#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
GABRD	2563	broad.mit.edu	37	1	1961436	1961436	+	Silent	SNP	C	C	T	rs75511732		TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr1:1961436C>T	ENST00000378585.4	+	9	1157	c.1074C>T	c.(1072-1074)aaC>aaT	p.N358N		NM_000815.4	NP_000806.2	O14764	GBRD_HUMAN	gamma-aminobutyric acid (GABA) A receptor, delta	358					signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.N358N(1)		central_nervous_system(2)|endometrium(3)|kidney(2)|lung(8)|ovary(2)|prostate(1)|skin(2)	20	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;2.7e-19)|all_lung(118;1.22e-08)|Lung NSC(185;1.24e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;2.19e-38)|OV - Ovarian serous cystadenocarcinoma(86;3.17e-24)|GBM - Glioblastoma multiforme(42;9.56e-08)|Colorectal(212;4.12e-05)|COAD - Colon adenocarcinoma(227;0.000194)|Kidney(185;0.00231)|BRCA - Breast invasive adenocarcinoma(365;0.00441)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0344)|Lung(427;0.2)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	ACGTGAGGAACGCCATTGTCC	0.687																																							uc001aip.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|central_nervous_system(1)|skin(1)	3						c.(1072-1074)AAC>AAT		gamma-aminobutyric acid (GABA) A receptor, delta							51.0	50.0	50.0					1																	1961436		2200	4288	6488	SO:0001819	synonymous_variant	2563					cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity	g.chr1:1961436C>T	BC033801	CCDS36.1	1p36.3	2012-06-22			ENSG00000187730	ENSG00000187730		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4084	protein-coding gene	gene with protein product	"""GABA(A) receptor, delta"""	137163				2176788, 10965146	Standard	NM_000815		Approved		uc001aip.2	O14764	OTTHUMG00000041064	ENST00000378585.4:c.1074C>T	1.37:g.1961436C>T			Somatic					p.N358N	NM_000815	NP_000806	WXS	Illumina HiSeq	Unspecified	O14764	GBRD_HUMAN		Epithelial(90;2.19e-38)|OV - Ovarian serous cystadenocarcinoma(86;3.17e-24)|GBM - Glioblastoma multiforme(42;9.56e-08)|Colorectal(212;4.12e-05)|COAD - Colon adenocarcinoma(227;0.000194)|Kidney(185;0.00231)|BRCA - Breast invasive adenocarcinoma(365;0.00441)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0344)|Lung(427;0.2)	9	1169	+	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;2.7e-19)|all_lung(118;1.22e-08)|Lung NSC(185;1.24e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)	358			Cytoplasmic (Probable).		Q8N4N9	Silent	SNP	ENST00000378585.4	37	c.1074C>T	CCDS36.1																																																																																				0.687	GABRD-001	KNOWN	mRNA_start_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098493.1	NM_000815		12	73	0	0	0	0.003163	0	12	73				
CCDC28B	79140	broad.mit.edu	37	1	32667694	32667694	+	Missense_Mutation	SNP	T	T	C			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr1:32667694T>C	ENST00000373602.5	+	2	505	c.158T>C	c.(157-159)tTc>tCc	p.F53S	CCDC28B_ENST00000421922.2_Missense_Mutation_p.F53S|CCDC28B_ENST00000483009.1_3'UTR|RP4-622L5.7_ENST00000373604.4_RNA	NM_024296.3	NP_077272.2	Q9BUN5	CC28B_HUMAN	coiled-coil domain containing 28B	53					cilium assembly (GO:0042384)	centrosome (GO:0005813)|cytoplasm (GO:0005737)		p.F53S(1)		large_intestine(4)|lung(3)|ovary(1)|upper_aerodigestive_tract(2)	10		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174)				CGGGCCAAGTTCAAGAGGTGG	0.612																																							uc001bul.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(157-159)TTC>TCC		coiled-coil domain containing 28B							31.0	33.0	32.0					1																	32667694		2203	4300	6503	SO:0001583	missense	79140							g.chr1:32667694T>C	BC022848	CCDS354.2, CCDS72749.1	1p36.11-p34.2	2008-02-05			ENSG00000160050	ENSG00000160050			28163	protein-coding gene	gene with protein product		610162				16327777	Standard	XM_006710892		Approved	MGC1203, RP4-622L5.5	uc001bul.1	Q9BUN5	OTTHUMG00000005738	ENST00000373602.5:c.158T>C	1.37:g.32667694T>C	ENSP00000362704:p.Phe53Ser		Somatic				CCDC28B_uc001buk.2_Missense_Mutation_p.F53S	p.F53S	NM_024296	NP_077272	WXS	Illumina HiSeq	Unspecified	Q9BUN5	CC28B_HUMAN			2	290	+		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174)	53					A8K789|Q8TBV8	Missense_Mutation	SNP	ENST00000373602.5	37	c.158T>C	CCDS354.2	.	.	.	.	.	.	.	.	.	.	T	16.10	3.026643	0.54683	.	.	ENSG00000160050	ENST00000373602;ENST00000421922	T;T	0.42131	1.02;0.98	5.39	5.39	0.77823	.	0.369943	0.31233	N	0.008018	T	0.33789	0.0875	L	0.44542	1.39	0.29152	N	0.87834	B;P	0.48764	0.063;0.915	B;B	0.42462	0.016;0.388	T	0.25572	-1.0128	10	0.21540	T	0.41	-0.5051	9.7692	0.40578	0.0:0.0819:0.0:0.9181	.	53;53	Q9BUN5;E9PM81	CC28B_HUMAN;.	S	53	ENSP00000362704:F53S;ENSP00000413017:F53S	ENSP00000362704:F53S	F	+	2	0	CCDC28B	32440281	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	1.442000	0.35046	2.182000	0.69389	0.533000	0.62120	TTC		0.612	CCDC28B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015723.4	NM_024296		10	47	0	0	0	0.006214	0	10	47				
RSPO1	284654	broad.mit.edu	37	1	38082223	38082223	+	Silent	SNP	G	G	A	rs375442568		TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr1:38082223G>A	ENST00000401069.1	-	4	931	c.219C>T	c.(217-219)ggC>ggT	p.G73G	RSPO1_ENST00000373059.1_Silent_p.G46G|RSPO1_ENST00000401070.1_Silent_p.G73G|RSPO1_ENST00000401071.2_Silent_p.G73G|RSPO1_ENST00000401068.1_Silent_p.G73G|RSPO1_ENST00000356545.2_Silent_p.G73G	NM_001242908.1	NP_001229837.1	Q2MKA7	RSPO1_HUMAN	R-spondin 1	73					canonical Wnt signaling pathway (GO:0060070)|male meiosis (GO:0007140)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of non-canonical Wnt signaling pathway (GO:2000052)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of gene expression (GO:0010468)|regulation of male germ cell proliferation (GO:2000254)|regulation of receptor internalization (GO:0002090)	extracellular space (GO:0005615)|nucleus (GO:0005634)	G-protein coupled receptor binding (GO:0001664)|heparin binding (GO:0008201)|receptor binding (GO:0005102)	p.G73G(1)|p.P305L(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(5)	12		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				GCAAGCAGACGCCCACCTGGC	0.622																																					GBM(122;680 2230 27822 42821)	GBM(122;680 2230 27822 42821)	uc001cbl.1		NA																	2	Substitution - Missense(1)|Substitution - coding silent(1)		lung(2)		0						c.(217-219)GGC>GGT		R-spondin1 precursor		G	,,,	1,4123		0,1,2061	69.0	73.0	72.0		219,219,138,219	3.8	1.0	1		72	0,8398		0,0,4199	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	RSPO1	NM_001038633.3,NM_001242908.1,NM_001242909.1,NM_001242910.1	,,,	0,1,6260	AA,AG,GG		0.0,0.0242,0.0080	,,,	73/264,73/264,46/237,73/201	38082223	1,12521	2062	4199	6261	SO:0001819	synonymous_variant	284654				positive regulation of canonical Wnt receptor signaling pathway|regulation of receptor internalization		heparin binding	g.chr1:38082223G>A	AK098225	CCDS41304.1, CCDS55590.1, CCDS55591.1	1p34.2	2014-01-30	2011-06-29		ENSG00000169218	ENSG00000169218		"""Endogenous ligands"""	21679	protein-coding gene	gene with protein product		609595	"""R-spondin homolog (Xenopus laevis)"""				Standard	NM_001038633		Approved	FLJ40906, RSPONDIN	uc001cbm.2	Q2MKA7	OTTHUMG00000004321	ENST00000401069.1:c.219C>T	1.37:g.38082223G>A			Somatic				RSPO1_uc001cbm.1_Silent_p.G73G|RSPO1_uc009vvf.1_Silent_p.G46G|RSPO1_uc009vvg.1_Silent_p.G73G	p.G73G	NM_001038633	NP_001033722	WXS	Illumina HiSeq	Unspecified	Q2MKA7	RSPO1_HUMAN			5	1007	-		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)	73			FU 1.		A2A420|Q0H8S6|Q14C72|Q5T0F2|Q8N7L5	Silent	SNP	ENST00000401069.1	37	c.219C>T	CCDS41304.1																																																																																				0.622	RSPO1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012477.2	NM_173640		16	151	0	0	0	0.006122	0	16	151				
LRRC40	55631	broad.mit.edu	37	1	70625094	70625095	+	Missense_Mutation	DNP	GC	GC	AT			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	GC	GC	-	-	GC	GC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr1:70625094_70625095GC>AT	ENST00000370952.3	-	10	1217_1218	c.1138_1139GC>AT	c.(1138-1140)GCt>ATt	p.A380I		NM_017768.4	NP_060238.3	Q9H9A6	LRC40_HUMAN	leucine rich repeat containing 40	380						membrane (GO:0016020)		p.A380I(1)		breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)|skin(2)	27						AGTCTCAGTAGCAGACTCACTT	0.302																																							uc001der.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1138-1140)GCT>ATT		leucine rich repeat containing 40																																				SO:0001583	missense	55631							g.chr1:70625094_70625095GC>AT		CCDS646.1	1p31.1	2008-02-05			ENSG00000066557	ENSG00000066557			26004	protein-coding gene	gene with protein product						12477932	Standard	NM_017768		Approved	FLJ20331	uc001der.2	Q9H9A6	OTTHUMG00000009348	ENST00000370952.3:c.1138_1139delinsAT	1.37:g.70625094_70625095delinsAT	ENSP00000359990:p.Ala380Ile		Somatic					p.A380I	NM_017768	NP_060238	WXS	Illumina HiSeq	Unspecified	Q9H9A6	LRC40_HUMAN			10	1190_1191	-			380					Q9BTR7|Q9NSK1|Q9NXC1	Missense_Mutation	DNP	ENST00000370952.3	37	c.1138_1139GC>AT	CCDS646.1																																																																																				0.302	LRRC40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025914.1	NM_017768		5	38	0	0	0	0.004672	0	5	38				
DNTTIP2	30836	broad.mit.edu	37	1	94342445	94342445	+	Missense_Mutation	SNP	G	G	A			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr1:94342445G>A	ENST00000436063.2	-	2	1103	c.1046C>T	c.(1045-1047)tCa>tTa	p.S349L	DNTTIP2_ENST00000460191.1_5'UTR	NM_014597.4	NP_055412.2	Q5QJE6	TDIF2_HUMAN	deoxynucleotidyltransferase, terminal, interacting protein 2	349					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.S349L(1)		NS(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(15)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	38		all_lung(203;0.0111)|Lung NSC(277;0.0347)		all cancers(265;0.00679)|GBM - Glioblastoma multiforme(16;0.0278)|Epithelial(280;0.128)		AGAGTGCACTGATACAGCATT	0.393																																							uc001dqf.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1045-1047)TCA>TTA		deoxynucleotidyltransferase, terminal,							101.0	91.0	94.0					1																	94342445		1843	4090	5933	SO:0001583	missense	30836				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus		g.chr1:94342445G>A	AY394925	CCDS44174.1	1p22.1	2008-02-05			ENSG00000067334	ENSG00000067334			24013	protein-coding gene	gene with protein product	"""acidic 82 kDa protein mRNA"""	611199				15047147	Standard	NM_014597		Approved	HSU15552, ERBP, TdIF2	uc001dqf.3	Q5QJE6	OTTHUMG00000010268	ENST00000436063.2:c.1046C>T	1.37:g.94342445G>A	ENSP00000411010:p.Ser349Leu		Somatic				DNTTIP2_uc010otm.1_RNA|DNTTIP2_uc009wdo.1_Missense_Mutation_p.S144L	p.S349L	NM_014597	NP_055412	WXS	Illumina HiSeq	Unspecified	Q5QJE6	TDIF2_HUMAN		all cancers(265;0.00679)|GBM - Glioblastoma multiforme(16;0.0278)|Epithelial(280;0.128)	2	1084	-		all_lung(203;0.0111)|Lung NSC(277;0.0347)	349					Q12987|Q53H59|Q5TFJ4|Q6TLI0|Q76MJ8|Q86WX9	Missense_Mutation	SNP	ENST00000436063.2	37	c.1046C>T	CCDS44174.1	.	.	.	.	.	.	.	.	.	.	G	5.646	0.303840	0.10678	.	.	ENSG00000067334	ENST00000436063	T	0.14893	2.47	5.43	3.54	0.40534	.	1.111220	0.06870	N	0.800585	T	0.08537	0.0212	M	0.65975	2.015	0.09310	N	1	B	0.18863	0.031	B	0.15870	0.014	T	0.36578	-0.9742	10	0.51188	T	0.08	.	7.5768	0.27942	0.1288:0.0:0.7349:0.1363	.	349	Q5QJE6	TDIF2_HUMAN	L	349	ENSP00000411010:S349L	ENSP00000352137:S349L	S	-	2	0	DNTTIP2	94115033	0.033000	0.19621	0.004000	0.12327	0.052000	0.14988	0.944000	0.29043	0.835000	0.34877	0.655000	0.94253	TCA		0.393	DNTTIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028317.2	NM_014597		14	86	0	0	0	0.00245	0	14	86				
LOC728989	728989	broad.mit.edu	37	1	146493351	146493351	+	IGR	SNP	A	A	G	rs372773070		TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr1:146493351A>G								RP4-704D21.2 (18174 upstream) : RNVU1-8 (57943 downstream)																							TGAAGGAGCCACTCCTGTTTG	0.488																																							uc001epd.2		NA																	0					0						c.(562-564)TGG>CGG		SubName: Full=cDNA FLJ59595, highly similar to Homo sapiens phosphodiesterase 4D interacting protein, transcript variant 1, mRNA;																																				SO:0001628	intergenic_variant	728989							g.chr1:146493351A>G																													1.37:g.146493351A>G			Somatic					p.W188R	NR_024442		WXS	Illumina HiSeq	Unspecified					5	636	-									Missense_Mutation	SNP		37	c.562T>C																																																																																				0	0.488									3	42	0	0	0	0.000602	0	3	42				
FLG2	388698	broad.mit.edu	37	1	152323784	152323784	+	Missense_Mutation	SNP	A	A	T	rs113396101		TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr1:152323784A>T	ENST00000388718.5	-	3	6550	c.6478T>A	c.(6478-6480)Tct>Act	p.S2160T	FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000445097.1_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	2160					establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.S2160T(1)		NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCATGACCAGACTGGCCATGT	0.512																																							uc001ezw.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17						c.(6478-6480)TCT>ACT		filaggrin family member 2							366.0	330.0	343.0					1																	152323784		2203	4300	6503	SO:0001583	missense	388698						calcium ion binding|structural molecule activity	g.chr1:152323784A>T	AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.6478T>A	1.37:g.152323784A>T	ENSP00000373370:p.Ser2160Thr		Somatic				uc001ezv.2_Intron	p.S2160T	NM_001014342	NP_001014364	WXS	Illumina HiSeq	Unspecified	Q5D862	FILA2_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	6551	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		2160			Filaggrin 10.		Q9H4U1	Missense_Mutation	SNP	ENST00000388718.5	37	c.6478T>A	CCDS30861.1	.	.	.	.	.	.	.	.	.	.	A	3.239	-0.155810	0.06544	.	.	ENSG00000143520	ENST00000388718	T	0.36520	1.25	3.1	-1.73	0.08081	.	.	.	.	.	T	0.13415	0.0325	L	0.31420	0.93	0.09310	N	1	P	0.52061	0.95	P	0.58013	0.831	T	0.08310	-1.0728	9	0.08179	T	0.78	1.8661	4.2241	0.10572	0.3853:0.413:0.0:0.2017	.	2160	Q5D862	FILA2_HUMAN	T	2160	ENSP00000373370:S2160T	ENSP00000373370:S2160T	S	-	1	0	FLG2	150590408	0.000000	0.05858	0.001000	0.08648	0.061000	0.15899	-1.249000	0.02888	-0.420000	0.07427	0.450000	0.29827	TCT		0.512	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034018.5	NM_001014342		127	498	0	0	0	0.01441	0	127	498				
LCE3C	353144	broad.mit.edu	37	1	152573217	152573217	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr1:152573217C>A	ENST00000333881.3	+	1	80	c.10C>A	c.(10-12)Cag>Aag	p.Q4K		NM_178434.2	NP_848521.1	Q5T5A8	LCE3C_HUMAN	late cornified envelope 3C	4					keratinization (GO:0031424)			p.Q4K(1)		lung(1)	1	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)	UCEC - Uterine corpus endometrioid carcinoma (5;0.153)|KIRC - Kidney renal clear cell carcinoma(4;0.0313)|Kidney(5;0.0367)		GATGTCCTGCCAGCAAAACCA	0.507																																							uc001fac.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(10-12)CAG>AAG		late cornified envelope 3C							133.0	123.0	127.0					1																	152573217		1850	2855	4705	SO:0001583	missense	353144				keratinization			g.chr1:152573217C>A	BI670516	CCDS1015.1	1q21.3	2008-02-05		2004-10-15	ENSG00000244057	ENSG00000244057		"""Late cornified envelopes"""	16612	protein-coding gene	gene with protein product		612615	"""small proline rich-like (epidermal differentiation complex) 3A"""	SPRL3A		11698679	Standard	NM_178434		Approved	LEP15	uc001fac.2	Q5T5A8	OTTHUMG00000014403	ENST00000333881.3:c.10C>A	1.37:g.152573217C>A	ENSP00000334644:p.Gln4Lys		Somatic					p.Q4K	NM_178434	NP_848521	WXS	Illumina HiSeq	Unspecified	Q5T5A8	LCE3C_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)	UCEC - Uterine corpus endometrioid carcinoma (5;0.153)|KIRC - Kidney renal clear cell carcinoma(4;0.0313)|Kidney(5;0.0367)	1	80	+	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		4					A1L420	Missense_Mutation	SNP	ENST00000333881.3	37	c.10C>A	CCDS1015.1	.	.	.	.	.	.	.	.	.	.	C	9.583	1.124138	0.20959	.	.	ENSG00000244057	ENST00000333881	T	0.05513	3.43	4.18	4.18	0.49190	.	.	.	.	.	T	0.13756	0.0333	.	.	.	0.34317	D	0.686088	D	0.67145	0.996	D	0.73708	0.981	T	0.00636	-1.1633	8	0.87932	D	0	.	11.8216	0.52242	0.0:1.0:0.0:0.0	.	4	Q5T5A8	LCE3C_HUMAN	K	4	ENSP00000334644:Q4K	ENSP00000334644:Q4K	Q	+	1	0	LCE3C	150839841	1.000000	0.71417	1.000000	0.80357	0.565000	0.35776	3.206000	0.51098	2.144000	0.66660	0.491000	0.48974	CAG		0.507	LCE3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040061.2	NM_178434		55	641	1	0	1.95512e-22	0.01441	2.62884e-22	55	641				
CRTC2	200186	broad.mit.edu	37	1	153927404	153927404	+	Missense_Mutation	SNP	C	C	T			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr1:153927404C>T	ENST00000368633.1	-	3	444	c.317G>A	c.(316-318)cGg>cAg	p.R106Q	CRTC2_ENST00000368630.3_Intron|CRTC2_ENST00000476883.1_5'UTR	NM_181715.2	NP_859066.1	Q53ET0	CRTC2_HUMAN	CREB regulated transcription coactivator 2	106					gluconeogenesis (GO:0006094)|glucose homeostasis (GO:0042593)|histone H3-K9 acetylation (GO:0043970)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotetramerization (GO:0051289)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	cAMP response element binding protein binding (GO:0008140)	p.R106Q(1)		NS(1)|breast(1)|cervix(2)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)	27	all_lung(78;3.05e-32)|Lung NSC(65;3.74e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			TCGCTGCACCCGTTCCACCAG	0.567																																							uc010ped.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(316-318)CGG>CAG		CREB regulated transcription coactivator 2							60.0	52.0	55.0					1																	153927404		2203	4300	6503	SO:0001583	missense	200186				interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	protein binding	g.chr1:153927404C>T	AY360172	CCDS30875.1	1q21.3	2008-02-05			ENSG00000160741	ENSG00000160741			27301	protein-coding gene	gene with protein product		608972				14506290, 14536081	Standard	NM_181715		Approved	TORC2	uc021pab.1	Q53ET0	OTTHUMG00000037156	ENST00000368633.1:c.317G>A	1.37:g.153927404C>T	ENSP00000357622:p.Arg106Gln		Somatic				CRTC2_uc001fde.3_5'Flank|CRTC2_uc001fdf.3_5'Flank	p.R106Q	NM_181715	NP_859066	WXS	Illumina HiSeq	Unspecified	Q53ET0	CRTC2_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.151)		3	387	-	all_lung(78;3.05e-32)|Lung NSC(65;3.74e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		106					Q6UUV8|Q7Z3X7|Q8N332	Missense_Mutation	SNP	ENST00000368633.1	37	c.317G>A	CCDS30875.1	.	.	.	.	.	.	.	.	.	.	C	29.5	5.013728	0.93404	.	.	ENSG00000160741	ENST00000368633	T	0.18657	2.2	4.75	4.75	0.60458	.	0.000000	0.64402	D	0.000003	T	0.11410	0.0278	M	0.64170	1.965	0.37615	D	0.921084	B	0.33494	0.414	B	0.17098	0.017	T	0.05468	-1.0883	10	0.72032	D	0.01	-7.6326	13.1012	0.59219	0.0:1.0:0.0:0.0	.	106	Q53ET0	CRTC2_HUMAN	Q	106	ENSP00000357622:R106Q	ENSP00000357622:R106Q	R	-	2	0	CRTC2	152194028	1.000000	0.71417	1.000000	0.80357	0.840000	0.47671	5.216000	0.65246	2.461000	0.83175	0.305000	0.20034	CGG		0.567	CRTC2-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090272.3	NM_181715		8	71	0	0	0	0.008291	0	8	71				
FCRL3	115352	broad.mit.edu	37	1	157666998	157666998	+	Nonsense_Mutation	SNP	C	C	T			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr1:157666998C>T	ENST00000368184.3	-	6	1067	c.776G>A	c.(775-777)tGg>tAg	p.W259*	RP11-367J7.3_ENST00000453692.1_RNA|FCRL3_ENST00000368186.5_Nonsense_Mutation_p.W259*|FCRL3_ENST00000473231.1_5'UTR	NM_052939.3	NP_443171.2	Q96P31	FCRL3_HUMAN	Fc receptor-like 3	259	Ig-like C2-type 3.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.W259*(1)		autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(1)|large_intestine(13)|lung(31)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)	69	all_hematologic(112;0.0378)					CACCTCACACCAGTAAGACCC	0.537																																							uc001frb.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(3)|breast(1)	4						c.(775-777)TGG>TAG		Fc receptor-like 3 precursor							116.0	104.0	108.0					1																	157666998		2203	4300	6503	SO:0001587	stop_gained	115352					integral to membrane|plasma membrane	receptor activity	g.chr1:157666998C>T	AF459027	CCDS1167.1	1q21-q22	2013-01-11			ENSG00000160856	ENSG00000160856		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18506	protein-coding gene	gene with protein product		606510				11493702, 12014205	Standard	XR_241065		Approved	FCRH3, IRTA3, IFGP3, SPAP2a, SPAP2, SPAP2b, SPAP2c, SPAP2d, SPAP2e, CD307c	uc001frb.3	Q96P31	OTTHUMG00000019400	ENST00000368184.3:c.776G>A	1.37:g.157666998C>T	ENSP00000357167:p.Trp259*		Somatic				FCRL3_uc001fqx.3_RNA|FCRL3_uc001fqy.3_RNA|FCRL3_uc001fqz.3_Nonsense_Mutation_p.W259*|FCRL3_uc009wsn.2_Intron|FCRL3_uc009wso.2_RNA|FCRL3_uc001fra.2_5'UTR|FCRL3_uc001frc.1_Nonsense_Mutation_p.W259*	p.W259*	NM_052939	NP_443171	WXS	Illumina HiSeq	Unspecified	Q96P31	FCRL3_HUMAN			6	1068	-	all_hematologic(112;0.0378)		259			Ig-like C2-type 3.|Extracellular (Potential).		A0N0M4|A8MTH7|D3DVD2|Q5VXZ8|Q8N6S2|Q96LA4|Q96P27|Q96P28|Q96P29|Q96P30	Nonsense_Mutation	SNP	ENST00000368184.3	37	c.776G>A	CCDS1167.1	.	.	.	.	.	.	.	.	.	.	C	16.67	3.186619	0.57909	.	.	ENSG00000160856	ENST00000368186;ENST00000368184;ENST00000292392	.	.	.	5.85	2.82	0.32997	.	1.549980	0.04089	N	0.310915	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.4316	0.16456	0.1271:0.5652:0.2276:0.0802	.	.	.	.	X	259	.	ENSP00000292392:W259X	W	-	2	0	FCRL3	155933622	0.989000	0.36119	0.984000	0.44739	0.065000	0.16274	0.009000	0.13219	1.476000	0.48215	0.491000	0.48974	TGG		0.537	FCRL3-006	NOVEL	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051419.2	NM_052939		21	130	0	0	0	0.014323	0	21	130				
FMO4	2329	broad.mit.edu	37	1	171293296	171293296	+	Missense_Mutation	SNP	C	C	T			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr1:171293296C>T	ENST00000367749.3	+	5	671	c.341C>T	c.(340-342)aCg>aTg	p.T114M	FMO4_ENST00000462992.1_3'UTR	NM_002022.1	NP_002013.1	P31512	FMO4_HUMAN	flavin containing monooxygenase 4	114					drug catabolic process (GO:0042737)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)	p.T114M(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	33	all_cancers(6;3.9e-08)|all_hematologic(923;0.088)|Acute lymphoblastic leukemia(37;0.181)					TGCAGCATAACGAAGCGTCCA	0.463																																					Pancreas(24;816 862 7754 7993 32832)	Pancreas(24;816 862 7754 7993 32832)	uc001gho.2		NA																	1	Substitution - Missense(1)		lung(1)	kidney(2)|skin(1)	3						c.(340-342)ACG>ATG		flavin containing monooxygenase 4							289.0	267.0	275.0					1																	171293296		2203	4300	6503	SO:0001583	missense	2329				xenobiotic metabolic process	integral to membrane|intrinsic to endoplasmic reticulum membrane|microsome	flavin adenine dinucleotide binding|flavin-containing monooxygenase activity|NADP binding	g.chr1:171293296C>T	BC002780	CCDS1295.1	1q24.3	2011-08-04			ENSG00000076258	ENSG00000076258	1.14.13.8		3772	protein-coding gene	gene with protein product		136131		FMO2		8311461	Standard	NM_002022		Approved		uc001gho.3	P31512	OTTHUMG00000035506	ENST00000367749.3:c.341C>T	1.37:g.171293296C>T	ENSP00000356723:p.Thr114Met		Somatic					p.T114M	NM_002022	NP_002013	WXS	Illumina HiSeq	Unspecified	P31512	FMO4_HUMAN			5	558	+	all_cancers(6;3.9e-08)|all_hematologic(923;0.088)|Acute lymphoblastic leukemia(37;0.181)		114					Q53XR0	Missense_Mutation	SNP	ENST00000367749.3	37	c.341C>T	CCDS1295.1	.	.	.	.	.	.	.	.	.	.	C	10.15	1.272501	0.23221	.	.	ENSG00000076258	ENST00000367749	T	0.55052	0.54	5.69	4.78	0.61160	.	0.172360	0.52532	D	0.000073	T	0.31040	0.0784	M	0.65320	2	0.09310	N	0.999999	P	0.36909	0.573	B	0.38020	0.263	T	0.35201	-0.9798	10	0.62326	D	0.03	-16.9873	4.4285	0.11515	0.1417:0.5784:0.1974:0.0825	.	114	P31512	FMO4_HUMAN	M	114	ENSP00000356723:T114M	ENSP00000356723:T114M	T	+	2	0	FMO4	169559920	0.001000	0.12720	0.077000	0.20336	0.055000	0.15305	-0.443000	0.06862	2.692000	0.91855	0.655000	0.94253	ACG		0.463	FMO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086223.1	NM_002022		121	490	0	0	0	0.01441	0	121	490				
CFHR5	81494	broad.mit.edu	37	1	196977743	196977743	+	Missense_Mutation	SNP	C	C	A	rs534950713		TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr1:196977743C>A	ENST00000256785.4	+	10	1749	c.1640C>A	c.(1639-1641)gCg>gAg	p.A547E	CFHR5_ENST00000367414.5_Missense_Mutation_p.A571E			Q9BXR6	FHR5_HUMAN	complement factor H-related 5	547	Sushi 9. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation, alternative pathway (GO:0006957)	extracellular region (GO:0005576)		p.A547E(1)		NS(2)|breast(2)|endometrium(2)|kidney(1)|large_intestine(7)|liver(2)|lung(23)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)	49						CCACATAAAGCGATGATATCA	0.343																																							uc001gts.3		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)|skin(1)	2						c.(1639-1641)GCG>GAG		complement factor H-related 5 precursor							120.0	110.0	114.0					1																	196977743		2203	4300	6503	SO:0001583	missense	81494				complement activation, alternative pathway	extracellular region		g.chr1:196977743C>A	AF295327	CCDS1387.1	1q31.3	2014-09-17		2006-02-28	ENSG00000134389	ENSG00000134389		"""Complement system"""	24668	protein-coding gene	gene with protein product	"""factor H related protein 5"""	608593		CFHL5		11058592, 12041828	Standard	NM_030787		Approved	FHR5, FHR-5	uc001gts.4	Q9BXR6	OTTHUMG00000036517	ENST00000256785.4:c.1640C>A	1.37:g.196977743C>A	ENSP00000256785:p.Ala547Glu		Somatic					p.A547E	NM_030787	NP_110414	WXS	Illumina HiSeq	Unspecified	Q9BXR6	FHR5_HUMAN			10	1768	+			547			Sushi 9.		Q2NKK2	Missense_Mutation	SNP	ENST00000256785.4	37	c.1640C>A	CCDS1387.1	.	.	.	.	.	.	.	.	.	.	C	12.26	1.884005	0.33255	.	.	ENSG00000134389	ENST00000367414;ENST00000256785	D;D	0.82984	-1.67;-1.67	4.48	-8.33	0.00992	Complement control module (1);Sushi/SCR/CCP (1);	.	.	.	.	T	0.61375	0.2342	N	0.21448	0.665	0.09310	N	1	B	0.22146	0.065	B	0.20184	0.028	T	0.48875	-0.8996	9	0.33141	T	0.24	.	0.5816	0.00712	0.4159:0.1542:0.1494:0.2806	.	547	Q9BXR6	FHR5_HUMAN	E	571;547	ENSP00000356384:A571E;ENSP00000256785:A547E	ENSP00000256785:A547E	A	+	2	0	CFHR5	195244366	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.797000	0.04570	-0.967000	0.03582	-0.291000	0.09656	GCG		0.343	CFHR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088814.2	NM_030787		11	142	1	0	1.61879e-10	0.013537	2.00087e-10	11	142				
FMOD	2331	broad.mit.edu	37	1	203316507	203316507	+	Missense_Mutation	SNP	G	G	T	rs201969614	byFrequency	TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr1:203316507G>T	ENST00000354955.4	-	2	1355	c.892C>A	c.(892-894)Cta>Ata	p.L298I	FMOD_ENST00000493296.1_Intron	NM_002023.4	NP_002014.2	Q06828	FMOD_HUMAN	fibromodulin	298					carbohydrate metabolic process (GO:0005975)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)|transforming growth factor beta receptor complex assembly (GO:0007181)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)		p.L298I(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(4)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	17			BRCA - Breast invasive adenocarcinoma(75;0.171)			GAGAGGTCTAGCTCAAGGAGG	0.567													G|||	2	0.000399361	0.0	0.0	5008	,	,		17679	0.002		0.0	False		,,,				2504	0.0						uc001gzr.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|breast(1)	3						c.(892-894)CTA>ATA		fibromodulin precursor							153.0	144.0	147.0					1																	203316507		2203	4300	6503	SO:0001583	missense	2331				transforming growth factor beta receptor complex assembly	extracellular space|proteinaceous extracellular matrix		g.chr1:203316507G>T	U05291	CCDS30976.1	1q32	2008-02-05			ENSG00000122176	ENSG00000122176		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	3774	protein-coding gene	gene with protein product	"""fibromodulin proteoglycan"""	600245				7851907	Standard	NM_002023		Approved	SLRR2E	uc001gzr.3	Q06828	OTTHUMG00000035910	ENST00000354955.4:c.892C>A	1.37:g.203316507G>T	ENSP00000347041:p.Leu298Ile		Somatic				FMOD_uc010pqi.1_RNA	p.L298I	NM_002023	NP_002014	WXS	Illumina HiSeq	Unspecified	Q06828	FMOD_HUMAN	BRCA - Breast invasive adenocarcinoma(75;0.171)		2	1028	-			298			LRR 9.		Q15331|Q8IV47	Missense_Mutation	SNP	ENST00000354955.4	37	c.892C>A	CCDS30976.1	2	9.157509157509158E-4	0	0.0	0	0.0	2	0.0034965034965034965	0	0.0	G	23.3	4.403110	0.83230	.	.	ENSG00000122176	ENST00000435105;ENST00000354955	T	0.80566	-1.39	5.18	5.18	0.71444	.	0.000000	0.85682	D	0.000000	D	0.90120	0.6913	M	0.82132	2.575	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.91473	0.5198	10	0.87932	D	0	-18.5485	17.2771	0.87119	0.0:0.0:1.0:0.0	.	298	Q06828	FMOD_HUMAN	I	285;298	ENSP00000347041:L298I	ENSP00000347041:L298I	L	-	1	2	FMOD	201583130	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	5.455000	0.66658	2.414000	0.81942	0.655000	0.94253	CTA		0.567	FMOD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087472.1	NM_002023		67	173	1	0	1.26778e-28	0.01441	1.728e-28	67	173				
KCNK2	3776	broad.mit.edu	37	1	215259842	215259842	+	Nonsense_Mutation	SNP	A	A	T			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr1:215259842A>T	ENST00000444842.2	+	2	328	c.178A>T	c.(178-180)Aag>Tag	p.K60*	KCNK2_ENST00000391894.2_Nonsense_Mutation_p.K45*|KCNK2_ENST00000391895.2_Nonsense_Mutation_p.K56*	NM_001017425.2|NM_014217.3	NP_001017425.2|NP_055032.1	O95069	KCNK2_HUMAN	potassium channel, subfamily K, member 2	60					G-protein coupled receptor signaling pathway (GO:0007186)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|potassium ion leak channel activity (GO:0022841)	p.K60*(1)|p.K45*(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|upper_aerodigestive_tract(1)	30				OV - Ovarian serous cystadenocarcinoma(81;0.0399)|all cancers(67;0.0556)|GBM - Glioblastoma multiforme(131;0.068)	Dofetilide(DB00204)|Dronedarone(DB04855)	TATGAAATGGAAGACGGTCTC	0.512																																							uc001hkq.2		NA																	2	Substitution - Nonsense(2)		lung(2)		0						c.(178-180)AAG>TAG		potassium channel, subfamily K, member 2 isoform	Dofetilide(DB00204)						90.0	76.0	81.0					1																	215259842		2203	4300	6503	SO:0001587	stop_gained	3776						outward rectifier potassium channel activity	g.chr1:215259842A>T	AF004711	CCDS31024.1, CCDS41466.1, CCDS41467.1	1q41	2012-03-07			ENSG00000082482	ENSG00000082482		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6277	protein-coding gene	gene with protein product		603219				9721223, 16382106	Standard	NM_001017424		Approved	K2p2.1, TREK-1	uc001hkr.4	O95069	OTTHUMG00000037017	ENST00000444842.2:c.178A>T	1.37:g.215259842A>T	ENSP00000394033:p.Lys60*		Somatic				KCNK2_uc001hko.2_Nonsense_Mutation_p.K56*|KCNK2_uc009xdm.2_RNA|KCNK2_uc001hkp.2_RNA|KCNK2_uc010pua.1_RNA|KCNK2_uc001hkr.3_Nonsense_Mutation_p.K45*	p.K60*	NM_001017425	NP_001017425	WXS	Illumina HiSeq	Unspecified	O95069	KCNK2_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0399)|all cancers(67;0.0556)|GBM - Glioblastoma multiforme(131;0.068)	2	347	+			60			Cytoplasmic (Potential).		A1Z1V3|A8K618|B2RCS4|B7ZL56|D3DTA5|Q5DP47|Q5DP48|Q9NRT2|Q9UNE3	Nonsense_Mutation	SNP	ENST00000444842.2	37	c.178A>T	CCDS41467.1	.	.	.	.	.	.	.	.	.	.	A	39	7.670560	0.98422	.	.	ENSG00000082482	ENST00000366948;ENST00000391895;ENST00000478774;ENST00000391894;ENST00000444842;ENST00000457122	.	.	.	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.0954	0.81117	1.0:0.0:0.0:0.0	.	.	.	.	X	56;56;4;45;60;4	.	ENSP00000355915:K56X	K	+	1	0	KCNK2	213326465	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.962000	0.93254	2.203000	0.70933	0.455000	0.32223	AAG		0.512	KCNK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089856.2	NM_014217		52	54	0	0	0	0.01441	0	52	54				
FMN2	56776	broad.mit.edu	37	1	240371640	240371640	+	Silent	SNP	G	G	A	rs183336748		TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr1:240371640G>A	ENST00000319653.9	+	5	3758	c.3528G>A	c.(3526-3528)ccG>ccA	p.P1176P		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	1176	FH1.|Pro-rich.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)	p.P1319P(1)		NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			TACCCCCTCCGCCCCCTCTAC	0.687																																							uc010pyd.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12						c.(3526-3528)CCG>CCA		formin 2																																				SO:0001819	synonymous_variant	56776				actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding	g.chr1:240371640G>A	AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.3528G>A	1.37:g.240371640G>A			Somatic				FMN2_uc010pye.1_Silent_p.P1180P	p.P1176P	NM_020066	NP_064450	WXS	Illumina HiSeq	Unspecified	Q9NZ56	FMN2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0106)		5	3753	+	Ovarian(103;0.127)	all_cancers(173;0.013)	1176			Pro-rich.|FH1.		B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Silent	SNP	ENST00000319653.9	37	c.3528G>A	CCDS31069.2																																																																																				0.687	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096217.2	XM_371352		7	8	0	0	0	0.00308	0	7	8				
SFMBT2	57713	broad.mit.edu	37	10	7262456	7262456	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr10:7262456G>T	ENST00000361972.4	-	11	1337	c.1247C>A	c.(1246-1248)gCt>gAt	p.A416D	SFMBT2_ENST00000397167.1_Missense_Mutation_p.A416D	NM_001018039.1	NP_001018049.1	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2	416					negative regulation of gene expression (GO:0010629)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	histone binding (GO:0042393)	p.A416D(1)		NS(2)|breast(3)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(26)|lung(34)|ovary(5)|pancreas(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	99						GGGGTTCACAGCTTCAAGTTT	0.532																																							uc009xio.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|upper_aerodigestive_tract(2)|large_intestine(1)|central_nervous_system(1)	8						c.(1246-1248)GCT>GAT		Scm-like with four mbt domains 2							211.0	188.0	196.0					10																	7262456		2203	4300	6503	SO:0001583	missense	57713				regulation of transcription, DNA-dependent	nucleus		g.chr10:7262456G>T	AB046837	CCDS31138.1	10p15.1	2013-01-10	2003-11-14		ENSG00000198879	ENSG00000198879		"""Sterile alpha motif (SAM) domain containing"""	20256	protein-coding gene	gene with protein product		615392	"""Scm-related gene containing four mbt domains 2"""			10997877	Standard	NM_001029880		Approved	KIAA1617	uc009xio.2	Q5VUG0	OTTHUMG00000017630	ENST00000361972.4:c.1247C>A	10.37:g.7262456G>T	ENSP00000355109:p.Ala416Asp		Somatic				SFMBT2_uc001ijn.1_Missense_Mutation_p.A416D|SFMBT2_uc010qay.1_Intron	p.A416D	NM_001029880	NP_001025051	WXS	Illumina HiSeq	Unspecified	Q5VUG0	SMBT2_HUMAN			11	1338	-			416			MBT 4.		A7MD09|Q9HCF5	Missense_Mutation	SNP	ENST00000361972.4	37	c.1247C>A	CCDS31138.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.086118	0.76642	.	.	ENSG00000198879	ENST00000361972;ENST00000397167	T;T	0.47528	0.84;0.84	5.4	4.3	0.51218	.	0.047328	0.85682	D	0.000000	T	0.74450	0.3718	H	0.95470	3.675	0.80722	D	1	D	0.63046	0.992	P	0.61132	0.884	T	0.83095	-0.0131	10	0.87932	D	0	.	14.7165	0.69272	0.0834:0.0:0.9166:0.0	.	416	Q5VUG0	SMBT2_HUMAN	D	416	ENSP00000355109:A416D;ENSP00000380353:A416D	ENSP00000355109:A416D	A	-	2	0	SFMBT2	7302462	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.809000	0.69172	2.530000	0.85305	0.563000	0.77884	GCT		0.532	SFMBT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046673.1	NM_001029880		102	74	1	0	8.32725e-61	0.01441	1.15883e-60	102	74				
GPR158	57512	broad.mit.edu	37	10	25887829	25887829	+	Missense_Mutation	SNP	A	A	G	rs371598390		TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr10:25887829A>G	ENST00000376351.3	+	11	3633	c.3274A>G	c.(3274-3276)Act>Gct	p.T1092A	GPR158_ENST00000490549.1_3'UTR	NM_020752.2	NP_065803.2	Q5T848	GP158_HUMAN	G protein-coupled receptor 158	1092					protein localization to plasma membrane (GO:0072659)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.T1092A(1)		breast(5)|cervix(1)|endometrium(9)|kidney(10)|large_intestine(20)|lung(56)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	119						GATTTCCAAGACTCCAGTTCT	0.517																																							uc001isj.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|large_intestine(2)|pancreas(1)|skin(1)	8						c.(3274-3276)ACT>GCT		G protein-coupled receptor 158 precursor		A	ALA/THR	0,4406		0,0,2203	76.0	82.0	80.0		3274	1.9	0.8	10		80	1,8599	1.2+/-3.3	0,1,4299	no	missense	GPR158	NM_020752.2	58	0,1,6502	GG,GA,AA		0.0116,0.0,0.0077	benign	1092/1216	25887829	1,13005	2203	4300	6503	SO:0001583	missense	57512					integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr10:25887829A>G	AB032962	CCDS31166.1	10p12.31	2012-08-21			ENSG00000151025	ENSG00000151025		"""GPCR / Class C : Orphans"""	23689	protein-coding gene	gene with protein product		614573					Standard	NM_020752		Approved	KIAA1136	uc001isj.3	Q5T848	OTTHUMG00000017832	ENST00000376351.3:c.3274A>G	10.37:g.25887829A>G	ENSP00000365529:p.Thr1092Ala		Somatic				GPR158_uc001isk.2_Missense_Mutation_p.T467A	p.T1092A	NM_020752	NP_065803	WXS	Illumina HiSeq	Unspecified	Q5T848	GP158_HUMAN			11	3334	+			1092			Cytoplasmic (Potential).		Q6QR81|Q9ULT3	Missense_Mutation	SNP	ENST00000376351.3	37	c.3274A>G	CCDS31166.1	.	.	.	.	.	.	.	.	.	.	A	3.842	-0.033572	0.07543	0.0	1.16E-4	ENSG00000151025	ENST00000376351	T	0.61040	0.14	5.85	1.93	0.25924	.	0.187498	0.37483	N	0.002064	T	0.35595	0.0937	L	0.27053	0.805	0.09310	N	0.999999	B	0.22480	0.07	B	0.19148	0.024	T	0.15723	-1.0427	10	0.12103	T	0.63	.	6.8118	0.23809	0.4179:0.3038:0.0:0.2782	.	1092	Q5T848	GP158_HUMAN	A	1092	ENSP00000365529:T1092A	ENSP00000365529:T1092A	T	+	1	0	GPR158	25927835	1.000000	0.71417	0.831000	0.32960	0.071000	0.16799	1.571000	0.36450	0.427000	0.26145	0.533000	0.62120	ACT		0.517	GPR158-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047248.2	XM_166110		88	54	0	0	0	0.01441	0	88	54				
FAM213A	84293	broad.mit.edu	37	10	82180281	82180281	+	Missense_Mutation	SNP	G	G	A			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr10:82180281G>A	ENST00000372181.1	+	1	528	c.58G>A	c.(58-60)Gga>Aga	p.G20R	FAM213A_ENST00000372187.5_Missense_Mutation_p.G20R|FAM213A_ENST00000372185.1_Missense_Mutation_p.G9R|FAM213A_ENST00000372188.1_Missense_Mutation_p.G20R	NM_001243778.1|NM_001243782.1	NP_001230707.1|NP_001230711.1	Q9BRX8	F213A_HUMAN	family with sequence similarity 213, member A	20	Thioredoxin fold. {ECO:0000250}.				oxidation-reduction process (GO:0055114)|regulation of osteoclast differentiation (GO:0045670)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	antioxidant activity (GO:0016209)	p.G20R(1)									CATTGGTGCAGGAGCCCTGGG	0.547																																							uc001kcc.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(58-60)GGA>AGA		hypothetical protein LOC84293 precursor							76.0	74.0	75.0					10																	82180281		2203	4300	6503	SO:0001583	missense	84293					extracellular region		g.chr10:82180281G>A	AF086462	CCDS7368.1, CCDS58089.1	10q23.1	2011-12-08	2011-12-08	2011-12-08	ENSG00000122378	ENSG00000122378			28651	protein-coding gene	gene with protein product	"""peroxiredoxin-like 2 activated in M-CSF stimulated monocytes"""		"""chromosome 10 open reading frame 58"""	C10orf58		11483580, 19951071	Standard	NM_032333		Approved	MGC4248, PAMM	uc001kce.4	Q9BRX8	OTTHUMG00000018614	ENST00000372181.1:c.58G>A	10.37:g.82180281G>A	ENSP00000361254:p.Gly20Arg		Somatic				C10orf58_uc001kcd.3_Missense_Mutation_p.G9R|C10orf58_uc001kce.3_Missense_Mutation_p.G20R|C10orf58_uc001kcf.3_Missense_Mutation_p.G20R	p.G20R	NM_032333	NP_115709	WXS	Illumina HiSeq	Unspecified	Q9BRX8	CJ058_HUMAN	Colorectal(32;0.229)		2	218	+			20					B2RD81|Q6UW08|Q8N2K3|Q8NBK9|Q96JR0	Missense_Mutation	SNP	ENST00000372181.1	37	c.58G>A	CCDS7368.1	.	.	.	.	.	.	.	.	.	.	G	31	5.067844	0.93950	.	.	ENSG00000122378	ENST00000372188;ENST00000372187;ENST00000372185;ENST00000372181	.	.	.	5.63	5.63	0.86233	.	0.099352	0.64402	D	0.000002	T	0.80717	0.4676	M	0.80982	2.52	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.82682	-0.0336	9	0.72032	D	0.01	-21.3146	17.1684	0.86822	0.0:0.0:1.0:0.0	.	20	Q9BRX8	PAMM_HUMAN	R	20;20;9;20	.	ENSP00000361254:G20R	G	+	1	0	C10orf58	82170261	1.000000	0.71417	0.978000	0.43139	0.971000	0.66376	7.358000	0.79466	2.654000	0.90174	0.655000	0.94253	GGA		0.547	FAM213A-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049077.2			5	129	0	0	0	0.000602	0	5	129				
OBFC1	79991	broad.mit.edu	37	10	105657388	105657388	+	Missense_Mutation	SNP	A	A	C			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr10:105657388A>C	ENST00000224950.3	-	7	838	c.671T>G	c.(670-672)tTt>tGt	p.F224C	OBFC1_ENST00000369764.1_Missense_Mutation_p.F224C|OBFC1_ENST00000466828.1_5'UTR	NM_024928.4	NP_079204.2	Q9H668	STN1_HUMAN	oligonucleotide/oligosaccharide-binding fold containing 1	224	Winged helix-turn-helix (wHTH) 1.				positive regulation of DNA replication (GO:0045740)|telomere maintenance (GO:0000723)|telomere maintenance via telomere lengthening (GO:0010833)	intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nuclear chromosome, telomeric region (GO:0000784)|nucleolus (GO:0005730)|nucleus (GO:0005634)|Stn1-Ten1 complex (GO:0070188)	single-stranded DNA binding (GO:0003697)|single-stranded telomeric DNA binding (GO:0043047)	p.F224C(1)		large_intestine(3)|lung(7)|ovary(1)|pancreas(2)	13		Colorectal(252;0.178)		Epithelial(162;3.39e-10)|all cancers(201;1.32e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0151)		CTGCTGGTAAAAGCTCTGCAC	0.547																																							uc001kxl.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(670-672)TTT>TGT		oligonucleotide/oligosaccharide-binding fold							120.0	105.0	110.0					10																	105657388		2203	4300	6503	SO:0001583	missense	79991				positive regulation of DNA replication|telomere maintenance via telomere lengthening		protein binding|single-stranded telomeric DNA binding	g.chr10:105657388A>C	BC017400	CCDS7552.1	10q25.1	2011-06-14				ENSG00000107960			26200	protein-coding gene	gene with protein product		613128				12477932	Standard	NM_024928		Approved	FLJ22559, bA541N10.2	uc001kxm.3	Q9H668		ENST00000224950.3:c.671T>G	10.37:g.105657388A>C	ENSP00000224950:p.Phe224Cys		Somatic				OBFC1_uc001kxm.2_Missense_Mutation_p.F224C|OBFC1_uc001kxn.2_RNA	p.F224C	NM_024928	NP_079204	WXS	Illumina HiSeq	Unspecified	Q9H668	STN1_HUMAN		Epithelial(162;3.39e-10)|all cancers(201;1.32e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0151)	6	746	-		Colorectal(252;0.178)	224					D3DR99|Q5TCZ0	Missense_Mutation	SNP	ENST00000224950.3	37	c.671T>G	CCDS7552.1	.	.	.	.	.	.	.	.	.	.	A	18.24	3.579232	0.65878	.	.	ENSG00000107960	ENST00000224950;ENST00000369764	T;T	0.68331	-0.32;-0.32	5.39	5.39	0.77823	Domain of unknown function DUF1879, CTS complex STN1 subunit (1);	0.000000	0.85682	D	0.000000	T	0.81361	0.4806	M	0.80183	2.485	0.58432	D	0.999995	D	0.89917	1.0	D	0.97110	1.0	D	0.83873	0.0275	10	0.87932	D	0	-15.8181	11.7965	0.52102	1.0:0.0:0.0:0.0	.	224	Q9H668	STN1_HUMAN	C	224	ENSP00000224950:F224C;ENSP00000358779:F224C	ENSP00000224950:F224C	F	-	2	0	OBFC1	105647378	1.000000	0.71417	1.000000	0.80357	0.891000	0.51852	5.061000	0.64319	2.031000	0.59945	0.528000	0.53228	TTT		0.547	OBFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050174.1	NM_024928		73	36	0	0	0	0.01441	0	73	36				
OR52M1	119772	broad.mit.edu	37	11	4566720	4566720	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr11:4566720G>T	ENST00000360213.1	+	1	300	c.300G>T	c.(298-300)ttG>ttT	p.L100F		NM_001004137.1	NP_001004137.1	Q8NGK5	O52M1_HUMAN	olfactory receptor, family 52, subfamily M, member 1	100						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L100F(1)		endometrium(2)|large_intestine(2)|lung(9)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	18		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;8.45e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0285)|LUSC - Lung squamous cell carcinoma(625;0.19)		ACGCCTGCTTGGGCCAAATGT	0.517																																							uc010qyf.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(298-300)TTG>TTT		olfactory receptor, family 52, subfamily M,							163.0	145.0	151.0					11																	4566720		2201	4298	6499	SO:0001583	missense	119772				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:4566720G>T	AB065789	CCDS31353.1	11p15.4	2012-08-09	2002-11-13	2002-11-15	ENSG00000197790	ENSG00000197790		"""GPCR / Class A : Olfactory receptors"""	15225	protein-coding gene	gene with protein product			"""olfactory receptor, family 52, subfamily M, member 1 pseudogene"""	OR52M1P			Standard	NM_001004137		Approved		uc010qyf.2	Q8NGK5	OTTHUMG00000165706	ENST00000360213.1:c.300G>T	11.37:g.4566720G>T	ENSP00000353343:p.Leu100Phe		Somatic					p.L100F	NM_001004137	NP_001004137	WXS	Illumina HiSeq	Unspecified	Q8NGK5	O52M1_HUMAN		Epithelial(150;8.45e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0285)|LUSC - Lung squamous cell carcinoma(625;0.19)	1	300	+		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)	100			Extracellular (Potential).			Missense_Mutation	SNP	ENST00000360213.1	37	c.300G>T	CCDS31353.1	.	.	.	.	.	.	.	.	.	.	G	13.67	2.306046	0.40795	.	.	ENSG00000197790	ENST00000360213	T	0.04603	3.59	4.99	1.79	0.24919	GPCR, rhodopsin-like superfamily (1);	0.000000	0.38111	N	0.001819	T	0.12347	0.0300	L	0.59912	1.85	0.24442	N	0.994521	D	0.89917	1.0	D	0.91635	0.999	T	0.05115	-1.0905	10	0.87932	D	0	.	3.3399	0.07115	0.0992:0.3108:0.4469:0.1431	.	100	Q8NGK5	O52M1_HUMAN	F	100	ENSP00000353343:L100F	ENSP00000353343:L100F	L	+	3	2	OR52M1	4523296	0.000000	0.05858	0.581000	0.28614	0.589000	0.36550	-1.509000	0.02264	0.756000	0.33013	0.655000	0.94253	TTG		0.517	OR52M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385847.1	NM_001004137		19	142	1	0	6.33239e-15	0.010504	8.29043e-15	19	142				
ANO5	203859	broad.mit.edu	37	11	22281108	22281108	+	Missense_Mutation	SNP	G	G	A			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr11:22281108G>A	ENST00000324559.8	+	15	1768	c.1451G>A	c.(1450-1452)cGc>cAc	p.R484H	CTD-3064C13.1_ENST00000526935.1_RNA	NM_001142649.1|NM_213599.2	NP_001136121.1|NP_998764.1	Q75V66	ANO5_HUMAN	anoctamin 5	484					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	intracellular calcium activated chloride channel activity (GO:0005229)	p.R484H(1)		breast(2)|central_nervous_system(3)|endometrium(1)|kidney(2)|large_intestine(12)|lung(36)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						ATTGTGTACCGCCTGTCAGTC	0.413																																							uc001mqi.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(3)|ovary(1)	4						c.(1450-1452)CGC>CAC		anoctamin 5 isoform a							227.0	195.0	206.0					11																	22281108		2203	4300	6503	SO:0001583	missense	203859					chloride channel complex|endoplasmic reticulum membrane	chloride channel activity	g.chr11:22281108G>A	AL833271	CCDS31444.1	11p15.1	2014-09-17	2008-08-28	2008-08-28	ENSG00000171714	ENSG00000171714		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	27337	protein-coding gene	gene with protein product		608662	"""transmembrane protein 16E"", ""limb girdle muscular dystrophy 2L (autosomal recessive)"""	TMEM16E, LGMD2L		15067359, 20096397, 24692353	Standard	NM_213599		Approved	GDD1	uc001mqi.2	Q75V66	OTTHUMG00000166051	ENST00000324559.8:c.1451G>A	11.37:g.22281108G>A	ENSP00000315371:p.Arg484His		Somatic				ANO5_uc001mqj.2_Missense_Mutation_p.R483H	p.R484H	NM_213599	NP_998764	WXS	Illumina HiSeq	Unspecified	Q75V66	ANO5_HUMAN			15	1768	+			484			Extracellular (Potential).			Missense_Mutation	SNP	ENST00000324559.8	37	c.1451G>A	CCDS31444.1	.	.	.	.	.	.	.	.	.	.	G	34	5.383489	0.95967	.	.	ENSG00000171714	ENST00000324559	T	0.66460	-0.21	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	D	0.88392	0.6424	H	0.95884	3.735	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91682	0.5359	10	0.87932	D	0	.	19.5418	0.95277	0.0:0.0:1.0:0.0	.	484	Q75V66	ANO5_HUMAN	H	484	ENSP00000315371:R484H	ENSP00000315371:R484H	R	+	2	0	ANO5	22237684	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	9.855000	0.99526	2.610000	0.88304	0.655000	0.94253	CGC		0.413	ANO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387615.1	NM_213599		18	108	0	0	0	0.012319	0	18	108				
TRAF6	7189	broad.mit.edu	37	11	36520069	36520069	+	Silent	SNP	A	A	G			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr11:36520069A>G	ENST00000526995.1	-	3	664	c.418T>C	c.(418-420)Ttg>Ctg	p.L140L	TRAF6_ENST00000348124.5_Silent_p.L140L|TRAF6_ENST00000529150.1_5'Flank	NM_004620.3	NP_004611.1	Q9Y4K3	TRAF6_HUMAN	TNF receptor-associated factor 6, E3 ubiquitin protein ligase	140	Interaction with TAX1BP1.				activation of MAPK activity (GO:0000187)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|activation of protein kinase activity (GO:0032147)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|apoptotic signaling pathway (GO:0097190)|bone resorption (GO:0045453)|cell development (GO:0048468)|cellular response to lipopolysaccharide (GO:0071222)|Fc-epsilon receptor signaling pathway (GO:0038095)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|interleukin-1-mediated signaling pathway (GO:0070498)|JNK cascade (GO:0007254)|membrane protein intracellular domain proteolysis (GO:0031293)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|osteoclast differentiation (GO:0030316)|positive regulation of apoptotic process (GO:0043065)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-6 biosynthetic process (GO:0045410)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell cytokine production (GO:0002726)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|protein autoubiquitination (GO:0051865)|protein complex assembly (GO:0006461)|protein K63-linked ubiquitination (GO:0070534)|protein polyubiquitination (GO:0000209)|regulation of immunoglobulin secretion (GO:0051023)|response to interleukin-1 (GO:0070555)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|T-helper 1 type immune response (GO:0042088)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	CD40 receptor complex (GO:0035631)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|lipid particle (GO:0005811)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	histone deacetylase binding (GO:0042826)|ligase activity (GO:0016874)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein kinase B binding (GO:0043422)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|signal transducer activity (GO:0004871)|thioesterase binding (GO:0031996)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin conjugating enzyme binding (GO:0031624)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.L140L(1)		NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(13)|ovary(2)|pancreas(1)	27	all_lung(20;0.211)	all_hematologic(20;0.107)				ATCTTGTGCAAACAACCTTCA	0.363																																							uc001mwr.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(418-420)TTG>CTG		TNF receptor-associated factor 6							125.0	119.0	121.0					11																	36520069		2202	4298	6500	SO:0001819	synonymous_variant	7189				activation of MAPK activity|activation of NF-kappaB-inducing kinase activity|anti-apoptosis|apoptosis|induction of apoptosis by extracellular signals|innate immune response|JNK cascade|membrane protein intracellular domain proteolysis|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|ossification|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-2 production|positive regulation of JUN kinase activity|positive regulation of NF-kappaB transcription factor activity|positive regulation of osteoclast differentiation|positive regulation of T cell cytokine production|protein autoubiquitination|protein K63-linked ubiquitination|response to interleukin-1|stress-activated MAPK cascade|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	CD40 receptor complex|cell cortex|cytosol|endosome membrane|internal side of plasma membrane|nuclear membrane	histone deacetylase binding|mitogen-activated protein kinase kinase kinase binding|protein kinase B binding|protein N-terminus binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr11:36520069A>G		CCDS7901.1	11p12	2013-01-09	2012-02-23		ENSG00000175104	ENSG00000175104		"""RING-type (C3HC4) zinc fingers"""	12036	protein-coding gene	gene with protein product		602355	"""TNF receptor-associated factor 6"""			8837778	Standard	NM_004620		Approved	RNF85	uc001mws.2	Q9Y4K3	OTTHUMG00000166391	ENST00000526995.1:c.418T>C	11.37:g.36520069A>G			Somatic				TRAF6_uc001mws.1_Silent_p.L140L	p.L140L	NM_145803	NP_665802	WXS	Illumina HiSeq	Unspecified	Q9Y4K3	TRAF6_HUMAN			4	758	-	all_lung(20;0.211)	all_hematologic(20;0.107)	140			Interaction with TAX1BP1.		A6NKI7|A8KAB3|D3DR16|Q8NEH5	Silent	SNP	ENST00000526995.1	37	c.418T>C	CCDS7901.1																																																																																				0.363	TRAF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389530.1	NM_145803		40	130	0	0	0	0.01441	0	40	130				
