	early endosome|Golgi apparatus|integral to membrane|perinuclear region of cytoplasm|recycling endosome	ATP binding|myosin VI binding|protein phosphatase inhibitor activity|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr7:97822649G>T	AB029002	CCDS5654.1	7q22.1	2014-06-12			ENSG00000164715	ENSG00000164715			17880	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 100"""	610989				15005709	Standard	NM_014916		Approved	KIAA1079, KPI2, KPI-2, cprk, LMR2, BREK, AATYK2, PPP1R100	uc003upd.2	Q8IWU2	OTTHUMG00000154256	ENST00000297293.5:c.2872G>T	7.37:g.97822649G>T	ENSP00000297293:p.Ala958Ser		Somatic					p.A958S	NM_014916	NP_055731	WXS	Illumina HiSeq	Unspecified	Q8IWU2	LMTK2_HUMAN			11	3165	+	all_cancers(62;3.23e-09)|all_epithelial(64;7.65e-10)|Lung NSC(181;0.00902)|all_lung(186;0.0104)|Esophageal squamous(72;0.0125)		958					A4D272|Q75MG7|Q9UPS3	Missense_Mutation	SNP	ENST00000297293.5	37	c.2872G>T	CCDS5654.1	.	.	.	.	.	.	.	.	.	.	G	6.253	0.414781	0.11870	.	.	ENSG00000164715	ENST00000297293	T	0.78364	-1.17	4.89	0.907	0.19321	.	0.870685	0.10339	N	0.686564	T	0.70002	0.3174	L	0.55103	1.725	0.09310	N	1	B	0.24483	0.104	B	0.23150	0.044	T	0.56583	-0.7955	10	0.45353	T	0.12	.	6.6404	0.22906	0.2283:0.0:0.6437:0.128	.	958	Q8IWU2	LMTK2_HUMAN	S	958	ENSP00000297293:A958S	ENSP00000297293:A958S	A	+	1	0	LMTK2	97660585	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	0.084000	0.14891	-0.269000	0.09298	-0.813000	0.03139	GCA		0.502	LMTK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334560.1	NM_014916		7	95	1	0	7.48243e-07	0.006214	1.23488e-06	7	95				
MUC17	140453	broad.mit.edu	37	7	100677756	100677757	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr7:100677756_100677757CC>AA	ENST00000306151.4	+	3	3123_3124	c.3059_3060CC>AA	c.(3058-3060)gCC>gAA	p.A1020E		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	1020	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)	p.A1020A(1)		NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					TCTACTGAAGCCAGTTCACCTC	0.525																																							uc003uxp.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(14)|skin(8)|breast(3)|lung(2)	27						c.(3058-3060)GCC>GAA		mucin 17 precursor																																				SO:0001583	missense	140453					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity	g.chr7:100677756_100677757CC>AA	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	Exception_encountered	7.37:g.100677756_100677757delinsAA	ENSP00000302716:p.Ala1020Glu		Somatic				MUC17_uc010lho.1_RNA	p.A1020E	NM_001040105	NP_001035194	WXS	Illumina HiSeq	Unspecified	Q685J3	MUC17_HUMAN			3	3112_3113	+	Lung NSC(181;0.136)|all_lung(186;0.182)		1020			Extracellular (Potential).|Ser-rich.|59 X approximate tandem repeats.|15.		O14761|Q685J2|Q8TDH7	Missense_Mutation	DNP	ENST00000306151.4	37	c.3059_3060CC>AA	CCDS34711.1																																																																																				0.525	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105		26	660	0	0	0	0.004672	0	26	660				
SH2B2	10603	broad.mit.edu	37	7	101952177	101952177	+	Silent	SNP	C	C	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr7:101952177C>T	ENST00000536178.1	+	4	1086	c.1041C>T	c.(1039-1041)tgC>tgT	p.C347C	SH2B2_ENST00000306803.8_Silent_p.C304C			O14492	SH2B2_HUMAN	SH2B adaptor protein 2	304					actin cytoskeleton organization (GO:0030036)|antigen receptor-mediated signaling pathway (GO:0050851)|B-1 B cell homeostasis (GO:0001922)|blood coagulation (GO:0007596)|brown fat cell differentiation (GO:0050873)|cytokine-mediated signaling pathway (GO:0019221)|insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|regulation of JAK-STAT cascade (GO:0046425)|regulation of metabolic process (GO:0019222)|regulation of Ras protein signal transduction (GO:0046578)|signal transduction (GO:0007165)	actin filament (GO:0005884)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|stress fiber (GO:0001725)	JAK pathway signal transduction adaptor activity (GO:0008269)|SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)	p.C347C(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|skin(1)	9						TCCAGGGCTGCGTGGACCCCG	0.607																																							uc011kko.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1039-1041)TGC>TGT		SH2B adaptor protein 2							121.0	130.0	127.0					7																	101952177		2113	4231	6344	SO:0001819	synonymous_variant	10603				blood coagulation|insulin receptor signaling pathway|intracellular signal transduction	cytosol|plasma membrane	JAK pathway signal transduction adaptor activity|SH3/SH2 adaptor activity|signal transducer activity	g.chr7:101952177C>T	AB000520		7q22.1	2013-02-14			ENSG00000160999	ENSG00000160999		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	17381	protein-coding gene	gene with protein product	"""adaptor protein with pleckstrin homology and src"""	605300				9233773	Standard	XM_005276976		Approved	APS	uc011kko.2	O14492	OTTHUMG00000150652	ENST00000536178.1:c.1041C>T	7.37:g.101952177C>T			Somatic					p.C347C	NM_020979	NP_066189	WXS	Illumina HiSeq	Unspecified	O14492	SH2B2_HUMAN			4	1086	+			304			PH.		A6ND74	Silent	SNP	ENST00000536178.1	37	c.1041C>T																																																																																					0.607	SH2B2-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_020979		11	145	0	0	0	0.008291	0	11	145				
RELN	5649	broad.mit.edu	37	7	103214661	103214661	+	Nonsense_Mutation	SNP	G	G	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr7:103214661G>T	ENST00000428762.1	-	30	4548	c.4389C>A	c.(4387-4389)taC>taA	p.Y1463*	RELN_ENST00000424685.2_Nonsense_Mutation_p.Y1463*|RELN_ENST00000343529.5_Nonsense_Mutation_p.Y1463*	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	1463					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)	p.Y1463*(1)		NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		CTGTTATCTTGTACCACAGAG	0.498																																					NSCLC(146;835 1944 15585 22231 52158)	NSCLC(146;835 1944 15585 22231 52158)	uc003vca.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19						c.(4387-4389)TAC>TAA		reelin isoform a							138.0	116.0	123.0					7																	103214661		2203	4300	6503	SO:0001587	stop_gained	5649				axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity	g.chr7:103214661G>T		CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.4389C>A	7.37:g.103214661G>T	ENSP00000392423:p.Tyr1463*		Somatic				RELN_uc010liz.2_Nonsense_Mutation_p.Y1463*	p.Y1463*	NM_005045	NP_005036	WXS	Illumina HiSeq	Unspecified	P78509	RELN_HUMAN		COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)	30	4549	-			1463					A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Nonsense_Mutation	SNP	ENST00000428762.1	37	c.4389C>A	CCDS47680.1	.	.	.	.	.	.	.	.	.	.	G	45	11.736638	0.99597	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000448171	.	.	.	5.51	5.51	0.81932	.	0.124366	0.56097	D	0.000025	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.0435	0.58913	0.074:0.0:0.926:0.0	.	.	.	.	X	1463	.	ENSP00000345694:Y1463X	Y	-	3	2	RELN	103001897	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	4.037000	0.57311	2.750000	0.94351	0.655000	0.94253	TAC		0.498	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	NM_005045		5	143	1	0	2.0095e-06	0.001984	3.24327e-06	5	143				
PAX4	5078	broad.mit.edu	37	7	127255560	127255560	+	Silent	SNP	C	C	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr7:127255560C>T	ENST00000341640.2	-	1	220	c.15G>A	c.(13-15)ggG>ggA	p.G5G	PAX4_ENST00000338516.3_Silent_p.G13G|PAX4_ENST00000463946.1_5'UTR|PAX4_ENST00000378740.2_Silent_p.G5G	NM_006193.2	NP_006184.2	O43316	PAX4_HUMAN	paired box 4	13	Paired. {ECO:0000255|PROSITE- ProRule:PRU00381}.				cell differentiation (GO:0030154)|circadian rhythm (GO:0007623)|endocrine pancreas development (GO:0031018)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|positive regulation of cell differentiation (GO:0045597)|response to cAMP (GO:0051591)|response to drug (GO:0042493)|retina development in camera-type eye (GO:0060041)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)	p.G5G(1)		cervix(1)|kidney(2)|large_intestine(6)|lung(20)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	35						CAAAGAGCCCCCCAAGCTGGT	0.627																																					Ovarian(113;737 1605 7858 27720 34092)	Ovarian(113;737 1605 7858 27720 34092)	uc010lld.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(13-15)GGG>GGA		paired box 4							76.0	79.0	78.0					7																	127255560		2203	4300	6503	SO:0001819	synonymous_variant	5078				cell differentiation|endocrine pancreas development|organ morphogenesis	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr7:127255560C>T		CCDS5797.1	7q32.1	2011-06-20	2007-07-12		ENSG00000106331	ENSG00000106331		"""Paired boxes"", ""Homeoboxes / PRD class"""	8618	protein-coding gene	gene with protein product		167413	"""paired box gene 4"""				Standard	NM_006193		Approved	MODY9	uc010lld.1	O43316	OTTHUMG00000157562	ENST00000341640.2:c.15G>A	7.37:g.127255560C>T			Somatic				PAX4_uc003vmf.2_5'UTR|PAX4_uc003vmg.1_Silent_p.G5G|PAX4_uc003vmh.2_5'UTR	p.G5G	NM_006193	NP_006184	WXS	Illumina HiSeq	Unspecified	O43316	PAX4_HUMAN			1	221	-			13			Paired.		O95161|Q6B0H0	Silent	SNP	ENST00000341640.2	37	c.15G>A	CCDS5797.1																																																																																				0.627	PAX4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000349165.1			4	77	0	0	0	0.000602	0	4	77				
LEP	3952	broad.mit.edu	37	7	127892140	127892140	+	Silent	SNP	C	C	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr7:127892140C>T	ENST00000308868.4	+	2	120	c.69C>T	c.(67-69)ccC>ccT	p.P23P		NM_000230.2	NP_000221.1	P41159	LEP_HUMAN	leptin	23					adipose tissue development (GO:0060612)|adult feeding behavior (GO:0008343)|bile acid metabolic process (GO:0008206)|bone mineralization involved in bone maturation (GO:0035630)|cellular response to L-ascorbic acid (GO:0071298)|cellular response to retinoic acid (GO:0071300)|central nervous system neuron development (GO:0021954)|cholesterol metabolic process (GO:0008203)|circadian rhythm (GO:0007623)|eating behavior (GO:0042755)|energy reserve metabolic process (GO:0006112)|fatty acid beta-oxidation (GO:0006635)|female pregnancy (GO:0007565)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycerol biosynthetic process (GO:0006114)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|leptin-mediated signaling pathway (GO:0033210)|leukocyte tethering or rolling (GO:0050901)|negative regulation of apoptotic process (GO:0043066)|negative regulation of appetite (GO:0032099)|negative regulation of cartilage development (GO:0061037)|negative regulation of glucagon secretion (GO:0070093)|negative regulation of glutamine transport (GO:2000486)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of vasoconstriction (GO:0045906)|ovulation from ovarian follicle (GO:0001542)|placenta development (GO:0001890)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokine production (GO:0001819)|positive regulation of developmental growth (GO:0048639)|positive regulation of follicle-stimulating hormone secretion (GO:0046881)|positive regulation of hepatic stellate cell activation (GO:2000491)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of ion transport (GO:0043270)|positive regulation of luteinizing hormone secretion (GO:0033686)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of myeloid cell differentiation (GO:0045639)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|regulation of blood pressure (GO:0008217)|regulation of fat cell differentiation (GO:0045598)|regulation of gluconeogenesis (GO:0006111)|regulation of insulin secretion (GO:0050796)|regulation of intestinal cholesterol absorption (GO:0030300)|regulation of lipoprotein lipid oxidation (GO:0060587)|regulation of steroid biosynthetic process (GO:0050810)|response to dietary excess (GO:0002021)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|response to vitamin E (GO:0033197)|tyrosine phosphorylation of STAT protein (GO:0007260)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)		p.P23P(1)		endometrium(1)|large_intestine(2)|lung(5)	8						AAGCTGTGCCCATCCAAAAAG	0.488																																							uc003vml.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(67-69)CCC>CCT		leptin precursor							268.0	238.0	248.0					7																	127892140		2203	4300	6503	SO:0001819	synonymous_variant	3952				adult feeding behavior|energy reserve metabolic process|negative regulation of appetite|placenta development|positive regulation of developmental growth	extracellular space		g.chr7:127892140C>T		CCDS5800.1	7q31	2008-03-06	2008-03-06		ENSG00000174697	ENSG00000174697			6553	protein-coding gene	gene with protein product		164160	"""leptin (murine obesity homolog)"", ""leptin (obesity homolog, mouse)"""	OBS, OB		1686014, 16932309	Standard	NM_000230		Approved		uc003vml.2	P41159	OTTHUMG00000157564	ENST00000308868.4:c.69C>T	7.37:g.127892140C>T			Somatic				LEP_uc003vmm.2_Silent_p.P23P	p.P23P	NM_000230	NP_000221	WXS	Illumina HiSeq	Unspecified	P41159	LEP_HUMAN			2	126	+			23					O15158|Q56A88	Silent	SNP	ENST00000308868.4	37	c.69C>T	CCDS5800.1																																																																																				0.488	LEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349174.1			19	222	0	0	0	0.008871	0	19	222				
FLNC	2318	broad.mit.edu	37	7	128493588	128493588	+	Nonsense_Mutation	SNP	G	G	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr7:128493588G>T	ENST00000325888.8	+	38	6535	c.6274G>T	c.(6274-6276)Gag>Tag	p.E2092*	FLNC_ENST00000346177.6_Nonsense_Mutation_p.E2059*|RP11-309L24.2_ENST00000469965.1_RNA	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	2092					cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)	p.E2092*(1)		biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						TGAGGACATGGAGGACGGGAC	0.562																																							uc003vnz.3		NA																	1	Substitution - Nonsense(1)		lung(1)	breast(5)|large_intestine(3)|ovary(2)|central_nervous_system(1)|skin(1)	12						c.(6274-6276)GAG>TAG		gamma filamin isoform a							113.0	120.0	118.0					7																	128493588		2089	4214	6303	SO:0001587	stop_gained	2318				cell junction assembly	cytoskeleton|cytosol|plasma membrane|sarcomere	actin binding	g.chr7:128493588G>T	AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.6274G>T	7.37:g.128493588G>T	ENSP00000327145:p.Glu2092*		Somatic				FLNC_uc003voa.3_Nonsense_Mutation_p.E2059*	p.E2092*	NM_001458	NP_001449	WXS	Illumina HiSeq	Unspecified	Q14315	FLNC_HUMAN			38	6483	+			2092			Filamin 19.		B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Nonsense_Mutation	SNP	ENST00000325888.8	37	c.6274G>T	CCDS43644.1	.	.	.	.	.	.	.	.	.	.	G	48	14.891119	0.99814	.	.	ENSG00000128591	ENST00000325888;ENST00000346177	.	.	.	5.42	5.42	0.78866	.	0.054385	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.25106	T	0.35	.	19.2243	0.93812	0.0:0.0:1.0:0.0	.	.	.	.	X	2092;2059	.	ENSP00000327145:E2092X	E	+	1	0	FLNC	128280824	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.835000	0.99442	2.539000	0.85634	0.561000	0.74099	GAG		0.562	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059948.3			4	41	1	0	1.23904e-05	0.000602	1.87565e-05	4	41				
MGAM	8972	broad.mit.edu	37	7	141758016	141758016	+	Missense_Mutation	SNP	C	C	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr7:141758016C>T	ENST00000549489.2	+	31	3802	c.3707C>T	c.(3706-3708)cCt>cTt	p.P1236L	MGAM_ENST00000475668.2_Missense_Mutation_p.P1236L	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)	1236	Glucoamylase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)	p.P1236L(3)		cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	ATTGGCCGGCCTGTGATGGTA	0.438																																							uc003vwy.2		NA																	3	Substitution - Missense(3)		lung(3)	ovary(2)	2						c.(3706-3708)CCT>CTT		maltase-glucoamylase	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)						258.0	250.0	253.0					7																	141758016		1905	4111	6016	SO:0001583	missense	8972				polysaccharide digestion|starch catabolic process	apical plasma membrane|integral to membrane	carbohydrate binding|glucan 1,4-alpha-glucosidase activity|maltose alpha-glucosidase activity	g.chr7:141758016C>T	AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.3707C>T	7.37:g.141758016C>T	ENSP00000447378:p.Pro1236Leu		Somatic					p.P1236L	NM_004668	NP_004659	WXS	Illumina HiSeq	Unspecified	O43451	MGA_HUMAN			31	3761	+	Melanoma(164;0.0272)		1236			Glucoamylase.|Lumenal (Potential).		Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	ENST00000549489.2	37	c.3707C>T	CCDS47727.1	.	.	.	.	.	.	.	.	.	.	c	16.99	3.273249	0.59649	.	.	ENSG00000257335	ENST00000549489;ENST00000475668;ENST00000548812	D	0.94000	-3.33	3.72	3.72	0.42706	Glycoside hydrolase, superfamily (1);	.	.	.	.	D	0.97726	0.9254	H	0.96916	3.905	0.54753	D	0.999989	D	0.89917	1.0	D	0.97110	1.0	D	0.98977	1.0803	9	0.87932	D	0	.	14.3362	0.66592	0.0:1.0:0.0:0.0	.	1236	O43451	MGA_HUMAN	L	1236;1236;1113	ENSP00000447378:P1236L	ENSP00000316431:P1113L	P	+	2	0	MGAM	141404485	1.000000	0.71417	0.956000	0.39512	0.352000	0.29268	7.550000	0.82173	1.623000	0.50342	0.173000	0.16961	CCT		0.438	MGAM-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351244.3			31	467	0	0	0	0.006999	0	31	467				
PRSS58	136541	broad.mit.edu	37	7	141955355	141955355	+	Splice_Site	SNP	G	G	C			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr7:141955355G>C	ENST00000552471.1	-	2	498	c.179C>G	c.(178-180)cCa>cGa	p.P60R	PRSS58_ENST00000547058.2_Splice_Site_p.P60R			Q8IYP2	PRS58_HUMAN	protease, serine, 58	60	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)	p.P60R(1)		kidney(1)|large_intestine(2)|lung(11)|ovary(1)|prostate(2)|skin(2)	19						TATCACTCACGGTAAATTGCA	0.498																																							uc003vxb.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(178-180)CCA>CGA		trypsin X3 precursor							75.0	75.0	75.0					7																	141955355		2203	4300	6503	SO:0001630	splice_region_variant	136541				proteolysis	extracellular region	serine-type endopeptidase activity	g.chr7:141955355G>C		CCDS5871.1	7q34	2012-10-03			ENSG00000258223	ENSG00000258223	3.4.21.4	"""Serine peptidases / Serine peptidases"""	39125	protein-coding gene	gene with protein product	"""trypsin X3"""						Standard	NM_001001317		Approved	TRYX3	uc003vxc.4	Q8IYP2	OTTHUMG00000158565	ENST00000552471.1:c.179+1C>G	7.37:g.141955355G>C			Somatic				TRYX3_uc003vxc.3_Missense_Mutation_p.P60R	p.P60R	NM_001001317	NP_001001317	WXS	Illumina HiSeq	Unspecified	Q8IYP2	PRS58_HUMAN			2	499	-	Melanoma(164;0.0272)		60			Peptidase S1.		B3KVJ6|D3DXD2	Missense_Mutation	SNP	ENST00000552471.1	37	c.179C>G	CCDS5871.1	.	.	.	.	.	.	.	.	.	.	G	14.83	2.653389	0.47362	.	.	ENSG00000258223	ENST00000547058;ENST00000552471	D;D	0.88046	-2.33;-2.33	5.1	4.22	0.49857	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	D	0.88905	0.6564	L	0.35644	1.08	0.37206	D	0.904601	D	0.89917	1.0	D	0.87578	0.998	D	0.88980	0.3407	8	.	.	.	.	11.3609	0.49642	0.0877:0.0:0.9123:0.0	.	60	Q8IYP2	PRS58_HUMAN	R	60	ENSP00000447588:P60R;ENSP00000446916:P60R	.	P	-	2	0	PRSS58	141601832	0.979000	0.34478	1.000000	0.80357	0.873000	0.50193	1.193000	0.32162	1.382000	0.46385	0.655000	0.94253	CCA		0.498	PRSS58-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351328.2	NM_001001317	Missense_Mutation	9	112	0	0	0	0.008291	0	9	112				
PRSS1	5644	broad.mit.edu	37	7	142459655	142459655	+	Missense_Mutation	SNP	C	C	A	rs555535168		TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr7:142459655C>A	ENST00000311737.7	+	3	237	c.231C>A	c.(229-231)aaC>aaA	p.N77K	PRSS1_ENST00000486171.1_Missense_Mutation_p.N91K	NM_002769.4	NP_002760.1	P07477	TRY1_HUMAN	protease, serine, 1 (trypsin 1)	77	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(24)|prostate(2)	38	Melanoma(164;0.047)	all_cancers(3;2.14e-49)|Acute lymphoblastic leukemia(3;7.3e-185)|all_hematologic(3;1.1e-165)	all cancers(2;0.000126)|Colorectal(2;0.000157)|Epithelial(2;0.000191)|COAD - Colon adenocarcinoma(2;0.00189)		Aprotinin(DB06692)	GAGAGCACAACATCGAAGTCC	0.552																																							uc003wak.2		NA																	0				large_intestine(1)|central_nervous_system(1)	2						c.(229-231)AAC>AAA		protease, serine, 1 preproprotein							186.0	177.0	180.0					7																	142459655		2203	4300	6503	SO:0001583	missense	5644	Hereditary_Pancreatitis			digestion|proteolysis	extracellular space	metal ion binding|protein binding|serine-type endopeptidase activity	g.chr7:142459655C>A	M22612	CCDS5872.1	7q34	2012-10-02			ENSG00000204983	ENSG00000204983	3.4.21.4	"""Serine peptidases / Serine peptidases"""	9475	protein-coding gene	gene with protein product		276000		TRY1			Standard	NM_002769		Approved		uc003wak.2	P07477	OTTHUMG00000158923	ENST00000311737.7:c.231C>A	7.37:g.142459655C>A	ENSP00000308720:p.Asn77Lys		Somatic				uc011krr.1_Intron|uc003vzp.2_Intron|uc011ksh.1_Intron|uc011ksi.1_Intron|uc003vzw.1_Intron|uc010loj.1_Intron|uc003wad.2_Intron|uc003wag.1_Intron|TRY6_uc011ksn.1_Intron|PRSS1_uc011ksm.1_3'UTR|PRSS1_uc003wam.2_Missense_Mutation_p.N17K	p.N77K	NM_002769	NP_002760	WXS	Illumina HiSeq	Unspecified	P07477	TRY1_HUMAN	all cancers(2;0.000126)|Colorectal(2;0.000157)|Epithelial(2;0.000191)|COAD - Colon adenocarcinoma(2;0.00189)		3	248	+	Melanoma(164;0.047)	all_cancers(3;2.14e-49)|Acute lymphoblastic leukemia(3;7.3e-185)|all_hematologic(3;1.1e-165)	77			Peptidase S1.	Calcium; via carbonyl oxygen.	A1A509|A6NJ71|B2R5I5|Q5NV57|Q7M4N3|Q7M4N4|Q92955|Q9HAN4|Q9HAN5|Q9HAN6|Q9HAN7	Missense_Mutation	SNP	ENST00000311737.7	37	c.231C>A	CCDS5872.1	.	.	.	.	.	.	.	.	.	.	C	16.21	3.058236	0.55325	.	.	ENSG00000204983	ENST00000486171;ENST00000311737;ENST00000529243;ENST00000492062	D;D;D	0.93547	-3.24;-3.24;-1.61	3.28	3.28	0.37604	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.039018	0.85682	D	0.000000	D	0.94159	0.8126	L	0.39020	1.185	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.76575	0.988;0.988	D	0.94755	0.7931	10	0.87932	D	0	.	14.0086	0.64481	0.0:1.0:0.0:0.0	.	91;77	E7EQ64;P07477	.;TRY1_HUMAN	K	91;77;77;27	ENSP00000417854:N91K;ENSP00000308720:N77K;ENSP00000419912:N27K	ENSP00000308720:N77K	N	+	3	2	PRSS1	142139229	1.000000	0.71417	0.982000	0.44146	0.099000	0.18886	5.969000	0.70422	1.789000	0.52484	0.398000	0.26397	AAC		0.552	PRSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352538.2			10	204	1	0	2.27111e-07	0.001368	3.83468e-07	10	204				
TRPV6	55503	broad.mit.edu	37	7	142574936	142574936	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr7:142574936C>A	ENST00000359396.3	-	4	691	c.446G>T	c.(445-447)gGc>gTc	p.G149V	RP11-114L10.2_ENST00000438839.1_RNA	NM_018646.3	NP_061116	Q9H1D0	TRPV6_HUMAN	transient receptor potential cation channel, subfamily V, member 6	149					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|regulation of calcium ion-dependent exocytosis (GO:0017158)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|calmodulin binding (GO:0005516)	p.G149V(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(15)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	42	Melanoma(164;0.059)					GAAGGCAGTGCCTGTGGCTCT	0.617																																							uc003wbx.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(445-447)GGC>GTC		transient receptor potential cation channel,							77.0	69.0	72.0					7																	142574936		2203	4300	6503	SO:0001583	missense	55503				regulation of calcium ion-dependent exocytosis	integral to plasma membrane	calcium channel activity|calmodulin binding	g.chr7:142574936C>A	AJ277909	CCDS5874.1	7q34	2013-01-10	2002-01-29	2002-02-01	ENSG00000165125	ENSG00000165125		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	14006	protein-coding gene	gene with protein product		606680	"""epithelial calcium channel 2"""	ECAC2		11097838, 11549322, 16382100, 16717058	Standard	NM_018646		Approved	CaT1	uc003wbx.2	Q9H1D0	OTTHUMG00000157158	ENST00000359396.3:c.446G>T	7.37:g.142574936C>A	ENSP00000352358:p.Gly149Val		Somatic				TRPV6_uc003wbw.1_5'Flank|TRPV6_uc010lou.1_Missense_Mutation_p.G20V	p.G149V	NM_018646	NP_061116	WXS	Illumina HiSeq	Unspecified	Q9H1D0	TRPV6_HUMAN			4	662	-	Melanoma(164;0.059)		149			Cytoplasmic (Potential).		A4D2I8|Q8TDL3|Q8WXR8|Q96LC5|Q9H1D1|Q9H296	Missense_Mutation	SNP	ENST00000359396.3	37	c.446G>T	CCDS5874.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.056151	0.76074	.	.	ENSG00000165125	ENST00000359396	T	0.52295	0.67	3.86	3.86	0.44501	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	T	0.72598	0.3480	M	0.88979	2.995	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.80058	-0.1541	10	0.87932	D	0	-21.843	14.9814	0.71313	0.0:1.0:0.0:0.0	.	149	Q9H1D0	TRPV6_HUMAN	V	149	ENSP00000352358:G149V	ENSP00000352358:G149V	G	-	2	0	TRPV6	142285058	1.000000	0.71417	0.067000	0.19924	0.809000	0.45718	5.176000	0.65026	1.995000	0.58328	0.655000	0.94253	GGC		0.617	TRPV6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347662.1	NM_014274		3	25	1	0	0.000602214	0.000602	0.000753197	3	25				
GIMAP2	26157	broad.mit.edu	37	7	150390208	150390208	+	Missense_Mutation	SNP	G	G	C			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr7:150390208G>C	ENST00000223293.5	+	3	928	c.834G>C	c.(832-834)caG>caC	p.Q278H		NM_015660.2	NP_056475.1	Q9UG22	GIMA2_HUMAN	GTPase, IMAP family member 2	278						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)	GTP binding (GO:0005525)	p.Q278H(1)		kidney(1)|large_intestine(1)|lung(8)|skin(2)|urinary_tract(1)	13			OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TTTGTATTCAGTTGTTTCTCA	0.363																																							uc003who.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(832-834)CAG>CAC		GTPase, IMAP family member 2							118.0	113.0	115.0					7																	150390208		2203	4300	6503	SO:0001583	missense	26157					integral to membrane	GTP binding	g.chr7:150390208G>C	AL110151	CCDS5905.1	7q36.1	2014-04-04			ENSG00000106560	ENSG00000106560		"""GTPases, IMAP"""	21789	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 12"""	608085				15474311	Standard	NM_015660		Approved	DKFZp586D0824, HIMAP2, IMAP2, IAN12	uc003who.3	Q9UG22	OTTHUMG00000157488	ENST00000223293.5:c.834G>C	7.37:g.150390208G>C	ENSP00000223293:p.Gln278His		Somatic				GIMAP1_uc003whp.2_Intron	p.Q278H	NM_015660	NP_056475	WXS	Illumina HiSeq	Unspecified	Q9UG22	GIMA2_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	3	922	+			278			Helical; (Potential).		Q96L25	Missense_Mutation	SNP	ENST00000223293.5	37	c.834G>C	CCDS5905.1	.	.	.	.	.	.	.	.	.	.	G	1.535	-0.543205	0.04053	.	.	ENSG00000106560	ENST00000223293	T	0.06218	3.33	3.31	1.21	0.21127	.	2.096730	0.02353	N	0.076134	T	0.05135	0.0137	N	0.19112	0.55	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.37641	-0.9697	10	0.44086	T	0.13	.	3.3153	0.07031	0.1596:0.0:0.5739:0.2665	.	278	Q9UG22	GIMA2_HUMAN	H	278	ENSP00000223293:Q278H	ENSP00000223293:Q278H	Q	+	3	2	GIMAP2	150021141	0.000000	0.05858	0.001000	0.08648	0.291000	0.27294	0.058000	0.14301	0.150000	0.19136	-0.355000	0.07637	CAG		0.363	GIMAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348948.1	NM_015660		3	64	0	0	0	0.000248	0	3	64				
