#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
GPATCH3	63906	broad.mit.edu	37	1	27216290	27216290	+	IGR	SNP	C	C	T			TCGA-44-2665-01A-01D-1040-01	TCGA-44-2665-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	520db804-4c03-4a0c-9966-fc0c9f98cfec	4b84f6af-2361-4e9b-9c8c-f1cbeb8513f2	g.chr1:27216290C>T	ENST00000361720.5	-	0	2123				GPN2_ENST00000461282.1_5'Flank|GPN2_ENST00000374135.4_Missense_Mutation_p.D100N	NM_022078.2	NP_071361.2	Q96I76	GPTC3_HUMAN	G patch domain containing 3								nucleic acid binding (GO:0003676)	p.D100N(2)		endometrium(2)|large_intestine(1)|lung(11)|skin(1)	15		all_cancers(24;1.29e-21)|all_epithelial(13;2.35e-19)|Colorectal(325;0.000147)|all_lung(284;0.00122)|Lung NSC(340;0.00128)|Breast(348;0.00131)|Renal(390;0.00211)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;3.97e-51)|OV - Ovarian serous cystadenocarcinoma(117;9.55e-30)|Colorectal(126;5.31e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000513)|STAD - Stomach adenocarcinoma(196;0.000595)|KIRC - Kidney renal clear cell carcinoma(1967;0.00072)|READ - Rectum adenocarcinoma(331;0.0419)		CGGAGGGGGTCGAGCTTGGCA	0.667																																							uc001bnd.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(298-300)GAC>AAC		ATP binding domain 1 family, member B							59.0	56.0	57.0					1																	27216290		2202	4300	6502	SO:0001628	intergenic_variant	54707						GTP binding	g.chr1:27216290C>T	BC007767	CCDS290.1	1p35.3-p35.1	2013-01-28		2006-12-13	ENSG00000198746	ENSG00000198746		"""G patch domain containing"""	25720	protein-coding gene	gene with protein product				GPATC3			Standard	NM_022078		Approved	FLJ12455	uc001bne.3	Q96I76	OTTHUMG00000004229		1.37:g.27216290C>T			Somatic					p.D100N	NM_018066	NP_060536	WXS	Illumina HiSeq	Unspecified	Q9H9Y4	GPN2_HUMAN			1	580	-			100					Q5JYH2|Q8NDJ2|Q9H9Z3	Missense_Mutation	SNP	ENST00000361720.5	37	c.298G>A	CCDS290.1	.	.	.	.	.	.	.	.	.	.	C	14.18	2.459366	0.43634	.	.	ENSG00000142751	ENST00000374135	T	0.21543	2.0	4.79	3.85	0.44370	.	0.357216	0.31542	N	0.007472	T	0.10337	0.0253	N	0.10945	0.07	0.27751	N	0.944147	B	0.02656	0.0	B	0.09377	0.004	T	0.13388	-1.0511	10	0.41790	T	0.15	-19.8292	7.0463	0.25048	0.0:0.5802:0.3166:0.1032	.	100	Q9H9Y4	GPN2_HUMAN	N	100	ENSP00000363250:D100N	ENSP00000363250:D100N	D	-	1	0	GPN2	27088877	0.019000	0.18553	0.539000	0.28077	0.968000	0.65278	1.561000	0.36342	1.184000	0.42957	0.563000	0.77884	GAC		0.667	GPATCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012181.1	NM_022078		16	68	0	0	0	0.028581	0	16	68				
KIAA1522	57648	broad.mit.edu	37	1	33237497	33237497	+	Missense_Mutation	SNP	C	C	T			TCGA-44-2665-01A-01D-1040-01	TCGA-44-2665-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	520db804-4c03-4a0c-9966-fc0c9f98cfec	4b84f6af-2361-4e9b-9c8c-f1cbeb8513f2	g.chr1:33237497C>T	ENST00000373480.1	+	6	2643	c.2540C>T	c.(2539-2541)tCg>tTg	p.S847L	KIAA1522_ENST00000294521.3_Intron|KIAA1522_ENST00000401073.2_Missense_Mutation_p.S906L|KIAA1522_ENST00000373481.3_Missense_Mutation_p.S858L	NM_001198972.1	NP_001185901.1	Q9P206	K1522_HUMAN	KIAA1522	847	Pro-rich.							p.S906L(2)		breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(2)|lung(5)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	24		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.244)				CTGGGGCCATCGGCCCCCCAG	0.721																																							uc001bvv.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(2539-2541)TCG>TTG		hypothetical protein LOC57648							7.0	9.0	9.0					1																	33237497		1845	4051	5896	SO:0001583	missense	57648							g.chr1:33237497C>T	AL713671	CCDS41298.1, CCDS55588.1, CCDS55589.1	1p35.1	2009-02-18			ENSG00000162522	ENSG00000162522			29301	protein-coding gene	gene with protein product						10819331	Standard	NM_020888		Approved		uc001bvu.1	Q9P206	OTTHUMG00000008088	ENST00000373480.1:c.2540C>T	1.37:g.33237497C>T	ENSP00000362579:p.Ser847Leu		Somatic				KIAA1522_uc001bvu.1_Missense_Mutation_p.S906L|KIAA1522_uc010ohm.1_Missense_Mutation_p.S858L|KIAA1522_uc010ohn.1_Intron	p.S847L	NM_020888	NP_065939	WXS	Illumina HiSeq	Unspecified	Q9P206	K1522_HUMAN			6	2676	+		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.244)	847			Pro-rich.		B4DQU8|B5MDY0|C9JH84|Q8TCQ0	Missense_Mutation	SNP	ENST00000373480.1	37	c.2540C>T	CCDS55588.1	.	.	.	.	.	.	.	.	.	.	C	7.618	0.676254	0.14841	.	.	ENSG00000162522	ENST00000401073;ENST00000373481;ENST00000373480	T;T;T	0.13420	2.59;2.59;2.6	4.98	0.67	0.17923	.	1.220330	0.06128	N	0.670027	T	0.10551	0.0258	N	0.21448	0.665	0.09310	N	1	B;B;B	0.09022	0.002;0.001;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.38887	-0.9640	10	0.40728	T	0.16	0.2419	9.2652	0.37636	0.0:0.6927:0.108:0.1993	.	858;847;906	Q9P206-3;Q9P206;Q9P206-2	.;K1522_HUMAN;.	L	906;858;847	ENSP00000383851:S906L;ENSP00000362580:S858L;ENSP00000362579:S847L	ENSP00000362579:S847L	S	+	2	0	KIAA1522	33010084	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	0.138000	0.16016	0.001000	0.14605	-0.813000	0.03139	TCG		0.721	KIAA1522-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000022130.1			8	15	0	0	0	0.047766	0	8	15				
CSF1	1435	broad.mit.edu	37	1	110465931	110465931	+	Missense_Mutation	SNP	G	G	A			TCGA-44-2665-01A-01D-1040-01	TCGA-44-2665-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	520db804-4c03-4a0c-9966-fc0c9f98cfec	4b84f6af-2361-4e9b-9c8c-f1cbeb8513f2	g.chr1:110465931G>A	ENST00000329608.6	+	6	1079	c.688G>A	c.(688-690)Gag>Aag	p.E230K	CSF1_ENST00000369802.3_Missense_Mutation_p.E230K|CSF1_ENST00000344188.5_Missense_Mutation_p.E230K|CSF1_ENST00000369801.1_Missense_Mutation_p.E230K|CSF1_ENST00000420111.2_Intron	NM_000757.5|NM_172211.3	NP_000748|NP_757350.1	P09603	CSF1_HUMAN	colony stimulating factor 1 (macrophage)	230					branching involved in mammary gland duct morphogenesis (GO:0060444)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|developmental process involved in reproduction (GO:0003006)|hemopoiesis (GO:0030097)|homeostasis of number of cells within a tissue (GO:0048873)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|macrophage differentiation (GO:0030225)|mammary duct terminal end bud growth (GO:0060763)|mammary gland fat development (GO:0060611)|monocyte activation (GO:0042117)|odontogenesis (GO:0042476)|ossification (GO:0001503)|osteoclast differentiation (GO:0030316)|osteoclast proliferation (GO:0002158)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of gene expression (GO:0010628)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of monocyte differentiation (GO:0045657)|positive regulation of mononuclear cell proliferation (GO:0032946)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of odontogenesis of dentin-containing tooth (GO:0042488)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of macrophage derived foam cell differentiation (GO:0010743)|regulation of ossification (GO:0030278)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|macrophage colony-stimulating factor receptor binding (GO:0005157)|protein homodimerization activity (GO:0042803)	p.E230K(2)		breast(1)|endometrium(3)|large_intestine(3)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	20		all_epithelial(167;3.58e-05)|all_lung(203;0.000116)|Lung NSC(277;0.000233)|Acute lymphoblastic leukemia(138;0.204)		Lung(183;0.0238)|Colorectal(144;0.112)|all cancers(265;0.117)|Epithelial(280;0.127)|LUSC - Lung squamous cell carcinoma(189;0.135)		TGAGGGAACTGAGGGCAGCTC	0.662											OREG0013645	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001dyu.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(688-690)GAG>AAG		colony stimulating factor 1 isoform a precursor							51.0	55.0	54.0					1																	110465931		2203	4300	6503	SO:0001583	missense	1435				cell proliferation|developmental process involved in reproduction|macrophage differentiation|monocyte activation|osteoclast differentiation|positive regulation of cell migration|positive regulation of cell-matrix adhesion|positive regulation of cellular protein metabolic process|positive regulation of gene expression|positive regulation of macrophage derived foam cell differentiation|positive regulation of macrophage differentiation|positive regulation of monocyte differentiation|positive regulation of mononuclear cell proliferation|positive regulation of protein kinase activity	extracellular space|integral to membrane|perinuclear region of cytoplasm|plasma membrane|receptor complex	cytokine activity|growth factor activity|macrophage colony-stimulating factor receptor binding|protein homodimerization activity	g.chr1:110465931G>A	BC021117	CCDS816.1, CCDS817.1, CCDS30797.1	1p13.3	2012-09-20			ENSG00000184371	ENSG00000184371			2432	protein-coding gene	gene with protein product		120420				1540160	Standard	NM_172210		Approved	M-CSF, MCSF, MGC31930	uc001dyw.4	P09603	OTTHUMG00000011646	ENST00000329608.6:c.688G>A	1.37:g.110465931G>A	ENSP00000327513:p.Glu230Lys		Somatic	OREG0013645	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1427	CSF1_uc001dyt.2_Missense_Mutation_p.E230K|CSF1_uc001dyv.3_Intron|CSF1_uc001dyw.3_Missense_Mutation_p.E230K	p.E230K	NM_172212	NP_757351	WXS	Illumina HiSeq	Unspecified	P09603	CSF1_HUMAN		Lung(183;0.0238)|Colorectal(144;0.112)|all cancers(265;0.117)|Epithelial(280;0.127)|LUSC - Lung squamous cell carcinoma(189;0.135)	6	1101	+		all_epithelial(167;3.58e-05)|all_lung(203;0.000116)|Lung NSC(277;0.000233)|Acute lymphoblastic leukemia(138;0.204)	230			Lumenal (Potential).		A8K6J5|Q13130|Q14086|Q14806|Q5VVF3|Q5VVF4|Q9UQR8	Missense_Mutation	SNP	ENST00000329608.6	37	c.688G>A	CCDS816.1	.	.	.	.	.	.	.	.	.	.	G	17.09	3.300590	0.60195	.	.	ENSG00000184371	ENST00000344188;ENST00000329608;ENST00000488198;ENST00000369802;ENST00000369801	T;T;T;T;T	0.13307	2.6;2.6;2.6;2.6;2.6	4.42	3.48	0.39840	.	0.616412	0.15142	N	0.278258	T	0.10035	0.0246	L	0.56769	1.78	0.32901	D	0.513224	P;P	0.52692	0.955;0.86	P;P	0.52424	0.698;0.453	T	0.12218	-1.0556	10	0.16420	T	0.52	.	10.2721	0.43489	0.0:0.2276:0.7724:0.0	.	230;230	P09603;P09603-2	CSF1_HUMAN;.	K	230;230;189;230;230	ENSP00000342718:E230K;ENSP00000327513:E230K;ENSP00000433837:E189K;ENSP00000358817:E230K;ENSP00000358816:E230K	ENSP00000327513:E230K	E	+	1	0	CSF1	110267454	1.000000	0.71417	0.777000	0.31699	0.778000	0.44026	1.986000	0.40677	0.929000	0.37192	0.313000	0.20887	GAG		0.662	CSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032208.1	NM_000757		14	49	0	0	0	0.016723	0	14	49				
AMPD1	270	broad.mit.edu	37	1	115222965	115222965	+	Missense_Mutation	SNP	C	C	T			TCGA-44-2665-01A-01D-1040-01	TCGA-44-2665-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	520db804-4c03-4a0c-9966-fc0c9f98cfec	4b84f6af-2361-4e9b-9c8c-f1cbeb8513f2	g.chr1:115222965C>T	ENST00000520113.2	-	6	796	c.781G>A	c.(781-783)Gag>Aag	p.E261K	AMPD1_ENST00000353928.6_Missense_Mutation_p.E228K|AMPD1_ENST00000369538.3_Missense_Mutation_p.E257K			P23109	AMPD1_HUMAN	adenosine monophosphate deaminase 1	261					IMP salvage (GO:0032264)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|response to organic substance (GO:0010033)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	AMP deaminase activity (GO:0003876)|metal ion binding (GO:0046872)	p.E228K(1)|p.E261K(1)		NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(3)|pancreas(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	45	all_epithelial(7;7.83e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)	Adenosine monophosphate(DB00131)	GGCTTAGGCTCATCTTTGCTG	0.423																																							uc001efe.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|large_intestine(1)|skin(1)	4						c.(682-684)GAG>AAG		adenosine monophosphate deaminase 1 (isoform M)	Adenosine monophosphate(DB00131)						202.0	186.0	192.0					1																	115222965		2203	4300	6503	SO:0001583	missense	270				purine base metabolic process|purine ribonucleoside monophosphate biosynthetic process|purine-containing compound salvage	cytosol	AMP deaminase activity|metal ion binding	g.chr1:115222965C>T	M60092	CCDS876.1, CCDS876.2, CCDS53349.1	1p13	2010-02-10	2010-02-10		ENSG00000116748	ENSG00000116748	3.5.4.6		468	protein-coding gene	gene with protein product	"""AMPD isoform M"", ""skeletal muscle AMPD"""	102770	"""adenosine monophosphate deaminase 1 (isoform M)"""			1400401	Standard	NM_001172626		Approved	MAD, MADA	uc001efe.2	P23109	OTTHUMG00000011892	ENST00000520113.2:c.781G>A	1.37:g.115222965C>T	ENSP00000430075:p.Glu261Lys		Somatic				AMPD1_uc001eff.1_Missense_Mutation_p.E224K	p.E228K	NM_000036	NP_000027	WXS	Illumina HiSeq	Unspecified	P23109	AMPD1_HUMAN		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)	6	766	-	all_epithelial(7;7.83e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)	228					A8K5N4|B2RAM1|F2Z3B3|Q5TF00|Q5TF02	Missense_Mutation	SNP	ENST00000520113.2	37	c.682G>A	CCDS876.2	.	.	.	.	.	.	.	.	.	.	C	11.39	1.625142	0.28889	.	.	ENSG00000116748	ENST00000520113;ENST00000369538;ENST00000353928	D;D;D	0.93366	-3.21;-3.21;-3.21	6.07	5.16	0.70880	.	0.183426	0.64402	D	0.000013	T	0.74061	0.3667	N	0.11154	0.105	0.35843	D	0.826195	B;B	0.09022	0.002;0.0	B;B	0.08055	0.003;0.002	T	0.62798	-0.6778	10	0.10377	T	0.69	-19.0848	13.56	0.61784	0.0:0.8223:0.115:0.0627	.	257;228	Q5TF02;P23109	.;AMPD1_HUMAN	K	261;257;228	ENSP00000430075:E261K;ENSP00000358551:E257K;ENSP00000316520:E228K	ENSP00000316520:E228K	E	-	1	0	AMPD1	115024488	0.974000	0.33945	0.999000	0.59377	0.903000	0.53119	2.159000	0.42339	0.913000	0.36797	-1.371000	0.01190	GAG		0.423	AMPD1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000032860.4			4	53	0	0	0	0.009096	0	4	53				
AQP10	89872	broad.mit.edu	37	1	154296116	154296116	+	Missense_Mutation	SNP	C	C	T			TCGA-44-2665-01A-01D-1040-01	TCGA-44-2665-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	520db804-4c03-4a0c-9966-fc0c9f98cfec	4b84f6af-2361-4e9b-9c8c-f1cbeb8513f2	g.chr1:154296116C>T	ENST00000324978.3	+	5	581	c.541C>T	c.(541-543)Cgg>Tgg	p.R181W	ATP8B2_ENST00000368487.3_5'Flank|AQP10_ENST00000355197.4_3'UTR|AQP10_ENST00000484864.1_Missense_Mutation_p.R181W	NM_080429.2	NP_536354.2	Q96PS8	AQP10_HUMAN	aquaporin 10	181					response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)	p.R181W(2)		central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(14)|stomach(2)|upper_aerodigestive_tract(1)	23	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			CCTGGACAGACGGAACAAGGG	0.612																																							uc001feu.2		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(1)	1						c.(541-543)CGG>TGG		aquaporin 10							140.0	143.0	142.0					1																	154296116		2203	4300	6503	SO:0001583	missense	89872				response to toxin|transmembrane transport|water transport	integral to membrane|plasma membrane	transporter activity	g.chr1:154296116C>T	AF159174	CCDS1065.1	1q21.3	2008-02-05			ENSG00000143595	ENSG00000143595		"""Ion channels / Aquaporins"""	16029	protein-coding gene	gene with protein product		606578				11573934	Standard	NM_080429		Approved		uc001feu.3	Q96PS8	OTTHUMG00000035980	ENST00000324978.3:c.541C>T	1.37:g.154296116C>T	ENSP00000318355:p.Arg181Trp		Somatic				AQP10_uc001fev.2_Missense_Mutation_p.R181W|ATP8B2_uc001few.2_5'Flank	p.R181W	NM_080429	NP_536354	WXS	Illumina HiSeq	Unspecified	Q96PS8	AQP10_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.185)		5	581	+	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		181			Cytoplasmic (Potential).		Q5VYD3|Q5VYD4|Q8NG70	Missense_Mutation	SNP	ENST00000324978.3	37	c.541C>T	CCDS1065.1	.	.	.	.	.	.	.	.	.	.	C	15.64	2.894226	0.52121	.	.	ENSG00000143595	ENST00000324978;ENST00000484864	D;D	0.85955	-2.05;-2.05	4.9	1.67	0.24075	Aquaporin-like (2);	0.410133	0.24642	N	0.036791	D	0.90542	0.7036	H	0.95043	3.615	0.09310	N	1	D;D	0.67145	0.996;0.994	P;P	0.59889	0.742;0.865	D	0.84976	0.0885	10	0.66056	D	0.02	.	12.93	0.58282	0.5075:0.4925:0.0:0.0	.	181;181	Q96PS8-2;Q96PS8	.;AQP10_HUMAN	W	181	ENSP00000318355:R181W;ENSP00000420341:R181W	ENSP00000318355:R181W	R	+	1	2	AQP10	152562740	0.003000	0.15002	0.109000	0.21407	0.949000	0.60115	0.450000	0.21762	0.639000	0.30564	0.555000	0.69702	CGG		0.612	AQP10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087661.1	NM_080429		31	277	0	0	0	0.041601	0	31	277				
DDR2	4921	broad.mit.edu	37	1	162740301	162740301	+	Splice_Site	SNP	A	A	G			TCGA-44-2665-01A-01D-1040-01	TCGA-44-2665-10A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	520db804-4c03-4a0c-9966-fc0c9f98cfec	4b84f6af-2361-4e9b-9c8c-f1cbeb8513f2	g.chr1:162740301A>G	ENST00000367922.3	+	13	1941	c.1503A>G	c.(1501-1503)tcA>tcG	p.S501S	DDR2_ENST00000367921.3_Splice_Site_p.S501S	NM_001014796.1	NP_001014796.1	Q16832	DDR2_HUMAN	discoidin domain receptor tyrosine kinase 2	501					biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|chondrocyte proliferation (GO:0035988)|collagen fibril organization (GO:0030199)|collagen-activated tyrosine kinase receptor signaling pathway (GO:0038063)|endochondral bone growth (GO:0003416)|extracellular matrix organization (GO:0030198)|ossification (GO:0001503)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of extracellular matrix disassembly (GO:0090091)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein autophosphorylation (GO:0046777)|regulation of bone mineralization (GO:0030500)|regulation of extracellular matrix disassembly (GO:0010715)|signal transduction (GO:0007165)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|collagen binding (GO:0005518)|protein tyrosine kinase collagen receptor activity (GO:0038062)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.S501S(2)		central_nervous_system(2)|kidney(1)|lung(2)|ovary(1)|skin(1)	7	all_hematologic(112;0.115)		BRCA - Breast invasive adenocarcinoma(70;0.113)		Regorafenib(DB08896)	AGGAGGAGTCAGGTGAGGATG	0.527																																					NSCLC(161;314 2006 8283 19651 23192)	NSCLC(161;314 2006 8283 19651 23192)	uc001gcf.2		NA																	2	Substitution - coding silent(2)		lung(2)	lung(2)|central_nervous_system(2)|ovary(1)|kidney(1)	6						c.(1501-1503)TCA>TCG		discoidin domain receptor family, member 2							68.0	65.0	66.0					1																	162740301		2203	4300	6503	SO:0001630	splice_region_variant	4921				cell adhesion	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity	g.chr1:162740301A>G	AK095975	CCDS1241.1	1q12-q23	2009-07-10	2008-01-23		ENSG00000162733	ENSG00000162733	2.7.10.1		2731	protein-coding gene	gene with protein product		191311	"""discoidin domain receptor family, member 2"""	TYRO10, NTRKR3		9659899	Standard	XM_005245221		Approved	TKT	uc001gcg.3	Q16832	OTTHUMG00000034423	ENST00000367922.3:c.1504+1A>G	1.37:g.162740301A>G			Somatic				DDR2_uc001gcg.2_Silent_p.S501S	p.S501S	NM_001014796	NP_001014796	WXS	Illumina HiSeq	Unspecified	Q16832	DDR2_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.113)		13	1968	+	all_hematologic(112;0.115)		501			Cytoplasmic (Potential).		Q7Z730	Silent	SNP	ENST00000367922.3	37	c.1503A>G	CCDS1241.1	.	.	.	.	.	.	.	.	.	.	A	12.52	1.961258	0.34565	.	.	ENSG00000162733	ENST00000433757	.	.	.	5.79	2.12	0.27331	.	.	.	.	.	T	0.14743	0.0356	.	.	.	0.58432	D	0.999997	.	.	.	.	.	.	T	0.17992	-1.0351	3	.	.	.	.	3.7993	0.08751	0.4659:0.0:0.1443:0.3898	.	.	.	.	G	94	.	.	R	+	1	2	DDR2	161006925	0.953000	0.32496	0.998000	0.56505	0.853000	0.48598	0.158000	0.16422	0.093000	0.17368	-0.327000	0.08410	AGG		0.527	DDR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083213.2	NM_006182	Silent	5	26	0	0	0	0.014758	0	5	26				
BROX	148362	broad.mit.edu	37	1	222900585	222900585	+	Missense_Mutation	SNP	T	T	C			TCGA-44-2665-01A-01D-1040-01	TCGA-44-2665-10A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	520db804-4c03-4a0c-9966-fc0c9f98cfec	4b84f6af-2361-4e9b-9c8c-f1cbeb8513f2	g.chr1:222900585T>C	ENST00000340934.5	+	8	1062	c.656T>C	c.(655-657)tTc>tCc	p.F219S	BROX_ENST00000537020.1_Missense_Mutation_p.F219S|BROX_ENST00000539697.1_Missense_Mutation_p.F187S	NM_144695.2	NP_653296.2	Q5VW32	BROX_HUMAN	BRO1 domain and CAAX motif containing	219	BRO1. {ECO:0000255|PROSITE- ProRule:PRU00526}.					extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)		p.F219S(2)		breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|skin(1)|stomach(1)	14						ACAGCCAATTTCTATCAAAAA	0.343																																							uc001hnq.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(655-657)TTC>TCC		Bro1-domain-containing protein							103.0	101.0	102.0					1																	222900585		2203	4300	6503	SO:0001583	missense	148362					membrane		g.chr1:222900585T>C		CCDS1534.1, CCDS73036.1, CCDS73037.1	1q41	2010-11-30	2010-11-30	2010-11-30	ENSG00000162819	ENSG00000162819			26512	protein-coding gene	gene with protein product	"""BRO1 domain containing protein"""		"""chromosome 1 open reading frame 58"""	C1orf58		18190528	Standard	XM_005273065		Approved	FLJ32421	uc001hnq.1	Q5VW32	OTTHUMG00000037650	ENST00000340934.5:c.656T>C	1.37:g.222900585T>C	ENSP00000343742:p.Phe219Ser		Somatic				C1orf58_uc010put.1_Missense_Mutation_p.F187S|C1orf58_uc010puu.1_Missense_Mutation_p.F219S|C1orf58_uc010puv.1_Missense_Mutation_p.F187S|uc001hnr.1_RNA	p.F219S	NM_144695	NP_653296	WXS	Illumina HiSeq	Unspecified	Q5VW32	BROX_HUMAN		GBM - Glioblastoma multiforme(131;0.0667)	8	1051	+			219			BRO1.		B7Z9G5|Q96MG1	Missense_Mutation	SNP	ENST00000340934.5	37	c.656T>C	CCDS1534.1	.	.	.	.	.	.	.	.	.	.	t	17.37	3.372957	0.61624	.	.	ENSG00000162819	ENST00000340934;ENST00000537020;ENST00000539697	T;T;T	0.18016	2.24;2.24;2.24	5.96	5.96	0.96718	BRO1 domain (3);	0.042697	0.85682	D	0.000000	T	0.27629	0.0679	M	0.63843	1.955	0.80722	D	1	P;P;D	0.53619	0.826;0.662;0.961	B;B;P	0.50231	0.291;0.322;0.635	T	0.01532	-1.1331	10	0.54805	T	0.06	-15.9569	11.5191	0.50541	0.1336:0.0:0.0:0.8664	.	219;187;219	F5GXQ0;B7Z9G5;Q5VW32	.;.;BROX_HUMAN	S	219;219;187	ENSP00000343742:F219S;ENSP00000440041:F219S;ENSP00000441080:F187S	ENSP00000343742:F219S	F	+	2	0	BROX	220967208	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.261000	0.58841	2.285000	0.76669	0.533000	0.62120	TTC		0.343	BROX-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091815.2	NM_144695		10	42	0	0	0	0.010729	0	10	42				