MAPK8IP1	9479	broad.mit.edu	37	11	45926281	45926281	+	Missense_Mutation	SNP	C	C	T			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr11:45926281C>T	ENST00000241014.2	+	9	1959	c.1789C>T	c.(1789-1791)Cgc>Tgc	p.R597C	MAPK8IP1_ENST00000395629.2_Missense_Mutation_p.R587C|RP11-618K13.2_ENST00000533218.1_RNA	NM_005456.3	NP_005447.1	Q9UQF2	JIP1_HUMAN	mitogen-activated protein kinase 8 interacting protein 1	597	Interaction with VRK2.|PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				JUN phosphorylation (GO:0007258)|negative regulation of apoptotic process (GO:0043066)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|positive regulation of signal transduction (GO:0009967)|regulation of JNK cascade (GO:0046328)|regulation of transcription, DNA-templated (GO:0006355)|vesicle-mediated transport (GO:0016192)	axonal growth cone (GO:0044295)|cell body (GO:0044297)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic growth cone (GO:0044294)|dentate gyrus mossy fiber (GO:0044302)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|synapse (GO:0045202)	kinesin binding (GO:0019894)|MAP-kinase scaffold activity (GO:0005078)|protein kinase inhibitor activity (GO:0004860)	p.R597C(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(2)|prostate(1)|skin(2)	24				GBM - Glioblastoma multiforme(35;0.231)		TGCCACCACCCGCCGGCTCAC	0.612																																							uc001nbr.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|breast(1)|skin(1)	4						c.(1789-1791)CGC>TGC		mitogen-activated protein kinase 8 interacting							77.0	79.0	79.0					11																	45926281		2203	4299	6502	SO:0001583	missense	9479				vesicle-mediated transport	nucleus|perinuclear region of cytoplasm	kinesin binding|MAP-kinase scaffold activity|protein kinase inhibitor activity	g.chr11:45926281C>T		CCDS7916.1	11p11.2	2009-07-24			ENSG00000121653	ENSG00000121653			6882	protein-coding gene	gene with protein product		604641		PRKM8IP		9235893, 9442013	Standard	NM_005456		Approved	IB1, JIP-1, JIP1	uc001nbr.3	Q9UQF2	OTTHUMG00000134324	ENST00000241014.2:c.1789C>T	11.37:g.45926281C>T	ENSP00000241014:p.Arg597Cys		Somatic					p.R597C	NM_005456	NP_005447	WXS	Illumina HiSeq	Unspecified	Q9UQF2	JIP1_HUMAN		GBM - Glioblastoma multiforme(35;0.231)	9	1959	+			597			PID.		D3DQP4|O43407	Missense_Mutation	SNP	ENST00000241014.2	37	c.1789C>T	CCDS7916.1	.	.	.	.	.	.	.	.	.	.	C	27.9	4.877396	0.91664	.	.	ENSG00000121653	ENST00000241014;ENST00000395629	T;T	0.21543	2.0;2.0	5.84	5.84	0.93424	Phosphotyrosine interaction domain (3);Pleckstrin homology-type (1);	0.000000	0.85682	D	0.000000	T	0.53690	0.1812	M	0.84326	2.69	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.56631	-0.7947	10	0.87932	D	0	-30.5229	20.1278	0.97990	0.0:1.0:0.0:0.0	.	597	Q9UQF2	JIP1_HUMAN	C	597;587	ENSP00000241014:R597C;ENSP00000378991:R587C	ENSP00000241014:R597C	R	+	1	0	MAPK8IP1	45882857	0.988000	0.35896	1.000000	0.80357	0.991000	0.79684	2.829000	0.48128	2.768000	0.95171	0.561000	0.74099	CGC		0.612	MAPK8IP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259405.1	NM_005456		23	86	0	0	0	0.005443	0	23	86				
OR4A47	403253	broad.mit.edu	37	11	48510483	48510483	+	Missense_Mutation	SNP	G	G	A	rs142333570	byFrequency	TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr11:48510483G>A	ENST00000446524.1	+	1	215	c.139G>A	c.(139-141)Gta>Ata	p.V47I		NM_001005512.2	NP_001005512.2	Q6IF82	O4A47_HUMAN	olfactory receptor, family 4, subfamily A, member 47	47						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V47I(1)		NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(18)|ovary(1)|skin(1)|urinary_tract(2)	29						TGTAGTGACCGTAACTGTCAG	0.418																																							uc010rhx.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(139-141)GTA>ATA		olfactory receptor, family 4, subfamily A,		G	ILE/VAL	4,4398		0,4,2197	53.0	49.0	50.0		139	-2.6	0.0	11	dbSNP_134	50	0,8596		0,0,4298	no	missense	OR4A47	NM_001005512.2	29	0,4,6495	AA,AG,GG		0.0,0.0909,0.0308	benign	47/310	48510483	4,12994	2201	4298	6499	SO:0001583	missense	403253				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:48510483G>A	BK004380	CCDS31490.1	11p11.2	2012-08-09			ENSG00000237388	ENSG00000237388		"""GPCR / Class A : Olfactory receptors"""	31266	protein-coding gene	gene with protein product							Standard	NM_001005512		Approved		uc010rhx.2	Q6IF82	OTTHUMG00000166581	ENST00000446524.1:c.139G>A	11.37:g.48510483G>A	ENSP00000412752:p.Val47Ile		Somatic					p.V47I	NM_001005512	NP_001005512	WXS	Illumina HiSeq	Unspecified	Q6IF82	O4A47_HUMAN			1	139	+			47			Helical; Name=1; (Potential).			Missense_Mutation	SNP	ENST00000446524.1	37	c.139G>A	CCDS31490.1	.	.	.	.	.	.	.	.	.	.	N	0	-2.755915	0.00085	9.09E-4	0.0	ENSG00000237388	ENST00000446524	T	0.01422	4.91	4.81	-2.56	0.06268	GPCR, rhodopsin-like superfamily (1);	0.283306	0.24856	N	0.035056	T	0.00496	0.0016	N	0.02120	-0.675	0.09310	N	1	B	0.12013	0.005	B	0.11329	0.006	T	0.44221	-0.9342	10	0.02654	T	1	.	6.8371	0.23943	0.5036:0.1212:0.3752:0.0	.	47	Q6IF82	O4A47_HUMAN	I	47	ENSP00000412752:V47I	ENSP00000412752:V47I	V	+	1	0	OR4A47	48467059	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-2.236000	0.01201	-0.561000	0.06094	-0.921000	0.02739	GTA		0.418	OR4A47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390559.1	NM_001005512		22	18	0	0	0	0.005443	0	22	18				
GLYATL1	92292	broad.mit.edu	37	11	58723260	58723260	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr11:58723260G>T	ENST00000317391.4	+	8	1009	c.669G>T	c.(667-669)atG>atT	p.M223I	RP11-142C4.6_ENST00000525714.1_RNA|GLYATL1_ENST00000300079.5_Missense_Mutation_p.M254I|RP11-142C4.6_ENST00000533954.1_RNA	NM_001220494.1	NP_001207423.1	Q969I3	GLYL1_HUMAN	glycine-N-acyltransferase-like 1	223						mitochondrion (GO:0005739)	glutamine N-acyltransferase activity (GO:0047946)|glycine N-acyltransferase activity (GO:0047961)	p.M254I(1)|p.M223I(1)		NS(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(19)|ovary(1)|skin(4)|urinary_tract(1)	34					Glycine(DB00145)	GGGTAACCATGGACCCTTCTT	0.522																																							uc001nnf.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(667-669)ATG>ATT		SubName: Full=Glycine acyltransferase family-C; SubName: Full=Glycine-N-acyltransferase-like 1, isoform CRA_a;	Glycine(DB00145)						59.0	55.0	56.0					11																	58723260		2201	4295	6496	SO:0001583	missense	92292					mitochondrion	glycine N-acyltransferase activity	g.chr11:58723260G>T	AK091965	CCDS31556.1, CCDS55768.1	11q12.1	2014-08-12			ENSG00000166840	ENSG00000166840			30519	protein-coding gene	gene with protein product		614761				12477932	Standard	NM_080661		Approved	MGC15397, FLJ34646	uc001nnh.2	Q969I3	OTTHUMG00000167221	ENST00000317391.4:c.669G>T	11.37:g.58723260G>T	ENSP00000322223:p.Met223Ile		Somatic				uc001nng.1_Intron|GLYATL1_uc001nnh.1_Missense_Mutation_p.M254I|GLYATL1_uc001nni.1_Missense_Mutation_p.M223I|GLYATL1_uc001nnj.1_Missense_Mutation_p.M223I	p.M223I			WXS	Illumina HiSeq	Unspecified	Q969I3	GLYL1_HUMAN			8	1045	+			223					A6NDT0|Q7Z510|Q8NAW8	Missense_Mutation	SNP	ENST00000317391.4	37	c.669G>T	CCDS55768.1	.	.	.	.	.	.	.	.	.	.	.	15.37	2.814871	0.50527	.	.	ENSG00000166840	ENST00000444580;ENST00000317391;ENST00000300079	T;T	0.16073	2.37;2.37	2.62	2.62	0.31277	Acyl-CoA N-acyltransferase (2);Glycine N-acyltransferase, C-terminal (1);	0.315214	0.22438	U	0.060044	T	0.22205	0.0535	M	0.73430	2.235	0.09310	N	1	P;P	0.40534	0.673;0.72	B;B	0.42959	0.351;0.403	T	0.06373	-1.0830	10	0.41790	T	0.15	.	8.4486	0.32858	0.0:0.0:1.0:0.0	.	254;223	Q969I3-2;Q969I3	.;GLYL1_HUMAN	I	200;223;254	ENSP00000322223:M223I;ENSP00000300079:M254I	ENSP00000300079:M254I	M	+	3	0	GLYATL1	58479836	0.960000	0.32886	0.073000	0.20177	0.303000	0.27691	2.196000	0.42686	1.284000	0.44531	0.411000	0.27672	ATG		0.522	GLYATL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393783.1	NM_080661		13	39	1	0	1.61879e-10	0.013537	2.00087e-10	13	39				
FAM111B	374393	broad.mit.edu	37	11	58892054	58892054	+	Missense_Mutation	SNP	C	C	G			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr11:58892054C>G	ENST00000343597.3	+	4	675	c.484C>G	c.(484-486)Caa>Gaa	p.Q162E	FAM111B_ENST00000411426.1_Missense_Mutation_p.Q132E|FAM111B_ENST00000529618.1_Missense_Mutation_p.Q132E	NM_198947.3	NP_945185.1	Q6SJ93	F111B_HUMAN	family with sequence similarity 111, member B	162							catalytic activity (GO:0003824)	p.Q162E(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(12)|ovary(3)|pancreas(1)|skin(1)	40						TACATTTGGTCAAAGAAAGAG	0.338																																							uc001nnl.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(484-486)CAA>GAA		hypothetical protein LOC374393 isoform a							74.0	72.0	73.0					11																	58892054		2201	4294	6495	SO:0001583	missense	374393						catalytic activity	g.chr11:58892054C>G	BC062456	CCDS7972.1, CCDS44611.1	11q12.1	2014-03-13			ENSG00000189057	ENSG00000189057			24200	protein-coding gene	gene with protein product		615584				24268661	Standard	NM_198947		Approved	CANP	uc001nnl.3	Q6SJ93	OTTHUMG00000167279	ENST00000343597.3:c.484C>G	11.37:g.58892054C>G	ENSP00000341565:p.Gln162Glu		Somatic				FAM111B_uc001nnm.2_Missense_Mutation_p.Q132E|FAM111B_uc010rko.1_Missense_Mutation_p.Q132E	p.Q162E	NM_198947	NP_945185	WXS	Illumina HiSeq	Unspecified	Q6SJ93	F111B_HUMAN			4	727	+			162					B4E2G2|Q6P661	Missense_Mutation	SNP	ENST00000343597.3	37	c.484C>G	CCDS7972.1	.	.	.	.	.	.	.	.	.	.	C	5.885	0.347393	0.11126	.	.	ENSG00000189057	ENST00000411426;ENST00000529618;ENST00000534403;ENST00000343597	T;T;T	0.30714	1.52;1.52;1.52	3.86	-0.446	0.12238	.	1.309290	0.05713	N	0.596399	T	0.33527	0.0866	M	0.69823	2.125	0.09310	N	1	B	0.20550	0.046	B	0.12837	0.008	T	0.41360	-0.9513	10	0.62326	D	0.03	.	8.3317	0.32191	0.5816:0.2757:0.1426:0.0	.	162	Q6SJ93	F111B_HUMAN	E	132;132;132;162	ENSP00000393855:Q132E;ENSP00000432875:Q132E;ENSP00000341565:Q162E	ENSP00000341565:Q162E	Q	+	1	0	FAM111B	58648630	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.853000	0.04303	-0.055000	0.13244	-0.152000	0.13540	CAA		0.338	FAM111B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393974.1	NM_198947		4	51	0	0	0	0.009096	0	4	51				
NPAS4	266743	broad.mit.edu	37	11	66189606	66189606	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr11:66189606G>T	ENST00000311034.2	+	2	367	c.191G>T	c.(190-192)gGc>gTc	p.G64V		NM_178864.3	NP_849195.2	Q8IUM7	NPAS4_HUMAN	neuronal PAS domain protein 4	64					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)	p.G64V(1)		breast(4)|endometrium(2)|kidney(3)|large_intestine(11)|liver(2)|lung(20)|ovary(1)|prostate(3)|skin(3)	49						CCTCTGGCGGGCCCCACGGGG	0.572																																							uc001ohx.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(190-192)GGC>GTC		neuronal PAS domain protein 4							37.0	40.0	39.0					11																	66189606		2200	4295	6495	SO:0001583	missense	266743				transcription, DNA-dependent		DNA binding|signal transducer activity	g.chr11:66189606G>T	AB049469	CCDS8138.1	11q13.2	2013-05-21			ENSG00000174576	ENSG00000174576		"""Basic helix-loop-helix proteins"""	18983	protein-coding gene	gene with protein product		608554				14701734	Standard	NM_178864		Approved	PASD10, NXF, Le-PAS, bHLHe79	uc001ohx.1	Q8IUM7	OTTHUMG00000167045	ENST00000311034.2:c.191G>T	11.37:g.66189606G>T	ENSP00000311196:p.Gly64Val		Somatic				NPAS4_uc010rpc.1_5'UTR	p.G64V	NM_178864	NP_849195	WXS	Illumina HiSeq	Unspecified	Q8IUM7	NPAS4_HUMAN			2	367	+			64					B7ZL81|Q8N8S5|Q8N9Q9	Missense_Mutation	SNP	ENST00000311034.2	37	c.191G>T	CCDS8138.1	.	.	.	.	.	.	.	.	.	.	G	14.90	2.674216	0.47781	.	.	ENSG00000174576	ENST00000311034	T	0.50813	0.73	4.8	3.89	0.44902	.	0.110839	0.40908	D	0.000993	T	0.37128	0.0992	L	0.47716	1.5	0.58432	D	0.999996	B	0.34214	0.442	B	0.33799	0.17	T	0.18178	-1.0345	10	0.35671	T	0.21	-8.2616	7.3964	0.26939	0.1947:0.0:0.8053:0.0	.	64	Q8IUM7	NPAS4_HUMAN	V	64	ENSP00000311196:G64V	ENSP00000311196:G64V	G	+	2	0	NPAS4	65946182	0.099000	0.21834	0.995000	0.50966	0.931000	0.56810	0.472000	0.22116	1.369000	0.46134	0.563000	0.77884	GGC		0.572	NPAS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392634.1	NM_178864		11	65	1	0	1.61879e-10	0.013537	2.00087e-10	11	65				
CCDC87	55231	broad.mit.edu	37	11	66359594	66359594	+	Missense_Mutation	SNP	G	G	A			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr11:66359594G>A	ENST00000333861.3	-	1	960	c.893C>T	c.(892-894)tCc>tTc	p.S298F	CCS_ENST00000310190.4_5'Flank|CCS_ENST00000533244.1_5'Flank	NM_018219.2	NP_060689.2	Q9NVE4	CCD87_HUMAN	coiled-coil domain containing 87	298					cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)			p.S298F(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28						AGGCGAGGGGGAAGCCCTGCT	0.617																																							uc001oiq.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(892-894)TCC>TTC		coiled-coil domain containing 87							46.0	50.0	49.0					11																	66359594		2200	4295	6495	SO:0001583	missense	55231							g.chr11:66359594G>A	BC034469	CCDS8145.1	11q13.2	2006-03-15			ENSG00000182791	ENSG00000182791			25579	protein-coding gene	gene with protein product						12477932	Standard	NM_018219		Approved	FLJ10786	uc001oiq.4	Q9NVE4	OTTHUMG00000167237	ENST00000333861.3:c.893C>T	11.37:g.66359594G>A	ENSP00000328487:p.Ser298Phe		Somatic				CCS_uc001oir.2_5'Flank	p.S298F	NM_018219	NP_060689	WXS	Illumina HiSeq	Unspecified	Q9NVE4	CCD87_HUMAN			1	961	-			298					Q8NE76	Missense_Mutation	SNP	ENST00000333861.3	37	c.893C>T	CCDS8145.1	.	.	.	.	.	.	.	.	.	.	G	1.572	-0.533797	0.04082	.	.	ENSG00000182791	ENST00000333861	T	0.30981	1.51	4.6	-0.874	0.10631	.	1.790020	0.03076	N	0.157868	T	0.19967	0.0480	L	0.54323	1.7	0.09310	N	1	P	0.35982	0.531	B	0.27608	0.081	T	0.09143	-1.0688	10	0.09338	T	0.73	.	0.8085	0.01089	0.1877:0.1575:0.3322:0.3226	.	298	Q9NVE4	CCD87_HUMAN	F	298	ENSP00000328487:S298F	ENSP00000328487:S298F	S	-	2	0	CCDC87	66116170	0.000000	0.05858	0.000000	0.03702	0.122000	0.20287	0.317000	0.19487	-0.022000	0.13986	0.514000	0.50259	TCC		0.617	CCDC87-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393825.1	NM_018219		37	133	0	0	0	0.004878	0	37	133				
NUMA1	4926	broad.mit.edu	37	11	71719881	71719881	+	Missense_Mutation	SNP	G	G	C			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr11:71719881G>C	ENST00000393695.3	-	20	5400	c.5069C>G	c.(5068-5070)gCa>gGa	p.A1690G	NUMA1_ENST00000351960.6_Missense_Mutation_p.A554G|NUMA1_ENST00000358965.6_Missense_Mutation_p.A1676G	NM_006185.2	NP_006176.2			nuclear mitotic apparatus protein 1									p.A1690G(1)		central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(12)|lung(20)|ovary(5)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	65						CTGCTGGTCTGCATGGGCAAC	0.577			T	RARA	APL																																		uc001orl.1		NA		Dom	yes		11	11q13	4926	T	nuclear mitotic apparatus protein 1			L	RARA		APL		1	Substitution - Missense(1)		lung(1)	ovary(3)|lung(2)|skin(2)|central_nervous_system(1)	8						c.(5068-5070)GCA>GGA		nuclear mitotic apparatus protein 1							65.0	69.0	67.0					11																	71719881		2200	4293	6493	SO:0001583	missense	4926				G2/M transition of mitotic cell cycle|mitotic anaphase|nucleus organization	chromosome|cytosol|nucleoplasm|spindle microtubule|spindle pole	protein binding|structural molecule activity	g.chr11:71719881G>C	Z11584	CCDS31633.1, CCDS66156.1	11q13	2008-02-05				ENSG00000137497			8059	protein-coding gene	gene with protein product		164009				8406455	Standard	NM_006185		Approved		uc001orl.1	Q14980		ENST00000393695.3:c.5069C>G	11.37:g.71719881G>C	ENSP00000377298:p.Ala1690Gly		Somatic				NUMA1_uc001orj.2_5'UTR|NUMA1_uc009ysw.1_Missense_Mutation_p.A1239G|NUMA1_uc001ork.1_Missense_Mutation_p.A554G|NUMA1_uc001orm.1_Missense_Mutation_p.A1676G|NUMA1_uc001orn.2_Missense_Mutation_p.A1253G	p.A1690G	NM_006185	NP_006176	WXS	Illumina HiSeq	Unspecified	Q14980	NUMA1_HUMAN			20	5241	-			1690			Potential.			Missense_Mutation	SNP	ENST00000393695.3	37	c.5069C>G	CCDS31633.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.7|22.7	4.325499|4.325499	0.81580|0.81580	.|.	.|.	ENSG00000137497|ENSG00000137497	ENST00000351960;ENST00000358965;ENST00000393695;ENST00000359652;ENST00000536544|ENST00000541584	T;T;T|.	0.42131|.	1.78;0.98;1.97|.	4.74|4.74	4.74|4.74	0.60224|0.60224	.|.	0.000000|.	0.53938|.	D|.	0.000060|.	T|T	0.55847|0.55847	0.1946|0.1946	L|L	0.27053|0.27053	0.805|0.805	0.45097|0.45097	D|D	0.998112|0.998112	D;D;D;D;D|.	0.76494|.	0.999;0.99;0.999;0.999;0.998|.	D;D;D;D;D|.	0.83275|.	0.983;0.98;0.996;0.983;0.941|.	T|T	0.50980|0.50980	-0.8763|-0.8763	10|5	0.30854|.	T|.	0.27|.	.|.	17.8772|17.8772	0.88828|0.88828	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1696;1160;1676;1690;554|.	Q4LE64;Q59HB8;Q14980-2;Q14980;Q9BTE9|.	.;.;.;NUMA1_HUMAN;.|.	G|E	554;1676;1690;1239;645|521	ENSP00000260051:A554G;ENSP00000351851:A1676G;ENSP00000377298:A1690G|.	ENSP00000260051:A554G|.	A|Q	-|-	2|1	0|0	NUMA1|NUMA1	71397529|71397529	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.951000|0.951000	0.60555|0.60555	6.645000|6.645000	0.74343|0.74343	2.618000|2.618000	0.88619|0.88619	0.561000|0.561000	0.74099|0.74099	GCA|CAG		0.577	NUMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395769.1			13	161	0	0	0	0.004007	0	13	161				
DPAGT1	1798	broad.mit.edu	37	11	118971518	118971518	+	Silent	SNP	G	G	A			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr11:118971518G>A	ENST00000409993.2	-	5	1869	c.318C>T	c.(316-318)tgC>tgT	p.C106C	DPAGT1_ENST00000432443.2_5'UTR|DPAGT1_ENST00000354202.4_Silent_p.C106C|DPAGT1_ENST00000445653.1_5'UTR			Q9H3H5	GPT_HUMAN	dolichyl-phosphate (UDP-N-acetylglucosamine) N-acetylglucosaminephosphotransferase 1 (GlcNAc-1-P transferase)	106					cellular protein metabolic process (GO:0044267)|dolichol biosynthetic process (GO:0019408)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)|protein oligomerization (GO:0051259)|UDP-N-acetylglucosamine metabolic process (GO:0006047)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	phospho-N-acetylmuramoyl-pentapeptide-transferase activity (GO:0008963)|transferase activity, transferring glycosyl groups (GO:0016757)|UDP-N-acetylglucosamine-dolichyl-phosphate N-acetylglucosaminephosphotransferase activity (GO:0003975)	p.C106C(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(2)	17	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.55e-05)		AGATCATGCAGCAGATGGCAA	0.557											OREG0021396	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001pvi.2		NA																	1	Substitution - coding silent(1)		lung(1)	breast(2)|ovary(1)	3						c.(316-318)TGC>TGT		UDP-N-acetylglucosamine-dolichyl-phosphate							65.0	61.0	62.0					11																	118971518		2200	4295	6495	SO:0001819	synonymous_variant	1798				dolichol biosynthetic process|dolichol-linked oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine|protein oligomerization	integral to endoplasmic reticulum membrane|microsome	phospho-N-acetylmuramoyl-pentapeptide-transferase activity|transferase activity, transferring glycosyl groups|UDP-N-acetylglucosamine-dolichyl-phosphate N-acetylglucosaminephosphotransferase activity	g.chr11:118971518G>A	Z82022	CCDS8411.1	11q23.3	2007-12-14			ENSG00000172269	ENSG00000172269	2.7.8.15		2995	protein-coding gene	gene with protein product		191350		DPAGT2, DPAGT		8244387	Standard	NM_001382		Approved	GPT, D11S366, DGPT, ALG7, CDG-Ij	uc001pvi.3	Q9H3H5	OTTHUMG00000153533	ENST00000409993.2:c.318C>T	11.37:g.118971518G>A			Somatic	OREG0021396	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1492	DPAGT1_uc001pvj.2_5'UTR|DPAGT1_uc009zaq.2_RNA|DPAGT1_uc001pvk.2_Intron|DPAGT1_uc010ryz.1_Silent_p.C106C|DPAGT1_uc001pvm.1_5'UTR|DPAGT1_uc010rza.1_5'UTR	p.C106C	NM_001382	NP_001373	WXS	Illumina HiSeq	Unspecified	Q9H3H5	GPT_HUMAN		BRCA - Breast invasive adenocarcinoma(274;7.55e-05)	3	738	-	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)	106			Helical; (Potential).		O15216|Q86WV9|Q9BWE6	Silent	SNP	ENST00000409993.2	37	c.318C>T	CCDS8411.1																																																																																				0.557	DPAGT1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331527.2	NM_001382		12	52	0	0	0	0.00245	0	12	52				
C11orf63	79864	broad.mit.edu	37	11	122805201	122805201	+	Missense_Mutation	SNP	T	T	C			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr11:122805201T>C	ENST00000531316.1	+	4	1144	c.1052T>C	c.(1051-1053)aTg>aCg	p.M351T	C11orf63_ENST00000227349.2_Missense_Mutation_p.M351T			Q6NUN7	CK063_HUMAN	chromosome 11 open reading frame 63	351					axoneme assembly (GO:0035082)|brain development (GO:0007420)|cerebrospinal fluid secretion (GO:0033326)|ciliary basal body organization (GO:0032053)			p.M351T(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(13)|lung(14)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	47		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.018)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.34e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0311)		CCTTCTGACATGGTGAATGAC	0.418																																							uc001pym.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(1051-1053)ATG>ACG		hypothetical protein LOC79864 isoform 1							71.0	59.0	63.0					11																	122805201		2202	4299	6501	SO:0001583	missense	79864							g.chr11:122805201T>C	BC068507	CCDS8438.1, CCDS8439.1	11q24.1	2012-05-25			ENSG00000109944	ENSG00000109944			26288	protein-coding gene	gene with protein product						12477932	Standard	NM_024806		Approved	FLJ23554	uc001pym.4	Q6NUN7	OTTHUMG00000166027	ENST00000531316.1:c.1052T>C	11.37:g.122805201T>C	ENSP00000431669:p.Met351Thr		Somatic					p.M351T	NM_024806	NP_079082	WXS	Illumina HiSeq	Unspecified	Q6NUN7	CK063_HUMAN		BRCA - Breast invasive adenocarcinoma(274;5.34e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0311)	5	1349	+		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.018)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)	351					A8K6G0|Q96GB5|Q9H5D6	Missense_Mutation	SNP	ENST00000531316.1	37	c.1052T>C	CCDS8438.1	.	.	.	.	.	.	.	.	.	.	T	0.008	-1.887649	0.00527	.	.	ENSG00000109944	ENST00000227349;ENST00000531316	T;T	0.19250	2.16;2.16	5.46	1.43	0.22495	.	1.596180	0.03510	N	0.219412	T	0.04363	0.0120	N	0.00237	-1.79	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.37957	-0.9683	10	0.07030	T	0.85	1.5554	1.9584	0.03381	0.1384:0.4936:0.1345:0.2335	.	351	Q6NUN7	CK063_HUMAN	T	351	ENSP00000227349:M351T;ENSP00000431669:M351T	ENSP00000227349:M351T	M	+	2	0	C11orf63	122310411	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.015000	0.12634	0.007000	0.14760	-0.221000	0.12465	ATG		0.418	C11orf63-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387511.1	NM_024806		3	36	0	0	0	0.004672	0	3	36				
PTPN6	5777	broad.mit.edu	37	12	7060825	7060825	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr12:7060825G>T	ENST00000318974.9	+	2	306	c.62G>T	c.(61-63)cGa>cTa	p.R21L	PTPN6_ENST00000447931.2_Intron|PTPN6_ENST00000456013.1_Missense_Mutation_p.R21L|PTPN6_ENST00000399448.1_Missense_Mutation_p.R23L	NM_002831.5	NP_002822.2	P29350	PTN6_HUMAN	protein tyrosine phosphatase, non-receptor type 6	21	SH2 1. {ECO:0000255|PROSITE- ProRule:PRU00191}.				abortive mitotic cell cycle (GO:0033277)|apoptotic process (GO:0006915)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cytokine-mediated signaling pathway (GO:0019221)|G-protein coupled receptor signaling pathway (GO:0007186)|interferon-gamma-mediated signaling pathway (GO:0060333)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|leukocyte migration (GO:0050900)|megakaryocyte development (GO:0035855)|natural killer cell mediated cytotoxicity (GO:0042267)|negative regulation of B cell receptor signaling pathway (GO:0050859)|negative regulation of cell proliferation (GO:0008285)|negative regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002924)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of T cell receptor signaling pathway (GO:0050860)|peptidyl-tyrosine dephosphorylation (GO:0035335)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell proliferation (GO:0008284)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|protein dephosphorylation (GO:0006470)|regulation of B cell differentiation (GO:0045577)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|T cell costimulation (GO:0031295)|type I interferon signaling pathway (GO:0060337)	alpha-beta T cell receptor complex (GO:0042105)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.R21L(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(5)|prostate(3)	18						CTCAAGGGCCGAGGTGTCCAC	0.672																																							uc001qsb.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(61-63)CGA>CTA		protein tyrosine phosphatase, non-receptor type							57.0	64.0	62.0					12																	7060825		1962	4161	6123	SO:0001583	missense	5777				apoptosis|cell junction assembly|G-protein coupled receptor protein signaling pathway|interferon-gamma-mediated signaling pathway|leukocyte migration|negative regulation of peptidyl-tyrosine phosphorylation|platelet activation|positive regulation of cell proliferation|positive regulation of phosphatidylinositol 3-kinase cascade|regulation of G1/S transition of mitotic cell cycle|regulation of interferon-gamma-mediated signaling pathway|regulation of type I interferon-mediated signaling pathway|T cell costimulation|type I interferon-mediated signaling pathway	cytosol|membrane|nucleus	protein binding|protein tyrosine phosphatase activity	g.chr12:7060825G>T		CCDS41744.1, CCDS44820.1, CCDS44821.1	12p13.31	2013-02-14			ENSG00000111679	ENSG00000111679		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"", ""SH2 domain containing"""	9658	protein-coding gene	gene with protein product		176883				1639416	Standard	NM_080548		Approved	HCP, HCPH, PTP-1C, SHP-1, SHP1	uc001qsa.1	P29350	OTTHUMG00000168518	ENST00000318974.9:c.62G>T	12.37:g.7060825G>T	ENSP00000326010:p.Arg21Leu		Somatic				PTPN6_uc001qsa.1_Missense_Mutation_p.R23L|PTPN6_uc010sfr.1_Intron|PTPN6_uc009zfl.1_Missense_Mutation_p.R21L|PTPN6_uc010sfs.1_5'UTR	p.R21L	NM_002831	NP_002822	WXS	Illumina HiSeq	Unspecified	P29350	PTN6_HUMAN			2	304	+			21			SH2 1.		A8K306|G3V0F8|Q969V8|Q9UK67	Missense_Mutation	SNP	ENST00000318974.9	37	c.62G>T	CCDS44820.1	.	.	.	.	.	.	.	.	.	.	G	19.59	3.855379	0.71719	.	.	ENSG00000111679	ENST00000543115;ENST00000399448;ENST00000538715;ENST00000318974;ENST00000456013;ENST00000536521;ENST00000541698	D;D;D;D;D;D;D	0.88818	-2.43;-2.43;-2.43;-2.43;-2.43;-2.43;-2.43	4.72	3.82	0.43975	SH2 motif (4);	0.000000	0.64402	D	0.000006	D	0.88596	0.6479	M	0.73430	2.235	0.80722	D	1	P;P;P	0.40970	0.734;0.543;0.543	B;B;B	0.42319	0.264;0.383;0.383	D	0.88719	0.3228	10	0.45353	T	0.12	.	12.2402	0.54538	0.0827:0.0:0.9173:0.0	.	21;21;23	G3V0F8;P29350;Q53XS4	.;PTN6_HUMAN;.	L	42;23;21;21;21;21;21	ENSP00000443393:R42L;ENSP00000382376:R23L;ENSP00000438740:R21L;ENSP00000326010:R21L;ENSP00000391592:R21L;ENSP00000444337:R21L;ENSP00000445646:R21L	ENSP00000326010:R21L	R	+	2	0	PTPN6	6931086	1.000000	0.71417	0.943000	0.38184	0.930000	0.56654	8.022000	0.88759	2.168000	0.68352	0.491000	0.48974	CGA		0.672	PTPN6-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400023.1	NM_002831		12	86	1	0	0.000151284	0.001855	0.000168188	12	86				
PDZRN4	29951	broad.mit.edu	37	12	41587896	41587896	+	Missense_Mutation	SNP	G	G	A			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr12:41587896G>A	ENST00000402685.2	+	3	757	c.749G>A	c.(748-750)gGa>gAa	p.G250E		NM_001164595.1	NP_001158067.1	Q6ZMN7	PZRN4_HUMAN	PDZ domain containing ring finger 4	250	PDZ 1. {ECO:0000255|PROSITE- ProRule:PRU00143}.						ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.G250E(1)		breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	77	all_cancers(12;0.000673)	Lung NSC(34;0.0205)|all_lung(34;0.0264)				AATCAGGAAGGAACATCGACT	0.318																																							uc010skn.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(3)|skin(3)|ovary(2)|large_intestine(1)|kidney(1)|pancreas(1)	11						c.(151-153)GGA>GAA		PDZ domain containing RING finger 4 isoform 2							50.0	48.0	49.0					12																	41587896		1568	3582	5150	SO:0001583	missense	29951						ubiquitin-protein ligase activity|zinc ion binding	g.chr12:41587896G>A	AK094690	CCDS8739.1, CCDS53777.1	12q12	2008-08-14	2008-08-14			ENSG00000165966		"""RING-type (C3HC4) zinc fingers"""	30552	protein-coding gene	gene with protein product	"""similar to semaF cytoplasmic domain associated protein 3"""	609730				11230166, 15010864	Standard	NM_013377		Approved	DKFZp434B0417, LNX4, FLJ33777, IMAGE5767589	uc010skn.2	Q6ZMN7		ENST00000402685.2:c.749G>A	12.37:g.41587896G>A	ENSP00000384197:p.Gly250Glu		Somatic					p.G51E	NM_013377	NP_037509	WXS	Illumina HiSeq	Unspecified	Q6ZMN7	PZRN4_HUMAN			3	220	+	all_cancers(12;0.000673)	Lung NSC(34;0.0205)|all_lung(34;0.0264)	250			PDZ 1.		Q52LY3|Q52LY4|Q6N052|Q8IUU1|Q9NTP7	Missense_Mutation	SNP	ENST00000402685.2	37	c.152G>A	CCDS53777.1	.	.	.	.	.	.	.	.	.	.	G	12.06	1.823186	0.32237	.	.	ENSG00000165966	ENST00000402685	T	0.75154	-0.91	4.63	3.49	0.39957	PDZ/DHR/GLGF (4);	.	.	.	.	T	0.65491	0.2696	L	0.58302	1.8	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.55717	-0.8097	9	0.15066	T	0.55	-3.6762	8.7439	0.34573	0.9092:0.0:0.0908:0.0	.	250	Q6ZMN7	PZRN4_HUMAN	E	250	ENSP00000384197:G250E	ENSP00000384197:G250E	G	+	2	0	PDZRN4	39874163	1.000000	0.71417	0.336000	0.25522	0.080000	0.17528	3.105000	0.50314	0.886000	0.36113	-0.469000	0.05056	GGA		0.318	PDZRN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403701.1	NM_013377		6	48	0	0	0	0.001168	0	6	48				
TUBA1C	84790	broad.mit.edu	37	12	49666727	49666727	+	Missense_Mutation	SNP	A	A	G			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr12:49666727A>G	ENST00000301072.6	+	4	1342	c.1067A>G	c.(1066-1068)aAt>aGt	p.N356S	TUBA1C_ENST00000541364.1_Missense_Mutation_p.N426S|RP11-161H23.5_ENST00000550468.2_RNA	NM_032704.3	NP_116093.1	Q9BQE3	TBA1C_HUMAN	tubulin, alpha 1c	356					'de novo' posttranslational protein folding (GO:0051084)|cell division (GO:0051301)|cellular protein metabolic process (GO:0044267)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasmic microtubule (GO:0005881)|microtubule (GO:0005874)|nucleus (GO:0005634)|vesicle (GO:0031982)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.N356S(1)		endometrium(1)|large_intestine(3)|liver(1)|lung(7)|skin(1)	13						GTTGGCATTAATTACCAGCCT	0.552																																							uc001rtt.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1066-1068)AAT>AGT		tubulin alpha 6							70.0	59.0	63.0					12																	49666727		2203	4300	6503	SO:0001583	missense	84790				'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|protein binding|structural molecule activity	g.chr12:49666727A>G	BC004949	CCDS8782.1	12q13.12	2007-03-16	2007-02-12	2007-02-12		ENSG00000167553		"""Tubulins"""	20768	protein-coding gene	gene with protein product			"""tubulin, alpha 6"""	TUBA6		7821789	Standard	NM_032704		Approved	MGC14580, MGC10851, bcm948	uc001rtt.1	Q9BQE3		ENST00000301072.6:c.1067A>G	12.37:g.49666727A>G	ENSP00000301072:p.Asn356Ser		Somatic				TUBA1C_uc001rts.2_Missense_Mutation_p.N321S|TUBA1C_uc010smh.1_Missense_Mutation_p.N426S|uc010smi.1_5'UTR	p.N356S	NM_032704	NP_116093	WXS	Illumina HiSeq	Unspecified	Q9BQE3	TBA1C_HUMAN			4	1167	+			356						Missense_Mutation	SNP	ENST00000301072.6	37	c.1067A>G	CCDS8782.1	.	.	.	.	.	.	.	.	.	.	A	15.90	2.968471	0.53614	.	.	ENSG00000167553	ENST00000541364;ENST00000301072;ENST00000321665	D;D	0.84070	-1.8;-1.8	4.89	4.89	0.63831	Tubulin/FtsZ, 2-layer sandwich domain (3);Tubulin/FtsZ, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.92319	0.7563	M	0.92317	3.295	0.80722	D	1	D;P	0.63046	0.992;0.812	D;P	0.66602	0.945;0.641	D	0.94067	0.7332	10	0.87932	D	0	.	14.2423	0.65966	1.0:0.0:0.0:0.0	.	426;356	F5H5D3;Q9BQE3	.;TBA1C_HUMAN	S	426;356;226	ENSP00000443475:N426S;ENSP00000301072:N356S	ENSP00000301072:N356S	N	+	2	0	TUBA1C	47952994	1.000000	0.71417	0.941000	0.38009	0.956000	0.61745	7.056000	0.76662	2.154000	0.67381	0.454000	0.30748	AAT		0.552	TUBA1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404424.1	NM_032704		8	76	0	0	0	0.004482	0	8	76				
EIF4B	1975	broad.mit.edu	37	12	53412608	53412608	+	Missense_Mutation	SNP	G	G	A			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr12:53412608G>A	ENST00000262056.9	+	3	504	c.178G>A	c.(178-180)Gac>Aac	p.D60N	EIF4B_ENST00000416762.3_Missense_Mutation_p.D60N|RP11-983P16.4_ENST00000552905.1_RNA|EIF4B_ENST00000420463.3_Missense_Mutation_p.D60N|RP11-983P16.4_ENST00000549388.1_RNA|EIF4B_ENST00000551527.1_3'UTR	NM_001417.4	NP_001408.2	P23588	IF4B_HUMAN	eukaryotic translation initiation factor 4B	60					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|insulin receptor signaling pathway (GO:0008286)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of translational initiation (GO:0006446)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|translation initiation factor activity (GO:0003743)	p.D60N(1)		breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(10)|stomach(1)|upper_aerodigestive_tract(1)	22						CAGTAACGATGACGATGTGTA	0.493																																							uc001sbh.3		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)|kidney(1)	2						c.(178-180)GAC>AAC		eukaryotic translation initiation factor 4B							115.0	107.0	110.0					12																	53412608		1932	4135	6067	SO:0001583	missense	1975				insulin receptor signaling pathway|nuclear-transcribed mRNA poly(A) tail shortening|regulation of translational initiation	cytosol|eukaryotic translation initiation factor 4F complex	nucleotide binding|translation initiation factor activity	g.chr12:53412608G>A	X55733	CCDS41788.1, CCDS73474.1	12q13.13	2013-02-12			ENSG00000063046	ENSG00000063046		"""RNA binding motif (RRM) containing"""	3285	protein-coding gene	gene with protein product		603928					Standard	XM_005268709		Approved		uc001sbh.4	P23588	OTTHUMG00000169570	ENST00000262056.9:c.178G>A	12.37:g.53412608G>A	ENSP00000262056:p.Asp60Asn		Somatic				EIF4B_uc009zmp.1_RNA|EIF4B_uc010snu.1_Missense_Mutation_p.D60N|EIF4B_uc010snv.1_Missense_Mutation_p.D60N|EIF4B_uc001sbi.2_5'UTR	p.D60N	NM_001417	NP_001408	WXS	Illumina HiSeq	Unspecified	P23588	IF4B_HUMAN			3	384	+			60					Q4G0E3|Q53HQ2|Q6GPH5|Q6IB46|Q8WYK5	Missense_Mutation	SNP	ENST00000262056.9	37	c.178G>A	CCDS41788.1	.	.	.	.	.	.	.	.	.	.	G	15.40	2.820954	0.50633	.	.	ENSG00000063046	ENST00000262056;ENST00000551002;ENST00000420463;ENST00000430205;ENST00000416762;ENST00000549481;ENST00000552490	D;D;D;D;D;D	0.94330	-3.4;-3.4;-3.4;-3.4;-3.4;-3.4	4.67	4.67	0.58626	.	0.053585	0.64402	D	0.000001	D	0.94066	0.8098	L	0.47716	1.5	0.58432	D	0.999999	D;D;D	0.64830	0.994;0.989;0.989	P;P;P	0.60886	0.88;0.762;0.762	D	0.91741	0.5404	10	0.18276	T	0.48	.	17.0175	0.86423	0.0:0.0:1.0:0.0	.	60;60;60	B4DS13;E7EX17;P23588	.;.;IF4B_HUMAN	N	60;14;60;60;60;60;60	ENSP00000262056:D60N;ENSP00000447192:D14N;ENSP00000388806:D60N;ENSP00000412530:D60N;ENSP00000449746:D60N;ENSP00000450324:D60N	ENSP00000262056:D60N	D	+	1	0	EIF4B	51698875	1.000000	0.71417	0.652000	0.29579	0.427000	0.31564	7.739000	0.84976	2.521000	0.84997	0.591000	0.81541	GAC		0.493	EIF4B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000404852.2	NM_001417		70	165	0	0	0	0.01441	0	70	165				
DPY19L2	283417	broad.mit.edu	37	12	64055199	64055199	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr12:64055199C>A	ENST00000324472.4	-	4	696	c.513G>T	c.(511-513)tgG>tgT	p.W171C	RP11-415I12.3_ENST00000509615.2_RNA	NM_173812.4	NP_776173.3	Q6NUT2	D19L2_HUMAN	dpy-19-like 2 (C. elegans)	171					multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)|nuclear inner membrane (GO:0005637)|nucleus (GO:0005634)	transferase activity, transferring glycosyl groups (GO:0016757)	p.W171C(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(19)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	45			GBM - Glioblastoma multiforme(1;2.77e-05)	GBM - Glioblastoma multiforme(28;0.044)		TCATAATCATCCACAGTCCTT	0.303																																							uc001srp.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)|skin(1)	2						c.(511-513)TGG>TGT		dpy-19-like 2							77.0	79.0	78.0					12																	64055199		2203	4295	6498	SO:0001583	missense	283417				multicellular organismal development|spermatid development	integral to membrane		g.chr12:64055199C>A		CCDS31851.1	12q14.2	2012-11-14			ENSG00000177990	ENSG00000177990			19414	protein-coding gene	gene with protein product	"""spermatogenesis associated 34"""	613893				12975309	Standard	XM_006719348		Approved	FLJ32949, SPATA34	uc001srp.1	Q6NUT2	OTTHUMG00000168712	ENST00000324472.4:c.513G>T	12.37:g.64055199C>A	ENSP00000315988:p.Trp171Cys		Somatic				DPY19L2_uc009zqk.1_RNA	p.W171C	NM_173812	NP_776173	WXS	Illumina HiSeq	Unspecified	Q6NUT2	D19L2_HUMAN	GBM - Glioblastoma multiforme(1;2.77e-05)	GBM - Glioblastoma multiforme(28;0.044)	4	694	-			171			Helical; (Potential).		A4FVC1|B4E191|Q3ZCX2|Q6UWG8|Q96LZ9	Missense_Mutation	SNP	ENST00000324472.4	37	c.513G>T	CCDS31851.1	.	.	.	.	.	.	.	.	.	.	C	10.24	1.295917	0.23564	.	.	ENSG00000177990	ENST00000324472;ENST00000538147	T;T	0.54675	0.56;0.56	2.67	2.67	0.31697	.	0.439797	0.23420	N	0.048380	T	0.34106	0.0886	N	0.22421	0.69	0.80722	D	1	B	0.22746	0.074	B	0.27715	0.082	T	0.08764	-1.0706	9	.	.	.	.	7.6108	0.28129	0.0:0.7333:0.2667:0.0	.	171	Q6NUT2	D19L2_HUMAN	C	171;28	ENSP00000315988:W171C;ENSP00000439567:W28C	.	W	-	3	0	DPY19L2	62341466	1.000000	0.71417	1.000000	0.80357	0.641000	0.38312	1.850000	0.39328	1.499000	0.48617	0.184000	0.17185	TGG		0.303	DPY19L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400689.2	NM_173812		13	267	1	0	1.3612e-06	0.003163	1.55678e-06	13	267				
LRRIQ1	84125	broad.mit.edu	37	12	85450634	85450634	+	Missense_Mutation	SNP	G	G	A			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr12:85450634G>A	ENST00000393217.2	+	8	2124	c.2063G>A	c.(2062-2064)aGt>aAt	p.S688N		NM_001079910.1	NP_001073379.1	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	688								p.S688N(2)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|liver(1)|lung(28)|ovary(5)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	83				GBM - Glioblastoma multiforme(134;0.212)		GAGGGCTTGAGTAACTATAAT	0.338																																							uc001tac.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|central_nervous_system(1)|skin(1)	6						c.(2062-2064)AGT>AAT		leucine-rich repeats and IQ motif containing 1							87.0	89.0	88.0					12																	85450634		2202	4300	6502	SO:0001583	missense	84125							g.chr12:85450634G>A	AK022365	CCDS41816.1	12q21	2008-02-05			ENSG00000133640	ENSG00000133640			25708	protein-coding gene	gene with protein product						11347906	Standard	NM_001079910		Approved	FLJ12303, KIAA1801	uc001tac.3	Q96JM4	OTTHUMG00000166185	ENST00000393217.2:c.2063G>A	12.37:g.85450634G>A	ENSP00000376910:p.Ser688Asn		Somatic				LRRIQ1_uc001tab.1_Missense_Mutation_p.S688N|LRRIQ1_uc001taa.1_Missense_Mutation_p.S663N	p.S688N	NM_001079910	NP_001073379	WXS	Illumina HiSeq	Unspecified	Q96JM4	LRIQ1_HUMAN		GBM - Glioblastoma multiforme(134;0.212)	8	2174	+			688					Q567P4|Q9BS17|Q9HA36	Missense_Mutation	SNP	ENST00000393217.2	37	c.2063G>A	CCDS41816.1	.	.	.	.	.	.	.	.	.	.	G	11.65	1.703220	0.30232	.	.	ENSG00000133640	ENST00000256007;ENST00000378580;ENST00000393217	T	0.56103	0.48	5.16	3.3	0.37823	.	1.185490	0.06238	N	0.689888	T	0.34048	0.0884	N	0.22421	0.69	0.09310	N	1	B;B	0.29432	0.244;0.244	B;B	0.21917	0.026;0.037	T	0.14755	-1.0461	10	0.06625	T	0.88	.	8.3382	0.32228	0.1929:0.0:0.8071:0.0	.	688;663	Q96JM4;C9JI57	LRIQ1_HUMAN;.	N	688;663;688	ENSP00000376910:S688N	ENSP00000256007:S688N	S	+	2	0	LRRIQ1	83974765	0.001000	0.12720	0.002000	0.10522	0.002000	0.02628	0.877000	0.28106	1.311000	0.45024	0.591000	0.81541	AGT		0.338	LRRIQ1-004	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388249.2	NM_032165		28	108	0	0	0	0.00632	0	28	108				
ATP8A2	51761	broad.mit.edu	37	13	26343230	26343230	+	Silent	SNP	C	C	A	rs560280973		TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr13:26343230C>A	ENST00000381655.2	+	26	2573	c.2431C>A	c.(2431-2433)Cgg>Agg	p.R811R	ATP8A2_ENST00000255283.8_Silent_p.R771R|ATP8A2_ENST00000491840.1_3'UTR	NM_016529.4	NP_057613.4	Q9NTI2	AT8A2_HUMAN	ATPase, aminophospholipid transporter, class I, type 8A, member 2	771					aging (GO:0007568)|axonogenesis (GO:0007409)|detection of light stimulus involved in visual perception (GO:0050908)|eating behavior (GO:0042755)|inner ear morphogenesis (GO:0042472)|involuntary skeletal muscle contraction (GO:0003011)|negative regulation of cell proliferation (GO:0008285)|neurofilament cytoskeleton organization (GO:0060052)|neuromuscular process controlling posture (GO:0050884)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phospholipid translocation (GO:0061092)|response to auditory stimulus (GO:0010996)|retina layer formation (GO:0010842)|skin development (GO:0043588)	cell projection (GO:0042995)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.R811R(1)		breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(17)|lung(31)|ovary(4)|skin(3)|stomach(1)|urinary_tract(1)	72		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)		GGTGAAGAAGCGGGTGAAGGC	0.537																																							uc001uqk.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|large_intestine(1)|skin(1)	4						c.(2431-2433)CGG>AGG		ATPase, aminophospholipid transporter-like,							78.0	82.0	81.0					13																	26343230		2036	4185	6221	SO:0001819	synonymous_variant	51761				ATP biosynthetic process|negative regulation of cell proliferation	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity	g.chr13:26343230C>A	AL137256	CCDS41873.1	13q12	2010-04-20	2010-03-31		ENSG00000132932	ENSG00000132932	3.6.3.1	"""ATPases / P-type"""	13533	protein-coding gene	gene with protein product		605870	"""ATPase, aminophospholipid transporter-like, Class I, type 8A, member 2"", ""ATPase, aminophospholipid transporter-like, class I, type 8A, member 2"""			11015572, 19778899	Standard	NM_016529		Approved	ATPIB, ML-1	uc001uqk.3	Q9NTI2	OTTHUMG00000016611	ENST00000381655.2:c.2431C>A	13.37:g.26343230C>A			Somatic				ATP8A2_uc010tdi.1_Silent_p.R771R|ATP8A2_uc010tdj.1_RNA|ATP8A2_uc010aaj.1_Silent_p.R361R	p.R811R	NM_016529	NP_057613	WXS	Illumina HiSeq	Unspecified	Q9NTI2	AT8A2_HUMAN		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)	26	2573	+		Breast(139;0.0201)|Lung SC(185;0.0225)	771			Cytoplasmic (Potential).		Q9H527|Q9NPU6|Q9NTL2|Q9NYM3	Silent	SNP	ENST00000381655.2	37	c.2431C>A	CCDS41873.1																																																																																				0.537	ATP8A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044236.2	NM_016529		28	49	1	0	2.65835e-16	0.007291	3.55041e-16	28	49				
ELF1	1997	broad.mit.edu	37	13	41507961	41507961	+	Missense_Mutation	SNP	T	T	A			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr13:41507961T>A	ENST00000239882.3	-	9	1774	c.1460A>T	c.(1459-1461)cAg>cTg	p.Q487L	ELF1_ENST00000442101.1_Missense_Mutation_p.Q463L|ELF1_ENST00000498824.1_5'UTR	NM_172373.3	NP_758961.1	P32519	ELF1_HUMAN	E74-like factor 1 (ets domain transcription factor)	487					cell differentiation (GO:0030154)|negative regulation of T cell receptor signaling pathway (GO:0050860)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokine production (GO:0001817)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q487L(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	37		Lung NSC(96;8.3e-05)|Prostate(109;0.0233)|Breast(139;0.0296)|Lung SC(185;0.0367)		all cancers(112;1.87e-08)|Epithelial(112;8.45e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000202)|GBM - Glioblastoma multiforme(144;0.00266)|BRCA - Breast invasive adenocarcinoma(63;0.072)		CTTTTGTGACTGCAGCATGAC	0.478																																							uc001uxs.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1459-1461)CAG>CTG		E74-like factor 1 (ets domain transcription							142.0	149.0	146.0					13																	41507961		2203	4300	6503	SO:0001583	missense	1997				positive regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr13:41507961T>A	M82882	CCDS9374.1	13q13	2008-07-18			ENSG00000120690	ENSG00000120690			3316	protein-coding gene	gene with protein product		189973				1545787	Standard	NM_001145353		Approved		uc001uxs.3	P32519	OTTHUMG00000016783	ENST00000239882.3:c.1460A>T	13.37:g.41507961T>A	ENSP00000239882:p.Gln487Leu		Somatic				ELF1_uc010tfc.1_Missense_Mutation_p.Q463L|ELF1_uc010acd.2_Missense_Mutation_p.Q380L	p.Q487L	NM_172373	NP_758961	WXS	Illumina HiSeq	Unspecified	P32519	ELF1_HUMAN		all cancers(112;1.87e-08)|Epithelial(112;8.45e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000202)|GBM - Glioblastoma multiforme(144;0.00266)|BRCA - Breast invasive adenocarcinoma(63;0.072)	9	1833	-		Lung NSC(96;8.3e-05)|Prostate(109;0.0233)|Breast(139;0.0296)|Lung SC(185;0.0367)	487					B4E2I5|E9PDQ9|Q8N6F6|Q9UDE1	Missense_Mutation	SNP	ENST00000239882.3	37	c.1460A>T	CCDS9374.1	.	.	.	.	.	.	.	.	.	.	T	12.50	1.956914	0.34565	.	.	ENSG00000120690	ENST00000442101;ENST00000379498;ENST00000239882	T;T	0.48522	0.81;0.81	5.3	4.1	0.47936	.	0.249544	0.36034	N	0.002821	T	0.57344	0.2047	L	0.36672	1.1	0.44719	D	0.997715	D;D	0.69078	0.994;0.997	D;D	0.77004	0.985;0.989	T	0.59134	-0.7511	10	0.87932	D	0	.	12.3366	0.55071	0.0:0.0:0.1415:0.8585	.	463;487	E9PDQ9;P32519	.;ELF1_HUMAN	L	463;229;487	ENSP00000405580:Q463L;ENSP00000239882:Q487L	ENSP00000239882:Q487L	Q	-	2	0	ELF1	40405961	1.000000	0.71417	0.994000	0.49952	0.228000	0.25075	1.577000	0.36515	0.819000	0.34492	-0.316000	0.08728	CAG		0.478	ELF1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044654.3	NM_172373		50	159	0	0	0	0.01441	0	50	159				
DIS3	22894	broad.mit.edu	37	13	73333994	73333994	+	Missense_Mutation	SNP	G	G	C			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr13:73333994G>C	ENST00000377767.4	-	21	2916	c.2816C>G	c.(2815-2817)aCt>aGt	p.T939S	DIS3_ENST00000377780.4_Missense_Mutation_p.T909S|DIS3_ENST00000545453.1_Missense_Mutation_p.T777S	NM_014953.3	NP_055768.3	Q9Y2L1	RRP44_HUMAN	DIS3 exosome endoribonuclease and 3'-5' exoribonuclease	939					CUT catabolic process (GO:0071034)|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of GTPase activity (GO:0043547)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA catabolic process (GO:0016075)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|membrane (GO:0016020)|nuclear exosome (RNase complex) (GO:0000176)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5'-exoribonuclease activity (GO:0000175)|endonuclease activity (GO:0004519)|guanyl-nucleotide exchange factor activity (GO:0005085)|RNA binding (GO:0003723)	p.T939S(1)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(7)|kidney(5)|large_intestine(10)|lung(6)|prostate(2)|skin(1)	35		Breast(118;0.0074)|Acute lymphoblastic leukemia(28;0.0195)		GBM - Glioblastoma multiforme(99;0.000181)		TGAAGTATCAGTAGGAATGCT	0.363										Multiple Myeloma(4;0.011)																													uc001vix.3		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(2815-2817)ACT>AGT		DIS3 mitotic control isoform a							121.0	122.0	122.0					13																	73333994		2203	4299	6502	SO:0001583	missense	22894				CUT catabolic process|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|rRNA catabolic process|rRNA processing	cytosol|exosome (RNase complex)|nucleolus|nucleoplasm	3'-5'-exoribonuclease activity|endonuclease activity|guanyl-nucleotide exchange factor activity|protein binding|RNA binding	g.chr13:73333994G>C	AB023225	CCDS9447.1, CCDS45057.1	13q21.32	2014-03-05	2014-03-05	2007-01-12	ENSG00000083520	ENSG00000083520			20604	protein-coding gene	gene with protein product	"""exosome component 11"""	607533	"""KIAA1008"", ""DIS3 mitotic control homolog (S. cerevisiae)"""	KIAA1008		11935316, 9562621	Standard	XM_005266294		Approved	dis3p, RRP44, EXOSC11	uc001vix.4	Q9Y2L1	OTTHUMG00000017070	ENST00000377767.4:c.2816C>G	13.37:g.73333994G>C	ENSP00000366997:p.Thr939Ser	Multiple Myeloma(4;0.011)	Somatic				DIS3_uc001viy.3_Missense_Mutation_p.T909S|DIS3_uc001viz.2_RNA	p.T939S	NM_014953	NP_055768	WXS	Illumina HiSeq	Unspecified	Q9Y2L1	RRP44_HUMAN		GBM - Glioblastoma multiforme(99;0.000181)	21	3190	-		Breast(118;0.0074)|Acute lymphoblastic leukemia(28;0.0195)	939					A6NI21|B2RBL2|Q5W0P7|Q5W0P8|Q658Z7|Q7Z481|Q8WWI2|Q9UG36	Missense_Mutation	SNP	ENST00000377767.4	37	c.2816C>G	CCDS9447.1	.	.	.	.	.	.	.	.	.	.	G	0.012	-1.677932	0.00751	.	.	ENSG00000083520	ENST00000377767;ENST00000377780;ENST00000545453	T;T;T	0.21734	1.99;1.99;2.0	5.81	3.01	0.34805	.	0.833922	0.10848	N	0.627511	T	0.12518	0.0304	L	0.29908	0.895	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.41662	-0.9496	10	0.07644	T	0.81	.	6.0053	0.19542	0.1768:0.1538:0.6694:0.0	.	909;939	Q9Y2L1-2;Q9Y2L1	.;RRP44_HUMAN	S	939;909;777	ENSP00000366997:T939S;ENSP00000367011:T909S;ENSP00000440058:T777S	ENSP00000366997:T939S	T	-	2	0	DIS3	72231995	0.000000	0.05858	0.000000	0.03702	0.061000	0.15899	-0.202000	0.09451	0.314000	0.23086	0.555000	0.69702	ACT		0.363	DIS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045250.2	NM_014953		19	59	0	0	0	0.014323	0	19	59				
MYCBP2	23077	broad.mit.edu	37	13	77755944	77755944	+	Silent	SNP	A	A	G			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr13:77755944A>G	ENST00000544440.2	-	33	4736	c.4719T>C	c.(4717-4719)gaT>gaC	p.D1573D	MYCBP2_ENST00000407578.2_Silent_p.D1611D|MYCBP2_ENST00000357337.6_Silent_p.D1573D|MYCBP2_ENST00000360084.5_5'UTR					MYC binding protein 2, E3 ubiquitin protein ligase									p.D1573D(2)|p.D1611D(1)		NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		ATACTTCTCCATCATACGCAA	0.423																																							uc001vkf.2		NA																	3	Substitution - coding silent(3)		lung(3)	ovary(4)|breast(4)|skin(3)|lung(2)|pancreas(1)	14						c.(4717-4719)GAT>GAC		MYC binding protein 2							148.0	130.0	136.0					13																	77755944		2203	4300	6503	SO:0001819	synonymous_variant	23077				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ligase activity|protein binding|zinc ion binding	g.chr13:77755944A>G	AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.4719T>C	13.37:g.77755944A>G			Somatic				MYCBP2_uc010aev.2_Silent_p.D977D	p.D1573D	NM_015057	NP_055872	WXS	Illumina HiSeq	Unspecified	O75592	MYCB2_HUMAN		GBM - Glioblastoma multiforme(99;0.109)	34	4810	-		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)	1573						Silent	SNP	ENST00000544440.2	37	c.4719T>C																																																																																					0.423	MYCBP2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000045326.1	NM_015057		37	85	0	0	0	0.004289	0	37	85				
OR4K5	79317	broad.mit.edu	37	14	20389573	20389573	+	Missense_Mutation	SNP	T	T	C			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr14:20389573T>C	ENST00000315915.4	+	1	833	c.808T>C	c.(808-810)Ttt>Ctt	p.F270L		NM_001005483.1	NP_001005483.1	Q8NGD3	OR4K5_HUMAN	olfactory receptor, family 4, subfamily K, member 5	270						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.F270L(1)		central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(6)|liver(1)|lung(27)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	47	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		TTTGGATAAATTTCTTGCCAT	0.388																																							uc010tkw.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(808-810)TTT>CTT		olfactory receptor, family 4, subfamily K,							200.0	209.0	206.0					14																	20389573		2203	4300	6503	SO:0001583	missense	79317				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr14:20389573T>C	BK004355	CCDS32024.1	14q11.22	2012-08-09				ENSG00000176281		"""GPCR / Class A : Olfactory receptors"""	14745	protein-coding gene	gene with protein product						14983052	Standard	NM_001005483		Approved		uc010tkw.2	Q8NGD3		ENST00000315915.4:c.808T>C	14.37:g.20389573T>C	ENSP00000319511:p.Phe270Leu		Somatic					p.F270L	NM_001005483	NP_001005483	WXS	Illumina HiSeq	Unspecified	Q8NGD3	OR4K5_HUMAN	Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)	1	808	+	all_cancers(95;0.00108)		270			Helical; Name=7; (Potential).		Q6IFA7	Missense_Mutation	SNP	ENST00000315915.4	37	c.808T>C	CCDS32024.1	.	.	.	.	.	.	.	.	.	.	.	6.164	0.398375	0.11696	.	.	ENSG00000176281	ENST00000315915	T	0.00042	8.84	4.52	-1.11	0.09840	GPCR, rhodopsin-like superfamily (1);	1.534910	0.04291	N	0.345612	T	0.00073	0.0002	N	0.12663	0.25	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.24870	-1.0148	10	0.46703	T	0.11	.	1.059	0.01596	0.1808:0.1498:0.2534:0.4161	.	270	Q8NGD3	OR4K5_HUMAN	L	270	ENSP00000319511:F270L	ENSP00000319511:F270L	F	+	1	0	OR4K5	19459413	0.000000	0.05858	0.630000	0.29268	0.076000	0.17211	-1.764000	0.01800	-0.096000	0.12329	-0.213000	0.12676	TTT		0.388	OR4K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409867.1	NM_001005483		16	296	0	0	0	0.006122	0	16	296				
ARHGEF40	55701	broad.mit.edu	37	14	21543035	21543035	+	Missense_Mutation	SNP	G	G	C			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr14:21543035G>C	ENST00000298694.4	+	3	1273	c.1146G>C	c.(1144-1146)aaG>aaC	p.K382N	ARHGEF40_ENST00000298693.3_Missense_Mutation_p.K382N			Q8TER5	ARH40_HUMAN	Rho guanine nucleotide exchange factor (GEF) 40	382	Gly-rich.					cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.K382N(1)		large_intestine(4)|ovary(3)|upper_aerodigestive_tract(2)	9						ACAGAAGAAAGAAGCGAGCTG	0.627																																							uc001vzp.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1144-1146)AAG>AAC		hypothetical protein LOC55701							72.0	61.0	64.0					14																	21543035		2203	4300	6503	SO:0001583	missense	55701				regulation of Rho protein signal transduction	cytoplasm	Rho guanyl-nucleotide exchange factor activity	g.chr14:21543035G>C		CCDS32041.1	14q11.2	2012-07-24			ENSG00000165801	ENSG00000165801		"""Rho guanine nucleotide exchange factors"""	25516	protein-coding gene	gene with protein product		610018				16143467	Standard	NM_001278529		Approved	solo, FLJ10357	uc001vzp.3	Q8TER5		ENST00000298694.4:c.1146G>C	14.37:g.21543035G>C	ENSP00000298694:p.Lys382Asn		Somatic				FLJ10357_uc001vzn.1_Missense_Mutation_p.K382N|FLJ10357_uc001vzo.1_Intron|FLJ10357_uc010aij.2_RNA|FLJ10357_uc010tln.1_5'UTR	p.K382N	NM_018071	NP_060541	WXS	Illumina HiSeq	Unspecified	Q8TER5	ARH40_HUMAN	OV - Ovarian serous cystadenocarcinoma(11;5.79e-11)|Epithelial(56;8.35e-09)|all cancers(55;4.23e-08)	GBM - Glioblastoma multiforme(265;0.0197)	3	1175	+	all_cancers(95;0.00185)		382			Gly-rich.		A5PL07|Q9BWP5|Q9H7L6|Q9NTF9|Q9NW24	Missense_Mutation	SNP	ENST00000298694.4	37	c.1146G>C	CCDS32041.1	.	.	.	.	.	.	.	.	.	.	G	14.98	2.698663	0.48307	.	.	ENSG00000165801	ENST00000298694;ENST00000555038;ENST00000298693	T;T	0.02916	4.16;4.11	5.14	2.32	0.28847	.	0.000000	0.53938	D	0.000047	T	0.04998	0.0134	L	0.27053	0.805	0.33302	D	0.564957	D;D	0.69078	0.982;0.997	P;D	0.66351	0.702;0.943	T	0.45848	-0.9233	10	0.20046	T	0.44	.	6.9788	0.24692	0.2872:0.0:0.7128:0.0	.	382;382	Q8TER5;G3V3N2	ARH40_HUMAN;.	N	382	ENSP00000298694:K382N;ENSP00000298693:K382N	ENSP00000298693:K382N	K	+	3	2	ARHGEF40	20612875	0.980000	0.34600	0.999000	0.59377	0.882000	0.50991	0.530000	0.23036	0.283000	0.22279	0.462000	0.41574	AAG		0.627	ARHGEF40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413122.1			16	77	0	0	0	0.006122	0	16	77				