CSMD1	64478	broad.mit.edu	37	8	2855612	2855612	+	Silent	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr8:2855612C>A	ENST00000520002.1	-	55	8856	c.8301G>T	c.(8299-8301)acG>acT	p.T2767T	CSMD1_ENST00000602723.1_Silent_p.T2709T|CSMD1_ENST00000542608.1_Silent_p.T2708T|CSMD1_ENST00000602557.1_Silent_p.T2767T|CSMD1_ENST00000400186.3_Silent_p.T2709T|CSMD1_ENST00000537824.1_Silent_p.T2766T			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	2767	Sushi 19. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)		p.T2766T(1)|p.T2495T(1)		breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		GCAAATAGCCCGTGTTGCAGG	0.557																																							uc011kwk.1		NA																	2	Substitution - coding silent(2)		lung(2)	breast(20)|large_intestine(5)	25						c.(8299-8301)ACG>ACT		CUB and Sushi multiple domains 1 precursor							114.0	112.0	112.0					8																	2855612		2049	4197	6246	SO:0001819	synonymous_variant	64478					integral to membrane		g.chr8:2855612C>A			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.8301G>T	8.37:g.2855612C>A			Somatic				CSMD1_uc011kwj.1_Silent_p.T2096T|CSMD1_uc010lrg.2_Silent_p.T777T	p.T2767T	NM_033225	NP_150094	WXS	Illumina HiSeq	Unspecified	Q96PZ7	CSMD1_HUMAN		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)	54	8691	-		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)	2767			Extracellular (Potential).|Sushi 19.		Q0H0J5|Q96QU9|Q96RM4	Silent	SNP	ENST00000520002.1	37	c.8301G>T		.	.	.	.	.	.	.	.	.	.	C	0.693	-0.793810	0.02862	.	.	ENSG00000183117	ENST00000335551	.	.	.	6.07	-9.91	0.00458	.	.	.	.	.	T	0.32255	0.0823	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.41556	-0.9502	4	.	.	.	.	1.6068	0.02685	0.4135:0.1851:0.0856:0.3158	.	.	.	.	W	2184	.	.	G	-	1	0	CSMD1	2843019	0.000000	0.05858	0.008000	0.14137	0.144000	0.21451	-4.514000	0.00222	-1.549000	0.01710	-0.794000	0.03295	GGG		0.557	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225		5	70	1	0	0.000602214	0.000602	0.000753197	5	70				
TNKS	8658	broad.mit.edu	37	8	9623218	9623218	+	Missense_Mutation	SNP	A	A	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr8:9623218A>T	ENST00000310430.6	+	24	3490	c.3464A>T	c.(3463-3465)aAc>aTc	p.N1155I	TNKS_ENST00000518281.1_Missense_Mutation_p.N918I	NM_003747.2	NP_003738.2	O95271	TNKS1_HUMAN	tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase	1155	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.				mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|mRNA transport (GO:0051028)|negative regulation of DNA binding (GO:0043392)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of telomere maintenance via telomerase (GO:0032212)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)|protein localization to chromosome, telomeric region (GO:0070198)|protein poly-ADP-ribosylation (GO:0070212)|protein polyubiquitination (GO:0000209)|protein transport (GO:0015031)|regulation of telomere maintenance via telomerase (GO:0032210)|spindle assembly (GO:0051225)|Wnt signaling pathway (GO:0016055)	chromosome, centromeric region (GO:0000775)|chromosome, telomeric region (GO:0000781)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nuclear chromosome, telomeric region (GO:0000784)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)	NAD+ ADP-ribosyltransferase activity (GO:0003950)|zinc ion binding (GO:0008270)	p.N1155I(2)		NS(1)|endometrium(10)|kidney(6)|large_intestine(4)|lung(17)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)	49				COAD - Colon adenocarcinoma(149;0.0467)		AAAGTTGTCAACAAGAAGTTG	0.388																																							uc003wss.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(4)|ovary(2)|kidney(1)	7						c.(3463-3465)AAC>ATC		tankyrase, TRF1-interacting ankyrin-related							98.0	91.0	93.0					8																	9623218		2203	4300	6503	SO:0001583	missense	8658				mitotic spindle organization|mRNA transport|negative regulation of DNA binding|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of telomere maintenance via telomerase|protein auto-ADP-ribosylation|protein localization to chromosome, telomeric region|protein poly-ADP-ribosylation|protein polyubiquitination|protein transport|spindle assembly|transmembrane transport|Wnt receptor signaling pathway	chromosome, centromeric region|Golgi membrane|microsome|nuclear chromosome, telomeric region|nuclear membrane|nuclear pore|pericentriolar material	NAD+ ADP-ribosyltransferase activity|protein binding|zinc ion binding	g.chr8:9623218A>T	AF082556	CCDS5974.1	8p23.1	2013-01-10			ENSG00000173273	ENSG00000173273		"""Poly (ADP-ribose) polymerases"", ""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	11941	protein-coding gene	gene with protein product		603303				9822378, 10198177	Standard	XM_006716263		Approved	TIN1, TINF1, TNKS1, PARP-5a, PARP5A, pART5	uc003wss.3	O95271	OTTHUMG00000090481	ENST00000310430.6:c.3464A>T	8.37:g.9623218A>T	ENSP00000311579:p.Asn1155Ile		Somatic				TNKS_uc011kww.1_Missense_Mutation_p.N918I	p.N1155I	NM_003747	NP_003738	WXS	Illumina HiSeq	Unspecified	O95271	TNKS1_HUMAN		COAD - Colon adenocarcinoma(149;0.0467)	24	3469	+			1155			PARP catalytic.		O95272|Q4G0F2	Missense_Mutation	SNP	ENST00000310430.6	37	c.3464A>T	CCDS5974.1	.	.	.	.	.	.	.	.	.	.	A	28.2	4.896887	0.91962	.	.	ENSG00000173273	ENST00000310430;ENST00000518281	T;T	0.15139	2.45;2.45	6.0	6.0	0.97389	Poly(ADP-ribose) polymerase, catalytic domain (2);	0.000000	0.85682	D	0.000000	T	0.52289	0.1725	M	0.91090	3.175	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.63157	-0.6700	10	0.87932	D	0	.	16.5047	0.84268	1.0:0.0:0.0:0.0	.	1155	O95271	TNKS1_HUMAN	I	1155;918	ENSP00000311579:N1155I;ENSP00000429890:N918I	ENSP00000311579:N1155I	N	+	2	0	TNKS	9660628	1.000000	0.71417	0.995000	0.50966	0.980000	0.70556	9.320000	0.96346	2.297000	0.77311	0.533000	0.62120	AAC		0.388	TNKS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206935.1	NM_003747		6	94	0	0	0	0.004482	0	6	94				
SOX7	83595	broad.mit.edu	37	8	10583456	10583456	+	Missense_Mutation	SNP	T	T	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr8:10583456T>A	ENST00000304501.1	-	2	1037	c.959A>T	c.(958-960)cAg>cTg	p.Q320L	SOX7_ENST00000553390.1_Missense_Mutation_p.Q372L|SOX7_ENST00000554914.1_Missense_Mutation_p.Q372L	NM_031439.2	NP_113627.1	Q9BT81	SOX7_HUMAN	SRY (sex determining region Y)-box 7	320	Sox C-terminal. {ECO:0000255|PROSITE- ProRule:PRU00849}.				endoderm formation (GO:0001706)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|regulation of canonical Wnt signaling pathway (GO:0060828)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.Q320L(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	20				COAD - Colon adenocarcinoma(149;0.0732)		GAGTTCCACCTGGCTCAGTTG	0.627																																							uc003wtf.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(958-960)CAG>CTG		SRY-box 7							72.0	67.0	69.0					8																	10583456		2203	4300	6503	SO:0001583	missense	83595				endoderm formation|negative regulation of cell proliferation|negative regulation of transcription, DNA-dependent|positive regulation of caspase activity|regulation of canonical Wnt receptor signaling pathway	cytoplasm|nucleus	transcription regulatory region DNA binding	g.chr8:10583456T>A	AJ409320	CCDS5977.1	8p22	2013-01-25			ENSG00000171056	ENSG00000171056		"""SRY (sex determining region Y)-boxes"""	18196	protein-coding gene	gene with protein product		612202				11691915	Standard	NM_031439		Approved		uc003wtf.3	Q9BT81	OTTHUMG00000090585	ENST00000304501.1:c.959A>T	8.37:g.10583456T>A	ENSP00000301921:p.Gln320Leu		Somatic				SOX7_uc011kwz.1_Missense_Mutation_p.Q372L	p.Q320L	NM_031439	NP_113627	WXS	Illumina HiSeq	Unspecified	Q9BT81	SOX7_HUMAN		COAD - Colon adenocarcinoma(149;0.0732)	2	1038	-			320			Sox C-terminal.		B4DKV0|Q53YD0	Missense_Mutation	SNP	ENST00000304501.1	37	c.959A>T	CCDS5977.1	.	.	.	.	.	.	.	.	.	.	T	19.63	3.864428	0.71949	.	.	ENSG00000171056;ENSG00000171056;ENSG00000258724	ENST00000304501;ENST00000553390;ENST00000554914	T;T;T	0.79940	-1.32;-1.32;-1.32	4.52	4.52	0.55395	.	0.000000	0.85682	U	0.000000	D	0.86781	0.6015	M	0.78049	2.395	0.80722	D	1	D;D	0.69078	0.997;0.993	D;D	0.67231	0.932;0.95	D	0.84569	0.0654	10	0.11182	T	0.66	.	13.164	0.59560	0.0:0.0:0.0:1.0	.	372;320	B4DKV0;Q9BT81	.;SOX7_HUMAN	L	320;372;372	ENSP00000301921:Q320L;ENSP00000452017:Q372L;ENSP00000451145:Q372L	ENSP00000346908:Q372L	Q	-	2	0	SOX7;CTD-2135J3.4	10620866	1.000000	0.71417	1.000000	0.80357	0.754000	0.42855	7.809000	0.86057	1.876000	0.54355	0.379000	0.24179	CAG		0.627	SOX7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207131.1			6	40	0	0	0	0.001984	0	6	40				
EBF2	64641	broad.mit.edu	37	8	25716008	25716008	+	Missense_Mutation	SNP	T	T	C			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr8:25716008T>C	ENST00000520164.1	-	14	1892	c.1355A>G	c.(1354-1356)aAc>aGc	p.N452S	EBF2_ENST00000408929.3_Missense_Mutation_p.N304S|EBF2_ENST00000535548.1_Missense_Mutation_p.N183S	NM_022659.3	NP_073150.2	Q9HAK2	COE2_HUMAN	early B-cell factor 2	452					adipose tissue development (GO:0060612)|brown fat cell differentiation (GO:0050873)|cell fate determination (GO:0001709)|positive regulation of chromatin binding (GO:0035563)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.N452S(2)		endometrium(3)|kidney(2)|large_intestine(3)|lung(22)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	39		all_cancers(63;0.0989)|Ovarian(32;2.74e-05)|all_epithelial(46;0.0608)|Prostate(55;0.0845)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0277)|Epithelial(17;3.29e-10)|Colorectal(74;0.00383)|COAD - Colon adenocarcinoma(73;0.00738)		GCTGCTTGTGTTGCGGATGTA	0.522																																					Esophageal Squamous(166;1018 1046 3854 8328 13429 13634 14071 26624 32918)	Esophageal Squamous(166;1018 1046 3854 8328 13429 13634 14071 26624 32918)	uc003xes.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|skin(1)	4						c.(1354-1356)AAC>AGC		early B-cell factor 2							123.0	122.0	123.0					8																	25716008		2046	4195	6241	SO:0001583	missense	64641				multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|metal ion binding	g.chr8:25716008T>C	AK021562, AK001144	CCDS43726.1	8p21.1	2007-07-26			ENSG00000221818	ENSG00000221818			19090	protein-coding gene	gene with protein product		609934				9151732	Standard	NM_022659		Approved	FLJ11500, COE2	uc003xes.2	Q9HAK2	OTTHUMG00000163838	ENST00000520164.1:c.1355A>G	8.37:g.25716008T>C	ENSP00000430241:p.Asn452Ser		Somatic				PPP2R2A_uc003xek.2_Intron|EBF2_uc010lug.1_RNA	p.N452S	NM_022659	NP_073150	WXS	Illumina HiSeq	Unspecified	Q9HAK2	COE2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (27;0.0277)|Epithelial(17;3.29e-10)|Colorectal(74;0.00383)|COAD - Colon adenocarcinoma(73;0.00738)	14	1372	-		all_cancers(63;0.0989)|Ovarian(32;2.74e-05)|all_epithelial(46;0.0608)|Prostate(55;0.0845)	452					A0PJM4|A6NMF7|F5H645|Q66VZ3|Q6DK36|Q6IS86|Q6ISA4	Missense_Mutation	SNP	ENST00000520164.1	37	c.1355A>G	CCDS43726.1	.	.	.	.	.	.	.	.	.	.	T	20.5	4.001480	0.74818	.	.	ENSG00000221818	ENST00000520164;ENST00000408929;ENST00000535548	T;T;T	0.36520	1.25;1.25;1.25	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	T	0.26666	0.0652	L	0.29908	0.895	0.58432	D	0.999999	B	0.16396	0.017	B	0.17979	0.02	T	0.07539	-1.0767	10	0.12103	T	0.63	.	14.5223	0.67859	0.0:0.0:0.0:1.0	.	452	Q9HAK2	COE2_HUMAN	S	452;304;183	ENSP00000430241:N452S;ENSP00000386178:N304S;ENSP00000437909:N183S	ENSP00000386178:N304S	N	-	2	0	EBF2	25771925	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	8.040000	0.89188	2.028000	0.59812	0.533000	0.62120	AAC		0.522	EBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375886.2	NM_022659		7	55	0	0	0	0.00308	0	7	55				
EXTL3	2137	broad.mit.edu	37	8	28573840	28573840	+	Silent	SNP	G	G	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr8:28573840G>T	ENST00000220562.4	+	3	1166	c.264G>T	c.(262-264)tcG>tcT	p.S88S	EXTL3_ENST00000523149.1_Intron|EXTL3_ENST00000519886.1_Intron	NM_001440.2	NP_001431.1	O43909	EXTL3_HUMAN	exostosin-like glycosyltransferase 3	88					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|positive regulation of cell growth (GO:0030307)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)	glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity (GO:0001888)|metal ion binding (GO:0046872)	p.S88S(2)		biliary_tract(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(8)|ovary(1)|prostate(2)|skin(2)|soft_tissue(1)|urinary_tract(1)	36		Ovarian(32;0.069)		KIRC - Kidney renal clear cell carcinoma(542;0.107)|Kidney(114;0.129)|Colorectal(74;0.228)		TCCGGGAGTCGGTGAGTGAAG	0.582																																							uc003xgz.1		NA																	2	Substitution - coding silent(2)		large_intestine(1)|lung(1)	skin(2)	2						c.(262-264)TCG>TCT		exostoses-like 3							59.0	58.0	58.0					8																	28573840		2203	4300	6503	SO:0001819	synonymous_variant	2137					integral to membrane|intrinsic to endoplasmic reticulum membrane	glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity|metal ion binding|protein binding	g.chr8:28573840G>T	U76188	CCDS6070.1	8p22-p12	2013-03-01	2013-03-01		ENSG00000012232	ENSG00000012232	2.4.1.223	"""Exostosin glycosyltransferase family"""	3518	protein-coding gene	gene with protein product	"""REG receptor"", ""glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase"""	605744	"""exostoses (multiple)-like 3"""			9479495, 9450183, 11257457	Standard	NM_001440		Approved	botv, REGR	uc003xgz.2	O43909	OTTHUMG00000102146	ENST00000220562.4:c.264G>T	8.37:g.28573840G>T			Somatic					p.S88S	NM_001440	NP_001431	WXS	Illumina HiSeq	Unspecified	O43909	EXTL3_HUMAN		KIRC - Kidney renal clear cell carcinoma(542;0.107)|Kidney(114;0.129)|Colorectal(74;0.228)	3	857	+		Ovarian(32;0.069)	88			Lumenal (Potential).		D3DST8|O00225|Q53XT3	Silent	SNP	ENST00000220562.4	37	c.264G>T	CCDS6070.1																																																																																				0.582	EXTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219987.3	NM_001440		5	38	1	0	1.23904e-05	0.000602	1.87565e-05	5	38				
GPR124	25960	broad.mit.edu	37	8	37704488	37704488	+	IGR	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr8:37704488C>A	ENST00000412232.2	+	0	5651				BRF2_ENST00000520601.1_Silent_p.T140T|BRF2_ENST00000220659.6_Silent_p.T140T|BRF2_ENST00000521170.1_3'UTR	NM_032777.9	NP_116166.9	Q96PE1	GP124_HUMAN	G protein-coupled receptor 124						central nervous system development (GO:0007417)|endothelial cell migration (GO:0043542)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|neuropeptide signaling pathway (GO:0007218)|positive regulation of endothelial cell migration (GO:0010595)|regulation of angiogenesis (GO:0045765)|regulation of chemotaxis (GO:0050920)|regulation of establishment of blood-brain barrier (GO:0090210)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.T140T(2)		central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(16)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	37			BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)			CATACAACAGCGTGCAGATGG	0.527																																							uc003xkk.2		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(418-420)ACG>ACT		RNA polymerase III transcription initiation							230.0	213.0	219.0					8																	37704488		2203	4300	6503	SO:0001628	intergenic_variant	55290				regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter|transcription initiation, DNA-dependent	nucleoplasm	protein binding|zinc ion binding	g.chr8:37704488C>A	AB040964	CCDS6097.2	8p11.22	2014-08-08			ENSG00000020181	ENSG00000020181		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17849	protein-coding gene	gene with protein product	"""tumor endothelial marker 5"""	606823				11559528, 12565841	Standard	NM_032777		Approved	TEM5, DKFZp434C211, DKFZp434J0911, KIAA1531, FLJ14390	uc003xkj.3	Q96PE1	OTTHUMG00000156182		8.37:g.37704488C>A			Somatic					p.T140T	NM_018310	NP_060780	WXS	Illumina HiSeq	Unspecified	Q9HAW0	BRF2_HUMAN	BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;1.81e-10)		3	530	-		Lung NSC(58;0.118)|all_lung(54;0.195)	140			1.		A6H8W3|D3DSW4|Q8N3R1|Q8TEM3|Q96KB2|Q9P1Z7|Q9UFY4	Silent	SNP	ENST00000412232.2	37	c.420G>T	CCDS6097.2																																																																																				0.527	GPR124-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343331.2			17	350	1	0	5.01169e-05	0.00499	7.14329e-05	17	350				
MYBL1	4603	broad.mit.edu	37	8	67492485	67492485	+	Silent	SNP	C	C	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr8:67492485C>T	ENST00000522677.3	-	9	1394	c.984G>A	c.(982-984)caG>caA	p.Q328Q	MYBL1_ENST00000517885.1_Intron|MYBL1_ENST00000524176.2_Silent_p.Q328Q	NM_001080416.2|NM_001144755.1	NP_001073885.1|NP_001138227.1	P10243	MYBA_HUMAN	v-myb avian myeloblastosis viral oncogene homolog-like 1	328	Negative regulatory domain. {ECO:0000250}.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.Q328Q(1)		breast(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|pancreas(1)|skin(1)	25			Epithelial(68;0.00211)|all cancers(69;0.00726)|OV - Ovarian serous cystadenocarcinoma(28;0.00989)|BRCA - Breast invasive adenocarcinoma(89;0.0938)			CAGACACAGGCTGATTTTCAT	0.458																																							uc003xwj.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|pancreas(1)	3						c.(982-984)CAG>CAA		v-myb myeloblastosis viral oncogene homolog							72.0	72.0	72.0					8																	67492485		1943	4142	6085	SO:0001819	synonymous_variant	4603				positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding	g.chr8:67492485C>T	X13294	CCDS47867.1, CCDS55241.1	8q22	2013-07-09	2013-07-09		ENSG00000185697	ENSG00000185697			7547	protein-coding gene	gene with protein product		159405					Standard	XM_005251251		Approved	AMYB, A-myb	uc003xwj.3	P10243	OTTHUMG00000164559	ENST00000522677.3:c.984G>A	8.37:g.67492485C>T			Somatic				MYBL1_uc003xwl.2_Silent_p.Q328Q|MYBL1_uc003xwk.2_Silent_p.Q327Q	p.Q328Q	NM_001080416	NP_001073885	WXS	Illumina HiSeq	Unspecified	P10243	MYBA_HUMAN	Epithelial(68;0.00211)|all cancers(69;0.00726)|OV - Ovarian serous cystadenocarcinoma(28;0.00989)|BRCA - Breast invasive adenocarcinoma(89;0.0938)		9	1391	-			328			Negative regulatory domain (By similarity).		E7EW29|Q495F9	Silent	SNP	ENST00000522677.3	37	c.984G>A	CCDS47867.1																																																																																				0.458	MYBL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379221.3	XM_034274		9	44	0	0	0	0.006214	0	9	44				
SNX31	169166	broad.mit.edu	37	8	101601166	101601166	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr8:101601166G>T	ENST00000311812.2	-	11	1170	c.1020C>A	c.(1018-1020)aaC>aaA	p.N340K	SNX31_ENST00000428383.2_Missense_Mutation_p.N241K|SNX31_ENST00000519521.1_5'UTR	NM_152628.3	NP_689841.3	Q8N9S9	SNX31_HUMAN	sorting nexin 31	340					protein transport (GO:0015031)	protein complex (GO:0043234)	phosphatidylinositol binding (GO:0035091)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(12)|prostate(1)|skin(3)|urinary_tract(1)	26	all_cancers(14;4.01e-05)|all_epithelial(15;1.26e-07)|Lung NSC(17;0.000453)|all_lung(17;0.00125)		Epithelial(11;1.21e-11)|all cancers(13;2.62e-09)|OV - Ovarian serous cystadenocarcinoma(57;3.22e-06)|STAD - Stomach adenocarcinoma(118;0.206)			CTAAGTTCTGGTTGAGAGTTC	0.418																																							uc003yjr.2		NA																	0					0						c.(1018-1020)AAC>AAA		sorting nexin 31							111.0	104.0	106.0					8																	101601166		2203	4300	6503	SO:0001583	missense	169166				cell communication|protein transport		phosphatidylinositol binding	g.chr8:101601166G>T		CCDS6288.1	8q22.3	2011-05-03			ENSG00000174226	ENSG00000174226		"""Sorting nexins"""	28605	protein-coding gene	gene with protein product						16782399	Standard	NM_152628		Approved	MGC39715	uc003yjr.3	Q8N9S9	OTTHUMG00000164725	ENST00000311812.2:c.1020C>A	8.37:g.101601166G>T	ENSP00000312368:p.Asn340Lys		Somatic				SNX31_uc011lha.1_Missense_Mutation_p.N135K|SNX31_uc011lhb.1_Missense_Mutation_p.N241K	p.N340K	NM_152628	NP_689841	WXS	Illumina HiSeq	Unspecified	Q8N9S9	SNX31_HUMAN	Epithelial(11;1.21e-11)|all cancers(13;2.62e-09)|OV - Ovarian serous cystadenocarcinoma(57;3.22e-06)|STAD - Stomach adenocarcinoma(118;0.206)		11	1171	-	all_cancers(14;4.01e-05)|all_epithelial(15;1.26e-07)|Lung NSC(17;0.000453)|all_lung(17;0.00125)		340					C9J6L9|Q8N0U9	Missense_Mutation	SNP	ENST00000311812.2	37	c.1020C>A	CCDS6288.1	.	.	.	.	.	.	.	.	.	.	G	16.17	3.047335	0.55110	.	.	ENSG00000174226	ENST00000311812;ENST00000428383	T;T	0.22539	2.3;1.95	5.79	4.02	0.46733	.	0.229286	0.37857	N	0.001908	T	0.18045	0.0433	L	0.54323	1.7	0.40829	D	0.983571	B;P	0.39665	0.372;0.682	B;B	0.32980	0.114;0.156	T	0.03875	-1.0996	10	0.27785	T	0.31	-16.7112	11.496	0.50408	0.1468:0.0:0.8532:0.0	.	241;340	Q8N9S9-2;Q8N9S9	.;SNX31_HUMAN	K	340;241	ENSP00000312368:N340K;ENSP00000405024:N241K	ENSP00000312368:N340K	N	-	3	2	SNX31	101670342	1.000000	0.71417	1.000000	0.80357	0.880000	0.50808	2.748000	0.47483	0.799000	0.34018	0.655000	0.94253	AAC		0.418	SNX31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379910.1	NM_152628		7	84	1	0	8.12818e-05	0.001984	0.000111161	7	84				
TRPS1	7227	broad.mit.edu	37	8	116617157	116617157	+	Missense_Mutation	SNP	G	G	C			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr8:116617157G>C	ENST00000220888.5	-	3	1159	c.1000C>G	c.(1000-1002)Cgc>Ggc	p.R334G	TRPS1_ENST00000519674.1_Missense_Mutation_p.R334G|TRPS1_ENST00000395715.3_Missense_Mutation_p.R347G|TRPS1_ENST00000520276.1_Missense_Mutation_p.R338G|TRPS1_ENST00000519076.1_Missense_Mutation_p.R288G			Q9UHF7	TRPS1_HUMAN	trichorhinophalangeal syndrome I	334					chondrocyte differentiation (GO:0002062)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|regulation of chondrocyte differentiation (GO:0032330)|regulation of histone deacetylation (GO:0031063)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.R347G(1)|p.R334G(1)		autonomic_ganglia(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(58)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	111	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			AATTTACAGCGGAAATACTTG	0.413									Langer-Giedion syndrome																														uc003ynz.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|skin(2)|pancreas(1)|lung(1)|kidney(1)	7						c.(1000-1002)CGC>GGC		zinc finger transcription factor TRPS1							94.0	92.0	92.0					8																	116617157		1896	4106	6002	SO:0001583	missense	7227	Langer-Giedion_syndrome	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II	negative regulation of transcription from RNA polymerase II promoter|NLS-bearing substrate import into nucleus|regulation of chondrocyte differentiation|skeletal system development|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:116617157G>C	AF183810	CCDS6318.2, CCDS64957.1	8q23.3	2014-06-23			ENSG00000104447	ENSG00000104447		"""GATA zinc finger domain containing"", ""Zinc fingers, C2H2-type"""	12340	protein-coding gene	gene with protein product		604386				8530105, 10615131, 10647898	Standard	NM_001282903		Approved	LGCR	uc003yny.3	Q9UHF7	OTTHUMG00000142829	ENST00000220888.5:c.1000C>G	8.37:g.116617157G>C	ENSP00000220888:p.Arg334Gly		Somatic				TRPS1_uc011lhy.1_Missense_Mutation_p.R338G|TRPS1_uc003yny.2_Missense_Mutation_p.R347G|TRPS1_uc010mcy.2_Missense_Mutation_p.R334G	p.R334G	NM_014112	NP_054831	WXS	Illumina HiSeq	Unspecified	Q9UHF7	TRPS1_HUMAN	Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)		3	1459	-	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		334			C2H2-type 2; atypical.		B4E1Z5|Q08AU2|Q9NWE1|Q9UHH6	Missense_Mutation	SNP	ENST00000220888.5	37	c.1000C>G		.	.	.	.	.	.	.	.	.	.	G	18.10	3.548754	0.65311	.	.	ENSG00000104447	ENST00000395715;ENST00000220888;ENST00000519076;ENST00000520276;ENST00000519674	T;T;T;T;T	0.08370	3.1;3.1;3.1;3.1;3.1	5.69	5.69	0.88448	Zinc finger, C2H2-like (1);	0.000000	0.85682	D	0.000000	T	0.20047	0.0482	N	0.24115	0.695	0.58432	D	0.999994	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.995;0.998	T	0.01448	-1.1352	10	0.87932	D	0	.	20.181	0.98201	0.0:0.0:1.0:0.0	.	338;334;347	Q9UHF7-3;Q9UHF7;Q9UHF7-2	.;TRPS1_HUMAN;.	G	347;334;288;338;334	ENSP00000379065:R347G;ENSP00000220888:R334G;ENSP00000428910:R288G;ENSP00000428680:R338G;ENSP00000429174:R334G	ENSP00000220888:R334G	R	-	1	0	TRPS1	116686332	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.809000	0.86057	2.840000	0.97914	0.655000	0.94253	CGC		0.413	TRPS1-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000286436.3	NM_014112		8	161	0	0	0	0.004482	0	8	161				
ZHX1	11244	broad.mit.edu	37	8	124266616	124266616	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr8:124266616C>A	ENST00000522655.1	-	3	2111	c.1571G>T	c.(1570-1572)aGt>aTt	p.S524I	ZHX1-C8ORF76_ENST00000357082.4_Intron|ZHX1_ENST00000522595.1_5'Flank|ZHX1_ENST00000297857.2_Missense_Mutation_p.S524I|ZHX1_ENST00000395571.3_Missense_Mutation_p.S524I			Q9UKY1	ZHX1_HUMAN	zinc fingers and homeoboxes 1	524	Required for interaction with NFYA.				cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.S524I(1)		breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29	Lung NSC(37;1.25e-09)|Ovarian(258;0.0154)		STAD - Stomach adenocarcinoma(47;0.00527)			GCACTGATTACTCTTTGAATT	0.388																																							uc003yqe.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1570-1572)AGT>ATT		zinc fingers and homeoboxes 1							144.0	139.0	141.0					8																	124266616		2203	4300	6503	SO:0001583	missense	11244				negative regulation of transcription, DNA-dependent	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:124266616C>A	AF106862	CCDS6342.1	8q24.13	2012-03-09	2004-01-23		ENSG00000165156	ENSG00000165156		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	12871	protein-coding gene	gene with protein product		604764	"""zinc-fingers and homeoboxes 1"""			10441475	Standard	NM_001017926		Approved		uc003yqe.3	Q9UKY1	OTTHUMG00000165088	ENST00000522655.1:c.1571G>T	8.37:g.124266616C>A	ENSP00000428821:p.Ser524Ile		Somatic				C8orf76_uc003yqd.2_Intron|ZHX1_uc003yqf.2_Missense_Mutation_p.S524I|ZHX1_uc003yqg.2_Intron|ZHX1_uc010mdi.2_Missense_Mutation_p.S524I	p.S524I	NM_007222	NP_009153	WXS	Illumina HiSeq	Unspecified	Q9UKY1	ZHX1_HUMAN	STAD - Stomach adenocarcinoma(47;0.00527)		3	2001	-	Lung NSC(37;1.25e-09)|Ovarian(258;0.0154)		524			Homeobox 2.|Required for interaction with NFYA.		Q8IWD8	Missense_Mutation	SNP	ENST00000522655.1	37	c.1571G>T	CCDS6342.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.27|10.27	1.303464|1.303464	0.23736|0.23736	.|.	.|.	ENSG00000165156|ENSG00000165156	ENST00000297857;ENST00000395571;ENST00000522655|ENST00000520474	D;D;D|.	0.91792|.	-2.91;-2.91;-2.91|.	5.19|5.19	4.31|4.31	0.51392|0.51392	Homeodomain-related (1);Homeobox (1);Homeodomain-like (1);|.	0.287275|.	0.43747|.	D|.	0.000537|.	T|T	0.51873|0.51873	0.1700|0.1700	.|.	.|.	.|.	0.36289|0.36289	D|D	0.856308|0.856308	B|.	0.28128|.	0.201|.	B|.	0.24541|.	0.054|.	T|T	0.57757|0.57757	-0.7756|-0.7756	9|4	0.87932|.	D|.	0|.	-8.8218|-8.8218	7.3449|7.3449	0.26658|0.26658	0.0:0.7161:0.1719:0.112|0.0:0.7161:0.1719:0.112	.|.	524|.	Q9UKY1|.	ZHX1_HUMAN|.	I|L	524|209	ENSP00000297857:S524I;ENSP00000378938:S524I;ENSP00000428821:S524I|.	ENSP00000297857:S524I|.	S|V	-|-	2|1	0|0	ZHX1|ZHX1	124335797|124335797	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.989000|0.989000	0.77384|0.77384	2.461000|2.461000	0.45040|0.45040	1.394000|1.394000	0.46624|0.46624	-0.315000|-0.315000	0.08773|0.08773	AGT|GTA		0.388	ZHX1-003	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000381759.1			28	337	1	0	6.12954e-19	0.004656	1.31262e-18	28	337				