OR14A16	284532	broad.mit.edu	37	1	247978972	247978972	+	Missense_Mutation	SNP	A	A	C			TCGA-44-2665-01A-01D-1040-01	TCGA-44-2665-10A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	520db804-4c03-4a0c-9966-fc0c9f98cfec	4b84f6af-2361-4e9b-9c8c-f1cbeb8513f2	g.chr1:247978972A>C	ENST00000357627.1	-	1	59	c.60T>G	c.(58-60)aaT>aaG	p.N20K		NM_001001966.1	NP_001001966.1	Q8NHC5	O14AG_HUMAN	olfactory receptor, family 14, subfamily A, member 16	20						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.N20K(2)		breast(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(32)|skin(2)|stomach(1)	45						AAATGCACATATTTTTATTGG	0.383																																					Ovarian(112;180 1586 15073 21914 33526)	Ovarian(112;180 1586 15073 21914 33526)	uc001idm.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(58-60)AAT>AAG		olfactory receptor, family 14, subfamily A,							64.0	64.0	64.0					1																	247978972		2203	4300	6503	SO:0001583	missense	284532				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:247978972A>C	BK004366	CCDS31097.1	1q44	2012-08-09	2008-04-02	2008-04-02	ENSG00000196772	ENSG00000196772		"""GPCR / Class A : Olfactory receptors"""	15022	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily AT, member 1"""	OR5AT1			Standard	NM_001001966		Approved		uc001idm.1	Q8NHC5	OTTHUMG00000040199	ENST00000357627.1:c.60T>G	1.37:g.247978972A>C	ENSP00000350248:p.Asn20Lys		Somatic					p.N20K	NM_001001966	NP_001001966	WXS	Illumina HiSeq	Unspecified	Q8NHC5	O14AG_HUMAN			1	60	-			20			Extracellular (Potential).		Q6IF96	Missense_Mutation	SNP	ENST00000357627.1	37	c.60T>G	CCDS31097.1	.	.	.	.	.	.	.	.	.	.	A	8.879	0.951081	0.18431	.	.	ENSG00000196772	ENST00000357627	T	0.00611	6.23	3.17	-5.71	0.02413	.	2.017100	0.02802	N	0.123280	T	0.00328	0.0010	N	0.04320	-0.23	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.48210	-0.9055	10	0.44086	T	0.13	.	2.7901	0.05386	0.1816:0.4715:0.0996:0.2472	.	20	Q8NHC5	O14AG_HUMAN	K	20	ENSP00000350248:N20K	ENSP00000350248:N20K	N	-	3	2	OR14A16	246045595	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.470000	0.00991	-0.743000	0.04784	-0.461000	0.05368	AAT		0.383	OR14A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096856.1	NM_001001966		8	18	0	0	0	0.010729	0	8	18				
SVIL	6840	broad.mit.edu	37	10	29819539	29819539	+	Silent	SNP	G	G	A			TCGA-44-2665-01A-01D-1040-01	TCGA-44-2665-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	520db804-4c03-4a0c-9966-fc0c9f98cfec	4b84f6af-2361-4e9b-9c8c-f1cbeb8513f2	g.chr10:29819539G>A	ENST00000355867.4	-	11	2855	c.2103C>T	c.(2101-2103)ttC>ttT	p.F701F	SVIL_ENST00000375400.3_Silent_p.F307F|SVIL_ENST00000375398.2_Silent_p.F701F	NM_021738.2	NP_068506.2	O95425	SVIL_HUMAN	supervillin	701					cytoskeleton organization (GO:0007010)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|costamere (GO:0043034)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)	p.F701F(2)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(24)|lung(35)|ovary(8)|prostate(2)|skin(4)|stomach(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	112		Breast(68;0.103)				AGCTTACCCTGAAAAGCAACC	0.483																																							uc001iut.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(5)|upper_aerodigestive_tract(1)	6						c.(2101-2103)TTC>TTT		supervillin isoform 2							196.0	180.0	185.0					10																	29819539		2203	4300	6503	SO:0001819	synonymous_variant	6840				cytoskeleton organization|skeletal muscle tissue development	cell junction|costamere|invadopodium|nucleus|podosome	actin filament binding	g.chr10:29819539G>A	AF051851	CCDS7163.1, CCDS7164.1	10p11.2	2008-07-29			ENSG00000197321	ENSG00000197321			11480	protein-coding gene	gene with protein product	"""archvillin"""	604126				9382871	Standard	NM_003174		Approved		uc001iut.1	O95425	OTTHUMG00000017882	ENST00000355867.4:c.2103C>T	10.37:g.29819539G>A			Somatic				SVIL_uc001iuu.1_Silent_p.F307F	p.F701F	NM_021738	NP_068506	WXS	Illumina HiSeq	Unspecified	O95425	SVIL_HUMAN			11	2856	-		Breast(68;0.103)	701					D3DRW9|M1J557|O60611|O60612|Q5VZK5|Q5VZK6|Q9H1R7	Silent	SNP	ENST00000355867.4	37	c.2103C>T	CCDS7164.1																																																																																				0.483	SVIL-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047395.1			16	73	0	0	0	0.0333	0	16	73				
AMPD3	272	broad.mit.edu	37	11	10500113	10500113	+	Silent	SNP	C	C	T			TCGA-44-2665-01A-01D-1040-01	TCGA-44-2665-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	520db804-4c03-4a0c-9966-fc0c9f98cfec	4b84f6af-2361-4e9b-9c8c-f1cbeb8513f2	g.chr11:10500113C>T	ENST00000396554.3	+	3	630	c.289C>T	c.(289-291)Ctg>Ttg	p.L97L	AMPD3_ENST00000444303.2_Intron	NM_000480.2	NP_000471.1	Q01432	AMPD3_HUMAN	adenosine monophosphate deaminase 3	88					ADP metabolic process (GO:0046031)|AMP catabolic process (GO:0006196)|ATP metabolic process (GO:0046034)|energy homeostasis (GO:0097009)|IMP salvage (GO:0032264)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	AMP deaminase activity (GO:0003876)|metal ion binding (GO:0046872)	p.L97L(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(12)|ovary(1)|prostate(3)|skin(1)	25				all cancers(16;1.14e-08)|Epithelial(150;2.83e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0291)		GTCCCTGTCTCTGCAAATGCC	0.547																																							uc001mio.1		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(1)|ovary(1)	2						c.(262-264)CTG>TTG		adenosine monophosphate deaminase 3 isoform 1B							138.0	162.0	154.0					11																	10500113		2201	4294	6495	SO:0001819	synonymous_variant	272				AMP catabolic process|purine base metabolic process|purine ribonucleoside monophosphate biosynthetic process|purine-containing compound salvage	cytosol	AMP deaminase activity|metal ion binding	g.chr11:10500113C>T	M84722	CCDS7802.1, CCDS41617.1, CCDS44537.1, CCDS53601.1	11p15	2010-02-10	2010-02-10			ENSG00000133805	3.5.4.6		470	protein-coding gene	gene with protein product	"""erythrocyte-specific AMP deaminase"""	102772	"""adenosine monophosphate deaminase (isoform E)"""			1400401	Standard	NM_001172430		Approved		uc001min.1	Q01432		ENST00000396554.3:c.289C>T	11.37:g.10500113C>T			Somatic				AMPD3_uc010rbz.1_Intron|AMPD3_uc001min.1_Silent_p.L97L|AMPD3_uc009yfw.1_RNA|AMPD3_uc009yfx.1_Silent_p.L88L|AMPD3_uc009yfz.2_RNA|AMPD3_uc001mip.1_Silent_p.L95L|AMPD3_uc009yfy.2_Silent_p.L88L	p.L88L	NM_001025389	NP_001020560	WXS	Illumina HiSeq	Unspecified	Q01432	AMPD3_HUMAN		all cancers(16;1.14e-08)|Epithelial(150;2.83e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0291)	3	597	+			88					A0AUX0|B7Z2S2|B7Z763|B7Z877	Silent	SNP	ENST00000396554.3	37	c.262C>T	CCDS7802.1																																																																																				0.547	AMPD3-001	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000385783.2	NM_000480		11	234	0	0	0	0.010729	0	11	234				
KAT5	10524	broad.mit.edu	37	11	65482336	65482336	+	Silent	SNP	C	C	G			TCGA-44-2665-01A-01D-1040-01	TCGA-44-2665-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	520db804-4c03-4a0c-9966-fc0c9f98cfec	4b84f6af-2361-4e9b-9c8c-f1cbeb8513f2	g.chr11:65482336C>G	ENST00000377046.3	+	9	1157	c.885C>G	c.(883-885)cgC>cgG	p.R295R	KAT5_ENST00000530446.1_Silent_p.R276R|KAT5_ENST00000534650.1_Silent_p.R84R|KAT5_ENST00000352980.4_Silent_p.R243R|KAT5_ENST00000341318.4_Silent_p.R328R	NM_006388.3	NP_006379.2	Q92993	KAT5_HUMAN	K(lysine) acetyltransferase 5	295	MYST-type HAT.				androgen receptor signaling pathway (GO:0030521)|cellular response to estradiol stimulus (GO:0071392)|chromatin organization (GO:0006325)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|double-strand break repair (GO:0006302)|histone acetylation (GO:0016573)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of growth (GO:0040008)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytosol (GO:0005829)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Piccolo NuA4 histone acetyltransferase complex (GO:0032777)|Swr1 complex (GO:0000812)|transcription factor complex (GO:0005667)	androgen receptor binding (GO:0050681)|histone acetyltransferase activity (GO:0004402)|metal ion binding (GO:0046872)|repressing transcription factor binding (GO:0070491)|transcription coactivator activity (GO:0003713)	p.R328R(2)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(9)	21						AGATTTACCGCAAGGGCACCA	0.522																																							uc001ofi.2		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(883-885)CGC>CGG		K(lysine) acetyltransferase 5 isoform 2							147.0	117.0	127.0					11																	65482336		2201	4297	6498	SO:0001819	synonymous_variant	10524				androgen receptor signaling pathway|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|double-strand break repair|interspecies interaction between organisms|negative regulation of interleukin-2 production|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|regulation of growth|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|nucleolus|perinuclear region of cytoplasm|Piccolo NuA4 histone acetyltransferase complex	androgen receptor binding|histone acetyltransferase activity|metal ion binding|repressing transcription factor binding|transcription coactivator activity	g.chr11:65482336C>G	U74667	CCDS8109.1, CCDS8110.1, CCDS31610.1, CCDS55771.1	11q13	2013-01-10	2008-07-04	2008-07-04	ENSG00000172977	ENSG00000172977		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"""	5275	protein-coding gene	gene with protein product	"""Tat interacting protein, 60kDa"", ""K-acetyltransferase 5"""	601409	"""HIV-1 Tat interactive protein, 60kDa"""	HTATIP		8607265	Standard	NM_006388		Approved	TIP60, PLIP, cPLA2, HTATIP1, ESA1, ZC2HC5	uc001ofk.3	Q92993	OTTHUMG00000166617	ENST00000377046.3:c.885C>G	11.37:g.65482336C>G			Somatic				KAT5_uc001ofj.2_Silent_p.R243R|KAT5_uc001ofk.2_Silent_p.R328R|KAT5_uc010roo.1_Silent_p.R276R|KAT5_uc001ofl.2_Silent_p.R84R	p.R295R	NM_006388	NP_006379	WXS	Illumina HiSeq	Unspecified	Q92993	KAT5_HUMAN			9	1135	+			295					B4E3C7|C9JL99|O95624|Q13430|Q17RW5|Q561W3|Q6GSE8|Q9BWK7	Silent	SNP	ENST00000377046.3	37	c.885C>G	CCDS31610.1																																																																																				0.522	KAT5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390866.2	NM_006388		26	66	0	0	0	0.027356	0	26	66				
C11orf63	79864	broad.mit.edu	37	11	122774779	122774779	+	Missense_Mutation	SNP	A	A	G	rs147035469	byFrequency	TCGA-44-2665-01A-01D-1040-01	TCGA-44-2665-10A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	520db804-4c03-4a0c-9966-fc0c9f98cfec	4b84f6af-2361-4e9b-9c8c-f1cbeb8513f2	g.chr11:122774779A>G	ENST00000531316.1	+	2	583	c.491A>G	c.(490-492)tAc>tGc	p.Y164C	C11orf63_ENST00000307257.6_Missense_Mutation_p.Y164C|C11orf63_ENST00000227349.2_Missense_Mutation_p.Y164C			Q6NUN7	CK063_HUMAN	chromosome 11 open reading frame 63	164					axoneme assembly (GO:0035082)|brain development (GO:0007420)|cerebrospinal fluid secretion (GO:0033326)|ciliary basal body organization (GO:0032053)			p.Y164C(2)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(13)|lung(14)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	47		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.018)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.34e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0311)		GCTCCCCTCTACCCTTCCCAG	0.517													A|||	2	0.000399361	0.0015	0.0	5008	,	,		16476	0.0		0.0	False		,,,				2504	0.0						uc001pym.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)	3						c.(490-492)TAC>TGC		hypothetical protein LOC79864 isoform 1		A	CYS/TYR,CYS/TYR	2,4402	4.2+/-10.8	0,2,2200	59.0	67.0	65.0		491,491	3.1	0.9	11	dbSNP_134	65	0,8598		0,0,4299	yes	missense,missense	C11orf63	NM_024806.2,NM_199124.1	194,194	0,2,6499	GG,GA,AA		0.0,0.0454,0.0154	probably-damaging,probably-damaging	164/779,164/308	122774779	2,13000	2202	4299	6501	SO:0001583	missense	79864							g.chr11:122774779A>G	BC068507	CCDS8438.1, CCDS8439.1	11q24.1	2012-05-25			ENSG00000109944	ENSG00000109944			26288	protein-coding gene	gene with protein product						12477932	Standard	NM_024806		Approved	FLJ23554	uc001pym.4	Q6NUN7	OTTHUMG00000166027	ENST00000531316.1:c.491A>G	11.37:g.122774779A>G	ENSP00000431669:p.Tyr164Cys		Somatic				C11orf63_uc001pyl.1_Missense_Mutation_p.Y164C	p.Y164C	NM_024806	NP_079082	WXS	Illumina HiSeq	Unspecified	Q6NUN7	CK063_HUMAN		BRCA - Breast invasive adenocarcinoma(274;5.34e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0311)	3	788	+		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.018)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)	164					A8K6G0|Q96GB5|Q9H5D6	Missense_Mutation	SNP	ENST00000531316.1	37	c.491A>G	CCDS8438.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	A	12.36	1.915126	0.33815	4.54E-4	0.0	ENSG00000109944	ENST00000307257;ENST00000227349;ENST00000531316	T;T	0.50548	0.74;0.74	5.53	3.14	0.36123	.	0.658088	0.14782	N	0.298718	T	0.59715	0.2214	M	0.70595	2.14	0.09310	N	1	D;D	0.71674	0.998;0.998	P;P	0.61592	0.891;0.891	T	0.47368	-0.9123	10	0.49607	T	0.09	-2.9796	7.0208	0.24912	0.7929:0.0:0.0736:0.1335	.	164;164	Q6NUN7;Q6NUN7-2	CK063_HUMAN;.	C	164	ENSP00000227349:Y164C;ENSP00000431669:Y164C	ENSP00000227349:Y164C	Y	+	2	0	C11orf63	122279989	0.743000	0.28239	0.869000	0.34112	0.275000	0.26752	2.193000	0.42658	0.996000	0.38943	0.533000	0.62120	TAC		0.517	C11orf63-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387511.1	NM_024806		15	61	0	0	0	0.020292	0	15	61				
KRT73	319101	broad.mit.edu	37	12	53012246	53012246	+	Silent	SNP	G	G	A	rs531582563		TCGA-44-2665-01A-01D-1040-01	TCGA-44-2665-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	520db804-4c03-4a0c-9966-fc0c9f98cfec	4b84f6af-2361-4e9b-9c8c-f1cbeb8513f2	g.chr12:53012246G>A	ENST00000305748.3	-	1	97	c.63C>T	c.(61-63)tcC>tcT	p.S21S		NM_175068.2	NP_778238.1	Q86Y46	K2C73_HUMAN	keratin 73	21	Gly-rich.|Head.					extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)	p.S21S(2)		NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44				BRCA - Breast invasive adenocarcinoma(357;0.189)		AGAGCACAGCGGAGCAGCCGC	0.642																																							uc001sas.2		NA																	2	Substitution - coding silent(2)		lung(2)	large_intestine(2)|ovary(2)|skin(2)	6						c.(61-63)TCC>TCT		keratin 73							38.0	45.0	43.0					12																	53012246		2203	4298	6501	SO:0001819	synonymous_variant	319101					keratin filament	structural molecule activity	g.chr12:53012246G>A	AJ508776	CCDS8834.1	12q13.13	2013-06-25			ENSG00000186049	ENSG00000186049		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28928	protein-coding gene	gene with protein product		608247				12648212, 16831889	Standard	NM_175068		Approved	KRT6IRS3, K6IRS3	uc001sas.3	Q86Y46	OTTHUMG00000169746	ENST00000305748.3:c.63C>T	12.37:g.53012246G>A			Somatic					p.S21S	NM_175068	NP_778238	WXS	Illumina HiSeq	Unspecified	Q86Y46	K2C73_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.189)	1	98	-			21			Head.|Gly-rich.		Q32MB2	Silent	SNP	ENST00000305748.3	37	c.63C>T	CCDS8834.1																																																																																				0.642	KRT73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405700.1	NM_175068		26	86	0	0	0	0.024334	0	26	86				
FOXA1	3169	broad.mit.edu	37	14	38061461	38061461	+	Missense_Mutation	SNP	G	G	C			TCGA-44-2665-01A-01D-1040-01	TCGA-44-2665-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	520db804-4c03-4a0c-9966-fc0c9f98cfec	4b84f6af-2361-4e9b-9c8c-f1cbeb8513f2	g.chr14:38061461G>C	ENST00000250448.2	-	2	589	c.528C>G	c.(526-528)atC>atG	p.I176M	FOXA1_ENST00000540786.1_Missense_Mutation_p.I143M|FOXA1_ENST00000545425.2_5'UTR	NM_004496.3	NP_004487.2	P55317	FOXA1_HUMAN	forkhead box A1	176					anatomical structure formation involved in morphogenesis (GO:0048646)|chromatin remodeling (GO:0006338)|dorsal/ventral neural tube patterning (GO:0021904)|epithelial cell maturation involved in prostate gland development (GO:0060743)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|epithelial-mesenchymal signaling involved in prostate gland development (GO:0060738)|glucose homeostasis (GO:0042593)|hormone metabolic process (GO:0042445)|lung epithelial cell differentiation (GO:0060487)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron fate specification (GO:0048665)|positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate gland epithelium morphogenesis (GO:0060740)|prostate gland stromal morphogenesis (GO:0060741)|response to estradiol (GO:0032355)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)	microvillus (GO:0005902)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.I176M(2)		breast(1)|endometrium(1)|large_intestine(2)|lung(3)|prostate(12)	19	Breast(36;0.0954)|Esophageal squamous(585;0.164)|Hepatocellular(127;0.213)		Lung(238;5.41e-07)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.0454)|LUSC - Lung squamous cell carcinoma(13;0.0917)|all cancers(34;0.0925)|BRCA - Breast invasive adenocarcinoma(188;0.239)	GBM - Glioblastoma multiforme(112;0.0222)		TGATGAGCGAGATGTACGAGT	0.657																																							uc001wuf.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(526-528)ATC>ATG		forkhead box A1							96.0	88.0	91.0					14																	38061461		2203	4300	6503	SO:0001583	missense	3169				chromatin remodeling|embryo development|epithelial cell maturation involved in prostate gland development|epithelial tube branching involved in lung morphogenesis|epithelial-mesenchymal signaling involved in prostate gland development|glucose homeostasis|lung epithelial cell differentiation|negative regulation of survival gene product expression|neuron fate specification|pattern specification process|positive regulation of estrogen receptor signaling pathway|positive regulation of mitotic cell cycle|positive regulation of neuron differentiation|positive regulation of sequence-specific DNA binding transcription factor activity|prostate gland epithelium morphogenesis|prostate gland stromal morphogenesis|response to estradiol stimulus|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development	transcription factor complex	DNA bending activity|double-stranded DNA binding|protein domain specific binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|transcription regulatory region DNA binding	g.chr14:38061461G>C	U39840	CCDS9665.1	14q12-q13	2008-04-10		2002-09-20	ENSG00000129514	ENSG00000129514		"""Forkhead boxes"""	5021	protein-coding gene	gene with protein product		602294	"""hepatocyte nuclear factor 3, alpha"""	HNF3A		9119385, 8652662	Standard	NM_004496		Approved		uc001wuf.4	P55317	OTTHUMG00000140253	ENST00000250448.2:c.528C>G	14.37:g.38061461G>C	ENSP00000250448:p.Ile176Met		Somatic				FOXA1_uc010tpz.1_Missense_Mutation_p.I143M	p.I176M	NM_004496	NP_004487	WXS	Illumina HiSeq	Unspecified	P55317	FOXA1_HUMAN	Lung(238;5.41e-07)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.0454)|LUSC - Lung squamous cell carcinoma(13;0.0917)|all cancers(34;0.0925)|BRCA - Breast invasive adenocarcinoma(188;0.239)	GBM - Glioblastoma multiforme(112;0.0222)	2	840	-	Breast(36;0.0954)|Esophageal squamous(585;0.164)|Hepatocellular(127;0.213)		176			Fork-head.		B2R9H6|B7ZAP5|Q9H2A0	Missense_Mutation	SNP	ENST00000250448.2	37	c.528C>G	CCDS9665.1	.	.	.	.	.	.	.	.	.	.	G	16.64	3.179477	0.57800	.	.	ENSG00000129514	ENST00000250448;ENST00000540786	D;D	0.95656	-3.77;-3.77	3.88	0.91	0.19337	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (4);Transcription factor, fork head, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.96864	0.8976	M	0.81497	2.545	0.54753	D	0.999983	D	0.89917	1.0	D	0.97110	1.0	D	0.95547	0.8617	10	0.87932	D	0	.	8.7702	0.34728	0.2749:0.0:0.7251:0.0	.	176	P55317	FOXA1_HUMAN	M	176;143	ENSP00000250448:I176M;ENSP00000440178:I143M	ENSP00000250448:I176M	I	-	3	3	FOXA1	37131212	1.000000	0.71417	1.000000	0.80357	0.711000	0.40976	2.158000	0.42329	0.318000	0.23185	0.505000	0.49811	ATC		0.657	FOXA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276735.1			15	73	0	0	0	0.024245	0	15	73				