NUBPL	80224	broad.mit.edu	37	14	32030658	32030658	+	Nonsense_Mutation	SNP	C	C	T			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr14:32030658C>T	ENST00000281081.7	+	1	58	c.13C>T	c.(13-15)Cag>Tag	p.Q5*	CTD-2213F21.3_ENST00000548096.1_RNA|CTD-2213F21.4_ENST00000547093.1_RNA	NM_001201573.1|NM_001201574.1|NM_025152.2	NP_001188502.1|NP_001188503.1|NP_079428.2	Q8TB37	NUBPL_HUMAN	nucleotide binding protein-like	5					mitochondrial respiratory chain complex I assembly (GO:0032981)|mitochondrion morphogenesis (GO:0070584)	mitochondrion (GO:0005739)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)	p.Q5*(1)		endometrium(1)|lung(2)|prostate(1)|skin(1)	5	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.214)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0677)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.0102)		GGGGATTTGGCAGCGTCTGCT	0.667																																							uc001wrk.3		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(13-15)CAG>TAG		nucleotide binding protein-like							26.0	30.0	29.0					14																	32030658		1936	4135	6071	SO:0001587	stop_gained	80224				mitochondrial respiratory chain complex I assembly|mitochondrion morphogenesis	mitochondrion	4 iron, 4 sulfur cluster binding|ATP binding|metal ion binding	g.chr14:32030658C>T	AK022722	CCDS41940.1	14q12	2012-10-12	2005-01-07	2005-01-07	ENSG00000151413	ENSG00000151413		"""Mitochondrial respiratory chain complex assembly factors"""	20278	protein-coding gene	gene with protein product	"""iron-sulfur protein required for NADH dehydrogenase"""	613621	"""chromosome 14 open reading frame 127"""	C14orf127			Standard	NM_025152		Approved	FLJ12660, IND1, huInd1	uc001wrk.4	Q8TB37	OTTHUMG00000170521	ENST00000281081.7:c.13C>T	14.37:g.32030658C>T	ENSP00000281081:p.Gln5*		Somatic				NUBPL_uc010amj.2_RNA	p.Q5*	NM_025152	NP_079428	WXS	Illumina HiSeq	Unspecified	Q8TB37	NUBPL_HUMAN	LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0677)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.0102)	1	68	+	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.214)		5					B4DHZ1|Q86TZ4|Q9H9M2	Nonsense_Mutation	SNP	ENST00000281081.7	37	c.13C>T	CCDS41940.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.670564	0.88348	.	.	ENSG00000151413	ENST00000550649;ENST00000281081	.	.	.	5.35	2.4	0.29515	.	1.281220	0.04940	N	0.458410	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	0.3189	3.8424	0.08920	0.1699:0.5781:0.164:0.088	.	.	.	.	X	5	.	ENSP00000281081:Q5X	Q	+	1	0	NUBPL	31100409	0.625000	0.27111	0.407000	0.26434	0.018000	0.09664	0.807000	0.27140	0.427000	0.26145	0.655000	0.94253	CAG		0.667	NUBPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409519.1	NM_025152		3	22	0	0	0	0.00308	0	3	22				
RALGAPA1	253959	broad.mit.edu	37	14	36217939	36217939	+	Missense_Mutation	SNP	G	G	C			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr14:36217939G>C	ENST00000389698.3	-	10	1493	c.1103C>G	c.(1102-1104)tCc>tGc	p.S368C	RALGAPA1_ENST00000258840.6_Missense_Mutation_p.S368C|RALGAPA1_ENST00000554704.1_5'UTR|RALGAPA1_ENST00000307138.6_Missense_Mutation_p.S368C|RALGAPA1_ENST00000382366.3_Missense_Mutation_p.S368C	NM_014990.1	NP_055805.1	Q6GYQ0	RGPA1_HUMAN	Ral GTPase activating protein, alpha subunit 1 (catalytic)	368					activation of Ral GTPase activity (GO:0032859)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)	p.S368C(2)		breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(7)|large_intestine(14)|lung(21)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						GCTTGTATTGGAATGAGACTG	0.393																																							uc001wti.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|breast(1)	4						c.(1102-1104)TCC>TGC		Ral GTPase activating protein, alpha subunit 1							128.0	116.0	120.0					14																	36217939		2203	4300	6503	SO:0001583	missense	253959				activation of Ral GTPase activity	cytosol|mitochondrion|nucleus	protein heterodimerization activity|Ral GTPase activator activity	g.chr14:36217939G>C	AK126975	CCDS32064.1, CCDS32065.1, CCDS61439.1	14q13.2	2012-01-26	2009-09-09	2009-09-09	ENSG00000174373	ENSG00000174373			17770	protein-coding gene	gene with protein product	"""tuberin-like protein 1"", ""GAP-related interacting protein to E12"""	608884	"""GTPase activating RANGAP domain-like 1"", ""GTPase activating Rap/RanGAP domain-like 1"""	GARNL1		19520869	Standard	NM_014990		Approved	GRIPE, DKFZp667F074, KIAA0884, Tulip1, RalGAPalpha1	uc001wtj.3	Q6GYQ0	OTTHUMG00000170619	ENST00000389698.3:c.1103C>G	14.37:g.36217939G>C	ENSP00000374348:p.Ser368Cys		Somatic				RALGAPA1_uc001wtj.2_Missense_Mutation_p.S368C|RALGAPA1_uc010tpv.1_Missense_Mutation_p.S368C|RALGAPA1_uc010tpw.1_Missense_Mutation_p.S368C|RALGAPA1_uc001wtk.1_Missense_Mutation_p.S219C	p.S368C	NM_014990	NP_055805	WXS	Illumina HiSeq	Unspecified	Q6GYQ0	RGPA1_HUMAN			10	1494	-			368					A6NMA4|B9EK38|C5NU19|O94960|Q6GYP9|Q6ZT23|Q86YF3|Q86YF5|Q8ND69	Missense_Mutation	SNP	ENST00000389698.3	37	c.1103C>G	CCDS32065.1	.	.	.	.	.	.	.	.	.	.	G	28.9	4.956209	0.92726	.	.	ENSG00000174373	ENST00000389698;ENST00000307138;ENST00000335518;ENST00000258840;ENST00000382366;ENST00000553892	T;T;T;T;T	0.79554	-1.28;-1.28;-1.28;-1.28;-1.28	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	D	0.90079	0.6901	M	0.73962	2.25	0.80722	D	1	D;D;B;D;D	0.89917	1.0;1.0;0.011;1.0;1.0	D;D;B;D;D	0.91635	0.999;0.99;0.059;0.998;0.996	D	0.90312	0.4338	10	0.72032	D	0.01	-6.0152	19.8769	0.96880	0.0:0.0:1.0:0.0	.	368;368;368;368;368	Q6GYQ0-6;B9EK38;Q6GYQ0-3;Q6GYQ0-2;Q6GYQ0	.;.;.;.;RGPA1_HUMAN	C	368	ENSP00000374348:S368C;ENSP00000302647:S368C;ENSP00000258840:S368C;ENSP00000371803:S368C;ENSP00000451877:S368C	ENSP00000258840:S368C	S	-	2	0	RALGAPA1	35287690	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.607000	0.82883	2.700000	0.92200	0.655000	0.94253	TCC		0.393	RALGAPA1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409829.1	XM_210022		78	55	0	0	0	0.01441	0	78	55				
MGAT2	4247	broad.mit.edu	37	14	50088220	50088220	+	Silent	SNP	G	G	T			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr14:50088220G>T	ENST00000305386.2	+	1	732	c.234G>T	c.(232-234)gcG>gcT	p.A78A	RP11-649E7.5_ENST00000555043.1_RNA|RPL36AL_ENST00000298289.6_5'Flank	NM_002408.3	NP_002399.1	Q10469	MGAT2_HUMAN	mannosyl (alpha-1,6-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase	78					cellular protein metabolic process (GO:0044267)|oligosaccharide biosynthetic process (GO:0009312)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	alpha-1,6-mannosylglycoprotein 2-beta-N-acetylglucosaminyltransferase activity (GO:0008455)|carbohydrate binding (GO:0030246)	p.A78A(1)		cervix(1)|endometrium(3)|large_intestine(1)|lung(6)	11	all_epithelial(31;0.0021)|Breast(41;0.0124)					TGGTCCCGGCGGTCCCCCAGC	0.682																																							uc001wwr.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(232-234)GCG>GCT		mannosyl (alpha-1,6-)-glycoprotein							23.0	27.0	26.0					14																	50088220		2200	4290	6490	SO:0001819	synonymous_variant	4247				oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|Golgi stack|integral to membrane|membrane fraction	alpha-1,6-mannosylglycoprotein 2-beta-N-acetylglucosaminyltransferase activity	g.chr14:50088220G>T	U15128	CCDS9690.1	14q21	2013-02-25			ENSG00000168282	ENSG00000168282	2.4.1.143	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7045	protein-coding gene	gene with protein product		602616				7635144	Standard	NM_002408		Approved	GNT-II	uc001wwr.3	Q10469	OTTHUMG00000140271	ENST00000305386.2:c.234G>T	14.37:g.50088220G>T			Somatic				SDCCAG1_uc010anj.1_Intron|RPL36AL_uc001wwq.1_5'Flank	p.A78A	NM_002408	NP_002399	WXS	Illumina HiSeq	Unspecified	Q10469	MGAT2_HUMAN			1	732	+	all_epithelial(31;0.0021)|Breast(41;0.0124)		78			Lumenal (Potential).		B3KPC5|B3KQM0	Silent	SNP	ENST00000305386.2	37	c.234G>T	CCDS9690.1																																																																																				0.682	MGAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276807.1	NM_002408		11	30	1	0	3.41278e-10	0.00499	4.19225e-10	11	30				
ZFYVE26	23503	broad.mit.edu	37	14	68274475	68274475	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr14:68274475G>T	ENST00000347230.4	-	5	664	c.526C>A	c.(526-528)Ctt>Att	p.L176I	ZFYVE26_ENST00000555452.1_Missense_Mutation_p.L176I	NM_015346.3	NP_056161.2	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	176					cell death (GO:0008219)|cytokinesis (GO:0000910)|double-strand break repair via homologous recombination (GO:0000724)	centrosome (GO:0005813)|lysosomal membrane (GO:0005765)|midbody (GO:0030496)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)	p.L176I(1)|p.L176V(1)		NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(8)|lung(39)|ovary(12)|pancreas(1)|prostate(7)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	94				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		TCCTCCTCAAGCAGGAGCTCC	0.607																																							uc001xka.2		NA																	2	Substitution - Missense(2)	p.L176V(1)	ovary(1)|lung(1)	ovary(9)|breast(2)	11						c.(526-528)CTT>ATT		zinc finger, FYVE domain containing 26							110.0	113.0	112.0					14																	68274475		2203	4300	6503	SO:0001583	missense	23503				cell cycle|cell death|cytokinesis|double-strand break repair via homologous recombination	centrosome|midbody	metal ion binding|phosphatidylinositol-3-phosphate binding|protein binding	g.chr14:68274475G>T	AB002319	CCDS9788.1	14q23.3	2012-11-23				ENSG00000072121		"""Zinc fingers, FYVE domain containing"""	20761	protein-coding gene	gene with protein product	"""spastizin"", ""FYVE-CENT"""	612012	"""spastic paraplegia 15 (complicated, autosomal recessive)"""	SPG15		9205841, 18394578	Standard	NM_015346		Approved	KIAA0321	uc001xka.2	Q68DK2		ENST00000347230.4:c.526C>A	14.37:g.68274475G>T	ENSP00000251119:p.Leu176Ile		Somatic				ZFYVE26_uc010tsz.1_RNA|ZFYVE26_uc001xkc.3_Missense_Mutation_p.L176I|ZFYVE26_uc010tta.1_Missense_Mutation_p.L176I	p.L176I	NM_015346	NP_056161	WXS	Illumina HiSeq	Unspecified	Q68DK2	ZFY26_HUMAN		all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)	5	665	-			176					B1B5Y3|B4E2U3|O15035|Q68DT9|Q6AW90|Q6ZR50|Q7Z3A4|Q7Z3I1|Q8N4W7	Missense_Mutation	SNP	ENST00000347230.4	37	c.526C>A	CCDS9788.1	.	.	.	.	.	.	.	.	.	.	G	13.99	2.402209	0.42613	.	.	ENSG00000072121	ENST00000347230;ENST00000411699;ENST00000555452	T;T	0.28454	1.76;1.61	5.83	4.01	0.46588	.	0.373630	0.28332	N	0.015731	T	0.30166	0.0756	M	0.62723	1.935	0.32655	N	0.518845	P;P;B	0.38827	0.465;0.649;0.22	B;B;B	0.36666	0.178;0.23;0.036	T	0.38499	-0.9658	10	0.25106	T	0.35	-3.6563	12.9282	0.58272	0.112:0.0:0.888:0.0	.	176;176;176	Q68DK2-4;G3V2D8;Q68DK2	.;.;ZFY26_HUMAN	I	176	ENSP00000251119:L176I;ENSP00000450603:L176I	ENSP00000251119:L176I	L	-	1	0	ZFYVE26	67344228	1.000000	0.71417	0.959000	0.39883	0.678000	0.39670	4.999000	0.63934	0.813000	0.34350	0.591000	0.81541	CTT		0.607	ZFYVE26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412736.2	NM_015346		31	182	1	0	6.70999e-13	0.004289	8.55953e-13	31	182				
TDP1	55775	broad.mit.edu	37	14	90499508	90499508	+	Missense_Mutation	SNP	C	C	G			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr14:90499508C>G	ENST00000335725.4	+	16	1953	c.1703C>G	c.(1702-1704)gCc>gGc	p.A568G	TDP1_ENST00000393452.3_Silent_p.G583G|TDP1_ENST00000357382.3_Missense_Mutation_p.A329G|TDP1_ENST00000555880.1_Intron|TDP1_ENST00000393454.2_Missense_Mutation_p.A568G	NM_018319.3	NP_060789.2	Q9NUW8	TYDP1_HUMAN	tyrosyl-DNA phosphodiesterase 1	568					cell death (GO:0008219)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|single strand break repair (GO:0000012)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	3'-tyrosyl-DNA phosphodiesterase activity (GO:0017005)|double-stranded DNA binding (GO:0003690)|exonuclease activity (GO:0004527)|single-stranded DNA binding (GO:0003697)	p.A568G(1)		NS(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(3)|prostate(1)|urinary_tract(1)	25		all_cancers(154;0.185)		COAD - Colon adenocarcinoma(157;0.23)		GAGCCAATGGCCACCTTTCCT	0.453								Repair of DNA-protein crosslinks																															uc001xxy.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1702-1704)GCC>GGC	Repair_of_DNA-protein_crosslinks	tyrosyl-DNA phosphodiesterase 1							60.0	57.0	58.0					14																	90499508		2203	4300	6503	SO:0001583	missense	55775				cell death|double-strand break repair|single strand break repair	cytoplasm|nucleus	3'-tyrosyl-DNA phosphodiesterase activity|double-stranded DNA binding|exonuclease activity|protein binding|single-stranded DNA binding	g.chr14:90499508C>G	AF182002	CCDS9888.1	14q32.11	2008-08-11				ENSG00000042088			18884	protein-coding gene	gene with protein product		607198				11839309, 12244316	Standard	XM_005267847		Approved	FLJ11090, SCAN1	uc001xxz.3	Q9NUW8		ENST00000335725.4:c.1703C>G	14.37:g.90499508C>G	ENSP00000337353:p.Ala568Gly		Somatic				TDP1_uc010atm.2_RNA|TDP1_uc001xxz.2_Missense_Mutation_p.A568G|TDP1_uc010atn.2_Silent_p.G583G|TDP1_uc001xya.2_Missense_Mutation_p.A329G|TDP1_uc001xyb.2_RNA|TDP1_uc010ato.2_Intron|TDP1_uc001xyd.1_Missense_Mutation_p.A183G	p.A568G	NM_018319	NP_060789	WXS	Illumina HiSeq	Unspecified	Q9NUW8	TYDP1_HUMAN		COAD - Colon adenocarcinoma(157;0.23)	16	2002	+		all_cancers(154;0.185)	568					Q2HXX4|Q86TV8|Q96BK7|Q9NZM7|Q9NZM8	Missense_Mutation	SNP	ENST00000335725.4	37	c.1703C>G	CCDS9888.1	.	.	.	.	.	.	.	.	.	.	C	4.921	0.171173	0.09391	.	.	ENSG00000042088	ENST00000393454;ENST00000335725;ENST00000357382	T;T;T	0.44881	0.91;0.91;0.91	5.9	0.724	0.18236	.	0.506251	0.22651	N	0.057336	T	0.29976	0.0750	L	0.58101	1.795	0.09310	N	1	B;B;B	0.21520	0.0;0.057;0.001	B;B;B	0.23150	0.002;0.044;0.002	T	0.18461	-1.0336	10	0.22706	T	0.39	-31.289	1.8712	0.03209	0.2819:0.4267:0.1368:0.1546	.	568;329;568	B2RDI0;Q86TV8;Q9NUW8	.;.;TYDP1_HUMAN	G	568;568;329	ENSP00000377099:A568G;ENSP00000337353:A568G;ENSP00000349952:A329G	ENSP00000337353:A568G	A	+	2	0	TDP1	89569261	0.003000	0.15002	0.000000	0.03702	0.278000	0.26855	1.729000	0.38115	-0.128000	0.11641	-0.225000	0.12378	GCC		0.453	TDP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411239.1	NM_018319		17	18	0	0	0	0.007413	0	17	18				
SERPINA11	256394	broad.mit.edu	37	14	94914835	94914835	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr14:94914835C>A	ENST00000334708.3	-	2	341	c.277G>T	c.(277-279)Gct>Tct	p.A93S	RP11-349I1.2_ENST00000536735.1_RNA	NM_001080451.1	NP_001073920.1	Q86U17	SPA11_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 11	93					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.A275S(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(14)|skin(1)|upper_aerodigestive_tract(1)	24				COAD - Colon adenocarcinoma(157;0.211)		GAGGTGTTAGCTTGGGCCCCA	0.597																																							uc001ydd.1		NA																	1	Substitution - Missense(1)		lung(1)	kidney(1)	1						c.(277-279)GCT>TCT		serpin peptidase inhibitor, clade A (alpha-1							84.0	87.0	86.0					14																	94914835		2203	4300	6503	SO:0001583	missense	256394				regulation of proteolysis	extracellular region	serine-type endopeptidase inhibitor activity	g.chr14:94914835C>A	BX248259	CCDS32149.1	14q32.13	2014-02-18	2005-08-18		ENSG00000186910	ENSG00000186910		"""Serine (or cysteine) peptidase inhibitors"""	19193	protein-coding gene	gene with protein product			"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 11"""			15014966, 24172014	Standard	NM_001080451		Approved		uc001ydd.1	Q86U17	OTTHUMG00000171348	ENST00000334708.3:c.277G>T	14.37:g.94914835C>A	ENSP00000335024:p.Ala93Ser		Somatic					p.A93S	NM_001080451	NP_001073920	WXS	Illumina HiSeq	Unspecified	Q86U17	SPA11_HUMAN		COAD - Colon adenocarcinoma(157;0.211)	2	337	-			93					B2RV07	Missense_Mutation	SNP	ENST00000334708.3	37	c.277G>T	CCDS32149.1	.	.	.	.	.	.	.	.	.	.	C	0.004	-2.261091	0.00262	.	.	ENSG00000186910	ENST00000334708	D	0.87179	-2.22	4.85	1.86	0.25419	Serpin domain (3);	1.197380	0.06185	N	0.680265	T	0.63343	0.2503	N	0.01424	-0.875	0.09310	N	1	B	0.09022	0.002	B	0.10450	0.005	T	0.60316	-0.7287	10	0.02654	T	1	.	4.1733	0.10339	0.2478:0.4323:0.2466:0.0733	.	93	Q86U17	SPA11_HUMAN	S	93	ENSP00000335024:A93S	ENSP00000335024:A93S	A	-	1	0	SERPINA11	93984588	0.001000	0.12720	0.000000	0.03702	0.038000	0.13279	0.799000	0.27028	0.602000	0.29896	-0.176000	0.13171	GCT		0.597	SERPINA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413091.1	NM_001080451		22	129	1	0	8.10497e-08	0.010504	9.60053e-08	22	129				
MGA	23269	broad.mit.edu	37	15	41988517	41988517	+	Nonsense_Mutation	SNP	G	G	T			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr15:41988517G>T	ENST00000570161.1	+	2	1309	c.1309G>T	c.(1309-1311)Gaa>Taa	p.E437*	MGA_ENST00000219905.7_Nonsense_Mutation_p.E437*|MGA_ENST00000566586.1_Nonsense_Mutation_p.E437*|MGA_ENST00000568630.1_3'UTR|MGA_ENST00000545763.1_Nonsense_Mutation_p.E437*|MGA_ENST00000389936.4_Nonsense_Mutation_p.E437*			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0	Maltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)	p.E437*(1)		NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	TGACAACCCAGAAGCTGACCA	0.408																																							uc001zog.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(6)|kidney(3)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	12						c.(1309-1311)GAA>TAA		MAX-interacting protein isoform 2							77.0	73.0	74.0					15																	41988517		1892	4114	6006	SO:0001587	stop_gained	23269					MLL1 complex	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr15:41988517G>T	AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.1309G>T	15.37:g.41988517G>T	ENSP00000457035:p.Glu437*		Somatic				MGA_uc010ucy.1_Nonsense_Mutation_p.E437*|MGA_uc010ucz.1_Nonsense_Mutation_p.E437*	p.E437*	NM_001080541	NP_001074010	WXS	Illumina HiSeq	Unspecified	Q8IWI9	MGAP_HUMAN		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	3	1400	+		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)	437					Q0VAX6|Q75ME7|Q86UM5	Nonsense_Mutation	SNP	ENST00000570161.1	37	c.1309G>T	CCDS55959.1	.	.	.	.	.	.	.	.	.	.	G	29.7	5.024840	0.93518	.	.	ENSG00000174197	ENST00000219905;ENST00000389936;ENST00000545763	.	.	.	5.53	5.53	0.82687	.	0.889113	0.10198	N	0.703720	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	11.8526	0.52419	0.0795:0.0:0.9205:0.0	.	.	.	.	X	437	.	ENSP00000219905:E437X	E	+	1	0	MGA	39775809	0.998000	0.40836	1.000000	0.80357	0.768000	0.43524	3.857000	0.55972	2.588000	0.87417	0.561000	0.74099	GAA		0.408	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000420229.1	NM_001164273.1		28	31	1	0	1.08312e-15	0.009535	1.42742e-15	28	31				
C15orf48	84419	broad.mit.edu	37	15	45723236	45723236	+	Missense_Mutation	SNP	G	G	A			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr15:45723236G>A	ENST00000344300.3	+	2	264	c.74G>A	c.(73-75)gGt>gAt	p.G25D	RP11-519G16.5_ENST00000559553.1_RNA|C15orf48_ENST00000396650.2_Missense_Mutation_p.G25D|MIR147B_ENST00000390185.1_RNA	NM_032413.3	NP_115789.1	Q9C002	NMES1_HUMAN	chromosome 15 open reading frame 48	25						mitochondrion (GO:0005739)|nucleus (GO:0005634)		p.G25D(1)		large_intestine(1)|lung(2)|ovary(1)	4		Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.67e-16)|GBM - Glioblastoma multiforme(94;1.71e-06)		GTGGCGGCGGGTGGAGCCTCA	0.423																																							uc001zvg.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(73-75)GGT>GAT		normal mucosa of esophagus specific 1							183.0	178.0	180.0					15																	45723236		2198	4298	6496	SO:0001583	missense	84419					nucleus		g.chr15:45723236G>A		CCDS10124.1	15q21.1	2014-05-29			ENSG00000166920	ENSG00000166920			29898	protein-coding gene	gene with protein product	"""normal mucosa of esophagus specific 1"""	608409				12209954	Standard	NM_032413		Approved	NMES1	uc001zvh.4	Q9C002	OTTHUMG00000131424	ENST00000344300.3:c.74G>A	15.37:g.45723236G>A	ENSP00000341610:p.Gly25Asp		Somatic				C15orf48_uc001zvh.2_Missense_Mutation_p.G25D|MIR147B_hsa-mir-147b|MI0005544_5'Flank	p.G25D	NM_197955	NP_922946	WXS	Illumina HiSeq	Unspecified	Q9C002	NMES1_HUMAN		all cancers(107;1.67e-16)|GBM - Glioblastoma multiforme(94;1.71e-06)	3	192	+		Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)	25						Missense_Mutation	SNP	ENST00000344300.3	37	c.74G>A	CCDS10124.1	.	.	.	.	.	.	.	.	.	.	G	16.49	3.138144	0.56936	.	.	ENSG00000166920	ENST00000396650;ENST00000344300	T;T	0.78924	-1.22;-1.22	5.69	-8.39	0.00969	.	2.440800	0.01433	N	0.014823	T	0.62756	0.2454	.	.	.	0.09310	N	1	B	0.29301	0.241	B	0.25614	0.062	T	0.52525	-0.8564	9	0.34782	T	0.22	-4.1793	11.5472	0.50700	0.0:0.4511:0.1646:0.3843	.	25	Q9C002	NMES1_HUMAN	D	25	ENSP00000379887:G25D;ENSP00000341610:G25D	ENSP00000341610:G25D	G	+	2	0	C15orf48	43510528	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.738000	0.04871	-0.915000	0.03823	-0.293000	0.09583	GGT		0.423	C15orf48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254217.2	NM_032413		20	68	0	0	0	0.007291	0	20	68				
POLR2M	81488	broad.mit.edu	37	15	58001463	58001463	+	Missense_Mutation	SNP	C	C	T			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr15:58001463C>T	ENST00000299638.3	+	2	879	c.665C>T	c.(664-666)tCc>tTc	p.S222F	GCOM1_ENST00000380568.3_Intron|POLR2M_ENST00000464308.1_3'UTR|GCOM1_ENST00000484300.1_3'UTR|POLR2M_ENST00000380563.2_Missense_Mutation_p.S222F|GCOM1_ENST00000587652.1_Missense_Mutation_p.S619F|GCOM1_ENST00000380569.2_Intron|POLR2M_ENST00000380557.4_Missense_Mutation_p.S65F	NM_015532.3	NP_056347.1	P0CAP2	GRL1A_HUMAN	polymerase (RNA) II (DNA directed) polypeptide M	222					maintenance of ER location (GO:0051685)	DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|neuronal cell body (GO:0043025)|nuclear envelope (GO:0005635)	DNA-directed RNA polymerase activity (GO:0003899)	p.S222F(1)									ACAGGCCTTTCCAGTGGGACT	0.443																																							uc002aet.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(664-666)TCC>TTC		glutamate receptor, ionotropic, N-methyl							53.0	54.0	54.0					15																	58001463		2192	4292	6484	SO:0001583	missense	81488				intracellular signal transduction	extrinsic to internal side of plasma membrane|I band		g.chr15:58001463C>T	AF326773	CCDS32252.1, CCDS42045.1	15q21.3	2013-01-21	2011-11-07	2011-11-07		ENSG00000255529		"""RNA polymerase subunits"""	14862	protein-coding gene	gene with protein product		606485	"""glutamate receptor, ionotropic, N-methyl D-aspartate-like 1A"""	GRINL1A		16769904, 22850672	Standard	NM_015532		Approved	Gdown, Gdown1, GCOM1	uc002aev.1	P0CAP2	OTTHUMG00000166486	ENST00000299638.3:c.665C>T	15.37:g.58001463C>T	ENSP00000299638:p.Ser222Phe		Somatic				GCOM1_uc002aem.2_Intron|GCOM1_uc002aeq.2_Intron|GCOM1_uc002aen.2_Intron|GCOM1_uc010bfy.2_Intron|GCOM1_uc002aeo.2_Intron|GCOM1_uc002aep.2_RNA|GCOM1_uc010bfx.2_Intron|GRINL1A_uc002aes.2_5'UTR|GRINL1A_uc002aev.1_3'UTR|GRINL1A_uc010ugu.1_RNA|GRINL1A_uc002aeu.3_Missense_Mutation_p.S65F	p.S222F	NM_015532	NP_056347	WXS	Illumina HiSeq	Unspecified	P0CAP1	GCOM1_HUMAN		all cancers(107;0.0697)|GBM - Glioblastoma multiforme(80;0.12)	2	805	+			Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					Q6EER8|Q6EES2|Q6EEV3|Q6EF00|Q6EF01|Q6EF02|Q6EF46|Q6EFN8|Q6EM48|Q6K046|Q6K050|Q6K051|Q6ZQZ3|Q8NC58|Q8NCF3|Q96DI5|Q96JB7|Q96NF5|Q9Y3V6	Missense_Mutation	SNP	ENST00000299638.3	37	c.665C>T	CCDS32252.1	.	.	.	.	.	.	.	.	.	.	C	6.240	0.412403	0.11812	.	.	ENSG00000255529	ENST00000380563;ENST00000299638;ENST00000380557	T;T;T	0.28454	1.61;1.61;1.61	5.21	-6.75	0.01738	.	.	.	.	.	T	0.18467	0.0443	.	.	.	0.09310	N	1	B;B	0.19200	0.008;0.034	B;B	0.09377	0.003;0.004	T	0.35276	-0.9795	8	0.54805	T	0.06	.	9.3545	0.38157	0.3834:0.4816:0.135:0.0	.	65;222	P0CAP2-2;P0CAP2	.;GRL1A_HUMAN	F	222;222;65	ENSP00000369937:S222F;ENSP00000299638:S222F;ENSP00000369930:S65F	ENSP00000299638:S222F	S	+	2	0	GRINL1A	55788755	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-1.985000	0.01485	-0.845000	0.04179	-0.518000	0.04402	TCC		0.443	POLR2M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255719.2			12	56	0	0	0	0.001855	0	12	56				
RPL4	6124	broad.mit.edu	37	15	66792408	66792408	+	Missense_Mutation	SNP	G	G	A			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr15:66792408G>A	ENST00000307961.6	-	9	1116	c.1024C>T	c.(1024-1026)Cgc>Tgc	p.R342C	RPL4_ENST00000568588.1_Missense_Mutation_p.R248C|SNAPC5_ENST00000566658.1_5'Flank|SNAPC5_ENST00000316634.5_5'Flank|SNAPC5_ENST00000307979.7_5'Flank|SNAPC5_ENST00000395589.2_5'Flank|SNORD18C_ENST00000362704.1_RNA|SNAPC5_ENST00000563480.2_5'Flank|SNORD18B_ENST00000365659.1_RNA|SNORD16_ENST00000362803.1_RNA	NM_000968.3	NP_000959.2	P36578	RL4_HUMAN	ribosomal protein L4	342					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)	p.R342C(1)		endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|skin(1)|stomach(1)|urinary_tract(1)	17						CTGGCCTGGCGAAGAATGGTG	0.473																																							uc002apv.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1024-1026)CGC>TGC		ribosomal protein L4							82.0	71.0	75.0					15																	66792408		2201	4299	6500	SO:0001583	missense	6124				endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit|nucleolus	protein binding|RNA binding|structural constituent of ribosome	g.chr15:66792408G>A	AB007167	CCDS10218.1	15q22	2011-04-06			ENSG00000174444	ENSG00000174444		"""L ribosomal proteins"""	10353	protein-coding gene	gene with protein product	"""60S ribosomal protein L4"""	180479				9582194, 8268230	Standard	NM_000968		Approved	L4	uc002apv.3	P36578	OTTHUMG00000133193	ENST00000307961.6:c.1024C>T	15.37:g.66792408G>A	ENSP00000311430:p.Arg342Cys		Somatic				SNAPC5_uc002apu.1_5'Flank|RPL4_uc010bhr.2_Missense_Mutation_p.R248C|RPL4_uc002apw.2_Missense_Mutation_p.R248C|RPL4_uc002apx.2_Missense_Mutation_p.R248C	p.R342C	NM_000968	NP_000959	WXS	Illumina HiSeq	Unspecified	P36578	RL4_HUMAN			9	1080	-			342					A8K502|P39029|Q4VBR0|Q969Z9	Missense_Mutation	SNP	ENST00000307961.6	37	c.1024C>T	CCDS10218.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.12|15.12	2.737824|2.737824	0.49045|0.49045	.|.	.|.	ENSG00000174444|ENSG00000174444	ENST00000307961;ENST00000432669|ENST00000449253	.|.	.|.	.|.	5.12|5.12	5.12|5.12	0.69794|0.69794	.|.	0.313323|.	0.36200|.	N|.	0.002739|.	T|T	0.63153|0.63153	0.2487|0.2487	L|L	0.36672|0.36672	1.1|1.1	0.45415|0.45415	D|D	0.998392|0.998392	B|.	0.15473|.	0.013|.	B|.	0.14023|.	0.01|.	T|T	0.65594|0.65594	-0.6130|-0.6130	9|6	0.62326|0.59425	D|D	0.03|0.04	-5.0627|-5.0627	18.5905|18.5905	0.91210|0.91210	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	342|.	P36578|.	RL4_HUMAN|.	C|L	342|141	.|.	ENSP00000311430:R342C|ENSP00000403183:S141L	R|S	-|-	1|2	0|0	RPL4|RPL4	64579462|64579462	0.998000|0.998000	0.40836|0.40836	0.998000|0.998000	0.56505|0.56505	0.987000|0.987000	0.75469|0.75469	2.995000|2.995000	0.49441|0.49441	2.384000|2.384000	0.81235|0.81235	0.655000|0.655000	0.94253|0.94253	CGC|TCG		0.473	RPL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256903.2	NM_000968		9	86	0	0	0	0.006214	0	9	86				
ARID3B	10620	broad.mit.edu	37	15	74883593	74883593	+	Missense_Mutation	SNP	G	G	A			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr15:74883593G>A	ENST00000346246.5	+	6	1214	c.983G>A	c.(982-984)cGg>cAg	p.R328Q		NM_006465.2	NP_006456.1	Q8IVW6	ARI3B_HUMAN	AT rich interactive domain 3B (BRIGHT-like)	328	Interaction with RB1.					nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)	p.R328Q(1)		NS(1)|breast(1)|endometrium(1)|large_intestine(2)|lung(7)|prostate(2)	14						GAGGGCCGGCGGCCCAGCTAC	0.617																																							uc002aye.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(982-984)CGG>CAG		AT rich interactive domain 3B							71.0	85.0	80.0					15																	74883593		2196	4296	6492	SO:0001583	missense	10620				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding	g.chr15:74883593G>A		CCDS10264.1	15q24	2013-02-07	2006-11-08		ENSG00000179361	ENSG00000179361		"""-"""	14350	protein-coding gene	gene with protein product		612457	"""AT rich interactive domain 3B (BRIGHT- like)"""				Standard	NM_006465		Approved	BDP, DRIL2	uc002ayd.3	Q8IVW6	OTTHUMG00000141321	ENST00000346246.5:c.983G>A	15.37:g.74883593G>A	ENSP00000343126:p.Arg328Gln		Somatic				ARID3B_uc002ayd.2_Missense_Mutation_p.R328Q|ARID3B_uc010bjs.1_Missense_Mutation_p.R33Q	p.R328Q	NM_006465	NP_006456	WXS	Illumina HiSeq	Unspecified	Q8IVW6	ARI3B_HUMAN			6	1184	+			328			Interaction with RB1.		O95443|Q59HC9|Q6P9C9	Missense_Mutation	SNP	ENST00000346246.5	37	c.983G>A	CCDS10264.1	.	.	.	.	.	.	.	.	.	.	G	33	5.249345	0.95305	.	.	ENSG00000179361	ENST00000382537;ENST00000346246;ENST00000395077	T	0.54675	0.56	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	T	0.73497	0.3594	M	0.76170	2.325	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.85130	0.992;0.962;0.997	T	0.75717	-0.3220	10	0.54805	T	0.06	-21.6515	18.5888	0.91200	0.0:0.0:1.0:0.0	.	328;328;328	B4DXL8;Q8IVW6;Q8IVW6-4	.;ARI3B_HUMAN;.	Q	328	ENSP00000343126:R328Q	ENSP00000343126:R328Q	R	+	2	0	ARID3B	72670646	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.357000	0.97099	2.403000	0.81681	0.561000	0.74099	CGG		0.617	ARID3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280688.2	NM_006465		22	155	0	0	0	0.005443	0	22	155				
LOC645752	645752	broad.mit.edu	37	15	78211648	78211648	+	lincRNA	SNP	A	A	G	rs577974396	byFrequency	TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr15:78211648A>G	ENST00000565869.1	+	0	111				RN7SL214P_ENST00000487317.2_RNA|RP11-114H24.2_ENST00000567226.1_RNA																							CGCCAGGGATAGGGGCTCAGC	0.522																																							uc010bky.2		NA																	0					0						c.(118-120)CTA>CCA		SubName: Full=GOLGA6 protein; Flags: Fragment;																																						645752							g.chr15:78211648A>G																													15.37:g.78211648A>G			Somatic					p.L40P	NR_027024		WXS	Illumina HiSeq	Unspecified					11	883	-									Missense_Mutation	SNP	ENST00000565869.1	37	c.119T>C																																																																																					0.522	RP11-114H24.7-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000421587.1			3	63	0	0	0	0.004672	0	3	63				
ADAMTSL3	57188	broad.mit.edu	37	15	84611522	84611522	+	Silent	SNP	C	C	T			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr15:84611522C>T	ENST00000286744.5	+	18	2516	c.2292C>T	c.(2290-2292)caC>caT	p.H764H	ADAMTSL3_ENST00000567476.1_Silent_p.H764H	NM_207517.2	NP_997400.2	P82987	ATL3_HUMAN	ADAMTS-like 3	764	TSP type-1 6. {ECO:0000255|PROSITE- ProRule:PRU00210}.					proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.H764H(1)		NS(2)|breast(7)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(24)|lung(51)|ovary(7)|pancreas(2)|prostate(2)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	130			BRCA - Breast invasive adenocarcinoma(143;0.211)			CTGGCTGGCACATTGAAGAAT	0.572																																							uc002bjz.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(6)|central_nervous_system(5)|lung(5)|large_intestine(4)|breast(3)|skin(2)|kidney(1)|pancreas(1)	27						c.(2290-2292)CAC>CAT		ADAMTS-like 3 precursor							34.0	36.0	35.0					15																	84611522		2203	4300	6503	SO:0001819	synonymous_variant	57188					proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding	g.chr15:84611522C>T	AF237652	CCDS10326.1, CCDS73773.1	15q25.2	2013-01-29			ENSG00000156218	ENSG00000156218		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14633	protein-coding gene	gene with protein product		609199				9628581, 10574462	Standard	NM_207517		Approved	KIAA1233, punctin-2	uc002bjz.4	P82987	OTTHUMG00000147363	ENST00000286744.5:c.2292C>T	15.37:g.84611522C>T			Somatic				ADAMTSL3_uc010bmt.1_Silent_p.H764H|ADAMTSL3_uc010bmu.1_Silent_p.H764H	p.H764H	NM_207517	NP_997400	WXS	Illumina HiSeq	Unspecified	P82987	ATL3_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.211)		18	2516	+			764			TSP type-1 6.		A1A566|A1A567|Q9ULI7	Silent	SNP	ENST00000286744.5	37	c.2292C>T	CCDS10326.1																																																																																				0.572	ADAMTSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304007.2	NM_207517		3	23	0	0	0	0.009096	0	3	23				
EME2	197342	broad.mit.edu	37	16	1825151	1825152	+	Intron	DNP	GC	GC	AA			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	GC	GC	-	-	GC	GC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr16:1825151_1825152GC>AA	ENST00000568449.1	+	4	590				MRPS34_ENST00000177742.3_5'Flank|MRPS34_ENST00000397375.2_5'Flank|EME2_ENST00000307394.7_Nonsense_Mutation_p.C196*	NM_001257370.1	NP_001244299.1	A4GXA9	EME2_HUMAN	essential meiotic structure-specific endonuclease subunit 2						DNA recombination (GO:0006310)|DNA repair (GO:0006281)	nucleus (GO:0005634)	DNA binding (GO:0003677)|endonuclease activity (GO:0004519)	p.C196*(1)		central_nervous_system(1)|kidney(2)|lung(5)|pancreas(1)	9						TCACTCTCATGCCCACAGCAGG	0.668								Direct reversal of damage;Homologous recombination																															uc002cmq.1		NA																	1	Substitution - Nonsense(1)		lung(1)	lung(1)|central_nervous_system(1)|pancreas(1)	3						c.(586-588)TGC>TAA	Direct_reversal_of_damage|Homologous_recombination	essential meiotic endonuclease 1 homolog 2																																				SO:0001627	intron_variant	197342				DNA recombination|DNA repair	nucleus	DNA binding|endonuclease activity	g.chr16:1825151_1825152GC>AA	AK074080	CCDS58404.1	16p13.3	2013-07-03	2013-07-03			ENSG00000197774			27289	protein-coding gene	gene with protein product	"""SLX2 structure-specific endonuclease subunit homolog B (S. cerevisiae)"""	610886	"""essential meiotic endonuclease 1 homolog 2 (S. pombe)"""			12721304	Standard	NM_001257370		Approved	FLJ00151, SLX2B	uc010brw.1	A4GXA9		Exception_encountered	16.37:g.1825151_1825152delinsAA			Somatic				MRPS34_uc002cmn.2_5'Flank|MRPS34_uc002cmo.2_5'Flank|MRPS34_uc002cmp.1_5'Flank|EME2_uc010brw.1_Intron	p.C196*	NM_001010865	NP_001010865	WXS	Illumina HiSeq	Unspecified	A4GXA9	EME2_HUMAN			4	587_588	+			Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					Q8TEP2|Q96RY3	Nonsense_Mutation	DNP	ENST00000568449.1	37	c.587_588GC>AA	CCDS58404.1																																																																																				0.668	EME2-001	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000433185.2	NM_001010865		17	133	0	0	0	0.004672	0	17	133				
C16orf62	57020	broad.mit.edu	37	16	19702685	19702685	+	Silent	SNP	C	C	T			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr16:19702685C>T	ENST00000251143.5	+	29	2550	c.2538C>T	c.(2536-2538)aaC>aaT	p.N846N	C16orf62_ENST00000542263.1_Silent_p.N842N|C16orf62_ENST00000438132.3_Silent_p.N935N|C16orf62_ENST00000417362.2_Silent_p.N753N|C16orf62_ENST00000448695.1_Silent_p.N696N|C16orf62_ENST00000543152.1_Silent_p.N595N			Q7Z3J2	CP062_HUMAN	chromosome 16 open reading frame 62	846						integral component of membrane (GO:0016021)		p.N935N(1)|p.N846N(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(7)|liver(1)|lung(11)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	36						TGGACTCCAACGACAGCCTCT	0.562																																							uc002dgn.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(2536-2538)AAC>AAT		hypothetical protein LOC57020							106.0	88.0	94.0					16																	19702685		2197	4300	6497	SO:0001819	synonymous_variant	57020					integral to membrane		g.chr16:19702685C>T		CCDS32397.1, CCDS32397.2, CCDS73840.1	16p12.3	2012-05-30			ENSG00000103544	ENSG00000103544			24641	protein-coding gene	gene with protein product						10493829	Standard	NM_020314		Approved	MGC16824	uc002dgn.3	Q7Z3J2	OTTHUMG00000167925	ENST00000251143.5:c.2538C>T	16.37:g.19702685C>T			Somatic				C16orf62_uc002dgo.1_Silent_p.N753N|C16orf62_uc002dgp.1_Silent_p.N595N	p.N846N	NM_020314	NP_064710	WXS	Illumina HiSeq	Unspecified	Q7Z3J2	CP062_HUMAN			29	2550	+			846					A8K2M1|O43329|Q69YI1|Q6PDA0|Q7L371|Q86W66|Q8WXA5|Q9H0L7|Q9H7C8	Silent	SNP	ENST00000251143.5	37	c.2538C>T																																																																																					0.562	C16orf62-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_020314		9	41	0	0	0	0.006214	0	9	41				
LCMT1	51451	broad.mit.edu	37	16	25175965	25175965	+	Missense_Mutation	SNP	C	C	G			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr16:25175965C>G	ENST00000399069.3	+	7	771	c.616C>G	c.(616-618)Cca>Gca	p.P206A	LCMT1_ENST00000380966.4_Missense_Mutation_p.P151A|LCMT1_ENST00000572869.1_3'UTR	NM_016309.2	NP_057393.2	Q9UIC8	LCMT1_HUMAN	leucine carboxyl methyltransferase 1	206					C-terminal protein methylation (GO:0006481)|cellular protein modification process (GO:0006464)|negative regulation of protein complex assembly (GO:0031333)|protein methylation (GO:0006479)|regulation of apoptotic process (GO:0042981)|regulation of glucose metabolic process (GO:0010906)|regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090266)	cytosol (GO:0005829)	protein C-terminal carboxyl O-methyltransferase activity (GO:0003880)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)	p.P206A(1)							GBM - Glioblastoma multiforme(48;0.0336)	L-Leucine(DB00149)	TTACATGACTCCAGAGCAGTC	0.438																																					Colon(200;565 2072 24396 47922 50898)	Colon(200;565 2072 24396 47922 50898)	uc002dnx.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(616-618)CCA>GCA		leucine carboxyl methyltransferase 1 isoform a	L-Leucine(DB00149)						106.0	99.0	102.0					16																	25175965		1923	4155	6078	SO:0001583	missense	51451						protein binding|protein C-terminal carboxyl O-methyltransferase activity|S-adenosylmethionine-dependent methyltransferase activity	g.chr16:25175965C>G	AF037601	CCDS45445.1, CCDS45446.1	16p12.1	2014-08-01			ENSG00000205629	ENSG00000205629			17557	protein-coding gene	gene with protein product	"""protein phosphatase methyltransferase 1"""	610286				10810093	Standard	XM_005255354		Approved	CGI-68, PPMT1	uc002dnx.1	Q9UIC8	OTTHUMG00000177182	ENST00000399069.3:c.616C>G	16.37:g.25175965C>G	ENSP00000382021:p.Pro206Ala		Somatic				LCMT1_uc002dny.1_Missense_Mutation_p.P151A|LCMT1_uc002dnz.1_Missense_Mutation_p.P106A|LCMT1_uc002doa.1_Missense_Mutation_p.P51A	p.P206A	NM_016309	NP_057393	WXS	Illumina HiSeq	Unspecified	Q9UIC8	LCMT1_HUMAN		GBM - Glioblastoma multiforme(48;0.0336)	7	774	+			206					A6NL89|A8K770|Q53FC5|Q96CI5|Q9H6I9|Q9NTG4|Q9Y378	Missense_Mutation	SNP	ENST00000399069.3	37	c.616C>G	CCDS45445.1	.	.	.	.	.	.	.	.	.	.	C	15.15	2.748618	0.49257	.	.	ENSG00000205629	ENST00000399069;ENST00000380966;ENST00000380962	T;T	0.25250	1.81;1.81	5.83	4.82	0.62117	.	0.053908	0.85682	D	0.000000	T	0.27933	0.0688	L	0.61218	1.895	0.80722	D	1	B;B	0.09022	0.002;0.002	B;B	0.14578	0.011;0.003	T	0.03051	-1.1078	10	0.33141	T	0.24	-25.4881	14.1131	0.65134	0.0:0.8485:0.1515:0.0	.	151;206	Q9UIC8-3;Q9UIC8	.;LCMT1_HUMAN	A	206;151;223	ENSP00000382021:P206A;ENSP00000370353:P151A	ENSP00000370349:P223A	P	+	1	0	LCMT1	25083466	0.999000	0.42202	0.984000	0.44739	0.977000	0.68977	4.264000	0.58859	2.745000	0.94114	0.563000	0.77884	CCA		0.438	LCMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435747.4	NM_016309		4	108	0	0	0	0.009096	0	4	108				
PRRT2	112476	broad.mit.edu	37	16	29825755	29825755	+	Silent	SNP	C	C	A			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr16:29825755C>A	ENST00000358758.7	+	3	1264	c.981C>A	c.(979-981)atC>atA	p.I327I	PAGR1_ENST00000609618.1_5'Flank|PAGR1_ENST00000320330.6_5'Flank|PRRT2_ENST00000300797.6_3'UTR|AC009133.14_ENST00000569981.1_RNA|AC009133.20_ENST00000569039.1_RNA|PRRT2_ENST00000567659.1_Silent_p.I327I	NM_001256442.1|NM_001256443.1|NM_145239.2	NP_001243371.1|NP_001243372.1|NP_660282.2	Q7Z6L0	PRRT2_HUMAN	proline-rich transmembrane protein 2	327					neuromuscular process controlling posture (GO:0050884)|response to biotic stimulus (GO:0009607)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)		p.I327I(1)		central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	8						GAGTCCTCATCATCATCGCCT	0.642																																							uc002due.3		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(979-981)ATC>ATA		proline-rich transmembrane protein 2							74.0	81.0	78.0					16																	29825755		2197	4300	6497	SO:0001819	synonymous_variant	112476				response to biotic stimulus	integral to membrane		g.chr16:29825755C>A	BC011405	CCDS10654.1, CCDS58445.1, CCDS58446.1	16p11.2	2014-02-03			ENSG00000167371	ENSG00000167371		"""Proline-rich transmembrane proteins"""	30500	protein-coding gene	gene with protein product	"""interferon induced transmembrane protein domain containing 1"""	614386	"""infantile convulsions and paroxysmal choreoathetosis"""	ICCA		22101681, 22243967	Standard	NM_145239		Approved	FLJ25513, DKFZp547J199, IFITMD1, FICCA	uc002dud.3	Q7Z6L0	OTTHUMG00000177142	ENST00000358758.7:c.981C>A	16.37:g.29825755C>A			Somatic				uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|uc002duc.1_5'Flank|PRRT2_uc002dud.2_Silent_p.I327I|PRRT2_uc002duf.1_3'UTR|C16orf53_uc002dug.3_5'Flank	p.I327I	NM_145239	NP_660282	WXS	Illumina HiSeq	Unspecified	Q7Z6L0	PRRT2_HUMAN			3	1282	+			327			Helical; (Potential).		A8K8M8|Q8N2N8|Q8NAQ7|Q8ND36|Q96FA8	Silent	SNP	ENST00000358758.7	37	c.981C>A	CCDS10654.1																																																																																				0.642	PRRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255161.3	NM_145239		7	103	1	0	0.000157383	0.00308	0.000173035	7	103				
SALL1	6299	broad.mit.edu	37	16	51174943	51174943	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr16:51174943G>T	ENST00000251020.4	-	2	1223	c.1190C>A	c.(1189-1191)tCc>tAc	p.S397Y	SALL1_ENST00000566102.1_Intron|SALL1_ENST00000440970.1_Missense_Mutation_p.S300Y|SALL1_ENST00000562674.1_5'Flank|SALL1_ENST00000541611.1_Intron	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	397					adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S397Y(1)		NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			CGAGTTAGCGGAGGCTTGCTG	0.498																																					GBM(103;1352 1446 1855 4775 8890)	GBM(103;1352 1446 1855 4775 8890)	uc010vgs.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(5)|ovary(3)	8						c.(1189-1191)TCC>TAC		sal-like 1 isoform a							89.0	93.0	91.0					16																	51174943		2198	4300	6498	SO:0001583	missense	6299				adrenal gland development|branching involved in ureteric bud morphogenesis|embryonic digestive tract development|embryonic digit morphogenesis|gonad development|histone deacetylation|inductive cell-cell signaling|mesenchymal to epithelial transition involved in metanephros morphogenesis|negative regulation of transcription from RNA polymerase II promoter|olfactory bulb interneuron differentiation|olfactory bulb mitral cell layer development|olfactory nerve development|outer ear morphogenesis|pituitary gland development|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway|ureteric bud invasion|ventricular septum development	chromocenter|cytoplasm|heterochromatin|nucleus	beta-catenin binding|DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr16:51174943G>T	X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.1190C>A	16.37:g.51174943G>T	ENSP00000251020:p.Ser397Tyr		Somatic				SALL1_uc010vgr.1_Missense_Mutation_p.S300Y|SALL1_uc010cbv.2_Intron	p.S397Y	NM_002968	NP_002959	WXS	Illumina HiSeq	Unspecified	Q9NSC2	SALL1_HUMAN	COAD - Colon adenocarcinoma(2;0.24)		2	1221	-		all_cancers(37;0.0322)	397					Q99881|Q9NSC3|Q9P1R0	Missense_Mutation	SNP	ENST00000251020.4	37	c.1190C>A	CCDS10747.1	.	.	.	.	.	.	.	.	.	.	G	17.92	3.507555	0.64410	.	.	ENSG00000103449	ENST00000251020;ENST00000440970;ENST00000457559	T;T	0.09163	3.01;3.04	5.18	5.18	0.71444	.	0.099034	0.64402	D	0.000001	T	0.13243	0.0321	L	0.34521	1.04	0.40661	D	0.982122	B	0.32425	0.371	B	0.36885	0.235	T	0.07366	-1.0776	10	0.56958	D	0.05	.	18.685	0.91560	0.0:0.0:1.0:0.0	.	397	Q9NSC2	SALL1_HUMAN	Y	397;300;361	ENSP00000251020:S397Y;ENSP00000407914:S300Y	ENSP00000251020:S397Y	S	-	2	0	SALL1	49732444	1.000000	0.71417	0.995000	0.50966	0.841000	0.47740	9.850000	0.99511	2.386000	0.81285	0.563000	0.77884	TCC		0.498	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256883.2	NM_002968		12	139	1	0	6.42651e-13	0.010729	8.30439e-13	12	139				
SALL1	6299	broad.mit.edu	37	16	51175382	51175382	+	Missense_Mutation	SNP	G	G	A			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr16:51175382G>A	ENST00000251020.4	-	2	784	c.751C>T	c.(751-753)Cgt>Tgt	p.R251C	SALL1_ENST00000566102.1_Intron|SALL1_ENST00000440970.1_Missense_Mutation_p.R154C|SALL1_ENST00000562674.1_5'Flank|SALL1_ENST00000541611.1_Intron	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	251					adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R251C(1)		NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			ATTTGGTGACGAATCTGTTCG	0.532																																					GBM(103;1352 1446 1855 4775 8890)	GBM(103;1352 1446 1855 4775 8890)	uc010vgs.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(5)|ovary(3)	8						c.(751-753)CGT>TGT		sal-like 1 isoform a							85.0	88.0	87.0					16																	51175382		2198	4300	6498	SO:0001583	missense	6299				adrenal gland development|branching involved in ureteric bud morphogenesis|embryonic digestive tract development|embryonic digit morphogenesis|gonad development|histone deacetylation|inductive cell-cell signaling|mesenchymal to epithelial transition involved in metanephros morphogenesis|negative regulation of transcription from RNA polymerase II promoter|olfactory bulb interneuron differentiation|olfactory bulb mitral cell layer development|olfactory nerve development|outer ear morphogenesis|pituitary gland development|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway|ureteric bud invasion|ventricular septum development	chromocenter|cytoplasm|heterochromatin|nucleus	beta-catenin binding|DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr16:51175382G>A	X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.751C>T	16.37:g.51175382G>A	ENSP00000251020:p.Arg251Cys		Somatic				SALL1_uc010vgr.1_Missense_Mutation_p.R154C|SALL1_uc010cbv.2_Intron	p.R251C	NM_002968	NP_002959	WXS	Illumina HiSeq	Unspecified	Q9NSC2	SALL1_HUMAN	COAD - Colon adenocarcinoma(2;0.24)		2	782	-		all_cancers(37;0.0322)	251					Q99881|Q9NSC3|Q9P1R0	Missense_Mutation	SNP	ENST00000251020.4	37	c.751C>T	CCDS10747.1	.	.	.	.	.	.	.	.	.	.	G	19.67	3.871584	0.72065	.	.	ENSG00000103449	ENST00000251020;ENST00000440970;ENST00000457559	T;T	0.09350	3.02;2.99	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	T	0.29190	0.0726	L	0.48362	1.52	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.00611	-1.1645	10	0.54805	T	0.06	.	19.11	0.93313	0.0:0.0:1.0:0.0	.	251	Q9NSC2	SALL1_HUMAN	C	251;154;215	ENSP00000251020:R251C;ENSP00000407914:R154C	ENSP00000251020:R251C	R	-	1	0	SALL1	49732883	1.000000	0.71417	0.475000	0.27278	0.971000	0.66376	9.850000	0.99511	2.493000	0.84123	0.561000	0.74099	CGT		0.532	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256883.2	NM_002968		10	149	0	0	0	0.010729	0	10	149				
GSE1	23199	broad.mit.edu	37	16	85695049	85695049	+	Silent	SNP	G	G	T			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr16:85695049G>T	ENST00000253458.7	+	9	2114	c.1938G>T	c.(1936-1938)ctG>ctT	p.L646L	RN7SL381P_ENST00000577658.1_RNA|GSE1_ENST00000393243.1_Silent_p.L573L|GSE1_ENST00000405402.2_Silent_p.L542L	NM_014615.2	NP_055430.1	Q14687	GSE1_HUMAN	Gse1 coiled-coil protein	646	Pro-rich.							p.L646L(1)									CTGCCCCTCTGGACAAGTACC	0.706																																							uc002fix.2		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(3)|ovary(1)|skin(1)	5						c.(1936-1938)CTG>CTT		genetic suppressor element 1 isoform 1							17.0	22.0	20.0					16																	85695049		2189	4279	6468	SO:0001819	synonymous_variant	23199						protein binding	g.chr16:85695049G>T	D80004	CCDS10952.1, CCDS45539.1, CCDS62007.1	16q24.1	2012-12-07	2012-12-07	2012-10-02	ENSG00000131149	ENSG00000131149			28979	protein-coding gene	gene with protein product	"""genetic suppressor element 1"""		"""KIAA0182"", ""Gse1 coiled-coil protein homolog (mouse)"""	KIAA0182		8724849, 8786132	Standard	NM_014615		Approved		uc002fix.4	Q14687	OTTHUMG00000137650	ENST00000253458.7:c.1938G>T	16.37:g.85695049G>T			Somatic				KIAA0182_uc002fiw.2_Silent_p.L542L|KIAA0182_uc002fiy.2_Silent_p.L573L|KIAA0182_uc002fiz.2_5'Flank|KIAA0182_uc010cho.2_5'Flank	p.L646L	NM_014615	NP_055430	WXS	Illumina HiSeq	Unspecified	Q14687	GSE1_HUMAN			9	2012	+			646			Pro-rich.		D3DUM4|Q8IY61|Q96GA4|Q9BW09	Silent	SNP	ENST00000253458.7	37	c.1938G>T	CCDS10952.1	.	.	.	.	.	.	.	.	.	.	G	2.449	-0.326715	0.05350	.	.	ENSG00000131149	ENST00000412692	.	.	.	4.79	4.79	0.61399	.	.	.	.	.	T	0.73442	0.3587	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.73522	-0.3956	4	.	.	.	-9.535	17.4363	0.87553	0.0:0.0:1.0:0.0	.	.	.	.	L	453	.	.	W	+	2	0	KIAA0182	84252550	1.000000	0.71417	0.987000	0.45799	0.215000	0.24574	4.249000	0.58766	2.208000	0.71279	0.561000	0.74099	TGG		0.706	GSE1-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325527.1	NM_014615		5	20	1	0	1.06961e-07	0.00308	1.25949e-07	5	20				
SPATA22	84690	broad.mit.edu	37	17	3343538	3343538	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr17:3343538C>A	ENST00000573128.1	-	9	1478	c.995G>T	c.(994-996)aGa>aTa	p.R332I	SPATA22_ENST00000268981.5_3'UTR|SPATA22_ENST00000397168.3_Missense_Mutation_p.R332I|SPATA22_ENST00000572969.1_Missense_Mutation_p.R332I|SPATA22_ENST00000541913.1_Missense_Mutation_p.R316I|SPATA22_ENST00000355380.4_Missense_Mutation_p.R289I|SPATA22_ENST00000575375.1_Missense_Mutation_p.R332I			Q8NHS9	SPT22_HUMAN	spermatogenesis associated 22	332					fertilization (GO:0009566)|gamete generation (GO:0007276)|meiotic DNA repair synthesis (GO:0000711)|regulation of meiotic cell cycle (GO:0051445)|reproductive system development (GO:0061458)|synapsis (GO:0007129)	chromosome (GO:0005694)		p.R332I(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|skin(2)	19						AGACGCCGGTCTGACAGAAAC	0.378																																							uc002fvm.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(994-996)AGA>ATA		spermatogenesis associated 22							66.0	71.0	69.0					17																	3343538		2203	4300	6503	SO:0001583	missense	84690							g.chr17:3343538C>A	AY035868	CCDS11027.1, CCDS54066.1, CCDS54067.1	17p13.3	2005-12-19							30705	protein-coding gene	gene with protein product						12477932	Standard	NM_001170696		Approved	NYD-SP20	uc002fvn.3	Q8NHS9		ENST00000573128.1:c.995G>T	17.37:g.3343538C>A	ENSP00000459580:p.Arg332Ile		Somatic				SPATA22_uc010vrg.1_Missense_Mutation_p.R316I|SPATA22_uc010vrf.1_3'UTR|SPATA22_uc002fvn.2_Missense_Mutation_p.R332I|SPATA22_uc002fvo.2_Missense_Mutation_p.R332I|SPATA22_uc002fvp.2_Missense_Mutation_p.R332I|SPATA22_uc010ckf.2_Missense_Mutation_p.R289I	p.R332I	NM_032598	NP_115987	WXS	Illumina HiSeq	Unspecified	Q8NHS9	SPT22_HUMAN			9	1232	-			332					B4DXB1|D3DTI9|J3KN63|Q969H3|Q96JT4	Missense_Mutation	SNP	ENST00000573128.1	37	c.995G>T	CCDS11027.1	.	.	.	.	.	.	.	.	.	.	C	25.4	4.631284	0.87660	.	.	ENSG00000141255	ENST00000355380;ENST00000397168;ENST00000541913	T;T;T	0.35605	1.3;1.3;1.3	5.71	4.74	0.60224	.	0.061977	0.64402	D	0.000014	T	0.45955	0.1368	L	0.27053	0.805	0.53005	D	0.99996	D;D;D	0.67145	0.996;0.996;0.996	D;D;D	0.68483	0.958;0.958;0.958	T	0.50021	-0.8876	10	0.87932	D	0	-22.5226	14.1402	0.65316	0.0:0.9281:0.0:0.0719	.	316;289;332	F5GWB9;Q8NHS9-2;Q8NHS9	.;.;SPT22_HUMAN	I	289;332;316	ENSP00000347541:R289I;ENSP00000380354:R332I;ENSP00000441920:R316I	ENSP00000347541:R289I	R	-	2	0	SPATA22	3290288	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	4.572000	0.60886	1.564000	0.49628	0.557000	0.71058	AGA		0.378	SPATA22-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438067.2	NM_032598		7	124	1	0	5.18039e-06	0.00308	5.89085e-06	7	124				
SLC13A2	9058	broad.mit.edu	37	17	26818601	26818601	+	Missense_Mutation	SNP	G	G	C			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr17:26818601G>C	ENST00000314669.5	+	5	1141	c.721G>C	c.(721-723)Gca>Cca	p.A241P	SLC13A2_ENST00000537681.1_Missense_Mutation_p.A170P|SLC13A2_ENST00000444914.3_Missense_Mutation_p.A290P|SLC13A2_ENST00000545060.1_Missense_Mutation_p.A198P	NM_003984.3	NP_003975.1	Q13183	S13A2_HUMAN	solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 2	241					dicarboxylic acid transport (GO:0006835)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	low-affinity sodium:dicarboxylate symporter activity (GO:0015361)	p.A241T(1)|p.A290T(1)|p.A241P(1)|p.A290P(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	all_lung(13;0.000871)|Lung NSC(42;0.0027)			UCEC - Uterine corpus endometrioid carcinoma (53;0.154)	Succinic acid(DB00139)	GACTGGCACCGCACCCAACCT	0.627																																							uc002hbh.2		NA																	4	Substitution - Missense(4)		lung(4)		0						c.(721-723)GCA>CCA		solute carrier family 13, member 2 isoform b	Succinic acid(DB00139)						59.0	55.0	56.0					17																	26818601		2203	4300	6503	SO:0001583	missense	9058					integral to plasma membrane|membrane fraction	low affinity sodium:dicarboxylate symporter activity	g.chr17:26818601G>C	U26209	CCDS11231.1, CCDS54098.1	17p13.2	2013-05-22			ENSG00000007216	ENSG00000007216		"""Solute carriers"""	10917	protein-coding gene	gene with protein product		604148				8967342, 10343111	Standard	NM_001145975		Approved	NaDC-1	uc010wan.2	Q13183	OTTHUMG00000132523	ENST00000314669.5:c.721G>C	17.37:g.26818601G>C	ENSP00000316202:p.Ala241Pro		Somatic				SLC13A2_uc010wal.1_Missense_Mutation_p.A198P|SLC13A2_uc010wam.1_Missense_Mutation_p.A197P|SLC13A2_uc010wan.1_Missense_Mutation_p.A290P|SLC13A2_uc010wao.1_Missense_Mutation_p.A198P|SLC13A2_uc002hbi.2_Missense_Mutation_p.A170P	p.A241P	NM_003984	NP_003975	WXS	Illumina HiSeq	Unspecified	Q13183	S13A2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (53;0.154)	5	788	+	all_lung(13;0.000871)|Lung NSC(42;0.0027)		241			Helical; (Potential).		B2RBI9|B4DPL1|E7ETH5|Q4VAR7	Missense_Mutation	SNP	ENST00000314669.5	37	c.721G>C	CCDS11231.1	.	.	.	.	.	.	.	.	.	.	G	14.36	2.512967	0.44660	.	.	ENSG00000007216	ENST00000314669;ENST00000444914;ENST00000545060;ENST00000541739;ENST00000537681	T;T;T;T	0.12569	2.67;2.67;2.67;2.67	5.5	-5.97	0.02227	.	0.295443	0.41605	D	0.000856	T	0.03608	0.0103	N	0.01454	-0.855	0.27401	N	0.954856	P;B;B;P;B	0.37141	0.578;0.001;0.0;0.584;0.001	P;B;B;P;B	0.45474	0.482;0.018;0.004;0.449;0.015	T	0.36138	-0.9760	10	0.07325	T	0.83	-16.872	4.1181	0.10092	0.4445:0.0:0.2456:0.3099	.	198;290;197;170;241	F5GWV6;E7ETH5;B4E1M6;G3V1L2;Q13183	.;.;.;.;S13A2_HUMAN	P	241;290;198;197;170	ENSP00000316202:A241P;ENSP00000392411:A290P;ENSP00000441935:A198P;ENSP00000440802:A170P	ENSP00000316202:A241P	A	+	1	0	SLC13A2	23842728	0.576000	0.26700	0.006000	0.13384	0.633000	0.38033	1.138000	0.31491	-0.913000	0.03832	-0.691000	0.03719	GCA		0.627	SLC13A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255722.1	NM_003984		13	79	0	0	0	0.003163	0	13	79				