ZNF252P	286101	broad.mit.edu	37	8	146220548	146220548	+	RNA	SNP	G	G	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr8:146220548G>A	ENST00000426361.2	-	0	245				RP5-1047A19.4_ENST00000530223.1_RNA	NR_023392.1				zinc finger protein 252, pseudogene											endometrium(1)	1						TACAACCAAGGGGAAATTTGC	0.458																																							uc003zey.2		NA																	0					0						c.(277-279)GGG>AGG		Homo sapiens mRNA for Tmp21-II putative transcribed pseudogene.																																						286102							g.chr8:146220548G>A	BC019922		8q24.3	2012-10-05	2012-04-19	2012-04-19	ENSG00000196922	ENSG00000196922			13046	pseudogene	pseudogene			"""zinc finger protein 252"""	ZNF252			Standard	NR_023392		Approved		uc011llo.2		OTTHUMG00000165201		8.37:g.146220548G>A			Somatic				ZNF252_uc003zew.3_Intron|ZNF252_uc011llo.1_Intron	p.G93R	NR_002807		WXS	Illumina HiSeq	Unspecified					1	298	+									Missense_Mutation	SNP	ENST00000426361.2	37	c.277G>A																																																																																					0.458	ZNF252P-008	KNOWN	basic|exp_conf	processed_transcript	pseudogene	OTTHUMT00000451422.1	NR_023392		5	88	0	0	0	0.000602	0	5	88				
DENND4C	55667	broad.mit.edu	37	9	19369931	19369931	+	Missense_Mutation	SNP	T	T	G			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr9:19369931T>G	ENST00000380432.2	+	26	4799	c.4766T>G	c.(4765-4767)cTt>cGt	p.L1589R	RP11-513M16.7_ENST00000609609.1_RNA|DENND4C_ENST00000434457.2_Missense_Mutation_p.L1874R|DENND4C_ENST00000602925.1_Missense_Mutation_p.L1825R			Q5VZ89	DEN4C_HUMAN	DENN/MADD domain containing 4C	1589					cellular response to insulin stimulus (GO:0032869)|positive regulation of Rab GTPase activity (GO:0032851)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)	cytosol (GO:0005829)|insulin-responsive compartment (GO:0032593)|plasma membrane (GO:0005886)|retromer complex (GO:0030904)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.L1589R(1)		breast(1)|endometrium(8)|kidney(1)|large_intestine(7)|liver(2)|lung(13)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40						AATAATGTTCTTAAACCCATC	0.378																																							uc003znq.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(4765-4767)CTT>CGT		DENN/MADD domain containing 4C							96.0	86.0	89.0					9																	19369931		2203	4300	6503	SO:0001583	missense	55667					integral to membrane		g.chr9:19369931T>G	AK000693	CCDS6491.2, CCDS6491.3	9p22.1	2012-10-03	2006-01-27	2006-01-27	ENSG00000137145	ENSG00000137145		"""DENN/MADD domain containing"""	26079	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 55B"", ""chromosome 9 open reading frame 55"""	C9orf55B, C9orf55		12906859	Standard	NM_017925		Approved	FLJ20686, bA513M16.3	uc031tcw.1	Q5VZ89	OTTHUMG00000019627	ENST00000380432.2:c.4766T>G	9.37:g.19369931T>G	ENSP00000369797:p.Leu1589Arg		Somatic				DENND4C_uc011lnc.1_Missense_Mutation_p.L919R|DENND4C_uc011lnd.1_Missense_Mutation_p.L877R|DENND4C_uc003znr.2_Missense_Mutation_p.L877R|DENND4C_uc003zns.2_Missense_Mutation_p.L771R	p.L1589R	NM_017925	NP_060395	WXS	Illumina HiSeq	Unspecified	Q5VZ89	DEN4C_HUMAN			26	4799	+			1589					A2A3R1|A2A3R2|A2A3R3|A2A3R9|Q6AI48|Q6ZUB3|Q8NCY7|Q9H6N4|Q9NUT1|Q9NWA5|Q9NWT3	Missense_Mutation	SNP	ENST00000380432.2	37	c.4766T>G		.	.	.	.	.	.	.	.	.	.	T	19.26	3.793275	0.70452	.	.	ENSG00000137145	ENST00000380437;ENST00000307015;ENST00000453857;ENST00000540671;ENST00000380432;ENST00000380427;ENST00000361024	T;T	0.24908	1.83;1.83	5.07	5.07	0.68467	.	0.378699	0.27846	N	0.017615	T	0.43277	0.1240	M	0.65498	2.005	0.37218	D	0.905121	P;P;P	0.51147	0.708;0.942;0.93	P;P;P	0.55871	0.465;0.786;0.483	T	0.48317	-0.9046	9	.	.	.	-2.2953	14.9862	0.71351	0.0:0.0:0.0:1.0	.	919;771;1589	B7Z660;Q5VZ89-3;Q5VZ89	.;.;DEN4C_HUMAN	R	1589;1062;771;919;1062;771;586	ENSP00000305795:L1062R;ENSP00000443804:L919R	.	L	+	2	0	DENND4C	19359931	0.917000	0.31117	0.932000	0.37286	0.972000	0.66771	3.773000	0.55333	2.132000	0.65825	0.528000	0.53228	CTT		0.378	DENND4C-201	KNOWN	basic	protein_coding	protein_coding		NM_017925		4	93	0	0	0	0.000248	0	4	93				
TOPORS	10210	broad.mit.edu	37	9	32543811	32543811	+	Missense_Mutation	SNP	T	T	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr9:32543811T>A	ENST00000360538.2	-	3	828	c.712A>T	c.(712-714)Agg>Tgg	p.R238W	TOPORS_ENST00000379858.1_Missense_Mutation_p.R173W	NM_005802.4	NP_005793.2	Q9NS56	TOPRS_HUMAN	topoisomerase I binding, arginine/serine-rich, E3 ubiquitin protein ligase	238	Required for DNA-binding.				cellular response to DNA damage stimulus (GO:0006974)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|maintenance of protein location in nucleus (GO:0051457)|negative regulation of apoptotic process (GO:0043066)|photoreceptor cell outer segment organization (GO:0035845)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|protein localization to nucleus (GO:0034504)|protein monoubiquitination (GO:0006513)|protein sumoylation (GO:0016925)|regulation of cell proliferation (GO:0042127)|retina layer formation (GO:0010842)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	centriole (GO:0005814)|ciliary basal body (GO:0036064)|gamma-tubulin complex (GO:0000930)|midbody (GO:0030496)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|PML body (GO:0016605)|spindle pole (GO:0000922)|ubiquitin ligase complex (GO:0000151)	antigen binding (GO:0003823)|DNA binding (GO:0003677)|DNA topoisomerase binding (GO:0044547)|SUMO ligase activity (GO:0019789)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R238W(1)		large_intestine(6)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	12			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.0018)		GTAGTTGGCCTCCTTACTGCA	0.398																																							uc003zrb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|upper_aerodigestive_tract(1)|skin(1)	5						c.(712-714)AGG>TGG		topoisomerase I binding, arginine/serine-rich							116.0	119.0	118.0					9																	32543811		2203	4300	6503	SO:0001583	missense	10210				DNA damage response, signal transduction resulting in induction of apoptosis|maintenance of protein location in nucleus|proteasomal ubiquitin-dependent protein catabolic process|protein sumoylation|transcription, DNA-dependent	nuclear speck|PML body	antigen binding|DNA binding|DNA topoisomerase I binding|SUMO ligase activity|ubiquitin-protein ligase activity|zinc ion binding	g.chr9:32543811T>A	AF098300	CCDS6527.1, CCDS56566.1	9p21	2013-01-09	2010-09-17		ENSG00000197579	ENSG00000197579		"""RING-type (C3HC4) zinc fingers"""	21653	protein-coding gene	gene with protein product		609507	"""retinitis pigmentosa 31 (autosomal dominant)"", ""topoisomerase I binding, arginine/serine-rich"""	RP31		10352183, 12083797, 17924349	Standard	NM_005802		Approved	TP53BPL, LUN	uc003zrb.3	Q9NS56	OTTHUMG00000019743	ENST00000360538.2:c.712A>T	9.37:g.32543811T>A	ENSP00000353735:p.Arg238Trp		Somatic				TOPORS_uc003zrc.2_Missense_Mutation_p.R171W	p.R238W	NM_005802	NP_005793	WXS	Illumina HiSeq	Unspecified	Q9NS56	TOPRS_HUMAN	LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.0018)	3	879	-			238			Required for DNA-binding.		O43273|Q6P987|Q9NS55|Q9UNR9	Missense_Mutation	SNP	ENST00000360538.2	37	c.712A>T	CCDS6527.1	.	.	.	.	.	.	.	.	.	.	T	12.73	2.026372	0.35701	.	.	ENSG00000197579	ENST00000360538;ENST00000379858	T;T	0.18016	2.24;2.24	5.2	0.989	0.19802	.	0.114581	0.39759	N	0.001266	T	0.15132	0.0365	L	0.43152	1.355	0.31725	N	0.637808	D	0.61697	0.99	P	0.48901	0.594	T	0.17868	-1.0355	10	0.72032	D	0.01	-3.0827	2.3035	0.04168	0.145:0.1138:0.4323:0.3089	.	238	Q9NS56	TOPRS_HUMAN	W	238;173	ENSP00000353735:R238W;ENSP00000369187:R173W	ENSP00000353735:R238W	R	-	1	2	TOPORS	32533811	0.921000	0.31238	0.952000	0.39060	0.475000	0.33008	0.492000	0.22435	0.420000	0.25954	0.533000	0.62120	AGG		0.398	TOPORS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052007.1	NM_005802		7	218	0	0	0	0.00308	0	7	218				
UNC13B	10497	broad.mit.edu	37	9	35403960	35403960	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr9:35403960G>T	ENST00000378495.3	+	39	4928	c.4706G>T	c.(4705-4707)aGc>aTc	p.S1569I	ATP8B5P_ENST00000430846.1_RNA|UNC13B_ENST00000396787.1_Missense_Mutation_p.S1600I|UNC13B_ENST00000378496.4_Missense_Mutation_p.S1588I	NM_006377.3	NP_006368.3	O14795	UN13B_HUMAN	unc-13 homolog B (C. elegans)	1569					apoptotic process (GO:0006915)|excretion (GO:0007588)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|positive regulation of synaptic vesicle priming (GO:0010808)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle priming (GO:0016082)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|terminal bouton (GO:0043195)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)	p.S1569I(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(16)|liver(2)|lung(17)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	63	all_epithelial(49;0.212)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)|STAD - Stomach adenocarcinoma(86;0.194)			TCTCAGAGGAGCAATGACGAG	0.557																																							uc003zwq.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|large_intestine(1)|skin(1)	5						c.(4705-4707)AGC>ATC		UNC13 (C. elegans)-like							70.0	70.0	70.0					9																	35403960		2203	4300	6503	SO:0001583	missense	10497				excretion|induction of apoptosis|intracellular signal transduction	cell junction|Golgi apparatus|synapse	metal ion binding|receptor activity	g.chr9:35403960G>T	AF020202	CCDS6579.1	9p13.3	2008-05-15	2003-10-17	2003-10-17	ENSG00000198722	ENSG00000198722			12566	protein-coding gene	gene with protein product		605836	"""unc-13-like (C. elegans)"""	UNC13		9607201	Standard	NM_006377		Approved	hmunc13, Unc13h2	uc003zwq.3	O14795	OTTHUMG00000019856	ENST00000378495.3:c.4706G>T	9.37:g.35403960G>T	ENSP00000367756:p.Ser1569Ile		Somatic				UNC13B_uc003zwr.2_Missense_Mutation_p.S1588I|ATP8B5P_uc010mkn.1_5'Flank|ATP8B5P_uc010mko.2_5'Flank|ATP8B5P_uc010mkp.2_5'Flank|ATP8B5P_uc003zwu.2_5'Flank	p.S1569I	NM_006377	NP_006368	WXS	Illumina HiSeq	Unspecified	O14795	UN13B_HUMAN	LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)|STAD - Stomach adenocarcinoma(86;0.194)		39	4998	+	all_epithelial(49;0.212)		1569					Q5VYM8	Missense_Mutation	SNP	ENST00000378495.3	37	c.4706G>T	CCDS6579.1	.	.	.	.	.	.	.	.	.	.	G	14.75	2.629988	0.46944	.	.	ENSG00000198722	ENST00000396787;ENST00000378495;ENST00000378496;ENST00000535471	D;D;D	0.84223	-1.69;-1.62;-1.82	5.95	4.0	0.46444	.	0.157911	0.64402	D	0.000019	T	0.81182	0.4769	M	0.61703	1.905	0.44067	D	0.996819	P;P	0.46912	0.886;0.469	B;B	0.39876	0.312;0.157	T	0.81974	-0.0687	10	0.59425	D	0.04	-17.5659	9.5865	0.39519	0.0781:0.4202:0.5017:0.0	.	1588;1569	F8W8M9;O14795	.;UN13B_HUMAN	I	1600;1569;1588;1175	ENSP00000380006:S1600I;ENSP00000367756:S1569I;ENSP00000367757:S1588I	ENSP00000367756:S1569I	S	+	2	0	UNC13B	35393960	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.208000	0.42797	1.503000	0.48686	0.655000	0.94253	AGC		0.557	UNC13B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000052296.1	NM_006377		5	79	1	0	1.024e-07	0.000602	1.78387e-07	5	79				
SPATA31B1P	404770	broad.mit.edu	37	9	84676025	84676026	+	IGR	DNP	GG	GG	TT			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr9:84676025_84676026GG>TT								SPATA31D1 (65854 upstream) : RP11-15B24.5 (211644 downstream)														p.Q134K(1)									TCTGGTGGCTGGGAGGCACTTA	0.589																																							uc010mpu.1		NA																	1	Substitution - Missense(1)		lung(1)		NA						c.(397-402)TCCCAG>TCAAAG		hypothetical protein LOC404770																																				SO:0001628	intergenic_variant	0							g.chr9:84676025_84676026GG>TT																													9.37:g.84676025_84676026delinsTT			Somatic					p.Q134K	NM_001164339	NP_001157811	WXS	Illumina HiSeq	Unspecified					3	402_403	-									Missense_Mutation	DNP		37	c.399_400CC>AA																																																																																				0	0.589									16	273	0	0	0	0.004672	0	16	273				
SPATA31C1	441452	broad.mit.edu	37	9	90536768	90536768	+	RNA	SNP	A	A	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr9:90536768A>T	ENST00000602681.1	+	0	1927							P0DKV0	S31C1_HUMAN	SPATA31 subfamily C, member 1						cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											CTGTGTACTCAGCAGGTGCTG	0.522																																							uc010mqi.2		NA																	0					0						c.(1945-1947)CAG>CTG		family with sequence similarity 75, member C1							60.0	51.0	54.0					9																	90536768		692	1591	2283			441452							g.chr9:90536768A>T	AK093374		9q22.1	2014-03-18	2012-10-12	2012-10-12	ENSG00000230246	ENSG00000230246			27846	other	unknown			"""family with sequence similarity 75, member C1"""	FAM75C1			Standard	NM_001145124		Approved	FLJ36055	uc010mqi.3	P0DKV0	OTTHUMG00000020160		9.37:g.90536768A>T			Somatic				FAM75C1_uc004apq.3_Missense_Mutation_p.Q632L	p.Q649L	NM_001145124	NP_001138596	WXS	Illumina HiSeq	Unspecified					4	1975	+									Missense_Mutation	SNP	ENST00000602681.1	37	c.1946A>T																																																																																					0.522	SPATA31C1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000467313.1	NM_001145124		22	201	0	0	0	0.001882	0	22	201				
SPATA31C2	645961	broad.mit.edu	37	9	90744734	90744734	+	IGR	SNP	C	C	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr9:90744734C>T								U6 (131484 upstream) : U3 (244449 downstream)																							CGAGGCATGGCGCGCATGGCA	0.517																																							uc011lti.1		NA																	0					NA						c.(3217-3219)CGC>CAC		SubName: Full=cDNA FLJ59639;							63.0	52.0	55.0					9																	90744734		692	1591	2283	SO:0001628	intergenic_variant	0							g.chr9:90744734C>T																													9.37:g.90744734C>T			Somatic				uc004apx.1_5'Flank	p.R1073H			WXS	Illumina HiSeq	Unspecified					4	3247	-									Missense_Mutation	SNP		37	c.3218G>A																																																																																				0	0.517									4	104	0	0	0	0.000248	0	4	104				
ROR2	4920	broad.mit.edu	37	9	94486066	94486066	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr9:94486066C>A	ENST00000375708.3	-	9	2908	c.2710G>T	c.(2710-2712)Ggg>Tgg	p.G904W	ROR2_ENST00000375715.1_Intron|ROR2_ENST00000550066.1_5'UTR	NM_004560.3	NP_004551.2	Q01974	ROR2_HUMAN	receptor tyrosine kinase-like orphan receptor 2	904					cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|embryonic genitalia morphogenesis (GO:0030538)|inner ear morphogenesis (GO:0042472)|JNK cascade (GO:0007254)|multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)|somitogenesis (GO:0001756)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	clathrin-coated endocytic vesicle membrane (GO:0030669)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|Wnt-protein binding (GO:0017147)	p.G904W(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(31)|ovary(3)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	71						CTCTGGGCCCCATCTTCTGGG	0.637																																							uc004arj.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(8)|central_nervous_system(5)|ovary(3)|large_intestine(2)|stomach(1)|breast(1)	20						c.(2710-2712)GGG>TGG		receptor tyrosine kinase-like orphan receptor 2							89.0	89.0	89.0					9																	94486066		2203	4300	6503	SO:0001583	missense	4920				negative regulation of cell proliferation|positive regulation of cell migration|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity|Wnt-protein binding	g.chr9:94486066C>A	M97639	CCDS6691.1	9q22	2013-01-11			ENSG00000169071	ENSG00000169071		"""Immunoglobulin superfamily / I-set domain containing"""	10257	protein-coding gene	gene with protein product		602337		NTRKR2, BDB, BDB1		1334494, 10700182	Standard	NM_004560		Approved		uc004arj.2	Q01974	OTTHUMG00000020211	ENST00000375708.3:c.2710G>T	9.37:g.94486066C>A	ENSP00000364860:p.Gly904Trp		Somatic				ROR2_uc004ari.1_Intron	p.G904W	NM_004560	NP_004551	WXS	Illumina HiSeq	Unspecified	Q01974	ROR2_HUMAN			9	2909	-			904			Cytoplasmic (Potential).		Q59GF5|Q5SPI5|Q9HAY7|Q9HB61	Missense_Mutation	SNP	ENST00000375708.3	37	c.2710G>T	CCDS6691.1	.	.	.	.	.	.	.	.	.	.	C	0.770	-0.766007	0.02974	.	.	ENSG00000169071	ENST00000375708	T	0.76839	-1.05	4.75	0.764	0.18465	.	1.148670	0.06814	N	0.790808	T	0.61148	0.2324	N	0.24115	0.695	0.09310	N	1	P	0.39831	0.69	B	0.35971	0.215	T	0.53085	-0.8488	10	0.48119	T	0.1	.	4.4463	0.11598	0.0:0.3799:0.1664:0.4537	.	904	Q01974	ROR2_HUMAN	W	904	ENSP00000364860:G904W	ENSP00000364860:G904W	G	-	1	0	ROR2	93525887	0.000000	0.05858	0.001000	0.08648	0.000000	0.00434	0.207000	0.17395	0.234000	0.21139	-0.304000	0.09214	GGG		0.637	ROR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053040.1			11	135	1	0	4.3838e-07	0.001855	7.28973e-07	11	135				
OGN	4969	broad.mit.edu	37	9	95163438	95163438	+	Silent	SNP	C	C	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr9:95163438C>T	ENST00000262551.4	-	3	624	c.204G>A	c.(202-204)gaG>gaA	p.E68E	OGN_ENST00000375561.5_Silent_p.E68E|CENPP_ENST00000375587.3_Intron	NM_033014.2	NP_148935.1	P20774	MIME_HUMAN	osteoglycin	68					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|negative regulation of smooth muscle cell proliferation (GO:0048662)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)		p.E68E(1)		central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|prostate(1)|urinary_tract(1)	13						GAAGACTTTTCTCATTGGGTA	0.308																																							uc004asa.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(202-204)GAG>GAA		osteoglycin preproprotein							186.0	177.0	180.0					9																	95163438		2202	4298	6500	SO:0001819	synonymous_variant	4969					extracellular space|proteinaceous extracellular matrix	growth factor activity	g.chr9:95163438C>T	AI424992	CCDS6695.1	9q22	2008-02-05	2007-02-16		ENSG00000106809	ENSG00000106809		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	8126	protein-coding gene	gene with protein product	"""mimecan proteoglycan"""	602383	"""osteoglycin (osteoinductive factor)"""			2372374	Standard	NM_033014		Approved	mimecan, OIF, SLRR3A	uc004asa.3	P20774	OTTHUMG00000020224	ENST00000262551.4:c.204G>A	9.37:g.95163438C>T			Somatic				CENPP_uc004arz.2_Intron|CENPP_uc010mqx.2_Intron|OGN_uc004asb.2_Silent_p.E68E|OGN_uc011ltx.1_Silent_p.E86E	p.E68E	NM_014057	NP_054776	WXS	Illumina HiSeq	Unspecified	P20774	MIME_HUMAN			3	439	-			68					Q6FIB0|Q9UF90|Q9UNK5	Silent	SNP	ENST00000262551.4	37	c.204G>A	CCDS6695.1																																																																																				0.308	OGN-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053087.1	NM_024416		9	188	0	0	0	0.006214	0	9	188				
ECM2	1842	broad.mit.edu	37	9	95272247	95272247	+	Missense_Mutation	SNP	A	A	G			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr9:95272247A>G	ENST00000344604.5	-	6	1389	c.1240T>C	c.(1240-1242)Tct>Cct	p.S414P	CENPP_ENST00000375587.3_Intron|ECM2_ENST00000444490.2_Missense_Mutation_p.S392P	NM_001197295.1|NM_001393.3	NP_001184224.1|NP_001384.1	O94769	ECM2_HUMAN	extracellular matrix protein 2, female organ and adipocyte specific	414					cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	interstitial matrix (GO:0005614)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)	p.S392P(1)|p.S414P(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	27						TCTAATGTAGATGGCAATTGT	0.299																																							uc004ash.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|skin(1)	2						c.(1240-1242)TCT>CCT		extracellular matrix protein 2 precursor							85.0	83.0	84.0					9																	95272247		2202	4298	6500	SO:0001583	missense	1842				cell-matrix adhesion		integrin binding	g.chr9:95272247A>G	AB011792	CCDS6698.1, CCDS56578.1	9q22.3	2008-07-21			ENSG00000106823	ENSG00000106823			3154	protein-coding gene	gene with protein product	"""matrix glycoprotein SC1/ECM2"""	603479				9790758	Standard	NM_001393		Approved		uc011lty.2	O94769	OTTHUMG00000020226	ENST00000344604.5:c.1240T>C	9.37:g.95272247A>G	ENSP00000344758:p.Ser414Pro		Somatic				CENPP_uc004arz.2_Intron|CENPP_uc010mqx.2_Intron|ECM2_uc004asf.3_Missense_Mutation_p.S392P|ECM2_uc011lty.1_Missense_Mutation_p.S414P|ECM2_uc004asg.2_Missense_Mutation_p.S392P	p.S414P	NM_001393	NP_001384	WXS	Illumina HiSeq	Unspecified	O94769	ECM2_HUMAN			6	1305	-			414			LRR 2.		B2R730|E2PU11|Q5T9F2|Q7Z3D0	Missense_Mutation	SNP	ENST00000344604.5	37	c.1240T>C	CCDS6698.1	.	.	.	.	.	.	.	.	.	.	A	9.531	1.110863	0.20714	.	.	ENSG00000106823	ENST00000444490;ENST00000344604	T;T	0.24538	1.85;5.42	4.48	-0.37	0.12530	.	0.376807	0.31381	N	0.007755	T	0.09379	0.0231	N	0.02876	-0.465	0.50467	D	0.999875	B;B;B	0.19817	0.001;0.039;0.002	B;B;B	0.22386	0.005;0.039;0.008	T	0.17837	-1.0356	10	0.28530	T	0.3	.	8.9466	0.35762	0.6993:0.0:0.3007:0.0	.	414;392;392	O94769;B4DK93;O94769-2	ECM2_HUMAN;.;.	P	392;414	ENSP00000393971:S392P;ENSP00000344758:S414P	ENSP00000344758:S414P	S	-	1	0	ECM2	94312068	0.984000	0.35163	0.983000	0.44433	0.881000	0.50899	1.130000	0.31393	0.026000	0.15269	0.460000	0.39030	TCT		0.299	ECM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053091.1	NM_001393		3	83	0	0	0	0.004672	0	3	83				
ERCC6L2	375748	broad.mit.edu	37	9	98678023	98678023	+	Missense_Mutation	SNP	A	A	T	rs370912243		TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr9:98678023A>T	ENST00000288985.7	+	5	1200	c.895A>T	c.(895-897)Atg>Ttg	p.M299L	ERCC6L2_ENST00000437817.1_Missense_Mutation_p.M110L|ERCC6L2_ENST00000466840.1_3'UTR	NM_001010895.2	NP_001010895.1	Q5T890	ER6L2_HUMAN	excision repair cross-complementation group 6-like 2	299	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				DNA repair (GO:0006281)	cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|DNA binding (GO:0003677)	p.M299L(1)									AACAGAAGTTATGAAAGCTTT	0.398																																							uc004avt.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(895-897)ATG>TTG		RAD26L hypothetical protein							103.0	100.0	101.0					9																	98678023		2203	4300	6503	SO:0001583	missense	375748				DNA repair	nucleus	ATP binding|ATP-dependent helicase activity|DNA binding	g.chr9:98678023A>T	BC022957	CCDS35072.1	9q22.32	2014-03-07	2014-03-07	2012-03-30	ENSG00000182150	ENSG00000182150			26922	protein-coding gene	gene with protein product		615667	"""chromosome 9 open reading frame 102"", ""excision repair cross-complementing rodent repair deficiency, complementation group 6-like 2"""	C9orf102			Standard	NM_001010895		Approved	FLJ37706, RAD26L	uc004avt.4	Q5T890	OTTHUMG00000020289	ENST00000288985.7:c.895A>T	9.37:g.98678023A>T	ENSP00000288985:p.Met299Leu		Somatic				C9orf102_uc010mrx.1_RNA|C9orf102_uc011lum.1_Missense_Mutation_p.M1L|C9orf102_uc010mry.1_Missense_Mutation_p.M1L|C9orf102_uc010mrz.2_Missense_Mutation_p.M110L	p.M299L	NM_001010895	NP_001010895	WXS	Illumina HiSeq	Unspecified	Q5T890	RAD26_HUMAN			5	1283	+		Acute lymphoblastic leukemia(62;0.0559)	299			Helicase ATP-binding.		A4D997|B2RTP8|Q49AM9|Q5T892|Q8N663|Q8N9D0|Q9NPM7	Missense_Mutation	SNP	ENST00000288985.7	37	c.895A>T	CCDS35072.1	.	.	.	.	.	.	.	.	.	.	A	17.97	3.519081	0.64634	.	.	ENSG00000182150	ENST00000288985;ENST00000437817	D;D	0.91068	-2.78;-2.78	5.96	5.96	0.96718	DEAD-like helicase (2);SNF2-related (1);	0.000000	0.64402	D	0.000004	T	0.79730	0.4496	N	0.05510	-0.035	0.80722	D	1	B;B	0.19935	0.004;0.04	B;B	0.19946	0.003;0.027	T	0.75345	-0.3350	10	0.02654	T	1	-25.4625	16.4277	0.83824	1.0:0.0:0.0:0.0	.	110;299	Q5T890-2;Q5T890	.;RAD26_HUMAN	L	299;110	ENSP00000288985:M299L;ENSP00000416286:M110L	ENSP00000288985:M299L	M	+	1	0	C9orf102	97717844	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.247000	0.65416	2.279000	0.76181	0.533000	0.62120	ATG		0.398	ERCC6L2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000053247.2	NM_001010895		15	131	0	0	0	0.003163	0	15	131				
COL15A1	1306	broad.mit.edu	37	9	101797630	101797630	+	Splice_Site	SNP	A	A	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr9:101797630A>T	ENST00000375001.3	+	19	2643		c.e19-1			NM_001855.3	NP_001846.3	P39059	COFA1_HUMAN	collagen, type XV, alpha 1						angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|signal transduction (GO:0007165)	collagen type XV trimer (GO:0005582)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	extracellular matrix structural constituent (GO:0005201)	p.?(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(20)|liver(1)|lung(42)|ovary(6)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	107		Acute lymphoblastic leukemia(62;0.0562)				CTCCTTCCCCAGGATACCGAA	0.527																																							uc004azb.1		NA																	1	Unknown(1)		lung(1)	ovary(6)	6						c.e19-2		alpha 1 type XV collagen precursor							95.0	91.0	92.0					9																	101797630		2203	4300	6503	SO:0001630	splice_region_variant	1306				angiogenesis|cell differentiation|signal transduction	collagen type XV|extracellular space|integral to membrane	binding	g.chr9:101797630A>T	L25286	CCDS35081.1	9q21-q22	2013-01-16			ENSG00000204291	ENSG00000204291		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2192	protein-coding gene	gene with protein product	"""collagen type XV proteoglycan"""	120325				1427836	Standard	NM_001855		Approved		uc004azb.2	P39059	OTTHUMG00000020351	ENST00000375001.3:c.2221-1A>T	9.37:g.101797630A>T			Somatic					p.D741_splice	NM_001855	NP_001846	WXS	Illumina HiSeq	Unspecified	P39059	COFA1_HUMAN			19	2427	+		Acute lymphoblastic leukemia(62;0.0562)						Q5T6J4|Q9UDC5|Q9Y4W4	Splice_Site	SNP	ENST00000375001.3	37	c.2221_splice	CCDS35081.1	.	.	.	.	.	.	.	.	.	.	A	12.91	2.079245	0.36662	.	.	ENSG00000204291	ENST00000375001;ENST00000536083	.	.	.	5.29	4.16	0.48862	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.6854	0.28538	0.9045:0.0:0.0955:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	COL15A1	100837451	0.927000	0.31430	0.548000	0.28192	0.405000	0.30901	1.826000	0.39092	0.871000	0.35750	0.533000	0.62120	.		0.527	COL15A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053386.3	NM_001855	Intron	11	114	0	0	0	0.00245	0	11	114				
AKAP2	11217	broad.mit.edu	37	9	112898635	112898635	+	Missense_Mutation	SNP	G	G	T	rs146199973	byFrequency	TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr9:112898635G>T	ENST00000259318.7	+	2	325	c.118G>T	c.(118-120)Gat>Tat	p.D40Y	AKAP2_ENST00000510514.5_Missense_Mutation_p.D271Y|AKAP2_ENST00000434623.2_Missense_Mutation_p.D129Y|AKAP2_ENST00000374525.1_Missense_Mutation_p.D129Y|AKAP2_ENST00000555236.1_Missense_Mutation_p.D271Y|PALM2-AKAP2_ENST00000302798.7_Missense_Mutation_p.D271Y|PALM2-AKAP2_ENST00000374530.3_Missense_Mutation_p.D271Y	NM_001136562.2	NP_001130034.1	Q9Y2D5	AKAP2_HUMAN	A kinase (PRKA) anchor protein 2	40								p.D271Y(1)|p.D129Y(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	33						CCTCCTTACTGATCACCACGA	0.498																																							uc004bei.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|central_nervous_system(2)|skin(1)	6						c.(1507-1509)GAT>TAT		A kinase (PRKA) anchor protein 2 isoform 2							185.0	161.0	169.0					9																	112898635		2203	4300	6503	SO:0001583	missense	445815						enzyme binding	g.chr9:112898635G>T	AB023137	CCDS43861.1, CCDS48003.1, CCDS56581.1	9q31.3	2009-10-16			ENSG00000241978	ENSG00000241978		"""A-kinase anchor proteins"""	372	protein-coding gene	gene with protein product	"""protein kinase A2"""	604582		PRKA2		10231032	Standard	NM_001136562		Approved	AKAP-KL, KIAA0920, DKFZp564L0716		Q9Y2D5	OTTHUMG00000156811	ENST00000259318.7:c.118G>T	9.37:g.112898635G>T	ENSP00000259318:p.Asp40Tyr		Somatic				PALM2-AKAP2_uc004bek.3_Missense_Mutation_p.D271Y|PALM2-AKAP2_uc004bej.3_Missense_Mutation_p.D271Y|PALM2-AKAP2_uc004bel.1_Missense_Mutation_p.D81Y|AKAP2_uc011lwi.1_Missense_Mutation_p.D129Y|AKAP2_uc004bem.2_Missense_Mutation_p.D129Y|PALM2-AKAP2_uc010mtw.1_Missense_Mutation_p.D89Y|AKAP2_uc011lwj.1_Missense_Mutation_p.D40Y|PALM2-AKAP2_uc004ben.2_Missense_Mutation_p.D40Y	p.D503Y	NM_001136562	NP_001130034	WXS	Illumina HiSeq	Unspecified	Q9Y2D5	AKAP2_HUMAN			9	1699	+			40					B1ALX9|B2RTU4|B3KQ00|B4DTZ2|B7ZW07|B9EJB5|Q9UG26	Missense_Mutation	SNP	ENST00000259318.7	37	c.1507G>T	CCDS48003.1	.	.	.	.	.	.	.	.	.	.	G	17.46	3.394822	0.62066	.	.	ENSG00000157654;ENSG00000157654;ENSG00000241978;ENSG00000241978;ENSG00000241978;ENSG00000241978;ENSG00000241978;ENSG00000241978	ENST00000374530;ENST00000302798;ENST00000555236;ENST00000510514;ENST00000434623;ENST00000374525;ENST00000480388;ENST00000259318	T;T;T;T;T;T;T;T	0.54071	1.91;1.92;1.91;1.92;1.18;0.59;0.59;1.21	6.17	4.31	0.51392	.	0.220280	0.39210	N	0.001424	T	0.60663	0.2286	M	0.64997	1.995	0.37646	D	0.922231	P;D;P;D;D;P;P;P	0.56521	0.729;0.976;0.87;0.976;0.959;0.867;0.867;0.79	B;P;P;P;P;P;P;B	0.57101	0.276;0.813;0.459;0.813;0.655;0.541;0.541;0.34	T	0.66204	-0.5982	10	0.72032	D	0.01	-20.0367	7.5969	0.28054	0.1409:0.1368:0.7223:0.0	.	40;129;123;129;130;271;271;89	Q9Y2D5;Q9Y2D5-7;B4E2K2;Q9Y2D5-5;B1ALY1;Q9Y2D5-6;Q9Y2D5-4;C9JVY5	AKAP2_HUMAN;.;.;.;.;.;.;.	Y	271;271;271;271;129;129;89;40	ENSP00000363654:D271Y;ENSP00000305861:D271Y;ENSP00000451476:D271Y;ENSP00000421522:D271Y;ENSP00000404782:D129Y;ENSP00000363649:D129Y;ENSP00000419268:D89Y;ENSP00000259318:D40Y	ENSP00000259318:D40Y	D	+	1	0	PALM2-AKAP2;AKAP2	111938456	0.995000	0.38212	0.461000	0.27105	0.772000	0.43724	2.826000	0.48104	0.906000	0.36621	0.655000	0.94253	GAT		0.498	AKAP2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000346067.3	NM_001004065		9	227	1	0	0.000442599	0.006214	0.000564829	9	227				