PAPOLA	10914	broad.mit.edu	37	14	97022682	97022682	+	Missense_Mutation	SNP	A	A	G			TCGA-44-2665-01A-01D-1040-01	TCGA-44-2665-10A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	520db804-4c03-4a0c-9966-fc0c9f98cfec	4b84f6af-2361-4e9b-9c8c-f1cbeb8513f2	g.chr14:97022682A>G	ENST00000216277.8	+	19	2156	c.1936A>G	c.(1936-1938)Ata>Gta	p.I646V	PAPOLA_ENST00000392990.2_Missense_Mutation_p.I646V	NM_032632.4	NP_116021.2	P51003	PAPOA_HUMAN	poly(A) polymerase alpha	646					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA splicing, via spliceosome (GO:0000398)|RNA polyadenylation (GO:0043631)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|polynucleotide adenylyltransferase activity (GO:0004652)|RNA binding (GO:0003723)	p.I646V(2)		breast(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(6)|skin(1)|urinary_tract(1)	21		all_cancers(154;0.0555)|all_epithelial(191;0.149)|Melanoma(154;0.155)		COAD - Colon adenocarcinoma(157;0.213)		ACCTACTCCTATAGTAGGAGT	0.398																																					NSCLC(19;254 734 11908 35501 39234)	NSCLC(19;254 734 11908 35501 39234)	uc001yfq.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(1936-1938)ATA>GTA		poly(A) polymerase alpha							110.0	107.0	108.0					14																	97022682		2203	4300	6503	SO:0001583	missense	10914				mRNA polyadenylation|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	cytoplasm|nucleoplasm	ATP binding|magnesium ion binding|manganese ion binding|polynucleotide adenylyltransferase activity|RNA binding	g.chr14:97022682A>G	X76770	CCDS9946.1, CCDS58334.1, CCDS58335.1	14q32.1-q32.2	2008-02-08				ENSG00000090060	2.7.7.19		14981	protein-coding gene	gene with protein product		605553				8302877, 10429366	Standard	NM_032632		Approved	PAP	uc001yfq.3	P51003		ENST00000216277.8:c.1936A>G	14.37:g.97022682A>G	ENSP00000216277:p.Ile646Val		Somatic				PAPOLA_uc001yfr.2_Missense_Mutation_p.I645V|PAPOLA_uc010twv.1_Missense_Mutation_p.I646V|PAPOLA_uc010avp.2_Missense_Mutation_p.I396V	p.I646V	NM_032632	NP_116021	WXS	Illumina HiSeq	Unspecified	P51003	PAPOA_HUMAN		COAD - Colon adenocarcinoma(157;0.213)	19	2146	+		all_cancers(154;0.0555)|all_epithelial(191;0.149)|Melanoma(154;0.155)	646					Q86SX4|Q86TV0|Q8IYF5|Q9BVU2	Missense_Mutation	SNP	ENST00000216277.8	37	c.1936A>G	CCDS9946.1	.	.	.	.	.	.	.	.	.	.	A	6.348	0.432254	0.12045	.	.	ENSG00000090060	ENST00000216277;ENST00000546064;ENST00000392990;ENST00000555626	.	.	.	6.1	0.82	0.18793	.	0.225800	0.40818	N	0.001004	T	0.24084	0.0583	N	0.16656	0.425	0.25510	N	0.987466	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.15150	-1.0447	9	0.28530	T	0.3	.	11.1029	0.48186	0.4438:0.0:0.5562:0.0	.	662;662;646	F5H5I8;B4DYF4;P51003	.;.;PAPOA_HUMAN	V	646;662;646;396	.	ENSP00000216277:I646V	I	+	1	0	PAPOLA	96092435	0.987000	0.35691	0.323000	0.25347	0.925000	0.55904	0.618000	0.24373	-0.091000	0.12440	-0.256000	0.11100	ATA		0.398	PAPOLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413411.2			6	34	0	0	0	0.021553	0	6	34				
PDIA3	2923	broad.mit.edu	37	15	44038800	44038800	+	Silent	SNP	C	C	T			TCGA-44-2665-01A-01D-1040-01	TCGA-44-2665-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	520db804-4c03-4a0c-9966-fc0c9f98cfec	4b84f6af-2361-4e9b-9c8c-f1cbeb8513f2	g.chr15:44038800C>T	ENST00000300289.5	+	1	211	c.63C>T	c.(61-63)ctC>ctT	p.L21L	PDIA3_ENST00000469684.1_3'UTR|PDIA3_ENST00000538521.1_5'UTR|CATSPER2P1_ENST00000381680.2_RNA	NM_005313.4	NP_005304.3	P30101	PDIA3_HUMAN	protein disulfide isomerase family A, member 3	21					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell redox homeostasis (GO:0045454)|cellular protein metabolic process (GO:0044267)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein import into nucleus (GO:0006606)|protein N-linked glycosylation via asparagine (GO:0018279)|protein retention in ER lumen (GO:0006621)|proteolysis (GO:0006508)|response to endoplasmic reticulum stress (GO:0034976)|signal transduction (GO:0007165)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|phospholipase C activity (GO:0004629)|poly(A) RNA binding (GO:0044822)|protein disulfide isomerase activity (GO:0003756)	p.L21L(2)		breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(9)|ovary(2)|skin(1)	17		all_cancers(109;2.61e-15)|all_epithelial(112;1.12e-12)|Lung NSC(122;2.17e-08)|all_lung(180;2.45e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;9.48e-07)		CGGCCCGCCTCGCCGCTGCCT	0.706																																							uc001zsu.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)|skin(1)	2						c.(61-63)CTC>CTT		protein disulfide-isomerase A3 precursor							14.0	15.0	15.0					15																	44038800		2043	4071	6114	SO:0001819	synonymous_variant	2923				cell redox homeostasis|glycerol ether metabolic process|post-translational protein modification|protein folding|protein import into nucleus|protein N-linked glycosylation via asparagine|protein retention in ER lumen|signal transduction	endoplasmic reticulum lumen|melanosome	cysteine-type endopeptidase activity|electron carrier activity|phospholipase C activity|protein binding|protein disulfide isomerase activity|protein disulfide oxidoreductase activity	g.chr15:44038800C>T		CCDS10101.1	15q15	2009-11-20	2005-06-29	2005-03-03	ENSG00000167004	ENSG00000167004	5.3.4.1	"""Protein disulfide isomerases"""	4606	protein-coding gene	gene with protein product		602046	"""glucose regulated protein, 58kDa"", ""protein disulfide isomerase-associated 3"""	GRP58		8974399	Standard	NM_005313		Approved	P58, ERp61, ERp57, ERp60, GRP57, PI-PLC, HsT17083	uc001zsu.3	P30101	OTTHUMG00000044444	ENST00000300289.5:c.63C>T	15.37:g.44038800C>T			Somatic				PDIA3_uc010bdp.2_5'UTR|PDIA3_uc010ued.1_Intron|CATSPER2P1_uc001zss.2_5'Flank|CATSPER2P1_uc001zst.2_RNA	p.L21L	NM_005313	NP_005304	WXS	Illumina HiSeq	Unspecified	P30101	PDIA3_HUMAN		GBM - Glioblastoma multiforme(94;9.48e-07)	1	211	+		all_cancers(109;2.61e-15)|all_epithelial(112;1.12e-12)|Lung NSC(122;2.17e-08)|all_lung(180;2.45e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)	21					Q13453|Q14255|Q8IYF8|Q9UMU7	Silent	SNP	ENST00000300289.5	37	c.63C>T	CCDS10101.1																																																																																				0.706	PDIA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103532.3	NM_005313		12	26	0	0	0	0.010729	0	12	26				
THSD4	79875	broad.mit.edu	37	15	72020908	72020908	+	Missense_Mutation	SNP	C	C	T			TCGA-44-2665-01A-01D-1040-01	TCGA-44-2665-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	520db804-4c03-4a0c-9966-fc0c9f98cfec	4b84f6af-2361-4e9b-9c8c-f1cbeb8513f2	g.chr15:72020908C>T	ENST00000355327.3	+	9	1512	c.1378C>T	c.(1378-1380)Cgc>Tgc	p.R460C	THSD4_ENST00000357769.4_Missense_Mutation_p.R100C|THSD4_ENST00000261862.6_Missense_Mutation_p.R460C|THSD4_ENST00000567838.1_3'UTR			Q6ZMP0	THSD4_HUMAN	thrombospondin, type I, domain containing 4	460					elastic fiber assembly (GO:0048251)	extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)	metalloendopeptidase activity (GO:0004222)	p.R460C(2)		breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(20)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						TCGTTCTGGACGCTCCATCAT	0.507																																							uc002atb.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(1378-1380)CGC>TGC		thrombospondin, type I, domain containing 4							125.0	117.0	119.0					15																	72020908		1915	4114	6029	SO:0001583	missense	79875					proteinaceous extracellular matrix	metalloendopeptidase activity	g.chr15:72020908C>T	AK023772	CCDS10238.2, CCDS66817.1	15q23	2009-11-09			ENSG00000187720	ENSG00000187720			25835	protein-coding gene	gene with protein product		614476				19734141	Standard	NM_001286429		Approved	FVSY9334, PRO34005, FLJ13710, ADAMTSL6	uc002atb.1	Q6ZMP0	OTTHUMG00000133389	ENST00000355327.3:c.1378C>T	15.37:g.72020908C>T	ENSP00000347484:p.Arg460Cys		Somatic				THSD4_uc002atd.1_Missense_Mutation_p.R134C|THSD4_uc010ukg.1_Missense_Mutation_p.R100C|THSD4_uc002ate.2_Missense_Mutation_p.R100C	p.R460C	NM_024817	NP_079093	WXS	Illumina HiSeq	Unspecified	Q6ZMP0	THSD4_HUMAN			8	1457	+			460					B2RTY3|B4DR13|Q6MZI3|Q6UXZ8|Q9H8E4	Missense_Mutation	SNP	ENST00000355327.3	37	c.1378C>T	CCDS10238.2	.	.	.	.	.	.	.	.	.	.	C	20.1	3.938037	0.73557	.	.	ENSG00000187720	ENST00000355327;ENST00000261862;ENST00000357769	T;T;T	0.53640	0.61;0.61;0.61	5.17	5.17	0.71159	ADAM-TS Spacer 1 (1);	1.051040	0.07476	N	0.903020	T	0.69214	0.3086	M	0.69523	2.12	0.58432	D	0.999996	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.973;0.992;0.981	T	0.60224	-0.7305	10	0.72032	D	0.01	.	11.2941	0.49267	0.1821:0.8179:0.0:0.0	.	100;100;460;460	B4E1J6;B4DR13;Q6ZMP0-2;Q6ZMP0	.;.;.;THSD4_HUMAN	C	460;460;100	ENSP00000347484:R460C;ENSP00000261862:R460C;ENSP00000350413:R100C	ENSP00000261862:R460C	R	+	1	0	THSD4	69807962	0.973000	0.33851	1.000000	0.80357	0.885000	0.51271	2.389000	0.44407	2.404000	0.81709	0.462000	0.41574	CGC		0.507	THSD4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257253.2	NM_024817		9	50	0	0	0	0.069234	0	9	50				
PDILT	204474	broad.mit.edu	37	16	20370667	20370667	+	Missense_Mutation	SNP	T	T	C			TCGA-44-2665-01A-01D-1040-01	TCGA-44-2665-10A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	520db804-4c03-4a0c-9966-fc0c9f98cfec	4b84f6af-2361-4e9b-9c8c-f1cbeb8513f2	g.chr16:20370667T>C	ENST00000302451.4	-	12	1977	c.1729A>G	c.(1729-1731)Aaa>Gaa	p.K577E		NM_174924.1	NP_777584.1	Q8N807	PDILT_HUMAN	protein disulfide isomerase-like, testis expressed	577					cell migration (GO:0016477)|cell redox homeostasis (GO:0045454)|multicellular organismal development (GO:0007275)|protein folding (GO:0006457)|spermatid development (GO:0007286)	endoplasmic reticulum (GO:0005783)	protein disulfide isomerase activity (GO:0003756)	p.K577E(2)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(33)|prostate(3)|skin(1)|urinary_tract(1)	61						ACTTTTGGTTTCTTCTTTTGC	0.448																																							uc002dhc.1		NA																	2	Substitution - Missense(2)		lung(2)	large_intestine(1)	1						c.(1729-1731)AAA>GAA		protein disulfide isomerase-like, testis							165.0	156.0	159.0					16																	20370667		2203	4300	6503	SO:0001583	missense	204474				cell differentiation|cell redox homeostasis|multicellular organismal development|spermatogenesis	endoplasmic reticulum	isomerase activity	g.chr16:20370667T>C		CCDS10584.1	16p12.3	2011-11-10	2009-02-23		ENSG00000169340	ENSG00000169340		"""Protein disulfide isomerases"""	27338	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 7"", ""protein disulfide isomerase-like protein of the testis"""					15475357	Standard	NM_174924		Approved	PDIA7	uc002dhc.1	Q8N807	OTTHUMG00000131487	ENST00000302451.4:c.1729A>G	16.37:g.20370667T>C	ENSP00000305465:p.Lys577Glu		Somatic					p.K577E	NM_174924	NP_777584	WXS	Illumina HiSeq	Unspecified	Q8N807	PDILT_HUMAN			12	1952	-			577					Q8IVQ5	Missense_Mutation	SNP	ENST00000302451.4	37	c.1729A>G	CCDS10584.1	.	.	.	.	.	.	.	.	.	.	T	16.65	3.181408	0.57800	.	.	ENSG00000169340	ENST00000302451	T	0.03860	3.78	4.33	3.24	0.37175	.	0.547003	0.19492	N	0.112960	T	0.07098	0.0180	L	0.29908	0.895	0.09310	N	1	D	0.61697	0.99	P	0.54759	0.76	T	0.17776	-1.0358	10	0.87932	D	0	.	5.9246	0.19101	0.0:0.1159:0.0:0.8841	.	577	Q8N807	PDILT_HUMAN	E	577	ENSP00000305465:K577E	ENSP00000305465:K577E	K	-	1	0	PDILT	20278168	0.502000	0.26107	0.163000	0.22734	0.769000	0.43574	1.744000	0.38268	1.948000	0.56530	0.467000	0.42956	AAA		0.448	PDILT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254332.1	NM_174924		26	166	0	0	0	0.01892	0	26	166				
TANGO6	79613	broad.mit.edu	37	16	68941376	68941376	+	Silent	SNP	G	G	A			TCGA-44-2665-01A-01D-1040-01	TCGA-44-2665-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	520db804-4c03-4a0c-9966-fc0c9f98cfec	4b84f6af-2361-4e9b-9c8c-f1cbeb8513f2	g.chr16:68941376G>A	ENST00000261778.1	+	10	1710	c.1698G>A	c.(1696-1698)caG>caA	p.Q566Q		NM_024562.1	NP_078838.1	Q9C0B7	TNG6_HUMAN	transport and golgi organization 6 homolog (Drosophila)	566						integral component of membrane (GO:0016021)		p.Q95Q(2)|p.Q566Q(2)									CCCTGTACCAGAAGGTATCCT	0.473																																							uc002ewi.3		NA																	4	Substitution - coding silent(4)		lung(4)		0						c.(1696-1698)CAG>CAA		transmembrane and coiled-coil domains 7							99.0	99.0	99.0					16																	68941376		1892	4103	5995	SO:0001819	synonymous_variant	79613					integral to membrane	binding	g.chr16:68941376G>A		CCDS45516.1	16q22.1	2012-12-13	2012-12-13	2012-12-13	ENSG00000103047	ENSG00000103047			25749	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 7"""	TMCO7		11214970	Standard	NM_024562		Approved	FLJ12688, KIAA1746	uc002ewi.4	Q9C0B7	OTTHUMG00000176743	ENST00000261778.1:c.1698G>A	16.37:g.68941376G>A			Somatic					p.Q566Q	NM_024562	NP_078838	WXS	Illumina HiSeq	Unspecified	Q9C0B7	TMCO7_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.0446)|Epithelial(162;0.198)	10	1710	+		Ovarian(137;0.0568)	566					Q569F9|Q9H9K1	Silent	SNP	ENST00000261778.1	37	c.1698G>A	CCDS45516.1																																																																																				0.473	TANGO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433471.2	XM_928235.2		8	77	0	0	0	0.058154	0	8	77				
CLEC3A	10143	broad.mit.edu	37	16	78064470	78064470	+	Missense_Mutation	SNP	A	A	G			TCGA-44-2665-01A-01D-1040-01	TCGA-44-2665-10A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	520db804-4c03-4a0c-9966-fc0c9f98cfec	4b84f6af-2361-4e9b-9c8c-f1cbeb8513f2	g.chr16:78064470A>G	ENST00000575655.1	+	3	407	c.326A>G	c.(325-327)gAc>gGc	p.D109G	CLEC3A_ENST00000565808.1_3'UTR|CLEC3A_ENST00000299642.4_Missense_Mutation_p.D118G|RP11-281J9.2_ENST00000563114.1_RNA	NM_005752.4	NP_005743.4	O75596	CLC3A_HUMAN	C-type lectin domain family 3, member A	109	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				skeletal system development (GO:0001501)	extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)	p.D109G(2)		NS(1)|endometrium(2)|large_intestine(1)|lung(11)|ovary(1)|upper_aerodigestive_tract(2)	18						AGGAACTCCGACGAAATCAAC	0.473																																							uc002ffh.3		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(325-327)GAC>GGC		C-type lectin domain family 3 member A							78.0	70.0	73.0					16																	78064470		2198	4300	6498	SO:0001583	missense	10143				skeletal system development	extracellular region	sugar binding	g.chr16:78064470A>G	AF077345	CCDS10927.1, CCDS10927.2	16q23	2008-02-05	2005-02-09	2005-02-11	ENSG00000166509	ENSG00000166509		"""C-type lectin domain containing"""	2052	protein-coding gene	gene with protein product		613588	"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 1 (cartilage-derived)"""	CLECSF1		10524194	Standard	NM_001244755		Approved		uc002ffh.5	O75596	OTTHUMG00000137620	ENST00000575655.1:c.326A>G	16.37:g.78064470A>G	ENSP00000460682:p.Asp109Gly		Somatic					p.D109G	NM_005752	NP_005743	WXS	Illumina HiSeq	Unspecified	O75596	CLC3A_HUMAN			3	407	+			109			C-type lectin.		B2R8C4|Q3SX91|Q6UXF5	Missense_Mutation	SNP	ENST00000575655.1	37	c.326A>G		.	.	.	.	.	.	.	.	.	.	A	15.98	2.993078	0.54041	.	.	ENSG00000166509	ENST00000299642	.	.	.	5.76	5.76	0.90799	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.350509	0.36200	N	0.002727	T	0.51092	0.1654	L	0.41710	1.295	0.37537	D	0.918144	P	0.38677	0.642	B	0.37508	0.252	T	0.58183	-0.7681	9	0.42905	T	0.14	-34.8548	16.0399	0.80667	1.0:0.0:0.0:0.0	.	109	O75596	CLC3A_HUMAN	G	109	.	ENSP00000299642:D109G	D	+	2	0	CLEC3A	76621971	1.000000	0.71417	0.578000	0.28575	0.793000	0.44817	5.648000	0.67930	2.323000	0.78572	0.528000	0.53228	GAC		0.473	CLEC3A-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_005752		8	61	0	0	0	0.038147	0	8	61				
ZNF407	55628	broad.mit.edu	37	18	72344697	72344697	+	Silent	SNP	A	A	G			TCGA-44-2665-01A-01D-1040-01	TCGA-44-2665-10A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	520db804-4c03-4a0c-9966-fc0c9f98cfec	4b84f6af-2361-4e9b-9c8c-f1cbeb8513f2	g.chr18:72344697A>G	ENST00000299687.5	+	1	1722	c.1722A>G	c.(1720-1722)gaA>gaG	p.E574E	ZNF407_ENST00000577538.1_Silent_p.E574E|ZNF407_ENST00000309902.6_Silent_p.E574E|ZNF407_ENST00000582337.1_Silent_p.E574E	NM_017757.2	NP_060227.2	Q9C0G0	ZN407_HUMAN	zinc finger protein 407	574					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.E574E(2)		central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(21)|lung(23)|ovary(4)|prostate(3)|upper_aerodigestive_tract(2)	67		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.184)		ACTTAGATGAACATTTGCACA	0.398																																							uc002llw.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)	2						c.(1720-1722)GAA>GAG		zinc finger protein 407 isoform 1							213.0	220.0	218.0					18																	72344697		1934	4134	6068	SO:0001819	synonymous_variant	55628				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr18:72344697A>G	AB051490	CCDS45885.1, CCDS54191.1, CCDS58634.1	18q23	2013-01-08			ENSG00000215421	ENSG00000215421		"""Zinc fingers, C2H2-type"""	19904	protein-coding gene	gene with protein product		615894				11214970	Standard	NM_017757		Approved	FLJ20307, FLJ13839, KIAA1703	uc002llw.2	Q9C0G0		ENST00000299687.5:c.1722A>G	18.37:g.72344697A>G			Somatic				ZNF407_uc010xfc.1_Silent_p.E574E|ZNF407_uc010dqu.1_Silent_p.E574E|ZNF407_uc002llu.2_Silent_p.E573E	p.E574E	NM_017757	NP_060227	WXS	Illumina HiSeq	Unspecified	Q9C0G0	ZN407_HUMAN		BRCA - Breast invasive adenocarcinoma(31;0.184)	1	1779	+		Esophageal squamous(42;0.131)|Prostate(75;0.173)	574			C2H2-type 5.		B5MD54|Q96MY0|Q9H8A1|Q9NXD4|Q9NXD7	Silent	SNP	ENST00000299687.5	37	c.1722A>G	CCDS45885.1																																																																																				0.398	ZNF407-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444903.1	NM_017757		8	114	0	0	0	0.038147	0	8	114				
RPL36	25873	broad.mit.edu	37	19	5694505	5694505	+	IGR	SNP	G	G	A			TCGA-44-2665-01A-01D-1040-01	TCGA-44-2665-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	520db804-4c03-4a0c-9966-fc0c9f98cfec	4b84f6af-2361-4e9b-9c8c-f1cbeb8513f2	g.chr19:5694505G>A	ENST00000577222.1	+	0	874				LONP1_ENST00000590729.1_Missense_Mutation_p.T608M|LONP1_ENST00000593119.1_Missense_Mutation_p.T674M|LONP1_ENST00000585374.1_Missense_Mutation_p.T624M|LONP1_ENST00000360614.3_Missense_Mutation_p.T738M|LONP1_ENST00000540670.2_Missense_Mutation_p.T542M			Q9Y3U8	RL36_HUMAN	ribosomal protein L36						cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|membrane (GO:0016020)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)	p.T738M(1)		breast(1)|upper_aerodigestive_tract(1)	2						GTTCTCGGGCGTCACCTCCAC	0.647																																							uc002mcx.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2212-2214)ACG>ATG		mitochondrial lon peptidase 1 precursor							77.0	62.0	67.0					19																	5694505		2203	4300	6503	SO:0001628	intergenic_variant	9361				cellular chaperone-mediated protein complex assembly|cellular response to oxidative stress|misfolded or incompletely synthesized protein catabolic process|mitochondrial DNA metabolic process|oxidation-dependent protein catabolic process|protein homooligomerization|response to hypoxia	mitochondrial nucleoid	ADP binding|ATP binding|ATP-dependent peptidase activity|DNA polymerase binding|G-quadruplex DNA binding|mitochondrial heavy strand promoter anti-sense binding|mitochondrial light strand promoter anti-sense binding|sequence-specific DNA binding|serine-type endopeptidase activity|single-stranded DNA binding|single-stranded RNA binding	g.chr19:5694505G>A		CCDS12147.1	19p13.2	2011-04-06				ENSG00000130255		"""L ribosomal proteins"""	13631	protein-coding gene	gene with protein product							Standard	NM_033643		Approved	DKFZp566B023, L36	uc002mcv.3	Q9Y3U8			19.37:g.5694505G>A			Somatic				LONP1_uc002mcy.2_Missense_Mutation_p.T674M|LONP1_uc010duh.2_Missense_Mutation_p.T479M|LONP1_uc010dui.2_Missense_Mutation_p.T722M|LONP1_uc002mcz.2_Missense_Mutation_p.T542M	p.T738M	NM_004793	NP_004784	WXS	Illumina HiSeq	Unspecified	P36776	LONM_HUMAN			15	2246	-			738					B2R4Y1|D6W634|Q6FIG1|Q9UQF6	Missense_Mutation	SNP	ENST00000577222.1	37	c.2213C>T	CCDS12147.1	.	.	.	.	.	.	.	.	.	.	G	18.08	3.543507	0.65198	.	.	ENSG00000196365	ENST00000360614;ENST00000358403;ENST00000540670	T;T	0.33216	1.42;1.42	3.97	3.97	0.46021	Peptidase S16, Lon C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.39253	0.1071	M	0.91406	3.205	0.53688	D	0.999972	P;P;D	0.53151	0.89;0.89;0.958	B;B;B	0.36186	0.219;0.219;0.219	T	0.60934	-0.7164	10	0.66056	D	0.02	-26.0763	13.5555	0.61757	0.0:0.0:1.0:0.0	.	738;674;738	E5KMH8;Q8N8K8;P36776	.;.;LONM_HUMAN	M	738;702;542	ENSP00000353826:T738M;ENSP00000441523:T542M	ENSP00000351177:T702M	T	-	2	0	LONP1	5645505	1.000000	0.71417	0.972000	0.41901	0.819000	0.46315	8.945000	0.92985	1.770000	0.52166	0.462000	0.41574	ACG		0.647	RPL36-001	KNOWN	alternative_5_UTR|overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442561.1	NM_015414		13	78	0	0	0	0.016723	0	13	78				
SOS1	6654	broad.mit.edu	37	2	39278344	39278344	+	Missense_Mutation	SNP	T	T	C			TCGA-44-2665-01A-01D-1040-01	TCGA-44-2665-10A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	520db804-4c03-4a0c-9966-fc0c9f98cfec	4b84f6af-2361-4e9b-9c8c-f1cbeb8513f2	g.chr2:39278344T>C	ENST00000426016.1	-	7	891	c.805A>G	c.(805-807)Atg>Gtg	p.M269V	SOS1_ENST00000402219.2_Missense_Mutation_p.M269V|SOS1_ENST00000395038.2_Missense_Mutation_p.M269V|SOS1_ENST00000428721.2_Missense_Mutation_p.M212V			Q07889	SOS1_HUMAN	son of sevenless homolog 1 (Drosophila)	269	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.		M -> R (in NS4; dbSNP:rs137852813). {ECO:0000269|PubMed:17143282, ECO:0000269|PubMed:17143285, ECO:0000269|PubMed:21387466}.|M -> T (in NS4). {ECO:0000269|PubMed:19953625, ECO:0000269|PubMed:20683980, ECO:0000269|PubMed:21387466}.		apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|Ras protein signal transduction (GO:0007265)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	DNA binding (GO:0003677)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.M269V(2)		autonomic_ganglia(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|liver(1)|lung(29)|ovary(4)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	75		all_hematologic(82;0.21)				TCATCTGTCATTTCTACTGTA	0.378									Noonan syndrome																														uc002rrk.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|breast(3)|lung(2)|central_nervous_system(1)	10						c.(805-807)ATG>GTG		son of sevenless homolog 1							126.0	126.0	126.0					2																	39278344		2203	4300	6503	SO:0001583	missense	6654	Noonan_syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	apoptosis|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|induction of apoptosis by extracellular signals|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	cytosol	DNA binding|protein binding|Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity	g.chr2:39278344T>C	L13857	CCDS1802.1	2p21	2014-09-17	2002-11-05		ENSG00000115904	ENSG00000115904		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11187	protein-coding gene	gene with protein product		182530	"""gingival fibromatosis, hereditary, 1"""	GINGF		8276400, 10995566	Standard	NM_005633		Approved	HGF, GF1	uc002rrk.4	Q07889	OTTHUMG00000102109	ENST00000426016.1:c.805A>G	2.37:g.39278344T>C	ENSP00000387784:p.Met269Val		Somatic				SOS1_uc010ynr.1_RNA|SOS1_uc002rrl.2_Missense_Mutation_p.M1V	p.M269V	NM_005633	NP_005624	WXS	Illumina HiSeq	Unspecified	Q07889	SOS1_HUMAN			6	846	-		all_hematologic(82;0.21)	269		M -> R (in NS4).|M -> T (in NS4).	DH.		A8K2G3|B4DXG2	Missense_Mutation	SNP	ENST00000426016.1	37	c.805A>G	CCDS1802.1	.	.	.	.	.	.	.	.	.	.	T	16.81	3.226955	0.58668	.	.	ENSG00000115904	ENST00000426016;ENST00000402219;ENST00000543698;ENST00000395038;ENST00000263879;ENST00000428721	D;D;D;T	0.92149	-2.98;-2.98;-2.98;0.96	5.65	5.65	0.86999	Dbl homology (DH) domain (5);	0.080511	0.85682	D	0.000000	D	0.95974	0.8689	M	0.80422	2.495	0.80722	D	1	D;B	0.57257	0.979;0.006	D;B	0.73708	0.981;0.034	D	0.96411	0.9304	10	0.72032	D	0.01	.	15.541	0.76048	0.0:0.0:0.0:1.0	.	1;269	F5GX06;Q07889	.;SOS1_HUMAN	V	269;269;1;269;269;212	ENSP00000387784:M269V;ENSP00000384675:M269V;ENSP00000378479:M269V;ENSP00000399992:M212V	ENSP00000263879:M269V	M	-	1	0	SOS1	39131848	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.930000	0.87610	2.152000	0.67230	0.460000	0.39030	ATG		0.378	SOS1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219948.3	NM_005633		4	22	0	0	0	0.009096	0	4	22				