RNF135	84282	broad.mit.edu	37	17	29325909	29325909	+	Silent	SNP	G	G	A			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr17:29325909G>A	ENST00000328381.5	+	5	1872	c.999G>A	c.(997-999)gaG>gaA	p.E333E	RNF135_ENST00000324689.4_3'UTR|RNF135_ENST00000443677.2_3'UTR|RNF135_ENST00000535306.2_3'UTR	NM_032322.3	NP_115698.3	Q8IUD6	RN135_HUMAN	ring finger protein 135	333	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|positive regulation of interferon-beta production (GO:0032728)|protein ubiquitination (GO:0016567)|regulation of innate immune response (GO:0045088)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ligase activity (GO:0016874)|ribonucleoprotein complex binding (GO:0043021)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.E333E(1)|p.?(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(1)|skin(2)|urinary_tract(1)	10		all_cancers(10;8.65e-08)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Myeloproliferative disorder(56;0.0255)				CTTCCTGGGAGATGAGCCGCG	0.557																																							uc002hfz.2		NA																	2	Unknown(1)|Substitution - coding silent(1)	p.?(1)	lung(1)|central_nervous_system(1)	skin(2)	2						c.(997-999)GAG>GAA		ring finger protein 135 isoform 1							48.0	46.0	47.0					17																	29325909		2203	4300	6503	SO:0001819	synonymous_variant	84282				innate immune response|negative regulation of type I interferon production|positive regulation of interferon-beta production|regulation of innate immune response	cytosol	protein binding|ribonucleoprotein binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr17:29325909G>A	AJ496729	CCDS11262.1, CCDS11263.1, CCDS54104.1	17q11.2	2013-01-09			ENSG00000181481	ENSG00000181481		"""RING-type (C3HC4) zinc fingers"""	21158	protein-coding gene	gene with protein product	"""riplet"""	611358				11468690, 19017631	Standard	NM_001184992		Approved	MGC13061	uc002hfz.3	Q8IUD6	OTTHUMG00000132867	ENST00000328381.5:c.999G>A	17.37:g.29325909G>A			Somatic				RNF135_uc002hga.2_3'UTR|RNF135_uc010csm.2_3'UTR|RNF135_uc002hgb.2_3'UTR	p.E333E	NM_032322	NP_115698	WXS	Illumina HiSeq	Unspecified	Q8IUD6	RN135_HUMAN			5	1135	+		all_cancers(10;8.65e-08)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Myeloproliferative disorder(56;0.0255)	333			B30.2/SPRY.		A0AVM5|B2R7G9|B6ZLM5|F5GX60|Q9BSE9	Silent	SNP	ENST00000328381.5	37	c.999G>A	CCDS11262.1																																																																																				0.557	RNF135-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256342.3	NM_032322		12	50	0	0	0	0.001855	0	12	50				
CDK12	51755	broad.mit.edu	37	17	37627359	37627359	+	Missense_Mutation	SNP	T	T	C			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr17:37627359T>C	ENST00000447079.4	+	2	1307	c.1274T>C	c.(1273-1275)gTa>gCa	p.V425A	CDK12_ENST00000430627.2_Missense_Mutation_p.V425A	NM_015083.1|NM_016507.2	NP_055898.1|NP_057591.2	Q9NYV4	CDK12_HUMAN	cyclin-dependent kinase 12	425					mRNA processing (GO:0006397)|phosphorylation of RNA polymerase II C-terminal domain (GO:0070816)|protein autophosphorylation (GO:0046777)|regulation of MAP kinase activity (GO:0043405)|RNA splicing (GO:0008380)	cyclin K-CDK12 complex (GO:0002944)|nuclear cyclin-dependent protein kinase holoenzyme complex (GO:0019908)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)	p.V425A(1)		NS(4)|breast(3)|endometrium(5)|kidney(4)|large_intestine(11)|lung(23)|ovary(11)|prostate(4)|skin(2)|urinary_tract(3)	70						GGTTCACCTGTATTTTTGCCT	0.438			"""Mis, N, F"""		serous ovarian					TCGA Ovarian(9;0.13)																													uc010cvv.2		NA		Rec	yes		17	17q12	51755		cyclin-dependent kinase 12			E					1	Substitution - Missense(1)		lung(1)	ovary(10)|lung(4)|breast(2)|skin(2)|large_intestine(1)	19						c.(1273-1275)GTA>GCA		Cdc2-related kinase, arginine/serine-rich							63.0	63.0	63.0					17																	37627359		2203	4300	6503	SO:0001583	missense	51755				mRNA processing|phosphorylation of RNA polymerase II C-terminal domain|protein autophosphorylation|regulation of MAP kinase activity|RNA splicing	nuclear cyclin-dependent protein kinase holoenzyme complex|nuclear speck|nucleolus	ATP binding|cyclin-dependent protein kinase activity|protein binding|RNA polymerase II carboxy-terminal domain kinase activity	g.chr17:37627359T>C	AF227198	CCDS11337.1, CCDS45666.1	17q12	2011-10-25	2009-12-16	2009-12-16	ENSG00000167258	ENSG00000167258		"""Cyclin-dependent kinases"""	24224	protein-coding gene	gene with protein product	"""CDC2 related protein kinase 7"""	615514	"""Cdc2-related kinase, arginine/serine-rich"""	CRKRS		10048485, 11683387, 19884882	Standard	XM_005257456		Approved	CRK7, CRKR, KIAA0904	uc010cvv.3	Q9NYV4	OTTHUMG00000133214	ENST00000447079.4:c.1274T>C	17.37:g.37627359T>C	ENSP00000398880:p.Val425Ala	TCGA Ovarian(9;0.13)	Somatic				CDK12_uc010wef.1_Missense_Mutation_p.V424A|CDK12_uc002hrw.3_Missense_Mutation_p.V425A	p.V425A	NM_016507	NP_057591	WXS	Illumina HiSeq	Unspecified	Q9NYV4	CDK12_HUMAN			2	1860	+			425					A7E2B2|B4DYX4|B9EIQ6|O94978	Missense_Mutation	SNP	ENST00000447079.4	37	c.1274T>C	CCDS11337.1	.	.	.	.	.	.	.	.	.	.	T	10.44	1.350951	0.24512	.	.	ENSG00000167258	ENST00000430627;ENST00000447079	T;T	0.39592	1.07;1.07	6.16	3.92	0.45320	.	0.651402	0.14227	N	0.333032	T	0.19525	0.0469	N	0.08118	0	0.09310	N	1	B;B;B	0.11235	0.002;0.002;0.004	B;B;B	0.15484	0.006;0.006;0.013	T	0.26849	-1.0091	10	0.16896	T	0.51	-0.3001	4.7632	0.13118	0.1189:0.0642:0.1244:0.6925	.	424;425;425	E7EUM9;Q9NYV4;Q9NYV4-2	.;CDK12_HUMAN;.	A	425	ENSP00000407720:V425A;ENSP00000398880:V425A	ENSP00000407720:V425A	V	+	2	0	CDK12	34880885	0.843000	0.29541	0.975000	0.42487	0.995000	0.86356	2.173000	0.42472	0.530000	0.28619	0.528000	0.53228	GTA		0.438	CDK12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256941.4	NM_016507		23	124	0	0	0	0.014323	0	23	124				
KRTAP4-9	100132386	broad.mit.edu	37	17	39261731	39261731	+	Missense_Mutation	SNP	G	G	C	rs369890328	byFrequency	TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr17:39261731G>C	ENST00000391415.1	+	1	148	c.91G>C	c.(91-93)Gag>Cag	p.E31Q		NM_001146041.1	NP_001139513.1	Q9BYQ8	KRA49_HUMAN	keratin associated protein 4-9	31	29 X 5 AA repeats of C-C-[RQVHIEK]- [SPTR]-[VSTQCRNP].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)		p.E31Q(1)		central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|urinary_tract(3)	14						CAGCTGCTGTGAGACCACCTG	0.637													G|||	8	0.00159744	0.0015	0.0	5008	,	,		17461	0.0		0.001	False		,,,				2504	0.0051						uc010wfp.1		NA																	1	Substitution - Missense(1)		endometrium(1)		0						c.(91-93)GAG>CAG		keratin associated protein 4-9							16.0	22.0	20.0					17																	39261731		692	1590	2282	SO:0001583	missense	100132386					keratin filament		g.chr17:39261731G>C	AJ406941	CCDS54124.1	17q21.2	2013-06-25			ENSG00000212722	ENSG00000212722		"""Keratin associated proteins"""	18910	protein-coding gene	gene with protein product							Standard	NM_001146041		Approved	KAP4.9	uc010wfp.2	Q9BYQ8	OTTHUMG00000133584	ENST00000391415.1:c.91G>C	17.37:g.39261731G>C	ENSP00000375234:p.Glu31Gln		Somatic					p.E31Q	NM_001146041	NP_001139513	WXS	Illumina HiSeq	Unspecified	Q9BYQ8	KRA49_HUMAN			1	91	+			31			2.|29 X 5 AA repeats of C-C-[RQVHIEK]- [SPTR]-[VSTQCRNP].			Missense_Mutation	SNP	ENST00000391415.1	37	c.91G>C	CCDS54124.1	.	.	.	.	.	.	.	.	.	.	.	0.005	-2.121653	0.00346	.	.	ENSG00000212722	ENST00000391415;ENST00000333994	T	0.26518	1.73	3.31	-2.91	0.05631	.	.	.	.	.	T	0.02727	0.0082	N	0.00020	-2.78	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.45425	-0.9262	9	0.02654	T	1	.	7.3216	0.26531	0.2761:0.3069:0.4171:0.0	.	31	Q9BYQ8	KRA49_HUMAN	Q	31	ENSP00000375234:E31Q	ENSP00000334461:E31Q	E	+	1	0	KRTAP4-9	36515257	0.000000	0.05858	0.038000	0.18304	0.335000	0.28730	-1.734000	0.01848	-0.249000	0.09569	-1.188000	0.01700	GAG		0.637	KRTAP4-9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257688.1	NM_001146041		3	69	0	0	0	0.004672	0	3	69				
MAPT	4137	broad.mit.edu	37	17	44061120	44061120	+	Missense_Mutation	SNP	A	A	C			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr17:44061120A>C	ENST00000571987.1	+	5	950	c.950A>C	c.(949-951)cAc>cCc	p.H317P	MAPT_ENST00000576518.1_Intron|MAPT_ENST00000334239.8_Intron|MAPT_ENST00000535772.1_Intron|MAPT_ENST00000347967.5_Intron|MAPT_ENST00000351559.5_Intron|MAPT_ENST00000344290.5_Missense_Mutation_p.H317P|MAPT_ENST00000420682.2_Intron|MAPT_ENST00000431008.3_Intron|MAPT_ENST00000570299.1_Intron|MAPT_ENST00000340799.5_Intron|MAPT_ENST00000415613.2_Missense_Mutation_p.H317P|MAPT_ENST00000574436.1_Intron|MAPT_ENST00000446361.3_Intron|MAPT_ENST00000262410.5_Missense_Mutation_p.H317P			P10636	TAU_HUMAN	microtubule-associated protein tau	317					adult walking behavior (GO:0007628)|apoptotic process (GO:0006915)|axon cargo transport (GO:0008088)|axon extension (GO:0048675)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|generation of neurons (GO:0048699)|microtubule cytoskeleton organization (GO:0000226)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|neuron migration (GO:0001764)|positive regulation of axon extension (GO:0045773)|positive regulation of microtubule polymerization (GO:0031116)|regulation of autophagy (GO:0010506)|regulation of microtubule polymerization (GO:0031113)|regulation of microtubule-based movement (GO:0060632)	axon (GO:0030424)|axoneme (GO:0005930)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|growth cone (GO:0030426)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nuclear periphery (GO:0034399)|plasma membrane (GO:0005886)|tubulin complex (GO:0045298)	apolipoprotein binding (GO:0034185)|enzyme binding (GO:0019899)|lipoprotein particle binding (GO:0071813)|microtubule binding (GO:0008017)|SH3 domain binding (GO:0017124)|structural constituent of cytoskeleton (GO:0005200)	p.H317P(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	38		Melanoma(429;0.216)			Docetaxel(DB01248)|Paclitaxel(DB01229)	GAGCAGGCGCACTCGGAGGAG	0.647																																							uc002ijr.3		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)	1						c.(949-951)CAC>CCC		microtubule-associated protein tau isoform 1							36.0	42.0	40.0					17																	44061120		2203	4300	6503	SO:0001583	missense	4137				cellular component disassembly involved in apoptosis|microtubule cytoskeleton organization|negative regulation of microtubule depolymerization|positive regulation of axon extension|positive regulation of microtubule polymerization|regulation of autophagy	axon|cytosol|growth cone|microtubule|microtubule associated complex|nuclear periphery|plasma membrane|tubulin complex	apolipoprotein E binding|enzyme binding|identical protein binding|lipoprotein particle binding|microtubule binding|protein binding|SH3 domain binding|structural constituent of cytoskeleton	g.chr17:44061120A>C	J03778	CCDS11499.1, CCDS11500.1, CCDS11501.1, CCDS11502.1, CCDS45715.1, CCDS45716.1, CCDS56033.1	17q21	2014-09-17			ENSG00000186868	ENSG00000186868			6893	protein-coding gene	gene with protein product	"""G protein beta1/gamma2 subunit-interacting factor 1"", ""microtubule-associated protein tau, isoform 4"", ""protein phosphatase 1, regulatory subunit 103"""	157140		DDPAC, MAPTL		7936241, 3131773	Standard	NM_001123067		Approved	MTBT1, tau, PPND, FTDP-17, TAU, MSTD, MTBT2, FLJ31424, MGC138549, PPP1R103	uc010dau.3	P10636	OTTHUMG00000168833	ENST00000571987.1:c.950A>C	17.37:g.44061120A>C	ENSP00000458742:p.His317Pro		Somatic				MAPT_uc010dau.2_Missense_Mutation_p.H317P|MAPT_uc002ijs.3_Intron|MAPT_uc002ijx.3_Intron|MAPT_uc002ijt.3_Intron|MAPT_uc002iju.3_Intron|MAPT_uc002ijv.3_Intron	p.H317P	NM_016835	NP_058519	WXS	Illumina HiSeq	Unspecified	P10636	TAU_HUMAN			6	1270	+		Melanoma(429;0.216)	317					P18518|Q14799|Q15549|Q15550|Q15551|Q1RMF6|Q53YB1|Q5CZI7|Q5XWF0|Q6QT54|Q9UDJ3|Q9UMH0|Q9UQ96	Missense_Mutation	SNP	ENST00000571987.1	37	c.950A>C	CCDS11501.1	.	.	.	.	.	.	.	.	.	.	A	9.629	1.135956	0.21123	.	.	ENSG00000186868	ENST00000344290;ENST00000262410;ENST00000415613	T;T;T	0.09723	2.95;2.95;2.95	4.38	-5.78	0.02362	.	2.595140	0.01427	N	0.014619	T	0.06188	0.0160	L	0.29908	0.895	0.09310	N	0.999999	P;P	0.40731	0.728;0.476	B;B	0.37198	0.243;0.057	T	0.30357	-0.9981	10	0.29301	T	0.29	13.9193	1.2358	0.01952	0.3622:0.2816:0.2255:0.1307	.	317;317	P10636-9;P10636	.;TAU_HUMAN	P	317	ENSP00000340820:H317P;ENSP00000262410:H317P;ENSP00000410838:H317P	ENSP00000262410:H317P	H	+	2	0	MAPT	41416957	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.774000	0.04684	-0.625000	0.05604	-0.337000	0.08149	CAC		0.647	MAPT-008	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000440133.1	NM_016835		11	90	0	0	0	0.013537	0	11	90				
TBX21	30009	broad.mit.edu	37	17	45822618	45822618	+	Missense_Mutation	SNP	G	G	C			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr17:45822618G>C	ENST00000177694.1	+	6	1705	c.1494G>C	c.(1492-1494)aaG>aaC	p.K498N		NM_013351.1	NP_037483.1	Q9UL17	TBX21_HUMAN	T-box 21	498					cellular response to organic substance (GO:0071310)|lymphocyte migration (GO:0072676)|multicellular organismal development (GO:0007275)|positive regulation of isotype switching to IgG isotypes (GO:0048304)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to virus (GO:0009615)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	neuronal cell body (GO:0043025)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.K498N(1)		NS(1)|endometrium(1)|large_intestine(3)|lung(14)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	22						GAGACTCTAAGAGGAGGCGCG	0.587																																							uc002ilv.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1492-1494)AAG>AAC		T-box 21							45.0	47.0	47.0					17																	45822618		2203	4300	6503	SO:0001583	missense	30009				lymphocyte migration|multicellular organismal development|positive regulation of transcription, DNA-dependent|response to virus	nucleus	sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding	g.chr17:45822618G>C	AF093098	CCDS11514.1	17q21.2	2008-06-23				ENSG00000073861		"""T-boxes"""	11599	protein-coding gene	gene with protein product		604895					Standard	NM_013351		Approved	TBLYM, T-bet	uc002ilv.1	Q9UL17		ENST00000177694.1:c.1494G>C	17.37:g.45822618G>C	ENSP00000177694:p.Lys498Asn		Somatic					p.K498N	NM_013351	NP_037483	WXS	Illumina HiSeq	Unspecified	Q9UL17	TBX21_HUMAN			6	1705	+			498						Missense_Mutation	SNP	ENST00000177694.1	37	c.1494G>C	CCDS11514.1	.	.	.	.	.	.	.	.	.	.	G	25.4	4.635181	0.87760	.	.	ENSG00000073861	ENST00000177694	D	0.92048	-2.96	5.38	5.38	0.77491	.	0.467416	0.23171	N	0.051133	D	0.95623	0.8577	M	0.76727	2.345	0.58432	D	0.999997	D	0.89917	1.0	D	0.83275	0.996	D	0.95817	0.8846	10	0.87932	D	0	.	14.6327	0.68668	0.0:0.0:1.0:0.0	.	498	Q9UL17	TBX21_HUMAN	N	498	ENSP00000177694:K498N	ENSP00000177694:K498N	K	+	3	2	TBX21	43177617	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.958000	0.63660	2.499000	0.84300	0.655000	0.94253	AAG		0.587	TBX21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441365.1	NM_013351		12	96	0	0	0	0.010729	0	12	96				
WFIKKN2	124857	broad.mit.edu	37	17	48918350	48918350	+	Silent	SNP	C	C	T	rs370063693		TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr17:48918350C>T	ENST00000311378.4	+	2	2229	c.1701C>T	c.(1699-1701)gaC>gaT	p.D567D	WFIKKN2_ENST00000426127.1_Silent_p.D474D|RP11-506D12.5_ENST00000572491.2_RNA	NM_175575.5	NP_783165.1	Q8TEU8	WFKN2_HUMAN	WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 2	567					muscle fiber development (GO:0048747)|negative regulation of DNA binding (GO:0043392)|negative regulation of protein binding (GO:0032091)|palate development (GO:0060021)|skeletal system development (GO:0001501)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular region (GO:0005576)	metalloendopeptidase inhibitor activity (GO:0008191)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.D567D(1)		cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(13)|ovary(4)|skin(1)	29			BRCA - Breast invasive adenocarcinoma(22;1.09e-08)			AGACCTGTGACGTCCTCAAGG	0.622																																							uc002isv.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|skin(1)	3						c.(1699-1701)GAC>GAT		WFIKKN2 protein		C		0,4400		0,0,2200	42.0	38.0	40.0		1701	-10.2	0.1	17		40	1,8597		0,1,4298	no	coding-synonymous	WFIKKN2	NM_175575.5		0,1,6498	TT,TC,CC		0.0116,0.0,0.0077		567/577	48918350	1,12997	2200	4299	6499	SO:0001819	synonymous_variant	124857					extracellular region	metalloendopeptidase inhibitor activity|protein binding|serine-type endopeptidase inhibitor activity	g.chr17:48918350C>T	AY358142	CCDS11575.1	17q21.33	2013-01-21			ENSG00000173714	ENSG00000173714		"""Immunoglobulin superfamily / I-set domain containing"", ""WAP four-disulfide core domain containing"""	30916	protein-coding gene	gene with protein product	"""WAP four-disulfide core domain 20B"""	610895				11928817, 12709070	Standard	NM_175575		Approved	WFIKKNRP, WFDC20B	uc002isv.4	Q8TEU8	OTTHUMG00000162274	ENST00000311378.4:c.1701C>T	17.37:g.48918350C>T			Somatic				WFIKKN2_uc010dbu.2_Silent_p.D474D	p.D567D	NM_175575	NP_783165	WXS	Illumina HiSeq	Unspecified	Q8TEU8	WFKN2_HUMAN	BRCA - Breast invasive adenocarcinoma(22;1.09e-08)		2	2395	+			567					Q6UXZ9	Silent	SNP	ENST00000311378.4	37	c.1701C>T	CCDS11575.1																																																																																				0.622	WFIKKN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368358.1	NM_175575		5	58	0	0	0	0.00308	0	5	58				
TYMS	7298	broad.mit.edu	37	18	670729	670729	+	Silent	SNP	C	C	G			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr18:670729C>G	ENST00000323274.10	+	5	733	c.594C>G	c.(592-594)ctC>ctG	p.L198L	TYMS_ENST00000581920.1_3'UTR|TYMS_ENST00000323224.7_Silent_p.L164L|TYMS_ENST00000323250.5_Silent_p.L115L	NM_001071.2	NP_001062.1	P04818	TYSY_HUMAN	thymidylate synthetase	198					aging (GO:0007568)|cartilage development (GO:0051216)|circadian rhythm (GO:0007623)|deoxyribonucleoside monophosphate biosynthetic process (GO:0009157)|developmental growth (GO:0048589)|dTMP biosynthetic process (GO:0006231)|dTTP biosynthetic process (GO:0006235)|dUMP metabolic process (GO:0046078)|G1/S transition of mitotic cell cycle (GO:0000082)|immortalization of host cell by virus (GO:0019088)|intestinal epithelial cell maturation (GO:0060574)|mitotic cell cycle (GO:0000278)|nucleobase-containing compound metabolic process (GO:0006139)|nucleobase-containing small molecule metabolic process (GO:0055086)|organ regeneration (GO:0031100)|polysaccharide metabolic process (GO:0005976)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside biosynthetic process (GO:0046134)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to folic acid (GO:0051593)|response to glucocorticoid (GO:0051384)|response to organophosphorus (GO:0046683)|response to progesterone (GO:0032570)|response to toxic substance (GO:0009636)|response to vitamin A (GO:0033189)|small molecule metabolic process (GO:0044281)|tetrahydrofolate metabolic process (GO:0046653)|uracil metabolic process (GO:0019860)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cofactor binding (GO:0048037)|drug binding (GO:0008144)|folic acid binding (GO:0005542)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|thymidylate synthase activity (GO:0004799)	p.L198L(1)		endometrium(1)|large_intestine(3)|lung(2)|urinary_tract(2)	8					Capecitabine(DB01101)|Floxuridine(DB00322)|Fluorouracil(DB00544)|Gemcitabine(DB00441)|Leucovorin(DB00650)|Methotrexate(DB00563)|Pemetrexed(DB00642)|Pralatrexate(DB06813)|Raltitrexed(DB00293)|Trifluridine(DB00432)|Trimethoprim(DB00440)	GCCATGCCCTCTGCCAGTTCT	0.557																																							uc010dka.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(592-594)CTC>CTG		thymidylate synthase	Capecitabine(DB01101)|Floxuridine(DB00322)|Fluorouracil(DB00544)|Gemcitabine(DB00441)|Leucovorin(DB00650)|Pemetrexed(DB00642)|Raltitrexed(DB00293)|Trifluridine(DB00432)						156.0	132.0	140.0					18																	670729		2203	4300	6503	SO:0001819	synonymous_variant	7298				DNA repair|DNA replication|phosphatidylinositol-mediated signaling|pyrimidine base metabolic process|pyrimidine nucleoside biosynthetic process|regulation of transcription involved in G1/S phase of mitotic cell cycle|response to organophosphorus	cytosol	thymidylate synthase activity	g.chr18:670729C>G	X02308	CCDS11821.1	18p11.31-p11.21	2014-09-17			ENSG00000176890	ENSG00000176890	2.1.1.45		12441	protein-coding gene	gene with protein product		188350		TS			Standard	NM_001071		Approved	Tsase, TMS, HsT422	uc010dka.1	P04818	OTTHUMG00000131473	ENST00000323274.10:c.594C>G	18.37:g.670729C>G			Somatic				TYMS_uc010dkb.1_Silent_p.L164L|TYMS_uc010dkc.1_Silent_p.L115L	p.L198L	NM_001071	NP_001062	WXS	Illumina HiSeq	Unspecified	P04818	TYSY_HUMAN			5	733	+			198					Q8WYK3|Q8WYK4	Silent	SNP	ENST00000323274.10	37	c.594C>G	CCDS11821.1																																																																																				0.557	TYMS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254316.1	NM_001071		45	189	0	0	0	0.009718	0	45	189				
SPIRE1	56907	broad.mit.edu	37	18	12546780	12546780	+	Missense_Mutation	SNP	C	C	G			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr18:12546780C>G	ENST00000409402.4	-	3	763	c.496G>C	c.(496-498)Gct>Cct	p.A166P	SPIRE1_ENST00000453447.2_Missense_Mutation_p.A46P|SPIRE1_ENST00000309836.5_Intron|SPIRE1_ENST00000383356.2_Missense_Mutation_p.A7P|SPIRE1_ENST00000410092.3_Missense_Mutation_p.A166P	NM_001128626.1	NP_001122098.1			spire-type actin nucleation factor 1									p.A166P(1)|p.A7P(1)		breast(3)|endometrium(3)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)	28						CTACCGTCAGCTTCCACCGTG	0.448																																							uc002kre.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(496-498)GCT>CCT		spire homolog 1 isoform a							175.0	157.0	163.0					18																	12546780		2203	4300	6503	SO:0001583	missense	56907					cytoskeleton|perinuclear region of cytoplasm	actin binding	g.chr18:12546780C>G	AL833817	CCDS32790.2, CCDS45829.1, CCDS45830.1	18p11.21	2013-08-27	2013-08-27		ENSG00000134278	ENSG00000134278			30622	protein-coding gene	gene with protein product		609216	"""spire homolog 1 (Drosophila)"", ""spire family actin nucleation factor 1"""			10574461, 11747823	Standard	NM_001128626		Approved	spir-1, KIAA1135	uc002kre.3	Q08AE8	OTTHUMG00000153940	ENST00000409402.4:c.496G>C	18.37:g.12546780C>G	ENSP00000387266:p.Ala166Pro		Somatic				SPIRE1_uc002krc.2_RNA|SPIRE1_uc010wzw.1_Missense_Mutation_p.A46P|SPIRE1_uc010wzx.1_Intron|SPIRE1_uc010wzy.1_Missense_Mutation_p.A166P	p.A166P	NM_001128626	NP_001122098	WXS	Illumina HiSeq	Unspecified	Q08AE8	SPIR1_HUMAN			3	543	-			166			KIND.			Missense_Mutation	SNP	ENST00000409402.4	37	c.496G>C	CCDS45829.1	.	.	.	.	.	.	.	.	.	.	C	14.49	2.550740	0.45383	.	.	ENSG00000134278	ENST00000453447;ENST00000409402;ENST00000410092;ENST00000383356;ENST00000449797	T;T;T;T;T	0.34072	1.38;1.38;1.38;1.38;1.38	5.43	2.66	0.31614	KIND (2);	0.507748	0.22437	N	0.060068	T	0.31009	0.0783	L	0.43152	1.355	0.09310	N	1	P;P	0.47302	0.823;0.893	P;P	0.46585	0.477;0.521	T	0.10019	-1.0648	10	0.40728	T	0.16	-13.0732	4.9208	0.13869	0.0:0.5417:0.1465:0.3118	.	166;166	Q08AE8-2;Q08AE8	.;SPIR1_HUMAN	P	46;166;166;7;46	ENSP00000407050:A46P;ENSP00000387266:A166P;ENSP00000387226:A166P;ENSP00000372847:A7P;ENSP00000401392:A46P	ENSP00000372847:A7P	A	-	1	0	SPIRE1	12536780	0.003000	0.15002	0.377000	0.26055	0.643000	0.38383	0.191000	0.17076	0.353000	0.24079	0.563000	0.77884	GCT		0.448	SPIRE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333109.2	XM_290818		31	192	0	0	0	0.013726	0	31	192				
CCDC178	374864	broad.mit.edu	37	18	30913186	30913186	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr18:30913186C>A	ENST00000383096.3	-	10	1013	c.831G>T	c.(829-831)caG>caT	p.Q277H	CCDC178_ENST00000403303.1_Missense_Mutation_p.Q277H|CCDC178_ENST00000300227.8_Missense_Mutation_p.Q277H|CCDC178_ENST00000579916.1_Intron|CCDC178_ENST00000406524.2_Missense_Mutation_p.Q277H|CCDC178_ENST00000583930.1_Missense_Mutation_p.Q277H|CCDC178_ENST00000402325.1_Missense_Mutation_p.Q277H|CCDC178_ENST00000579947.1_Missense_Mutation_p.Q277H			Q5BJE1	CC178_HUMAN	coiled-coil domain containing 178	277								p.Q277H(2)									GTTCCTGATTCTGCTTAGAGT	0.323																																							uc002kxn.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(829-831)CAG>CAT		hypothetical protein LOC374864 isoform 1							181.0	163.0	169.0					18																	30913186		2203	4300	6503	SO:0001583	missense	374864							g.chr18:30913186C>A	AK126038	CCDS11906.1, CCDS42424.1	18q12.1	2012-10-15	2012-10-15	2012-10-15	ENSG00000166960	ENSG00000166960			29588	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 34"""	C18orf34			Standard	NM_198995		Approved	FLJ44050	uc002kxn.2	Q5BJE1	OTTHUMG00000132279	ENST00000383096.3:c.831G>T	18.37:g.30913186C>A	ENSP00000372576:p.Gln277His		Somatic				C18orf34_uc010xbr.1_Missense_Mutation_p.Q277H|C18orf34_uc010dmf.1_Intron|C18orf34_uc002kxo.2_Missense_Mutation_p.Q277H|C18orf34_uc002kxp.2_Missense_Mutation_p.Q277H	p.Q277H	NM_001105528	NP_001098998	WXS	Illumina HiSeq	Unspecified	Q5BJE1	CR034_HUMAN			9	973	-			277			Potential.		A6NDC6|J3KS92|Q6ZP67|Q6ZU20	Missense_Mutation	SNP	ENST00000383096.3	37	c.831G>T	CCDS42424.1	.	.	.	.	.	.	.	.	.	.	C	7.661	0.684878	0.14973	.	.	ENSG00000166960	ENST00000403303;ENST00000383096;ENST00000300227;ENST00000406524;ENST00000402325;ENST00000399177	T;T;T;T;T;T	0.44482	2.52;2.52;2.51;2.51;2.51;0.92	5.32	-3.76	0.04359	.	.	.	.	.	T	0.15132	0.0365	N	0.08118	0	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.001;0.001;0.001;0.001	T	0.22347	-1.0219	9	0.13853	T	0.58	5.8037	1.8482	0.03163	0.233:0.2472:0.3579:0.1619	.	277;277;277;277	F8W7A7;B5MD75;Q5BJE1-2;Q5BJE1	.;.;.;CR034_HUMAN	H	277	ENSP00000385591:Q277H;ENSP00000372576:Q277H;ENSP00000300227:Q277H;ENSP00000385867:Q277H;ENSP00000385234:Q277H;ENSP00000382130:Q277H	ENSP00000300227:Q277H	Q	-	3	2	C18orf34	29167184	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.250000	0.08830	-1.069000	0.03153	0.557000	0.71058	CAG		0.323	CCDC178-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255373.2	NM_198995		29	57	1	0	1.06801e-11	0.009535	1.35372e-11	29	57				
DNMT1	1786	broad.mit.edu	37	19	10252742	10252742	+	Missense_Mutation	SNP	A	A	C			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr19:10252742A>C	ENST00000340748.4	-	29	3458	c.3223T>G	c.(3223-3225)Tac>Gac	p.Y1075D	DNMT1_ENST00000589538.1_5'UTR|DNMT1_ENST00000359526.4_Missense_Mutation_p.Y1091D|DNMT1_ENST00000540357.1_Missense_Mutation_p.Y1075D			P26358	DNMT1_HUMAN	DNA (cytosine-5-)-methyltransferase 1	1075	BAH 2. {ECO:0000255|PROSITE- ProRule:PRU00370}.				cellular response to amino acid stimulus (GO:0071230)|chromatin modification (GO:0016568)|DNA methylation (GO:0006306)|gene silencing (GO:0016458)|maintenance of DNA methylation (GO:0010216)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of gene expression (GO:0010628)|positive regulation of histone H3-K4 methylation (GO:0051571)|regulation of cell proliferation (GO:0042127)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)|replication fork (GO:0005657)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA binding (GO:0003677)|DNA-methyltransferase activity (GO:0009008)|methyl-CpG binding (GO:0008327)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.Y1075D(1)		breast(5)|endometrium(8)|kidney(5)|large_intestine(21)|lung(11)|ovary(2)|pancreas(1)|prostate(10)|skin(5)|stomach(1)|urinary_tract(1)	70			OV - Ovarian serous cystadenocarcinoma(20;1.59e-09)|Epithelial(33;2.86e-06)|all cancers(31;6.68e-06)		Azacitidine(DB00928)|Decitabine(DB01262)|Flucytosine(DB01099)|Procainamide(DB01035)	CCCATGGAGTACACCTGGACG	0.632																																							uc002mng.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|prostate(1)|lung(1)|breast(1)|skin(1)	6						c.(3223-3225)TAC>GAC		DNA (cytosine-5-)-methyltransferase 1 isoform b	Azacitidine(DB00928)|Decitabine(DB01262)|Flucytosine(DB01099)|Ifosfamide(DB01181)|Procainamide(DB01035)						64.0	55.0	58.0					19																	10252742		2203	4300	6503	SO:0001583	missense	1786				chromatin modification|maintenance of DNA methylation|negative regulation of histone H3-K9 methylation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of gene expression|positive regulation of histone H3-K4 methylation|transcription, DNA-dependent	nucleus	DNA (cytosine-5-)-methyltransferase activity|DNA binding|transcription factor binding	g.chr19:10252742A>C	X63692	CCDS12228.1, CCDS45958.1	19p13.2	2014-09-17				ENSG00000130816	2.1.1.37		2976	protein-coding gene	gene with protein product		126375		DNMT		1594447	Standard	NM_001379		Approved	MCMT, CXXC9	uc010xlc.2	P26358		ENST00000340748.4:c.3223T>G	19.37:g.10252742A>C	ENSP00000345739:p.Tyr1075Asp		Somatic				DNMT1_uc002mne.2_5'Flank|DNMT1_uc002mnf.2_5'UTR|DNMT1_uc010xlc.1_Missense_Mutation_p.Y1091D|DNMT1_uc002mnh.2_Missense_Mutation_p.Y970D|DNMT1_uc010xld.1_Missense_Mutation_p.Y1075D	p.Y1075D	NM_001379	NP_001370	WXS	Illumina HiSeq	Unspecified	P26358	DNMT1_HUMAN	OV - Ovarian serous cystadenocarcinoma(20;1.59e-09)|Epithelial(33;2.86e-06)|all cancers(31;6.68e-06)		29	3403	-			1075			BAH 2.		A0AV63|B7ZLW6|Q9UHG5|Q9ULA2|Q9UMZ6	Missense_Mutation	SNP	ENST00000340748.4	37	c.3223T>G	CCDS12228.1	.	.	.	.	.	.	.	.	.	.	A	16.64	3.178154	0.57692	.	.	ENSG00000130816	ENST00000359526;ENST00000540357;ENST00000340748;ENST00000541266	D;D;D	0.85629	-2.01;-2.01;-2.01	5.36	5.36	0.76844	Bromo adjacent homology (BAH) domain (3);	0.060047	0.64402	D	0.000002	D	0.91529	0.7325	M	0.79805	2.47	0.58432	D	0.999998	P;P;P	0.51240	0.93;0.93;0.943	P;P;P	0.62089	0.837;0.837;0.898	D	0.92292	0.5842	10	0.59425	D	0.04	.	14.3033	0.66368	1.0:0.0:0.0:0.0	.	1075;1091;1075	F5GX68;P26358-2;P26358	.;.;DNMT1_HUMAN	D	1091;1075;1075;943	ENSP00000352516:Y1091D;ENSP00000440457:Y1075D;ENSP00000345739:Y1075D	ENSP00000345739:Y1075D	Y	-	1	0	DNMT1	10113742	1.000000	0.71417	0.838000	0.33150	0.125000	0.20455	9.117000	0.94347	2.039000	0.60335	0.533000	0.62120	TAC		0.632	DNMT1-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451166.1	NM_001379		3	25	0	0	0	0.009096	0	3	25				
ZNF536	9745	broad.mit.edu	37	19	30935455	30935455	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr19:30935455C>A	ENST00000355537.3	+	2	1133	c.986C>A	c.(985-987)gCc>gAc	p.A329D		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	329					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)	p.A329D(1)		NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					GCCGAGTCGGCCCAGGGCCAG	0.652																																							uc002nsu.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(7)|large_intestine(2)|skin(2)	11						c.(985-987)GCC>GAC		zinc finger protein 536							85.0	97.0	93.0					19																	30935455		2203	4300	6503	SO:0001583	missense	9745				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding	g.chr19:30935455C>A		CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.986C>A	19.37:g.30935455C>A	ENSP00000347730:p.Ala329Asp		Somatic				ZNF536_uc010edd.1_Missense_Mutation_p.A329D	p.A329D	NM_014717	NP_055532	WXS	Illumina HiSeq	Unspecified	O15090	ZN536_HUMAN			2	1124	+	Esophageal squamous(110;0.0834)		329					A2RU18	Missense_Mutation	SNP	ENST00000355537.3	37	c.986C>A	CCDS32984.1	.	.	.	.	.	.	.	.	.	.	C	13.50	2.255652	0.39896	.	.	ENSG00000198597	ENST00000355537	T	0.08984	3.03	5.59	5.59	0.84812	.	0.053346	0.85682	D	0.000000	T	0.13670	0.0331	L	0.37697	1.125	0.53688	D	0.99997	P;D	0.60160	0.93;0.987	P;P	0.53146	0.462;0.719	T	0.00412	-1.1755	10	0.54805	T	0.06	-29.3274	12.861	0.57913	0.0:0.9253:0.0:0.0747	.	329;329	A7E228;O15090	.;ZN536_HUMAN	D	329	ENSP00000347730:A329D	ENSP00000347730:A329D	A	+	2	0	ZNF536	35627295	1.000000	0.71417	0.997000	0.53966	0.970000	0.65996	6.062000	0.71155	2.631000	0.89168	0.491000	0.48974	GCC		0.652	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459667.2	NM_014717		20	253	1	0	1.85244e-09	0.00333	2.23416e-09	20	253				
RHPN2	85415	broad.mit.edu	37	19	33503585	33503585	+	Missense_Mutation	SNP	C	C	G			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr19:33503585C>G	ENST00000254260.3	-	5	471	c.436G>C	c.(436-438)Gat>Cat	p.D146H	RHPN2_ENST00000400226.4_5'UTR	NM_033103.4	NP_149094.3	Q8IUC4	RHPN2_HUMAN	rhophilin, Rho GTPase binding protein 2	146	BRO1. {ECO:0000255|PROSITE- ProRule:PRU00526}.				signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)		p.D146H(1)		NS(1)|breast(3)|central_nervous_system(5)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(3)|skin(3)|urinary_tract(1)	44	Esophageal squamous(110;0.137)					GCAATTTCATCTTCATATAAA	0.398																																							uc002nuf.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(5)|ovary(1)	6						c.(436-438)GAT>CAT		rhophilin, Rho GTPase binding protein 2							93.0	89.0	90.0					19																	33503585		2203	4300	6503	SO:0001583	missense	85415				signal transduction	perinuclear region of cytoplasm	protein binding	g.chr19:33503585C>G	AF268032	CCDS12427.1	19q13.12	2008-02-05				ENSG00000131941			19974	protein-coding gene	gene with protein product						12221077	Standard	NM_033103		Approved		uc002nuf.3	Q8IUC4		ENST00000254260.3:c.436G>C	19.37:g.33503585C>G	ENSP00000254260:p.Asp146His		Somatic				RHPN2_uc010xro.1_5'UTR|RHPN2_uc002nue.2_5'UTR	p.D146H	NM_033103	NP_149094	WXS	Illumina HiSeq	Unspecified	Q8IUC4	RHPN2_HUMAN			5	502	-	Esophageal squamous(110;0.137)		146			BRO1.		B2RCG8|B3KUY8|B4DUS7|Q8N3T7|Q8N9D6|Q8NE33|Q96RU1	Missense_Mutation	SNP	ENST00000254260.3	37	c.436G>C	CCDS12427.1	.	.	.	.	.	.	.	.	.	.	C	12.65	2.003116	0.35320	.	.	ENSG00000131941	ENST00000254260	T	0.19938	2.11	4.67	4.67	0.58626	BRO1 domain (3);	0.145761	0.64402	D	0.000009	T	0.48537	0.1505	M	0.89214	3.015	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	T	0.54077	-0.8347	10	0.62326	D	0.03	4.762	8.6665	0.34123	0.0:0.8294:0.0:0.1706	.	146	Q8IUC4	RHPN2_HUMAN	H	146	ENSP00000254260:D146H	ENSP00000254260:D146H	D	-	1	0	RHPN2	38195425	1.000000	0.71417	1.000000	0.80357	0.110000	0.19582	2.091000	0.41691	2.142000	0.66516	0.455000	0.32223	GAT		0.398	RHPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450828.2	NM_033103		14	119	0	0	0	0.003163	0	14	119				
SBSN	374897	broad.mit.edu	37	19	36018821	36018821	+	Silent	SNP	G	G	A	rs561114497	byFrequency	TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr19:36018821G>A	ENST00000452271.2	-	1	391	c.363C>T	c.(361-363)aaC>aaT	p.N121N	SBSN_ENST00000518157.1_Silent_p.N121N	NM_001166034.1	NP_001159506.1	Q6UWP8	SBSN_HUMAN	suprabasin	121	Ala/Gly/His-rich.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)		p.N121N(2)		large_intestine(5)|lung(6)|ovary(1)|prostate(2)	14	all_lung(56;1.62e-08)|Lung NSC(56;2.47e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			GTCCAGCAGCGTTGTTGACCC	0.572																																							uc002oae.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(361-363)AAC>AAT		suprabasin isoform 2 precursor							198.0	189.0	192.0					19																	36018821		2203	4300	6503	SO:0001819	synonymous_variant	374897					extracellular region		g.chr19:36018821G>A	AY358701	CCDS12464.1, CCDS54253.1	19q13.13	2008-02-05							24950	protein-coding gene	gene with protein product		609969				12228223	Standard	NM_198538		Approved	UNQ698, HLAR698	uc002oad.2	Q6UWP8		ENST00000452271.2:c.363C>T	19.37:g.36018821G>A			Somatic				SBSN_uc002oad.1_Silent_p.N121N	p.N121N	NM_198538	NP_940940	WXS	Illumina HiSeq	Unspecified	Q6UWP8	SBSN_HUMAN	LUSC - Lung squamous cell carcinoma(66;0.0724)		1	433	-	all_lung(56;1.62e-08)|Lung NSC(56;2.47e-08)|Esophageal squamous(110;0.162)		121			Ala/Gly/His-rich.		A8K5J0|E9PBV3	Silent	SNP	ENST00000452271.2	37	c.363C>T	CCDS54253.1																																																																																				0.572	SBSN-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000109463.3	NM_198538		7	313	0	0	0	0.001984	0	7	313				
ATP4A	495	broad.mit.edu	37	19	36054337	36054337	+	Silent	SNP	C	C	A			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr19:36054337C>A	ENST00000262623.3	-	2	133	c.105G>T	c.(103-105)ggG>ggT	p.G35G		NM_000704.2	NP_000695.2	P20648	ATP4A_HUMAN	ATPase, H+/K+ exchanging, alpha polypeptide	35					ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|ion transmembrane transport (GO:0034220)|pH reduction (GO:0045851)|regulation of proton transport (GO:0010155)|response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|magnesium ion binding (GO:0000287)	p.G35G(1)		breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(26)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	53	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)		Esomeprazole(DB00736)|Lansoprazole(DB00448)|Omeprazole(DB00338)|Pantoprazole(DB00213)|Rabeprazole(DB01129)	TCTTGCCACCCCCGCCACCCG	0.602																																							uc002oal.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(103-105)GGG>GGT		hydrogen/potassium-exchanging ATPase 4A	Esomeprazole(DB00736)|Lansoprazole(DB00448)|Omeprazole(DB00338)|Pantoprazole(DB00213)|Rabeprazole(DB01129)|Trifluoperazine(DB00831)						174.0	180.0	178.0					19																	36054337		2203	4300	6503	SO:0001819	synonymous_variant	495				ATP biosynthetic process|ATP hydrolysis coupled proton transport	integral to plasma membrane	ATP binding|hydrogen:potassium-exchanging ATPase activity|magnesium ion binding	g.chr19:36054337C>A		CCDS12467.1	19q13.1	2010-04-20			ENSG00000105675	ENSG00000105675	3.6.3.10	"""ATPases / P-type"""	819	protein-coding gene	gene with protein product	"""gastric H,K-ATPase alpha subunit"", ""H(+)-K(+)-ATPase alpha subunit"", ""proton pump"""	137216				1330887	Standard	NM_000704		Approved	ATP6A	uc002oal.1	P20648	OTTHUMG00000048106	ENST00000262623.3:c.105G>T	19.37:g.36054337C>A			Somatic					p.G35G	NM_000704	NP_000695	WXS	Illumina HiSeq	Unspecified	P20648	ATP4A_HUMAN	LUSC - Lung squamous cell carcinoma(66;0.0724)		2	134	-	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		35			Cytoplasmic (Potential).		O00738	Silent	SNP	ENST00000262623.3	37	c.105G>T	CCDS12467.1																																																																																				0.602	ATP4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109470.2	NM_000704		28	347	1	0	6.50621e-10	0.013726	7.89473e-10	28	347				
RYR1	6261	broad.mit.edu	37	19	39025446	39025446	+	Silent	SNP	C	C	T			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr19:39025446C>T	ENST00000359596.3	+	79	11346	c.11346C>T	c.(11344-11346)atC>atT	p.I3782I	RYR1_ENST00000360985.3_Silent_p.I3782I|AC067969.2_ENST00000595853.1_RNA|RYR1_ENST00000355481.4_Silent_p.I3777I			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	3782					calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)	p.I3782I(1)		NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	TGCAGATGATCAGTGCCTGCA	0.602																																							uc002oit.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12						c.(11344-11346)ATC>ATT		skeletal muscle ryanodine receptor isoform 1	Dantrolene(DB01219)						46.0	42.0	43.0					19																	39025446		2203	4300	6503	SO:0001819	synonymous_variant	6261				muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity	g.chr19:39025446C>T	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.11346C>T	19.37:g.39025446C>T			Somatic				RYR1_uc002oiu.2_Silent_p.I3777I|RYR1_uc002oiv.1_Silent_p.I697I|RYR1_uc010xuf.1_Silent_p.I702I	p.I3782I	NM_000540	NP_000531	WXS	Illumina HiSeq	Unspecified	P21817	RYR1_HUMAN	Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		79	11476	+	all_cancers(60;7.91e-06)		3782					Q16314|Q16368|Q9NPK1|Q9P1U4	Silent	SNP	ENST00000359596.3	37	c.11346C>T	CCDS33011.1																																																																																				0.602	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1			3	24	0	0	0	0.009096	0	3	24				
PPP1R13L	10848	broad.mit.edu	37	19	45885837	45885837	+	Nonsense_Mutation	SNP	C	C	T			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr19:45885837C>T	ENST00000418234.2	-	12	2474	c.2396G>A	c.(2395-2397)tGg>tAg	p.W799*	PPP1R13L_ENST00000360957.5_Nonsense_Mutation_p.W799*	NM_001142502.1	NP_001135974.1	Q8WUF5	IASPP_HUMAN	protein phosphatase 1, regulatory subunit 13 like	799	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				apoptotic process (GO:0006915)|cardiac muscle contraction (GO:0060048)|cardiac right ventricle morphogenesis (GO:0003215)|embryonic camera-type eye development (GO:0031076)|hair cycle (GO:0042633)|multicellular organism growth (GO:0035264)|multicellular organismal homeostasis (GO:0048871)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|post-embryonic development (GO:0009791)|transcription, DNA-templated (GO:0006351)|ventricular cardiac muscle tissue development (GO:0003229)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)	p.W799*(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(14)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0182)		CGCGGCCCACCACCAGTCGGT	0.697																																					Pancreas(61;1447 1663 31419 50578)	Pancreas(61;1447 1663 31419 50578)	uc002pbn.2		NA																	1	Substitution - Nonsense(1)		lung(1)	skin(1)	1						c.(2395-2397)TGG>TAG		protein phosphatase 1, regulatory subunit 13							45.0	45.0	45.0					19																	45885837		2202	4299	6501	SO:0001587	stop_gained	10848				apoptosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	transcription corepressor activity|transcription factor binding	g.chr19:45885837C>T	AF078036	CCDS33050.1	19q13.32	2013-01-10	2011-10-04		ENSG00000104881	ENSG00000104881		"""Ankyrin repeat domain containing"""	18838	protein-coding gene	gene with protein product		607463	"""protein phosphatase 1, regulatory (inhibitor) subunit 13 like"""			10336463	Standard	NM_006663		Approved	RAI, IASPP	uc002pbo.3	Q8WUF5		ENST00000418234.2:c.2396G>A	19.37:g.45885837C>T	ENSP00000403902:p.Trp799*		Somatic				PPP1R13L_uc002pbm.2_Nonsense_Mutation_p.W378*|PPP1R13L_uc002pbo.2_Nonsense_Mutation_p.W799*	p.W799*	NM_006663	NP_006654	WXS	Illumina HiSeq	Unspecified	Q8WUF5	IASPP_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.0182)	12	2473	-		all_neural(266;0.224)|Ovarian(192;0.231)	799			SH3.		Q2PNZ9|Q5DU71|Q5I1X4|Q6P1R7|Q6PKF8|Q9Y290	Nonsense_Mutation	SNP	ENST00000418234.2	37	c.2396G>A	CCDS33050.1	.	.	.	.	.	.	.	.	.	.	C	40	8.036692	0.98621	.	.	ENSG00000104881	ENST00000418234;ENST00000360957;ENST00000221478	.	.	.	4.61	4.61	0.57282	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.9426	0.71006	0.0:1.0:0.0:0.0	.	.	.	.	X	799;799;373	.	ENSP00000221478:W373X	W	-	2	0	PPP1R13L	50577677	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	7.368000	0.79567	2.100000	0.63781	0.462000	0.41574	TGG		0.697	PPP1R13L-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457586.1	NM_006663		18	72	0	0	0	0.00333	0	18	72				
LIG1	3978	broad.mit.edu	37	19	48660337	48660337	+	Missense_Mutation	SNP	T	T	G			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr19:48660337T>G	ENST00000263274.7	-	5	723	c.304A>C	c.(304-306)Aat>Cat	p.N102H	LIG1_ENST00000536218.1_Missense_Mutation_p.N102H|LIG1_ENST00000599165.1_Intron|LIG1_ENST00000427526.2_Missense_Mutation_p.N72H	NM_000234.1	NP_000225.1	P18858	DNLI1_HUMAN	ligase I, DNA, ATP-dependent	102					anatomical structure morphogenesis (GO:0009653)|base-excision repair (GO:0006284)|cell division (GO:0051301)|DNA biosynthetic process (GO:0071897)|DNA ligation involved in DNA repair (GO:0051103)|DNA metabolic process (GO:0006259)|DNA repair (GO:0006281)|DNA strand elongation involved in DNA replication (GO:0006271)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|double-strand break repair via nonhomologous end joining (GO:0006303)|lagging strand elongation (GO:0006273)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|response to hydrogen peroxide (GO:0042542)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	chromosome (GO:0005694)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA ligase (ATP) activity (GO:0003910)|DNA ligase activity (GO:0003909)|metal ion binding (GO:0046872)	p.N102H(1)		breast(1)|cervix(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(22)|prostate(2)|skin(1)	44		all_epithelial(76;3.1e-06)|all_lung(116;4.39e-06)|Lung NSC(112;8.96e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;8.45e-05)|all cancers(93;0.000423)|Epithelial(262;0.0177)|GBM - Glioblastoma multiforme(486;0.0329)	Bleomycin(DB00290)	AGGGAAGCATTGTTCTCAGGA	0.602								Nucleotide excision repair (NER)																															uc002pia.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(2)|lung(1)	3						c.(304-306)AAT>CAT	NER	DNA ligase I	Bleomycin(DB00290)						123.0	122.0	122.0					19																	48660337		2203	4300	6503	SO:0001583	missense	3978				anatomical structure morphogenesis|base-excision repair|cell division|DNA ligation involved in DNA repair|DNA strand elongation involved in DNA replication|double-strand break repair via homologous recombination|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	nucleoplasm	ATP binding|DNA binding|DNA ligase (ATP) activity|metal ion binding	g.chr19:48660337T>G		CCDS12711.1, CCDS74409.1, CCDS74410.1	19q13.2-q13.3	2014-09-17				ENSG00000105486	6.5.1.1		6598	protein-coding gene	gene with protein product		126391					Standard	XM_005258934		Approved		uc002pia.1	P18858		ENST00000263274.7:c.304A>C	19.37:g.48660337T>G	ENSP00000263274:p.Asn102His		Somatic				LIG1_uc002phz.1_RNA|LIG1_uc002pib.1_RNA|LIG1_uc010xzf.1_Missense_Mutation_p.N102H|LIG1_uc010xzg.1_Missense_Mutation_p.N72H|LIG1_uc010xzh.1_RNA	p.N102H	NM_000234	NP_000225	WXS	Illumina HiSeq	Unspecified	P18858	DNLI1_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;8.45e-05)|all cancers(93;0.000423)|Epithelial(262;0.0177)|GBM - Glioblastoma multiforme(486;0.0329)	5	424	-		all_epithelial(76;3.1e-06)|all_lung(116;4.39e-06)|Lung NSC(112;8.96e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)	102					B2RAI8|Q2TB12|Q32P23	Missense_Mutation	SNP	ENST00000263274.7	37	c.304A>C	CCDS12711.1	.	.	.	.	.	.	.	.	.	.	T	14.67	2.603661	0.46423	.	.	ENSG00000105486	ENST00000263274;ENST00000544761;ENST00000427526;ENST00000536218;ENST00000542460	T;T;T;T	0.57107	0.53;0.42;0.54;1.96	4.72	3.7	0.42460	.	0.505190	0.22780	N	0.055730	T	0.27489	0.0675	N	0.08118	0	0.09310	N	1	P;B;P	0.35600	0.511;0.015;0.511	B;B;B	0.28232	0.087;0.004;0.087	T	0.10917	-1.0609	10	0.46703	T	0.11	-6.2143	9.0407	0.36316	0.0:0.0:0.1865:0.8135	.	72;102;102	B4DTU4;F5GZ28;P18858	.;.;DNLI1_HUMAN	H	102;134;72;102;102	ENSP00000263274:N102H;ENSP00000442841:N72H;ENSP00000441531:N102H;ENSP00000445928:N102H	ENSP00000263274:N102H	N	-	1	0	LIG1	53352149	0.039000	0.19947	0.008000	0.14137	0.014000	0.08584	1.841000	0.39240	0.892000	0.36259	-0.258000	0.10820	AAT		0.602	LIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465575.1	NM_000234		5	191	0	0	0	0.001984	0	5	191				
ZNF577	84765	broad.mit.edu	37	19	52380585	52380585	+	Missense_Mutation	SNP	C	C	G			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr19:52380585C>G	ENST00000301399.5	-	6	598	c.233G>C	c.(232-234)gGa>gCa	p.G78A	ZNF577_ENST00000485702.1_5'UTR|ZNF577_ENST00000412216.1_Missense_Mutation_p.G78A|ZNF577_ENST00000420592.1_Missense_Mutation_p.G78A|ZNF577_ENST00000451628.2_Missense_Mutation_p.G78A	NM_032679.2	NP_116068.2	Q9BSK1	ZN577_HUMAN	zinc finger protein 577	78	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G71A(1)		breast(1)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	21		all_neural(266;0.0602)		GBM - Glioblastoma multiforme(134;0.00161)|OV - Ovarian serous cystadenocarcinoma(262;0.019)		TGGGGGTTCTCCTTGCTCCAA	0.498																																							uc010yde.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(232-234)GGA>GCA		zinc finger protein 577 isoform a							177.0	157.0	164.0					19																	52380585		2203	4300	6503	SO:0001583	missense	84765				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:52380585C>G	AL832871	CCDS12842.2, CCDS46160.1	19q13.41	2013-09-20			ENSG00000161551	ENSG00000161551		"""Zinc fingers, C2H2-type"", ""-"""	28673	protein-coding gene	gene with protein product						12477932	Standard	NM_032679		Approved	MGC4400	uc010yde.2	Q9BSK1	OTTHUMG00000157045	ENST00000301399.5:c.233G>C	19.37:g.52380585C>G	ENSP00000301399:p.Gly78Ala		Somatic				ZNF577_uc010ydd.1_RNA|ZNF577_uc002pxx.3_Missense_Mutation_p.G78A|ZNF577_uc002pxv.2_Missense_Mutation_p.G71A|ZNF577_uc002pxw.2_Missense_Mutation_p.G71A	p.G78A	NM_032679	NP_116068	WXS	Illumina HiSeq	Unspecified	Q9BSK1	ZN577_HUMAN		GBM - Glioblastoma multiforme(134;0.00161)|OV - Ovarian serous cystadenocarcinoma(262;0.019)	6	624	-		all_neural(266;0.0602)	78			KRAB.		A8K0B4|A8K6Z7|C9JFB9	Missense_Mutation	SNP	ENST00000301399.5	37	c.233G>C	CCDS12842.2	.	.	.	.	.	.	.	.	.	.	.	11.85	1.761741	0.31228	.	.	ENSG00000161551	ENST00000412216;ENST00000301399;ENST00000420592;ENST00000451628;ENST00000458390	T;T;T;T;T	0.00976	5.48;5.48;5.48;5.48;5.48	2.63	1.56	0.23342	Krueppel-associated box (3);	.	.	.	.	T	0.01661	0.0053	M	0.80508	2.5	0.09310	N	1	B;B	0.28584	0.216;0.026	B;B	0.23018	0.043;0.012	T	0.32719	-0.9896	9	0.49607	T	0.09	.	7.4454	0.27209	0.0:0.7304:0.2696:0.0	.	78;78	Q9BSK1;Q9BSK1-2	ZN577_HUMAN;.	A	78	ENSP00000394828:G78A;ENSP00000301399:G78A;ENSP00000413476:G78A;ENSP00000389652:G78A;ENSP00000404509:G78A	ENSP00000301399:G78A	G	-	2	0	ZNF577	57072397	0.001000	0.12720	0.013000	0.15412	0.021000	0.10359	0.688000	0.25422	0.624000	0.30286	0.591000	0.81541	GGA		0.498	ZNF577-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347243.1	NM_032679		8	164	0	0	0	0.010729	0	8	164				
CLEC4F	165530	broad.mit.edu	37	2	71036905	71036905	+	Missense_Mutation	SNP	C	C	G			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr2:71036905C>G	ENST00000272367.2	-	6	1700	c.1624G>C	c.(1624-1626)Gat>Cat	p.D542H	CLEC4F_ENST00000426626.1_Missense_Mutation_p.D542H	NM_001258027.1|NM_173535.2	NP_001244956.1|NP_775806.2	Q8N1N0	CLC4F_HUMAN	C-type lectin domain family 4, member F	542	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				endocytosis (GO:0006897)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)	p.D542H(1)		endometrium(1)|large_intestine(5)|lung(18)|ovary(5)|prostate(5)|skin(1)|upper_aerodigestive_tract(2)	37						GGTGTCCCATCTGTCCAGCGC	0.552																																					Colon(107;10 2157 6841 26035)	Colon(107;10 2157 6841 26035)	uc002shf.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)	5						c.(1624-1626)GAT>CAT		C-type lectin, superfamily member 13							166.0	145.0	153.0					2																	71036905		2203	4300	6503	SO:0001583	missense	165530				endocytosis	integral to membrane	receptor activity|sugar binding	g.chr2:71036905C>G	AK096429	CCDS1910.1	2p13.3	2008-02-05	2005-02-09	2005-02-11	ENSG00000152672	ENSG00000152672		"""C-type lectin domain containing"""	25357	protein-coding gene	gene with protein product			"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 13"""	CLECSF13		8889548, 1846367	Standard	NM_001258027		Approved	FLJ39110, KCLR	uc002shf.3	Q8N1N0	OTTHUMG00000129713	ENST00000272367.2:c.1624G>C	2.37:g.71036905C>G	ENSP00000272367:p.Asp542His		Somatic				CLEC4F_uc010yqv.1_Missense_Mutation_p.D542H	p.D542H	NM_173535	NP_775806	WXS	Illumina HiSeq	Unspecified	Q8N1N0	CLC4F_HUMAN			6	1701	-			542			Extracellular (Potential).|C-type lectin.		A4QPA5	Missense_Mutation	SNP	ENST00000272367.2	37	c.1624G>C	CCDS1910.1	.	.	.	.	.	.	.	.	.	.	C	16.03	3.006286	0.54361	.	.	ENSG00000152672	ENST00000272367;ENST00000426626	T;T	0.31769	1.48;1.48	4.29	4.29	0.51040	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	.	.	.	.	T	0.65637	0.2710	H	0.95294	3.65	0.38419	D	0.946123	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.984	T	0.78170	-0.2308	9	0.87932	D	0	.	12.6057	0.56523	0.0:1.0:0.0:0.0	.	542;542	B7ZMM1;Q8N1N0	.;CLC4F_HUMAN	H	542	ENSP00000272367:D542H;ENSP00000390581:D542H	ENSP00000272367:D542H	D	-	1	0	CLEC4F	70890413	0.987000	0.35691	0.711000	0.30485	0.559000	0.35586	3.839000	0.55835	2.112000	0.64535	0.460000	0.39030	GAT		0.552	CLEC4F-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251922.1	NM_173535		42	85	0	0	0	0.009718	0	42	85				