TLR4	7099	broad.mit.edu	37	9	120475650	120475650	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr9:120475650G>T	ENST00000355622.6	+	3	1345	c.1244G>T	c.(1243-1245)aGt>aTt	p.S415I	TLR4_ENST00000472304.1_3'UTR|TLR4_ENST00000394487.4_Missense_Mutation_p.S375I	NM_138554.4|NM_138557.2	NP_612564.1|NP_612567.1	O00206	TLR4_HUMAN	toll-like receptor 4	415					activation of MAPK activity (GO:0000187)|B cell proliferation involved in immune response (GO:0002322)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|detection of fungus (GO:0016046)|detection of lipopolysaccharide (GO:0032497)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|intestinal epithelial structure maintenance (GO:0060729)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation (GO:0042116)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-23 production (GO:0032707)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of tumor necrosis factor production (GO:0032720)|nitric oxide production involved in inflammatory response (GO:0002537)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine production (GO:0032722)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 production (GO:0032732)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070430)|positive regulation of nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070434)|positive regulation of platelet activation (GO:0010572)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cytokine secretion (GO:0050707)|response to lipopolysaccharide (GO:0032496)|T-helper 1 type immune response (GO:0042088)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|lipopolysaccharide receptor complex (GO:0046696)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	lipopolysaccharide binding (GO:0001530)|lipopolysaccharide receptor activity (GO:0001875)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)	p.S415I(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(66)|ovary(4)|pancreas(1)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	103					Naloxone(DB01183)	ATTACCATGAGTTCAAACTTC	0.373																																							uc004bjz.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(10)|ovary(4)|breast(1)|skin(1)	16						c.(1243-1245)AGT>ATT		toll-like receptor 4 precursor							61.0	62.0	62.0					9																	120475650		2203	4300	6503	SO:0001583	missense	7099				activation of MAPK activity|cellular response to mechanical stimulus|detection of fungus|detection of lipopolysaccharide|I-kappaB phosphorylation|innate immune response|intestinal epithelial structure maintenance|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of ERK1 and ERK2 cascade|negative regulation of interferon-gamma production|negative regulation of interleukin-17 production|negative regulation of interleukin-23 production|negative regulation of interleukin-6 production|negative regulation of osteoclast differentiation|negative regulation of tumor necrosis factor production|positive regulation of chemokine production|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of interferon-gamma production|positive regulation of interleukin-1 production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 biosynthetic process|positive regulation of interleukin-12 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 biosynthetic process|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of platelet activation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor biosynthetic process|positive regulation of tumor necrosis factor production|T-helper 1 type immune response|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	external side of plasma membrane|integral to plasma membrane|lipopolysaccharide receptor complex|perinuclear region of cytoplasm	lipopolysaccharide receptor activity|transmembrane receptor activity	g.chr9:120475650G>T	U88880	CCDS6818.1	9q33.1	2013-01-23			ENSG00000136869	ENSG00000136869		"""CD molecules"""	11850	protein-coding gene	gene with protein product		603030				9435236, 9237759	Standard	NM_138554		Approved	hToll, CD284, TLR-4, ARMD10	uc004bjz.4	O00206	OTTHUMG00000021046	ENST00000355622.6:c.1244G>T	9.37:g.120475650G>T	ENSP00000363089:p.Ser415Ile		Somatic				TLR4_uc004bka.2_Missense_Mutation_p.S375I|TLR4_uc004bkb.2_Missense_Mutation_p.S215I	p.S415I	NM_138554	NP_612564	WXS	Illumina HiSeq	Unspecified	O00206	TLR4_HUMAN			3	1535	+			415			LRR 12.|Extracellular (Potential).		A8K1Y8|A9XLP9|A9XLQ0|A9XLQ1|B4E194|D1CS52|D1CS53|Q5VZI8|Q5VZI9|Q9UK78|Q9UM57	Missense_Mutation	SNP	ENST00000355622.6	37	c.1244G>T	CCDS6818.1	.	.	.	.	.	.	.	.	.	.	G	11.37	1.618685	0.28801	.	.	ENSG00000136869	ENST00000394487;ENST00000355622	T;T	0.00995	5.46;5.46	5.7	-7.36	0.01417	.	1.389790	0.04423	N	0.367960	T	0.01558	0.0050	L	0.60904	1.88	0.09310	N	1	P	0.42941	0.794	B	0.40659	0.336	T	0.31308	-0.9948	10	0.72032	D	0.01	.	12.5515	0.56229	0.3285:0.5525:0.1189:0.0	.	415	O00206	TLR4_HUMAN	I	375;415	ENSP00000377997:S375I;ENSP00000363089:S415I	ENSP00000363089:S415I	S	+	2	0	TLR4	119515471	0.000000	0.05858	0.000000	0.03702	0.269000	0.26545	-1.799000	0.01746	-1.202000	0.02655	-0.182000	0.12963	AGT		0.373	TLR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055549.3	NM_138554		13	164	1	0	7.93312e-07	0.00245	1.29949e-06	13	164				
MXRA5	25878	broad.mit.edu	37	X	3240239	3240239	+	Missense_Mutation	SNP	G	G	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chrX:3240239G>A	ENST00000217939.6	-	5	3641	c.3487C>T	c.(3487-3489)Cgc>Tgc	p.R1163C		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	1163						extracellular vesicular exosome (GO:0070062)		p.R1163C(2)		NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				TGCCGGTGGCGGAATTTGTTG	0.493																																							uc004crg.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(5)|lung(1)|central_nervous_system(1)|skin(1)	8						c.(3487-3489)CGC>TGC		adlican precursor							127.0	127.0	127.0					X																	3240239		2203	4300	6503	SO:0001583	missense	25878					extracellular region		g.chrX:3240239G>A	AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.3487C>T	X.37:g.3240239G>A	ENSP00000217939:p.Arg1163Cys		Somatic					p.R1163C	NM_015419	NP_056234	WXS	Illumina HiSeq	Unspecified	Q9NR99	MXRA5_HUMAN			5	3644	-		all_lung(23;0.00031)|Lung NSC(23;0.000946)	1163					Q6P1M7|Q9Y3Y8	Missense_Mutation	SNP	ENST00000217939.6	37	c.3487C>T	CCDS14124.1	.	.	.	.	.	.	.	.	.	.	g	14.21	2.466654	0.43839	.	.	ENSG00000101825	ENST00000381114;ENST00000217939	T	0.77750	-1.12	2.88	2.88	0.33553	.	0.000000	0.32548	U	0.005958	T	0.79598	0.4473	L	0.32530	0.975	0.09310	N	1	D	0.89917	1.0	D	0.87578	0.998	T	0.68138	-0.5488	10	0.87932	D	0	.	8.9611	0.35847	0.0:0.0:0.779:0.2209	.	1163	Q9NR99	MXRA5_HUMAN	C	1163	ENSP00000217939:R1163C	ENSP00000217939:R1163C	R	-	1	0	MXRA5	3250239	0.362000	0.24980	0.008000	0.14137	0.210000	0.24377	2.257000	0.43240	1.438000	0.47492	0.519000	0.50382	CGC		0.493	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055655.2	NM_015419		16	199	0	0	0	0.006122	0	16	199				
PHKA2	5256	broad.mit.edu	37	X	18972504	18972504	+	Silent	SNP	G	G	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chrX:18972504G>T	ENST00000379942.4	-	2	770	c.105C>A	c.(103-105)gcC>gcA	p.A35A		NM_000292.2	NP_000283.1	P46019	KPB2_HUMAN	phosphorylase kinase, alpha 2 (liver)	35					carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)	p.A35A(1)		NS(1)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(23)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	61	Hepatocellular(33;0.183)					GCTCATGGCTGGCTGACAGCA	0.552																																							uc004cyv.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(103-105)GCC>GCA		phosphorylase kinase, alpha 2 (liver)							82.0	61.0	68.0					X																	18972504		2203	4300	6503	SO:0001819	synonymous_variant	5256				glucose metabolic process|glycogen catabolic process	cytosol|phosphorylase kinase complex|plasma membrane	calmodulin binding|glucan 1,4-alpha-glucosidase activity|phosphorylase kinase activity	g.chrX:18972504G>T		CCDS14190.1	Xp22.2-p22.1	2009-07-10			ENSG00000044446	ENSG00000044446	2.7.11.19		8926	protein-coding gene	gene with protein product		300798		PHK, PYK		2387090	Standard	NM_000292		Approved		uc004cyv.4	P46019	OTTHUMG00000021222	ENST00000379942.4:c.105C>A	X.37:g.18972504G>T			Somatic				PHKA2_uc010nfh.1_RNA|PHKA2_uc010nfi.1_5'UTR	p.A35A	NM_000292	NP_000283	WXS	Illumina HiSeq	Unspecified	P46019	KPB2_HUMAN			2	535	-	Hepatocellular(33;0.183)		35					A8K1T1|Q6LAJ5|Q7Z6W0|Q96CR3|Q9UDA1	Silent	SNP	ENST00000379942.4	37	c.105C>A	CCDS14190.1																																																																																				0.552	PHKA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055960.1	NM_000292		7	84	1	0	7.48243e-07	0.006214	1.23488e-06	7	84				
PTCHD1	139411	broad.mit.edu	37	X	23412216	23412216	+	Missense_Mutation	SNP	A	A	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chrX:23412216A>T	ENST00000379361.4	+	3	3441	c.2581A>T	c.(2581-2583)Aat>Tat	p.N861Y		NM_173495.2	NP_775766.2	Q96NR3	PTHD1_HUMAN	patched domain containing 1	861					cognition (GO:0050890)|smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hedgehog receptor activity (GO:0008158)	p.N756Y(1)|p.N861Y(1)		NS(1)|breast(4)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|ovary(4)|skin(2)|urinary_tract(2)	42						AGAGAAGAAAAATCCTGAGAA	0.398																																							uc004dal.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|kidney(1)|skin(1)	6						c.(2581-2583)AAT>TAT		patched domain containing 1							86.0	88.0	87.0					X																	23412216		2203	4300	6503	SO:0001583	missense	139411				cognition|smoothened signaling pathway	integral to membrane|plasma membrane	hedgehog receptor activity	g.chrX:23412216A>T	AK054858	CCDS35215.2	Xp22.13	2008-02-05			ENSG00000165186	ENSG00000165186			26392	protein-coding gene	gene with protein product		300828					Standard	NM_173495		Approved	FLJ30296	uc004dal.4	Q96NR3	OTTHUMG00000021251	ENST00000379361.4:c.2581A>T	X.37:g.23412216A>T	ENSP00000368666:p.Asn861Tyr		Somatic					p.N861Y	NM_173495	NP_775766	WXS	Illumina HiSeq	Unspecified	Q96NR3	PTHD1_HUMAN			3	2589	+			861					B4DQH0|Q0IJ60|Q6P6B8	Missense_Mutation	SNP	ENST00000379361.4	37	c.2581A>T	CCDS35215.2	.	.	.	.	.	.	.	.	.	.	A	8.997	0.979187	0.18812	.	.	ENSG00000165186	ENST00000379361	D	0.89485	-2.52	4.71	3.52	0.40303	.	0.240542	0.43416	D	0.000576	T	0.78824	0.4344	N	0.14661	0.345	0.26570	N	0.973572	B	0.28512	0.214	B	0.25884	0.064	T	0.70015	-0.4988	10	0.59425	D	0.04	.	10.9523	0.47336	0.8448:0.1552:0.0:0.0	.	861	Q96NR3	PTHD1_HUMAN	Y	861	ENSP00000368666:N861Y	ENSP00000368666:N861Y	N	+	1	0	PTCHD1	23322137	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	3.977000	0.56874	0.564000	0.29238	0.356000	0.21956	AAT		0.398	PTCHD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056047.2	NM_173495		10	187	0	0	0	0.006214	0	10	187				
IL1RAPL1	11141	broad.mit.edu	37	X	29938086	29938086	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chrX:29938086G>T	ENST00000378993.1	+	8	1605	c.932G>T	c.(931-933)gGg>gTg	p.G311V	IL1RAPL1_ENST00000302196.4_Missense_Mutation_p.G311V	NM_014271.3	NP_055086.1	Q9NZN1	IRPL1_HUMAN	interleukin 1 receptor accessory protein-like 1	311	Ig-like C2-type 3.				calcium ion transmembrane transport (GO:0070588)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of exocytosis (GO:0045920)|neuron differentiation (GO:0030182)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|regulation of neuron projection development (GO:0010975)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	receptor binding (GO:0005102)|voltage-gated calcium channel activity (GO:0005245)	p.G311V(2)		biliary_tract(1)|breast(1)|endometrium(5)|large_intestine(9)|lung(38)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62						GAGCATCTTGGGGAACAGGAA	0.373																																							uc004dby.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|lung(1)|pancreas(1)	5						c.(931-933)GGG>GTG		interleukin 1 receptor accessory protein-like 1							205.0	175.0	185.0					X																	29938086		2202	4300	6502	SO:0001583	missense	11141				innate immune response|negative regulation of calcium ion transport via voltage-gated calcium channel activity|negative regulation of exocytosis|regulation of neuron projection development	cytoplasm|integral to membrane|plasma membrane	protein binding|transmembrane receptor activity	g.chrX:29938086G>T	AJ243874	CCDS14218.1	Xp22.1-p21.3	2013-01-29	2004-02-13		ENSG00000169306	ENSG00000169306		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5996	protein-coding gene	gene with protein product		300206	"""mental retardation, X-linked 34"", ""mental retardation, X-linked 21"", ""mental retardation, X-linked 10"""	IL1RAPL, MRX34, MRX21, MRX10		10471494, 10757639	Standard	NM_014271		Approved	OPHN4, TIGIRR-2, IL1R8	uc004dby.2	Q9NZN1	OTTHUMG00000021317	ENST00000378993.1:c.932G>T	X.37:g.29938086G>T	ENSP00000368278:p.Gly311Val		Somatic					p.G311V	NM_014271	NP_055086	WXS	Illumina HiSeq	Unspecified	Q9NZN1	IRPL1_HUMAN			8	1440	+			311			Extracellular (Potential).|Ig-like C2-type 3.		A0AVG4|Q9UJ53	Missense_Mutation	SNP	ENST00000378993.1	37	c.932G>T	CCDS14218.1	.	.	.	.	.	.	.	.	.	.	G	23.3	4.405003	0.83230	.	.	ENSG00000169306	ENST00000378993;ENST00000302196	T;T	0.13657	2.57;2.57	5.91	5.91	0.95273	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.050013	0.85682	D	0.000000	T	0.41903	0.1179	M	0.76838	2.35	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.14420	-1.0473	9	.	.	.	.	19.2812	0.94053	0.0:0.0:1.0:0.0	.	311	Q9NZN1	IRPL1_HUMAN	V	311	ENSP00000368278:G311V;ENSP00000305200:G311V	.	G	+	2	0	IL1RAPL1	29848007	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	9.476000	0.97823	2.505000	0.84491	0.523000	0.50628	GGG		0.373	IL1RAPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056155.1	NM_014271		11	252	1	0	1.61879e-10	0.001368	3.11688e-10	11	252				
DMD	1756	broad.mit.edu	37	X	32382758	32382758	+	Missense_Mutation	SNP	C	C	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chrX:32382758C>T	ENST00000357033.4	-	36	5301	c.5095G>A	c.(5095-5097)Gac>Aac	p.D1699N	DMD_ENST00000378677.2_Missense_Mutation_p.D1695N	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	1699	Interaction with SYNM. {ECO:0000250}.				cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)	p.D1699N(1)|p.D1695N(1)|p.D1694N(1)|p.D358N(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				AAAAGTGTGTCAGCCTGAATG	0.373																																							uc004dda.1		NA																	4	Substitution - Missense(4)		lung(4)	ovary(3)|pancreas(2)|large_intestine(1)	6						c.(5095-5097)GAC>AAC		dystrophin Dp427m isoform							247.0	200.0	216.0					X																	32382758		2202	4300	6502	SO:0001583	missense	1756				muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding	g.chrX:32382758C>T	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.5095G>A	X.37:g.32382758C>T	ENSP00000354923:p.Asp1699Asn		Somatic				DMD_uc004dcw.2_Missense_Mutation_p.D355N|DMD_uc004dcx.2_Missense_Mutation_p.D358N|DMD_uc004dcz.2_Missense_Mutation_p.D1576N|DMD_uc004dcy.1_Missense_Mutation_p.D1695N|DMD_uc004ddb.1_Missense_Mutation_p.D1691N|DMD_uc010ngo.1_Intron	p.D1699N	NM_004006	NP_003997	WXS	Illumina HiSeq	Unspecified	P11532	DMD_HUMAN			36	5339	-		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)	1699			Spectrin 12.|Interaction with SYNM (By similarity).		E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	ENST00000357033.4	37	c.5095G>A	CCDS14233.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.114414	0.77210	.	.	ENSG00000198947	ENST00000534884;ENST00000378682;ENST00000378684;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280	T;T	0.35236	1.32;1.32	5.38	5.38	0.77491	.	0.202899	0.23088	U	0.052064	T	0.30448	0.0765	N	0.22421	0.69	0.80722	D	1	B;P;B;B;B	0.38677	0.275;0.642;0.322;0.322;0.322	B;B;B;B;B	0.37550	0.12;0.253;0.19;0.19;0.125	T	0.18085	-1.0348	10	0.72032	D	0.01	.	18.3946	0.90494	0.0:1.0:0.0:0.0	.	1691;1699;1695;358;355	P11532-4;P11532;E9PDN5;E7EQS7;E7EQS6	.;DMD_HUMAN;.;.;.	N	1691;358;355;1695;1699;1699;1576	ENSP00000367948:D1695N;ENSP00000354923:D1699N	ENSP00000354923:D1699N	D	-	1	0	DMD	32292679	1.000000	0.71417	0.975000	0.42487	0.983000	0.72400	4.728000	0.62000	2.371000	0.80710	0.538000	0.68166	GAC		0.373	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006		12	249	0	0	0	0.000978	0	12	249				
FAM47C	442444	broad.mit.edu	37	X	37028015	37028015	+	Missense_Mutation	SNP	G	G	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chrX:37028015G>A	ENST00000358047.3	+	1	1584	c.1532G>A	c.(1531-1533)cGc>cAc	p.R511H		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	511								p.R511H(2)		breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						TCTCATCTCCGCCCAGAGCCT	0.602																																							uc004ddl.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)	3						c.(1531-1533)CGC>CAC		hypothetical protein LOC442444							85.0	82.0	83.0					X																	37028015		2202	4300	6502	SO:0001583	missense	442444							g.chrX:37028015G>A	AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.1532G>A	X.37:g.37028015G>A	ENSP00000367913:p.Arg511His		Somatic					p.R511H	NM_001013736	NP_001013758	WXS	Illumina HiSeq	Unspecified	Q5HY64	FA47C_HUMAN			1	1546	+			511					Q6ZU46	Missense_Mutation	SNP	ENST00000358047.3	37	c.1532G>A	CCDS35227.1	.	.	.	.	.	.	.	.	.	.	g	3.628	-0.076232	0.07184	.	.	ENSG00000198173	ENST00000358047	T	0.21191	2.02	0.993	-0.0537	0.13816	.	.	.	.	.	T	0.09686	0.0238	N	0.14661	0.345	0.09310	N	1	D	0.63880	0.993	B	0.41723	0.365	T	0.17107	-1.0380	9	0.39692	T	0.17	.	2.8694	0.05611	0.297:0.3895:0.3134:0.0	.	511	Q5HY64	FA47C_HUMAN	H	511	ENSP00000367913:R511H	ENSP00000367913:R511H	R	+	2	0	FAM47C	36937936	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.709000	0.01890	-0.086000	0.12550	-0.718000	0.03613	CGC		0.602	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060508.1	NM_001013736		9	131	0	0	0	0.004482	0	9	131				
RPGR	6103	broad.mit.edu	37	X	38132700	38132700	+	Nonsense_Mutation	SNP	G	G	C			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chrX:38132700G>C	ENST00000339363.3	-	17	2962	c.2795C>G	c.(2794-2796)tCa>tGa	p.S932*	RPGR_ENST00000309513.3_Nonsense_Mutation_p.S665*|RPGR_ENST00000318842.7_Nonsense_Mutation_p.S727*|RPGR_ENST00000338898.3_3'UTR|TM4SF2_ENST00000465127.1_Intron			Q92834	RPGR_HUMAN	retinitis pigmentosa GTPase regulator	932					cilium assembly (GO:0042384)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|intraciliary transport (GO:0042073)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|Golgi apparatus (GO:0005794)|photoreceptor outer segment (GO:0001750)|sperm flagellum (GO:0036126)	guanyl-nucleotide exchange factor activity (GO:0005085)|poly(A) RNA binding (GO:0044822)	p.S727*(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	25						GATTTCTAATGAACTGCTATC	0.328																																							uc004deb.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)	1						c.(2179-2181)TCA>TGA		retinitis pigmentosa GTPase regulator isoform A							238.0	184.0	202.0					X																	38132700		2201	4299	6500	SO:0001587	stop_gained	6103				intracellular protein transport|response to stimulus|visual perception	Golgi apparatus|photoreceptor outer segment	guanyl-nucleotide exchange factor activity|protein binding	g.chrX:38132700G>C	U57629	CCDS14246.1, CCDS35229.1	Xp11.4	2013-06-06	2004-02-13		ENSG00000156313	ENSG00000156313			10295	protein-coding gene	gene with protein product		312610	"""retinitis pigmentosa 15"", ""cone dystrophy 1 (X-linked)"""	CRD, RP3, RP15, COD1		8673101, 8817343	Standard	XM_005272633		Approved	CORDX1	uc004ded.1	Q92834	OTTHUMG00000021361	ENST00000339363.3:c.2795C>G	X.37:g.38132700G>C	ENSP00000343671:p.Ser932*		Somatic				RPGR_uc004dea.2_RNA|RPGR_uc004dec.2_RNA	p.S727*	NM_000328	NP_000319	WXS	Illumina HiSeq	Unspecified	Q92834	RPGR_HUMAN			18	2348	-			Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					B1ARN3|E9PE28|O00702|O00737|Q3KN84|Q8N5T6|Q93039|Q9HD29|Q9UMR1	Nonsense_Mutation	SNP	ENST00000339363.3	37	c.2180C>G		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	32|32	5.129865|5.129865	0.94473|0.94473	.|.	.|.	ENSG00000156313|ENSG00000156313	ENST00000494707|ENST00000339363;ENST00000309513;ENST00000318842	.|.	.|.	.|.	4.44|4.44	2.56|2.56	0.30785|0.30785	.|.	.|.	.|.	.|.	.|.	T|.	0.39989|.	0.1099|.	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.34625|.	-0.9821|.	4|.	.|0.72032	.|D	.|0.01	.|.	5.5959|5.5959	0.17327|0.17327	0.1175:0.1986:0.6839:0.0|0.1175:0.1986:0.6839:0.0	.|.	.|.	.|.	.|.	L|X	138|932;665;727	.|.	.|ENSP00000308783:S665X	F|S	-|-	3|2	2|0	RPGR|RPGR	38017644|38017644	0.207000|0.207000	0.23482|0.23482	0.004000|0.004000	0.12327|0.12327	0.019000|0.019000	0.09904|0.09904	0.882000|0.882000	0.28186|0.28186	0.379000|0.379000	0.24794|0.24794	0.410000|0.410000	0.27636|0.27636	TTC|TCA		0.328	RPGR-203	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_000328		4	58	0	0	0	0.000248	0	4	58				
RPGR	6103	broad.mit.edu	37	X	38169932	38169932	+	Silent	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chrX:38169932C>A	ENST00000339363.3	-	7	881	c.714G>T	c.(712-714)gtG>gtT	p.V238V	RPGR_ENST00000342811.3_Silent_p.V238V|RPGR_ENST00000378505.2_Silent_p.V238V|RPGR_ENST00000309513.3_Silent_p.V238V|RPGR_ENST00000318842.7_Silent_p.V238V|RPGR_ENST00000338898.3_Silent_p.V238V|SNORA31_ENST00000516241.1_RNA|TM4SF2_ENST00000465127.1_Intron			Q92834	RPGR_HUMAN	retinitis pigmentosa GTPase regulator	238					cilium assembly (GO:0042384)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|intraciliary transport (GO:0042073)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|Golgi apparatus (GO:0005794)|photoreceptor outer segment (GO:0001750)|sperm flagellum (GO:0036126)	guanyl-nucleotide exchange factor activity (GO:0005085)|poly(A) RNA binding (GO:0044822)	p.V238V(2)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	25						GAATTTCAGACACCAGCTGGG	0.507																																							uc004ded.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(712-714)GTG>GTT		retinitis pigmentosa GTPase regulator isoform C							107.0	80.0	89.0					X																	38169932		2202	4300	6502	SO:0001819	synonymous_variant	6103				intracellular protein transport|response to stimulus|visual perception	Golgi apparatus|photoreceptor outer segment	guanyl-nucleotide exchange factor activity|protein binding	g.chrX:38169932C>A	U57629	CCDS14246.1, CCDS35229.1	Xp11.4	2013-06-06	2004-02-13		ENSG00000156313	ENSG00000156313			10295	protein-coding gene	gene with protein product		312610	"""retinitis pigmentosa 15"", ""cone dystrophy 1 (X-linked)"""	CRD, RP3, RP15, COD1		8673101, 8817343	Standard	XM_005272633		Approved	CORDX1	uc004ded.1	Q92834	OTTHUMG00000021361	ENST00000339363.3:c.714G>T	X.37:g.38169932C>A			Somatic				RPGR_uc004deb.2_Silent_p.V238V|RPGR_uc004dea.2_RNA|RPGR_uc004dec.2_RNA	p.V238V	NM_001034853	NP_001030025	WXS	Illumina HiSeq	Unspecified	Q92834	RPGR_HUMAN			7	882	-			238			RCC1 4.		B1ARN3|E9PE28|O00702|O00737|Q3KN84|Q8N5T6|Q93039|Q9HD29|Q9UMR1	Silent	SNP	ENST00000339363.3	37	c.714G>T																																																																																					0.507	RPGR-203	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_000328		8	71	1	0	0.00307968	0.00308	0.00362461	8	71				
DUSP21	63904	broad.mit.edu	37	X	44703492	44703492	+	Missense_Mutation	SNP	C	C	G			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chrX:44703492C>G	ENST00000339042.4	+	1	244	c.114C>G	c.(112-114)aaC>aaG	p.N38K		NM_022076.3	NP_071359.3	Q9H596	DUS21_HUMAN	dual specificity phosphatase 21	38	Tyrosine-protein phosphatase.				peptidyl-tyrosine dephosphorylation (GO:0035335)	cytoplasm (GO:0005737)|mitochondrial inner membrane (GO:0005743)|nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.N38K(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|skin(3)	19						TGGCCGCCAACGACAAACTCC	0.512																																							uc004dgd.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|lung(1)	2						c.(112-114)AAC>AAG		dual specificity phosphatase 21							131.0	100.0	111.0					X																	44703492		2203	4300	6503	SO:0001583	missense	63904					cytoplasm|nucleus	MAP kinase tyrosine/serine/threonine phosphatase activity|protein tyrosine phosphatase activity	g.chrX:44703492C>G	AF143321	CCDS14264.1	Xp11.4-p11.23	2011-06-09			ENSG00000189037	ENSG00000189037		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	20476	protein-coding gene	gene with protein product		300678				12408986	Standard	NM_022076		Approved		uc004dgd.3	Q9H596	OTTHUMG00000021401	ENST00000339042.4:c.114C>G	X.37:g.44703492C>G	ENSP00000343244:p.Asn38Lys		Somatic					p.N38K	NM_022076	NP_071359	WXS	Illumina HiSeq	Unspecified	Q9H596	DUS21_HUMAN			1	244	+			38			Tyrosine-protein phosphatase.		Q0VDA6|Q6IAJ6|Q6YDQ8	Missense_Mutation	SNP	ENST00000339042.4	37	c.114C>G	CCDS14264.1	.	.	.	.	.	.	.	.	.	.	c	9.242	1.038509	0.19669	.	.	ENSG00000189037	ENST00000339042;ENST00000537377	T	0.59906	0.23	3.82	-3.74	0.04385	Dual specificity phosphatase, catalytic domain (1);Dual specificity phosphatase, subgroup, catalytic domain (2);	0.537086	0.20832	N	0.084873	T	0.35941	0.0949	N	0.25094	0.71	0.20975	N	0.999813	P	0.51933	0.949	P	0.45753	0.492	T	0.50083	-0.8869	10	0.16896	T	0.51	.	6.7023	0.23232	0.0:0.3551:0.1238:0.5211	.	38	Q9H596	DUS21_HUMAN	K	38	ENSP00000343244:N38K	ENSP00000343244:N38K	N	+	3	2	DUSP21	44588436	0.977000	0.34250	0.000000	0.03702	0.020000	0.10135	0.323000	0.19593	-1.196000	0.02676	0.597000	0.82753	AAC		0.512	DUSP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056323.1	NM_022076		7	97	0	0	0	0.006214	0	7	97				