CNTNAP5	129684	broad.mit.edu	37	2	125671706	125671706	+	Silent	SNP	C	C	T			TCGA-44-2665-01A-01D-1040-01	TCGA-44-2665-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	520db804-4c03-4a0c-9966-fc0c9f98cfec	4b84f6af-2361-4e9b-9c8c-f1cbeb8513f2	g.chr2:125671706C>T	ENST00000431078.1	+	24	4126	c.3762C>T	c.(3760-3762)atC>atT	p.I1254I		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	1254					cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)		p.I1254I(2)		NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		TCTTCTGTATCATCGGCATCA	0.473																																							uc002tno.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(10)	10						c.(3760-3762)ATC>ATT		contactin associated protein-like 5 precursor							171.0	162.0	165.0					2																	125671706		1974	4175	6149	SO:0001819	synonymous_variant	129684				cell adhesion|signal transduction	integral to membrane	receptor binding	g.chr2:125671706C>T	AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.3762C>T	2.37:g.125671706C>T			Somatic				CNTNAP5_uc010flu.2_Silent_p.I1255I	p.I1254I	NM_130773	NP_570129	WXS	Illumina HiSeq	Unspecified	Q8WYK1	CNTP5_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.248)	24	4126	+			1254			Helical; (Potential).		Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Silent	SNP	ENST00000431078.1	37	c.3762C>T	CCDS46401.1																																																																																				0.473	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330864.3			5	41	0	0	0	0.02938	0	5	41				
GPR17	2840	broad.mit.edu	37	2	128409116	128409116	+	Silent	SNP	C	C	T	rs144990681		TCGA-44-2665-01A-01D-1040-01	TCGA-44-2665-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	520db804-4c03-4a0c-9966-fc0c9f98cfec	4b84f6af-2361-4e9b-9c8c-f1cbeb8513f2	g.chr2:128409116C>T	ENST00000272644.3	+	3	965	c.891C>T	c.(889-891)tgC>tgT	p.C297C	GPR17_ENST00000486700.1_3'UTR|GPR17_ENST00000393018.3_Silent_p.C297C|LIMS2_ENST00000409455.1_Intron|LIMS2_ENST00000355119.4_Intron|LIMS2_ENST00000545738.2_Intron|LIMS2_ENST00000410011.1_Intron|LIMS2_ENST00000324938.5_Intron|LIMS2_ENST00000409254.1_5'Flank|GPR17_ENST00000544369.1_Silent_p.C297C|LIMS2_ENST00000409808.2_Intron	NM_001161416.1|NM_001161417.1|NM_005291.2	NP_001154888.1|NP_001154889.1|NP_005282.1	Q13304	GPR17_HUMAN	G protein-coupled receptor 17	297					chemokine-mediated signaling pathway (GO:0070098)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	chemokine receptor activity (GO:0004950)	p.C297C(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(11)|prostate(2)|urinary_tract(1)	19	Colorectal(110;0.1)	Ovarian(717;0.15)		BRCA - Breast invasive adenocarcinoma(221;0.0677)		GGGCCTCCTGCGCCACCCAGC	0.622																																							uc010yzn.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(889-891)TGC>TGT		G protein-coupled receptor 17 isoform a		C	,,,,,,,	1,4405		0,1,2202	83.0	76.0	78.0		,,,891,807,807,891,	-3.4	0.0	2	dbSNP_134	78	0,8600		0,0,4300	no	intron,intron,intron,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,intron	GPR17,LIMS2	NM_001136037.2,NM_001161403.1,NM_001161404.1,NM_001161415.1,NM_001161416.1,NM_001161417.1,NM_005291.2,NM_017980.4	,,,,,,,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,,,,,,,	,,,297/368,269/340,269/340,297/368,	128409116	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	2840					integral to plasma membrane	chemokine receptor activity|purinergic nucleotide receptor activity, G-protein coupled	g.chr2:128409116C>T		CCDS2148.1	2q21	2014-01-30			ENSG00000144230	ENSG00000144230		"""GPCR / Class A : Orphans"""	4471	protein-coding gene	gene with protein product		603071				8558062	Standard	NM_001161415		Approved		uc002tpc.3	Q13304	OTTHUMG00000131533	ENST00000272644.3:c.891C>T	2.37:g.128409116C>T			Somatic				LIMS2_uc002tox.2_Intron|LIMS2_uc010fmb.2_Intron|LIMS2_uc002toy.2_Intron|LIMS2_uc010yzm.1_Intron|LIMS2_uc002tpa.2_Intron|LIMS2_uc002toz.2_Intron|LIMS2_uc002tpb.2_Intron|GPR17_uc002tpc.2_Silent_p.C297C|GPR17_uc010yzo.1_Silent_p.C269C|GPR17_uc002tpd.2_Silent_p.C269C	p.C297C	NM_001161415	NP_001154887	WXS	Illumina HiSeq	Unspecified	Q13304	GPR17_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.0677)	4	1502	+	Colorectal(110;0.1)	Ovarian(717;0.15)	297			Extracellular (Potential).		A8K9L0|B2R9X0|Q8N5S7|Q9UDZ6|Q9UE21	Silent	SNP	ENST00000272644.3	37	c.891C>T	CCDS2148.1																																																																																				0.622	GPR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254390.1			9	59	0	0	0	0.047766	0	9	59				
CASP8	841	broad.mit.edu	37	2	202131375	202131375	+	Nonsense_Mutation	SNP	G	G	T			TCGA-44-2665-01A-01D-1040-01	TCGA-44-2665-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	520db804-4c03-4a0c-9966-fc0c9f98cfec	4b84f6af-2361-4e9b-9c8c-f1cbeb8513f2	g.chr2:202131375G>T	ENST00000432109.2	+	3	355	c.166G>T	c.(166-168)Gaa>Taa	p.E56*	CASP8_ENST00000264274.9_Nonsense_Mutation_p.E56*|CASP8_ENST00000392259.2_Nonsense_Mutation_p.E56*|CASP8_ENST00000392266.3_Nonsense_Mutation_p.E56*|CASP8_ENST00000392258.3_Nonsense_Mutation_p.E56*|CASP8_ENST00000264275.5_Nonsense_Mutation_p.E56*|CASP8_ENST00000358485.4_Nonsense_Mutation_p.E115*|CASP8_ENST00000323492.7_Nonsense_Mutation_p.E56*	NM_033355.3	NP_203519.1	Q14790	CASP8_HUMAN	caspase 8, apoptosis-related cysteine peptidase	56	DED 1. {ECO:0000255|PROSITE- ProRule:PRU00065}.				activation of cysteine-type endopeptidase activity (GO:0097202)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|B cell activation (GO:0042113)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to mechanical stimulus (GO:0071260)|cellular response to organic cyclic compound (GO:0071407)|execution phase of apoptosis (GO:0097194)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|heart development (GO:0007507)|hepatocyte apoptotic process (GO:0097284)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|macrophage differentiation (GO:0030225)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|natural killer cell activation (GO:0030101)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of necroptotic process (GO:0060546)|neural tube formation (GO:0001841)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of proteolysis (GO:0045862)|protein heterooligomerization (GO:0051291)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|regulation of thymocyte apoptotic process (GO:0070243)|response to antibiotic (GO:0046677)|response to cobalt ion (GO:0032025)|response to cold (GO:0009409)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)|syncytiotrophoblast cell differentiation involved in labyrinthine layer development (GO:0060715)|T cell activation (GO:0042110)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRAIL-activated apoptotic signaling pathway (GO:0036462)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	CD95 death-inducing signaling complex (GO:0031265)|cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|death-inducing signaling complex (GO:0031264)|membrane raft (GO:0045121)|microtubule organizing center (GO:0005815)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|Noc1p-Noc2p complex (GO:0030690)|nucleus (GO:0005634)|ripoptosome (GO:0097342)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type endopeptidase activity involved in apoptotic process (GO:0097153)|cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097199)|cysteine-type peptidase activity (GO:0008234)|death effector domain binding (GO:0035877)|peptidase activity (GO:0008233)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)	p.E56*(4)|p.E115*(2)		breast(5)|cervix(2)|endometrium(6)|large_intestine(11)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(9)|urinary_tract(3)	52						AATGTTGGAGGAAAGCAATCT	0.453										HNSCC(4;0.00038)																											Melanoma(82;831 1348 20716 36952 40159)	Melanoma(82;831 1348 20716 36952 40159)	uc002uxr.1		NA																	6	Substitution - Nonsense(6)		lung(6)	upper_aerodigestive_tract(2)|ovary(1)|breast(1)|skin(1)	5						c.(166-168)GAA>TAA		caspase 8 isoform B precursor							77.0	77.0	77.0					2																	202131375		2203	4300	6503	SO:0001587	stop_gained	841				activation of caspase activity|activation of pro-apoptotic gene products|cellular component disassembly involved in apoptosis|cellular response to mechanical stimulus|induction of apoptosis by extracellular signals|induction of apoptosis by intracellular signals|positive regulation of I-kappaB kinase/NF-kappaB cascade|proteolysis involved in cellular protein catabolic process|response to tumor necrosis factor	centrosome|cytosol|mitochondrial outer membrane	cysteine-type endopeptidase activity|protein binding|protein binding	g.chr2:202131375G>T	U60520	CCDS2342.1, CCDS2343.1, CCDS2345.1, CCDS42798.1, CCDS42799.1	2q33-q34	2014-09-17	2005-08-17		ENSG00000064012	ENSG00000064012		"""Caspases"""	1509	protein-coding gene	gene with protein product		601763	"""caspase 8, apoptosis-related cysteine protease"""			8681376, 8681377	Standard	NM_033355		Approved	MCH5, MACH, FLICE, Casp-8	uc002uxt.1	Q14790	OTTHUMG00000132821	ENST00000432109.2:c.166G>T	2.37:g.202131375G>T	ENSP00000412523:p.Glu56*	HNSCC(4;0.00038)	Somatic				CASP8_uc010ftc.1_Nonsense_Mutation_p.E56*|CASP8_uc002uxo.1_Nonsense_Mutation_p.E56*|CASP8_uc002uxp.1_Nonsense_Mutation_p.E56*|CASP8_uc002uxq.1_Nonsense_Mutation_p.E56*|CASP8_uc002uxs.1_Nonsense_Mutation_p.E56*|CASP8_uc002uxt.1_Nonsense_Mutation_p.E115*|CASP8_uc002uxu.1_RNA|CASP8_uc010ftd.1_Intron|CASP8_uc002uxv.1_Nonsense_Mutation_p.E56*|CASP8_uc002uxw.1_Nonsense_Mutation_p.E56*|CASP8_uc002uxy.1_Nonsense_Mutation_p.E56*|CASP8_uc002uxx.1_Nonsense_Mutation_p.E56*|CASP8_uc010ftf.2_Nonsense_Mutation_p.E56*	p.E56*	NM_033355	NP_203519	WXS	Illumina HiSeq	Unspecified	Q14790	CASP8_HUMAN			3	375	+			56			DED 1.		O14676|Q14791|Q14792|Q14793|Q14794|Q14795|Q14796|Q15780|Q15806|Q53TT5|Q8TDI1|Q8TDI2|Q8TDI3|Q8TDI4|Q8TDI5|Q96T22|Q9C0K4|Q9UQ81	Nonsense_Mutation	SNP	ENST00000432109.2	37	c.166G>T	CCDS2342.1	.	.	.	.	.	.	.	.	.	.	G	37	6.166365	0.97343	.	.	ENSG00000064012	ENST00000392263;ENST00000264274;ENST00000392259;ENST00000392266;ENST00000432109;ENST00000264275;ENST00000440732;ENST00000392258;ENST00000447616;ENST00000358485;ENST00000392261;ENST00000413726;ENST00000323492;ENST00000429881	.	.	.	5.47	4.6	0.57074	.	0.178059	0.39210	N	0.001421	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.31617	T	0.26	.	13.0819	0.59119	0.0771:0.0:0.9229:0.0	.	.	.	.	X	56;56;56;56;56;56;56;56;56;115;56;56;56;56	.	ENSP00000264274:E56X	E	+	1	0	CASP8	201839620	0.999000	0.42202	0.984000	0.44739	0.598000	0.36846	2.916000	0.48813	1.300000	0.44818	0.561000	0.74099	GAA		0.453	CASP8-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000336853.2	NM_001228		5	26	1	0	0.000602214	0.014758	0.000627307	5	26				
CASP8	841	broad.mit.edu	37	2	202137390	202137390	+	Missense_Mutation	SNP	G	G	C			TCGA-44-2665-01A-01D-1040-01	TCGA-44-2665-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	520db804-4c03-4a0c-9966-fc0c9f98cfec	4b84f6af-2361-4e9b-9c8c-f1cbeb8513f2	g.chr2:202137390G>C	ENST00000432109.2	+	5	630	c.441G>C	c.(439-441)gaG>gaC	p.E147D	CASP8_ENST00000264274.9_Missense_Mutation_p.E147D|CASP8_ENST00000392259.2_Missense_Mutation_p.E147D|CASP8_ENST00000392266.3_Missense_Mutation_p.E147D|CASP8_ENST00000392258.3_Missense_Mutation_p.E147D|CASP8_ENST00000264275.5_Missense_Mutation_p.E179D|CASP8_ENST00000358485.4_Missense_Mutation_p.E206D|CASP8_ENST00000323492.7_Missense_Mutation_p.E147D	NM_033355.3	NP_203519.1	Q14790	CASP8_HUMAN	caspase 8, apoptosis-related cysteine peptidase	147	DED 2. {ECO:0000255|PROSITE- ProRule:PRU00065}.				activation of cysteine-type endopeptidase activity (GO:0097202)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|B cell activation (GO:0042113)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to mechanical stimulus (GO:0071260)|cellular response to organic cyclic compound (GO:0071407)|execution phase of apoptosis (GO:0097194)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|heart development (GO:0007507)|hepatocyte apoptotic process (GO:0097284)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|macrophage differentiation (GO:0030225)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|natural killer cell activation (GO:0030101)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of necroptotic process (GO:0060546)|neural tube formation (GO:0001841)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of proteolysis (GO:0045862)|protein heterooligomerization (GO:0051291)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|regulation of thymocyte apoptotic process (GO:0070243)|response to antibiotic (GO:0046677)|response to cobalt ion (GO:0032025)|response to cold (GO:0009409)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)|syncytiotrophoblast cell differentiation involved in labyrinthine layer development (GO:0060715)|T cell activation (GO:0042110)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRAIL-activated apoptotic signaling pathway (GO:0036462)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	CD95 death-inducing signaling complex (GO:0031265)|cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|death-inducing signaling complex (GO:0031264)|membrane raft (GO:0045121)|microtubule organizing center (GO:0005815)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|Noc1p-Noc2p complex (GO:0030690)|nucleus (GO:0005634)|ripoptosome (GO:0097342)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type endopeptidase activity involved in apoptotic process (GO:0097153)|cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097199)|cysteine-type peptidase activity (GO:0008234)|death effector domain binding (GO:0035877)|peptidase activity (GO:0008233)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)	p.E179D(4)|p.E206D(2)		breast(5)|cervix(2)|endometrium(6)|large_intestine(11)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(9)|urinary_tract(3)	52						TAGAGATGGAGAAGAGGGTCA	0.398										HNSCC(4;0.00038)																											Melanoma(82;831 1348 20716 36952 40159)	Melanoma(82;831 1348 20716 36952 40159)	uc002uxr.1		NA																	6	Substitution - Missense(6)		lung(6)	upper_aerodigestive_tract(2)|ovary(1)|breast(1)|skin(1)	5						c.(439-441)GAG>GAC		caspase 8 isoform B precursor							127.0	131.0	130.0					2																	202137390		2203	4300	6503	SO:0001583	missense	841				activation of caspase activity|activation of pro-apoptotic gene products|cellular component disassembly involved in apoptosis|cellular response to mechanical stimulus|induction of apoptosis by extracellular signals|induction of apoptosis by intracellular signals|positive regulation of I-kappaB kinase/NF-kappaB cascade|proteolysis involved in cellular protein catabolic process|response to tumor necrosis factor	centrosome|cytosol|mitochondrial outer membrane	cysteine-type endopeptidase activity|protein binding|protein binding	g.chr2:202137390G>C	U60520	CCDS2342.1, CCDS2343.1, CCDS2345.1, CCDS42798.1, CCDS42799.1	2q33-q34	2014-09-17	2005-08-17		ENSG00000064012	ENSG00000064012		"""Caspases"""	1509	protein-coding gene	gene with protein product		601763	"""caspase 8, apoptosis-related cysteine protease"""			8681376, 8681377	Standard	NM_033355		Approved	MCH5, MACH, FLICE, Casp-8	uc002uxt.1	Q14790	OTTHUMG00000132821	ENST00000432109.2:c.441G>C	2.37:g.202137390G>C	ENSP00000412523:p.Glu147Asp	HNSCC(4;0.00038)	Somatic				CASP8_uc010ftc.1_Missense_Mutation_p.E147D|CASP8_uc002uxo.1_Missense_Mutation_p.E147D|CASP8_uc002uxp.1_Missense_Mutation_p.E179D|CASP8_uc002uxq.1_Missense_Mutation_p.E147D|CASP8_uc002uxs.1_Missense_Mutation_p.E147D|CASP8_uc002uxt.1_Missense_Mutation_p.E206D|CASP8_uc002uxu.1_RNA|CASP8_uc010ftd.1_Missense_Mutation_p.E44D|CASP8_uc002uxv.1_Missense_Mutation_p.E147D|CASP8_uc002uxw.1_Missense_Mutation_p.E147D|CASP8_uc002uxy.1_Missense_Mutation_p.E147D|CASP8_uc002uxx.1_Missense_Mutation_p.E147D|CASP8_uc010ftf.2_Missense_Mutation_p.E147D|CASP8_uc010fte.1_Missense_Mutation_p.E44D	p.E147D	NM_033355	NP_203519	WXS	Illumina HiSeq	Unspecified	Q14790	CASP8_HUMAN			5	650	+			147			DED 2.		O14676|Q14791|Q14792|Q14793|Q14794|Q14795|Q14796|Q15780|Q15806|Q53TT5|Q8TDI1|Q8TDI2|Q8TDI3|Q8TDI4|Q8TDI5|Q96T22|Q9C0K4|Q9UQ81	Missense_Mutation	SNP	ENST00000432109.2	37	c.441G>C	CCDS2342.1	.	.	.	.	.	.	.	.	.	.	G	18.27	3.587746	0.66105	.	.	ENSG00000064012	ENST00000392263;ENST00000264274;ENST00000392259;ENST00000392266;ENST00000432109;ENST00000264275;ENST00000450491;ENST00000392258;ENST00000447616;ENST00000358485;ENST00000392261;ENST00000413726;ENST00000323492;ENST00000424461;ENST00000444430	T;D;D;D;T;D;D;D;D;T;D;T;D;D	0.85629	3.39;-2.01;-2.01;-2.01;3.88;-2.01;-2.01;-2.01;-2.01;3.8;-2.01;3.39;-2.01;-2.01	5.98	3.2	0.36748	DEATH-like (2);Death effector (3);	0.000000	0.85682	D	0.000000	D	0.91005	0.7171	M	0.89715	3.055	0.31926	N	0.612764	D;D;D;D;D;D;D;D;D;D	0.89917	0.997;1.0;1.0;1.0;1.0;1.0;1.0;1.0;0.999;1.0	D;D;D;D;D;D;D;D;D;D	0.97110	0.987;0.999;1.0;1.0;1.0;0.983;1.0;1.0;0.983;0.999	D	0.87532	0.2453	10	0.16420	T	0.52	.	6.2271	0.20714	0.152:0.0:0.6969:0.1511	.	147;147;147;147;147;206;147;147;179;147	Q14790-3;Q14790-6;E7ETB7;Q14790-7;A8MU92;Q14790-9;Q14790;Q14790-2;Q14790-4;Q14790-5	.;.;.;.;.;.;CASP8_HUMAN;.;.;.	D	147;147;147;147;147;179;44;147;147;206;147;147;147;10;10	ENSP00000376091:E147D;ENSP00000264274:E147D;ENSP00000376088:E147D;ENSP00000376094:E147D;ENSP00000412523:E147D;ENSP00000264275:E179D;ENSP00000391709:E44D;ENSP00000376087:E147D;ENSP00000388306:E147D;ENSP00000351273:E206D;ENSP00000397528:E147D;ENSP00000325722:E147D;ENSP00000390346:E10D;ENSP00000394434:E10D	ENSP00000264274:E147D	E	+	3	2	CASP8	201845635	1.000000	0.71417	1.000000	0.80357	0.617000	0.37484	1.334000	0.33827	0.849000	0.35215	0.591000	0.81541	GAG		0.398	CASP8-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000336853.2	NM_001228		23	73	0	0	0	0.062417	0	23	73				
ANO7	50636	broad.mit.edu	37	2	242148934	242148934	+	Missense_Mutation	SNP	G	G	C			TCGA-44-2665-01A-01D-1040-01	TCGA-44-2665-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	520db804-4c03-4a0c-9966-fc0c9f98cfec	4b84f6af-2361-4e9b-9c8c-f1cbeb8513f2	g.chr2:242148934G>C	ENST00000274979.8	+	13	1508	c.1405G>C	c.(1405-1407)Gcc>Ccc	p.A469P	ANO7_ENST00000402430.3_Missense_Mutation_p.A468P	NM_001001891.3	NP_001001891.2	Q6IWH7	ANO7_HUMAN	anoctamin 7	469					calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|calcium activated phosphatidylserine scrambling (GO:0061589)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)|phospholipid scramblase activity (GO:0017128)	p.A469P(1)		NS(1)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(14)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(2)	32						GCCCCAGTTTGCCGCCTCAGC	0.711																																							uc002wax.2		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(2)|central_nervous_system(1)	3						c.(1405-1407)GCC>CCC		transmembrane protein 16G isoform NGEP long							27.0	31.0	30.0					2																	242148934		2201	4299	6500	SO:0001583	missense	50636					cell junction|chloride channel complex|cytosol	chloride channel activity	g.chr2:242148934G>C	AY617079	CCDS33423.1, CCDS46563.1	2q37.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000146205	ENSG00000146205		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	31677	protein-coding gene	gene with protein product		605096	"""transmembrane protein 16G"""	PCANAP5, TMEM16G		14981236, 15375614, 24692353	Standard	NM_001001891		Approved	NGEP, PCANAP5L, IPCA-5	uc002wax.2	Q6IWH7	OTTHUMG00000151702	ENST00000274979.8:c.1405G>C	2.37:g.242148934G>C	ENSP00000274979:p.Ala469Pro		Somatic					p.A469P	NM_001001891	NP_001001891	WXS	Illumina HiSeq	Unspecified	Q6IWH7	ANO7_HUMAN			13	1508	+			469			Cytoplasmic (Potential).		Q6IWH6	Missense_Mutation	SNP	ENST00000274979.8	37	c.1405G>C	CCDS33423.1	.	.	.	.	.	.	.	.	.	.	G	17.97	3.518915	0.64634	.	.	ENSG00000146205	ENST00000274979;ENST00000402430	T;T	0.64618	-0.11;-0.11	3.61	2.71	0.32032	.	0.374713	0.23629	N	0.046157	T	0.71367	0.3331	M	0.82630	2.6	0.30192	N	0.799435	P	0.52463	0.953	P	0.57371	0.819	T	0.66995	-0.5782	10	0.35671	T	0.21	.	5.992	0.19472	0.1067:0.0:0.7023:0.1911	.	469	Q6IWH7	ANO7_HUMAN	P	469;468	ENSP00000274979:A469P;ENSP00000385418:A468P	ENSP00000274979:A469P	A	+	1	0	ANO7	241797607	0.008000	0.16893	0.934000	0.37439	0.928000	0.56348	0.640000	0.24705	0.493000	0.27837	0.306000	0.20318	GCC		0.711	ANO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323509.1	NM_001001891		4	23	0	0	0	0.009096	0	4	23				