SMARCAL1	50485	broad.mit.edu	37	2	217285083	217285083	+	Missense_Mutation	SNP	C	C	G			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr2:217285083C>G	ENST00000357276.4	+	5	1254	c.924C>G	c.(922-924)agC>agG	p.S308R	SMARCAL1_ENST00000358207.5_Missense_Mutation_p.S308R	NM_014140.3	NP_054859.2	Q9NZC9	SMAL1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a-like 1	308					cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA metabolic process (GO:0006259)|DNA strand renaturation (GO:0000733)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|replication fork processing (GO:0031297)	nucleus (GO:0005634)|site of double-strand break (GO:0035861)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)	p.S308R(1)		NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(10)|liver(1)|lung(15)|ovary(3)|prostate(1)|skin(1)	42		Renal(323;0.0458)		Epithelial(149;9.48e-06)|all cancers(144;0.000621)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0111)		CCTATGGCAGCAGCGAGTCAC	0.567									Schimke Immuno-Osseous Dysplasia																														uc002vgc.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|breast(3)|skin(1)	7						c.(922-924)AGC>AGG		SWI/SNF-related matrix-associated							72.0	59.0	63.0					2																	217285083		2203	4300	6503	SO:0001583	missense	50485	Schimke_Immuno-Osseous_Dysplasia	Familial Cancer Database	SIOD	chromatin modification|DNA metabolic process|regulation of transcription from RNA polymerase II promoter	nucleus	ATP binding|DNA binding|DNA helicase activity|DNA-dependent ATPase activity	g.chr2:217285083C>G	AF210833	CCDS2403.1	2q35	2014-09-17			ENSG00000138375	ENSG00000138375			11102	protein-coding gene	gene with protein product	"""HepA-related protein"", ""ATP-driven annealing helicase"""	606622				10713074, 10857751, 18974355	Standard	NM_014140		Approved	HHARP, HARP	uc002vgd.4	Q9NZC9	OTTHUMG00000133055	ENST00000357276.4:c.924C>G	2.37:g.217285083C>G	ENSP00000349823:p.Ser308Arg		Somatic				SMARCAL1_uc010fvf.2_RNA|SMARCAL1_uc002vgd.3_Missense_Mutation_p.S308R|SMARCAL1_uc010fvg.2_Missense_Mutation_p.S308R	p.S308R	NM_014140	NP_054859	WXS	Illumina HiSeq	Unspecified	Q9NZC9	SMAL1_HUMAN		Epithelial(149;9.48e-06)|all cancers(144;0.000621)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0111)	5	1254	+		Renal(323;0.0458)	308					A6NEH0|Q53R00|Q96AY1|Q9NXQ5|Q9UFH3|Q9UI93	Missense_Mutation	SNP	ENST00000357276.4	37	c.924C>G	CCDS2403.1	.	.	.	.	.	.	.	.	.	.	C	8.789	0.930110	0.18131	.	.	ENSG00000138375	ENST00000357276;ENST00000358207;ENST00000427645;ENST00000392128;ENST00000412913	D;D;T;D;T	0.86230	-2.04;-2.04;1.45;-2.09;0.62	3.25	2.23	0.28157	.	0.947068	0.09007	N	0.862189	T	0.79021	0.4376	L	0.47716	1.5	0.09310	N	1	P	0.34462	0.454	B	0.29785	0.107	T	0.64867	-0.6306	10	0.16420	T	0.52	-0.5792	6.1473	0.20293	0.0:0.7719:0.0:0.2281	.	308	Q9NZC9	SMAL1_HUMAN	R	308;308;207;172;28	ENSP00000349823:S308R;ENSP00000350940:S308R;ENSP00000392997:S207R;ENSP00000375974:S172R;ENSP00000390248:S28R	ENSP00000349823:S308R	S	+	3	2	SMARCAL1	216993328	0.039000	0.19947	0.610000	0.28997	0.690000	0.40134	0.874000	0.28065	1.638000	0.50547	0.561000	0.74099	AGC		0.567	SMARCAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256671.2			3	36	0	0	0	0.001168	0	3	36				
STK36	27148	broad.mit.edu	37	2	219563551	219563551	+	Missense_Mutation	SNP	G	G	A			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr2:219563551G>A	ENST00000295709.3	+	26	3563	c.3284G>A	c.(3283-3285)aGc>aAc	p.S1095N	STK36_ENST00000392106.2_Missense_Mutation_p.S1074N|STK36_ENST00000440309.1_Missense_Mutation_p.S1095N|STK36_ENST00000392105.3_Missense_Mutation_p.S1074N	NM_015690.4	NP_056505.2			serine/threonine kinase 36											biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(6)|lung(20)|ovary(4)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	52		Renal(207;0.0915)		Epithelial(149;9.65e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.00984)		CTGTCTCCCAGCCACTTGTCC	0.587																																							uc002viu.2		NA																	0				ovary(4)|stomach(2)|lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)	11						c.(3283-3285)AGC>AAC		serine/threonine kinase 36							84.0	78.0	80.0					2																	219563551		2203	4300	6503	SO:0001583	missense	27148				cilium assembly|positive regulation of hh target transcription factor activity|positive regulation of smoothened signaling pathway|post-embryonic development	aggresome|cytoplasm|focal adhesion|intermediate filament cytoskeleton|nucleus	ATP binding|protein serine/threonine kinase activity|transcription factor binding	g.chr2:219563551G>A	AB033104	CCDS2421.1, CCDS58750.1	2q35	2010-06-25	2010-06-25		ENSG00000163482	ENSG00000163482			17209	protein-coding gene	gene with protein product	"""fused homolog (Drosophila)"""	607652	"""serine/threonine kinase 36 (fused homolog, Drosophila)"""			10806483	Standard	NM_001243313		Approved	KIAA1278, FU	uc002viu.3	Q9NRP7	OTTHUMG00000133079	ENST00000295709.3:c.3284G>A	2.37:g.219563551G>A	ENSP00000295709:p.Ser1095Asn		Somatic				STK36_uc002viv.2_Missense_Mutation_p.S1074N|STK36_uc002viw.2_Missense_Mutation_p.S273N|STK36_uc002vix.2_Missense_Mutation_p.S140N	p.S1095N	NM_015690	NP_056505	WXS	Illumina HiSeq	Unspecified	Q9NRP7	STK36_HUMAN		Epithelial(149;9.65e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.00984)	26	3550	+		Renal(207;0.0915)	1095						Missense_Mutation	SNP	ENST00000295709.3	37	c.3284G>A	CCDS2421.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	7.265|7.265	0.606012|0.606012	0.14002|0.14002	.|.	.|.	ENSG00000163482|ENSG00000163482	ENST00000431040|ENST00000295709;ENST00000392106;ENST00000392105;ENST00000440309	.|T;T;T;T	.|0.63255	.|0.72;0.72;-0.03;0.72	6.06|6.06	3.05|3.05	0.35203|0.35203	.|Armadillo-type fold (1);	.|0.123693	.|0.37219	.|N	.|0.002183	T|T	0.40522|0.40522	0.1120|0.1120	N|N	0.19112|0.19112	0.55|0.55	0.18873|0.18873	N|N	0.999987|0.999987	.|B;B;B	.|0.28713	.|0.22;0.001;0.001	.|B;B;B	.|0.25140	.|0.058;0.004;0.002	T|T	0.17137|0.17137	-1.0379|-1.0379	5|10	.|0.22706	.|T	.|0.39	-1.1486|-1.1486	7.7759|7.7759	0.29037|0.29037	0.1609:0.3511:0.488:0.0|0.1609:0.3511:0.488:0.0	.|.	.|1074;1074;1095	.|A8MU99;Q9NRP7-2;Q9NRP7	.|.;.;STK36_HUMAN	T|N	288|1095;1074;1074;1095	.|ENSP00000295709:S1095N;ENSP00000375955:S1074N;ENSP00000375954:S1074N;ENSP00000394095:S1095N	.|ENSP00000295709:S1095N	A|S	+|+	1|2	0|0	STK36|STK36	219271795|219271795	0.008000|0.008000	0.16893|0.16893	0.982000|0.982000	0.44146|0.44146	0.197000|0.197000	0.23852|0.23852	0.157000|0.157000	0.16402|0.16402	0.854000|0.854000	0.35336|0.35336	0.655000|0.655000	0.94253|0.94253	GCC|AGC		0.587	STK36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256723.2			3	77	0	0	0	0.004672	0	3	77				
NGEF	25791	broad.mit.edu	37	2	233757737	233757737	+	Missense_Mutation	SNP	C	C	T			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr2:233757737C>T	ENST00000264051.3	-	7	1291	c.1013G>A	c.(1012-1014)cGg>cAg	p.R338Q	NGEF_ENST00000539537.1_Missense_Mutation_p.R61Q|NGEF_ENST00000373552.4_Missense_Mutation_p.R246Q	NM_019850.2	NP_062824.2	Q8N5V2	NGEF_HUMAN	neuronal guanine nucleotide exchange factor	338	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|ephrin receptor signaling pathway (GO:0048013)|negative regulation of dendritic spine morphogenesis (GO:0061002)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell projection (GO:0042995)|cytosol (GO:0005829)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.R338Q(2)		central_nervous_system(4)|endometrium(8)|kidney(2)|large_intestine(3)|lung(10)|ovary(3)|pancreas(1)|skin(4)	35		Breast(86;0.00279)|Renal(207;0.00339)|all_hematologic(139;0.00793)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;8.65e-17)|BRCA - Breast invasive adenocarcinoma(100;0.00037)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(119;0.00984)|GBM - Glioblastoma multiforme(43;0.0604)		CTCCTCCATCCGGTGCTCCAG	0.592																																							uc002vts.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|central_nervous_system(3)|skin(1)	7						c.(1012-1014)CGG>CAG		neuronal guanine nucleotide exchange factor							133.0	107.0	116.0					2																	233757737		2203	4299	6502	SO:0001583	missense	25791				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|nervous system development|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|growth cone|plasma membrane	Rho guanyl-nucleotide exchange factor activity	g.chr2:233757737C>T	AJ238899	CCDS2500.1, CCDS46544.1	2q37	2012-07-24			ENSG00000066248	ENSG00000066248		"""Rho guanine nucleotide exchange factors"""	7807	protein-coding gene	gene with protein product	"""ephexin"""	605991				10777665	Standard	NM_019850		Approved	ARHGEF27	uc002vts.2	Q8N5V2	OTTHUMG00000133272	ENST00000264051.3:c.1013G>A	2.37:g.233757737C>T	ENSP00000264051:p.Arg338Gln		Somatic				NGEF_uc010zmm.1_Missense_Mutation_p.R61Q|NGEF_uc010fyg.1_Missense_Mutation_p.R246Q	p.R338Q	NM_019850	NP_062824	WXS	Illumina HiSeq	Unspecified	Q8N5V2	NGEF_HUMAN		Epithelial(121;8.65e-17)|BRCA - Breast invasive adenocarcinoma(100;0.00037)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(119;0.00984)|GBM - Glioblastoma multiforme(43;0.0604)	7	1261	-		Breast(86;0.00279)|Renal(207;0.00339)|all_hematologic(139;0.00793)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)	338			DH.		B4DMB8|B9A045|E9PC42|Q53QQ4|Q53ST7|Q6GMQ5|Q9NQD6	Missense_Mutation	SNP	ENST00000264051.3	37	c.1013G>A	CCDS2500.1	.	.	.	.	.	.	.	.	.	.	C	36	5.697062	0.96802	.	.	ENSG00000066248	ENST00000264051;ENST00000373552;ENST00000541023;ENST00000539537;ENST00000416114;ENST00000458735	T;T;T;T;T	0.35048	1.33;1.33;1.33;1.33;1.33	5.14	5.14	0.70334	Dbl homology (DH) domain (5);	0.000000	0.85682	D	0.000000	T	0.59500	0.2198	M	0.67569	2.06	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.68943	0.961;0.957	T	0.62821	-0.6773	10	0.66056	D	0.02	-38.7855	18.6071	0.91271	0.0:1.0:0.0:0.0	.	246;338	E9PC42;Q8N5V2	.;NGEF_HUMAN	Q	338;246;228;61;61;61	ENSP00000264051:R338Q;ENSP00000362653:R246Q;ENSP00000439035:R61Q;ENSP00000401063:R61Q;ENSP00000412614:R61Q	ENSP00000264051:R338Q	R	-	2	0	NGEF	233465981	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.416000	0.80143	2.396000	0.81511	0.655000	0.94253	CGG		0.592	NGEF-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257051.2	XM_044799		24	69	0	0	0	0.008361	0	24	69				
RALGAPA2	57186	broad.mit.edu	37	20	20506983	20506983	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr20:20506983C>A	ENST00000202677.7	-	28	3613	c.3606G>T	c.(3604-3606)caG>caT	p.Q1202H		NM_020343.3	NP_065076.2	Q2PPJ7	RGPA2_HUMAN	Ral GTPase activating protein, alpha subunit 2 (catalytic)	1202					activation of Ral GTPase activity (GO:0032859)|membrane organization (GO:0061024)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)	p.Q1202H(2)		endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(25)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	54						CGCAAGCTACCTGGGCCACGA	0.413																																							uc002wrz.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(3604-3606)CAG>CAT		akt substrate AS250							37.0	37.0	37.0					20																	20506983		1896	4120	6016	SO:0001583	missense	57186				activation of Ral GTPase activity	cytosol|nucleus	protein heterodimerization activity|Ral GTPase activator activity	g.chr20:20506983C>A	AL078634, DQ310704	CCDS46584.1	20p11.23	2009-09-09	2009-09-09	2009-09-09	ENSG00000188559	ENSG00000188559			16207	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 74"""	C20orf74		16490346, 19520869	Standard	NM_020343		Approved	dJ1049G11.4, AS250, KIAA1272, RapGAPalpha2	uc002wrz.3	Q2PPJ7	OTTHUMG00000032010	ENST00000202677.7:c.3606G>T	20.37:g.20506983C>A	ENSP00000202677:p.Gln1202His		Somatic				RALGAPA2_uc010gcx.2_Missense_Mutation_p.Q906H|RALGAPA2_uc010zsg.1_Missense_Mutation_p.Q650H|RALGAPA2_uc002wsa.1_Translation_Start_Site	p.Q1202H	NM_020343	NP_065076	WXS	Illumina HiSeq	Unspecified	Q2PPJ7	RGPA2_HUMAN			28	3749	-			1202					Q4VXU6|Q5JUA3|Q5JUA4|Q5T9K3|Q96CX9|Q9BQT7|Q9H9D9|Q9ULE8	Missense_Mutation	SNP	ENST00000202677.7	37	c.3606G>T	CCDS46584.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	7.860|7.860	0.725841|0.725841	0.15439|0.15439	.|.	.|.	ENSG00000188559|ENSG00000188559	ENST00000202677|ENST00000430436	T|.	0.30981|.	1.51|.	5.49|5.49	4.52|4.52	0.55395|0.55395	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.62684|0.62684	0.2448|0.2448	L|L	0.60455|0.60455	1.87|1.87	0.38229|0.38229	D|D	0.940997|0.940997	B;B|.	0.21309|.	0.053;0.054|.	B;B|.	0.26202|.	0.067;0.058|.	T|T	0.64980|0.64980	-0.6279|-0.6279	10|5	0.17832|.	T|.	0.49|.	.|.	11.3514|11.3514	0.49589|0.49589	0.0:0.9054:0.0:0.0946|0.0:0.9054:0.0:0.0946	.|.	1040;1202|.	A8MSM5;Q2PPJ7|.	.;RGPA2_HUMAN|.	H|M	1202|1019	ENSP00000202677:Q1202H|.	ENSP00000202677:Q1202H|.	Q|R	-|-	3|2	2|0	RALGAPA2|RALGAPA2	20454983|20454983	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.845000|0.845000	0.48019|0.48019	1.340000|1.340000	0.33896|0.33896	1.356000|1.356000	0.45884|0.45884	0.561000|0.561000	0.74099|0.74099	CAG|AGG		0.413	RALGAPA2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000471941.1	NM_020343		3	17	1	0	0.00909568	0.009096	0.009784	3	17				
CHMP4B	128866	broad.mit.edu	37	20	32440005	32440005	+	Silent	SNP	A	A	G			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr20:32440005A>G	ENST00000217402.2	+	4	771	c.606A>G	c.(604-606)aaA>aaG	p.K202K		NM_176812.4	NP_789782.1	Q9H444	CHM4B_HUMAN	charged multivesicular body protein 4B	202					endosomal transport (GO:0016197)|membrane organization (GO:0061024)|negative regulation of autophagic vacuole assembly (GO:1902902)|negative regulation of neuron death (GO:1901215)|positive regulation of viral release from host cell (GO:1902188)|posttranslational protein targeting to membrane (GO:0006620)|protein homooligomerization (GO:0051260)|regulation of viral process (GO:0050792)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|ESCRT III complex (GO:0000815)|extracellular vesicular exosome (GO:0070062)|midbody (GO:0030496)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)	p.K202K(1)		central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	13						TACCATCAAAACCCGGTGAGT	0.493																																							uc002xaa.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(604-606)AAA>AAG		chromatin modifying protein 4B							151.0	139.0	143.0					20																	32440005		2203	4300	6503	SO:0001819	synonymous_variant	128866				cellular membrane organization|endosome transport|protein transport	cytosol|late endosome membrane	protein binding	g.chr20:32440005A>G	AL050349	CCDS13228.1	20q11.22	2011-09-21	2011-09-21	2005-04-04	ENSG00000101421	ENSG00000101421		"""Charged multivesicular body proteins"""	16171	protein-coding gene	gene with protein product		610897	"""chromosome 20 open reading frame 178"", ""chromatin modifying protein 4B"""	C20orf178		14678797	Standard	NM_176812		Approved	dJ553F4.4, Shax1, SNF7-2, VPS32B	uc002xaa.3	Q9H444	OTTHUMG00000032272	ENST00000217402.2:c.606A>G	20.37:g.32440005A>G			Somatic					p.K202K	NM_176812	NP_789782	WXS	Illumina HiSeq	Unspecified	Q9H444	CHM4B_HUMAN			4	762	+			202					E1P5N4|Q53ZD6	Silent	SNP	ENST00000217402.2	37	c.606A>G	CCDS13228.1																																																																																				0.493	CHMP4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078738.2			56	259	0	0	0	0.01441	0	56	259				
ZNF831	128611	broad.mit.edu	37	20	57768042	57768042	+	Silent	SNP	G	G	T			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr20:57768042G>T	ENST00000371030.2	+	1	1968	c.1968G>T	c.(1966-1968)ctG>ctT	p.L656L		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	656							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)	p.L656L(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					GGGCAGAACTGGGCTTTCCTC	0.582																																							uc002yan.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(13)|ovary(1)	14						c.(1966-1968)CTG>CTT		zinc finger protein 831							51.0	61.0	57.0					20																	57768042		2045	4188	6233	SO:0001819	synonymous_variant	128611					intracellular	nucleic acid binding|zinc ion binding	g.chr20:57768042G>T	AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.1968G>T	20.37:g.57768042G>T			Somatic					p.L656L	NM_178457	NP_848552	WXS	Illumina HiSeq	Unspecified	Q5JPB2	ZN831_HUMAN			1	1968	+	all_lung(29;0.0085)		656					Q5TDR4|Q8TCP0	Silent	SNP	ENST00000371030.2	37	c.1968G>T	CCDS42894.1																																																																																				0.582	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000079916.2	NM_178457		14	121	1	0	0.000151284	0.001855	0.000168188	14	121				
CHRNA4	1137	broad.mit.edu	37	20	61990970	61990970	+	Missense_Mutation	SNP	C	C	T			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr20:61990970C>T	ENST00000370263.4	-	2	379	c.158G>A	c.(157-159)cGa>cAa	p.R53Q	CHRNA4_ENST00000463705.1_Intron|RP11-261N11.8_ENST00000370257.1_RNA	NM_000744.6|NM_001256573.1	NP_000735.1|NP_001243502.1	P43681	ACHA4_HUMAN	cholinergic receptor, nicotinic, alpha 4 (neuronal)	53					action potential (GO:0001508)|B cell activation (GO:0042113)|behavioral response to nicotine (GO:0035095)|calcium ion transport (GO:0006816)|cation transmembrane transport (GO:0098655)|cognition (GO:0050890)|DNA repair (GO:0006281)|exploration behavior (GO:0035640)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|neurological system process (GO:0050877)|regulation of dopamine secretion (GO:0014059)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of membrane potential (GO:0042391)|respiratory gaseous exchange (GO:0007585)|response to hypoxia (GO:0001666)|response to nicotine (GO:0035094)|response to oxidative stress (GO:0006979)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ligand-gated ion channel activity (GO:0015276)	p.R53Q(1)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(19)|prostate(3)|skin(3)|soft_tissue(1)	33	all_cancers(38;1.71e-10)				Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Dextromethorphan(DB00514)|Galantamine(DB00674)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Nicotine(DB00184)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)|Varenicline(DB01273)	GGCCACGGGTCGGGACCACTT	0.647																																							uc002yes.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)|skin(1)	2						c.(157-159)CGA>CAA		cholinergic receptor, nicotinic, alpha 4 subunit	Nicotine(DB00184)|Varenicline(DB01273)						124.0	107.0	113.0					20																	61990970		2198	4293	6491	SO:0001583	missense	1137				B cell activation|behavioral response to nicotine|calcium ion transport|cognition|DNA repair|membrane depolarization|regulation of action potential|regulation of dopamine secretion|regulation of inhibitory postsynaptic membrane potential|response to hypoxia|response to oxidative stress|sensory perception of pain|synaptic transmission, cholinergic	cell junction|dendrite|external side of plasma membrane|membrane fraction|neuronal cell body|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity	g.chr20:61990970C>T		CCDS13517.1	20q13.33	2013-09-20	2012-02-07		ENSG00000101204	ENSG00000101204		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1958	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 4 (neuronal)"""	118504	"""cholinergic receptor, nicotinic, alpha polypeptide 4"""	EBN, EBN1		1505988	Standard	NM_000744		Approved	BFNC	uc002yes.3	P43681	OTTHUMG00000033080	ENST00000370263.4:c.158G>A	20.37:g.61990970C>T	ENSP00000359285:p.Arg53Gln		Somatic				CHRNA4_uc002yet.1_Intron|CHRNA4_uc011aaw.1_RNA|CHRNA4_uc010gke.1_5'UTR|CHRNA4_uc002yev.1_5'UTR|CHRNA4_uc010gkf.1_5'UTR	p.R53Q	NM_000744	NP_000735	WXS	Illumina HiSeq	Unspecified	P43681	ACHA4_HUMAN			2	336	-	all_cancers(38;1.71e-10)		53			Extracellular (Potential).		Q4JGR7|Q4VAQ5|Q4VAQ6	Missense_Mutation	SNP	ENST00000370263.4	37	c.158G>A	CCDS13517.1	.	.	.	.	.	.	.	.	.	.	C	35	5.494029	0.96339	.	.	ENSG00000101204	ENST00000370263	T	0.62105	0.05	4.26	4.26	0.50523	Neurotransmitter-gated ion-channel ligand-binding (3);	0.070231	0.64402	D	0.000016	D	0.84156	0.5410	M	0.93763	3.455	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89354	0.3663	10	0.87932	D	0	.	16.68	0.85289	0.0:1.0:0.0:0.0	.	53	P43681	ACHA4_HUMAN	Q	53	ENSP00000359285:R53Q	ENSP00000359285:R53Q	R	-	2	0	CHRNA4	61461414	1.000000	0.71417	0.998000	0.56505	0.798000	0.45092	7.625000	0.83145	1.929000	0.55896	0.491000	0.48974	CGA		0.647	CHRNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080508.3			22	95	0	0	0	0.004656	0	22	95				
CYYR1	116159	broad.mit.edu	37	21	27852642	27852642	+	Missense_Mutation	SNP	G	G	A			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr21:27852642G>A	ENST00000299340.4	-	3	626	c.283C>T	c.(283-285)Cgc>Tgc	p.R95C	CYYR1_ENST00000400043.3_Missense_Mutation_p.R95C|AP001597.1_ENST00000357401.3_RNA|CYYR1_ENST00000435845.2_3'UTR|AP001597.1_ENST00000414486.1_RNA	NM_052954.2	NP_443186.1	Q96J86	CYYR1_HUMAN	cysteine/tyrosine-rich 1	95			R -> H (in dbSNP:rs35253087).			integral component of membrane (GO:0016021)		p.R95C(1)		large_intestine(2)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	15						ATGCCCACGCGGGTCGCCCTG	0.498																																							uc002ymd.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(283-285)CGC>TGC		cysteine and tyrosine-rich 1 protein precursor							140.0	126.0	131.0					21																	27852642		2203	4300	6503	SO:0001583	missense	116159					integral to membrane		g.chr21:27852642G>A	AY061853	CCDS13578.1	21q21.2	2014-07-04	2005-07-24		ENSG00000166265	ENSG00000166265			16274	protein-coding gene	gene with protein product			"""cysteine and tyrosine-rich 1"""	C21orf95		12036297, 12062809, 24981926	Standard	NM_052954		Approved		uc002ymd.3	Q96J86	OTTHUMG00000078689	ENST00000299340.4:c.283C>T	21.37:g.27852642G>A	ENSP00000299340:p.Arg95Cys		Somatic				CYYR1_uc011ack.1_RNA|CYYR1_uc002yme.2_Missense_Mutation_p.R95C	p.R95C	NM_052954	NP_443186	WXS	Illumina HiSeq	Unspecified	Q96J86	CYYR1_HUMAN			3	605	-			95			Cytoplasmic (Potential).		A0A059TD09|A8MTU9|B2R845|Q53ER3|Q5JPD0|Q96NV7|R9QAJ4|W8CQB3	Missense_Mutation	SNP	ENST00000299340.4	37	c.283C>T	CCDS13578.1	.	.	.	.	.	.	.	.	.	.	G	13.28	2.189523	0.38707	.	.	ENSG00000166265	ENST00000299340;ENST00000400043	T;T	0.43294	0.95;0.95	4.9	3.03	0.35002	.	0.000000	0.85682	D	0.000000	T	0.53916	0.1826	M	0.64997	1.995	0.80722	D	1	D;D	0.89917	1.0;1.0	P;D	0.64687	0.882;0.928	T	0.53676	-0.8405	10	0.87932	D	0	-10.5896	7.0453	0.25042	0.0823:0.0:0.6135:0.3042	.	95;95	Q96J86-2;Q96J86	.;CYYR1_HUMAN	C	95	ENSP00000299340:R95C;ENSP00000382918:R95C	ENSP00000299340:R95C	R	-	1	0	CYYR1	26774513	1.000000	0.71417	0.956000	0.39512	0.010000	0.07245	2.719000	0.47244	0.698000	0.31739	0.585000	0.79938	CGC		0.498	CYYR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171654.2	NM_052954		40	150	0	0	0	0.00874	0	40	150				
RWDD2B	10069	broad.mit.edu	37	21	30378852	30378852	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr21:30378852G>T	ENST00000493196.1	-	5	946	c.846C>A	c.(844-846)ttC>ttA	p.F282L	RWDD2B_ENST00000486719.1_5'UTR	NM_016940.2	NP_058636.1	P57060	RWD2B_HUMAN	RWD domain containing 2B	282								p.F282L(1)		endometrium(1)|kidney(1)|large_intestine(8)|lung(2)	12						CATTAACACTGAACACTTTTT	0.388																																							uc002yms.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(844-846)TTC>TTA		RWD domain containing 2B							119.0	109.0	113.0					21																	30378852		2203	4300	6503	SO:0001583	missense	10069							g.chr21:30378852G>T	AF212232	CCDS13582.1	21q22.11	2012-12-07	2007-07-17	2007-07-17	ENSG00000156253	ENSG00000156253			1302	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 6"""	C21orf6		10729227	Standard	NM_016940		Approved	GL011	uc002yms.3	P57060	OTTHUMG00000078805	ENST00000493196.1:c.846C>A	21.37:g.30378852G>T	ENSP00000418693:p.Phe282Leu		Somatic				RWDD2B_uc002ymt.2_Missense_Mutation_p.F253L|RWDD2B_uc002ymu.2_RNA|RWDD2B_uc002ymv.2_Missense_Mutation_p.F202L	p.F282L	NM_016940	NP_058636	WXS	Illumina HiSeq	Unspecified	P57060	RWD2B_HUMAN			5	933	-			282						Missense_Mutation	SNP	ENST00000493196.1	37	c.846C>A	CCDS13582.1	.	.	.	.	.	.	.	.	.	.	G	11.26	1.587257	0.28268	.	.	ENSG00000156253	ENST00000493196	.	.	.	5.45	1.42	0.22433	Domain of unknown function DUF1115 (1);	0.000000	0.85682	D	0.000000	T	0.68952	0.3057	M	0.78456	2.415	0.53688	D	0.999977	D;D	0.89917	1.0;1.0	D;D	0.87578	0.995;0.998	T	0.66192	-0.5985	9	0.15952	T	0.53	-21.0571	8.5222	0.33282	0.4892:0.0:0.5108:0.0	.	282;282	Q53FD2;P57060	.;RWD2B_HUMAN	L	282	.	ENSP00000418693:F282L	F	-	3	2	RWDD2B	29300723	1.000000	0.71417	0.064000	0.19789	0.057000	0.15508	2.636000	0.46545	0.433000	0.26313	-0.157000	0.13467	TTC		0.388	RWDD2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171858.1			18	130	1	0	6.49762e-13	0.006122	8.3421e-13	18	130				
CSTB	1476	broad.mit.edu	37	21	45194608	45194608	+	Missense_Mutation	SNP	C	C	G			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr21:45194608C>G	ENST00000291568.5	-	2	274	c.99G>C	c.(97-99)aaG>aaC	p.K33N		NM_000100.3	NP_000091.1	P04080	CYTB_HUMAN	cystatin B (stefin B)	33					adult locomotory behavior (GO:0008344)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of peptidase activity (GO:0010466)|negative regulation of proteolysis (GO:0045861)|regulation of apoptotic process (GO:0042981)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)	cysteine-type endopeptidase inhibitor activity (GO:0004869)|endopeptidase inhibitor activity (GO:0004866)|poly(A) RNA binding (GO:0044822)|protease binding (GO:0002020)	p.K33N(1)		lung(1)|prostate(1)	2				STAD - Stomach adenocarcinoma(101;0.168)		CAGGGAACTTCTTGTTTTCTT	0.522																																					Esophageal Squamous(58;831 1093 17019 29789 35147)	Esophageal Squamous(58;831 1093 17019 29789 35147)	uc002zdr.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(97-99)AAG>AAC		cystatin B							153.0	149.0	150.0					21																	45194608		2203	4300	6503	SO:0001583	missense	1476					cytoplasm|nucleolus	cysteine-type endopeptidase inhibitor activity|protease binding	g.chr21:45194608C>G	L03558	CCDS13701.1	21q22.3	2014-09-17			ENSG00000160213	ENSG00000160213			2482	protein-coding gene	gene with protein product		601145		EPM1, STFB		8596935	Standard	NM_000100		Approved	CST6, PME	uc002zdr.4	P04080	OTTHUMG00000086886	ENST00000291568.5:c.99G>C	21.37:g.45194608C>G	ENSP00000291568:p.Lys33Asn		Somatic					p.K33N	NM_000100	NP_000091	WXS	Illumina HiSeq	Unspecified	P04080	CYTB_HUMAN		STAD - Stomach adenocarcinoma(101;0.168)	2	208	-			33						Missense_Mutation	SNP	ENST00000291568.5	37	c.99G>C	CCDS13701.1	.	.	.	.	.	.	.	.	.	.	C	17.29	3.352075	0.61183	.	.	ENSG00000160213	ENST00000291568	T	0.26373	1.74	5.61	1.6	0.23607	Proteinase inhibitor I25, cystatin (2);	0.517985	0.21153	N	0.079294	T	0.37348	0.1000	.	.	.	0.09310	N	1	D	0.63880	0.993	P	0.60286	0.872	T	0.11036	-1.0604	9	0.62326	D	0.03	-1.7211	6.1414	0.20261	0.0:0.5176:0.3124:0.17	.	33	P04080	CYTB_HUMAN	N	33	ENSP00000291568:K33N	ENSP00000291568:K33N	K	-	3	2	CSTB	44019036	1.000000	0.71417	0.017000	0.16124	0.872000	0.50106	1.149000	0.31626	0.281000	0.22233	0.561000	0.74099	AAG		0.522	CSTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195689.1	NM_000100		4	184	0	0	0	0.001168	0	4	184				
TRPM2	7226	broad.mit.edu	37	21	45821603	45821603	+	Silent	SNP	C	C	T			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr21:45821603C>T	ENST00000397928.1	+	16	2806	c.2361C>T	c.(2359-2361)cgC>cgT	p.R787R	TRPM2_ENST00000397932.2_Silent_p.R787R|TRPM2_ENST00000300481.9_Silent_p.R767R|TRPM2_ENST00000498430.1_3'UTR|TRPM2_ENST00000300482.5_Silent_p.R787R	NM_003307.3	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel, subfamily M, member 2	787					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|response to hydroperoxide (GO:0033194)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ADP-ribose diphosphatase activity (GO:0047631)|calcium channel activity (GO:0005262)|manganese ion transmembrane transporter activity (GO:0005384)|sodium channel activity (GO:0005272)	p.R787R(1)		breast(3)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(15)|lung(29)|ovary(3)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	76						CCGCGGCCCGCGCCCGTGCCT	0.647																																							uc002zet.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|central_nervous_system(1)|pancreas(1)	3						c.(2359-2361)CGC>CGT		transient receptor potential cation channel,							141.0	111.0	121.0					21																	45821603		2203	4300	6503	SO:0001819	synonymous_variant	7226					integral to plasma membrane	ADP-ribose diphosphatase activity|calcium channel activity|sodium channel activity	g.chr21:45821603C>T	AB001535	CCDS13710.1	21q22.3	2011-12-14		2002-01-18	ENSG00000142185	ENSG00000142185		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Nudix motif containing"""	12339	protein-coding gene	gene with protein product		603749		TRPC7		9806837, 11385575, 16382100	Standard	NR_038257		Approved	KNP3, LTRPC2, NUDT9L1, NUDT9H, EREG1	uc002zew.1	O94759	OTTHUMG00000040840	ENST00000397928.1:c.2361C>T	21.37:g.45821603C>T			Somatic				TRPM2_uc002zeu.1_Silent_p.R787R|TRPM2_uc002zew.1_Silent_p.R787R|TRPM2_uc010gpt.1_Silent_p.R787R|TRPM2_uc002zex.1_Silent_p.R573R|TRPM2_uc002zey.1_Silent_p.R300R	p.R787R	NM_003307	NP_003298	WXS	Illumina HiSeq	Unspecified	O94759	TRPM2_HUMAN			17	2574	+			787			Extracellular (Potential).		D3DSL6|Q5KTC2|Q6J3P5|Q96KN6|Q96Q93	Silent	SNP	ENST00000397928.1	37	c.2361C>T	CCDS13710.1																																																																																				0.647	TRPM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098086.1	NM_003307		18	185	0	0	0	0.007413	0	18	185				
KCNJ4	3761	broad.mit.edu	37	22	38824024	38824024	+	Silent	SNP	C	C	T			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr22:38824024C>T	ENST00000303592.3	-	2	372	c.114G>A	c.(112-114)aaG>aaA	p.K38K	RP3-434P1.6_ENST00000433230.1_RNA	NM_004981.1|NM_152868.2	NP_004972.1|NP_690607.1	P48050	KCNJ4_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 4	38					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|voltage-gated potassium channel complex (GO:0008076)	inward rectifier potassium channel activity (GO:0005242)|PDZ domain binding (GO:0030165)	p.K38K(1)		endometrium(7)|kidney(1)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	23	Melanoma(58;0.0286)					AGCGCTGCGACTTGTTGCTCA	0.627																																							uc003avs.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(112-114)AAG>AAA		potassium inwardly-rectifying channel J4							323.0	243.0	271.0					22																	38824024		2203	4300	6503	SO:0001819	synonymous_variant	3761				synaptic transmission	basolateral plasma membrane|voltage-gated potassium channel complex	inward rectifier potassium channel activity|PDZ domain binding	g.chr22:38824024C>T	U07364	CCDS13971.1	22q13.1	2011-07-05			ENSG00000168135	ENSG00000168135		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6265	protein-coding gene	gene with protein product		600504				8016146, 16382105	Standard	NM_152868		Approved	Kir2.3, HIR, HRK1, hIRK2, IRK3	uc003avs.1	P48050	OTTHUMG00000151131	ENST00000303592.3:c.114G>A	22.37:g.38824024C>T			Somatic				KCNJ4_uc003avt.1_Silent_p.K38K	p.K38K	NM_004981	NP_004972	WXS	Illumina HiSeq	Unspecified	P48050	IRK4_HUMAN			2	211	-	Melanoma(58;0.0286)		38			Cytoplasmic (By similarity).		Q14D44	Silent	SNP	ENST00000303592.3	37	c.114G>A	CCDS13971.1																																																																																				0.627	KCNJ4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321447.1	NM_004981		114	158	0	0	0	0.01441	0	114	158				
PPP6R2	9701	broad.mit.edu	37	22	50875986	50875986	+	Missense_Mutation	SNP	T	T	G			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr22:50875986T>G	ENST00000216061.5	+	17	2105	c.1735T>G	c.(1735-1737)Ttt>Gtt	p.F579V	PPP6R2_ENST00000395741.3_Missense_Mutation_p.F553V|PPP6R2_ENST00000395744.3_Missense_Mutation_p.F552V|PPP6R2_ENST00000359139.3_Missense_Mutation_p.F552V			O75170	PP6R2_HUMAN	protein phosphatase 6, regulatory subunit 2	579						cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)		p.F552V(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|liver(1)|lung(6)|ovary(2)|skin(1)|urinary_tract(1)	22						CGTGGATCAGTTTGGCTTCAA	0.587																																							uc003blb.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1735-1737)TTT>GTT		SAPS domain family, member 2							138.0	112.0	121.0					22																	50875986		2203	4300	6503	SO:0001583	missense	9701					cytoplasm|intracellular membrane-bounded organelle	protein binding	g.chr22:50875986T>G	AB014585	CCDS33681.1, CCDS56235.1, CCDS56236.1, CCDS74881.1	22q13.33	2012-04-17	2010-06-28	2010-06-28	ENSG00000100239	ENSG00000100239		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"""	19253	protein-coding gene	gene with protein product		610877	"""KIAA0685"", ""SAPS domain family, member 2"""	KIAA0685, SAPS2		16769727	Standard	NM_014678		Approved	dJ579N16.1, SAP190	uc003blc.3	O75170	OTTHUMG00000150199	ENST00000216061.5:c.1735T>G	22.37:g.50875986T>G	ENSP00000216061:p.Phe579Val		Somatic				SAPS2_uc003bky.1_Missense_Mutation_p.F552V|SAPS2_uc003bkz.1_Missense_Mutation_p.F552V|SAPS2_uc003blc.2_Missense_Mutation_p.F579V|SAPS2_uc003bla.1_Missense_Mutation_p.F553V|SAPS2_uc003bld.1_Missense_Mutation_p.F111V	p.F579V	NM_014678	NP_055493	WXS	Illumina HiSeq	Unspecified	O75170	PP6R2_HUMAN		BRCA - Breast invasive adenocarcinoma(115;0.222)	17	2157	+		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)	579					A6PVG3|B7Z7T3|Q5U5P3|Q7Z2L2|Q7Z5G5|Q7Z731|Q9UGB9	Missense_Mutation	SNP	ENST00000216061.5	37	c.1735T>G		.	.	.	.	.	.	.	.	.	.	T	26.8	4.774601	0.90108	.	.	ENSG00000100239	ENST00000359139;ENST00000395741;ENST00000395744;ENST00000216061	T;T;T;T	0.51071	0.78;0.78;0.78;0.72	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	T	0.70448	0.3225	M	0.84326	2.69	0.58432	D	0.999999	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.91635	0.998;0.999;0.998;0.99;0.999;0.99	T	0.75687	-0.3231	10	0.72032	D	0.01	-11.8218	13.92	0.63926	0.0:0.0:0.0:1.0	.	111;579;579;553;552;552	F2Z3M7;O75170-5;O75170;O75170-3;O75170-4;O75170-2	.;.;PP6R2_HUMAN;.;.;.	V	552;553;552;579	ENSP00000352051:F552V;ENSP00000379090:F553V;ENSP00000379093:F552V;ENSP00000216061:F579V	ENSP00000216061:F579V	F	+	1	0	PPP6R2	49222852	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	7.827000	0.86722	1.939000	0.56221	0.379000	0.24179	TTT		0.587	PPP6R2-004	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000316809.1	NM_014678		10	24	0	0	0	0.001855	0	10	24				
SHISA5	51246	broad.mit.edu	37	3	48510922	48510922	+	Nonsense_Mutation	SNP	G	G	A			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr3:48510922G>A	ENST00000296444.2	-	5	817	c.481C>T	c.(481-483)Cag>Tag	p.Q161*	SHISA5_ENST00000426002.1_Nonsense_Mutation_p.Q58*|SHISA5_ENST00000442747.1_Nonsense_Mutation_p.Q130*|SHISA5_ENST00000465449.1_5'UTR|SHISA5_ENST00000444115.1_Nonsense_Mutation_p.Q130*|SHISA5_ENST00000443308.2_Nonsense_Mutation_p.Q154*	NM_001272065.1|NM_016479.3	NP_001258994.1|NP_057563.3	Q8N114	SHSA5_HUMAN	shisa family member 5	161	Pro-rich.				intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)	signal transducer activity (GO:0004871)|WW domain binding (GO:0050699)	p.Q161*(1)		large_intestine(1)|lung(1)	2						CTTGGAGGCTGAGGATAAGGG	0.602																																							uc003ctp.1		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(481-483)CAG>TAG		scotin precursor							112.0	103.0	106.0					3																	48510922		2203	4300	6503	SO:0001587	stop_gained	51246				apoptosis|positive regulation of I-kappaB kinase/NF-kappaB cascade	endoplasmic reticulum membrane|integral to membrane|nuclear membrane	signal transducer activity|WW domain binding	g.chr3:48510922G>A	AF520698	CCDS2770.1, CCDS63621.1, CCDS63622.1, CCDS63623.1	3p21.31	2013-07-31	2013-07-31		ENSG00000164054	ENSG00000164054		"""Shisa homologs"""	30376	protein-coding gene	gene with protein product		607290	"""shisa homolog 5 (Xenopus laevis)"""			11042152, 12135983	Standard	NM_016479		Approved	SCOTIN, hShisa5	uc011bbk.1	Q8N114	OTTHUMG00000133529	ENST00000296444.2:c.481C>T	3.37:g.48510922G>A	ENSP00000296444:p.Gln161*		Somatic				SHISA5_uc003ctn.1_Missense_Mutation_p.S29L|SHISA5_uc003ctm.1_Nonsense_Mutation_p.Q58*|SHISA5_uc011bbk.1_Missense_Mutation_p.S69L|SHISA5_uc003cto.1_Nonsense_Mutation_p.Q130*|SHISA5_uc003ctq.1_Nonsense_Mutation_p.Q154*|SHISA5_uc003ctr.1_Nonsense_Mutation_p.Q130*|SHISA5_uc003cts.1_Nonsense_Mutation_p.Q130*|SHISA5_uc003ctt.2_Nonsense_Mutation_p.Q58*|SHISA5_uc003ctu.1_RNA|SHISA5_uc011bbl.1_Nonsense_Mutation_p.Q59*	p.Q161*	NM_016479	NP_057563	WXS	Illumina HiSeq	Unspecified	Q8N114	SHSA5_HUMAN			5	615	-			161			Cytoplasmic (Potential).|Pro-rich.		B3KW99|F8W9N8|Q69YY9|Q7Z433|Q8NHL9|Q96MW8|Q9BV58	Nonsense_Mutation	SNP	ENST00000296444.2	37	c.481C>T	CCDS2770.1	.	.	.	.	.	.	.	.	.	.	G	37	6.161928	0.97338	.	.	ENSG00000164054	ENST00000296444;ENST00000444115;ENST00000426002;ENST00000442747;ENST00000443308	.	.	.	5.05	5.05	0.67936	.	0.337981	0.24683	N	0.036442	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	-11.6466	14.2556	0.66051	0.0:0.0:1.0:0.0	.	.	.	.	X	161;130;58;130;154	.	ENSP00000296444:Q161X	Q	-	1	0	SHISA5	48485926	1.000000	0.71417	0.996000	0.52242	0.996000	0.88848	6.485000	0.73625	2.497000	0.84241	0.563000	0.77884	CAG		0.602	SHISA5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257504.3	NM_016479		5	73	0	0	0	0.000602	0	5	73				
NISCH	11188	broad.mit.edu	37	3	52492774	52492774	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr3:52492774C>A	ENST00000479054.1	+	4	346	c.274C>A	c.(274-276)Ctg>Atg	p.L92M	NISCH_ENST00000420808.2_Missense_Mutation_p.L92M|NISCH_ENST00000488380.1_Missense_Mutation_p.L92M|NISCH_ENST00000345716.4_Missense_Mutation_p.L92M			Q9Y2I1	NISCH_HUMAN	nischarin	92	Necessary for binding to phosphoinositide-3-P; not sufficient for targeting to endosomes.|PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				actin cytoskeleton organization (GO:0030036)|apoptotic process (GO:0006915)|glucose metabolic process (GO:0006006)|negative regulation of cell migration (GO:0030336)|norepinephrine secretion (GO:0048243)|Rac protein signal transduction (GO:0016601)|regulation of blood pressure (GO:0008217)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytosol (GO:0005829)|endosome (GO:0005768)|membrane (GO:0016020)|plasma membrane (GO:0005886)	G-protein coupled amine receptor activity (GO:0008227)|identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)	p.L92M(1)		NS(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(9)|ovary(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	33				BRCA - Breast invasive adenocarcinoma(193;1.93e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)|OV - Ovarian serous cystadenocarcinoma(275;0.0577)	Tizanidine(DB00697)	GGAGAAGGATCTGGAGGTCTA	0.483																																							uc011beg.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|central_nervous_system(1)	4						c.(274-276)CTG>ATG		nischarin							94.0	95.0	95.0					3																	52492774		2203	4300	6503	SO:0001583	missense	11188				apoptosis|cell communication	cytosol|early endosome|plasma membrane|recycling endosome	phosphatidylinositol binding|receptor activity	g.chr3:52492774C>A	AF082516	CCDS33767.1, CCDS63651.1, CCDS63652.1	3p21.1	2008-07-18			ENSG00000010322	ENSG00000010322			18006	protein-coding gene	gene with protein product	"""imidazoline receptor candidate"", ""I-1 receptor candidate protein"", ""imidazoline receptor antisera selected"""	615507				11912194, 10882231	Standard	NM_007184		Approved	KIAA0975, I-1, IRAS	uc003ded.4	Q9Y2I1	OTTHUMG00000158571	ENST00000479054.1:c.274C>A	3.37:g.52492774C>A	ENSP00000418232:p.Leu92Met		Somatic				NISCH_uc003ded.3_Missense_Mutation_p.L92M|NISCH_uc003dec.1_Missense_Mutation_p.L92M	p.L92M	NM_007184	NP_009115	WXS	Illumina HiSeq	Unspecified	Q9Y2I1	NISCH_HUMAN		BRCA - Breast invasive adenocarcinoma(193;1.93e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)|OV - Ovarian serous cystadenocarcinoma(275;0.0577)	4	346	+			92			PX.|Necessary for binding to phosphoinositide-3-P; not sufficient for targeting to endosomes.		C9J245|Q6PGP3|Q6PIB4|Q7L8M3|Q7Z2X6|Q9UES6|Q9UEU4|Q9UFW3	Missense_Mutation	SNP	ENST00000479054.1	37	c.274C>A	CCDS33767.1	.	.	.	.	.	.	.	.	.	.	C	18.80	3.700219	0.68501	.	.	ENSG00000010322	ENST00000479054;ENST00000345716;ENST00000433196;ENST00000488380;ENST00000420808	T;T;T;T	0.67345	-0.26;-0.26;-0.26;-0.26	5.7	1.68	0.24146	Phox homologous domain (5);	0.000000	0.64402	D	0.000001	D	0.84669	0.5523	H	0.95114	3.625	0.53005	D	0.999965	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.86406	0.1745	10	0.87932	D	0	-14.7152	10.4639	0.44596	0.0:0.6072:0.0:0.3928	.	92;92	Q9Y2I1;C9J715	NISCH_HUMAN;.	M	92	ENSP00000418232:L92M;ENSP00000339958:L92M;ENSP00000417812:L92M;ENSP00000392484:L92M	ENSP00000339958:L92M	L	+	1	2	NISCH	52467814	1.000000	0.71417	0.999000	0.59377	0.999000	0.98932	1.986000	0.40677	0.677000	0.31305	0.655000	0.94253	CTG		0.483	NISCH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351357.1	NM_007184		13	100	1	0	4.36969e-10	0.001855	5.33478e-10	13	100				
EPHA6	285220	broad.mit.edu	37	3	96706597	96706597	+	Missense_Mutation	SNP	G	G	A			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr3:96706597G>A	ENST00000389672.5	+	3	912	c.874G>A	c.(874-876)Gtt>Att	p.V292I	EPHA6_ENST00000542517.1_Missense_Mutation_p.V198I|EPHA6_ENST00000470610.2_Missense_Mutation_p.V292I	NM_001080448.2	NP_001073917.2	Q9UF33	EPHA6_HUMAN	EPH receptor A6	198						integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)	p.V198I(2)|p.V292I(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(2)|lung(60)|ovary(3)|skin(11)|stomach(5)|upper_aerodigestive_tract(2)	101						CATTGCCCTGGTTTCAGTCCG	0.458																																							uc010how.1		NA																	3	Substitution - Missense(3)		lung(3)	stomach(5)|lung(4)|central_nervous_system(3)|breast(1)|skin(1)|ovary(1)|kidney(1)	16						c.(874-876)GTT>ATT		EPH receptor A6 isoform a							230.0	240.0	237.0					3																	96706597		1974	4196	6170	SO:0001583	missense	285220					integral to plasma membrane	ATP binding|ephrin receptor activity	g.chr3:96706597G>A	AK092565	CCDS46876.1, CCDS54616.1, CCDS63697.1	3q12.1	2013-02-11	2004-10-28		ENSG00000080224	ENSG00000080224		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19296	protein-coding gene	gene with protein product		600066				12471243	Standard	NM_001080448		Approved	FLJ35246	uc010how.1	Q9UF33	OTTHUMG00000159208	ENST00000389672.5:c.874G>A	3.37:g.96706597G>A	ENSP00000374323:p.Val292Ile		Somatic				EPHA6_uc003drp.1_Missense_Mutation_p.V292I	p.V292I	NM_001080448	NP_001073917	WXS	Illumina HiSeq	Unspecified	Q9UF33	EPHA6_HUMAN			3	917	+			197			Ephrin-binding.|Extracellular (Potential).		D6RAL5	Missense_Mutation	SNP	ENST00000389672.5	37	c.874G>A	CCDS46876.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.2|20.2	3.951789|3.951789	0.73787|0.73787	.|.	.|.	ENSG00000080224|ENSG00000080224	ENST00000506569|ENST00000470610;ENST00000389672;ENST00000542517	.|T;T;T	.|0.04015	.|3.73;3.73;3.73	5.48|5.48	5.48|5.48	0.80851|0.80851	.|.	.|0.196976	.|0.31145	.|U	.|0.008170	T|T	0.18841|0.18841	0.0452|0.0452	L|L	0.59436|0.59436	1.845|1.845	0.80722|0.80722	D|D	1|1	.|D;D	.|0.61697	.|0.99;0.978	.|D;D	.|0.83275	.|0.996;0.995	T|T	0.00628|0.00628	-1.1637|-1.1637	5|10	.|0.30854	.|T	.|0.27	.|.	18.3424|18.3424	0.90309|0.90309	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|292;292	.|B3KS12;E7EU71	.|.;.	D|I	236|292;292;198	.|ENSP00000420598:V292I;ENSP00000374323:V292I;ENSP00000439758:V198I	.|ENSP00000374323:V292I	G|V	+|+	2|1	0|0	EPHA6|EPHA6	98189287|98189287	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.729000|0.729000	0.41735|0.41735	9.869000|9.869000	0.99810|0.99810	2.554000|2.554000	0.86153|0.86153	0.655000|0.655000	0.94253|0.94253	GGT|GTT		0.458	EPHA6-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353845.3	NM_001080448		23	247	0	0	0	0.003954	0	23	247				
CD200	4345	broad.mit.edu	37	3	112068659	112068659	+	Missense_Mutation	SNP	G	G	C			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr3:112068659G>C	ENST00000315711.8	+	5	852	c.795G>C	c.(793-795)caG>caC	p.Q265H	CD200_ENST00000473539.1_Missense_Mutation_p.Q290H|CD200_ENST00000383681.3_Missense_Mutation_p.Q191H	NM_005944.5	NP_005935.4	P41217	OX2G_HUMAN	CD200 molecule	265					regulation of immune response (GO:0050776)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)		p.Q290H(1)		endometrium(1)|kidney(2)|large_intestine(2)|lung(6)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	16		Acute lymphoblastic leukemia(4;1.7e-08)|all_hematologic(4;8.82e-05)				ACCGGAATCAGGACCGAGGTG	0.363																																							uc003dyw.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(868-870)CAG>CAC		CD200 antigen isoform b							93.0	83.0	87.0					3																	112068659		2203	4300	6503	SO:0001583	missense	4345				regulation of immune response	integral to plasma membrane		g.chr3:112068659G>C		CCDS2965.1, CCDS33818.1	3q13.2	2013-09-20	2006-03-28	2004-09-01	ENSG00000091972	ENSG00000091972		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7203	protein-coding gene	gene with protein product		155970	"""antigen identified by monoclonal antibody MRC OX-2"", ""CD200 antigen"""	MOX1, MOX2			Standard	XM_005247482		Approved	MRC, OX-2	uc003dyw.3	P41217	OTTHUMG00000159248	ENST00000315711.8:c.795G>C	3.37:g.112068659G>C	ENSP00000312766:p.Gln265His		Somatic				CD200_uc010hqd.1_Missense_Mutation_p.Q149H|CD200_uc003dyx.2_Missense_Mutation_p.Q265H|CD200_uc003dyy.2_Missense_Mutation_p.Q149H|CD200_uc003dyz.2_Missense_Mutation_p.Q191H	p.Q290H	NM_001004196	NP_001004196	WXS	Illumina HiSeq	Unspecified	P41217	OX2G_HUMAN			6	1014	+		Acute lymphoblastic leukemia(4;1.7e-08)|all_hematologic(4;8.82e-05)	265			Cytoplasmic (Potential).		B3KQI1|B4DLW9|D3DN65|Q6J2Q6|Q6PIQ4|Q8TB85|Q9H3J3	Missense_Mutation	SNP	ENST00000315711.8	37	c.870G>C	CCDS2965.1	.	.	.	.	.	.	.	.	.	.	G	17.10	3.302970	0.60195	.	.	ENSG00000091972	ENST00000315711;ENST00000473539;ENST00000383681	T;T;T	0.70749	1.12;-0.51;-0.49	5.22	2.11	0.27256	.	0.124721	0.36703	N	0.002451	T	0.72070	0.3415	L	0.29908	0.895	0.27069	N	0.963359	D;D;D;D;D	0.71674	0.998;0.994;0.99;0.994;0.994	D;D;D;D;D	0.79784	0.993;0.991;0.979;0.991;0.991	T	0.63409	-0.6644	10	0.87932	D	0	-14.4425	8.8656	0.35284	0.2173:0.0:0.7827:0.0	.	265;191;191;265;290	P41217;F8W7G1;B4DDZ6;P41217-2;P41217-3	OX2G_HUMAN;.;.;.;.	H	265;290;191	ENSP00000312766:Q265H;ENSP00000420298:Q290H;ENSP00000373179:Q191H	ENSP00000312766:Q265H	Q	+	3	2	CD200	113551349	0.982000	0.34865	0.997000	0.53966	0.960000	0.62799	0.547000	0.23299	0.604000	0.29930	0.655000	0.94253	CAG		0.363	CD200-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354078.1			19	49	0	0	0	0.007413	0	19	49				
GPR156	165829	broad.mit.edu	37	3	119886215	119886215	+	Silent	SNP	G	G	A			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr3:119886215G>A	ENST00000464295.1	-	10	2554	c.2109C>T	c.(2107-2109)ggC>ggT	p.G703G	GPR156_ENST00000315843.3_Silent_p.G703G|GPR156_ENST00000461057.1_Silent_p.G699G			Q8NFN8	GP156_HUMAN	G protein-coupled receptor 156	703						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled GABA receptor activity (GO:0004965)	p.G703G(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(11)|lung(12)|ovary(1)|prostate(1)|skin(1)	32				GBM - Glioblastoma multiforme(114;0.19)		TTGGGGCCCGGCCAGAACCAG	0.637																																							uc011bjf.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|skin(1)	2						c.(2107-2109)GGC>GGT		G protein-coupled receptor 156							42.0	45.0	44.0					3																	119886215		2203	4299	6502	SO:0001819	synonymous_variant	165829					integral to membrane|plasma membrane	G-protein coupled receptor activity|GABA-B receptor activity	g.chr3:119886215G>A	AF488739	CCDS2997.1, CCDS54629.1	3q13.33	2012-08-21			ENSG00000175697	ENSG00000175697		"""GPCR / Class C : Orphans"""	20844	protein-coding gene	gene with protein product		610464				12591167	Standard	NM_153002		Approved	PGR28, GABABL	uc011bjf.2	Q8NFN8	OTTHUMG00000159406	ENST00000464295.1:c.2109C>T	3.37:g.119886215G>A			Somatic				GPR156_uc011bjg.1_Silent_p.G699G	p.G703G	NM_153002	NP_694547	WXS	Illumina HiSeq	Unspecified	Q8NFN8	GP156_HUMAN		GBM - Glioblastoma multiforme(114;0.19)	9	2109	-			703			Cytoplasmic (Potential).		B7ZL66|E9PFZ4|Q14CM1|Q86SN6	Silent	SNP	ENST00000464295.1	37	c.2109C>T	CCDS2997.1																																																																																				0.637	GPR156-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355139.1	NM_153002		4	107	0	0	0	0.009096	0	4	107				
PARP14	54625	broad.mit.edu	37	3	122446793	122446793	+	Silent	SNP	C	C	T			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr3:122446793C>T	ENST00000474629.2	+	16	5342	c.5076C>T	c.(5074-5076)gtC>gtT	p.V1692V		NM_017554.2	NP_060024.2	Q460N5	PAR14_HUMAN	poly (ADP-ribose) polymerase family, member 14	1692	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	NAD+ ADP-ribosyltransferase activity (GO:0003950)	p.V1529V(1)|p.V1692V(1)		NS(2)|breast(5)|cervix(2)|endometrium(7)|kidney(5)|large_intestine(8)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	50				GBM - Glioblastoma multiforme(114;0.0531)		TGCCACACGTCAATCGAAATG	0.502																																							uc003efq.3		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)|breast(2)|lung(1)|pancreas(1)	6						c.(5074-5076)GTC>GTT		poly (ADP-ribose) polymerase family, member 14							63.0	63.0	63.0					3																	122446793		1999	4181	6180	SO:0001819	synonymous_variant	54625				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	NAD+ ADP-ribosyltransferase activity	g.chr3:122446793C>T	AB033094	CCDS46894.1	3q21	2010-02-16			ENSG00000173193	ENSG00000173193		"""Poly (ADP-ribose) polymerases"""	29232	protein-coding gene	gene with protein product		610028				15273990	Standard	NM_017554		Approved	KIAA1268, pART8	uc003efq.4	Q460N5	OTTHUMG00000159552	ENST00000474629.2:c.5076C>T	3.37:g.122446793C>T			Somatic				PARP14_uc010hrk.2_RNA|PARP14_uc003efr.2_Silent_p.V1409V	p.V1692V	NM_017554	NP_060024	WXS	Illumina HiSeq	Unspecified	Q460N5	PAR14_HUMAN		GBM - Glioblastoma multiforme(114;0.0531)	16	5135	+			1692			PARP catalytic.		B4E2H0|Q460N4|Q8J027|Q9H9X9|Q9NV60|Q9ULF2	Silent	SNP	ENST00000474629.2	37	c.5076C>T	CCDS46894.1																																																																																				0.502	PARP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356173.2	NM_017554		44	20	0	0	0	0.01441	0	44	20				
CP	1356	broad.mit.edu	37	3	148903209	148903209	+	Missense_Mutation	SNP	G	G	A			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr3:148903209G>A	ENST00000264613.6	-	12	2364	c.2102C>T	c.(2101-2103)aCa>aTa	p.T701I	CP_ENST00000462336.1_Intron	NM_000096.3	NP_000087	P00450	CERU_HUMAN	ceruloplasmin (ferroxidase)	701	F5/8 type A 2.|Plastocyanin-like 4.				cellular iron ion homeostasis (GO:0006879)|copper ion transport (GO:0006825)|transmembrane transport (GO:0055085)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)	chaperone binding (GO:0051087)|copper ion binding (GO:0005507)|ferroxidase activity (GO:0004322)	p.T701I(1)		breast(6)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|prostate(1)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		Prostate(884;0.00217)|Hepatocellular(537;0.00826)|Myeloproliferative disorder(1037;0.0122)|all_neural(597;0.0189)|Melanoma(1037;0.152)	LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)		Drotrecogin alfa(DB00055)	ATGATCAGTTGTAAGGCATTC	0.453																																							uc003ewy.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(2101-2103)ACA>ATA		ceruloplasmin precursor	Drotrecogin alfa(DB00055)						118.0	110.0	113.0					3																	148903209		2203	4300	6503	SO:0001583	missense	1356				cellular iron ion homeostasis|copper ion transport|transmembrane transport	extracellular space	chaperone binding|ferroxidase activity	g.chr3:148903209G>A	M13536	CCDS3141.1	3q23-q25	2010-07-01			ENSG00000047457	ENSG00000047457	1.16.3.1		2295	protein-coding gene	gene with protein product		117700					Standard	NM_000096		Approved		uc003ewy.4	P00450	OTTHUMG00000159563	ENST00000264613.6:c.2102C>T	3.37:g.148903209G>A	ENSP00000264613:p.Thr701Ile		Somatic				CP_uc011bnr.1_RNA|CP_uc003ewx.3_Missense_Mutation_p.T482I|CP_uc003ewz.2_Missense_Mutation_p.T701I	p.T701I	NM_000096	NP_000087	WXS	Illumina HiSeq	Unspecified	P00450	CERU_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)		12	2355	-		Prostate(884;0.00217)|Hepatocellular(537;0.00826)|Myeloproliferative disorder(1037;0.0122)|all_neural(597;0.0189)|Melanoma(1037;0.152)	701			Plastocyanin-like 4.|F5/8 type A 2.		Q14063|Q2PP18|Q9UKS4	Missense_Mutation	SNP	ENST00000264613.6	37	c.2102C>T	CCDS3141.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.183958	0.78677	.	.	ENSG00000047457	ENST00000264613;ENST00000494544	D;D	0.99709	-6.48;-6.48	5.63	5.63	0.86233	Cupredoxin (2);	0.000000	0.85682	D	0.000000	D	0.99539	0.9835	L	0.56340	1.77	0.58432	D	0.999996	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.72982	0.953;0.965;0.979	D	0.99457	1.0942	10	0.36615	T	0.2	-23.5241	19.6942	0.96016	0.0:0.0:1.0:0.0	.	701;701;701	A8K5A4;P00450;Q1L857	.;CERU_HUMAN;.	I	701;484	ENSP00000264613:T701I;ENSP00000420545:T484I	ENSP00000264613:T701I	T	-	2	0	CP	150385899	1.000000	0.71417	0.897000	0.35233	0.913000	0.54294	4.912000	0.63335	2.651000	0.90000	0.455000	0.32223	ACA		0.453	CP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317498.1	NM_000096		70	102	0	0	0	0.01441	0	70	102				
IGSF10	285313	broad.mit.edu	37	3	151155695	151155695	+	Silent	SNP	G	G	A			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr3:151155695G>A	ENST00000282466.3	-	6	6653	c.6654C>T	c.(6652-6654)ccC>ccT	p.P2218P	IGSF10_ENST00000495443.1_5'UTR	NM_001178145.1|NM_001178146.1|NM_178822.4	NP_001171616.1|NP_001171617.1|NP_849144.2	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10	2218	Ig-like C2-type 8.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)	extracellular region (GO:0005576)		p.P2218P(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(24)|liver(4)|lung(43)|ovary(8)|prostate(4)|skin(9)|stomach(1)|urinary_tract(3)	116			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			CATCCCCACTGGGATTTCGGG	0.423																																							uc011bod.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(7)|ovary(5)|central_nervous_system(1)	13						c.(6652-6654)CCC>CCT		immunoglobulin superfamily, member 10 precursor							117.0	109.0	112.0					3																	151155695		2203	4300	6503	SO:0001819	synonymous_variant	285313				cell differentiation|multicellular organismal development|ossification	extracellular region		g.chr3:151155695G>A	AY273815	CCDS3160.1	3q25.1	2013-01-11			ENSG00000152580	ENSG00000152580		"""Immunoglobulin superfamily / I-set domain containing"""	26384	protein-coding gene	gene with protein product						12477932	Standard	NM_178822		Approved	FLJ25972, CMF608	uc011bod.2	Q6WRI0	OTTHUMG00000159856	ENST00000282466.3:c.6654C>T	3.37:g.151155695G>A			Somatic				IGSF10_uc011bob.1_Silent_p.P245P|IGSF10_uc011boc.1_Silent_p.P197P	p.P2218P	NM_178822	NP_849144	WXS	Illumina HiSeq	Unspecified	Q6WRI0	IGS10_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)		6	6654	-			2218			Ig-like C2-type 8.		Q86YJ9|Q8N772|Q8NA84	Silent	SNP	ENST00000282466.3	37	c.6654C>T	CCDS3160.1																																																																																				0.423	IGSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357782.1	NM_178822		54	111	0	0	0	0.01441	0	54	111				