CLCN5	1184	broad.mit.edu	37	X	49845313	49845313	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chrX:49845313C>A	ENST00000307367.2	+	5	747	c.456C>A	c.(454-456)ttC>ttA	p.F152L	CLCN5_ENST00000376088.3_Missense_Mutation_p.F222L|CLCN5_ENST00000376091.3_Missense_Mutation_p.F222L|CLCN5_ENST00000376108.3_Missense_Mutation_p.F152L			P51795	CLCN5_HUMAN	chloride channel, voltage-sensitive 5	152					chloride transmembrane transport (GO:1902476)|endocytosis (GO:0006897)|excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical part of cell (GO:0045177)|endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)	p.F222L(1)|p.F152L(1)		central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(8)|ovary(2)|skin(1)	30	Ovarian(276;0.236)					TATTTGCCTTCCTTGCCGTAT	0.443																																							uc004dos.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|lung(1)|central_nervous_system(1)	4						c.(454-456)TTC>TTA		chloride channel 5 isoform b							195.0	144.0	161.0					X																	49845313		2203	4300	6503	SO:0001583	missense	1184				excretion	apical part of cell|endosome membrane|Golgi membrane|integral to plasma membrane	antiporter activity|ATP binding	g.chrX:49845313C>A	X91906	CCDS14328.1, CCDS48115.1, CCDS69763.1	Xp11.23-p11.22	2012-09-26	2012-02-23		ENSG00000171365	ENSG00000171365		"""Ion channels / Chloride channels : Voltage-sensitive"""	2023	protein-coding gene	gene with protein product	"""Dent disease"""	300008	"""nephrolithiasis 2, X-linked"", ""nephrolithiasis 1 (X-linked)"", ""chloride channel 5"""	NPHL2, NPHL1		7874126, 8111383, 8099916, 8559248, 9602200	Standard	NM_001272102		Approved	DENTS, XLRH, hClC-K2, hCIC-K2, CLC5, XRN, ClC-5	uc004doq.1	P51795	OTTHUMG00000021514	ENST00000307367.2:c.456C>A	X.37:g.49845313C>A	ENSP00000304257:p.Phe152Leu		Somatic				CLCN5_uc004dor.1_Missense_Mutation_p.F222L|CLCN5_uc004doq.1_Missense_Mutation_p.F222L|CLCN5_uc004dot.1_Missense_Mutation_p.F152L	p.F152L	NM_000084	NP_000075	WXS	Illumina HiSeq	Unspecified	P51795	CLCN5_HUMAN			5	704	+	Ovarian(276;0.236)		152			Helical; (By similarity).		A1L475|B3KPN6|Q5JQD5|Q7RTN8	Missense_Mutation	SNP	ENST00000307367.2	37	c.456C>A	CCDS14328.1	.	.	.	.	.	.	.	.	.	.	C	11.44	1.640328	0.29157	.	.	ENSG00000171365	ENST00000376088;ENST00000450422;ENST00000376091;ENST00000376108;ENST00000307367	D;D;D;D	0.92397	-3.03;-3.03;-3.03;-3.03	5.6	4.55	0.56014	Chloride channel, core (2);	0.162320	0.56097	D	0.000024	T	0.80303	0.4598	N	0.11651	0.15	0.42605	D	0.993295	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.73464	-0.3974	10	0.08179	T	0.78	-7.0929	9.6121	0.39670	0.0:0.8143:0.0:0.1857	.	152;222	P51795;P51795-2	CLCN5_HUMAN;.	L	222;54;222;152;152	ENSP00000365256:F222L;ENSP00000365259:F222L;ENSP00000365276:F152L;ENSP00000304257:F152L	ENSP00000304257:F152L	F	+	3	2	CLCN5	49732053	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.157000	0.31724	2.341000	0.79615	0.594000	0.82650	TTC		0.443	CLCN5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056544.1			5	150	1	0	1.23904e-05	0.000602	1.87565e-05	5	150				
ZCCHC5	203430	broad.mit.edu	37	X	77912683	77912683	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chrX:77912683G>T	ENST00000321110.1	-	2	1530	c.1235C>A	c.(1234-1236)cCc>cAc	p.P412H		NM_152694.2	NP_689907.1	Q8N8U3	ZCHC5_HUMAN	zinc finger, CCHC domain containing 5	412							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.P412H(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(18)|ovary(1)|prostate(1)|skin(1)	37						TGGACTCTCGGGTCCATCTCC	0.527																																							uc004edc.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1234-1236)CCC>CAC		zinc finger, CCHC domain containing 5							146.0	121.0	130.0					X																	77912683		2203	4300	6503	SO:0001583	missense	203430						nucleic acid binding|zinc ion binding	g.chrX:77912683G>T	AK096184	CCDS14440.1	Xq13.3	2008-02-05			ENSG00000179300	ENSG00000179300		"""Zinc fingers, CCHC domain containing"""	22997	protein-coding gene	gene with protein product						15716091, 16093683	Standard	NM_152694		Approved	FLJ38865, Mar3, Mart3, ZHC5	uc004edc.1	Q8N8U3	OTTHUMG00000021892	ENST00000321110.1:c.1235C>A	X.37:g.77912683G>T	ENSP00000316794:p.Pro412His		Somatic					p.P412H	NM_152694	NP_689907	WXS	Illumina HiSeq	Unspecified	Q8N8U3	ZCHC5_HUMAN			2	1531	-			412					B2RMZ0|Q5JQE9	Missense_Mutation	SNP	ENST00000321110.1	37	c.1235C>A	CCDS14440.1	.	.	.	.	.	.	.	.	.	.	G	5.912	0.352299	0.11182	.	.	ENSG00000179300	ENST00000321110	T	0.20463	2.07	3.1	2.2	0.27929	.	.	.	.	.	T	0.14399	0.0348	L	0.29908	0.895	0.09310	N	1	P	0.36990	0.577	B	0.37422	0.249	T	0.17077	-1.0381	9	0.52906	T	0.07	.	4.907	0.13804	0.183:0.0:0.817:0.0	.	412	Q8N8U3	ZCHC5_HUMAN	H	412	ENSP00000316794:P412H	ENSP00000316794:P412H	P	-	2	0	ZCCHC5	77799339	0.006000	0.16342	0.001000	0.08648	0.011000	0.07611	0.827000	0.27421	0.656000	0.30886	0.513000	0.50165	CCC		0.527	ZCCHC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057319.1	NM_152694		13	144	1	0	9.31168e-06	0.001855	1.44958e-05	13	144				
LPAR4	2846	broad.mit.edu	37	X	78010954	78010954	+	Silent	SNP	C	C	G			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chrX:78010954C>G	ENST00000435339.3	+	2	974	c.588C>G	c.(586-588)gtC>gtG	p.V196V		NM_005296.2	NP_005287.1	Q99677	LPAR4_HUMAN	lysophosphatidic acid receptor 4	196					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lipid binding (GO:0008289)	p.V196V(3)		breast(3)|endometrium(3)|kidney(4)|large_intestine(4)|lung(16)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	38						CCAAACGTGTCTGGAAGACTT	0.413																																							uc010nme.2		NA																	3	Substitution - coding silent(3)		lung(3)	ovary(3)	3						c.(586-588)GTC>GTG		lysophosphatidic acid receptor 4							86.0	77.0	80.0					X																	78010954		2202	4299	6501	SO:0001819	synonymous_variant	2846					integral to plasma membrane	lipid binding|purinergic nucleotide receptor activity, G-protein coupled	g.chrX:78010954C>G	U90322	CCDS14441.1	Xq21.1	2012-08-08	2008-04-11	2008-04-11	ENSG00000147145	ENSG00000147145		"""GPCR / Class A : Lysophospholipid receptors : Lysophosphatidic acid"""	4478	protein-coding gene	gene with protein product		300086	"""G protein-coupled receptor 23"""	GPR23			Standard	NM_005296		Approved	P2Y9, P2Y5-LIKE, P2RY9, LPA4	uc010nme.3	Q99677	OTTHUMG00000021895	ENST00000435339.3:c.588C>G	X.37:g.78010954C>G			Somatic					p.V196V	NM_005296	NP_005287	WXS	Illumina HiSeq	Unspecified	Q99677	LPAR4_HUMAN			2	993	+			196			Extracellular (Potential).		B2RAC7|O15132|Q502U9|Q6NSP5	Silent	SNP	ENST00000435339.3	37	c.588C>G	CCDS14441.1																																																																																				0.413	LPAR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057322.2	NM_005296		8	160	0	0	0	0.004482	0	8	160				
GPR174	84636	broad.mit.edu	37	X	78426662	78426662	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chrX:78426662G>T	ENST00000276077.1	+	1	194	c.158G>T	c.(157-159)cGa>cTa	p.R53L		NM_032553.1	NP_115942.1	Q9BXC1	GP174_HUMAN	G protein-coupled receptor 174	53						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.R53L(1)		central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|liver(1)|lung(19)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	38						GAAACAAAACGAGCTGTGATA	0.373										HNSCC(63;0.18)																													uc004edg.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)|central_nervous_system(1)	2						c.(157-159)CGA>CTA		putative purinergic receptor FKSG79							102.0	79.0	87.0					X																	78426662		2202	4300	6502	SO:0001583	missense	84636					integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled	g.chrX:78426662G>T	AF345567	CCDS14443.1	Xq13.3	2012-08-21			ENSG00000147138	ENSG00000147138		"""GPCR / Class A : Orphans"""	30245	protein-coding gene	gene with protein product		300903					Standard	NM_032553		Approved	FKSG79	uc004edg.1	Q9BXC1	OTTHUMG00000021898	ENST00000276077.1:c.158G>T	X.37:g.78426662G>T	ENSP00000276077:p.Arg53Leu	HNSCC(63;0.18)	Somatic					p.R53L	NM_032553	NP_115942	WXS	Illumina HiSeq	Unspecified	Q9BXC1	GP174_HUMAN			1	194	+			53			Cytoplasmic (Potential).		Q2M3F7	Missense_Mutation	SNP	ENST00000276077.1	37	c.158G>T	CCDS14443.1	.	.	.	.	.	.	.	.	.	.	G	15.74	2.923418	0.52653	.	.	ENSG00000147138	ENST00000276077	T	0.36340	1.26	5.2	4.33	0.51752	GPCR, rhodopsin-like superfamily (1);	0.063131	0.64402	D	0.000012	T	0.44726	0.1307	L	0.34521	1.04	0.38314	D	0.943331	D	0.61697	0.99	D	0.69142	0.962	T	0.36432	-0.9748	10	0.28530	T	0.3	.	11.7918	0.52073	0.0879:0.0:0.9121:0.0	.	53	Q9BXC1	GP174_HUMAN	L	53	ENSP00000276077:R53L	ENSP00000276077:R53L	R	+	2	0	GPR174	78313318	1.000000	0.71417	0.959000	0.39883	0.724000	0.41520	3.528000	0.53524	0.975000	0.38392	0.538000	0.68166	CGA		0.373	GPR174-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057327.1	NM_032553		4	40	1	0	2.56e-06	0.000248	4.11663e-06	4	40				
CYLC1	1538	broad.mit.edu	37	X	83128563	83128563	+	Missense_Mutation	SNP	T	T	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chrX:83128563T>A	ENST00000329312.4	+	4	884	c.847T>A	c.(847-849)Tat>Aat	p.Y283N		NM_021118.1	NP_066941.1	P35663	CYLC1_HUMAN	cylicin, basic protein of sperm head cytoskeleton 1	283					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	acrosomal matrix (GO:0043159)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.Y283N(1)|p.Y282N(1)		NS(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|liver(1)|lung(22)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	58						GTATACAAAGTATACAAAGAA	0.313																																							uc004eei.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|skin(1)	5						c.(847-849)TAT>AAT		cylicin, basic protein of sperm head							26.0	27.0	27.0					X																	83128563		2179	4267	6446	SO:0001583	missense	1538				cell differentiation|multicellular organismal development|spermatogenesis	acrosomal matrix|cytoskeletal calyx	structural molecule activity	g.chrX:83128563T>A	Z22780	CCDS35341.1, CCDS75998.1	Xq21.1	2008-07-31			ENSG00000183035	ENSG00000183035			2582	protein-coding gene	gene with protein product	"""cylicin 1"""	300768				7737358, 8354692	Standard	NM_021118		Approved		uc004eei.2	P35663	OTTHUMG00000021922	ENST00000329312.4:c.847T>A	X.37:g.83128563T>A	ENSP00000331556:p.Tyr283Asn		Somatic				CYLC1_uc004eeh.1_Missense_Mutation_p.Y282N	p.Y283N	NM_021118	NP_066941	WXS	Illumina HiSeq	Unspecified	P35663	CYLC1_HUMAN			4	868	+			283			1.		A0AVQ8|Q5JQQ9	Missense_Mutation	SNP	ENST00000329312.4	37	c.847T>A	CCDS35341.1	.	.	.	.	.	.	.	.	.	.	-	6.107	0.387933	0.11581	.	.	ENSG00000183035	ENST00000329312;ENST00000544771	T	0.45668	0.89	4.75	-7.5	0.01351	.	.	.	.	.	T	0.15003	0.0362	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.21143	-1.0254	9	0.15066	T	0.55	6.1819	4.3525	0.11162	0.2037:0.144:0.4979:0.1544	.	283;283	P35663;F5H4V5	CYLC1_HUMAN;.	N	283	ENSP00000331556:Y283N	ENSP00000331556:Y283N	Y	+	1	0	CYLC1	83015219	0.000000	0.05858	0.000000	0.03702	0.161000	0.22273	-3.919000	0.00334	-1.709000	0.01399	-0.186000	0.12905	TAT		0.313	CYLC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057371.1	NM_021118		7	69	0	0	0	0.001984	0	7	69				
SATL1	340562	broad.mit.edu	37	X	84363147	84363147	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chrX:84363147C>A	ENST00000395409.3	-	1	827	c.267G>T	c.(265-267)atG>atT	p.M89I	SATL1_ENST00000332921.5_Missense_Mutation_p.M89I|SATL1_ENST00000509231.1_Missense_Mutation_p.M276I			Q86VE3	SATL1_HUMAN	spermidine/spermine N1-acetyl transferase-like 1	89	Gln-rich.						N-acetyltransferase activity (GO:0008080)	p.M276I(1)		NS(1)|breast(5)|endometrium(2)|large_intestine(3)|lung(13)|skin(3)|stomach(1)|urinary_tract(1)	29						TCCATTGGTTCATGTCCATTT	0.448																																							uc011mqx.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(2)	2						c.(826-828)ATG>ATT		spermidine/spermine N1-acetyl transferase-like 1							286.0	229.0	249.0					X																	84363147		2203	4300	6503	SO:0001583	missense	340562						N-acetyltransferase activity	g.chrX:84363147C>A	BC043215	CCDS35343.1, CCDS35343.2	Xq21	2008-02-05			ENSG00000184788	ENSG00000184788			27992	protein-coding gene	gene with protein product						12477932	Standard	NM_001012980		Approved		uc004een.3	Q86VE3	OTTHUMG00000021931	ENST00000395409.3:c.267G>T	X.37:g.84363147C>A	ENSP00000378804:p.Met89Ile		Somatic				SATL1_uc004een.2_Missense_Mutation_p.M276I	p.M276I	NM_001163541	NP_001157013	WXS	Illumina HiSeq	Unspecified	Q86VE3	SATL1_HUMAN			1	828	-			89			Gln-rich.		A0AVK7|E9PB72|Q5H8V9	Missense_Mutation	SNP	ENST00000395409.3	37	c.828G>T		.	.	.	.	.	.	.	.	.	.	C	0.916	-0.717366	0.03182	.	.	ENSG00000184788	ENST00000395409;ENST00000332921;ENST00000509231	T;T;T	0.44881	0.91;0.91;0.91	2.67	-1.33	0.09172	.	1.805090	0.03383	N	0.200634	T	0.33556	0.0867	L	0.39245	1.2	0.09310	N	1	B;B	0.19817	0.006;0.039	B;B	0.22880	0.003;0.042	T	0.15206	-1.0445	10	0.19147	T	0.46	0.2704	7.7434	0.28853	0.0:0.3291:0.0:0.6709	.	89;276	Q86VE3;E9PB72	SATL1_HUMAN;.	I	89;89;276	ENSP00000378804:M89I;ENSP00000329115:M89I;ENSP00000425421:M276I	ENSP00000329115:M89I	M	-	3	0	SATL1	84249803	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.388000	0.07352	-0.530000	0.06349	-1.181000	0.01715	ATG		0.448	SATL1-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		XM_291339		19	218	1	0	1.55795e-14	0.001882	3.27243e-14	19	218				
GLA	2717	broad.mit.edu	37	X	100662735	100662735	+	Missense_Mutation	SNP	T	T	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chrX:100662735T>A	ENST00000218516.3	-	1	178	c.157A>T	c.(157-159)Aac>Tac	p.N53Y	GLA_ENST00000479445.1_5'UTR|HNRNPH2_ENST00000316594.5_5'Flank|RPL36A-HNRNPH2_ENST00000409170.3_Intron	NM_000169.2	NP_000160.1	P06280	AGAL_HUMAN	galactosidase, alpha	53					glycoside catabolic process (GO:0016139)|glycosphingolipid catabolic process (GO:0046479)|glycosphingolipid metabolic process (GO:0006687)|glycosylceramide catabolic process (GO:0046477)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of nitric-oxide synthase activity (GO:0051001)|oligosaccharide metabolic process (GO:0009311)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)	alpha-galactosidase activity (GO:0004557)|catalytic activity (GO:0003824)|galactoside binding (GO:0016936)|hydrolase activity (GO:0016787)|protein homodimerization activity (GO:0042803)|raffinose alpha-galactosidase activity (GO:0052692)|receptor binding (GO:0005102)	p.N53Y(1)		endometrium(1)|kidney(1)|large_intestine(4)|lung(8)	14						CAGTCAAGGTTGCACATGAAG	0.552																																					Colon(193;776 2816 31189 44474)	Colon(193;776 2816 31189 44474)	uc004ehl.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(157-159)AAC>TAC		alpha-galactosidase A precursor	Agalsidase beta(DB00103)						123.0	120.0	121.0					X																	100662735		2203	4300	6503	SO:0001583	missense	2717				glycoside catabolic process|glycosphingolipid catabolic process|glycosylceramide catabolic process|negative regulation of nitric oxide biosynthetic process|negative regulation of nitric-oxide synthase activity|oligosaccharide metabolic process	extracellular region|Golgi apparatus|lysosome	cation binding|protein homodimerization activity|raffinose alpha-galactosidase activity|receptor binding	g.chrX:100662735T>A	X16889	CCDS14484.1	Xq21.3-q22	2014-09-17			ENSG00000102393	ENSG00000102393	3.2.1.22		4296	protein-coding gene	gene with protein product		300644					Standard	NM_000169		Approved	GALA	uc004ehl.1	P06280	OTTHUMG00000022026	ENST00000218516.3:c.157A>T	X.37:g.100662735T>A	ENSP00000218516:p.Asn53Tyr		Somatic				HNRNPH2_uc004ehm.2_5'Flank|HNRNPH2_uc004ehn.2_5'Flank|GLA_uc011mrj.1_Missense_Mutation_p.N53Y	p.N53Y	NM_000169	NP_000160	WXS	Illumina HiSeq	Unspecified	P06280	AGAL_HUMAN			1	267	-			53					Q6LER7	Missense_Mutation	SNP	ENST00000218516.3	37	c.157A>T	CCDS14484.1	.	.	.	.	.	.	.	.	.	.	T	19.04	3.748930	0.69533	.	.	ENSG00000102393	ENST00000218516	D	0.99824	-6.96	5.54	5.54	0.83059	Aldolase-type TIM barrel (1);Glycoside hydrolase, superfamily (1);	0.235442	0.51477	D	0.000095	D	0.99691	0.9883	.	.	.	0.45852	D	0.998714	D;D	0.76494	0.999;0.999	D;D	0.72338	0.977;0.965	D	0.98258	1.0497	9	0.56958	D	0.05	-20.1672	5.8025	0.18422	0.0:0.091:0.169:0.7399	.	53;53	B4DLT5;P06280	.;AGAL_HUMAN	Y	53	ENSP00000218516:N53Y	ENSP00000218516:N53Y	N	-	1	0	GLA	100549391	1.000000	0.71417	0.963000	0.40424	0.996000	0.88848	2.500000	0.45381	2.053000	0.61076	0.486000	0.48141	AAC		0.552	GLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057540.1			8	141	0	0	0	0.00308	0	8	141				
NXF5	55998	broad.mit.edu	37	X	101096045	101096045	+	Silent	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chrX:101096045C>A	ENST00000361708.2	-	8	782	c.423G>T	c.(421-423)ctG>ctT	p.L141L	NXF5_ENST00000473265.2_Silent_p.L141L|NXF5_ENST00000537026.1_Silent_p.L141L			Q9H1B4	NXF5_HUMAN	nuclear RNA export factor 5	141					mRNA export from nucleus (GO:0006406)|multicellular organismal development (GO:0007275)|RNA transport (GO:0050658)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.L141L(1)		breast(2)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(16)|skin(1)	30						TTCTTCGATTCAGGATTATAT	0.522																																							uc011mrk.1		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)	1						c.(421-423)CTG>CTT		nuclear RNA export factor 5							82.0	78.0	79.0					X																	101096045		2199	4297	6496	SO:0001819	synonymous_variant	55998				mRNA export from nucleus|multicellular organismal development	actin cytoskeleton|cytoplasm|nucleus	nucleocytoplasmic transporter activity|nucleotide binding|protein binding|RNA binding	g.chrX:101096045C>A	AJ277654	CCDS14491.1, CCDS14491.2	Xq22	2008-07-28			ENSG00000126952	ENSG00000126952			8075	protein-coding gene	gene with protein product		300319				11566096	Standard	NM_032946		Approved		uc011mrk.1	Q9H1B4	OTTHUMG00000022042	ENST00000361708.2:c.423G>T	X.37:g.101096045C>A			Somatic				NXF5_uc004eih.1_RNA|NXF5_uc004eii.1_RNA|NXF5_uc004eij.1_RNA|NXF5_uc004eik.1_RNA|NXF5_uc004eil.1_RNA	p.L141L	NM_032946	NP_116564	WXS	Illumina HiSeq	Unspecified	Q9H1B4	NXF5_HUMAN			8	783	-			141					A2RRM0|B1AV82|B1AV83|B1AV84|B1AV85|Q9H1B0|Q9H1B1|Q9H1B2|Q9H1B3	Silent	SNP	ENST00000361708.2	37	c.423G>T																																																																																					0.522	NXF5-201	KNOWN	basic	protein_coding	protein_coding				9	224	1	0	2.17888e-05	0.006214	3.2646e-05	9	224				
NXF5	55998	broad.mit.edu	37	X	101096677	101096677	+	Missense_Mutation	SNP	C	C	T	rs145492861		TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chrX:101096677C>T	ENST00000361708.2	-	5	568	c.209G>A	c.(208-210)aGt>aAt	p.S70N	NXF5_ENST00000473265.2_Missense_Mutation_p.S70N|NXF5_ENST00000537026.1_Missense_Mutation_p.S70N			Q9H1B4	NXF5_HUMAN	nuclear RNA export factor 5	70	RRM.				mRNA export from nucleus (GO:0006406)|multicellular organismal development (GO:0007275)|RNA transport (GO:0050658)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.S70N(1)		breast(2)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(16)|skin(1)	30						AATCTTATAACTGACATCCTT	0.488																																							uc011mrk.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(208-210)AGT>AAT		nuclear RNA export factor 5							163.0	136.0	145.0					X																	101096677		2203	4300	6503	SO:0001583	missense	55998				mRNA export from nucleus|multicellular organismal development	actin cytoskeleton|cytoplasm|nucleus	nucleocytoplasmic transporter activity|nucleotide binding|protein binding|RNA binding	g.chrX:101096677C>T	AJ277654	CCDS14491.1, CCDS14491.2	Xq22	2008-07-28			ENSG00000126952	ENSG00000126952			8075	protein-coding gene	gene with protein product		300319				11566096	Standard	NM_032946		Approved		uc011mrk.1	Q9H1B4	OTTHUMG00000022042	ENST00000361708.2:c.209G>A	X.37:g.101096677C>T	ENSP00000355286:p.Ser70Asn		Somatic				NXF5_uc004eih.1_RNA|NXF5_uc004eii.1_RNA|NXF5_uc004eij.1_RNA|NXF5_uc004eik.1_Intron|NXF5_uc004eil.1_Intron	p.S70N	NM_032946	NP_116564	WXS	Illumina HiSeq	Unspecified	Q9H1B4	NXF5_HUMAN			5	569	-			70			RRM.		A2RRM0|B1AV82|B1AV83|B1AV84|B1AV85|Q9H1B0|Q9H1B1|Q9H1B2|Q9H1B3	Missense_Mutation	SNP	ENST00000361708.2	37	c.209G>A		.	.	.	.	.	.	.	.	.	.	.	1.374	-0.585157	0.03827	.	.	ENSG00000126952	ENST00000537026;ENST00000473265;ENST00000361708	T;T;T	0.59083	0.29;0.29;0.29	2.18	-0.856	0.10697	.	0.289003	0.32901	U	0.005518	T	0.33614	0.0869	N	0.21373	0.66	0.09310	N	1	B	0.14438	0.01	B	0.22386	0.039	T	0.16188	-1.0411	10	0.15066	T	0.55	.	5.3452	0.16006	0.0:0.5009:0.0:0.4991	.	70	A2RRM0	.	N	70	ENSP00000442401:S70N;ENSP00000426978:S70N;ENSP00000355286:S70N	ENSP00000263032:S70N	S	-	2	0	NXF5	100983333	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	-0.648000	0.05391	-0.349000	0.08274	-0.669000	0.03829	AGT		0.488	NXF5-201	KNOWN	basic	protein_coding	protein_coding				6	203	0	0	0	0.00308	0	6	203				
GPRASP1	9737	broad.mit.edu	37	X	101911404	101911404	+	Nonsense_Mutation	SNP	G	G	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chrX:101911404G>T	ENST00000361600.5	+	5	3364	c.2563G>T	c.(2563-2565)Gag>Tag	p.E855*	GPRASP1_ENST00000415986.1_Nonsense_Mutation_p.E855*|GPRASP1_ENST00000444152.1_Nonsense_Mutation_p.E855*|RP4-769N13.7_ENST00000602441.1_RNA|GPRASP1_ENST00000537097.1_Nonsense_Mutation_p.E855*	NM_014710.4	NP_055525.3	Q5JY77	GASP1_HUMAN	G protein-coupled receptor associated sorting protein 1	855	Glu-rich.				endosome to lysosome transport (GO:0008333)|G-protein coupled receptor catabolic process (GO:1990172)	cytoplasm (GO:0005737)		p.E855*(1)		NS(1)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	60						GGCCAGTCCGGAGGCAGTGGC	0.517																																							uc004ejj.3		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)|lung(1)	2						c.(2563-2565)GAG>TAG		G protein-coupled receptor associated sorting							77.0	82.0	81.0					X																	101911404		2203	4300	6503	SO:0001587	stop_gained	9737					cytoplasm	protein binding	g.chrX:101911404G>T	AB007903	CCDS35352.1	Xq22.1	2014-03-21			ENSG00000198932	ENSG00000198932		"""Armadillo repeat containing"""	24834	protein-coding gene	gene with protein product		300417				9455477, 15086532, 16221301	Standard	NM_014710		Approved	GASP, GASP1	uc010nod.3	Q5JY77	OTTHUMG00000022061	ENST00000361600.5:c.2563G>T	X.37:g.101911404G>T	ENSP00000355146:p.Glu855*		Somatic				GPRASP1_uc004eji.3_Nonsense_Mutation_p.E855*|GPRASP1_uc010nod.2_Nonsense_Mutation_p.E855*	p.E855*	NM_014710	NP_055525	WXS	Illumina HiSeq	Unspecified	Q5JY77	GASP1_HUMAN			5	3364	+			855			Glu-rich.		O43168|Q96LA1	Nonsense_Mutation	SNP	ENST00000361600.5	37	c.2563G>T	CCDS35352.1	.	.	.	.	.	.	.	.	.	.	G	46	12.263516	0.99651	.	.	ENSG00000198932	ENST00000415986;ENST00000444152;ENST00000361600;ENST00000537097	.	.	.	2.55	1.67	0.24075	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	.	6.6025	0.22708	0.1623:0.0:0.8377:0.0	.	.	.	.	X	855	.	ENSP00000355146:E855X	E	+	1	0	GPRASP1	101798060	0.007000	0.16637	0.002000	0.10522	0.577000	0.36160	0.797000	0.26999	0.495000	0.27882	0.292000	0.19580	GAG		0.517	GPRASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057634.2	NM_014710		8	143	1	0	0.000274275	0.004482	0.000355182	8	143				
NXF3	56000	broad.mit.edu	37	X	102338133	102338133	+	Silent	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chrX:102338133C>A	ENST00000395065.3	-	6	710	c.609G>T	c.(607-609)gtG>gtT	p.V203V	NXF3_ENST00000425644.1_5'UTR|NXF3_ENST00000425463.2_Silent_p.V114V	NM_022052.1	NP_071335.1	Q9H4D5	NXF3_HUMAN	nuclear RNA export factor 3	203					mRNA export from nucleus (GO:0006406)|poly(A)+ mRNA export from nucleus (GO:0016973)	cytoplasm (GO:0005737)|nuclear RNA export factor complex (GO:0042272)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)	p.V203V(1)		NS(1)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(2)|lung(15)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26						TTATCTGCTCCACCTTTTCTG	0.498																																							uc004eju.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|lung(1)|central_nervous_system(1)	3						c.(607-609)GTG>GTT		nuclear RNA export factor 3							142.0	124.0	130.0					X																	102338133		2203	4300	6503	SO:0001819	synonymous_variant	56000					cytoplasm|nuclear RNA export factor complex	nucleocytoplasmic transporter activity|nucleotide binding|protein binding	g.chrX:102338133C>A	AJ277527	CCDS14503.1	Xq22	2008-02-05			ENSG00000147206	ENSG00000147206			8073	protein-coding gene	gene with protein product		300316				11073998	Standard	NM_022052		Approved		uc004eju.3	Q9H4D5	OTTHUMG00000022088	ENST00000395065.3:c.609G>T	X.37:g.102338133C>A			Somatic				NXF3_uc010noi.1_Silent_p.V53V|NXF3_uc011mrw.1_Silent_p.V203V|NXF3_uc011mrx.1_Silent_p.V114V	p.V203V	NM_022052	NP_071335	WXS	Illumina HiSeq	Unspecified	Q9H4D5	NXF3_HUMAN			6	680	-			203					B4DYS7|Q5H9I1|Q9H1A9	Silent	SNP	ENST00000395065.3	37	c.609G>T	CCDS14503.1	.	.	.	.	.	.	.	.	.	.	C	1.488	-0.555330	0.03967	.	.	ENSG00000147206	ENST00000427570	.	.	.	3.64	2.78	0.32641	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	0.999996	.	.	.	.	.	.	.	.	.	.	.	.	.	-0.5418	6.2469	0.20823	0.0:0.8609:0.0:0.1391	.	.	.	.	X	80	.	.	G	-	1	0	NXF3	102224789	0.003000	0.15002	0.001000	0.08648	0.004000	0.04260	-0.324000	0.07986	0.925000	0.37094	-0.297000	0.09499	GGA		0.498	NXF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057684.1	NM_022052		14	172	1	0	4.7546e-09	0.004007	8.69696e-09	14	172				
TBC1D8B	54885	broad.mit.edu	37	X	106117037	106117037	+	Missense_Mutation	SNP	T	T	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chrX:106117037T>A	ENST00000357242.5	+	21	3379	c.3205T>A	c.(3205-3207)Ttt>Att	p.F1069I	TBC1D8B_ENST00000276175.3_Missense_Mutation_p.F1063I	NM_017752.2	NP_060222.2	Q0IIM8	TBC8B_HUMAN	TBC1 domain family, member 8B (with GRAM domain)	1069							calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)	p.F1069I(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(6)|liver(4)|lung(15)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						TCCTTGTTCCTTTAGGGAGGA	0.458																																							uc004emo.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)|skin(1)	4						c.(3205-3207)TTT>ATT		TBC1 domain family, member 8B (with GRAM domain)							96.0	91.0	92.0					X																	106117037		2203	4300	6503	SO:0001583	missense	54885					intracellular	calcium ion binding|Rab GTPase activator activity	g.chrX:106117037T>A	AK123957	CCDS14522.1, CCDS14523.1	Xq22.3	2013-01-10			ENSG00000133138	ENSG00000133138		"""EF-hand domain containing"""	24715	protein-coding gene	gene with protein product						8889548	Standard	NM_017752		Approved	FLJ20298, RP11-321G1.1	uc004emo.3	Q0IIM8	OTTHUMG00000022152	ENST00000357242.5:c.3205T>A	X.37:g.106117037T>A	ENSP00000349781:p.Phe1069Ile		Somatic				MORC4_uc004emp.3_Intron	p.F1069I	NM_017752	NP_060222	WXS	Illumina HiSeq	Unspecified	Q0IIM8	TBC8B_HUMAN			21	3370	+			1069					B9A6K5|B9A6K6|Q5JRB7|Q6ZVX5|Q9NXE3	Missense_Mutation	SNP	ENST00000357242.5	37	c.3205T>A	CCDS14522.1	.	.	.	.	.	.	.	.	.	.	T	1.939	-0.444033	0.04604	.	.	ENSG00000133138	ENST00000357242;ENST00000276175	T;T	0.07114	3.22;3.22	5.62	4.75	0.60458	.	0.876711	0.09986	N	0.730426	T	0.04634	0.0126	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.44528	-0.9322	10	0.21014	T	0.42	2.417	7.2852	0.26335	0.0:0.7344:0.0:0.2656	.	1069	Q0IIM8	TBC8B_HUMAN	I	1069;1063	ENSP00000349781:F1069I;ENSP00000276175:F1063I	ENSP00000276175:F1063I	F	+	1	0	TBC1D8B	106003693	0.001000	0.12720	0.002000	0.10522	0.037000	0.13140	0.921000	0.28718	1.163000	0.42636	-0.223000	0.12442	TTT		0.458	TBC1D8B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057807.2	NM_017752		7	204	0	0	0	0.001984	0	7	204				