FRG1B	284802	broad.mit.edu	37	20	29628263	29628263	+	Missense_Mutation	SNP	A	A	G			TCGA-44-2665-01A-01D-1040-01	TCGA-44-2665-10A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	520db804-4c03-4a0c-9966-fc0c9f98cfec	4b84f6af-2361-4e9b-9c8c-f1cbeb8513f2	g.chr20:29628263A>G	ENST00000278882.3	+	6	645	c.265A>G	c.(265-267)Att>Gtt	p.I89V	FRG1B_ENST00000358464.4_Missense_Mutation_p.I89V|FRG1B_ENST00000439954.2_Missense_Mutation_p.I94V			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	89								p.I89V(4)		endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						TAGCTGCTTTATTAGATGCAA	0.363																																							uc010ztl.1		NA																	4	Substitution - Missense(4)		prostate(2)|kidney(2)		0						c.(175-177)ATT>GTT		Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.																																				SO:0001583	missense	284802							g.chr20:29628263A>G			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.265A>G	20.37:g.29628263A>G	ENSP00000278882:p.Ile89Val		Somatic				FRG1B_uc002wvm.1_RNA|FRG1B_uc010ztj.1_RNA|FRG1B_uc010gdr.1_RNA|FRG1B_uc010ztk.1_Missense_Mutation_p.I11V	p.I59V			WXS	Illumina HiSeq	Unspecified					3	207	+								C4AME5	Missense_Mutation	SNP	ENST00000278882.3	37	c.175A>G		.	.	.	.	.	.	.	.	.	.	a	8.196	0.797144	0.16327	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.44482	0.92	2.08	2.08	0.27032	Actin cross-linking (1);	0.052017	0.85682	D	0.000000	T	0.22666	0.0547	.	.	.	0.33862	D	0.633895	B;B	0.06786	0.0;0.001	B;B	0.20767	0.018;0.031	T	0.12041	-1.0563	9	0.22706	T	0.39	.	3.8663	0.09018	0.8139:0.0:0.1861:0.0	.	94;89	F5H5R5;Q9BZ01	.;FRG1B_HUMAN	V	89;94;89	ENSP00000408863:I94V	ENSP00000278882:I89V	I	+	1	0	FRG1B	28241924	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	4.345000	0.59360	1.208000	0.43306	0.347000	0.21830	ATT		0.363	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579		3	11	0	0	0	0.004672	0	3	11				
PRSS50	29122	broad.mit.edu	37	3	46784015	46784015	+	Intron	SNP	A	A	C			TCGA-44-2665-01A-01D-1040-01	TCGA-44-2665-10A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	520db804-4c03-4a0c-9966-fc0c9f98cfec	4b84f6af-2361-4e9b-9c8c-f1cbeb8513f2	g.chr3:46784015A>C	ENST00000460241.1	-	4	1129				PRSS45_ENST00000442359.2_Missense_Mutation_p.V171G			Q9UI38	TSP50_HUMAN	protease, serine, 50						proteolysis (GO:0006508)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)	serine-type endopeptidase activity (GO:0004252)|threonine-type endopeptidase activity (GO:0004298)			endometrium(2)|kidney(2)|large_intestine(1)|lung(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	11						CCAGGACAACACCCCAGCCAG	0.527																																					Pancreas(41;915 1239 11561 17469)		uc010hjl.2		NA																	0					0						c.(511-513)GTG>GGG		testis serine protease 5							143.0	165.0	158.0					3																	46784015		1986	4169	6155	SO:0001627	intron_variant	377047				proteolysis		serine-type endopeptidase activity	g.chr3:46784015A>C	AF100707	CCDS2745.1	3p21.31	2011-05-24			ENSG00000206549	ENSG00000206549		"""Serine peptidases / Serine peptidases"""	17910	protein-coding gene	gene with protein product	"""cancer/testis antigen 20"", ""testes specific protease 50"""	607950				10397268	Standard	NM_013270		Approved	TSP50, CT20	uc003cqe.1	Q9UI38	OTTHUMG00000164067	ENST00000460241.1:c.541+6099T>G	3.37:g.46784015A>C			Somatic				PRSS45_uc011bam.1_RNA	p.V171G	NM_199183	NP_954652	WXS	Illumina HiSeq	Unspecified	Q7RTY3	PRS45_HUMAN			4	512	-			203			Peptidase S1.			Missense_Mutation	SNP	ENST00000460241.1	37	c.512T>G	CCDS2745.1	.	.	.	.	.	.	.	.	.	.	A	21.8	4.202240	0.79127	.	.	ENSG00000188086	ENST00000331814;ENST00000442359	D	0.95272	-3.66	5.65	5.65	0.86999	.	0.271719	0.26407	N	0.024554	D	0.96793	0.8953	.	.	.	0.80722	D	1	D	0.76494	0.999	D	0.69142	0.962	D	0.97059	0.9769	9	0.87932	D	0	.	12.1892	0.54261	1.0:0.0:0.0:0.0	.	171	Q7RTY3-2	.	G	203;171	ENSP00000401932:V171G	ENSP00000330940:V203G	V	-	2	0	PRSS45	46759019	0.818000	0.29161	0.287000	0.24848	0.945000	0.59286	7.426000	0.80270	2.371000	0.80710	0.533000	0.62120	GTG		0.527	PRSS50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354544.1			6	59	0	0	0	0.024245	0	6	59				
NDUFAF3	25915	broad.mit.edu	37	3	49060156	49060156	+	Missense_Mutation	SNP	A	A	G			TCGA-44-2665-01A-01D-1040-01	TCGA-44-2665-10A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	520db804-4c03-4a0c-9966-fc0c9f98cfec	4b84f6af-2361-4e9b-9c8c-f1cbeb8513f2	g.chr3:49060156A>G	ENST00000326925.6	+	3	1426	c.292A>G	c.(292-294)Acc>Gcc	p.T98A	MIR425_ENST00000362162.1_RNA|NDUFAF3_ENST00000451378.2_Missense_Mutation_p.T41A|DALRD3_ENST00000496568.1_5'Flank|NDUFAF3_ENST00000395458.2_Missense_Mutation_p.T41A|DALRD3_ENST00000440857.1_5'Flank|NDUFAF3_ENST00000326912.4_Missense_Mutation_p.T41A|MIR191_ENST00000384873.1_RNA|DALRD3_ENST00000313778.5_5'Flank	NM_199069.1	NP_951032.1	Q9BU61	NDUF3_HUMAN	NADH dehydrogenase (ubiquinone) complex I, assembly factor 3	98					mitochondrial respiratory chain complex I assembly (GO:0032981)	mitochondrial inner membrane (GO:0005743)|nucleus (GO:0005634)		p.T98A(2)		haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(4)	8						CCAGGACATCACCGAAGACAG	0.592																																							uc003cvq.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(292-294)ACC>GCC		NADH dehydrogenase (ubiquinone) 1 alpha							176.0	179.0	178.0					3																	49060156		2203	4300	6503	SO:0001583	missense	25915				mitochondrial respiratory chain complex I assembly	mitochondrial inner membrane|nucleus	protein binding	g.chr3:49060156A>G		CCDS2784.1, CCDS2785.1	3p21.31	2012-10-12	2012-05-08	2009-03-18	ENSG00000178057	ENSG00000178057		"""Mitochondrial respiratory chain complex assembly factors"""	29918	protein-coding gene	gene with protein product		612911	"""chromosome 3 open reading frame 60"", ""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 3"""	C3orf60		12653254, 9349717	Standard	NM_199069		Approved	MGC10527, DKFZP564J0123, E3-3, 2P1	uc003cvq.3	Q9BU61	OTTHUMG00000156773	ENST00000326925.6:c.292A>G	3.37:g.49060156A>G	ENSP00000323076:p.Thr98Ala		Somatic				DALRD3_uc003cvm.1_5'Flank|DALRD3_uc010hko.1_5'Flank|uc011bcb.1_5'Flank|MIR425_hsa-mir-425|MI0001448_5'Flank|NDUFAF3_uc003cvn.2_Missense_Mutation_p.T41A|uc003cvo.1_5'Flank|MIR191_hsa-mir-191|MI0000465_5'Flank|NDUFAF3_uc003cvp.2_Missense_Mutation_p.T41A|NDUFAF3_uc003cvr.2_Missense_Mutation_p.T41A|NDUFAF3_uc003cvs.2_Missense_Mutation_p.T41A	p.T98A	NM_199069	NP_951032	WXS	Illumina HiSeq	Unspecified	Q9BU61	NDUF3_HUMAN			3	796	+			98						Missense_Mutation	SNP	ENST00000326925.6	37	c.292A>G	CCDS2784.1	.	.	.	.	.	.	.	.	.	.	A	32	5.107448	0.94292	.	.	ENSG00000178057	ENST00000326912;ENST00000326925;ENST00000395458;ENST00000451378	D;D;D;D	0.86366	-2.11;-2.11;-2.11;-2.11	5.47	5.47	0.80525	.	0.153741	0.56097	D	0.000023	D	0.89774	0.6812	M	0.70787	2.145	0.45097	D	0.998117	P	0.35894	0.526	P	0.48921	0.595	D	0.88482	0.3069	10	0.38643	T	0.18	-15.4135	11.2369	0.48946	0.8629:0.0:0.0:0.1371	.	98	Q9BU61	NDUF3_HUMAN	A	41;98;41;41	ENSP00000323003:T41A;ENSP00000323076:T98A;ENSP00000378843:T41A;ENSP00000402465:T41A	ENSP00000323003:T41A	T	+	1	0	NDUFAF3	49035160	1.000000	0.71417	0.987000	0.45799	0.981000	0.71138	2.850000	0.48294	2.074000	0.62210	0.482000	0.46254	ACC		0.592	NDUFAF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345683.2	NM_199069		31	198	0	0	0	0.050027	0	31	198				
MST1R	4486	broad.mit.edu	37	3	49928032	49928032	+	Silent	SNP	G	G	A			TCGA-44-2665-01A-01D-1040-01	TCGA-44-2665-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	520db804-4c03-4a0c-9966-fc0c9f98cfec	4b84f6af-2361-4e9b-9c8c-f1cbeb8513f2	g.chr3:49928032G>A	ENST00000296474.3	-	18	3723	c.3696C>T	c.(3694-3696)gaC>gaT	p.D1232D	MST1R_ENST00000344206.4_Silent_p.D1183D	NM_002447.2	NP_002438	Q04912	RON_HUMAN	macrophage stimulating 1 receptor (c-met-related tyrosine kinase)	1232	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular component movement (GO:0006928)|defense response (GO:0006952)|innate immune response (GO:0045087)|macrophage colony-stimulating factor signaling pathway (GO:0038145)|multicellular organismal development (GO:0007275)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|response to virus (GO:0009615)|signal transduction (GO:0007165)|single fertilization (GO:0007338)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|macrophage colony-stimulating factor receptor activity (GO:0005011)	p.D1232D(4)		cervix(1)|endometrium(5)|large_intestine(3)|lung(17)|ovary(5)|prostate(2)|skin(1)|urinary_tract(3)	37				BRCA - Breast invasive adenocarcinoma(193;4.65e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00553)|Kidney(197;0.00625)		TGTCCAGGATGTCGCGGGCCA	0.557																																							uc003cxy.3		NA																	4	Substitution - coding silent(4)		lung(4)	ovary(5)|lung(1)	6						c.(3694-3696)GAC>GAT		macrophage stimulating 1 receptor precursor							144.0	114.0	124.0					3																	49928032		2203	4300	6503	SO:0001819	synonymous_variant	4486				cellular component movement|defense response|multicellular organismal development|positive regulation of cell proliferation|single fertilization|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|macrophage colony-stimulating factor receptor activity|protein binding	g.chr3:49928032G>A	X70040	CCDS2807.1, CCDS58833.1	3p21	2008-08-18			ENSG00000164078	ENSG00000164078		"""CD molecules"""	7381	protein-coding gene	gene with protein product		600168	"""PTK8 protein tyrosine kinase 8"""	RON, PTK8		8386824	Standard	NM_002447		Approved	CDw136, CD136	uc003cxy.4	Q04912	OTTHUMG00000156709	ENST00000296474.3:c.3696C>T	3.37:g.49928032G>A			Somatic				MST1R_uc011bdc.1_Silent_p.D111D	p.D1232D	NM_002447	NP_002438	WXS	Illumina HiSeq	Unspecified	Q04912	RON_HUMAN		BRCA - Breast invasive adenocarcinoma(193;4.65e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00553)|Kidney(197;0.00625)	18	3960	-			1232			Cytoplasmic (Potential).|Protein kinase.		B5A944|B5A945|B5A946|B5A947	Silent	SNP	ENST00000296474.3	37	c.3696C>T	CCDS2807.1	.	.	.	.	.	.	.	.	.	.	G	4.686	0.127587	0.08981	.	.	ENSG00000164078	ENST00000434765;ENST00000440292	.	.	.	5.41	-1.87	0.07737	.	.	.	.	.	T	0.38453	0.1041	.	.	.	0.25694	N	0.985654	.	.	.	.	.	.	T	0.40776	-0.9545	4	.	.	.	-3.2643	13.574	0.61864	0.6313:0.0:0.3687:0.0	.	.	.	.	I	210;253	.	.	T	-	2	0	MST1R	49903036	0.000000	0.05858	0.000000	0.03702	0.628000	0.37860	-0.398000	0.07259	-0.276000	0.09206	0.561000	0.74099	ACA		0.557	MST1R-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000345403.1			6	25	0	0	0	0.021553	0	6	25				
CD200	4345	broad.mit.edu	37	3	112068653	112068653	+	Silent	SNP	G	G	C			TCGA-44-2665-01A-01D-1040-01	TCGA-44-2665-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	520db804-4c03-4a0c-9966-fc0c9f98cfec	4b84f6af-2361-4e9b-9c8c-f1cbeb8513f2	g.chr3:112068653G>C	ENST00000315711.8	+	5	846	c.789G>C	c.(787-789)cgG>cgC	p.R263R	CD200_ENST00000473539.1_Silent_p.R288R|CD200_ENST00000383681.3_Silent_p.R189R	NM_005944.5	NP_005935.4	P41217	OX2G_HUMAN	CD200 molecule	263					regulation of immune response (GO:0050776)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)		p.R288R(1)		endometrium(1)|kidney(2)|large_intestine(2)|lung(6)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	16		Acute lymphoblastic leukemia(4;1.7e-08)|all_hematologic(4;8.82e-05)				AACGTCACCGGAATCAGGACC	0.358																																							uc003dyw.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(862-864)CGG>CGC		CD200 antigen isoform b							96.0	86.0	90.0					3																	112068653		2203	4300	6503	SO:0001819	synonymous_variant	4345				regulation of immune response	integral to plasma membrane		g.chr3:112068653G>C		CCDS2965.1, CCDS33818.1	3q13.2	2013-09-20	2006-03-28	2004-09-01	ENSG00000091972	ENSG00000091972		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7203	protein-coding gene	gene with protein product		155970	"""antigen identified by monoclonal antibody MRC OX-2"", ""CD200 antigen"""	MOX1, MOX2			Standard	XM_005247482		Approved	MRC, OX-2	uc003dyw.3	P41217	OTTHUMG00000159248	ENST00000315711.8:c.789G>C	3.37:g.112068653G>C			Somatic				CD200_uc010hqd.1_Silent_p.R147R|CD200_uc003dyx.2_Silent_p.R263R|CD200_uc003dyy.2_Silent_p.R147R|CD200_uc003dyz.2_Silent_p.R189R	p.R288R	NM_001004196	NP_001004196	WXS	Illumina HiSeq	Unspecified	P41217	OX2G_HUMAN			6	1008	+		Acute lymphoblastic leukemia(4;1.7e-08)|all_hematologic(4;8.82e-05)	263			Cytoplasmic (Potential).		B3KQI1|B4DLW9|D3DN65|Q6J2Q6|Q6PIQ4|Q8TB85|Q9H3J3	Silent	SNP	ENST00000315711.8	37	c.864G>C	CCDS2965.1																																																																																				0.358	CD200-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354078.1			2	4	0	0	0	0.004672	0	2	4				
PLXNA1	5361	broad.mit.edu	37	3	126747837	126747837	+	Splice_Site	SNP	G	G	A			TCGA-44-2665-01A-01D-1040-01	TCGA-44-2665-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	520db804-4c03-4a0c-9966-fc0c9f98cfec	4b84f6af-2361-4e9b-9c8c-f1cbeb8513f2	g.chr3:126747837G>A	ENST00000393409.2	+	25	4671	c.4671G>A	c.(4669-4671)gaG>gaA	p.E1557E	PLXNA1_ENST00000251772.4_Splice_Site_p.E1534E	NM_032242.3	NP_115618.3	Q9UIW2	PLXA1_HUMAN	plexin A1	1557					axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|multicellular organismal development (GO:0007275)|regulation of smooth muscle cell migration (GO:0014910)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)	p.E1534E(2)		breast(3)|central_nervous_system(5)|endometrium(10)|kidney(5)|large_intestine(4)|lung(32)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	67				GBM - Glioblastoma multiforme(114;0.155)		CTCCCCCAGAGTGGCGCCAGG	0.647																																							uc003ejg.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)|pancreas(1)|skin(1)	3						c.(4600-4602)GAG>GAA		plexin A1							63.0	51.0	55.0					3																	126747837		2203	4300	6503	SO:0001630	splice_region_variant	5361				axon guidance	integral to membrane|intracellular|plasma membrane	semaphorin receptor activity	g.chr3:126747837G>A	X87832	CCDS33847.1, CCDS33847.2	3q21.2	2006-12-19				ENSG00000114554		"""Plexins"""	9099	protein-coding gene	gene with protein product		601055		PLXN1		8570614	Standard	NM_032242		Approved	NOV	uc003ejg.3	Q9UIW2		ENST00000393409.2:c.4670-1G>A	3.37:g.126747837G>A			Somatic				PLXNA1_uc003ejh.2_Silent_p.E202E	p.E1534E	NM_032242	NP_115618	WXS	Illumina HiSeq	Unspecified	Q9UIW2	PLXA1_HUMAN		GBM - Glioblastoma multiforme(114;0.155)	25	4606	+			1557			Cytoplasmic (Potential).			Silent	SNP	ENST00000393409.2	37	c.4602G>A	CCDS33847.2																																																																																				0.647	PLXNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356451.1	NM_032242	Silent	6	27	0	0	0	0.021553	0	6	27				
EFCAB12	90288	broad.mit.edu	37	3	129137132	129137132	+	Missense_Mutation	SNP	T	T	G			TCGA-44-2665-01A-01D-1040-01	TCGA-44-2665-10A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	520db804-4c03-4a0c-9966-fc0c9f98cfec	4b84f6af-2361-4e9b-9c8c-f1cbeb8513f2	g.chr3:129137132T>G	ENST00000505956.1	-	3	808	c.646A>C	c.(646-648)Atc>Ctc	p.I216L	EFCAB12_ENST00000326085.3_Missense_Mutation_p.I216L	NM_207307.1	NP_997190.1	Q6NXP0	EFC12_HUMAN	EF-hand calcium binding domain 12	216	EF-hand. {ECO:0000255|PROSITE- ProRule:PRU00448}.						calcium ion binding (GO:0005509)	p.I216L(2)									TCCCTGGTGATTCTCTGGTTC	0.547																																							uc003emg.2		NA																	2	Substitution - Missense(2)		lung(2)		NA						c.(646-648)ATC>CTC		hypothetical protein LOC90288							57.0	54.0	55.0					3																	129137132		1997	4157	6154	SO:0001583	missense	0							g.chr3:129137132T>G	AK096099	CCDS54638.1	3q21.3	2013-01-10	2012-07-20	2012-07-20	ENSG00000172771	ENSG00000172771		"""EF-hand domain containing"""	28061	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 25"""	C3orf25			Standard	NM_207307		Approved		uc003emg.3	Q6NXP0	OTTHUMG00000159464	ENST00000505956.1:c.646A>C	3.37:g.129137132T>G	ENSP00000420854:p.Ile216Leu		Somatic					p.I216L	NM_207307	NP_997190	WXS	Illumina HiSeq	Unspecified					3	809	-								Q69YX4	Missense_Mutation	SNP	ENST00000505956.1	37	c.646A>C	CCDS54638.1	.	.	.	.	.	.	.	.	.	.	T	16.87	3.242514	0.58995	.	.	ENSG00000172771	ENST00000505956;ENST00000326085;ENST00000503957	T;T;T	0.53857	0.6;0.6;0.6	4.39	-0.711	0.11230	EF-hand-like domain (1);	0.423696	0.22244	N	0.062657	T	0.38188	0.1031	L	0.32530	0.975	0.09310	N	0.999999	P	0.35348	0.496	B	0.38264	0.269	T	0.30563	-0.9974	10	0.66056	D	0.02	-30.043	7.2243	0.26005	0.0:0.4136:0.0:0.5864	.	216	Q6NXP0	CC025_HUMAN	L	216;216;66	ENSP00000420854:I216L;ENSP00000324241:I216L;ENSP00000421462:I66L	ENSP00000324241:I216L	I	-	1	0	C3orf25	130619822	0.088000	0.21588	0.056000	0.19401	0.134000	0.20937	-0.047000	0.11963	-0.193000	0.10415	0.459000	0.35465	ATC		0.547	EFCAB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355530.1	NM_207307		7	27	0	0	0	0.038147	0	7	27				
COL25A1	84570	broad.mit.edu	37	4	109817864	109817864	+	Missense_Mutation	SNP	C	C	T			TCGA-44-2665-01A-01D-1040-01	TCGA-44-2665-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	520db804-4c03-4a0c-9966-fc0c9f98cfec	4b84f6af-2361-4e9b-9c8c-f1cbeb8513f2	g.chr4:109817864C>T	ENST00000399132.1	-	16	1395	c.865G>A	c.(865-867)Gac>Aac	p.D289N	COL25A1_ENST00000399126.1_Missense_Mutation_p.D289N|COL25A1_ENST00000399127.1_Missense_Mutation_p.D285N	NM_198721.2	NP_942014.1			collagen, type XXV, alpha 1									p.D289N(7)		NS(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(19)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	49		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000173)		TCTCCAGCGTCTCCCTGAGGA	0.393																																							uc003hze.1		NA																	7	Substitution - Missense(7)		lung(4)|cervix(2)|haematopoietic_and_lymphoid_tissue(1)	ovary(2)	2						c.(865-867)GAC>AAC		collagen, type XXV, alpha 1 isoform 1							113.0	110.0	111.0					4																	109817864		1890	4109	5999	SO:0001583	missense	84570					collagen|extracellular space	beta-amyloid binding|heparin binding	g.chr4:109817864C>T	AF293340	CCDS43258.1, CCDS43259.1, CCDS58922.1	4q25	2013-01-16			ENSG00000188517	ENSG00000188517		"""Collagens"""	18603	protein-coding gene	gene with protein product		610004				11927537	Standard	NM_001256074		Approved		uc003hze.2	Q9BXS0	OTTHUMG00000150039	ENST00000399132.1:c.865G>A	4.37:g.109817864C>T	ENSP00000382083:p.Asp289Asn		Somatic				COL25A1_uc003hzg.2_Missense_Mutation_p.D289N|COL25A1_uc003hzd.2_RNA|COL25A1_uc003hzf.2_Missense_Mutation_p.D70N	p.D289N	NM_198721	NP_942014	WXS	Illumina HiSeq	Unspecified	Q9BXS0	COPA1_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000173)	15	1396	-		Hepatocellular(203;0.217)	289			Extracellular (Potential).|Collagen-like 3.			Missense_Mutation	SNP	ENST00000399132.1	37	c.865G>A	CCDS43258.1	.	.	.	.	.	.	.	.	.	.	C	18.18	3.566929	0.65651	.	.	ENSG00000188517	ENST00000399132;ENST00000333642;ENST00000401873;ENST00000399127;ENST00000399126;ENST00000443653	D;D;D	0.93547	-3.2;-3.24;-3.2	5.47	5.47	0.80525	.	0.142143	0.47455	D	0.000228	D	0.94039	0.8090	L	0.31804	0.96	0.38735	D	0.953765	D;D	0.71674	0.998;0.993	D;D	0.78314	0.991;0.956	D	0.93593	0.6923	9	.	.	.	-10.4006	16.4121	0.83722	0.0:1.0:0.0:0.0	.	289;289	Q9BXS0-2;Q9BXS0	.;COPA1_HUMAN	N	289;291;285;285;289;219	ENSP00000382083:D289N;ENSP00000382078:D285N;ENSP00000382077:D289N	.	D	-	1	0	COL25A1	110037313	1.000000	0.71417	1.000000	0.80357	0.778000	0.44026	4.457000	0.60088	2.723000	0.93209	0.655000	0.94253	GAC		0.393	COL25A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315938.2	NM_032518		8	19	0	0	0	0.047766	0	8	19				
NAA15	80155	broad.mit.edu	37	4	140265339	140265339	+	Splice_Site	SNP	G	G	A			TCGA-44-2665-01A-01D-1040-01	TCGA-44-2665-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	520db804-4c03-4a0c-9966-fc0c9f98cfec	4b84f6af-2361-4e9b-9c8c-f1cbeb8513f2	g.chr4:140265339G>A	ENST00000296543.5	+	6	860		c.e6-1		NAA15_ENST00000480277.2_Splice_Site|NAA15_ENST00000398947.1_Splice_Site	NM_057175.3	NP_476516.1	Q9BXJ9	NAA15_HUMAN	N(alpha)-acetyltransferase 15, NatA auxiliary subunit						angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|N-terminal protein amino acid acetylation (GO:0006474)|negative regulation of apoptotic process (GO:0043066)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|NatA complex (GO:0031415)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	N-acetyltransferase activity (GO:0008080)|poly(A) RNA binding (GO:0044822)|ribosome binding (GO:0043022)	p.?(2)		NS(1)|endometrium(3)|large_intestine(7)|liver(2)|lung(8)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	29						TCCATATACAGACATCCCCTG	0.333																																							uc003ihu.1		NA																	2	Unknown(2)		lung(2)	ovary(1)|skin(1)	2						c.e6-1		NMDA receptor regulated 1							65.0	58.0	60.0					4																	140265339		1812	4072	5884	SO:0001630	splice_region_variant	80155				angiogenesis|cell differentiation|N-terminal protein amino acid acetylation|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|transcription factor complex	protein binding	g.chr4:140265339G>A	AY039242	CCDS43270.1	4q31.1	2010-01-14	2010-01-14	2010-01-14	ENSG00000164134	ENSG00000164134		"""N(alpha)-acetyltransferase subunits"""	30782	protein-coding gene	gene with protein product		608000	"""NMDA receptor regulated 1"""	NARG1		12140756, 11478804, 19660095	Standard	XM_005263236		Approved	TBDN100, NATH, FLJ13340	uc003ihu.1	Q9BXJ9	OTTHUMG00000137363	ENST00000296543.5:c.538-1G>A	4.37:g.140265339G>A			Somatic					p.T180_splice	NM_057175	NP_476516	WXS	Illumina HiSeq	Unspecified	Q9BXJ9	NAA15_HUMAN			6	794	+								D3DNY6|Q52LG9|Q8IWH4|Q8NEV2|Q9H8P6	Splice_Site	SNP	ENST00000296543.5	37	c.538_splice	CCDS43270.1	.	.	.	.	.	.	.	.	.	.	G	18.53	3.642918	0.67244	.	.	ENSG00000164134	ENST00000296543;ENST00000544077;ENST00000398947	.	.	.	4.8	4.8	0.61643	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.4096	0.90546	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NAA15	140484789	1.000000	0.71417	0.998000	0.56505	0.761000	0.43186	9.174000	0.94824	2.655000	0.90218	0.484000	0.47621	.		0.333	NAA15-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000267839.2	NM_057175	Intron	4	22	0	0	0	0.009096	0	4	22				