YEATS2	55689	broad.mit.edu	37	3	183476724	183476724	+	Missense_Mutation	SNP	G	G	A	rs370579078		TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr3:183476724G>A	ENST00000305135.5	+	13	1822	c.1627G>A	c.(1627-1629)Gga>Aga	p.G543R		NM_018023.4	NP_060493.3	Q9ULM3	YETS2_HUMAN	YEATS domain containing 2	543					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|mitotic spindle (GO:0072686)	TBP-class protein binding (GO:0017025)	p.G543R(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(24)|ovary(3)|prostate(2)|skin(3)	49	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.38e-42)|Epithelial(37;1.9e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			TAAAATTCATGGAAGTAGTTT	0.358																																							uc003fly.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|large_intestine(1)	4						c.(1627-1629)GGA>AGA		YEATS domain containing 2		G	ARG/GLY	2,3644		0,2,1821	111.0	101.0	104.0		1627	5.2	1.0	3		104	0,8172		0,0,4086	no	missense	YEATS2	NM_018023.4	125	0,2,5907	AA,AG,GG		0.0,0.0549,0.0169	probably-damaging	543/1423	183476724	2,11816	1823	4086	5909	SO:0001583	missense	55689				histone H3 acetylation|negative regulation of transcription from RNA polymerase II promoter	Ada2/Gcn5/Ada3 transcription activator complex	TBP-class protein binding	g.chr3:183476724G>A	AB033023	CCDS43175.1	3q27.3	2004-08-18			ENSG00000163872	ENSG00000163872			25489	protein-coding gene	gene with protein product		613373				10574462	Standard	NM_018023		Approved	FLJ10201, FLJ12841, FLJ13308, KIAA1197	uc003fly.2	Q9ULM3	OTTHUMG00000156898	ENST00000305135.5:c.1627G>A	3.37:g.183476724G>A	ENSP00000306983:p.Gly543Arg		Somatic					p.G543R	NM_018023	NP_060493	WXS	Illumina HiSeq	Unspecified	Q9ULM3	YETS2_HUMAN	all cancers(12;2.38e-42)|Epithelial(37;1.9e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)		13	1822	+	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		543					A7E2B9|D3DNS9|Q641P6|Q9NW96	Missense_Mutation	SNP	ENST00000305135.5	37	c.1627G>A	CCDS43175.1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.553170	0.86127	5.49E-4	0.0	ENSG00000163872	ENST00000421660;ENST00000305135	T	0.28895	1.59	5.22	5.22	0.72569	.	0.354855	0.26719	N	0.022856	T	0.44456	0.1294	L	0.27053	0.805	0.46396	D	0.999021	D	0.89917	1.0	D	0.69307	0.963	T	0.45745	-0.9240	10	0.72032	D	0.01	-14.8593	18.812	0.92061	0.0:0.0:1.0:0.0	.	543	Q9ULM3	YETS2_HUMAN	R	543	ENSP00000306983:G543R	ENSP00000306983:G543R	G	+	1	0	YEATS2	184959418	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.121000	0.71602	2.449000	0.82847	0.585000	0.79938	GGA		0.358	YEATS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346507.2	NM_018023		39	101	0	0	0	0.009718	0	39	101				
SDHAP1	255812	broad.mit.edu	37	3	195701285	195701285	+	RNA	SNP	G	G	T	rs201085786	byFrequency	TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr3:195701285G>T	ENST00000427841.1	-	0	1539					NR_003264.2				succinate dehydrogenase complex, subunit A, flavoprotein pseudogene 1																		GCACGACTCTGCGATGCTCAG	0.537																																					Ovarian(67;1158 1227 12109 20189 43170)	Ovarian(67;1158 1227 12109 20189 43170)	uc011btq.1		NA																	0					0						c.(577-579)CGC>CGA		SubName: Full=cDNA FLJ56858, highly similar to Succinate dehydrogenase (ubiquinone) flavoprotein subunit, mitochondrial (EC 1.3.5.1);																																						255812							g.chr3:195701285G>T	BC071730		3q29	2009-12-02	2006-11-21	2009-12-02	ENSG00000185485	ENSG00000185485			32455	pseudogene	pseudogene			"""succinate dehydrogenase complex, subunit A, flavoprotein-like 1"""	SDHAL1, SDHALP1			Standard	NR_003264		Approved		uc003fvy.3		OTTHUMG00000155716		3.37:g.195701285G>T			Somatic				SDHAP1_uc003fvx.3_RNA|SDHAP1_uc011btp.1_RNA	p.R193R			WXS	Illumina HiSeq	Unspecified					8	1208	-									Silent	SNP	ENST00000427841.1	37	c.579C>A																																																																																					0.537	SDHAP1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000341367.1			10	35	1	0	7.93312e-07	0.00245	9.12538e-07	10	35				
SDHAP1	255812	broad.mit.edu	37	3	195701304	195701304	+	RNA	SNP	C	C	T	rs200047587	byFrequency	TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr3:195701304C>T	ENST00000427841.1	-	0	1520					NR_003264.2				succinate dehydrogenase complex, subunit A, flavoprotein pseudogene 1																		AGGGCACATGCCTGACCAGAC	0.572																																					Ovarian(67;1158 1227 12109 20189 43170)	Ovarian(67;1158 1227 12109 20189 43170)	uc011btq.1		NA																	0					0						c.(559-561)GGC>GAC		SubName: Full=cDNA FLJ56858, highly similar to Succinate dehydrogenase (ubiquinone) flavoprotein subunit, mitochondrial (EC 1.3.5.1);																																						255812							g.chr3:195701304C>T	BC071730		3q29	2009-12-02	2006-11-21	2009-12-02	ENSG00000185485	ENSG00000185485			32455	pseudogene	pseudogene			"""succinate dehydrogenase complex, subunit A, flavoprotein-like 1"""	SDHAL1, SDHALP1			Standard	NR_003264		Approved		uc003fvy.3		OTTHUMG00000155716		3.37:g.195701304C>T			Somatic				SDHAP1_uc003fvx.3_RNA|SDHAP1_uc011btp.1_RNA	p.G187D			WXS	Illumina HiSeq	Unspecified					8	1189	-									Missense_Mutation	SNP	ENST00000427841.1	37	c.560G>A																																																																																					0.572	SDHAP1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000341367.1			13	45	0	0	0	0.00499	0	13	45				
HGFAC	3083	broad.mit.edu	37	4	3446354	3446354	+	Nonsense_Mutation	SNP	T	T	A			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr4:3446354T>A	ENST00000382774.3	+	7	850	c.735T>A	c.(733-735)tgT>tgA	p.C245*	HGFAC_ENST00000511533.1_Nonsense_Mutation_p.C245*	NM_001528.2	NP_001519.1	Q04756	HGFA_HUMAN	HGF activator	245	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|rough endoplasmic reticulum (GO:0005791)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.C245*(1)		central_nervous_system(3)|cervix(1)|endometrium(4)|large_intestine(2)|lung(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	22				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)		CCCCAGCTTGTCTGAGCAGCC	0.711																																							uc003ghc.2		NA																	1	Substitution - Nonsense(1)		lung(1)	central_nervous_system(2)	2						c.(733-735)TGT>TGA		HGF activator preproprotein							13.0	15.0	14.0					4																	3446354		2186	4269	6455	SO:0001587	stop_gained	3083				proteolysis	extracellular space	protein binding|serine-type endopeptidase activity	g.chr4:3446354T>A	D14012	CCDS3369.1, CCDS75098.1	4p16	2008-02-07			ENSG00000109758	ENSG00000109758	3.4.21.-		4894	protein-coding gene	gene with protein product		604552				7683665, 8226803	Standard	XM_005247966		Approved	HGFAP, HGFA	uc003ghc.3	Q04756	OTTHUMG00000090281	ENST00000382774.3:c.735T>A	4.37:g.3446354T>A	ENSP00000372224:p.Cys245*		Somatic				HGFAC_uc010icw.2_Nonsense_Mutation_p.C245*	p.C245*	NM_001528	NP_001519	WXS	Illumina HiSeq	Unspecified	Q04756	HGFA_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (64;0.163)	7	738	+			245			EGF-like 2.		Q14726|Q2M1W7|Q53X47	Nonsense_Mutation	SNP	ENST00000382774.3	37	c.735T>A	CCDS3369.1	.	.	.	.	.	.	.	.	.	.	T	17.54	3.415201	0.62511	.	.	ENSG00000109758	ENST00000382774;ENST00000511533	.	.	.	3.44	-4.98	0.03019	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.2469	0.49002	0.0:0.2328:0.0:0.7672	.	.	.	.	X	245	.	ENSP00000372224:C245X	C	+	3	2	HGFAC	3416152	0.034000	0.19679	0.437000	0.26809	0.327000	0.28475	-0.805000	0.04530	-1.188000	0.02705	-1.489000	0.00976	TGT		0.711	HGFAC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206607.3			4	11	0	0	0	0.009096	0	4	11				
LDB2	9079	broad.mit.edu	37	4	16760880	16760880	+	Missense_Mutation	SNP	T	T	G			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr4:16760880T>G	ENST00000304523.5	-	2	459	c.136A>C	c.(136-138)Agt>Cgt	p.S46R	LDB2_ENST00000502640.1_Missense_Mutation_p.S46R|LDB2_ENST00000441778.2_Missense_Mutation_p.S46R|LDB2_ENST00000515064.1_Missense_Mutation_p.S46R	NM_001290.3	NP_001281.1	O43679	LDB2_HUMAN	LIM domain binding 2	46					epithelial structure maintenance (GO:0010669)|hair follicle development (GO:0001942)|positive regulation of cellular component biogenesis (GO:0044089)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|somatic stem cell maintenance (GO:0035019)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	LIM domain binding (GO:0030274)|transcription cofactor activity (GO:0003712)	p.S46R(2)		breast(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(23)|urinary_tract(1)	33						AGGTTGTCACTATCCTGCAAA	0.413																																							uc003goz.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(136-138)AGT>CGT		LIM domain binding 2 isoform a							82.0	79.0	80.0					4																	16760880		2203	4300	6503	SO:0001583	missense	9079						LIM domain binding|transcription cofactor activity	g.chr4:16760880T>G	AF068651	CCDS3420.1, CCDS47031.1	4p16	2008-08-01			ENSG00000169744	ENSG00000169744			6533	protein-coding gene	gene with protein product		603450				9853615, 9880598, 10861853	Standard	NM_001290		Approved	CLIM1, LDB1	uc003goz.3	O43679	OTTHUMG00000048212	ENST00000304523.5:c.136A>C	4.37:g.16760880T>G	ENSP00000306772:p.Ser46Arg		Somatic				LDB2_uc003gpa.2_Missense_Mutation_p.S46R|LDB2_uc003gpb.2_Missense_Mutation_p.S46R|LDB2_uc011bxh.1_Missense_Mutation_p.S46R|LDB2_uc010iee.2_Missense_Mutation_p.S46R	p.S46R	NM_001290	NP_001281	WXS	Illumina HiSeq	Unspecified	O43679	LDB2_HUMAN			2	452	-			46					O60619|O75480	Missense_Mutation	SNP	ENST00000304523.5	37	c.136A>C	CCDS3420.1	.	.	.	.	.	.	.	.	.	.	T	16.41	3.116887	0.56505	.	.	ENSG00000169744	ENST00000515064;ENST00000441778;ENST00000304523;ENST00000502640;ENST00000506732	.	.	.	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	T	0.77644	0.4161	M	0.79123	2.44	0.80722	D	1	P;D;D;D;P	0.58970	0.911;0.984;0.964;0.98;0.904	P;P;P;P;P	0.62560	0.604;0.904;0.844;0.782;0.79	T	0.78597	-0.2142	9	0.46703	T	0.11	-14.1677	15.6296	0.76893	0.0:0.0:0.0:1.0	.	12;46;46;46;46	B7Z6D0;E9PFI4;G5E9Y7;O43679-2;O43679	.;.;.;.;LDB2_HUMAN	R	46;46;46;46;22	.	ENSP00000306772:S46R	S	-	1	0	LDB2	16369978	1.000000	0.71417	0.674000	0.29902	0.800000	0.45204	3.410000	0.52664	2.285000	0.76669	0.533000	0.62120	AGT		0.413	LDB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250321.2			4	134	0	0	0	0.001168	0	4	134				
TLR6	10333	broad.mit.edu	37	4	38829252	38829252	+	Missense_Mutation	SNP	G	G	C			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr4:38829252G>C	ENST00000381950.1	-	1	1908	c.1843C>G	c.(1843-1845)Ctc>Gtc	p.L615V	TLR6_ENST00000436693.2_Missense_Mutation_p.L615V			Q9Y2C9	TLR6_HUMAN	toll-like receptor 6	615					activation of NF-kappaB-inducing kinase activity (GO:0007250)|cellular response to diacyl bacterial lipopeptide (GO:0071726)|defense response to bacterium (GO:0042742)|detection of diacyl bacterial lipopeptide (GO:0042496)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|nitric oxide metabolic process (GO:0046209)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 biosynthetic process (GO:0045410)|positive regulation of JUN kinase activity (GO:0043507)|regulation of cytokine secretion (GO:0050707)|signal transduction (GO:0007165)|T-helper 1 type immune response (GO:0042088)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 6 signaling pathway (GO:0034150)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cytoplasmic vesicle (GO:0031410)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|Toll-like receptor 2-Toll-like receptor 6 protein complex (GO:0035355)	diacyl lipopeptide binding (GO:0042498)|lipopeptide binding (GO:0071723)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)	p.L615V(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						ACCATCCTGAGATACCAGGGC	0.517																																							uc003gtm.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1843-1845)CTC>GTC		toll-like receptor 6 precursor							111.0	100.0	104.0					4																	38829252		2203	4300	6503	SO:0001583	missense	10333				activation of NF-kappaB-inducing kinase activity|cellular response to diacyl bacterial lipopeptide|defense response to bacterium|detection of diacyl bacterial lipopeptide|inflammatory response|innate immune response|MyD88-dependent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-6 biosynthetic process|positive regulation of JUN kinase activity|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	integral to plasma membrane|phagocytic vesicle membrane	lipopeptide binding|transmembrane receptor activity	g.chr4:38829252G>C		CCDS3446.1	4p16.1	2009-11-23			ENSG00000174130	ENSG00000174130		"""CD molecules"""	16711	protein-coding gene	gene with protein product		605403				10231569	Standard	NM_006068		Approved	CD286	uc010ifg.2	Q9Y2C9	OTTHUMG00000128579	ENST00000381950.1:c.1843C>G	4.37:g.38829252G>C	ENSP00000371376:p.Leu615Val		Somatic				TLR6_uc010ifg.1_Missense_Mutation_p.L615V	p.L615V	NM_006068	NP_006059	WXS	Illumina HiSeq	Unspecified	Q9Y2C9	TLR6_HUMAN			1	1909	-			615			Cytoplasmic (Potential).		B3Y640|B6CH35|B6RFS4|B6RFS5|Q2NKL3	Missense_Mutation	SNP	ENST00000381950.1	37	c.1843C>G	CCDS3446.1	.	.	.	.	.	.	.	.	.	.	G	5.780	0.328292	0.10956	.	.	ENSG00000174130	ENST00000436693;ENST00000381950	T;T	0.10573	2.86;2.86	4.29	2.48	0.30137	.	0.340590	0.24735	N	0.036023	T	0.08223	0.0205	L	0.42245	1.32	0.28395	N	0.918894	B	0.16802	0.019	B	0.17979	0.02	T	0.26258	-1.0108	10	0.27785	T	0.31	.	4.575	0.12228	0.0867:0.4312:0.3344:0.1477	.	615	Q9Y2C9	TLR6_HUMAN	V	615	ENSP00000389600:L615V;ENSP00000371376:L615V	ENSP00000371376:L615V	L	-	1	0	TLR6	38505647	0.585000	0.26774	0.997000	0.53966	0.988000	0.76386	0.680000	0.25306	0.405000	0.25532	0.561000	0.74099	CTC		0.517	TLR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250431.1			24	186	0	0	0	0.00333	0	24	186				
POLR2B	5431	broad.mit.edu	37	4	57889908	57889908	+	Silent	SNP	T	T	C			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr4:57889908T>C	ENST00000381227.1	+	21	3260	c.2847T>C	c.(2845-2847)taT>taC	p.Y949Y	POLR2B_ENST00000441246.2_Silent_p.Y942Y|POLR2B_ENST00000431623.2_Silent_p.Y874Y|POLR2B_ENST00000314595.5_Silent_p.Y949Y			P30876	RPB2_HUMAN	polymerase (RNA) II (DNA directed) polypeptide B, 140kDa	949					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	DNA-directed RNA polymerase II, core complex (GO:0005665)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|ribonucleoside binding (GO:0032549)	p.Y949Y(1)		breast(1)|central_nervous_system(2)|endometrium(6)|kidney(10)|large_intestine(9)|lung(17)|ovary(2)|prostate(4)|skin(1)	52	Glioma(25;0.08)|all_neural(26;0.181)					GTATTCAGTATAGACAAGAGG	0.333																																							uc003hcl.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(2845-2847)TAT>TAC		DNA directed RNA polymerase II polypeptide B							86.0	84.0	85.0					4																	57889908		2203	4300	6503	SO:0001819	synonymous_variant	5431				mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|protein phosphorylation|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	DNA-directed RNA polymerase II, core complex	DNA binding|DNA-directed RNA polymerase activity|metal ion binding|protein binding|ribonucleoside binding	g.chr4:57889908T>C		CCDS3511.1	4q12	2013-01-21	2002-08-29		ENSG00000047315	ENSG00000047315		"""RNA polymerase subunits"""	9188	protein-coding gene	gene with protein product		180661	"""polymerase (RNA) II (DNA directed) polypeptide B (140kD)"""			1518060, 8034326	Standard	NM_000938		Approved	RPB2	uc003hcl.1	P30876	OTTHUMG00000128771	ENST00000381227.1:c.2847T>C	4.37:g.57889908T>C			Somatic				POLR2B_uc011cae.1_Silent_p.Y942Y|POLR2B_uc011caf.1_Silent_p.Y874Y|POLR2B_uc003hcm.1_Silent_p.Y442Y	p.Y949Y	NM_000938	NP_000929	WXS	Illumina HiSeq	Unspecified	P30876	RPB2_HUMAN			20	2890	+	Glioma(25;0.08)|all_neural(26;0.181)		949					A8K1A8|Q8IZ61	Silent	SNP	ENST00000381227.1	37	c.2847T>C	CCDS3511.1																																																																																				0.333	POLR2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250692.1	NM_000938		49	99	0	0	0	0.01441	0	49	99				
UGT8	7368	broad.mit.edu	37	4	115544374	115544374	+	Missense_Mutation	SNP	A	A	T			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr4:115544374A>T	ENST00000310836.6	+	2	860	c.338A>T	c.(337-339)aAc>aTc	p.N113I	UGT8_ENST00000394511.3_Missense_Mutation_p.N113I	NM_001128174.1	NP_001121646	Q16880	CGT_HUMAN	UDP glycosyltransferase 8	113					axon cargo transport (GO:0008088)|central nervous system development (GO:0007417)|cytoskeleton organization (GO:0007010)|galactosylceramide biosynthetic process (GO:0006682)|neuron projection morphogenesis (GO:0048812)|paranodal junction assembly (GO:0030913)|peripheral nervous system development (GO:0007422)|protein localization to paranode region of axon (GO:0002175)	integral component of membrane (GO:0016021)	2-hydroxyacylsphingosine 1-beta-galactosyltransferase activity (GO:0003851)|UDP-galactose:glucosylceramide beta-1,4-galactosyltransferase activity (GO:0008489)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(11)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	31		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000632)		TATACTAAGAACTGTGACCTG	0.448																																							uc003ibs.2		NA																	0				ovary(1)|skin(1)	2						c.(337-339)AAC>ATC		UDP-galactose-ceramide galactosyltransferase 8							150.0	149.0	150.0					4																	115544374		2203	4300	6503	SO:0001583	missense	7368				central nervous system development|peripheral nervous system development	integral to membrane	2-hydroxyacylsphingosine 1-beta-galactosyltransferase activity|UDP-galactose:glucosylceramide beta-1,4-galactosyltransferase activity	g.chr4:115544374A>T	AK127970	CCDS3705.1	4q26	2013-02-21	2008-07-31	2005-07-20	ENSG00000174607	ENSG00000174607	2.4.1.45	"""UDP glucuronosyltransferases"""	12555	protein-coding gene	gene with protein product	"""2-hydroxyacylsphingosine 1-beta-galactosyltransferase"""	601291	"""UDP-galactose ceramide galactosyltransferase"""	CGT		8661025	Standard	NM_003360		Approved		uc003ibs.2	Q16880	OTTHUMG00000132915	ENST00000310836.6:c.338A>T	4.37:g.115544374A>T	ENSP00000311648:p.Asn113Ile		Somatic				UGT8_uc003ibt.2_Missense_Mutation_p.N113I|UGT8_uc011cge.1_RNA	p.N113I	NM_001128174	NP_001121646	WXS	Illumina HiSeq	Unspecified	Q16880	CGT_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000632)	2	860	+		Ovarian(17;0.156)	113					B3KXU7|O00196	Missense_Mutation	SNP	ENST00000310836.6	37	c.338A>T	CCDS3705.1	.	.	.	.	.	.	.	.	.	.	A	23.7	4.442132	0.83993	.	.	ENSG00000174607	ENST00000310836;ENST00000507710;ENST00000394511	T;T;T	0.58940	0.3;0.3;0.3	5.2	5.2	0.72013	.	0.239889	0.43579	D	0.000541	T	0.44582	0.1300	N	0.25201	0.72	0.80722	D	1	B	0.11235	0.004	B	0.19946	0.027	T	0.30909	-0.9962	10	0.21540	T	0.41	.	15.3418	0.74303	1.0:0.0:0.0:0.0	.	113	Q16880	CGT_HUMAN	I	113	ENSP00000311648:N113I;ENSP00000421446:N113I;ENSP00000378019:N113I	ENSP00000311648:N113I	N	+	2	0	UGT8	115763823	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.083000	0.94067	2.093000	0.63338	0.528000	0.53228	AAC		0.448	UGT8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256426.2	NM_003360		4	157	0	0	0	0.009096	0	4	157				
DNAH5	1767	broad.mit.edu	37	5	13776694	13776694	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr5:13776694C>A	ENST00000265104.4	-	55	9331	c.9227G>T	c.(9226-9228)aGt>aTt	p.S3076I		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	3076	AAA 4. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.S3076I(1)		NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					TCGGACCCGACTCATGAAGTA	0.463									Kartagener syndrome																														uc003jfd.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31						c.(9226-9228)AGT>ATT		dynein, axonemal, heavy chain 5							115.0	105.0	108.0					5																	13776694		2203	4300	6503	SO:0001583	missense	1767	Kartagener_syndrome	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr5:13776694C>A	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.9227G>T	5.37:g.13776694C>A	ENSP00000265104:p.Ser3076Ile		Somatic					p.S3076I	NM_001369	NP_001360	WXS	Illumina HiSeq	Unspecified	Q8TE73	DYH5_HUMAN			55	9269	-	Lung NSC(4;0.00476)		3076			AAA 4 (By similarity).		Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	37	c.9227G>T	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.391097	0.82902	.	.	ENSG00000039139	ENST00000265104	T	0.44083	0.93	5.79	5.79	0.91817	Dynein heavy chain, P-loop containing D4 domain (1);	0.203898	0.50627	D	0.000109	T	0.65749	0.2721	M	0.89601	3.045	0.51233	D	0.999912	P	0.48764	0.915	P	0.55667	0.781	T	0.72030	-0.4413	10	0.66056	D	0.02	.	14.4456	0.67347	0.0:0.7388:0.2612:0.0	.	3076	Q8TE73	DYH5_HUMAN	I	3076	ENSP00000265104:S3076I	ENSP00000265104:S3076I	S	-	2	0	DNAH5	13829694	1.000000	0.71417	0.994000	0.49952	0.989000	0.77384	3.543000	0.53633	2.726000	0.93360	0.655000	0.94253	AGT		0.463	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369		31	129	1	0	5.90632e-09	0.012213	7.08047e-09	31	129				
FBXL7	23194	broad.mit.edu	37	5	15928521	15928521	+	Missense_Mutation	SNP	T	T	G			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr5:15928521T>G	ENST00000504595.1	+	3	1131	c.650T>G	c.(649-651)cTg>cGg	p.L217R	FBXL7_ENST00000329673.7_Missense_Mutation_p.L205R|FBXL7_ENST00000510662.1_Missense_Mutation_p.L170R	NM_001278317.1|NM_012304.3	NP_001265246.1|NP_036436.1	Q9UJT9	FBXL7_HUMAN	F-box and leucine-rich repeat protein 7	217					cell proliferation (GO:0008283)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|ubiquitin-dependent protein catabolic process (GO:0006511)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)	p.L217R(1)		cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(13)|lung(33)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	60						CTGAGGCGACTGGAAGTCTCA	0.562																																							uc003jfn.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|lung(1)	3						c.(649-651)CTG>CGG		F-box and leucine-rich repeat protein 7							82.0	81.0	81.0					5																	15928521		2057	4194	6251	SO:0001583	missense	23194				ubiquitin-dependent protein catabolic process	ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity	g.chr5:15928521T>G	AB020647	CCDS54833.1, CCDS64129.1	5p15.1	2011-06-09				ENSG00000183580		"""F-boxes / Leucine-rich repeats"""	13604	protein-coding gene	gene with protein product		605656				10048485, 10531035	Standard	NM_012304		Approved	KIAA0840, FBL7, FBL6	uc003jfn.1	Q9UJT9		ENST00000504595.1:c.650T>G	5.37:g.15928521T>G	ENSP00000423630:p.Leu217Arg		Somatic					p.L217R	NM_012304	NP_036436	WXS	Illumina HiSeq	Unspecified	Q9UJT9	FBXL7_HUMAN			3	1131	+			217			LRR 2.		B9EGF1|D6RDY7|O94926	Missense_Mutation	SNP	ENST00000504595.1	37	c.650T>G	CCDS54833.1	.	.	.	.	.	.	.	.	.	.	T	22.0	4.232344	0.79688	.	.	ENSG00000183580	ENST00000504595;ENST00000510662;ENST00000329673	T;T;T	0.78924	-1.22;-1.22;-1.22	5.14	5.14	0.70334	.	0.000000	0.85682	D	0.000000	D	0.91002	0.7170	H	0.94385	3.53	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	D	0.93506	0.6849	10	0.87932	D	0	.	14.9504	0.71067	0.0:0.0:0.0:1.0	.	217	Q9UJT9	FBXL7_HUMAN	R	217;170;205	ENSP00000423630:L217R;ENSP00000425184:L170R;ENSP00000329632:L205R	ENSP00000329632:L205R	L	+	2	0	FBXL7	15981521	1.000000	0.71417	0.976000	0.42696	0.989000	0.77384	8.040000	0.89188	1.944000	0.56390	0.459000	0.35465	CTG		0.562	FBXL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366117.1	NM_012304		22	87	0	0	0	0.004656	0	22	87				
MEGF10	84466	broad.mit.edu	37	5	126676236	126676236	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr5:126676236C>A	ENST00000274473.6	+	5	500	c.233C>A	c.(232-234)aCa>aAa	p.T78K	MEGF10_ENST00000418761.2_Missense_Mutation_p.T78K|MEGF10_ENST00000508365.1_Missense_Mutation_p.T78K|MEGF10_ENST00000503335.2_Missense_Mutation_p.T78K	NM_032446.2	NP_115822.1	Q96KG7	MEG10_HUMAN	multiple EGF-like-domains 10	78	EMI. {ECO:0000255|PROSITE- ProRule:PRU00384}.|Necessary for interaction with AP2M1, self-assembly and formation of the irregular, mosaic-like adhesion pattern.				homotypic cell-cell adhesion (GO:0034109)|muscle cell development (GO:0055001)|recognition of apoptotic cell (GO:0043654)|regulation of muscle cell differentiation (GO:0051147)|regulation of skeletal muscle tissue development (GO:0048641)|skeletal muscle satellite cell activation (GO:0014719)|skeletal muscle satellite cell differentiation (GO:0014816)|skeletal muscle satellite cell proliferation (GO:0014841)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)		p.T78K(1)		breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(28)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	68		Prostate(80;0.165)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0657)|Epithelial(69;0.123)		AGCTATCGGACAGCCTATCGA	0.373																																							uc003kuh.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)	4						c.(232-234)ACA>AAA		multiple EGF-like-domains 10 precursor							165.0	154.0	158.0					5																	126676236		2203	4300	6503	SO:0001583	missense	84466				cell adhesion|phagocytosis	basolateral plasma membrane|cell projection|integral to membrane|phagocytic cup		g.chr5:126676236C>A	AK021631	CCDS4142.1	5q33	2008-02-05			ENSG00000145794	ENSG00000145794			29634	protein-coding gene	gene with protein product		612453				11347906	Standard	NM_032446		Approved	KIAA1780	uc003kui.4	Q96KG7	OTTHUMG00000128984	ENST00000274473.6:c.233C>A	5.37:g.126676236C>A	ENSP00000274473:p.Thr78Lys		Somatic				MEGF10_uc010jdc.1_Missense_Mutation_p.T78K|MEGF10_uc010jdd.1_Missense_Mutation_p.T78K|MEGF10_uc003kui.3_Missense_Mutation_p.T78K	p.T78K	NM_032446	NP_115822	WXS	Illumina HiSeq	Unspecified	Q96KG7	MEG10_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0657)|Epithelial(69;0.123)	5	595	+		Prostate(80;0.165)	78			Extracellular (Potential).|Necessary for interaction with AP2M1, self-assembly and formation of the irregular, mosaic-like adhesion pattern.|EMI.		Q68DE5|Q8WUL3	Missense_Mutation	SNP	ENST00000274473.6	37	c.233C>A	CCDS4142.1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.335249	0.81801	.	.	ENSG00000145794	ENST00000503335;ENST00000508365;ENST00000418761;ENST00000274473	T;T;T;T	0.80994	-1.44;2.86;2.86;-1.44	5.3	5.3	0.74995	EMI domain (1);	0.069940	0.56097	D	0.000036	D	0.88952	0.6577	M	0.71206	2.165	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.79784	0.986;0.993	D	0.88060	0.2793	10	0.42905	T	0.14	-10.9641	18.1017	0.89508	0.0:1.0:0.0:0.0	.	78;78	Q96KG7-2;Q96KG7	.;MEG10_HUMAN	K	78	ENSP00000423354:T78K;ENSP00000423195:T78K;ENSP00000416284:T78K;ENSP00000274473:T78K	ENSP00000274473:T78K	T	+	2	0	MEGF10	126704135	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	5.902000	0.69869	2.648000	0.89879	0.650000	0.86243	ACA		0.373	MEGF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250973.2	NM_032446		12	72	1	0	2.27111e-07	0.013537	2.64299e-07	12	72				
PCDHA7	56141	broad.mit.edu	37	5	140214302	140214302	+	Missense_Mutation	SNP	A	A	T			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr5:140214302A>T	ENST00000525929.1	+	1	334	c.334A>T	c.(334-336)Agg>Tgg	p.R112W	PCDHA7_ENST00000378125.3_Missense_Mutation_p.R112W|PCDHA2_ENST00000526136.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA5_ENST00000529859.1_Intron	NM_018910.2	NP_061733.1	Q9UN72	PCDA7_HUMAN	protocadherin alpha 7	112	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.R112W(2)		NS(2)|biliary_tract(1)|breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(27)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GATCGTGGAAAGGCCGCTGCA	0.562																																					NSCLC(160;258 2013 5070 22440 28951)	NSCLC(160;258 2013 5070 22440 28951)	uc003lhq.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|skin(2)	4						c.(334-336)AGG>TGG		protocadherin alpha 7 isoform 1 precursor							148.0	176.0	166.0					5																	140214302		2203	4300	6503	SO:0001583	missense	56141				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding	g.chr5:140214302A>T	AF152485	CCDS54918.1	5q31	2010-11-26				ENSG00000204963		"""Cadherins / Protocadherins : Clustered"""	8673	other	complex locus constituent	"""KIAA0345-like 7"", ""ortholog to mouse CNR4"""	606313		CNRS4		10380929, 10662547	Standard	NM_018910		Approved	CNR4, CRNR4		Q9UN72		ENST00000525929.1:c.334A>T	5.37:g.140214302A>T	ENSP00000436426:p.Arg112Trp		Somatic				PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc011dac.1_Missense_Mutation_p.R112W	p.R112W	NM_018910	NP_061733	WXS	Illumina HiSeq	Unspecified	Q9UN72	PCDA7_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	334	+			112			Cadherin 1.|Extracellular (Potential).		O75282	Missense_Mutation	SNP	ENST00000525929.1	37	c.334A>T	CCDS54918.1	.	.	.	.	.	.	.	.	.	.	A	16.73	3.204448	0.58234	.	.	ENSG00000204963	ENST00000525929;ENST00000378125	T;T	0.53640	0.61;0.63	3.99	-2.78	0.05859	Cadherin (3);Cadherin-like (1);	3.925160	0.03093	U	0.160087	T	0.69052	0.3068	M	0.71581	2.175	0.09310	N	1	D;D	0.71674	0.995;0.998	D;D	0.70935	0.971;0.955	T	0.67110	-0.5753	10	0.87932	D	0	.	15.8086	0.78538	0.3383:0.6617:0.0:0.0	.	112;112	Q9UN72-2;Q9UN72	.;PCDA7_HUMAN	W	112	ENSP00000436426:R112W;ENSP00000367365:R112W	ENSP00000367365:R112W	R	+	1	2	PCDHA7	140194486	0.000000	0.05858	0.416000	0.26546	0.919000	0.55068	-0.230000	0.09083	-0.746000	0.04766	0.369000	0.22263	AGG		0.562	PCDHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372887.2	NM_018910		36	363	0	0	0	0.009718	0	36	363				
FBXO38	81545	broad.mit.edu	37	5	147782066	147782066	+	Silent	SNP	A	A	G			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr5:147782066A>G	ENST00000340253.5	+	5	750	c.582A>G	c.(580-582)ttA>ttG	p.L194L	FBXO38_ENST00000509699.2_3'UTR|FBXO38_ENST00000513826.1_Silent_p.L194L|FBXO38_ENST00000296701.6_Silent_p.L194L|FBXO38_ENST00000394370.3_Silent_p.L194L			Q6PIJ6	FBX38_HUMAN	F-box protein 38	194					cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.L194L(1)	ATG4C/FBXO38(2)	NS(1)|breast(2)|endometrium(7)|kidney(5)|large_intestine(9)|lung(15)|ovary(5)|prostate(2)|skin(2)|stomach(2)|urinary_tract(1)	51			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTCAAACTTTACATTTAGTTG	0.318																																							uc003lpf.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|skin(2)	6						c.(580-582)TTA>TTG		F-box protein 38 isoform b							73.0	75.0	74.0					5																	147782066		2203	4300	6503	SO:0001819	synonymous_variant	81545					cytoplasm|nucleus		g.chr5:147782066A>G	BC005873	CCDS43384.1, CCDS64285.1	5q33.1	2008-02-05			ENSG00000145868	ENSG00000145868		"""F-boxes /  ""other"""""	28844	protein-coding gene	gene with protein product		608533				12477932	Standard	NM_030793		Approved	MOKA, SP329, FLJ13962, Fbx38	uc003lpg.2	Q6PIJ6	OTTHUMG00000129929	ENST00000340253.5:c.582A>G	5.37:g.147782066A>G			Somatic				FBXO38_uc003lpg.1_Silent_p.L194L|FBXO38_uc003lph.2_Silent_p.L194L	p.L194L	NM_205836	NP_995308	WXS	Illumina HiSeq	Unspecified	Q6PIJ6	FBX38_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		5	702	+			194					Q6PK72|Q7Z2U0|Q86VN3|Q9BXY6|Q9H837|Q9HC40	Silent	SNP	ENST00000340253.5	37	c.582A>G																																																																																					0.318	FBXO38-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000252185.2	NM_030793		28	55	0	0	0	0.007291	0	28	55				
RANBP17	64901	broad.mit.edu	37	5	170319516	170319516	+	Missense_Mutation	SNP	G	G	A			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr5:170319516G>A	ENST00000523189.1	+	4	546	c.382G>A	c.(382-384)Gtc>Atc	p.V128I		NM_022897.3	NP_075048.1	Q9H2T7	RBP17_HUMAN	RAN binding protein 17	128					mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|nuclear pore (GO:0005643)	GTP binding (GO:0005525)	p.V128I(1)		breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(25)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	50	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			AGACCAATTTGTCTTCAGAGA	0.388			T	TRD@	ALL																																		uc003mba.2		NA		Dom	yes		5	5q34	64901	T	RAN binding protein 17			L	TRD@		ALL		1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(382-384)GTC>ATC		RAN binding protein 17							182.0	176.0	178.0					5																	170319516		2203	4300	6503	SO:0001583	missense	64901				mRNA transport|protein import into nucleus|transmembrane transport	cytoplasm|nuclear pore	GTP binding|protein transporter activity	g.chr5:170319516G>A	AF222747	CCDS34287.1	5q34	2009-01-12			ENSG00000204764	ENSG00000204764			14428	protein-coding gene	gene with protein product		606141				11024021	Standard	NM_022897		Approved		uc003mba.3	Q9H2T7	OTTHUMG00000163203	ENST00000523189.1:c.382G>A	5.37:g.170319516G>A	ENSP00000427975:p.Val128Ile		Somatic				RANBP17_uc003max.1_RNA|RANBP17_uc003may.1_RNA|RANBP17_uc003maz.1_RNA|RANBP17_uc010jjr.1_RNA|RANBP17_uc003maw.2_Missense_Mutation_p.V128I|RANBP17_uc011dew.1_Missense_Mutation_p.V128I	p.V128I	NM_022897	NP_075048	WXS	Illumina HiSeq	Unspecified	Q9H2T7	RBP17_HUMAN	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)		4	398	+	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	128					Q8IU74	Missense_Mutation	SNP	ENST00000523189.1	37	c.382G>A	CCDS34287.1	.	.	.	.	.	.	.	.	.	.	G	11.79	1.743918	0.30865	.	.	ENSG00000204764	ENST00000523189;ENST00000545246	T	0.43688	0.94	5.78	1.04	0.20106	Armadillo-type fold (1);	0.944931	0.08844	N	0.885403	T	0.33469	0.0864	L	0.47016	1.485	0.35544	D	0.803309	B;B	0.06786	0.0;0.001	B;B	0.09377	0.003;0.004	T	0.32824	-0.9892	10	0.13108	T	0.6	-2.7595	9.9837	0.41828	0.4074:0.0:0.5926:0.0	.	128;178	Q9H2T7;B4DQG2	RBP17_HUMAN;.	I	128;46	ENSP00000427975:V128I	ENSP00000373770:V128I	V	+	1	0	RANBP17	170252094	1.000000	0.71417	0.998000	0.56505	0.496000	0.33645	1.163000	0.31798	0.104000	0.17725	-0.258000	0.10820	GTC		0.388	RANBP17-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000372036.1	NM_022897		61	156	0	0	0	0.01441	0	61	156				
SCGN	10590	broad.mit.edu	37	6	25665258	25665258	+	Missense_Mutation	SNP	C	C	G			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr6:25665258C>G	ENST00000377961.2	+	4	502	c.334C>G	c.(334-336)Cag>Gag	p.Q112E	SCGN_ENST00000334979.6_3'UTR	NM_006998.3	NP_008929.2	O76038	SEGN_HUMAN	secretagogin, EF-hand calcium binding protein	112	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.					cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)	p.Q112E(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	24						GGAGTTTATGCAGGTGAGTGC	0.512																																							uc003nfb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|pancreas(1)	3						c.(334-336)CAG>GAG		secretagogin precursor							110.0	100.0	103.0					6																	25665258		2203	4300	6503	SO:0001583	missense	10590					extracellular region|transport vesicle membrane	calcium ion binding	g.chr6:25665258C>G	BC000336	CCDS4561.1	6p22.3-p22.1	2013-01-10			ENSG00000079689	ENSG00000079689		"""EF-hand domain containing"""	16941	protein-coding gene	gene with protein product	"""calbindin-like"""	609202				10811645	Standard	NM_006998		Approved	SECRET, DJ501N12.8, SEGN, CALBL	uc003nfb.3	O76038	OTTHUMG00000014409	ENST00000377961.2:c.334C>G	6.37:g.25665258C>G	ENSP00000367197:p.Gln112Glu		Somatic				SCGN_uc010jpz.2_Missense_Mutation_p.C21W	p.Q112E	NM_006998	NP_008929	WXS	Illumina HiSeq	Unspecified	O76038	SEGN_HUMAN			4	537	+			112			EF-hand 3.		A8K0B2|Q5VV44|Q96QV7|Q9UJF6	Missense_Mutation	SNP	ENST00000377961.2	37	c.334C>G	CCDS4561.1	.	.	.	.	.	.	.	.	.	.	C	5.395	0.258010	0.10239	.	.	ENSG00000079689	ENST00000377961	T	0.69040	-0.37	5.09	5.09	0.68999	EF-hand-like domain (1);	0.193536	0.50627	D	0.000120	T	0.24736	0.0600	N	0.04805	-0.155	0.80722	D	1	B	0.14805	0.011	B	0.10450	0.005	T	0.33369	-0.9871	10	0.02654	T	1	.	17.2839	0.87136	0.0:1.0:0.0:0.0	.	112	O76038	SEGN_HUMAN	E	112	ENSP00000367197:Q112E	ENSP00000367197:Q112E	Q	+	1	0	SCGN	25773237	1.000000	0.71417	1.000000	0.80357	0.185000	0.23345	2.775000	0.47702	2.343000	0.79666	0.585000	0.79938	CAG		0.512	SCGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040067.1			11	80	0	0	0	0.008291	0	11	80				
BAG6	7917	broad.mit.edu	37	6	31612875	31612875	+	Missense_Mutation	SNP	G	G	C			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr6:31612875G>C	ENST00000375964.6	-	10	1548	c.1235C>G	c.(1234-1236)tCc>tGc	p.S412C	BAG6_ENST00000439687.2_Missense_Mutation_p.S406C|BAG6_ENST00000211379.5_Missense_Mutation_p.S406C|BAG6_ENST00000404765.2_Missense_Mutation_p.S406C|BAG6_ENST00000362049.6_Missense_Mutation_p.S406C|BAG6_ENST00000375976.4_Missense_Mutation_p.S406C|BAG6_ENST00000470875.1_5'Flank	NM_004639.3|NM_080703.2	NP_004630.3|NP_542434.1	P46379	BAG6_HUMAN	BCL2-associated athanogene 6	412	4 X 29 AA approximate repeats.|Pro-rich.				brain development (GO:0007420)|cell differentiation (GO:0030154)|chromatin modification (GO:0016568)|embryo development (GO:0009790)|immune system process (GO:0002376)|internal peptidyl-lysine acetylation (GO:0018393)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|kidney development (GO:0001822)|lung development (GO:0030324)|negative regulation of apoptotic process (GO:0043066)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|negative regulation of proteolysis (GO:0045861)|protein stabilization (GO:0050821)|regulation of cell proliferation (GO:0042127)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)|tail-anchored membrane protein insertion into ER membrane (GO:0071816)|transport (GO:0006810)|ubiquitin-dependent protein catabolic process (GO:0006511)	BAT3 complex (GO:0071818)|cytosol (GO:0005829)|nucleus (GO:0005634)	polyubiquitin binding (GO:0031593)|proteasome binding (GO:0070628)|ribosome binding (GO:0043022)|ubiquitin protein ligase binding (GO:0031625)	p.S406C(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(18)|ovary(2)|pancreas(2)|skin(3)|urinary_tract(2)	36						CGGAGCCACGGATGAGGCCTG	0.657																																							uc003nvg.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1234-1236)TCC>TGC		HLA-B associated transcript-3 isoform a							70.0	87.0	81.0					6																	31612875		1510	2708	4218	SO:0001583	missense	7917				apoptosis in response to endoplasmic reticulum stress|brain development|cell differentiation|chromatin modification|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|embryo development|internal peptidyl-lysine acetylation|kidney development|lung development|negative regulation of proteasomal ubiquitin-dependent protein catabolic process|protein stabilization|spermatogenesis|synaptonemal complex assembly|tail-anchored membrane protein insertion into ER membrane|transport|ubiquitin-dependent protein catabolic process	BAT3 complex|nucleus	polyubiquitin binding|proteasome binding|ribosome binding	g.chr6:31612875G>C	M31294	CCDS4709.1, CCDS47403.1, CCDS56414.1, CCDS56415.1	6p21.3	2011-06-14	2010-12-09	2010-12-09	ENSG00000204463	ENSG00000204463			13919	protein-coding gene	gene with protein product		142590	"""HLA-B associated transcript 3"""	BAT3		2156268	Standard	NM_004639		Approved	G3, D6S52E	uc003nvf.4	P46379	OTTHUMG00000031171	ENST00000375964.6:c.1235C>G	6.37:g.31612875G>C	ENSP00000365131:p.Ser412Cys		Somatic				BAT3_uc003nvf.3_Missense_Mutation_p.S406C|BAT3_uc003nvh.3_Missense_Mutation_p.S406C|BAT3_uc003nvi.3_Missense_Mutation_p.S406C|BAT3_uc011dnw.1_Missense_Mutation_p.S406C|BAT3_uc011dnx.1_Missense_Mutation_p.S406C|BAT3_uc003nvj.1_Missense_Mutation_p.S406C	p.S412C	NM_004639	NP_004630	WXS	Illumina HiSeq	Unspecified	P46379	BAG6_HUMAN			10	1549	-			412			Pro-rich.|4 X 29 AA approximate repeats.		A2ADJ7|A3KQ42|A3KQ44|A6NGY6|A6PWF7|B0UX84|B4DZ12|B4E3V4|E7EMZ4|F8VXY4|O95874|Q5HYL9|Q5SQ35|Q5SQ36|Q5SQ37|Q5SQ41|Q5SRP8|Q5SRP9|Q5STC1|Q5STX1|Q5STX3|Q96SA6|Q9BCN4	Missense_Mutation	SNP	ENST00000375964.6	37	c.1235C>G	CCDS47403.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.05|12.05	1.822082|1.822082	0.32237|0.32237	.|.	.|.	ENSG00000204463|ENSG00000204463	ENST00000453833|ENST00000375976;ENST00000375964;ENST00000211379;ENST00000404765;ENST00000439687;ENST00000362049;ENST00000437771;ENST00000435080	.|T;T;T;T;T;T;T	.|0.49139	.|1.4;1.39;1.4;1.37;0.81;1.37;0.79	4.98|4.98	4.98|4.98	0.66077|0.66077	.|.	.|0.531636	.|0.19389	.|N	.|0.115443	T|T	0.28400|0.28400	0.0702|0.0702	N|N	0.14661|0.14661	0.345|0.345	0.09310|0.09310	N|N	1|1	.|P;D;P;P;P	.|0.54964	.|0.947;0.969;0.926;0.875;0.924	.|B;P;P;P;P	.|0.50192	.|0.339;0.54;0.599;0.533;0.634	T|T	0.20773|0.20773	-1.0265|-1.0265	5|10	.|0.66056	.|D	.|0.02	.|.	15.8115|15.8115	0.78568|0.78568	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|406;406;406;412;406	.|E7EMZ4;F8VXY4;B0UX85;P46379;P46379-2	.|.;.;.;BAG6_HUMAN;.	M|C	66|406;412;406;406;406;406;406;406	.|ENSP00000365143:S406C;ENSP00000365131:S412C;ENSP00000211379:S406C;ENSP00000384494:S406C;ENSP00000402856:S406C;ENSP00000354875:S406C;ENSP00000397978:S406C	.|ENSP00000211379:S406C	I|S	-|-	3|2	3|0	BAG6|BAG6	31720854|31720854	1.000000|1.000000	0.71417|0.71417	0.160000|0.160000	0.22671|0.22671	0.435000|0.435000	0.31806|0.31806	7.339000|7.339000	0.79282|0.79282	2.298000|2.298000	0.77334|0.77334	0.645000|0.645000	0.84053|0.84053	ATC|TCC		0.657	BAG6-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_080703		17	144	0	0	0	0.008871	0	17	144				
PNISR	25957	broad.mit.edu	37	6	99848691	99848691	+	Nonsense_Mutation	SNP	G	G	A			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr6:99848691G>A	ENST00000369239.5	-	12	2347	c.2143C>T	c.(2143-2145)Cga>Tga	p.R715*	PNISR_ENST00000438806.1_Nonsense_Mutation_p.R715*	NM_032870.2	NP_116259.2	Q8TF01	PNISR_HUMAN	PNN-interacting serine/arginine-rich protein	715						cytoplasm (GO:0005737)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.R715*(1)		breast(2)|cervix(1)|endometrium(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24						TCACTTTCTCGTTTCCTTTTT	0.318																																							uc003ppo.3		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(2143-2145)CGA>TGA		splicing factor, arginine/serine-rich 130							97.0	95.0	95.0					6																	99848691		2203	4298	6501	SO:0001587	stop_gained	25957					nuclear speck		g.chr6:99848691G>A	AK027759	CCDS5043.1	6q16.3	2011-06-06	2011-06-06	2011-06-06	ENSG00000132424	ENSG00000132424			21222	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 111"", ""splicing factor, arginine/serine-rich 18"""	C6orf111, SFRS18		14578391	Standard	NM_032870		Approved	FLJ14752, bA98I9.2, DKFZp564B0769, SRrp130	uc021zdd.1	Q8TF01	OTTHUMG00000015262	ENST00000369239.5:c.2143C>T	6.37:g.99848691G>A	ENSP00000358242:p.Arg715*		Somatic				SFRS18_uc003ppl.2_Nonsense_Mutation_p.R261*|SFRS18_uc003ppp.3_Nonsense_Mutation_p.R715*|SFRS18_uc011eag.1_Nonsense_Mutation_p.R715*	p.R715*	NM_032870	NP_116259	WXS	Illumina HiSeq	Unspecified	Q8TF01	PNISR_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0631)	12	2371	-		all_cancers(76;1.24e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.00716)|Colorectal(196;0.0691)|Lung NSC(302;0.186)	715					A8K540|E1P5D2|Q5T064|Q5T065|Q6P2B4|Q6P2N4|Q6PJ93|Q6PK36|Q7Z640|Q8N2L1|Q8TF00|Q96K10|Q96SI3|Q96SM5|Q9P076|Q9P0C0|Q9Y4N3	Nonsense_Mutation	SNP	ENST00000369239.5	37	c.2143C>T	CCDS5043.1	.	.	.	.	.	.	.	.	.	.	G	37	6.491463	0.97612	.	.	ENSG00000132424	ENST00000369239;ENST00000438806	.	.	.	5.72	2.58	0.30949	.	0.058417	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.4751	0.61303	0.0:0.0:0.3076:0.6924	.	.	.	.	X	715	.	ENSP00000358242:R715X	R	-	1	2	PNISR	99955412	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.391000	0.52530	0.724000	0.32296	0.549000	0.68633	CGA		0.318	PNISR-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041598.1	NM_032870		6	59	0	0	0	0.001984	0	6	59				
TAGAP	117289	broad.mit.edu	37	6	159464670	159464670	+	Missense_Mutation	SNP	A	A	T	rs375593539		TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr6:159464670A>T	ENST00000367066.3	-	4	430	c.99T>A	c.(97-99)caT>caA	p.H33Q	TAGAP_ENST00000326965.6_5'UTR|RP1-111C20.4_ENST00000606466.1_RNA|RP1-111C20.4_ENST00000607796.1_RNA|RP1-111C20.4_ENST00000607391.1_RNA|RP1-111C20.4_ENST00000606470.1_RNA|TAGAP_ENST00000338313.5_Missense_Mutation_p.H33Q	NM_001278733.1|NM_054114.3	NP_001265662.1|NP_473455.2	Q8N103	TAGAP_HUMAN	T-cell activation RhoGTPase activating protein	33					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)	p.H33Q(1)		NS(1)|autonomic_ganglia(1)|endometrium(3)|large_intestine(8)|lung(7)|ovary(2)|skin(1)	23		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.16e-16)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)		CCAACAGGGGATGTTCCTTGA	0.373																																							uc003qrz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(97-99)CAT>CAA		T-cell activation Rho GTPase-activating protein							183.0	187.0	186.0					6																	159464670		2203	4300	6503	SO:0001583	missense	117289				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|guanyl-nucleotide exchange factor activity	g.chr6:159464670A>T	AF385429	CCDS5261.1, CCDS5262.1, CCDS5263.1	6q25.3	2011-09-07	2008-03-25		ENSG00000164691	ENSG00000164691		"""Rho GTPase activating proteins"""	15669	protein-coding gene	gene with protein product		609667	"""T-cell activation GTPase activating protein"""			16375659, 18311140, 18356936	Standard	NM_152133		Approved	FLJ32631, IDDM21, ARHGAP47	uc003qrz.3	Q8N103	OTTHUMG00000015923	ENST00000367066.3:c.99T>A	6.37:g.159464670A>T	ENSP00000356033:p.His33Gln		Somatic				TAGAP_uc011eft.1_5'Flank|TAGAP_uc003qsa.2_5'UTR|TAGAP_uc003qsb.2_Missense_Mutation_p.H33Q|uc003qsc.2_Intron	p.H33Q	NM_054114	NP_473455	WXS	Illumina HiSeq	Unspecified	Q8N103	TAGAP_HUMAN		OV - Ovarian serous cystadenocarcinoma(65;2.16e-16)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)	4	431	-		Breast(66;0.000776)|Ovarian(120;0.0303)	33					Q2NKM8|Q8NI40|Q96KZ2|Q96QA2	Missense_Mutation	SNP	ENST00000367066.3	37	c.99T>A	CCDS5261.1	.	.	.	.	.	.	.	.	.	.	A	11.68	1.710273	0.30322	.	.	ENSG00000164691	ENST00000367066;ENST00000338313	T;T	0.20069	2.25;2.1	5.52	-6.03	0.02185	.	0.772672	0.12268	N	0.484085	T	0.04543	0.0124	L	0.27053	0.805	0.09310	N	1	P;P	0.51653	0.478;0.947	B;B	0.41374	0.178;0.355	T	0.13255	-1.0516	10	0.29301	T	0.29	-3.7463	13.3212	0.60434	0.1443:0.1174:0.7383:0.0	.	33;33	Q8N103-4;Q8N103	.;TAGAP_HUMAN	Q	33	ENSP00000356033:H33Q;ENSP00000340217:H33Q	ENSP00000340217:H33Q	H	-	3	2	TAGAP	159384658	0.903000	0.30736	0.008000	0.14137	0.982000	0.71751	0.060000	0.14342	-1.155000	0.02822	-0.256000	0.11100	CAT		0.373	TAGAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042890.1	NM_054114		9	339	0	0	0	0.004482	0	9	339				
MRPL18	29074	broad.mit.edu	37	6	160218467	160218467	+	Nonsense_Mutation	SNP	C	C	T			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr6:160218467C>T	ENST00000367034.4	+	3	510	c.388C>T	c.(388-390)Cga>Tga	p.R130*	PNLDC1_ENST00000610273.1_5'Flank|MRPL18_ENST00000480842.1_3'UTR|PNLDC1_ENST00000392167.3_5'Flank	NM_014161.3	NP_054880.2	Q9H0U6	RM18_HUMAN	mitochondrial ribosomal protein L18	130					rRNA import into mitochondrion (GO:0035928)|translation (GO:0006412)	extracellular space (GO:0005615)|mitochondrial ribosome (GO:0005761)|mitochondrion (GO:0005739)	5S rRNA binding (GO:0008097)|structural constituent of ribosome (GO:0003735)	p.R130*(1)		cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(4)	11		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.44e-18)|BRCA - Breast invasive adenocarcinoma(81;5.79e-06)		GAGTATAGGACGAGTGCTGGC	0.493																																							uc003qsw.3		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(388-390)CGA>TGA		mitochondrial ribosomal protein L18 precursor							107.0	101.0	103.0					6																	160218467		2203	4300	6503	SO:0001587	stop_gained	29074				rRNA transport|translation	mitochondrial ribosome	5S rRNA binding|structural constituent of ribosome	g.chr6:160218467C>T	AF161556	CCDS5270.1	6q25.3	2012-09-13			ENSG00000112110	ENSG00000112110		"""Mitochondrial ribosomal proteins / large subunits"""	14477	protein-coding gene	gene with protein product		611831				11042152, 11551941	Standard	NM_014161		Approved	HSPC071	uc003qsw.4	Q9H0U6	OTTHUMG00000015942	ENST00000367034.4:c.388C>T	6.37:g.160218467C>T	ENSP00000356001:p.Arg130*		Somatic				MRPL18_uc010kkb.2_RNA|PNLDC1_uc003qsx.1_5'Flank|PNLDC1_uc003qsy.1_5'Flank	p.R130*	NM_014161	NP_054880	WXS	Illumina HiSeq	Unspecified	Q9H0U6	RM18_HUMAN		OV - Ovarian serous cystadenocarcinoma(65;1.44e-18)|BRCA - Breast invasive adenocarcinoma(81;5.79e-06)	3	516	+		Breast(66;0.000776)|Ovarian(120;0.0303)	130					Q5TAP9|Q9NZW8	Nonsense_Mutation	SNP	ENST00000367034.4	37	c.388C>T	CCDS5270.1	.	.	.	.	.	.	.	.	.	.	C	17.04	3.288335	0.59976	.	.	ENSG00000112110	ENST00000367034	.	.	.	4.98	2.17	0.27698	.	0.214190	0.39475	N	0.001360	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-3.9862	15.1129	0.72372	0.319:0.681:0.0:0.0	.	.	.	.	X	130	.	ENSP00000356001:R130X	R	+	1	2	MRPL18	160138457	0.266000	0.24112	0.112000	0.21494	0.869000	0.49853	0.872000	0.28037	0.630000	0.30394	0.655000	0.94253	CGA		0.493	MRPL18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042925.1			20	74	0	0	0	0.003954	0	20	74				
SUN1	23353	broad.mit.edu	37	7	901102	901102	+	Splice_Site	SNP	G	G	A			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr7:901102G>A	ENST00000405266.1	+	16	1999		c.e16+1		SUN1_ENST00000389574.3_Splice_Site|SUN1_ENST00000456758.2_Splice_Site|SUN1_ENST00000413514.2_Splice_Site|SUN1_ENST00000425407.2_Splice_Site|SUN1_ENST00000452783.2_Splice_Site|SUN1_ENST00000401592.1_Splice_Site			O94901	SUN1_HUMAN	Sad1 and UNC84 domain containing 1						cytoskeletal anchoring at nuclear membrane (GO:0090286)|nuclear envelope organization (GO:0006998)|nuclear matrix anchoring at nuclear membrane (GO:0090292)	acrosomal membrane (GO:0002080)|integral component of nuclear inner membrane (GO:0005639)|nuclear envelope (GO:0005635)|SUN-KASH complex (GO:0034993)		p.?(2)		NS(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(17)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						GAATCTGGTGGTGAGTAAATA	0.507																																							uc011jvp.1		NA																	2	Unknown(2)		lung(2)		0						c.e16+1		unc-84 homolog A isoform a							141.0	146.0	145.0					7																	901102		2042	4172	6214	SO:0001630	splice_region_variant	23353				cytoskeletal anchoring at nuclear membrane|nuclear matrix anchoring at nuclear membrane	integral to membrane|nuclear inner membrane|SUN-KASH complex	protein binding	g.chr7:901102G>A	AF202724	CCDS43533.1, CCDS47525.1, CCDS55078.1, CCDS55079.1, CCDS55080.1	7p22.3	2010-01-27	2010-01-27	2010-01-27	ENSG00000164828	ENSG00000164828			18587	protein-coding gene	gene with protein product	"""Sad1 unc-84 domain protein 1"""	607723	"""unc-84 homolog A (C. elegans)"""	UNC84A		11593002	Standard	NM_001130965		Approved	KIAA0810, FLJ12407	uc021zym.1	O94901	OTTHUMG00000151426	ENST00000405266.1:c.1975+1G>A	7.37:g.901102G>A			Somatic				GET4_uc003sjj.1_Splice_Site|SUN1_uc003sjf.2_Splice_Site_p.G539_splice|SUN1_uc011jvq.1_Splice_Site_p.G519_splice|SUN1_uc003sjg.2_Splice_Site_p.G527_splice|SUN1_uc011jvr.1_Splice_Site_p.G420_splice|SUN1_uc003sji.2_Splice_Site_p.G460_splice|SUN1_uc003sjk.2_Splice_Site_p.G261_splice	p.G622_splice	NM_001130965	NP_001124437	WXS	Illumina HiSeq	Unspecified	O94901	SUN1_HUMAN			16	1943	+								A5PL20|B3KMV7|B4DZF7|B7WNY4|B7WP53|E9PDU4|E9PF23|F8WD13|Q96CZ7|Q9HA14|Q9UH98	Splice_Site	SNP	ENST00000405266.1	37	c.1864_splice		.	.	.	.	.	.	.	.	.	.	G	14.82	2.648465	0.47258	.	.	ENSG00000164828	ENST00000456758;ENST00000389574;ENST00000452783;ENST00000405266;ENST00000401592;ENST00000297445;ENST00000425407;ENST00000429178;ENST00000413514;ENST00000433212	.	.	.	5.2	5.2	0.72013	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.7114	0.91658	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SUN1	867628	1.000000	0.71417	0.796000	0.32109	0.654000	0.38779	9.048000	0.93830	2.414000	0.81942	0.563000	0.77884	.		0.507	SUN1-001	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000322566.1	NM_025154	Intron	62	80	0	0	0	0.01441	0	62	80				
DNAH11	8701	broad.mit.edu	37	7	21784217	21784217	+	Splice_Site	SNP	A	A	T			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr7:21784217A>T	ENST00000409508.3	+	50	8347	c.8316A>T	c.(8314-8316)gaA>gaT	p.E2772D	DNAH11_ENST00000328843.6_Splice_Site_p.E2779D	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	2779					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.E2779D(1)		NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						AATATTTTGAAGTAAGCGTAT	0.388									Kartagener syndrome																														uc003svc.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						c.(8335-8337)GAA>GAT		dynein, axonemal, heavy chain 11							54.0	53.0	54.0					7																	21784217		1872	4113	5985	SO:0001630	splice_region_variant	8701	Kartagener_syndrome	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr7:21784217A>T	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.8316+1A>T	7.37:g.21784217A>T			Somatic					p.E2779D	NM_003777	NP_003768	WXS	Illumina HiSeq	Unspecified	Q96DT5	DYH11_HUMAN			51	8368	+			2779					Q9UJ82	Missense_Mutation	SNP	ENST00000409508.3	37	c.8337A>T		.	.	.	.	.	.	.	.	.	.	A	10.89	1.479329	0.26511	.	.	ENSG00000105877	ENST00000328843	T	0.23950	1.88	5.91	4.57	0.56435	.	0.145681	0.64402	D	0.000009	T	0.14442	0.0349	.	.	.	0.48040	D	0.999572	B	0.28900	0.227	B	0.32022	0.139	T	0.09314	-1.0680	9	0.11182	T	0.66	.	8.0748	0.30710	0.859:0.0:0.141:0.0	.	2779	Q96DT5	DYH11_HUMAN	D	2779	ENSP00000330671:E2779D	ENSP00000330671:E2779D	E	+	3	2	DNAH11	21750742	1.000000	0.71417	1.000000	0.80357	0.840000	0.47671	0.834000	0.27518	2.254000	0.74563	0.533000	0.62120	GAA		0.388	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000326582.6	NM_003777	Missense_Mutation	11	92	0	0	0	0.008291	0	11	92				