TEX13B	56156	broad.mit.edu	37	X	107224961	107224961	+	Missense_Mutation	SNP	C	C	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chrX:107224961C>T	ENST00000302917.1	-	2	489	c.397G>A	c.(397-399)Gag>Aag	p.E133K		NM_031273.2	NP_112563.1	Q9BXU2	TX13B_HUMAN	testis expressed 13B	133								p.E133K(1)		breast(1)|endometrium(5)|large_intestine(4)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	28						AGGCTGGTCTCGGTTAGCTGC	0.572																																							uc004enn.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(397-399)GAG>AAG		testis expressed 13B							146.0	119.0	128.0					X																	107224961		2199	4300	6499	SO:0001583	missense	56156							g.chrX:107224961C>T	AF285598	CCDS14534.1	Xq23	2008-02-05	2007-03-13		ENSG00000170925	ENSG00000170925			11736	protein-coding gene	gene with protein product		300313	"""testis expressed sequence 13B"""			11279525	Standard	NM_031273		Approved	TSGA5, TGC3B	uc004enn.1	Q9BXU2	OTTHUMG00000022174	ENST00000302917.1:c.397G>A	X.37:g.107224961C>T	ENSP00000303777:p.Glu133Lys		Somatic					p.E133K	NM_031273	NP_112563	WXS	Illumina HiSeq	Unspecified	Q9BXU2	TX13B_HUMAN			2	490	-			133					Q5JYF6	Missense_Mutation	SNP	ENST00000302917.1	37	c.397G>A	CCDS14534.1	.	.	.	.	.	.	.	.	.	.	C	9.709	1.156644	0.21454	.	.	ENSG00000170925	ENST00000302917	.	.	.	3.89	2.13	0.27403	.	.	.	.	.	T	0.13798	0.0334	N	0.02539	-0.55	0.09310	N	1	B	0.18013	0.025	B	0.11329	0.006	T	0.19745	-1.0296	8	0.40728	T	0.16	.	4.6873	0.12764	0.1263:0.2214:0.6523:0.0	.	133	Q9BXU2	TX13B_HUMAN	K	133	.	ENSP00000303777:E133K	E	-	1	0	TEX13B	107111617	0.011000	0.17503	0.002000	0.10522	0.006000	0.05464	0.937000	0.28951	0.435000	0.26365	-0.192000	0.12808	GAG		0.572	TEX13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057857.1			5	135	0	0	0	0.001168	0	5	135				
ATG4A	115201	broad.mit.edu	37	X	107377577	107377577	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chrX:107377577G>T	ENST00000372232.3	+	6	562	c.403G>T	c.(403-405)Ggt>Tgt	p.G135C	ATG4A_ENST00000545696.1_Missense_Mutation_p.G58C|ATG4A_ENST00000345734.3_Missense_Mutation_p.G135C|ATG4A_ENST00000372254.3_Missense_Mutation_p.G111C	NM_052936.3	NP_443168.2	Q8WYN0	ATG4A_HUMAN	autophagy related 4A, cysteine peptidase	135					autophagy (GO:0006914)|protein transport (GO:0015031)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	cysteine-type peptidase activity (GO:0008234)	p.G135C(2)		endometrium(3)|large_intestine(3)|lung(3)|pancreas(1)|prostate(1)	11						AGCACAAATGGGTGTAGGAGA	0.338																																							uc004enr.2		NA																	2	Substitution - Missense(2)		lung(2)	pancreas(1)	1						c.(403-405)GGT>TGT		autophagy-related cysteine endopeptidase 2							145.0	129.0	134.0					X																	107377577		2203	4300	6503	SO:0001583	missense	115201				autophagy|protein transport|proteolysis	cytoplasm	cysteine-type peptidase activity	g.chrX:107377577G>T	AJ320508	CCDS14538.1, CCDS14539.1	Xq22.1-q22.3	2014-02-12	2012-06-06	2005-09-11	ENSG00000101844	ENSG00000101844			16489	protein-coding gene	gene with protein product		300663	"""AUT-like 2, cysteine endopeptidase (S. cerevisiae)"", ""APG4 autophagy 4 homolog A (S. cerevisiae)"", ""ATG4 autophagy related 4 homolog A (S. cerevisiae)"""	AUTL2, APG4A		12446702, 12473658	Standard	NM_052936		Approved		uc004enr.3	Q8WYN0	OTTHUMG00000022176	ENST00000372232.3:c.403G>T	X.37:g.107377577G>T	ENSP00000361306:p.Gly135Cys		Somatic				ATG4A_uc004ent.2_Missense_Mutation_p.G135C|ATG4A_uc004ens.2_Missense_Mutation_p.G51C|ATG4A_uc011msl.1_Missense_Mutation_p.G51C|ATG4A_uc010npi.2_Intron|ATG4A_uc004enu.2_Missense_Mutation_p.G51C	p.G135C	NM_052936	NP_443168	WXS	Illumina HiSeq	Unspecified	Q8WYN0	ATG4A_HUMAN			6	526	+			135					A6NCH2|B2RAZ7|D3DUY0|O95534|Q5JYY9|Q5JYZ0|Q86VE5|Q96KQ0|Q96KQ1	Missense_Mutation	SNP	ENST00000372232.3	37	c.403G>T	CCDS14538.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.0|24.0	4.478534|4.478534	0.84747|0.84747	.|.	.|.	ENSG00000101844|ENSG00000101844	ENST00000372232;ENST00000345734;ENST00000372254;ENST00000457035;ENST00000545696|ENST00000394892	T;T;T;T|.	0.63417|.	0.42;0.68;0.48;-0.04|.	5.85|5.85	5.85|5.85	0.93711|0.93711	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.90501|0.90501	0.7024|0.7024	H|H	0.97390|0.97390	3.995|3.995	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.97110|.	1.0;1.0;1.0|.	D|D	0.93595|0.93595	0.6925|0.6925	10|5	0.72032|.	D|.	0.01|.	-11.6245|-11.6245	19.1093|19.1093	0.93310|0.93310	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	58;135;135|.	F5H3G3;Q8WYN0-2;Q8WYN0|.	.;.;ATG4A_HUMAN|.	C|C	135;135;111;58;58|107	ENSP00000361306:G135C;ENSP00000298131:G135C;ENSP00000361328:G111C;ENSP00000438936:G58C|.	ENSP00000298131:G135C|.	G|W	+|+	1|3	0|0	ATG4A|ATG4A	107264233|107264233	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	9.000000|9.000000	0.93564|0.93564	2.463000|2.463000	0.83235|0.83235	0.513000|0.513000	0.50165|0.50165	GGT|TGG		0.338	ATG4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057860.1	NM_052936		8	92	1	0	3.86212e-05	0.008291	5.52271e-05	8	92				
ALG13	79868	broad.mit.edu	37	X	110925492	110925492	+	Nonsense_Mutation	SNP	C	C	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chrX:110925492C>T	ENST00000394780.3	+	2	226	c.214C>T	c.(214-216)Cag>Tag	p.Q72*	ALG13_ENST00000371979.3_Nonsense_Mutation_p.Q72*|ALG13_ENST00000251943.4_5'UTR	NM_001099922.2|NM_001257231.1	NP_001093392.1|NP_001244160.1	Q9NP73	ALG13_HUMAN	ALG13, UDP-N-acetylglucosaminyltransferase subunit	72	Glycosyltransferase activity.				cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|lipid glycosylation (GO:0030259)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)	carbohydrate binding (GO:0030246)|cysteine-type peptidase activity (GO:0008234)|N-acetylglucosaminyldiphosphodolichol N-acetylglucosaminyltransferase activity (GO:0004577)|poly(A) RNA binding (GO:0044822)	p.Q72*(2)		endometrium(2)|lung(10)|skin(1)	13						AGAAGACATTCAGAAAGCAGA	0.403																																							uc011msy.1		NA																	2	Substitution - Nonsense(2)		lung(2)	lung(1)	1						c.(214-216)CAG>TAG		SubName: Full=Asparagine-linked glycosylation 13 homolog (S. cerevisiae);							115.0	101.0	106.0					X																	110925492		2203	4300	6503	SO:0001587	stop_gained	79868				dolichol-linked oligosaccharide biosynthetic process|lipid glycosylation|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane	carbohydrate binding|N-acetylglucosaminyldiphosphodolichol N-acetylglucosaminyltransferase activity	g.chrX:110925492C>T	AF220051	CCDS14559.1, CCDS55477.1, CCDS59173.1, CCDS76011.1, CCDS76012.1, CCDS76013.1	Xq23	2014-02-24	2013-02-21	2006-11-07	ENSG00000101901	ENSG00000101901	2.4.1.141	"""Tudor domain containing"", ""OTU domain containing"""	30881	protein-coding gene	gene with protein product	"""tudor domain containing 13"", ""N-acetylglucosaminyldiphosphodolichol N-acetylglucosaminyltransferase"""	300776	"""glycosyltransferase 28 domain containing 1"", ""chromosome X open reading frame 45"", ""asparagine-linked glycosylation 13 homolog (S. cerevisiae)"""	GLT28D1, CXorf45		12477932	Standard	NM_018466		Approved	MDS031, YGL047W, FLJ23018, TDRD13	uc011msy.2	Q9NP73	OTTHUMG00000022209	ENST00000394780.3:c.214C>T	X.37:g.110925492C>T	ENSP00000378260:p.Gln72*		Somatic				ALG13_uc004epi.1_Nonsense_Mutation_p.Q72*|ALG13_uc011msw.1_Intron|ALG13_uc011msx.1_5'UTR|ALG13_uc011msz.1_Intron|ALG13_uc011mta.1_5'UTR|ALG13_uc011mtb.1_5'UTR	p.Q72*			WXS	Illumina HiSeq	Unspecified	Q9NP73	ALG13_HUMAN			2	248	+			72					B1AKD6|B1AKM1|B2R5L5|B7Z6J0|B7Z804|B7Z847|B7Z9A8|B7ZAJ1|B7ZB57|Q17RC3|Q5JXY9|Q9H5U8	Nonsense_Mutation	SNP	ENST00000394780.3	37	c.214C>T	CCDS55477.1	.	.	.	.	.	.	.	.	.	.	C	12.42	1.933379	0.34096	.	.	ENSG00000101901	ENST00000371979;ENST00000486353;ENST00000394780	.	.	.	5.55	-0.229	0.13094	.	.	.	.	.	.	.	.	.	.	.	0.19575	N	0.999962	.	.	.	.	.	.	.	.	.	.	0.06236	T	0.91	.	5.4678	0.16652	0.2009:0.4451:0.2843:0.0697	.	.	.	.	X	72	.	ENSP00000361047:Q72X	Q	+	1	0	ALG13	110812148	0.000000	0.05858	0.287000	0.24848	0.018000	0.09664	-0.244000	0.08903	-0.079000	0.12707	-0.192000	0.12808	CAG		0.403	ALG13-011	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000272895.1	NM_018466		9	238	0	0	0	0.006214	0	9	238				
HTR2C	3358	broad.mit.edu	37	X	114141513	114141513	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chrX:114141513C>A	ENST00000276198.1	+	6	1640	c.912C>A	c.(910-912)aaC>aaA	p.N304K	HTR2C_ENST00000371950.3_3'UTR|HTR2C_ENST00000371951.1_Missense_Mutation_p.N304K	NM_000868.2	NP_000859.1	P28335	5HT2C_HUMAN	5-hydroxytryptamine (serotonin) receptor 2C, G protein-coupled	304					behavioral fear response (GO:0001662)|cellular calcium ion homeostasis (GO:0006874)|cGMP biosynthetic process (GO:0006182)|feeding behavior (GO:0007631)|locomotory behavior (GO:0007626)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipase C-activating serotonin receptor signaling pathway (GO:0007208)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol biosynthetic process (GO:0010513)|regulation of appetite (GO:0032098)|regulation of corticotropin-releasing hormone secretion (GO:0043397)|regulation of neurological system process (GO:0031644)|release of sequestered calcium ion into cytosol (GO:0051209)|response to drug (GO:0042493)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding (GO:0071886)|drug binding (GO:0008144)|Gq/11-coupled serotonin receptor activity (GO:0001587)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)	p.N304K(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(15)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	50					Agomelatine(DB06594)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Clomipramine(DB01242)|Clozapine(DB00363)|Cyproheptadine(DB00434)|Desipramine(DB01151)|Dexfenfluramine(DB01191)|Doxepin(DB01142)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Lorcaserin(DB04871)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Pramipexole(DB00413)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Sertindole(DB06144)|Tramadol(DB00193)|Trazodone(DB00656)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)	AGGCTATCAACAATGAAAGAA	0.458																																							uc004epu.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(910-912)AAC>AAA		5-hydroxytryptamine (serotonin) receptor 2C	Chlorprothixene(DB01239)|Clozapine(DB00363)|Dexfenfluramine(DB01191)|Fenfluramine(DB00574)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Sertindole(DB06144)|Thiethylperazine(DB00372)|Tramadol(DB00193)|Ziprasidone(DB00246)						161.0	143.0	149.0					X																	114141513		2203	4300	6503	SO:0001583	missense	3358				cGMP biosynthetic process|ERK1 and ERK2 cascade|feeding behavior|phosphatidylinositol biosynthetic process|release of sequestered calcium ion into cytosol|response to drug|synaptic transmission	cytoplasm|integral to membrane|nucleus|plasma membrane	1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding|drug binding|phosphatidylinositol phospholipase C activity|protein binding|serotonin binding|serotonin receptor activity	g.chrX:114141513C>A		CCDS14564.1, CCDS59174.1	Xq23	2013-12-19	2012-02-03		ENSG00000147246	ENSG00000147246		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5295	protein-coding gene	gene with protein product		312861	"""5-hydroxytryptamine (serotonin) receptor 2C"""	HTR1C		7895773	Standard	NM_000868		Approved	5-HT2C, 5HTR2C	uc004epu.1	P28335	OTTHUMG00000022226	ENST00000276198.1:c.912C>A	X.37:g.114141513C>A	ENSP00000276198:p.Asn304Lys		Somatic				HTR2C_uc010nqc.1_Missense_Mutation_p.N304K|HTR2C_uc004epv.1_3'UTR	p.N304K	NM_000868	NP_000859	WXS	Illumina HiSeq	Unspecified	P28335	5HT2C_HUMAN			6	1640	+			304			Cytoplasmic (By similarity).		B1AMW4|Q5VUF8|Q9NP28	Missense_Mutation	SNP	ENST00000276198.1	37	c.912C>A	CCDS14564.1	.	.	.	.	.	.	.	.	.	.	C	11.23	1.577166	0.28092	.	.	ENSG00000147246	ENST00000276198;ENST00000371951	T;T	0.26373	1.74;1.74	5.14	3.33	0.38152	GPCR, rhodopsin-like superfamily (1);	0.354936	0.31415	N	0.007695	T	0.08758	0.0217	N	0.01522	-0.82	0.80722	D	1	B	0.21147	0.052	B	0.30401	0.115	T	0.17228	-1.0376	10	0.06494	T	0.89	.	9.3835	0.38329	0.0:0.8037:0.0:0.1963	.	304	P28335	5HT2C_HUMAN	K	304	ENSP00000276198:N304K;ENSP00000361019:N304K	ENSP00000276198:N304K	N	+	3	2	HTR2C	114047769	1.000000	0.71417	0.998000	0.56505	0.926000	0.56050	1.818000	0.39012	1.068000	0.40764	0.468000	0.43344	AAC		0.458	HTR2C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057962.1	NM_000868		23	254	1	0	2.89027e-11	0.002299	5.61428e-11	23	254				
HTR2C	3358	broad.mit.edu	37	X	114141543	114141543	+	Silent	SNP	G	G	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chrX:114141543G>A	ENST00000276198.1	+	6	1670	c.942G>A	c.(940-942)ggG>ggA	p.G314G	HTR2C_ENST00000371950.3_3'UTR|HTR2C_ENST00000371951.1_Silent_p.G314G	NM_000868.2	NP_000859.1	P28335	5HT2C_HUMAN	5-hydroxytryptamine (serotonin) receptor 2C, G protein-coupled	314					behavioral fear response (GO:0001662)|cellular calcium ion homeostasis (GO:0006874)|cGMP biosynthetic process (GO:0006182)|feeding behavior (GO:0007631)|locomotory behavior (GO:0007626)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipase C-activating serotonin receptor signaling pathway (GO:0007208)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol biosynthetic process (GO:0010513)|regulation of appetite (GO:0032098)|regulation of corticotropin-releasing hormone secretion (GO:0043397)|regulation of neurological system process (GO:0031644)|release of sequestered calcium ion into cytosol (GO:0051209)|response to drug (GO:0042493)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding (GO:0071886)|drug binding (GO:0008144)|Gq/11-coupled serotonin receptor activity (GO:0001587)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)	p.G314G(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(15)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	50					Agomelatine(DB06594)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Clomipramine(DB01242)|Clozapine(DB00363)|Cyproheptadine(DB00434)|Desipramine(DB01151)|Dexfenfluramine(DB01191)|Doxepin(DB01142)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Lorcaserin(DB04871)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Pramipexole(DB00413)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Sertindole(DB06144)|Tramadol(DB00193)|Trazodone(DB00656)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)	AAGTCCTTGGGATTGTTTTCT	0.433																																							uc004epu.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)	3						c.(940-942)GGG>GGA		5-hydroxytryptamine (serotonin) receptor 2C	Chlorprothixene(DB01239)|Clozapine(DB00363)|Dexfenfluramine(DB01191)|Fenfluramine(DB00574)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Sertindole(DB06144)|Thiethylperazine(DB00372)|Tramadol(DB00193)|Ziprasidone(DB00246)						196.0	171.0	180.0					X																	114141543		2203	4300	6503	SO:0001819	synonymous_variant	3358				cGMP biosynthetic process|ERK1 and ERK2 cascade|feeding behavior|phosphatidylinositol biosynthetic process|release of sequestered calcium ion into cytosol|response to drug|synaptic transmission	cytoplasm|integral to membrane|nucleus|plasma membrane	1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding|drug binding|phosphatidylinositol phospholipase C activity|protein binding|serotonin binding|serotonin receptor activity	g.chrX:114141543G>A		CCDS14564.1, CCDS59174.1	Xq23	2013-12-19	2012-02-03		ENSG00000147246	ENSG00000147246		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5295	protein-coding gene	gene with protein product		312861	"""5-hydroxytryptamine (serotonin) receptor 2C"""	HTR1C		7895773	Standard	NM_000868		Approved	5-HT2C, 5HTR2C	uc004epu.1	P28335	OTTHUMG00000022226	ENST00000276198.1:c.942G>A	X.37:g.114141543G>A			Somatic				HTR2C_uc010nqc.1_Silent_p.G314G|HTR2C_uc004epv.1_3'UTR	p.G314G	NM_000868	NP_000859	WXS	Illumina HiSeq	Unspecified	P28335	5HT2C_HUMAN			6	1670	+			314			Helical; Name=6; (By similarity).		B1AMW4|Q5VUF8|Q9NP28	Silent	SNP	ENST00000276198.1	37	c.942G>A	CCDS14564.1																																																																																				0.433	HTR2C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057962.1	NM_000868		24	290	0	0	0	0.00278	0	24	290				
KLHL13	90293	broad.mit.edu	37	X	117079444	117079444	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chrX:117079444G>T	ENST00000262820.3	-	2	1102	c.193C>A	c.(193-195)Cct>Act	p.P65T	KLHL13_ENST00000541812.1_Missense_Mutation_p.P49T|KLHL13_ENST00000545703.1_Missense_Mutation_p.P23T|KLHL13_ENST00000539496.1_Missense_Mutation_p.P68T|KLHL13_ENST00000540167.1_Missense_Mutation_p.P49T|KLHL13_ENST00000371878.1_Missense_Mutation_p.P14T|KLHL13_ENST00000371876.1_Missense_Mutation_p.P14T|KLHL13_ENST00000371882.1_Missense_Mutation_p.P14T|KLHL13_ENST00000469946.1_Missense_Mutation_p.P14T	NM_033495.3	NP_277030.2	Q9P2N7	KLH13_HUMAN	kelch-like family member 13	65					cytokinesis (GO:0000910)|mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)		p.P65T(1)		NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(9)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	34						ATGCGTGTAGGTCCTGCCTTG	0.458																																							uc004eql.2		NA																	1	Substitution - Missense(1)		lung(1)	kidney(1)|skin(1)	2						c.(193-195)CCT>ACT		kelch-like 13							117.0	95.0	102.0					X																	117079444		2203	4300	6503	SO:0001583	missense	90293				cytokinesis|mitosis|protein ubiquitination	Cul3-RING ubiquitin ligase complex		g.chrX:117079444G>T	AB037730	CCDS14571.1, CCDS55479.1, CCDS55480.1, CCDS55481.1	Xq23-q24	2013-01-30	2013-01-30	2004-02-18	ENSG00000003096	ENSG00000003096		"""Kelch-like"", ""BTB/POZ domain containing"""	22931	protein-coding gene	gene with protein product		300655	"""BTB and kelch domain containing 2, KIAA1309"", ""kelch-like 13 (Drosophila)"""	BKLHD2, KIAA1309		10718198	Standard	NM_033495		Approved	FLJ10262	uc011mtp.2	Q9P2N7	OTTHUMG00000022252	ENST00000262820.3:c.193C>A	X.37:g.117079444G>T	ENSP00000262820:p.Pro65Thr		Somatic				KLHL13_uc004eqk.2_Missense_Mutation_p.P14T|KLHL13_uc011mtn.1_5'UTR|KLHL13_uc011mto.1_Missense_Mutation_p.P59T|KLHL13_uc011mtp.1_Missense_Mutation_p.P67T|KLHL13_uc004eqm.2_Missense_Mutation_p.P14T|KLHL13_uc011mtq.1_Missense_Mutation_p.P49T	p.P65T	NM_033495	NP_277030	WXS	Illumina HiSeq	Unspecified	Q9P2N7	KLH13_HUMAN			2	255	-			65					B3KV78|B3KWM7|B7Z3S9|B7Z5P2|B7Z802|D3DWH6|Q6P2E3|Q96QI7|Q9UDN9	Missense_Mutation	SNP	ENST00000262820.3	37	c.193C>A	CCDS14571.1	.	.	.	.	.	.	.	.	.	.	G	1.663	-0.510922	0.04231	.	.	ENSG00000003096	ENST00000371882;ENST00000371876;ENST00000371878;ENST00000447671;ENST00000541812;ENST00000540167;ENST00000539496;ENST00000262820;ENST00000545703;ENST00000469946;ENST00000453826	T;T;T;T;T;T;T;T;T;T	0.70631	-0.46;-0.46;-0.46;-0.46;-0.38;-0.38;-0.5;-0.48;-0.47;-0.46	5.09	-0.21	0.13176	BTB/POZ fold (2);	0.377654	0.32204	N	0.006440	T	0.40119	0.1104	N	0.08118	0	0.21290	N	0.999737	B;B;B;B	0.11235	0.001;0.004;0.003;0.0	B;B;B;B	0.13407	0.009;0.005;0.005;0.0	T	0.19614	-1.0300	10	0.11485	T	0.65	.	5.1009	0.14759	0.0:0.2926:0.1492:0.5582	.	49;68;59;65	Q9P2N7-3;Q9P2N7-5;Q9P2N7-4;Q9P2N7	.;.;.;KLH13_HUMAN	T	14;14;14;14;49;49;68;65;23;14;14	ENSP00000360949:P14T;ENSP00000360943:P14T;ENSP00000360945:P14T;ENSP00000412640:P14T;ENSP00000444450:P49T;ENSP00000441029:P49T;ENSP00000443191:P68T;ENSP00000262820:P65T;ENSP00000440707:P23T;ENSP00000419803:P14T	ENSP00000262820:P65T	P	-	1	0	KLHL13	116963472	1.000000	0.71417	0.949000	0.38748	0.991000	0.79684	2.230000	0.42999	-0.235000	0.09767	-0.325000	0.08501	CCT		0.458	KLHL13-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_033495		7	126	1	0	0.00198382	0.001984	0.00237301	7	126				
XIAP	331	broad.mit.edu	37	X	123019764	123019764	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chrX:123019764G>T	ENST00000371199.3	+	2	551	c.252G>T	c.(250-252)agG>agT	p.R84S	XIAP_ENST00000468691.1_Intron|XIAP_ENST00000434753.3_Missense_Mutation_p.R84S|XIAP_ENST00000355640.3_Missense_Mutation_p.R84S	NM_001167.3	NP_001158.2	P98170	XIAP_HUMAN	X-linked inhibitor of apoptosis	84					apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|copper ion homeostasis (GO:0055070)|inhibition of cysteine-type endopeptidase activity involved in apoptotic process (GO:1990001)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of neuron apoptotic process (GO:0043524)|neuron apoptotic process (GO:0051402)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of protein linear polyubiquitination (GO:1902530)|positive regulation of protein ubiquitination (GO:0031398)|protein ubiquitination (GO:0016567)|regulation of BMP signaling pathway (GO:0030510)|regulation of cell proliferation (GO:0042127)|regulation of inflammatory response (GO:0050727)|regulation of innate immune response (GO:0045088)|regulation of nucleotide-binding oligomerization domain containing signaling pathway (GO:0070424)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)	cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R84S(1)		breast(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(12)|ovary(3)	25						GAAGACACAGGAAAGTATCCC	0.423									X-linked Lymphoproliferative syndrome																														uc010nqu.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|lung(1)	2						c.(250-252)AGG>AGT		baculoviral IAP repeat-containing protein 4							77.0	72.0	74.0					X																	123019764		2203	4300	6503	SO:0001583	missense	331	X-linked_Lymphoproliferative_syndrome	Familial Cancer Database	XLP, Duncan syndrome, Familial Fatal Epstein-Barr Infection, incl. XLP2	anti-apoptosis|apoptosis|induction of apoptosis by intracellular signals|response to DNA damage stimulus	cytosol	caspase inhibitor activity|ligase activity|protein binding|zinc ion binding	g.chrX:123019764G>T	U45880	CCDS14606.1	Xq25	2014-09-17	2008-03-04	2008-03-04	ENSG00000101966	ENSG00000101966		"""Baculoviral IAP repeat containing"""	592	protein-coding gene	gene with protein product		300079	"""baculoviral IAP repeat-containing 4"""	API3, BIRC4		8552191, 8654366	Standard	NM_001167		Approved	hILP	uc010nqu.3	P98170	OTTHUMG00000022336	ENST00000371199.3:c.252G>T	X.37:g.123019764G>T	ENSP00000360242:p.Arg84Ser		Somatic				XIAP_uc004etx.2_Missense_Mutation_p.R84S|XIAP_uc010nqv.2_Intron	p.R84S	NM_001167	NP_001158	WXS	Illumina HiSeq	Unspecified	P98170	XIAP_HUMAN			2	378	+			84			BIR 1.		D3DTF2|Q9NQ14	Missense_Mutation	SNP	ENST00000371199.3	37	c.252G>T	CCDS14606.1	.	.	.	.	.	.	.	.	.	.	G	17.43	3.388756	0.61956	.	.	ENSG00000101966	ENST00000434753;ENST00000430625;ENST00000371199;ENST00000355640	T;T;T;T	0.72051	-0.62;-0.62;-0.62;-0.62	5.81	3.07	0.35406	Baculoviral inhibition of apoptosis protein repeat (5);	0.067579	0.64402	D	0.000017	T	0.76737	0.4029	M	0.69248	2.105	0.39905	D	0.973957	D	0.55800	0.973	P	0.61003	0.882	T	0.76610	-0.2896	9	.	.	.	-22.9073	7.7709	0.29008	0.3515:0.0:0.6485:0.0	.	84	P98170	XIAP_HUMAN	S	84	ENSP00000395230:R84S;ENSP00000400637:R84S;ENSP00000360242:R84S;ENSP00000347858:R84S	.	R	+	3	2	XIAP	122847445	0.392000	0.25229	1.000000	0.80357	0.992000	0.81027	-0.010000	0.12743	1.227000	0.43598	0.508000	0.49915	AGG		0.423	XIAP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058165.5	NM_001167		8	182	1	0	0.000157383	0.00308	0.000210004	8	182				
DCAF12L2	340578	broad.mit.edu	37	X	125298618	125298618	+	Silent	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chrX:125298618C>A	ENST00000360028.2	-	1	1316	c.1290G>T	c.(1288-1290)gcG>gcT	p.A430A	DCAF12L2_ENST00000538699.1_Silent_p.A430A			Q5VW00	DC122_HUMAN	DDB1 and CUL4 associated factor 12-like 2	430								p.A430A(3)		NS(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(36)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(3)	64						GGGTGTAGAGCGCATTGGGGA	0.597																																							uc004euk.1		NA																	3	Substitution - coding silent(3)		lung(2)|large_intestine(1)	lung(2)|skin(2)|large_intestine(1)|pancreas(1)|ovary(1)	7						c.(1288-1290)GCG>GCT		DDB1 and CUL4 associated factor 12-like 2							117.0	118.0	118.0					X																	125298618		2203	4300	6503	SO:0001819	synonymous_variant	340578							g.chrX:125298618C>A	AL445072	CCDS43991.1	Xq25	2013-01-09	2009-07-17	2009-07-17	ENSG00000198354	ENSG00000198354		"""WD repeat domain containing"""	32950	protein-coding gene	gene with protein product			"""WD repeat domain 40C"""	WDR40C			Standard	NM_001013628		Approved		uc004euk.2	Q5VW00	OTTHUMG00000022348	ENST00000360028.2:c.1290G>T	X.37:g.125298618C>A			Somatic					p.A430A	NM_001013628	NP_001013650	WXS	Illumina HiSeq	Unspecified	Q5VW00	DC122_HUMAN			1	1317	-			430					B2RN42	Silent	SNP	ENST00000360028.2	37	c.1290G>T	CCDS43991.1																																																																																				0.597	DCAF12L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058181.1	NM_001013628		21	197	1	0	1.96292e-10	0.001523	3.76298e-10	21	197				
DCAF12L2	340578	broad.mit.edu	37	X	125298934	125298934	+	Missense_Mutation	SNP	G	G	C			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chrX:125298934G>C	ENST00000360028.2	-	1	1000	c.974C>G	c.(973-975)tCt>tGt	p.S325C	DCAF12L2_ENST00000538699.1_Missense_Mutation_p.S325C			Q5VW00	DC122_HUMAN	DDB1 and CUL4 associated factor 12-like 2	325								p.S325C(2)		NS(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(36)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(3)	64						GTGGGACTGAGAGCCCACAGC	0.627																																							uc004euk.1		NA																	2	Substitution - Missense(2)		lung(2)	lung(2)|skin(2)|large_intestine(1)|pancreas(1)|ovary(1)	7						c.(973-975)TCT>TGT		DDB1 and CUL4 associated factor 12-like 2							80.0	84.0	82.0					X																	125298934		2203	4300	6503	SO:0001583	missense	340578							g.chrX:125298934G>C	AL445072	CCDS43991.1	Xq25	2013-01-09	2009-07-17	2009-07-17	ENSG00000198354	ENSG00000198354		"""WD repeat domain containing"""	32950	protein-coding gene	gene with protein product			"""WD repeat domain 40C"""	WDR40C			Standard	NM_001013628		Approved		uc004euk.2	Q5VW00	OTTHUMG00000022348	ENST00000360028.2:c.974C>G	X.37:g.125298934G>C	ENSP00000353128:p.Ser325Cys		Somatic					p.S325C	NM_001013628	NP_001013650	WXS	Illumina HiSeq	Unspecified	Q5VW00	DC122_HUMAN			1	1001	-			325					B2RN42	Missense_Mutation	SNP	ENST00000360028.2	37	c.974C>G	CCDS43991.1	.	.	.	.	.	.	.	.	.	.	G	6.712	0.500125	0.12762	.	.	ENSG00000198354	ENST00000538699;ENST00000360028	T;T	0.69175	-0.38;-0.38	4.05	4.05	0.47172	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.35838	N	0.002945	T	0.59649	0.2209	L	0.49256	1.55	0.40607	D	0.981634	B	0.15473	0.013	B	0.15870	0.014	T	0.59521	-0.7439	10	0.37606	T	0.19	.	13.1427	0.59444	0.0:0.0:1.0:0.0	.	325	Q5VW00	DC122_HUMAN	C	325	ENSP00000441489:S325C;ENSP00000353128:S325C	ENSP00000353128:S325C	S	-	2	0	DCAF12L2	125126615	1.000000	0.71417	0.891000	0.34965	0.235000	0.25334	8.049000	0.89443	2.263000	0.75096	0.544000	0.68410	TCT		0.627	DCAF12L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058181.1	NM_001013628		9	149	0	0	0	0.004482	0	9	149				