TRIM60	166655	broad.mit.edu	37	4	165962566	165962566	+	Missense_Mutation	SNP	G	G	A	rs200745587		TCGA-44-2665-01A-01D-1040-01	TCGA-44-2665-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	520db804-4c03-4a0c-9966-fc0c9f98cfec	4b84f6af-2361-4e9b-9c8c-f1cbeb8513f2	g.chr4:165962566G>A	ENST00000512596.1	+	3	1558	c.1342G>A	c.(1342-1344)Gtt>Att	p.V448I	TRIM60_ENST00000341062.5_Missense_Mutation_p.V448I|TRIM60_ENST00000508504.1_Missense_Mutation_p.V448I	NM_152620.2	NP_689833.1	Q495X7	TRI60_HUMAN	tripartite motif containing 60	448	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)	p.V448I(2)		NS(1)|breast(2)|endometrium(3)|large_intestine(6)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	29	all_hematologic(180;0.221)	Prostate(90;0.0959)|Melanoma(52;0.18)		GBM - Glioblastoma multiforme(119;0.0844)		CACAGAAGCCGTTTGGCCTTA	0.348																																							uc003iqy.1		NA																	2	Substitution - Missense(2)		lung(2)	skin(1)	1						c.(1342-1344)GTT>ATT		ring finger protein 129							59.0	64.0	62.0					4																	165962566		2202	4300	6502	SO:0001583	missense	166655					intracellular	zinc ion binding	g.chr4:165962566G>A	AK093201	CCDS3808.1	4q32.3	2013-01-09	2011-01-25	2004-11-17	ENSG00000176979	ENSG00000176979		"""RING-type (C3HC4) zinc fingers"", ""Tripartite motif containing / Tripartite motif containing"""	21162	protein-coding gene	gene with protein product			"""ring finger protein 129"", ""tripartite motif-containing 60"""	RNF129, RNF33			Standard	NM_152620		Approved	FLJ35882	uc003iqy.1	Q495X7	OTTHUMG00000161262	ENST00000512596.1:c.1342G>A	4.37:g.165962566G>A	ENSP00000421142:p.Val448Ile		Somatic				TRIM60_uc010iqx.1_Missense_Mutation_p.V448I	p.V448I	NM_152620	NP_689833	WXS	Illumina HiSeq	Unspecified	Q495X7	TRI60_HUMAN		GBM - Glioblastoma multiforme(119;0.0844)	3	1512	+	all_hematologic(180;0.221)	Prostate(90;0.0959)|Melanoma(52;0.18)	448			B30.2/SPRY.		Q8NA35	Missense_Mutation	SNP	ENST00000512596.1	37	c.1342G>A	CCDS3808.1	.	.	.	.	.	.	.	.	.	.	G	6.093	0.385477	0.11524	.	.	ENSG00000176979	ENST00000512596;ENST00000508504;ENST00000341062	T;T;T	0.69926	-0.44;-0.44;-0.44	2.33	-4.66	0.03329	Concanavalin A-like lectin/glucanase (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	12.818600	0.01556	N	0.019918	T	0.54951	0.1890	L	0.32530	0.975	0.09310	N	1	B	0.13145	0.007	B	0.13407	0.009	T	0.47142	-0.9140	10	0.72032	D	0.01	.	7.6626	0.28413	0.2594:0.4568:0.2838:0.0	.	448	Q495X7	TRI60_HUMAN	I	448	ENSP00000421142:V448I;ENSP00000426496:V448I;ENSP00000343765:V448I	ENSP00000343765:V448I	V	+	1	0	TRIM60	166182016	0.000000	0.05858	0.000000	0.03702	0.163000	0.22366	-2.115000	0.01328	-2.510000	0.00504	-0.795000	0.03280	GTT		0.348	TRIM60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364325.1	NM_152620		5	24	0	0	0	0.021553	0	5	24				
FAM149A	25854	broad.mit.edu	37	4	187084634	187084634	+	Missense_Mutation	SNP	C	C	T	rs201598032	byFrequency	TCGA-44-2665-01A-01D-1040-01	TCGA-44-2665-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	520db804-4c03-4a0c-9966-fc0c9f98cfec	4b84f6af-2361-4e9b-9c8c-f1cbeb8513f2	g.chr4:187084634C>T	ENST00000356371.5	+	10	1763	c.1763C>T	c.(1762-1764)cCg>cTg	p.P588L	FAM149A_ENST00000227065.4_Missense_Mutation_p.P297L|FAM149A_ENST00000389354.5_Missense_Mutation_p.P297L|FAM149A_ENST00000514153.1_Missense_Mutation_p.P297L|FAM149A_ENST00000503432.1_Missense_Mutation_p.P297L|FAM149A_ENST00000502970.1_Missense_Mutation_p.P297L			A5PLN7	F149A_HUMAN	family with sequence similarity 149, member A	588								p.P297L(2)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(8)|lung(8)|pancreas(1)|prostate(1)|skin(2)	25		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.19e-10)|BRCA - Breast invasive adenocarcinoma(30;1.22e-05)|GBM - Glioblastoma multiforme(59;0.000122)|STAD - Stomach adenocarcinoma(60;0.000288)|LUSC - Lung squamous cell carcinoma(40;0.00241)|READ - Rectum adenocarcinoma(43;0.166)		TCCTCCGCACCGCACAGACTG	0.557													g|||	15	0.00299521	0.0	0.0	5008	,	,		18106	0.0		0.0	False		,,,				2504	0.0153						uc003iyt.3		NA																	2	Substitution - Missense(2)		lung(2)	breast(1)	1						c.(889-891)CCG>CTG		hypothetical protein LOC25854			LEU/PRO,LEU/PRO	2,4404		0,2,2201	82.0	78.0	79.0		890,890	3.3	0.0	4		79	2,8598		0,2,4298	yes	missense,missense	FAM149A	NM_001006655.2,NM_015398.2	98,98	0,4,6499	TT,TC,CC		0.0233,0.0454,0.0308	benign,benign	297/483,297/483	187084634	4,13002	2203	4300	6503	SO:0001583	missense	25854							g.chr4:187084634C>T	AK057166	CCDS34117.1	4q35.1	2012-04-19			ENSG00000109794	ENSG00000109794			24527	protein-coding gene	gene with protein product							Standard	NM_015398		Approved	DKFZP564J102, MST119, MSTP119	uc010isl.3	A5PLN7	OTTHUMG00000160565	ENST00000356371.5:c.1763C>T	4.37:g.187084634C>T	ENSP00000348732:p.Pro588Leu		Somatic				FAM149A_uc011cla.1_Missense_Mutation_p.P297L|FAM149A_uc003iyu.3_Missense_Mutation_p.P297L|FAM149A_uc010isl.2_Missense_Mutation_p.P297L|FAM149A_uc011clb.1_Missense_Mutation_p.P297L	p.P297L	NM_015398	NP_056213	WXS	Illumina HiSeq	Unspecified	A5PLN7	F149A_HUMAN		OV - Ovarian serous cystadenocarcinoma(60;1.19e-10)|BRCA - Breast invasive adenocarcinoma(30;1.22e-05)|GBM - Glioblastoma multiforme(59;0.000122)|STAD - Stomach adenocarcinoma(60;0.000288)|LUSC - Lung squamous cell carcinoma(40;0.00241)|READ - Rectum adenocarcinoma(43;0.166)	10	1469	+		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)	588					B5MDB8|Q2TAN6|Q7Z2S5|Q9Y4T9	Missense_Mutation	SNP	ENST00000356371.5	37	c.890C>T		.	.	.	.	.	.	.	.	.	.	g	17.33	3.362228	0.61403	4.54E-4	2.33E-4	ENSG00000109794	ENST00000503432;ENST00000356371;ENST00000227065;ENST00000502970;ENST00000514153;ENST00000389354	T;T;T;T;T;T	0.12879	2.64;2.66;2.64;2.64;2.64;2.64	5.19	3.35	0.38373	.	0.587035	0.16660	N	0.204809	T	0.06917	0.0176	N	0.14661	0.345	0.09310	N	1	B;B	0.29646	0.013;0.253	B;B	0.16289	0.0;0.015	T	0.32719	-0.9896	10	0.42905	T	0.14	-8.2761	6.9059	0.24309	0.2295:0.1253:0.6451:0.0	.	588;588	A5PLN7-3;A5PLN7	.;F149A_HUMAN	L	297;588;297;297;297;297	ENSP00000426835:P297L;ENSP00000348732:P588L;ENSP00000227065:P297L;ENSP00000427155:P297L;ENSP00000424380:P297L;ENSP00000374005:P297L	ENSP00000227065:P297L	P	+	2	0	FAM149A	187321628	0.000000	0.05858	0.001000	0.08648	0.103000	0.19146	0.246000	0.18160	0.158000	0.19367	-0.739000	0.03532	CCG		0.557	FAM149A-201	KNOWN	basic	protein_coding	protein_coding		NM_001006655		10	62	0	0	0	0.010729	0	10	62				
GPR98	84059	broad.mit.edu	37	5	89923108	89923108	+	Silent	SNP	C	C	A			TCGA-44-2665-01A-01D-1040-01	TCGA-44-2665-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	520db804-4c03-4a0c-9966-fc0c9f98cfec	4b84f6af-2361-4e9b-9c8c-f1cbeb8513f2	g.chr5:89923108C>A	ENST00000405460.2	+	7	849	c.753C>A	c.(751-753)tcC>tcA	p.S251S		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	251					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.S251S(2)		NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		CTAGGAATTCCATTGAGATCA	0.343																																							uc003kju.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(11)|central_nervous_system(3)|pancreas(2)	16						c.(751-753)TCC>TCA		G protein-coupled receptor 98 precursor							58.0	57.0	57.0					5																	89923108		1831	4081	5912	SO:0001819	synonymous_variant	84059				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity	g.chr5:89923108C>A	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.753C>A	5.37:g.89923108C>A			Somatic				GPR98_uc003kjt.2_5'UTR	p.S251S	NM_032119	NP_115495	WXS	Illumina HiSeq	Unspecified	Q8WXG9	GPR98_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)	7	849	+		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)	251			Extracellular (Potential).		O75171|Q8TF58|Q9H0X5|Q9UL61	Silent	SNP	ENST00000405460.2	37	c.753C>A	CCDS47246.1																																																																																				0.343	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119		3	14	1	0	6.4e-05	0.004672	6.85714e-05	3	14				
SPRY4	81848	broad.mit.edu	37	5	141693820	141693820	+	Missense_Mutation	SNP	G	G	C			TCGA-44-2665-01A-01D-1040-01	TCGA-44-2665-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	520db804-4c03-4a0c-9966-fc0c9f98cfec	4b84f6af-2361-4e9b-9c8c-f1cbeb8513f2	g.chr5:141693820G>C	ENST00000434127.2	-	2	1097	c.854C>G	c.(853-855)gCa>gGa	p.A285G	SPRY4_ENST00000503582.1_5'Flank|SPRY4_ENST00000344120.4_Missense_Mutation_p.A308G	NM_001127496.1	NP_001120968.1	Q9C004	SPY4_HUMAN	sprouty homolog 4 (Drosophila)	285					multicellular organismal development (GO:0007275)|negative regulation of MAP kinase activity (GO:0043407)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)		p.A308G(2)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(7)|ovary(1)	18		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCCGCTGGCTGCTTTGCAGAT	0.627									Testicular Cancer, Familial Clustering of																														uc003lml.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|lung(1)	2						c.(853-855)GCA>GGA		sprouty homolog 4 isoform 2							45.0	37.0	40.0					5																	141693820		2202	4299	6501	SO:0001583	missense	81848	Testicular_Cancer_Familial_Clustering_of	Familial Cancer Database		multicellular organismal development	cytoplasm|ruffle membrane	protein binding	g.chr5:141693820G>C	AF227516	CCDS4274.1, CCDS47296.1	5q31.3	2010-08-05			ENSG00000187678	ENSG00000187678			15533	protein-coding gene	gene with protein product		607984				16465403	Standard	NM_030964		Approved		uc010jgi.1	Q9C004	OTTHUMG00000129663	ENST00000434127.2:c.854C>G	5.37:g.141693820G>C	ENSP00000399468:p.Ala285Gly		Somatic				SPRY4_uc010jgi.1_Missense_Mutation_p.A308G	p.A285G	NM_001127496	NP_001120968	WXS	Illumina HiSeq	Unspecified	Q9C004	SPY4_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		2	1113	-		all_hematologic(541;0.118)	285					A4FVB2|A4FVB3|Q6QIX2|Q9C003	Missense_Mutation	SNP	ENST00000434127.2	37	c.854C>G	CCDS47296.1	.	.	.	.	.	.	.	.	.	.	G	13.65	2.301163	0.40694	.	.	ENSG00000187678	ENST00000344120;ENST00000434127	T;T	0.65178	-0.14;-0.12	5.05	4.19	0.49359	.	0.344290	0.30219	N	0.010132	T	0.53222	0.1783	L	0.44542	1.39	0.39560	D	0.96911	B	0.19200	0.034	B	0.19391	0.025	T	0.50233	-0.8852	10	0.22109	T	0.4	-3.4727	13.8809	0.63682	0.0734:0.0:0.9266:0.0	.	285	Q9C004	SPY4_HUMAN	G	308;285	ENSP00000344967:A308G;ENSP00000399468:A285G	ENSP00000344967:A308G	A	-	2	0	SPRY4	141674004	0.867000	0.29959	0.926000	0.36857	0.423000	0.31445	1.230000	0.32612	1.339000	0.45563	0.655000	0.94253	GCA		0.627	SPRY4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370652.1			8	60	0	0	0	0.047766	0	8	60				
CAMK2A	815	broad.mit.edu	37	5	149636177	149636177	+	Silent	SNP	G	G	A			TCGA-44-2665-01A-01D-1040-01	TCGA-44-2665-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	520db804-4c03-4a0c-9966-fc0c9f98cfec	4b84f6af-2361-4e9b-9c8c-f1cbeb8513f2	g.chr5:149636177G>A	ENST00000348628.6	-	6	1035	c.370C>T	c.(370-372)Ctg>Ttg	p.L124L	CAMK2A_ENST00000398376.3_Silent_p.L124L	NM_015981.3|NM_171825.2	NP_057065.2|NP_741960.1	Q9UQM7	KCC2A_HUMAN	calcium/calmodulin-dependent protein kinase II alpha	124	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				calcium ion transport (GO:0006816)|cytokine-mediated signaling pathway (GO:0019221)|G1/S transition of mitotic cell cycle (GO:0000082)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of neurotransmitter secretion (GO:0046928)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|kinase activity (GO:0016301)|protein homodimerization activity (GO:0042803)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|skin(1)|stomach(1)	15		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TGGCAGTGCAGCACAGCCTCC	0.642																																							uc003lru.2		NA																	0				large_intestine(1)	1						c.(370-372)CTG>TTG		calcium/calmodulin-dependent protein kinase II							39.0	46.0	44.0					5																	149636177		2137	4269	6406	SO:0001819	synonymous_variant	815				interferon-gamma-mediated signaling pathway|positive regulation of NF-kappaB transcription factor activity|synaptic transmission	cell junction|cytosol|endocytic vesicle membrane|nucleoplasm|presynaptic membrane	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity	g.chr5:149636177G>A	AB023185	CCDS43386.1, CCDS43387.1	5q32	2013-09-20	2008-10-30		ENSG00000070808	ENSG00000070808	2.7.11.17		1460	protein-coding gene	gene with protein product	"""CaM-kinase II alpha chain"", ""calcium/calmodulin-dependent protein kinase II alpha-B subunit"", ""CaM kinase II alpha subunit"", ""CaMK-II alpha subunit"", ""calcium/calmodulin-dependent protein kinase type II alpha chain"""	114078	"""calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha"""	CAMKA		10231032, 3475713	Standard	NM_015981		Approved	KIAA0968, CaMKIINalpha	uc003lrt.2	Q9UQM7	OTTHUMG00000134281	ENST00000348628.6:c.370C>T	5.37:g.149636177G>A			Somatic				CAMK2A_uc003lrt.2_Silent_p.L124L|CAMK2A_uc010jhe.2_Silent_p.L104L|CAMK2A_uc010jhf.1_5'UTR	p.L124L	NM_171825	NP_741960	WXS	Illumina HiSeq	Unspecified	Q9UQM7	KCC2A_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		6	585	-		all_hematologic(541;0.224)	124			Protein kinase.		Q9UL21|Q9Y2H4|Q9Y352	Silent	SNP	ENST00000348628.6	37	c.370C>T	CCDS43386.1																																																																																				0.642	CAMK2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258869.2	NM_015981		3	48	0	0	0	0.004672	0	3	48				
KCNMB1	3779	broad.mit.edu	37	5	169812334	169812334	+	Missense_Mutation	SNP	G	G	T			TCGA-44-2665-01A-01D-1040-01	TCGA-44-2665-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	520db804-4c03-4a0c-9966-fc0c9f98cfec	4b84f6af-2361-4e9b-9c8c-f1cbeb8513f2	g.chr5:169812334G>T	ENST00000274629.4	-	2	560	c.118C>A	c.(118-120)Ccc>Acc	p.P40T	KCNIP1_ENST00000377360.4_Intron|KCNIP1_ENST00000518527.1_Intron|KCNMB1_ENST00000521859.1_Missense_Mutation_p.P40T	NM_004137.3	NP_004128.1	Q16558	KCMB1_HUMAN	potassium large conductance calcium-activated channel, subfamily M, beta member 1	40					blood coagulation (GO:0007596)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|response to calcium ion (GO:0051592)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|potassium channel regulator activity (GO:0015459)	p.P40T(2)		endometrium(1)|large_intestine(1)|lung(7)|ovary(2)	11	Renal(175;0.000159)|Lung NSC(126;0.0165)|all_lung(126;0.026)	Medulloblastoma(196;0.0109)|all_neural(177;0.0146)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.175)	Miconazole(DB01110)|Procaine(DB00721)	TGGTAGAGGGGCAGCACAGTC	0.597																																							uc003maq.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(118-120)CCC>ACC		potassium large conductance calcium-activated							157.0	134.0	142.0					5																	169812334		2203	4300	6503	SO:0001583	missense	3779				platelet activation|synaptic transmission		calcium-activated potassium channel activity|potassium channel regulator activity	g.chr5:169812334G>T	AF035046	CCDS4373.1	5q34	2012-02-23			ENSG00000145936	ENSG00000145936		"""Potassium channels"""	6285	protein-coding gene	gene with protein product	"""BK channel beta subunit"""	603951				8799178, 9888999	Standard	NM_004137		Approved	hslo-beta	uc003maq.2	Q16558	OTTHUMG00000130439	ENST00000274629.4:c.118C>A	5.37:g.169812334G>T	ENSP00000274629:p.Pro40Thr		Somatic				KCNIP1_uc003map.2_Intron|KCNMB1_uc003mar.2_Missense_Mutation_p.P40T	p.P40T	NM_004137	NP_004128	WXS	Illumina HiSeq	Unspecified	Q16558	KCMB1_HUMAN	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.175)	2	518	-	Renal(175;0.000159)|Lung NSC(126;0.0165)|all_lung(126;0.026)	Medulloblastoma(196;0.0109)|all_neural(177;0.0146)	40			Extracellular (Potential).		O00707|O00708|P78475|Q53YR0|Q8TAX3|Q93005	Missense_Mutation	SNP	ENST00000274629.4	37	c.118C>A	CCDS4373.1	.	.	.	.	.	.	.	.	.	.	G	17.98	3.521299	0.64747	.	.	ENSG00000145936	ENST00000274629;ENST00000521859	T;T	0.09350	2.99;2.99	5.14	4.28	0.50868	.	0.107337	0.64402	D	0.000003	T	0.25827	0.0629	L	0.57536	1.79	0.38021	D	0.934841	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.03795	-1.1003	9	.	.	.	.	9.7952	0.40731	0.0955:0.0:0.9045:0.0	.	40;40	Q16558-2;Q16558	.;KCMB1_HUMAN	T	40	ENSP00000274629:P40T;ENSP00000427940:P40T	.	P	-	1	0	KCNMB1	169744912	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	6.561000	0.73955	1.296000	0.44742	0.655000	0.94253	CCC		0.597	KCNMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252830.3			13	107	1	0	0.00010058	0.013537	0.000106246	13	107				
F13A1	2162	broad.mit.edu	37	6	6167746	6167746	+	Missense_Mutation	SNP	T	T	C			TCGA-44-2665-01A-01D-1040-01	TCGA-44-2665-10A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	520db804-4c03-4a0c-9966-fc0c9f98cfec	4b84f6af-2361-4e9b-9c8c-f1cbeb8513f2	g.chr6:6167746T>C	ENST00000264870.3	-	13	2118	c.1853A>G	c.(1852-1854)gAt>gGt	p.D618G	MIR5683_ENST00000584820.1_RNA	NM_000129.3	NP_000120.2	P00488	F13A_HUMAN	coagulation factor XIII, A1 polypeptide	618					blood coagulation (GO:0007596)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|platelet alpha granule lumen (GO:0031093)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)	p.D618G(2)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(37)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	62	Ovarian(93;0.0816)	all_hematologic(90;0.152)			L-Glutamine(DB00130)	GGCCAGAACATCCCTGGTCTC	0.537																																							uc003mwv.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|pancreas(1)|skin(1)	6						c.(1852-1854)GAT>GGT		coagulation factor XIII A1 subunit precursor	L-Glutamine(DB00130)						222.0	159.0	180.0					6																	6167746		2203	4300	6503	SO:0001583	missense	2162				peptide cross-linking|platelet activation|platelet degranulation	extracellular region|platelet alpha granule lumen	acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity	g.chr6:6167746T>C	M14539	CCDS4496.1	6p24.2-p23	2014-01-24			ENSG00000124491	ENSG00000124491		"""Transglutaminases"""	3531	protein-coding gene	gene with protein product		134570		F13A			Standard	NM_000129		Approved		uc003mwv.3	P00488	OTTHUMG00000014186	ENST00000264870.3:c.1853A>G	6.37:g.6167746T>C	ENSP00000264870:p.Asp618Gly		Somatic				F13A1_uc011dib.1_Missense_Mutation_p.D555G	p.D618G	NM_000129	NP_000120	WXS	Illumina HiSeq	Unspecified	P00488	F13A_HUMAN			13	1976	-	Ovarian(93;0.0816)	all_hematologic(90;0.152)	618					Q59HA7|Q8N6X2|Q96P24|Q9BX29	Missense_Mutation	SNP	ENST00000264870.3	37	c.1853A>G	CCDS4496.1	.	.	.	.	.	.	.	.	.	.	T	8.234	0.805237	0.16467	.	.	ENSG00000124491	ENST00000264870;ENST00000441301	T	0.68025	-0.3	5.54	3.07	0.35406	Transglutaminase, C-terminal (2);Immunoglobulin-like fold (1);	0.671898	0.15399	N	0.264403	T	0.41190	0.1148	L	0.51422	1.61	0.09310	N	1	B;B	0.24576	0.106;0.066	B;B	0.26517	0.05;0.07	T	0.37502	-0.9703	10	0.46703	T	0.11	.	10.383	0.44123	0.2606:0.0:0.0:0.7394	.	555;618	F5H080;P00488	.;F13A_HUMAN	G	618;555	ENSP00000264870:D618G	ENSP00000264870:D618G	D	-	2	0	F13A1	6112745	0.103000	0.21917	0.001000	0.08648	0.094000	0.18550	2.590000	0.46154	0.357000	0.24183	0.383000	0.25322	GAT		0.537	F13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039756.3	NM_000129		10	35	0	0	0	0.058154	0	10	35				