VPS41	27072	broad.mit.edu	37	7	38791781	38791781	+	Missense_Mutation	SNP	C	C	T			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr7:38791781C>T	ENST00000310301.4	-	22	1975	c.1921G>A	c.(1921-1923)Gaa>Aaa	p.E641K	VPS41_ENST00000395969.2_Missense_Mutation_p.E616K	NM_014396.3	NP_055211.2	P49754	VPS41_HUMAN	vacuolar protein sorting 41 homolog (S. cerevisiae)	641					Golgi vesicle transport (GO:0048193)|intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	cytosol (GO:0005829)|early endosome (GO:0005769)|Golgi-associated vesicle (GO:0005798)|HOPS complex (GO:0030897)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)	zinc ion binding (GO:0008270)	p.E641K(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(5)|lung(17)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	44						CTTACCTTTTCAAGTGGGCAA	0.423																																							uc003tgy.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	4						c.(1921-1923)GAA>AAA		vacuolar protein sorting 41 isoform 1							216.0	197.0	204.0					7																	38791781		2203	4300	6503	SO:0001583	missense	27072				Golgi vesicle transport|intracellular protein transport|vesicle-mediated transport	cytosol|Golgi-associated vesicle|HOPS complex|membrane fraction	zinc ion binding	g.chr7:38791781C>T	U87309	CCDS5457.1, CCDS5458.2	7p14.1-p13	2009-05-08	2006-12-19		ENSG00000006715	ENSG00000006715			12713	protein-coding gene	gene with protein product		605485	"""vacuolar protein sorting 41 (yeast homolog)"", ""vacuolar protein sorting 41 (yeast)"""			9159129	Standard	NM_080631		Approved	HVSP41	uc003tgy.3	P49754	OTTHUMG00000023629	ENST00000310301.4:c.1921G>A	7.37:g.38791781C>T	ENSP00000309457:p.Glu641Lys		Somatic				VPS41_uc003tgz.2_Missense_Mutation_p.E616K|VPS41_uc010kxn.2_Missense_Mutation_p.E552K	p.E641K	NM_014396	NP_055211	WXS	Illumina HiSeq	Unspecified	P49754	VPS41_HUMAN			22	1947	-			641			Clathrin.		E9PF36|Q86TP8|Q99851|Q99852	Missense_Mutation	SNP	ENST00000310301.4	37	c.1921G>A	CCDS5457.1	.	.	.	.	.	.	.	.	.	.	C	33	5.220893	0.95139	.	.	ENSG00000006715	ENST00000310301;ENST00000395969	T;T	0.20200	2.09;2.09	5.86	5.86	0.93980	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	T	0.39091	0.1065	M	0.73319	2.225	0.80722	D	1	P;D;D	0.53619	0.921;0.961;0.961	P;P;P	0.52957	0.714;0.621;0.621	T	0.02909	-1.1095	10	0.22109	T	0.4	-23.1805	20.1883	0.98225	0.0:1.0:0.0:0.0	.	641;616;641	B2RB94;E9PF36;P49754	.;.;VPS41_HUMAN	K	641;616	ENSP00000309457:E641K;ENSP00000379297:E616K	ENSP00000309457:E641K	E	-	1	0	VPS41	38758306	1.000000	0.71417	0.995000	0.50966	0.990000	0.78478	5.939000	0.70179	2.776000	0.95493	0.650000	0.86243	GAA		0.423	VPS41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226986.3			5	275	0	0	0	0.000602	0	5	275				
GLI3	2737	broad.mit.edu	37	7	42006187	42006187	+	Silent	SNP	C	C	T	rs116840759		TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr7:42006187C>T	ENST00000395925.3	-	15	2568	c.2484G>A	c.(2482-2484)ccG>ccA	p.P828P	GLI3_ENST00000479210.1_5'UTR	NM_000168.5	NP_000159.3	P10071	GLI3_HUMAN	GLI family zinc finger 3	828					anterior semicircular canal development (GO:0060873)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye morphogenesis (GO:0048593)|cell differentiation involved in kidney development (GO:0061005)|cerebral cortex radial glia guided migration (GO:0021801)|developmental growth (GO:0048589)|embryonic digestive tract development (GO:0048566)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain radial glial cell differentiation (GO:0021861)|frontal suture morphogenesis (GO:0060364)|heart development (GO:0007507)|hindgut morphogenesis (GO:0007442)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|lambdoid suture morphogenesis (GO:0060366)|lateral ganglionic eminence cell proliferation (GO:0022018)|lateral semicircular canal development (GO:0060875)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|mammary gland specification (GO:0060594)|melanocyte differentiation (GO:0030318)|metanephros development (GO:0001656)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative thymic T cell selection (GO:0045060)|nose morphogenesis (GO:0043585)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte differentiation (GO:0048709)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein processing (GO:0016485)|proximal/distal pattern formation (GO:0009954)|response to estrogen (GO:0043627)|sagittal suture morphogenesis (GO:0060367)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|smoothened signaling pathway involved in spinal cord motor neuron cell fate specification (GO:0021776)|smoothened signaling pathway involved in ventral spinal cord interneuron specification (GO:0021775)|T cell differentiation in thymus (GO:0033077)|thymocyte apoptotic process (GO:0070242)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|primary cilium (GO:0072372)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P828P(2)		NS(2)|biliary_tract(1)|breast(4)|central_nervous_system(2)|endometrium(12)|kidney(7)|large_intestine(25)|lung(49)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	112						CGCTTCTGCCCGGGAGAAGCG	0.592									Pallister-Hall syndrome;Greig Cephalopolysyndactyly																														uc011kbh.1		NA																	2	Substitution - coding silent(2)		NS(1)|lung(1)	lung(11)|ovary(3)|large_intestine(2)|central_nervous_system(1)|kidney(1)|pancreas(1)	19						c.(2482-2484)CCG>CCA		GLI-Kruppel family member GLI3							72.0	76.0	75.0					7																	42006187		2203	4300	6503	SO:0001819	synonymous_variant	2737	Greig_Cephalopolysyndactyly|Pallister-Hall_syndrome	Familial Cancer Database	;	negative regulation of alpha-beta T cell differentiation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of smoothened signaling pathway|negative regulation of transcription from RNA polymerase II promoter|negative thymic T cell selection|positive regulation of alpha-beta T cell differentiation|positive regulation of transcription from RNA polymerase II promoter|thymocyte apoptosis	cilium|cytosol|nucleolus	beta-catenin binding|histone acetyltransferase binding|histone deacetylase binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr7:42006187C>T		CCDS5465.1	7p13	2013-01-25	2009-03-05		ENSG00000106571	ENSG00000106571		"""Zinc fingers, C2H2-type"""	4319	protein-coding gene	gene with protein product	"""zinc finger protein GLI3"", ""oncogene GLI3"", ""DNA-binding protein"""	165240	"""Greig cephalopolysyndactyly syndrome"", ""GLI-Kruppel family member GLI3"", ""glioma-associated oncogene family zinc finger 3"""	GCPS, PHS		2118997	Standard	NM_000168		Approved	PAP-A, PAPA, PAPA1, PAPB, ACLS, PPDIV	uc011kbh.2	P10071	OTTHUMG00000023630	ENST00000395925.3:c.2484G>A	7.37:g.42006187C>T			Somatic				GLI3_uc011kbg.1_Silent_p.P769P	p.P828P	NM_000168	NP_000159	WXS	Illumina HiSeq	Unspecified	P10071	GLI3_HUMAN			15	2575	-			828					A4D1W1|O75219|Q17RW4|Q75MT0|Q75MU9|Q9UDT5|Q9UJ39	Silent	SNP	ENST00000395925.3	37	c.2484G>A	CCDS5465.1																																																																																				0.592	GLI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250806.3	NM_000168		20	195	0	0	0	0.012319	0	20	195				
PKD1L1	168507	broad.mit.edu	37	7	47917203	47917203	+	Missense_Mutation	SNP	C	C	G			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr7:47917203C>G	ENST00000289672.2	-	22	3597	c.3547G>C	c.(3547-3549)Gct>Cct	p.A1183P		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	1183	REJ. {ECO:0000255|PROSITE- ProRule:PRU00511}.				detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)	p.A1183P(1)	BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						TACAGCTGAGCTTTACCCAGT	0.498																																							uc003tny.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(8)|upper_aerodigestive_tract(2)|breast(1)	11						c.(3547-3549)GCT>CCT		polycystin-1L1							92.0	81.0	85.0					7																	47917203		2203	4300	6503	SO:0001583	missense	168507				cell-cell adhesion	integral to membrane		g.chr7:47917203C>G	AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.3547G>C	7.37:g.47917203C>G	ENSP00000289672:p.Ala1183Pro		Somatic					p.A1183P	NM_138295	NP_612152	WXS	Illumina HiSeq	Unspecified	Q8TDX9	PK1L1_HUMAN			22	3547	-			1183			Extracellular (Potential).|REJ.		Q6UWK1	Missense_Mutation	SNP	ENST00000289672.2	37	c.3547G>C	CCDS34633.1	.	.	.	.	.	.	.	.	.	.	C	11.25	1.582966	0.28268	.	.	ENSG00000158683	ENST00000289672	D	0.82433	-1.61	5.2	4.32	0.51571	Egg jelly receptor, REJ-like (1);PKD/REJ-like protein (1);	0.168029	0.37261	N	0.002161	D	0.88544	0.6465	L	0.56769	1.78	0.22903	N	0.998582	D	0.89917	1.0	D	0.77557	0.99	T	0.81678	-0.0824	10	0.66056	D	0.02	-15.3064	12.811	0.57639	0.0:0.9131:0.0:0.0869	.	1183	Q8TDX9	PK1L1_HUMAN	P	1183	ENSP00000289672:A1183P	ENSP00000289672:A1183P	A	-	1	0	PKD1L1	47883728	1.000000	0.71417	0.175000	0.22980	0.005000	0.04900	1.946000	0.40283	0.609000	0.30018	-0.797000	0.03246	GCT		0.498	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340974.1	NM_138295		7	86	0	0	0	0.001984	0	7	86				
SSC4D	136853	broad.mit.edu	37	7	76026893	76026893	+	Silent	SNP	G	G	A			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr7:76026893G>A	ENST00000275560.3	-	6	1157	c.810C>T	c.(808-810)agC>agT	p.S270S	ZP3_ENST00000336517.4_5'UTR	NM_080744.1	NP_542782.1												p.S270S(1)		autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|lung(9)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	21						CCCAGCCCAGGCTCTGGCAGG	0.726																																							uc003ufb.2		NA																	1	Substitution - coding silent(1)		lung(1)	pancreas(1)	1						c.(808-810)AGC>AGT		scavenger receptor cysteine rich domain							13.0	16.0	15.0					7																	76026893		2192	4295	6487	SO:0001819	synonymous_variant	136853					extracellular region|membrane	scavenger receptor activity	g.chr7:76026893G>A																												ENST00000275560.3:c.810C>T	7.37:g.76026893G>A			Somatic				ZP3_uc003ufc.3_5'UTR	p.S270S	NM_080744	NP_542782	WXS	Illumina HiSeq	Unspecified	Q8WTU2	SRB4D_HUMAN			6	1158	-			270			SRCR 2.			Silent	SNP	ENST00000275560.3	37	c.810C>T	CCDS5585.1																																																																																				0.726	SRCRB4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253001.3			5	6	0	0	0	0.010729	0	5	6				
SEMA3D	223117	broad.mit.edu	37	7	84702345	84702345	+	Missense_Mutation	SNP	A	A	C			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr7:84702345A>C	ENST00000284136.6	-	4	471	c.428T>G	c.(427-429)aTa>aGa	p.I143R	SEMA3D_ENST00000444867.1_Missense_Mutation_p.I143R	NM_152754.2	NP_689967.2	O95025	SEM3D_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3D	143	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|membrane (GO:0016020)	receptor activity (GO:0004872)	p.I143R(1)		NS(1)|breast(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(19)|lung(29)|ovary(3)|pancreas(1)|prostate(4)|skin(2)	73						ACACACATATATGTGAGTTTT	0.343																																					Ovarian(63;442 1191 17318 29975 31528)	Ovarian(63;442 1191 17318 29975 31528)	uc003uic.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|large_intestine(2)	5						c.(427-429)ATA>AGA		semaphorin 3D precursor							111.0	103.0	106.0					7																	84702345		2203	4300	6503	SO:0001583	missense	223117				cell differentiation|nervous system development	extracellular region|membrane	receptor activity	g.chr7:84702345A>C	BC029590	CCDS34676.1	7q21.11	2013-01-11			ENSG00000153993	ENSG00000153993		"""Semaphorins"", ""Immunoglobulin superfamily / V-set domain containing"""	10726	protein-coding gene	gene with protein product		609907					Standard	NM_152754		Approved	coll-2, Sema-Z2	uc003uic.3	O95025	OTTHUMG00000154569	ENST00000284136.6:c.428T>G	7.37:g.84702345A>C	ENSP00000284136:p.Ile143Arg		Somatic				SEMA3D_uc010led.2_Missense_Mutation_p.I143R|SEMA3D_uc010lee.1_Missense_Mutation_p.I143R	p.I143R	NM_152754	NP_689967	WXS	Illumina HiSeq	Unspecified	O95025	SEM3D_HUMAN			4	468	-			143			Sema.		A6NK46|Q6UW77|Q8NCQ1	Missense_Mutation	SNP	ENST00000284136.6	37	c.428T>G	CCDS34676.1	.	.	.	.	.	.	.	.	.	.	A	14.99	2.700355	0.48307	.	.	ENSG00000153993	ENST00000284136;ENST00000444867	T;T	0.11930	2.73;2.73	5.07	5.07	0.68467	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.572406	0.19497	N	0.112838	T	0.14657	0.0354	L	0.39898	1.24	0.41747	D	0.989648	B;B	0.32467	0.372;0.042	B;B	0.37989	0.262;0.048	T	0.04650	-1.0936	10	0.87932	D	0	.	9.3849	0.38336	0.9197:0.0:0.0803:0.0	.	143;143	C9JYT6;O95025	.;SEM3D_HUMAN	R	143	ENSP00000284136:I143R;ENSP00000401366:I143R	ENSP00000284136:I143R	I	-	2	0	SEMA3D	84540281	0.989000	0.36119	0.586000	0.28679	0.926000	0.56050	3.726000	0.54977	1.889000	0.54706	0.455000	0.32223	ATA		0.343	SEMA3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336084.2	NM_152754		18	63	0	0	0	0.008871	0	18	63				
ZNF804B	219578	broad.mit.edu	37	7	88966114	88966114	+	Missense_Mutation	SNP	C	C	T	rs567180757	byFrequency	TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr7:88966114C>T	ENST00000333190.4	+	4	4427	c.3818C>T	c.(3817-3819)gCt>gTt	p.A1273V		NM_181646.2	NP_857597.1	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	1273							metal ion binding (GO:0046872)	p.A1273V(1)		NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(20)|lung(78)|ovary(5)|pancreas(5)|prostate(2)|skin(11)|soft_tissue(1)|upper_aerodigestive_tract(9)	144	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			TTAGTAGCTGCTACCCCCTTC	0.473										HNSCC(36;0.09)																													uc011khi.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|skin(3)|pancreas(2)|upper_aerodigestive_tract(1)	11						c.(3817-3819)GCT>GTT		zinc finger protein 804B							237.0	200.0	213.0					7																	88966114		2203	4300	6503	SO:0001583	missense	219578					intracellular	zinc ion binding	g.chr7:88966114C>T	AK056672	CCDS5613.1	7q21.13	2012-10-05	2006-12-18		ENSG00000182348	ENSG00000182348			21958	protein-coding gene	gene with protein product			"""zinc finger 804B"""				Standard	NM_181646		Approved	FLJ32110	uc011khi.2	A4D1E1	OTTHUMG00000131037	ENST00000333190.4:c.3818C>T	7.37:g.88966114C>T	ENSP00000329638:p.Ala1273Val	HNSCC(36;0.09)	Somatic					p.A1273V	NM_181646	NP_857597	WXS	Illumina HiSeq	Unspecified	A4D1E1	Z804B_HUMAN	STAD - Stomach adenocarcinoma(171;0.0513)		4	4356	+	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		1273					B2RTV2|Q7Z714|Q96MN7	Missense_Mutation	SNP	ENST00000333190.4	37	c.3818C>T	CCDS5613.1	.	.	.	.	.	.	.	.	.	.	C	19.36	3.813527	0.70912	.	.	ENSG00000182348	ENST00000333190	T	0.22336	1.96	4.99	4.99	0.66335	.	0.296596	0.29376	N	0.012326	T	0.40171	0.1106	M	0.66939	2.045	0.43025	D	0.994587	D	0.64830	0.994	P	0.54706	0.759	T	0.28964	-1.0027	10	0.66056	D	0.02	-2.3282	18.8228	0.92105	0.0:1.0:0.0:0.0	.	1273	A4D1E1	Z804B_HUMAN	V	1273	ENSP00000329638:A1273V	ENSP00000329638:A1273V	A	+	2	0	ZNF804B	88804050	0.945000	0.32115	0.721000	0.30653	0.955000	0.61496	5.268000	0.65536	2.739000	0.93911	0.655000	0.94253	GCT		0.473	ZNF804B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253683.2	NM_181646		83	229	0	0	0	0.01441	0	83	229				
LAMB1	3912	broad.mit.edu	37	7	107615484	107615484	+	Missense_Mutation	SNP	C	C	T			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr7:107615484C>T	ENST00000222399.6	-	12	1659	c.1429G>A	c.(1429-1431)Ggt>Agt	p.G477S	LAMB1_ENST00000393561.1_Missense_Mutation_p.G501S|LAMB1_ENST00000393560.1_Missense_Mutation_p.G477S	NM_002291.2	NP_002282.2	P07942	LAMB1_HUMAN	laminin, beta 1	477	Laminin EGF-like 4. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|neuron projection development (GO:0031175)|neuronal-glial interaction involved in cerebral cortex radial glia guided migration (GO:0021812)|odontogenesis (GO:0042476)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell proliferation (GO:0050679)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-2 complex (GO:0005607)|laminin-8 complex (GO:0043257)|perinuclear region of cytoplasm (GO:0048471)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)|structural molecule activity (GO:0005198)	p.G477S(1)		NS(3)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(37)|ovary(6)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)	82						TAGCAGTGACCTGTCTCGGAA	0.483																																							uc003vew.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	8						c.(1429-1431)GGT>AGT		laminin, beta 1 precursor	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)						96.0	87.0	90.0					7																	107615484		2203	4300	6503	SO:0001583	missense	3912				axon guidance|odontogenesis|positive regulation of cell migration|positive regulation of epithelial cell proliferation|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-2 complex|laminin-8 complex|perinuclear region of cytoplasm	extracellular matrix structural constituent	g.chr7:107615484C>T	M61916	CCDS5750.1	7q22	2013-03-01			ENSG00000091136	ENSG00000091136		"""Laminins"""	6486	protein-coding gene	gene with protein product		150240	"""cutis laxa with marfanoid phenotype"""	CLM		2563160, 2704655, 1864606	Standard	NM_002291		Approved		uc003vew.2	P07942	OTTHUMG00000149966	ENST00000222399.6:c.1429G>A	7.37:g.107615484C>T	ENSP00000222399:p.Gly477Ser		Somatic				LAMB1_uc003vev.2_Missense_Mutation_p.G501S|LAMB1_uc003vex.2_Missense_Mutation_p.G477S|LAMB1_uc010ljn.1_Missense_Mutation_p.G563S	p.G477S	NM_002291	NP_002282	WXS	Illumina HiSeq	Unspecified	P07942	LAMB1_HUMAN			12	1764	-			477			Laminin EGF-like 4.		Q14D91	Missense_Mutation	SNP	ENST00000222399.6	37	c.1429G>A	CCDS5750.1	.	.	.	.	.	.	.	.	.	.	C	28.2	4.902604	0.92035	.	.	ENSG00000091136	ENST00000393561;ENST00000222399;ENST00000393560	T;T;T	0.75477	-0.94;-0.94;-0.19	5.56	5.56	0.83823	EGF-like, laminin (3);	.	.	.	.	D	0.91503	0.7317	H	0.97077	3.935	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	D	0.93934	0.7217	9	0.87932	D	0	.	19.5261	0.95208	0.0:1.0:0.0:0.0	.	477;477;501	E7EPA6;P07942;G3XAI2	.;LAMB1_HUMAN;.	S	501;477;477	ENSP00000377191:G501S;ENSP00000222399:G477S;ENSP00000377190:G477S	ENSP00000222399:G477S	G	-	1	0	LAMB1	107402720	1.000000	0.71417	0.529000	0.27951	0.635000	0.38103	7.321000	0.79088	2.632000	0.89209	0.655000	0.94253	GGT		0.483	LAMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314584.1	NM_002291		28	32	0	0	0	0.008361	0	28	32				
RNF148	378925	broad.mit.edu	37	7	122342609	122342609	+	Missense_Mutation	SNP	A	A	T			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr7:122342609A>T	ENST00000434824.1	-	1	412	c.196T>A	c.(196-198)Tct>Act	p.S66T	RNF148_ENST00000447240.1_Intron|CADPS2_ENST00000449022.2_Intron|CADPS2_ENST00000313070.7_Intron|CADPS2_ENST00000412584.2_Intron|CADPS2_ENST00000334010.7_Intron	NM_198085.1	NP_932351.1	Q8N7C7	RN148_HUMAN	ring finger protein 148	66	PA.					integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)	p.S66T(2)		endometrium(2)|kidney(1)|large_intestine(6)|lung(7)	16						TCCAGAGGAGAATGATTCCCG	0.468																																							uc003vkk.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(196-198)TCT>ACT		ring finger protein 148 precursor							125.0	115.0	118.0					7																	122342609		1964	4157	6121	SO:0001583	missense	378925					integral to membrane	zinc ion binding	g.chr7:122342609A>T	BC029264	CCDS47692.1	7q31.33	2013-01-09			ENSG00000235631	ENSG00000235631		"""RING-type (C3HC4) zinc fingers"""	22411	protein-coding gene	gene with protein product						8744354	Standard	NM_198085		Approved	MGC35222	uc003vkk.1	Q8N7C7	OTTHUMG00000157099	ENST00000434824.1:c.196T>A	7.37:g.122342609A>T	ENSP00000388207:p.Ser66Thr		Somatic				CADPS2_uc010lkp.2_Intron|CADPS2_uc010lkq.2_Intron|RNF148_uc010lkr.1_Intron	p.S66T	NM_198085	NP_932351	WXS	Illumina HiSeq	Unspecified	Q8N7C7	RN148_HUMAN			1	413	-			66			PA.		A4D0X4|Q8N308	Missense_Mutation	SNP	ENST00000434824.1	37	c.196T>A	CCDS47692.1	.	.	.	.	.	.	.	.	.	.	A	20.3	3.965523	0.74131	.	.	ENSG00000235631	ENST00000434824	T	0.05447	3.44	5.4	4.25	0.50352	.	.	.	.	.	T	0.26991	0.0661	M	0.91090	3.175	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	T	0.13388	-1.0511	9	0.22109	T	0.4	.	10.3878	0.44152	0.9224:0.0:0.0776:0.0	.	66	Q8N7C7	RN148_HUMAN	T	66	ENSP00000388207:S66T	ENSP00000388207:S66T	S	-	1	0	RNF148	122129845	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.285000	0.51716	2.044000	0.60594	0.454000	0.30748	TCT		0.468	RNF148-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347424.1	NM_198085		16	108	0	0	0	0.004007	0	16	108				
UBN2	254048	broad.mit.edu	37	7	138957090	138957090	+	Missense_Mutation	SNP	T	T	C			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr7:138957090T>C	ENST00000473989.3	+	9	1619	c.1619T>C	c.(1618-1620)cTg>cCg	p.L540P	UBN2_ENST00000288561.8_Missense_Mutation_p.L457P	NM_173569.3	NP_775840.3	Q6ZU65	UBN2_HUMAN	ubinuclein 2	540						extracellular space (GO:0005615)|nucleus (GO:0005634)		p.L457P(1)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	42						AGAGAACCTCTGCAAAAACTG	0.373																																							uc011kqr.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(1618-1620)CTG>CCG		ubinuclein 2							123.0	112.0	115.0					7																	138957090		1848	4102	5950	SO:0001583	missense	254048							g.chr7:138957090T>C	AK098644	CCDS43655.1, CCDS43655.2	7q34	2008-12-08			ENSG00000157741	ENSG00000157741			21931	protein-coding gene	gene with protein product		613841				19029251	Standard	NM_173569		Approved	FLJ25778, KIAA2030	uc011kqr.2	Q6ZU65	OTTHUMG00000157623	ENST00000473989.3:c.1619T>C	7.37:g.138957090T>C	ENSP00000418648:p.Leu540Pro		Somatic				UBN2_uc003vuv.2_Missense_Mutation_p.L263P	p.L540P	NM_173569	NP_775840	WXS	Illumina HiSeq	Unspecified	Q6ZU65	UBN2_HUMAN			9	1619	+			540					A4D1S2|Q2YDY4|Q6P1K0|Q86XN9|Q8N7D1	Missense_Mutation	SNP	ENST00000473989.3	37	c.1619T>C	CCDS43655.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	27.0|27.0	4.795703|4.795703	0.90453|0.90453	.|.	.|.	ENSG00000157741|ENSG00000157741	ENST00000483726|ENST00000473989;ENST00000288561	.|T;T	.|0.59502	.|0.26;0.26	5.65|5.65	5.65|5.65	0.86999|0.86999	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.76919|0.76919	0.4055|0.4055	M|M	0.79258|0.79258	2.445|2.445	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.91635	.|0.999	T|T	0.80248|0.80248	-0.1461|-0.1461	5|10	.|0.87932	.|D	.|0	-6.9179|-6.9179	15.8733|15.8733	0.79141|0.79141	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|540	.|Q6ZU65	.|UBN2_HUMAN	R|P	309|540;457	.|ENSP00000418648:L540P;ENSP00000288561:L457P	.|ENSP00000288561:L457P	C|L	+|+	1|2	0|0	UBN2|UBN2	138607630|138607630	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	7.841000|7.841000	0.86834|0.86834	2.149000|2.149000	0.67028|0.67028	0.454000|0.454000	0.30748|0.30748	TGC|CTG		0.373	UBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349272.3	NM_173569		32	158	0	0	0	0.012213	0	32	158				
KMT2C	58508	broad.mit.edu	37	7	151927085	151927085	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr7:151927085C>A	ENST00000262189.6	-	18	3117	c.2899G>T	c.(2899-2901)Ggc>Tgc	p.G967C	KMT2C_ENST00000355193.2_Missense_Mutation_p.G967C	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	967					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.G967C(2)									GCTCCTTGGCCAAAACTGCCA	0.343																																						Colon(68;14 1149 1884 27689 34759)	uc003wla.2		NA								N							medulloblastoma		2	Substitution - Missense(2)		lung(2)	large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63						c.(2899-2901)GGC>TGC		myeloid/lymphoid or mixed-lineage leukemia 3							62.0	52.0	55.0					7																	151927085		2200	4278	6478	SO:0001583	missense	58508				intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding	g.chr7:151927085C>A	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.2899G>T	7.37:g.151927085C>A	ENSP00000262189:p.Gly967Cys		Somatic				MLL3_uc003wkz.2_Missense_Mutation_p.G28C	p.G967C	NM_170606	NP_733751	WXS	Illumina HiSeq	Unspecified	Q8NEZ4	MLL3_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)	18	3118	-	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	967			PHD-type 4.		Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	37	c.2899G>T	CCDS5931.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.78|17.78	3.473398|3.473398	0.63737|0.63737	.|.	.|.	ENSG00000055609|ENSG00000055609	ENST00000262189;ENST00000355193|ENST00000418673	D;D|.	0.87966|.	-2.32;-2.32|.	4.67|4.67	4.67|4.67	0.58626|0.58626	Zinc finger, PHD-finger (1);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (1);Zinc finger, PHD-type (1);Zinc finger, FYVE/PHD-type (1);|.	0.000000|.	0.42053|.	U|.	0.000771|.	T|T	0.76807|0.76807	0.4039|0.4039	M|M	0.76838|0.76838	2.35|2.35	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	1.0;1.0|.	T|T	0.78239|0.78239	-0.2281|-0.2281	10|5	0.87932|.	D|.	0|.	.|.	17.9348|17.9348	0.89009|0.89009	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	967;28|.	Q8NEZ4;Q8NEZ4-2|.	MLL3_HUMAN;.|.	C|L	967|122	ENSP00000262189:G967C;ENSP00000347325:G967C|.	ENSP00000262189:G967C|.	G|W	-|-	1|2	0|0	MLL3|MLL3	151558018|151558018	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	7.770000|7.770000	0.85390|0.85390	2.303000|2.303000	0.77524|0.77524	0.460000|0.460000	0.39030|0.39030	GGC|TGG		0.343	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3			10	350	1	0	2.61681e-11	0.00245	3.29586e-11	10	350				
CLVS1	157807	broad.mit.edu	37	8	62289222	62289222	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr8:62289222G>T	ENST00000519846.1	+	4	986	c.514G>T	c.(514-516)Gat>Tat	p.D172Y	CLVS1_ENST00000518592.1_5'UTR|CLVS1_ENST00000325897.4_Missense_Mutation_p.D172Y			Q8IUQ0	CLVS1_HUMAN	clavesin 1	172	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.				lysosome organization (GO:0007040)	clathrin-coated vesicle (GO:0030136)|endosome (GO:0005768)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|transporter activity (GO:0005215)	p.D172Y(1)		endometrium(3)|kidney(4)|large_intestine(4)|lung(21)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	41						CCTAATCGAAGATCCGGAGCT	0.443																																							uc003xuh.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(4)|ovary(1)	5						c.(514-516)GAT>TAT		retinaldehyde binding protein 1-like 1							110.0	105.0	107.0					8																	62289222		2203	4300	6503	SO:0001583	missense	157807				lysosome organization	clathrin-coated vesicle|early endosome membrane|trans-Golgi network	phosphatidylinositol-3,5-bisphosphate binding|transporter activity	g.chr8:62289222G>T	AY094971	CCDS6176.1	8q12.1	2009-10-14	2009-10-14	2009-10-14		ENSG00000177182			23139	protein-coding gene	gene with protein product		611292	"""retinaldehyde binding protein 1-like 1"""	RLBP1L1		16802092, 19651769	Standard	NM_173519		Approved	MGC34646, CRALBPL, C6orf212L	uc003xuh.3	Q8IUQ0		ENST00000519846.1:c.514G>T	8.37:g.62289222G>T	ENSP00000428402:p.Asp172Tyr		Somatic				CLVS1_uc003xug.2_3'UTR|CLVS1_uc003xui.2_RNA|CLVS1_uc010lyp.2_Missense_Mutation_p.D172Y	p.D172Y	NM_173519	NP_775790	WXS	Illumina HiSeq	Unspecified	Q8IUQ0	CLVS1_HUMAN			3	838	+			172			CRAL-TRIO.		B2R7M5|C8UZT3|Q8NB32	Missense_Mutation	SNP	ENST00000519846.1	37	c.514G>T	CCDS6176.1	.	.	.	.	.	.	.	.	.	.	G	19.39	3.818370	0.71028	.	.	ENSG00000177182	ENST00000519846;ENST00000325897	T;T	0.75260	-0.92;-0.92	5.64	5.64	0.86602	Cellular retinaldehyde-binding/triple function, C-terminal (5);	0.046872	0.85682	D	0.000000	D	0.85401	0.5688	M	0.81341	2.54	0.58432	D	0.999996	P	0.51240	0.943	P	0.56398	0.797	D	0.86859	0.2028	10	0.87932	D	0	-6.1261	19.691	0.96000	0.0:0.0:1.0:0.0	.	172	Q8IUQ0	CLVS1_HUMAN	Y	172	ENSP00000428402:D172Y;ENSP00000325506:D172Y	ENSP00000325506:D172Y	D	+	1	0	CLVS1	62451776	1.000000	0.71417	1.000000	0.80357	0.886000	0.51366	7.600000	0.82769	2.671000	0.90904	0.585000	0.79938	GAT		0.443	CLVS1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378323.1	NM_173519		24	182	1	0	3.6726e-16	0.003954	4.87232e-16	24	182				
MCMDC2	157777	broad.mit.edu	37	8	67796088	67796088	+	Missense_Mutation	SNP	C	C	T			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr8:67796088C>T	ENST00000422365.2	+	9	1103	c.932C>T	c.(931-933)tCa>tTa	p.S311L	MCMDC2_ENST00000541540.1_Missense_Mutation_p.S248L|MCMDC2_ENST00000396592.3_Missense_Mutation_p.S311L|MCMDC2_ENST00000492775.1_Missense_Mutation_p.S311L|MCMDC2_ENST00000313616.5_Missense_Mutation_p.S311L	NM_173518.4	NP_775789.3	Q4G0Z9	MCMD2_HUMAN	minichromosome maintenance domain containing 2	311					DNA replication (GO:0006260)		ATP binding (GO:0005524)|DNA binding (GO:0003677)	p.S311L(2)|p.S306L(1)		endometrium(2)|kidney(2)|lung(5)	9						ATCTTTGCATCACAAATTACC	0.433																																							uc003xwz.3		NA																	3	Substitution - Missense(3)		lung(3)	ovary(1)	1						c.(931-933)TCA>TTA		minichromosome maintenance complex							72.0	67.0	69.0					8																	67796088		2203	4300	6503	SO:0001583	missense	157777				DNA replication		ATP binding|DNA binding	g.chr8:67796088C>T	BC034576	CCDS6197.2, CCDS47868.1, CCDS47869.1	8q13.1	2012-04-13	2012-04-13	2012-04-13	ENSG00000178460	ENSG00000178460			26368	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 45"""	C8orf45			Standard	NM_173518		Approved	FLJ25692	uc003xwz.4	Q4G0Z9	OTTHUMG00000157068	ENST00000422365.2:c.932C>T	8.37:g.67796088C>T	ENSP00000413632:p.Ser311Leu		Somatic				C8orf45_uc003xwv.2_Missense_Mutation_p.S311L|C8orf45_uc011lev.1_Missense_Mutation_p.S311L|C8orf45_uc011lew.1_Missense_Mutation_p.S242L|C8orf45_uc011lex.1_Missense_Mutation_p.S69L|C8orf45_uc003xwy.3_Missense_Mutation_p.S311L	p.S311L	NM_173518	NP_775789	WXS	Illumina HiSeq	Unspecified	Q4G0Z9	CH045_HUMAN	Epithelial(68;0.00384)|OV - Ovarian serous cystadenocarcinoma(28;0.00913)|all cancers(69;0.0175)|BRCA - Breast invasive adenocarcinoma(89;0.206)		9	1103	+	Breast(64;0.186)		311					B4DYZ3|B4DZM4|B4E293|Q6P533|Q7Z3P4	Missense_Mutation	SNP	ENST00000422365.2	37	c.932C>T	CCDS6197.2	.	.	.	.	.	.	.	.	.	.	C	18.00	3.526201	0.64860	.	.	ENSG00000178460	ENST00000379356;ENST00000396592;ENST00000422365;ENST00000492775;ENST00000313616;ENST00000541540	T;T;T;T;T	0.42131	0.98;0.98;0.98;0.98;0.98	5.57	5.57	0.84162	.	0.069984	0.64402	D	0.000011	T	0.41971	0.1182	L	0.51422	1.61	0.46437	D	0.99904	B;B;B;B	0.20261	0.043;0.003;0.003;0.019	B;B;B;B	0.20767	0.031;0.008;0.005;0.01	T	0.16512	-1.0400	10	0.25751	T	0.34	-7.482	19.9215	0.97087	0.0:1.0:0.0:0.0	.	248;311;311;311	Q4G0Z9-4;Q4G0Z9;B4DXX4;G3XAN3	.;CH045_HUMAN;.;.	L	183;311;311;311;311;248	ENSP00000379837:S311L;ENSP00000413632:S311L;ENSP00000428037:S311L;ENSP00000317234:S311L;ENSP00000445629:S248L	ENSP00000317234:S311L	S	+	2	0	C8orf45	67958642	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	4.127000	0.57944	2.785000	0.95823	0.655000	0.94253	TCA		0.433	MCMDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347350.1	NM_173518		5	157	0	0	0	0.001168	0	5	157				
RIMS2	9699	broad.mit.edu	37	8	105263321	105263321	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr8:105263321G>T	ENST00000436393.2	+	27	4056	c.3815G>T	c.(3814-3816)aGa>aTa	p.R1272I	RIMS2_ENST00000507740.1_Missense_Mutation_p.R1068I|RIMS2_ENST00000406091.3_Missense_Mutation_p.R1254I|RIMS2_ENST00000262231.10_Missense_Mutation_p.R1093I|RIMS2_ENST00000339750.2_Missense_Mutation_p.R190I			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	1316	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)	p.R1068I(2)|p.R1254I(1)|p.R1272I(1)		NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			AAAGTGGCAAGAAAAACGCTG	0.388										HNSCC(12;0.0054)																													uc003yls.2		NA																	4	Substitution - Missense(4)		lung(4)	ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15						c.(3814-3816)AGA>ATA		regulating synaptic membrane exocytosis 2							86.0	75.0	78.0					8																	105263321		1844	4100	5944	SO:0001583	missense	9699				intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding	g.chr8:105263321G>T	AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.3815G>T	8.37:g.105263321G>T	ENSP00000390665:p.Arg1272Ile	HNSCC(12;0.0054)	Somatic				RIMS2_uc003ylp.2_Missense_Mutation_p.R1254I|RIMS2_uc003ylw.2_Missense_Mutation_p.R1261I|RIMS2_uc003ylq.2_Missense_Mutation_p.R1068I|RIMS2_uc003ylr.2_Missense_Mutation_p.R1093I	p.R1272I	NM_014677	NP_055492	WXS	Illumina HiSeq	Unspecified	Q9UQ26	RIMS2_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)		27	4056	+			1316			C2 2.		B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Missense_Mutation	SNP	ENST00000436393.2	37	c.3815G>T		.	.	.	.	.	.	.	.	.	.	G	33	5.287284	0.95517	.	.	ENSG00000176406	ENST00000329869;ENST00000406091;ENST00000402998;ENST00000262231;ENST00000507740;ENST00000436393;ENST00000523362;ENST00000339750	T;T;T;T;T;T	0.70516	-0.49;-0.49;-0.49;-0.49;-0.49;-0.49	5.36	5.36	0.76844	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	.	.	.	.	D	0.88976	0.6584	H	0.94582	3.555	0.80722	D	1	D;D;P;D;D	0.63046	0.976;0.992;0.691;0.985;0.985	D;D;P;D;D	0.72338	0.949;0.974;0.668;0.977;0.977	D	0.91504	0.5221	9	0.72032	D	0.01	.	19.4366	0.94798	0.0:0.0:1.0:0.0	.	1316;1272;1093;1068;1254	Q9UQ26;D6RA03;Q9UQ26-1;Q9UQ26-3;F8WD47	RIMS2_HUMAN;.;.;.;.	I	1291;1254;1316;1093;1068;1272;190;190	ENSP00000384892:R1254I;ENSP00000262231:R1093I;ENSP00000423559:R1068I;ENSP00000390665:R1272I;ENSP00000428478:R190I;ENSP00000342051:R190I	ENSP00000262231:R1093I	R	+	2	0	RIMS2	105332497	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.801000	0.99128	2.669000	0.90835	0.585000	0.79938	AGA		0.388	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000367217.1	NM_001100117		54	13	1	0	7.34454e-26	0.01441	9.94262e-26	54	13				
PRUNE2	158471	broad.mit.edu	37	9	79324375	79324375	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr9:79324375C>A	ENST00000376718.3	-	8	2938	c.2815G>T	c.(2815-2817)Gat>Tat	p.D939Y	PRUNE2_ENST00000428286.1_Missense_Mutation_p.D580Y	NM_015225.2	NP_056040.2	Q8WUY3	PRUN2_HUMAN	prune homolog 2 (Drosophila)	939					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)	p.D939Y(1)		endometrium(1)|kidney(4)|large_intestine(3)|lung(7)|prostate(1)	16						AAGAAGGAATCTTCCCAAGGA	0.423																																							uc010mpk.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2815-2817)GAT>TAT		prune homolog 2							225.0	209.0	214.0					9																	79324375		1568	3582	5150	SO:0001583	missense	158471				apoptosis|G1 phase|induction of apoptosis	cytoplasm	metal ion binding|pyrophosphatase activity	g.chr9:79324375C>A	BC019095	CCDS47982.1	9q21.32	2013-04-29	2006-11-24	2006-11-24	ENSG00000106772	ENSG00000106772			25209	protein-coding gene	gene with protein product	"""olfaxin"""	610691	"""chromosome 9 open reading frame 65"", ""KIAA0367"""	C9orf65, KIAA0367		16288218	Standard	NM_015225		Approved	BMCC1, BNIPXL, A214N16.3, bA214N16.3	uc010mpk.3	Q8WUY3	OTTHUMG00000020047	ENST00000376718.3:c.2815G>T	9.37:g.79324375C>A	ENSP00000365908:p.Asp939Tyr		Somatic					p.D939Y	NM_015225	NP_056040	WXS	Illumina HiSeq	Unspecified	Q8WUY3	PRUN2_HUMAN			8	2939	-			939					B3KYC4|B4DQH8|O15073|Q58A63|Q5JUB6|Q5T304|Q5T476|Q6T2V6|Q6T2V7|Q8N665	Missense_Mutation	SNP	ENST00000376718.3	37	c.2815G>T	CCDS47982.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.54|16.54	3.150508|3.150508	0.57151|0.57151	.|.	.|.	ENSG00000106772|ENSG00000106772	ENST00000376718;ENST00000428286;ENST00000422033|ENST00000426088	T;T|.	0.60171|.	0.24;0.21|.	6.04|6.04	5.14|5.14	0.70334|0.70334	.|.	0.234285|.	0.30134|.	N|.	0.010332|.	T|T	0.56187|0.56187	0.1968|0.1968	L|L	0.32530|0.32530	0.975|0.975	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.72625|.	0.978|.	T|T	0.48896|0.48896	-0.8994|-0.8994	10|5	0.87932|.	D|.	0|.	-16.5953|-16.5953	14.7468|14.7468	0.69494|0.69494	0.0:0.9314:0.0:0.0686|0.0:0.9314:0.0:0.0686	.|.	939|.	Q8WUY3|.	PRUN2_HUMAN|.	Y|I	939;580;938|260	ENSP00000365908:D939Y;ENSP00000397425:D580Y|.	ENSP00000365908:D939Y|.	D|R	-|-	1|2	0|0	PRUNE2|PRUNE2	78514195|78514195	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.986000|0.986000	0.74619|0.74619	2.849000|2.849000	0.48286|0.48286	2.873000|2.873000	0.98535|0.98535	0.561000|0.561000	0.74099|0.74099	GAT|AGA		0.423	PRUNE2-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052730.2	NM_138818		81	144	1	0	7.7321e-48	0.01441	1.06116e-47	81	144				
BRINP1	1620	broad.mit.edu	37	9	122000956	122000956	+	Missense_Mutation	SNP	G	G	A	rs1473785	byFrequency	TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr9:122000956G>A	ENST00000265922.3	-	5	1123	c.662C>T	c.(661-663)aCg>aTg	p.T221M	BRINP1_ENST00000373964.2_Missense_Mutation_p.T221M	NM_014618.2	NP_055433.2	O60477	BRNP1_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 1	221	MACPF.				cell cycle arrest (GO:0007050)|cell death (GO:0008219)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell cycle (GO:0045786)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	cytoplasm (GO:0005737)		p.T221M(1)									TTTGCTCTCCGTGCTTTGCAG	0.512																																							uc004bkc.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|ovary(2)|central_nervous_system(2)|large_intestine(1)	8						c.(661-663)ACG>ATG		deleted in bladder cancer 1 precursor							118.0	81.0	94.0					9																	122000956		2203	4300	6503	SO:0001583	missense	1620				cell cycle arrest|cell death	cytoplasm	protein binding	g.chr9:122000956G>A	AF027734	CCDS6822.1	9q32-q33	2013-08-06	2013-08-06	2013-07-31	ENSG00000078725	ENSG00000078725			2687	protein-coding gene	gene with protein product		602865	"""deleted in bladder cancer chromosome region candidate 1"", ""deleted in bladder cancer 1"""	DBCCR1, DBC1		9175739, 10444335, 15193422	Standard	NM_014618		Approved	FAM5A	uc004bkc.2	O60477	OTTHUMG00000021020	ENST00000265922.3:c.662C>T	9.37:g.122000956G>A	ENSP00000265922:p.Thr221Met		Somatic				DBC1_uc004bkd.2_Missense_Mutation_p.T221M	p.T221M	NM_014618	NP_055433	WXS	Illumina HiSeq	Unspecified	O60477	DBC1_HUMAN			5	1118	-			221			MACPF.		Q6IPV6|Q6P1A0|Q8WU22	Missense_Mutation	SNP	ENST00000265922.3	37	c.662C>T	CCDS6822.1	.	.	.	.	.	.	.	.	.	.	G	17.22	3.333801	0.60853	.	.	ENSG00000078725	ENST00000373969;ENST00000265922;ENST00000373964	T;T	0.45668	2.47;0.89	5.91	5.91	0.95273	Membrane attack complex component/perforin (MACPF) domain (1);	0.088405	0.85682	D	0.000000	T	0.20292	0.0488	N	0.03608	-0.345	0.47214	D	0.999355	B;B	0.29716	0.255;0.037	B;B	0.14578	0.011;0.005	T	0.10200	-1.0640	10	0.54805	T	0.06	-16.8736	12.5712	0.56339	0.0752:0.0:0.9248:0.0	rs1473785;rs1473785	221;221	O60477-2;O60477	.;DBC1_HUMAN	M	221	ENSP00000265922:T221M;ENSP00000363075:T221M	ENSP00000265922:T221M	T	-	2	0	DBC1	121040777	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.830000	0.86741	2.794000	0.96219	0.655000	0.94253	ACG		0.512	BRINP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055440.2	NM_014618		18	42	0	0	0	0.008871	0	18	42				
FCN1	2219	broad.mit.edu	37	9	137806617	137806617	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr9:137806617G>T	ENST00000371806.3	-	3	347	c.256C>A	c.(256-258)Cca>Aca	p.P86T		NM_002003.3	NP_001994.2	O00602	FCN1_HUMAN	ficolin (collagen/fibrinogen domain containing) 1	86	Collagen-like.				cell surface pattern recognition receptor signaling pathway (GO:0002752)|complement activation (GO:0006956)|complement activation, lectin pathway (GO:0001867)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|opsonization (GO:0008228)|positive regulation of interleukin-8 secretion (GO:2000484)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|extrinsic component of external side of plasma membrane (GO:0031232)	antigen binding (GO:0003823)|calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|G-protein coupled receptor binding (GO:0001664)|signaling pattern recognition receptor activity (GO:0008329)	p.P86T(1)		endometrium(3)|kidney(3)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	37		Myeloproliferative disorder(178;0.0333)		OV - Ovarian serous cystadenocarcinoma(145;3.46e-08)|Epithelial(140;6.01e-08)|all cancers(34;3.69e-07)		GGCCCCACTGGTCCTGCCTTT	0.527																																							uc004cfi.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|ovary(1)	2						c.(256-258)CCA>ACA		ficolin 1 precursor							56.0	46.0	50.0					9																	137806617		2203	4300	6503	SO:0001583	missense	2219				opsonization|signal transduction	collagen|extracellular space	antigen binding|calcium ion binding|receptor binding|sugar binding	g.chr9:137806617G>T	D83920	CCDS6985.1	9q34	2013-02-06	2002-01-14		ENSG00000085265	ENSG00000085265		"""Fibrinogen C domain containing"""	3623	protein-coding gene	gene with protein product		601252	"""ficolin (collagen/fibrinogen domain-containing) 1"""			8573080, 8884275	Standard	NM_002003		Approved	FCNM	uc004cfi.3	O00602	OTTHUMG00000020895	ENST00000371806.3:c.256C>A	9.37:g.137806617G>T	ENSP00000360871:p.Pro86Thr		Somatic					p.P86T	NM_002003	NP_001994	WXS	Illumina HiSeq	Unspecified	O00602	FCN1_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;3.46e-08)|Epithelial(140;6.01e-08)|all cancers(34;3.69e-07)	3	348	-		Myeloproliferative disorder(178;0.0333)	86			Collagen-like.		Q5VYV5|Q92596	Missense_Mutation	SNP	ENST00000371806.3	37	c.256C>A	CCDS6985.1	.	.	.	.	.	.	.	.	.	.	G	8.027	0.760962	0.15914	.	.	ENSG00000085265	ENST00000371807;ENST00000371806;ENST00000308299	D	0.93189	-3.18	3.52	2.59	0.31030	.	.	.	.	.	D	0.94175	0.8131	L	0.52126	1.63	0.19300	N	0.999978	D	0.64830	0.994	D	0.64237	0.923	D	0.86450	0.1772	9	0.48119	T	0.1	.	9.9028	0.41357	0.0:0.0:0.7941:0.2059	.	86	O00602	FCN1_HUMAN	T	86	ENSP00000360871:P86T	ENSP00000308877:P86T	P	-	1	0	FCN1	136946438	1.000000	0.71417	0.022000	0.16811	0.031000	0.12232	5.433000	0.66520	0.775000	0.33450	0.549000	0.68633	CCA		0.527	FCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054963.1	NM_002003		3	16	1	0	0.000602214	0.000602	0.000651308	3	16				
MBTPS2	51360	broad.mit.edu	37	X	21861374	21861374	+	Silent	SNP	T	T	A			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chrX:21861374T>A	ENST00000379484.5	+	2	261	c.162T>A	c.(160-162)acT>acA	p.T54T	MBTPS2_ENST00000465888.1_3'UTR|MBTPS2_ENST00000365779.2_Silent_p.T54T	NM_015884.3	NP_056968.1	O43462	MBTP2_HUMAN	membrane-bound transcription factor peptidase, site 2	54					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cholesterol metabolic process (GO:0008203)|endoplasmic reticulum unfolded protein response (GO:0030968)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)	p.T54T(1)		breast(2)|endometrium(3)|large_intestine(3)|lung(13)|ovary(1)|skin(2)	24						GATGGCAAACTGCTGTTTTCA	0.403																																							uc010nfq.2		NA																	1	Substitution - coding silent(1)		lung(1)	breast(1)|skin(1)	2						c.(160-162)ACT>ACA		YY2 transcription factor							201.0	194.0	196.0					X																	21861374		2203	4300	6503	SO:0001819	synonymous_variant	404281				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|plasma membrane	DNA binding|zinc ion binding	g.chrX:21861374T>A	AF019612	CCDS14201.1	Xp22.12-p22.11	2014-02-03	2005-08-17		ENSG00000012174	ENSG00000012174			15455	protein-coding gene	gene with protein product		300294	"""membrane-bound transcription factor protease, site 2"", ""keratosis follicularis spinulosa decalvans"""	KFSD		9847074, 9659902, 20672378	Standard	NM_015884		Approved	S2P	uc004dae.3	O43462	OTTHUMG00000021237	ENST00000379484.5:c.162T>A	X.37:g.21861374T>A			Somatic				MBTPS2_uc004dae.2_Silent_p.T54T|MBTPS2_uc004dab.2_Silent_p.T54T	p.T54T	NM_206923	NP_996806	WXS	Illumina HiSeq	Unspecified	O15391	TYY2_HUMAN			2	359	+			Error:Variant_position_missing_in_O15391_after_alignment					Q9UM70|Q9UMD3	Silent	SNP	ENST00000379484.5	37	c.162T>A	CCDS14201.1																																																																																				0.403	MBTPS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056026.1			39	215	0	0	0	0.005524	0	39	215				
SUPT20HL1	100130302	broad.mit.edu	37	X	24381622	24381622	+	IGR	SNP	C	C	T			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chrX:24381622C>T								AC004552.1 (14599 upstream) : PDK3 (101715 downstream)														p.P356S(1)									CTCTGTAAAGCCACAGCAGGA	0.512																																							uc011mjx.1		NA																	1	Substitution - Missense(1)		lung(1)	kidney(1)	1						c.(745-747)CCA>TCA		hypothetical protein LOC100130302							96.0	80.0	85.0					X																	24381622		1568	3582	5150	SO:0001628	intergenic_variant	100130302							g.chrX:24381622C>T																													X.37:g.24381622C>T			Somatic					p.P249S	NM_001136234	NP_001129706	WXS	Illumina HiSeq	Unspecified					1	745	+									Missense_Mutation	SNP		37	c.745C>T																																																																																				0	0.512									22	156	0	0	0	0.00333	0	22	156				
CYBB	1536	broad.mit.edu	37	X	37651312	37651312	+	Splice_Site	SNP	G	G	C			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chrX:37651312G>C	ENST00000378588.4	+	4	404	c.337G>C	c.(337-339)Gcg>Ccg	p.A113P	TM4SF2_ENST00000465127.1_Intron|CYBB_ENST00000545017.1_Splice_Site_p.A81P|CYBB_ENST00000536160.1_5'UTR	NM_000397.3	NP_000388.2	P04839	CY24B_HUMAN	cytochrome b-245, beta polypeptide	113	Ferric oxidoreductase.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|hydrogen peroxide biosynthetic process (GO:0050665)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interaction with host (GO:0051701)|oxidation-reduction process (GO:0055114)|phagosome maturation (GO:0090382)|respiratory burst (GO:0045730)|response to drug (GO:0042493)|response to nutrient (GO:0007584)|superoxide anion generation (GO:0042554)|superoxide metabolic process (GO:0006801)	dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|NADPH oxidase complex (GO:0043020)|neuronal cell body (GO:0043025)|phagocytic vesicle membrane (GO:0030670)|rough endoplasmic reticulum (GO:0005791)	flavin adenine dinucleotide binding (GO:0050660)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|superoxide-generating NADPH oxidase activity (GO:0016175)|voltage-gated ion channel activity (GO:0005244)	p.A113P(1)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(20)|prostate(2)|skin(2)	32					Dextromethorphan(DB00514)	ACTTCACTCTGGTAAGTTTAT	0.388																																							uc004ddr.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)|skin(1)	2						c.(337-339)GCG>CCG		cytochrome b-245 beta polypeptide							89.0	81.0	84.0					X																	37651312		2202	4300	6502	SO:0001630	splice_region_variant	1536				electron transport chain|inflammatory response|innate immune response|respiratory burst|superoxide anion generation	NADPH oxidase complex	electron carrier activity|flavin adenine dinucleotide binding|heme binding|protein heterodimerization activity|superoxide-generating NADPH oxidase activity|voltage-gated ion channel activity	g.chrX:37651312G>C	X04011	CCDS14242.1	Xp21.1	2014-09-17	2008-07-29		ENSG00000165168	ENSG00000165168		"""Cytochrome b genes"""	2578	protein-coding gene	gene with protein product		300481	"""chronic granulomatous disease"""	CGD			Standard	NM_000397		Approved	GP91-PHOX, NOX2	uc004ddr.2	P04839	OTTHUMG00000033175	ENST00000378588.4:c.337+1G>C	X.37:g.37651312G>C			Somatic				CYBB_uc011mke.1_RNA|CYBB_uc011mkf.1_Missense_Mutation_p.A81P|CYBB_uc011mkg.1_5'UTR	p.A113P	NM_000397	NP_000388	WXS	Illumina HiSeq	Unspecified	P04839	CY24B_HUMAN			4	398	+			113			Ferric oxidoreductase.|Helical; (Potential).		A8K138|Q2PP16	Missense_Mutation	SNP	ENST00000378588.4	37	c.337G>C	CCDS14242.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.254956	0.80135	.	.	ENSG00000165168	ENST00000378588;ENST00000545017	D;D	0.91464	-2.85;-2.85	5.87	4.1	0.47936	Flavoprotein transmembrane component (1);	0.109365	0.64402	D	0.000012	D	0.94420	0.8205	M	0.88979	2.995	0.80722	D	1	P;D	0.58268	0.927;0.982	P;P	0.61592	0.862;0.891	D	0.93291	0.6668	10	0.37606	T	0.19	.	9.627	0.39757	0.2244:0.0:0.7756:0.0	.	81;113	F5GWD2;P04839	.;CY24B_HUMAN	P	113;81	ENSP00000367851:A113P;ENSP00000441896:A81P	ENSP00000367851:A113P	A	+	1	0	CYBB	37536252	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	3.760000	0.55235	1.233000	0.43693	-0.199000	0.12753	GCG		0.388	CYBB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080881.1		Missense_Mutation	10	56	0	0	0	0.010729	0	10	56				
ZNF630	57232	broad.mit.edu	37	X	47919181	47919181	+	Missense_Mutation	SNP	G	G	T	rs200370530		TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chrX:47919181G>T	ENST00000409324.3	-	5	876	c.650C>A	c.(649-651)gCt>gAt	p.A217D	ZNF630_ENST00000276054.4_Missense_Mutation_p.A93D|ZNF630-AS1_ENST00000436124.1_RNA|ZNF630_ENST00000442455.3_Missense_Mutation_p.A203D	NM_001037735.2	NP_001032824.2	Q2M218	ZN630_HUMAN	zinc finger protein 630	217					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A217D(1)		endometrium(1)|large_intestine(6)|lung(11)|ovary(1)	19						AGAACAGGAAGCATTATACTT	0.408																																							uc004div.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|lung(1)	2						c.(649-651)GCT>GAT		zinc finger protein 630							75.0	66.0	69.0					X																	47919181		2194	4289	6483	SO:0001583	missense	57232				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chrX:47919181G>T	AK000580	CCDS35237.2, CCDS75971.1	Xp11.3-p11.1	2013-01-08			ENSG00000221994	ENSG00000221994		"""Zinc fingers, C2H2-type"", ""-"""	28855	protein-coding gene	gene with protein product		300819					Standard	NM_001037735		Approved	BC037316, dJ54B20.2, FLJ20573, MGC138344	uc004div.4	Q2M218	OTTHUMG00000021463	ENST00000409324.3:c.650C>A	X.37:g.47919181G>T	ENSP00000386393:p.Ala217Asp		Somatic				ZNF630_uc010nhz.1_Intron|ZNF630_uc004diw.2_Missense_Mutation_p.A93D	p.A217D	NM_001037735	NP_001032824	WXS	Illumina HiSeq	Unspecified	Q2M218	ZN630_HUMAN			5	902	-			217					F8WAG4|Q5H8Z5	Missense_Mutation	SNP	ENST00000409324.3	37	c.650C>A	CCDS35237.2	.	.	.	.	.	.	.	.	.	.	.	7.569	0.666417	0.14710	.	.	ENSG00000221994	ENST00000442455;ENST00000276054;ENST00000409324	T;T;T	0.08102	3.24;3.13;3.29	2.7	-4.88	0.03113	.	.	.	.	.	T	0.05181	0.0138	L	0.38175	1.15	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.41556	-0.9502	9	0.66056	D	0.02	.	0.3755	0.00387	0.2211:0.2845:0.2065:0.2878	.	217	Q2M218	ZN630_HUMAN	D	203;93;217	ENSP00000393163:A203D;ENSP00000354683:A93D;ENSP00000386393:A217D	ENSP00000354683:A93D	A	-	2	0	ZNF630	47804125	0.000000	0.05858	0.000000	0.03702	0.065000	0.16274	-0.968000	0.03817	-1.697000	0.01420	-1.119000	0.02030	GCT		0.408	ZNF630-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327254.1	NM_001037735		8	104	1	0	0.000157383	0.00308	0.000173035	8	104				
MTMR8	55613	broad.mit.edu	37	X	63488494	63488494	+	Missense_Mutation	SNP	C	C	T			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chrX:63488494C>T	ENST00000374852.3	-	14	2105	c.2038G>A	c.(2038-2040)Ggg>Agg	p.G680R	MTMR8_ENST00000453546.1_Intron	NM_017677.3	NP_060147.2	Q96EF0	MTMR8_HUMAN	myotubularin related protein 8	680						nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)	p.0?(2)|p.G680R(1)		breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(2)|skin(3)	37						CCCATGTCCCCAGAGAAACCC	0.537																																							uc004dvs.2		NA																	3	Whole gene deletion(2)|Substitution - Missense(1)		ovary(1)|lung(1)|large_intestine(1)	ovary(2)|breast(2)	4						c.(2038-2040)GGG>AGG		myotubularin related protein 8							69.0	63.0	65.0					X																	63488494		2203	4300	6503	SO:0001583	missense	55613					nuclear envelope	protein tyrosine phosphatase activity	g.chrX:63488494C>T	AK000133	CCDS14379.1	Xq11.2-q12	2013-01-11			ENSG00000102043	ENSG00000102043		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	16825	protein-coding gene	gene with protein product						11275328	Standard	NM_017677		Approved	FLJ20126	uc004dvs.3	Q96EF0	OTTHUMG00000021707	ENST00000374852.3:c.2038G>A	X.37:g.63488494C>T	ENSP00000363985:p.Gly680Arg		Somatic				MTMR8_uc011mou.1_Intron	p.G680R	NM_017677	NP_060147	WXS	Illumina HiSeq	Unspecified	Q96EF0	MTMR8_HUMAN			14	2106	-			680					Q5JT99|Q9NXP6	Missense_Mutation	SNP	ENST00000374852.3	37	c.2038G>A	CCDS14379.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.743|9.743	1.165403|1.165403	0.21538|0.21538	.|.	.|.	ENSG00000102043|ENSG00000102043	ENST00000374852;ENST00000247400|ENST00000442913	D|.	0.97642|.	-4.47|.	3.06|3.06	0.137|0.137	0.14787|0.14787	.|.	.|.	.|.	.|.	.|.	T|.	0.15132|.	0.0365|.	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	B|.	0.09022|.	0.002|.	B|.	0.04013|.	0.001|.	T|.	0.27020|.	-1.0086|.	9|.	0.87932|.	D|.	0|.	.|.	4.6273|4.6273	0.12484|0.12484	0.0:0.5781:0.1803:0.2416|0.0:0.5781:0.1803:0.2416	.|.	680|.	Q96EF0|.	MTMR8_HUMAN|.	R|X	680;566|483	ENSP00000363985:G680R|.	ENSP00000247400:G566R|.	G|W	-|-	1|2	0|0	MTMR8|MTMR8	63405219|63405219	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.119000|0.119000	0.20118|0.20118	0.437000|0.437000	0.21543|0.21543	-0.095000|-0.095000	0.12351|0.12351	0.513000|0.513000	0.50165|0.50165	GGG|TGG		0.537	MTMR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056949.2	NM_017677		15	38	0	0	0	0.004007	0	15	38				
KIF4A	24137	broad.mit.edu	37	X	69563564	69563564	+	Silent	SNP	G	G	A			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chrX:69563564G>A	ENST00000374403.3	+	12	1360	c.1278G>A	c.(1276-1278)gcG>gcA	p.A426A	KIF4A_ENST00000374388.3_Silent_p.A426A	NM_012310.4	NP_036442.3	O95239	KIF4A_HUMAN	kinesin family member 4A	426					anterograde axon cargo transport (GO:0008089)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle organization (GO:0006996)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)	p.A426A(1)		breast(6)|endometrium(9)|kidney(3)|large_intestine(8)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	51						CAGAGCAAGCGAATGAAAAAA	0.448																																							uc004dyg.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)	4						c.(1276-1278)GCG>GCA		kinesin family member 4							64.0	50.0	55.0					X																	69563564		2203	4300	6503	SO:0001819	synonymous_variant	24137				anterograde axon cargo transport|axon guidance|blood coagulation|organelle organization	chromosome|cytosol|midbody|nuclear matrix|spindle microtubule	ATP binding|DNA binding|microtubule motor activity|protein binding	g.chrX:69563564G>A	AF179308	CCDS14401.1	Xq13.1	2008-08-11			ENSG00000090889	ENSG00000090889		"""Kinesins"""	13339	protein-coding gene	gene with protein product	"""chromokinesin"""	300521				10773663	Standard	NM_012310		Approved	KIF4-G1, KIF4, HSA271784, FLJ12530, FLJ12655, FLJ14204, FLJ20631	uc004dyg.3	O95239	OTTHUMG00000021775	ENST00000374403.3:c.1278G>A	X.37:g.69563564G>A			Somatic				KIF4A_uc010nkw.2_Silent_p.A426A|KIF4A_uc004dyf.1_Silent_p.A426A	p.A426A	NM_012310	NP_036442	WXS	Illumina HiSeq	Unspecified	O95239	KIF4A_HUMAN			12	1405	+			426			Potential.		B2R7V5|D3DVU4|Q86TN3|Q86XX7|Q9NNY6|Q9NY24|Q9UMW3	Silent	SNP	ENST00000374403.3	37	c.1278G>A	CCDS14401.1																																																																																				0.448	KIF4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057068.1	NM_012310		8	59	0	0	0	0.00308	0	8	59				