XPNPEP2	7512	broad.mit.edu	37	X	128890485	128890485	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chrX:128890485C>A	ENST00000371106.3	+	14	1513	c.1321C>A	c.(1321-1323)Ctg>Atg	p.L441M		NM_003399.5	NP_003390.4	O43895	XPP2_HUMAN	X-prolyl aminopeptidase (aminopeptidase P) 2, membrane-bound	441						anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)	p.L441M(1)		endometrium(3)|kidney(3)|large_intestine(5)|liver(1)|lung(20)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	37						GAACCGCAAGCTGTCCTCAGA	0.597																																							uc004eut.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1321-1323)CTG>ATG		X-prolyl aminopeptidase 2, membrane-bound							139.0	98.0	112.0					X																	128890485		2203	4300	6503	SO:0001583	missense	7512				cellular process|proteolysis	anchored to membrane|plasma membrane	aminopeptidase activity|metal ion binding|metalloexopeptidase activity	g.chrX:128890485C>A	U90724	CCDS14613.1	Xq25	2008-02-05			ENSG00000122121	ENSG00000122121	3.4.11.9		12823	protein-coding gene	gene with protein product		300145				9375790, 9628831	Standard	NM_003399		Approved		uc004eut.1	O43895	OTTHUMG00000022373	ENST00000371106.3:c.1321C>A	X.37:g.128890485C>A	ENSP00000360147:p.Leu441Met		Somatic					p.L441M	NM_003399	NP_003390	WXS	Illumina HiSeq	Unspecified	O43895	XPP2_HUMAN			14	1565	+			441					A0AV16|O75994	Missense_Mutation	SNP	ENST00000371106.3	37	c.1321C>A	CCDS14613.1	.	.	.	.	.	.	.	.	.	.	C	17.92	3.507027	0.64410	.	.	ENSG00000122121	ENST00000371106	D	0.83335	-1.71	5.62	4.75	0.60458	Peptidase M24, structural domain (3);	0.000000	0.85682	D	0.000000	D	0.90249	0.6951	M	0.83012	2.62	0.41322	D	0.987181	D	0.89917	1.0	D	0.91635	0.999	D	0.90420	0.4416	10	0.87932	D	0	-12.1827	8.9206	0.35610	0.0:0.8229:0.0:0.1771	.	441	O43895	XPP2_HUMAN	M	441	ENSP00000360147:L441M	ENSP00000360147:L441M	L	+	1	2	XPNPEP2	128718166	1.000000	0.71417	0.998000	0.56505	0.989000	0.77384	2.012000	0.40932	1.118000	0.41863	0.600000	0.82982	CTG		0.597	XPNPEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058210.1	NM_003399		8	119	1	0	2.17888e-05	0.006214	3.2646e-05	8	119				
ZDHHC9	51114	broad.mit.edu	37	X	128975899	128975899	+	Missense_Mutation	SNP	T	T	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chrX:128975899T>A	ENST00000357166.6	-	3	414	c.23A>T	c.(22-24)aAg>aTg	p.K8M	ZDHHC9_ENST00000371064.3_Missense_Mutation_p.K8M	NM_016032.3	NP_057116.2	Q9Y397	ZDHC9_HUMAN	zinc finger, DHHC-type containing 9	8					peptidyl-L-cysteine S-palmitoylation (GO:0018230)|protein palmitoylation (GO:0018345)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intrinsic component of Golgi membrane (GO:0031228)|palmitoyltransferase complex (GO:0002178)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|Ras palmitoyltransferase activity (GO:0043849)|zinc ion binding (GO:0008270)	p.K8M(1)		breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(8)|ovary(1)|pancreas(1)	19						TGTCACCTTCTTTCTCACCAC	0.498																																							uc004euv.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(22-24)AAG>ATG		zinc finger, DHHC domain containing 9							173.0	139.0	150.0					X																	128975899		2203	4300	6503	SO:0001583	missense	51114					endoplasmic reticulum membrane|Golgi membrane|integral to membrane	acyltransferase activity|zinc ion binding	g.chrX:128975899T>A	AF151847	CCDS35395.1	Xq26.1	2008-02-05			ENSG00000188706	ENSG00000188706		"""Zinc fingers, DHHC-type"""	18475	protein-coding gene	gene with protein product		300646	"""zinc finger, DHHC-type containing 10"", ""chromosome X open reading frame 11"""	ZDHHC10, CXorf11		10810093	Standard	NM_001008222		Approved	ZNF379, CGI-89, ZNF380	uc004euw.3	Q9Y397	OTTHUMG00000022375	ENST00000357166.6:c.23A>T	X.37:g.128975899T>A	ENSP00000349689:p.Lys8Met		Somatic				ZDHHC9_uc004euw.2_Missense_Mutation_p.K8M|ZDHHC9_uc004eux.1_Missense_Mutation_p.K8M|ZDHHC9_uc004euy.1_Intron	p.K8M	NM_001008222	NP_001008223	WXS	Illumina HiSeq	Unspecified	Q9Y397	ZDHC9_HUMAN			2	392	-			8			Cytoplasmic (Potential).		B4F6G2|D3DTF9|Q59EK4|Q5JSW5|Q8WWS7|Q9BPY4|Q9NSP0|Q9NVL0|Q9NVR6	Missense_Mutation	SNP	ENST00000357166.6	37	c.23A>T	CCDS35395.1	.	.	.	.	.	.	.	.	.	.	T	18.51	3.639170	0.67244	.	.	ENSG00000188706	ENST00000357166;ENST00000371064;ENST00000406492	T;T;T	0.65916	1.0;1.0;-0.18	5.79	4.63	0.57726	.	0.232866	0.36703	N	0.002457	T	0.58018	0.2093	L	0.43923	1.385	0.42171	D	0.99164	D	0.54397	0.966	P	0.46718	0.525	T	0.58719	-0.7587	10	0.52906	T	0.07	-14.3505	10.5528	0.45099	0.0:0.0769:0.0:0.9231	.	8	Q9Y397	ZDHC9_HUMAN	M	8	ENSP00000349689:K8M;ENSP00000360103:K8M;ENSP00000383991:K8M	ENSP00000349689:K8M	K	-	2	0	ZDHHC9	128803580	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.713000	0.54882	0.821000	0.34540	0.486000	0.48141	AAG		0.498	ZDHHC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058213.1	NM_016032		10	219	0	0	0	0.008291	0	10	219				
USP26	83844	broad.mit.edu	37	X	132159958	132159958	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chrX:132159958C>A	ENST00000511190.1	-	6	2760	c.2291G>T	c.(2290-2292)gGc>gTc	p.G764V	USP26_ENST00000406273.1_Missense_Mutation_p.G764V|USP26_ENST00000370832.1_Missense_Mutation_p.G764V	NM_031907.1	NP_114113.1	Q9BXU7	UBP26_HUMAN	ubiquitin specific peptidase 26	764	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)	p.G764V(1)		breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(11)|liver(2)|lung(18)|ovary(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(3)	60	Acute lymphoblastic leukemia(192;0.000127)					CCCCTGGGTGCCTGGCTTTGG	0.463																																					NSCLC(104;342 1621 36940 47097 52632)	NSCLC(104;342 1621 36940 47097 52632)	uc010nrm.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(3)|central_nervous_system(3)|kidney(1)|liver(1)	8						c.(2290-2292)GGC>GTC		ubiquitin-specific protease 26							93.0	95.0	94.0					X																	132159958		2202	4299	6501	SO:0001583	missense	83844				protein deubiquitination|ubiquitin-dependent protein catabolic process	nucleus	cysteine-type peptidase activity|protein binding|ubiquitin thiolesterase activity	g.chrX:132159958C>A	AF285593	CCDS14635.1	Xq26.2	2012-07-13	2005-08-08		ENSG00000134588	ENSG00000134588	3.4.19.12	"""Ubiquitin-specific peptidases"""	13485	protein-coding gene	gene with protein product		300309	"""ubiquitin specific protease 26"""			12838346	Standard	NM_031907		Approved		uc011mvf.2	Q9BXU7	OTTHUMG00000022429	ENST00000511190.1:c.2291G>T	X.37:g.132159958C>A	ENSP00000423390:p.Gly764Val		Somatic				USP26_uc011mvf.1_Missense_Mutation_p.G764V	p.G764V	NM_031907	NP_114113	WXS	Illumina HiSeq	Unspecified	Q9BXU7	UBP26_HUMAN			6	2761	-	Acute lymphoblastic leukemia(192;0.000127)		764					B9WRT6|Q5H9H4	Missense_Mutation	SNP	ENST00000511190.1	37	c.2291G>T	CCDS14635.1	.	.	.	.	.	.	.	.	.	.	C	7.445	0.641582	0.14451	.	.	ENSG00000134588	ENST00000370832;ENST00000511190;ENST00000406273	T;T;T	0.54279	0.58;0.58;0.58	4.26	-8.53	0.00916	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	2.729110	0.01382	N	0.012968	T	0.44603	0.1301	L	0.36672	1.1	0.09310	N	1	B	0.31910	0.346	B	0.40329	0.326	T	0.47275	-0.9130	10	0.30078	T	0.28	1.9129	8.4312	0.32759	0.468:0.4132:0.0:0.1188	.	764	Q9BXU7	UBP26_HUMAN	V	764	ENSP00000359869:G764V;ENSP00000423390:G764V;ENSP00000384360:G764V	ENSP00000359869:G764V	G	-	2	0	USP26	131987624	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-4.707000	0.00196	-3.094000	0.00246	-1.021000	0.02439	GGC		0.463	USP26-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359441.1	NM_031907		8	218	1	0	1.06961e-07	0.00308	1.84866e-07	8	218				
GPC4	2239	broad.mit.edu	37	X	132438835	132438835	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chrX:132438835G>T	ENST00000370828.3	-	7	1734	c.1210C>A	c.(1210-1212)Ccg>Acg	p.P404T	GPC4_ENST00000535467.1_Missense_Mutation_p.P334T	NM_001448.2	NP_001439.2	O75487	GPC4_HUMAN	glypican 4	404					anatomical structure morphogenesis (GO:0009653)|carbohydrate metabolic process (GO:0005975)|cell proliferation (GO:0008283)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)		p.P404T(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(16)|skin(1)|upper_aerodigestive_tract(1)	28	Acute lymphoblastic leukemia(192;0.000127)					ACGTTGCTCGGAAGGGAGGAC	0.428																																							uc004exc.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1210-1212)CCG>ACG		glypican 4 precursor							252.0	197.0	216.0					X																	132438835		2203	4300	6503	SO:0001583	missense	2239				anatomical structure morphogenesis|cell proliferation	anchored to membrane|external side of plasma membrane|extracellular space|insoluble fraction|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding	g.chrX:132438835G>T	AF030186	CCDS14637.1	Xq26.1	2008-02-05			ENSG00000076716	ENSG00000076716		"""Proteoglycans / Cell Surface : Glypicans"""	4452	protein-coding gene	gene with protein product	"""glypican proteoglycan 4"""	300168				9787072	Standard	NM_001448		Approved	K-glypican	uc004exc.1	O75487	OTTHUMG00000022434	ENST00000370828.3:c.1210C>A	X.37:g.132438835G>T	ENSP00000359864:p.Pro404Thr		Somatic				GPC4_uc011mvg.1_Missense_Mutation_p.P334T	p.P404T	NM_001448	NP_001439	WXS	Illumina HiSeq	Unspecified	O75487	GPC4_HUMAN			7	1422	-	Acute lymphoblastic leukemia(192;0.000127)		404					B2R6J7|B4E2C0|Q6ZMA6|Q96L43|Q9NU08|Q9UJN1|Q9UPD9	Missense_Mutation	SNP	ENST00000370828.3	37	c.1210C>A	CCDS14637.1	.	.	.	.	.	.	.	.	.	.	G	28.2	4.903200	0.92035	.	.	ENSG00000076716	ENST00000370828;ENST00000536418;ENST00000535467	T;T	0.57107	0.42;0.42	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	T	0.75693	0.3884	M	0.89715	3.055	0.80722	D	1	D	0.54397	0.966	P	0.61132	0.884	T	0.82224	-0.0563	10	0.87932	D	0	-0.0027	16.6061	0.84830	0.0:0.0:1.0:0.0	.	404	O75487	GPC4_HUMAN	T	404;398;334	ENSP00000359864:P404T;ENSP00000444959:P334T	ENSP00000359864:P404T	P	-	1	0	GPC4	132266501	1.000000	0.71417	0.815000	0.32552	0.990000	0.78478	9.395000	0.97266	2.122000	0.65172	0.594000	0.82650	CCG		0.428	GPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058338.1	NM_001448		16	232	1	0	1.99824e-07	0.00499	3.4001e-07	16	232				
GPR112	139378	broad.mit.edu	37	X	135482265	135482265	+	Silent	SNP	A	A	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chrX:135482265A>T	ENST00000394143.1	+	21	8856	c.8565A>T	c.(8563-8565)ctA>ctT	p.L2855L	GPR112_ENST00000287534.4_Silent_p.L2608L|GPR112_ENST00000370652.1_Silent_p.L2855L|GPR112_ENST00000412101.1_Silent_p.L2650L|GPR112_ENST00000394141.1_Silent_p.L2650L	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	2855					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.L2855L(1)		NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					AATTTTGTCTAGTTGGTTGGG	0.338																																							uc004ezu.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(5)|large_intestine(2)|skin(2)|lung(1)|breast(1)|pancreas(1)	12						c.(8563-8565)CTA>CTT		G-protein coupled receptor 112							138.0	122.0	127.0					X																	135482265		2203	4300	6503	SO:0001819	synonymous_variant	139378				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chrX:135482265A>T	AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.8565A>T	X.37:g.135482265A>T			Somatic				GPR112_uc010nsb.1_Silent_p.L2650L	p.L2855L	NM_153834	NP_722576	WXS	Illumina HiSeq	Unspecified	Q8IZF6	GP112_HUMAN			21	8856	+	Acute lymphoblastic leukemia(192;0.000127)		2855			Helical; Name=4; (Potential).		A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Silent	SNP	ENST00000394143.1	37	c.8565A>T	CCDS35409.1																																																																																				0.338	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000286639.1			11	164	0	0	0	0.000978	0	11	164				
SLITRK4	139065	broad.mit.edu	37	X	142717341	142717341	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chrX:142717341C>A	ENST00000381779.4	-	2	1809	c.1584G>T	c.(1582-1584)ttG>ttT	p.L528F	SLITRK4_ENST00000356928.1_Missense_Mutation_p.L528F|SLITRK4_ENST00000338017.4_Missense_Mutation_p.L528F	NM_001184749.2|NM_001184750.1|NM_173078.4	NP_001171678.1|NP_001171679.1|NP_775101.1	Q8IW52	SLIK4_HUMAN	SLIT and NTRK-like family, member 4	528						integral component of membrane (GO:0016021)		p.L528F(1)		autonomic_ganglia(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(27)|ovary(2)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	60	Acute lymphoblastic leukemia(192;6.56e-05)					GGTTGCCCTCCAAGTCAATCT	0.478																																							uc004fbx.2		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|large_intestine(1)	2						c.(1582-1584)TTG>TTT		slit and trk like 4 protein precursor							145.0	141.0	143.0					X																	142717341		2203	4300	6503	SO:0001583	missense	139065					integral to membrane		g.chrX:142717341C>A	BC040986	CCDS14679.1	Xq27.3	2004-06-23			ENSG00000179542	ENSG00000179542			23502	protein-coding gene	gene with protein product		300562				14557068	Standard	NM_001184749		Approved	DKFZp547M2010	uc004fby.3	Q8IW52	OTTHUMG00000022580	ENST00000381779.4:c.1584G>T	X.37:g.142717341C>A	ENSP00000371198:p.Leu528Phe		Somatic				SLITRK4_uc004fby.2_Missense_Mutation_p.L528F	p.L528F	NM_173078	NP_775101	WXS	Illumina HiSeq	Unspecified	Q8IW52	SLIK4_HUMAN			2	1960	-	Acute lymphoblastic leukemia(192;6.56e-05)		528			Extracellular (Potential).		Q5JXG3|Q8TCM8|Q96DL3	Missense_Mutation	SNP	ENST00000381779.4	37	c.1584G>T	CCDS14679.1	.	.	.	.	.	.	.	.	.	.	C	12.62	1.991276	0.35131	.	.	ENSG00000179542	ENST00000381779;ENST00000356928;ENST00000338017	T;T;T	0.61392	0.11;0.11;0.11	5.41	1.36	0.22044	.	0.000000	0.64402	U	0.000011	T	0.68888	0.3050	M	0.72479	2.2	0.58432	D	0.999994	D	0.89917	1.0	D	0.97110	1.0	T	0.66444	-0.5922	10	0.87932	D	0	-5.1003	6.3978	0.21622	0.128:0.6375:0.0:0.2345	.	528	Q8IW52	SLIK4_HUMAN	F	528	ENSP00000371198:L528F;ENSP00000349400:L528F;ENSP00000336627:L528F	ENSP00000336627:L528F	L	-	3	2	SLITRK4	142545007	0.697000	0.27767	0.994000	0.49952	0.980000	0.70556	-0.086000	0.11233	0.192000	0.20272	-0.192000	0.12808	TTG		0.478	SLITRK4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058617.1	NM_173078		11	274	1	0	3.07112e-06	0.000978	4.88486e-06	11	274				
SLITRK2	84631	broad.mit.edu	37	X	144904119	144904119	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chrX:144904119C>A	ENST00000370490.1	+	1	4431	c.176C>A	c.(175-177)cCc>cAc	p.P59H	SLITRK2_ENST00000428560.2_Missense_Mutation_p.P59H|SLITRK2_ENST00000434188.2_Missense_Mutation_p.P59H|SLITRK2_ENST00000413937.2_Missense_Mutation_p.P59H|SLITRK2_ENST00000447897.2_Missense_Mutation_p.P59H			Q9H156	SLIK2_HUMAN	SLIT and NTRK-like family, member 2	59					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)		p.P59H(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(17)|lung(40)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	86	Acute lymphoblastic leukemia(192;6.56e-05)					CTGCTCCAGCCCCCCCAGTAT	0.428																																							uc004fcd.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|central_nervous_system(1)|pancreas(1)	7						c.(175-177)CCC>CAC		SLIT and NTRK-like family, member 2 precursor							93.0	83.0	86.0					X																	144904119		2203	4300	6503	SO:0001583	missense	84631					integral to membrane		g.chrX:144904119C>A	Y19205	CCDS14680.1	Xq27.3	2008-02-05	2004-03-11		ENSG00000185985	ENSG00000185985			13449	protein-coding gene	gene with protein product		300561	"""slit-like 1 (Drosophila)"""	SLITL1		11347906, 14557068	Standard	NM_032539		Approved	KIAA1854, CXorf2	uc011mwr.2	Q9H156	OTTHUMG00000022595	ENST00000370490.1:c.176C>A	X.37:g.144904119C>A	ENSP00000359521:p.Pro59His		Somatic				SLITRK2_uc010nsp.2_Missense_Mutation_p.P59H|SLITRK2_uc010nso.2_Missense_Mutation_p.P59H|SLITRK2_uc011mwq.1_Missense_Mutation_p.P59H|SLITRK2_uc011mwr.1_Missense_Mutation_p.P59H|SLITRK2_uc011mws.1_Missense_Mutation_p.P59H|SLITRK2_uc004fcg.2_Missense_Mutation_p.P59H|SLITRK2_uc011mwt.1_Missense_Mutation_p.P59H	p.P59H	NM_032539	NP_115928	WXS	Illumina HiSeq	Unspecified	Q9H156	SLIK2_HUMAN			5	1166	+	Acute lymphoblastic leukemia(192;6.56e-05)		59			Extracellular (Potential).		A8K117|Q2KHN3|Q5JXB1|Q8NBC7|Q96JH3	Missense_Mutation	SNP	ENST00000370490.1	37	c.176C>A	CCDS14680.1	.	.	.	.	.	.	.	.	.	.	C	17.89	3.499303	0.64298	.	.	ENSG00000185985	ENST00000335565;ENST00000447897;ENST00000370490;ENST00000434188;ENST00000413937;ENST00000428560	T;T;T;T;T;T	0.51574	0.7;0.7;0.7;0.7;0.7;0.7	5.01	5.01	0.66863	Leucine-rich repeat-containing N-terminal (1);	0.063171	0.64402	U	0.000006	T	0.63129	0.2485	L	0.54323	1.7	0.58432	D	0.999992	D	0.89917	1.0	D	0.70487	0.969	T	0.65857	-0.6066	10	0.62326	D	0.03	-7.0926	14.7597	0.69596	0.0:1.0:0.0:0.0	.	59	Q9H156	SLIK2_HUMAN	H	59	ENSP00000334374:P59H;ENSP00000411681:P59H;ENSP00000359521:P59H;ENSP00000397015:P59H;ENSP00000407347:P59H;ENSP00000412010:P59H	ENSP00000334374:P59H	P	+	2	0	SLITRK2	144711811	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	7.818000	0.86416	2.066000	0.61787	0.529000	0.55759	CCC		0.428	SLITRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058633.1	NM_032539		8	95	1	0	0.00307968	0.00308	0.00362461	8	95				
MAGEA8	4107	broad.mit.edu	37	X	149013858	149013858	+	Missense_Mutation	SNP	G	G	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chrX:149013858G>A	ENST00000542674.1	+	3	1333	c.812G>A	c.(811-813)cGc>cAc	p.R271H	MAGEA8_ENST00000535454.1_Missense_Mutation_p.R271H|MAGEA8_ENST00000286482.1_Missense_Mutation_p.R271H	NM_001166401.1	NP_001159873.1	P43361	MAGA8_HUMAN	melanoma antigen family A, 8	271	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.							p.R271H(1)		NS(1)|breast(2)|endometrium(2)|large_intestine(2)|lung(12)|upper_aerodigestive_tract(1)	20	Acute lymphoblastic leukemia(192;6.56e-05)					GATCCTGTGCGCTACGAGTTC	0.567																																							uc004fdw.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(811-813)CGC>CAC		melanoma antigen family A, 8							119.0	113.0	115.0					X																	149013858		2203	4298	6501	SO:0001583	missense	4107							g.chrX:149013858G>A		CCDS14692.1	Xq28	2009-03-13			ENSG00000156009	ENSG00000156009			6806	protein-coding gene	gene with protein product	"""MAGE-8 antigen"", ""cancer/testis antigen family 1, member 8"""	300341		MAGE8		8575766	Standard	NM_005364		Approved	MGC2182, CT1.8	uc004fdw.2	P43361	OTTHUMG00000022635	ENST00000542674.1:c.812G>A	X.37:g.149013858G>A	ENSP00000443776:p.Arg271His		Somatic					p.R271H	NM_005364	NP_005355	WXS	Illumina HiSeq	Unspecified	P43361	MAGA8_HUMAN			3	1027	+	Acute lymphoblastic leukemia(192;6.56e-05)		271			MAGE.		Q9BUN9	Missense_Mutation	SNP	ENST00000542674.1	37	c.812G>A	CCDS14692.1	.	.	.	.	.	.	.	.	.	.	.	10.06	1.246859	0.22796	.	.	ENSG00000156009	ENST00000535454;ENST00000542674;ENST00000286482	T;T;T	0.04917	3.53;3.53;3.53	1.0	-0.859	0.10685	.	0.808128	0.11189	N	0.590138	T	0.05640	0.0148	L	0.58101	1.795	0.09310	N	1	B	0.16603	0.018	B	0.12156	0.007	T	0.47661	-0.9100	10	0.13108	T	0.6	.	3.4059	0.07340	0.5328:0.0:0.4672:0.0	.	271	P43361	MAGA8_HUMAN	H	271	ENSP00000438293:R271H;ENSP00000443776:R271H;ENSP00000286482:R271H	ENSP00000286482:R271H	R	+	2	0	MAGEA8	148774516	0.000000	0.05858	0.023000	0.16930	0.602000	0.36980	-0.564000	0.05936	-0.376000	0.07943	0.190000	0.17370	CGC		0.567	MAGEA8-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058728.1	NM_005364		11	240	0	0	0	0.001855	0	11	240				
MAGEA1	4100	broad.mit.edu	37	X	152482377	152482378	+	Nonsense_Mutation	DNP	CC	CC	AA			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chrX:152482377_152482378CC>AA	ENST00000356661.5	-	3	851_852	c.633_634GG>TT	c.(631-636)gaGGag>gaTTag	p.211_212EE>D*		NM_004988.4	NP_004979.3	P43355	MAGA1_HUMAN	melanoma antigen family A, 1 (directs expression of antigen MZ2-E)	211	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.				negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	histone deacetylase binding (GO:0042826)	p.E211_E212>D*(1)		breast(1)|central_nervous_system(7)|kidney(2)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CAGATTTCCTCCTCAGGAGCAT	0.545																																							uc004fhf.2		NA																	1	Complex - compound substitution(1)		lung(1)	central_nervous_system(7)|ovary(1)|lung(1)|breast(1)	10						c.(631-636)GAGGAG>GATTAG		melanoma antigen family A, 1																																				SO:0001587	stop_gained	4100					cytoplasm|plasma membrane		g.chrX:152482377_152482378CC>AA		CCDS76051.1	Xq28	2010-05-26			ENSG00000198681	ENSG00000198681			6796	protein-coding gene	gene with protein product	"""melanoma-associated antigen 1"", ""melanoma-associated antigen MZ2-E"", ""melanoma antigen MAGE-1"", ""melanoma antigen family A 1"", ""cancer/testis antigen family 1, member 1"""	300016		MAGE1		1840703	Standard	NM_004988		Approved	MGC9326, CT1.1	uc004fhf.2	P43355	OTTHUMG00000024192	ENST00000356661.5:c.633_634delinsAA	X.37:g.152482377_152482378delinsAA	ENSP00000349085:p.E211_E212delinsD*		Somatic					p.211_212EE>D*	NM_004988	NP_004979	WXS	Illumina HiSeq	Unspecified	P43355	MAGA1_HUMAN			3	853_854	-	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)		211_212			MAGE.		B2RC81|O00346	Nonsense_Mutation	DNP	ENST00000356661.5	37	c.633_634GG>TT	CCDS14720.1																																																																																				0.545	MAGEA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060940.1	NM_004988		6	162	0	0	0	0.004672	0	6	162				
ATP2B3	492	broad.mit.edu	37	X	152807850	152807850	+	Missense_Mutation	SNP	C	C	G	rs375375490		TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chrX:152807850C>G	ENST00000349466.2	+	5	1060	c.734C>G	c.(733-735)aCg>aGg	p.T245R	ATP2B3_ENST00000370181.2_Missense_Mutation_p.T245R|ATP2B3_ENST00000359149.3_Missense_Mutation_p.T245R|ATP2B3_ENST00000263519.4_Missense_Mutation_p.T245R|ATP2B3_ENST00000370186.1_Missense_Mutation_p.T245R|ATP2B3_ENST00000393842.1_Missense_Mutation_p.T245R			Q16720	AT2B3_HUMAN	ATPase, Ca++ transporting, plasma membrane 3	245					blood coagulation (GO:0007596)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)	p.T245R(4)		NS(2)|breast(5)|endometrium(7)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|skin(3)	50	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					AGCTCCCTGACGGGCGAGTCT	0.647																																							uc004fht.1		NA																	4	Substitution - Missense(4)		lung(4)	pancreas(1)	1						c.(733-735)ACG>AGG		plasma membrane calcium ATPase 3 isoform 3b							95.0	68.0	77.0					X																	152807850		2203	4300	6503	SO:0001583	missense	492				ATP biosynthetic process|platelet activation	integral to membrane|plasma membrane	ATP binding|calcium-transporting ATPase activity|calmodulin binding|metal ion binding	g.chrX:152807850C>G	U60414	CCDS14722.1, CCDS35440.1	Xq28	2014-07-18			ENSG00000067842	ENSG00000067842	3.6.3.8	"""ATPases / P-type"""	816	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 3"", ""cilia and flagella associated protein 39"""	300014	"""spinocerebellar ataxia, X-linked 1"", ""cerebellar ataxia 2 (X-linked)"""	SCAX1, CLA2		8187550, 22912398	Standard	NM_021949		Approved	PMCA3, CFAP39	uc004fht.1	Q16720	OTTHUMG00000024202	ENST00000349466.2:c.734C>G	X.37:g.152807850C>G	ENSP00000343886:p.Thr245Arg		Somatic				ATP2B3_uc004fhs.1_Missense_Mutation_p.T245R	p.T245R	NM_001001344	NP_001001344	WXS	Illumina HiSeq	Unspecified	Q16720	AT2B3_HUMAN			4	860	+	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)		245			Cytoplasmic (Potential).		B7WNR8|B7WNY5|Q12995|Q16858	Missense_Mutation	SNP	ENST00000349466.2	37	c.734C>G	CCDS35440.1	.	.	.	.	.	.	.	.	.	.	C	28.6	4.936362	0.92458	.	.	ENSG00000067842	ENST00000370186;ENST00000349466;ENST00000393842;ENST00000359149;ENST00000263519;ENST00000370181	D;D;D;D;D;D	0.94687	-3.49;-3.49;-3.49;-3.49;-3.49;-3.49	5.45	5.45	0.79879	ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.054381	0.64402	D	0.000001	D	0.98566	0.9521	H	0.98849	4.35	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99830	1.1053	10	0.87932	D	0	-6.3278	16.9818	0.86329	0.0:1.0:0.0:0.0	.	245;245	Q16720;Q16720-2	AT2B3_HUMAN;.	R	245	ENSP00000359205:T245R;ENSP00000343886:T245R;ENSP00000377425:T245R;ENSP00000352062:T245R;ENSP00000263519:T245R;ENSP00000359200:T245R	ENSP00000263519:T245R	T	+	2	0	ATP2B3	152461044	1.000000	0.71417	0.937000	0.37676	0.772000	0.43724	7.776000	0.85560	2.273000	0.75805	0.513000	0.50165	ACG		0.647	ATP2B3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060957.1	NM_021949		6	58	0	0	0	0.001168	0	6	58				
L1CAM	3897	broad.mit.edu	37	X	153141232	153141232	+	Silent	SNP	G	G	A			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chrX:153141232G>A	ENST00000370060.1	-	2	249	c.60C>T	c.(58-60)atC>atT	p.I20I	L1CAM_ENST00000370057.3_Silent_p.I20I|L1CAM_ENST00000370055.1_Silent_p.I20I|L1CAM_ENST00000361981.3_Silent_p.I20I|L1CAM_ENST00000538883.1_Silent_p.I20I|L1CAM_ENST00000361699.4_Silent_p.I20I|L1CAM_ENST00000543994.1_Silent_p.I20I	NM_001278116.1	NP_001265045.1	P32004	L1CAM_HUMAN	L1 cell adhesion molecule	20					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cell surface receptor signaling pathway (GO:0007166)|cell-cell adhesion mediated by integrin (GO:0033631)|chemotaxis (GO:0006935)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|homotypic cell-cell adhesion (GO:0034109)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|nervous system development (GO:0007399)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	sialic acid binding (GO:0033691)	p.I20I(1)		NS(1)|breast(4)|central_nervous_system(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|liver(1)|lung(31)|ovary(13)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	81	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CGGGGATCTGGATAAGCAGGC	0.642																																							uc004fjb.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(8)|central_nervous_system(1)	9						c.(58-60)ATC>ATT		L1 cell adhesion molecule isoform 1 precursor							75.0	60.0	65.0					X																	153141232		2203	4300	6503	SO:0001819	synonymous_variant	3897				axon guidance|blood coagulation|cell death|leukocyte migration	integral to membrane		g.chrX:153141232G>A	M74387	CCDS14733.1, CCDS14734.1, CCDS48192.1	Xq28	2014-09-17	2003-04-07		ENSG00000198910	ENSG00000198910		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	6470	protein-coding gene	gene with protein product		308840	"""antigen identified by monoclonal antibody R1"""	HSAS1, SPG1, HSAS, MASA, MIC5, S10			Standard	NM_001278116		Approved	CD171	uc031tks.1	P32004	OTTHUMG00000024221	ENST00000370060.1:c.60C>T	X.37:g.153141232G>A			Somatic				L1CAM_uc004fjc.2_Silent_p.I20I|L1CAM_uc010nuo.2_Silent_p.I20I|L1CAM_uc004fje.1_Silent_p.I20I	p.I20I	NM_000425	NP_000416	WXS	Illumina HiSeq	Unspecified	P32004	L1CAM_HUMAN			1	168	-	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)		20			Extracellular (Potential).		A0AV65|A4ZYW4|B2RMU7|G3XAF4|Q8TA87	Silent	SNP	ENST00000370060.1	37	c.60C>T	CCDS14733.1																																																																																				0.642	L1CAM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061094.2	NM_024003		3	42	0	0	0	0.004672	0	3	42				
OPN1MW2	728458	broad.mit.edu	37	X	153496193	153496193	+	Silent	SNP	G	G	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chrX:153496193G>T	ENST00000369929.4	+	5	981	c.921G>T	c.(919-921)ccG>ccT	p.P307P		NM_001048181.2	NP_001041646.1	P04001	OPSG_HUMAN	opsin 1 (cone pigments), medium-wave-sensitive 2	307					G-protein coupled receptor signaling pathway (GO:0007186)|phototransduction, visible light (GO:0007603)|positive regulation of cytokinesis (GO:0032467)|protein-chromophore linkage (GO:0018298)|retinoid metabolic process (GO:0001523)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|photoreceptor activity (GO:0009881)	p.P307P(1)		haematopoietic_and_lymphoid_tissue(1)|lung(1)|prostate(1)|stomach(2)|urinary_tract(1)	6	all_cancers(53;1.83e-16)|all_epithelial(53;2.73e-10)|all_lung(58;6.39e-07)|Lung NSC(58;8.37e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CTGCCCTGCCGGCCTTCTTTG	0.537																																							uc004fkd.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(919-921)CCG>CCT		opsin 1 (cone pigments), medium-wave-sensitive							72.0	53.0	59.0					X																	153496193		2081	3730	5811	SO:0001819	synonymous_variant	2652				phototransduction|protein-chromophore linkage|visual perception	integral to plasma membrane	G-protein coupled receptor activity|photoreceptor activity	g.chrX:153496193G>T		CCDS35447.1	Xq28	2012-08-08			ENSG00000166160	ENSG00000166160		"""GPCR / Class A : Opsin receptors"""	26952	protein-coding gene	gene with protein product							Standard	NM_001048181		Approved			P04001	OTTHUMG00000024231	ENST00000369929.4:c.921G>T	X.37:g.153496193G>T			Somatic					p.P307P	NM_000513	NP_000504	WXS	Illumina HiSeq	Unspecified	P04001	OPSG_HUMAN			5	1003	+	all_cancers(53;1.83e-16)|all_epithelial(53;2.73e-10)|all_lung(58;6.39e-07)|Lung NSC(58;8.37e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)		307			Helical; Name=7; (Potential).			Silent	SNP	ENST00000369929.4	37	c.921G>T	CCDS35447.1																																																																																				0.537	OPN1MW2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061149.2	NM_001048181		12	81	1	0	1.00905e-13	0.008871	2.06033e-13	12	81				