MAP7	9053	broad.mit.edu	37	6	136681011	136681011	+	Missense_Mutation	SNP	G	G	A			TCGA-44-2665-01A-01D-1040-01	TCGA-44-2665-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	520db804-4c03-4a0c-9966-fc0c9f98cfec	4b84f6af-2361-4e9b-9c8c-f1cbeb8513f2	g.chr6:136681011G>A	ENST00000354570.3	-	15	2269	c.1859C>T	c.(1858-1860)aCc>aTc	p.T620I	MAP7_ENST00000544465.1_Missense_Mutation_p.T605I|MAP7_ENST00000438100.2_Missense_Mutation_p.T605I|MAP7_ENST00000454590.1_Missense_Mutation_p.T642I|MAP7_ENST00000432797.2_Missense_Mutation_p.T474I	NM_001198616.1|NM_001198617.1|NM_001198619.1|NM_003980.4	NP_001185545.1|NP_001185546.1|NP_001185548.1|NP_003971.1	Q14244	MAP7_HUMAN	microtubule-associated protein 7	620					cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|establishment or maintenance of cell polarity (GO:0007163)|fertilization (GO:0009566)|germ cell development (GO:0007281)|glycosphingolipid metabolic process (GO:0006687)|homeostasis of number of cells (GO:0048872)|Leydig cell differentiation (GO:0033327)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|nucleus organization (GO:0006997)|organ growth (GO:0035265)|protein localization to plasma membrane (GO:0072659)|response to osmotic stress (GO:0006970)|response to retinoic acid (GO:0032526)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)|structural molecule activity (GO:0005198)	p.T620I(2)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(11)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00199)|OV - Ovarian serous cystadenocarcinoma(155;0.00643)		CTGATCACTGGTTTTCTACGA	0.328																																							uc003qgz.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(1858-1860)ACC>ATC		microtubule-associated protein 7							118.0	133.0	128.0					6																	136681011		2203	4300	6503	SO:0001583	missense	9053				establishment or maintenance of cell polarity|microtubule cytoskeleton organization|protein localization in plasma membrane|response to osmotic stress	basolateral plasma membrane|microtubule|microtubule associated complex|nucleus|perinuclear region of cytoplasm	receptor binding|structural molecule activity	g.chr6:136681011G>A	X73882	CCDS5178.1, CCDS56452.1, CCDS56453.1, CCDS56454.1, CCDS56455.1, CCDS75527.1, CCDS75528.1, CCDS75529.1	6q23.2	2008-07-28			ENSG00000135525	ENSG00000135525			6869	protein-coding gene	gene with protein product		604108				8408219	Standard	NM_003980		Approved	E-MAP-115	uc011edg.2	Q14244	OTTHUMG00000015646	ENST00000354570.3:c.1859C>T	6.37:g.136681011G>A	ENSP00000346581:p.Thr620Ile		Somatic				MAP7_uc011edf.1_Missense_Mutation_p.T605I|MAP7_uc011edg.1_Missense_Mutation_p.T650I|MAP7_uc010kgu.2_Missense_Mutation_p.T642I|MAP7_uc011edh.1_Missense_Mutation_p.T605I|MAP7_uc010kgv.2_Missense_Mutation_p.T642I|MAP7_uc010kgs.2_Missense_Mutation_p.T474I|MAP7_uc011edi.1_Missense_Mutation_p.T474I|MAP7_uc010kgq.1_Missense_Mutation_p.T526I|MAP7_uc003qha.1_Missense_Mutation_p.T583I	p.T620I	NM_003980	NP_003971	WXS	Illumina HiSeq	Unspecified	Q14244	MAP7_HUMAN		GBM - Glioblastoma multiforme(68;0.00199)|OV - Ovarian serous cystadenocarcinoma(155;0.00643)	15	2105	-	Colorectal(23;0.24)		620					B7Z290|B7Z400|B7Z5S7|B7Z9U7|C9JPS0|E9PCP3|F5H1E2|Q7Z6S0|Q8TAU5|Q9NY82|Q9NY83	Missense_Mutation	SNP	ENST00000354570.3	37	c.1859C>T	CCDS5178.1	.	.	.	.	.	.	.	.	.	.	G	18.01	3.527098	0.64860	.	.	ENSG00000135525	ENST00000354570;ENST00000454590;ENST00000544465;ENST00000438100;ENST00000432797;ENST00000345567	T;T;T;T;T	0.23950	1.88;1.88;1.88;1.88;1.88	5.86	4.99	0.66335	.	0.272649	0.26282	N	0.025274	T	0.31199	0.0789	L	0.57536	1.79	0.33269	D	0.560813	D;D;D;D;D;D;D	0.61697	0.964;0.984;0.988;0.99;0.96;0.96;0.99	P;P;P;P;P;P;P	0.60682	0.825;0.868;0.806;0.878;0.792;0.807;0.878	T	0.04281	-1.0963	10	0.46703	T	0.11	-19.1394	12.7055	0.57058	0.0755:0.0:0.9245:0.0	.	605;642;605;642;526;583;620	B7Z290;B7ZB64;F5H1E2;E9PCP3;F8W783;Q14244-2;Q14244	.;.;.;.;.;.;MAP7_HUMAN	I	620;642;605;605;474;526	ENSP00000346581:T620I;ENSP00000414712:T642I;ENSP00000445737:T605I;ENSP00000400790:T605I;ENSP00000414879:T474I	ENSP00000344217:T526I	T	-	2	0	MAP7	136722704	0.720000	0.27996	0.973000	0.42090	0.686000	0.39977	3.267000	0.51577	2.777000	0.95525	0.591000	0.81541	ACC		0.328	MAP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042382.2	NM_003980		16	63	0	0	0	0.038395	0	16	63				
GRM1	2911	broad.mit.edu	37	6	146351336	146351336	+	Missense_Mutation	SNP	C	C	T			TCGA-44-2665-01A-01D-1040-01	TCGA-44-2665-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	520db804-4c03-4a0c-9966-fc0c9f98cfec	4b84f6af-2361-4e9b-9c8c-f1cbeb8513f2	g.chr6:146351336C>T	ENST00000282753.1	+	1	918	c.683C>T	c.(682-684)tCt>tTt	p.S228F	GRM1_ENST00000361719.2_Missense_Mutation_p.S228F|GRM1_ENST00000492807.2_Missense_Mutation_p.S228F|GRM1_ENST00000392299.2_Missense_Mutation_p.S228F|GRM1_ENST00000355289.4_Missense_Mutation_p.S228F|GRM1_ENST00000507907.1_Missense_Mutation_p.S228F			Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1	228					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|cell death (GO:0008219)|cellular response to electrical stimulus (GO:0071257)|dimeric G-protein coupled receptor signaling pathway (GO:0038042)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|G-protein coupled receptor dimeric complex (GO:0038037)|G-protein coupled receptor homodimeric complex (GO:0038038)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)	p.S228F(4)		NS(2)|breast(5)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(54)|ovary(7)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	126		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)		ACCTATGTCTCTGCAGTCCAC	0.448																																							uc010khw.1		NA																	4	Substitution - Missense(4)		lung(4)	lung(8)|ovary(4)|central_nervous_system(3)|large_intestine(2)|breast(2)	19						c.(682-684)TCT>TTT		glutamate receptor, metabotropic 1 isoform alpha	Acamprosate(DB00659)|L-Glutamic Acid(DB00142)						59.0	60.0	60.0					6																	146351336		2203	4300	6503	SO:0001583	missense	2911				synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity	g.chr6:146351336C>T	U31215	CCDS5209.1, CCDS47497.1, CCDS64548.1	6q24	2014-06-12			ENSG00000152822	ENSG00000152822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4593	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 85"""	604473				9076744, 9376535	Standard	NM_001278064		Approved	GPRC1A, mGlu1, MGLUR1, PPP1R85	uc010khw.2	Q13255	OTTHUMG00000015752	ENST00000282753.1:c.683C>T	6.37:g.146351336C>T	ENSP00000282753:p.Ser228Phe		Somatic				GRM1_uc010khu.1_Missense_Mutation_p.S228F|GRM1_uc010khv.1_Missense_Mutation_p.S228F|GRM1_uc003qll.2_Missense_Mutation_p.S228F|GRM1_uc011edz.1_Missense_Mutation_p.S228F|GRM1_uc011eea.1_Missense_Mutation_p.S228F	p.S228F	NM_000838	NP_000829	WXS	Illumina HiSeq	Unspecified	Q13255	GRM1_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)	2	1153	+		Ovarian(120;0.0387)	228			Extracellular (Potential).		B9EG79|F8W805|Q13256|Q14757|Q14758|Q5VTF7|Q5VTF8|Q9NU10|Q9UGS9|Q9UGT0	Missense_Mutation	SNP	ENST00000282753.1	37	c.683C>T	CCDS5209.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.369014	0.82463	.	.	ENSG00000152822	ENST00000361719;ENST00000392299;ENST00000492807;ENST00000282753;ENST00000355289;ENST00000507907	D;D;D;D;D;D	0.83992	-1.79;-1.79;-1.79;-1.79;-1.79;-1.79	5.79	5.79	0.91817	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.90669	0.7073	M	0.80746	2.51	0.80722	D	1	D;D;D;D	0.59767	0.983;0.983;0.986;0.983	D;P;D;D	0.68943	0.935;0.9;0.961;0.935	D	0.91015	0.4853	10	0.87932	D	0	.	19.6316	0.95708	0.0:1.0:0.0:0.0	.	228;228;223;228	F8W805;Q13255;Q59HC2;Q13255-2	.;GRM1_HUMAN;.;.	F	228	ENSP00000354896:S228F;ENSP00000376119:S228F;ENSP00000424095:S228F;ENSP00000282753:S228F;ENSP00000347437:S228F;ENSP00000425599:S228F	ENSP00000282753:S228F	S	+	2	0	GRM1	146393029	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.818000	0.86416	2.736000	0.93811	0.561000	0.74099	TCT		0.448	GRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042574.1	NM_000838		10	45	0	0	0	0.069234	0	10	45				
TNFRSF10B	8795	broad.mit.edu	37	8	22926500	22926500	+	De_novo_Start_OutOfFrame	SNP	G	G	C			TCGA-44-2665-01A-01D-1040-01	TCGA-44-2665-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	520db804-4c03-4a0c-9966-fc0c9f98cfec	4b84f6af-2361-4e9b-9c8c-f1cbeb8513f2	g.chr8:22926500G>C	ENST00000276431.4	-	0	192				RP11-875O11.2_ENST00000501897.1_RNA|TNFRSF10B_ENST00000542226.1_De_novo_Start_OutOfFrame|TNFRSF10B_ENST00000347739.3_De_novo_Start_OutOfFrame|RP11-875O11.3_ENST00000520840.1_RNA	NM_003842.4|NM_147187.2	NP_003833.4|NP_671716.2	O14763	TR10B_HUMAN	tumor necrosis factor receptor superfamily, member 10b						activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell surface receptor signaling pathway (GO:0007166)|cellular response to mechanical stimulus (GO:0071260)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of apoptotic process (GO:0042981)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|response to endoplasmic reticulum stress (GO:0034976)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|TRAIL binding (GO:0045569)			NS(1)|endometrium(2)|large_intestine(7)|liver(1)|lung(3)|skin(1)	15		Prostate(55;0.0421)|Breast(100;0.067)		Colorectal(74;0.0179)|COAD - Colon adenocarcinoma(73;0.0703)		TGGGCGCAGAGATTGCGGGGT	0.597																																					GBM(94;1064 1342 1839 21060 42553)	GBM(94;1064 1342 1839 21060 42553)	uc003xcu.2		NA																	0					0						c.(-94--90)ATCTC>ATGTC		tumor necrosis factor receptor superfamily,																																						8795				activation of NF-kappaB-inducing kinase activity|activation of pro-apoptotic gene products|cell surface receptor linked signaling pathway|cellular response to mechanical stimulus|induction of apoptosis via death domain receptors|positive regulation of I-kappaB kinase/NF-kappaB cascade	plasma membrane	caspase activator activity|receptor activity|TRAIL binding	g.chr8:22926500G>C	AF012628	CCDS6035.1, CCDS6036.1	8p22-p21	2006-02-22			ENSG00000120889	ENSG00000120889		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11905	protein-coding gene	gene with protein product		603612				9285725, 9311998	Standard	NM_003842		Approved	DR5, KILLER, TRICK2A, TRAIL-R2, TRICKB, CD262	uc003xcu.2	O14763	OTTHUMG00000097826	ENST00000276431.4:c.-93C>G	8.37:g.22926500G>C			Somatic				uc003xcw.1_Intron|TNFRSF10B_uc003xct.2_Translation_Start_Site|TNFRSF10B_uc011kzq.1_Translation_Start_Site|TNFRSF10B_uc003xcv.2_Translation_Start_Site		NM_003842	NP_003833	WXS	Illumina HiSeq	Unspecified	O14763	TR10B_HUMAN		Colorectal(74;0.0179)|COAD - Colon adenocarcinoma(73;0.0703)	1	201	-		Prostate(55;0.0421)|Breast(100;0.067)						O14720|O15508|O15517|O15531|Q6UXM8|Q7Z360|Q9BVE0	Translation_Start_Site	SNP	ENST00000276431.4	37	c.-92C>G	CCDS6035.1																																																																																				0.597	TNFRSF10B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000215099.2	NM_147187		6	26	0	0	0	0.021553	0	6	26				
WRN	7486	broad.mit.edu	37	8	30945312	30945312	+	Missense_Mutation	SNP	T	T	A			TCGA-44-2665-01A-01D-1040-01	TCGA-44-2665-10A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	520db804-4c03-4a0c-9966-fc0c9f98cfec	4b84f6af-2361-4e9b-9c8c-f1cbeb8513f2	g.chr8:30945312T>A	ENST00000298139.5	+	12	1701	c.1452T>A	c.(1450-1452)agT>agA	p.S484R		NM_000553.4	NP_000544.2	Q14191	WRN_HUMAN	Werner syndrome, RecQ helicase-like	484					aging (GO:0007568)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|cell aging (GO:0007569)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to starvation (GO:0009267)|DNA duplex unwinding (GO:0032508)|DNA metabolic process (GO:0006259)|DNA recombination (GO:0006310)|DNA replication (GO:0006260)|DNA synthesis involved in DNA repair (GO:0000731)|double-strand break repair (GO:0006302)|multicellular organismal aging (GO:0010259)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleolus to nucleoplasm transport (GO:0032066)|positive regulation of hydrolase activity (GO:0051345)|regulation of apoptotic process (GO:0042981)|regulation of growth rate (GO:0040009)|replication fork processing (GO:0031297)|replicative cell aging (GO:0001302)|response to oxidative stress (GO:0006979)|response to UV-C (GO:0010225)|telomere maintenance (GO:0000723)	centrosome (GO:0005813)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	3'-5' DNA helicase activity (GO:0043138)|3'-5' exonuclease activity (GO:0008408)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|bubble DNA binding (GO:0000405)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|exonuclease activity (GO:0004527)|four-way junction helicase activity (GO:0009378)|G-quadruplex DNA binding (GO:0051880)|helicase activity (GO:0004386)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|Y-form DNA binding (GO:0000403)	p.S484R(2)		central_nervous_system(2)|endometrium(4)|kidney(4)|large_intestine(13)|lung(28)|ovary(3)|skin(3)|upper_aerodigestive_tract(3)	60		Breast(100;0.195)		KIRC - Kidney renal clear cell carcinoma(542;0.147)|Kidney(114;0.176)|Colorectal(111;0.192)		ACCTCAATAGTGGCACGGTAG	0.333			"""Mis, N, F, S"""			"""osteosarcoma, meningioma, others"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Werner syndrome																												Ovarian(18;161 598 2706 14834 27543)	Ovarian(18;161 598 2706 14834 27543)	uc003xio.3		NA	yes	Rec		Werner Syndrome	8	8p12-p11.2	7486	Mis|N|F|S	Werner syndrome (RECQL2)			"""L, E, M, O"""		osteosarcoma|meningioma|others			2	Substitution - Missense(2)		lung(2)	ovary(2)|kidney(2)|large_intestine(1)|lung(1)|skin(1)	7						c.(1450-1452)AGT>AGA	Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	Werner syndrome protein							114.0	123.0	120.0					8																	30945312		2203	4300	6503	SO:0001583	missense	7486	Werner_syndrome	Familial Cancer Database	WS, Adult Progeria	base-excision repair|cellular response to starvation|DNA recombination|DNA synthesis involved in DNA repair|multicellular organismal aging|nucleolus to nucleoplasm transport|positive regulation of hydrolase activity|regulation of apoptosis|replication fork processing|response to oxidative stress|response to UV-C|telomere maintenance	centrosome|nucleolus|nucleoplasm	3'-5' exonuclease activity|ATP binding|ATP-dependent 3'-5' DNA helicase activity|bubble DNA binding|four-way junction helicase activity|G-quadruplex DNA binding|magnesium ion binding|manganese ion binding|protein complex binding|protein homodimerization activity|Y-form DNA binding	g.chr8:30945312T>A		CCDS6082.1	8p12	2014-09-17	2009-03-19		ENSG00000165392	ENSG00000165392			12791	protein-coding gene	gene with protein product		604611	"""Werner syndrome"""			9288107	Standard	NM_000553		Approved	RECQL2, RECQ3	uc003xio.4	Q14191	OTTHUMG00000163894	ENST00000298139.5:c.1452T>A	8.37:g.30945312T>A	ENSP00000298139:p.Ser484Arg		Somatic				WRN_uc011lbe.1_Missense_Mutation_p.S12R|WRN_uc010lvk.2_5'UTR	p.S484R	NM_000553	NP_000544	WXS	Illumina HiSeq	Unspecified	Q14191	WRN_HUMAN		KIRC - Kidney renal clear cell carcinoma(542;0.147)|Kidney(114;0.176)|Colorectal(111;0.192)	12	2240	+		Breast(100;0.195)	484					A1KYY9	Missense_Mutation	SNP	ENST00000298139.5	37	c.1452T>A	CCDS6082.1	.	.	.	.	.	.	.	.	.	.	T	5.955	0.360174	0.11296	.	.	ENSG00000165392	ENST00000298139	T	0.45668	0.89	5.07	3.88	0.44766	.	0.400169	0.31484	N	0.007569	T	0.34250	0.0891	L	0.46157	1.445	0.09310	N	0.999998	B	0.13594	0.008	B	0.15052	0.012	T	0.29366	-1.0014	10	0.54805	T	0.06	-19.0687	8.3488	0.32290	0.0:0.093:0.0:0.907	.	484	Q14191	WRN_HUMAN	R	484	ENSP00000298139:S484R	ENSP00000298139:S484R	S	+	3	2	WRN	31064854	0.245000	0.23899	0.022000	0.16811	0.058000	0.15608	1.044000	0.30329	0.983000	0.38602	0.528000	0.53228	AGT		0.333	WRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376248.1			4	24	0	0	0	0.014758	0	4	24				
NRG1	3084	broad.mit.edu	37	8	32621515	32621515	+	Silent	SNP	G	G	A			TCGA-44-2665-01A-01D-1040-01	TCGA-44-2665-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	520db804-4c03-4a0c-9966-fc0c9f98cfec	4b84f6af-2361-4e9b-9c8c-f1cbeb8513f2	g.chr8:32621515G>A	ENST00000405005.3	+	12	1518	c.1518G>A	c.(1516-1518)gcG>gcA	p.A506A	NRG1_ENST00000539990.1_Silent_p.A349A|NRG1_ENST00000287845.5_Silent_p.A477A|NRG1_ENST00000521670.1_3'UTR|NRG1_ENST00000287842.3_Silent_p.A503A|RP11-1002K11.1_ENST00000607314.1_lincRNA|NRG1_ENST00000338921.4_Silent_p.A514A|NRG1_ENST00000341377.5_3'UTR|NRG1_ENST00000356819.4_Silent_p.A511A|NRG1_ENST00000519301.1_Silent_p.A456A			Q02297	NRG1_HUMAN	neuregulin 1	506					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cardiac conduction system development (GO:0003161)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle cell myoblast differentiation (GO:0060379)|cell communication (GO:0007154)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|cellular protein complex disassembly (GO:0043624)|embryo development (GO:0009790)|endocardial cell differentiation (GO:0060956)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell fate commitment (GO:0021781)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|mammary gland development (GO:0030879)|MAPK cascade (GO:0000165)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of secretion (GO:0051048)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|neural crest cell development (GO:0014032)|neuron fate commitment (GO:0048663)|neurotransmitter receptor metabolic process (GO:0045213)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of striated muscle cell differentiation (GO:0051155)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein homodimerization activity (GO:0043496)|synapse assembly (GO:0007416)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ventricular cardiac muscle cell differentiation (GO:0055012)|ventricular trabecula myocardium morphogenesis (GO:0003222)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)	cytokine activity (GO:0005125)|ErbB-3 class receptor binding (GO:0043125)|growth factor activity (GO:0008083)|protein tyrosine kinase activator activity (GO:0030296)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)	p.A511A(2)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(1)|skin(1)	39		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)		ACAACCCCGCGCATGACAGTA	0.542																																							uc003xiv.2		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(1516-1518)GCG>GCA		neuregulin 1 isoform HRG-alpha							101.0	80.0	87.0					8																	32621515		2203	4300	6503	SO:0001819	synonymous_variant	3084				activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|cardiac muscle cell differentiation|cell communication|cell proliferation|cellular protein complex disassembly|embryo development|mammary gland development|negative regulation of cardiac muscle cell apoptosis|negative regulation of secretion|negative regulation of transcription, DNA-dependent|nervous system development|neural crest cell development|Notch signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of cell adhesion|positive regulation of cell growth|positive regulation of striated muscle cell differentiation|regulation of protein heterodimerization activity|regulation of protein homodimerization activity|transmembrane receptor protein tyrosine kinase signaling pathway|ventricular cardiac muscle cell differentiation|wound healing|wound healing	apical plasma membrane|extracellular region|extracellular space|integral to membrane|nucleus|plasma membrane	cytokine activity|ErbB-3 class receptor binding|growth factor activity|growth factor activity|protein binding|protein tyrosine kinase activator activity|receptor tyrosine kinase binding|transcription cofactor activity|transmembrane receptor protein tyrosine kinase activator activity	g.chr8:32621515G>A	L12261	CCDS6084.1, CCDS6085.1, CCDS6086.1, CCDS6087.1, CCDS47836.1, CCDS55218.1, CCDS55219.1, CCDS75727.1	8p21-p12	2014-06-23			ENSG00000157168	ENSG00000157168		"""Immunoglobulin superfamily / I-set domain containing"""	7997	protein-coding gene	gene with protein product		142445	"""NRG1 intronic transcript 2 (non-protein coding)"""	HGL, NRG1-IT2		1350381, 8095334	Standard	NM_013962		Approved	HRG, NDF, GGF	uc003xiu.2	Q02297	OTTHUMG00000163918	ENST00000405005.3:c.1518G>A	8.37:g.32621515G>A			Somatic				NRG1_uc010lvo.2_3'UTR|NRG1_uc003xiu.2_Silent_p.A511A|NRG1_uc003xiw.2_Silent_p.A503A|NRG1_uc003xit.2_3'UTR|NRG1_uc010lvr.2_Silent_p.A248A|NRG1_uc010lvs.2_Silent_p.A248A|NRG1_uc010lvp.2_Silent_p.A460A|NRG1_uc010lvq.2_Silent_p.A443A|NRG1_uc011lbg.1_3'UTR|NRG1_uc011lbh.1_Silent_p.A349A|NRG1_uc003xja.2_Silent_p.A317A	p.A506A	NM_013964	NP_039258	WXS	Illumina HiSeq	Unspecified	Q02297	NRG1_HUMAN		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)	12	2035	+		Breast(100;0.203)	506			Cytoplasmic (Potential).		A5YAK4|A5YAK5|A8K1L2|B7Z4Z3|E9PHH4|O14667|P98202|Q02298|Q02299|Q07110|Q07111|Q12779|Q12780|Q12781|Q12782|Q12783|Q12784|Q15491|Q7RTV9|Q7RTW0|Q7RTW1|Q7RTW2|Q8NFN1|Q8NFN2|Q8NFN3|Q9UPE3	Silent	SNP	ENST00000405005.3	37	c.1518G>A	CCDS6085.1																																																																																				0.542	NRG1-017	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000472504.1			4	33	0	0	0	0.009096	0	4	33				
TESK1	7016	broad.mit.edu	37	9	35609179	35609179	+	Missense_Mutation	SNP	T	T	C			TCGA-44-2665-01A-01D-1040-01	TCGA-44-2665-10A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	520db804-4c03-4a0c-9966-fc0c9f98cfec	4b84f6af-2361-4e9b-9c8c-f1cbeb8513f2	g.chr9:35609179T>C	ENST00000336395.5	+	10	1571	c.1321T>C	c.(1321-1323)Tcc>Ccc	p.S441P	MIR4667_ENST00000578933.1_RNA|TESK1_ENST00000498522.1_3'UTR|CD72_ENST00000490239.1_5'Flank	NM_006285.2	NP_006276.2	Q15569	TESK1_HUMAN	testis-specific kinase 1	441					cell junction assembly (GO:0034329)|spermatogenesis (GO:0007283)	cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	27			Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			ACTACCCTCATCCCCCGAGCT	0.672																																							uc003zxa.2		NA																	0				stomach(2)|breast(2)|lung(1)|ovary(1)|skin(1)	7						c.(1321-1323)TCC>CCC		testis-specific protein kinase 1							53.0	63.0	60.0					9																	35609179		2199	4296	6495	SO:0001583	missense	7016				cell junction assembly|spermatogenesis	cytosol	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr9:35609179T>C	D50863	CCDS6580.1	9p13	2010-04-27			ENSG00000107140	ENSG00000107140	2.7.12.1		11731	protein-coding gene	gene with protein product	"""testis-specific kinase-1"", ""testis specific kinase-1"""	601782				8537404	Standard	NM_006285		Approved		uc003zxa.3	Q15569	OTTHUMG00000019863	ENST00000336395.5:c.1321T>C	9.37:g.35609179T>C	ENSP00000338127:p.Ser441Pro		Somatic				TESK1_uc003zwz.1_RNA|TESK1_uc010mks.2_Missense_Mutation_p.S281P	p.S441P	NM_006285	NP_006276	WXS	Illumina HiSeq	Unspecified	Q15569	TESK1_HUMAN	Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)		10	1657	+			441					Q8IXZ8	Missense_Mutation	SNP	ENST00000336395.5	37	c.1321T>C	CCDS6580.1	.	.	.	.	.	.	.	.	.	.	T	17.98	3.521822	0.64747	.	.	ENSG00000107140	ENST00000336395	T	0.69175	-0.38	5.69	5.69	0.88448	.	0.000000	0.44483	D	0.000445	T	0.72495	0.3467	L	0.52011	1.625	0.44798	D	0.997808	D;D	0.61697	0.99;0.99	P;P	0.54815	0.743;0.761	T	0.75651	-0.3244	10	0.72032	D	0.01	-23.1913	14.777	0.69738	0.0:0.0:0.0:1.0	.	359;441	B4DQQ3;Q15569	.;TESK1_HUMAN	P	441	ENSP00000338127:S441P	ENSP00000338127:S441P	S	+	1	0	TESK1	35599179	1.000000	0.71417	0.999000	0.59377	0.707000	0.40811	3.342000	0.52159	2.162000	0.67917	0.533000	0.62120	TCC		0.672	TESK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052314.1	NM_006285		7	66	0	0	0	0.037714	0	7	66				