SNX12	29934	broad.mit.edu	37	X	70288110	70288110	+	Missense_Mutation	SNP	G	G	A			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chrX:70288110G>A	ENST00000374274.3	-	1	163	c.47C>T	c.(46-48)cCg>cTg	p.P16L	SNX12_ENST00000465030.1_5'UTR|SNX12_ENST00000276105.3_Missense_Mutation_p.P16L	NM_001256185.1|NM_001256188.1|NM_013346.3	NP_001243114.1|NP_001243117.1|NP_037478.2	Q9UMY4	SNX12_HUMAN	sorting nexin 12	16					intracellular protein transport (GO:0006886)|negative regulation of early endosome to late endosome transport (GO:2000642)|negative regulation of gene expression (GO:0010629)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein processing (GO:0010955)|negative regulation of protein transport (GO:0051224)|regulation of endocytosis (GO:0030100)	early endosome (GO:0005769)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	enzyme binding (GO:0019899)|phosphatidylinositol binding (GO:0035091)	p.P16L(1)		endometrium(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)	8	Renal(35;0.156)					CAGGTCCTGCGGCTTCGAGTT	0.627																																							uc004dyr.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(46-48)CCG>CTG		sorting nexin 12							53.0	41.0	45.0					X																	70288110		2203	4299	6502	SO:0001583	missense	29934				cell communication|protein transport	membrane	phosphatidylinositol binding|protein binding	g.chrX:70288110G>A	AF171229	CCDS14405.1, CCDS59169.1	Xq13.1	2008-03-11			ENSG00000147164	ENSG00000147164		"""Sorting nexins"""	14976	protein-coding gene	gene with protein product		300883					Standard	NM_013346		Approved		uc004dyr.2	Q9UMY4	OTTHUMG00000021786	ENST00000374274.3:c.47C>T	X.37:g.70288110G>A	ENSP00000363392:p.Pro16Leu		Somatic				SNX12_uc004dyp.1_RNA	p.P16L	NM_013346	NP_037478	WXS	Illumina HiSeq	Unspecified	Q9UMY4	SNX12_HUMAN			1	122	-	Renal(35;0.156)		16					F8W8K5|Q8WUG9	Missense_Mutation	SNP	ENST00000374274.3	37	c.47C>T	CCDS14405.1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.584595	0.86748	.	.	ENSG00000147164	ENST00000374274;ENST00000276105	T;T	0.63913	-0.05;-0.07	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.63710	0.2534	M	0.71581	2.175	0.80722	D	1	D	0.58620	0.983	B	0.41619	0.361	T	0.71407	-0.4602	10	0.59425	D	0.04	-15.6631	17.1179	0.86694	0.0:0.0:1.0:0.0	.	16	Q3SYF1	.	L	16	ENSP00000363392:P16L;ENSP00000276105:P16L	ENSP00000276105:P16L	P	-	2	0	SNX12	70204835	1.000000	0.71417	0.965000	0.40720	0.990000	0.78478	8.975000	0.93437	2.340000	0.79590	0.544000	0.68410	CCG		0.627	SNX12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057094.1	NM_013346		3	19	0	0	0	0.000602	0	3	19				
TBX22	50945	broad.mit.edu	37	X	79286464	79286464	+	Missense_Mutation	SNP	G	G	A			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chrX:79286464G>A	ENST00000373294.5	+	8	1445	c.1417G>A	c.(1417-1419)Gac>Aac	p.D473N	TBX22_ENST00000373291.1_Missense_Mutation_p.D353N|TBX22_ENST00000442340.1_Missense_Mutation_p.D353N|TBX22_ENST00000373296.3_Missense_Mutation_p.D473N	NM_016954.2	NP_058650.1	Q9Y458	TBX22_HUMAN	T-box 22	473					multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D473N(1)		breast(2)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(13)|lung(38)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	65						TCCTTCCTATGACTTTTATAG	0.378																																							uc010nmg.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(7)|large_intestine(3)|central_nervous_system(2)|breast(1)|skin(1)|ovary(1)	15						c.(1417-1419)GAC>AAC		T-box 22 isoform 1							98.0	89.0	92.0					X																	79286464		2203	4300	6503	SO:0001583	missense	50945				multicellular organismal development|negative regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	g.chrX:79286464G>A	AL031000	CCDS14445.1, CCDS43975.1	Xq21.1	2011-02-11			ENSG00000122145	ENSG00000122145		"""T-boxes"""	11600	protein-coding gene	gene with protein product		300307	"""cleft palate and/or ankyloglossia"""	CPX, CLPA		11559848, 14729838	Standard	NM_001109878		Approved		uc004edj.1	Q9Y458	OTTHUMG00000021901	ENST00000373294.5:c.1417G>A	X.37:g.79286464G>A	ENSP00000362390:p.Asp473Asn		Somatic				TBX22_uc004edi.1_Missense_Mutation_p.D353N|TBX22_uc004edj.1_Missense_Mutation_p.D473N	p.D473N	NM_001109878	NP_001103348	WXS	Illumina HiSeq	Unspecified	Q9Y458	TBX22_HUMAN			9	1551	+			473					Q5JZ06|Q96LC0|Q9HBF1	Missense_Mutation	SNP	ENST00000373294.5	37	c.1417G>A	CCDS14445.1	.	.	.	.	.	.	.	.	.	.	G	4.181	0.032291	0.08101	.	.	ENSG00000122145	ENST00000373296;ENST00000442340;ENST00000373294;ENST00000373291	D;D;D;D	0.85088	-1.94;-1.69;-1.94;-1.69	3.96	3.96	0.45880	.	0.153981	0.29799	N	0.011161	T	0.64136	0.2571	N	0.02539	-0.55	0.09310	N	0.99999	B	0.23937	0.094	B	0.18871	0.023	T	0.46871	-0.9160	10	0.10377	T	0.69	.	13.8969	0.63778	0.0:0.0:1.0:0.0	.	473	Q9Y458	TBX22_HUMAN	N	473;353;473;353	ENSP00000362393:D473N;ENSP00000396394:D353N;ENSP00000362390:D473N;ENSP00000362388:D353N	ENSP00000362388:D353N	D	+	1	0	TBX22	79173120	1.000000	0.71417	0.647000	0.29507	0.200000	0.23975	1.992000	0.40737	1.813000	0.52934	0.513000	0.50165	GAC		0.378	TBX22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057334.1	NM_016954		12	101	0	0	0	0.013537	0	12	101				
ZNF711	7552	broad.mit.edu	37	X	84526697	84526697	+	Missense_Mutation	SNP	T	T	A			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chrX:84526697T>A	ENST00000373165.3	+	9	2455	c.2149T>A	c.(2149-2151)Tct>Act	p.S717T	ZNF711_ENST00000276123.3_Missense_Mutation_p.S717T|ZNF711_ENST00000360700.4_Missense_Mutation_p.S763T|ZNF711_ENST00000395402.1_Missense_Mutation_p.S725T|ZNF711_ENST00000542798.1_Missense_Mutation_p.S559T	NM_021998.4	NP_068838.3	Q9Y462	ZN711_HUMAN	zinc finger protein 711	717					positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)	p.S717T(1)|p.S727T(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(14)|ovary(3)|skin(4)	28						TACAGATGCATCTGGCTTTAA	0.368																																							uc004eeo.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|skin(1)	4						c.(2149-2151)TCT>ACT		zinc finger protein 711							113.0	98.0	103.0					X																	84526697		2203	4299	6502	SO:0001583	missense	7552				positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding|sequence-specific DNA binding|zinc ion binding	g.chrX:84526697T>A	BC006349	CCDS35344.1	Xq21.1	2014-02-19	2006-06-29	2006-06-29	ENSG00000147180	ENSG00000147180		"""Zinc fingers, C2H2-type"""	13128	protein-coding gene	gene with protein product		314990	"""zinc finger protein 6 (CMPX1)"", ""zinc finger protein 6"""	ZNF6		19377476	Standard	XM_005262186		Approved	CMPX1, ZNF4, ZNF5, dJ75N13.1, Zfp711, MRX97	uc004eeo.3	Q9Y462	OTTHUMG00000021933	ENST00000373165.3:c.2149T>A	X.37:g.84526697T>A	ENSP00000362260:p.Ser717Thr		Somatic				ZNF711_uc004eep.2_Missense_Mutation_p.S717T|ZNF711_uc004eeq.2_Missense_Mutation_p.S763T|ZNF711_uc011mqy.1_Missense_Mutation_p.S316T	p.S717T	NM_021998	NP_068838	WXS	Illumina HiSeq	Unspecified	Q9Y462	ZN711_HUMAN			9	2496	+			717			C2H2-type 11.		B4DSV4|Q6NX42|Q9Y4J6	Missense_Mutation	SNP	ENST00000373165.3	37	c.2149T>A	CCDS35344.1	.	.	.	.	.	.	.	.	.	.	T	18.98	3.737583	0.69304	.	.	ENSG00000147180	ENST00000395402;ENST00000373165;ENST00000276123;ENST00000360700;ENST00000542798	T;T;T;T;T	0.17854	2.25;2.25;2.25;2.25;2.25	4.85	4.85	0.62838	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.000000	0.42548	D	0.000685	T	0.33789	0.0875	L	0.48935	1.535	0.58432	D	0.999996	D;D	0.63880	0.982;0.993	D;D	0.68943	0.961;0.956	T	0.06516	-1.0822	10	0.87932	D	0	-9.661	13.829	0.63368	0.0:0.0:0.0:1.0	.	763;717	Q9Y462-3;Q9Y462	.;ZN711_HUMAN	T	725;717;717;763;559	ENSP00000378798:S725T;ENSP00000362260:S717T;ENSP00000276123:S717T;ENSP00000353922:S763T;ENSP00000442071:S559T	ENSP00000276123:S717T	S	+	1	0	ZNF711	84413353	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.997000	0.88414	1.709000	0.51313	0.412000	0.27726	TCT		0.368	ZNF711-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057388.2	NM_021998		18	130	0	0	0	0.008871	0	18	130				
SYTL4	94121	broad.mit.edu	37	X	99942191	99942191	+	Missense_Mutation	SNP	T	T	A			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chrX:99942191T>A	ENST00000372989.1	-	13	1388	c.1057A>T	c.(1057-1059)Aac>Tac	p.N353Y	SYTL4_ENST00000454200.2_Missense_Mutation_p.N355Y|SYTL4_ENST00000455616.1_Missense_Mutation_p.N353Y|SYTL4_ENST00000263033.5_Missense_Mutation_p.N353Y|SYTL4_ENST00000276141.6_Missense_Mutation_p.N353Y|SYTL4_ENST00000372981.1_3'UTR	NM_080737.2	NP_542775.2	Q96C24	SYTL4_HUMAN	synaptotagmin-like 4	353					exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)|multivesicular body sorting pathway (GO:0071985)|negative regulation of insulin secretion (GO:0046676)|positive regulation of exocytosis (GO:0045921)|positive regulation of protein secretion (GO:0050714)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|endosome (GO:0005768)|extrinsic component of membrane (GO:0019898)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|synaptic vesicle (GO:0008021)	neurexin family protein binding (GO:0042043)|phospholipid binding (GO:0005543)|transporter activity (GO:0005215)|zinc ion binding (GO:0008270)	p.N353Y(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(2)|prostate(1)|skin(2)	27					"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	ACAAAGATGTTCCCGAAATCA	0.527																																							uc004egd.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1057-1059)AAC>TAC		synaptotagmin-like 4	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)						104.0	83.0	90.0					X																	99942191		2203	4300	6503	SO:0001583	missense	94121				exocytosis|intracellular protein transport	extrinsic to membrane|plasma membrane|synaptic vesicle|transport vesicle membrane	neurexin binding|phospholipid binding|Rab GTPase binding|transporter activity|zinc ion binding	g.chrX:99942191T>A		CCDS14472.1	Xq21.33	2008-07-31	2008-07-31		ENSG00000102362	ENSG00000102362			15588	protein-coding gene	gene with protein product	"""granuphilin-a"", ""exophilin-2"""	300723					Standard	NM_080737		Approved		uc010nnc.3	Q96C24	OTTHUMG00000022004	ENST00000372989.1:c.1057A>T	X.37:g.99942191T>A	ENSP00000362080:p.Asn353Tyr		Somatic				SYTL4_uc010nnb.2_Missense_Mutation_p.N25Y|SYTL4_uc010nnc.2_Missense_Mutation_p.N353Y|SYTL4_uc004ege.3_Missense_Mutation_p.N353Y|SYTL4_uc004egf.3_Missense_Mutation_p.N353Y|SYTL4_uc004egg.3_3'UTR	p.N353Y	NM_080737	NP_542775	WXS	Illumina HiSeq	Unspecified	Q96C24	SYTL4_HUMAN			13	1413	-			353					Q5H9J3|Q5JPG8|Q8N9P4|Q9H4R0|Q9H4R1	Missense_Mutation	SNP	ENST00000372989.1	37	c.1057A>T	CCDS14472.1	.	.	.	.	.	.	.	.	.	.	T	21.7	4.181417	0.78677	.	.	ENSG00000102362	ENST00000372989;ENST00000455616;ENST00000454200;ENST00000276141;ENST00000263033	T;T;T;T;T	0.08720	3.06;3.06;3.06;3.06;3.06	5.98	5.98	0.97165	C2 calcium/lipid-binding domain, CaLB (1);	0.126969	0.64402	D	0.000001	T	0.30947	0.0781	M	0.81497	2.545	0.39565	D	0.969185	D	0.71674	0.998	D	0.71414	0.973	T	0.07908	-1.0748	9	.	.	.	-29.6583	15.4011	0.74841	0.0:0.0:0.0:1.0	.	353	Q96C24	SYTL4_HUMAN	Y	353;353;355;353;353	ENSP00000362080:N353Y;ENSP00000390252:N353Y;ENSP00000403556:N355Y;ENSP00000276141:N353Y;ENSP00000263033:N353Y	.	N	-	1	0	SYTL4	99828847	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	4.834000	0.62774	2.021000	0.59480	0.481000	0.45027	AAC		0.527	SYTL4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000057488.1	NM_080737		11	69	0	0	0	0.001855	0	11	69				
IL1RAPL2	26280	broad.mit.edu	37	X	105011610	105011610	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chrX:105011610C>A	ENST00000372582.1	+	11	2773	c.2017C>A	c.(2017-2019)Cct>Act	p.P673T	IL1RAPL2_ENST00000344799.4_Missense_Mutation_p.P673T	NM_017416.1	NP_059112.1	Q9NP60	IRPL2_HUMAN	interleukin 1 receptor accessory protein-like 2	673					central nervous system development (GO:0007417)|cytokine-mediated signaling pathway (GO:0019221)	integral component of membrane (GO:0016021)	interleukin-1 receptor activity (GO:0004908)|interleukin-1, Type II, blocking receptor activity (GO:0004910)	p.P673T(1)		breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(14)|lung(23)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						TTCTTTGCTGCCTTTATCCTC	0.403																																							uc004elz.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(2)|ovary(1)	3						c.(2017-2019)CCT>ACT		interleukin 1 receptor accessory protein-like 2							107.0	106.0	107.0					X																	105011610		2203	4300	6503	SO:0001583	missense	26280				central nervous system development|innate immune response	integral to membrane	interleukin-1, Type II, blocking receptor activity	g.chrX:105011610C>A	AF181285	CCDS14517.1	Xq22	2013-01-11			ENSG00000189108	ENSG00000189108		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5997	protein-coding gene	gene with protein product		300277				10757639	Standard	NM_017416		Approved	IL-1R9, TIGIRR-1, IL1RAPL-2, IL1R9	uc004elz.1	Q9NP60	OTTHUMG00000022141	ENST00000372582.1:c.2017C>A	X.37:g.105011610C>A	ENSP00000361663:p.Pro673Thr		Somatic					p.P673T	NM_017416	NP_059112	WXS	Illumina HiSeq	Unspecified	Q9NP60	IRPL2_HUMAN			11	2773	+			673			Cytoplasmic (Potential).		Q2M3U3|Q9NZN0	Missense_Mutation	SNP	ENST00000372582.1	37	c.2017C>A	CCDS14517.1	.	.	.	.	.	.	.	.	.	.	C	15.56	2.870234	0.51588	.	.	ENSG00000189108	ENST00000372582;ENST00000344799;ENST00000538500	T;T;T	0.06933	3.45;3.45;3.24	5.83	4.97	0.65823	.	0.082263	0.53938	D	0.000057	T	0.14270	0.0345	M	0.72894	2.215	0.58432	D	0.999999	B	0.26081	0.141	B	0.31016	0.123	T	0.01235	-1.1410	10	0.87932	D	0	.	12.7913	0.57534	0.0:0.92:0.0:0.08	.	673	Q9NP60	IRPL2_HUMAN	T	673;673;278	ENSP00000361663:P673T;ENSP00000344976:P673T;ENSP00000445576:P278T	ENSP00000344976:P673T	P	+	1	0	IL1RAPL2	104898266	1.000000	0.71417	0.995000	0.50966	0.731000	0.41821	5.778000	0.68940	1.198000	0.43158	0.600000	0.82982	CCT		0.403	IL1RAPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057785.1	NM_017416		17	121	1	0	8.00594e-06	0.007413	9.05217e-06	17	121				
MCF2	4168	broad.mit.edu	37	X	138708867	138708867	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chrX:138708867G>T	ENST00000370576.4	-	5	696	c.487C>A	c.(487-489)Ctg>Atg	p.L163M	MCF2_ENST00000520602.1_Missense_Mutation_p.L223M|MCF2_ENST00000414978.1_Missense_Mutation_p.L223M|MCF2_ENST00000370573.4_Missense_Mutation_p.L163M|MCF2_ENST00000519895.1_Missense_Mutation_p.L223M|MCF2_ENST00000370578.4_Missense_Mutation_p.L308M|MCF2_ENST00000536274.1_Missense_Mutation_p.L124M|MCF2_ENST00000338585.6_Missense_Mutation_p.L163M	NM_001171879.1|NM_005369.4	NP_001165350.1|NP_005360.3	P10911	MCF2_HUMAN	MCF.2 cell line derived transforming sequence	163					apoptotic signaling pathway (GO:0097190)|dendrite development (GO:0016358)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.L163M(3)|p.L223M(2)		NS(2)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(15)|lung(34)|pancreas(1)|pleura(1)|prostate(1)	62	Acute lymphoblastic leukemia(192;0.000127)					GGCACTTCCAGATTTGTTAGC	0.383																																							uc004fau.2		NA																	5	Substitution - Missense(5)		lung(3)|large_intestine(2)	lung(1)|pleura(1)	2						c.(487-489)CTG>ATG		MCF.2 cell line derived transforming sequence							147.0	134.0	138.0					X																	138708867		2203	4300	6503	SO:0001583	missense	4168				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytoskeleton|cytosol|membrane|membrane fraction	protein binding|Rho guanyl-nucleotide exchange factor activity	g.chrX:138708867G>T		CCDS14667.1, CCDS48175.1, CCDS55514.1, CCDS55515.1, CCDS55516.1, CCDS55517.1	Xq26.3-q27.1	2012-07-24			ENSG00000101977	ENSG00000101977		"""Rho guanine nucleotide exchange factors"""	6940	protein-coding gene	gene with protein product	"""Oncogene MCF2 (oncogene DBL)"""	311030				2577874, 1611909	Standard	NM_001099855		Approved	DBL, ARHGEF21	uc011mwo.1	P10911	OTTHUMG00000022537	ENST00000370576.4:c.487C>A	X.37:g.138708867G>T	ENSP00000359608:p.Leu163Met		Somatic				MCF2_uc004fav.2_Missense_Mutation_p.L163M|MCF2_uc011mwl.1_Missense_Mutation_p.L124M|MCF2_uc010nsh.1_Missense_Mutation_p.L163M|MCF2_uc011mwm.1_Missense_Mutation_p.L124M|MCF2_uc011mwn.1_Missense_Mutation_p.L308M|MCF2_uc004faw.2_Missense_Mutation_p.L223M|MCF2_uc011mwo.1_Missense_Mutation_p.L223M	p.L163M	NM_005369	NP_005360	WXS	Illumina HiSeq	Unspecified	P10911	MCF2_HUMAN			5	781	-	Acute lymphoblastic leukemia(192;0.000127)		163					B7Z3Y5|B7Z869|B7ZAV1|E9PH77|F5H091|P14919|Q5JYJ2|Q5JYJ3|Q5JYJ4|Q8IUF3|Q8IUF4|Q9UJB3	Missense_Mutation	SNP	ENST00000370576.4	37	c.487C>A	CCDS14667.1	.	.	.	.	.	.	.	.	.	.	g	15.01	2.706682	0.48412	.	.	ENSG00000101977	ENST00000520602;ENST00000370576;ENST00000536274;ENST00000370578;ENST00000414978;ENST00000519895;ENST00000370573;ENST00000338585	T;T;T;T;T;T;T;T	0.46819	0.86;0.86;0.86;0.86;0.86;0.86;0.86;0.86	4.57	3.42	0.39159	.	0.308626	0.28895	N	0.013785	T	0.56630	0.1998	L	0.58810	1.83	0.29809	N	0.831758	P;D;P;P;P;P;D;P	0.76494	0.458;0.999;0.593;0.458;0.593;0.458;0.999;0.458	B;D;P;B;P;B;D;B	0.79108	0.313;0.976;0.511;0.313;0.511;0.313;0.992;0.313	T	0.54384	-0.8302	10	0.49607	T	0.09	.	3.9831	0.09503	0.2962:0.0:0.7038:0.0	.	223;308;124;163;163;308;163;163	E9PH77;B7Z3Z2;F5H091;B2R9S6;P10911-2;Q5JYJ7;P10911-4;P10911	.;.;.;.;.;.;.;MCF2_HUMAN	M	223;163;124;308;223;223;163;163	ENSP00000427745:L223M;ENSP00000359608:L163M;ENSP00000438155:L124M;ENSP00000359610:L308M;ENSP00000397055:L223M;ENSP00000430276:L223M;ENSP00000359605:L163M;ENSP00000342204:L163M	ENSP00000342204:L163M	L	-	1	2	MCF2	138536533	1.000000	0.71417	0.997000	0.53966	0.909000	0.53808	2.839000	0.48207	1.991000	0.58162	0.597000	0.82753	CTG		0.383	MCF2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058560.1	NM_005369		15	118	1	0	3.27435e-08	0.00245	3.90177e-08	15	118				
GABRQ	55879	broad.mit.edu	37	X	151821213	151821213	+	Silent	SNP	C	C	T			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chrX:151821213C>T	ENST00000370306.2	+	9	1388	c.1368C>T	c.(1366-1368)acC>acT	p.T456T		NM_018558.2	NP_061028.3	Q9UN88	GBRT_HUMAN	gamma-aminobutyric acid (GABA) A receptor, theta	456					neurotransmitter transport (GO:0006836)|signal transduction (GO:0007165)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|neurotransmitter transporter activity (GO:0005326)|transmembrane signaling receptor activity (GO:0004888)	p.T456T(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(9)|lung(25)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	52	Acute lymphoblastic leukemia(192;6.56e-05)				Acamprosate(DB00659)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	TCCCCTCCACCTCAGAGCAGG	0.592																																							uc004ffp.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|pancreas(1)	3						c.(1366-1368)ACC>ACT		gamma-aminobutyric acid (GABA) receptor, theta							102.0	94.0	96.0					X																	151821213		2203	4300	6503	SO:0001819	synonymous_variant	55879					cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|neurotransmitter transporter activity	g.chrX:151821213C>T	U47334	CCDS14707.1	Xq28	2012-06-22	2012-02-03		ENSG00000147402	ENSG00000268089		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	14454	protein-coding gene	gene with protein product	"""GABA(A) receptor, theta"""	300349	"""gamma-aminobutyric acid (GABA) receptor, theta"""			10804200, 10449790	Standard	NM_018558		Approved	THETA	uc004ffp.1	Q9UN88	OTTHUMG00000022649	ENST00000370306.2:c.1368C>T	X.37:g.151821213C>T			Somatic					p.T456T	NM_018558	NP_061028	WXS	Illumina HiSeq	Unspecified	Q9UN88	GBRT_HUMAN			9	1388	+	Acute lymphoblastic leukemia(192;6.56e-05)		456					A6NFN1|Q32MB4|Q9NZK8	Silent	SNP	ENST00000370306.2	37	c.1368C>T	CCDS14707.1																																																																																				0.592	GABRQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058763.2	NM_018558		5	127	0	0	0	0.000602	0	5	127				
GDI1	2664	broad.mit.edu	37	X	153668809	153668809	+	Missense_Mutation	SNP	A	A	T			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chrX:153668809A>T	ENST00000447750.2	+	6	1010	c.675A>T	c.(673-675)ttA>ttT	p.L225F		NM_001493.2	NP_001484.1	P31150	GDIA_HUMAN	GDP dissociation inhibitor 1	225					negative regulation of axonogenesis (GO:0050771)|negative regulation of protein targeting to membrane (GO:0090315)|protein transport (GO:0015031)|Rab protein signal transduction (GO:0032482)|regulation of catalytic activity (GO:0050790)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|midbody (GO:0030496)|neuron projection (GO:0043005)|protein complex (GO:0043234)	GDP-dissociation inhibitor activity (GO:0005092)|GTPase activator activity (GO:0005096)|Rab GDP-dissociation inhibitor activity (GO:0005093)	p.L225F(1)		autonomic_ganglia(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	16	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GCCCATATTTATACCCGCTCT	0.567																																							uc004fli.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(673-675)TTA>TTT		GDP dissociation inhibitor 1							109.0	97.0	101.0					X																	153668809		2203	4300	6503	SO:0001583	missense	2664				protein transport|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|midbody	GTPase activator activity|protein binding	g.chrX:153668809A>T	X79353	CCDS35452.1	Xq28	2008-08-01			ENSG00000203879	ENSG00000203879			4226	protein-coding gene	gene with protein product	"""mental retardation, X-linked 41"", ""mental retardation, X-linked 48"", ""rab GDP-dissociation inhibitor, alpha"""	300104		MRX48, MRX41, GDIL		7543319, 7849400	Standard	NM_001493		Approved	RABGDIA, XAP-4, OPHN2, FLJ41411	uc004fli.4	P31150	OTTHUMG00000033293	ENST00000447750.2:c.675A>T	X.37:g.153668809A>T	ENSP00000394071:p.Leu225Phe		Somatic				GDI1_uc011mzo.1_3'UTR|GDI1_uc004flj.2_5'Flank	p.L225F	NM_001493	NP_001484	WXS	Illumina HiSeq	Unspecified	P31150	GDIA_HUMAN			6	1017	+	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)		225					P50394|Q6FG50|Q7Z2G6|Q7Z2G9|Q7Z2H5|Q7Z2I6	Missense_Mutation	SNP	ENST00000447750.2	37	c.675A>T	CCDS35452.1	.	.	.	.	.	.	.	.	.	.	A	12.45	1.941290	0.34283	.	.	ENSG00000203879	ENST00000447750;ENST00000369741	D	0.90069	-2.61	5.71	-11.4	0.00090	.	0.000000	0.64402	D	0.000002	D	0.93625	0.7964	M	0.90759	3.145	0.44587	D	0.997558	D	0.76494	0.999	D	0.80764	0.994	D	0.99964	1.1794	10	0.87932	D	0	-3.9801	18.4995	0.90876	0.0793:0.2785:0.6422:0.0	.	225	P31150	GDIA_HUMAN	F	225;209	ENSP00000394071:L225F	ENSP00000358756:L209F	L	+	3	2	GDI1	153322003	0.000000	0.05858	0.000000	0.03702	0.160000	0.22226	-3.661000	0.00400	-4.731000	0.00034	-0.323000	0.08544	TTA		0.567	GDI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081649.2	NM_001493		18	70	0	0	0	0.006122	0	18	70				
OR2B11	127623	broad.mit.edu	37	1	247614375	247614375	+	Frame_Shift_Del	DEL	C	C	-			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr1:247614375delC	ENST00000318749.6	-	1	933	c.910delG	c.(910-912)gctfs	p.A304fs		NM_001004492.1	NP_001004492.1	Q5JQS5	OR2BB_HUMAN	olfactory receptor, family 2, subfamily B, member 11	304						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(13)|large_intestine(7)|lung(31)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	60	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.241)	OV - Ovarian serous cystadenocarcinoma(106;0.0188)			CTCCTCAGAGCCCCCTTCATA	0.458																																							uc010pyx.1		NA																	0				upper_aerodigestive_tract(1)	1						c.(910-912)GCTfs		olfactory receptor, family 2, subfamily B,							196.0	210.0	205.0					1																	247614375		2203	4300	6503	SO:0001589	frameshift_variant	127623				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:247614375delC		CCDS31090.1	1q44	2012-08-09			ENSG00000177535	ENSG00000177535		"""GPCR / Class A : Olfactory receptors"""	31249	protein-coding gene	gene with protein product							Standard	NM_001004492		Approved		uc010pyx.2	Q5JQS5	OTTHUMG00000040572	ENST00000318749.6:c.910delG	1.37:g.247614375delC	ENSP00000325682:p.Ala304fs		Somatic					p.A304fs	NM_001004492	NP_001004492	WXS	Illumina HiSeq	Unspecified	Q5JQS5	OR2BB_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0188)		1	910	-	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.241)	304			Cytoplasmic (Potential).		B2RP03	Frame_Shift_Del	DEL	ENST00000318749.6	37	c.910delG	CCDS31090.1																																																																																				0.458	OR2B11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097620.1	NM_001004492		9	763	NA	NA	NA	NA	NA	9	763	---	---	---	---
NLRP14	338323	broad.mit.edu	37	11	7079029	7079029	+	Frame_Shift_Del	DEL	C	C	-			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr11:7079029delC	ENST00000299481.4	+	7	2759	c.2413delC	c.(2413-2415)cttfs	p.L806fs		NM_176822.3	NP_789792.1	Q86W24	NAL14_HUMAN	NLR family, pyrin domain containing 14	806					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)		ATP binding (GO:0005524)			breast(3)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	21				Epithelial(150;4.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0871)		TGGAGTGCAGCTTTTGTGTGA	0.383																																							uc001mfb.1		NA																	0				ovary(3)|breast(2)|pancreas(1)|lung(1)|skin(1)	8						c.(2413-2415)CTTfs		NLR family, pyrin domain containing 14							236.0	211.0	219.0					11																	7079029		2201	4296	6497	SO:0001589	frameshift_variant	338323				cell differentiation|multicellular organismal development|spermatogenesis		ATP binding	g.chr11:7079029delC	BK001107	CCDS7776.1	11p15.4	2006-12-08	2006-12-08	2006-12-08		ENSG00000158077		"""Nucleotide-binding domain and leucine rich repeat containing"""	22939	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 14"""	609665	"""NACHT, leucine rich repeat and PYD containing 14"""	NALP14		12563287	Standard	NM_176822		Approved	NOD5, GC-LRR, Nalp-iota, PAN8, CLR11.2	uc001mfb.1	Q86W24		ENST00000299481.4:c.2413delC	11.37:g.7079029delC	ENSP00000299481:p.Leu806fs		Somatic					p.L805fs	NM_176822	NP_789792	WXS	Illumina HiSeq	Unspecified	Q86W24	NAL14_HUMAN		Epithelial(150;4.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0871)	7	2736	+			805			LRR 3.		Q7RTR6	Frame_Shift_Del	DEL	ENST00000299481.4	37	c.2413delC	CCDS7776.1																																																																																				0.383	NLRP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384551.1	NM_176822		24	210	NA	NA	NA	NA	NA	24	210	---	---	---	---
GCN1L1	10985	broad.mit.edu	37	12	120580382	120580383	+	Frame_Shift_Ins	INS	-	-	C			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr12:120580382_120580383insC	ENST00000300648.6	-	44	5769_5770	c.5757_5758insG	c.(5755-5760)ttgcgtfs	p.R1920fs		NM_006836.1	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis 1-like 1 (yeast)	1920					regulation of translation (GO:0006417)|translation (GO:0006412)	cytoplasm (GO:0005737)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)			NS(2)|breast(2)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(13)|liver(1)|lung(36)|ovary(4)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	94	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					AGGATCTCACGCAAGGTGCGGG	0.589																																							uc001txo.2		NA																	0				ovary(4)	4						c.(5755-5760)TTGCGTfs		GCN1 general control of amino-acid synthesis																																				SO:0001589	frameshift_variant	10985				regulation of translation	ribosome	protein binding|translation factor activity, nucleic acid binding	g.chr12:120580382_120580383insC	U77700	CCDS41847.1	12q24.2	2008-07-03	2001-11-28						4199	protein-coding gene	gene with protein product		605614	"""GCN1 (general control of amino-acid synthesis 1, yeast)-like 1"""			9234705	Standard	NM_006836		Approved	KIAA0219, GCN1, GCN1L	uc001txo.3	Q92616	OTTHUMG00000169338	ENST00000300648.6:c.5758dupG	12.37:g.120580383_120580383dupC	ENSP00000300648:p.Arg1920fs		Somatic					p.L1919fs	NM_006836	NP_006827	WXS	Illumina HiSeq	Unspecified	Q92616	GCN1L_HUMAN			44	5770_5771	-	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)		1919_1920					A8KAY1|O95001|O95651|Q6P2S3|Q86X65|Q8N5I5|Q8WU80|Q99736|Q9UE60	Frame_Shift_Ins	INS	ENST00000300648.6	37	c.5757_5758insG	CCDS41847.1																																																																																				0.589	GCN1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403592.1			22	77	NA	NA	NA	NA	NA	22	77	---	---	---	---
HNRNPC	3183	broad.mit.edu	37	14	21681149	21681161	+	Frame_Shift_Del	DEL	CACTCTTAGAATT	CACTCTTAGAATT	-			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	CACTCTTAGAATT	CACTCTTAGAATT	-	-	CACTCTTAGAATT	CACTCTTAGAATT	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr14:21681149_21681161delCACTCTTAGAATT	ENST00000320084.7	-	5	759_771	c.520_532delAATTCTAAGAGTG	c.(520-534)aattctaagagtggafs	p.NSKSG174fs	HNRNPC_ENST00000449098.1_Frame_Shift_Del_p.NSKSG161fs|HNRNPC_ENST00000553753.1_Frame_Shift_Del_p.NSKSG161fs|HNRNPC_ENST00000555883.1_Intron|HNRNPC_ENST00000430246.2_Frame_Shift_Del_p.NSKSG161fs|HNRNPC_ENST00000554455.1_Frame_Shift_Del_p.NSKSG174fs|HNRNPC_ENST00000556142.1_Frame_Shift_Del_p.NSKSG174fs|HNRNPC_ENST00000420743.2_Frame_Shift_Del_p.NSKSG174fs|HNRNPC_ENST00000556897.1_Frame_Shift_Del_p.NSKSG161fs|HNRNPC_ENST00000336053.6_Frame_Shift_Del_p.NSKSG161fs|HNRNPC_ENST00000555309.1_Frame_Shift_Del_p.NSKSG174fs|HNRNPC_ENST00000556513.1_Frame_Shift_Del_p.NSKSG174fs|HNRNPC_ENST00000556628.1_Frame_Shift_Del_p.NSKSG94fs|HNRNPC_ENST00000554969.1_Frame_Shift_Del_p.NSKSG161fs|HNRNPC_ENST00000553300.1_Frame_Shift_Del_p.NSKSG161fs|HNRNPC_ENST00000557201.1_Frame_Shift_Del_p.NSKSG174fs|HNRNPC_ENST00000555914.1_Frame_Shift_Del_p.NSKSG161fs	NM_001077442.1	NP_001070910.1	P07910	HNRPC_HUMAN	heterogeneous nuclear ribonucleoprotein C (C1/C2)	174					3'-UTR-mediated mRNA stabilization (GO:0070935)|ATP-dependent chromatin remodeling (GO:0043044)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|spliceosomal complex (GO:0005681)	identical protein binding (GO:0042802)|mRNA 3'-UTR binding (GO:0003730)|nucleosomal DNA binding (GO:0031492)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)	p.K176N(1)		breast(1)|liver(1)|lung(6)|skin(1)	9	all_cancers(95;0.00176)		Epithelial(56;1.08e-06)|all cancers(55;8.95e-06)	GBM - Glioblastoma multiforme(265;0.00783)		CCCCGCTGTCCACTCTTAGAATTGAAGCCACTT	0.455																																					NSCLC(108;607 2244 12726 38757)	NSCLC(108;607 2244 12726 38757)	uc001vzy.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(520-534)AATTCTAAGAGTGGAfs		heterogeneous nuclear ribonucleoprotein C																																				SO:0001589	frameshift_variant	3183					catalytic step 2 spliceosome|nucleoplasm	identical protein binding|nucleotide binding|RNA binding	g.chr14:21681149_21681161delCACTCTTAGAATT		CCDS41915.1, CCDS45079.1	14q11.2	2013-06-12		2007-08-16	ENSG00000092199	ENSG00000092199		"""RNA binding motif (RRM) containing"""	5035	protein-coding gene	gene with protein product		164020		HNRPC		3457372	Standard	NM_031314		Approved	hnRNPC	uc001waa.3	P07910	OTTHUMG00000170757	ENST00000320084.7:c.520_532delAATTCTAAGAGTG	14.37:g.21681149_21681161delCACTCTTAGAATT	ENSP00000319690:p.Asn174fs		Somatic				HNRNPC_uc001vzw.2_Frame_Shift_Del_p.N161fs|HNRNPC_uc001wad.2_Frame_Shift_Del_p.N94fs|HNRNPC_uc001vzx.2_Intron|HNRNPC_uc001vzz.2_Frame_Shift_Del_p.N161fs|HNRNPC_uc001waa.2_Frame_Shift_Del_p.N174fs|HNRNPC_uc010ail.2_Frame_Shift_Del_p.N174fs|HNRNPC_uc010tlq.1_RNA|HNRNPC_uc001wab.2_Frame_Shift_Del_p.N161fs|HNRNPC_uc001wac.2_Intron|HNRNPC_uc010tlr.1_Frame_Shift_Del_p.N39fs|HNRNPC_uc001waf.2_Frame_Shift_Del_p.N161fs|HNRNPC_uc001wae.2_Frame_Shift_Del_p.N161fs	p.N174fs	NM_031314	NP_112604	WXS	Illumina HiSeq	Unspecified	P07910	HNRPC_HUMAN	Epithelial(56;1.08e-06)|all cancers(55;8.95e-06)	GBM - Glioblastoma multiforme(265;0.00783)	6	764_776	-	all_cancers(95;0.00176)		174_178					D3DS19|D3DS22|P22628|Q53EX2|Q59FD3|Q5FWE8|Q86SF8|Q86U45|Q96HK7|Q96HM4|Q96IY5|Q9BTS3	Frame_Shift_Del	DEL	ENST00000320084.7	37	c.520_532delAATTCTAAGAGTG	CCDS41915.1																																																																																				0.455	HNRNPC-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000410235.1			10	176	NA	NA	NA	NA	NA	10	176	---	---	---	---
NPHS1	4868	broad.mit.edu	37	19	36333449	36333451	+	Splice_Site	DEL	CTC	CTC	-			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	CTC	CTC	-	-	CTC	CTC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr19:36333449_36333451delCTC	ENST00000378910.5	-	18	2335_2337	c.2336_2338delGAG	c.(2335-2340)ggagaa>gaa	p.G779del	NPHS1_ENST00000353632.6_Splice_Site_p.G779del	NM_004646.3	NP_004637.1	O60500	NPHN_HUMAN	nephrosis 1, congenital, Finnish type (nephrin)	779	Ig-like C2-type 7.				cell adhesion (GO:0007155)|excretion (GO:0007588)|glomerular basement membrane development (GO:0032836)|glomerular visceral epithelial cell development (GO:0072015)|JNK cascade (GO:0007254)|myoblast fusion (GO:0007520)|positive regulation of actin filament polymerization (GO:0030838)|regulation of excretion (GO:0044062)|skeletal muscle tissue development (GO:0007519)	cell projection (GO:0042995)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)	myosin binding (GO:0017022)			NS(2)|breast(1)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|liver(1)|lung(26)|ovary(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	74	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			TCCTCATCTTCTCCCTGGAGGCC	0.581																																							uc002oby.2		NA																	0		p.G779*(1)		ovary(4)|skin(1)	5						c.(2335-2340)GGAGAA>GAA		nephrin precursor																																				SO:0001630	splice_region_variant	4868				cell adhesion|excretion|muscle organ development	integral to plasma membrane		g.chr19:36333449_36333451delCTC		CCDS32996.1	19q12-q13.1	2014-09-17				ENSG00000161270		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7908	protein-coding gene	gene with protein product		602716				9915943, 9660941	Standard	NM_004646		Approved	CNF, NPHN	uc002oby.3	O60500		ENST00000378910.5:c.2335-1GAG>-	19.37:g.36333449_36333451delCTC			Somatic					p.G779del	NM_004646	NP_004637	WXS	Illumina HiSeq	Unspecified	O60500	NPHN_HUMAN	LUSC - Lung squamous cell carcinoma(66;0.0515)		18	2336_2338	-	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		779			Ig-like C2-type 7.|Extracellular (Potential).		A6NDH2|C3RX61	In_Frame_Del	DEL	ENST00000378910.5	37	c.2336_2338delGAG	CCDS32996.1																																																																																				0.581	NPHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452553.1		In_Frame_Del	20	133	NA	NA	NA	NA	NA	20	133	---	---	---	---
HIST1H4B	8366	broad.mit.edu	37	6	26027259	26027267	+	In_Frame_Del	DEL	CGTGTAGGT	CGTGTAGGT	-	rs139832518|rs367858628		TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	CGTGTAGGT	CGTGTAGGT	-	-	CGTGTAGGT	CGTGTAGGT	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr6:26027259_26027267delCGTGTAGGT	ENST00000377364.3	-	1	213_221	c.214_222delACCTACACG	c.(214-222)acctacacgdel	p.TYT72del		NM_003544.2	NP_003535.1	P62805	H4_HUMAN	histone cluster 1, H4b	72					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)			large_intestine(4)|lung(6)|ovary(2)|upper_aerodigestive_tract(1)	13						TGGCGTGCTCCGTGTAGGTCACGGCGTCC	0.55											OREG0017238	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc003nfr.2		NA																	0				ovary(2)	2						c.(214-222)ACCTACACGdel		histone cluster 1, H4b																																				SO:0001651	inframe_deletion	8366				CenH3-containing nucleosome assembly at centromere|negative regulation of megakaryocyte differentiation|phosphatidylinositol-mediated signaling|telomere maintenance	nucleoplasm|nucleosome	DNA binding|protein binding	g.chr6:26027259_26027267delCGTGTAGGT	X67081	CCDS4572.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000124529	ENSG00000278705		"""Histones / Replication-dependent"""	4789	protein-coding gene	gene with protein product		602829	"""H4 histone family, member I"", ""histone 1, H4b"""	H4FI		9119399, 12408966	Standard	NM_003544		Approved	H4/I	uc003nfr.3	P62805	OTTHUMG00000014417	ENST00000377364.3:c.214_222delACCTACACG	6.37:g.26027259_26027267delCGTGTAGGT	ENSP00000366581:p.Thr72_Thr74del		Somatic	OREG0017238	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	783		p.TYT72del	NM_003544	NP_003535	WXS	Illumina HiSeq	Unspecified	P62805	H4_HUMAN			1	214_222	-			72_74					A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	In_Frame_Del	DEL	ENST00000377364.3	37	c.214_222delACCTACACG	CCDS4572.1																																																																																				0.550	HIST1H4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040079.2	NM_003544		20	120	NA	NA	NA	NA	NA	20	120	---	---	---	---
EGFR	1956	broad.mit.edu	37	7	55242465	55242479	+	In_Frame_Del	DEL	GGAATTAAGAGAAGC	GGAATTAAGAGAAGC	-	rs121913438|rs121913439|rs397517099|rs397517098|rs397517097|rs397517096|rs397517095|rs397517094|rs121913435|rs121913436|rs121913437|rs397509368|rs121913229|rs121913441|rs121913440|rs121913442|rs121913423|rs121913422|rs121913421|rs121913427|rs121913426|rs121913425|rs121913424		TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	GGAATTAAGAGAAGC	GGAATTAAGAGAAGC	-	-	GGAATTAAGAGAAGC	GGAATTAAGAGAAGC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr7:55242465_55242479delGGAATTAAGAGAAGC	ENST00000275493.2	+	19	2412_2426	c.2235_2249delGGAATTAAGAGAAGC	c.(2233-2250)aaggaattaagagaagca>aaa	p.ELREA746del	EGFR_ENST00000455089.1_In_Frame_Del_p.ELREA701del|EGFR_ENST00000442591.1_Intron|EGFR_ENST00000454757.2_In_Frame_Del_p.ELREA693del	NM_005228.3	NP_005219.2	P00533	EGFR_HUMAN	epidermal growth factor receptor	746	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		ELREAT -> A (found in a lung cancer sample). {ECO:0000269|PubMed:15623594}.|ELREATS -> D (found in a lung cancer sample). {ECO:0000269|PubMed:15623594}.|Missing (found in a lung cancer sample). {ECO:0000269|PubMed:15623594}.|Missing (found in a lung cancer sample). {ECO:0000269|PubMed:16533793}.		activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|activation of phospholipase C activity (GO:0007202)|alkanesulfonate metabolic process (GO:0019694)|astrocyte activation (GO:0048143)|axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cellular response to amino acid stimulus (GO:0071230)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to drug (GO:0035690)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to estradiol stimulus (GO:0071392)|cellular response to mechanical stimulus (GO:0071260)|cerebral cortex cell migration (GO:0021795)|circadian rhythm (GO:0007623)|digestive tract morphogenesis (GO:0048546)|diterpenoid metabolic process (GO:0016101)|embryonic placenta development (GO:0001892)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hair follicle development (GO:0001942)|hydrogen peroxide metabolic process (GO:0042743)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|liver development (GO:0001889)|lung development (GO:0030324)|magnesium ion homeostasis (GO:0010960)|MAPK cascade (GO:0000165)|morphogenesis of an epithelial fold (GO:0060571)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein catabolic process (GO:0042177)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|polysaccharide metabolic process (GO:0005976)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of DNA repair (GO:0045739)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein autophosphorylation (GO:0046777)|protein insertion into membrane (GO:0051205)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to calcium ion (GO:0051592)|response to cobalamin (GO:0033590)|response to hydroxyisoflavone (GO:0033594)|response to osmotic stress (GO:0006970)|response to oxidative stress (GO:0006979)|response to stress (GO:0006950)|response to UV-A (GO:0070141)|salivary gland morphogenesis (GO:0007435)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|tongue development (GO:0043586)|translation (GO:0006412)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|Shc-EGFR complex (GO:0070435)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|epidermal growth factor-activated receptor activity (GO:0005006)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)	p.E746_A750del(1007)|p.L747_P753>S(123)|p.L747_A750>P(82)|p.L747_T751del(76)|p.E746_S752>V(57)|p.L747_S752del(34)|p.L747_T751>P(21)|p.E746_T751>A(21)|p.L747_E749del(16)|p.E746_E749del(9)|p.L747_T751>S(7)|p.L747_P753>Q(7)|p.K745_E749del(6)|p.E746_T751>V(6)|p.L747S(6)|p.E746_S752>A(6)|p.E746_T751>VA(6)|p.K745_E746insIPVAIK(5)|p.L747_T751>Q(5)|p.E746_T751del(4)|p.E746_T751>I(4)|p.E746_S752>D(4)|p.E746_S752>I(4)|p.K745_E746insVPVAIK(4)|p.E746_A750>IP(3)|p.L747P(3)|p.L747_S752>Q(3)|p.E746K(3)|p.E746_T751>IP(3)|p.E746_T751>VP(3)|p.E746_A750>RP(2)|p.L747_S752>QH(2)|p.E746_S752del(2)|p.A750_E758>P(2)|p.E746_P753>VS(2)|p.E746_A750>QP(2)|p.L747_K754del(2)|p.L747_K754>ST(1)|p.E746_A750>VP(1)|p.A750_K754del(1)|p.L747_P753del(1)|p.E746del(1)|p.L747_K754>N(1)|p.E746_P753>IS(1)|p.E746_T751>L(1)|p.L747_R748>FP(1)|p.E749G(1)|p.L747_T751>A(1)|p.I744_E749>LKR(1)|p.E746_P753>LS(1)|p.E746_T751>Q(1)|p.E746_T751>S(1)|p.E746_P753>VQ(1)|p.E746_A750>DP(1)|p.A750_E758del(1)|p.E746V(1)|p.I744_A750>VK(1)|p.R748I(1)|p.K745_E746insTPVAIK(1)|p.K745_A750del(1)|p.R748K(1)		NS(2)|adrenal_gland(5)|biliary_tract(8)|bone(3)|breast(18)|central_nervous_system(106)|endometrium(26)|eye(3)|haematopoietic_and_lymphoid_tissue(9)|kidney(11)|large_intestine(85)|liver(2)|lung(13575)|oesophagus(21)|ovary(38)|pancreas(3)|peritoneum(11)|pleura(2)|prostate(35)|salivary_gland(11)|skin(9)|small_intestine(1)|soft_tissue(4)|stomach(41)|thymus(2)|thyroid(14)|upper_aerodigestive_tract(59)|urinary_tract(6)	14110	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Afatinib(DB08916)|Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)|Vandetanib(DB05294)	TCGCTATCAAGGAATTAAGAGAAGCAACATCTCCG	0.479	E746K(HCC827_LUNG)|E746_A750del(NCIH1650_LUNG)|E746_A750del(PC14_LUNG)|L747_P753>Q(HCC4006_LUNG)	8	"""A, O, Mis"""		"""glioma, NSCLC"""	NSCLC			Lung Cancer, Familial Clustering of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)																													uc003tqk.2	E746_A750del(NCIH1650_LUNG)|E746K(HCC827_LUNG)|E746_A750del(PC14_LUNG)|L747_P753>Q(HCC4006_LUNG)	8	yes	Dom	yes	Familial lung cancer	7	7p12.3-p12.1	1956	A|O|Mis	"""epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)"""			"""E, O"""		NSCLC	glioma|NSCLC		1576	Deletion - In frame(1161)|Complex - deletion inframe(388)|Substitution - Missense(16)|Insertion - In frame(10)|Complex - compound substitution(1)	p.E746_A750del(1613)|p.L747_P753>S(110)|p.L747_A750>P(74)|p.E746_S752>V(67)|p.L747_T751del(62)|p.E746_T751>A(30)|p.L747_S752del(28)|p.L747_T751>P(20)|p.E746_T751del(18)|p.L747_E749del(18)|p.K745_E749del(14)|p.E746_E749del(12)|p.E746_S752del(10)|p.L747_T751>S(7)|p.L747_P753>Q(7)|p.E746_P753>VS(6)|p.E746_A750>IP(5)|p.L747_T751>Q(5)|p.E746_T751>I(5)|p.E746_T751>V(5)|p.E746_S752>A(5)|p.E746_T751>IP(5)|p.E746_A750>QP(4)|p.E746V(4)|p.E746_S752>D(4)|p.K745_A750del(4)|p.L747S(3)|p.L747_S752>Q(3)|p.A750P(3)|p.E746_T751>VA(3)|p.E746_T751>VP(3)|p.E746_A750>RP(2)|p.E746_A750>S(2)|p.E746_S752>T(2)|p.A750_E758>P(2)|p.E746_T751>Q(2)|p.E746_T751>S(2)|p.E746_A750>DP(2)|p.E746_T751>L(2)|p.E746K(2)|p.E746_P753del(2)|p.E746_S752>I(2)|p.K745_E746insVPVAIK(2)|p.E746_A750>AP(2)|p.L747_K754>ST(1)|p.E746_A750>A(1)|p.E746_T751>P(1)|p.E746del(1)|p.A750_K754del(1)|p.L747_S752>QH(1)|p.L747P(1)|p.E746_A750>VP(1)|p.L747_K754>N(1)|p.L747_R748>FP(1)|p.K745_L747del(1)|p.L747_T751>A(1)|p.E746_P753>LS(1)|p.E746_P753>VQ(1)|p.E746_T751>LS(1)|p.A750_E758del(1)|p.E746_R748del(1)|p.I744_A750>VK(1)|p.E746I(1)|p.L747_K754del(1)|p.R748I(1)|p.E746_A750>KP(1)|p.E746_A750>EP(1)	lung(1549)|upper_aerodigestive_tract(9)|salivary_gland(6)|thyroid(3)|large_intestine(2)|breast(2)|ovary(2)|central_nervous_system(1)|prostate(1)|kidney(1)	lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571						c.(2233-2250)AAGGAATTAAGAGAAGCA>AAA		epidermal growth factor receptor isoform a	Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)																																			SO:0001651	inframe_deletion	1956	Lung_Cancer_Familial_Clustering_of	Familial Cancer Database	incl. Hereditary Lung cancer, Hereditary Non-Small Cell Lung cancer	activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	g.chr7:55242465_55242479delGGAATTAAGAGAAGC		CCDS5514.1, CCDS5515.1, CCDS5516.1, CCDS47587.1	7p12	2014-09-17	2010-06-25		ENSG00000146648	ENSG00000146648			3236	protein-coding gene	gene with protein product	"""erythroblastic leukemia viral (v-erb-b) oncogene homolog (avian)"""	131550	"""epidermal growth factor receptor (avian erythroblastic leukemia viral (v-erb-b) oncogene homolog)"""	ERBB		1505215	Standard	NM_201282		Approved	ERBB1	uc003tqk.3	P00533	OTTHUMG00000023661	ENST00000275493.2:c.2235_2249delGGAATTAAGAGAAGC	7.37:g.55242465_55242479delGGAATTAAGAGAAGC	ENSP00000275493:p.Glu746_Ala750del	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)	Somatic				EGFR_uc010kzg.1_In_Frame_Del_p.ELREA701del|EGFR_uc011kco.1_In_Frame_Del_p.ELREA693del	p.ELREA746del	NM_005228	NP_005219	WXS	Illumina HiSeq	Unspecified	P00533	EGFR_HUMAN	GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		19	2481_2495	+	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		746_750		Missing (found in a lung cancer sample).	Cytoplasmic (Potential).|Protein kinase.		O00688|O00732|P06268|Q14225|Q68GS5|Q92795|Q9BZS2|Q9GZX1|Q9H2C9|Q9H3C9|Q9UMD7|Q9UMD8|Q9UMG5	In_Frame_Del	DEL	ENST00000275493.2	37	c.2235_2249delGGAATTAAGAGAAGC	CCDS5514.1																																																																																				0.479	EGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251456.2	NM_005228		31	85	NA	NA	NA	NA	NA	31	85	---	---	---	---
KDM7A	80853	broad.mit.edu	37	7	139838949	139838949	+	Frame_Shift_Del	DEL	A	A	-			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr7:139838949delA	ENST00000397560.2	-	2	333	c.236delT	c.(235-237)ctgfs	p.L79fs	JHDM1D_ENST00000006967.5_Frame_Shift_Del_p.L79fs	NM_030647.1	NP_085150.1	Q6ZMT4	KDM7A_HUMAN		79					histone H3-K27 demethylation (GO:0071557)|histone H3-K36 demethylation (GO:0070544)|histone H3-K9 demethylation (GO:0033169)|histone H4-K20 demethylation (GO:0035574)|midbrain development (GO:0030901)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K27 specific) (GO:0071558)|histone demethylase activity (H3-K36 specific) (GO:0051864)|histone demethylase activity (H3-K9 specific) (GO:0032454)|histone demethylase activity (H4-K20 specific) (GO:0035575)|iron ion binding (GO:0005506)|methylated histone binding (GO:0035064)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|skin(1)|stomach(1)	22	Melanoma(164;0.0142)					ACAGTGATACAGGTCAATGTC	0.353																																							uc003vvm.2		NA																	0				ovary(1)	1						c.(235-237)CTGfs		jumonji C domain containing histone demethylase							157.0	147.0	150.0					7																	139838949		1922	4137	6059	SO:0001589	frameshift_variant	80853				midbrain development|transcription, DNA-dependent	nucleolus	histone demethylase activity (H3-K27 specific)|histone demethylase activity (H3-K36 specific)|histone demethylase activity (H3-K9 specific)|histone demethylase activity (H4-K20 specific)|iron ion binding|methylated histone residue binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding	g.chr7:139838949delA																												ENST00000397560.2:c.236delT	7.37:g.139838949delA	ENSP00000380692:p.Leu79fs		Somatic					p.L79fs	NM_030647	NP_085150	WXS	Illumina HiSeq	Unspecified	Q6ZMT4	KDM7_HUMAN			2	240	-	Melanoma(164;0.0142)		79			PHD-type.		A4D1S9|C9JJH9|C9JQU2|Q6MZL8|Q9C0E5	Frame_Shift_Del	DEL	ENST00000397560.2	37	c.236delT	CCDS43658.1																																																																																				0.353	JHDM1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348460.1			7	209	NA	NA	NA	NA	NA	7	209	---	---	---	---
ACO1	48	broad.mit.edu	37	9	32424665	32424666	+	Splice_Site	INS	-	-	AG			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr9:32424665_32424666insAG	ENST00000309951.6	+	10	1326		c.e10+2		ACO1_ENST00000541043.1_Splice_Site|ACO1_ENST00000379923.1_Splice_Site	NM_002197.2	NP_002188.1	P21399	ACOC_HUMAN	aconitase 1, soluble						cellular iron ion homeostasis (GO:0006879)|citrate metabolic process (GO:0006101)|intestinal absorption (GO:0050892)|post-embryonic development (GO:0009791)|regulation of translation (GO:0006417)|response to iron(II) ion (GO:0010040)|tricarboxylic acid cycle (GO:0006099)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)	4 iron, 4 sulfur cluster binding (GO:0051539)|aconitate hydratase activity (GO:0003994)|iron-responsive element binding (GO:0030350)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)			breast(1)|endometrium(7)|kidney(5)|large_intestine(6)|lung(6)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	30			LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;3.94e-06)		GGAGCCAAGGTAGGGGCCTGCG	0.515																																							uc003zqw.3		NA																	0					0						c.e10+2		aconitase 1																																				SO:0001630	splice_region_variant	48				citrate metabolic process|response to iron(II) ion|tricarboxylic acid cycle	cytosol|endoplasmic reticulum|Golgi apparatus	4 iron, 4 sulfur cluster binding|aconitate hydratase activity|citrate hydro-lyase (cis-aconitate-forming) activity|iron-responsive element binding|isocitrate hydro-lyase (cis-aconitate-forming) activity|metal ion binding|protein binding	g.chr9:32424665_32424666insAG	M58510	CCDS6525.1	9p21.1	2013-05-21			ENSG00000122729	ENSG00000122729	4.2.1.3		117	protein-coding gene	gene with protein product	"""aconitate hydratase, cytoplasmic"""	100880		IREB1		2172968, 2771641	Standard	NM_002197		Approved	IRP1, IREBP	uc003zqw.4	P21399	OTTHUMG00000019740	ENST00000309951.6:c.1188+2->AG	9.37:g.32424666_32424667dupAG			Somatic				ACO1_uc010mjh.1_Splice_Site_p.K230_splice|ACO1_uc003zqx.3_Splice_Site_p.K396_splice|ACO1_uc003zqy.3_Splice_Site	p.K396_splice	NM_002197	NP_002188	WXS	Illumina HiSeq	Unspecified	P21399	ACOC_HUMAN	LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;3.94e-06)	10	1343	+								D3DRK7|Q14652|Q5VZA7	Splice_Site	INS	ENST00000309951.6	37	c.1188_splice	CCDS6525.1																																																																																				0.515	ACO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051998.3	NM_002197	Intron	26	107	NA	NA	NA	NA	NA	26	107	---	---	---	---
AGPAT2	10555	broad.mit.edu	37	9	139571073	139571073	+	Frame_Shift_Del	DEL	A	A	-			TCGA-38-4628-01A-01D-1265-08	TCGA-38-4628-11A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	67bc44b7-92cf-4e8f-a7f6-c53bf34a17c6	850c7f34-0d4a-4e8e-a9a3-c4563d4dcb04	g.chr9:139571073delA	ENST00000371696.2	-	4	617	c.552delT	c.(550-552)tttfs	p.F184fs	AGPAT2_ENST00000538402.1_Frame_Shift_Del_p.F184fs|AGPAT2_ENST00000371694.3_Intron	NM_006412.3	NP_006403.2	O15120	PLCB_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 2	184					CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|epidermis development (GO:0008544)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|positive regulation of cytokine production (GO:0001819)|positive regulation of cytokine-mediated signaling pathway (GO:0001961)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)			endometrium(1)|large_intestine(1)|lung(2)|prostate(2)	6	all_cancers(76;0.0893)|all_epithelial(76;0.231)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;9.87e-06)|Epithelial(140;0.000123)		CGCCCTTCTTAAAAGGCAGCA	0.632																																							uc004cii.1		NA																	0					0						c.(550-552)TTTfs		1-acylglycerol-3-phosphate O-acyltransferase 2							113.0	99.0	104.0					9																	139571073		2203	4300	6503	SO:0001589	frameshift_variant	10555				phosphatidic acid biosynthetic process|positive regulation of cytokine production|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane	1-acylglycerol-3-phosphate O-acyltransferase activity	g.chr9:139571073delA	AF000237	CCDS7003.1, CCDS35181.1	9q34.3	2013-02-05	2013-02-05		ENSG00000169692	ENSG00000169692	2.3.1.51	"""1-acylglycerol-3-phosphate O-acyltransferases"""	325	protein-coding gene	gene with protein product	"""LPAAT-beta"", ""lysophosphatidic acid acyltransferase, beta"""	603100	"""Berardinelli-Seip congenital lipodystrophy"", ""1-acylglycerol-3-phosphate O-acyltransferase 2 (lysophosphatidic acid acyltransferase, beta)"""	BSCL		9242711, 9212163	Standard	NM_006412		Approved		uc004cii.1	O15120	OTTHUMG00000020936	ENST00000371696.2:c.552delT	9.37:g.139571073delA	ENSP00000360761:p.Phe184fs		Somatic				AGPAT2_uc004cij.1_Intron	p.F184fs	NM_006412	NP_006403	WXS	Illumina HiSeq	Unspecified	O15120	PLCB_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;9.87e-06)|Epithelial(140;0.000123)	4	654	-	all_cancers(76;0.0893)|all_epithelial(76;0.231)	Myeloproliferative disorder(178;0.0511)	184					O00516|O15106|Q5VUD3|Q5VUD4|Q9BSV7|Q9BWR7	Frame_Shift_Del	DEL	ENST00000371696.2	37	c.552delT	CCDS7003.1																																																																																				0.632	AGPAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055090.1	NM_006412		26	102	NA	NA	NA	NA	NA	26	102	---	---	---	---