TKTL1	8277	broad.mit.edu	37	X	153551614	153551614	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chrX:153551614G>T	ENST00000369915.3	+	9	1437	c.1248G>T	c.(1246-1248)aaG>aaT	p.K416N	TKTL1_ENST00000369912.2_Missense_Mutation_p.K360N|TKTL1_ENST00000217905.7_Missense_Mutation_p.K156N	NM_001145933.1|NM_012253.3	NP_001139405.1|NP_036385.3	P51854	TKTL1_HUMAN	transketolase-like 1	416					glucose catabolic process (GO:0006007)|thiamine metabolic process (GO:0006772)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|transketolase activity (GO:0004802)	p.K416N(1)		NS(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(5)|prostate(1)|skin(1)|urinary_tract(2)	34	all_cancers(53;5.05e-16)|all_epithelial(53;1.82e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CCATTCCCAAGTGCACGATCT	0.522																																							uc004fkg.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(1)	4						c.(1246-1248)AAG>AAT		transketolase-like 1 isoform a							197.0	146.0	164.0					X																	153551614		2203	4300	6503	SO:0001583	missense	8277				glucose catabolic process|thiamine metabolic process	cytoplasm|nucleus	metal ion binding|transketolase activity	g.chrX:153551614G>T	X91817	CCDS35448.1, CCDS55541.1	Xq28	2008-02-05			ENSG00000007350	ENSG00000007350			11835	protein-coding gene	gene with protein product		300044				8838793	Standard	NM_012253		Approved	TKR, TKT2	uc004fkg.3	P51854	OTTHUMG00000022707	ENST00000369915.3:c.1248G>T	X.37:g.153551614G>T	ENSP00000358931:p.Lys416Asn		Somatic				TKTL1_uc011mzl.1_Missense_Mutation_p.K410N|TKTL1_uc011mzm.1_Missense_Mutation_p.K212N|TKTL1_uc004fkh.2_Missense_Mutation_p.K360N	p.K416N	NM_012253	NP_036385	WXS	Illumina HiSeq	Unspecified	P51854	TKTL1_HUMAN			9	1434	+	all_cancers(53;5.05e-16)|all_epithelial(53;1.82e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)		416					A8K896|Q5TYJ8|Q5TYJ9|Q8TC75	Missense_Mutation	SNP	ENST00000369915.3	37	c.1248G>T	CCDS35448.1	.	.	.	.	.	.	.	.	.	.	G	0.127	-1.117842	0.01785	.	.	ENSG00000007350	ENST00000369915;ENST00000441970;ENST00000217905;ENST00000369912	T;T;T	0.32272	1.46;1.46;1.46	5.12	-1.66	0.08265	Transketolase-like, pyrimidine-binding domain (2);	0.343688	0.31660	N	0.007266	T	0.02455	0.0075	N	0.00005	-3.295	0.21861	N	0.999505	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.0;0.002;0.002	T	0.47611	-0.9104	10	0.05833	T	0.94	-12.8763	6.0675	0.19871	0.0:0.3061:0.3734:0.3205	.	156;410;416	B7Z7M4;B7Z7I0;P51854	.;.;TKTL1_HUMAN	N	416;360;156;360	ENSP00000358931:K416N;ENSP00000217905:K156N;ENSP00000358928:K360N	ENSP00000217905:K156N	K	+	3	2	TKTL1	153204808	0.000000	0.05858	0.044000	0.18714	0.018000	0.09664	-0.511000	0.06321	-0.353000	0.08224	-0.545000	0.04230	AAG		0.522	TKTL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058923.1	NM_012253		12	185	1	0	4.3838e-07	0.001855	7.28973e-07	12	185				
LCE5A	254910	broad.mit.edu	37	1	152484167	152484167	+	Frame_Shift_Del	DEL	G	G	-			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr1:152484167delG	ENST00000334269.2	+	2	333	c.157delG	c.(157-159)ggtfs	p.G53fs	CRCT1_ENST00000368790.3_5'Flank	NM_178438.4	NP_848525.1	Q5TCM9	LCE5A_HUMAN	late cornified envelope 5A	53	Cys-rich.				keratinization (GO:0031424)					lung(3)|ovary(1)|prostate(3)	7	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			TTCCTGCTGTGGTTCCAGCTC	0.637																																							uc001ezy.2		NA																	0				ovary(1)	1						c.(157-159)GGTfs		late cornified envelope 5A							74.0	75.0	75.0					1																	152484167		2203	4300	6503	SO:0001589	frameshift_variant	254910				keratinization			g.chr1:152484167delG	BI670518	CCDS1011.1	1q21.3	2008-02-05	2004-10-11	2004-10-15	ENSG00000186207	ENSG00000186207		"""Late cornified envelopes"""	16614	protein-coding gene	gene with protein product		612619	"""small proline rich-like (epidermal differentiation complex) 5A"""	SPRL5A		11698679	Standard	NM_178438		Approved	LEP18	uc001ezy.3	Q5TCM9	OTTHUMG00000014401	ENST00000334269.2:c.157delG	1.37:g.152484167delG	ENSP00000333952:p.Gly53fs		Somatic				CRCT1_uc001ezz.2_5'Flank	p.G53fs	NM_178438	NP_848525	WXS	Illumina HiSeq	Unspecified	Q5TCM9	LCE5A_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		2	333	+	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		53			Cys-rich.			Frame_Shift_Del	DEL	ENST00000334269.2	37	c.157delG	CCDS1011.1																																																																																				0.637	LCE5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040059.1	NM_178438		12	137	NA	NA	NA	NA	NA	12	137	---	---	---	---
RYR2	6262	broad.mit.edu	37	1	237666676	237666676	+	Frame_Shift_Del	DEL	A	A	-			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr1:237666676delA	ENST00000366574.2	+	22	2801	c.2484delA	c.(2482-2484)ccafs	p.P828fs	RYR2_ENST00000542537.1_Frame_Shift_Del_p.P812fs|RYR2_ENST00000360064.6_Frame_Shift_Del_p.P826fs	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	828					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CTGTTCTGCCAAAAGAAAAGT	0.493																																							uc001hyl.1		NA																	0				ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(2482-2484)CCAfs		cardiac muscle ryanodine receptor							90.0	92.0	92.0					1																	237666676		1941	4133	6074	SO:0001589	frameshift_variant	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237666676delA	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.2484delA	1.37:g.237666676delA	ENSP00000355533:p.Pro828fs		Somatic					p.P828fs	NM_001035	NP_001026	WXS	Illumina HiSeq	Unspecified	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		22	2604	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	828			Cytoplasmic (By similarity).		Q15411|Q546N8|Q5T3P2	Frame_Shift_Del	DEL	ENST00000366574.2	37	c.2484delA	CCDS55691.1																																																																																				0.493	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		10	70	NA	NA	NA	NA	NA	10	70	---	---	---	---
PDCD11	22984	broad.mit.edu	37	10	105198508	105198508	+	Frame_Shift_Del	DEL	A	A	-			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr10:105198508delA	ENST00000369797.3	+	27	4062	c.3968delA	c.(3967-3969)gaafs	p.E1323fs		NM_014976.1	NP_055791.1	Q14690	RRP5_HUMAN	programmed cell death 11	1323					mRNA processing (GO:0006397)|rRNA processing (GO:0006364)	cytosol (GO:0005829)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	64		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)		GACATTAAGGAAGGGCAGCTT	0.507																																							uc001kwy.1		NA																	0				ovary(2)|breast(2)|skin(2)|central_nervous_system(1)	7						c.(3967-3969)GAAfs		programmed cell death 11							114.0	117.0	116.0					10																	105198508		2203	4300	6503	SO:0001589	frameshift_variant	22984				mRNA processing|rRNA processing	nucleolus	RNA binding|transcription factor binding	g.chr10:105198508delA	D80007	CCDS31276.1	10q24.32	2010-07-06			ENSG00000148843	ENSG00000148843			13408	protein-coding gene	gene with protein product		612333				10229231	Standard	XM_005269647		Approved	KIAA0185, ALG-4, RRP5	uc001kwy.1	Q14690	OTTHUMG00000018988	ENST00000369797.3:c.3968delA	10.37:g.105198508delA	ENSP00000358812:p.Glu1323fs		Somatic					p.E1323fs	NM_014976	NP_055791	WXS	Illumina HiSeq	Unspecified	Q14690	RRP5_HUMAN		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)	27	4055	+		Colorectal(252;0.0747)|Breast(234;0.128)	1323					Q2TA92|Q5W093|Q6P2J3|Q86VQ8|Q9H4P1	Frame_Shift_Del	DEL	ENST00000369797.3	37	c.3968delA	CCDS31276.1																																																																																				0.507	PDCD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050151.1			8	121	NA	NA	NA	NA	NA	8	121	---	---	---	---
VWF	7450	broad.mit.edu	37	12	6078534	6078535	+	Frame_Shift_Ins	INS	-	-	G	rs562305031|rs374690023	byFrequency	TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr12:6078534_6078535insG	ENST00000261405.5	-	45	7825_7826	c.7571_7572insC	c.(7570-7572)ccgfs	p.P2524fs		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	2524					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	AGGGGTTCTCCGGGGAGGCCCA	0.604																																							uc001qnn.1		NA																	0				skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|breast(1)	12						c.(7570-7572)CCGfs		von Willebrand factor preproprotein	Antihemophilic Factor(DB00025)																																			SO:0001589	frameshift_variant	7450				blood coagulation, intrinsic pathway|cell-substrate adhesion|platelet activation|platelet degranulation|protein homooligomerization	endoplasmic reticulum|platelet alpha granule lumen|proteinaceous extracellular matrix|Weibel-Palade body	chaperone binding|collagen binding|glycoprotein binding|immunoglobulin binding|integrin binding|protease binding|protein homodimerization activity|protein N-terminus binding	g.chr12:6078534_6078535insG		CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.7572dupC	12.37:g.6078538_6078538dupG	ENSP00000261405:p.Pro2524fs		Somatic				VWF_uc010set.1_Intron	p.P2524fs	NM_000552	NP_000543	WXS	Illumina HiSeq	Unspecified	P04275	VWF_HUMAN			45	7821_7822	-			2524					Q8TCE8|Q99806	Frame_Shift_Ins	INS	ENST00000261405.5	37	c.7571_7572insC	CCDS8539.1																																																																																				0.604	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399020.1	NM_000552		9	85	NA	NA	NA	NA	NA	9	85	---	---	---	---
RAMP2	10266	broad.mit.edu	37	17	40914762	40914762	+	Frame_Shift_Del	DEL	C	C	-	rs377604752		TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr17:40914762delC	ENST00000253796.5	+	4	488	c.420delC	c.(418-420)gacfs	p.D140fs	RAMP2_ENST00000589683.1_Frame_Shift_Del_p.D65fs|RAMP2-AS1_ENST00000592670.1_lincRNA|RAMP2_ENST00000588576.1_Frame_Shift_Del_p.T104fs|RAMP2_ENST00000587142.1_Frame_Shift_Del_p.D145fs	NM_005854.2	NP_005845.2	O60895	RAMP2_HUMAN	receptor (G protein-coupled) activity modifying protein 2	140					adherens junction assembly (GO:0034333)|angiogenesis (GO:0001525)|basement membrane assembly (GO:0070831)|calcium ion transport (GO:0006816)|cAMP biosynthetic process (GO:0006171)|cellular response to hormone stimulus (GO:0032870)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|female pregnancy (GO:0007565)|G-protein coupled receptor signaling pathway (GO:0007186)|heart development (GO:0007507)|intracellular protein transport (GO:0006886)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of vascular permeability (GO:0043116)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of gene expression (GO:0010628)|positive regulation of vasculogenesis (GO:2001214)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|receptor internalization (GO:0031623)|regulation of blood pressure (GO:0008217)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|response to estradiol (GO:0032355)|response to hypoxia (GO:0001666)|response to progesterone (GO:0032570)|sprouting angiogenesis (GO:0002040)|tight junction assembly (GO:0070830)|vascular smooth muscle cell development (GO:0097084)|vasculogenesis (GO:0001570)	cell surface (GO:0009986)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	coreceptor activity (GO:0015026)|protein transporter activity (GO:0008565)			endometrium(2)|lung(1)|stomach(1)	4		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.0741)	Pramlintide(DB01278)	CCTTCTCTGACCCCCCAGAGG	0.552																																							uc002ibg.2		NA																	0					0						c.(418-420)GACfs		receptor activity modifying protein 2 precursor	Pramlintide(DB01278)						101.0	91.0	94.0					17																	40914762		2203	4300	6503	SO:0001589	frameshift_variant	10266				intracellular protein transport|receptor-mediated endocytosis|regulation of G-protein coupled receptor protein signaling pathway	coated pit|integral to plasma membrane|lysosome	protein transporter activity	g.chr17:40914762delC	AJ001015	CCDS11437.1	17q12-q21.1	2012-08-17	2006-11-21		ENSG00000131477	ENSG00000131477		"""Receptor (G protein-coupled) activity modifying proteins"""	9844	protein-coding gene	gene with protein product		605154	"""receptor activity modifying protein 2"", ""receptor (calcitonin) activity modifying protein 2"""				Standard	NM_005854		Approved		uc002ibg.3	O60895		ENST00000253796.5:c.420delC	17.37:g.40914762delC	ENSP00000253796:p.Asp140fs		Somatic				LOC100190938_uc002ibd.1_5'Flank|LOC100190938_uc002ibe.3_5'Flank|LOC100190938_uc002ibf.3_5'Flank|RAMP2_uc010cyt.2_Frame_Shift_Del_p.D145fs|RAMP2_uc002ibh.2_Frame_Shift_Del_p.T104fs	p.D140fs	NM_005854	NP_005845	WXS	Illumina HiSeq	Unspecified	O60895	RAMP2_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.0741)	4	488	+		Breast(137;0.000143)	140			Extracellular (Potential).		A7L9S6|K7EMD3|Q8N1F2	Frame_Shift_Del	DEL	ENST00000253796.5	37	c.420delC	CCDS11437.1																																																																																				0.552	RAMP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000452380.1	NM_005854		7	89	NA	NA	NA	NA	NA	7	89	---	---	---	---
SDPR	8436	broad.mit.edu	37	2	192700826	192700826	+	Frame_Shift_Del	DEL	C	C	-			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr2:192700826delC	ENST00000304141.4	-	2	1430	c.1101delG	c.(1099-1101)gggfs	p.G367fs		NM_004657.5	NP_004648.1			serum deprivation response											NS(1)|central_nervous_system(1)|cervix(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|urinary_tract(3)	23			OV - Ovarian serous cystadenocarcinoma(117;0.0647)			TGCTGTCCATCCCCGAGTTAC	0.582																																							uc002utb.2		NA																	0				ovary(1)|pancreas(1)	2						c.(1099-1101)GGGfs		serum deprivation response protein	Phosphatidylserine(DB00144)						137.0	126.0	130.0					2																	192700826		2203	4300	6503	SO:0001589	frameshift_variant	8436					caveola|cytosol	phosphatidylserine binding|protein binding	g.chr2:192700826delC	AF085481	CCDS2313.1	2q32-q33	2011-04-20	2009-09-18		ENSG00000168497	ENSG00000168497			10690	protein-coding gene	gene with protein product	"""phosphatidylserine binding protein"""	606728	"""serum deprivation response (phosphatidylserine-binding protein)"", ""serum deprivation response (phosphatidylserine binding protein)"""			10191091, 8241023	Standard	NM_004657		Approved	SDR, PS-p68, cavin-2, CAVIN2	uc002utb.3	O95810	OTTHUMG00000154309	ENST00000304141.4:c.1101delG	2.37:g.192700826delC	ENSP00000305675:p.Gly367fs		Somatic					p.G367fs	NM_004657	NP_004648	WXS	Illumina HiSeq	Unspecified	O95810	SDPR_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0647)		2	1431	-			367						Frame_Shift_Del	DEL	ENST00000304141.4	37	c.1101delG	CCDS2313.1																																																																																				0.582	SDPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334791.2	NM_004657		9	298	NA	NA	NA	NA	NA	9	298	---	---	---	---
MYH15	22989	broad.mit.edu	37	3	108102463	108102463	+	Frame_Shift_Del	DEL	T	T	-			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr3:108102463delT	ENST00000273353.3	-	41	5861	c.5805delA	c.(5803-5805)aaafs	p.K1935fs		NM_014981.1	NP_055796.1	Q9Y2K3	MYH15_HUMAN	myosin, heavy chain 15	1935						cytoplasm (GO:0005737)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(1)|breast(3)|central_nervous_system(2)|cervix(4)|endometrium(10)|kidney(4)|large_intestine(14)|lung(47)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	105						ACTCTCTTGCTTTAATTTTGA	0.368																																							uc003dxa.1		NA																	0				ovary(5)|central_nervous_system(2)	7						c.(5803-5805)AAAfs		myosin, heavy polypeptide 15							213.0	200.0	204.0					3																	108102463		1847	4096	5943	SO:0001589	frameshift_variant	22989					myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity	g.chr3:108102463delT	AB023217	CCDS43127.1	3q13	2011-09-27	2006-09-29		ENSG00000144821	ENSG00000144821		"""Myosins / Myosin superfamily : Class II"""	31073	protein-coding gene	gene with protein product		609929	"""myosin, heavy polypeptide 15"""			15014174, 15042088	Standard	NM_014981		Approved	KIAA1000	uc003dxa.1	Q9Y2K3	OTTHUMG00000159226	ENST00000273353.3:c.5805delA	3.37:g.108102463delT	ENSP00000273353:p.Lys1935fs		Somatic					p.K1935fs	NM_014981	NP_055796	WXS	Illumina HiSeq	Unspecified	Q9Y2K3	MYH15_HUMAN			41	5862	-			1935			Potential.			Frame_Shift_Del	DEL	ENST00000273353.3	37	c.5805delA	CCDS43127.1																																																																																				0.368	MYH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353935.1	XM_036988		44	348	NA	NA	NA	NA	NA	44	348	---	---	---	---
STXBP5L	9515	broad.mit.edu	37	3	121126216	121126216	+	Frame_Shift_Del	DEL	G	G	-			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr3:121126216delG	ENST00000273666.6	+	24	3057	c.2786delG	c.(2785-2787)tggfs	p.W929fs	STXBP5L_ENST00000471454.1_Frame_Shift_Del_p.W905fs|STXBP5L_ENST00000472879.1_Frame_Shift_Del_p.W905fs|STXBP5L_ENST00000497029.1_Frame_Shift_Del_p.W903fs|STXBP5L_ENST00000492541.1_Frame_Shift_Del_p.W929fs	NM_014980.2	NP_055795.1	Q9Y2K9	STB5L_HUMAN	syntaxin binding protein 5-like	929					exocytosis (GO:0006887)|glucose homeostasis (GO:0042593)|negative regulation of insulin secretion (GO:0046676)|positive regulation of protein secretion (GO:0050714)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(12)|lung(28)|ovary(7)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				GBM - Glioblastoma multiforme(114;0.0694)		GAAAAATCTTGGAGAAGGAAA	0.393																																							uc003eec.3		NA																	0				ovary(7)|skin(2)	9						c.(2785-2787)TGGfs		syntaxin binding protein 5-like							95.0	92.0	93.0					3																	121126216		1851	4089	5940	SO:0001589	frameshift_variant	9515				exocytosis|protein transport	cytoplasm|integral to membrane|plasma membrane		g.chr3:121126216delG	AB023223	CCDS43137.1	3q13.33-q21.1	2013-01-10			ENSG00000145087	ENSG00000145087		"""WD repeat domain containing"""	30757	protein-coding gene	gene with protein product		609381				10231032, 14767561	Standard	NM_014980		Approved	KIAA1006, LLGL4	uc003eec.4	Q9Y2K9	OTTHUMG00000159426	ENST00000273666.6:c.2786delG	3.37:g.121126216delG	ENSP00000273666:p.Trp929fs		Somatic				STXBP5L_uc011bji.1_Frame_Shift_Del_p.W905fs	p.W929fs	NM_014980	NP_055795	WXS	Illumina HiSeq	Unspecified	Q9Y2K9	STB5L_HUMAN		GBM - Glioblastoma multiforme(114;0.0694)	24	2926	+			929			WD 12.		Q4G1B4|Q6PIC3	Frame_Shift_Del	DEL	ENST00000273666.6	37	c.2786delG	CCDS43137.1																																																																																				0.393	STXBP5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355256.3			21	120	NA	NA	NA	NA	NA	21	120	---	---	---	---
IQGAP2	10788	broad.mit.edu	37	5	75964638	75964638	+	Frame_Shift_Del	DEL	C	C	-			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr5:75964638delC	ENST00000274364.6	+	23	3109	c.2812delC	c.(2812-2814)cttfs	p.L938fs	IQGAP2_ENST00000502745.1_Frame_Shift_Del_p.L434fs|IQGAP2_ENST00000379730.3_Frame_Shift_Del_p.L440fs|IQGAP2_ENST00000396234.3_Frame_Shift_Del_p.L434fs	NM_006633.2	NP_006624	Q13576	IQGA2_HUMAN	IQ motif containing GTPase activating protein 2	938	Ras-GAP. {ECO:0000255|PROSITE- ProRule:PRU00167}.				negative regulation of catalytic activity (GO:0043086)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microvillus (GO:0005902)	actin binding (GO:0003779)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Ras GTPase activator activity (GO:0005099)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(23)|ovary(6)|prostate(1)|skin(3)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	68		all_lung(232;0.000514)|Lung NSC(167;0.00135)|Prostate(461;0.00838)|Ovarian(174;0.0149)		all cancers(79;1.38e-36)		ACTTCTCAAGCTTTTTAAAAC	0.333																																							uc003kek.2		NA																	0				ovary(6)|central_nervous_system(1)	7						c.(2812-2814)CTTfs		IQ motif containing GTPase activating protein 2							52.0	54.0	53.0					5																	75964638		2202	4296	6498	SO:0001589	frameshift_variant	10788				small GTPase mediated signal transduction	actin cytoskeleton	actin binding|calmodulin binding|GTPase inhibitor activity|Ras GTPase activator activity	g.chr5:75964638delC	U51903	CCDS34188.1, CCDS68897.1, CCDS68898.1, CCDS75262.1	5q	2008-07-18			ENSG00000145703	ENSG00000145703			6111	protein-coding gene	gene with protein product		605401				8756646	Standard	XM_005248409		Approved		uc003kek.3	Q13576	OTTHUMG00000162432	ENST00000274364.6:c.2812delC	5.37:g.75964638delC	ENSP00000274364:p.Leu938fs		Somatic				IQGAP2_uc010izv.2_Frame_Shift_Del_p.L491fs|IQGAP2_uc011csv.1_Frame_Shift_Del_p.L434fs|IQGAP2_uc003kel.2_Frame_Shift_Del_p.L434fs	p.L938fs	NM_006633	NP_006624	WXS	Illumina HiSeq	Unspecified	Q13576	IQGA2_HUMAN		all cancers(79;1.38e-36)	23	3034	+		all_lung(232;0.000514)|Lung NSC(167;0.00135)|Prostate(461;0.00838)|Ovarian(174;0.0149)	938			Ras-GAP.		A8K4V1|B7Z8A4|J3KR91	Frame_Shift_Del	DEL	ENST00000274364.6	37	c.2812delC	CCDS34188.1																																																																																				0.333	IQGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368877.1	NM_006633		8	98	NA	NA	NA	NA	NA	8	98	---	---	---	---
PKHD1	5314	broad.mit.edu	37	6	51890920	51890920	+	Frame_Shift_Del	DEL	C	C	-			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr6:51890920delC	ENST00000371117.3	-	32	3963	c.3688delG	c.(3688-3690)gtafs	p.V1230fs	PKHD1_ENST00000340994.4_Frame_Shift_Del_p.V1230fs	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	1230	IPT/TIG 7.				cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					CCCACAAGTACCCAAACCAAA	0.517																																							uc003pah.1		NA																	0				lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44						c.(3688-3690)GTAfs		fibrocystin isoform 1							64.0	65.0	65.0					6																	51890920		2203	4300	6503	SO:0001589	frameshift_variant	5314				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity	g.chr6:51890920delC	AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.3688delG	6.37:g.51890920delC	ENSP00000360158:p.Val1230fs		Somatic				PKHD1_uc003pai.2_Frame_Shift_Del_p.V1230fs	p.V1230fs	NM_138694	NP_619639	WXS	Illumina HiSeq	Unspecified	P08F94	PKHD1_HUMAN			32	3964	-	Lung NSC(77;0.0605)		1230			Extracellular (Potential).|IPT/TIG 7.		Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Frame_Shift_Del	DEL	ENST00000371117.3	37	c.3688delG	CCDS4935.1																																																																																				0.517	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694		10	104	NA	NA	NA	NA	NA	10	104	---	---	---	---
HOXA2	3199	broad.mit.edu	37	7	27141898	27141899	+	Frame_Shift_Ins	INS	-	-	T			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chr7:27141898_27141899insT	ENST00000222718.5	-	1	531_532	c.221_222insA	c.(220-222)aagfs	p.K74fs	HOTAIRM1_ENST00000434063.3_RNA|HOTAIRM1_ENST00000428939.3_RNA|HOTAIRM1_ENST00000425358.2_RNA|HOTAIRM1_ENST00000593300.1_RNA|HOTAIRM1_ENST00000429611.3_RNA	NM_006735.3	NP_006726.1	O43364	HXA2_HUMAN	homeobox A2	74					anterior/posterior pattern specification (GO:0009952)|brain segmentation (GO:0035284)|cell fate determination (GO:0001709)|dorsal/ventral pattern formation (GO:0009953)|embryonic viscerocranium morphogenesis (GO:0048703)|middle ear morphogenesis (GO:0042474)|motor neuron axon guidance (GO:0008045)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|osteoblast development (GO:0002076)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|rhombomere 2 development (GO:0021568)|rhombomere 3 morphogenesis (GO:0021658)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|cervix(1)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|skin(1)	22						cggggcTCGGCTTGGGGCGGCC	0.693																																							uc003syh.2		NA																	0				ovary(1)|skin(1)	2						c.(220-222)AAGfs		homeobox A2																																				SO:0001589	frameshift_variant	3199					nucleus	sequence-specific DNA binding transcription factor activity	g.chr7:27141898_27141899insT		CCDS5403.1	7p15.2	2011-06-20	2005-12-22		ENSG00000105996	ENSG00000105996		"""Homeoboxes / ANTP class : HOXL subclass"""	5103	protein-coding gene	gene with protein product		604685	"""homeo box A2"""	HOX1K		1358459	Standard	NM_006735		Approved		uc003syh.3	O43364	OTTHUMG00000023208	ENST00000222718.5:c.222dupA	7.37:g.27141900_27141900dupT	ENSP00000222718:p.Lys74fs		Somatic					p.K74fs	NM_006735	NP_006726	WXS	Illumina HiSeq	Unspecified	O43364	HXA2_HUMAN			1	496_497	-			74					A1L4K3|B2RMW3	Frame_Shift_Ins	INS	ENST00000222718.5	37	c.221_222insA	CCDS5403.1																																																																																				0.693	HOXA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358508.2			5	9	NA	NA	NA	NA	NA	5	9	---	---	---	---
RGAG1	57529	broad.mit.edu	37	X	109695829	109695829	+	Frame_Shift_Del	DEL	G	G	-			TCGA-38-4626-01A-01D-1553-08	TCGA-38-4626-11A-01D-1553-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	85b56ce7-b420-433e-a77d-43ef628d685c	4443344e-b4c7-48a7-9b46-05fbe1c32326	g.chrX:109695829delG	ENST00000465301.2	+	3	2230	c.1984delG	c.(1984-1986)gccfs	p.A662fs	RGAG1_ENST00000540313.1_Frame_Shift_Del_p.A662fs	NM_020769.2	NP_065820.1	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1	662										NS(1)|autonomic_ganglia(1)|breast(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	73						GACAGACACAGCCTCTGGAGG	0.512																																							uc004eor.1		NA																	0				lung(2)|upper_aerodigestive_tract(1)|ovary(1)	4						c.(1984-1986)GCCfs		retrotransposon gag domain containing 1							105.0	88.0	94.0					X																	109695829		2203	4300	6503	SO:0001589	frameshift_variant	57529							g.chrX:109695829delG	AY121804	CCDS14552.1	Xq23	2008-02-05			ENSG00000243978	ENSG00000243978			29245	protein-coding gene	gene with protein product						10718198, 15716091, 16093683	Standard	NM_020769		Approved	KIAA1318, Mart9, Mar9	uc004eor.2	Q8NET4	OTTHUMG00000022196	ENST00000465301.2:c.1984delG	X.37:g.109695829delG	ENSP00000419786:p.Ala662fs		Somatic				RGAG1_uc011msr.1_Frame_Shift_Del_p.A662fs	p.A662fs	NM_020769	NP_065820	WXS	Illumina HiSeq	Unspecified	Q8NET4	RGAG1_HUMAN			3	2230	+			662					Q9P2M8	Frame_Shift_Del	DEL	ENST00000465301.2	37	c.1984delG	CCDS14552.1																																																																																				0.512	RGAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057906.2	NM_020769		7	107	NA	NA	NA	NA	NA	7	107	---	---	---	---