APBA1	320	broad.mit.edu	37	9	72131361	72131361	+	Missense_Mutation	SNP	C	C	T			TCGA-44-2665-01A-01D-1040-01	TCGA-44-2665-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	520db804-4c03-4a0c-9966-fc0c9f98cfec	4b84f6af-2361-4e9b-9c8c-f1cbeb8513f2	g.chr9:72131361C>T	ENST00000265381.4	-	2	988	c.766G>A	c.(766-768)Gcg>Acg	p.A256T		NM_001163.3	NP_001154.2	Q02410	APBA1_HUMAN	amyloid beta (A4) precursor protein-binding, family A, member 1	256	Munc-18-1 binding.				axon cargo transport (GO:0008088)|cell adhesion (GO:0007155)|gamma-aminobutyric acid secretion (GO:0014051)|glutamate secretion (GO:0014047)|in utero embryonic development (GO:0001701)|intracellular protein transport (GO:0006886)|locomotory behavior (GO:0007626)|multicellular organism growth (GO:0035264)|nervous system development (GO:0007399)|protein complex assembly (GO:0006461)|regulation of gene expression (GO:0010468)|synaptic transmission (GO:0007268)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synaptic vesicle (GO:0008021)	beta-amyloid binding (GO:0001540)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.A256T(2)		endometrium(4)|kidney(2)|large_intestine(12)|lung(13)|prostate(3)|skin(3)	37						GGGTAGGGCGCGAACTCGGCC	0.687																																							uc004ahh.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(1)	1						c.(766-768)GCG>ACG		amyloid beta A4 precursor protein-binding,							38.0	29.0	32.0					9																	72131361		2201	4300	6501	SO:0001583	missense	320				axon cargo transport|cell adhesion|intracellular protein transport|nervous system development|protein complex assembly|synaptic transmission	synaptic vesicle		g.chr9:72131361C>T	AF029106	CCDS6630.1	9q13-q21	2008-07-18	2008-07-18		ENSG00000107282	ENSG00000107282			578	protein-coding gene	gene with protein product		602414		MINT1		7678331, 7719031	Standard	NM_001163		Approved	D9S411E, X11	uc004ahh.2	Q02410	OTTHUMG00000019984	ENST00000265381.4:c.766G>A	9.37:g.72131361C>T	ENSP00000265381:p.Ala256Thr		Somatic					p.A256T	NM_001163	NP_001154	WXS	Illumina HiSeq	Unspecified	Q02410	APBA1_HUMAN			2	1042	-			256			Munc-18-1 binding.		O14914|O60570|Q5VYR8	Missense_Mutation	SNP	ENST00000265381.4	37	c.766G>A	CCDS6630.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.130315	0.77549	.	.	ENSG00000107282	ENST00000265381	T	0.06933	3.24	5.77	4.86	0.63082	.	0.057532	0.64402	D	0.000001	T	0.08088	0.0202	L	0.29908	0.895	0.58432	D	0.999998	B	0.26635	0.155	B	0.14578	0.011	T	0.12993	-1.0526	10	0.51188	T	0.08	.	16.0749	0.80962	0.1352:0.8648:0.0:0.0	.	256	Q02410	APBA1_HUMAN	T	256	ENSP00000265381:A256T	ENSP00000265381:A256T	A	-	1	0	APBA1	71321181	1.000000	0.71417	1.000000	0.80357	0.886000	0.51366	3.623000	0.54224	1.421000	0.47157	0.561000	0.74099	GCG		0.687	APBA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052589.2	NM_001163		7	32	0	0	0	0.038147	0	7	32				
HSPA5	3309	broad.mit.edu	37	9	128000573	128000573	+	Missense_Mutation	SNP	G	G	A			TCGA-44-2665-01A-01D-1040-01	TCGA-44-2665-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	520db804-4c03-4a0c-9966-fc0c9f98cfec	4b84f6af-2361-4e9b-9c8c-f1cbeb8513f2	g.chr9:128000573G>A	ENST00000324460.6	-	7	1452	c.1249C>T	c.(1249-1251)Ctt>Ttt	p.L417F		NM_005347.4	NP_005338.1	P11021	GRP78_HUMAN	heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa)	417					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|cellular response to antibiotic (GO:0071236)|cellular response to glucose starvation (GO:0042149)|cellular response to interleukin-4 (GO:0071353)|cerebellar Purkinje cell layer development (GO:0021680)|cerebellum structural organization (GO:0021589)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER overload response (GO:0006983)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|maintenance of protein localization in endoplasmic reticulum (GO:0035437)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cell migration (GO:0030335)|positive regulation of protein ubiquitination (GO:0031398)|regulation of protein folding in endoplasmic reticulum (GO:0060904)|substantia nigra development (GO:0021762)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum chaperone complex (GO:0034663)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|chaperone binding (GO:0051087)|enzyme binding (GO:0019899)|glycoprotein binding (GO:0001948)|misfolded protein binding (GO:0051787)|protein domain specific binding (GO:0019904)|ribosome binding (GO:0043022)|ubiquitin protein ligase binding (GO:0031625)|unfolded protein binding (GO:0051082)	p.L417F(2)		breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(4)|prostate(2)|skin(1)	23					Acetylsalicylic acid(DB00945)|Antihemophilic Factor(DB00025)	CATACATCAAGCAGTACCAGG	0.398										Prostate(1;0.17)																													uc004bpn.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|skin(1)	4						c.(1249-1251)CTT>TTT		heat shock 70kDa protein 5	Antihemophilic Factor(DB00025)						111.0	98.0	102.0					9																	128000573		2203	4300	6503	SO:0001583	missense	3309				anti-apoptosis|cellular response to glucose starvation|ER-associated protein catabolic process|platelet activation|platelet degranulation|regulation of protein folding in endoplasmic reticulum	cell surface|endoplasmic reticulum chaperone complex|endoplasmic reticulum lumen|ER-Golgi intermediate compartment|integral to endoplasmic reticulum membrane|melanosome|midbody|nucleus|perinuclear region of cytoplasm	ATP binding|ATPase activity|calcium ion binding|caspase inhibitor activity|chaperone binding|misfolded protein binding|protein binding, bridging|protein domain specific binding|ubiquitin protein ligase binding|unfolded protein binding	g.chr9:128000573G>A		CCDS6863.1	9q33.3	2011-09-02	2002-08-29		ENSG00000044574	ENSG00000044574		"""Heat shock proteins / HSP70"""	5238	protein-coding gene	gene with protein product		138120	"""heat shock 70kD protein 5 (glucose-regulated protein, 78kD)"""	GRP78			Standard	NM_005347		Approved	BiP	uc004bpn.3	P11021	OTTHUMG00000020672	ENST00000324460.6:c.1249C>T	9.37:g.128000573G>A	ENSP00000324173:p.Leu417Phe	Prostate(1;0.17)	Somatic					p.L417F	NM_005347	NP_005338	WXS	Illumina HiSeq	Unspecified	P11021	GRP78_HUMAN			7	1505	-			417					B0QZ61|Q2EF78|Q9NPF1|Q9UK02	Missense_Mutation	SNP	ENST00000324460.6	37	c.1249C>T	CCDS6863.1	.	.	.	.	.	.	.	.	.	.	G	28.4	4.915915	0.92178	.	.	ENSG00000044574	ENST00000324460	T	0.05382	3.45	4.61	4.61	0.57282	.	0.000000	0.85682	D	0.000000	T	0.37073	0.0990	H	0.98351	4.21	0.80722	D	1	D	0.53745	0.962	P	0.56960	0.81	T	0.64114	-0.6483	10	0.87932	D	0	-20.489	16.4353	0.83873	0.0:0.0:1.0:0.0	.	417	P11021	GRP78_HUMAN	F	417	ENSP00000324173:L417F	ENSP00000324173:L417F	L	-	1	0	HSPA5	127040394	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	9.869000	0.99810	2.092000	0.63282	0.557000	0.71058	CTT		0.398	HSPA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054062.1			11	32	0	0	0	0.020292	0	11	32				
MXRA5	25878	broad.mit.edu	37	X	3241386	3241386	+	Silent	SNP	C	C	T			TCGA-44-2665-01A-01D-1040-01	TCGA-44-2665-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	520db804-4c03-4a0c-9966-fc0c9f98cfec	4b84f6af-2361-4e9b-9c8c-f1cbeb8513f2	g.chrX:3241386C>T	ENST00000217939.6	-	5	2494	c.2340G>A	c.(2338-2340)ccG>ccA	p.P780P		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	780						extracellular vesicular exosome (GO:0070062)		p.P780P(4)		NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				CCCAGCGCTCCGGATTAATCT	0.453																																							uc004crg.3		NA																	4	Substitution - coding silent(4)		lung(4)	ovary(5)|lung(1)|central_nervous_system(1)|skin(1)	8						c.(2338-2340)CCG>CCA		adlican precursor							111.0	104.0	107.0					X																	3241386		2203	4300	6503	SO:0001819	synonymous_variant	25878					extracellular region		g.chrX:3241386C>T	AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.2340G>A	X.37:g.3241386C>T			Somatic					p.P780P	NM_015419	NP_056234	WXS	Illumina HiSeq	Unspecified	Q9NR99	MXRA5_HUMAN			5	2497	-		all_lung(23;0.00031)|Lung NSC(23;0.000946)	780					Q6P1M7|Q9Y3Y8	Silent	SNP	ENST00000217939.6	37	c.2340G>A	CCDS14124.1																																																																																				0.453	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055655.2	NM_015419		14	57	0	0	0	0.020292	0	14	57				
MSL3	10943	broad.mit.edu	37	X	11783605	11783605	+	Missense_Mutation	SNP	C	C	T			TCGA-44-2665-01A-01D-1040-01	TCGA-44-2665-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	520db804-4c03-4a0c-9966-fc0c9f98cfec	4b84f6af-2361-4e9b-9c8c-f1cbeb8513f2	g.chrX:11783605C>T	ENST00000312196.4	+	9	1033	c.928C>T	c.(928-930)Ccc>Tcc	p.P310S	MSL3_ENST00000398527.2_Missense_Mutation_p.P298S|MSL3_ENST00000337339.2_Missense_Mutation_p.P310S|MSL3_ENST00000361672.2_Missense_Mutation_p.P161S|MSL3_ENST00000380693.3_Missense_Mutation_p.P144S	NM_078629.3	NP_523353.2	Q8N5Y2	MS3L1_HUMAN	male-specific lethal 3 homolog (Drosophila)	310	MRG. {ECO:0000255|PROSITE- ProRule:PRU00972}.|Required for the histone acetyltransferase activity of the MSL complex.				chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|multicellular organismal development (GO:0007275)|transcription from RNA polymerase II promoter (GO:0006366)	MSL complex (GO:0072487)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|methylated histone binding (GO:0035064)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(3)|cervix(1)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|urinary_tract(1)	19						GGAACTCTCTCCCAGTCCGCC	0.557																																							uc004cuw.2		NA																	0				ovary(1)	1						c.(928-930)CCC>TCC		male-specific lethal 3-like 1 isoform a							106.0	95.0	99.0					X																	11783605		2203	4300	6503	SO:0001583	missense	10943				histone H4-K16 acetylation|multicellular organismal development|transcription from RNA polymerase II promoter	MSL complex	DNA binding|methylated histone residue binding|sequence-specific DNA binding transcription factor activity	g.chrX:11783605C>T	AF117065	CCDS14147.1, CCDS14148.1, CCDS14149.1, CCDS55369.1, CCDS65213.1	Xp22.3	2008-10-29	2008-10-29	2008-10-29	ENSG00000005302	ENSG00000005302			7370	protein-coding gene	gene with protein product		300609	"""male-specific lethal-3 (Drosophila)-like 1"", ""male-specific lethal 3-like 1 (Drosophila)"""	MSL3L1		10395802, 10908644	Standard	NM_078628		Approved		uc004cuw.3	Q8N5Y2	OTTHUMG00000021132	ENST00000312196.4:c.928C>T	X.37:g.11783605C>T	ENSP00000312244:p.Pro310Ser		Somatic				MSL3_uc004cuv.1_Missense_Mutation_p.P310S|MSL3_uc004cux.2_Missense_Mutation_p.P251S|MSL3_uc011mig.1_Missense_Mutation_p.P161S|MSL3_uc011mih.1_Missense_Mutation_p.P298S|MSL3_uc004cuy.2_Missense_Mutation_p.P144S	p.P310S	NM_078629	NP_523353	WXS	Illumina HiSeq	Unspecified	Q8N5Y2	MS3L1_HUMAN			9	1033	+			310					A6NCU2|A6NHW8|A8K165|B4DUV8|B7Z227|Q9UG70|Q9Y5Z8	Missense_Mutation	SNP	ENST00000312196.4	37	c.928C>T	CCDS14147.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.107805	0.77096	.	.	ENSG00000005302	ENST00000312196;ENST00000337339;ENST00000361672;ENST00000398527;ENST00000380693;ENST00000380692	T;T;T;T;T;T	0.12879	3.25;3.17;2.9;3.07;2.91;2.64	4.71	4.71	0.59529	.	0.117529	0.64402	D	0.000019	T	0.39064	0.1064	M	0.83012	2.62	0.58432	D	0.999994	D;D;D;D;D	0.89917	0.999;0.992;0.998;0.999;1.0	D;D;D;D;D	0.91635	0.977;0.913;0.919;0.977;0.999	T	0.37430	-0.9706	10	0.14656	T	0.56	.	17.2483	0.87034	0.0:1.0:0.0:0.0	.	298;161;251;310;310	B4DUV8;B7Z227;Q8N5Y2-2;Q8N5Y2;A6NHW8	.;.;.;MS3L1_HUMAN;.	S	310;310;161;298;144;144	ENSP00000312244:P310S;ENSP00000338078:P310S;ENSP00000354562:P161S;ENSP00000381538:P298S;ENSP00000370069:P144S;ENSP00000370068:P144S	ENSP00000312244:P310S	P	+	1	0	MSL3	11693526	1.000000	0.71417	0.993000	0.49108	0.932000	0.56968	6.436000	0.73417	2.083000	0.62718	0.529000	0.55759	CCC		0.557	MSL3-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055757.1	NM_006800		4	121	0	0	0	0.014758	0	4	121				
PLP2	5355	broad.mit.edu	37	X	49029495	49029495	+	Missense_Mutation	SNP	T	T	C			TCGA-44-2665-01A-01D-1040-01	TCGA-44-2665-10A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	520db804-4c03-4a0c-9966-fc0c9f98cfec	4b84f6af-2361-4e9b-9c8c-f1cbeb8513f2	g.chrX:49029495T>C	ENST00000376327.5	+	2	191	c.116T>C	c.(115-117)cTg>cCg	p.L39P	PLP2_ENST00000376322.3_Missense_Mutation_p.L39P	NM_002668.2	NP_002659.1	Q04941	PLP2_HUMAN	proteolipid protein 2 (colonic epithelium-enriched)	39	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				chemotaxis (GO:0006935)|cytokine-mediated signaling pathway (GO:0019221)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	chemokine binding (GO:0019956)|ion transmembrane transporter activity (GO:0015075)	p.L39P(2)		endometrium(3)|large_intestine(1)|lung(6)|urinary_tract(3)	13						CTGGTGATCCTGATCTGCTTC	0.493																																							uc004dmx.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(115-117)CTG>CCG		proteolipid protein 2 (colonic							187.0	127.0	147.0					X																	49029495		2203	4300	6503	SO:0001583	missense	5355				chemotaxis|cytokine-mediated signaling pathway	endoplasmic reticulum membrane|integral to membrane|membrane fraction|plasma membrane	chemokine binding|ion transmembrane transporter activity	g.chrX:49029495T>C	L09604	CCDS14319.1	Xp11.23	2008-08-01			ENSG00000102007	ENSG00000102007			9087	protein-coding gene	gene with protein product	"""A4 differentiation-dependent protein"""	300112				8470895, 7622043	Standard	NM_002668		Approved	A4, A4-LSB, MGC126187	uc004dmx.3	Q04941	OTTHUMG00000021513	ENST00000376327.5:c.116T>C	X.37:g.49029495T>C	ENSP00000365505:p.Leu39Pro		Somatic					p.L39P	NM_002668	NP_002659	WXS	Illumina HiSeq	Unspecified	Q04941	PLP2_HUMAN			2	191	+			39			Helical; (Potential).|MARVEL.		A6NDT7|Q32MM8	Missense_Mutation	SNP	ENST00000376327.5	37	c.116T>C	CCDS14319.1	.	.	.	.	.	.	.	.	.	.	T	21.1	4.105421	0.77096	.	.	ENSG00000102007	ENST00000376322;ENST00000376327	T;T	0.35236	1.32;1.32	5.34	5.34	0.76211	Marvel (1);MARVEL-like domain (1);	0.181333	0.38058	N	0.001834	T	0.58680	0.2139	M	0.78916	2.43	0.80722	D	1	D	0.69078	0.997	D	0.67548	0.952	T	0.63853	-0.6543	10	0.72032	D	0.01	-4.8307	12.2333	0.54500	0.0:0.0:0.0:1.0	.	39	Q04941	PLP2_HUMAN	P	39	ENSP00000365500:L39P;ENSP00000365505:L39P	ENSP00000365500:L39P	L	+	2	0	PLP2	48916439	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	4.007000	0.57093	1.794000	0.52575	0.481000	0.45027	CTG		0.493	PLP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056540.1	NM_002668		6	29	0	0	0	0.02938	0	6	29				
MSN	4478	broad.mit.edu	37	X	64959737	64959737	+	Silent	SNP	C	C	T			TCGA-44-2665-01A-01D-1040-01	TCGA-44-2665-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	520db804-4c03-4a0c-9966-fc0c9f98cfec	4b84f6af-2361-4e9b-9c8c-f1cbeb8513f2	g.chrX:64959737C>T	ENST00000360270.5	+	13	1888	c.1716C>T	c.(1714-1716)gaC>gaT	p.D572D		NM_002444.2	NP_002435.1	P26038	MOES_HUMAN	moesin	572					cellular component movement (GO:0006928)|establishment of endothelial barrier (GO:0061028)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|membrane to membrane docking (GO:0022614)|positive regulation of gene expression (GO:0010628)|regulation of lymphocyte migration (GO:2000401)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|uropod (GO:0001931)|vesicle (GO:0031982)	cell adhesion molecule binding (GO:0050839)|double-stranded RNA binding (GO:0003725)|protein kinase binding (GO:0019901)|receptor binding (GO:0005102)|structural constituent of cytoskeleton (GO:0005200)	p.D572D(1)	MSN/ALK(6)	breast(4)|central_nervous_system(3)|endometrium(7)|kidney(5)|large_intestine(6)|lung(11)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	43						AGCGCATTGACGAATTTGAGT	0.532			T	ALK	ALCL																																		uc004dwf.2		NA		Dom	yes		X	Xq11.2-q12	4478	T	moesin			L	ALK		ALCL	MSN/ALK(6)	1	Substitution - coding silent(1)		lung(1)	haematopoietic_and_lymphoid_tissue(6)|ovary(3)|lung(1)	10						c.(1714-1716)GAC>GAT		moesin							116.0	93.0	101.0					X																	64959737		2203	4300	6503	SO:0001819	synonymous_variant	4478				leukocyte cell-cell adhesion|leukocyte migration|membrane to membrane docking	apical plasma membrane|cytoskeleton|extrinsic to membrane|microvillus membrane|nucleolus	cell adhesion molecule binding|receptor binding|structural constituent of cytoskeleton	g.chrX:64959737C>T	M69066	CCDS14382.1	Xq11.1	2010-10-20			ENSG00000147065	ENSG00000147065			7373	protein-coding gene	gene with protein product		309845				1924289, 7628534	Standard	XM_005262269		Approved		uc004dwf.3	P26038	OTTHUMG00000021723	ENST00000360270.5:c.1716C>T	X.37:g.64959737C>T			Somatic					p.D572D	NM_002444	NP_002435	WXS	Illumina HiSeq	Unspecified	P26038	MOES_HUMAN			13	1914	+			572						Silent	SNP	ENST00000360270.5	37	c.1716C>T	CCDS14382.1																																																																																				0.532	MSN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056981.1	NM_002444		7	82	0	0	0	0.047766	0	7	82				
ZFHX3	463	broad.mit.edu	37	16	72991713	72991715	+	In_Frame_Del	DEL	CCA	CCA	-	rs4788682	byFrequency	TCGA-44-2665-01A-01D-1040-01	TCGA-44-2665-10A-01D-1040-01	CCA	CCA	-	-	CCA	CCA	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	520db804-4c03-4a0c-9966-fc0c9f98cfec	4b84f6af-2361-4e9b-9c8c-f1cbeb8513f2	g.chr16:72991713_72991715delCCA	ENST00000268489.5	-	2	3002_3004	c.2330_2332delTGG	c.(2329-2334)gtggct>gct	p.V777del	ZFHX3_ENST00000397992.5_Intron	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	777	Poly-Ala.		V -> A (in dbSNP:rs4788682). {ECO:0000269|PubMed:7592926}.		brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.V777V(1)		NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				gccgccgcagccaccgccgccgc	0.635																																							uc002fck.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|skin(2)	4						c.(2329-2334)GTGGCT>GCT		zinc finger homeobox 3 isoform A			,	1706,1886		582,542,672					,	5.5	0.1			17	4240,2792		1606,1028,882	no	coding,intron	ZFHX3	NM_006885.3,NM_001164766.1	,	2188,1570,1554	A1A1,A1R,RR		39.7042,47.4944,44.0324	,	,		5946,4678				SO:0001651	inframe_deletion	463				muscle organ development|negative regulation of myoblast differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|positive regulation of myoblast differentiation	transcription factor complex	enzyme binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription regulatory region DNA binding|zinc ion binding	g.chr16:72991713_72991715delCCA	D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.2330_2332delTGG	16.37:g.72991713_72991715delCCA	ENSP00000268489:p.Val777del		Somatic				ZFHX3_uc002fcl.2_Intron	p.V777del	NM_006885	NP_008816	WXS	Illumina HiSeq	Unspecified	Q15911	ZFHX3_HUMAN			2	3003_3005	-		Ovarian(137;0.13)	777			Poly-Ala.		D3DWS8|O15101|Q13719	In_Frame_Del	DEL	ENST00000268489.5	37	c.2330_2332delTGG	CCDS10908.1																																																																																				0.635	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269008.1	NM_006885		7	157	NA	NA	NA	NA	NA	7	157	---	---	---	---
VEZF1	7716	broad.mit.edu	37	17	56056604	56056605	+	In_Frame_Ins	INS	-	-	TGC	rs61731354|rs57786397|rs138088904|rs369163670	byFrequency	TCGA-44-2665-01A-01D-1040-01	TCGA-44-2665-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	520db804-4c03-4a0c-9966-fc0c9f98cfec	4b84f6af-2361-4e9b-9c8c-f1cbeb8513f2	g.chr17:56056604_56056605insTGC	ENST00000581208.1	-	5	1086_1087	c.1046_1047insGCA	c.(1045-1047)caa>caGCAa	p.349_349Q>QQ	VEZF1_ENST00000584396.1_In_Frame_Ins_p.340_340Q>QQ	NM_007146.2	NP_009077.2	Q14119	VEZF1_HUMAN	vascular endothelial zinc finger 1	349	Poly-Gln.				angiogenesis (GO:0001525)|cellular defense response (GO:0006968)|endothelial cell development (GO:0001885)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|kidney(2)|lung(5)|ovary(1)	10						gttgttgttgttgctgctgctg	0.465																																							uc002ivf.1		NA																	0				ovary(1)|breast(1)	2						c.(1045-1047)CAA>CAGCAA		zinc finger protein 161																																				SO:0001652	inframe_insertion	7716				cellular defense response|regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding	g.chr17:56056604_56056605insTGC	D28118	CCDS32687.1	17q22	2012-10-05	2006-08-16	2006-08-16	ENSG00000136451	ENSG00000136451		"""Zinc fingers, C2H2-type"""	12949	protein-coding gene	gene with protein product		606747	"""zinc finger protein 161"""	ZNF161		8035792	Standard	XM_005257643		Approved	DB1	uc002ivf.1	Q14119	OTTHUMG00000178777	ENST00000581208.1:c.1044_1046dupGCA	17.37:g.56056611_56056613dupTGC	ENSP00000462337:p.Gln354dup		Somatic				VEZF1_uc010dcn.1_In_Frame_Ins_p.199_199Q>QQ	p.349_349Q>QQ	NM_007146	NP_009077	WXS	Illumina HiSeq	Unspecified	Q14119	VEZF1_HUMAN			5	1189_1190	-			349			Poly-Gln.			In_Frame_Ins	INS	ENST00000581208.1	37	c.1046_1047insGCA	CCDS32687.1																																																																																				0.465	VEZF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000443321.1			10	120	NA	NA	NA	NA	NA	10	120	---	---	---	---
